Add a complete documented example of the new obitag format

Former-commit-id: 748a2357cc29aefd3bdee55c85c06eab31fb9fe1
This commit is contained in:
Eric Coissac
2024-06-06 23:44:23 +02:00
parent e47b50de7f
commit bc12b1aaa2
2 changed files with 107 additions and 5 deletions
+106 -4
View File
@@ -99,10 +99,112 @@ func CLIAskConfigTemplate() bool {
}
func CLIConfigTemplate() string {
return `experiment,sample,sample_tag,forward_primer,reverse_primer
return `###
### Example of NGSFilter CSV configuration file
###
#
# The CSV file can contain comments starting with the # character
# and empty lines.
# At the top of the file a set of lines of three or four columns and having
# the first column containing @param can be used to define parameters
# for the obimultiplex tool. The structure of these lines is :
#
# @param,parameter_name,parameter_value
# @param,parameter_name,parameter_value1,parameter_value2
#
# The following lines describes the PCR multiplexed in the sequencing library.
# The first line describes the columns of the CSV file and the following lines
# describe the PCR multiplexed.
#
# Five columns are expected :
#
# - experiment: the experiment name
# - sample: the sample (pcr) name
# - sample_tag: the tag identifying the sample
# - forward_primer: the forward primer sequence
# - reverse_primer: the reverse primer sequence
#
# Supplementary columns are allowed. Their names and content will be used to
# annotate the sequence corresponding to the sample, as the key=value; located
# after the @ sign did in the original ngsfilter file format.
#
###
### Description of the parameters
###
#
# The forward_spacer and the reverse_spacer allow to specify the number of
# nucleotide separating the 5' end of the forward or reverse primer respectively
# to the 3' end of the tag. The default value is 0.
#
# The param spacer allows for specify this value for both forward and reverse
# simultaneously. The spacer parameter can also, when used wirh two arguments,
# allow to specify the # the spacer value for a specific primer:
#
# @param,spacer,CAGCTGCTATGTCGATGCTGACT,2
#
@param,forward_spacer,0
@param,reverse_spacer,0
#
# A new method for designing indel proof tag is to not use one of the four
# nucleotides in their sequence and to flank the tag with this fourth nucleotide.
# That nucleotide is the tag delimiter. Similarly, to the spacer value,
# three ways to specify the tag delimiter exist:
# - the forward_tag_delimiter and reverse_tag_delimiter
# - the tag_delimiter in its two forms with one and two arguments
#
@param,forward_tag_delimiter,0
@param,reverse_tag_delimiter,0
#
# Three algorithms are available to math a pair of tags with a sample.
# It is specified using the @matching parameter. The three possible
# values are strict, hamming, and indel. The default value is strict.
# As for previous parameters, forward_matching and reverse_matching can
# be used to specify the matching value for each primer. And spacer
# can be used with two arguments to specify the matching value for
# a specific primer.
#
@param,matching,strict
#
# The primer_mismatches parameter allows to specify the number of errors allowed
# when matching the primer. The default value is 2. The same declination of
# the parameters forward_primer_mismatches and reverse_primer_mismatches exist.
#
@param,primer_mismatches,2
#
# The @indel parameter allows to specify if indel are allowed during the matching
# of the primers to the sequence. The default value is false. forward_indel and
# reverse_indel can be used to specify the value for each primer.
#
@param,indels,false
#
###
### Description of the PCR multiplexed
###
#
# Below is an example for the minimal description of the PCRs multiplexed in the
# sequencing library.
#
# The first line is the column names and must exist.
# Five columns are expected :
# - experiment: the experiment name, that allows for grouping samples
# - sample: the sample (pcr) name
# - sample_tag: the tag identifying the sample
# The sample tag must be unique in the library for a given pair of primers
# + They can be a simple DNA word as here. This means that the same tag is used
# for both primers.
# + It can be two DNA words separated by a colon. For example, aagtag:gaagtag.
# This means that the first tag is used for the forward primer and the second for the
# reverse primers. "aagtag" is the same as "aagtag:aagtag".
# + In the two word syntax, if a primer forward or reverse is not tagged, its tag
# is replaced by a hyphen '-', for example 'aagtag:-' or '-:aagtag'.
# For a given primer all the tags must have the same length.
# - forward_primer: the forward primer sequence
# - reverse_primer: the reverse primer sequence
#
experiment,sample,sample_tag,forward_primer,reverse_primer
wolf_diet,13a_F730603,aattaac,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
wolf_diet,15a_F730814,gaagtag:gaatatc,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
wolf_diet,26a_F040644,gaatatc:-,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
wolf_diet,29a_F260619,-:-,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
wolf_diet,15a_F730814,gaagtag,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
wolf_diet,26a_F040644,gaatatc,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
wolf_diet,29a_F260619,gcctcct,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
`
}