mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-05-09 15:40:40 +00:00
correction of bug and format in obisplit
Former-commit-id: d600713a5f48c8d682971be9b8a09a1c021be28c
This commit is contained in:
@@ -7,7 +7,7 @@ import (
|
|||||||
// TODO: The version number is extracted from git. This induces that the version
|
// TODO: The version number is extracted from git. This induces that the version
|
||||||
// corresponds to the last commit, and not the one when the file will be
|
// corresponds to the last commit, and not the one when the file will be
|
||||||
// commited
|
// commited
|
||||||
var _Commit = "5affee2"
|
var _Commit = "0e9a136"
|
||||||
var _Version = "Release 4.2.0"
|
var _Version = "Release 4.2.0"
|
||||||
|
|
||||||
// Version returns the version of the obitools package.
|
// Version returns the version of the obitools package.
|
||||||
|
|||||||
@@ -168,6 +168,11 @@ func SplitPattern(sequence *obiseq.BioSequence,
|
|||||||
|
|
||||||
if from.name == to.name {
|
if from.name == to.name {
|
||||||
sub.SetAttribute("obisplit_group", from.name)
|
sub.SetAttribute("obisplit_group", from.name)
|
||||||
|
if from.name == "extremity" {
|
||||||
|
sub.SetAttribute("obisplit_set", "NA")
|
||||||
|
} else {
|
||||||
|
sub.SetAttribute("obisplit_set", from.name)
|
||||||
|
}
|
||||||
} else {
|
} else {
|
||||||
fname := from.name
|
fname := from.name
|
||||||
tname := to.name
|
tname := to.name
|
||||||
@@ -179,6 +184,11 @@ func SplitPattern(sequence *obiseq.BioSequence,
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
sub.SetAttribute("obisplit_group", fmt.Sprintf("%s-%s", fname, tname))
|
sub.SetAttribute("obisplit_group", fmt.Sprintf("%s-%s", fname, tname))
|
||||||
|
if fname == "extremity" {
|
||||||
|
sub.SetAttribute("obisplit_set", tname)
|
||||||
|
} else {
|
||||||
|
sub.SetAttribute("obisplit_set", "NA")
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
sub.SetAttribute("obisplit_location", fmt.Sprintf("%d..%d", start+1, end))
|
sub.SetAttribute("obisplit_location", fmt.Sprintf("%d..%d", start+1, end))
|
||||||
@@ -226,6 +236,12 @@ func SplitPattern(sequence *obiseq.BioSequence,
|
|||||||
sub.SetAttribute("obisplit_frg", nfrag)
|
sub.SetAttribute("obisplit_frg", nfrag)
|
||||||
if from.name == to.name {
|
if from.name == to.name {
|
||||||
sub.SetAttribute("obisplit_group", from.name)
|
sub.SetAttribute("obisplit_group", from.name)
|
||||||
|
if from.name == "extremity" {
|
||||||
|
sub.SetAttribute("obisplit_set", "NA")
|
||||||
|
} else {
|
||||||
|
sub.SetAttribute("obisplit_set", from.name)
|
||||||
|
}
|
||||||
|
|
||||||
} else {
|
} else {
|
||||||
fname := from.name
|
fname := from.name
|
||||||
tname := to.name
|
tname := to.name
|
||||||
@@ -236,7 +252,13 @@ func SplitPattern(sequence *obiseq.BioSequence,
|
|||||||
fname, tname = tname, fname
|
fname, tname = tname, fname
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
sub.SetAttribute("obisplit_group", fmt.Sprintf("%s-%s", fname, tname))
|
sub.SetAttribute("obisplit_group", fmt.Sprintf("%s-%s", fname, tname))
|
||||||
|
if fname == "extremity" {
|
||||||
|
sub.SetAttribute("obisplit_set", tname)
|
||||||
|
} else {
|
||||||
|
sub.SetAttribute("obisplit_set", "NA")
|
||||||
|
}
|
||||||
}
|
}
|
||||||
sub.SetAttribute("obisplit_location", fmt.Sprintf("%d..%d", start+1, end))
|
sub.SetAttribute("obisplit_location", fmt.Sprintf("%d..%d", start+1, end))
|
||||||
|
|
||||||
|
|||||||
@@ -76,11 +76,11 @@ func CLIConfig() []SplitSequence {
|
|||||||
|
|
||||||
header := records[0]
|
header := records[0]
|
||||||
|
|
||||||
pattern_idx := slices.Index(header, "T-tag")
|
pattern_idx := slices.Index(header, "tag")
|
||||||
pool_idx := slices.Index(header, "pcr_pool")
|
pool_idx := slices.Index(header, "pcr_pool")
|
||||||
|
|
||||||
if pattern_idx == -1 {
|
if pattern_idx == -1 {
|
||||||
log.Fatalf("Config file %s doesn't contain `T-tag`column", CLIConfigFile())
|
log.Fatalf("Config file %s doesn't contain `tag`column", CLIConfigFile())
|
||||||
}
|
}
|
||||||
|
|
||||||
if pool_idx == -1 {
|
if pool_idx == -1 {
|
||||||
@@ -128,7 +128,7 @@ func CLIAskConfigTemplate() bool {
|
|||||||
}
|
}
|
||||||
|
|
||||||
func CLIConfigTemplate() string {
|
func CLIConfigTemplate() string {
|
||||||
return `T-tag,pcr_pool
|
return `tag,pcr_pool
|
||||||
CGGCACCTGTTACGCAGCCACTATCGGCT,pool_1
|
CGGCACCTGTTACGCAGCCACTATCGGCT,pool_1
|
||||||
CGGCAAGACCCTATTGCATTGGCGCGGCT,pool_2
|
CGGCAAGACCCTATTGCATTGGCGCGGCT,pool_2
|
||||||
`
|
`
|
||||||
|
|||||||
Reference in New Issue
Block a user