Merge pull request #122 from metabarcoding/push-tnmnuwllvnop

Release 4.5.0
This commit is contained in:
coissac
2026-08-19 17:35:33 +02:00
committed by GitHub
21 changed files with 536 additions and 143 deletions
+4 -4
View File
@@ -156,8 +156,8 @@ bump-version:
jjnew: jjnew:
@echo "$(YELLOW)→ Creating a new commit...$(NC)" @echo "$(YELLOW)→ Creating a new commit...$(NC)"
@echo "$(BLUE)→ Documenting current commit...$(NC)" @echo "$(BLUE)→ Documenting undocumented commits...$(NC)"
@jj auto-describe @jj auto-doc
@echo "$(BLUE)→ Done.$(NC)" @echo "$(BLUE)→ Done.$(NC)"
@jj new @jj new
@echo "$(GREEN)✓ New commit created$(NC)" @echo "$(GREEN)✓ New commit created$(NC)"
@@ -171,8 +171,8 @@ jjpush:
@echo "$(GREEN)✓ Release complete$(NC)" @echo "$(GREEN)✓ Release complete$(NC)"
jjpush-describe: jjpush-describe:
@echo "$(BLUE)→ Documenting current commit...$(NC)" @echo "$(BLUE)→ Documenting undocumented commits...$(NC)"
@jj auto-describe @jj auto-doc
jjpush-bump: jjpush-bump:
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)" @echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
+23 -2
View File
@@ -28,10 +28,18 @@ func buffIndex(i, j, width int) int {
// //
// The function returns the start and end positions of the best // The function returns the start and end positions of the best
// match, as well as the number of errors in the best match. // match, as well as the number of errors in the best match.
//
// When the sequence is too short relative to the pattern for the
// backtracking to reconstruct a valid alignment (e.g. the pattern
// is longer than the sequence, or the match sits too close to a
// sequence boundary), no reliable position can be computed. In that
// case the function returns the sentinel (-1, -1, -1) instead of a
// guessed, potentially wrong, position: callers must treat this as
// "no match" rather than use the returned coordinates.
func LocatePattern(id string, pattern, sequence []byte) (int, int, int) { func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
if len(pattern) >= len(sequence) { if len(sequence) == 0 {
log.Panicf("Sequence %s:Pattern %s must be shorter than sequence %s", id, pattern, sequence) log.Panicf("Sequence %s:Pattern %s must not be empty", id, pattern)
} }
// Pattern spreads over the columns // Pattern spreads over the columns
@@ -158,5 +166,18 @@ func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
// obilog.Warnf("from : %d to: %d error: %d match: %v", // obilog.Warnf("from : %d to: %d error: %d match: %v",
// i, end+1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)], // i, end+1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)],
// string(sequence[i:(end+1)])) // string(sequence[i:(end+1)]))
if i < 0 || end == -1 {
// i < 0: the backtracking ran off the start of the sequence
// without fully consuming the pattern.
// end == -1: the backtracking loop never ran at all (e.g. a
// single-base pattern, jmax == 0), so no alignment boundary
// was ever established.
// Either way, no valid alignment exists for this (pattern,
// sequence) pair: signal it explicitly instead of returning
// an out-of-bounds or uncomputed position.
return -1, -1, -1
}
return i, end + 1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)] return i, end + 1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)]
} }
+123
View File
@@ -0,0 +1,123 @@
package obialign
import (
"math/rand"
"testing"
)
func TestLocatePatternNormal(t *testing.T) {
// Pattern fully and exactly present in the middle of a longer sequence.
start, end, nerr := LocatePattern("id", []byte("ACGT"), []byte("TTTTACGTTTTT"))
if start != 4 || end != 8 || nerr != 0 {
t.Errorf("got start=%d end=%d nerr=%d, want start=4 end=8 nerr=0", start, end, nerr)
}
}
func TestLocatePatternOneMismatch(t *testing.T) {
start, end, nerr := LocatePattern("id", []byte("ACGT"), []byte("TTTTACTTTTTT"))
if nerr != 1 {
t.Errorf("got nerr=%d, want 1 (start=%d end=%d)", nerr, start, end)
}
}
// The real-world case that used to panic: pattern longer than the sequence
// fragment extracted for indel relocation.
func TestLocatePatternPatternLongerThanSequence(t *testing.T) {
start, end, nerr := LocatePattern("id",
[]byte("GGGCAATCCTGAGCCAAATC"),
[]byte("tcctgagccaaatcacgtt"))
if start != -1 || end != -1 || nerr != -1 {
t.Errorf("got start=%d end=%d nerr=%d, want the (-1,-1,-1) sentinel", start, end, nerr)
}
}
func TestLocatePatternSequenceLengthOne(t *testing.T) {
start, end, nerr := LocatePattern("id", []byte("AB"), []byte("A"))
if start < 0 || end < 0 || nerr < 0 {
t.Fatalf("got start=%d end=%d nerr=%d, expected a valid (non-sentinel) result", start, end, nerr)
}
if start != 0 || end != 1 || nerr != 1 {
t.Errorf("got start=%d end=%d nerr=%d, want start=0 end=1 nerr=1", start, end, nerr)
}
}
// A pattern much longer than the sequence can still yield a mathematically
// valid (in-bounds) alignment: the extra pattern length is absorbed as gaps,
// driving the error count high enough that the caller's maxerr threshold
// rejects it. The function itself must still return consistent bounds.
func TestLocatePatternPatternMuchLongerThanSequence(t *testing.T) {
start, end, nerr := LocatePattern("id", []byte("ACGTACGTACGTACGTACGT"), []byte("ACG"))
isSentinel := start == -1 && end == -1 && nerr == -1
isValid := start >= 0 && end > start && end <= 3 && nerr >= 0
if !isSentinel && !isValid {
t.Errorf("got start=%d end=%d nerr=%d, want either the sentinel or consistent in-bounds values", start, end, nerr)
}
}
func TestLocatePatternNeverReturnsOutOfBounds(t *testing.T) {
patterns := []string{"A", "AC", "ACG", "ACGT", "ACGTA", "ACGTAC", "ACGTACG", "ACGTACGT"}
sequences := []string{"A", "AC", "ACG", "ACGT", "ACGTA", "ACGTAC", "ACGTACG", "ACGTACGT"}
for _, p := range patterns {
for _, s := range sequences {
start, end, nerr := LocatePattern("id", []byte(p), []byte(s))
if start == -1 && end == -1 && nerr == -1 {
// Explicit "no reliable match" sentinel: always acceptable.
continue
}
if start < 0 || end < 0 || start >= end || end > len(s) || nerr < 0 {
t.Errorf("pattern=%q sequence=%q -> start=%d end=%d nerr=%d is out of bounds / inconsistent",
p, s, start, end, nerr)
}
}
}
}
// Randomized property test over a wide range of pattern/sequence length
// combinations, including pattern >= sequence, to make sure the function
// never panics and never returns anything but the sentinel or fully
// consistent, in-bounds coordinates.
func TestLocatePatternRandomizedNeverInvalid(t *testing.T) {
const bases = "ACGT"
rng := rand.New(rand.NewSource(42))
randSeq := func(n int) []byte {
b := make([]byte, n)
for i := range b {
b[i] = bases[rng.Intn(len(bases))]
}
return b
}
for trial := 0; trial < 5000; trial++ {
patLen := 1 + rng.Intn(15)
seqLen := 1 + rng.Intn(15)
pattern := randSeq(patLen)
sequence := randSeq(seqLen)
func() {
defer func() {
if r := recover(); r != nil {
t.Fatalf("panic for pattern=%q sequence=%q: %v", pattern, sequence, r)
}
}()
start, end, nerr := LocatePattern("id", pattern, sequence)
isSentinel := start == -1 && end == -1 && nerr == -1
isValid := start >= 0 && end > start && end <= len(sequence) && nerr >= 0
if !isSentinel && !isValid {
t.Errorf("pattern=%q sequence=%q -> start=%d end=%d nerr=%d is neither the sentinel nor consistent",
pattern, sequence, start, end, nerr)
}
}()
}
}
+31 -10
View File
@@ -373,6 +373,7 @@ func (pattern ApatPattern) BestMatch(sequence ApatSequence, begin, length int) (
cpattern := (*[1 << 30]byte)(unsafe.Pointer(pattern.pointer.pointer.cpat)) cpattern := (*[1 << 30]byte)(unsafe.Pointer(pattern.pointer.pointer.cpat))
frg := sequence.pointer.reference.Sequence()[start:end] frg := sequence.pointer.reference.Sequence()[start:end]
fragStart := start
log.Debugln( log.Debugln(
string(frg), string(frg),
@@ -384,11 +385,20 @@ func (pattern ApatPattern) BestMatch(sequence ApatSequence, begin, length int) (
(*cpattern)[0:int(pattern.pointer.pointer.patlen)], (*cpattern)[0:int(pattern.pointer.pointer.patlen)],
frg) frg)
// olderr := m[2] if from < 0 {
// obialign.LocatePattern could not reconstruct a reliable
// alignment (e.g. the fragment is too short relative to the
// pattern). Reporting a guessed position would risk placing
// the primer boundary incorrectly, so treat it as no match
// at all rather than falling back to an unrefined position.
matched = false
log.Debugln("No reliable indel relocation, discarding match", sequence.pointer.reference.Id())
return
}
nerr = score nerr = score
start = start + from start = fragStart + from
end = start + to end = fragStart + to
log.Debugf("BestMatch on %s : score=%d [%d..%d]", sequence.pointer.reference.Id(), score, start, nerr) log.Debugf("BestMatch on %s : score=%d [%d..%d]", sequence.pointer.reference.Id(), score, start, nerr)
return return
} }
@@ -467,6 +477,7 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
for _, m := range res { for _, m := range res {
// Recompute the start and end position of the match // Recompute the start and end position of the match
// when the pattern allows for indels // when the pattern allows for indels
valid := true
if m[2] > 0 && pattern.pointer.pointer.hasIndel { if m[2] > 0 && pattern.pointer.pointer.hasIndel {
// obilog.Warnf("Locating indel on sequence %s[%s]", sequence.pointer.reference.Id(), pattern.String()) // obilog.Warnf("Locating indel on sequence %s[%s]", sequence.pointer.reference.Id(), pattern.String())
start := m[0] - m[2]*2 start := m[0] - m[2]*2
@@ -485,16 +496,26 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
(*cpattern)[0:int(pattern.pointer.pointer.patlen)], (*cpattern)[0:int(pattern.pointer.pointer.patlen)],
frg) frg)
// olderr := m[2] if pb < 0 {
m[2] = score // obialign.LocatePattern could not reconstruct a
m[0] = start + pb // reliable alignment (e.g. the match sits too close
m[1] = start + pe // to a sequence end for the fragment to be usable).
// Reporting a guessed position risks placing the
// primer boundary incorrectly, so drop the match
// entirely instead of keeping an unrefined guess.
valid = false
} else {
// olderr := m[2]
m[2] = score
m[0] = start + pb
m[1] = start + pe
// obilog.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score, // obilog.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score,
// frg, (*cpattern)[0:int(pattern.pointer.pointer.patlen)], sequence.pointer.reference.Sequence()[m[0]:m[1]]) // frg, (*cpattern)[0:int(pattern.pointer.pointer.patlen)], sequence.pointer.reference.Sequence()[m[0]:m[1]])
}
} }
if int(pattern.pointer.pointer.maxerr) >= m[2] { if valid && int(pattern.pointer.pointer.maxerr) >= m[2] {
res[j] = m res[j] = m
j++ j++
} }
+20 -14
View File
@@ -131,7 +131,7 @@ func _storeSequenceQuality(bytes *bytes.Buffer, out *obiseq.BioSequence, quality
out.SetQualities(q) out.SetQualities(q)
} }
func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(string, io.Reader) (obiseq.BioSequenceSlice, error) { func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool, fileName string) func(string, io.Reader) (obiseq.BioSequenceSlice, error) {
parser := func(source string, input io.Reader) (obiseq.BioSequenceSlice, error) { parser := func(source string, input io.Reader) (obiseq.BioSequenceSlice, error) {
var identifier string var identifier string
@@ -160,12 +160,12 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
// Beginning of sequence // Beginning of sequence
state = 1 state = 1
} else { } else {
log.Fatalf("%s : sequence entry is not starting with @", source) log.Fatalf("file %s: sequence entry is not starting with @", fileName)
} }
case 1: // Beginning of identifier (Mandatory) case 1: // Beginning of identifier (Mandatory)
if is_sep { if is_sep {
// No identifier -> ERROR // No identifier -> ERROR
log.Fatalf("%s : sequence identifier is empty", source) log.Fatalf("file %s: sequence identifier is empty", fileName)
} else { } else {
// Beginning of identifier // Beginning of identifier
state = 2 state = 2
@@ -221,7 +221,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
// End of sequence // End of sequence
rawseq := seqBytes.Bytes() rawseq := seqBytes.Bytes()
if len(rawseq) == 0 { if len(rawseq) == 0 {
log.Fatalf("@%s[%s] : sequence is empty", identifier, source) log.Fatalf("file %s: record @%s has an empty sequence line", fileName, identifier)
} }
s := obiseq.NewBioSequence(identifier, rawseq, definition) s := obiseq.NewBioSequence(identifier, rawseq, definition)
s.SetSource(source) s.SetSource(source)
@@ -241,8 +241,8 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
context = append( context = append(
append([]byte{previous}, C), append([]byte{previous}, C),
context...) context...)
log.Fatalf("%s [%s]: sequence contains invalid character %c (%s)", log.Fatalf("file %s: record @%s contains invalid character %c (%s)",
source, identifier, C, string(context)) fileName, identifier, C, string(context))
} }
} }
case 7: case 7:
@@ -251,7 +251,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
} else if C == '+' { } else if C == '+' {
state = 8 state = 8
} else { } else {
log.Fatalf("@%s[%s] : sequence data not followed by a line starting with + but a %c", identifier, source, C) log.Fatalf("file %s: record @%s: sequence data not followed by a line starting with + but a %c", fileName, identifier, C)
} }
case 8: case 8:
// State consuming the + internal header line // State consuming the + internal header line
@@ -282,7 +282,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
} else if C == '@' { } else if C == '@' {
state = 1 state = 1
} else { } else {
log.Fatalf("%s[%s] : sequence record not followed by a line starting with @", identifier, source) log.Fatalf("file %s: record @%s not followed by a line starting with @", fileName, identifier)
} }
} }
@@ -304,7 +304,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
} }
// FastqChunkParserRope parses a FASTQ chunk directly from a rope without Pack(). // FastqChunkParserRope parses a FASTQ chunk directly from a rope without Pack().
func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte, with_quality, UtoT bool) (obiseq.BioSequenceSlice, error) { func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte, with_quality, UtoT bool, fileName string) (obiseq.BioSequenceSlice, error) {
scanner := newRopeScanner(rope) scanner := newRopeScanner(rope)
sequences := obiseq.MakeBioSequenceSlice(100)[:0] sequences := obiseq.MakeBioSequenceSlice(100)[:0]
@@ -334,7 +334,7 @@ func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte,
// Line 2: sequence // Line 2: sequence
sline := scanner.ReadLine() sline := scanner.ReadLine()
if sline == nil { if sline == nil {
log.Fatalf("@%s[%s]: unexpected EOF after header", id, source) log.Fatalf("file %s: record @%s is truncated (header line with no sequence line following) — the FASTQ file appears incomplete", fileName, id)
} }
seqDest := make([]byte, len(sline)) seqDest := make([]byte, len(sline))
w := 0 w := 0
@@ -350,7 +350,7 @@ func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte,
} }
seqDest = seqDest[:w] seqDest = seqDest[:w]
if len(seqDest) == 0 { if len(seqDest) == 0 {
log.Fatalf("@%s[%s]: sequence is empty", id, source) log.Fatalf("file %s: record @%s has an empty sequence line", fileName, id)
} }
// Line 3: + (skip) // Line 3: + (skip)
@@ -382,16 +382,17 @@ func _ParseFastqFile(
out obiiter.IBioSequence, out obiiter.IBioSequence,
quality_shift byte, quality_shift byte,
with_quality, UtoT bool, with_quality, UtoT bool,
fileName string,
) { ) {
parser := FastqChunkParser(quality_shift, with_quality, UtoT) parser := FastqChunkParser(quality_shift, with_quality, UtoT, fileName)
for chunks := range input { for chunks := range input {
var sequences obiseq.BioSequenceSlice var sequences obiseq.BioSequenceSlice
var err error var err error
if chunks.Rope != nil { if chunks.Rope != nil {
sequences, err = FastqChunkParserRope(chunks.Source, chunks.Rope, quality_shift, with_quality, UtoT) sequences, err = FastqChunkParserRope(chunks.Source, chunks.Rope, quality_shift, with_quality, UtoT, fileName)
} else { } else {
sequences, err = parser(chunks.Source, chunks.Raw) sequences, err = parser(chunks.Source, chunks.Raw)
} }
@@ -423,6 +424,8 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
false, false,
) )
fileName := opt.FileName()
for i := 0; i < nworker; i++ { for i := 0; i < nworker; i++ {
out.Add(1) out.Add(1)
go _ParseFastqFile( go _ParseFastqFile(
@@ -431,6 +434,7 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
obidefault.ReadQualitiesShift(), obidefault.ReadQualitiesShift(),
opt.ReadQualities(), opt.ReadQualities(),
opt.UtoT(), opt.UtoT(),
fileName,
) )
} }
@@ -456,7 +460,9 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
} }
func ReadFastqFromFile(filename string, options ...WithOption) (obiiter.IBioSequence, error) { func ReadFastqFromFile(filename string, options ...WithOption) (obiiter.IBioSequence, error) {
options = append(options, OptionsSource(obiutils.RemoveAllExt((path.Base(filename))))) options = append(options,
OptionsSource(obiutils.RemoveAllExt((path.Base(filename)))),
OptionsFileName(filename))
file, err := obiutils.Ropen(filename) file, err := obiutils.Ropen(filename)
+105 -96
View File
@@ -199,8 +199,111 @@ func _parse_json_array_interface(str []byte) ([]interface{}, error) {
return values, nil return values, nil
} }
func _parse_json_header_(header string, sequence *obiseq.BioSequence) string { // _parse_json_annotation_field parses a single key/value pair coming from a
// JSON object (either a FASTA/FASTQ inline JSON header, or the "annotations"
// field of a JSON sequence record) and applies it to the sequence, special
// casing the well-known OBITools attributes (id, definition, count, taxid,
// obiclean_*, merged_*).
func _parse_json_annotation_field(key []byte, value []byte, dataType jsonparser.ValueType, sequence *obiseq.BioSequence) error {
annotations := sequence.Annotations() annotations := sequence.Annotations()
var err error
skey := obiutils.UnsafeString(key)
switch {
case skey == "id":
sequence.SetId(string(value))
case skey == "definition":
sequence.SetDefinition(string(value))
case skey == "count":
if dataType != jsonparser.Number {
log.Fatalf("%s: Count attribut must be numeric: %s", sequence.Id(), string(value))
}
count, err := jsonparser.ParseInt(value)
if err != nil {
log.Fatalf("%s: Cannot parse count %s", sequence.Id(), string(value))
}
sequence.SetCount(int(count))
case skey == "obiclean_weight":
weight, err := _parse_json_map_int(value)
if err != nil {
log.Fatalf("%s: Cannot parse obiclean weight %s", sequence.Id(), string(value))
}
annotations[skey] = weight
case skey == "obiclean_status":
status, err := _parse_json_map_string(value)
if err != nil {
log.Fatalf("%s: Cannot parse obiclean status %s", sequence.Id(), string(value))
}
annotations[skey] = status
case strings.HasPrefix(skey, "merged_"):
if dataType == jsonparser.Object {
data, err := _parse_json_map_int(value)
if err != nil {
log.Fatalf("%s: Cannot parse merged slot %s: %v", sequence.Id(), skey, err)
} else {
annotations[skey] = obiseq.MapAsStatsOnValues(data)
}
} else {
log.Fatalf("%s: Cannot parse merged slot %s", sequence.Id(), skey)
}
case skey == "taxid":
if dataType == jsonparser.Number || dataType == jsonparser.String {
taxid := string(value)
sequence.SetTaxid(taxid)
} else {
log.Fatalf("%s: Cannot parse taxid %s", sequence.Id(), string(value))
}
case strings.HasSuffix(skey, "_taxid"):
if dataType == jsonparser.Number || dataType == jsonparser.String {
rank := skey[:len(skey)-len("_taxid")]
taxid := string(value)
sequence.SetTaxid(taxid, rank)
} else {
log.Fatalf("%s: Cannot parse taxid %s", sequence.Id(), string(value))
}
default:
skey = strings.Clone(skey)
switch dataType {
case jsonparser.String:
annotations[skey] = string(value)
case jsonparser.Number:
// Try to parse the number as an int at first then as float if that fails.
annotations[skey], err = jsonparser.ParseInt(value)
if err != nil {
annotations[skey], err = strconv.ParseFloat(obiutils.UnsafeString(value), 64)
}
case jsonparser.Array:
annotations[skey], err = _parse_json_array_interface(value)
case jsonparser.Object:
annotations[skey], err = _parse_json_map_interface(value)
case jsonparser.Boolean:
annotations[skey], err = jsonparser.ParseBoolean(value)
case jsonparser.Null:
annotations[skey] = nil
default:
log.Fatalf("Unknown data type %v", dataType)
}
}
if err != nil {
annotations[skey] = "NaN"
log.Fatalf("%s: Cannot parse value %s assicated to key %s into a %s value",
sequence.Id(), string(value), skey, dataType.String())
}
return err
}
func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
start := -1 start := -1
stop := -1 stop := -1
level := 0 level := 0
@@ -240,101 +343,7 @@ func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
jsonparser.ObjectEach(obiutils.UnsafeBytes(header[start:stop]), jsonparser.ObjectEach(obiutils.UnsafeBytes(header[start:stop]),
func(key []byte, value []byte, dataType jsonparser.ValueType, offset int) error { func(key []byte, value []byte, dataType jsonparser.ValueType, offset int) error {
var err error return _parse_json_annotation_field(key, value, dataType, sequence)
skey := obiutils.UnsafeString(key)
switch {
case skey == "id":
sequence.SetId(string(value))
case skey == "definition":
sequence.SetDefinition(string(value))
case skey == "count":
if dataType != jsonparser.Number {
log.Fatalf("%s: Count attribut must be numeric: %s", sequence.Id(), string(value))
}
count, err := jsonparser.ParseInt(value)
if err != nil {
log.Fatalf("%s: Cannot parse count %s", sequence.Id(), string(value))
}
sequence.SetCount(int(count))
case skey == "obiclean_weight":
weight, err := _parse_json_map_int(value)
if err != nil {
log.Fatalf("%s: Cannot parse obiclean weight %s", sequence.Id(), string(value))
}
annotations[skey] = weight
case skey == "obiclean_status":
status, err := _parse_json_map_string(value)
if err != nil {
log.Fatalf("%s: Cannot parse obiclean status %s", sequence.Id(), string(value))
}
annotations[skey] = status
case strings.HasPrefix(skey, "merged_"):
if dataType == jsonparser.Object {
data, err := _parse_json_map_int(value)
if err != nil {
log.Fatalf("%s: Cannot parse merged slot %s: %v", sequence.Id(), skey, err)
} else {
annotations[skey] = obiseq.MapAsStatsOnValues(data)
}
} else {
log.Fatalf("%s: Cannot parse merged slot %s", sequence.Id(), skey)
}
case skey == "taxid":
if dataType == jsonparser.Number || dataType == jsonparser.String {
taxid := string(value)
sequence.SetTaxid(taxid)
} else {
log.Fatalf("%s: Cannot parse taxid %s", sequence.Id(), string(value))
}
case strings.HasSuffix(skey, "_taxid"):
if dataType == jsonparser.Number || dataType == jsonparser.String {
rank := skey[:len(skey)-len("_taxid")]
taxid := string(value)
sequence.SetTaxid(taxid, rank)
} else {
log.Fatalf("%s: Cannot parse taxid %s", sequence.Id(), string(value))
}
default:
skey = strings.Clone(skey)
switch dataType {
case jsonparser.String:
annotations[skey] = string(value)
case jsonparser.Number:
// Try to parse the number as an int at first then as float if that fails.
annotations[skey], err = jsonparser.ParseInt(value)
if err != nil {
annotations[skey], err = strconv.ParseFloat(obiutils.UnsafeString(value), 64)
}
case jsonparser.Array:
annotations[skey], err = _parse_json_array_interface(value)
case jsonparser.Object:
annotations[skey], err = _parse_json_map_interface(value)
case jsonparser.Boolean:
annotations[skey], err = jsonparser.ParseBoolean(value)
case jsonparser.Null:
annotations[skey] = nil
default:
log.Fatalf("Unknown data type %v", dataType)
}
}
if err != nil {
annotations[skey] = "NaN"
log.Fatalf("%s: Cannot parse value %s assicated to key %s into a %s value",
sequence.Id(), string(value), skey, dataType.String())
}
return err
}, },
) )
+147
View File
@@ -0,0 +1,147 @@
package obiformats
import (
"io"
"os"
"path"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
"github.com/buger/jsonparser"
"github.com/goccy/go-json"
log "github.com/sirupsen/logrus"
)
// _parse_json_record parses a single JSON object describing a sequence
// (as produced by JSONRecord in json_writer.go) into a *obiseq.BioSequence.
func _parse_json_record(raw []byte, shift byte) *obiseq.BioSequence {
sequence := obiseq.NewEmptyBioSequence(0)
if id, err := jsonparser.GetString(raw, "id"); err == nil {
sequence.SetId(id)
}
if seq, err := jsonparser.GetString(raw, "sequence"); err == nil {
sequence.SetSequence([]byte(seq))
}
if qual, err := jsonparser.GetString(raw, "qualities"); err == nil {
q := []byte(qual)
for i := 0; i < len(q); i++ {
q[i] -= shift
}
sequence.SetQualities(q)
}
if annot, dataType, _, err := jsonparser.Get(raw, "annotations"); err == nil && dataType == jsonparser.Object {
jsonparser.ObjectEach(annot,
func(key []byte, value []byte, valType jsonparser.ValueType, offset int) error {
return _parse_json_annotation_field(key, value, valType, sequence)
},
)
}
return sequence
}
// _ParseJsonFile streams the top-level JSON array, decoding and pushing one
// batch of sequences at a time, without ever loading the whole document in
// memory. Only one raw record at a time is buffered by the decoder.
func _ParseJsonFile(source string,
reader io.Reader,
out obiiter.IBioSequence,
shift byte,
batchSize int) {
dec := json.NewDecoder(reader)
if _, err := dec.Token(); err != nil {
if err == io.EOF {
out.Done()
return
}
log.Fatalf("cannot parse JSON data: %v", err)
}
slice := obiseq.MakeBioSequenceSlice()
o := 0
for dec.More() {
var raw json.RawMessage
if err := dec.Decode(&raw); err != nil {
log.Fatalf("cannot parse JSON data: %v", err)
}
sequence := _parse_json_record(raw, shift)
slice = append(slice, sequence)
if len(slice) >= batchSize {
out.Push(obiiter.MakeBioSequenceBatch(source, o, slice))
o++
slice = obiseq.MakeBioSequenceSlice()
}
}
if len(slice) > 0 {
out.Push(obiiter.MakeBioSequenceBatch(source, o, slice))
}
out.Done()
}
func ReadJSON(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
opt := MakeOptions(options)
out := obiiter.MakeIBioSequence()
out.Add(1)
go _ParseJsonFile(opt.Source(),
reader,
out,
obidefault.ReadQualitiesShift(),
opt.BatchSize())
go func() {
out.WaitAndClose()
}()
return out, nil
}
func ReadJSONFromFile(filename string, options ...WithOption) (obiiter.IBioSequence, error) {
options = append(options, OptionsSource(obiutils.RemoveAllExt((path.Base(filename)))))
file, err := obiutils.Ropen(filename)
if err == obiutils.ErrNoContent {
log.Infof("file %s is empty", filename)
return ReadEmptyFile(options...)
}
if err != nil {
return obiiter.NilIBioSequence, err
}
return ReadJSON(file, options...)
}
func ReadJSONFromStdin(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
options = append(options, OptionsSource(obiutils.RemoveAllExt("stdin")))
input, err := obiutils.Buf(os.Stdin)
if err == obiutils.ErrNoContent {
log.Infof("stdin is empty")
return ReadEmptyFile(options...)
}
if err != nil {
log.Fatalf("open file error: %v", err)
return obiiter.NilIBioSequence, err
}
return ReadJSON(input, options...)
}
+19
View File
@@ -35,6 +35,7 @@ type __options__ struct {
csv_auto bool csv_auto bool
paired_filename string paired_filename string
source string source string
filename string
with_feature_table bool with_feature_table bool
with_pattern bool with_pattern bool
with_parent bool with_parent bool
@@ -216,6 +217,16 @@ func (opt Options) Source() string {
return opt.pointer.source return opt.pointer.source
} }
// FileName returns the full path of the file being read, for use in
// diagnostic messages. It falls back to Source() when no explicit
// file name has been set (e.g. reading from stdin or a raw reader).
func (opt Options) FileName() string {
if opt.pointer.filename == "" {
return opt.pointer.source
}
return opt.pointer.filename
}
func (opt Options) WithFeatureTable() bool { func (opt Options) WithFeatureTable() bool {
return opt.pointer.with_feature_table return opt.pointer.with_feature_table
} }
@@ -421,6 +432,14 @@ func OptionsSource(source string) WithOption {
return f return f
} }
func OptionsFileName(filename string) WithOption {
f := WithOption(func(opt Options) {
opt.pointer.filename = filename
})
return f
}
func OptionsWithProgressBar() WithOption { func OptionsWithProgressBar() WithOption {
f := WithOption(func(opt Options) { f := WithOption(func(opt Options) {
opt.pointer.with_progress_bar = true opt.pointer.with_progress_bar = true
+2
View File
@@ -145,6 +145,8 @@ func ReadSequencesFromFile(filename string,
return ReadGenbank(reader, options...) return ReadGenbank(reader, options...)
case "text/csv": case "text/csv":
return ReadCSV(reader, options...) return ReadCSV(reader, options...)
case "application/json":
return ReadJSON(reader, options...)
default: default:
log.Fatalf("File %s has guessed format %s which is not yet implemented", log.Fatalf("File %s has guessed format %s which is not yet implemented",
filename, mime.String()) filename, mime.String())
+3 -3
View File
@@ -134,7 +134,7 @@ func TestUint128_QuoRem(t *testing.T) {
u := Uint128{w1: 3, w0: 8} u := Uint128{w1: 3, w0: 8}
v := Uint128{w1: 0, w0: 4} v := Uint128{w1: 0, w0: 4}
q, r := u.QuoRem(v) q, r := u.QuoRem(v)
assert.Equal(t, Uint128{w1: 0, w0: 2}, q) assert.Equal(t, Uint128{w1: 0, w0: 13835058055282163714}, q)
assert.Equal(t, Uint128{w1: 0, w0: 0}, r) assert.Equal(t, Uint128{w1: 0, w0: 0}, r)
} }
@@ -150,7 +150,7 @@ func TestUint128_Div(t *testing.T) {
u := Uint128{w1: 3, w0: 8} u := Uint128{w1: 3, w0: 8}
v := Uint128{w1: 0, w0: 4} v := Uint128{w1: 0, w0: 4}
q := u.Div(v) q := u.Div(v)
assert.Equal(t, Uint128{w1: 0, w0: 2}, q) assert.Equal(t, Uint128{w1: 0, w0: 13835058055282163714}, q)
} }
func TestUint128_Div64(t *testing.T) { func TestUint128_Div64(t *testing.T) {
@@ -183,7 +183,7 @@ func TestUint128_Cmp(t *testing.T) {
func TestUint128_Cmp64(t *testing.T) { func TestUint128_Cmp64(t *testing.T) {
u := Uint128{w1: 1, w0: 2} u := Uint128{w1: 1, w0: 2}
v := uint64(3) v := uint64(3)
assert.Equal(t, -1, u.Cmp64(v)) assert.Equal(t, 1, u.Cmp64(v))
} }
func TestUint128_Equals(t *testing.T) { func TestUint128_Equals(t *testing.T) {
+1 -1
View File
@@ -777,7 +777,7 @@ func (library *NGSLibrary) ExtractMultiBarcodeSliceWorker(options ...WithOption)
library.SetAllowsIndels(true) library.SetAllowsIndels(true)
} }
if opt.AllowedMismatches() > 0 { if opt.AllowedMismatchesIsSet() {
library.SetAllowedMismatches(opt.AllowedMismatches()) library.SetAllowedMismatches(opt.AllowedMismatches())
} }
+15 -7
View File
@@ -6,13 +6,14 @@ import (
) )
type _Options struct { type _Options struct {
discardErrors bool discardErrors bool
unidentified string unidentified string
allowedMismatch int allowedMismatch int
allowsIndel bool allowedMismatchSet bool
withProgressBar bool allowsIndel bool
parallelWorkers int withProgressBar bool
batchSize int parallelWorkers int
batchSize int
} }
// Options stores a set of option usable by the // Options stores a set of option usable by the
@@ -52,6 +53,7 @@ func OptionWithProgressBar(yes bool) WithOption {
func OptionAllowedMismatches(count int) WithOption { func OptionAllowedMismatches(count int) WithOption {
f := WithOption(func(opt Options) { f := WithOption(func(opt Options) {
opt.pointer.allowedMismatch = count opt.pointer.allowedMismatch = count
opt.pointer.allowedMismatchSet = true
}) })
return f return f
@@ -97,6 +99,12 @@ func (options Options) AllowedMismatches() int {
return options.pointer.allowedMismatch return options.pointer.allowedMismatch
} }
// AllowedMismatchesIsSet returns true if OptionAllowedMismatches
// was explicitly applied to these options.
func (options Options) AllowedMismatchesIsSet() bool {
return options.pointer.allowedMismatchSet
}
func (options Options) AllowsIndels() bool { func (options Options) AllowsIndels() bool {
return options.pointer.allowsIndel return options.pointer.allowsIndel
} }
+1 -1
View File
@@ -3,7 +3,7 @@ package obioptions
// Version is automatically updated by the Makefile from version.txt // Version is automatically updated by the Makefile from version.txt
// The patch number (third digit) is incremented on each push to the repository // The patch number (third digit) is incremented on each push to the repository
var _Version = "Release 4.4.46" var _Version = "Release 4.5.0"
// Version returns the version of the obitools package. // Version returns the version of the obitools package.
// //
+6
View File
@@ -24,6 +24,7 @@ var __input_genbank_format__ = false
var __input_fastq_format__ = false var __input_fastq_format__ = false
var __input_fasta_format__ = false var __input_fasta_format__ = false
var __input_csv_format__ = false var __input_csv_format__ = false
var __input_json_format__ = false
var __output_in_fasta__ = false var __output_in_fasta__ = false
var __output_in_fastq__ = false var __output_in_fastq__ = false
@@ -71,6 +72,9 @@ func InputOptionSet(options *getoptions.GetOpt) {
options.BoolVar(&__input_csv_format__, "csv", __input_csv_format__, options.BoolVar(&__input_csv_format__, "csv", __input_csv_format__,
options.Description("Read data following the CSV format.")) options.Description("Read data following the CSV format."))
options.BoolVar(&__input_json_format__, "json", __input_json_format__,
options.Description("Read data following the JSON format."))
options.BoolVar(&__no_ordered_input__, "no-order", __no_ordered_input__, options.BoolVar(&__no_ordered_input__, "no-order", __no_ordered_input__,
options.Description("When several input files are provided, "+ options.Description("When several input files are provided, "+
"indicates that there is no order among them.")) "indicates that there is no order among them."))
@@ -158,6 +162,8 @@ func CLIInputFormat() string {
return "genbank" return "genbank"
case __input_csv_format__: case __input_csv_format__:
return "csv" return "csv"
case __input_json_format__:
return "json"
default: default:
return "guessed" return "guessed"
} }
+7 -1
View File
@@ -73,7 +73,9 @@ func ExpandListOfFiles(check_ext bool, filenames ...string) ([]string, error) {
strings.HasSuffix(path, "dat") || strings.HasSuffix(path, "dat") ||
strings.HasSuffix(path, "dat.gz") || strings.HasSuffix(path, "dat.gz") ||
strings.HasSuffix(path, "ecopcr") || strings.HasSuffix(path, "ecopcr") ||
strings.HasSuffix(path, "ecopcr.gz") { strings.HasSuffix(path, "ecopcr.gz") ||
strings.HasSuffix(path, "json") ||
strings.HasSuffix(path, "json.gz") {
log.Debugf("Appending %s file\n", path) log.Debugf("Appending %s file\n", path)
list_of_files.Add(path) list_of_files.Add(path)
} }
@@ -142,6 +144,8 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
iterator, err = obiformats.ReadFastq(os.Stdin, opts...) iterator, err = obiformats.ReadFastq(os.Stdin, opts...)
case "csv": case "csv":
iterator, err = obiformats.ReadCSV(os.Stdin, opts...) iterator, err = obiformats.ReadCSV(os.Stdin, opts...)
case "json":
iterator, err = obiformats.ReadJSON(os.Stdin, opts...)
default: default:
iterator, err = obiformats.ReadSequencesFromStdin(opts...) iterator, err = obiformats.ReadSequencesFromStdin(opts...)
} }
@@ -163,6 +167,8 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
reader = obiformats.ReadFastaFromFile reader = obiformats.ReadFastaFromFile
case "csv": case "csv":
reader = obiformats.ReadCSVFromFile reader = obiformats.ReadCSVFromFile
case "json":
reader = obiformats.ReadJSONFromFile
case "ecopcr": case "ecopcr":
reader = obiformats.ReadEcoPCRFromFile reader = obiformats.ReadEcoPCRFromFile
case "embl": case "embl":
+1 -1
View File
@@ -170,7 +170,7 @@ func CLISelectLandmarkSequences(iterator obiiter.IBioSequence) obiiter.IBioSeque
for i, seq := range library { for i, seq := range library {
taxon := seq.Taxon(taxo) taxon := seq.Taxon(taxo)
if taxon == nil { if taxon == nil {
log.Fatal("%s: Cannot identify taxid %s in %s", seq.Id(), seq.Taxid(), taxo.Name()) log.Fatalf("%s: Cannot identify taxid %s in %s", seq.Id(), seq.Taxid(), taxo.Name())
} }
taxa.Set(i, taxon) taxa.Set(i, taxon)
} }
+8 -1
View File
@@ -15,7 +15,6 @@ func IExtractBarcode(iterator obiiter.IBioSequence) (obiiter.IBioSequence, error
opts := make([]obingslibrary.WithOption, 0, 10) opts := make([]obingslibrary.WithOption, 0, 10)
opts = append(opts, opts = append(opts,
obingslibrary.OptionAllowedMismatches(CLIAllowedMismatch()),
obingslibrary.OptionAllowedIndel(CLIAllowsIndel()), obingslibrary.OptionAllowedIndel(CLIAllowsIndel()),
obingslibrary.OptionUnidentified(CLIUnidentifiedFileName()), obingslibrary.OptionUnidentified(CLIUnidentifiedFileName()),
obingslibrary.OptionDiscardErrors(!CLIConservedErrors()), obingslibrary.OptionDiscardErrors(!CLIConservedErrors()),
@@ -23,6 +22,14 @@ func IExtractBarcode(iterator obiiter.IBioSequence) (obiiter.IBioSequence, error
obingslibrary.OptionBatchSize(obidefault.BatchSize()), obingslibrary.OptionBatchSize(obidefault.BatchSize()),
) )
// Only propagate the CLI --allowed-mismatches value if the user
// explicitly set it: otherwise the per-primer values defined in
// the NGSFilter config file (@primer_mismatches, @forward_mismatches,
// @reverse_mismatches) must be preserved.
if CLIAllowedMismatchIsSet() {
opts = append(opts, obingslibrary.OptionAllowedMismatches(CLIAllowedMismatch()))
}
ngsfilter, err := CLINGSFIlter() ngsfilter, err := CLINGSFIlter()
if err != nil { if err != nil {
log.Fatalf("%v", err) log.Fatalf("%v", err)
+12
View File
@@ -18,6 +18,7 @@ var _UnidentifiedFile = ""
var _AllowedMismatch = 2 var _AllowedMismatch = 2
var _AllowsIndel = false var _AllowsIndel = false
var _ConservedError = false var _ConservedError = false
var _optionsParser *getoptions.GetOpt
// PCROptionSet defines every options related to a simulated PCR. // PCROptionSet defines every options related to a simulated PCR.
// //
@@ -29,6 +30,8 @@ var _ConservedError = false
// - option : is a pointer to a getoptions.GetOpt instance normaly // - option : is a pointer to a getoptions.GetOpt instance normaly
// produced by the // produced by the
func MultiplexOptionSet(options *getoptions.GetOpt) { func MultiplexOptionSet(options *getoptions.GetOpt) {
_optionsParser = options
options.StringVar(&_NGSFilterFile, "tag-list", _NGSFilterFile, options.StringVar(&_NGSFilterFile, "tag-list", _NGSFilterFile,
options.Alias("s"), options.Alias("s"),
options.Description("File name of the NGSFilter file describing PCRs.")) options.Description("File name of the NGSFilter file describing PCRs."))
@@ -62,6 +65,15 @@ func CLIAllowedMismatch() int {
return _AllowedMismatch return _AllowedMismatch
} }
// CLIAllowedMismatchIsSet returns true if the user explicitly
// specified --allowed-mismatches on the command line, as opposed
// to relying on its default value. This allows per-primer mismatch
// settings from the NGSFilter config file to take precedence unless
// the user explicitly overrides them from the CLI.
func CLIAllowedMismatchIsSet() bool {
return _optionsParser != nil && _optionsParser.Called("allowed-mismatches")
}
func CLIAllowsIndel() bool { func CLIAllowsIndel() bool {
return _AllowsIndel return _AllowsIndel
} }
+1 -1
View File
@@ -55,7 +55,7 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
ngsfilter.SetAllowsIndels(true) ngsfilter.SetAllowsIndels(true)
} }
if obimultiplex.CLIAllowedMismatch() > 0 { if obimultiplex.CLIAllowedMismatchIsSet() {
ngsfilter.SetAllowedMismatches(obimultiplex.CLIAllowedMismatch()) ngsfilter.SetAllowedMismatches(obimultiplex.CLIAllowedMismatch())
} }
+6
View File
@@ -102,6 +102,11 @@ func RegisterOBIMimeType() {
return ok return ok
} }
jsonDetector := func(raw []byte, limit uint32) bool {
raw = bytes.TrimLeft(raw, " \t\r\n")
return len(raw) > 0 && (raw[0] == '[' || raw[0] == '{')
}
mimetype.Lookup("text/plain").Extend(fastaDetector, "text/fasta", ".fasta") mimetype.Lookup("text/plain").Extend(fastaDetector, "text/fasta", ".fasta")
mimetype.Lookup("text/plain").Extend(fastqDetector, "text/fastq", ".fastq") mimetype.Lookup("text/plain").Extend(fastqDetector, "text/fastq", ".fastq")
mimetype.Lookup("text/plain").Extend(ecoPCR2Detector, "text/ecopcr2", ".ecopcr") mimetype.Lookup("text/plain").Extend(ecoPCR2Detector, "text/ecopcr2", ".ecopcr")
@@ -115,6 +120,7 @@ func RegisterOBIMimeType() {
mimetype.Lookup("application/octet-stream").Extend(genbankDetector, "text/genbank", ".seq") mimetype.Lookup("application/octet-stream").Extend(genbankDetector, "text/genbank", ".seq")
mimetype.Lookup("application/octet-stream").Extend(emblDetector, "text/embl", ".dat") mimetype.Lookup("application/octet-stream").Extend(emblDetector, "text/embl", ".dat")
mimetype.Lookup("application/octet-stream").Extend(csv, "text/csv", ".csv") mimetype.Lookup("application/octet-stream").Extend(csv, "text/csv", ".csv")
mimetype.Lookup("application/octet-stream").Extend(jsonDetector, "application/json", ".json")
} }
__obimimetype_registred__ = true __obimimetype_registred__ = true
} }
+1 -1
View File
@@ -1 +1 @@
4.4.46 4.5.0