Documentation writting

This commit is contained in:
2023-02-03 23:00:23 +01:00
parent 14a4522a07
commit a6af0abdd8
16 changed files with 1771 additions and 666 deletions
Binary file not shown.

After

Width:  |  Height:  |  Size: 7.6 KiB

Binary file not shown.

After

Width:  |  Height:  |  Size: 7.6 KiB

+60 -55
View File
@@ -7,7 +7,7 @@
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes"> <meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
<title>OBITools V4 - 5&nbsp; Annexes</title> <title>OBITools V4 - 6&nbsp; Annexes</title>
<style> <style>
code{white-space: pre-wrap;} code{white-space: pre-wrap;}
span.smallcaps{font-variant: small-caps;} span.smallcaps{font-variant: small-caps;}
@@ -70,7 +70,7 @@ ul.task-list li input[type="checkbox"] {
<header id="quarto-header" class="headroom fixed-top"> <header id="quarto-header" class="headroom fixed-top">
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }"> <nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
<div class="container-fluid d-flex justify-content-between"> <div class="container-fluid d-flex justify-content-between">
<h1 class="quarto-secondary-nav-title"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">Annexes</span></h1> <h1 class="quarto-secondary-nav-title"><span class="chapter-number">6</span>&nbsp; <span class="chapter-title">Annexes</span></h1>
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation"> <button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
<i class="bi bi-chevron-right"></i> <i class="bi bi-chevron-right"></i>
</button> </button>
@@ -105,22 +105,27 @@ ul.task-list li input[type="checkbox"] {
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a> <a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./commands.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a> <a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./library.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a> <a href="./commands.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">Annexes</span></a> <a href="./library.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">6</span>&nbsp; <span class="chapter-title">Annexes</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
@@ -137,7 +142,7 @@ ul.task-list li input[type="checkbox"] {
<h2 id="toc-title">Table of contents</h2> <h2 id="toc-title">Table of contents</h2>
<ul> <ul>
<li><a href="#sequence-attributes" id="toc-sequence-attributes" class="nav-link active" data-scroll-target="#sequence-attributes"><span class="toc-section-number">5.0.1</span> Sequence attributes</a></li> <li><a href="#sequence-attributes" id="toc-sequence-attributes" class="nav-link active" data-scroll-target="#sequence-attributes"><span class="toc-section-number">6.0.1</span> Sequence attributes</a></li>
</ul> </ul>
</nav> </nav>
</div> </div>
@@ -146,7 +151,7 @@ ul.task-list li input[type="checkbox"] {
<header id="title-block-header" class="quarto-title-block default"> <header id="title-block-header" class="quarto-title-block default">
<div class="quarto-title"> <div class="quarto-title">
<h1 class="title d-none d-lg-block"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">Annexes</span></h1> <h1 class="title d-none d-lg-block"><span class="chapter-number">6</span>&nbsp; <span class="chapter-title">Annexes</span></h1>
</div> </div>
@@ -161,79 +166,79 @@ ul.task-list li input[type="checkbox"] {
</header> </header>
<section id="sequence-attributes" class="level3" data-number="5.0.1"> <section id="sequence-attributes" class="level3" data-number="6.0.1">
<h3 data-number="5.0.1" class="anchored" data-anchor-id="sequence-attributes"><span class="header-section-number">5.0.1</span> Sequence attributes</h3> <h3 data-number="6.0.1" class="anchored" data-anchor-id="sequence-attributes"><span class="header-section-number">6.0.1</span> Sequence attributes</h3>
<section id="reserved-sequence-attributes" class="level4" data-number="5.0.1.1"> <section id="reserved-sequence-attributes" class="level4" data-number="6.0.1.1">
<h4 data-number="5.0.1.1" class="anchored" data-anchor-id="reserved-sequence-attributes"><span class="header-section-number">5.0.1.1</span> Reserved sequence attributes</h4> <h4 data-number="6.0.1.1" class="anchored" data-anchor-id="reserved-sequence-attributes"><span class="header-section-number">6.0.1.1</span> Reserved sequence attributes</h4>
<section id="ali_dir" class="level5" data-number="5.0.1.1.1"> <section id="ali_dir" class="level5" data-number="6.0.1.1.1">
<h5 data-number="5.0.1.1.1" class="anchored" data-anchor-id="ali_dir"><span class="header-section-number">5.0.1.1.1</span> <code>ali_dir</code></h5> <h5 data-number="6.0.1.1.1" class="anchored" data-anchor-id="ali_dir"><span class="header-section-number">6.0.1.1.1</span> <code>ali_dir</code></h5>
<section id="type-string" class="level6" data-number="5.0.1.1.1.1"> <section id="type-string" class="level6" data-number="6.0.1.1.1.1">
<h6 data-number="5.0.1.1.1.1" class="anchored" data-anchor-id="type-string"><span class="header-section-number">5.0.1.1.1.1</span> Type : <code>string</code></h6> <h6 data-number="6.0.1.1.1.1" class="anchored" data-anchor-id="type-string"><span class="header-section-number">6.0.1.1.1.1</span> Type : <code>string</code></h6>
<p>The attribute can contain 2 string values <code>"left"</code> or <code>"right".</code></p> <p>The attribute can contain 2 string values <code>"left"</code> or <code>"right".</code></p>
</section> </section>
<section id="set-by-the-obipairing-tool" class="level6" data-number="5.0.1.1.1.2"> <section id="set-by-the-obipairing-tool" class="level6" data-number="6.0.1.1.1.2">
<h6 data-number="5.0.1.1.1.2" class="anchored" data-anchor-id="set-by-the-obipairing-tool"><span class="header-section-number">5.0.1.1.1.2</span> Set by the <em>obipairing</em> tool</h6> <h6 data-number="6.0.1.1.1.2" class="anchored" data-anchor-id="set-by-the-obipairing-tool"><span class="header-section-number">6.0.1.1.1.2</span> Set by the <em>obipairing</em> tool</h6>
<p>The alignment generated by <em>obipairing</em> is a 3-end gap free algorithm. Two cases can occur when aligning the forward and reverse reads. If the barcode is long enough, both the reads overlap only on their 3 ends. In such case, the alignment direction <code>ali_dir</code> is set to <em>left</em>. If the barcode is shorter than the read length, the paired reads overlap by their 5 ends, and the complete barcode is sequenced by both the reads. In that later case, <code>ali_dir</code> is set to <em>right</em>.</p> <p>The alignment generated by <em>obipairing</em> is a 3-end gap free algorithm. Two cases can occur when aligning the forward and reverse reads. If the barcode is long enough, both the reads overlap only on their 3 ends. In such case, the alignment direction <code>ali_dir</code> is set to <em>left</em>. If the barcode is shorter than the read length, the paired reads overlap by their 5 ends, and the complete barcode is sequenced by both the reads. In that later case, <code>ali_dir</code> is set to <em>right</em>.</p>
</section> </section>
</section> </section>
<section id="ali_length" class="level5" data-number="5.0.1.1.2"> <section id="ali_length" class="level5" data-number="6.0.1.1.2">
<h5 data-number="5.0.1.1.2" class="anchored" data-anchor-id="ali_length"><span class="header-section-number">5.0.1.1.2</span> <code>ali_length</code></h5> <h5 data-number="6.0.1.1.2" class="anchored" data-anchor-id="ali_length"><span class="header-section-number">6.0.1.1.2</span> <code>ali_length</code></h5>
<section id="set-by-the-obipairing-tool-1" class="level6" data-number="5.0.1.1.2.1"> <section id="set-by-the-obipairing-tool-1" class="level6" data-number="6.0.1.1.2.1">
<h6 data-number="5.0.1.1.2.1" class="anchored" data-anchor-id="set-by-the-obipairing-tool-1"><span class="header-section-number">5.0.1.1.2.1</span> Set by the <em>obipairing</em> tool</h6> <h6 data-number="6.0.1.1.2.1" class="anchored" data-anchor-id="set-by-the-obipairing-tool-1"><span class="header-section-number">6.0.1.1.2.1</span> Set by the <em>obipairing</em> tool</h6>
<p>Length of the aligned parts when merging forward and reverse reads</p> <p>Length of the aligned parts when merging forward and reverse reads</p>
</section> </section>
</section> </section>
<section id="count-the-number-of-sequence-occurrences" class="level5" data-number="5.0.1.1.3"> <section id="count-the-number-of-sequence-occurrences" class="level5" data-number="6.0.1.1.3">
<h5 data-number="5.0.1.1.3" class="anchored" data-anchor-id="count-the-number-of-sequence-occurrences"><span class="header-section-number">5.0.1.1.3</span> <code>count</code> : the number of sequence occurrences</h5> <h5 data-number="6.0.1.1.3" class="anchored" data-anchor-id="count-the-number-of-sequence-occurrences"><span class="header-section-number">6.0.1.1.3</span> <code>count</code> : the number of sequence occurrences</h5>
<section id="set-by-the-obiuniq-tool" class="level6" data-number="5.0.1.1.3.1"> <section id="set-by-the-obiuniq-tool" class="level6" data-number="6.0.1.1.3.1">
<h6 data-number="5.0.1.1.3.1" class="anchored" data-anchor-id="set-by-the-obiuniq-tool"><span class="header-section-number">5.0.1.1.3.1</span> Set by the <em>obiuniq</em> tool</h6> <h6 data-number="6.0.1.1.3.1" class="anchored" data-anchor-id="set-by-the-obiuniq-tool"><span class="header-section-number">6.0.1.1.3.1</span> Set by the <em>obiuniq</em> tool</h6>
<p>The <code>count</code> attribute indicates how-many strictly identical sequences have been merged in a single record. It contains an integer value. If it is absent this means that the sequence record represents a single occurrence of the sequence.</p> <p>The <code>count</code> attribute indicates how-many strictly identical sequences have been merged in a single record. It contains an integer value. If it is absent this means that the sequence record represents a single occurrence of the sequence.</p>
</section> </section>
<section id="getter-method-count" class="level6" data-number="5.0.1.1.3.2"> <section id="getter-method-count" class="level6" data-number="6.0.1.1.3.2">
<h6 data-number="5.0.1.1.3.2" class="anchored" data-anchor-id="getter-method-count"><span class="header-section-number">5.0.1.1.3.2</span> Getter : method <code>Count()</code></h6> <h6 data-number="6.0.1.1.3.2" class="anchored" data-anchor-id="getter-method-count"><span class="header-section-number">6.0.1.1.3.2</span> Getter : method <code>Count()</code></h6>
<p>The <code>Count()</code> method allows to access to the count attribute as an integer value. If the <code>count</code> attribute is not defined for the given sequence, the value <em>1</em> is returned</p> <p>The <code>Count()</code> method allows to access to the count attribute as an integer value. If the <code>count</code> attribute is not defined for the given sequence, the value <em>1</em> is returned</p>
</section> </section>
</section> </section>
<section id="merged_" class="level5" data-number="5.0.1.1.4"> <section id="merged_" class="level5" data-number="6.0.1.1.4">
<h5 data-number="5.0.1.1.4" class="anchored" data-anchor-id="merged_"><span class="header-section-number">5.0.1.1.4</span> <code>merged_*</code></h5> <h5 data-number="6.0.1.1.4" class="anchored" data-anchor-id="merged_"><span class="header-section-number">6.0.1.1.4</span> <code>merged_*</code></h5>
<section id="type-mapstringint" class="level6" data-number="5.0.1.1.4.1"> <section id="type-mapstringint" class="level6" data-number="6.0.1.1.4.1">
<h6 data-number="5.0.1.1.4.1" class="anchored" data-anchor-id="type-mapstringint"><span class="header-section-number">5.0.1.1.4.1</span> Type : <code>map[string]int</code></h6> <h6 data-number="6.0.1.1.4.1" class="anchored" data-anchor-id="type-mapstringint"><span class="header-section-number">6.0.1.1.4.1</span> Type : <code>map[string]int</code></h6>
</section> </section>
<section id="set-by-the-obiuniq-tool-1" class="level6" data-number="5.0.1.1.4.2"> <section id="set-by-the-obiuniq-tool-1" class="level6" data-number="6.0.1.1.4.2">
<h6 data-number="5.0.1.1.4.2" class="anchored" data-anchor-id="set-by-the-obiuniq-tool-1"><span class="header-section-number">5.0.1.1.4.2</span> Set by the <em>obiuniq</em> tool</h6> <h6 data-number="6.0.1.1.4.2" class="anchored" data-anchor-id="set-by-the-obiuniq-tool-1"><span class="header-section-number">6.0.1.1.4.2</span> Set by the <em>obiuniq</em> tool</h6>
<p>The <code>-m</code> option of the <em>obiuniq</em> tools allows for keeping track of the distribution of the values stored in given attribute of interest. Often this option is used to summarise distribution of a sequence variant accross samples when <em>obiuniq</em> is run after running <em>obimultiplex</em>. The actual name of the attribute depends on the name of the monitored attribute. If <code>-m</code> option is used with the attribute <em>sample</em>, then this attribute names <em>merged_sample</em>.</p> <p>The <code>-m</code> option of the <em>obiuniq</em> tools allows for keeping track of the distribution of the values stored in given attribute of interest. Often this option is used to summarise distribution of a sequence variant accross samples when <em>obiuniq</em> is run after running <em>obimultiplex</em>. The actual name of the attribute depends on the name of the monitored attribute. If <code>-m</code> option is used with the attribute <em>sample</em>, then this attribute names <em>merged_sample</em>.</p>
</section> </section>
</section> </section>
<section id="mode" class="level5" data-number="5.0.1.1.5"> <section id="mode" class="level5" data-number="6.0.1.1.5">
<h5 data-number="5.0.1.1.5" class="anchored" data-anchor-id="mode"><span class="header-section-number">5.0.1.1.5</span> <code>mode</code></h5> <h5 data-number="6.0.1.1.5" class="anchored" data-anchor-id="mode"><span class="header-section-number">6.0.1.1.5</span> <code>mode</code></h5>
<section id="set-by-the-obipairing-tool-2" class="level6" data-number="5.0.1.1.5.1"> <section id="set-by-the-obipairing-tool-2" class="level6" data-number="6.0.1.1.5.1">
<h6 data-number="5.0.1.1.5.1" class="anchored" data-anchor-id="set-by-the-obipairing-tool-2"><span class="header-section-number">5.0.1.1.5.1</span> Set by the <em>obipairing</em> tool</h6> <h6 data-number="6.0.1.1.5.1" class="anchored" data-anchor-id="set-by-the-obipairing-tool-2"><span class="header-section-number">6.0.1.1.5.1</span> Set by the <em>obipairing</em> tool</h6>
<p><strong><code>obitag_ref_index</code></strong></p> <p><strong><code>obitag_ref_index</code></strong></p>
</section> </section>
<section id="set-by-the-obirefidx-tool." class="level6" data-number="5.0.1.1.5.2"> <section id="set-by-the-obirefidx-tool." class="level6" data-number="6.0.1.1.5.2">
<h6 data-number="5.0.1.1.5.2" class="anchored" data-anchor-id="set-by-the-obirefidx-tool."><span class="header-section-number">5.0.1.1.5.2</span> Set by the <em>obirefidx</em> tool.</h6> <h6 data-number="6.0.1.1.5.2" class="anchored" data-anchor-id="set-by-the-obirefidx-tool."><span class="header-section-number">6.0.1.1.5.2</span> Set by the <em>obirefidx</em> tool.</h6>
<p>It resumes to which taxonomic annotation a match to that sequence must lead according to the number of differences existing between the query sequence and the reference sequence having that tag.</p> <p>It resumes to which taxonomic annotation a match to that sequence must lead according to the number of differences existing between the query sequence and the reference sequence having that tag.</p>
</section> </section>
<section id="getter-method-count-1" class="level6" data-number="5.0.1.1.5.3"> <section id="getter-method-count-1" class="level6" data-number="6.0.1.1.5.3">
<h6 data-number="5.0.1.1.5.3" class="anchored" data-anchor-id="getter-method-count-1"><span class="header-section-number">5.0.1.1.5.3</span> Getter : method <code>Count()</code></h6> <h6 data-number="6.0.1.1.5.3" class="anchored" data-anchor-id="getter-method-count-1"><span class="header-section-number">6.0.1.1.5.3</span> Getter : method <code>Count()</code></h6>
</section> </section>
</section> </section>
<section id="pairing_mismatches" class="level5" data-number="5.0.1.1.6"> <section id="pairing_mismatches" class="level5" data-number="6.0.1.1.6">
<h5 data-number="5.0.1.1.6" class="anchored" data-anchor-id="pairing_mismatches"><span class="header-section-number">5.0.1.1.6</span> <code>pairing_mismatches</code></h5> <h5 data-number="6.0.1.1.6" class="anchored" data-anchor-id="pairing_mismatches"><span class="header-section-number">6.0.1.1.6</span> <code>pairing_mismatches</code></h5>
<section id="set-by-the-obipairing-tool-3" class="level6" data-number="5.0.1.1.6.1"> <section id="set-by-the-obipairing-tool-3" class="level6" data-number="6.0.1.1.6.1">
<h6 data-number="5.0.1.1.6.1" class="anchored" data-anchor-id="set-by-the-obipairing-tool-3"><span class="header-section-number">5.0.1.1.6.1</span> Set by the <em>obipairing</em> tool</h6> <h6 data-number="6.0.1.1.6.1" class="anchored" data-anchor-id="set-by-the-obipairing-tool-3"><span class="header-section-number">6.0.1.1.6.1</span> Set by the <em>obipairing</em> tool</h6>
</section> </section>
</section> </section>
<section id="score" class="level5" data-number="5.0.1.1.7"> <section id="score" class="level5" data-number="6.0.1.1.7">
<h5 data-number="5.0.1.1.7" class="anchored" data-anchor-id="score"><span class="header-section-number">5.0.1.1.7</span> <code>score</code></h5> <h5 data-number="6.0.1.1.7" class="anchored" data-anchor-id="score"><span class="header-section-number">6.0.1.1.7</span> <code>score</code></h5>
<section id="set-by-the-obipairing-tool-4" class="level6" data-number="5.0.1.1.7.1"> <section id="set-by-the-obipairing-tool-4" class="level6" data-number="6.0.1.1.7.1">
<h6 data-number="5.0.1.1.7.1" class="anchored" data-anchor-id="set-by-the-obipairing-tool-4"><span class="header-section-number">5.0.1.1.7.1</span> Set by the <em>obipairing</em> tool</h6> <h6 data-number="6.0.1.1.7.1" class="anchored" data-anchor-id="set-by-the-obipairing-tool-4"><span class="header-section-number">6.0.1.1.7.1</span> Set by the <em>obipairing</em> tool</h6>
</section> </section>
</section> </section>
<section id="score_norm" class="level5" data-number="5.0.1.1.8"> <section id="score_norm" class="level5" data-number="6.0.1.1.8">
<h5 data-number="5.0.1.1.8" class="anchored" data-anchor-id="score_norm"><span class="header-section-number">5.0.1.1.8</span> <code>score_norm</code></h5> <h5 data-number="6.0.1.1.8" class="anchored" data-anchor-id="score_norm"><span class="header-section-number">6.0.1.1.8</span> <code>score_norm</code></h5>
<section id="set-by-the-obipairing-tool-5" class="level6" data-number="5.0.1.1.8.1"> <section id="set-by-the-obipairing-tool-5" class="level6" data-number="6.0.1.1.8.1">
<h6 data-number="5.0.1.1.8.1" class="anchored" data-anchor-id="set-by-the-obipairing-tool-5"><span class="header-section-number">5.0.1.1.8.1</span> Set by the <em>obipairing</em> tool</h6> <h6 data-number="6.0.1.1.8.1" class="anchored" data-anchor-id="set-by-the-obipairing-tool-5"><span class="header-section-number">6.0.1.1.8.1</span> Set by the <em>obipairing</em> tool</h6>
</section> </section>
@@ -378,7 +383,7 @@ window.document.addEventListener("DOMContentLoaded", function (event) {
<nav class="page-navigation"> <nav class="page-navigation">
<div class="nav-page nav-page-previous"> <div class="nav-page nav-page-previous">
<a href="./library.html" class="pagination-link"> <a href="./library.html" class="pagination-link">
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></span> <i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></span>
</a> </a>
</div> </div>
<div class="nav-page nav-page-next"> <div class="nav-page nav-page-next">
+108 -103
View File
@@ -7,7 +7,7 @@
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes"> <meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
<title>OBITools V4 - 3&nbsp; The OBITools V4 commands</title> <title>OBITools V4 - 4&nbsp; The OBITools V4 commands</title>
<style> <style>
code{white-space: pre-wrap;} code{white-space: pre-wrap;}
span.smallcaps{font-variant: small-caps;} span.smallcaps{font-variant: small-caps;}
@@ -90,7 +90,7 @@ div.csl-indent {
<header id="quarto-header" class="headroom fixed-top"> <header id="quarto-header" class="headroom fixed-top">
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }"> <nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
<div class="container-fluid d-flex justify-content-between"> <div class="container-fluid d-flex justify-content-between">
<h1 class="quarto-secondary-nav-title"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></h1> <h1 class="quarto-secondary-nav-title"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></h1>
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation"> <button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
<i class="bi bi-chevron-right"></i> <i class="bi bi-chevron-right"></i>
</button> </button>
@@ -125,22 +125,27 @@ div.csl-indent {
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a> <a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./commands.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a> <a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./library.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a> <a href="./commands.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">Annexes</span></a> <a href="./library.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span>&nbsp; <span class="chapter-title">Annexes</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
@@ -157,29 +162,29 @@ div.csl-indent {
<h2 id="toc-title">Table of contents</h2> <h2 id="toc-title">Table of contents</h2>
<ul> <ul>
<li><a href="#specifying-the-input-files-to-obitools-commands" id="toc-specifying-the-input-files-to-obitools-commands" class="nav-link active" data-scroll-target="#specifying-the-input-files-to-obitools-commands"><span class="toc-section-number">3.1</span> Specifying the input files to <em>OBITools</em> commands</a></li> <li><a href="#specifying-the-input-files-to-obitools-commands" id="toc-specifying-the-input-files-to-obitools-commands" class="nav-link active" data-scroll-target="#specifying-the-input-files-to-obitools-commands"><span class="toc-section-number">4.1</span> Specifying the input files to <em>OBITools</em> commands</a></li>
<li><a href="#options-common-to-most-of-the-obitools-commands" id="toc-options-common-to-most-of-the-obitools-commands" class="nav-link" data-scroll-target="#options-common-to-most-of-the-obitools-commands"><span class="toc-section-number">3.2</span> Options common to most of the <em>OBITools</em> commands</a> <li><a href="#options-common-to-most-of-the-obitools-commands" id="toc-options-common-to-most-of-the-obitools-commands" class="nav-link" data-scroll-target="#options-common-to-most-of-the-obitools-commands"><span class="toc-section-number">4.2</span> Options common to most of the <em>OBITools</em> commands</a>
<ul class="collapse"> <ul class="collapse">
<li><a href="#specifying-input-format" id="toc-specifying-input-format" class="nav-link" data-scroll-target="#specifying-input-format"><span class="toc-section-number">3.2.1</span> Specifying input format</a></li> <li><a href="#specifying-input-format" id="toc-specifying-input-format" class="nav-link" data-scroll-target="#specifying-input-format"><span class="toc-section-number">4.2.1</span> Specifying input format</a></li>
<li><a href="#specifying-output-format" id="toc-specifying-output-format" class="nav-link" data-scroll-target="#specifying-output-format"><span class="toc-section-number">3.2.2</span> Specifying output format</a></li> <li><a href="#specifying-output-format" id="toc-specifying-output-format" class="nav-link" data-scroll-target="#specifying-output-format"><span class="toc-section-number">4.2.2</span> Specifying output format</a></li>
<li><a href="#format-of-the-annotations-in-fasta-and-fastq-files" id="toc-format-of-the-annotations-in-fasta-and-fastq-files" class="nav-link" data-scroll-target="#format-of-the-annotations-in-fasta-and-fastq-files"><span class="toc-section-number">3.2.3</span> Format of the annotations in Fasta and Fastq files</a></li> <li><a href="#the-fasta-and-fastq-annotations-format" id="toc-the-fasta-and-fastq-annotations-format" class="nav-link" data-scroll-target="#the-fasta-and-fastq-annotations-format"><span class="toc-section-number">4.2.3</span> The Fasta and Fastq annotations format</a></li>
</ul></li> </ul></li>
<li><a href="#obitools-expression-language" id="toc-obitools-expression-language" class="nav-link" data-scroll-target="#obitools-expression-language"><span class="toc-section-number">3.3</span> OBITools expression language</a> <li><a href="#obitools-expression-language" id="toc-obitools-expression-language" class="nav-link" data-scroll-target="#obitools-expression-language"><span class="toc-section-number">4.3</span> OBITools expression language</a>
<ul class="collapse"> <ul class="collapse">
<li><a href="#variables-usable-in-the-expression" id="toc-variables-usable-in-the-expression" class="nav-link" data-scroll-target="#variables-usable-in-the-expression"><span class="toc-section-number">3.3.1</span> Variables usable in the expression</a></li> <li><a href="#variables-usable-in-the-expression" id="toc-variables-usable-in-the-expression" class="nav-link" data-scroll-target="#variables-usable-in-the-expression"><span class="toc-section-number">4.3.1</span> Variables usable in the expression</a></li>
<li><a href="#function-defined-in-the-language" id="toc-function-defined-in-the-language" class="nav-link" data-scroll-target="#function-defined-in-the-language"><span class="toc-section-number">3.3.2</span> Function defined in the language</a></li> <li><a href="#function-defined-in-the-language" id="toc-function-defined-in-the-language" class="nav-link" data-scroll-target="#function-defined-in-the-language"><span class="toc-section-number">4.3.2</span> Function defined in the language</a></li>
<li><a href="#accessing-to-the-sequence-annotations" id="toc-accessing-to-the-sequence-annotations" class="nav-link" data-scroll-target="#accessing-to-the-sequence-annotations"><span class="toc-section-number">3.3.3</span> Accessing to the sequence annotations</a></li> <li><a href="#accessing-to-the-sequence-annotations" id="toc-accessing-to-the-sequence-annotations" class="nav-link" data-scroll-target="#accessing-to-the-sequence-annotations"><span class="toc-section-number">4.3.3</span> Accessing to the sequence annotations</a></li>
</ul></li> </ul></li>
<li><a href="#metabarcode-design-and-quality-assessment" id="toc-metabarcode-design-and-quality-assessment" class="nav-link" data-scroll-target="#metabarcode-design-and-quality-assessment"><span class="toc-section-number">3.4</span> Metabarcode design and quality assessment</a></li> <li><a href="#metabarcode-design-and-quality-assessment" id="toc-metabarcode-design-and-quality-assessment" class="nav-link" data-scroll-target="#metabarcode-design-and-quality-assessment"><span class="toc-section-number">4.4</span> Metabarcode design and quality assessment</a></li>
<li><a href="#file-format-conversions" id="toc-file-format-conversions" class="nav-link" data-scroll-target="#file-format-conversions"><span class="toc-section-number">3.5</span> File format conversions</a></li> <li><a href="#file-format-conversions" id="toc-file-format-conversions" class="nav-link" data-scroll-target="#file-format-conversions"><span class="toc-section-number">4.5</span> File format conversions</a></li>
<li><a href="#sequence-annotations" id="toc-sequence-annotations" class="nav-link" data-scroll-target="#sequence-annotations"><span class="toc-section-number">3.6</span> Sequence annotations</a></li> <li><a href="#sequence-annotations" id="toc-sequence-annotations" class="nav-link" data-scroll-target="#sequence-annotations"><span class="toc-section-number">4.6</span> Sequence annotations</a></li>
<li><a href="#computations-on-sequences" id="toc-computations-on-sequences" class="nav-link" data-scroll-target="#computations-on-sequences"><span class="toc-section-number">3.7</span> Computations on sequences</a> <li><a href="#computations-on-sequences" id="toc-computations-on-sequences" class="nav-link" data-scroll-target="#computations-on-sequences"><span class="toc-section-number">4.7</span> Computations on sequences</a>
<ul class="collapse"> <ul class="collapse">
<li><a href="#obipairing" id="toc-obipairing" class="nav-link" data-scroll-target="#obipairing"><span class="toc-section-number">3.7.1</span> <code>obipairing</code></a></li> <li><a href="#obipairing" id="toc-obipairing" class="nav-link" data-scroll-target="#obipairing"><span class="toc-section-number">4.7.1</span> <code>obipairing</code></a></li>
</ul></li> </ul></li>
<li><a href="#sequence-sampling-and-filtering" id="toc-sequence-sampling-and-filtering" class="nav-link" data-scroll-target="#sequence-sampling-and-filtering"><span class="toc-section-number">3.8</span> Sequence sampling and filtering</a> <li><a href="#sequence-sampling-and-filtering" id="toc-sequence-sampling-and-filtering" class="nav-link" data-scroll-target="#sequence-sampling-and-filtering"><span class="toc-section-number">4.8</span> Sequence sampling and filtering</a>
<ul class="collapse"> <ul class="collapse">
<li><a href="#utilities" id="toc-utilities" class="nav-link" data-scroll-target="#utilities"><span class="toc-section-number">3.8.1</span> Utilities</a></li> <li><a href="#utilities" id="toc-utilities" class="nav-link" data-scroll-target="#utilities"><span class="toc-section-number">4.8.1</span> Utilities</a></li>
</ul></li> </ul></li>
</ul> </ul>
</nav> </nav>
@@ -189,7 +194,7 @@ div.csl-indent {
<header id="title-block-header" class="quarto-title-block default"> <header id="title-block-header" class="quarto-title-block default">
<div class="quarto-title"> <div class="quarto-title">
<h1 class="title d-none d-lg-block"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></h1> <h1 class="title d-none d-lg-block"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></h1>
</div> </div>
@@ -204,26 +209,26 @@ div.csl-indent {
</header> </header>
<section id="specifying-the-input-files-to-obitools-commands" class="level2" data-number="3.1"> <section id="specifying-the-input-files-to-obitools-commands" class="level2" data-number="4.1">
<h2 data-number="3.1" class="anchored" data-anchor-id="specifying-the-input-files-to-obitools-commands"><span class="header-section-number">3.1</span> Specifying the input files to <em>OBITools</em> commands</h2> <h2 data-number="4.1" class="anchored" data-anchor-id="specifying-the-input-files-to-obitools-commands"><span class="header-section-number">4.1</span> Specifying the input files to <em>OBITools</em> commands</h2>
</section> </section>
<section id="options-common-to-most-of-the-obitools-commands" class="level2" data-number="3.2"> <section id="options-common-to-most-of-the-obitools-commands" class="level2" data-number="4.2">
<h2 data-number="3.2" class="anchored" data-anchor-id="options-common-to-most-of-the-obitools-commands"><span class="header-section-number">3.2</span> Options common to most of the <em>OBITools</em> commands</h2> <h2 data-number="4.2" class="anchored" data-anchor-id="options-common-to-most-of-the-obitools-commands"><span class="header-section-number">4.2</span> Options common to most of the <em>OBITools</em> commands</h2>
<section id="specifying-input-format" class="level3" data-number="3.2.1"> <section id="specifying-input-format" class="level3" data-number="4.2.1">
<h3 data-number="3.2.1" class="anchored" data-anchor-id="specifying-input-format"><span class="header-section-number">3.2.1</span> Specifying input format</h3> <h3 data-number="4.2.1" class="anchored" data-anchor-id="specifying-input-format"><span class="header-section-number">4.2.1</span> Specifying input format</h3>
<p>Five sequence formats are accepted for input files. <a href="#fasta-classical" title="Fasta format description">Fasta</a> and <a href="#fastq-classical" title="Fastq format description">Fastq</a> are the main ones, EMBL and Genbank allow the use of flat files produced by these two international databases. The last one, ecoPCR, is maintained for compatibility with previous <em>OBITools</em> and allows to read <em>ecoPCR</em> outputs as sequence files.</p> <p>Five sequence formats are accepted for input files. <em>Fasta</em> (<a href="formats.html#sec-fasta"><span>Section&nbsp;2.1.2</span></a>) and <em>Fastq</em> (<a href="formats.html#sec-fastq"><span>Section&nbsp;2.1.3</span></a>) are the main ones, EMBL and Genbank allow the use of flat files produced by these two international databases. The last one, ecoPCR, is maintained for compatibility with previous <em>OBITools</em> and allows to read <em>ecoPCR</em> outputs as sequence files.</p>
<ul> <ul>
<li><code>--ecopcr</code> : Read data following the <em>ecoPCR</em> output format.</li> <li><code>--ecopcr</code> : Read data following the <em>ecoPCR</em> output format.</li>
<li><code>--embl</code> Read data following the <em>EMBL</em> flatfile format.</li> <li><code>--embl</code> Read data following the <em>EMBL</em> flatfile format.</li>
<li><code>--genbank</code> Read data following the <em>Genbank</em> flatfile format.</li> <li><code>--genbank</code> Read data following the <em>Genbank</em> flatfile format.</li>
</ul> </ul>
<p>Several encoding schemes have been proposed for quality scores in <a href="#fastq-classical" title="Fastq format description">Fastq</a> format. Currently, <em>OBITools</em> considers Sanger encoding as the standard. For reasons of compatibility with older datasets produced with <em>Solexa</em> sequencers, it is possible, by using the following option, to force the use of the corresponding quality encoding scheme when reading these older files.</p> <p>Several encoding schemes have been proposed for quality scores in <em>Fastq</em> format. Currently, <em>OBITools</em> considers Sanger encoding as the standard. For reasons of compatibility with older datasets produced with <em>Solexa</em> sequencers, it is possible, by using the following option, to force the use of the corresponding quality encoding scheme when reading these older files.</p>
<ul> <ul>
<li><code>--solexa</code> Decodes quality string according to the Solexa specification. (default: false)</li> <li><code>--solexa</code> Decodes quality string according to the Solexa specification. (default: false)</li>
</ul> </ul>
</section> </section>
<section id="specifying-output-format" class="level3" data-number="3.2.2"> <section id="specifying-output-format" class="level3" data-number="4.2.2">
<h3 data-number="3.2.2" class="anchored" data-anchor-id="specifying-output-format"><span class="header-section-number">3.2.2</span> Specifying output format</h3> <h3 data-number="4.2.2" class="anchored" data-anchor-id="specifying-output-format"><span class="header-section-number">4.2.2</span> Specifying output format</h3>
<p>Only two output sequence formats are supported by OBITools, Fasta and Fastq. Fastq is used when output sequences are associated with quality information. Otherwise, Fasta is the default format. However, it is possible to force the output format by using one of the following two options. Forcing the use of Fasta results in the loss of quality information. Conversely, when the Fastq format is forced with sequences that have no quality data, dummy qualities set to 40 for each nucleotide are added.</p> <p>Only two output sequence formats are supported by OBITools, Fasta and Fastq. Fastq is used when output sequences are associated with quality information. Otherwise, Fasta is the default format. However, it is possible to force the output format by using one of the following two options. Forcing the use of Fasta results in the loss of quality information. Conversely, when the Fastq format is forced with sequences that have no quality data, dummy qualities set to 40 for each nucleotide are added.</p>
<ul> <ul>
<li><code>--fasta-output</code> Read data following the ecoPCR output format.</li> <li><code>--fasta-output</code> Read data following the ecoPCR output format.</li>
@@ -231,12 +236,12 @@ div.csl-indent {
</ul> </ul>
<p>OBITools allows multiple input files to be specified for a single command.</p> <p>OBITools allows multiple input files to be specified for a single command.</p>
<ul> <ul>
<li><code>--no-order</code> When several input files are provided, indicates that there is no order among them. (default: false)</li> <li><code>--no-order</code> When several input files are provided, indicates that there is no order among them. (default: false). Using such option can increase a lot the processing of the data.</li>
</ul> </ul>
</section> </section>
<section id="format-of-the-annotations-in-fasta-and-fastq-files" class="level3" data-number="3.2.3"> <section id="the-fasta-and-fastq-annotations-format" class="level3" data-number="4.2.3">
<h3 data-number="3.2.3" class="anchored" data-anchor-id="format-of-the-annotations-in-fasta-and-fastq-files"><span class="header-section-number">3.2.3</span> Format of the annotations in Fasta and Fastq files</h3> <h3 data-number="4.2.3" class="anchored" data-anchor-id="the-fasta-and-fastq-annotations-format"><span class="header-section-number">4.2.3</span> The Fasta and Fastq annotations format</h3>
<p>OBITools extend the <a href="#fasta-classical" title="Fasta format description">Fasta</a> and <a href="#fastq-classical" title="Fastq format description">Fastq</a> formats by introducing a format for the title lines of these formats allowing to annotate every sequence. While the previous version of OBITools used an <em>ad-hoc</em> format for these annotation, this new version introduce the usage of the standard JSON format to store them.</p> <p>OBITools extend the <a href="#the-fasta-sequence-format">Fasta</a> and <a href="#the-fastq-sequence-format">Fastq</a> formats by introducing a format for the title lines of these formats allowing to annotate every sequence. While the previous version of OBITools used an <em>ad-hoc</em> format for these annotation, this new version introduce the usage of the standard JSON format to store them.</p>
<p>On input, OBITools automatically recognize the format of the annotations, but two options allows to force the parsing following one of them. You should normally not need to use these options.</p> <p>On input, OBITools automatically recognize the format of the annotations, but two options allows to force the parsing following one of them. You should normally not need to use these options.</p>
<ul> <ul>
<li><p><code>--input-OBI-header</code> FASTA/FASTQ title line annotations follow OBI format. (default: false)</p></li> <li><p><code>--input-OBI-header</code> FASTA/FASTQ title line annotations follow OBI format. (default: false)</p></li>
@@ -247,8 +252,8 @@ div.csl-indent {
<li><p><code>--output-OBI-header|-O</code> output FASTA/FASTQ title line annotations follow OBI format. (default: false)</p></li> <li><p><code>--output-OBI-header|-O</code> output FASTA/FASTQ title line annotations follow OBI format. (default: false)</p></li>
<li><p><code>--output-json-header</code> output FASTA/FASTQ title line annotations follow json format. (default: false)</p></li> <li><p><code>--output-json-header</code> output FASTA/FASTQ title line annotations follow json format. (default: false)</p></li>
</ul> </ul>
<section id="system-related-options" class="level4" data-number="3.2.3.1"> <section id="system-related-options" class="level4" data-number="4.2.3.1">
<h4 data-number="3.2.3.1" class="anchored" data-anchor-id="system-related-options"><span class="header-section-number">3.2.3.1</span> System related options</h4> <h4 data-number="4.2.3.1" class="anchored" data-anchor-id="system-related-options"><span class="header-section-number">4.2.3.1</span> System related options</h4>
<ul> <ul>
<li><code>--debug</code> (default: false)</li> <li><code>--debug</code> (default: false)</li>
<li><code>--help\|-h\|-?</code> (default: false)</li> <li><code>--help\|-h\|-?</code> (default: false)</li>
@@ -258,78 +263,78 @@ div.csl-indent {
</section> </section>
</section> </section>
</section> </section>
<section id="obitools-expression-language" class="level2" data-number="3.3"> <section id="obitools-expression-language" class="level2" data-number="4.3">
<h2 data-number="3.3" class="anchored" data-anchor-id="obitools-expression-language"><span class="header-section-number">3.3</span> OBITools expression language</h2> <h2 data-number="4.3" class="anchored" data-anchor-id="obitools-expression-language"><span class="header-section-number">4.3</span> OBITools expression language</h2>
<p>Several OBITools (<em>e.g.</em> obigrep, obiannotate) allow the user to specify some simple expressions to compute values or define predicates. This expressions are parsed and evaluated using the <a href="https://pkg.go.dev/github.com/PaesslerAG/gval" title="Gval (Go eVALuate) for evaluating arbitrary expressions Go-like expressions.">gval</a> go package, which allows for evaluating go-Like expression.</p> <p>Several OBITools (<em>e.g.</em> obigrep, obiannotate) allow the user to specify some simple expressions to compute values or define predicates. This expressions are parsed and evaluated using the <a href="https://pkg.go.dev/github.com/PaesslerAG/gval" title="Gval (Go eVALuate) for evaluating arbitrary expressions Go-like expressions.">gval</a> go package, which allows for evaluating go-Like expression.</p>
<section id="variables-usable-in-the-expression" class="level3" data-number="3.3.1"> <section id="variables-usable-in-the-expression" class="level3" data-number="4.3.1">
<h3 data-number="3.3.1" class="anchored" data-anchor-id="variables-usable-in-the-expression"><span class="header-section-number">3.3.1</span> Variables usable in the expression</h3> <h3 data-number="4.3.1" class="anchored" data-anchor-id="variables-usable-in-the-expression"><span class="header-section-number">4.3.1</span> Variables usable in the expression</h3>
<section id="sequence" class="level4" data-number="3.3.1.1"> <section id="sequence" class="level4" data-number="4.3.1.1">
<h4 data-number="3.3.1.1" class="anchored" data-anchor-id="sequence"><span class="header-section-number">3.3.1.1</span> sequence</h4> <h4 data-number="4.3.1.1" class="anchored" data-anchor-id="sequence"><span class="header-section-number">4.3.1.1</span> sequence</h4>
<p>sequence is the sequence object on which the expression is evaluated</p> <p>sequence is the sequence object on which the expression is evaluated</p>
</section> </section>
<section id="annotation" class="level4" data-number="3.3.1.2"> <section id="annotation" class="level4" data-number="4.3.1.2">
<h4 data-number="3.3.1.2" class="anchored" data-anchor-id="annotation"><span class="header-section-number">3.3.1.2</span> annotation</h4> <h4 data-number="4.3.1.2" class="anchored" data-anchor-id="annotation"><span class="header-section-number">4.3.1.2</span> annotation</h4>
</section> </section>
</section> </section>
<section id="function-defined-in-the-language" class="level3" data-number="3.3.2"> <section id="function-defined-in-the-language" class="level3" data-number="4.3.2">
<h3 data-number="3.3.2" class="anchored" data-anchor-id="function-defined-in-the-language"><span class="header-section-number">3.3.2</span> Function defined in the language</h3> <h3 data-number="4.3.2" class="anchored" data-anchor-id="function-defined-in-the-language"><span class="header-section-number">4.3.2</span> Function defined in the language</h3>
<section id="len" class="level4" data-number="3.3.2.1"> <section id="len" class="level4" data-number="4.3.2.1">
<h4 data-number="3.3.2.1" class="anchored" data-anchor-id="len"><span class="header-section-number">3.3.2.1</span> len</h4> <h4 data-number="4.3.2.1" class="anchored" data-anchor-id="len"><span class="header-section-number">4.3.2.1</span> len</h4>
</section> </section>
<section id="ismap" class="level4" data-number="3.3.2.2"> <section id="ismap" class="level4" data-number="4.3.2.2">
<h4 data-number="3.3.2.2" class="anchored" data-anchor-id="ismap"><span class="header-section-number">3.3.2.2</span> ismap</h4> <h4 data-number="4.3.2.2" class="anchored" data-anchor-id="ismap"><span class="header-section-number">4.3.2.2</span> ismap</h4>
</section> </section>
<section id="hasattribute" class="level4" data-number="3.3.2.3"> <section id="hasattribute" class="level4" data-number="4.3.2.3">
<h4 data-number="3.3.2.3" class="anchored" data-anchor-id="hasattribute"><span class="header-section-number">3.3.2.3</span> hasattribute</h4> <h4 data-number="4.3.2.3" class="anchored" data-anchor-id="hasattribute"><span class="header-section-number">4.3.2.3</span> hasattribute</h4>
</section> </section>
<section id="min" class="level4" data-number="3.3.2.4"> <section id="min" class="level4" data-number="4.3.2.4">
<h4 data-number="3.3.2.4" class="anchored" data-anchor-id="min"><span class="header-section-number">3.3.2.4</span> min</h4> <h4 data-number="4.3.2.4" class="anchored" data-anchor-id="min"><span class="header-section-number">4.3.2.4</span> min</h4>
</section> </section>
<section id="max" class="level4" data-number="3.3.2.5"> <section id="max" class="level4" data-number="4.3.2.5">
<h4 data-number="3.3.2.5" class="anchored" data-anchor-id="max"><span class="header-section-number">3.3.2.5</span> max</h4> <h4 data-number="4.3.2.5" class="anchored" data-anchor-id="max"><span class="header-section-number">4.3.2.5</span> max</h4>
</section> </section>
</section> </section>
<section id="accessing-to-the-sequence-annotations" class="level3" data-number="3.3.3"> <section id="accessing-to-the-sequence-annotations" class="level3" data-number="4.3.3">
<h3 data-number="3.3.3" class="anchored" data-anchor-id="accessing-to-the-sequence-annotations"><span class="header-section-number">3.3.3</span> Accessing to the sequence annotations</h3> <h3 data-number="4.3.3" class="anchored" data-anchor-id="accessing-to-the-sequence-annotations"><span class="header-section-number">4.3.3</span> Accessing to the sequence annotations</h3>
</section> </section>
</section> </section>
<section id="metabarcode-design-and-quality-assessment" class="level2" data-number="3.4"> <section id="metabarcode-design-and-quality-assessment" class="level2" data-number="4.4">
<h2 data-number="3.4" class="anchored" data-anchor-id="metabarcode-design-and-quality-assessment"><span class="header-section-number">3.4</span> Metabarcode design and quality assessment</h2> <h2 data-number="4.4" class="anchored" data-anchor-id="metabarcode-design-and-quality-assessment"><span class="header-section-number">4.4</span> Metabarcode design and quality assessment</h2>
<section id="obipcr" class="level4" data-number="3.4.0.1"> <section id="obipcr" class="level4" data-number="4.4.0.1">
<h4 data-number="3.4.0.1" class="anchored" data-anchor-id="obipcr"><span class="header-section-number">3.4.0.1</span> <code>obipcr</code></h4> <h4 data-number="4.4.0.1" class="anchored" data-anchor-id="obipcr"><span class="header-section-number">4.4.0.1</span> <code>obipcr</code></h4>
<blockquote class="blockquote"> <blockquote class="blockquote">
<p>Replace the <code>ecoPCR</code> original <em>OBITools</em></p> <p>Replace the <code>ecoPCR</code> original <em>OBITools</em></p>
</blockquote> </blockquote>
</section> </section>
</section> </section>
<section id="file-format-conversions" class="level2" data-number="3.5"> <section id="file-format-conversions" class="level2" data-number="4.5">
<h2 data-number="3.5" class="anchored" data-anchor-id="file-format-conversions"><span class="header-section-number">3.5</span> File format conversions</h2> <h2 data-number="4.5" class="anchored" data-anchor-id="file-format-conversions"><span class="header-section-number">4.5</span> File format conversions</h2>
<section id="obiconvert" class="level4" data-number="3.5.0.1"> <section id="obiconvert" class="level4" data-number="4.5.0.1">
<h4 data-number="3.5.0.1" class="anchored" data-anchor-id="obiconvert"><span class="header-section-number">3.5.0.1</span> <code>obiconvert</code></h4> <h4 data-number="4.5.0.1" class="anchored" data-anchor-id="obiconvert"><span class="header-section-number">4.5.0.1</span> <code>obiconvert</code></h4>
</section> </section>
</section> </section>
<section id="sequence-annotations" class="level2" data-number="3.6"> <section id="sequence-annotations" class="level2" data-number="4.6">
<h2 data-number="3.6" class="anchored" data-anchor-id="sequence-annotations"><span class="header-section-number">3.6</span> Sequence annotations</h2> <h2 data-number="4.6" class="anchored" data-anchor-id="sequence-annotations"><span class="header-section-number">4.6</span> Sequence annotations</h2>
<section id="obitag" class="level4" data-number="3.6.0.1"> <section id="obitag" class="level4" data-number="4.6.0.1">
<h4 data-number="3.6.0.1" class="anchored" data-anchor-id="obitag"><span class="header-section-number">3.6.0.1</span> <code>obitag</code></h4> <h4 data-number="4.6.0.1" class="anchored" data-anchor-id="obitag"><span class="header-section-number">4.6.0.1</span> <code>obitag</code></h4>
</section> </section>
</section> </section>
<section id="computations-on-sequences" class="level2" data-number="3.7"> <section id="computations-on-sequences" class="level2" data-number="4.7">
<h2 data-number="3.7" class="anchored" data-anchor-id="computations-on-sequences"><span class="header-section-number">3.7</span> Computations on sequences</h2> <h2 data-number="4.7" class="anchored" data-anchor-id="computations-on-sequences"><span class="header-section-number">4.7</span> Computations on sequences</h2>
<section id="obipairing" class="level3" data-number="3.7.1"> <section id="obipairing" class="level3" data-number="4.7.1">
<h3 data-number="3.7.1" class="anchored" data-anchor-id="obipairing"><span class="header-section-number">3.7.1</span> <code>obipairing</code></h3> <h3 data-number="4.7.1" class="anchored" data-anchor-id="obipairing"><span class="header-section-number">4.7.1</span> <code>obipairing</code></h3>
<blockquote class="blockquote"> <blockquote class="blockquote">
<p>Replace the <code>illuminapairedends</code> original <em>OBITools</em></p> <p>Replace the <code>illuminapairedends</code> original <em>OBITools</em></p>
</blockquote> </blockquote>
<section id="alignment-procedure" class="level4" data-number="3.7.1.1"> <section id="alignment-procedure" class="level4" data-number="4.7.1.1">
<h4 data-number="3.7.1.1" class="anchored" data-anchor-id="alignment-procedure"><span class="header-section-number">3.7.1.1</span> Alignment procedure</h4> <h4 data-number="4.7.1.1" class="anchored" data-anchor-id="alignment-procedure"><span class="header-section-number">4.7.1.1</span> Alignment procedure</h4>
<p><code>obipairing</code> is introducing a new alignment algorithm compared to the <code>illuminapairedend</code> command of the <code>OBITools V2</code>. Nethertheless this new algorithm has been design to produce the same results than the previous, except in very few cases.</p> <p><code>obipairing</code> is introducing a new alignment algorithm compared to the <code>illuminapairedend</code> command of the <code>OBITools V2</code>. Nethertheless this new algorithm has been design to produce the same results than the previous, except in very few cases.</p>
<p>The new algorithm is a two-step procedure. First, a FASTN-type algorithm <span class="citation" data-cites="Lipman1985-hw">(<a href="references.html#ref-Lipman1985-hw" role="doc-biblioref">Lipman and Pearson 1985</a>)</span> identifies the best offset between the two matched readings. This identifies the region of overlap.</p> <p>The new algorithm is a two-step procedure. First, a FASTN-type algorithm <span class="citation" data-cites="Lipman1985-hw">(<a href="references.html#ref-Lipman1985-hw" role="doc-biblioref">Lipman and Pearson 1985</a>)</span> identifies the best offset between the two matched readings. This identifies the region of overlap.</p>
<p>In the second step, the matching regions of the two reads are extracted along with a flanking sequence of <span class="math inline">\(\Delta\)</span> base pairs. The two subsequences are then aligned using a “one side free end-gap” dynamic programming algorithm. This latter step is only called if at least one mismatch is detected by the FASTP step.</p> <p>In the second step, the matching regions of the two reads are extracted along with a flanking sequence of <span class="math inline">\(\Delta\)</span> base pairs. The two subsequences are then aligned using a “one side free end-gap” dynamic programming algorithm. This latter step is only called if at least one mismatch is detected by the FASTP step.</p>
<p>Unless the similarity between the two reads at their overlap region is very low, the addition of the flanking regions in the second step of the alignment ensures the same alignment as if the dynamic programming alignment was performed on the full reads.</p> <p>Unless the similarity between the two reads at their overlap region is very low, the addition of the flanking regions in the second step of the alignment ensures the same alignment as if the dynamic programming alignment was performed on the full reads.</p>
</section> </section>
<section id="the-scoring-system" class="level4" data-number="3.7.1.2"> <section id="the-scoring-system" class="level4" data-number="4.7.1.2">
<h4 data-number="3.7.1.2" class="anchored" data-anchor-id="the-scoring-system"><span class="header-section-number">3.7.1.2</span> The scoring system</h4> <h4 data-number="4.7.1.2" class="anchored" data-anchor-id="the-scoring-system"><span class="header-section-number">4.7.1.2</span> The scoring system</h4>
<p>In the dynamic programming step, the match and mismatch scores take into account the quality scores of the two aligned nucleotides. By taking these into account, the probability of a true match can be calculated for each aligned base pair.</p> <p>In the dynamic programming step, the match and mismatch scores take into account the quality scores of the two aligned nucleotides. By taking these into account, the probability of a true match can be calculated for each aligned base pair.</p>
<p>If we consider a nucleotide read with a quality score <span class="math inline">\(Q\)</span>, the probability of misreading this base (<span class="math inline">\(P_E\)</span>) is : <span class="math display">\[ <p>If we consider a nucleotide read with a quality score <span class="math inline">\(Q\)</span>, the probability of misreading this base (<span class="math inline">\(P_E\)</span>) is : <span class="math display">\[
P_E = 10^{-\frac{Q}{10}} P_E = 10^{-\frac{Q}{10}}
@@ -394,38 +399,38 @@ P(MATCH | X_1 \neq X_2) = (1-P_{E1})\frac{P_{E2}}{3} + (1-P_{E2})\frac{P_{E1}}
</div> </div>
</div> </div>
</section> </section>
<section id="obimultiplex" class="level4" data-number="3.7.1.3"> <section id="obimultiplex" class="level4" data-number="4.7.1.3">
<h4 data-number="3.7.1.3" class="anchored" data-anchor-id="obimultiplex"><span class="header-section-number">3.7.1.3</span> <code>obimultiplex</code></h4> <h4 data-number="4.7.1.3" class="anchored" data-anchor-id="obimultiplex"><span class="header-section-number">4.7.1.3</span> <code>obimultiplex</code></h4>
<blockquote class="blockquote"> <blockquote class="blockquote">
<p>Replace the <code>ngsfilter</code> original <em>OBITools</em></p> <p>Replace the <code>ngsfilter</code> original <em>OBITools</em></p>
</blockquote> </blockquote>
</section> </section>
<section id="obicomplement" class="level4" data-number="3.7.1.4"> <section id="obicomplement" class="level4" data-number="4.7.1.4">
<h4 data-number="3.7.1.4" class="anchored" data-anchor-id="obicomplement"><span class="header-section-number">3.7.1.4</span> <code>obicomplement</code></h4> <h4 data-number="4.7.1.4" class="anchored" data-anchor-id="obicomplement"><span class="header-section-number">4.7.1.4</span> <code>obicomplement</code></h4>
</section> </section>
<section id="obiclean" class="level4" data-number="3.7.1.5"> <section id="obiclean" class="level4" data-number="4.7.1.5">
<h4 data-number="3.7.1.5" class="anchored" data-anchor-id="obiclean"><span class="header-section-number">3.7.1.5</span> <code>obiclean</code></h4> <h4 data-number="4.7.1.5" class="anchored" data-anchor-id="obiclean"><span class="header-section-number">4.7.1.5</span> <code>obiclean</code></h4>
</section> </section>
<section id="obiuniq" class="level4" data-number="3.7.1.6"> <section id="obiuniq" class="level4" data-number="4.7.1.6">
<h4 data-number="3.7.1.6" class="anchored" data-anchor-id="obiuniq"><span class="header-section-number">3.7.1.6</span> <code>obiuniq</code></h4> <h4 data-number="4.7.1.6" class="anchored" data-anchor-id="obiuniq"><span class="header-section-number">4.7.1.6</span> <code>obiuniq</code></h4>
</section> </section>
</section> </section>
</section> </section>
<section id="sequence-sampling-and-filtering" class="level2" data-number="3.8"> <section id="sequence-sampling-and-filtering" class="level2" data-number="4.8">
<h2 data-number="3.8" class="anchored" data-anchor-id="sequence-sampling-and-filtering"><span class="header-section-number">3.8</span> Sequence sampling and filtering</h2> <h2 data-number="4.8" class="anchored" data-anchor-id="sequence-sampling-and-filtering"><span class="header-section-number">4.8</span> Sequence sampling and filtering</h2>
<section id="obigrep" class="level4" data-number="3.8.0.1"> <section id="obigrep" class="level4" data-number="4.8.0.1">
<h4 data-number="3.8.0.1" class="anchored" data-anchor-id="obigrep"><span class="header-section-number">3.8.0.1</span> <code>obigrep</code></h4> <h4 data-number="4.8.0.1" class="anchored" data-anchor-id="obigrep"><span class="header-section-number">4.8.0.1</span> <code>obigrep</code></h4>
</section> </section>
<section id="utilities" class="level3" data-number="3.8.1"> <section id="utilities" class="level3" data-number="4.8.1">
<h3 data-number="3.8.1" class="anchored" data-anchor-id="utilities"><span class="header-section-number">3.8.1</span> Utilities</h3> <h3 data-number="4.8.1" class="anchored" data-anchor-id="utilities"><span class="header-section-number">4.8.1</span> Utilities</h3>
<section id="obicount" class="level4" data-number="3.8.1.1"> <section id="obicount" class="level4" data-number="4.8.1.1">
<h4 data-number="3.8.1.1" class="anchored" data-anchor-id="obicount"><span class="header-section-number">3.8.1.1</span> <code>obicount</code></h4> <h4 data-number="4.8.1.1" class="anchored" data-anchor-id="obicount"><span class="header-section-number">4.8.1.1</span> <code>obicount</code></h4>
</section> </section>
<section id="obidistribute" class="level4" data-number="3.8.1.2"> <section id="obidistribute" class="level4" data-number="4.8.1.2">
<h4 data-number="3.8.1.2" class="anchored" data-anchor-id="obidistribute"><span class="header-section-number">3.8.1.2</span> <code>obidistribute</code></h4> <h4 data-number="4.8.1.2" class="anchored" data-anchor-id="obidistribute"><span class="header-section-number">4.8.1.2</span> <code>obidistribute</code></h4>
</section> </section>
<section id="obifind" class="level4" data-number="3.8.1.3"> <section id="obifind" class="level4" data-number="4.8.1.3">
<h4 data-number="3.8.1.3" class="anchored" data-anchor-id="obifind"><span class="header-section-number">3.8.1.3</span> <code>obifind</code></h4> <h4 data-number="4.8.1.3" class="anchored" data-anchor-id="obifind"><span class="header-section-number">4.8.1.3</span> <code>obifind</code></h4>
<blockquote class="blockquote"> <blockquote class="blockquote">
<p>Replace the <code>ecofind</code> original <em>OBITools.</em></p> <p>Replace the <code>ecofind</code> original <em>OBITools.</em></p>
</blockquote> </blockquote>
@@ -577,12 +582,12 @@ window.document.addEventListener("DOMContentLoaded", function (event) {
<nav class="page-navigation"> <nav class="page-navigation">
<div class="nav-page nav-page-previous"> <div class="nav-page nav-page-previous">
<a href="./tutorial.html" class="pagination-link"> <a href="./tutorial.html" class="pagination-link">
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></span> <i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></span>
</a> </a>
</div> </div>
<div class="nav-page nav-page-next"> <div class="nav-page nav-page-next">
<a href="./library.html" class="pagination-link"> <a href="./library.html" class="pagination-link">
<span class="nav-page-text"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></span> <i class="bi bi-arrow-right-short"></i> <span class="nav-page-text"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></span> <i class="bi bi-arrow-right-short"></i>
</a> </a>
</div> </div>
</nav> </nav>
+533
View File
@@ -0,0 +1,533 @@
<!DOCTYPE html>
<html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"><head>
<meta charset="utf-8">
<meta name="generator" content="quarto-1.2.256">
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
<title>OBITools V4 - 2&nbsp; File formats usable with OBITools</title>
<style>
code{white-space: pre-wrap;}
span.smallcaps{font-variant: small-caps;}
div.columns{display: flex; gap: min(4vw, 1.5em);}
div.column{flex: auto; overflow-x: auto;}
div.hanging-indent{margin-left: 1.5em; text-indent: -1.5em;}
ul.task-list{list-style: none;}
ul.task-list li input[type="checkbox"] {
width: 0.8em;
margin: 0 0.8em 0.2em -1.6em;
vertical-align: middle;
}
div.csl-bib-body { }
div.csl-entry {
clear: both;
}
.hanging div.csl-entry {
margin-left:2em;
text-indent:-2em;
}
div.csl-left-margin {
min-width:2em;
float:left;
}
div.csl-right-inline {
margin-left:2em;
padding-left:1em;
}
div.csl-indent {
margin-left: 2em;
}
</style>
<script src="site_libs/quarto-nav/quarto-nav.js"></script>
<script src="site_libs/quarto-nav/headroom.min.js"></script>
<script src="site_libs/clipboard/clipboard.min.js"></script>
<script src="site_libs/quarto-search/autocomplete.umd.js"></script>
<script src="site_libs/quarto-search/fuse.min.js"></script>
<script src="site_libs/quarto-search/quarto-search.js"></script>
<meta name="quarto:offset" content="./">
<link href="./tutorial.html" rel="next">
<link href="./intro.html" rel="prev">
<script src="site_libs/quarto-html/quarto.js"></script>
<script src="site_libs/quarto-html/popper.min.js"></script>
<script src="site_libs/quarto-html/tippy.umd.min.js"></script>
<script src="site_libs/quarto-html/anchor.min.js"></script>
<link href="site_libs/quarto-html/tippy.css" rel="stylesheet">
<link href="site_libs/quarto-html/quarto-syntax-highlighting.css" rel="stylesheet" id="quarto-text-highlighting-styles">
<script src="site_libs/bootstrap/bootstrap.min.js"></script>
<link href="site_libs/bootstrap/bootstrap-icons.css" rel="stylesheet">
<link href="site_libs/bootstrap/bootstrap.min.css" rel="stylesheet" id="quarto-bootstrap" data-mode="light">
<script id="quarto-search-options" type="application/json">{
"location": "sidebar",
"copy-button": false,
"collapse-after": 3,
"panel-placement": "start",
"type": "textbox",
"limit": 20,
"language": {
"search-no-results-text": "No results",
"search-matching-documents-text": "matching documents",
"search-copy-link-title": "Copy link to search",
"search-hide-matches-text": "Hide additional matches",
"search-more-match-text": "more match in this document",
"search-more-matches-text": "more matches in this document",
"search-clear-button-title": "Clear",
"search-detached-cancel-button-title": "Cancel",
"search-submit-button-title": "Submit"
}
}</script>
<script src="https://cdn.jsdelivr.net/npm/mathjax@3/es5/tex-chtml-full.js" type="text/javascript"></script>
</head>
<body class="nav-sidebar floating">
<div id="quarto-search-results"></div>
<header id="quarto-header" class="headroom fixed-top">
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
<div class="container-fluid d-flex justify-content-between">
<h1 class="quarto-secondary-nav-title"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">File formats usable with <em>OBITools</em></span></h1>
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
<i class="bi bi-chevron-right"></i>
</button>
</div>
</nav>
</header>
<!-- content -->
<div id="quarto-content" class="quarto-container page-columns page-rows-contents page-layout-article">
<!-- sidebar -->
<nav id="quarto-sidebar" class="sidebar collapse sidebar-navigation floating overflow-auto">
<div class="pt-lg-2 mt-2 text-left sidebar-header">
<div class="sidebar-title mb-0 py-0">
<a href="./">OBITools V4</a>
</div>
</div>
<div class="mt-2 flex-shrink-0 align-items-center">
<div class="sidebar-search">
<div id="quarto-search" class="" title="Search"></div>
</div>
</div>
<div class="sidebar-menu-container">
<ul class="list-unstyled mt-1">
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./index.html" class="sidebar-item-text sidebar-link">Preface</a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./intro.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">1</span>&nbsp; <span class="chapter-title">The OBITools</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./formats.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./commands.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./library.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span>&nbsp; <span class="chapter-title">Annexes</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./references.html" class="sidebar-item-text sidebar-link">References</a>
</div>
</li>
</ul>
</div>
</nav>
<!-- margin-sidebar -->
<div id="quarto-margin-sidebar" class="sidebar margin-sidebar">
<nav id="TOC" role="doc-toc" class="toc-active">
<h2 id="toc-title">Table of contents</h2>
<ul>
<li><a href="#the-dna-sequence-data" id="toc-the-dna-sequence-data" class="nav-link active" data-scroll-target="#the-dna-sequence-data"><span class="toc-section-number">2.1</span> The DNA sequence data</a>
<ul class="collapse">
<li><a href="#the-iupac-code" id="toc-the-iupac-code" class="nav-link" data-scroll-target="#the-iupac-code"><span class="toc-section-number">2.1.1</span> The IUPAC Code</a></li>
<li><a href="#sec-fasta" id="toc-sec-fasta" class="nav-link" data-scroll-target="#sec-fasta"><span class="toc-section-number">2.1.2</span> The <em>fasta</em> sequence format</a></li>
<li><a href="#sec-fastq" id="toc-sec-fastq" class="nav-link" data-scroll-target="#sec-fastq"><span class="toc-section-number">2.1.3</span> The <em>fastq</em> sequence format</a></li>
<li><a href="#file-extension" id="toc-file-extension" class="nav-link" data-scroll-target="#file-extension"><span class="toc-section-number">2.1.4</span> File extension</a></li>
</ul></li>
</ul>
</nav>
</div>
<!-- main -->
<main class="content" id="quarto-document-content">
<header id="title-block-header" class="quarto-title-block default">
<div class="quarto-title">
<h1 class="title d-none d-lg-block"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">File formats usable with <em>OBITools</em></span></h1>
</div>
<div class="quarto-title-meta">
</div>
</header>
<p>OBITools manipulate have to manipulate DNA sequence data and taxonomical data. They can use some supplentary metadata describing the experiment and produce some stats about the processed DNA data. All the manipulated data are stored in text files, following standard data format.</p>
<section id="the-dna-sequence-data" class="level2" data-number="2.1">
<h2 data-number="2.1" class="anchored" data-anchor-id="the-dna-sequence-data"><span class="header-section-number">2.1</span> The DNA sequence data</h2>
<p>Sequences can be stored following various format. OBITools knows some of them. The central formats for sequence files manipulated by OBITools scripts are the <a href="#the-fasta-sequence-format"><code>fasta</code></a> and <a href="#the-fastq-sequence-format"><code>fastq</code></a> format. OBITools extends the both these formats by specifying a syntax to include in the definition line data qualifying the sequence. All file formats use the <code>IUPAC</code> code for encoding nucleotides.</p>
<p>Moreover these two formats that can be used as input and output formats, <strong>OBITools4</strong> can read the following format :</p>
<ul>
<li><a href="https://ena-docs.readthedocs.io/en/latest/submit/fileprep/flat-file-example.html">EBML flat file</a> format (use by ENA)</li>
<li><a href="https://www.ncbi.nlm.nih.gov/Sitemap/samplerecord.html">Genbank flat file format</a></li>
<li><a href="https://pythonhosted.org/OBITools/scripts/ecoPCR.html">ecoPCR output files</a></li>
</ul>
<section id="the-iupac-code" class="level3" data-number="2.1.1">
<h3 data-number="2.1.1" class="anchored" data-anchor-id="the-iupac-code"><span class="header-section-number">2.1.1</span> The IUPAC Code</h3>
<p>The International Union of Pure and Applied Chemistry (IUPAC_) defined the standard code for representing protein or DNA sequences.</p>
<table class="table">
<thead>
<tr class="header">
<th><strong>Code</strong></th>
<th><strong>Nucleotide</strong></th>
</tr>
</thead>
<tbody>
<tr class="odd">
<td>A</td>
<td>Adenine</td>
</tr>
<tr class="even">
<td>C</td>
<td>Cytosine</td>
</tr>
<tr class="odd">
<td>G</td>
<td>Guanine</td>
</tr>
<tr class="even">
<td>T</td>
<td>Thymine</td>
</tr>
<tr class="odd">
<td>U</td>
<td>Uracil</td>
</tr>
<tr class="even">
<td>R</td>
<td>Purine (A or G)</td>
</tr>
<tr class="odd">
<td>Y</td>
<td>Pyrimidine (C, T, or U)</td>
</tr>
<tr class="even">
<td>M</td>
<td>C or A</td>
</tr>
<tr class="odd">
<td>K</td>
<td>T, U, or G</td>
</tr>
<tr class="even">
<td>W</td>
<td>T, U, or A</td>
</tr>
<tr class="odd">
<td>S</td>
<td>C or G</td>
</tr>
<tr class="even">
<td>B</td>
<td>C, T, U, or G (not A)</td>
</tr>
<tr class="odd">
<td>D</td>
<td>A, T, U, or G (not C)</td>
</tr>
<tr class="even">
<td>H</td>
<td>A, T, U, or C (not G)</td>
</tr>
<tr class="odd">
<td>V</td>
<td>A, C, or G (not T, not U)</td>
</tr>
<tr class="even">
<td>N</td>
<td>Any base (A, C, G, T, or U)</td>
</tr>
</tbody>
</table>
</section>
<section id="sec-fasta" class="level3" data-number="2.1.2">
<h3 data-number="2.1.2" class="anchored" data-anchor-id="sec-fasta"><span class="header-section-number">2.1.2</span> The <em>fasta</em> sequence format</h3>
<p>The <strong>fasta format</strong> is certainly the most widely used sequence file format. This is certainly due to its great simplicity. It was originally created for the Lipman and Pearson <a href="http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation">FASTA program</a>. OBITools use in more of the classical <code>fasta</code> format an <code>extended version</code> of this format where structured data are included in the title line.</p>
<p>In <em>fasta</em> format a sequence is represented by a title line beginning with a <strong><code>&gt;</code></strong> character and the sequences by itself following the :doc:<code>iupac</code> code. The sequence is usually split other severals lines of the same length (expect for the last one)</p>
<pre><code>&gt;my_sequence this is my pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT</code></pre>
<p>This is no special format for the title line excepting that this line should be unique. Usually the first word following the <strong>&gt;</strong> character is considered as the sequence identifier. The end of the title line corresponding to a description of the sequence. Several sequences can be concatenated in a same file. The description of the next sequence is just pasted at the end of the record of the previous one</p>
<pre><code>&gt;sequence_A this is my first pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
&gt;sequence_B this is my second pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
&gt;sequence_C this is my third pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT</code></pre>
</section>
<section id="sec-fastq" class="level3" data-number="2.1.3">
<h3 data-number="2.1.3" class="anchored" data-anchor-id="sec-fastq"><span class="header-section-number">2.1.3</span> The <em>fastq</em> sequence format<a href="#fn1" class="footnote-ref" id="fnref1" role="doc-noteref"><sup>1</sup></a></h3>
<p>The <strong>FASTQ</strong> format is a text file format for storing both biological sequences (only nucleic acid sequences) and the associated quality scores. The sequence and score are each encoded by a single ASCII character. This format was originally developed by the Wellcome Trust Sanger Institute to link a <a href="#the-fasta-sequence-format">FASTA</a> sequence file to the corresponding quality data, but has recently become the de facto standard for storing results from high-throughput sequencers <span class="citation" data-cites="cock2010sanger">(<a href="references.html#ref-cock2010sanger" role="doc-biblioref">Cock et al. 2010</a>)</span>.</p>
<p>A fastq file normally uses four lines per sequence.</p>
<ul>
<li>Line 1 begins with a @ character and is followed by a sequence identifier and an <em>optional</em> description (like a :ref:<code>fasta</code> title line).</li>
<li>Line 2 is the raw sequence letters.</li>
<li>Line 3 begins with a + character and is <em>optionally</em> followed by the same sequence identifier (and any description) again.</li>
<li>Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.</li>
</ul>
<p>A fastq file containing a single sequence might look like this:</p>
<pre><code>@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF&gt;&gt;&gt;&gt;&gt;&gt;CCCCCCC65</code></pre>
<p>The character ! represents the lowest quality while ~ is the highest. Here are the quality value characters in left-to-right increasing order of quality (<code>ASCII</code>):</p>
<pre><code>!"#$%&amp;'()*+,-./0123456789:;&lt;=&gt;?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~</code></pre>
<p>The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of “@” and “+” as markers (these characters can also occur in the quality string).</p>
<section id="sequence-quality-scores" class="level4 unnumbered">
<h4 class="unnumbered anchored" data-anchor-id="sequence-quality-scores">Sequence quality scores</h4>
<p>The Phred quality value <em>Q</em> is an integer mapping of <em>p</em> (i.e., the probability that the corresponding base call is incorrect). Two different equations have been in use. The first is the standard Sanger variant to assess reliability of a base call, otherwise known as Phred quality score:</p>
<p><span class="math display">\[
Q_\text{sanger} = -10 \, \log_{10} p
\]</span></p>
<p>The Solexa pipeline (i.e., the software delivered with the Illumina Genome Analyzer) earlier used a different mapping, encoding the odds <span class="math inline">\(\mathbf{p}/(1-\mathbf{p})\)</span> instead of the probability <span class="math inline">\(\mathbf{p}\)</span>:</p>
<p><span class="math display">\[
Q_\text{solexa-prior to v.1.3} = -10 \; \log_{10} \frac{p}{1-p}
\]</span></p>
<p>Although both mappings are asymptotically identical at higher quality values, they differ at lower quality levels (i.e., approximately <span class="math inline">\(\mathbf{p} &gt; 0.05\)</span>, or equivalently, <span class="math inline">\(\mathbf{Q} &lt; 13\)</span>).</p>
<div id="fig-Probabilitymetrics" class="quarto-figure quarto-figure-center anchored">
<figure class="figure">
<p><img src="Probabilitymetrics.png" class="img-fluid figure-img"></p>
<p></p><figcaption class="figure-caption">Figure&nbsp;2.1: Relationship between <em>Q</em> and <em>p</em> using the Sanger (red) and Solexa (black) equations (described above). The vertical dotted line indicates <span class="math inline">\(\mathbf{p}= 0.05\)</span>, or equivalently, <span class="math inline">\(Q = 13\)</span>.</figcaption><p></p>
</figure>
</div>
<section id="encoding" class="level5 unnumbered">
<h5 class="unnumbered anchored" data-anchor-id="encoding">Encoding</h5>
<p>The <em>fastq</em> format had differente way of encoding the Phred quality score along the time. Here a breif history of these changes is presented.</p>
<ul>
<li>Sanger format can encode a Phred quality score from 0 to 93 using ASCII 33 to 126 (although in raw read data the Phred quality score rarely exceeds 60, higher scores are possible in assemblies or read maps).</li>
<li>Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score from -5 to 62 using ASCII 59 to 126 (although in raw read data Solexa scores from -5 to 40 only are expected)</li>
<li>Starting with Illumina 1.3 and before Illumina 1.8, the format encoded a Phred quality score from 0 to 62 using ASCII 64 to 126 (although in raw read data Phred scores from 0 to 40 only are expected).</li>
<li>Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0 to 2 have a slightly different meaning. The values 0 and 1 are no longer used and the value 2, encoded by ASCII 66 “B”.</li>
</ul>
<blockquote class="blockquote">
<p>Sequencing Control Software, Version 2.6, (Catalog # SY-960-2601, Part # 15009921 Rev.&nbsp;A, November 2009, page 30) states the following: <em>If a read ends with a segment of mostly low quality (Q15 or below), then all of the quality values in the segment are replaced with a value of 2 (encoded as the letter B in Illuminas text-based encoding of quality scores)… This Q2 indicator does not predict a specific error rate, but rather indicates that a specific final portion of the read should not be used in further analyses.</em> Also, the quality score encoded as “B” letter may occur internally within reads at least as late as pipeline version 1.6, as shown in the following example:</p>
</blockquote>
<pre><code>@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
+HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB</code></pre>
<p>An alternative interpretation of this ASCII encoding has been proposed. Also, in Illumina runs using PhiX controls, the character B was observed to represent an “unknown quality score”. The error rate of B reads was roughly 3 phred scores lower the mean observed score of a given run.</p>
<ul>
<li>Starting in Illumina 1.8, the quality scores have basically returned to the use of the Sanger format (Phred+33).</li>
</ul>
<p>OBItools support the Sanger format. It is nevertheless to read files encoded following the Solexa/Illumina format, that are still possible to find in old files, by applying a shift of 62.</p>
</section>
</section>
</section>
<section id="file-extension" class="level3" data-number="2.1.4">
<h3 data-number="2.1.4" class="anchored" data-anchor-id="file-extension"><span class="header-section-number">2.1.4</span> File extension</h3>
<p>There is no standard file extension for a FASTQ file, but .fq and .fastq, are commonly used.</p>
<div id="refs" class="references csl-bib-body hanging-indent" role="doc-bibliography" style="display: none">
<div id="ref-cock2010sanger" class="csl-entry" role="doc-biblioentry">
Cock, Peter JA, Christopher J Fields, Naohisa Goto, Michael L Heuer, and Peter M Rice. 2010. <span>“The Sanger FASTQ File Format for Sequences with Quality Scores, and the Solexa/Illumina FASTQ Variants.”</span> <em>Nucleic Acids Research</em> 38 (6): 176771.
</div>
</div>
</section>
</section>
<section id="footnotes" class="footnotes footnotes-end-of-document" role="doc-endnotes">
<hr>
<ol>
<li id="fn1"><p>This article uses material from the Wikipedia article <a href="http://en.wikipedia.org/wiki/FASTQ_format"><code>FASTQ format</code></a> which is released under the <code>Creative Commons Attribution-Share-Alike License 3.0</code><a href="#fnref1" class="footnote-back" role="doc-backlink">↩︎</a></p></li>
</ol>
</section>
</main> <!-- /main -->
<script id="quarto-html-after-body" type="application/javascript">
window.document.addEventListener("DOMContentLoaded", function (event) {
const toggleBodyColorMode = (bsSheetEl) => {
const mode = bsSheetEl.getAttribute("data-mode");
const bodyEl = window.document.querySelector("body");
if (mode === "dark") {
bodyEl.classList.add("quarto-dark");
bodyEl.classList.remove("quarto-light");
} else {
bodyEl.classList.add("quarto-light");
bodyEl.classList.remove("quarto-dark");
}
}
const toggleBodyColorPrimary = () => {
const bsSheetEl = window.document.querySelector("link#quarto-bootstrap");
if (bsSheetEl) {
toggleBodyColorMode(bsSheetEl);
}
}
toggleBodyColorPrimary();
const icon = "";
const anchorJS = new window.AnchorJS();
anchorJS.options = {
placement: 'right',
icon: icon
};
anchorJS.add('.anchored');
const clipboard = new window.ClipboardJS('.code-copy-button', {
target: function(trigger) {
return trigger.previousElementSibling;
}
});
clipboard.on('success', function(e) {
// button target
const button = e.trigger;
// don't keep focus
button.blur();
// flash "checked"
button.classList.add('code-copy-button-checked');
var currentTitle = button.getAttribute("title");
button.setAttribute("title", "Copied!");
let tooltip;
if (window.bootstrap) {
button.setAttribute("data-bs-toggle", "tooltip");
button.setAttribute("data-bs-placement", "left");
button.setAttribute("data-bs-title", "Copied!");
tooltip = new bootstrap.Tooltip(button,
{ trigger: "manual",
customClass: "code-copy-button-tooltip",
offset: [0, -8]});
tooltip.show();
}
setTimeout(function() {
if (tooltip) {
tooltip.hide();
button.removeAttribute("data-bs-title");
button.removeAttribute("data-bs-toggle");
button.removeAttribute("data-bs-placement");
}
button.setAttribute("title", currentTitle);
button.classList.remove('code-copy-button-checked');
}, 1000);
// clear code selection
e.clearSelection();
});
function tippyHover(el, contentFn) {
const config = {
allowHTML: true,
content: contentFn,
maxWidth: 500,
delay: 100,
arrow: false,
appendTo: function(el) {
return el.parentElement;
},
interactive: true,
interactiveBorder: 10,
theme: 'quarto',
placement: 'bottom-start'
};
window.tippy(el, config);
}
const noterefs = window.document.querySelectorAll('a[role="doc-noteref"]');
for (var i=0; i<noterefs.length; i++) {
const ref = noterefs[i];
tippyHover(ref, function() {
// use id or data attribute instead here
let href = ref.getAttribute('data-footnote-href') || ref.getAttribute('href');
try { href = new URL(href).hash; } catch {}
const id = href.replace(/^#\/?/, "");
const note = window.document.getElementById(id);
return note.innerHTML;
});
}
const findCites = (el) => {
const parentEl = el.parentElement;
if (parentEl) {
const cites = parentEl.dataset.cites;
if (cites) {
return {
el,
cites: cites.split(' ')
};
} else {
return findCites(el.parentElement)
}
} else {
return undefined;
}
};
var bibliorefs = window.document.querySelectorAll('a[role="doc-biblioref"]');
for (var i=0; i<bibliorefs.length; i++) {
const ref = bibliorefs[i];
const citeInfo = findCites(ref);
if (citeInfo) {
tippyHover(citeInfo.el, function() {
var popup = window.document.createElement('div');
citeInfo.cites.forEach(function(cite) {
var citeDiv = window.document.createElement('div');
citeDiv.classList.add('hanging-indent');
citeDiv.classList.add('csl-entry');
var biblioDiv = window.document.getElementById('ref-' + cite);
if (biblioDiv) {
citeDiv.innerHTML = biblioDiv.innerHTML;
}
popup.appendChild(citeDiv);
});
return popup.innerHTML;
});
}
}
});
</script>
<nav class="page-navigation">
<div class="nav-page nav-page-previous">
<a href="./intro.html" class="pagination-link">
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">1</span>&nbsp; <span class="chapter-title">The OBITools</span></span>
</a>
</div>
<div class="nav-page nav-page-next">
<a href="./tutorial.html" class="pagination-link">
<span class="nav-page-text"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></span> <i class="bi bi-arrow-right-short"></i>
</a>
</div>
</nav>
</div> <!-- /content -->
</body></html>
+9 -4
View File
@@ -125,22 +125,27 @@ div.csl-indent {
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a> <a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./commands.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a> <a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./library.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a> <a href="./commands.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">Annexes</span></a> <a href="./library.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span>&nbsp; <span class="chapter-title">Annexes</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
+72 -200
View File
@@ -49,7 +49,7 @@ div.csl-indent {
<script src="site_libs/quarto-search/fuse.min.js"></script> <script src="site_libs/quarto-search/fuse.min.js"></script>
<script src="site_libs/quarto-search/quarto-search.js"></script> <script src="site_libs/quarto-search/quarto-search.js"></script>
<meta name="quarto:offset" content="./"> <meta name="quarto:offset" content="./">
<link href="./tutorial.html" rel="next"> <link href="./formats.html" rel="next">
<link href="./index.html" rel="prev"> <link href="./index.html" rel="prev">
<script src="site_libs/quarto-html/quarto.js"></script> <script src="site_libs/quarto-html/quarto.js"></script>
<script src="site_libs/quarto-html/popper.min.js"></script> <script src="site_libs/quarto-html/popper.min.js"></script>
@@ -125,22 +125,27 @@ div.csl-indent {
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a> <a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./commands.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a> <a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./library.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a> <a href="./commands.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">Annexes</span></a> <a href="./library.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span>&nbsp; <span class="chapter-title">Annexes</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
@@ -158,16 +163,11 @@ div.csl-indent {
<ul> <ul>
<li><a href="#aims-of-obitools" id="toc-aims-of-obitools" class="nav-link active" data-scroll-target="#aims-of-obitools"><span class="toc-section-number">1.1</span> Aims of <em>OBITools</em></a></li> <li><a href="#aims-of-obitools" id="toc-aims-of-obitools" class="nav-link active" data-scroll-target="#aims-of-obitools"><span class="toc-section-number">1.1</span> Aims of <em>OBITools</em></a></li>
<li><a href="#file-formats-usable-with-obitools" id="toc-file-formats-usable-with-obitools" class="nav-link" data-scroll-target="#file-formats-usable-with-obitools"><span class="toc-section-number">1.2</span> File formats usable with <em>OBITools</em></a> <li><a href="#installation-of-the-obitools" id="toc-installation-of-the-obitools" class="nav-link" data-scroll-target="#installation-of-the-obitools"><span class="toc-section-number">1.2</span> Installation of the obitools</a>
<ul class="collapse"> <ul class="collapse">
<li><a href="#the-sequence-files" id="toc-the-sequence-files" class="nav-link" data-scroll-target="#the-sequence-files"><span class="toc-section-number">1.2.1</span> The sequence files</a></li> <li><a href="#availability-of-the-obitools" id="toc-availability-of-the-obitools" class="nav-link" data-scroll-target="#availability-of-the-obitools"><span class="toc-section-number">1.2.1</span> Availability of the OBITools</a></li>
<li><a href="#the-iupac-code" id="toc-the-iupac-code" class="nav-link" data-scroll-target="#the-iupac-code"><span class="toc-section-number">1.2.2</span> The IUPAC Code</a></li> <li><a href="#prerequisites" id="toc-prerequisites" class="nav-link" data-scroll-target="#prerequisites"><span class="toc-section-number">1.2.2</span> Prerequisites</a></li>
<li><a href="#classical-fasta" id="toc-classical-fasta" class="nav-link" data-scroll-target="#classical-fasta"><span class="toc-section-number">1.2.3</span> The <em>fasta</em> format</a></li>
<li><a href="#classical-fastq" id="toc-classical-fastq" class="nav-link" data-scroll-target="#classical-fastq"><span class="toc-section-number">1.2.4</span> The <em>fastq</em> sequence format</a></li>
</ul></li> </ul></li>
<li><a href="#file-extension" id="toc-file-extension" class="nav-link" data-scroll-target="#file-extension"><span class="toc-section-number">1.3</span> File extension</a></li>
<li><a href="#see-also" id="toc-see-also" class="nav-link" data-scroll-target="#see-also"><span class="toc-section-number">1.4</span> See also</a></li>
<li><a href="#references" id="toc-references" class="nav-link" data-scroll-target="#references"><span class="toc-section-number">1.5</span> References</a></li>
</ul> </ul>
</nav> </nav>
</div> </div>
@@ -191,201 +191,73 @@ div.csl-indent {
</header> </header>
<p>The <em>OBITools4</em> are programs specifically designed for analyzing NGS data in a DNA metabarcoding context, taking into account taxonomic information. It is distributed as an open source software available on the following website: http://metabarcoding.org/obitools4.</p>
<section id="aims-of-obitools" class="level2" data-number="1.1"> <section id="aims-of-obitools" class="level2" data-number="1.1">
<h2 data-number="1.1" class="anchored" data-anchor-id="aims-of-obitools"><span class="header-section-number">1.1</span> Aims of <em>OBITools</em></h2> <h2 data-number="1.1" class="anchored" data-anchor-id="aims-of-obitools"><span class="header-section-number">1.1</span> Aims of <em>OBITools</em></h2>
<p>DNA metabarcoding is an efficient approach for biodiversity studies <span class="citation" data-cites="Taberlet2012-pf">(<a href="references.html#ref-Taberlet2012-pf" role="doc-biblioref">Taberlet et al. 2012</a>)</span>. Originally mainly developed by microbiologists <span class="citation" data-cites="Sogin2006-ab">(<em>e.g.</em> <a href="references.html#ref-Sogin2006-ab" role="doc-biblioref">Sogin et al. 2006</a>)</span>, it is now widely used for plants <span class="citation" data-cites="Sonstebo2010-vv Yoccoz2012-ix Parducci2012-rn">(<em>e.g.</em> <a href="references.html#ref-Sonstebo2010-vv" role="doc-biblioref">Sønstebø et al. 2010</a>; <a href="references.html#ref-Yoccoz2012-ix" role="doc-biblioref">Yoccoz et al. 2012</a>; <a href="references.html#ref-Parducci2012-rn" role="doc-biblioref">Parducci et al. 2012</a>)</span> and animals from meiofauna <span class="citation" data-cites="Chariton2010-cz Baldwin2013-yc">(<em>e.g.</em> <a href="references.html#ref-Chariton2010-cz" role="doc-biblioref">Chariton et al. 2010</a>; <a href="references.html#ref-Baldwin2013-yc" role="doc-biblioref">Baldwin et al. 2013</a>)</span> to larger organisms <span class="citation" data-cites="Andersen2012-gj Thomsen2012-au">(<em>e.g.</em> <a href="references.html#ref-Andersen2012-gj" role="doc-biblioref">Andersen et al. 2012</a>; <a href="references.html#ref-Thomsen2012-au" role="doc-biblioref">Thomsen et al. 2012</a>)</span>. Interestingly, this method is not limited to <em>sensu stricto</em> biodiversity surveys, but it can also be implemented in other ecological contexts such as for herbivore <span class="citation" data-cites="Valentini2009-ay Kowalczyk2011-kg">(e.g. <a href="references.html#ref-Valentini2009-ay" role="doc-biblioref">Valentini et al. 2009</a>; <a href="references.html#ref-Kowalczyk2011-kg" role="doc-biblioref">Kowalczyk et al. 2011</a>)</span> or carnivore <span class="citation" data-cites="Deagle2009-yh Shehzad2012-pn">(e.g. <a href="references.html#ref-Deagle2009-yh" role="doc-biblioref">Deagle, Kirkwood, and Jarman 2009</a>; <a href="references.html#ref-Shehzad2012-pn" role="doc-biblioref">Shehzad et al. 2012</a>)</span> diet analyses.</p>
<p>Whatever the biological question under consideration, the DNA metabarcoding methodology relies heavily on next-generation sequencing (NGS), and generates considerable numbers of DNA sequence reads (typically million of reads). Manipulation of such large datasets requires dedicated programs usually running on a Unix system. Unix is an operating system, whose first version was created during the sixties. Since its early stages, it is dedicated to scientific computing and includes a large set of simple tools to efficiently process text files. Most of those programs can be viewed as filters extracting information from a text file to create a new text file. These programs process text files as streams, line per line, therefore allowing computation on a huge dataset without requiring a large memory. Unix programs usually print their results to their standard output (<em>stdout</em>), which by default is the terminal, so the results can be examined on screen. The main philosophy of the Unix environment is to allow easy redirection of the <em>stdout</em> either to a file, for saving the results, or to the standard input (<em>stdin</em>) of a second program thus allowing to easily create complex processing from simple base commands. Access to Unix computers is increasingly easier for scientists nowadays. Indeed, the Linux operating system, an open source version of Unix, can be freely installed on every PC machine and the MacOS operating system, running on Apple computers, is also a Unix system. The <em>OBITools</em> programs imitate Unix standard programs because they usually act as filters, reading their data from text files or the <em>stdin</em> and writing their results to the <em>stdout</em>. The main difference with classical Unix programs is that text files are not analyzed line per line but sequence record per sequence record (see below for a detailed description of a sequence record). Compared to packages for similar purposes like mothur <span class="citation" data-cites="Schloss2009-qy">(<a href="references.html#ref-Schloss2009-qy" role="doc-biblioref">Schloss et al. 2009</a>)</span> or QIIME <span class="citation" data-cites="Caporaso2010-ii">(<a href="references.html#ref-Caporaso2010-ii" role="doc-biblioref">Caporaso et al. 2010</a>)</span>, the <em>OBITools</em> mainly rely on filtering and sorting algorithms. This allows users to set up versatile data analysis pipelines (Figure 1), adjustable to the broad range of DNA metabarcoding applications. The innovation of the <em>OBITools</em> is their ability to take into account the taxonomic annotations, ultimately allowing sorting and filtering of sequence records based on the taxonomy.</p>
</section> </section>
<section id="file-formats-usable-with-obitools" class="level2" data-number="1.2"> <section id="installation-of-the-obitools" class="level2" data-number="1.2">
<h2 data-number="1.2" class="anchored" data-anchor-id="file-formats-usable-with-obitools"><span class="header-section-number">1.2</span> File formats usable with <em>OBITools</em></h2> <h2 data-number="1.2" class="anchored" data-anchor-id="installation-of-the-obitools"><span class="header-section-number">1.2</span> Installation of the obitools</h2>
<section id="the-sequence-files" class="level3" data-number="1.2.1"> <section id="availability-of-the-obitools" class="level3" data-number="1.2.1">
<h3 data-number="1.2.1" class="anchored" data-anchor-id="the-sequence-files"><span class="header-section-number">1.2.1</span> The sequence files</h3> <h3 data-number="1.2.1" class="anchored" data-anchor-id="availability-of-the-obitools"><span class="header-section-number">1.2.1</span> Availability of the OBITools</h3>
<p>Sequences can be stored following various format. OBITools knows some of them. The central formats for sequence files manipulated by OBITools scripts are the <code>fasta</code> and fastq format. OBITools extends the both these formats by specifying a syntax to include in the definition line data qualifying the sequence. All file formats use the <code>IUPAC</code> code for encoding nucleotides.</p> <p>The <em>OBITools</em> are open source and protected by the <a href="http://www.cecill.info/licences/Licence_CeCILL_V2.1-en.html">CeCILL 2.1 license</a>.</p>
<p>All the sources of the <a href="http://metabarcoding.org/obitools4"><em>OBITools4</em></a> can be downloaded from the metabarcoding git server (https://git.metabarcoding.org).</p>
</section> </section>
<section id="the-iupac-code" class="level3" data-number="1.2.2"> <section id="prerequisites" class="level3" data-number="1.2.2">
<h3 data-number="1.2.2" class="anchored" data-anchor-id="the-iupac-code"><span class="header-section-number">1.2.2</span> The IUPAC Code</h3> <h3 data-number="1.2.2" class="anchored" data-anchor-id="prerequisites"><span class="header-section-number">1.2.2</span> Prerequisites</h3>
<p>The International Union of Pure and Applied Chemistry (IUPAC_) defined the standard code for representing protein or DNA sequences.</p> <p>The <em>OBITools4</em> are developped using the <a href="https://go.dev/">GO programming language</a>, we stick to the latest version of the language, today the <span class="math inline">\(1.19.5\)</span>. If you want to download and compile the sources yourself, you first need to install the corresponding compiler on your system. Some parts of the soft are also written in C, therefore a recent C compiler is also requested, GCC on Linux or Windows, the Developer Tools on Mac.</p>
<section id="DNA-IUPAC" class="level4" data-number="1.2.2.1"> <p>Whatever the installation you decide for, you will have to ensure that a C compiler is available on your system.</p>
<h4 data-number="1.2.2.1" class="anchored" data-anchor-id="DNA-IUPAC"><span class="header-section-number">1.2.2.1</span> Nucleic IUPAC Code</h4>
<table class="table">
<thead>
<tr class="header">
<th><strong>Code</strong></th>
<th><strong>Nucleotide</strong></th>
</tr>
</thead>
<tbody>
<tr class="odd">
<td>A</td>
<td>Adenine</td>
</tr>
<tr class="even">
<td>C</td>
<td>Cytosine</td>
</tr>
<tr class="odd">
<td>G</td>
<td>Guanine</td>
</tr>
<tr class="even">
<td>T</td>
<td>Thymine</td>
</tr>
<tr class="odd">
<td>U</td>
<td>Uracil</td>
</tr>
<tr class="even">
<td>R</td>
<td>Purine (A or G)</td>
</tr>
<tr class="odd">
<td>Y</td>
<td>Pyrimidine (C, T, or U)</td>
</tr>
<tr class="even">
<td>M</td>
<td>C or A</td>
</tr>
<tr class="odd">
<td>K</td>
<td>T, U, or G</td>
</tr>
<tr class="even">
<td>W</td>
<td>T, U, or A</td>
</tr>
<tr class="odd">
<td>S</td>
<td>C or G</td>
</tr>
<tr class="even">
<td>B</td>
<td>C, T, U, or G (not A)</td>
</tr>
<tr class="odd">
<td>D</td>
<td>A, T, U, or G (not C)</td>
</tr>
<tr class="even">
<td>H</td>
<td>A, T, U, or C (not G)</td>
</tr>
<tr class="odd">
<td>V</td>
<td>A, C, or G (not T, not U)</td>
</tr>
<tr class="even">
<td>N</td>
<td>Any base (A, C, G, T, or U)</td>
</tr>
</tbody>
</table>
</section>
</section>
<section id="classical-fasta" class="level3" data-number="1.2.3">
<h3 data-number="1.2.3" class="anchored" data-anchor-id="classical-fasta"><span class="header-section-number">1.2.3</span> The <em>fasta</em> format</h3>
<p>The <strong>fasta format</strong> is certainly the most widely used sequence file format. This is certainly due to its great simplicity. It was originally created for the Lipman and Pearson <a href="http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation">FASTA program</a>. OBITools use in more of the classical :ref:<code>fasta</code> format an :ref:<code>extended version</code> of this format where structured data are included in the title line.</p>
<p>In <em>fasta</em> format a sequence is represented by a title line beginning with a <strong><code>&gt;</code></strong> character and the sequences by itself following the :doc:<code>iupac</code> code. The sequence is usually split other severals lines of the same length (expect for the last one)</p>
<pre><code>&gt;my_sequence this is my pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT</code></pre>
<p>This is no special format for the title line excepting that this line should be unique. Usually the first word following the <strong>&gt;</strong> character is considered as the sequence identifier. The end of the title line corresponding to a description of the sequence. Several sequences can be concatenated in a same file. The description of the next sequence is just pasted at the end of the record of the previous one</p>
<pre><code>&gt;sequence_A this is my first pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
&gt;sequence_B this is my second pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
&gt;sequence_C this is my third pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT</code></pre>
</section>
<section id="classical-fastq" class="level3" data-number="1.2.4">
<h3 data-number="1.2.4" class="anchored" data-anchor-id="classical-fastq"><span class="header-section-number">1.2.4</span> The <em>fastq</em> sequence format<a href="#fn1" class="footnote-ref" id="fnref1" role="doc-noteref"><sup>1</sup></a></h3>
<p><strong>fastq format</strong> is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are encoded with a single ASCII character for brevity. It was originally developed at the <code>Wellcome Trust Sanger Institute</code> to bundle a <a href="#classical-fasta">fasta</a> sequence and its quality data, but has recently become the <em>de facto</em> standard for storing the output of high throughput sequencing instruments such as the Illumina Genome Analyzer Illumina <span class="citation" data-cites="cock2010sanger">(<a href="references.html#ref-cock2010sanger" role="doc-biblioref">Cock et al. 2010</a>)</span> .</p>
<p>A fastq file normally uses four lines per sequence.</p>
<ul>
<li>Line 1 begins with a @ character and is followed by a sequence identifier and an <em>optional</em> description (like a :ref:<code>fasta</code> title line).</li>
<li>Line 2 is the raw sequence letters.</li>
<li>Line 3 begins with a + character and is <em>optionally</em> followed by the same sequence identifier (and any description) again.</li>
<li>Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.</li>
</ul>
<p>A fastq file containing a single sequence might look like this:</p>
<pre><code>@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF&gt;&gt;&gt;&gt;&gt;&gt;CCCCCCC65</code></pre>
<p>The character ! represents the lowest quality while ~ is the highest. Here are the quality value characters in left-to-right increasing order of quality (<code>ASCII</code>):</p>
<pre><code>!"#$%&amp;'()*+,-./0123456789:;&lt;=&gt;?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~</code></pre>
<p>The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of “@” and “+” as markers (these characters can also occur in the quality string).</p>
<section id="variations" class="level4" data-number="1.2.4.1">
<h4 data-number="1.2.4.1" class="anchored" data-anchor-id="variations"><span class="header-section-number">1.2.4.1</span> Variations</h4>
<section id="quality" class="level5" data-number="1.2.4.1.1">
<h5 data-number="1.2.4.1.1" class="anchored" data-anchor-id="quality"><span class="header-section-number">1.2.4.1.1</span> Quality</h5>
<p>A quality value <em>Q</em> is an integer mapping of <em>p</em> (i.e., the probability that the corresponding base call is incorrect). Two different equations have been in use. The first is the standard Sanger variant to assess reliability of a base call, otherwise known as Phred quality score:</p>
<p><span class="math display">\[
Q_\text{sanger} = -10 \, \log_{10} p
\]</span></p>
<p>The Solexa pipeline (i.e., the software delivered with the Illumina Genome Analyzer) earlier used a different mapping, encoding the odds <span class="math inline">\(\mathbf{p}/(1-\mathbf{p})\)</span> instead of the probability <span class="math inline">\(\mathbf{p}\)</span>:</p>
<p><span class="math display">\[
Q_\text{solexa-prior to v.1.3} = -10 \, \log_{10} \frac{p}{1-p}
\]</span></p>
<p>Although both mappings are asymptotically identical at higher quality values, they differ at lower quality levels (i.e., approximately <span class="math inline">\(\mathbf{p} &gt; 0.05\)</span>, or equivalently, <span class="math inline">\(\mathbf{Q} &lt; 13\)</span>).</p>
<p>|Relationship between <em>Q</em> and <em>p</em> using the Sanger (red) and Solexa (black) equations (described above). The vertical dotted line indicates <span class="math inline">\(\mathbf{p}= 0.05\)</span>, or equivalently, <span class="math inline">\(Q = 13\)</span>.|</p>
</section>
</section>
<section id="encoding" class="level4" data-number="1.2.4.2">
<h4 data-number="1.2.4.2" class="anchored" data-anchor-id="encoding"><span class="header-section-number">1.2.4.2</span> Encoding</h4>
<ul>
<li>Sanger format can encode a Phred quality score from 0 to 93 using ASCII 33 to 126 (although in raw read data the Phred quality score rarely exceeds 60, higher scores are possible in assemblies or read maps).</li>
<li>Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score from -5 to 62 using ASCII 59 to 126 (although in raw read data Solexa scores from -5 to 40 only are expected)</li>
<li>Starting with Illumina 1.3 and before Illumina 1.8, the format encoded a Phred quality score from 0 to 62 using ASCII 64 to 126 (although in raw read data Phred scores from 0 to 40 only are expected).</li>
<li>Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0 to 2 have a slightly different meaning. The values 0 and 1 are no longer used and the value 2, encoded by ASCII 66 “B”.</li>
</ul>
<p>Sequencing Control Software, Version 2.6, Catalog # SY-960-2601, Part # 15009921 Rev.&nbsp;A, November 2009]&nbsp;<a href="[http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf](http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf){.uri}" class="uri">[http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\\](http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf){.uri}</a> (page 30) states the following: <em>If a read ends with a segment of mostly low quality (Q15 or below), then all of the quality values in the segment are replaced with a value of 2 (encoded as the letter B in Illuminas text-based encoding of quality scores)… This Q2 indicator does not predict a specific error rate, but rather indicates that a specific final portion of the read should not be used in further analyses.</em> Also, the quality score encoded as “B” letter may occur internally within reads at least as late as pipeline version 1.6, as shown in the following example:</p>
<pre><code>@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
+HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB</code></pre>
<p>An alternative interpretation of this ASCII encoding has been proposed. Also, in Illumina runs using PhiX controls, the character B was observed to represent an “unknown quality score”. The error rate of B reads was roughly 3 phred scores lower the mean observed score of a given run.</p>
<ul>
<li>Starting in Illumina 1.8, the quality scores have basically returned to the use of the Sanger format (Phred+33).</li>
</ul>
</section>
</section>
</section>
<section id="file-extension" class="level2" data-number="1.3">
<h2 data-number="1.3" class="anchored" data-anchor-id="file-extension"><span class="header-section-number">1.3</span> File extension</h2>
<p>There is no standard file extension for a FASTQ file, but .fq and .fastq, are commonly used.</p>
</section>
<section id="see-also" class="level2" data-number="1.4">
<h2 data-number="1.4" class="anchored" data-anchor-id="see-also"><span class="header-section-number">1.4</span> See also</h2>
<ul>
<li>:ref:<code>fasta</code></li>
</ul>
</section>
<section id="references" class="level2" data-number="1.5">
<h2 data-number="1.5" class="anchored" data-anchor-id="references"><span class="header-section-number">1.5</span> References</h2>
<p>.. [1] Cock et al (2009) The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Research,</p>
<p>.. [2] Illumina Quality Scores, Tobias Mann, Bioinformatics, San Diego, Illumina <code>1</code>__</p>
<p>.. |Relationship between <em>Q</em> and <em>p</em> using the Sanger (red) and Solexa (black) equations (described above). The vertical dotted line indicates <em>p</em> = 0.05, or equivalently, <em>Q</em> Å 13.| image:: Probability metrics.png</p>
<p>See <a href="http://en.wikipedia.org/wiki/FASTQ_format" class="uri">http://en.wikipedia.org/wiki/FASTQ_format</a></p>
<div id="refs" class="references csl-bib-body hanging-indent" role="doc-bibliography" style="display: none"> <div id="refs" class="references csl-bib-body hanging-indent" role="doc-bibliography" style="display: none">
<div id="ref-cock2010sanger" class="csl-entry" role="doc-biblioentry"> <div id="ref-Andersen2012-gj" class="csl-entry" role="doc-biblioentry">
Cock, Peter JA, Christopher J Fields, Naohisa Goto, Michael L Heuer, and Peter M Rice. 2010. <span>The Sanger FASTQ File Format for Sequences with Quality Scores, and the Solexa/Illumina FASTQ Variants.”</span> <em>Nucleic Acids Research</em> 38 (6): 176771. Andersen, Kenneth, Karen Lise Bird, Morten Rasmussen, James Haile, Henrik Breuning-Madsen, Kurt H Kjaer, Ludovic Orlando, M Thomas P Gilbert, and Eske Willerslev. 2012. <span><span class="nocase">Meta-barcoding of <span class="nocase">ë</span>dirt<span class="nocase">ı́</span>DNA from soil reflects vertebrate biodiversity</span>.”</span> <em>Molecular Ecology</em> 21 (8): 196679.
</div>
<div id="ref-Baldwin2013-yc" class="csl-entry" role="doc-biblioentry">
Baldwin, Darren S, Matthew J Colloff, Gavin N Rees, Anthony A Chariton, Garth O Watson, Leon N Court, Diana M Hartley, et al. 2013. <span><span class="nocase">Impacts of inundation and drought on eukaryote biodiversity in semi-arid floodplain soils</span>.”</span> <em>Molecular Ecology</em> 22 (6): 174658. <a href="https://doi.org/10.1111/mec.12190">https://doi.org/10.1111/mec.12190</a>.
</div>
<div id="ref-Caporaso2010-ii" class="csl-entry" role="doc-biblioentry">
Caporaso, J Gregory, Justin Kuczynski, Jesse Stombaugh, Kyle Bittinger, Frederic D Bushman, Elizabeth K Costello, Noah Fierer, et al. 2010. <span><span class="nocase">QIIME allows analysis of high-throughput community sequencing data</span>.”</span> <em>Nature Methods</em> 7 (5): 33536. <a href="https://doi.org/10.1038/nmeth.f.303">https://doi.org/10.1038/nmeth.f.303</a>.
</div>
<div id="ref-Chariton2010-cz" class="csl-entry" role="doc-biblioentry">
Chariton, Anthony A, Anthony C Roach, Stuart L Simpson, and Graeme E Batley. 2010. <span><span class="nocase">Influence of the choice of physical and chemistry variables on interpreting patterns of sediment contaminants and their relationships with estuarine macrobenthic communities</span>.”</span> <em>Marine and Freshwater Research</em>. <a href="https://doi.org/10.1071/mf09263">https://doi.org/10.1071/mf09263</a>.
</div>
<div id="ref-Deagle2009-yh" class="csl-entry" role="doc-biblioentry">
Deagle, Bruce E, Roger Kirkwood, and Simon N Jarman. 2009. <span><span class="nocase">Analysis of Australian fur seal diet by pyrosequencing prey DNA in faeces</span>.”</span> <em>Molecular Ecology</em> 18 (9): 202238. <a href="https://doi.org/10.1111/j.1365-294X.2009.04158.x">https://doi.org/10.1111/j.1365-294X.2009.04158.x</a>.
</div>
<div id="ref-Kowalczyk2011-kg" class="csl-entry" role="doc-biblioentry">
Kowalczyk, Rafał, Pierre Taberlet, Eric Coissac, Alice Valentini, Christian Miquel, Tomasz Kamiński, and Jan M Wójcik. 2011. <span><span class="nocase">Influence of management practices on large herbivore diet—Case of European bison in Bia<span class="nocase">ł</span>owie<span class="nocase">ż</span>a Primeval Forest (Poland)</span>.”</span> <em>Forest Ecology and Management</em> 261 (4): 82128. <a href="https://doi.org/10.1016/j.foreco.2010.11.026">https://doi.org/10.1016/j.foreco.2010.11.026</a>.
</div>
<div id="ref-Parducci2012-rn" class="csl-entry" role="doc-biblioentry">
Parducci, Laura, Tina Jørgensen, Mari Mette Tollefsrud, Ellen Elverland, Torbjørn Alm, Sonia L Fontana, K D Bennett, et al. 2012. <span><span class="nocase">Glacial survival of boreal trees in northern Scandinavia</span>.”</span> <em>Science</em> 335 (6072): 108386. <a href="https://doi.org/10.1126/science.1216043">https://doi.org/10.1126/science.1216043</a>.
</div>
<div id="ref-Schloss2009-qy" class="csl-entry" role="doc-biblioentry">
Schloss, Patrick D, Sarah L Westcott, Thomas Ryabin, Justine R Hall, Martin Hartmann, Emily B Hollister, Ryan A Lesniewski, et al. 2009. <span><span class="nocase">Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities</span>.”</span> <em>Applied and Environmental Microbiology</em> 75 (23): 753741. <a href="https://doi.org/10.1128/AEM.01541-09">https://doi.org/10.1128/AEM.01541-09</a>.
</div>
<div id="ref-Shehzad2012-pn" class="csl-entry" role="doc-biblioentry">
Shehzad, Wasim, Tiayyba Riaz, Muhammad A Nawaz, Christian Miquel, Carole Poillot, Safdar A Shah, Francois Pompanon, Eric Coissac, and Pierre Taberlet. 2012. <span><span class="nocase">Carnivore diet analysis based on next-generation sequencing: Application to the leopard cat (Prionailurus bengalensis) in Pakistan</span>.”</span> <em>Molecular Ecology</em> 21 (8): 195165. <a href="https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1365-294X.2011.05424.x">https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1365-294X.2011.05424.x</a>.
</div>
<div id="ref-Sogin2006-ab" class="csl-entry" role="doc-biblioentry">
Sogin, Mitchell L, Hilary G Morrison, Julie A Huber, David Mark Welch, Susan M Huse, Phillip R Neal, Jesus M Arrieta, and Gerhard J Herndl. 2006. <span><span class="nocase">Microbial diversity in the deep sea and the underexplored "rare biosphere"</span>.”</span> <em>Proceedings of the National Academy of Sciences of the United States of America</em> 103 (32): 1211520. <a href="https://doi.org/10.1073/pnas.0605127103">https://doi.org/10.1073/pnas.0605127103</a>.
</div>
<div id="ref-Sonstebo2010-vv" class="csl-entry" role="doc-biblioentry">
Sønstebø, J H, L Gielly, A K Brysting, R Elven, M Edwards, J Haile, E Willerslev, et al. 2010. <span><span class="nocase">Using next-generation sequencing for molecular reconstruction of past Arctic vegetation and climate</span>.”</span> <em>Molecular Ecology Resources</em> 10 (6): 100918. <a href="https://doi.org/10.1111/j.1755-0998.2010.02855.x">https://doi.org/10.1111/j.1755-0998.2010.02855.x</a>.
</div>
<div id="ref-Taberlet2012-pf" class="csl-entry" role="doc-biblioentry">
Taberlet, Pierre, Eric Coissac, Mehrdad Hajibabaei, and Loren H Rieseberg. 2012. <span><span>Environmental DNA</span>.”</span> <em>Molecular Ecology</em> 21 (8): 178993. <a href="https://doi.org/10.1111/j.1365-294X.2012.05542.x">https://doi.org/10.1111/j.1365-294X.2012.05542.x</a>.
</div>
<div id="ref-Thomsen2012-au" class="csl-entry" role="doc-biblioentry">
Thomsen, Philip Francis, Jos Kielgast, Lars L Iversen, Carsten Wiuf, Morten Rasmussen, M Thomas P Gilbert, Ludovic Orlando, and Eske Willerslev. 2012. <span><span class="nocase">Monitoring endangered freshwater biodiversity using environmental DNA</span>.”</span> <em>Molecular Ecology</em> 21 (11): 256573. <a href="https://doi.org/10.1111/j.1365-294X.2011.05418.x">https://doi.org/10.1111/j.1365-294X.2011.05418.x</a>.
</div>
<div id="ref-Valentini2009-ay" class="csl-entry" role="doc-biblioentry">
Valentini, Alice, Christian Miquel, Muhammad Ali Nawaz, Eva Bellemain, Eric Coissac, François Pompanon, Ludovic Gielly, et al. 2009. <span><span class="nocase">New perspectives in diet analysis based on DNA barcoding and parallel pyrosequencing: the trnL approach</span>.”</span> <em>Molecular Ecology Resources</em> 9 (1): 5160. <a href="https://doi.org/10.1111/j.1755-0998.2008.02352.x">https://doi.org/10.1111/j.1755-0998.2008.02352.x</a>.
</div>
<div id="ref-Yoccoz2012-ix" class="csl-entry" role="doc-biblioentry">
Yoccoz, N G, K A Bråthen, L Gielly, J Haile, M E Edwards, T Goslar, H Von Stedingk, et al. 2012. <span><span class="nocase">DNA from soil mirrors plant taxonomic and growth form diversity</span>.”</span> <em>Molecular Ecology</em> 21 (15): 364755. <a href="https://doi.org/10.1111/j.1365-294X.2012.05545.x">https://doi.org/10.1111/j.1365-294X.2012.05545.x</a>.
</div> </div>
</div> </div>
</section> </section>
<section id="footnotes" class="footnotes footnotes-end-of-document" role="doc-endnotes">
<hr>
<ol>
<li id="fn1"><p>This article uses material from the Wikipedia article <a href="http://en.wikipedia.org/wiki/FASTQ_format"><code>FASTQ format</code></a> which is released under the <code>Creative Commons Attribution-Share-Alike License 3.0</code><a href="#fnref1" class="footnote-back" role="doc-backlink">↩︎</a></p></li>
</ol>
</section> </section>
</main> <!-- /main --> </main> <!-- /main -->
@@ -529,8 +401,8 @@ window.document.addEventListener("DOMContentLoaded", function (event) {
</a> </a>
</div> </div>
<div class="nav-page nav-page-next"> <div class="nav-page nav-page-next">
<a href="./tutorial.html" class="pagination-link"> <a href="./formats.html" class="pagination-link">
<span class="nav-page-text"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></span> <i class="bi bi-arrow-right-short"></i> <span class="nav-page-text"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">File formats usable with <em>OBITools</em></span></span> <i class="bi bi-arrow-right-short"></i>
</a> </a>
</div> </div>
</nav> </nav>
+45 -40
View File
@@ -7,7 +7,7 @@
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes"> <meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
<title>OBITools V4 - 4&nbsp; The GO OBITools library</title> <title>OBITools V4 - 5&nbsp; The GO OBITools library</title>
<style> <style>
code{white-space: pre-wrap;} code{white-space: pre-wrap;}
span.smallcaps{font-variant: small-caps;} span.smallcaps{font-variant: small-caps;}
@@ -133,7 +133,7 @@ code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warni
<header id="quarto-header" class="headroom fixed-top"> <header id="quarto-header" class="headroom fixed-top">
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }"> <nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
<div class="container-fluid d-flex justify-content-between"> <div class="container-fluid d-flex justify-content-between">
<h1 class="quarto-secondary-nav-title"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></h1> <h1 class="quarto-secondary-nav-title"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></h1>
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation"> <button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
<i class="bi bi-chevron-right"></i> <i class="bi bi-chevron-right"></i>
</button> </button>
@@ -168,22 +168,27 @@ code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warni
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a> <a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./commands.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a> <a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./library.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a> <a href="./commands.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">Annexes</span></a> <a href="./library.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span>&nbsp; <span class="chapter-title">Annexes</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
@@ -200,18 +205,18 @@ code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warni
<h2 id="toc-title">Table of contents</h2> <h2 id="toc-title">Table of contents</h2>
<ul> <ul>
<li><a href="#biosequence" id="toc-biosequence" class="nav-link active" data-scroll-target="#biosequence"><span class="toc-section-number">4.1</span> BioSequence</a> <li><a href="#biosequence" id="toc-biosequence" class="nav-link active" data-scroll-target="#biosequence"><span class="toc-section-number">5.1</span> BioSequence</a>
<ul class="collapse"> <ul class="collapse">
<li><a href="#creating-new-instances" id="toc-creating-new-instances" class="nav-link" data-scroll-target="#creating-new-instances"><span class="toc-section-number">4.1.1</span> Creating new instances</a></li> <li><a href="#creating-new-instances" id="toc-creating-new-instances" class="nav-link" data-scroll-target="#creating-new-instances"><span class="toc-section-number">5.1.1</span> Creating new instances</a></li>
<li><a href="#end-of-life-of-a-biosequence-instance" id="toc-end-of-life-of-a-biosequence-instance" class="nav-link" data-scroll-target="#end-of-life-of-a-biosequence-instance"><span class="toc-section-number">4.1.2</span> End of life of a <code>BioSequence</code> instance</a></li> <li><a href="#end-of-life-of-a-biosequence-instance" id="toc-end-of-life-of-a-biosequence-instance" class="nav-link" data-scroll-target="#end-of-life-of-a-biosequence-instance"><span class="toc-section-number">5.1.2</span> End of life of a <code>BioSequence</code> instance</a></li>
<li><a href="#accessing-to-the-elements-of-a-sequence" id="toc-accessing-to-the-elements-of-a-sequence" class="nav-link" data-scroll-target="#accessing-to-the-elements-of-a-sequence"><span class="toc-section-number">4.1.3</span> Accessing to the elements of a sequence</a></li> <li><a href="#accessing-to-the-elements-of-a-sequence" id="toc-accessing-to-the-elements-of-a-sequence" class="nav-link" data-scroll-target="#accessing-to-the-elements-of-a-sequence"><span class="toc-section-number">5.1.3</span> Accessing to the elements of a sequence</a></li>
<li><a href="#the-annotations-of-a-sequence" id="toc-the-annotations-of-a-sequence" class="nav-link" data-scroll-target="#the-annotations-of-a-sequence"><span class="toc-section-number">4.1.4</span> The annotations of a sequence</a></li> <li><a href="#the-annotations-of-a-sequence" id="toc-the-annotations-of-a-sequence" class="nav-link" data-scroll-target="#the-annotations-of-a-sequence"><span class="toc-section-number">5.1.4</span> The annotations of a sequence</a></li>
</ul></li> </ul></li>
<li><a href="#the-sequence-iterator" id="toc-the-sequence-iterator" class="nav-link" data-scroll-target="#the-sequence-iterator"><span class="toc-section-number">4.2</span> The sequence iterator</a> <li><a href="#the-sequence-iterator" id="toc-the-sequence-iterator" class="nav-link" data-scroll-target="#the-sequence-iterator"><span class="toc-section-number">5.2</span> The sequence iterator</a>
<ul class="collapse"> <ul class="collapse">
<li><a href="#basic-usage-of-a-sequence-iterator" id="toc-basic-usage-of-a-sequence-iterator" class="nav-link" data-scroll-target="#basic-usage-of-a-sequence-iterator"><span class="toc-section-number">4.2.1</span> Basic usage of a sequence iterator</a></li> <li><a href="#basic-usage-of-a-sequence-iterator" id="toc-basic-usage-of-a-sequence-iterator" class="nav-link" data-scroll-target="#basic-usage-of-a-sequence-iterator"><span class="toc-section-number">5.2.1</span> Basic usage of a sequence iterator</a></li>
<li><a href="#the-pipable-functions" id="toc-the-pipable-functions" class="nav-link" data-scroll-target="#the-pipable-functions"><span class="toc-section-number">4.2.2</span> The <code>Pipable</code> functions</a></li> <li><a href="#the-pipable-functions" id="toc-the-pipable-functions" class="nav-link" data-scroll-target="#the-pipable-functions"><span class="toc-section-number">5.2.2</span> The <code>Pipable</code> functions</a></li>
<li><a href="#the-teeable-functions" id="toc-the-teeable-functions" class="nav-link" data-scroll-target="#the-teeable-functions"><span class="toc-section-number">4.2.3</span> The <code>Teeable</code> functions</a></li> <li><a href="#the-teeable-functions" id="toc-the-teeable-functions" class="nav-link" data-scroll-target="#the-teeable-functions"><span class="toc-section-number">5.2.3</span> The <code>Teeable</code> functions</a></li>
</ul></li> </ul></li>
</ul> </ul>
</nav> </nav>
@@ -221,7 +226,7 @@ code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warni
<header id="title-block-header" class="quarto-title-block default"> <header id="title-block-header" class="quarto-title-block default">
<div class="quarto-title"> <div class="quarto-title">
<h1 class="title d-none d-lg-block"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></h1> <h1 class="title d-none d-lg-block"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></h1>
</div> </div>
@@ -236,15 +241,15 @@ code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warni
</header> </header>
<section id="biosequence" class="level2" data-number="4.1"> <section id="biosequence" class="level2" data-number="5.1">
<h2 data-number="4.1" class="anchored" data-anchor-id="biosequence"><span class="header-section-number">4.1</span> BioSequence</h2> <h2 data-number="5.1" class="anchored" data-anchor-id="biosequence"><span class="header-section-number">5.1</span> BioSequence</h2>
<p>The <code>BioSequence</code> class is used to represent biological sequences. It allows for storing : - the sequence itself as a <code>[]byte</code> - the sequencing quality score as a <code>[]byte</code> if needed - an identifier as a <code>string</code> - a definition as a <code>string</code> - a set of <em>(key, value)</em> pairs in a <code>map[sting]interface{}</code></p> <p>The <code>BioSequence</code> class is used to represent biological sequences. It allows for storing : - the sequence itself as a <code>[]byte</code> - the sequencing quality score as a <code>[]byte</code> if needed - an identifier as a <code>string</code> - a definition as a <code>string</code> - a set of <em>(key, value)</em> pairs in a <code>map[sting]interface{}</code></p>
<p>BioSequence is defined in the obiseq module and is included using the code</p> <p>BioSequence is defined in the obiseq module and is included using the code</p>
<div class="sourceCode" id="cb1"><pre class="sourceCode go code-with-copy"><code class="sourceCode go"><span id="cb1-1"><a href="#cb1-1" aria-hidden="true" tabindex="-1"></a><span class="kw">import</span> <span class="op">(</span></span> <div class="sourceCode" id="cb1"><pre class="sourceCode go code-with-copy"><code class="sourceCode go"><span id="cb1-1"><a href="#cb1-1" aria-hidden="true" tabindex="-1"></a><span class="kw">import</span> <span class="op">(</span></span>
<span id="cb1-2"><a href="#cb1-2" aria-hidden="true" tabindex="-1"></a> <span class="st">"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"</span></span> <span id="cb1-2"><a href="#cb1-2" aria-hidden="true" tabindex="-1"></a> <span class="st">"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"</span></span>
<span id="cb1-3"><a href="#cb1-3" aria-hidden="true" tabindex="-1"></a><span class="op">)</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div> <span id="cb1-3"><a href="#cb1-3" aria-hidden="true" tabindex="-1"></a><span class="op">)</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
<section id="creating-new-instances" class="level3" data-number="4.1.1"> <section id="creating-new-instances" class="level3" data-number="5.1.1">
<h3 data-number="4.1.1" class="anchored" data-anchor-id="creating-new-instances"><span class="header-section-number">4.1.1</span> Creating new instances</h3> <h3 data-number="5.1.1" class="anchored" data-anchor-id="creating-new-instances"><span class="header-section-number">5.1.1</span> Creating new instances</h3>
<p>To create new instance, use</p> <p>To create new instance, use</p>
<ul> <ul>
<li><code>MakeBioSequence(id string, sequence []byte, definition string) obiseq.BioSequence</code></li> <li><code>MakeBioSequence(id string, sequence []byte, definition string) obiseq.BioSequence</code></li>
@@ -271,12 +276,12 @@ code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warni
<pre><code>&gt;id definition containing potentially several words <pre><code>&gt;id definition containing potentially several words
sequence</code></pre> sequence</code></pre>
</section> </section>
<section id="end-of-life-of-a-biosequence-instance" class="level3" data-number="4.1.2"> <section id="end-of-life-of-a-biosequence-instance" class="level3" data-number="5.1.2">
<h3 data-number="4.1.2" class="anchored" data-anchor-id="end-of-life-of-a-biosequence-instance"><span class="header-section-number">4.1.2</span> End of life of a <code>BioSequence</code> instance</h3> <h3 data-number="5.1.2" class="anchored" data-anchor-id="end-of-life-of-a-biosequence-instance"><span class="header-section-number">5.1.2</span> End of life of a <code>BioSequence</code> instance</h3>
<p>When an instance of <code>BioSequence</code> is no longer in use, it is normally taken over by the GO garbage collector. If you know that an instance will never be used again, you can, if you wish, call the <code>Recycle</code> method on it to store the allocated memory elements in a <code>pool</code> to limit the allocation effort when many sequences are being handled. Once the recycle method has been called on an instance, you must ensure that no other method is called on it.</p> <p>When an instance of <code>BioSequence</code> is no longer in use, it is normally taken over by the GO garbage collector. If you know that an instance will never be used again, you can, if you wish, call the <code>Recycle</code> method on it to store the allocated memory elements in a <code>pool</code> to limit the allocation effort when many sequences are being handled. Once the recycle method has been called on an instance, you must ensure that no other method is called on it.</p>
</section> </section>
<section id="accessing-to-the-elements-of-a-sequence" class="level3" data-number="4.1.3"> <section id="accessing-to-the-elements-of-a-sequence" class="level3" data-number="5.1.3">
<h3 data-number="4.1.3" class="anchored" data-anchor-id="accessing-to-the-elements-of-a-sequence"><span class="header-section-number">4.1.3</span> Accessing to the elements of a sequence</h3> <h3 data-number="5.1.3" class="anchored" data-anchor-id="accessing-to-the-elements-of-a-sequence"><span class="header-section-number">5.1.3</span> Accessing to the elements of a sequence</h3>
<p>The different elements of an <code>obiseq.BioSequence</code> must be accessed using a set of methods. For the three main elements provided during the creation of a new instance methodes are :</p> <p>The different elements of an <code>obiseq.BioSequence</code> must be accessed using a set of methods. For the three main elements provided during the creation of a new instance methodes are :</p>
<ul> <ul>
<li><code>Id() string</code></li> <li><code>Id() string</code></li>
@@ -305,8 +310,8 @@ sequence</code></pre>
<span id="cb4-14"><a href="#cb4-14" aria-hidden="true" tabindex="-1"></a> myseq<span class="op">.</span>SetId<span class="op">(</span><span class="st">"SPE01_0001"</span><span class="op">)</span></span> <span id="cb4-14"><a href="#cb4-14" aria-hidden="true" tabindex="-1"></a> myseq<span class="op">.</span>SetId<span class="op">(</span><span class="st">"SPE01_0001"</span><span class="op">)</span></span>
<span id="cb4-15"><a href="#cb4-15" aria-hidden="true" tabindex="-1"></a> fmt<span class="op">.</span>Println<span class="op">(</span>myseq<span class="op">.</span>Id<span class="op">())</span></span> <span id="cb4-15"><a href="#cb4-15" aria-hidden="true" tabindex="-1"></a> fmt<span class="op">.</span>Println<span class="op">(</span>myseq<span class="op">.</span>Id<span class="op">())</span></span>
<span id="cb4-16"><a href="#cb4-16" aria-hidden="true" tabindex="-1"></a><span class="op">}</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div> <span id="cb4-16"><a href="#cb4-16" aria-hidden="true" tabindex="-1"></a><span class="op">}</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
<section id="different-ways-for-accessing-an-editing-the-sequence" class="level4" data-number="4.1.3.1"> <section id="different-ways-for-accessing-an-editing-the-sequence" class="level4" data-number="5.1.3.1">
<h4 data-number="4.1.3.1" class="anchored" data-anchor-id="different-ways-for-accessing-an-editing-the-sequence"><span class="header-section-number">4.1.3.1</span> Different ways for accessing an editing the sequence</h4> <h4 data-number="5.1.3.1" class="anchored" data-anchor-id="different-ways-for-accessing-an-editing-the-sequence"><span class="header-section-number">5.1.3.1</span> Different ways for accessing an editing the sequence</h4>
<p>If <code>Sequence()</code>and <code>SetSequence(sequence []byte)</code> methods are the basic ones, several other methods exist.</p> <p>If <code>Sequence()</code>and <code>SetSequence(sequence []byte)</code> methods are the basic ones, several other methods exist.</p>
<ul> <ul>
<li><code>String() string</code> return the sequence directly converted to a <code>string</code> instance.</li> <li><code>String() string</code> return the sequence directly converted to a <code>string</code> instance.</li>
@@ -331,8 +336,8 @@ sequence</code></pre>
<span id="cb5-11"><a href="#cb5-11" aria-hidden="true" tabindex="-1"></a> fmt<span class="op">.</span>Println<span class="op">(</span>myseq<span class="op">.</span>String<span class="op">())</span></span> <span id="cb5-11"><a href="#cb5-11" aria-hidden="true" tabindex="-1"></a> fmt<span class="op">.</span>Println<span class="op">(</span>myseq<span class="op">.</span>String<span class="op">())</span></span>
<span id="cb5-12"><a href="#cb5-12" aria-hidden="true" tabindex="-1"></a><span class="op">}</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div> <span id="cb5-12"><a href="#cb5-12" aria-hidden="true" tabindex="-1"></a><span class="op">}</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
</section> </section>
<section id="sequence-quality-scores" class="level4" data-number="4.1.3.2"> <section id="sequence-quality-scores" class="level4" data-number="5.1.3.2">
<h4 data-number="4.1.3.2" class="anchored" data-anchor-id="sequence-quality-scores"><span class="header-section-number">4.1.3.2</span> Sequence quality scores</h4> <h4 data-number="5.1.3.2" class="anchored" data-anchor-id="sequence-quality-scores"><span class="header-section-number">5.1.3.2</span> Sequence quality scores</h4>
<p>Sequence quality scores cannot be initialized at the time of instance creation. You must use dedicated methods to add quality scores to a sequence.</p> <p>Sequence quality scores cannot be initialized at the time of instance creation. You must use dedicated methods to add quality scores to a sequence.</p>
<p>To be coherent the length of both the DNA sequence and que quality score sequence must be equal. But assessment of this constraint is realized. It is of the programmer responsability to check that invariant.</p> <p>To be coherent the length of both the DNA sequence and que quality score sequence must be equal. But assessment of this constraint is realized. It is of the programmer responsability to check that invariant.</p>
<p>While accessing to the quality scores relies on the method <code>Quality() []byte</code>, setting the quality need to call one of the following method. They run similarly to their sequence dedicated conterpart.</p> <p>While accessing to the quality scores relies on the method <code>Quality() []byte</code>, setting the quality need to call one of the following method. They run similarly to their sequence dedicated conterpart.</p>
@@ -344,8 +349,8 @@ sequence</code></pre>
<p>In a way analogous to the <code>Clear</code> method, <code>ClearQualities()</code> empties the sequence of quality scores.</p> <p>In a way analogous to the <code>Clear</code> method, <code>ClearQualities()</code> empties the sequence of quality scores.</p>
</section> </section>
</section> </section>
<section id="the-annotations-of-a-sequence" class="level3" data-number="4.1.4"> <section id="the-annotations-of-a-sequence" class="level3" data-number="5.1.4">
<h3 data-number="4.1.4" class="anchored" data-anchor-id="the-annotations-of-a-sequence"><span class="header-section-number">4.1.4</span> The annotations of a sequence</h3> <h3 data-number="5.1.4" class="anchored" data-anchor-id="the-annotations-of-a-sequence"><span class="header-section-number">5.1.4</span> The annotations of a sequence</h3>
<p>A sequence can be annotated with attributes. Each attribute is associated with a value. An attribute is identified by its name. The name of an attribute consists of a character string containing no spaces or blank characters. Values can be of several types.</p> <p>A sequence can be annotated with attributes. Each attribute is associated with a value. An attribute is identified by its name. The name of an attribute consists of a character string containing no spaces or blank characters. Values can be of several types.</p>
<ul> <ul>
<li>Scalar types: <li>Scalar types:
@@ -368,11 +373,11 @@ sequence</code></pre>
</ul> </ul>
</section> </section>
</section> </section>
<section id="the-sequence-iterator" class="level2" data-number="4.2"> <section id="the-sequence-iterator" class="level2" data-number="5.2">
<h2 data-number="4.2" class="anchored" data-anchor-id="the-sequence-iterator"><span class="header-section-number">4.2</span> The sequence iterator</h2> <h2 data-number="5.2" class="anchored" data-anchor-id="the-sequence-iterator"><span class="header-section-number">5.2</span> The sequence iterator</h2>
<p>The pakage <em>obiter</em> provides an iterator mecanism for manipulating sequences. The main class provided by this package is <code>obiiter.IBioSequence</code>. An <code>IBioSequence</code> iterator provides batch of sequences.</p> <p>The pakage <em>obiter</em> provides an iterator mecanism for manipulating sequences. The main class provided by this package is <code>obiiter.IBioSequence</code>. An <code>IBioSequence</code> iterator provides batch of sequences.</p>
<section id="basic-usage-of-a-sequence-iterator" class="level3" data-number="4.2.1"> <section id="basic-usage-of-a-sequence-iterator" class="level3" data-number="5.2.1">
<h3 data-number="4.2.1" class="anchored" data-anchor-id="basic-usage-of-a-sequence-iterator"><span class="header-section-number">4.2.1</span> Basic usage of a sequence iterator</h3> <h3 data-number="5.2.1" class="anchored" data-anchor-id="basic-usage-of-a-sequence-iterator"><span class="header-section-number">5.2.1</span> Basic usage of a sequence iterator</h3>
<p>Many functions, among them functions reading sequences from a text file, return a <code>IBioSequence</code> iterator. The iterator class provides two main methods:</p> <p>Many functions, among them functions reading sequences from a text file, return a <code>IBioSequence</code> iterator. The iterator class provides two main methods:</p>
<ul> <ul>
<li><code>Next() bool</code></li> <li><code>Next() bool</code></li>
@@ -395,12 +400,12 @@ sequence</code></pre>
<span id="cb6-14"><a href="#cb6-14" aria-hidden="true" tabindex="-1"></a><span class="op">}</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div> <span id="cb6-14"><a href="#cb6-14" aria-hidden="true" tabindex="-1"></a><span class="op">}</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
<p>An <code>obiseq.BioSequenceBatch</code> instance is a set of sequences stored in an <code>obiseq.BioSequenceSlice</code> and a sequence number. The number of sequences in a batch is not defined. A batch can even contain zero sequences, if for example all sequences initially included in the batch have been filtered out at some stage of their processing.</p> <p>An <code>obiseq.BioSequenceBatch</code> instance is a set of sequences stored in an <code>obiseq.BioSequenceSlice</code> and a sequence number. The number of sequences in a batch is not defined. A batch can even contain zero sequences, if for example all sequences initially included in the batch have been filtered out at some stage of their processing.</p>
</section> </section>
<section id="the-pipable-functions" class="level3" data-number="4.2.2"> <section id="the-pipable-functions" class="level3" data-number="5.2.2">
<h3 data-number="4.2.2" class="anchored" data-anchor-id="the-pipable-functions"><span class="header-section-number">4.2.2</span> The <code>Pipable</code> functions</h3> <h3 data-number="5.2.2" class="anchored" data-anchor-id="the-pipable-functions"><span class="header-section-number">5.2.2</span> The <code>Pipable</code> functions</h3>
<p>A function consuming a <code>obiiter.IBioSequence</code> and returning a <code>obiiter.IBioSequence</code> is of class <code>obiiter.Pipable</code>.</p> <p>A function consuming a <code>obiiter.IBioSequence</code> and returning a <code>obiiter.IBioSequence</code> is of class <code>obiiter.Pipable</code>.</p>
</section> </section>
<section id="the-teeable-functions" class="level3" data-number="4.2.3"> <section id="the-teeable-functions" class="level3" data-number="5.2.3">
<h3 data-number="4.2.3" class="anchored" data-anchor-id="the-teeable-functions"><span class="header-section-number">4.2.3</span> The <code>Teeable</code> functions</h3> <h3 data-number="5.2.3" class="anchored" data-anchor-id="the-teeable-functions"><span class="header-section-number">5.2.3</span> The <code>Teeable</code> functions</h3>
<p>A function consuming a <code>obiiter.IBioSequence</code> and returning two <code>obiiter.IBioSequence</code> instance is of class <code>obiiter.Teeable</code>.</p> <p>A function consuming a <code>obiiter.IBioSequence</code> and returning two <code>obiiter.IBioSequence</code> instance is of class <code>obiiter.Teeable</code>.</p>
@@ -544,12 +549,12 @@ window.document.addEventListener("DOMContentLoaded", function (event) {
<nav class="page-navigation"> <nav class="page-navigation">
<div class="nav-page nav-page-previous"> <div class="nav-page nav-page-previous">
<a href="./commands.html" class="pagination-link"> <a href="./commands.html" class="pagination-link">
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></span> <i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></span>
</a> </a>
</div> </div>
<div class="nav-page nav-page-next"> <div class="nav-page nav-page-next">
<a href="./annexes.html" class="pagination-link"> <a href="./annexes.html" class="pagination-link">
<span class="nav-page-text"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">Annexes</span></span> <i class="bi bi-arrow-right-short"></i> <span class="nav-page-text"><span class="chapter-number">6</span>&nbsp; <span class="chapter-title">Annexes</span></span> <i class="bi bi-arrow-right-short"></i>
</a> </a>
</div> </div>
</nav> </nav>
+101 -5
View File
@@ -123,22 +123,27 @@ div.csl-indent {
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a> <a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./commands.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a> <a href="./tutorial.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./library.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a> <a href="./commands.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">Annexes</span></a> <a href="./library.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span>&nbsp; <span class="chapter-title">Annexes</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
@@ -174,29 +179,79 @@ div.csl-indent {
</header> </header>
<div id="refs" class="references csl-bib-body hanging-indent" role="doc-bibliography"> <div id="refs" class="references csl-bib-body hanging-indent" role="doc-bibliography">
<div id="ref-Andersen2012-gj" class="csl-entry" role="doc-biblioentry">
Andersen, Kenneth, Karen Lise Bird, Morten Rasmussen, James Haile,
Henrik Breuning-Madsen, Kurt H Kjaer, Ludovic Orlando, M Thomas P
Gilbert, and Eske Willerslev. 2012. <span><span class="nocase">Meta-barcoding of <span class="nocase">ë</span>dirt<span class="nocase">ı́</span>DNA from soil reflects vertebrate
biodiversity</span>.”</span> <em>Molecular Ecology</em> 21 (8): 196679.
</div>
<div id="ref-Baldwin2013-yc" class="csl-entry" role="doc-biblioentry">
Baldwin, Darren S, Matthew J Colloff, Gavin N Rees, Anthony A Chariton,
Garth O Watson, Leon N Court, Diana M Hartley, et al. 2013. <span><span class="nocase">Impacts of inundation and drought on eukaryote
biodiversity in semi-arid floodplain soils</span>.”</span> <em>Molecular
Ecology</em> 22 (6): 174658. <a href="https://doi.org/10.1111/mec.12190">https://doi.org/10.1111/mec.12190</a>.
</div>
<div id="ref-Boyer2016-gq" class="csl-entry" role="doc-biblioentry"> <div id="ref-Boyer2016-gq" class="csl-entry" role="doc-biblioentry">
Boyer, Frédéric, Céline Mercier, Aurélie Bonin, Yvan Le Bras, Pierre Boyer, Frédéric, Céline Mercier, Aurélie Bonin, Yvan Le Bras, Pierre
Taberlet, and Eric Coissac. 2016. <span><span class="nocase">obitools: Taberlet, and Eric Coissac. 2016. <span><span class="nocase">obitools:
a unix-inspired software package for DNA metabarcoding</span>.”</span> a unix-inspired software package for DNA metabarcoding</span>.”</span>
<em>Molecular Ecology Resources</em> 16 (1): 17682. <a href="https://doi.org/10.1111/1755-0998.12428">https://doi.org/10.1111/1755-0998.12428</a>. <em>Molecular Ecology Resources</em> 16 (1): 17682. <a href="https://doi.org/10.1111/1755-0998.12428">https://doi.org/10.1111/1755-0998.12428</a>.
</div> </div>
<div id="ref-Caporaso2010-ii" class="csl-entry" role="doc-biblioentry">
Caporaso, J Gregory, Justin Kuczynski, Jesse Stombaugh, Kyle Bittinger,
Frederic D Bushman, Elizabeth K Costello, Noah Fierer, et al. 2010.
<span><span class="nocase">QIIME allows analysis of high-throughput
community sequencing data</span>.”</span> <em>Nature Methods</em> 7 (5):
33536. <a href="https://doi.org/10.1038/nmeth.f.303">https://doi.org/10.1038/nmeth.f.303</a>.
</div>
<div id="ref-Chariton2010-cz" class="csl-entry" role="doc-biblioentry">
Chariton, Anthony A, Anthony C Roach, Stuart L Simpson, and Graeme E
Batley. 2010. <span><span class="nocase">Influence of the choice of
physical and chemistry variables on interpreting patterns of sediment
contaminants and their relationships with estuarine macrobenthic
communities</span>.”</span> <em>Marine and Freshwater Research</em>. <a href="https://doi.org/10.1071/mf09263">https://doi.org/10.1071/mf09263</a>.
</div>
<div id="ref-cock2010sanger" class="csl-entry" role="doc-biblioentry"> <div id="ref-cock2010sanger" class="csl-entry" role="doc-biblioentry">
Cock, Peter JA, Christopher J Fields, Naohisa Goto, Michael L Heuer, and Cock, Peter JA, Christopher J Fields, Naohisa Goto, Michael L Heuer, and
Peter M Rice. 2010. <span>“The Sanger FASTQ File Format for Sequences Peter M Rice. 2010. <span>“The Sanger FASTQ File Format for Sequences
with Quality Scores, and the Solexa/Illumina FASTQ Variants.”</span> with Quality Scores, and the Solexa/Illumina FASTQ Variants.”</span>
<em>Nucleic Acids Research</em> 38 (6): 176771. <em>Nucleic Acids Research</em> 38 (6): 176771.
</div> </div>
<div id="ref-Deagle2009-yh" class="csl-entry" role="doc-biblioentry">
Deagle, Bruce E, Roger Kirkwood, and Simon N Jarman. 2009. <span><span class="nocase">Analysis of Australian fur seal diet by pyrosequencing
prey DNA in faeces</span>.”</span> <em>Molecular Ecology</em> 18 (9):
202238. <a href="https://doi.org/10.1111/j.1365-294X.2009.04158.x">https://doi.org/10.1111/j.1365-294X.2009.04158.x</a>.
</div>
<div id="ref-Kowalczyk2011-kg" class="csl-entry" role="doc-biblioentry">
Kowalczyk, Rafał, Pierre Taberlet, Eric Coissac, Alice Valentini,
Christian Miquel, Tomasz Kamiński, and Jan M Wójcik. 2011. <span><span class="nocase">Influence of management practices on large herbivore
diet—Case of European bison in Bia<span class="nocase">ł</span>owie<span class="nocase">ż</span>a Primeval Forest (Poland)</span>.”</span>
<em>Forest Ecology and Management</em> 261 (4): 82128. <a href="https://doi.org/10.1016/j.foreco.2010.11.026">https://doi.org/10.1016/j.foreco.2010.11.026</a>.
</div>
<div id="ref-Lipman1985-hw" class="csl-entry" role="doc-biblioentry"> <div id="ref-Lipman1985-hw" class="csl-entry" role="doc-biblioentry">
Lipman, D J, and W R Pearson. 1985. <span><span class="nocase">Rapid Lipman, D J, and W R Pearson. 1985. <span><span class="nocase">Rapid
and sensitive protein similarity searches</span>.”</span> and sensitive protein similarity searches</span>.”</span>
<em>Science</em> 227 (4693): 143541. <a href="http://www.ncbi.nlm.nih.gov/pubmed/2983426">http://www.ncbi.nlm.nih.gov/pubmed/2983426</a>. <em>Science</em> 227 (4693): 143541. <a href="http://www.ncbi.nlm.nih.gov/pubmed/2983426">http://www.ncbi.nlm.nih.gov/pubmed/2983426</a>.
</div> </div>
<div id="ref-Parducci2012-rn" class="csl-entry" role="doc-biblioentry">
Parducci, Laura, Tina Jørgensen, Mari Mette Tollefsrud, Ellen Elverland,
Torbjørn Alm, Sonia L Fontana, K D Bennett, et al. 2012. <span><span class="nocase">Glacial survival of boreal trees in northern
Scandinavia</span>.”</span> <em>Science</em> 335 (6072): 108386. <a href="https://doi.org/10.1126/science.1216043">https://doi.org/10.1126/science.1216043</a>.
</div>
<div id="ref-Riaz2011-gn" class="csl-entry" role="doc-biblioentry"> <div id="ref-Riaz2011-gn" class="csl-entry" role="doc-biblioentry">
Riaz, Tiayyba, Wasim Shehzad, Alain Viari, François Pompanon, Pierre Riaz, Tiayyba, Wasim Shehzad, Alain Viari, François Pompanon, Pierre
Taberlet, and Eric Coissac. 2011. <span><span class="nocase">ecoPrimers: inference of new DNA barcode markers from Taberlet, and Eric Coissac. 2011. <span><span class="nocase">ecoPrimers: inference of new DNA barcode markers from
whole genome sequence analysis</span>.”</span> <em>Nucleic Acids whole genome sequence analysis</span>.”</span> <em>Nucleic Acids
Research</em> 39 (21): e145. <a href="https://doi.org/10.1093/nar/gkr732">https://doi.org/10.1093/nar/gkr732</a>. Research</em> 39 (21): e145. <a href="https://doi.org/10.1093/nar/gkr732">https://doi.org/10.1093/nar/gkr732</a>.
</div> </div>
<div id="ref-Schloss2009-qy" class="csl-entry" role="doc-biblioentry">
Schloss, Patrick D, Sarah L Westcott, Thomas Ryabin, Justine R Hall,
Martin Hartmann, Emily B Hollister, Ryan A Lesniewski, et al. 2009.
<span><span class="nocase">Introducing mothur: open-source,
platform-independent, community-supported software for describing and
comparing microbial communities</span>.”</span> <em>Applied and
Environmental Microbiology</em> 75 (23): 753741. <a href="https://doi.org/10.1128/AEM.01541-09">https://doi.org/10.1128/AEM.01541-09</a>.
</div>
<div id="ref-Seguritan2001-tg" class="csl-entry" role="doc-biblioentry"> <div id="ref-Seguritan2001-tg" class="csl-entry" role="doc-biblioentry">
Seguritan, V, and F Rohwer. 2001. <span><span class="nocase">FastGroup: Seguritan, V, and F Rohwer. 2001. <span><span class="nocase">FastGroup:
a program to dereplicate libraries of 16S rDNA sequences</span>.”</span> a program to dereplicate libraries of 16S rDNA sequences</span>.”</span>
@@ -210,6 +265,47 @@ based on next-generation sequencing: Application to the leopard cat
(Prionailurus bengalensis) in Pakistan</span>.”</span> <em>Molecular (Prionailurus bengalensis) in Pakistan</span>.”</span> <em>Molecular
Ecology</em> 21 (8): 195165. <a href="https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1365-294X.2011.05424.x">https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1365-294X.2011.05424.x</a>. Ecology</em> 21 (8): 195165. <a href="https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1365-294X.2011.05424.x">https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1365-294X.2011.05424.x</a>.
</div> </div>
<div id="ref-Sogin2006-ab" class="csl-entry" role="doc-biblioentry">
Sogin, Mitchell L, Hilary G Morrison, Julie A Huber, David Mark Welch,
Susan M Huse, Phillip R Neal, Jesus M Arrieta, and Gerhard J Herndl.
2006. <span><span class="nocase">Microbial diversity in the deep sea
and the underexplored "rare biosphere"</span>.”</span> <em>Proceedings
of the National Academy of Sciences of the United States of America</em>
103 (32): 1211520. <a href="https://doi.org/10.1073/pnas.0605127103">https://doi.org/10.1073/pnas.0605127103</a>.
</div>
<div id="ref-Sonstebo2010-vv" class="csl-entry" role="doc-biblioentry">
Sønstebø, J H, L Gielly, A K Brysting, R Elven, M Edwards, J Haile, E
Willerslev, et al. 2010. <span><span class="nocase">Using
next-generation sequencing for molecular reconstruction of past Arctic
vegetation and climate</span>.”</span> <em>Molecular Ecology
Resources</em> 10 (6): 100918. <a href="https://doi.org/10.1111/j.1755-0998.2010.02855.x">https://doi.org/10.1111/j.1755-0998.2010.02855.x</a>.
</div>
<div id="ref-Taberlet2012-pf" class="csl-entry" role="doc-biblioentry">
Taberlet, Pierre, Eric Coissac, Mehrdad Hajibabaei, and Loren H
Rieseberg. 2012. <span><span>Environmental DNA</span>.”</span>
<em>Molecular Ecology</em> 21 (8): 178993. <a href="https://doi.org/10.1111/j.1365-294X.2012.05542.x">https://doi.org/10.1111/j.1365-294X.2012.05542.x</a>.
</div>
<div id="ref-Thomsen2012-au" class="csl-entry" role="doc-biblioentry">
Thomsen, Philip Francis, Jos Kielgast, Lars L Iversen, Carsten Wiuf,
Morten Rasmussen, M Thomas P Gilbert, Ludovic Orlando, and Eske
Willerslev. 2012. <span><span class="nocase">Monitoring endangered
freshwater biodiversity using environmental DNA</span>.”</span>
<em>Molecular Ecology</em> 21 (11): 256573. <a href="https://doi.org/10.1111/j.1365-294X.2011.05418.x">https://doi.org/10.1111/j.1365-294X.2011.05418.x</a>.
</div>
<div id="ref-Valentini2009-ay" class="csl-entry" role="doc-biblioentry">
Valentini, Alice, Christian Miquel, Muhammad Ali Nawaz, Eva Bellemain,
Eric Coissac, François Pompanon, Ludovic Gielly, et al. 2009.
<span><span class="nocase">New perspectives in diet analysis based on
DNA barcoding and parallel pyrosequencing: the trnL
approach</span>.”</span> <em>Molecular Ecology Resources</em> 9 (1):
5160. <a href="https://doi.org/10.1111/j.1755-0998.2008.02352.x">https://doi.org/10.1111/j.1755-0998.2008.02352.x</a>.
</div>
<div id="ref-Yoccoz2012-ix" class="csl-entry" role="doc-biblioentry">
Yoccoz, N G, K A Bråthen, L Gielly, J Haile, M E Edwards, T Goslar, H
Von Stedingk, et al. 2012. <span><span class="nocase">DNA from soil
mirrors plant taxonomic and growth form diversity</span>.”</span>
<em>Molecular Ecology</em> 21 (15): 364755. <a href="https://doi.org/10.1111/j.1365-294X.2012.05545.x">https://doi.org/10.1111/j.1365-294X.2012.05545.x</a>.
</div>
</div> </div>
@@ -351,7 +447,7 @@ window.document.addEventListener("DOMContentLoaded", function (event) {
<nav class="page-navigation"> <nav class="page-navigation">
<div class="nav-page nav-page-previous"> <div class="nav-page nav-page-previous">
<a href="./annexes.html" class="pagination-link"> <a href="./annexes.html" class="pagination-link">
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">Annexes</span></span> <i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">6</span>&nbsp; <span class="chapter-title">Annexes</span></span>
</a> </a>
</div> </div>
<div class="nav-page nav-page-next"> <div class="nav-page nav-page-next">
+49 -63
View File
File diff suppressed because one or more lines are too long
+66 -61
View File
@@ -7,7 +7,7 @@
<meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes"> <meta name="viewport" content="width=device-width, initial-scale=1.0, user-scalable=yes">
<title>OBITools V4 - 2&nbsp; OBITools V4 Tutorial</title> <title>OBITools V4 - 3&nbsp; OBITools V4 Tutorial</title>
<style> <style>
code{white-space: pre-wrap;} code{white-space: pre-wrap;}
span.smallcaps{font-variant: small-caps;} span.smallcaps{font-variant: small-caps;}
@@ -113,7 +113,7 @@ div.csl-indent {
<script src="site_libs/quarto-search/quarto-search.js"></script> <script src="site_libs/quarto-search/quarto-search.js"></script>
<meta name="quarto:offset" content="./"> <meta name="quarto:offset" content="./">
<link href="./commands.html" rel="next"> <link href="./commands.html" rel="next">
<link href="./intro.html" rel="prev"> <link href="./formats.html" rel="prev">
<script src="site_libs/quarto-html/quarto.js"></script> <script src="site_libs/quarto-html/quarto.js"></script>
<script src="site_libs/quarto-html/popper.min.js"></script> <script src="site_libs/quarto-html/popper.min.js"></script>
<script src="site_libs/quarto-html/tippy.umd.min.js"></script> <script src="site_libs/quarto-html/tippy.umd.min.js"></script>
@@ -153,7 +153,7 @@ div.csl-indent {
<header id="quarto-header" class="headroom fixed-top"> <header id="quarto-header" class="headroom fixed-top">
<nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }"> <nav class="quarto-secondary-nav" data-bs-toggle="collapse" data-bs-target="#quarto-sidebar" aria-controls="quarto-sidebar" aria-expanded="false" aria-label="Toggle sidebar navigation" onclick="if (window.quartoToggleHeadroom) { window.quartoToggleHeadroom(); }">
<div class="container-fluid d-flex justify-content-between"> <div class="container-fluid d-flex justify-content-between">
<h1 class="quarto-secondary-nav-title"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></h1> <h1 class="quarto-secondary-nav-title"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></h1>
<button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation"> <button type="button" class="quarto-btn-toggle btn" aria-label="Show secondary navigation">
<i class="bi bi-chevron-right"></i> <i class="bi bi-chevron-right"></i>
</button> </button>
@@ -188,22 +188,27 @@ div.csl-indent {
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./tutorial.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a> <a href="./formats.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">File formats usable with <em>OBITools</em></span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./commands.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a> <a href="./tutorial.html" class="sidebar-item-text sidebar-link active"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./library.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a> <a href="./commands.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
<div class="sidebar-item-container"> <div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">Annexes</span></a> <a href="./library.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">5</span>&nbsp; <span class="chapter-title">The GO <em>OBITools</em> library</span></a>
</div>
</li>
<li class="sidebar-item">
<div class="sidebar-item-container">
<a href="./annexes.html" class="sidebar-item-text sidebar-link"><span class="chapter-number">6</span>&nbsp; <span class="chapter-title">Annexes</span></a>
</div> </div>
</li> </li>
<li class="sidebar-item"> <li class="sidebar-item">
@@ -220,18 +225,18 @@ div.csl-indent {
<h2 id="toc-title">Table of contents</h2> <h2 id="toc-title">Table of contents</h2>
<ul> <ul>
<li><a href="#wolves-diet-based-on-dna-metabarcoding" id="toc-wolves-diet-based-on-dna-metabarcoding" class="nav-link active" data-scroll-target="#wolves-diet-based-on-dna-metabarcoding"><span class="toc-section-number">2.1</span> Wolves diet based on DNA metabarcoding</a></li> <li><a href="#wolves-diet-based-on-dna-metabarcoding" id="toc-wolves-diet-based-on-dna-metabarcoding" class="nav-link active" data-scroll-target="#wolves-diet-based-on-dna-metabarcoding"><span class="toc-section-number">3.1</span> Wolves diet based on DNA metabarcoding</a></li>
<li><a href="#step-by-step-analysis" id="toc-step-by-step-analysis" class="nav-link" data-scroll-target="#step-by-step-analysis"><span class="toc-section-number">2.2</span> Step by step analysis</a> <li><a href="#step-by-step-analysis" id="toc-step-by-step-analysis" class="nav-link" data-scroll-target="#step-by-step-analysis"><span class="toc-section-number">3.2</span> Step by step analysis</a>
<ul class="collapse"> <ul class="collapse">
<li><a href="#recover-full-sequence-reads-from-forward-and-reverse-partial-reads" id="toc-recover-full-sequence-reads-from-forward-and-reverse-partial-reads" class="nav-link" data-scroll-target="#recover-full-sequence-reads-from-forward-and-reverse-partial-reads"><span class="toc-section-number">2.2.1</span> Recover full sequence reads from forward and reverse partial reads</a></li> <li><a href="#recover-full-sequence-reads-from-forward-and-reverse-partial-reads" id="toc-recover-full-sequence-reads-from-forward-and-reverse-partial-reads" class="nav-link" data-scroll-target="#recover-full-sequence-reads-from-forward-and-reverse-partial-reads"><span class="toc-section-number">3.2.1</span> Recover full sequence reads from forward and reverse partial reads</a></li>
<li><a href="#remove-unaligned-sequence-records" id="toc-remove-unaligned-sequence-records" class="nav-link" data-scroll-target="#remove-unaligned-sequence-records"><span class="toc-section-number">2.2.2</span> Remove unaligned sequence records</a></li> <li><a href="#remove-unaligned-sequence-records" id="toc-remove-unaligned-sequence-records" class="nav-link" data-scroll-target="#remove-unaligned-sequence-records"><span class="toc-section-number">3.2.2</span> Remove unaligned sequence records</a></li>
<li><a href="#assign-each-sequence-record-to-the-corresponding-samplemarker-combination" id="toc-assign-each-sequence-record-to-the-corresponding-samplemarker-combination" class="nav-link" data-scroll-target="#assign-each-sequence-record-to-the-corresponding-samplemarker-combination"><span class="toc-section-number">2.2.3</span> Assign each sequence record to the corresponding sample/marker combination</a></li> <li><a href="#assign-each-sequence-record-to-the-corresponding-samplemarker-combination" id="toc-assign-each-sequence-record-to-the-corresponding-samplemarker-combination" class="nav-link" data-scroll-target="#assign-each-sequence-record-to-the-corresponding-samplemarker-combination"><span class="toc-section-number">3.2.3</span> Assign each sequence record to the corresponding sample/marker combination</a></li>
<li><a href="#dereplicate-reads-into-uniq-sequences" id="toc-dereplicate-reads-into-uniq-sequences" class="nav-link" data-scroll-target="#dereplicate-reads-into-uniq-sequences"><span class="toc-section-number">2.2.4</span> Dereplicate reads into uniq sequences</a></li> <li><a href="#dereplicate-reads-into-uniq-sequences" id="toc-dereplicate-reads-into-uniq-sequences" class="nav-link" data-scroll-target="#dereplicate-reads-into-uniq-sequences"><span class="toc-section-number">3.2.4</span> Dereplicate reads into uniq sequences</a></li>
<li><a href="#denoise-the-sequence-dataset" id="toc-denoise-the-sequence-dataset" class="nav-link" data-scroll-target="#denoise-the-sequence-dataset"><span class="toc-section-number">2.2.5</span> Denoise the sequence dataset</a></li> <li><a href="#denoise-the-sequence-dataset" id="toc-denoise-the-sequence-dataset" class="nav-link" data-scroll-target="#denoise-the-sequence-dataset"><span class="toc-section-number">3.2.5</span> Denoise the sequence dataset</a></li>
<li><a href="#taxonomic-assignment-of-sequences" id="toc-taxonomic-assignment-of-sequences" class="nav-link" data-scroll-target="#taxonomic-assignment-of-sequences"><span class="toc-section-number">2.2.6</span> Taxonomic assignment of sequences</a></li> <li><a href="#taxonomic-assignment-of-sequences" id="toc-taxonomic-assignment-of-sequences" class="nav-link" data-scroll-target="#taxonomic-assignment-of-sequences"><span class="toc-section-number">3.2.6</span> Taxonomic assignment of sequences</a></li>
<li><a href="#assign-each-sequence-to-a-taxon" id="toc-assign-each-sequence-to-a-taxon" class="nav-link" data-scroll-target="#assign-each-sequence-to-a-taxon"><span class="toc-section-number">2.2.7</span> Assign each sequence to a taxon</a></li> <li><a href="#assign-each-sequence-to-a-taxon" id="toc-assign-each-sequence-to-a-taxon" class="nav-link" data-scroll-target="#assign-each-sequence-to-a-taxon"><span class="toc-section-number">3.2.7</span> Assign each sequence to a taxon</a></li>
<li><a href="#generate-the-final-result-table" id="toc-generate-the-final-result-table" class="nav-link" data-scroll-target="#generate-the-final-result-table"><span class="toc-section-number">2.2.8</span> Generate the final result table</a></li> <li><a href="#generate-the-final-result-table" id="toc-generate-the-final-result-table" class="nav-link" data-scroll-target="#generate-the-final-result-table"><span class="toc-section-number">3.2.8</span> Generate the final result table</a></li>
<li><a href="#looking-at-the-data-in-r" id="toc-looking-at-the-data-in-r" class="nav-link" data-scroll-target="#looking-at-the-data-in-r"><span class="toc-section-number">2.2.9</span> Looking at the data in R</a></li> <li><a href="#looking-at-the-data-in-r" id="toc-looking-at-the-data-in-r" class="nav-link" data-scroll-target="#looking-at-the-data-in-r"><span class="toc-section-number">3.2.9</span> Looking at the data in R</a></li>
</ul></li> </ul></li>
</ul> </ul>
</nav> </nav>
@@ -241,7 +246,7 @@ div.csl-indent {
<header id="title-block-header" class="quarto-title-block default"> <header id="title-block-header" class="quarto-title-block default">
<div class="quarto-title"> <div class="quarto-title">
<h1 class="title d-none d-lg-block"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></h1> <h1 class="title d-none d-lg-block"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">OBITools V4 Tutorial</span></h1>
</div> </div>
@@ -261,8 +266,8 @@ div.csl-indent {
<li>the OBITools</li> <li>the OBITools</li>
<li>some basic Unix commands</li> <li>some basic Unix commands</li>
</ul> </ul>
<section id="wolves-diet-based-on-dna-metabarcoding" class="level2" data-number="2.1"> <section id="wolves-diet-based-on-dna-metabarcoding" class="level2" data-number="3.1">
<h2 data-number="2.1" class="anchored" data-anchor-id="wolves-diet-based-on-dna-metabarcoding"><span class="header-section-number">2.1</span> Wolves diet based on DNA metabarcoding</h2> <h2 data-number="3.1" class="anchored" data-anchor-id="wolves-diet-based-on-dna-metabarcoding"><span class="header-section-number">3.1</span> Wolves diet based on DNA metabarcoding</h2>
<p>The data used in this tutorial correspond to the analysis of four wolf scats, using the protocol published in <span class="citation" data-cites="Shehzad2012-pn">Shehzad et al. (<a href="references.html#ref-Shehzad2012-pn" role="doc-biblioref">2012</a>)</span> for assessing carnivore diet. After extracting DNA from the faeces, the DNA amplifications were carried out using the primers <code>TTAGATACCCCACTATGC</code> and <code>TAGAACAGGCTCCTCTAG</code> amplifiying the <em>12S-V5</em> region <span class="citation" data-cites="Riaz2011-gn">(<a href="references.html#ref-Riaz2011-gn" role="doc-biblioref">Riaz et al. 2011</a>)</span>, together with a wolf blocking oligonucleotide.</p> <p>The data used in this tutorial correspond to the analysis of four wolf scats, using the protocol published in <span class="citation" data-cites="Shehzad2012-pn">Shehzad et al. (<a href="references.html#ref-Shehzad2012-pn" role="doc-biblioref">2012</a>)</span> for assessing carnivore diet. After extracting DNA from the faeces, the DNA amplifications were carried out using the primers <code>TTAGATACCCCACTATGC</code> and <code>TAGAACAGGCTCCTCTAG</code> amplifiying the <em>12S-V5</em> region <span class="citation" data-cites="Riaz2011-gn">(<a href="references.html#ref-Riaz2011-gn" role="doc-biblioref">Riaz et al. 2011</a>)</span>, together with a wolf blocking oligonucleotide.</p>
<p>The complete data set can be downloaded here: <a href="wolf_diet.tgz">the tutorial dataset</a></p> <p>The complete data set can be downloaded here: <a href="wolf_diet.tgz">the tutorial dataset</a></p>
<p>Once the data file is downloaded, using a UNIX terminal unarchive the data from the <code>tgz</code> file.</p> <p>Once the data file is downloaded, using a UNIX terminal unarchive the data from the <code>tgz</code> file.</p>
@@ -293,10 +298,10 @@ div.csl-indent {
<div class="sourceCode cell-code" id="cb2"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb2-1"><a href="#cb2-1" aria-hidden="true" tabindex="-1"></a><span class="fu">mkdir</span> results</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div> <div class="sourceCode cell-code" id="cb2"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb2-1"><a href="#cb2-1" aria-hidden="true" tabindex="-1"></a><span class="fu">mkdir</span> results</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
</div> </div>
</section> </section>
<section id="step-by-step-analysis" class="level2" data-number="2.2"> <section id="step-by-step-analysis" class="level2" data-number="3.2">
<h2 data-number="2.2" class="anchored" data-anchor-id="step-by-step-analysis"><span class="header-section-number">2.2</span> Step by step analysis</h2> <h2 data-number="3.2" class="anchored" data-anchor-id="step-by-step-analysis"><span class="header-section-number">3.2</span> Step by step analysis</h2>
<section id="recover-full-sequence-reads-from-forward-and-reverse-partial-reads" class="level3" data-number="2.2.1"> <section id="recover-full-sequence-reads-from-forward-and-reverse-partial-reads" class="level3" data-number="3.2.1">
<h3 data-number="2.2.1" class="anchored" data-anchor-id="recover-full-sequence-reads-from-forward-and-reverse-partial-reads"><span class="header-section-number">2.2.1</span> Recover full sequence reads from forward and reverse partial reads</h3> <h3 data-number="3.2.1" class="anchored" data-anchor-id="recover-full-sequence-reads-from-forward-and-reverse-partial-reads"><span class="header-section-number">3.2.1</span> Recover full sequence reads from forward and reverse partial reads</h3>
<p>When using the result of a paired-end sequencing assay with supposedly overlapping forward and reverse reads, the first step is to recover the assembled sequence.</p> <p>When using the result of a paired-end sequencing assay with supposedly overlapping forward and reverse reads, the first step is to recover the assembled sequence.</p>
<p>The forward and reverse reads of the same fragment are <em>at the same line position</em> in the two fastq files obtained after sequencing. Based on these two files, the assembly of the forward and reverse reads is done with the <code>obipairing</code> utility that aligns the two reads and returns the reconstructed sequence.</p> <p>The forward and reverse reads of the same fragment are <em>at the same line position</em> in the two fastq files obtained after sequencing. Based on these two files, the assembly of the forward and reverse reads is done with the <code>obipairing</code> utility that aligns the two reads and returns the reconstructed sequence.</p>
<p>In our case, the command is:</p> <p>In our case, the command is:</p>
@@ -309,8 +314,8 @@ div.csl-indent {
</div> </div>
<p>The <code>--min-identity</code> and <code>--min-overlap</code> options allow discarding sequences with low alignment quality. If after the aligment, the overlaping parts of the reads is shorter than 10 base pairs or the similarity over this aligned region is below 80% of identity, in the output file, the forward and reverse reads are not aligned but concatenated, and the value of the <code>mode</code> attribute in the sequence header is set to <code>joined</code> instead of <code>alignment</code>.</p> <p>The <code>--min-identity</code> and <code>--min-overlap</code> options allow discarding sequences with low alignment quality. If after the aligment, the overlaping parts of the reads is shorter than 10 base pairs or the similarity over this aligned region is below 80% of identity, in the output file, the forward and reverse reads are not aligned but concatenated, and the value of the <code>mode</code> attribute in the sequence header is set to <code>joined</code> instead of <code>alignment</code>.</p>
</section> </section>
<section id="remove-unaligned-sequence-records" class="level3" data-number="2.2.2"> <section id="remove-unaligned-sequence-records" class="level3" data-number="3.2.2">
<h3 data-number="2.2.2" class="anchored" data-anchor-id="remove-unaligned-sequence-records"><span class="header-section-number">2.2.2</span> Remove unaligned sequence records</h3> <h3 data-number="3.2.2" class="anchored" data-anchor-id="remove-unaligned-sequence-records"><span class="header-section-number">3.2.2</span> Remove unaligned sequence records</h3>
<p>Unaligned sequences (:py<code class="interpreted-text" role="mod">mode=joined</code>) cannot be used. The following command allows removing them from the dataset:</p> <p>Unaligned sequences (:py<code class="interpreted-text" role="mod">mode=joined</code>) cannot be used. The following command allows removing them from the dataset:</p>
<div class="cell"> <div class="cell">
<div class="sourceCode cell-code" id="cb4"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb4-1"><a href="#cb4-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obigrep</span> <span class="at">-p</span> <span class="st">'annotations.mode != "join"'</span> <span class="dt">\</span></span> <div class="sourceCode cell-code" id="cb4"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb4-1"><a href="#cb4-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obigrep</span> <span class="at">-p</span> <span class="st">'annotations.mode != "join"'</span> <span class="dt">\</span></span>
@@ -327,8 +332,8 @@ ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactac
+ +
CCCCCCCBCCCCCCCCCCCCCCCCCCCCCCBCCCCCBCCCCCCC&lt;CcCccbe[`F`accXV&lt;TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCCCCCCACCCCCACCCCCCCCCCCCCCCC</code></pre> CCCCCCCBCCCCCCCCCCCCCCCCCCCCCCBCCCCCBCCCCCCC&lt;CcCccbe[`F`accXV&lt;TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCCCCCCACCCCCACCCCCCCCCCCCCCCC</code></pre>
</section> </section>
<section id="assign-each-sequence-record-to-the-corresponding-samplemarker-combination" class="level3" data-number="2.2.3"> <section id="assign-each-sequence-record-to-the-corresponding-samplemarker-combination" class="level3" data-number="3.2.3">
<h3 data-number="2.2.3" class="anchored" data-anchor-id="assign-each-sequence-record-to-the-corresponding-samplemarker-combination"><span class="header-section-number">2.2.3</span> Assign each sequence record to the corresponding sample/marker combination</h3> <h3 data-number="3.2.3" class="anchored" data-anchor-id="assign-each-sequence-record-to-the-corresponding-samplemarker-combination"><span class="header-section-number">3.2.3</span> Assign each sequence record to the corresponding sample/marker combination</h3>
<p>Each sequence record is assigned to its corresponding sample and marker using the data provided in a text file (here <code>wolf_diet_ngsfilter.txt</code>). This text file contains one line per sample, with the name of the experiment (several experiments can be included in the same file), the name of the tags (for example: <code>aattaac</code> if the same tag has been used on each extremity of the PCR products, or <code>aattaac:gaagtag</code> if the tags were different), the sequence of the forward primer, the sequence of the reverse primer, the letter <code>T</code> or <code>F</code> for sample identification using the forward primer and tag only or using both primers and both tags, respectively (see <code>obimultiplex</code> for details).</p> <p>Each sequence record is assigned to its corresponding sample and marker using the data provided in a text file (here <code>wolf_diet_ngsfilter.txt</code>). This text file contains one line per sample, with the name of the experiment (several experiments can be included in the same file), the name of the tags (for example: <code>aattaac</code> if the same tag has been used on each extremity of the PCR products, or <code>aattaac:gaagtag</code> if the tags were different), the sequence of the forward primer, the sequence of the reverse primer, the letter <code>T</code> or <code>F</code> for sample identification using the forward primer and tag only or using both primers and both tags, respectively (see <code>obimultiplex</code> for details).</p>
<div class="cell"> <div class="cell">
<div class="sourceCode cell-code" id="cb7"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb7-1"><a href="#cb7-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obimultiplex</span> <span class="at">-t</span> wolf_data/wolf_diet_ngsfilter.txt <span class="dt">\</span></span> <div class="sourceCode cell-code" id="cb7"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb7-1"><a href="#cb7-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obimultiplex</span> <span class="at">-t</span> wolf_data/wolf_diet_ngsfilter.txt <span class="dt">\</span></span>
@@ -348,8 +353,8 @@ ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggact
+ +
CCCBCCCCCBCCCCCCC&lt;CcCccbe[`F`accXV&lt;TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCC</code></pre> CCCBCCCCCBCCCCCCC&lt;CcCccbe[`F`accXV&lt;TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCC</code></pre>
</section> </section>
<section id="dereplicate-reads-into-uniq-sequences" class="level3" data-number="2.2.4"> <section id="dereplicate-reads-into-uniq-sequences" class="level3" data-number="3.2.4">
<h3 data-number="2.2.4" class="anchored" data-anchor-id="dereplicate-reads-into-uniq-sequences"><span class="header-section-number">2.2.4</span> Dereplicate reads into uniq sequences</h3> <h3 data-number="3.2.4" class="anchored" data-anchor-id="dereplicate-reads-into-uniq-sequences"><span class="header-section-number">3.2.4</span> Dereplicate reads into uniq sequences</h3>
<p>The same DNA molecule can be sequenced several times. In order to reduce both file size and computations time, and to get easier interpretable results, it is convenient to work with unique <em>sequences</em> instead of <em>reads</em>. To <em>dereplicate</em> such <em>reads</em> into unique <em>sequences</em>, we use the <code>obiuniq</code> command.</p> <p>The same DNA molecule can be sequenced several times. In order to reduce both file size and computations time, and to get easier interpretable results, it is convenient to work with unique <em>sequences</em> instead of <em>reads</em>. To <em>dereplicate</em> such <em>reads</em> into unique <em>sequences</em>, we use the <code>obiuniq</code> command.</p>
<table class="table"> <table class="table">
<colgroup> <colgroup>
@@ -408,8 +413,8 @@ gcctgaaactcaaaggacttggcggtgctttacatccct
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggactcggcggtgctttataccctt</code></pre> agcttaaaactcaaaggactcggcggtgctttataccctt</code></pre>
</section> </section>
<section id="denoise-the-sequence-dataset" class="level3" data-number="2.2.5"> <section id="denoise-the-sequence-dataset" class="level3" data-number="3.2.5">
<h3 data-number="2.2.5" class="anchored" data-anchor-id="denoise-the-sequence-dataset"><span class="header-section-number">2.2.5</span> Denoise the sequence dataset</h3> <h3 data-number="3.2.5" class="anchored" data-anchor-id="denoise-the-sequence-dataset"><span class="header-section-number">3.2.5</span> Denoise the sequence dataset</h3>
<p>To have a set of sequences assigned to their corresponding samples does not mean that all sequences are <em>biologically</em> meaningful i.e.&nbsp;some of these sequences can contains PCR and/or sequencing errors, or chimeras.</p> <p>To have a set of sequences assigned to their corresponding samples does not mean that all sequences are <em>biologically</em> meaningful i.e.&nbsp;some of these sequences can contains PCR and/or sequencing errors, or chimeras.</p>
<section id="tag-the-sequences-for-pcr-errors-sequence-variants" class="level4 unnumbered"> <section id="tag-the-sequences-for-pcr-errors-sequence-variants" class="level4 unnumbered">
<h4 class="unnumbered anchored" data-anchor-id="tag-the-sequences-for-pcr-errors-sequence-variants">Tag the sequences for PCR errors (sequence variants)</h4> <h4 class="unnumbered anchored" data-anchor-id="tag-the-sequences-for-pcr-errors-sequence-variants">Tag the sequences for PCR errors (sequence variants)</h4>
@@ -431,7 +436,7 @@ agcccaaaactcaaaggacttggcggtgcttcacaccctt</code></pre>
<div class="cell"> <div class="cell">
<div class="sourceCode cell-code" id="cb15"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb15-1"><a href="#cb15-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obicount</span> results/wolf.ali.assigned.simple.clean.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div> <div class="sourceCode cell-code" id="cb15"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb15-1"><a href="#cb15-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obicount</span> results/wolf.ali.assigned.simple.clean.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
<div class="cell-output cell-output-stdout"> <div class="cell-output cell-output-stdout">
<pre><code>time="2023-02-02T23:07:30+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.fasta file\n" <pre><code>time="2023-02-03T11:50:36+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.fasta file\n"
2749 36409 273387</code></pre> 2749 36409 273387</code></pre>
</div> </div>
</div> </div>
@@ -440,10 +445,10 @@ agcccaaaactcaaaggacttggcggtgcttcacaccctt</code></pre>
<div class="sourceCode cell-code" id="cb17"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb17-1"><a href="#cb17-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obigrep</span> <span class="at">-p</span> <span class="st">'sequence.Count() == 1'</span> results/wolf.ali.assigned.simple.clean.fasta <span class="dt">\</span></span> <div class="sourceCode cell-code" id="cb17"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb17-1"><a href="#cb17-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obigrep</span> <span class="at">-p</span> <span class="st">'sequence.Count() == 1'</span> results/wolf.ali.assigned.simple.clean.fasta <span class="dt">\</span></span>
<span id="cb17-2"><a href="#cb17-2" aria-hidden="true" tabindex="-1"></a> <span class="kw">|</span> <span class="ex">obicount</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div> <span id="cb17-2"><a href="#cb17-2" aria-hidden="true" tabindex="-1"></a> <span class="kw">|</span> <span class="ex">obicount</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
<div class="cell-output cell-output-stdout"> <div class="cell-output cell-output-stdout">
<pre><code>time="2023-02-02T23:07:30+01:00" level=info msg="Reading sequences from stdin in guessed\n" <pre><code>time="2023-02-03T11:50:36+01:00" level=info msg="Reading sequences from stdin in guessed\n"
time="2023-02-02T23:07:30+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.fasta file\n" time="2023-02-03T11:50:36+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.fasta file\n"
time="2023-02-02T23:07:30+01:00" level=info msg="On output use JSON headers" time="2023-02-03T11:50:36+01:00" level=info msg="On output use JSON headers"
2309 2309 229912</code></pre> 2229 2229 221982</code></pre>
</div> </div>
</div> </div>
<p>In that dataset sigletons corresponds to <span class="math inline">\(3511\)</span> variants.</p> <p>In that dataset sigletons corresponds to <span class="math inline">\(3511\)</span> variants.</p>
@@ -491,14 +496,14 @@ agcttaaaactcaaaggacttggcggtgctttataccctt</code></pre>
<div class="cell"> <div class="cell">
<div class="sourceCode cell-code" id="cb23"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb23-1"><a href="#cb23-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obicount</span> results/wolf.ali.assigned.simple.clean.c10.l80.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div> <div class="sourceCode cell-code" id="cb23"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb23-1"><a href="#cb23-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obicount</span> results/wolf.ali.assigned.simple.clean.c10.l80.fasta</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
<div class="cell-output cell-output-stdout"> <div class="cell-output cell-output-stdout">
<pre><code>time="2023-02-02T23:07:31+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.c10.l80.fasta file\n" <pre><code>time="2023-02-03T11:50:38+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.c10.l80.fasta file\n"
26 31337 2585</code></pre> 26 31337 2585</code></pre>
</div> </div>
</div> </div>
</section> </section>
</section> </section>
<section id="taxonomic-assignment-of-sequences" class="level3" data-number="2.2.6"> <section id="taxonomic-assignment-of-sequences" class="level3" data-number="3.2.6">
<h3 data-number="2.2.6" class="anchored" data-anchor-id="taxonomic-assignment-of-sequences"><span class="header-section-number">2.2.6</span> Taxonomic assignment of sequences</h3> <h3 data-number="3.2.6" class="anchored" data-anchor-id="taxonomic-assignment-of-sequences"><span class="header-section-number">3.2.6</span> Taxonomic assignment of sequences</h3>
<p>Once denoising has been done, the next step in diet analysis is to assign the barcodes to the corresponding species in order to get the complete list of species associated to each sample.</p> <p>Once denoising has been done, the next step in diet analysis is to assign the barcodes to the corresponding species in order to get the complete list of species associated to each sample.</p>
<p>Taxonomic assignment of sequences requires a reference database compiling all possible species to be identified in the sample. Assignment is then done based on sequence comparison between sample sequences and reference sequences.</p> <p>Taxonomic assignment of sequences requires a reference database compiling all possible species to be identified in the sample. Assignment is then done based on sequence comparison between sample sequences and reference sequences.</p>
<section id="download-the-taxonomy" class="level4 unnumbered"> <section id="download-the-taxonomy" class="level4 unnumbered">
@@ -582,8 +587,8 @@ agcttaaaactcaaaggacttggcggtgctttataccctt</code></pre>
</section> </section>
</section> </section>
</section> </section>
<section id="assign-each-sequence-to-a-taxon" class="level3" data-number="2.2.7"> <section id="assign-each-sequence-to-a-taxon" class="level3" data-number="3.2.7">
<h3 data-number="2.2.7" class="anchored" data-anchor-id="assign-each-sequence-to-a-taxon"><span class="header-section-number">2.2.7</span> Assign each sequence to a taxon</h3> <h3 data-number="3.2.7" class="anchored" data-anchor-id="assign-each-sequence-to-a-taxon"><span class="header-section-number">3.2.7</span> Assign each sequence to a taxon</h3>
<p>Once the reference database is built, taxonomic assignment can be carried out using the <code>obitag</code> command.</p> <p>Once the reference database is built, taxonomic assignment can be carried out using the <code>obitag</code> command.</p>
<div class="cell"> <div class="cell">
<div class="sourceCode cell-code" id="cb30"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb30-1"><a href="#cb30-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obitag</span> <span class="at">-t</span> TAXO <span class="at">-R</span> wolf_data/db_v05_r117.indexed.fasta <span class="dt">\</span></span> <div class="sourceCode cell-code" id="cb30"><pre class="sourceCode bash code-with-copy"><code class="sourceCode bash"><span id="cb30-1"><a href="#cb30-1" aria-hidden="true" tabindex="-1"></a><span class="ex">obitag</span> <span class="at">-t</span> TAXO <span class="at">-R</span> wolf_data/db_v05_r117.indexed.fasta <span class="dt">\</span></span>
@@ -602,8 +607,8 @@ agcttaaaactcaaaggacttggcggtgctttataccctt</code></pre>
<span id="cb31-2"><a href="#cb31-2" aria-hidden="true" tabindex="-1"></a><span class="ex">ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata</span></span> <span id="cb31-2"><a href="#cb31-2" aria-hidden="true" tabindex="-1"></a><span class="ex">ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata</span></span>
<span id="cb31-3"><a href="#cb31-3" aria-hidden="true" tabindex="-1"></a><span class="ex">gcttaaaactcaaaggacttggcggtgctttatatccct</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div> <span id="cb31-3"><a href="#cb31-3" aria-hidden="true" tabindex="-1"></a><span class="ex">gcttaaaactcaaaggacttggcggtgctttatatccct</span></span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
</section> </section>
<section id="generate-the-final-result-table" class="level3" data-number="2.2.8"> <section id="generate-the-final-result-table" class="level3" data-number="3.2.8">
<h3 data-number="2.2.8" class="anchored" data-anchor-id="generate-the-final-result-table"><span class="header-section-number">2.2.8</span> Generate the final result table</h3> <h3 data-number="3.2.8" class="anchored" data-anchor-id="generate-the-final-result-table"><span class="header-section-number">3.2.8</span> Generate the final result table</h3>
<p>Some unuseful attributes can be removed at this stage.</p> <p>Some unuseful attributes can be removed at this stage.</p>
<ul> <ul>
<li>obiclean_head</li> <li>obiclean_head</li>
@@ -626,8 +631,8 @@ agcttaaaactcaaaggacttggcggtgctttataccctt</code></pre>
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
gattaaacctcaaaggacttggcagtgctttatacccct</code></pre> gattaaacctcaaaggacttggcagtgctttatacccct</code></pre>
</section> </section>
<section id="looking-at-the-data-in-r" class="level3" data-number="2.2.9"> <section id="looking-at-the-data-in-r" class="level3" data-number="3.2.9">
<h3 data-number="2.2.9" class="anchored" data-anchor-id="looking-at-the-data-in-r"><span class="header-section-number">2.2.9</span> Looking at the data in R</h3> <h3 data-number="3.2.9" class="anchored" data-anchor-id="looking-at-the-data-in-r"><span class="header-section-number">3.2.9</span> Looking at the data in R</h3>
<div class="cell"> <div class="cell">
<div class="sourceCode cell-code" id="cb34"><pre class="sourceCode r code-with-copy"><code class="sourceCode r"><span id="cb34-1"><a href="#cb34-1" aria-hidden="true" tabindex="-1"></a><span class="fu">library</span>(ROBIFastread)</span> <div class="sourceCode cell-code" id="cb34"><pre class="sourceCode r code-with-copy"><code class="sourceCode r"><span id="cb34-1"><a href="#cb34-1" aria-hidden="true" tabindex="-1"></a><span class="fu">library</span>(ROBIFastread)</span>
<span id="cb34-2"><a href="#cb34-2" aria-hidden="true" tabindex="-1"></a><span class="fu">library</span>(vegan)</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div> <span id="cb34-2"><a href="#cb34-2" aria-hidden="true" tabindex="-1"></a><span class="fu">library</span>(vegan)</span></code><button title="Copy to Clipboard" class="code-copy-button"><i class="bi"></i></button></pre></div>
@@ -652,19 +657,19 @@ gattaaacctcaaaggacttggcagtgctttatacccct</code></pre>
<pre><code>4 x 26 sparse Matrix of class "dgCMatrix"</code></pre> <pre><code>4 x 26 sparse Matrix of class "dgCMatrix"</code></pre>
</div> </div>
<div class="cell-output cell-output-stderr"> <div class="cell-output cell-output-stderr">
<pre><code> [[ suppressing 26 column names 'HELIUM_000100422_612GNAAXX:7:30:17945:19531#0/1_sub[28..126]', 'HELIUM_000100422_612GNAAXX:7:94:16908:11285#0/1_sub[28..127]', 'HELIUM_000100422_612GNAAXX:7:100:4828:3492#0/1_sub[28..127]' ... ]]</code></pre> <pre><code> [[ suppressing 26 column names 'HELIUM_000100422_612GNAAXX:7:5:15939:5437#0/1_sub[28..126]', 'HELIUM_000100422_612GNAAXX:7:100:4828:3492#0/1_sub[28..127]', 'HELIUM_000100422_612GNAAXX:7:113:17236:15166#0/1_sub[28..126]' ... ]]</code></pre>
</div> </div>
<div class="cell-output cell-output-stdout"> <div class="cell-output cell-output-stdout">
<pre><code> <pre><code>
26a_F040644 43 . . . . 88 . 52 208 15 31 . . 14 481 72 17 . . 26a_F040644 12787 . 72 . . . 31 . 208 18 14 88 15 14 . 52 481 . .
13a_F730603 . 8409 22 1 . . . . . . . 20 . . 19 . . 15 . 13a_F730603 . 22 . . . . . 9 . . . . . . . . 19 . .
29a_F260619 . . . 13 353 . 391 . . . . . 6275 . 1 . . . 44 29a_F260619 . . . 353 25 16 . . . . . . . 110 391 . 1 6246 44
15a_F730814 . . . . . . . . . . . . 9165 . 5 . . . . 15a_F730814 . . . . . . . 4 . . . . . . . . 5 9165 .
26a_F040644 12830 14 . . 18 . . 26a_F040644 . . 17 . . . 43
13a_F730603 . . . 9 . . 25 13a_F730603 1 25 . 15 20 8409 .
29a_F260619 . 110 16 . . 25 . 29a_F260619 13 . . . . . .
15a_F730814 . . . 4 . . .</code></pre> 15a_F730814 . . . . . . .</code></pre>
</div> </div>
</div> </div>
<dl> <dl>
@@ -831,13 +836,13 @@ window.document.addEventListener("DOMContentLoaded", function (event) {
</script> </script>
<nav class="page-navigation"> <nav class="page-navigation">
<div class="nav-page nav-page-previous"> <div class="nav-page nav-page-previous">
<a href="./intro.html" class="pagination-link"> <a href="./formats.html" class="pagination-link">
<i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">1</span>&nbsp; <span class="chapter-title">The OBITools</span></span> <i class="bi bi-arrow-left-short"></i> <span class="nav-page-text"><span class="chapter-number">2</span>&nbsp; <span class="chapter-title">File formats usable with <em>OBITools</em></span></span>
</a> </a>
</div> </div>
<div class="nav-page nav-page-next"> <div class="nav-page nav-page-next">
<a href="./commands.html" class="pagination-link"> <a href="./commands.html" class="pagination-link">
<span class="nav-page-text"><span class="chapter-number">3</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></span> <i class="bi bi-arrow-right-short"></i> <span class="nav-page-text"><span class="chapter-number">4</span>&nbsp; <span class="chapter-title">The <em>OBITools V4</em> commands</span></span> <i class="bi bi-arrow-right-short"></i>
</a> </a>
</div> </div>
</nav> </nav>
+3
View File
@@ -10,6 +10,7 @@ book:
chapters: chapters:
- index.qmd - index.qmd
- intro.qmd - intro.qmd
- formats.qmd
- tutorial.qmd - tutorial.qmd
- commands.qmd - commands.qmd
- library.qmd - library.qmd
@@ -26,6 +27,8 @@ format:
theme: zephyr theme: zephyr
pdf: pdf:
documentclass: scrreprt documentclass: scrreprt
epub: default
+529
View File
@@ -178,3 +178,532 @@
doi = "10.1186/1471-2105-2-9", doi = "10.1186/1471-2105-2-9",
pmc = "PMC59723" pmc = "PMC59723"
} }
@ARTICLE{Taberlet2012-pf,
title = "{Environmental DNA}",
author = "Taberlet, Pierre and Coissac, Eric and Hajibabaei, Mehrdad and
Rieseberg, Loren H",
journal = "Molecular ecology",
volume = 21,
number = 8,
pages = "1789--1793",
month = apr,
year = 2012,
url = "http://dx.doi.org/10.1111/j.1365-294X.2012.05542.x",
language = "en",
issn = "0962-1083, 1365-294X",
pmid = "22486819",
doi = "10.1111/j.1365-294X.2012.05542.x"
}
@ARTICLE{Sogin2006-ab,
title = "{Microbial diversity in the deep sea and the underexplored "rare
biosphere"}",
author = "Sogin, Mitchell L and Morrison, Hilary G and Huber, Julie A and
Mark Welch, David and Huse, Susan M and Neal, Phillip R and
Arrieta, Jesus M and Herndl, Gerhard J",
abstract = "The evolution of marine microbes over billions of years predicts
that the composition of microbial communities should be much
greater than the published estimates of a few thousand distinct
kinds of microbes per liter of seawater. By adopting a massively
parallel tag sequencing strategy, we show that bacterial
communities of deep water masses of the North Atlantic and
diffuse flow hydrothermal vents are one to two orders of
magnitude more complex than previously reported for any microbial
environment. A relatively small number of different populations
dominate all samples, but thousands of low-abundance populations
account for most of the observed phylogenetic diversity. This
``rare biosphere'' is very ancient and may represent a nearly
inexhaustible source of genomic innovation. Members of the rare
biosphere are highly divergent from each other and, at different
times in earth's history, may have had a profound impact on
shaping planetary processes.",
journal = "Proceedings of the National Academy of Sciences of the United
States of America",
volume = 103,
number = 32,
pages = "12115--12120",
month = aug,
year = 2006,
url = "http://dx.doi.org/10.1073/pnas.0605127103",
issn = "0027-8424",
pmid = "16880384",
doi = "10.1073/pnas.0605127103",
pmc = "PMC1524930"
}
@ARTICLE{Sonstebo2010-vv,
title = "{Using next-generation sequencing for molecular reconstruction of
past Arctic vegetation and climate}",
author = "S{\o}nsteb{\o}, J H and Gielly, L and Brysting, A K and Elven, R
and Edwards, M and Haile, J and Willerslev, E and Coissac, E and
Rioux, D and Sannier, J and Taberlet, P and Brochmann, C",
abstract = "Palaeoenvironments and former climates are typically inferred
from pollen and macrofossil records. This approach is
time-consuming and suffers from low taxonomic resolution and
biased taxon sampling. Here, we test an alternative DNA-based
approach utilizing the P6 loop in the chloroplast trnL (UAA)
intron; a short (13-158 bp) and variable region with highly
conserved flanking sequences. For taxonomic reference, a whole
trnL intron sequence database was constructed from recently
collected material of 842 species, representing all widespread
and/or ecologically important taxa of the species-poor arctic
flora. The P6 loop alone allowed identification of all families,
most genera (>75\%) and one-third of the species, thus providing
much higher taxonomic resolution than pollen records. The
suitability of the P6 loop for analysis of samples containing
degraded ancient DNA from a mixture of species is demonstrated by
high-throughput parallel pyrosequencing of permafrost-preserved
DNA and reconstruction of two plant communities from the last
glacial period. Our approach opens new possibilities for
DNA-based assessment of ancient as well as modern biodiversity of
many groups of organisms using environmental samples.",
journal = "Molecular ecology resources",
volume = 10,
number = 6,
pages = "1009--1018",
month = nov,
year = 2010,
url = "http://dx.doi.org/10.1111/j.1755-0998.2010.02855.x",
language = "en",
issn = "1755-098X, 1755-0998",
pmid = "21565110",
doi = "10.1111/j.1755-0998.2010.02855.x"
}
@ARTICLE{Yoccoz2012-ix,
title = "{DNA from soil mirrors plant taxonomic and growth form diversity}",
author = "Yoccoz, N G and Br{\aa}then, K A and Gielly, L and Haile, J and
Edwards, M E and Goslar, T and Von Stedingk, H and Brysting, A K
and Coissac, E and Pompanon, F and S{\o}nsteb{\o}, J H and
Miquel, C and Valentini, A and De Bello, F and Chave, J and
Thuiller, W and Wincker, P and Cruaud, C and Gavory, F and
Rasmussen, M and Gilbert, M T P and Orlando, L and Brochmann, C
and Willerslev, E and Taberlet, P",
abstract = "Ecosystems across the globe are threatened by climate change and
human activities. New rapid survey approaches for monitoring
biodiversity would greatly advance assessment and understanding
of these threats. Taking advantage of next-generation DNA
sequencing, we tested an approach we call metabarcoding:
high-throughput and simultaneous taxa identification based on a
very short (usually <100 base pairs) but informative DNA
fragment. Short DNA fragments allow the use of degraded DNA from
environmental samples. All analyses included amplification using
plant-specific versatile primers, sequencing and estimation of
taxonomic diversity. We tested in three steps whether degraded
DNA from dead material in soil has the potential of efficiently
assessing biodiversity in different biomes. First, soil DNA from
eight boreal plant communities located in two different
vegetation types (meadow and heath) was amplified. Plant
diversity detected from boreal soil was highly consistent with
plant taxonomic and growth form diversity estimated from
conventional above-ground surveys. Second, we assessed DNA
persistence using samples from formerly cultivated soils in
temperate environments. We found that the number of crop DNA
sequences retrieved strongly varied with years since last
cultivation, and crop sequences were absent from nearby,
uncultivated plots. Third, we assessed the universal
applicability of DNA metabarcoding using soil samples from
tropical environments: a large proportion of species and families
from the study site were efficiently recovered. The results open
unprecedented opportunities for large-scale DNA-based
biodiversity studies across a range of taxonomic groups using
standardized metabarcoding approaches.",
journal = "Molecular ecology",
volume = 21,
number = 15,
pages = "3647--3655",
month = aug,
year = 2012,
url = "http://dx.doi.org/10.1111/j.1365-294X.2012.05545.x",
language = "en",
issn = "0962-1083, 1365-294X",
pmid = "22507540",
doi = "10.1111/j.1365-294X.2012.05545.x"
}
@ARTICLE{Parducci2012-rn,
title = "{Glacial survival of boreal trees in northern Scandinavia}",
author = "Parducci, Laura and J{\o}rgensen, Tina and Tollefsrud, Mari Mette
and Elverland, Ellen and Alm, Torbj{\o}rn and Fontana, Sonia L
and Bennett, K D and Haile, James and Matetovici, Irina and
Suyama, Yoshihisa and Edwards, Mary E and Andersen, Kenneth and
Rasmussen, Morten and Boessenkool, Sanne and Coissac, Eric and
Brochmann, Christian and Taberlet, Pierre and Houmark-Nielsen,
Michael and Larsen, Nicolaj Krog and Orlando, Ludovic and
Gilbert, M Thomas P and Kj{\ae}r, Kurt H and Alsos, Inger Greve
and Willerslev, Eske",
abstract = "It is commonly believed that trees were absent in Scandinavia
during the last glaciation and first recolonized the Scandinavian
Peninsula with the retreat of its ice sheet some 9000 years ago.
Here, we show the presence of a rare mitochondrial DNA haplotype
of spruce that appears unique to Scandinavia and with its highest
frequency to the west-an area believed to sustain ice-free
refugia during most of the last ice age. We further show the
survival of DNA from this haplotype in lake sediments and pollen
of Tr{\o}ndelag in central Norway dating back ~10,300 years and
chloroplast DNA of pine and spruce in lake sediments adjacent to
the ice-free And{\o}ya refugium in northwestern Norway as early
as ~22,000 and 17,700 years ago, respectively. Our findings imply
that conifer trees survived in ice-free refugia of Scandinavia
during the last glaciation, challenging current views on survival
and spread of trees as a response to climate changes.",
journal = "Science",
volume = 335,
number = 6072,
pages = "1083--1086",
month = mar,
year = 2012,
url = "http://dx.doi.org/10.1126/science.1216043",
language = "en",
issn = "0036-8075, 1095-9203",
pmid = "22383845",
doi = "10.1126/science.1216043"
}
@MISC{Chariton2010-cz,
title = "{Influence of the choice of physical and chemistry variables on
interpreting patterns of sediment contaminants and their
relationships with estuarine macrobenthic communities}",
author = "Chariton, Anthony A and Roach, Anthony C and Simpson, Stuart L and
Batley, Graeme E",
journal = "Marine and Freshwater Research",
volume = 61,
number = 10,
pages = "1109",
year = 2010,
url = "http://dx.doi.org/10.1071/mf09263",
doi = "10.1071/mf09263"
}
@ARTICLE{Baldwin2013-yc,
title = "{Impacts of inundation and drought on eukaryote biodiversity in
semi-arid floodplain soils}",
author = "Baldwin, Darren S and Colloff, Matthew J and Rees, Gavin N and
Chariton, Anthony A and Watson, Garth O and Court, Leon N and
Hartley, Diana M and Morgan, Matthew J and King, Andrew J and
Wilson, Jessica S and Hodda, Michael and Hardy, Christopher M",
abstract = "Floodplain ecosystems are characterized by alternating wet and
dry phases and periodic inundation defines their ecological
character. Climate change, river regulation and the construction
of levees have substantially altered natural flooding and drying
regimes worldwide with uncertain effects on key biotic groups.
In southern Australia, we hypothesized that soil eukaryotic
communities in climate change affected areas of a semi-arid
floodplain would transition towards comprising mainly dry-soil
specialist species with increasing drought severity. Here, we
used 18S rRNA amplicon pyrosequencing to measure the eukaryote
community composition in soils that had been depleted of water
to varying degrees to confirm that reproducible transitional
changes occur in eukaryotic biodiversity on this floodplain.
Interflood community structures (3 years post-flood) were
dominated by persistent rather than either aquatic or
dry-specialist organisms. Only 2\% of taxa were unique to dry
locations by 8 years post-flood, and 10\% were restricted to wet
locations (inundated a year to 2 weeks post-flood). Almost half
(48\%) of the total soil biota were detected in both these
environments. The discovery of a large suite of organisms able
to survive nearly a decade of drought, and up to a year
submerged supports the concept of inherent resilience of
Australian semi-arid floodplain soil communities under
increasing pressure from climatic induced changes in water
availability.",
journal = "Molecular ecology",
publisher = "Wiley Online Library",
volume = 22,
number = 6,
pages = "1746--1758",
month = mar,
year = 2013,
url = "http://dx.doi.org/10.1111/mec.12190",
issn = "0962-1083, 1365-294X",
pmid = "23379967",
doi = "10.1111/mec.12190"
}
@ARTICLE{Andersen2012-gj,
title = "{Meta-barcoding of {\"e}dirt{\'\i}DNA from soil reflects
vertebrate biodiversity}",
author = "Andersen, Kenneth and Bird, Karen Lise and Rasmussen, Morten and
Haile, James and Breuning-Madsen, Henrik and Kjaer, Kurt H and
Orlando, Ludovic and Gilbert, M Thomas P and Willerslev, Eske",
journal = "Molecular ecology",
publisher = "Wiley Online Library",
volume = 21,
number = 8,
pages = "1966--1979",
year = 2012,
issn = "0962-1083"
}
@ARTICLE{Thomsen2012-au,
title = "{Monitoring endangered freshwater biodiversity using environmental
DNA}",
author = "Thomsen, Philip Francis and Kielgast, Jos and Iversen, Lars L and
Wiuf, Carsten and Rasmussen, Morten and Gilbert, M Thomas P and
Orlando, Ludovic and Willerslev, Eske",
abstract = "Freshwater ecosystems are among the most endangered habitats on
Earth, with thousands of animal species known to be threatened or
already extinct. Reliable monitoring of threatened organisms is
crucial for data-driven conservation actions but remains a
challenge owing to nonstandardized methods that depend on
practical and taxonomic expertise, which is rapidly declining.
Here, we show that a diversity of rare and threatened freshwater
animals--representing amphibians, fish, mammals, insects and
crustaceans--can be detected and quantified based on DNA obtained
directly from small water samples of lakes, ponds and streams. We
successfully validate our findings in a controlled mesocosm
experiment and show that DNA becomes undetectable within 2 weeks
after removal of animals, indicating that DNA traces are near
contemporary with presence of the species. We further demonstrate
that entire faunas of amphibians and fish can be detected by
high-throughput sequencing of DNA extracted from pond water. Our
findings underpin the ubiquitous nature of DNA traces in the
environment and establish environmental DNA as a tool for
monitoring rare and threatened species across a wide range of
taxonomic groups.",
journal = "Molecular ecology",
volume = 21,
number = 11,
pages = "2565--2573",
month = jun,
year = 2012,
url = "http://dx.doi.org/10.1111/j.1365-294X.2011.05418.x",
issn = "0962-1083, 1365-294X",
pmid = "22151771",
doi = "10.1111/j.1365-294X.2011.05418.x"
}
@ARTICLE{Valentini2009-ay,
title = "{New perspectives in diet analysis based on DNA barcoding and
parallel pyrosequencing: the trnL approach}",
author = "Valentini, Alice and Miquel, Christian and Nawaz, Muhammad Ali
and Bellemain, Eva and Coissac, Eric and Pompanon, Fran{\c c}ois
and Gielly, Ludovic and Cruaud, Corinne and Nascetti, Giuseppe
and Wincker, Patrick and Swenson, Jon E and Taberlet, Pierre",
abstract = "The development of DNA barcoding (species identification using a
standardized DNA sequence), and the availability of recent DNA
sequencing techniques offer new possibilities in diet analysis.
DNA fragments shorter than 100-150 bp remain in a much higher
proportion in degraded DNA samples and can be recovered from
faeces. As a consequence, by using universal primers that
amplify a very short but informative DNA fragment, it is
possible to reliably identify the plant taxon that has been
eaten. According to our experience and using this identification
system, about 50\% of the taxa can be identified to species
using the trnL approach, that is, using the P6 loop of the
chloroplast trnL (UAA) intron. We demonstrated that this new
method is fast, simple to implement, and very robust. It can be
applied for diet analyses of a wide range of phytophagous
species at large scales. We also demonstrated that our approach
is efficient for mammals, birds, insects and molluscs. This
method opens new perspectives in ecology, not only by allowing
large-scale studies on diet, but also by enhancing studies on
resource partitioning among competing species, and describing
food webs in ecosystems.",
journal = "Molecular ecology resources",
publisher = "WILEY-BLACKWELL PUBLISHING, INC",
volume = 9,
number = 1,
pages = "51--60",
month = jan,
year = 2009,
url = "http://dx.doi.org/10.1111/j.1755-0998.2008.02352.x",
address = "COMMERCE PLACE, 350 MAIN ST, MALDEN 02148, MA USA",
keywords = "chloroplast DNA; diet analysis; DNA barcoding; faeces;
pyrosequencing; trnL (UAA) intron; universal primers",
language = "en",
issn = "1755-098X",
pmid = "21564566",
doi = "10.1111/j.1755-0998.2008.02352.x"
}
@ARTICLE{Kowalczyk2011-kg,
title = "{Influence of management practices on large herbivore diet---Case
of European bison in Bia{\l}owie{\.z}a Primeval Forest (Poland)}",
author = "Kowalczyk, Rafa{\l} and Taberlet, Pierre and Coissac, Eric and
Valentini, Alice and Miquel, Christian and Kami{\'n}ski, Tomasz
and W{\'o}jcik, Jan M",
abstract = "Large herbivores are keystone species in many forest areas, as
they shape the structure, species diversity and functioning of
those ecosystems. The European bison Bison bonasus has been
successfully restored after extinction in the wild at the
beginning of 20th century. As free-ranging populations of the
species were re-established mainly in forest habitats, knowledge
of the impact by the largest European terrestrial mammal on tree
stands is essential. This helps to make management and
conservation decisions for viable population maintenance of the
species in the wild. Using a novel DNA-based method of herbivore
diet analysis, the trnL approach (DNA-barcoding), we
investigated the influence of different foraging conditions
(access to supplementary fodder) on bison diet in winter and its
potential impact on woody species. Faecal samples were collected
from different bison treatment groups: (1) intensively fed; (2)
less intensively fed; (3) non-fed utilising forest habitats; and
(4) non-fed utilising agricultural areas surrounding the Forest.
These were analysed to estimate the proportion of different
plant groups consumed by bison. Bison groups differed
significantly in their diet. The amount of woody materials
(trees and shrubs) consumed by bison increased with decreasing
access to supplementary fodder, ranging from 16\% in intensively
fed bison to 65\% in non-fed bison utilising forest habitats.
Inversely, the amount of herbs, grasses and sedges decreased
from 82\% in intensively fed bison to 32\% in non fed bison
utilising forest habitats. The species of trees mainly browsed
by bison, Carpinus/Corylus, Betula sp. and Salix sp., were of
lower economic importance for forest management. The impact of
bison on tree species needs further investigation, however, we
can predict that browsing by bison, mainly on Carpinus/Corylus,
makes an insignificant impact on forestry due to the high and
increasing representation of this species in the forest
understory. Supplementary feeding has several negative effects
on bison ecology and health, therefore reduced and distributed
supplementary feeding should be applied as the management
practice in the Bia{\l}owie{\.z}a Forest.",
journal = "Forest ecology and management",
publisher = "ELSEVIER SCIENCE BV",
volume = 261,
number = 4,
pages = "821--828",
month = feb,
year = 2011,
url = "http://www.sciencedirect.com/science/article/pii/S0378112710006961",
annote = "di",
address = "PO BOX 211, 1000 AE AMSTERDAM, NETHERLANDS",
keywords = "Bison bonasus; trnL approach; DNA barcoding; Diet analysis;
Large ungulates; Wildlife management; L approach",
language = "English",
issn = "0378-1127",
doi = "10.1016/j.foreco.2010.11.026"
}
@ARTICLE{Deagle2009-yh,
title = "{Analysis of Australian fur seal diet by pyrosequencing prey DNA
in faeces}",
author = "Deagle, Bruce E and Kirkwood, Roger and Jarman, Simon N",
abstract = "DNA-based techniques have proven useful for defining trophic
links in a variety of ecosystems and recently developed
sequencing technologies provide new opportunities for dietary
studies. We investigated the diet of Australian fur seals
(Arctocephalus pusillus doriferus) by pyrosequencing prey DNA
from faeces collected at three breeding colonies across the
seals' range. DNA from 270 faecal samples was amplified with four
polymerase chain reaction primer sets and a blocking primer was
used to limit amplification of fur seal DNA. Pooled amplicons
from each colony were sequenced using the Roche GS-FLX platform,
generating > 20,000 sequences. Software was developed to sort and
group similar sequences. A total of 54 bony fish, 4 cartilaginous
fish and 4 cephalopods were identified based on the most
taxonomically informative amplicons sequenced (mitochondrial
16S). The prevalence of sequences from redbait (Emmelichthys
nitidus) and jack mackerel (Trachurus declivis) confirm the
importance of these species in the seals' diet. A third fish
species, blue mackerel (Scomber australasicus), may be a more
important prey species than previously recognised. There were
major differences in the proportions of prey DNA recovered in
faeces from different colonies, probably reflecting differences
in prey availability. Parallel hard-part analysis identified
largely the same main prey species as did the DNA-based
technique, but with lower species diversity and no remains from
cartilaginous prey. The pyrosequencing approach presented
significantly expands the capabilities of DNA-based methods of
dietary analysis and is suitable for large-scale diet
investigations on a broad range of animals.",
journal = "Molecular ecology",
volume = 18,
number = 9,
pages = "2022--2038",
month = may,
year = 2009,
url = "http://dx.doi.org/10.1111/j.1365-294X.2009.04158.x",
issn = "0962-1083, 1365-294X",
pmid = "19317847",
doi = "10.1111/j.1365-294X.2009.04158.x"
}
@ARTICLE{Shehzad2012-pn,
title = "{Carnivore diet analysis based on next-generation sequencing:
Application to the leopard cat (Prionailurus bengalensis) in
Pakistan}",
author = "Shehzad, Wasim and Riaz, Tiayyba and Nawaz, Muhammad A and
Miquel, Christian and Poillot, Carole and Shah, Safdar A and
Pompanon, Francois and Coissac, Eric and Taberlet, Pierre",
journal = "Molecular ecology",
publisher = "Wiley Online Library",
volume = 21,
number = 8,
pages = "1951--1965",
year = 2012,
url = "https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1365-294X.2011.05424.x",
issn = "0962-1083"
}
@ARTICLE{Schloss2009-qy,
title = "{Introducing mothur: open-source, platform-independent,
community-supported software for describing and comparing
microbial communities}",
author = "Schloss, Patrick D and Westcott, Sarah L and Ryabin, Thomas and
Hall, Justine R and Hartmann, Martin and Hollister, Emily B and
Lesniewski, Ryan A and Oakley, Brian B and Parks, Donovan H and
Robinson, Courtney J and Sahl, Jason W and Stres, Blaz and
Thallinger, Gerhard G and Van Horn, David J and Weber, Carolyn F",
abstract = "mothur aims to be a comprehensive software package that allows
users to use a single piece of software to analyze community
sequence data. It builds upon previous tools to provide a
flexible and powerful software package for analyzing sequencing
data. As a case study, we used mothur to trim, screen, and align
sequences; calculate distances; assign sequences to operational
taxonomic units; and describe the alpha and beta diversity of
eight marine samples previously characterized by pyrosequencing
of 16S rRNA gene fragments. This analysis of more than 222,000
sequences was completed in less than 2 h with a laptop computer.",
journal = "Applied and environmental microbiology",
volume = 75,
number = 23,
pages = "7537--7541",
month = dec,
year = 2009,
url = "http://dx.doi.org/10.1128/AEM.01541-09",
issn = "0099-2240, 1098-5336",
pmid = "19801464",
doi = "10.1128/AEM.01541-09",
pmc = "PMC2786419"
}
@ARTICLE{Caporaso2010-ii,
title = "{QIIME allows analysis of high-throughput community sequencing data}",
author = "Caporaso, J Gregory and Kuczynski, Justin and Stombaugh, Jesse and
Bittinger, Kyle and Bushman, Frederic D and Costello, Elizabeth K
and Fierer, Noah and Pe{\~n}a, Antonio Gonzalez and Goodrich,
Julia K and Gordon, Jeffrey I and Huttley, Gavin A and Kelley,
Scott T and Knights, Dan and Koenig, Jeremy E and Ley, Ruth E and
Lozupone, Catherine A and McDonald, Daniel and Muegge, Brian D and
Pirrung, Meg and Reeder, Jens and Sevinsky, Joel R and Turnbaugh,
Peter J and Walters, William A and Widmann, Jeremy and Yatsunenko,
Tanya and Zaneveld, Jesse and Knight, Rob",
journal = "Nature methods",
volume = 7,
number = 5,
pages = "335--336",
month = may,
year = 2010,
url = "http://dx.doi.org/10.1038/nmeth.f.303",
issn = "1548-7091, 1548-7105",
pmid = "20383131",
doi = "10.1038/nmeth.f.303",
pmc = "PMC3156573"
}
+6 -5
View File
@@ -6,13 +6,13 @@
### Specifying input format ### Specifying input format
Five sequence formats are accepted for input files. [Fasta](#fasta-classical "Fasta format description") and [Fastq](#fastq-classical "Fastq format description") are the main ones, EMBL and Genbank allow the use of flat files produced by these two international databases. The last one, ecoPCR, is maintained for compatibility with previous *OBITools* and allows to read *ecoPCR* outputs as sequence files. Five sequence formats are accepted for input files. *Fasta* (@sec-fasta) and *Fastq* (@sec-fastq) are the main ones, EMBL and Genbank allow the use of flat files produced by these two international databases. The last one, ecoPCR, is maintained for compatibility with previous *OBITools* and allows to read *ecoPCR* outputs as sequence files.
- `--ecopcr` : Read data following the *ecoPCR* output format. - `--ecopcr` : Read data following the *ecoPCR* output format.
- `--embl` Read data following the *EMBL* flatfile format. - `--embl` Read data following the *EMBL* flatfile format.
- `--genbank` Read data following the *Genbank* flatfile format. - `--genbank` Read data following the *Genbank* flatfile format.
Several encoding schemes have been proposed for quality scores in [Fastq](#fastq-classical "Fastq format description") format. Currently, *OBITools* considers Sanger encoding as the standard. For reasons of compatibility with older datasets produced with *Solexa* sequencers, it is possible, by using the following option, to force the use of the corresponding quality encoding scheme when reading these older files. Several encoding schemes have been proposed for quality scores in *Fastq* format. Currently, *OBITools* considers Sanger encoding as the standard. For reasons of compatibility with older datasets produced with *Solexa* sequencers, it is possible, by using the following option, to force the use of the corresponding quality encoding scheme when reading these older files.
- `--solexa` Decodes quality string according to the Solexa specification. (default: false) - `--solexa` Decodes quality string according to the Solexa specification. (default: false)
@@ -25,11 +25,12 @@ Only two output sequence formats are supported by OBITools, Fasta and Fastq. Fas
OBITools allows multiple input files to be specified for a single command. OBITools allows multiple input files to be specified for a single command.
- `--no-order` When several input files are provided, indicates that there is no order among them. (default: false) - `--no-order` When several input files are provided, indicates that there is no order among them. (default: false).
Using such option can increase a lot the processing of the data.
### Format of the annotations in Fasta and Fastq files ### The Fasta and Fastq annotations format
OBITools extend the [Fasta](#fasta-classical "Fasta format description") and [Fastq](#fastq-classical "Fastq format description") formats by introducing a format for the title lines of these formats allowing to annotate every sequence. While the previous version of OBITools used an *ad-hoc* format for these annotation, this new version introduce the usage of the standard JSON format to store them. OBITools extend the [Fasta](#the-fasta-sequence-format) and [Fastq](#the-fastq-sequence-format) formats by introducing a format for the title lines of these formats allowing to annotate every sequence. While the previous version of OBITools used an *ad-hoc* format for these annotation, this new version introduce the usage of the standard JSON format to store them.
On input, OBITools automatically recognize the format of the annotations, but two options allows to force the parsing following one of them. You should normally not need to use these options. On input, OBITools automatically recognize the format of the annotations, but two options allows to force the parsing following one of them. You should normally not need to use these options.
+145
View File
@@ -0,0 +1,145 @@
## File formats usable with *OBITools*
OBITools manipulate have to manipulate DNA sequence data and taxonomical data.
They can use some supplentary metadata describing the experiment and produce
some stats about the processed DNA data. All the manipulated data are stored in
text files, following standard data format.
## The DNA sequence data
Sequences can be stored following various format. OBITools knows some of them. The central formats for sequence files manipulated by OBITools scripts are the [`fasta`](#the-fasta-sequence-format) and [`fastq`](#the-fastq-sequence-format) format. OBITools extends the both these formats by specifying a syntax to include in the definition line data qualifying the sequence. All file formats use the `IUPAC` code for encoding nucleotides.
Moreover these two formats that can be used as input and output formats, **OBITools4** can read the following format :
- [EBML flat file](https://ena-docs.readthedocs.io/en/latest/submit/fileprep/flat-file-example.html) format (use by ENA)
- [Genbank flat file format](https://www.ncbi.nlm.nih.gov/Sitemap/samplerecord.html)
- [ecoPCR output files](https://pythonhosted.org/OBITools/scripts/ecoPCR.html)
### The IUPAC Code
The International Union of Pure and Applied Chemistry (IUPAC\_) defined the standard code for representing protein or DNA sequences.
| **Code** | **Nucleotide** |
|----------|-----------------------------|
| A | Adenine |
| C | Cytosine |
| G | Guanine |
| T | Thymine |
| U | Uracil |
| R | Purine (A or G) |
| Y | Pyrimidine (C, T, or U) |
| M | C or A |
| K | T, U, or G |
| W | T, U, or A |
| S | C or G |
| B | C, T, U, or G (not A) |
| D | A, T, U, or G (not C) |
| H | A, T, U, or C (not G) |
| V | A, C, or G (not T, not U) |
| N | Any base (A, C, G, T, or U) |
### The *fasta* sequence format {#sec-fasta}
The **fasta format** is certainly the most widely used sequence file format. This is certainly due to its great simplicity. It was originally created for the Lipman and Pearson [FASTA program](http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation). OBITools use in more of the classical `fasta` format an `extended version` of this format where structured data are included in the title line.
In *fasta* format a sequence is represented by a title line beginning with a **`>`** character and the sequences by itself following the :doc:`iupac` code. The sequence is usually split other severals lines of the same length (expect for the last one)
>my_sequence this is my pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
This is no special format for the title line excepting that this line should be unique. Usually the first word following the **\>** character is considered as the sequence identifier. The end of the title line corresponding to a description of the sequence. Several sequences can be concatenated in a same file. The description of the next sequence is just pasted at the end of the record of the previous one
>sequence_A this is my first pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
>sequence_B this is my second pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
>sequence_C this is my third pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
### The *fastq* sequence format[^01_obitools_doc-1]{#sec-fastq}
The **FASTQ** format is a text file format for storing both biological sequences (only nucleic acid sequences) and the associated quality scores. The sequence and score are each encoded by a single ASCII character. This format was originally developed by the Wellcome Trust Sanger Institute to link a [FASTA](#the-fasta-sequence-format) sequence file to the corresponding quality data, but has recently become the de facto standard for storing results from high-throughput sequencers [@cock2010sanger].
[^01_obitools_doc-1]: This article uses material from the Wikipedia article [`FASTQ format`](http://en.wikipedia.org/wiki/FASTQ_format) which is released under the `Creative Commons Attribution-Share-Alike License 3.0`
A fastq file normally uses four lines per sequence.
- Line 1 begins with a '\@' character and is followed by a sequence identifier and an *optional* description (like a :ref:`fasta` title line).
- Line 2 is the raw sequence letters.
- Line 3 begins with a '+' character and is *optionally* followed by the same sequence identifier (and any description) again.
- Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.
A fastq file containing a single sequence might look like this:
```
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
```
The character '!' represents the lowest quality while '\~' is the highest. Here are the quality value characters in left-to-right increasing order of quality (`ASCII`):
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of "\@" and "+" as markers (these characters can also occur in the quality string).
#### Sequence quality scores{.unnumbered}
The Phred quality value *Q* is an integer mapping of *p* (i.e., the probability that the corresponding base call is incorrect). Two different equations have been in use. The first is the standard Sanger variant to assess reliability of a base call, otherwise known as Phred quality score:
$$
Q_\text{sanger} = -10 \, \log_{10} p
$$
The Solexa pipeline (i.e., the software delivered with the Illumina Genome Analyzer) earlier used a different mapping, encoding the odds $\mathbf{p}/(1-\mathbf{p})$ instead of the probability $\mathbf{p}$:
$$
Q_\text{solexa-prior to v.1.3} = -10 \; \log_{10} \frac{p}{1-p}
$$
Although both mappings are asymptotically identical at higher quality values, they differ at lower quality levels (i.e., approximately $\mathbf{p} > 0.05$, or equivalently, $\mathbf{Q} < 13$).
![Relationship between *Q* and *p* using the Sanger (red) and Solexa (black) equations (described above). The vertical dotted line indicates $\mathbf{p}= 0.05$, or equivalently, $Q = 13$.](Probabilitymetrics.png){#fig-Probabilitymetrics}
##### Encoding{.unnumbered}
The *fastq* format had differente way of encoding the Phred quality score along the time. Here a breif history of these changes is presented.
- Sanger format can encode a Phred quality score from 0 to 93 using ASCII 33 to 126 (although in raw read data the Phred quality score rarely exceeds 60, higher scores are possible in assemblies or read maps).
- Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score from -5 to 62 using ASCII 59 to 126 (although in raw read data Solexa scores from -5 to 40 only are expected)
- Starting with Illumina 1.3 and before Illumina 1.8, the format encoded a Phred quality score from 0 to 62 using ASCII 64 to 126 (although in raw read data Phred scores from 0 to 40 only are expected).
- Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0 to 2 have a slightly different meaning. The values 0 and 1 are no longer used and the value 2, encoded by ASCII 66 "B".
> Sequencing Control Software, Version 2.6, (Catalog \# SY-960-2601, Part \# 15009921 Rev. A, November 2009, page 30)
> states the following: *If a read ends with a segment of mostly low quality (Q15 or below), then all of the quality
> values in the segment are replaced with a value of 2 (encoded as the letter B in Illumina's text-based encoding of
> quality scores)... This Q2 indicator does not predict a specific error rate, but rather indicates that a specific
> final portion of the read should not be used in further analyses.* Also, the quality score encoded as "B" letter
> may occur internally within reads at least as late as pipeline version 1.6, as shown in the following example:
```
@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
+HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB
```
An alternative interpretation of this ASCII encoding has been proposed. Also, in Illumina runs using PhiX controls, the character 'B' was observed to represent an "unknown quality score". The error rate of 'B' reads was roughly 3 phred scores lower the mean observed score of a given run.
- Starting in Illumina 1.8, the quality scores have basically returned to the use of the Sanger format (Phred+33).
OBItools support the Sanger format. It is nevertheless to read files encoded following the Solexa/Illumina format, that are still possible to find in old files, by applying a shift of 62.
### File extension
There is no standard file extension for a FASTQ file, but .fq and .fastq, are commonly used.
+45 -130
View File
@@ -1,142 +1,57 @@
# The OBITools # The OBITools
The *OBITools4* are programs specifically designed for analyzing NGS data in a DNA metabarcoding context, taking into account taxonomic information. It is distributed as an open source software available on the following website: http://metabarcoding.org/obitools4.
## Aims of *OBITools* ## Aims of *OBITools*
## File formats usable with *OBITools* DNA metabarcoding is an efficient approach for biodiversity studies [@Taberlet2012-pf]. Originally mainly developed by microbiologists [*e.g.* @Sogin2006-ab], it is now widely used for plants [*e.g.* @Sonstebo2010-vv;@Yoccoz2012-ix;@Parducci2012-rn] and animals from meiofauna [*e.g.* @Chariton2010-cz;@Baldwin2013-yc] to larger organisms [*e.g.* @Andersen2012-gj;@Thomsen2012-au]. Interestingly, this method is not limited to *sensu
stricto* biodiversity surveys, but it can also be implemented in other
ecological contexts such as for herbivore [e.g. @Valentini2009-ay;@Kowalczyk2011-kg] or carnivore [e.g. @Deagle2009-yh;@Shehzad2012-pn] diet
analyses.
### The sequence files Whatever the biological question under consideration, the DNA metabarcoding
methodology relies heavily on next-generation sequencing (NGS), and generates
considerable numbers of DNA sequence reads (typically million of reads).
Manipulation of such large datasets requires dedicated programs usually running
on a Unix system. Unix is an operating system, whose first version was created
during the sixties. Since its early stages, it is dedicated to scientific
computing and includes a large set of simple tools to efficiently process text
files. Most of those programs can be viewed as filters extracting information
from a text file to create a new text file. These programs process text files as
streams, line per line, therefore allowing computation on a huge dataset without
requiring a large memory. Unix programs usually print their results to their
standard output (*stdout*), which by default is the terminal, so the results can
be examined on screen. The main philosophy of the Unix environment is to allow
easy redirection of the *stdout* either to a file, for saving the results, or to
the standard input (*stdin*) of a second program thus allowing to easily create
complex processing from simple base commands. Access to Unix computers is
increasingly easier for scientists nowadays. Indeed, the Linux operating system,
an open source version of Unix, can be freely installed on every PC machine and
the MacOS operating system, running on Apple computers, is also a Unix system.
The *OBITools* programs imitate Unix standard programs because they usually act as
filters, reading their data from text files or the *stdin* and writing their
results to the *stdout*. The main difference with classical Unix programs is that
text files are not analyzed line per line but sequence record per sequence
record (see below for a detailed description of a sequence record).
Compared to packages for similar purposes like mothur [@Schloss2009-qy] or
QIIME [@Caporaso2010-ii], the *OBITools* mainly rely on filtering and sorting
algorithms. This allows users to set up versatile data analysis pipelines
(Figure 1), adjustable to the broad range of DNA metabarcoding applications.
The innovation of the *OBITools* is their ability to take into account the
taxonomic annotations, ultimately allowing sorting and filtering of sequence
records based on the taxonomy.
Sequences can be stored following various format. OBITools knows some of them. The central formats for sequence files manipulated by OBITools scripts are the `fasta` and fastq format. OBITools extends the both these formats by specifying a syntax to include in the definition line data qualifying the sequence. All file formats use the `IUPAC` code for encoding nucleotides. ## Installation of the obitools
### The IUPAC Code ### Availability of the OBITools
The International Union of Pure and Applied Chemistry (IUPAC\_) defined the standard code for representing protein or DNA sequences. The *OBITools* are open source and protected by the [CeCILL 2.1 license](http://www.cecill.info/licences/Licence_CeCILL_V2.1-en.html).
#### Nucleic IUPAC Code {#DNA-IUPAC} All the sources of the [*OBITools4*](http://metabarcoding.org/obitools4) can be downloaded from the metabarcoding git server (https://git.metabarcoding.org).
| **Code** | **Nucleotide** | ### Prerequisites
|----------|-----------------------------|
| A | Adenine |
| C | Cytosine |
| G | Guanine |
| T | Thymine |
| U | Uracil |
| R | Purine (A or G) |
| Y | Pyrimidine (C, T, or U) |
| M | C or A |
| K | T, U, or G |
| W | T, U, or A |
| S | C or G |
| B | C, T, U, or G (not A) |
| D | A, T, U, or G (not C) |
| H | A, T, U, or C (not G) |
| V | A, C, or G (not T, not U) |
| N | Any base (A, C, G, T, or U) |
### The *fasta* format {#classical-fasta} The *OBITools4* are developped using the [GO programming language](https://go.dev/), we stick to the latest version of the language, today the $1.19.5$. If you want to download and compile the sources yourself, you first need to install the corresponding compiler on your system. Some parts of the soft are also written in C, therefore a recent C compiler is also requested, GCC on Linux or Windows, the Developer Tools on Mac.
The **fasta format** is certainly the most widely used sequence file format. This is certainly due to its great simplicity. It was originally created for the Lipman and Pearson [FASTA program](http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation). OBITools use in more of the classical :ref:`fasta` format an :ref:`extended version` of this format where structured data are included in the title line. Whatever the installation you decide for, you will have to ensure that a C compiler is available on your system.
In *fasta* format a sequence is represented by a title line beginning with a **`>`** character and the sequences by itself following the :doc:`iupac` code. The sequence is usually split other severals lines of the same length (expect for the last one)
>my_sequence this is my pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
This is no special format for the title line excepting that this line should be unique. Usually the first word following the **\>** character is considered as the sequence identifier. The end of the title line corresponding to a description of the sequence. Several sequences can be concatenated in a same file. The description of the next sequence is just pasted at the end of the record of the previous one
>sequence_A this is my first pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
>sequence_B this is my second pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
>sequence_C this is my third pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
### The *fastq* sequence format[^01_obitools_doc-1] {#classical-fastq}
**fastq format** is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are encoded with a single ASCII character for brevity. It was originally developed at the `Wellcome Trust Sanger Institute` to bundle a [fasta](#classical-fasta) sequence and its quality data, but has recently become the *de facto* standard for storing the output of high throughput sequencing instruments such as the Illumina Genome Analyzer Illumina [@cock2010sanger] .
[^01_obitools_doc-1]: This article uses material from the Wikipedia article [`FASTQ format`](http://en.wikipedia.org/wiki/FASTQ_format) which is released under the `Creative Commons Attribution-Share-Alike License 3.0`
A fastq file normally uses four lines per sequence.
- Line 1 begins with a '\@' character and is followed by a sequence identifier and an *optional* description (like a :ref:`fasta` title line).
- Line 2 is the raw sequence letters.
- Line 3 begins with a '+' character and is *optionally* followed by the same sequence identifier (and any description) again.
- Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.
A fastq file containing a single sequence might look like this:
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
The character '!' represents the lowest quality while '\~' is the highest. Here are the quality value characters in left-to-right increasing order of quality (`ASCII`):
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of "\@" and "+" as markers (these characters can also occur in the quality string).
#### Variations
##### Quality
A quality value *Q* is an integer mapping of *p* (i.e., the probability that the corresponding base call is incorrect). Two different equations have been in use. The first is the standard Sanger variant to assess reliability of a base call, otherwise known as Phred quality score:
$$
Q_\text{sanger} = -10 \, \log_{10} p
$$
The Solexa pipeline (i.e., the software delivered with the Illumina Genome Analyzer) earlier used a different mapping, encoding the odds $\mathbf{p}/(1-\mathbf{p})$ instead of the probability $\mathbf{p}$:
$$
Q_\text{solexa-prior to v.1.3} = -10 \, \log_{10} \frac{p}{1-p}
$$
Although both mappings are asymptotically identical at higher quality values, they differ at lower quality levels (i.e., approximately $\mathbf{p} > 0.05$, or equivalently, $\mathbf{Q} < 13$).
\|Relationship between *Q* and *p* using the Sanger (red) and Solexa (black) equations (described above). The vertical dotted line indicates $\mathbf{p}= 0.05$, or equivalently, $Q = 13$.\|
#### Encoding
- Sanger format can encode a Phred quality score from 0 to 93 using ASCII 33 to 126 (although in raw read data the Phred quality score rarely exceeds 60, higher scores are possible in assemblies or read maps).
- Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score from -5 to 62 using ASCII 59 to 126 (although in raw read data Solexa scores from -5 to 40 only are expected)
- Starting with Illumina 1.3 and before Illumina 1.8, the format encoded a Phred quality score from 0 to 62 using ASCII 64 to 126 (although in raw read data Phred scores from 0 to 40 only are expected).
- Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0 to 2 have a slightly different meaning. The values 0 and 1 are no longer used and the value 2, encoded by ASCII 66 "B".
Sequencing Control Software, Version 2.6, Catalog \# SY-960-2601, Part \# 15009921 Rev. A, November 2009] [[http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\\\\](http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf){.uri}](%5Bhttp://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\%5D(http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf)%7B.uri%7D){.uri} (page 30) states the following: *If a read ends with a segment of mostly low quality (Q15 or below), then all of the quality values in the segment are replaced with a value of 2 (encoded as the letter B in Illumina's text-based encoding of quality scores)... This Q2 indicator does not predict a specific error rate, but rather indicates that a specific final portion of the read should not be used in further analyses.* Also, the quality score encoded as "B" letter may occur internally within reads at least as late as pipeline version 1.6, as shown in the following example:
@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
+HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB
An alternative interpretation of this ASCII encoding has been proposed. Also, in Illumina runs using PhiX controls, the character 'B' was observed to represent an "unknown quality score". The error rate of 'B' reads was roughly 3 phred scores lower the mean observed score of a given run.
- Starting in Illumina 1.8, the quality scores have basically returned to the use of the Sanger format (Phred+33).
## File extension
There is no standard file extension for a FASTQ file, but .fq and .fastq, are commonly used.
## See also
- :ref:`fasta`
## References
.. [1] Cock et al (2009) The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Research,
.. [2] Illumina Quality Scores, Tobias Mann, Bioinformatics, San Diego, Illumina `1`\_\_
.. \|Relationship between *Q* and *p* using the Sanger (red) and Solexa (black) equations (described above). The vertical dotted line indicates *p* = 0.05, or equivalently, *Q* Å 13.\| image:: Probability metrics.png
See <http://en.wikipedia.org/wiki/FASTQ_format>