mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-03-25 13:30:52 +00:00
Change path of the obitools pkg
Former-commit-id: 311cbf8df3b990b393c6f4885d62e74564423b65
This commit is contained in:
@@ -2,13 +2,14 @@ package main
|
|||||||
|
|
||||||
import (
|
import (
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiannotate"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiannotate"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
@@ -38,7 +39,7 @@ func main() {
|
|||||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Errorf("Cannot open file (%v)",err)
|
log.Errorf("Cannot open file (%v)", err)
|
||||||
os.Exit(1)
|
os.Exit(1)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -5,11 +5,11 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiclean"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiclean"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
|
|||||||
@@ -2,12 +2,13 @@ package main
|
|||||||
|
|
||||||
import (
|
import (
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obicleandb"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obicleandb"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
@@ -18,7 +19,7 @@ func main() {
|
|||||||
fs, err := obiconvert.CLIReadBioSequences(args...)
|
fs, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Errorf("Cannot open file (%v)",err)
|
log.Errorf("Cannot open file (%v)", err)
|
||||||
os.Exit(1)
|
os.Exit(1)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -2,13 +2,14 @@ package main
|
|||||||
|
|
||||||
import (
|
import (
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
@@ -19,7 +20,7 @@ func main() {
|
|||||||
fs, err := obiconvert.CLIReadBioSequences(args...)
|
fs, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Errorf("Cannot open file (%v)",err)
|
log.Errorf("Cannot open file (%v)", err)
|
||||||
os.Exit(1)
|
os.Exit(1)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -5,11 +5,11 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconsensus"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
|
|||||||
@@ -2,12 +2,13 @@ package main
|
|||||||
|
|
||||||
import (
|
import (
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
@@ -18,7 +19,7 @@ func main() {
|
|||||||
fs, err := obiconvert.CLIReadBioSequences(args...)
|
fs, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Errorf("Cannot open file (%v)",err)
|
log.Errorf("Cannot open file (%v)", err)
|
||||||
os.Exit(1)
|
os.Exit(1)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -3,12 +3,13 @@ package main
|
|||||||
import (
|
import (
|
||||||
"fmt"
|
"fmt"
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obicount"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obicount"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
@@ -37,7 +38,7 @@ func main() {
|
|||||||
fs, err := obiconvert.CLIReadBioSequences(args...)
|
fs, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Errorf("Cannot open file (%v)",err)
|
log.Errorf("Cannot open file (%v)", err)
|
||||||
os.Exit(1)
|
os.Exit(1)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -2,12 +2,13 @@ package main
|
|||||||
|
|
||||||
import (
|
import (
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obicsv"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obicsv"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
@@ -18,7 +19,7 @@ func main() {
|
|||||||
fs, err := obiconvert.CLIReadBioSequences(args...)
|
fs, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Errorf("Cannot open file (%v)",err)
|
log.Errorf("Cannot open file (%v)", err)
|
||||||
os.Exit(1)
|
os.Exit(1)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -2,13 +2,14 @@ package main
|
|||||||
|
|
||||||
import (
|
import (
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obidistribute"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obidistribute"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
@@ -19,11 +20,11 @@ func main() {
|
|||||||
fs, err := obiconvert.CLIReadBioSequences(args...)
|
fs, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Errorf("Cannot open file (%v)",err)
|
log.Errorf("Cannot open file (%v)", err)
|
||||||
os.Exit(1)
|
os.Exit(1)
|
||||||
}
|
}
|
||||||
|
|
||||||
obidistribute.DistributeSequence(fs)
|
obidistribute.CLIDistributeSequence(fs)
|
||||||
|
|
||||||
obiiter.WaitForLastPipe()
|
obiiter.WaitForLastPipe()
|
||||||
|
|
||||||
|
|||||||
@@ -4,8 +4,8 @@ import (
|
|||||||
"fmt"
|
"fmt"
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obifind"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obifind"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
|
|||||||
@@ -2,13 +2,14 @@ package main
|
|||||||
|
|
||||||
import (
|
import (
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obigrep"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obigrep"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
@@ -38,7 +39,7 @@ func main() {
|
|||||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Errorf("Cannot open file (%v)",err)
|
log.Errorf("Cannot open file (%v)", err)
|
||||||
os.Exit(1)
|
os.Exit(1)
|
||||||
}
|
}
|
||||||
selected := obigrep.CLIFilterSequence(sequences)
|
selected := obigrep.CLIFilterSequence(sequences)
|
||||||
|
|||||||
@@ -6,10 +6,10 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obimatrix"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obimatrix"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
|
|||||||
@@ -2,12 +2,13 @@ package main
|
|||||||
|
|
||||||
import (
|
import (
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obimultiplex"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obimultiplex"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
@@ -33,7 +34,7 @@ func main() {
|
|||||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Errorf("Cannot open file (%v)",err)
|
log.Errorf("Cannot open file (%v)", err)
|
||||||
os.Exit(1)
|
os.Exit(1)
|
||||||
}
|
}
|
||||||
amplicons, _ := obimultiplex.IExtractBarcode(sequences)
|
amplicons, _ := obimultiplex.IExtractBarcode(sequences)
|
||||||
|
|||||||
@@ -1,13 +1,14 @@
|
|||||||
package main
|
package main
|
||||||
|
|
||||||
import (
|
import (
|
||||||
log "github.com/sirupsen/logrus"
|
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
log "github.com/sirupsen/logrus"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obipairing"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipairing"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
|
|||||||
@@ -5,10 +5,10 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obipcr"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipcr"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
|
|||||||
@@ -2,13 +2,14 @@ package main
|
|||||||
|
|
||||||
import (
|
import (
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obirefidx"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obirefidx"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
@@ -19,7 +20,7 @@ func main() {
|
|||||||
fs, err := obiconvert.CLIReadBioSequences(args...)
|
fs, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Errorf("Cannot open file (%v)",err)
|
log.Errorf("Cannot open file (%v)", err)
|
||||||
os.Exit(1)
|
os.Exit(1)
|
||||||
}
|
}
|
||||||
indexed := obirefidx.IndexReferenceDB(fs)
|
indexed := obirefidx.IndexReferenceDB(fs)
|
||||||
|
|||||||
@@ -8,10 +8,10 @@ import (
|
|||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
"gopkg.in/yaml.v3"
|
"gopkg.in/yaml.v3"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obisummary"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obisummary"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
|
|||||||
@@ -6,12 +6,12 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obifind"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obifind"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obitag"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitag"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
|
|||||||
@@ -5,11 +5,11 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obipairing"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipairing"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obitagpcr"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitagpcr"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
|
|||||||
@@ -2,13 +2,14 @@ package main
|
|||||||
|
|
||||||
import (
|
import (
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiuniq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiuniq"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
@@ -38,7 +39,7 @@ func main() {
|
|||||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Errorf("Cannot open file (%v)",err)
|
log.Errorf("Cannot open file (%v)", err)
|
||||||
os.Exit(1)
|
os.Exit(1)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
184
cmd/test/main.go
184
cmd/test/main.go
@@ -1,178 +1,38 @@
|
|||||||
package main
|
package main
|
||||||
|
|
||||||
import (
|
import (
|
||||||
"fmt"
|
|
||||||
"log"
|
|
||||||
"os"
|
"os"
|
||||||
"runtime/trace"
|
|
||||||
|
|
||||||
"cloudeng.io/algo/lcs"
|
log "github.com/sirupsen/logrus"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/goutils"
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obialign"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
func SESStat(script *lcs.EditScript[byte]) (int, int) {
|
|
||||||
llcs := 0
|
|
||||||
gaps := 0
|
|
||||||
extra := 0
|
|
||||||
i := 0
|
|
||||||
ls := len(*script)
|
|
||||||
for i < ls {
|
|
||||||
e := (*script)[i]
|
|
||||||
// log.Println(i,e,e.Op)
|
|
||||||
switch e.Op {
|
|
||||||
case lcs.Identical: // 2
|
|
||||||
if gaps > 0 {
|
|
||||||
extra += gaps
|
|
||||||
}
|
|
||||||
llcs++
|
|
||||||
gaps = 0
|
|
||||||
i++
|
|
||||||
case lcs.Delete: // 1
|
|
||||||
if i+1 < ls {
|
|
||||||
en := (*script)[i+1]
|
|
||||||
if en.Op == lcs.Identical && e.Val == en.Val {
|
|
||||||
log.Println("Swap delete")
|
|
||||||
(*script)[i], (*script)[i+1] = (*script)[i+1], (*script)[i]
|
|
||||||
continue
|
|
||||||
}
|
|
||||||
}
|
|
||||||
gaps--
|
|
||||||
i++
|
|
||||||
case lcs.Insert: // 0
|
|
||||||
if i+1 < ls {
|
|
||||||
en := (*script)[i+1]
|
|
||||||
if en.Op == lcs.Identical && e.Val == en.Val {
|
|
||||||
log.Println("Swap Insert")
|
|
||||||
(*script)[i], (*script)[i+1] = (*script)[i+1], (*script)[i]
|
|
||||||
continue
|
|
||||||
}
|
|
||||||
}
|
|
||||||
gaps++
|
|
||||||
i++
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
if gaps > 0 {
|
|
||||||
extra += gaps
|
|
||||||
}
|
|
||||||
|
|
||||||
return llcs, extra
|
|
||||||
}
|
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
|
optionParser := obioptions.GenerateOptionParser(obiconvert.OptionSet)
|
||||||
|
|
||||||
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
fs, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
|
||||||
// Creating a file called cpu.trace.
|
|
||||||
ftrace, err := os.Create("cpu.trace")
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatal(err)
|
log.Errorf("Cannot open file (%v)", err)
|
||||||
}
|
os.Exit(1)
|
||||||
trace.Start(ftrace)
|
|
||||||
defer trace.Stop()
|
|
||||||
|
|
||||||
// "---CACGATCGTGC-CAGTCAT-GGCTAT"
|
|
||||||
// "CCCCA-GATCGTGCG-AGTCATGGGCTAT"
|
|
||||||
|
|
||||||
// 00 0 00000000 1111111 111222
|
|
||||||
// 01 2 34567889 0123456 789012
|
|
||||||
// "CA-C-GATCGTGC-CAGTCAT-GGCTAT"
|
|
||||||
// "CCCCAGATCGTGCG-AGTCATGGGCTAT"
|
|
||||||
|
|
||||||
//A := "CACGATCGTGCCCCCAGTCATGGCTAT"
|
|
||||||
A := "AAATGCCCCAGATCGTGC"
|
|
||||||
B := "TGCCCCAGAT"
|
|
||||||
|
|
||||||
//A = "aaaggaacttggactgaagatttccacagaggttgcgaatgaaaaacacgtattcgaatgcctcaaatacggaatcgatcttgtctg"
|
|
||||||
A = "aaaggaacttggactgaagatttccacagaggttgcgaatgaaaaacacgtattcgaatgcctcaaatacggaatcgatcttgtctg"
|
|
||||||
B = "atccggttttacgaaaatgcgtgtggtaggggcttatgaaaacgataatcgaataaaaaagggtaggtgcagagactcaacggaagatgttctaacaaatgg"
|
|
||||||
// A = "aataa"
|
|
||||||
// B = "ttttt"
|
|
||||||
sA := obiseq.NewBioSequence("A", []byte(A), "")
|
|
||||||
sB := obiseq.NewBioSequence("A", []byte(B), "")
|
|
||||||
|
|
||||||
var x interface{}
|
|
||||||
|
|
||||||
x = sA
|
|
||||||
|
|
||||||
if _, ok := x.(*obiseq.BioSequence); ok {
|
|
||||||
fmt.Println("Purée")
|
|
||||||
|
|
||||||
}
|
}
|
||||||
|
|
||||||
if _, ok := x.(interface{ Length() int }); ok {
|
frags := obiiter.IFragments(
|
||||||
fmt.Println("Victoire")
|
1000,
|
||||||
}
|
100,
|
||||||
|
10,
|
||||||
|
100,
|
||||||
|
obioptions.CLIParallelWorkers(),
|
||||||
|
)
|
||||||
|
|
||||||
fmt.Println(goutils.Len(x),goutils.Len([]int{1,2,3}))
|
obiconvert.CLIWriteBioSequences(fs.Pipe(frags), true)
|
||||||
// M := lcs.NewMyers([]byte(A), []byte(B))
|
|
||||||
// fmt.Println(M.LCS())
|
|
||||||
// fmt.Println(M.SES())
|
|
||||||
// fmt.Println(len(M.LCS()))
|
|
||||||
// M.SES().FormatHorizontal(os.Stdout, []byte(B))
|
|
||||||
// llcs, extra := SESStat(M.SES())
|
|
||||||
// nlcs, nali := obialign.LCSScore(sA, sB, sB.Length(), nil)
|
|
||||||
// fmt.Println(llcs, extra, len(A)+extra)
|
|
||||||
// fmt.Println(nlcs, nali)
|
|
||||||
nlcs, nali := obialign.FastLCSScore(sA, sB, sB.Len(), nil)
|
|
||||||
fmt.Println(nlcs, nali)
|
|
||||||
|
|
||||||
// option_parser := obioptions.GenerateOptionParser(
|
obiiter.WaitForLastPipe()
|
||||||
// obiconvert.InputOptionSet,
|
|
||||||
// )
|
|
||||||
|
|
||||||
// _, args, _ := option_parser(os.Args)
|
|
||||||
|
|
||||||
// fs, _ := obiconvert.ReadBioSequencesBatch(args...)
|
|
||||||
|
|
||||||
// obiclean.IOBIClean(fs)
|
|
||||||
|
|
||||||
// buffer := make([]byte, 0)
|
|
||||||
// fs.Next()
|
|
||||||
// s := fs.Get()
|
|
||||||
// index := obikmer.Index4mer(s, nil, nil)
|
|
||||||
// for fs.Next() {
|
|
||||||
// s := fs.Get()
|
|
||||||
// if s.IsNil() {
|
|
||||||
// log.Panicln("Read sequence is nil")
|
|
||||||
// }
|
|
||||||
// maxshift, maxcount := obikmer.FastShiftFourMer(index, s, buffer)
|
|
||||||
|
|
||||||
// fmt.Printf("Shift : %d Score : %d\n", maxshift, maxcount)
|
|
||||||
// }
|
|
||||||
|
|
||||||
// A := []byte("ccgcctccttagaacaggctcctctagaaaaccatgtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg")
|
|
||||||
// B := []byte("ccgcctccttagaacaggctcctctagaaaaaccatgtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg")
|
|
||||||
// B := []byte("cgccaccaccgagatctacactctttccctacacgacgctcttccgatctccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg")
|
|
||||||
// sA := obiseq.NewBioSequence("A", A, "")
|
|
||||||
// sB := obiseq.MakeBioSequence("B", B, "")
|
|
||||||
|
|
||||||
// s, l := obialign.LCSScore(sA, &sB, 2, nil)
|
|
||||||
|
|
||||||
// fmt.Printf("score : %d length : %d error : %d\n", s, l, l-s)
|
|
||||||
|
|
||||||
// s, l = obialign.LCSScore(&sB, &sB, 2, nil)
|
|
||||||
|
|
||||||
// fmt.Printf("score : %d length : %d error : %d\n", s, l, l-s)
|
|
||||||
|
|
||||||
// pat, _ := obiapat.MakeApatPattern("TCCTTCCAACAGGCTCCTC", 3)
|
|
||||||
// as, _ := obiapat.MakeApatSequence(sA, false)
|
|
||||||
// fmt.Println(pat.FindAllIndex(as))
|
|
||||||
|
|
||||||
// file, _ := os.Open("sample/wolf_diet_ngsfilter.txt")
|
|
||||||
// xxx, _ := obiformats.ReadNGSFilter(file)
|
|
||||||
// xxx.Compile(2)
|
|
||||||
// fmt.Printf("%v\n==================\n", xxx)
|
|
||||||
|
|
||||||
// for pp, m := range xxx {
|
|
||||||
// fmt.Printf("%v %v\n", pp, *m)
|
|
||||||
// }
|
|
||||||
|
|
||||||
// seqfile, _ := obiformats.ReadFastSeqFromFile("xxxx.fastq")
|
|
||||||
|
|
||||||
// for seqfile.Next() {
|
|
||||||
// seq := seqfile.Get()
|
|
||||||
// barcode, _ := xxx.ExtractBarcode(seq, true)
|
|
||||||
// fmt.Println(obiformats.FormatFasta(barcode, obiformats.FormatFastSeqOBIHeader))
|
|
||||||
// }
|
|
||||||
}
|
}
|
||||||
|
|||||||
2
go.mod
2
go.mod
@@ -1,4 +1,4 @@
|
|||||||
module git.metabarcoding.org/lecasofts/go/obitools
|
module git.metabarcoding.org/obitools/obitools4/obitools4
|
||||||
|
|
||||||
go 1.21
|
go 1.21
|
||||||
|
|
||||||
|
|||||||
@@ -9,7 +9,7 @@ import (
|
|||||||
"math"
|
"math"
|
||||||
"strings"
|
"strings"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
// // A pool of byte slices.
|
// // A pool of byte slices.
|
||||||
|
|||||||
@@ -1,8 +1,8 @@
|
|||||||
package obialign
|
package obialign
|
||||||
|
|
||||||
// import (
|
// import (
|
||||||
// "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
// "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
// "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
// "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
// )
|
// )
|
||||||
|
|
||||||
const wsize = 16
|
const wsize = 16
|
||||||
|
|||||||
@@ -1,8 +1,8 @@
|
|||||||
package obialign
|
package obialign
|
||||||
|
|
||||||
import (
|
import (
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
var _iupac = [26]byte{
|
var _iupac = [26]byte{
|
||||||
|
|||||||
@@ -1,7 +1,7 @@
|
|||||||
package obialign
|
package obialign
|
||||||
|
|
||||||
import (
|
import (
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
var _FourBitsBaseCode = []byte{0b0000,
|
var _FourBitsBaseCode = []byte{0b0000,
|
||||||
|
|||||||
@@ -1,6 +1,6 @@
|
|||||||
package obialign
|
package obialign
|
||||||
|
|
||||||
import "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
import "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
|
||||||
func abs(x int) int {
|
func abs(x int) int {
|
||||||
if x < 0 {
|
if x < 0 {
|
||||||
|
|||||||
@@ -3,8 +3,8 @@ package obialign
|
|||||||
import (
|
import (
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obikmer"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
type _PeAlignArena struct {
|
type _PeAlignArena struct {
|
||||||
|
|||||||
@@ -13,9 +13,9 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obialign"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
var _MaxPatLen = int(C.MAX_PAT_LEN)
|
var _MaxPatLen = int(C.MAX_PAT_LEN)
|
||||||
|
|||||||
@@ -3,8 +3,8 @@ package obiapat
|
|||||||
import (
|
import (
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
type _Options struct {
|
type _Options struct {
|
||||||
|
|||||||
@@ -8,9 +8,9 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiformats"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
func tempDir() (string, error) {
|
func tempDir() (string, error) {
|
||||||
@@ -42,7 +42,6 @@ func ISequenceChunkOnDisk(iterator obiiter.IBioSequence,
|
|||||||
return obiiter.NilIBioSequence, err
|
return obiiter.NilIBioSequence, err
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|
||||||
newIter := obiiter.MakeIBioSequence()
|
newIter := obiiter.MakeIBioSequence()
|
||||||
|
|
||||||
newIter.Add(1)
|
newIter.Add(1)
|
||||||
|
|||||||
@@ -5,8 +5,8 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
func ISequenceChunk(iterator obiiter.IBioSequence,
|
func ISequenceChunk(iterator obiiter.IBioSequence,
|
||||||
|
|||||||
@@ -6,9 +6,9 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
//
|
//
|
||||||
|
|||||||
@@ -5,8 +5,8 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
// Runs dereplication algorithm on a obiiter.IBioSequenceBatch
|
// Runs dereplication algorithm on a obiiter.IBioSequenceBatch
|
||||||
|
|||||||
@@ -3,14 +3,14 @@ package obicorazick
|
|||||||
import (
|
import (
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"github.com/rrethy/ahocorasick"
|
"github.com/rrethy/ahocorasick"
|
||||||
)
|
)
|
||||||
|
|
||||||
func AhoCorazickWorker(slot string, patterns []string) obiseq.SeqWorker {
|
func AhoCorazickWorker(slot string, patterns []string) obiseq.SeqWorker {
|
||||||
|
|
||||||
matcher := ahocorasick.CompileStrings(patterns)
|
matcher := ahocorasick.CompileStrings(patterns)
|
||||||
|
|
||||||
fslot := slot + "_Fwd"
|
fslot := slot + "_Fwd"
|
||||||
rslot := slot + "_Rev"
|
rslot := slot + "_Rev"
|
||||||
|
|
||||||
@@ -18,7 +18,7 @@ func AhoCorazickWorker(slot string, patterns []string) obiseq.SeqWorker {
|
|||||||
matchesF := len(matcher.FindAllByteSlice(s.Sequence()))
|
matchesF := len(matcher.FindAllByteSlice(s.Sequence()))
|
||||||
matchesR := len(matcher.FindAllByteSlice(s.ReverseComplement(false).Sequence()))
|
matchesR := len(matcher.FindAllByteSlice(s.ReverseComplement(false).Sequence()))
|
||||||
|
|
||||||
log.Debugln("Macthes = ",matchesF,matchesR)
|
log.Debugln("Macthes = ", matchesF, matchesR)
|
||||||
matches := matchesF + matchesR
|
matches := matchesF + matchesR
|
||||||
if matches > 0 {
|
if matches > 0 {
|
||||||
s.SetAttribute(slot, matches)
|
s.SetAttribute(slot, matches)
|
||||||
|
|||||||
@@ -3,8 +3,8 @@ package obiformats
|
|||||||
import (
|
import (
|
||||||
"log"
|
"log"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
func ReadSequencesBatchFromFiles(filenames []string,
|
func ReadSequencesBatchFromFiles(filenames []string,
|
||||||
@@ -48,8 +48,6 @@ func ReadSequencesBatchFromFiles(filenames []string,
|
|||||||
|
|
||||||
log.Printf("Start reading of file : %s", filename)
|
log.Printf("Start reading of file : %s", filename)
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
for iter.Next() {
|
for iter.Next() {
|
||||||
batch := iter.Get()
|
batch := iter.Get()
|
||||||
batchiter.Push(batch.Reorder(nextCounter()))
|
batchiter.Push(batch.Reorder(nextCounter()))
|
||||||
|
|||||||
@@ -1,5 +1,5 @@
|
|||||||
package obiformats
|
package obiformats
|
||||||
|
|
||||||
import "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
import "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
|
|
||||||
type IBatchReader func(string, ...WithOption) (obiiter.IBioSequence, error)
|
type IBatchReader func(string, ...WithOption) (obiiter.IBioSequence, error)
|
||||||
|
|||||||
@@ -9,10 +9,10 @@ import (
|
|||||||
"sync"
|
"sync"
|
||||||
"time"
|
"time"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -10,7 +10,7 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
)
|
)
|
||||||
|
|
||||||
type SequenceBatchWriterToFile func(iterator obiiter.IBioSequence,
|
type SequenceBatchWriterToFile func(iterator obiiter.IBioSequence,
|
||||||
|
|||||||
@@ -13,9 +13,9 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
type __ecopcr_file__ struct {
|
type __ecopcr_file__ struct {
|
||||||
|
|||||||
@@ -10,9 +10,9 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
var _FileChunkSize = 1 << 28
|
var _FileChunkSize = 1 << 28
|
||||||
|
|||||||
@@ -1,6 +1,6 @@
|
|||||||
package obiformats
|
package obiformats
|
||||||
|
|
||||||
import "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
import "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
|
|
||||||
func ReadEmptyFile(options ...WithOption) (obiiter.IBioSequence, error) {
|
func ReadEmptyFile(options ...WithOption) (obiiter.IBioSequence, error) {
|
||||||
out := obiiter.MakeIBioSequence()
|
out := obiiter.MakeIBioSequence()
|
||||||
|
|||||||
@@ -7,10 +7,10 @@ import (
|
|||||||
"os"
|
"os"
|
||||||
"path"
|
"path"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
"golang.org/x/exp/slices"
|
"golang.org/x/exp/slices"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|||||||
@@ -6,10 +6,10 @@ import (
|
|||||||
"os"
|
"os"
|
||||||
"path"
|
"path"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
"golang.org/x/exp/slices"
|
"golang.org/x/exp/slices"
|
||||||
)
|
)
|
||||||
|
|||||||
@@ -3,8 +3,8 @@ package obiformats
|
|||||||
import (
|
import (
|
||||||
"strings"
|
"strings"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
// ParseGuessedFastSeqHeader parses the guessed fast sequence header.
|
// ParseGuessedFastSeqHeader parses the guessed fast sequence header.
|
||||||
|
|||||||
@@ -1,5 +1,5 @@
|
|||||||
package obiformats
|
package obiformats
|
||||||
|
|
||||||
import "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
import "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
|
||||||
type FormatHeader func(sequence *obiseq.BioSequence) string
|
type FormatHeader func(sequence *obiseq.BioSequence) string
|
||||||
|
|||||||
@@ -6,8 +6,8 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
"github.com/goccy/go-json"
|
"github.com/goccy/go-json"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -9,8 +9,8 @@ import (
|
|||||||
"strconv"
|
"strconv"
|
||||||
"strings"
|
"strings"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
"github.com/goccy/go-json"
|
"github.com/goccy/go-json"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -14,10 +14,10 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
func _FastseqReader(source string,
|
func _FastseqReader(source string,
|
||||||
|
|||||||
@@ -12,9 +12,9 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
// min returns the minimum of two integers.
|
// min returns the minimum of two integers.
|
||||||
|
|||||||
@@ -10,10 +10,10 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
// The function FormatFastq takes a BioSequence object, a quality shift value, and a header formatter
|
// The function FormatFastq takes a BioSequence object, a quality shift value, and a header formatter
|
||||||
|
|||||||
@@ -11,9 +11,9 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
type gbstate int
|
type gbstate int
|
||||||
|
|||||||
@@ -11,9 +11,9 @@ import (
|
|||||||
"sync"
|
"sync"
|
||||||
"time"
|
"time"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -12,7 +12,7 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitax"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
|
||||||
)
|
)
|
||||||
|
|
||||||
func loadNodeTable(reader io.Reader, taxonomy *obitax.Taxonomy) {
|
func loadNodeTable(reader io.Reader, taxonomy *obitax.Taxonomy) {
|
||||||
|
|||||||
@@ -6,8 +6,8 @@ import (
|
|||||||
"io"
|
"io"
|
||||||
"strings"
|
"strings"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obingslibrary"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obingslibrary"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
func _readLines(reader io.Reader) []string {
|
func _readLines(reader io.Reader) []string {
|
||||||
|
|||||||
@@ -1,8 +1,8 @@
|
|||||||
package obiformats
|
package obiformats
|
||||||
|
|
||||||
import (
|
import (
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
type __options__ struct {
|
type __options__ struct {
|
||||||
|
|||||||
@@ -11,8 +11,8 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
// OBIMimeTypeGuesser is a function that takes an io.Reader as input and guesses the MIME type of the data.
|
// OBIMimeTypeGuesser is a function that takes an io.Reader as input and guesses the MIME type of the data.
|
||||||
|
|||||||
@@ -7,7 +7,7 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
)
|
)
|
||||||
|
|
||||||
func WriteSequence(iterator obiiter.IBioSequence,
|
func WriteSequence(iterator obiiter.IBioSequence,
|
||||||
|
|||||||
@@ -1,6 +1,6 @@
|
|||||||
package obiiter
|
package obiiter
|
||||||
|
|
||||||
import "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
import "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
|
||||||
type BioSequenceBatch struct {
|
type BioSequenceBatch struct {
|
||||||
slice obiseq.BioSequenceSlice
|
slice obiseq.BioSequenceSlice
|
||||||
|
|||||||
@@ -10,9 +10,9 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
"github.com/tevino/abool/v2"
|
"github.com/tevino/abool/v2"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -4,7 +4,7 @@ import (
|
|||||||
"fmt"
|
"fmt"
|
||||||
"sync"
|
"sync"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
type IDistribute struct {
|
type IDistribute struct {
|
||||||
@@ -46,8 +46,6 @@ func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, siz
|
|||||||
batchsize = sizes[0]
|
batchsize = sizes[0]
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
jobDone := sync.WaitGroup{}
|
jobDone := sync.WaitGroup{}
|
||||||
lock := sync.Mutex{}
|
lock := sync.Mutex{}
|
||||||
|
|
||||||
|
|||||||
@@ -3,8 +3,8 @@ package obiiter
|
|||||||
import (
|
import (
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
func IFragments(minsize, length, overlap, size, nworkers int) Pipeable {
|
func IFragments(minsize, length, overlap, size, nworkers int) Pipeable {
|
||||||
@@ -25,19 +25,19 @@ func IFragments(minsize, length, overlap, size, nworkers int) Pipeable {
|
|||||||
news := obiseq.MakeBioSequenceSlice()
|
news := obiseq.MakeBioSequenceSlice()
|
||||||
sl := iterator.Get()
|
sl := iterator.Get()
|
||||||
for _, s := range sl.Slice() {
|
for _, s := range sl.Slice() {
|
||||||
|
|
||||||
if s.Len() <= minsize {
|
if s.Len() <= minsize {
|
||||||
news = append(news, s)
|
news = append(news, s)
|
||||||
} else {
|
} else {
|
||||||
for i := 0; i < s.Len(); i += step {
|
for i := 0; i < s.Len(); i += step {
|
||||||
end := obiutils.MinInt(i+length, s.Len())
|
end := obiutils.MinInt(i+length, s.Len())
|
||||||
fusion:=false
|
fusion := false
|
||||||
if (s.Len() - end) < step {
|
if (s.Len() - end) < step {
|
||||||
end = s.Len()
|
end = s.Len()
|
||||||
fusion = true
|
fusion = true
|
||||||
}
|
}
|
||||||
frg, err := s.Subsequence(i, end, false)
|
frg, err := s.Subsequence(i, end, false)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Panicln(err)
|
log.Panicln(err)
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -1,6 +1,6 @@
|
|||||||
package obiiter
|
package obiiter
|
||||||
|
|
||||||
import "git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
import "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
|
||||||
func (iterator IBioSequence) IMergeSequenceBatch(na string, statsOn []string, sizes ...int) IBioSequence {
|
func (iterator IBioSequence) IMergeSequenceBatch(na string, statsOn []string, sizes ...int) IBioSequence {
|
||||||
batchsize := 100
|
batchsize := 100
|
||||||
|
|||||||
@@ -3,8 +3,8 @@ package obiiter
|
|||||||
import (
|
import (
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
// That method allows for applying a SeqWorker function on every sequences.
|
// That method allows for applying a SeqWorker function on every sequences.
|
||||||
@@ -56,6 +56,16 @@ func (iterator IBioSequence) MakeIWorker(worker obiseq.SeqWorker, sizes ...int)
|
|||||||
return newIter
|
return newIter
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// MakeIConditionalWorker applies a given worker function to each sequence in the iterator that satisfies the given predicate.
|
||||||
|
// It creates a new iterator with the modified sequences and returns it.
|
||||||
|
//
|
||||||
|
// Parameters:
|
||||||
|
// - predicate: A function that takes a sequence and returns a boolean value indicating whether the sequence satisfies a certain condition.
|
||||||
|
// - worker: A function that takes a sequence and returns a modified version of the sequence.
|
||||||
|
// - sizes: Optional. One or more integers representing the number of workers to be used for parallel processing. If not provided, the number of workers will be determined by the obioptions.CLIReadParallelWorkers() function.
|
||||||
|
//
|
||||||
|
// Return:
|
||||||
|
// - newIter: A new IBioSequence iterator with the modified sequences.
|
||||||
func (iterator IBioSequence) MakeIConditionalWorker(predicate obiseq.SequencePredicate,
|
func (iterator IBioSequence) MakeIConditionalWorker(predicate obiseq.SequencePredicate,
|
||||||
worker obiseq.SeqWorker, sizes ...int) IBioSequence {
|
worker obiseq.SeqWorker, sizes ...int) IBioSequence {
|
||||||
nworkers := obioptions.CLIReadParallelWorkers()
|
nworkers := obioptions.CLIReadParallelWorkers()
|
||||||
@@ -100,6 +110,16 @@ func (iterator IBioSequence) MakeIConditionalWorker(predicate obiseq.SequencePre
|
|||||||
return newIter
|
return newIter
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// MakeISliceWorker applies a SeqSliceWorker function to each slice in the IBioSequence iterator,
|
||||||
|
// creating a new IBioSequence with the modified slices.
|
||||||
|
//
|
||||||
|
// The worker function takes a slice as input and returns a modified slice. It is applied to each
|
||||||
|
// slice in the iterator.
|
||||||
|
//
|
||||||
|
// The sizes argument is optional and specifies the number of workers to use. If sizes is not
|
||||||
|
// provided, the default number of workers is used.
|
||||||
|
//
|
||||||
|
// The function returns a new IBioSequence containing the modified slices.
|
||||||
func (iterator IBioSequence) MakeISliceWorker(worker obiseq.SeqSliceWorker, sizes ...int) IBioSequence {
|
func (iterator IBioSequence) MakeISliceWorker(worker obiseq.SeqSliceWorker, sizes ...int) IBioSequence {
|
||||||
nworkers := obioptions.CLIParallelWorkers()
|
nworkers := obioptions.CLIParallelWorkers()
|
||||||
|
|
||||||
@@ -119,12 +139,12 @@ func (iterator IBioSequence) MakeISliceWorker(worker obiseq.SeqSliceWorker, size
|
|||||||
f := func(iterator IBioSequence) {
|
f := func(iterator IBioSequence) {
|
||||||
for iterator.Next() {
|
for iterator.Next() {
|
||||||
batch := iterator.Get()
|
batch := iterator.Get()
|
||||||
bs := len(batch.slice)
|
|
||||||
batch.slice = worker(batch.slice)
|
batch.slice = worker(batch.slice)
|
||||||
if bs != len(batch.slice) {
|
if batch.slice.Len() > 0 {
|
||||||
log.Warnf("Input size : %d output %d", bs, len(batch.slice))
|
newIter.Push(batch)
|
||||||
|
} else {
|
||||||
|
batch.Recycle(false)
|
||||||
}
|
}
|
||||||
newIter.Push(batch)
|
|
||||||
}
|
}
|
||||||
newIter.Done()
|
newIter.Done()
|
||||||
}
|
}
|
||||||
@@ -142,6 +162,17 @@ func (iterator IBioSequence) MakeISliceWorker(worker obiseq.SeqSliceWorker, size
|
|||||||
return newIter
|
return newIter
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// WorkerPipe is a function that takes a SeqWorker and a variadic list of sizes as parameters and returns a Pipeable.
|
||||||
|
//
|
||||||
|
// The WorkerPipe function creates a closure that takes an IBioSequence iterator as a parameter and returns an IBioSequence.
|
||||||
|
// Inside the closure, the MakeIWorker method of the iterator is called with the provided worker and sizes, and the result is returned.
|
||||||
|
//
|
||||||
|
// Parameters:
|
||||||
|
// - worker: A SeqWorker object that represents the worker to be used in the closure.
|
||||||
|
// - sizes: A variadic list of int values that represents the sizes to be used in the MakeIWorker method.
|
||||||
|
//
|
||||||
|
// Return:
|
||||||
|
// - f: A Pipeable object that represents the closure created by the WorkerPipe function.
|
||||||
func WorkerPipe(worker obiseq.SeqWorker, sizes ...int) Pipeable {
|
func WorkerPipe(worker obiseq.SeqWorker, sizes ...int) Pipeable {
|
||||||
f := func(iterator IBioSequence) IBioSequence {
|
f := func(iterator IBioSequence) IBioSequence {
|
||||||
return iterator.MakeIWorker(worker, sizes...)
|
return iterator.MakeIWorker(worker, sizes...)
|
||||||
@@ -150,6 +181,11 @@ func WorkerPipe(worker obiseq.SeqWorker, sizes ...int) Pipeable {
|
|||||||
return f
|
return f
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// SliceWorkerPipe creates a Pipeable function that applies a SeqSliceWorker to an iterator.
|
||||||
|
//
|
||||||
|
// The worker parameter is the SeqSliceWorker to be applied.
|
||||||
|
// The sizes parameter is a variadic parameter representing the sizes of the slices.
|
||||||
|
// The function returns a Pipeable function that applies the SeqSliceWorker to the iterator.
|
||||||
func SliceWorkerPipe(worker obiseq.SeqSliceWorker, sizes ...int) Pipeable {
|
func SliceWorkerPipe(worker obiseq.SeqSliceWorker, sizes ...int) Pipeable {
|
||||||
f := func(iterator IBioSequence) IBioSequence {
|
f := func(iterator IBioSequence) IBioSequence {
|
||||||
return iterator.MakeISliceWorker(worker, sizes...)
|
return iterator.MakeISliceWorker(worker, sizes...)
|
||||||
|
|||||||
@@ -3,8 +3,8 @@ package obikmer
|
|||||||
import (
|
import (
|
||||||
"math"
|
"math"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
type Table4mer [256]uint16
|
type Table4mer [256]uint16
|
||||||
|
|||||||
@@ -6,7 +6,7 @@ import (
|
|||||||
"math"
|
"math"
|
||||||
"math/bits"
|
"math/bits"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"github.com/daichi-m/go18ds/sets/linkedhashset"
|
"github.com/daichi-m/go18ds/sets/linkedhashset"
|
||||||
"github.com/daichi-m/go18ds/stacks/arraystack"
|
"github.com/daichi-m/go18ds/stacks/arraystack"
|
||||||
)
|
)
|
||||||
|
|||||||
@@ -1,7 +1,7 @@
|
|||||||
package obikmer
|
package obikmer
|
||||||
|
|
||||||
import (
|
import (
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
var __single_base_code__ = []byte{0,
|
var __single_base_code__ = []byte{0,
|
||||||
|
|||||||
@@ -7,9 +7,9 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiapat"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiapat"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
type DemultiplexMatch struct {
|
type DemultiplexMatch struct {
|
||||||
|
|||||||
@@ -1,8 +1,8 @@
|
|||||||
package obingslibrary
|
package obingslibrary
|
||||||
|
|
||||||
import (
|
import (
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiapat"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiapat"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
type PrimerPair struct {
|
type PrimerPair struct {
|
||||||
|
|||||||
@@ -1,7 +1,7 @@
|
|||||||
package obingslibrary
|
package obingslibrary
|
||||||
|
|
||||||
import (
|
import (
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
type _Options struct {
|
type _Options struct {
|
||||||
@@ -159,7 +159,7 @@ func ExtractBarcodeSlice(ngslibrary NGSLibrary,
|
|||||||
|
|
||||||
opt := MakeOptions(options)
|
opt := MakeOptions(options)
|
||||||
|
|
||||||
ngslibrary.Compile(opt.AllowedMismatch(),opt.AllowsIndel())
|
ngslibrary.Compile(opt.AllowedMismatch(), opt.AllowsIndel())
|
||||||
|
|
||||||
return _ExtractBarcodeSlice(ngslibrary, sequences, opt)
|
return _ExtractBarcodeSlice(ngslibrary, sequences, opt)
|
||||||
}
|
}
|
||||||
@@ -169,7 +169,7 @@ func ExtractBarcodeSliceWorker(ngslibrary NGSLibrary,
|
|||||||
|
|
||||||
opt := MakeOptions(options)
|
opt := MakeOptions(options)
|
||||||
|
|
||||||
ngslibrary.Compile(opt.AllowedMismatch(),opt.AllowsIndel())
|
ngslibrary.Compile(opt.AllowedMismatch(), opt.AllowsIndel())
|
||||||
|
|
||||||
worker := func(sequences obiseq.BioSequenceSlice) obiseq.BioSequenceSlice {
|
worker := func(sequences obiseq.BioSequenceSlice) obiseq.BioSequenceSlice {
|
||||||
return _ExtractBarcodeSlice(ngslibrary, sequences, opt)
|
return _ExtractBarcodeSlice(ngslibrary, sequences, opt)
|
||||||
|
|||||||
@@ -4,7 +4,7 @@ import (
|
|||||||
"fmt"
|
"fmt"
|
||||||
"strconv"
|
"strconv"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -15,8 +15,8 @@ import (
|
|||||||
"sync"
|
"sync"
|
||||||
"sync/atomic"
|
"sync/atomic"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -3,7 +3,7 @@ package obiseq
|
|||||||
import (
|
import (
|
||||||
"sync"
|
"sync"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
"golang.org/x/exp/slices"
|
"golang.org/x/exp/slices"
|
||||||
)
|
)
|
||||||
|
|||||||
@@ -6,7 +6,7 @@ import (
|
|||||||
"strconv"
|
"strconv"
|
||||||
"sync"
|
"sync"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -6,7 +6,7 @@ import (
|
|||||||
"reflect"
|
"reflect"
|
||||||
"strings"
|
"strings"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
"github.com/PaesslerAG/gval"
|
"github.com/PaesslerAG/gval"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -5,7 +5,7 @@ import (
|
|||||||
"reflect"
|
"reflect"
|
||||||
"strings"
|
"strings"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -4,7 +4,7 @@ import (
|
|||||||
"log"
|
"log"
|
||||||
"sync"
|
"sync"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
var _BioSequenceByteSlicePool = sync.Pool{
|
var _BioSequenceByteSlicePool = sync.Pool{
|
||||||
|
|||||||
@@ -5,8 +5,8 @@ import (
|
|||||||
"fmt"
|
"fmt"
|
||||||
"sort"
|
"sort"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
type Suffix struct {
|
type Suffix struct {
|
||||||
|
|||||||
@@ -5,8 +5,8 @@ import (
|
|||||||
"strconv"
|
"strconv"
|
||||||
"strings"
|
"strings"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -1,7 +1,7 @@
|
|||||||
package obitax
|
package obitax
|
||||||
|
|
||||||
import (
|
import (
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
// Setting the taxon at a given rank for a given sequence.
|
// Setting the taxon at a given rank for a given sequence.
|
||||||
|
|||||||
@@ -3,8 +3,8 @@ package obitax
|
|||||||
import (
|
import (
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
func (taxonomy *Taxonomy) IsAValidTaxon(withAutoCorrection ...bool) obiseq.SequencePredicate {
|
func (taxonomy *Taxonomy) IsAValidTaxon(withAutoCorrection ...bool) obiseq.SequencePredicate {
|
||||||
|
|||||||
@@ -1,8 +1,8 @@
|
|||||||
package obitax
|
package obitax
|
||||||
|
|
||||||
import (
|
import (
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -1,14 +1,17 @@
|
|||||||
package obiannotate
|
package obiannotate
|
||||||
|
|
||||||
import (
|
import (
|
||||||
|
"fmt"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obicorazick"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiapat"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obicorazick"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitax"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obigrep"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obigrep"
|
||||||
)
|
)
|
||||||
|
|
||||||
func DeleteAttributesWorker(toBeDeleted []string) obiseq.SeqWorker {
|
func DeleteAttributesWorker(toBeDeleted []string) obiseq.SeqWorker {
|
||||||
@@ -22,14 +25,69 @@ func DeleteAttributesWorker(toBeDeleted []string) obiseq.SeqWorker {
|
|||||||
return f
|
return f
|
||||||
}
|
}
|
||||||
|
|
||||||
// func MatchPatternWorker(pattern string, errormax int, allowsIndel bool) obiseq.SeqWorker {
|
func MatchPatternWorker(pattern, name string, errormax int, allowsIndel bool) obiseq.SeqWorker {
|
||||||
// pat, err := obiapat.MakeApatPattern(pattern, errormax, allowsIndel)
|
pat, err := obiapat.MakeApatPattern(pattern, errormax, allowsIndel)
|
||||||
// f := func(s *obiseq.BioSequence) *obiseq.BioSequence {
|
if err != nil {
|
||||||
// apats := obiapat.MakeApatSequence(s, false)
|
log.Fatalf("error in compiling pattern (%s) : %v", pattern, err)
|
||||||
// pat.BestMatch(apats, 0)
|
}
|
||||||
// return s
|
|
||||||
// }
|
cpat, err := pat.ReverseComplement()
|
||||||
// }
|
|
||||||
|
if err != nil {
|
||||||
|
log.Fatalf("error in reverse-complementing pattern (%s) : %v", pattern, err)
|
||||||
|
}
|
||||||
|
|
||||||
|
slot := "pattern"
|
||||||
|
if name != "pattern" && name != "" {
|
||||||
|
slot = fmt.Sprintf("%s_pattern", name)
|
||||||
|
} else {
|
||||||
|
name = "pattern"
|
||||||
|
}
|
||||||
|
|
||||||
|
slot_match := fmt.Sprintf("%s_match", name)
|
||||||
|
slot_error := fmt.Sprintf("%s_error", name)
|
||||||
|
slot_location := fmt.Sprintf("%s_location", name)
|
||||||
|
|
||||||
|
f := func(s *obiseq.BioSequence) *obiseq.BioSequence {
|
||||||
|
apats, err := obiapat.MakeApatSequence(s, false)
|
||||||
|
if err != nil {
|
||||||
|
log.Fatalf("error in preparing sequence %s : %v", s.Id(), err)
|
||||||
|
}
|
||||||
|
|
||||||
|
start, end, nerr, matched := pat.BestMatch(apats, 0, s.Len())
|
||||||
|
|
||||||
|
if matched {
|
||||||
|
annot := s.Annotations()
|
||||||
|
annot[slot] = pattern
|
||||||
|
match, err := s.Subsequence(start, end, false)
|
||||||
|
if err != nil {
|
||||||
|
log.Fatalf("Error in extracting pattern of sequence %s [%d;%d[ : %v",
|
||||||
|
s.Id(), start, end, err)
|
||||||
|
}
|
||||||
|
annot[slot_match] = match.String()
|
||||||
|
annot[slot_error] = nerr
|
||||||
|
annot[slot_location] = fmt.Sprintf("%d..%d", start+1, end)
|
||||||
|
} else {
|
||||||
|
start, end, nerr, matched := cpat.BestMatch(apats, 0, s.Len())
|
||||||
|
|
||||||
|
if matched {
|
||||||
|
annot := s.Annotations()
|
||||||
|
annot[slot] = pattern
|
||||||
|
match, err := s.Subsequence(start, end, false)
|
||||||
|
if err != nil {
|
||||||
|
log.Fatalf("Error in extracting pattern of sequence %s [%d;%d[ : %v",
|
||||||
|
s.Id(), start, end, err)
|
||||||
|
}
|
||||||
|
annot[slot_match] = match.ReverseComplement(true).String()
|
||||||
|
annot[slot_error] = nerr
|
||||||
|
annot[slot_location] = fmt.Sprintf("complement(%d..%d)", start+1, end)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return s
|
||||||
|
}
|
||||||
|
|
||||||
|
return f
|
||||||
|
}
|
||||||
|
|
||||||
func ToBeKeptAttributesWorker(toBeKept []string) obiseq.SeqWorker {
|
func ToBeKeptAttributesWorker(toBeKept []string) obiseq.SeqWorker {
|
||||||
|
|
||||||
@@ -229,6 +287,14 @@ func CLIAnnotationWorker() obiseq.SeqWorker {
|
|||||||
annotator = annotator.ChainWorkers(w)
|
annotator = annotator.ChainWorkers(w)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
if CLIHasPattern() {
|
||||||
|
log.Infof("Match pattern %s with %d error", CLIPattern(), CLIPatternError())
|
||||||
|
w := MatchPatternWorker(CLIPattern(), CLIHasPatternName(),
|
||||||
|
CLIPatternError(), CLIPatternInDels())
|
||||||
|
|
||||||
|
annotator = annotator.ChainWorkers(w)
|
||||||
|
}
|
||||||
|
|
||||||
return annotator
|
return annotator
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -7,8 +7,8 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obigrep"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obigrep"
|
||||||
"github.com/DavidGamba/go-getoptions"
|
"github.com/DavidGamba/go-getoptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
@@ -24,6 +24,9 @@ var _setSeqLength = false
|
|||||||
var _uniqueID = false
|
var _uniqueID = false
|
||||||
var _ahoCorazick = ""
|
var _ahoCorazick = ""
|
||||||
var _pattern = ""
|
var _pattern = ""
|
||||||
|
var _pattern_error = 0
|
||||||
|
var _pattern_indel = false
|
||||||
|
var _pattern_name = "pattern"
|
||||||
var _lcaSlot = ""
|
var _lcaSlot = ""
|
||||||
var _lcaError = 0.0
|
var _lcaError = 0.0
|
||||||
var _setId = ""
|
var _setId = ""
|
||||||
@@ -52,6 +55,18 @@ func SequenceAnnotationOptionSet(options *getoptions.GetOpt) {
|
|||||||
"to the sequence.",
|
"to the sequence.",
|
||||||
))
|
))
|
||||||
|
|
||||||
|
options.StringVar(&_pattern_name, "pattern-name", _pattern_name,
|
||||||
|
options.Description("specify the name to use as prefix for the slots reporting the match"),
|
||||||
|
)
|
||||||
|
|
||||||
|
options.IntVar(&_pattern_error, "pattern-error", _pattern_error,
|
||||||
|
options.Description("Maximum number of allowed error during pattern matching"),
|
||||||
|
)
|
||||||
|
|
||||||
|
options.BoolVar(&_pattern_indel, "allows-indels", _pattern_indel,
|
||||||
|
options.Description("Allows for indel during pattern matching"),
|
||||||
|
)
|
||||||
|
|
||||||
options.StringVar(&_lcaSlot, "add-lca-in", _lcaSlot,
|
options.StringVar(&_lcaSlot, "add-lca-in", _lcaSlot,
|
||||||
options.ArgName("SLOT_NAME"),
|
options.ArgName("SLOT_NAME"),
|
||||||
options.Description("From the taxonomic annotation of the sequence (taxid slot or merged_taxid slot), "+
|
options.Description("From the taxonomic annotation of the sequence (taxid slot or merged_taxid slot), "+
|
||||||
@@ -264,3 +279,23 @@ func CLIHasCut() bool {
|
|||||||
|
|
||||||
return f != 0 && t != 0
|
return f != 0 && t != 0
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func CLIPattern() string {
|
||||||
|
return _pattern
|
||||||
|
}
|
||||||
|
|
||||||
|
func CLIHasPattern() bool {
|
||||||
|
return _pattern != ""
|
||||||
|
}
|
||||||
|
|
||||||
|
func CLIHasPatternName() string {
|
||||||
|
return _pattern_name
|
||||||
|
}
|
||||||
|
|
||||||
|
func CLIPatternError() int {
|
||||||
|
return _pattern_error
|
||||||
|
}
|
||||||
|
|
||||||
|
func CLIPatternInDels() bool {
|
||||||
|
return _pattern_indel
|
||||||
|
}
|
||||||
|
|||||||
@@ -12,7 +12,7 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obialign"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign"
|
||||||
"github.com/schollz/progressbar/v3"
|
"github.com/schollz/progressbar/v3"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -4,10 +4,10 @@ import (
|
|||||||
"fmt"
|
"fmt"
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
"github.com/schollz/progressbar/v3"
|
"github.com/schollz/progressbar/v3"
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
)
|
)
|
||||||
|
|||||||
@@ -1,7 +1,7 @@
|
|||||||
package obiclean
|
package obiclean
|
||||||
|
|
||||||
import (
|
import (
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"github.com/DavidGamba/go-getoptions"
|
"github.com/DavidGamba/go-getoptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -3,11 +3,11 @@ package obicleandb
|
|||||||
import (
|
import (
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obichunk"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obichunk"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obigrep"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obigrep"
|
||||||
)
|
)
|
||||||
|
|
||||||
func ICleanDB(itertator obiiter.IBioSequence) obiiter.IBioSequence {
|
func ICleanDB(itertator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||||
|
|||||||
@@ -1,12 +1,11 @@
|
|||||||
package obicleandb
|
package obicleandb
|
||||||
|
|
||||||
import (
|
import (
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obigrep"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obigrep"
|
||||||
"github.com/DavidGamba/go-getoptions"
|
"github.com/DavidGamba/go-getoptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|
||||||
var _UpdateTaxids = false
|
var _UpdateTaxids = false
|
||||||
|
|
||||||
func ObicleanDBOptionSet(options *getoptions.GetOpt) {
|
func ObicleanDBOptionSet(options *getoptions.GetOpt) {
|
||||||
@@ -24,4 +23,4 @@ func OptionSet(options *getoptions.GetOpt) {
|
|||||||
|
|
||||||
func CLIUpdateTaxids() bool {
|
func CLIUpdateTaxids() bool {
|
||||||
return _UpdateTaxids
|
return _UpdateTaxids
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -8,11 +8,11 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obikmer"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obisuffix"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obisuffix"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
func BuildConsensus(seqs obiseq.BioSequenceSlice,
|
func BuildConsensus(seqs obiseq.BioSequenceSlice,
|
||||||
@@ -83,20 +83,20 @@ func BuildConsensus(seqs obiseq.BioSequenceSlice,
|
|||||||
}
|
}
|
||||||
|
|
||||||
graph.FilterMin(threshold)
|
graph.FilterMin(threshold)
|
||||||
|
|
||||||
log.Printf("Graph size : %d\n", graph.Len())
|
log.Printf("Graph size : %d\n", graph.Len())
|
||||||
|
|
||||||
if save_graph {
|
if save_graph {
|
||||||
|
|
||||||
file, err := os.Create(path.Join(dirname,
|
file, err := os.Create(path.Join(dirname,
|
||||||
fmt.Sprintf("%s.gml", seqs[0].Source())))
|
fmt.Sprintf("%s.gml", seqs[0].Source())))
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
fmt.Println(err)
|
fmt.Println(err)
|
||||||
} else {
|
} else {
|
||||||
file.WriteString(graph.Gml())
|
file.WriteString(graph.Gml())
|
||||||
file.Close()
|
file.Close()
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
seq, err := graph.LongestConsensus(seqs[0].Source())
|
seq, err := graph.LongestConsensus(seqs[0].Source())
|
||||||
@@ -122,11 +122,11 @@ func Consensus(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
|||||||
// path does not exist or is not directory
|
// path does not exist or is not directory
|
||||||
os.RemoveAll(dirname)
|
os.RemoveAll(dirname)
|
||||||
err := os.Mkdir(dirname, 0755)
|
err := os.Mkdir(dirname, 0755)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Panicf("Cannot create directory %s for saving graphs", dirname)
|
log.Panicf("Cannot create directory %s for saving graphs", dirname)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
newIter.Add(1)
|
newIter.Add(1)
|
||||||
|
|||||||
@@ -1,7 +1,7 @@
|
|||||||
package obiconsensus
|
package obiconsensus
|
||||||
|
|
||||||
import (
|
import (
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"github.com/DavidGamba/go-getoptions"
|
"github.com/DavidGamba/go-getoptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
@@ -66,4 +66,4 @@ func CLIKmerDepth() float64 {
|
|||||||
|
|
||||||
func CLIThreshold() float64 {
|
func CLIThreshold() float64 {
|
||||||
return _threshold
|
return _threshold
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -8,9 +8,9 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiformats"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
func _ExpandListOfFiles(check_ext bool, filenames ...string) ([]string, error) {
|
func _ExpandListOfFiles(check_ext bool, filenames ...string) ([]string, error) {
|
||||||
|
|||||||
@@ -6,9 +6,9 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiformats"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
func BuildPairedFileNames(filename string) (string, string) {
|
func BuildPairedFileNames(filename string) (string, string) {
|
||||||
|
|||||||
@@ -3,10 +3,10 @@ package obicsv
|
|||||||
import (
|
import (
|
||||||
"log"
|
"log"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiformats"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
)
|
)
|
||||||
|
|
||||||
func CLIWriteCSV(iterator obiiter.IBioSequence,
|
func CLIWriteCSV(iterator obiiter.IBioSequence,
|
||||||
|
|||||||
@@ -1,8 +1,8 @@
|
|||||||
package obicsv
|
package obicsv
|
||||||
|
|
||||||
import (
|
import (
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
"github.com/DavidGamba/go-getoptions"
|
"github.com/DavidGamba/go-getoptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -3,13 +3,13 @@ package obidistribute
|
|||||||
import (
|
import (
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiformats"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
)
|
)
|
||||||
|
|
||||||
func DistributeSequence(sequences obiiter.IBioSequence) {
|
func CLIDistributeSequence(sequences obiiter.IBioSequence) {
|
||||||
|
|
||||||
opts := make([]obiformats.WithOption, 0, 10)
|
opts := make([]obiformats.WithOption, 0, 10)
|
||||||
|
|
||||||
|
|||||||
@@ -6,8 +6,8 @@ import (
|
|||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"github.com/DavidGamba/go-getoptions"
|
"github.com/DavidGamba/go-getoptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
@@ -37,7 +37,7 @@ func DistributeOptionSet(options *getoptions.GetOpt) {
|
|||||||
options.Alias("d"),
|
options.Alias("d"),
|
||||||
options.Description("The name of a tag annotating the sequences. "+
|
options.Description("The name of a tag annotating the sequences. "+
|
||||||
"The name must corresponds to a string, a integer or a boolean value. "+
|
"The name must corresponds to a string, a integer or a boolean value. "+
|
||||||
"That value will be used to dispatch sequences amoong the different directory " +
|
"That value will be used to dispatch sequences amoong the different directory "+
|
||||||
"in conjunction with the -c|--classifier options"))
|
"in conjunction with the -c|--classifier options"))
|
||||||
|
|
||||||
options.StringVar(&_NAValue, "na-value", _NAValue,
|
options.StringVar(&_NAValue, "na-value", _NAValue,
|
||||||
@@ -66,11 +66,10 @@ func CLIAppendSequences() bool {
|
|||||||
return _append
|
return _append
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|
||||||
func CLISequenceClassifier() *obiseq.BioSequenceClassifier {
|
func CLISequenceClassifier() *obiseq.BioSequenceClassifier {
|
||||||
switch {
|
switch {
|
||||||
case _SequenceClassifierTag != "":
|
case _SequenceClassifierTag != "":
|
||||||
return obiseq.DualAnnotationClassifier(_SequenceClassifierTag,_DirectoryTag, _NAValue)
|
return obiseq.DualAnnotationClassifier(_SequenceClassifierTag, _DirectoryTag, _NAValue)
|
||||||
case _BatchCount > 0:
|
case _BatchCount > 0:
|
||||||
return obiseq.RotateClassifier(_BatchCount)
|
return obiseq.RotateClassifier(_BatchCount)
|
||||||
case _HashSize > 0:
|
case _HashSize > 0:
|
||||||
|
|||||||
@@ -4,7 +4,7 @@ import (
|
|||||||
"bytes"
|
"bytes"
|
||||||
"fmt"
|
"fmt"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitax"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
|
||||||
)
|
)
|
||||||
|
|
||||||
func IFilterRankRestriction() func(*obitax.ITaxonSet) *obitax.ITaxonSet {
|
func IFilterRankRestriction() func(*obitax.ITaxonSet) *obitax.ITaxonSet {
|
||||||
|
|||||||
@@ -3,8 +3,8 @@ package obifind
|
|||||||
import (
|
import (
|
||||||
"errors"
|
"errors"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiformats/ncbitaxdump"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats/ncbitaxdump"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitax"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
|
||||||
"github.com/DavidGamba/go-getoptions"
|
"github.com/DavidGamba/go-getoptions"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -3,9 +3,9 @@ package obigrep
|
|||||||
import (
|
import (
|
||||||
"log"
|
"log"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiiter"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
)
|
)
|
||||||
|
|
||||||
func CLIFilterSequence(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
func CLIFilterSequence(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||||
|
|||||||
Some files were not shown because too many files have changed in this diff Show More
Reference in New Issue
Block a user