mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-03-25 21:40:52 +00:00
Compare commits
37 Commits
Release_4.
...
Release_4.
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
0580611031 | ||
|
|
c30a22d356 | ||
|
|
1ce5da9bee | ||
|
|
dc23d9de9a | ||
|
|
aa9d7bbf72 | ||
|
|
db22d20d0a | ||
|
|
7c05bdb01c | ||
|
|
b6542c4523 | ||
|
|
ac41dd8a22 | ||
|
|
bebbbbfe7d | ||
|
|
c6e04265f1 | ||
|
|
9babcc0fae | ||
|
|
e775f7e256 | ||
|
|
f2937af1ad | ||
|
|
56c1f4180c | ||
|
|
f78543ee75 | ||
|
|
a016ad5b8a | ||
|
|
09d437d10f | ||
|
|
d00ab6f83a | ||
|
|
8037860518 | ||
|
|
43d6cbe56a | ||
|
|
6dadee9371 | ||
|
|
99a8e69d10 | ||
|
|
c0ae49ef92 | ||
|
|
08490420a2 | ||
|
|
1a28d5ed64 | ||
|
|
b2d16721f0 | ||
|
|
7c12b1ee83 | ||
|
|
db98ddb241 | ||
|
|
7a979ba77f | ||
|
|
00c8be6b48 | ||
|
|
4ae331db36 | ||
|
|
f1e2846d2d | ||
|
|
cd5562fb30 | ||
|
|
f79b018430 | ||
|
|
da8d851d4d | ||
|
|
9823bcb41b |
16
.github/workflows/obitest.yml
vendored
16
.github/workflows/obitest.yml
vendored
@@ -9,11 +9,11 @@ jobs:
|
|||||||
build:
|
build:
|
||||||
runs-on: ubuntu-latest
|
runs-on: ubuntu-latest
|
||||||
steps:
|
steps:
|
||||||
- name: Setup Go
|
- name: Checkout obitools4 project
|
||||||
uses: actions/setup-go@v2
|
uses: actions/checkout@v4
|
||||||
with:
|
- name: Setup Go
|
||||||
go-version: '1.23'
|
uses: actions/setup-go@v5
|
||||||
- name: Checkout obitools4 project
|
with:
|
||||||
uses: actions/checkout@v4
|
go-version: "1.23"
|
||||||
- name: Run tests
|
- name: Run tests
|
||||||
run: make githubtests
|
run: make githubtests
|
||||||
|
|||||||
3
.gitignore
vendored
3
.gitignore
vendored
@@ -31,3 +31,6 @@ LLM/**
|
|||||||
*_files
|
*_files
|
||||||
|
|
||||||
entropy.html
|
entropy.html
|
||||||
|
bug_id.txt
|
||||||
|
obilowmask_ref
|
||||||
|
test_*
|
||||||
|
|||||||
29
Makefile
29
Makefile
@@ -133,14 +133,33 @@ jjpush:
|
|||||||
@jj auto-describe
|
@jj auto-describe
|
||||||
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
|
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
|
||||||
@jj new
|
@jj new
|
||||||
@$(MAKE) bump-version
|
@previous_version=$$(cat version.txt); \
|
||||||
@echo "$(BLUE)→ Documenting version bump commit...$(NC)"
|
$(MAKE) bump-version; \
|
||||||
@jj auto-describe
|
version=$$(cat version.txt); \
|
||||||
@version=$$(cat version.txt); \
|
|
||||||
tag_name="Release_$$version"; \
|
tag_name="Release_$$version"; \
|
||||||
|
previous_tag="Release_$$previous_version"; \
|
||||||
|
echo "$(BLUE)→ Documenting version bump commit...$(NC)"; \
|
||||||
|
jj auto-describe; \
|
||||||
|
echo "$(BLUE)→ Generating release notes from $$previous_tag to current commit...$(NC)"; \
|
||||||
|
if command -v orla >/dev/null 2>&1 && command -v jq >/dev/null 2>&1; then \
|
||||||
|
release_json=$$(jj log -r "$$previous_tag::@" -T 'commit_id.short() ++ " " ++ description' | \
|
||||||
|
ORLA_MAX_TOOL_CALLS=50 orla agent -m ollama:qwen3-coder-next:latest \
|
||||||
|
"Summarize the following commits into a GitHub release note for version $$version. Ignore commits related to version bumps, .gitignore changes, or any internal housekeeping that is irrelevant to end users. Describe each user-facing change precisely without exposing code. Eliminate redundancy. Output strictly valid JSON with no surrounding text, using this exact schema: {\"title\": \"<short release title>\", \"body\": \"<detailed markdown release notes>\"}"); \
|
||||||
|
release_json=$$(echo "$$release_json" | sed -n '/^{/,/^}/p'); \
|
||||||
|
release_title=$$(echo "$$release_json" | jq -r '.title // empty') ; \
|
||||||
|
release_body=$$(echo "$$release_json" | jq -r '.body // empty') ; \
|
||||||
|
if [ -n "$$release_title" ] && [ -n "$$release_body" ]; then \
|
||||||
|
release_message="$$release_title"$$'\n\n'"$$release_body"; \
|
||||||
|
else \
|
||||||
|
echo "$(YELLOW)⚠ JSON parsing failed, falling back to raw output$(NC)"; \
|
||||||
|
release_message="Release $$version"$$'\n\n'"$$release_json"; \
|
||||||
|
fi; \
|
||||||
|
else \
|
||||||
|
release_message="Release $$version"; \
|
||||||
|
fi; \
|
||||||
echo "$(BLUE)→ Pushing commits and creating tag $$tag_name...$(NC)"; \
|
echo "$(BLUE)→ Pushing commits and creating tag $$tag_name...$(NC)"; \
|
||||||
jj git push --change @; \
|
jj git push --change @; \
|
||||||
git tag -a "$$tag_name" -m "Release $$version" 2>/dev/null || echo "Tag $$tag_name already exists"; \
|
git tag -a "$$tag_name" -m "$$release_message" 2>/dev/null || echo "Tag $$tag_name already exists"; \
|
||||||
git push origin "$$tag_name" 2>/dev/null || echo "Tag already pushed"
|
git push origin "$$tag_name" 2>/dev/null || echo "Tag already pushed"
|
||||||
@echo "$(GREEN)✓ Commits and tag pushed to repository$(NC)"
|
@echo "$(GREEN)✓ Commits and tag pushed to repository$(NC)"
|
||||||
|
|
||||||
|
|||||||
755
blackboard/Prospective/canonical-super-kmer-strategy.md
Normal file
755
blackboard/Prospective/canonical-super-kmer-strategy.md
Normal file
@@ -0,0 +1,755 @@
|
|||||||
|
# Prospective : Index k-mer v3 — Super-kmers canoniques, unitigs, et Aho-Corasick
|
||||||
|
|
||||||
|
## 1. Constat sur l'index v1
|
||||||
|
|
||||||
|
L'index actuel (`.kdi` delta-varint) stocke 18.6 milliards de k-mers (k=31, m=13, P=4096, 2 sets) en 85 Go, soit 4.8-5.6 bytes/k-mer. Les causes :
|
||||||
|
|
||||||
|
- Le canonical standard `min(fwd, rc)` disperse les k-mers sur 62 bits → deltas ~2^40 → 5-6 bytes varint
|
||||||
|
- Les k-mers partagés entre sets sont stockés N fois (une fois par set)
|
||||||
|
- Le matching nécessite N×P ouvertures de fichier (N passes)
|
||||||
|
|
||||||
|
## 2. Observations expérimentales
|
||||||
|
|
||||||
|
### 2.1 Déréplication brute
|
||||||
|
|
||||||
|
Sur un génome de *Betula exilis* 15× couvert, le pipeline `obik lowmask | obik super | obiuniq` réduit **80 Go de fastq.gz en 5.6 Go de fasta.gz** — un facteur 14×. Cela montre que la déréplication au niveau super-kmer est extrêmement efficace et que les super-kmers forment une représentation naturellement compacte.
|
||||||
|
|
||||||
|
### 2.2 Après filtre de fréquence (count > 1)
|
||||||
|
|
||||||
|
En éliminant les super-kmers observés une seule fois (erreurs de séquençage), le fichier passe de 5.6 Go à **2.7 Go de fasta.gz**. Les statistiques détaillées (obicount) :
|
||||||
|
|
||||||
|
| Métrique | Valeur |
|
||||||
|
|----------|--------|
|
||||||
|
| Variants (super-kmers uniques) | 37,294,271 |
|
||||||
|
| Reads (somme des counts) | 148,828,167 |
|
||||||
|
| Symboles (bases totales variants) | 1,415,018,593 |
|
||||||
|
| Longueur moyenne super-kmer | **37.9 bases** |
|
||||||
|
| K-mers/super-kmer moyen (k=31) | **7.9** |
|
||||||
|
| K-mers totaux estimés | **~295M** |
|
||||||
|
| Count moyen par super-kmer | **4.0×** |
|
||||||
|
|
||||||
|
### 2.3 Comparaison avec l'index v1
|
||||||
|
|
||||||
|
| Format | Taille | K-mers | Bytes/k-mer |
|
||||||
|
|--------|--------|--------|-------------|
|
||||||
|
| Index .kdi v1 (set Human dans Contaminent_idx) | 12.8 Go | ~3B | 4.3 |
|
||||||
|
| Delta-varint hypothétique (295M k-mers) | ~1.5 Go | 295M | 5.0 |
|
||||||
|
| Super-kmers 2-bit packed (*Betula* count>1) | ~354 Mo | 295M | **1.2** |
|
||||||
|
| Super-kmers fasta.gz (*Betula* count>1) | 2.7 Go | 295M | 9.2* |
|
||||||
|
|
||||||
|
\* Le fasta.gz inclut les headers, les counts, et la compression gzip — pas directement comparable au format binaire.
|
||||||
|
|
||||||
|
**Le format super-kmer 2-bit est ~4× plus compact que le delta-varint** à nombre égal de k-mers. Cette efficacité vient du fait qu'un super-kmer de 38 bases encode 8 k-mers en ~10 bytes au lieu de 8 × 5 = 40 bytes en delta-varint.
|
||||||
|
|
||||||
|
Note : la comparaison n'est pas directe (Contaminent_idx = génomes assemblés, *Betula* = reads bruts filtrés), mais le ratio bytes/k-mer est comparable car il dépend de la longueur des super-kmers, pas de la source des données.
|
||||||
|
|
||||||
|
## 3. Stratégie proposée : pipeline de construction v3
|
||||||
|
|
||||||
|
### 3.1 Définition du k-mer minimizer-canonique
|
||||||
|
|
||||||
|
On redéfinit la forme canonique d'un k-mer en fonction de son minimiseur :
|
||||||
|
|
||||||
|
```
|
||||||
|
CanonicalKmer(kmer, k, m) :
|
||||||
|
minimizer = plus petit m-mer canonique dans le k-mer
|
||||||
|
si minimizer == forward_mmer(minimizer_pos)
|
||||||
|
→ garder le k-mer tel quel
|
||||||
|
sinon
|
||||||
|
→ prendre le reverse-complement du k-mer
|
||||||
|
```
|
||||||
|
|
||||||
|
Propriétés :
|
||||||
|
- **m impair** → aucun m-mer ne peut être palindromique (`m_mer != RC(m_mer)` toujours) → la canonisation par le minimiseur est toujours non-ambiguë. C'est m, pas k, qui doit être impair : l'ambiguïté viendrait d'un minimiseur palindrome (`min == RC(min)`), auquel cas on ne saurait pas dans quel sens orienter le k-mer/super-kmer.
|
||||||
|
- Tous les k-mers d'un super-kmer partagent le même minimiseur
|
||||||
|
- **La canonisation peut se faire au niveau du super-kmer entier** : si `minimizer != canonical(minimizer)`, on RC le super-kmer complet. Tous les k-mers qu'il contient deviennent automatiquement minimizer-canoniques.
|
||||||
|
|
||||||
|
### 3.2 Pipeline de construction
|
||||||
|
|
||||||
|
```
|
||||||
|
Séquences brutes ([]byte, 1 byte/base)
|
||||||
|
│
|
||||||
|
▼
|
||||||
|
[0] Encodage 2-bit + nettoyage
|
||||||
|
│ - Encoder chaque séquence en 2 bits/base ([]byte packed)
|
||||||
|
│ - Couper aux bases ambiguës (N, R, Y, W, S, K, M, B, D, H, V)
|
||||||
|
│ - Retirer les fragments de longueur < k
|
||||||
|
│ - Résultat : fragments 2-bit clean, prêts pour toutes les opérations
|
||||||
|
▼
|
||||||
|
[1] Filtre de complexité (lowmask sur vecteurs 2-bit)
|
||||||
|
│ Supprime/masque les régions de faible entropie
|
||||||
|
▼
|
||||||
|
[2] Extraction des super-kmers (sur vecteurs 2-bit, non canonisé)
|
||||||
|
│ Chaque super-kmer a un minimiseur et une séquence 2-bit packed
|
||||||
|
▼
|
||||||
|
[3] Canonisation au niveau super-kmer
|
||||||
|
│ Si minimizer != CanonicalKmer(minimizer) → RC le super-kmer (op bit)
|
||||||
|
│ Résultat : super-kmers canoniques 2-bit packed
|
||||||
|
▼
|
||||||
|
[4] Écriture dans les partitions .skm (partition = minimizer % P)
|
||||||
|
│ Format natif 2-bit → écriture directe, pas de conversion
|
||||||
|
▼
|
||||||
|
[5] Déréplication des super-kmers par partition
|
||||||
|
│ Trier les super-kmers (comparaison uint64 sur données packed → très rapide)
|
||||||
|
│ Compter les occurrences identiques
|
||||||
|
│ Résultat : super-kmers uniques avec count
|
||||||
|
▼
|
||||||
|
[6] Construction des unitigs canoniques par partition
|
||||||
|
│ Assembler les super-kmers qui se chevauchent de (k-1) bases
|
||||||
|
│ en chaînes linéaires non-branchantes (tout en 2-bit)
|
||||||
|
│ Propager les counts : vecteur de poids par unitig
|
||||||
|
▼
|
||||||
|
[7] Filtre de fréquence sur le graphe pondéré (voir section 4)
|
||||||
|
│ Supprimer les k-mers (positions) avec poids < seuil
|
||||||
|
│ Re-calculer les unitigs après filtrage
|
||||||
|
▼
|
||||||
|
[8] Stockage des unitigs avec bitmask multiset
|
||||||
|
│ Format compact sur disque (déjà en 2-bit, écriture directe)
|
||||||
|
▼
|
||||||
|
Index v3
|
||||||
|
```
|
||||||
|
|
||||||
|
### 3.2bis Pourquoi encoder en 2-bit dès le début ?
|
||||||
|
|
||||||
|
**Alternative rejetée** : travailler en `[]byte` (1 byte/base) puis encoder en 2-bit seulement pour le stockage final.
|
||||||
|
|
||||||
|
| Aspect | `[]byte` (1 byte/base) | 2-bit packed |
|
||||||
|
|--------|----------------------|--------------|
|
||||||
|
| Programmation | Simple (slicing natif, pas de bit-shift) | Plus complexe (masques, shifts) |
|
||||||
|
| Mémoire par super-kmer (38 bases) | 38 bytes | 10 bytes (**3.8×** moins) |
|
||||||
|
| 37M super-kmers en RAM | ~1.4 Go | ~370 Mo |
|
||||||
|
| Tri (comparaison) | `bytes.Compare` sur slices | Comparaison uint64 (**beaucoup** plus rapide) |
|
||||||
|
| Format .skm | Conversion encode/decode à chaque I/O | Écriture/lecture directe |
|
||||||
|
| RC d'un super-kmer | Boucle sur bytes + lookup | Opérations bit (une instruction pour complement) |
|
||||||
|
|
||||||
|
L'opération la plus coûteuse du pipeline est le **tri des super-kmers** pour la déréplication (étape 5). En 2-bit packed, un super-kmer de ≤32 bases tient dans un `uint64` → tri par comparaison entière (une instruction CPU). Un super-kmer de 33-64 bases tient dans deux `uint64` → tri en deux comparaisons.
|
||||||
|
|
||||||
|
Le code de manipulation 2-bit est plus complexe à écrire mais **s'écrit une seule fois** (bibliothèque de primitives) et bénéficie à toute la chaîne. Le gain en mémoire (4×) et en temps de tri est significatif sur des dizaines de millions de super-kmers.
|
||||||
|
|
||||||
|
### 3.3 Canonisation des super-kmers : pourquoi ça marche
|
||||||
|
|
||||||
|
**Point crucial** : les super-kmers doivent être construits en utilisant le minimiseur **non-canonique** (le m-mer brut tel qu'il apparaît dans la séquence), et non le minimiseur canonique `min(fwd, rc)`.
|
||||||
|
|
||||||
|
**Pourquoi ?** Si on utilise le minimiseur canonique comme critère de regroupement, un même super-kmer pourrait contenir le minimiseur dans ses **deux orientations** à des positions différentes (le m-mer forward à une position, et sa forme RC à une autre position, ayant la même valeur canonique). Dans ce cas, le RC du super-kmer ne résoudrait pas l'ambiguïté.
|
||||||
|
|
||||||
|
**Algorithme correct** :
|
||||||
|
|
||||||
|
1. **Extraction** : construire les super-kmers en regroupant les k-mers consécutifs qui partagent le même m-mer minimal **non-canonique** (le m-mer brut). Au sein d'un tel super-kmer, le minimiseur apparaît toujours dans **une seule orientation**.
|
||||||
|
|
||||||
|
2. **Canonisation** : pour chaque super-kmer, comparer son minimiseur brut à `canonical(minimizer) = min(minimizer, RC(minimizer))` :
|
||||||
|
- Si `minimizer == canonical(minimizer)` → le minimiseur est déjà en forward → garder le super-kmer tel quel
|
||||||
|
- Si `minimizer != canonical(minimizer)` → le minimiseur est en RC → RC le super-kmer entier → le minimiseur apparaît maintenant en forward
|
||||||
|
|
||||||
|
Après cette étape, **chaque k-mer du super-kmer** contient le minimiseur canonique en position forward, ce qui correspond exactement à notre définition de k-mer minimizer-canonique.
|
||||||
|
|
||||||
|
**Note** : cela signifie que l'algorithme `IterSuperKmers` actuel (qui utilise le minimiseur canonique pour le regroupement) doit être modifié pour utiliser le minimiseur brut. C'est un changement dans le critère de rupture des super-kmers : on casse quand le **m-mer minimal brut** change, pas quand le **m-mer minimal canonique** change. Les super-kmers résultants seront potentiellement plus courts (un changement d'orientation du minimiseur force une coupure), mais c'est le prix de la canonicité absolue.
|
||||||
|
|
||||||
|
### 3.4 Déréplication des super-kmers
|
||||||
|
|
||||||
|
Deux super-kmers identiques (même séquence, même minimiseur) correspondent aux mêmes k-mers. On peut les dérépliquer en triant :
|
||||||
|
|
||||||
|
1. Par minimiseur (déjà partitionné)
|
||||||
|
2. Par séquence (tri lexicographique des séquences 2-bit packed)
|
||||||
|
|
||||||
|
Les super-kmers identiques deviennent consécutifs dans le tri → comptage linéaire.
|
||||||
|
|
||||||
|
Le tri peut se faire sur les fichiers .skm d'une partition, en mémoire si la partition tient en RAM, ou par merge-sort externe sinon.
|
||||||
|
|
||||||
|
## 4. Filtre de fréquence
|
||||||
|
|
||||||
|
### 4.1 Problème
|
||||||
|
|
||||||
|
Le filtre de fréquence (`--min-occurrence N`) élimine les k-mers vus moins de N fois. Avec la déréplication des super-kmers, on a un count par super-kmer, pas par k-mer. Un k-mer peut apparaître dans plusieurs super-kmers différents (aux jonctions, ou quand le minimiseur change), donc le count exact d'un k-mer n'est connu qu'après fusion.
|
||||||
|
|
||||||
|
### 4.2 Solution : filtrage sur le graphe de De Bruijn pondéré
|
||||||
|
|
||||||
|
Le filtre de fréquence doit être appliqué **après** la construction des unitigs canoniques (section 5), et non avant. Le pipeline devient :
|
||||||
|
|
||||||
|
```
|
||||||
|
Super-kmers canoniques dérepliqués (avec counts)
|
||||||
|
│
|
||||||
|
▼
|
||||||
|
Construction des unitigs canoniques (section 5)
|
||||||
|
│ Chaque position dans un unitig porte un poids
|
||||||
|
│ = somme des counts des super-kmers couvrant ce k-mer
|
||||||
|
▼
|
||||||
|
Graphe de De Bruijn pondéré (implicite dans les unitigs)
|
||||||
|
│
|
||||||
|
▼
|
||||||
|
Filtrage : supprimer les k-mers (positions) avec poids < seuil
|
||||||
|
│ Cela casse certains unitigs en fragments
|
||||||
|
▼
|
||||||
|
Recalcul des unitigs sur le graphe filtré
|
||||||
|
│
|
||||||
|
▼
|
||||||
|
Unitigs filtrés finaux
|
||||||
|
```
|
||||||
|
|
||||||
|
**Avantages** :
|
||||||
|
- Le filtre opère sur les **k-mers exacts** avec leurs **counts exacts** (pas une approximation par super-kmer)
|
||||||
|
- Le graphe de De Bruijn est implicitement contenu dans les unitigs — pas besoin de le construire explicitement avec une `map[uint64]uint`
|
||||||
|
- Les k-mers aux jonctions de super-kmers ont leurs counts correctement agrégés
|
||||||
|
|
||||||
|
### 4.3 Calcul du poids de chaque position dans un unitig
|
||||||
|
|
||||||
|
Un unitig est construit par chaînage de super-kmers. Chaque super-kmer S de longueur L et count C contribue (L-k+1) k-mers, chacun avec poids C. Quand deux super-kmers se chevauchent de (k-1) bases dans l'unitig, les k-mers de la zone de chevauchement reçoivent la **somme** des counts des deux super-kmers.
|
||||||
|
|
||||||
|
En pratique, lors de la construction de l'unitig par chaînage, on construit un vecteur de poids `weights[0..nkmers-1]` :
|
||||||
|
```
|
||||||
|
Pour chaque super-kmer S (count=C) ajouté à l'unitig:
|
||||||
|
Pour chaque position i couverte par S dans l'unitig:
|
||||||
|
weights[i] += C
|
||||||
|
```
|
||||||
|
|
||||||
|
### 4.4 Filtrage et re-construction
|
||||||
|
|
||||||
|
Après filtrage (`weights[i] < seuil` → supprimer position i), l'unitig est potentiellement coupé en fragments. Chaque fragment continu de positions conservées forme un nouvel unitig (ou super-kmer si court).
|
||||||
|
|
||||||
|
Le recalcul des unitigs après filtrage est trivial : les fragments sont déjà des chemins linéaires, il suffit de vérifier les conditions de non-branchement aux nouvelles extrémités.
|
||||||
|
|
||||||
|
### 4.5 Spectre de fréquence
|
||||||
|
|
||||||
|
Le spectre de fréquence exact peut être calculé directement depuis les vecteurs de poids des unitigs : `weights[i]` donne le count exact du k-mer à la position i. C'est un histogramme sur toutes les positions de tous les unitigs.
|
||||||
|
|
||||||
|
### 4.6 Faisabilité mémoire : graphe pondéré par partition
|
||||||
|
|
||||||
|
Données mesurées sur un index *Betula* (k=31, P=4096 partitions, 1 set, génome assemblé) — distribution des tailles de fichiers .kdi :
|
||||||
|
|
||||||
|
| Métrique | Taille fichier .kdi | K-mers estimés (~5 B/kmer) | Super-kmers (~8 kmer/skm) |
|
||||||
|
|----------|--------------------|-----------------------------|---------------------------|
|
||||||
|
| Mode | 100-200 Ko | 20 000 – 40 000 | 2 500 – 5 000 |
|
||||||
|
| Médiane | ~350-400 Ko | ~70 000 – 80 000 | ~9 000 – 10 000 |
|
||||||
|
| Max | ~2.3 Mo | ~460 000 | ~57 000 |
|
||||||
|
|
||||||
|
Le graphe de De Bruijn pondéré pour une partition nécessite d'extraire tous les k-mers (arêtes) et (k-1)-mers (nœuds) des super-kmers :
|
||||||
|
|
||||||
|
| Partition | K-mers (arêtes) | RAM arêtes (~20 B) | RAM nœuds (~16 B) | Total |
|
||||||
|
|-----------|-----------------|--------------------|--------------------|-------|
|
||||||
|
| Typique (~10K skm, 38 bases avg) | ~80K | ~1.6 Mo | ~1.3 Mo | **~3 Mo** |
|
||||||
|
| Maximale (~57K skm) | ~460K | ~9.2 Mo | ~7.4 Mo | **~17 Mo** |
|
||||||
|
|
||||||
|
C'est **largement en mémoire**. Les partitions étant indépendantes, elles peuvent être traitées en parallèle par un pool de goroutines. Avec 8 goroutines : **~136 Mo** au pic — négligeable. Les tableaux sont réutilisables entre partitions (allocation unique).
|
||||||
|
|
||||||
|
**Conclusion** : la construction du graphe de De Bruijn pondéré partition par partition est non seulement faisable mais triviale en termes de mémoire. C'est un argument fort en faveur de l'approche « filtre après unitigs » plutôt que « filtre sur super-kmers ».
|
||||||
|
|
||||||
|
### 4.7 Invariance de la distribution par rapport à la canonisation
|
||||||
|
|
||||||
|
La redéfinition du k-mer canonique (par le minimiseur au lieu de `min(fwd, rc)`) ne change **rien** à l'ensemble des k-mers ni à leur répartition par partition :
|
||||||
|
|
||||||
|
- C'est une **bijection** : chaque k-mer a toujours exactement un représentant canonique, on change juste lequel des deux brins on choisit
|
||||||
|
- Le partitionnement se fait sur `canonical(minimizer) % P` — la valeur du minimiseur canonique est la même dans les deux conventions
|
||||||
|
- **Même nombre de k-mers par partition, même distribution de tailles**
|
||||||
|
- **Même topologie du graphe de De Bruijn** (mêmes nœuds, mêmes arêtes)
|
||||||
|
|
||||||
|
Ce qui change, c'est **l'orientation** : avec la canonicité par minimiseur, les unitigs canoniques ne suivent que les arêtes « forward » (`suffix(S1) == prefix(S2)`, identité exacte). Certaines arêtes traversables en RC dans BCALM2 deviennent des points de cassure. Le graphe n'est pas plus gros — il suffit de ne construire que des unitigs canoniques, ce qui **simplifie** l'algorithme (pas de gestion des traversées de brin).
|
||||||
|
|
||||||
|
## 5. Construction des unitigs canoniques
|
||||||
|
|
||||||
|
### 5.1 Définition : unitig canonique absolu
|
||||||
|
|
||||||
|
Un **unitig canonique** est un chemin linéaire non-branchant dans le graphe de De Bruijn où :
|
||||||
|
1. Chaque k-mer est **minimizer-canonique** (le minimiseur y apparaît en forward)
|
||||||
|
2. Chaque super-kmer constituant est **canonique** (même convention)
|
||||||
|
3. Le chaînage se fait **sans traversée de brin** : `suffix(k-1, S1) == prefix(k-1, S2)` dans le même sens (pas en RC)
|
||||||
|
|
||||||
|
C'est plus restrictif que les unitigs BCALM2 (qui autorisent `suffix(S1) == RC(prefix(S2))`), mais cela garantit que **tout k-mer extrait par fenêtre glissante est directement dans sa forme canonique**, sans re-canonisation.
|
||||||
|
|
||||||
|
### 5.2 Pourquoi la canonicité absolue est essentielle
|
||||||
|
|
||||||
|
**Matching** : les k-mers requête sont canonisés une fois (par le minimiseur), puis comparés directement aux k-mers de l'unitig par scan. Pas de re-canonisation à la volée → plus rapide, plus simple.
|
||||||
|
|
||||||
|
**Opérations ensemblistes** : deux index utilisant la même convention produisent les mêmes unitigs canoniques pour les mêmes k-mers. L'intersect/union peut opérer par comparaison directe de séquences triées.
|
||||||
|
|
||||||
|
**Bitmask multiset** : la fusion de N sets est triviale — merger des listes de super-kmers/unitigs canoniques triés par séquence.
|
||||||
|
|
||||||
|
**Déterminisme** : un ensemble de k-mers produit toujours les mêmes unitigs canoniques, quel que soit l'ordre d'insertion ou la source des données.
|
||||||
|
|
||||||
|
### 5.3 Impact sur la compaction
|
||||||
|
|
||||||
|
La contrainte canonique interdit les traversées de brin aux jonctions → les unitigs canoniques sont **plus courts** que les unitigs BCALM2. Estimation :
|
||||||
|
- BCALM2 (unitigs libres) : 63 bases moyennes (mesuré sur *Betula*)
|
||||||
|
- Unitigs canoniques : probablement ~45-55 bases moyennes
|
||||||
|
- Super-kmers dérepliqués : 38 bases moyennes
|
||||||
|
|
||||||
|
Le facteur de compaction est légèrement réduit mais le gain en simplicité opérationnelle compense largement.
|
||||||
|
|
||||||
|
### 5.4 Construction par partition — le vrai graphe de De Bruijn
|
||||||
|
|
||||||
|
Les super-kmers canoniques dérepliqués sont des **chemins** dans le graphe de De Bruijn, pas des nœuds. On ne peut pas les chaîner directement comme des nœuds car :
|
||||||
|
- Deux super-kmers peuvent **se chevaucher** (partager des k-mers aux jonctions)
|
||||||
|
- Un super-kmer court peut avoir ses k-mers **inclus** dans un super-kmer plus long
|
||||||
|
|
||||||
|
Un super-kmer de longueur L contient (L-k+1) k-mers, soit (L-k+1) arêtes et (L-k+2) nœuds ((k-1)-mers) dans le graphe de De Bruijn.
|
||||||
|
|
||||||
|
#### 5.4.1 Nœuds = (k-1)-mers, Arêtes = k-mers
|
||||||
|
|
||||||
|
Le graphe de De Bruijn par partition a :
|
||||||
|
- **Nœuds** : les (k-1)-mers uniques (extraits de toutes les positions dans les super-kmers)
|
||||||
|
- **Arêtes** : les k-mers (chaque position dans un super-kmer = une arête entre deux (k-1)-mers consécutifs)
|
||||||
|
- **Poids** : chaque arête (k-mer) porte le count du super-kmer qui la contient
|
||||||
|
|
||||||
|
Les branchements (nœud avec degré entrant > 1 ou degré sortant > 1) peuvent être :
|
||||||
|
- Aux **bords** des super-kmers (jonctions entre super-kmers)
|
||||||
|
- Aux **positions internes** si un k-mer d'un autre super-kmer rejoint un (k-1)-mer interne
|
||||||
|
|
||||||
|
#### 5.4.2 Graphe complet nécessaire
|
||||||
|
|
||||||
|
Construire le graphe avec **tous** les (k-1)-mers (internes et bords) est nécessaire pour détecter correctement les branchements. Se limiter aux seuls bords de super-kmers serait incorrect car un (k-1)-mer de bord d'un super-kmer peut correspondre à un nœud interne d'un autre super-kmer.
|
||||||
|
|
||||||
|
Pour une partition typique de 10K super-kmers de longueur moyenne 38 bases → ~80K k-mers → ~80K arêtes et ~80K nœuds. Voir section 4.6 pour la faisabilité mémoire (~3 Mo par partition typique, ~17 Mo max).
|
||||||
|
|
||||||
|
#### 5.4.3 Structure de données : tableau trié d'arêtes
|
||||||
|
|
||||||
|
Plutôt que des hash maps, on utilise un **tableau trié** pour le graphe :
|
||||||
|
|
||||||
|
```go
|
||||||
|
type Edge struct {
|
||||||
|
srcKmer uint64 // (k-1)-mer source (prefix du k-mer)
|
||||||
|
dstKmer uint64 // (k-1)-mer destination (suffix du k-mer)
|
||||||
|
weight int32 // count du super-kmer contenant ce k-mer
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
Pour chaque super-kmer S de longueur L et count C, on émet (L-k+1) arêtes. Tableau total pour une partition typique : ~80K × 20 bytes = **~1.6 Mo**.
|
||||||
|
|
||||||
|
On trie par `srcKmer` pour obtenir la liste d'adjacence sortante, ou on construit deux vues triées (par src et par dst) pour avoir adjacence entrante et sortante.
|
||||||
|
|
||||||
|
#### 5.4.4 Détection des unitigs canoniques
|
||||||
|
|
||||||
|
Un unitig canonique est un chemin maximal non-branchant. L'algorithme :
|
||||||
|
|
||||||
|
```
|
||||||
|
1. Extraire toutes les arêtes des super-kmers → tableau edges[]
|
||||||
|
2. Trier edges[] par srcKmer → vue sortante
|
||||||
|
Trier une copie par dstKmer → vue entrante
|
||||||
|
3. Pour chaque (k-1)-mer unique :
|
||||||
|
- degré_sortant = nombre d'arêtes avec ce srcKmer
|
||||||
|
- degré_entrant = nombre d'arêtes avec ce dstKmer
|
||||||
|
- Si degré_sortant == 1 ET degré_entrant == 1 → nœud interne d'unitig
|
||||||
|
- Sinon → nœud de branchement (début ou fin d'unitig)
|
||||||
|
4. Parcourir les chemins non-branchants pour construire les unitigs
|
||||||
|
- Chaque unitig est une séquence de (k-1)-mers chaînés
|
||||||
|
- Le vecteur de poids est la séquence des weight des arêtes traversées
|
||||||
|
```
|
||||||
|
|
||||||
|
Les (k-1)-mers ne sont **pas canonisés** — on respecte l'orientation des super-kmers canoniques. Le chaînage est strictement orienté.
|
||||||
|
|
||||||
|
#### 5.4.5 Estimation mémoire
|
||||||
|
|
||||||
|
| Partition | K-mers (arêtes) | RAM arêtes | RAM nœuds | Total |
|
||||||
|
|-----------|-----------------|------------|-----------|-------|
|
||||||
|
| Typique (~10K skm, 38 bases avg) | ~80K | ~1.6 Mo | ~1.3 Mo | **~3 Mo** |
|
||||||
|
| Maximale (~57K skm) | ~460K | ~9.2 Mo | ~7.4 Mo | **~17 Mo** |
|
||||||
|
|
||||||
|
Avec traitement parallèle par un pool de G goroutines : RAM max = G × 17 Mo. Avec G=8 : **~136 Mo** au pic. Le tableau d'arêtes est réutilisable entre partitions (allocation unique, remise à zéro).
|
||||||
|
|
||||||
|
Complexité : O(E log E) par partition, avec E = nombre total de k-mers. Dominé par les deux tris.
|
||||||
|
|
||||||
|
### 5.5 Graphe par minimiseur, pas par partition
|
||||||
|
|
||||||
|
Les k-mers (arêtes) sont partitionnés par minimiseur. Deux k-mers adjacents dans le graphe de De Bruijn peuvent avoir des minimiseurs différents — c'est exactement ce qui définit les frontières de super-kmers. Si on construit le graphe par partition (qui regroupe plusieurs minimiseurs), des (k-1)-mers de jonction entre minimiseurs différents apparaîtraient comme nœuds partagés entre partitions → le graphe par partition n'est pas autonome.
|
||||||
|
|
||||||
|
**Solution : construire un graphe par minimiseur.**
|
||||||
|
|
||||||
|
Un super-kmer est par définition un chemin dont **tous les k-mers partagent le même minimiseur**. Donc :
|
||||||
|
- Toutes les arêtes d'un super-kmer appartiennent à un seul minimiseur
|
||||||
|
- Chaque graphe par minimiseur est **100% autonome** : toutes ses arêtes et nœuds internes sont auto-contenus
|
||||||
|
- Les (k-1)-mers aux bords des super-kmers qui touchent un autre minimiseur sont des extrémités (degré 0 dans ce graphe) → bouts d'unitig naturels
|
||||||
|
- Aucune jonction inter-graphe → pas de cassure artificielle d'unitig
|
||||||
|
|
||||||
|
**Taille des graphes** : avec ~16K minimiseurs théoriques par partition (P=4096, m=13), le calcul naïf donne ~5 arêtes/minimiseur. Mais en pratique, beaucoup de minimiseurs ne sont pas représentés (séquences biologiques, pas aléatoires) et la distribution est très inégale. Si seuls ~500-1000 minimiseurs sont effectivement présents dans une partition typique de 80K arêtes, on a plutôt **80-160 arêtes en moyenne** par minimiseur, avec une queue de distribution vers les centaines ou milliers pour les minimiseurs les plus fréquents. Même dans ce cas, les graphes restent petits (quelques Ko à quelques dizaines de Ko).
|
||||||
|
|
||||||
|
*À mesurer* : nombre de minimiseurs distincts par partition et distribution du nombre de k-mers par minimiseur sur un index existant.
|
||||||
|
|
||||||
|
**Algorithme** : les super-kmers étant déjà triés par minimiseur dans la partition, on itère séquentiellement et on construit/détruit un petit graphe à chaque changement de minimiseur. C'est plus simple que le graphe par partition — pas de tri global de toutes les arêtes, juste un buffer local réutilisé.
|
||||||
|
|
||||||
|
**Les unitigs résultants** sont les chemins maximaux non-branchants au sein d'un minimiseur. Un unitig ne traverse jamais une frontière de minimiseur, ce qui est correct : tous les k-mers d'un unitig partagent le même minimiseur canonique, ce qui renforce la propriété de canonicité absolue.
|
||||||
|
|
||||||
|
### 5.6 Quand les unitigs canoniques n'aident pas
|
||||||
|
|
||||||
|
- Si les super-kmers sont courts (peu de chevauchement entre super-kmers adjacents)
|
||||||
|
- Si le graphe est très branché (zones de divergence entre génomes)
|
||||||
|
- Si beaucoup de jonctions se font par traversée de brin (la contrainte canonique empêche la fusion)
|
||||||
|
- Données metabarcoding avec grande diversité taxonomique → courts unitigs
|
||||||
|
|
||||||
|
Dans ces cas, stocker les super-kmers dérepliqués directement est suffisant — ils sont déjà canoniques par construction.
|
||||||
|
|
||||||
|
## 6. Construction multiset : super-kmers par set, graphe commun
|
||||||
|
|
||||||
|
### 6.1 Pipeline en deux phases
|
||||||
|
|
||||||
|
La construction d'un index multiset (N sets) se fait en deux phases distinctes :
|
||||||
|
|
||||||
|
**Phase 1 — Par set (indépendant, parallélisable)** :
|
||||||
|
|
||||||
|
Chaque set i (i = 0..N-1) produit indépendamment ses super-kmers canoniques :
|
||||||
|
```
|
||||||
|
Set i : séquences → [0] 2-bit → [1] lowmask → [2] super-kmers → [3] canonisation → [4] partition .skm_i
|
||||||
|
```
|
||||||
|
Puis déréplication par partition : super-kmers triés avec counts, écrits dans des fichiers `.skm` distincts par set.
|
||||||
|
|
||||||
|
**Phase 2 — Par partition, tous sets confondus** :
|
||||||
|
|
||||||
|
Pour chaque partition P (parallélisable par goroutine) :
|
||||||
|
```
|
||||||
|
.skm_0[P], .skm_1[P], ..., .skm_{N-1}[P] (super-kmers triés de chaque set)
|
||||||
|
│
|
||||||
|
▼
|
||||||
|
[a] N-way merge des super-kmers triés
|
||||||
|
│ Même super-kmer dans sets i et j → fusionner en vecteur de counts [c_0, ..., c_{N-1}]
|
||||||
|
│ Super-kmer uniquement dans set i → counts = [0, ..., c_i, ..., 0]
|
||||||
|
▼
|
||||||
|
[b] Extraction des arêtes du graphe de De Bruijn
|
||||||
|
│ Chaque k-mer (arête) porte un vecteur de poids [w_0, ..., w_{N-1}]
|
||||||
|
│ w_i = count du super-kmer contenant ce k-mer dans le set i
|
||||||
|
▼
|
||||||
|
[c] Construction d'un SEUL graphe de De Bruijn par partition
|
||||||
|
│ Les branchements sont définis par l'UNION de tous les sets :
|
||||||
|
│ si un (k-1)-mer a degré > 1 dans n'importe quel set, c'est un branchement
|
||||||
|
▼
|
||||||
|
[d] Extraction des unitigs canoniques communs
|
||||||
|
│ Même séquence pour tous les sets
|
||||||
|
│ Chaque position porte un vecteur de poids (un count par set)
|
||||||
|
▼
|
||||||
|
[e] Filtre de fréquence (optionnel, par set ou global)
|
||||||
|
▼
|
||||||
|
[f] Encodage du bitmask par runs le long de chaque unitig
|
||||||
|
▼
|
||||||
|
Écriture dans le .sku de la partition
|
||||||
|
```
|
||||||
|
|
||||||
|
### 6.2 Le graphe est défini par l'union
|
||||||
|
|
||||||
|
Point crucial : les unitigs sont déterminés par la **topologie de l'union** de tous les sets. Un branchement dans un seul set force une coupure d'unitig pour tous les sets. Cela garantit que :
|
||||||
|
- Les unitigs sont les mêmes quelle que soit l'ordre des sets
|
||||||
|
- Un k-mer donné se trouve toujours au même endroit (même unitig, même position)
|
||||||
|
- Les opérations ensemblistes (intersect, union, difference) opèrent sur les mêmes unitigs
|
||||||
|
|
||||||
|
### 6.3 Arêtes à vecteur de poids
|
||||||
|
|
||||||
|
La structure Edge (section 5.4.3) est étendue pour le multiset :
|
||||||
|
|
||||||
|
```go
|
||||||
|
type Edge struct {
|
||||||
|
srcKmer uint64 // (k-1)-mer source
|
||||||
|
dstKmer uint64 // (k-1)-mer destination
|
||||||
|
weights []int32 // weights[i] = count dans le set i (0 si absent)
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
Pour la détection des branchements, le degré d'un nœud est le nombre d'arêtes distinctes (par dstKmer pour le degré sortant), **indépendamment** des sets. Une arête présente dans le set 0 mais pas le set 1 compte quand même.
|
||||||
|
|
||||||
|
### 6.4 Bitmask par runs le long des unitigs
|
||||||
|
|
||||||
|
Le long d'un unitig, le bitmask (quels sets contiennent ce k-mer) change rarement — les régions conservées entre génomes sont longues. On encode :
|
||||||
|
|
||||||
|
```
|
||||||
|
unitig_bitmask = [(bitmask_1, run_length_1), (bitmask_2, run_length_2), ...]
|
||||||
|
```
|
||||||
|
|
||||||
|
Où `bitmask_i` a un bit par set (bit j = 1 si `weights[j] > 0` à cette position).
|
||||||
|
|
||||||
|
Pour un unitig de 70 k-mers avec 2 sets :
|
||||||
|
- Si complètement partagé : 1 run `(0b11, 70)` → 2 bytes
|
||||||
|
- Si divergent au milieu : 2-3 runs → 4-6 bytes
|
||||||
|
- Pire cas : 70 runs → 140 bytes (très rare)
|
||||||
|
|
||||||
|
### 6.5 Impact mémoire du multiset
|
||||||
|
|
||||||
|
Le vecteur de poids par arête augmente la taille du graphe :
|
||||||
|
- 1 set : `weight int32` → 4 bytes/arête
|
||||||
|
- N sets : `weights [N]int32` → 4N bytes/arête
|
||||||
|
|
||||||
|
Pour la partition typique (~80K arêtes) avec N=2 sets : overhead = 80K × 4 = **320 Ko** supplémentaires. Négligeable.
|
||||||
|
|
||||||
|
Pour N=64 sets (cas extrême) : 80K × 256 = **~20 Mo** par partition. Reste faisable mais les sets très nombreux pourraient nécessiter un encodage plus compact (sparse vector si beaucoup de zéros).
|
||||||
|
|
||||||
|
### 6.6 Merge des super-kmers : N-way sur séquences triées
|
||||||
|
|
||||||
|
Le merge des N listes de super-kmers triés (par séquence 2-bit) est un N-way merge classique avec min-heap :
|
||||||
|
- Chaque .skm est déjà trié par séquence (étape de déréplication)
|
||||||
|
- On compare les séquences 2-bit packed (comparaison uint64, très rapide)
|
||||||
|
- Quand le même super-kmer apparaît dans plusieurs sets, on fusionne les counts
|
||||||
|
- Quand un super-kmer est unique à un set, les autres counts sont 0
|
||||||
|
|
||||||
|
C'est analogue au `KWayMerge` existant sur les k-mers triés, étendu aux super-kmers.
|
||||||
|
|
||||||
|
## 7. Format de stockage v3 : fichiers parallèles
|
||||||
|
|
||||||
|
### 7.1 Architecture : 3 fichiers par partition
|
||||||
|
|
||||||
|
Pour chaque partition, trois fichiers alignés :
|
||||||
|
|
||||||
|
```
|
||||||
|
index_v3/
|
||||||
|
metadata.toml
|
||||||
|
parts/
|
||||||
|
part_PPPP.sku # séquences 2-bit des unitigs concaténés
|
||||||
|
part_PPPP.skx # index par minimiseur (offsets dans .sku)
|
||||||
|
part_PPPP.skb # bitmask multiset (1 entrée par k-mer)
|
||||||
|
...
|
||||||
|
set_N/spectrum.bin # spectre de fréquence par set
|
||||||
|
```
|
||||||
|
|
||||||
|
### 7.2 Fichier .sku — séquences d'unitigs concaténées
|
||||||
|
|
||||||
|
Tous les unitigs d'une partition sont concaténés bout à bout en 2-bit packed, **ordonnés par minimiseur**. Entre deux unitigs, pas de séparateur dans le flux 2-bit.
|
||||||
|
|
||||||
|
Un **tableau de longueurs** stocké en en-tête ou dans le .skx donne la longueur (en bases) de chaque unitig dans l'ordre. Ce tableau permet :
|
||||||
|
- De retrouver les frontières d'unitigs
|
||||||
|
- De savoir si un match AC chevauche une jonction (à filtrer)
|
||||||
|
- D'indexer directement un unitig par son numéro
|
||||||
|
|
||||||
|
```
|
||||||
|
Format .sku :
|
||||||
|
Magic: "SKU\x01" (4 bytes)
|
||||||
|
TotalBases: uint64 LE (nombre total de bases dans la partition)
|
||||||
|
NUnitigs: uint64 LE (nombre d'unitigs)
|
||||||
|
Lengths: [NUnitigs]varint (longueur en bases de chaque unitig)
|
||||||
|
Sequence: ceil(TotalBases/4) bytes (flux 2-bit continu)
|
||||||
|
```
|
||||||
|
|
||||||
|
### 7.3 Fichier .skx — index par minimiseur
|
||||||
|
|
||||||
|
Pour chaque minimiseur présent dans la partition, l'index donne l'offset (en bases) dans le flux .sku et le nombre d'unitigs :
|
||||||
|
|
||||||
|
```
|
||||||
|
Format .skx :
|
||||||
|
Magic: "SKX\x01" (4 bytes)
|
||||||
|
NMinimizers: uint32 LE (nombre de minimiseurs présents)
|
||||||
|
Entries: [NMinimizers] {
|
||||||
|
Minimizer: uint64 LE (valeur du minimiseur canonique)
|
||||||
|
BaseOffset: uint64 LE (offset en bases dans le flux .sku)
|
||||||
|
UnitigOffset: uint32 LE (index du premier unitig de ce minimiseur dans le tableau de longueurs)
|
||||||
|
NUnitigs: uint32 LE (nombre d'unitigs pour ce minimiseur)
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
Les entrées sont triées par `Minimizer` → recherche binaire en O(log N).
|
||||||
|
|
||||||
|
Pour accéder aux unitigs d'un minimiseur donné :
|
||||||
|
1. Recherche binaire dans le .skx → `BaseOffset`, `UnitigOffset`, `NUnitigs`
|
||||||
|
2. Seek dans le .sku au bit `BaseOffset × 2`
|
||||||
|
3. Lecture de `NUnitigs` unitigs (longueurs dans le tableau à partir de `UnitigOffset`)
|
||||||
|
|
||||||
|
### 7.4 Fichier .skb — bitmask multiset parallèle
|
||||||
|
|
||||||
|
Le fichier bitmask est **aligné position par position** avec le flux de k-mers des unitigs. Chaque k-mer (position dans un unitig) a exactement une entrée dans le .skb, dans le même ordre que les k-mers apparaissent en lisant les unitigs séquentiellement.
|
||||||
|
|
||||||
|
```
|
||||||
|
Format .skb :
|
||||||
|
Magic: "SKB\x01" (4 bytes)
|
||||||
|
TotalKmers: uint64 LE (nombre total de k-mers)
|
||||||
|
NSets: uint8 (nombre de sets)
|
||||||
|
BitmaskSize: uint8 (ceil(NSets/8) bytes par entrée)
|
||||||
|
Bitmasks: [TotalKmers × BitmaskSize] bytes
|
||||||
|
```
|
||||||
|
|
||||||
|
**Accès direct** : la position absolue d'un k-mer dans le flux d'unitigs (offset en k-mers depuis le début de la partition) donne directement l'index dans le fichier .skb :
|
||||||
|
```
|
||||||
|
bitmask_offset = header_size + kmer_position × BitmaskSize
|
||||||
|
```
|
||||||
|
|
||||||
|
Pour 2 sets : 1 byte par k-mer (6 bits inutilisés).
|
||||||
|
Pour ≤8 sets : 1 byte par k-mer.
|
||||||
|
Pour ≤16 sets : 2 bytes par k-mer.
|
||||||
|
|
||||||
|
**Coût** : pour 295M k-mers (*Betula*, 2 sets) : 295 Mo. Pour l'index Contaminent_idx (18.6B k-mers, 2 sets) : ~18.6 Go. C'est significatif — voir section 7.5 pour la compression.
|
||||||
|
|
||||||
|
### 7.5 Compression du bitmask : RLE ou non ?
|
||||||
|
|
||||||
|
| Approche | Taille (2 sets, 295M k-mers) | Accès |
|
||||||
|
|----------|------------------------------|-------|
|
||||||
|
| Non compressé (1 byte/k-mer) | 295 Mo | O(1) direct |
|
||||||
|
| RLE par unitig | ~10-50 Mo (estimé) | O(decode) par unitig |
|
||||||
|
| Bitset par set (1 bit/k-mer/set) | 74 Mo | O(1) direct |
|
||||||
|
|
||||||
|
L'approche **bitset par set** (1 bit par k-mer par set, packed en bytes) est un bon compromis :
|
||||||
|
- 2 sets : 2 bits/k-mer → ~74 Mo (vs 295 Mo non compressé)
|
||||||
|
- Accès O(1) : `bit = (data[kmer_pos / 4] >> ((kmer_pos % 4) × 2)) & 0x3`
|
||||||
|
- Pas besoin de décompression séquentielle
|
||||||
|
|
||||||
|
Pour les très grands index (18.6B k-mers), même le bitset fait ~4.6 Go. Le RLE par minimiseur (ou par unitig) pourrait réduire à ~1-2 Go mais perd l'accès O(1).
|
||||||
|
|
||||||
|
**Recommandation** : bitset packed pour ≤8 sets (accès O(1)), RLE pour >8 sets ou très grands index.
|
||||||
|
|
||||||
|
## 8. Matching avec Aho-Corasick sur le flux d'unitigs
|
||||||
|
|
||||||
|
### 8.1 Principe
|
||||||
|
|
||||||
|
Pour chaque partition dont les k-mers requête partagent le minimiseur :
|
||||||
|
1. Seek dans le .sku au bloc du minimiseur (via .skx)
|
||||||
|
2. Construire un automate AC avec les k-mers requête canoniques de ce minimiseur
|
||||||
|
3. Scanner le flux 2-bit des unitigs de ce minimiseur
|
||||||
|
4. Pour chaque match : vérifier qu'il ne chevauche pas une frontière d'unitig
|
||||||
|
5. Pour chaque match valide : lookup dans le .skb à la position correspondante → bitmask
|
||||||
|
|
||||||
|
### 8.2 Le problème des faux matches aux jonctions
|
||||||
|
|
||||||
|
En 2-bit, pas de 5e lettre pour séparer les unitigs. Le scan AC sur le flux continu peut produire des matches à cheval sur deux unitigs adjacents.
|
||||||
|
|
||||||
|
**Solution : post-filtrage par le tableau de longueurs.**
|
||||||
|
|
||||||
|
Pendant le scan, on maintient un compteur de position et un index dans le tableau de longueurs (préfixe cumulé). Quand un match est trouvé à la position `p` :
|
||||||
|
- Le match couvre les bases `[p, p+k-1]`
|
||||||
|
- Si ces bases chevauchent une frontière d'unitig → faux positif, ignorer
|
||||||
|
- Sinon → match valide
|
||||||
|
|
||||||
|
Le coût du post-filtrage est O(1) par match (le compteur de frontière avance séquentiellement).
|
||||||
|
|
||||||
|
**Estimation du taux de faux positifs** : avec des unitigs de ~50 bases en moyenne, une jonction tous les ~50 bases, et k=31 : ~31/50 = ~62% des positions de jonction peuvent produire un faux match. Mais seule une infime fraction de ces positions correspond à un pattern dans l'automate AC. En pratique, le nombre de faux positifs est négligeable.
|
||||||
|
|
||||||
|
### 8.3 Du match à la position absolue dans le .skb
|
||||||
|
|
||||||
|
Un match AC à la position `p` dans le flux du minimiseur se traduit en position k-mer dans le .skb :
|
||||||
|
|
||||||
|
```
|
||||||
|
kmer_position_in_partition = base_offset_of_minimizer_in_partition
|
||||||
|
+ p
|
||||||
|
- (nombre de bases de padding/frontières avant p)
|
||||||
|
```
|
||||||
|
|
||||||
|
En fait, si le tableau de longueurs donne les longueurs d'unitigs en bases, la position k-mer cumulative est :
|
||||||
|
```
|
||||||
|
Pour l'unitig i contenant le match :
|
||||||
|
kmer_base = somme des longueurs des unitigs 0..i-1
|
||||||
|
kmer_offset_in_unitig = p - kmer_base
|
||||||
|
kmer_index = somme des (len_j - k + 1) pour j=0..i-1 + kmer_offset_in_unitig
|
||||||
|
```
|
||||||
|
|
||||||
|
Ce `kmer_index` est l'index direct dans le fichier .skb.
|
||||||
|
|
||||||
|
### 8.4 Comparaison avec le merge-scan v1
|
||||||
|
|
||||||
|
| Aspect | Merge-scan (v1) | AC sur unitigs (v3) |
|
||||||
|
|--------|----------------|---------------------|
|
||||||
|
| Pré-requis | Tri des requêtes O(Q log Q) | Construction automate AC O(Q×k) |
|
||||||
|
| Seek | .kdx sparse index | .skx index par minimiseur |
|
||||||
|
| Scan | O(Q + K) merge linéaire par set | O(bases_du_minimiseur + matches) |
|
||||||
|
| Multi-set | **N passes** (une par set) | **1 seule passe** (bitmask .skb) |
|
||||||
|
| I/O | N×P ouvertures de fichier | 1 seek + lecture séquentielle + lookup .skb |
|
||||||
|
| Accès bitmask | implicite (chaque .kdi = 1 set) | O(1) dans .skb |
|
||||||
|
|
||||||
|
Le gain principal du v3 est l'**élimination des N passes** : au lieu de scanner N fois (une par set), on scanne une seule fois et on consulte le bitmask. Pour N=2 sets et P=4096 partitions, cela réduit les ouvertures de fichier de 2×4096 = 8192 à 4096.
|
||||||
|
|
||||||
|
## 9. Estimations de taille et validation expérimentale
|
||||||
|
|
||||||
|
### 9.1 Cas mesuré : *Betula exilis* 15× (reads bruts, count > 1)
|
||||||
|
|
||||||
|
| Métrique | Valeur |
|
||||||
|
|----------|--------|
|
||||||
|
| Super-kmers uniques (count > 1) | 37.3M |
|
||||||
|
| Longueur moyenne | 37.9 bases |
|
||||||
|
| Bases totales | 1.415G |
|
||||||
|
|
||||||
|
**Stockage binaire 2-bit packed** :
|
||||||
|
- Séquences : 1.415G / 4 = **354 Mo**
|
||||||
|
- Headers (longueur varint + minimiseur) : 37.3M × ~4 bytes = **150 Mo**
|
||||||
|
- Bitmask (1 set → 0 bytes, ou 2 sets → 1 byte/entrée = 37 Mo)
|
||||||
|
- **Total estimé : ~500-550 Mo** pour un set
|
||||||
|
|
||||||
|
### 9.2 Extrapolation pour l'index Plants+Human (2 sets)
|
||||||
|
|
||||||
|
L'index v1 actuel contient 18.6B k-mers en 85 Go. Avec le pipeline v3 :
|
||||||
|
|
||||||
|
**Scénario reads bruts 15× par génome** (extrapolé depuis *Betula exilis*) :
|
||||||
|
- *Betula exilis* mesuré : ~37M super-kmers, ~1.4G bases → ~500 Mo
|
||||||
|
- Proportionnellement pour l'index Contaminent_idx (18.6B k-mers) : **~2-5 Go**
|
||||||
|
|
||||||
|
**Scénario génome assemblé (pas de filtre de fréquence)** :
|
||||||
|
- Un génome assemblé de 3 Gbases → estimation ~80M super-kmers × 38 bases → **760 Mo**
|
||||||
|
- Un génome assemblé de 10 Gbases → estimation ~350M super-kmers × 38 bases → **3.3 Go**
|
||||||
|
- Avec overlap multiset : super-kmers partagés fusionnés (bitmask) → **~4 Go**
|
||||||
|
|
||||||
|
**Le gain est spectaculaire dans les deux scénarios** :
|
||||||
|
- Reads bruts : facteur **~30-40×** grâce à la déréplication + filtre de fréquence
|
||||||
|
- Génomes assemblés : facteur **~20×** grâce au format super-kmer seul
|
||||||
|
|
||||||
|
Le format super-kmer est intrinsèquement plus efficace que le delta-varint car il exploite la structure locale du graphe de De Bruijn : des k-mers consécutifs partagent (k-1) bases, encodées une seule fois dans le super-kmer.
|
||||||
|
|
||||||
|
### 9.3 Validation expérimentale : unitigs BCALM2
|
||||||
|
|
||||||
|
*Betula exilis* 15×, après lowmask + super-kmers canoniques + déréplication + filtre count>1, passé dans BCALM2 (`-kmer-size 31 -abundance-min 1`) :
|
||||||
|
|
||||||
|
| Métrique | Super-kmers (count>1) | Unitigs (BCALM2) | Ratio |
|
||||||
|
|----------|----------------------|-------------------|-------|
|
||||||
|
| Variants | 37,294,271 | 6,473,171 | **5.8×** |
|
||||||
|
| Bases totales | 1,415,018,593 | 408,070,894 | **3.5×** |
|
||||||
|
| Longueur moyenne | 37.9 bases | 63.0 bases | 1.7× |
|
||||||
|
| K-mers estimés | ~295M | ~213M | — |
|
||||||
|
|
||||||
|
### Stockage estimé
|
||||||
|
|
||||||
|
| Format | Taille estimée | Bytes/k-mer | Facteur vs v1 |
|
||||||
|
|--------|---------------|-------------|---------------|
|
||||||
|
| .kdi v1 (delta-varint, assemblé) | 12.8 Go | 4.3 | 1× |
|
||||||
|
| Super-kmers 2-bit (count>1) | ~500 Mo | 1.7 | 25× |
|
||||||
|
| **Unitigs 2-bit (BCALM2)** | **~130 Mo** | **0.6** | **98×** |
|
||||||
|
|
||||||
|
### Extrapolation pour l'index Contaminent_idx (Plants+Human, 2 sets)
|
||||||
|
|
||||||
|
Le facteur ~100× mesuré sur *Betula exilis* 15× se décompose :
|
||||||
|
- Déréplication des reads redondants : facteur ~15× (couverture 15×)
|
||||||
|
- Compaction super-kmer/unitig vs delta-varint : facteur ~100/15 ≈ **6.7×**
|
||||||
|
|
||||||
|
L'index Contaminent_idx est construit à partir de **génomes assemblés** (sans redondance de séquençage). Seul le facteur de compaction unitig s'applique :
|
||||||
|
- Index v1 actuel : 85 Go (Plants 72 Go + Human 12.8 Go)
|
||||||
|
- **Estimation unitigs : ~85 / 6.7 ≈ 12-13 Go** (facteur **~6.7×**)
|
||||||
|
|
||||||
|
C'est un gain significatif mais bien moins spectaculaire que sur des reads bruts. Le facteur pourrait être meilleur si les unitigs des génomes assemblés sont plus longs que ceux des reads (moins de fragmentation par les erreurs de séquençage).
|
||||||
|
|
||||||
|
### Observation sur le nombre de k-mers
|
||||||
|
|
||||||
|
Les unitigs contiennent ~213M k-mers vs ~295M estimés dans les super-kmers. La différence (~80M) provient probablement de k-mers qui étaient comptés dans plusieurs super-kmers (aux jonctions) et qui ne sont comptés qu'une fois dans les unitigs (déduplication exacte par le graphe de De Bruijn).
|
||||||
|
|
||||||
|
### Conclusion
|
||||||
|
|
||||||
|
L'approche unitig est massivement plus compacte que toutes les alternatives. Le format de stockage final devrait être basé sur les unitigs (ou au minimum sur les super-kmers dérepliqués) plutôt que sur des k-mers individuels en delta-varint.
|
||||||
|
|
||||||
|
## 10. Questions ouvertes
|
||||||
|
|
||||||
|
### 10.1 Le format super-kmer est-il toujours meilleur que delta-varint ?
|
||||||
|
|
||||||
|
D'après les estimations révisées (section 8.3), le format super-kmer 2-bit est **toujours plus compact** que le delta-varint, même pour des génomes assemblés :
|
||||||
|
- Reads bruts 15× : ~500 Mo vs ~1.5 Go (facteur 3×, à k-mers égaux) + déréplication massive
|
||||||
|
- Génomes assemblés : ~1.2 bytes/k-mer vs ~5 bytes/k-mer (facteur 4×)
|
||||||
|
|
||||||
|
La raison fondamentale : le delta-varint encode chaque k-mer indépendamment (même avec deltas), tandis que le super-kmer exploite le chevauchement de (k-1) bases entre k-mers consécutifs. C'est un avantage structurel irrattrapable par le delta-varint.
|
||||||
|
|
||||||
|
**Le format super-kmer semble donc préférable dans tous les cas.**
|
||||||
|
|
||||||
|
### 10.2 L'index doit-il stocker les super-kmers ou les k-mers ?
|
||||||
|
|
||||||
|
Stocker les super-kmers/unitigs comme format d'index final a des avantages (compacité, scan naturel) mais des inconvénients :
|
||||||
|
- Pas de seek rapide vers un k-mer spécifique (vs .kdx sparse index)
|
||||||
|
- Le matching par scan complet est O(total_bases) vs O(Q + K) pour le merge-scan
|
||||||
|
- Les opérations ensemblistes (Union, Intersect) deviennent plus complexes
|
||||||
|
|
||||||
|
**Approche hybride possible** :
|
||||||
|
1. Phase de construction : lowmask → super-kmers canoniques → déréplication → filtre de fréquence
|
||||||
|
2. Phase de finalisation : extraire les k-mers uniques des super-kmers filtrés → delta-varint .kdi (v1 ou v2)
|
||||||
|
3. Les super-kmers servent de **format intermédiaire efficace**, pas de format d'index final
|
||||||
|
|
||||||
|
Cela combine le meilleur des deux mondes :
|
||||||
|
- Déréplication ultra-efficace au niveau super-kmer (facteur 16× sur reads bruts)
|
||||||
|
- Index final compact et query-efficient en delta-varint
|
||||||
|
|
||||||
|
### 10.3 Le filtre de fréquence simple (niveau super-kmer) est-il suffisant ?
|
||||||
|
|
||||||
|
À valider expérimentalement :
|
||||||
|
- Comparer le nombre de k-mers retenus par filtre super-kmer vs filtre k-mer exact
|
||||||
|
- Mesurer l'impact sur les métriques biologiques (Jaccard, match positions)
|
||||||
|
- Si la différence est <1%, le filtre simple suffit
|
||||||
|
|
||||||
|
### 10.4 Aho-Corasick vs merge-scan pour le matching final ?
|
||||||
|
|
||||||
|
Si le format d'index final reste delta-varint (question 9.2), le merge-scan reste la méthode naturelle de matching. L'AC/hash-set n'a d'intérêt que si le format de stockage est basé sur des séquences (unitigs/super-kmers).
|
||||||
|
|
||||||
|
## 11. Prochaine étape : validation expérimentale
|
||||||
|
|
||||||
|
Avant de modifier l'architecture, valider sur des données réelles :
|
||||||
|
|
||||||
|
1. **Taux de compaction super-kmer** : sur un génome assemblé vs reads bruts, mesurer le nombre de super-kmers uniques et leur longueur moyenne
|
||||||
|
2. **Impact du filtre super-kmer** : comparer filtre au niveau super-kmer vs filtre au niveau k-mer exact sur un jeu de données de référence
|
||||||
|
3. **Taux d'assembly en unitigs** : mesurer la longueur des unitigs obtenus à partir des super-kmers dérepliqués
|
||||||
|
4. **Benchmark stockage** : comparer taille index super-kmer vs delta-varint vs unitig sur les mêmes données
|
||||||
|
5. **Benchmark matching** : comparer temps de matching AC/hash vs merge-scan sur différentes densités de requêtes
|
||||||
508
blackboard/Prospective/kmer_disk_index_plan.md
Normal file
508
blackboard/Prospective/kmer_disk_index_plan.md
Normal file
@@ -0,0 +1,508 @@
|
|||||||
|
# Plan de refonte du package obikmer : index disk-based par partitions minimizer
|
||||||
|
|
||||||
|
## Constat
|
||||||
|
|
||||||
|
Les roaring64 bitmaps ne sont pas adaptés au stockage de 10^10 k-mers
|
||||||
|
(k=31) dispersés sur un espace de 2^62. L'overhead structurel (containers
|
||||||
|
roaring par high key 32 bits) dépasse la taille des données elles-mêmes,
|
||||||
|
et les opérations `Or()` entre bitmaps fragmentés ne terminent pas en
|
||||||
|
temps raisonnable.
|
||||||
|
|
||||||
|
## Principe de la nouvelle architecture
|
||||||
|
|
||||||
|
Un `KmerSet` est un ensemble trié de k-mers canoniques (uint64) stocké
|
||||||
|
sur disque, partitionné par minimizer. Chaque partition est un fichier
|
||||||
|
binaire contenant des uint64 triés, compressés par delta-varint.
|
||||||
|
|
||||||
|
Un `KmerSetGroup` est un répertoire contenant N ensembles partitionnés
|
||||||
|
de la même façon (même k, même m, même P).
|
||||||
|
|
||||||
|
Un `KmerSet` est un `KmerSetGroup` de taille 1 (singleton).
|
||||||
|
|
||||||
|
Les opérations ensemblistes se font partition par partition, en merge
|
||||||
|
streaming, sans charger l'index complet en mémoire.
|
||||||
|
|
||||||
|
## Cycle de vie d'un index
|
||||||
|
|
||||||
|
L'index a deux phases distinctes :
|
||||||
|
|
||||||
|
1. **Phase de construction (mutable)** : on ouvre un index, on y ajoute
|
||||||
|
des séquences. Pour chaque séquence, les super-kmers sont extraits
|
||||||
|
et écrits de manière compacte (2 bits/base) dans le fichier
|
||||||
|
temporaire de partition correspondant (`minimizer % P`). Les
|
||||||
|
super-kmers sont une représentation compressée naturelle des k-mers
|
||||||
|
chevauchants : un super-kmer de longueur L encode L-k+1 k-mers en
|
||||||
|
ne stockant que ~L/4 bytes au lieu de (L-k+1) × 8 bytes.
|
||||||
|
|
||||||
|
2. **Phase de clôture (optimisation)** : on ferme l'index, ce qui
|
||||||
|
déclenche le traitement **partition par partition** (indépendant,
|
||||||
|
parallélisable) :
|
||||||
|
- Charger les super-kmers de la partition
|
||||||
|
- En extraire tous les k-mers canoniques
|
||||||
|
- Trier le tableau de k-mers
|
||||||
|
- Dédupliquer (et compter si FrequencyFilter)
|
||||||
|
- Delta-encoder et écrire le fichier .kdi final
|
||||||
|
Après clôture, l'index est statique et immuable.
|
||||||
|
|
||||||
|
3. **Phase de lecture (immutable)** : opérations ensemblistes,
|
||||||
|
Jaccard, Quorum, Contains, itération. Toutes en streaming.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Format sur disque
|
||||||
|
|
||||||
|
### Index finalisé
|
||||||
|
|
||||||
|
```
|
||||||
|
index_dir/
|
||||||
|
metadata.toml
|
||||||
|
set_0/
|
||||||
|
part_0000.kdi
|
||||||
|
part_0001.kdi
|
||||||
|
...
|
||||||
|
part_{P-1}.kdi
|
||||||
|
set_1/
|
||||||
|
part_0000.kdi
|
||||||
|
...
|
||||||
|
...
|
||||||
|
set_{N-1}/
|
||||||
|
...
|
||||||
|
```
|
||||||
|
|
||||||
|
### Fichiers temporaires pendant la construction
|
||||||
|
|
||||||
|
```
|
||||||
|
index_dir/
|
||||||
|
.build/
|
||||||
|
set_0/
|
||||||
|
part_0000.skm # super-kmers encodés 2 bits/base
|
||||||
|
part_0001.skm
|
||||||
|
...
|
||||||
|
set_1/
|
||||||
|
...
|
||||||
|
```
|
||||||
|
|
||||||
|
Le répertoire `.build/` est supprimé après Close().
|
||||||
|
|
||||||
|
### metadata.toml
|
||||||
|
|
||||||
|
```toml
|
||||||
|
id = "mon_index"
|
||||||
|
k = 31
|
||||||
|
m = 13
|
||||||
|
partitions = 1024
|
||||||
|
type = "KmerSetGroup" # ou "KmerSet" (N=1)
|
||||||
|
size = 3 # nombre de sets (N)
|
||||||
|
sets_ids = ["genome_A", "genome_B", "genome_C"]
|
||||||
|
|
||||||
|
[user_metadata]
|
||||||
|
organism = "Triticum aestivum"
|
||||||
|
|
||||||
|
[sets_metadata]
|
||||||
|
# métadonnées individuelles par set si nécessaire
|
||||||
|
```
|
||||||
|
|
||||||
|
### Fichier .kdi (Kmer Delta Index)
|
||||||
|
|
||||||
|
Format binaire :
|
||||||
|
|
||||||
|
```
|
||||||
|
[magic: 4 bytes "KDI\x01"]
|
||||||
|
[count: uint64 little-endian] # nombre de k-mers dans cette partition
|
||||||
|
[first: uint64 little-endian] # premier k-mer (valeur absolue)
|
||||||
|
[delta_1: varint] # arr[1] - arr[0]
|
||||||
|
[delta_2: varint] # arr[2] - arr[1]
|
||||||
|
...
|
||||||
|
[delta_{count-1}: varint] # arr[count-1] - arr[count-2]
|
||||||
|
```
|
||||||
|
|
||||||
|
Varint : encoding unsigned, 7 bits utiles par byte, bit de poids fort
|
||||||
|
= continuation (identique au varint protobuf).
|
||||||
|
|
||||||
|
Fichier vide (partition sans k-mer) : magic + count=0.
|
||||||
|
|
||||||
|
### Fichier .skm (Super-Kmer temporaire)
|
||||||
|
|
||||||
|
Format binaire, séquence de super-kmers encodés :
|
||||||
|
|
||||||
|
```
|
||||||
|
[len: uint16 little-endian] # longueur du super-kmer en bases
|
||||||
|
[sequence: ceil(len/4) bytes] # séquence encodée 2 bits/base, packed
|
||||||
|
...
|
||||||
|
```
|
||||||
|
|
||||||
|
**Compression par rapport au stockage de k-mers bruts** :
|
||||||
|
|
||||||
|
Un super-kmer de longueur L contient L-k+1 k-mers.
|
||||||
|
- Stockage super-kmer : 2 + ceil(L/4) bytes
|
||||||
|
- Stockage k-mers bruts : (L-k+1) × 8 bytes
|
||||||
|
|
||||||
|
Exemple avec k=31, super-kmer typique L=50 :
|
||||||
|
- Super-kmer : 2 + 13 = 15 bytes → encode 20 k-mers
|
||||||
|
- K-mers bruts : 20 × 8 = 160 bytes
|
||||||
|
- **Facteur de compression : ~10×**
|
||||||
|
|
||||||
|
Pour un génome de 10 Gbases (~10^10 k-mers bruts) :
|
||||||
|
- K-mers bruts : ~80 Go par set temporaire
|
||||||
|
- Super-kmers : **~8 Go** par set temporaire
|
||||||
|
|
||||||
|
Avec FrequencyFilter et couverture 30× :
|
||||||
|
- K-mers bruts : ~2.4 To
|
||||||
|
- Super-kmers : **~240 Go**
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## FrequencyFilter
|
||||||
|
|
||||||
|
Le FrequencyFilter n'est plus un type de données séparé. C'est un
|
||||||
|
**mode de construction** du builder. Le résultat est un KmerSetGroup
|
||||||
|
standard.
|
||||||
|
|
||||||
|
### Principe
|
||||||
|
|
||||||
|
Pendant la construction, tous les super-kmers sont écrits dans les
|
||||||
|
fichiers temporaires .skm, y compris les doublons (chaque occurrence
|
||||||
|
de chaque séquence est écrite).
|
||||||
|
|
||||||
|
Pendant Close(), pour chaque partition :
|
||||||
|
1. Charger tous les super-kmers de la partition
|
||||||
|
2. Extraire tous les k-mers canoniques dans un tableau []uint64
|
||||||
|
3. Trier le tableau
|
||||||
|
4. Parcourir linéairement : les k-mers identiques sont consécutifs
|
||||||
|
5. Compter les occurrences de chaque k-mer
|
||||||
|
6. Si count >= minFreq → écrire dans le .kdi final (une seule fois)
|
||||||
|
7. Sinon → ignorer
|
||||||
|
|
||||||
|
### Dimensionnement
|
||||||
|
|
||||||
|
Pour un génome de 10 Gbases avec couverture 30× :
|
||||||
|
- N_brut ≈ 3×10^11 k-mers bruts
|
||||||
|
- Espace temporaire .skm ≈ 240 Go (compressé super-kmer)
|
||||||
|
- RAM par partition pendant Close() :
|
||||||
|
Avec P=1024 : ~3×10^8 k-mers/partition × 8 = **~2.4 Go**
|
||||||
|
Avec P=4096 : ~7.3×10^7 k-mers/partition × 8 = **~600 Mo**
|
||||||
|
|
||||||
|
Le choix de P détermine le compromis nombre de fichiers vs RAM par
|
||||||
|
partition.
|
||||||
|
|
||||||
|
### Sans FrequencyFilter (déduplication simple)
|
||||||
|
|
||||||
|
Pour de la déduplication simple (chaque k-mer écrit une fois), le
|
||||||
|
builder peut dédupliquer au niveau des buffers en RAM avant flush.
|
||||||
|
Cela réduit significativement l'espace temporaire car les doublons
|
||||||
|
au sein d'un même buffer (provenant de séquences proches) sont
|
||||||
|
éliminés immédiatement.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## API publique visée
|
||||||
|
|
||||||
|
### Structures
|
||||||
|
|
||||||
|
```go
|
||||||
|
// KmerSetGroup est l'entité de base.
|
||||||
|
// Un KmerSet est un KmerSetGroup avec Size() == 1.
|
||||||
|
type KmerSetGroup struct {
|
||||||
|
// champs internes : path, k, m, P, N, metadata, état
|
||||||
|
}
|
||||||
|
|
||||||
|
// KmerSetGroupBuilder construit un KmerSetGroup mutable.
|
||||||
|
type KmerSetGroupBuilder struct {
|
||||||
|
// champs internes : buffers I/O par partition et par set,
|
||||||
|
// fichiers temporaires .skm, paramètres (minFreq, etc.)
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
### Construction
|
||||||
|
|
||||||
|
```go
|
||||||
|
// NewKmerSetGroupBuilder crée un builder pour un nouveau KmerSetGroup.
|
||||||
|
// directory : répertoire de destination
|
||||||
|
// k : taille des k-mers (1-31)
|
||||||
|
// m : taille des minimizers (-1 pour auto = ceil(k/2.5))
|
||||||
|
// n : nombre de sets dans le groupe
|
||||||
|
// P : nombre de partitions (-1 pour auto)
|
||||||
|
// options : options de construction (FrequencyFilter, etc.)
|
||||||
|
func NewKmerSetGroupBuilder(directory string, k, m, n, P int,
|
||||||
|
options ...BuilderOption) (*KmerSetGroupBuilder, error)
|
||||||
|
|
||||||
|
// WithMinFrequency active le mode FrequencyFilter.
|
||||||
|
// Seuls les k-mers vus >= minFreq fois sont conservés dans l'index
|
||||||
|
// final. Les super-kmers sont écrits avec leurs doublons pendant
|
||||||
|
// la construction ; le comptage exact se fait au Close().
|
||||||
|
func WithMinFrequency(minFreq int) BuilderOption
|
||||||
|
|
||||||
|
// AddSequence extrait les super-kmers d'une séquence et les écrit
|
||||||
|
// dans les fichiers temporaires de partition du set i.
|
||||||
|
func (b *KmerSetGroupBuilder) AddSequence(setIndex int, seq *obiseq.BioSequence)
|
||||||
|
|
||||||
|
// AddSuperKmer écrit un super-kmer dans le fichier temporaire de
|
||||||
|
// sa partition pour le set i.
|
||||||
|
func (b *KmerSetGroupBuilder) AddSuperKmer(setIndex int, sk SuperKmer)
|
||||||
|
|
||||||
|
// Close finalise la construction :
|
||||||
|
// - flush des buffers d'écriture
|
||||||
|
// - pour chaque partition de chaque set (parallélisable) :
|
||||||
|
// - charger les super-kmers depuis le .skm
|
||||||
|
// - extraire les k-mers canoniques
|
||||||
|
// - trier, dédupliquer (compter si freq filter)
|
||||||
|
// - delta-encoder et écrire le .kdi
|
||||||
|
// - écrire metadata.toml
|
||||||
|
// - supprimer le répertoire .build/
|
||||||
|
// Retourne le KmerSetGroup en lecture seule.
|
||||||
|
func (b *KmerSetGroupBuilder) Close() (*KmerSetGroup, error)
|
||||||
|
```
|
||||||
|
|
||||||
|
### Lecture et opérations
|
||||||
|
|
||||||
|
```go
|
||||||
|
// OpenKmerSetGroup ouvre un index finalisé en lecture seule.
|
||||||
|
func OpenKmerSetGroup(directory string) (*KmerSetGroup, error)
|
||||||
|
|
||||||
|
// --- Métadonnées (API inchangée) ---
|
||||||
|
func (ksg *KmerSetGroup) K() int
|
||||||
|
func (ksg *KmerSetGroup) M() int // nouveau : taille du minimizer
|
||||||
|
func (ksg *KmerSetGroup) Partitions() int // nouveau : nombre de partitions
|
||||||
|
func (ksg *KmerSetGroup) Size() int
|
||||||
|
func (ksg *KmerSetGroup) Id() string
|
||||||
|
func (ksg *KmerSetGroup) SetId(id string)
|
||||||
|
func (ksg *KmerSetGroup) HasAttribute(key string) bool
|
||||||
|
func (ksg *KmerSetGroup) GetAttribute(key string) (interface{}, bool)
|
||||||
|
func (ksg *KmerSetGroup) SetAttribute(key string, value interface{})
|
||||||
|
// ... etc (toute l'API attributs actuelle est conservée)
|
||||||
|
|
||||||
|
// --- Opérations ensemblistes ---
|
||||||
|
// Toutes produisent un nouveau KmerSetGroup singleton sur disque.
|
||||||
|
// Opèrent partition par partition en streaming.
|
||||||
|
|
||||||
|
func (ksg *KmerSetGroup) Union(outputDir string) (*KmerSetGroup, error)
|
||||||
|
func (ksg *KmerSetGroup) Intersect(outputDir string) (*KmerSetGroup, error)
|
||||||
|
func (ksg *KmerSetGroup) Difference(outputDir string) (*KmerSetGroup, error)
|
||||||
|
func (ksg *KmerSetGroup) QuorumAtLeast(q int, outputDir string) (*KmerSetGroup, error)
|
||||||
|
func (ksg *KmerSetGroup) QuorumExactly(q int, outputDir string) (*KmerSetGroup, error)
|
||||||
|
func (ksg *KmerSetGroup) QuorumAtMost(q int, outputDir string) (*KmerSetGroup, error)
|
||||||
|
|
||||||
|
// --- Opérations entre deux KmerSetGroups ---
|
||||||
|
// Les deux groupes doivent avoir les mêmes k, m, P.
|
||||||
|
|
||||||
|
func (ksg *KmerSetGroup) UnionWith(other *KmerSetGroup, outputDir string) (*KmerSetGroup, error)
|
||||||
|
func (ksg *KmerSetGroup) IntersectWith(other *KmerSetGroup, outputDir string) (*KmerSetGroup, error)
|
||||||
|
|
||||||
|
// --- Métriques (résultat en mémoire, pas de sortie disque) ---
|
||||||
|
|
||||||
|
func (ksg *KmerSetGroup) JaccardDistanceMatrix() *obidist.DistMatrix
|
||||||
|
func (ksg *KmerSetGroup) JaccardSimilarityMatrix() *obidist.DistMatrix
|
||||||
|
|
||||||
|
// --- Accès individuel ---
|
||||||
|
|
||||||
|
func (ksg *KmerSetGroup) Len(setIndex ...int) uint64
|
||||||
|
func (ksg *KmerSetGroup) Contains(setIndex int, kmer uint64) bool
|
||||||
|
func (ksg *KmerSetGroup) Iterator(setIndex int) iter.Seq[uint64]
|
||||||
|
```
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Implémentation interne
|
||||||
|
|
||||||
|
### Primitives bas niveau
|
||||||
|
|
||||||
|
**`varint.go`** : encode/decode varint uint64
|
||||||
|
|
||||||
|
```go
|
||||||
|
func EncodeVarint(w io.Writer, v uint64) (int, error)
|
||||||
|
func DecodeVarint(r io.Reader) (uint64, error)
|
||||||
|
```
|
||||||
|
|
||||||
|
### Format .kdi
|
||||||
|
|
||||||
|
**`kdi_writer.go`** : écriture d'un fichier .kdi à partir d'un flux
|
||||||
|
trié de uint64 (delta-encode au vol).
|
||||||
|
|
||||||
|
```go
|
||||||
|
type KdiWriter struct { ... }
|
||||||
|
func NewKdiWriter(path string) (*KdiWriter, error)
|
||||||
|
func (w *KdiWriter) Write(kmer uint64) error
|
||||||
|
func (w *KdiWriter) Close() error
|
||||||
|
```
|
||||||
|
|
||||||
|
**`kdi_reader.go`** : lecture streaming d'un fichier .kdi (décode
|
||||||
|
les deltas au vol).
|
||||||
|
|
||||||
|
```go
|
||||||
|
type KdiReader struct { ... }
|
||||||
|
func NewKdiReader(path string) (*KdiReader, error)
|
||||||
|
func (r *KdiReader) Next() (uint64, bool)
|
||||||
|
func (r *KdiReader) Count() uint64
|
||||||
|
func (r *KdiReader) Close() error
|
||||||
|
```
|
||||||
|
|
||||||
|
### Format .skm
|
||||||
|
|
||||||
|
**`skm_writer.go`** : écriture de super-kmers encodés 2 bits/base.
|
||||||
|
|
||||||
|
```go
|
||||||
|
type SkmWriter struct { ... }
|
||||||
|
func NewSkmWriter(path string) (*SkmWriter, error)
|
||||||
|
func (w *SkmWriter) Write(sk SuperKmer) error
|
||||||
|
func (w *SkmWriter) Close() error
|
||||||
|
```
|
||||||
|
|
||||||
|
**`skm_reader.go`** : lecture de super-kmers depuis un fichier .skm.
|
||||||
|
|
||||||
|
```go
|
||||||
|
type SkmReader struct { ... }
|
||||||
|
func NewSkmReader(path string) (*SkmReader, error)
|
||||||
|
func (r *SkmReader) Next() (SuperKmer, bool)
|
||||||
|
func (r *SkmReader) Close() error
|
||||||
|
```
|
||||||
|
|
||||||
|
### Merge streaming
|
||||||
|
|
||||||
|
**`kdi_merge.go`** : k-way merge de plusieurs flux triés.
|
||||||
|
|
||||||
|
```go
|
||||||
|
type KWayMerge struct { ... }
|
||||||
|
func NewKWayMerge(readers []*KdiReader) *KWayMerge
|
||||||
|
func (m *KWayMerge) Next() (kmer uint64, count int, ok bool)
|
||||||
|
func (m *KWayMerge) Close() error
|
||||||
|
```
|
||||||
|
|
||||||
|
### Builder
|
||||||
|
|
||||||
|
**`kmer_set_builder.go`** : construction d'un KmerSetGroup.
|
||||||
|
|
||||||
|
Le builder gère :
|
||||||
|
- P × N écrivains .skm bufferisés (un par partition × set)
|
||||||
|
- À la clôture : traitement partition par partition
|
||||||
|
(parallélisable sur plusieurs cores)
|
||||||
|
|
||||||
|
Gestion mémoire des buffers d'écriture :
|
||||||
|
- Chaque SkmWriter a un buffer I/O de taille raisonnable (~64 Ko)
|
||||||
|
- Avec P=1024 et N=1 : 1024 × 64 Ko = 64 Mo de buffers
|
||||||
|
- Avec P=1024 et N=10 : 640 Mo de buffers
|
||||||
|
- Pas de buffer de k-mers en RAM : tout est écrit sur disque
|
||||||
|
immédiatement via les super-kmers
|
||||||
|
|
||||||
|
RAM pendant Close() (tri d'une partition) :
|
||||||
|
- Charger les super-kmers → extraire les k-mers → tableau []uint64
|
||||||
|
- Avec P=1024 et 10^10 k-mers/set : ~10^7 k-mers/partition × 8 = ~80 Mo
|
||||||
|
- Avec FrequencyFilter (doublons) et couverture 30× :
|
||||||
|
~3×10^8/partition × 8 = ~2.4 Go (ajustable via P)
|
||||||
|
|
||||||
|
### Structure disk-based
|
||||||
|
|
||||||
|
**`kmer_set_disk.go`** : KmerSetGroup en lecture seule.
|
||||||
|
|
||||||
|
**`kmer_set_disk_ops.go`** : opérations ensemblistes par merge
|
||||||
|
streaming partition par partition.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Ce qui change par rapport à l'API actuelle
|
||||||
|
|
||||||
|
### Changements de sémantique
|
||||||
|
|
||||||
|
| Aspect | Ancien (roaring) | Nouveau (disk-based) |
|
||||||
|
|---|---|---|
|
||||||
|
| Stockage | En mémoire (roaring64.Bitmap) | Sur disque (.kdi delta-encoded) |
|
||||||
|
| Temporaire construction | En mémoire | Super-kmers sur disque (.skm 2 bits/base) |
|
||||||
|
| Mutabilité | Mutable à tout moment | Builder → Close() → immutable |
|
||||||
|
| Opérations ensemblistes | Résultat en mémoire | Résultat sur disque (nouveau répertoire) |
|
||||||
|
| Contains | O(1) roaring lookup | O(log n) recherche binaire sur .kdi |
|
||||||
|
| Itération | Roaring iterator | Streaming décodage delta-varint |
|
||||||
|
|
||||||
|
### API conservée (signatures identiques ou quasi-identiques)
|
||||||
|
|
||||||
|
- `KmerSetGroup` : `K()`, `Size()`, `Id()`, `SetId()`
|
||||||
|
- Toute l'API attributs
|
||||||
|
- `JaccardDistanceMatrix()`, `JaccardSimilarityMatrix()`
|
||||||
|
- `Len()`, `Contains()`
|
||||||
|
|
||||||
|
### API modifiée
|
||||||
|
|
||||||
|
- `Union()`, `Intersect()`, etc. : ajout du paramètre `outputDir`
|
||||||
|
- `QuorumAtLeast()`, etc. : idem
|
||||||
|
- Construction : `NewKmerSetGroupBuilder()` + `AddSequence()` + `Close()`
|
||||||
|
au lieu de manipulation directe
|
||||||
|
|
||||||
|
### API supprimée
|
||||||
|
|
||||||
|
- `KmerSet` comme type distinct (remplacé par KmerSetGroup singleton)
|
||||||
|
- `FrequencyFilter` comme type distinct (mode du Builder)
|
||||||
|
- Tout accès direct à `roaring64.Bitmap`
|
||||||
|
- `KmerSet.Copy()` (copie de répertoire à la place)
|
||||||
|
- `KmerSet.Union()`, `.Intersect()`, `.Difference()` (deviennent méthodes
|
||||||
|
de KmerSetGroup avec outputDir)
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Fichiers à créer / modifier dans pkg/obikmer
|
||||||
|
|
||||||
|
### Nouveaux fichiers
|
||||||
|
|
||||||
|
| Fichier | Contenu |
|
||||||
|
|---|---|
|
||||||
|
| `varint.go` | Encode/Decode varint uint64 |
|
||||||
|
| `kdi_writer.go` | Écrivain de fichiers .kdi (delta-encoded) |
|
||||||
|
| `kdi_reader.go` | Lecteur streaming de fichiers .kdi |
|
||||||
|
| `skm_writer.go` | Écrivain de super-kmers encodés 2 bits/base |
|
||||||
|
| `skm_reader.go` | Lecteur de super-kmers depuis .skm |
|
||||||
|
| `kdi_merge.go` | K-way merge streaming de flux triés |
|
||||||
|
| `kmer_set_builder.go` | KmerSetGroupBuilder (construction) |
|
||||||
|
| `kmer_set_disk.go` | KmerSetGroup disk-based (lecture, métadonnées) |
|
||||||
|
| `kmer_set_disk_ops.go` | Opérations ensemblistes streaming |
|
||||||
|
|
||||||
|
### Fichiers à supprimer
|
||||||
|
|
||||||
|
| Fichier | Raison |
|
||||||
|
|---|---|
|
||||||
|
| `kmer_set.go` | Remplacé par kmer_set_disk.go |
|
||||||
|
| `kmer_set_group.go` | Idem |
|
||||||
|
| `kmer_set_attributes.go` | Intégré dans kmer_set_disk.go |
|
||||||
|
| `kmer_set_persistence.go` | L'index est nativement sur disque |
|
||||||
|
| `kmer_set_group_quorum.go` | Intégré dans kmer_set_disk_ops.go |
|
||||||
|
| `frequency_filter.go` | Mode du Builder, plus de type séparé |
|
||||||
|
| `kmer_index_builder.go` | Remplacé par kmer_set_builder.go |
|
||||||
|
|
||||||
|
### Fichiers conservés tels quels
|
||||||
|
|
||||||
|
| Fichier | Contenu |
|
||||||
|
|---|---|
|
||||||
|
| `encodekmer.go` | Encodage/décodage k-mers |
|
||||||
|
| `superkmer.go` | Structure SuperKmer |
|
||||||
|
| `superkmer_iter.go` | IterSuperKmers, IterCanonicalKmers |
|
||||||
|
| `encodefourmer.go` | Encode4mer |
|
||||||
|
| `counting.go` | Count4Mer |
|
||||||
|
| `kmermap.go` | KmerMap (usage indépendant) |
|
||||||
|
| `debruijn.go` | Graphe de de Bruijn |
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Ordre d'implémentation
|
||||||
|
|
||||||
|
1. `varint.go` + tests
|
||||||
|
2. `skm_writer.go` + `skm_reader.go` + tests
|
||||||
|
3. `kdi_writer.go` + `kdi_reader.go` + tests
|
||||||
|
4. `kdi_merge.go` + tests
|
||||||
|
5. `kmer_set_builder.go` + tests (construction + Close)
|
||||||
|
6. `kmer_set_disk.go` (structure, métadonnées, Open)
|
||||||
|
7. `kmer_set_disk_ops.go` + tests (Union, Intersect, Quorum, Jaccard)
|
||||||
|
8. Adaptation de `pkg/obitools/obikindex/`
|
||||||
|
9. Suppression des anciens fichiers roaring
|
||||||
|
10. Adaptation des tests existants
|
||||||
|
|
||||||
|
Chaque étape est testable indépendamment.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Dépendances externes
|
||||||
|
|
||||||
|
### Supprimées
|
||||||
|
|
||||||
|
- `github.com/RoaringBitmap/roaring` : plus nécessaire pour les
|
||||||
|
index k-mers (vérifier si d'autres packages l'utilisent encore)
|
||||||
|
|
||||||
|
### Ajoutées
|
||||||
|
|
||||||
|
- Aucune. Varint, delta-encoding, merge, encodage 2 bits/base :
|
||||||
|
tout est implémentable en Go standard.
|
||||||
3
blackboard/ToDo/Canonical-superkmers.md
Normal file
3
blackboard/ToDo/Canonical-superkmers.md
Normal file
@@ -0,0 +1,3 @@
|
|||||||
|
lit le ficier [@canonical-super-kmer-strategy.md](file:///Users/coissac/Sync/travail/__MOI__/GO/obitools4/blackboard/Prospective/canonical-super-kmer-strategy.md).
|
||||||
|
|
||||||
|
Dans le fichier [@superkmer_iter.go](file:///Users/coissac/Sync/travail/__MOI__/GO/obitools4/pkg/obikmer/superkmer_iter.go) implemente une nouvelle fonction IterCanonicalSuperKmers sur le modèle de IterSuperKmers, qui implémente la notion de SuperKmers canonique présenté dans le document d'architecture.
|
||||||
735
blackboard/architechture/architecture-commande-obitools.md
Normal file
735
blackboard/architechture/architecture-commande-obitools.md
Normal file
@@ -0,0 +1,735 @@
|
|||||||
|
# Architecture d'une commande OBITools
|
||||||
|
|
||||||
|
## Vue d'ensemble
|
||||||
|
|
||||||
|
Une commande OBITools suit une architecture modulaire et standardisée qui sépare clairement les responsabilités entre :
|
||||||
|
- Le package de la commande dans `pkg/obitools/<nom_commande>/`
|
||||||
|
- L'exécutable dans `cmd/obitools/<nom_commande>/`
|
||||||
|
|
||||||
|
Cette architecture favorise la réutilisabilité du code, la testabilité et la cohérence entre les différentes commandes de la suite OBITools.
|
||||||
|
|
||||||
|
## Structure du projet
|
||||||
|
|
||||||
|
```
|
||||||
|
obitools4/
|
||||||
|
├── pkg/obitools/
|
||||||
|
│ ├── obiconvert/ # Commande de conversion (base pour toutes)
|
||||||
|
│ │ ├── obiconvert.go # Fonctions vides (pas d'implémentation)
|
||||||
|
│ │ ├── options.go # Définition des options CLI
|
||||||
|
│ │ ├── sequence_reader.go # Lecture des séquences
|
||||||
|
│ │ └── sequence_writer.go # Écriture des séquences
|
||||||
|
│ ├── obiuniq/ # Commande de déréplication
|
||||||
|
│ │ ├── obiuniq.go # (fichier vide)
|
||||||
|
│ │ ├── options.go # Options spécifiques à obiuniq
|
||||||
|
│ │ └── unique.go # Implémentation du traitement
|
||||||
|
│ ├── obipairing/ # Assemblage de lectures paired-end
|
||||||
|
│ ├── obisummary/ # Résumé de fichiers de séquences
|
||||||
|
│ └── obimicrosat/ # Détection de microsatellites
|
||||||
|
└── cmd/obitools/
|
||||||
|
├── obiconvert/
|
||||||
|
│ └── main.go # Point d'entrée de la commande
|
||||||
|
├── obiuniq/
|
||||||
|
│ └── main.go
|
||||||
|
├── obipairing/
|
||||||
|
│ └── main.go
|
||||||
|
├── obisummary/
|
||||||
|
│ └── main.go
|
||||||
|
└── obimicrosat/
|
||||||
|
└── main.go
|
||||||
|
```
|
||||||
|
|
||||||
|
## Composants de l'architecture
|
||||||
|
|
||||||
|
### 1. Package `pkg/obitools/<commande>/`
|
||||||
|
|
||||||
|
Chaque commande possède son propre package dans `pkg/obitools/` qui contient l'implémentation complète de la logique métier. Ce package est structuré en plusieurs fichiers :
|
||||||
|
|
||||||
|
#### a) `options.go` - Gestion des options CLI
|
||||||
|
|
||||||
|
Ce fichier définit :
|
||||||
|
- Les **variables globales** privées (préfixées par `_`) stockant les valeurs des options
|
||||||
|
- La fonction **`OptionSet()`** qui configure toutes les options pour la commande
|
||||||
|
- Les fonctions **`CLI*()`** qui retournent les valeurs des options (getters)
|
||||||
|
- Les fonctions **`Set*()`** qui permettent de définir les options programmatiquement (setters)
|
||||||
|
|
||||||
|
**Exemple (obiuniq/options.go) :**
|
||||||
|
|
||||||
|
```go
|
||||||
|
package obiuniq
|
||||||
|
|
||||||
|
import (
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
// Variables globales privées pour stocker les options
|
||||||
|
var _StatsOn = make([]string, 0, 10)
|
||||||
|
var _Keys = make([]string, 0, 10)
|
||||||
|
var _InMemory = false
|
||||||
|
var _chunks = 100
|
||||||
|
|
||||||
|
// Configuration des options spécifiques à la commande
|
||||||
|
func UniqueOptionSet(options *getoptions.GetOpt) {
|
||||||
|
options.StringSliceVar(&_StatsOn, "merge", 1, 1,
|
||||||
|
options.Alias("m"),
|
||||||
|
options.ArgName("KEY"),
|
||||||
|
options.Description("Adds a merged attribute..."))
|
||||||
|
|
||||||
|
options.BoolVar(&_InMemory, "in-memory", _InMemory,
|
||||||
|
options.Description("Use memory instead of disk..."))
|
||||||
|
|
||||||
|
options.IntVar(&_chunks, "chunk-count", _chunks,
|
||||||
|
options.Description("In how many chunks..."))
|
||||||
|
}
|
||||||
|
|
||||||
|
// OptionSet combine les options de base + les options spécifiques
|
||||||
|
func OptionSet(options *getoptions.GetOpt) {
|
||||||
|
obiconvert.OptionSet(false)(options) // Options de base
|
||||||
|
UniqueOptionSet(options) // Options spécifiques
|
||||||
|
}
|
||||||
|
|
||||||
|
// Getters pour accéder aux valeurs des options
|
||||||
|
func CLIStatsOn() []string {
|
||||||
|
return _StatsOn
|
||||||
|
}
|
||||||
|
|
||||||
|
func CLIUniqueInMemory() bool {
|
||||||
|
return _InMemory
|
||||||
|
}
|
||||||
|
|
||||||
|
// Setters pour définir les options programmatiquement
|
||||||
|
func SetUniqueInMemory(inMemory bool) {
|
||||||
|
_InMemory = inMemory
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
**Convention de nommage :**
|
||||||
|
- Variables privées : `_NomOption` (underscore préfixe)
|
||||||
|
- Getters : `CLINomOption()` (préfixe CLI)
|
||||||
|
- Setters : `SetNomOption()` (préfixe Set)
|
||||||
|
|
||||||
|
#### b) Fichier(s) d'implémentation
|
||||||
|
|
||||||
|
Un ou plusieurs fichiers contenant la logique métier de la commande :
|
||||||
|
|
||||||
|
**Exemple (obiuniq/unique.go) :**
|
||||||
|
|
||||||
|
```go
|
||||||
|
package obiuniq
|
||||||
|
|
||||||
|
import (
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obichunk"
|
||||||
|
)
|
||||||
|
|
||||||
|
// Fonction CLI principale qui orchestre le traitement
|
||||||
|
func CLIUnique(sequences obiiter.IBioSequence) obiiter.IBioSequence {
|
||||||
|
// Récupération des options via les getters CLI*()
|
||||||
|
options := make([]obichunk.WithOption, 0, 30)
|
||||||
|
|
||||||
|
options = append(options,
|
||||||
|
obichunk.OptionBatchCount(CLINumberOfChunks()),
|
||||||
|
)
|
||||||
|
|
||||||
|
if CLIUniqueInMemory() {
|
||||||
|
options = append(options, obichunk.OptionSortOnMemory())
|
||||||
|
} else {
|
||||||
|
options = append(options, obichunk.OptionSortOnDisk())
|
||||||
|
}
|
||||||
|
|
||||||
|
// Appel de la fonction de traitement réelle
|
||||||
|
iUnique, err := obichunk.IUniqueSequence(sequences, options...)
|
||||||
|
|
||||||
|
if err != nil {
|
||||||
|
log.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
return iUnique
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
**Autres exemples d'implémentation :**
|
||||||
|
|
||||||
|
- **obimicrosat/microsat.go** : Contient `MakeMicrosatWorker()` et `CLIAnnotateMicrosat()`
|
||||||
|
- **obisummary/obisummary.go** : Contient `ISummary()` et les structures de données
|
||||||
|
|
||||||
|
#### c) Fichiers utilitaires (optionnel)
|
||||||
|
|
||||||
|
Certaines commandes ont des fichiers additionnels pour des fonctionnalités spécifiques.
|
||||||
|
|
||||||
|
**Exemple (obipairing/options.go) :**
|
||||||
|
|
||||||
|
```go
|
||||||
|
// Fonction spéciale pour créer un itérateur de séquences pairées
|
||||||
|
func CLIPairedSequence() (obiiter.IBioSequence, error) {
|
||||||
|
forward, err := obiconvert.CLIReadBioSequences(_ForwardFile)
|
||||||
|
if err != nil {
|
||||||
|
return obiiter.NilIBioSequence, err
|
||||||
|
}
|
||||||
|
|
||||||
|
reverse, err := obiconvert.CLIReadBioSequences(_ReverseFile)
|
||||||
|
if err != nil {
|
||||||
|
return obiiter.NilIBioSequence, err
|
||||||
|
}
|
||||||
|
|
||||||
|
paired := forward.PairTo(reverse)
|
||||||
|
return paired, nil
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
### 2. Package `obiconvert` - La base commune
|
||||||
|
|
||||||
|
Le package `obiconvert` est spécial car il fournit les fonctionnalités de base utilisées par toutes les autres commandes :
|
||||||
|
|
||||||
|
#### Fonctionnalités fournies :
|
||||||
|
|
||||||
|
1. **Lecture de séquences** (`sequence_reader.go`)
|
||||||
|
- `CLIReadBioSequences()` : lecture depuis fichiers ou stdin
|
||||||
|
- Support de multiples formats (FASTA, FASTQ, EMBL, GenBank, etc.)
|
||||||
|
- Gestion des fichiers multiples
|
||||||
|
- Barre de progression optionnelle
|
||||||
|
|
||||||
|
2. **Écriture de séquences** (`sequence_writer.go`)
|
||||||
|
- `CLIWriteBioSequences()` : écriture vers fichiers ou stdout
|
||||||
|
- Support de multiples formats
|
||||||
|
- Gestion des lectures pairées
|
||||||
|
- Compression optionnelle
|
||||||
|
|
||||||
|
3. **Options communes** (`options.go`)
|
||||||
|
- Options d'entrée (format, skip, etc.)
|
||||||
|
- Options de sortie (format, fichier, compression)
|
||||||
|
- Options de mode (barre de progression, etc.)
|
||||||
|
|
||||||
|
#### Utilisation par les autres commandes :
|
||||||
|
|
||||||
|
Toutes les commandes incluent les options de `obiconvert` via :
|
||||||
|
|
||||||
|
```go
|
||||||
|
func OptionSet(options *getoptions.GetOpt) {
|
||||||
|
obiconvert.OptionSet(false)(options) // false = pas de fichiers pairés
|
||||||
|
MaCommandeOptionSet(options) // Options spécifiques
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
### 3. Exécutable `cmd/obitools/<commande>/main.go`
|
||||||
|
|
||||||
|
Le fichier `main.go` de chaque commande est volontairement **minimaliste** et suit toujours le même pattern :
|
||||||
|
|
||||||
|
```go
|
||||||
|
package main
|
||||||
|
|
||||||
|
import (
|
||||||
|
"os"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/macommande"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
|
)
|
||||||
|
|
||||||
|
func main() {
|
||||||
|
// 1. Configuration optionnelle de paramètres par défaut
|
||||||
|
obidefault.SetBatchSize(10)
|
||||||
|
|
||||||
|
// 2. Génération du parser d'options
|
||||||
|
optionParser := obioptions.GenerateOptionParser(
|
||||||
|
"macommande", // Nom de la commande
|
||||||
|
"description de la commande", // Description
|
||||||
|
macommande.OptionSet) // Fonction de configuration des options
|
||||||
|
|
||||||
|
// 3. Parsing des arguments
|
||||||
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
// 4. Lecture des séquences d'entrée
|
||||||
|
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||||
|
|
||||||
|
// 5. Traitement spécifique de la commande
|
||||||
|
resultat := macommande.CLITraitement(sequences)
|
||||||
|
|
||||||
|
// 6. Écriture des résultats
|
||||||
|
obiconvert.CLIWriteBioSequences(resultat, true)
|
||||||
|
|
||||||
|
// 7. Attente de la fin du pipeline
|
||||||
|
obiutils.WaitForLastPipe()
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
## Patterns architecturaux
|
||||||
|
|
||||||
|
### Pattern 1 : Pipeline de traitement de séquences
|
||||||
|
|
||||||
|
La plupart des commandes suivent ce pattern :
|
||||||
|
|
||||||
|
```
|
||||||
|
Lecture → Traitement → Écriture
|
||||||
|
```
|
||||||
|
|
||||||
|
**Exemples :**
|
||||||
|
- **obiconvert** : Lecture → Écriture (conversion de format)
|
||||||
|
- **obiuniq** : Lecture → Déréplication → Écriture
|
||||||
|
- **obimicrosat** : Lecture → Annotation → Filtrage → Écriture
|
||||||
|
|
||||||
|
### Pattern 2 : Traitement avec entrées multiples
|
||||||
|
|
||||||
|
Certaines commandes acceptent plusieurs fichiers d'entrée :
|
||||||
|
|
||||||
|
**obipairing** :
|
||||||
|
```
|
||||||
|
Lecture Forward + Lecture Reverse → Pairing → Assemblage → Écriture
|
||||||
|
```
|
||||||
|
|
||||||
|
### Pattern 3 : Traitement sans écriture de séquences
|
||||||
|
|
||||||
|
**obisummary** : produit un résumé JSON/YAML au lieu de séquences
|
||||||
|
|
||||||
|
```go
|
||||||
|
func main() {
|
||||||
|
// ... parsing options et lecture ...
|
||||||
|
|
||||||
|
summary := obisummary.ISummary(fs, obisummary.CLIMapSummary())
|
||||||
|
|
||||||
|
// Formatage et affichage direct
|
||||||
|
if obisummary.CLIOutFormat() == "json" {
|
||||||
|
output, _ := json.MarshalIndent(summary, "", " ")
|
||||||
|
fmt.Print(string(output))
|
||||||
|
} else {
|
||||||
|
output, _ := yaml.Marshal(summary)
|
||||||
|
fmt.Print(string(output))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
### Pattern 4 : Utilisation de Workers
|
||||||
|
|
||||||
|
Les commandes qui transforment des séquences utilisent souvent le pattern Worker :
|
||||||
|
|
||||||
|
```go
|
||||||
|
// Création d'un worker
|
||||||
|
worker := MakeMicrosatWorker(
|
||||||
|
CLIMinUnitLength(),
|
||||||
|
CLIMaxUnitLength(),
|
||||||
|
// ... autres paramètres
|
||||||
|
)
|
||||||
|
|
||||||
|
// Application du worker sur l'itérateur
|
||||||
|
newIter = iterator.MakeIWorker(
|
||||||
|
worker,
|
||||||
|
false, // merge results
|
||||||
|
obidefault.ParallelWorkers() // parallélisation
|
||||||
|
)
|
||||||
|
```
|
||||||
|
|
||||||
|
## Étapes d'implémentation d'une nouvelle commande
|
||||||
|
|
||||||
|
### Étape 1 : Créer le package dans `pkg/obitools/`
|
||||||
|
|
||||||
|
```bash
|
||||||
|
mkdir -p pkg/obitools/macommande
|
||||||
|
```
|
||||||
|
|
||||||
|
### Étape 2 : Créer `options.go`
|
||||||
|
|
||||||
|
```go
|
||||||
|
package macommande
|
||||||
|
|
||||||
|
import (
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
// Variables privées pour les options
|
||||||
|
var _MonOption = "valeur_par_defaut"
|
||||||
|
|
||||||
|
// Configuration des options spécifiques
|
||||||
|
func MaCommandeOptionSet(options *getoptions.GetOpt) {
|
||||||
|
options.StringVar(&_MonOption, "mon-option", _MonOption,
|
||||||
|
options.Alias("o"),
|
||||||
|
options.Description("Description de l'option"))
|
||||||
|
}
|
||||||
|
|
||||||
|
// OptionSet combine options de base + spécifiques
|
||||||
|
func OptionSet(options *getoptions.GetOpt) {
|
||||||
|
obiconvert.OptionSet(false)(options) // false si pas de fichiers pairés
|
||||||
|
MaCommandeOptionSet(options)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Getters
|
||||||
|
func CLIMonOption() string {
|
||||||
|
return _MonOption
|
||||||
|
}
|
||||||
|
|
||||||
|
// Setters
|
||||||
|
func SetMonOption(value string) {
|
||||||
|
_MonOption = value
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
### Étape 3 : Créer le fichier d'implémentation
|
||||||
|
|
||||||
|
Créer `macommande.go` (ou un nom plus descriptif) :
|
||||||
|
|
||||||
|
```go
|
||||||
|
package macommande
|
||||||
|
|
||||||
|
import (
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
)
|
||||||
|
|
||||||
|
// Fonction de traitement principale
|
||||||
|
func CLIMaCommande(sequences obiiter.IBioSequence) obiiter.IBioSequence {
|
||||||
|
// Récupération des options
|
||||||
|
option := CLIMonOption()
|
||||||
|
|
||||||
|
// Implémentation du traitement
|
||||||
|
// ...
|
||||||
|
|
||||||
|
return resultat
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
### Étape 4 : Créer l'exécutable dans `cmd/obitools/`
|
||||||
|
|
||||||
|
```bash
|
||||||
|
mkdir -p cmd/obitools/macommande
|
||||||
|
```
|
||||||
|
|
||||||
|
Créer `main.go` :
|
||||||
|
|
||||||
|
```go
|
||||||
|
package main
|
||||||
|
|
||||||
|
import (
|
||||||
|
"os"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/macommande"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
|
)
|
||||||
|
|
||||||
|
func main() {
|
||||||
|
// Parser d'options
|
||||||
|
optionParser := obioptions.GenerateOptionParser(
|
||||||
|
"macommande",
|
||||||
|
"Description courte de ma commande",
|
||||||
|
macommande.OptionSet)
|
||||||
|
|
||||||
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
// Lecture
|
||||||
|
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||||
|
|
||||||
|
// Traitement
|
||||||
|
resultat := macommande.CLIMaCommande(sequences)
|
||||||
|
|
||||||
|
// Écriture
|
||||||
|
obiconvert.CLIWriteBioSequences(resultat, true)
|
||||||
|
|
||||||
|
// Attente
|
||||||
|
obiutils.WaitForLastPipe()
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
### Étape 5 : Configurations optionnelles
|
||||||
|
|
||||||
|
Dans `main.go`, avant le parsing des options, on peut configurer :
|
||||||
|
|
||||||
|
```go
|
||||||
|
// Taille des batchs de séquences
|
||||||
|
obidefault.SetBatchSize(10)
|
||||||
|
|
||||||
|
// Nombre de workers en lecture (strict)
|
||||||
|
obidefault.SetStrictReadWorker(2)
|
||||||
|
|
||||||
|
// Nombre de workers en écriture
|
||||||
|
obidefault.SetStrictWriteWorker(2)
|
||||||
|
|
||||||
|
// Désactiver la lecture des qualités
|
||||||
|
obidefault.SetReadQualities(false)
|
||||||
|
```
|
||||||
|
|
||||||
|
### Étape 6 : Gestion des erreurs
|
||||||
|
|
||||||
|
Utiliser les fonctions utilitaires pour les messages d'erreur cohérents :
|
||||||
|
|
||||||
|
```go
|
||||||
|
// Pour les erreurs d'ouverture de fichiers
|
||||||
|
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||||
|
|
||||||
|
// Pour les erreurs générales
|
||||||
|
if err != nil {
|
||||||
|
log.Errorf("Message d'erreur: %v", err)
|
||||||
|
os.Exit(1)
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
### Étape 7 : Tests et debugging (optionnel)
|
||||||
|
|
||||||
|
Des commentaires dans le code montrent comment activer le profiling :
|
||||||
|
|
||||||
|
```go
|
||||||
|
// go tool pprof -http=":8000" ./macommande ./cpu.pprof
|
||||||
|
// f, err := os.Create("cpu.pprof")
|
||||||
|
// if err != nil {
|
||||||
|
// log.Fatal(err)
|
||||||
|
// }
|
||||||
|
// pprof.StartCPUProfile(f)
|
||||||
|
// defer pprof.StopCPUProfile()
|
||||||
|
|
||||||
|
// go tool trace cpu.trace
|
||||||
|
// ftrace, err := os.Create("cpu.trace")
|
||||||
|
// if err != nil {
|
||||||
|
// log.Fatal(err)
|
||||||
|
// }
|
||||||
|
// trace.Start(ftrace)
|
||||||
|
// defer trace.Stop()
|
||||||
|
```
|
||||||
|
|
||||||
|
## Bonnes pratiques observées
|
||||||
|
|
||||||
|
### 1. Séparation des responsabilités
|
||||||
|
|
||||||
|
- **`main.go`** : orchestration minimale
|
||||||
|
- **`options.go`** : définition et gestion des options
|
||||||
|
- **Fichiers d'implémentation** : logique métier
|
||||||
|
|
||||||
|
### 2. Convention de nommage cohérente
|
||||||
|
|
||||||
|
- Variables d'options : `_NomOption`
|
||||||
|
- Getters CLI : `CLINomOption()`
|
||||||
|
- Setters : `SetNomOption()`
|
||||||
|
- Fonctions de traitement CLI : `CLITraitement()`
|
||||||
|
|
||||||
|
### 3. Réutilisation du code
|
||||||
|
|
||||||
|
- Toutes les commandes réutilisent `obiconvert` pour l'I/O
|
||||||
|
- Les options communes sont partagées
|
||||||
|
- Les fonctions utilitaires sont centralisées
|
||||||
|
|
||||||
|
### 4. Configuration par défaut
|
||||||
|
|
||||||
|
Les valeurs par défaut sont :
|
||||||
|
- Définies lors de l'initialisation des variables
|
||||||
|
- Modifiables via les options CLI
|
||||||
|
- Modifiables programmatiquement via les setters
|
||||||
|
|
||||||
|
### 5. Gestion des formats
|
||||||
|
|
||||||
|
Support automatique de multiples formats :
|
||||||
|
- FASTA / FASTQ (avec compression gzip)
|
||||||
|
- EMBL / GenBank
|
||||||
|
- ecoPCR
|
||||||
|
- CSV
|
||||||
|
- JSON (avec différents formats d'en-têtes)
|
||||||
|
|
||||||
|
### 6. Parallélisation
|
||||||
|
|
||||||
|
Les commandes utilisent les workers parallèles via :
|
||||||
|
- `obidefault.ParallelWorkers()`
|
||||||
|
- `obidefault.SetStrictReadWorker(n)`
|
||||||
|
- `obidefault.SetStrictWriteWorker(n)`
|
||||||
|
|
||||||
|
### 7. Logging cohérent
|
||||||
|
|
||||||
|
Utilisation de `logrus` pour tous les logs :
|
||||||
|
```go
|
||||||
|
log.Printf("Message informatif")
|
||||||
|
log.Errorf("Message d'erreur: %v", err)
|
||||||
|
log.Fatal(err) // Arrêt du programme
|
||||||
|
```
|
||||||
|
|
||||||
|
## Dépendances principales
|
||||||
|
|
||||||
|
### Packages internes OBITools
|
||||||
|
|
||||||
|
- `pkg/obidefault` : valeurs par défaut et configuration globale
|
||||||
|
- `pkg/obioptions` : génération du parser d'options
|
||||||
|
- `pkg/obiiter` : itérateurs de séquences biologiques
|
||||||
|
- `pkg/obiseq` : structures et fonctions pour séquences biologiques
|
||||||
|
- `pkg/obiformats` : lecture/écriture de différents formats
|
||||||
|
- `pkg/obiutils` : fonctions utilitaires diverses
|
||||||
|
- `pkg/obichunk` : traitement par chunks (pour dereplication, etc.)
|
||||||
|
|
||||||
|
### Packages externes
|
||||||
|
|
||||||
|
- `github.com/DavidGamba/go-getoptions` : parsing des options CLI
|
||||||
|
- `github.com/sirupsen/logrus` : logging structuré
|
||||||
|
- `gopkg.in/yaml.v3` : encodage/décodage YAML
|
||||||
|
- `github.com/dlclark/regexp2` : expressions régulières avancées
|
||||||
|
|
||||||
|
## Cas spéciaux
|
||||||
|
|
||||||
|
### Commande avec fichiers pairés (obipairing)
|
||||||
|
|
||||||
|
```go
|
||||||
|
func OptionSet(options *getoptions.GetOpt) {
|
||||||
|
obiconvert.OutputOptionSet(options)
|
||||||
|
obiconvert.InputOptionSet(options)
|
||||||
|
PairingOptionSet(options) // Options spécifiques au pairing
|
||||||
|
}
|
||||||
|
|
||||||
|
func CLIPairedSequence() (obiiter.IBioSequence, error) {
|
||||||
|
forward, err := obiconvert.CLIReadBioSequences(_ForwardFile)
|
||||||
|
// ...
|
||||||
|
reverse, err := obiconvert.CLIReadBioSequences(_ReverseFile)
|
||||||
|
// ...
|
||||||
|
paired := forward.PairTo(reverse)
|
||||||
|
return paired, nil
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
Dans `main.go` :
|
||||||
|
```go
|
||||||
|
pairs, err := obipairing.CLIPairedSequence() // Lecture spéciale
|
||||||
|
if err != nil {
|
||||||
|
log.Errorf("Cannot open file (%v)", err)
|
||||||
|
os.Exit(1)
|
||||||
|
}
|
||||||
|
|
||||||
|
paired := obipairing.IAssemblePESequencesBatch(
|
||||||
|
pairs,
|
||||||
|
obipairing.CLIGapPenality(),
|
||||||
|
// ... autres paramètres
|
||||||
|
)
|
||||||
|
```
|
||||||
|
|
||||||
|
### Commande sans sortie de séquences (obisummary)
|
||||||
|
|
||||||
|
Au lieu de `obiconvert.CLIWriteBioSequences()`, affichage direct :
|
||||||
|
|
||||||
|
```go
|
||||||
|
summary := obisummary.ISummary(fs, obisummary.CLIMapSummary())
|
||||||
|
|
||||||
|
if obisummary.CLIOutFormat() == "json" {
|
||||||
|
output, _ := json.MarshalIndent(summary, "", " ")
|
||||||
|
fmt.Print(string(output))
|
||||||
|
} else {
|
||||||
|
output, _ := yaml.Marshal(summary)
|
||||||
|
fmt.Print(string(output))
|
||||||
|
}
|
||||||
|
fmt.Printf("\n")
|
||||||
|
```
|
||||||
|
|
||||||
|
### Commande avec Workers personnalisés (obimicrosat)
|
||||||
|
|
||||||
|
```go
|
||||||
|
func CLIAnnotateMicrosat(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||||
|
// Création du worker
|
||||||
|
worker := MakeMicrosatWorker(
|
||||||
|
CLIMinUnitLength(),
|
||||||
|
CLIMaxUnitLength(),
|
||||||
|
CLIMinUnitCount(),
|
||||||
|
CLIMinLength(),
|
||||||
|
CLIMinFlankLength(),
|
||||||
|
CLIReoriented(),
|
||||||
|
)
|
||||||
|
|
||||||
|
// Application du worker
|
||||||
|
newIter := iterator.MakeIWorker(
|
||||||
|
worker,
|
||||||
|
false, // pas de merge
|
||||||
|
obidefault.ParallelWorkers(), // parallélisation
|
||||||
|
)
|
||||||
|
|
||||||
|
return newIter.FilterEmpty() // Filtrage des résultats vides
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
## Diagramme de flux d'exécution
|
||||||
|
|
||||||
|
```
|
||||||
|
┌─────────────────────────────────────────────────────────────┐
|
||||||
|
│ cmd/obitools/macommande/main.go │
|
||||||
|
└─────────────────────────────────────────────────────────────┘
|
||||||
|
│
|
||||||
|
▼
|
||||||
|
┌─────────────────────────────────────────────────────────────┐
|
||||||
|
│ 1. Génération du parser d'options │
|
||||||
|
│ obioptions.GenerateOptionParser( │
|
||||||
|
│ "macommande", │
|
||||||
|
│ "description", │
|
||||||
|
│ macommande.OptionSet) │
|
||||||
|
└─────────────────────────────────────────────────────────────┘
|
||||||
|
│
|
||||||
|
▼
|
||||||
|
┌─────────────────────────────────────────────────────────────┐
|
||||||
|
│ pkg/obitools/macommande/options.go │
|
||||||
|
│ ┌─────────────────────────────────────────────────────┐ │
|
||||||
|
│ │ func OptionSet(options *getoptions.GetOpt) │ │
|
||||||
|
│ │ obiconvert.OptionSet(false)(options) ───────────┐ │ │
|
||||||
|
│ │ MaCommandeOptionSet(options) │ │ │
|
||||||
|
│ └───────────────────────────────────────────────────┼─┘ │
|
||||||
|
└────────────────────────────────────────────────────────┼─────┘
|
||||||
|
│ │
|
||||||
|
│ │
|
||||||
|
┌─────────────┘ │
|
||||||
|
│ │
|
||||||
|
▼ ▼
|
||||||
|
┌─────────────────────────────────┐ ┌───────────────────────────────┐
|
||||||
|
│ 2. Parsing des arguments │ │ pkg/obitools/obiconvert/ │
|
||||||
|
│ _, args := optionParser(...) │ │ options.go │
|
||||||
|
└─────────────────────────────────┘ │ - InputOptionSet() │
|
||||||
|
│ │ - OutputOptionSet() │
|
||||||
|
▼ │ - PairedFilesOptionSet() │
|
||||||
|
┌─────────────────────────────────┐ └───────────────────────────────┘
|
||||||
|
│ 3. Lecture des séquences │
|
||||||
|
│ CLIReadBioSequences(args) │
|
||||||
|
└─────────────────────────────────┘
|
||||||
|
│
|
||||||
|
▼
|
||||||
|
┌─────────────────────────────────────────────────────────────┐
|
||||||
|
│ pkg/obitools/obiconvert/sequence_reader.go │
|
||||||
|
│ - ExpandListOfFiles() │
|
||||||
|
│ - ReadSequencesFromFile() / ReadSequencesFromStdin() │
|
||||||
|
│ - Support: FASTA, FASTQ, EMBL, GenBank, ecoPCR, CSV │
|
||||||
|
└─────────────────────────────────────────────────────────────┘
|
||||||
|
│
|
||||||
|
▼ obiiter.IBioSequence
|
||||||
|
┌─────────────────────────────────────────────────────────────┐
|
||||||
|
│ 4. Traitement spécifique │
|
||||||
|
│ macommande.CLITraitement(sequences) │
|
||||||
|
└─────────────────────────────────────────────────────────────┘
|
||||||
|
│
|
||||||
|
▼
|
||||||
|
┌─────────────────────────────────────────────────────────────┐
|
||||||
|
│ pkg/obitools/macommande/<implementation>.go │
|
||||||
|
│ - Récupération des options via CLI*() getters │
|
||||||
|
│ - Application de la logique métier │
|
||||||
|
│ - Retour d'un nouvel iterator │
|
||||||
|
└─────────────────────────────────────────────────────────────┘
|
||||||
|
│
|
||||||
|
▼ obiiter.IBioSequence
|
||||||
|
┌─────────────────────────────────────────────────────────────┐
|
||||||
|
│ 5. Écriture des résultats │
|
||||||
|
│ CLIWriteBioSequences(resultat, true) │
|
||||||
|
└─────────────────────────────────────────────────────────────┘
|
||||||
|
│
|
||||||
|
▼
|
||||||
|
┌─────────────────────────────────────────────────────────────┐
|
||||||
|
│ pkg/obitools/obiconvert/sequence_writer.go │
|
||||||
|
│ - WriteSequencesToFile() / WriteSequencesToStdout() │
|
||||||
|
│ - Support: FASTA, FASTQ, JSON │
|
||||||
|
│ - Gestion des lectures pairées │
|
||||||
|
│ - Compression optionnelle │
|
||||||
|
└─────────────────────────────────────────────────────────────┘
|
||||||
|
│
|
||||||
|
▼
|
||||||
|
┌─────────────────────────────────────────────────────────────┐
|
||||||
|
│ 6. Attente de fin du pipeline │
|
||||||
|
│ obiutils.WaitForLastPipe() │
|
||||||
|
└─────────────────────────────────────────────────────────────┘
|
||||||
|
```
|
||||||
|
|
||||||
|
## Conclusion
|
||||||
|
|
||||||
|
L'architecture des commandes OBITools est conçue pour :
|
||||||
|
|
||||||
|
1. **Maximiser la réutilisation** : `obiconvert` fournit les fonctionnalités communes
|
||||||
|
2. **Simplifier l'ajout de nouvelles commandes** : pattern standardisé et minimaliste
|
||||||
|
3. **Faciliter la maintenance** : séparation claire des responsabilités
|
||||||
|
4. **Garantir la cohérence** : conventions de nommage et structure uniforme
|
||||||
|
5. **Optimiser les performances** : parallélisation intégrée et traitement par batch
|
||||||
|
|
||||||
|
Cette architecture modulaire permet de créer rapidement de nouvelles commandes tout en maintenant une qualité et une cohérence élevées dans toute la suite OBITools.
|
||||||
99
blackboard/architechture/definition-superkmer.md
Normal file
99
blackboard/architechture/definition-superkmer.md
Normal file
@@ -0,0 +1,99 @@
|
|||||||
|
# Définition du super k-mer
|
||||||
|
|
||||||
|
## Définition
|
||||||
|
|
||||||
|
Un **super k-mer** est une **sous-séquence MAXIMALE** d'une séquence dans laquelle **tous les k-mers consécutifs partagent le même minimiseur**.
|
||||||
|
|
||||||
|
### Termes
|
||||||
|
|
||||||
|
- **k-mer** : sous-séquence de longueur k
|
||||||
|
- **minimiseur** : le plus petit m-mer canonique parmi tous les m-mers d'un k-mer
|
||||||
|
- **k-mers consécutifs** : k-mers aux positions i et i+1 (chevauchement de k-1 nucléotides)
|
||||||
|
- **MAXIMALE** : ne peut être étendue ni à gauche ni à droite
|
||||||
|
|
||||||
|
## RÈGLES ABSOLUES
|
||||||
|
|
||||||
|
### RÈGLE 1 : Longueur minimum = k
|
||||||
|
|
||||||
|
Un super k-mer contient au minimum k nucléotides.
|
||||||
|
|
||||||
|
```
|
||||||
|
longueur(super-kmer) >= k
|
||||||
|
```
|
||||||
|
|
||||||
|
### RÈGLE 2 : Chevauchement obligatoire = k-1
|
||||||
|
|
||||||
|
Deux super-kmers consécutifs se chevauchent d'EXACTEMENT k-1 nucléotides.
|
||||||
|
|
||||||
|
```
|
||||||
|
SK1.End - SK2.Start = k - 1
|
||||||
|
```
|
||||||
|
|
||||||
|
### RÈGLE 3 : Bijection séquence ↔ minimiseur
|
||||||
|
|
||||||
|
Une séquence de super k-mer a UN et UN SEUL minimiseur.
|
||||||
|
|
||||||
|
```
|
||||||
|
Même séquence → Même minimiseur (TOUJOURS)
|
||||||
|
```
|
||||||
|
|
||||||
|
**Si vous observez la même séquence avec deux minimiseurs différents, c'est un BUG.**
|
||||||
|
|
||||||
|
### RÈGLE 4 : Tous les k-mers partagent le minimiseur
|
||||||
|
|
||||||
|
TOUS les k-mers contenus dans un super k-mer ont le même minimiseur.
|
||||||
|
|
||||||
|
```
|
||||||
|
∀ k-mer K dans SK : minimiseur(K) = SK.minimizer
|
||||||
|
```
|
||||||
|
|
||||||
|
### RÈGLE 5 : Maximalité
|
||||||
|
|
||||||
|
Un super k-mer ne peut pas être étendu.
|
||||||
|
|
||||||
|
- Si on ajoute un nucléotide à gauche : le nouveau k-mer a un minimiseur différent
|
||||||
|
- Si on ajoute un nucléotide à droite : le nouveau k-mer a un minimiseur différent
|
||||||
|
|
||||||
|
## VIOLATIONS INTERDITES
|
||||||
|
|
||||||
|
❌ **Super k-mer de longueur < k**
|
||||||
|
❌ **Chevauchement ≠ k-1 entre consécutifs**
|
||||||
|
❌ **Même séquence avec minimiseurs différents**
|
||||||
|
❌ **K-mer dans le super k-mer avec minimiseur différent**
|
||||||
|
❌ **Super k-mer extensible (non-maximal)**
|
||||||
|
|
||||||
|
## CONSÉQUENCES PRATIQUES
|
||||||
|
|
||||||
|
### Pour l'extraction
|
||||||
|
|
||||||
|
L'algorithme doit :
|
||||||
|
1. Calculer le minimiseur de chaque k-mer
|
||||||
|
2. Découper quand le minimiseur change
|
||||||
|
3. Assigner au super k-mer le minimiseur commun à tous ses k-mers
|
||||||
|
4. Garantir que chaque super k-mer contient au moins k nucléotides
|
||||||
|
5. Garantir le chevauchement de k-1 entre consécutifs
|
||||||
|
|
||||||
|
### Pour la validation
|
||||||
|
|
||||||
|
Si après déduplication (obiuniq) on observe :
|
||||||
|
```
|
||||||
|
Séquence: ACGT...
|
||||||
|
Minimiseurs: {M1, M2} // plusieurs minimiseurs
|
||||||
|
```
|
||||||
|
|
||||||
|
C'est la PREUVE d'un bug : l'algorithme a produit cette séquence avec des minimiseurs différents, ce qui viole la RÈGLE 3.
|
||||||
|
|
||||||
|
## DIAGNOSTIC DU BUG
|
||||||
|
|
||||||
|
**Bug observé** : Même séquence avec minimiseurs différents après obiuniq
|
||||||
|
|
||||||
|
**Cause possible** : L'algorithme assigne le mauvais minimiseur OU découpe mal les super-kmers
|
||||||
|
|
||||||
|
**Ce que le bug NE PEUT PAS être** :
|
||||||
|
- Un problème d'obiuniq (révèle le bug, ne le crée pas)
|
||||||
|
- Un problème de chevauchement légitime (k-1 est correct)
|
||||||
|
|
||||||
|
**Ce que le bug DOIT être** :
|
||||||
|
- Minimiseur mal calculé ou mal assigné
|
||||||
|
- Découpage incorrect (mauvais endPos)
|
||||||
|
- Copie incorrecte des données
|
||||||
316
blackboard/architechture/guide-redaction-obitest.md
Normal file
316
blackboard/architechture/guide-redaction-obitest.md
Normal file
@@ -0,0 +1,316 @@
|
|||||||
|
# Guide de rédaction d'un obitest
|
||||||
|
|
||||||
|
## Règles essentielles
|
||||||
|
|
||||||
|
1. **Données < 1 KB** - Fichiers de test très petits
|
||||||
|
2. **Exécution < 10 sec** - Tests rapides pour CI/CD
|
||||||
|
3. **Auto-contenu** - Pas de dépendances externes
|
||||||
|
4. **Auto-nettoyage** - Pas de fichiers résiduels
|
||||||
|
|
||||||
|
## Structure minimale
|
||||||
|
|
||||||
|
```
|
||||||
|
obitests/obitools/<commande>/
|
||||||
|
├── test.sh # Script exécutable
|
||||||
|
└── data.fasta # Données minimales (optionnel)
|
||||||
|
```
|
||||||
|
|
||||||
|
## Template de test.sh
|
||||||
|
|
||||||
|
```bash
|
||||||
|
#!/bin/bash
|
||||||
|
|
||||||
|
TEST_NAME=<commande>
|
||||||
|
CMD=<commande>
|
||||||
|
|
||||||
|
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||||
|
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||||
|
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||||
|
|
||||||
|
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||||
|
|
||||||
|
TMPDIR="$(mktemp -d)"
|
||||||
|
ntest=0
|
||||||
|
success=0
|
||||||
|
failed=0
|
||||||
|
|
||||||
|
cleanup() {
|
||||||
|
echo "========================================" 1>&2
|
||||||
|
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||||
|
echo 1>&2
|
||||||
|
echo "- $ntest tests run" 1>&2
|
||||||
|
echo "- $success successfully completed" 1>&2
|
||||||
|
echo "- $failed failed tests" 1>&2
|
||||||
|
echo 1>&2
|
||||||
|
echo "Cleaning up the temporary directory..." 1>&2
|
||||||
|
echo 1>&2
|
||||||
|
echo "========================================" 1>&2
|
||||||
|
|
||||||
|
rm -rf "$TMPDIR"
|
||||||
|
|
||||||
|
if [ $failed -gt 0 ]; then
|
||||||
|
log "$TEST_NAME tests failed"
|
||||||
|
log
|
||||||
|
log
|
||||||
|
exit 1
|
||||||
|
fi
|
||||||
|
|
||||||
|
log
|
||||||
|
log
|
||||||
|
exit 0
|
||||||
|
}
|
||||||
|
|
||||||
|
log() {
|
||||||
|
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||||
|
}
|
||||||
|
|
||||||
|
log "Testing $TEST_NAME..."
|
||||||
|
log "Test directory is $TEST_DIR"
|
||||||
|
log "obitools directory is $OBITOOLS_DIR"
|
||||||
|
log "Temporary directory is $TMPDIR"
|
||||||
|
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||||
|
|
||||||
|
########## TESTS ##########
|
||||||
|
|
||||||
|
# Test 1: Help (OBLIGATOIRE)
|
||||||
|
((ntest++))
|
||||||
|
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||||
|
then
|
||||||
|
log "$MCMD: printing help OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: printing help failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Ajoutez vos tests ici...
|
||||||
|
|
||||||
|
###########################
|
||||||
|
|
||||||
|
cleanup
|
||||||
|
```
|
||||||
|
|
||||||
|
## Pattern de test
|
||||||
|
|
||||||
|
```bash
|
||||||
|
((ntest++))
|
||||||
|
if commande args > "${TMPDIR}/output.txt" 2>&1
|
||||||
|
then
|
||||||
|
log "$MCMD: description OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: description failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
```
|
||||||
|
|
||||||
|
## Tests courants
|
||||||
|
|
||||||
|
### Exécution basique
|
||||||
|
```bash
|
||||||
|
((ntest++))
|
||||||
|
if $CMD "${TEST_DIR}/input.fasta" > "${TMPDIR}/output.fasta" 2>&1
|
||||||
|
then
|
||||||
|
log "$MCMD: basic execution OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: basic execution failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
```
|
||||||
|
|
||||||
|
### Sortie non vide
|
||||||
|
```bash
|
||||||
|
((ntest++))
|
||||||
|
if [ -s "${TMPDIR}/output.fasta" ]
|
||||||
|
then
|
||||||
|
log "$MCMD: output not empty OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: output empty - failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
```
|
||||||
|
|
||||||
|
### Comptage
|
||||||
|
```bash
|
||||||
|
((ntest++))
|
||||||
|
count=$(grep -c "^>" "${TMPDIR}/output.fasta")
|
||||||
|
if [ "$count" -gt 0 ]
|
||||||
|
then
|
||||||
|
log "$MCMD: extracted $count sequences OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: no sequences - failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
```
|
||||||
|
|
||||||
|
### Présence de contenu
|
||||||
|
```bash
|
||||||
|
((ntest++))
|
||||||
|
if grep -q "expected_string" "${TMPDIR}/output.fasta"
|
||||||
|
then
|
||||||
|
log "$MCMD: expected content found OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: content not found - failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
```
|
||||||
|
|
||||||
|
### Comparaison avec référence
|
||||||
|
```bash
|
||||||
|
((ntest++))
|
||||||
|
if diff "${TEST_DIR}/expected.fasta" "${TMPDIR}/output.fasta" > /dev/null
|
||||||
|
then
|
||||||
|
log "$MCMD: matches reference OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: differs from reference - failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
```
|
||||||
|
|
||||||
|
### Test avec options
|
||||||
|
```bash
|
||||||
|
((ntest++))
|
||||||
|
if $CMD --opt value "${TEST_DIR}/input.fasta" > "${TMPDIR}/out.fasta" 2>&1
|
||||||
|
then
|
||||||
|
log "$MCMD: with option OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: with option failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
```
|
||||||
|
|
||||||
|
## Variables importantes
|
||||||
|
|
||||||
|
- **TEST_DIR** - Répertoire du test (données d'entrée)
|
||||||
|
- **TMPDIR** - Répertoire temporaire (sorties)
|
||||||
|
- **CMD** - Nom de la commande
|
||||||
|
- **MCMD** - Nom formaté pour les logs
|
||||||
|
|
||||||
|
## Règles d'or
|
||||||
|
|
||||||
|
✅ **Entrées** → `${TEST_DIR}/`
|
||||||
|
✅ **Sorties** → `${TMPDIR}/`
|
||||||
|
✅ **Toujours rediriger** → `> file 2>&1`
|
||||||
|
✅ **Incrémenter ntest** → Avant chaque test
|
||||||
|
✅ **Messages clairs** → Descriptions explicites
|
||||||
|
|
||||||
|
❌ **Pas de chemins en dur**
|
||||||
|
❌ **Pas de /tmp direct**
|
||||||
|
❌ **Pas de sortie vers TEST_DIR**
|
||||||
|
❌ **Pas de commandes sans redirection**
|
||||||
|
|
||||||
|
## Données de test
|
||||||
|
|
||||||
|
Créer un fichier minimal (< 500 bytes) :
|
||||||
|
|
||||||
|
```fasta
|
||||||
|
>seq1
|
||||||
|
ACGTACGTACGTACGT
|
||||||
|
>seq2
|
||||||
|
AAAACCCCGGGGTTTT
|
||||||
|
>seq3
|
||||||
|
ATCGATCGATCGATCG
|
||||||
|
```
|
||||||
|
|
||||||
|
## Création rapide
|
||||||
|
|
||||||
|
```bash
|
||||||
|
# 1. Créer le répertoire
|
||||||
|
mkdir -p obitests/obitools/<commande>
|
||||||
|
cd obitests/obitools/<commande>
|
||||||
|
|
||||||
|
# 2. Créer les données de test
|
||||||
|
cat > test_data.fasta << 'EOF'
|
||||||
|
>seq1
|
||||||
|
ACGTACGTACGTACGT
|
||||||
|
>seq2
|
||||||
|
AAAACCCCGGGGTTTT
|
||||||
|
EOF
|
||||||
|
|
||||||
|
# 3. Copier le template dans test.sh
|
||||||
|
# 4. Adapter le TEST_NAME et CMD
|
||||||
|
# 5. Ajouter les tests
|
||||||
|
# 6. Rendre exécutable
|
||||||
|
chmod +x test.sh
|
||||||
|
|
||||||
|
# 7. Tester
|
||||||
|
./test.sh
|
||||||
|
```
|
||||||
|
|
||||||
|
## Checklist
|
||||||
|
|
||||||
|
- [ ] `test.sh` exécutable (`chmod +x`)
|
||||||
|
- [ ] Test d'aide inclus
|
||||||
|
- [ ] Données < 1 KB
|
||||||
|
- [ ] Sorties vers `${TMPDIR}/`
|
||||||
|
- [ ] Entrées depuis `${TEST_DIR}/`
|
||||||
|
- [ ] Redirections `2>&1`
|
||||||
|
- [ ] Messages clairs
|
||||||
|
- [ ] Testé localement
|
||||||
|
- [ ] Exit code 0 si succès
|
||||||
|
|
||||||
|
## Debug
|
||||||
|
|
||||||
|
Conserver TMPDIR pour inspection :
|
||||||
|
```bash
|
||||||
|
cleanup() {
|
||||||
|
echo "Temporary directory: $TMPDIR" 1>&2
|
||||||
|
# rm -rf "$TMPDIR" # Commenté
|
||||||
|
...
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
Mode verbose :
|
||||||
|
```bash
|
||||||
|
set -x # Au début du script
|
||||||
|
```
|
||||||
|
|
||||||
|
## Exemples
|
||||||
|
|
||||||
|
**Simple (1 test)** - obimicrosat
|
||||||
|
```bash
|
||||||
|
# Juste l'aide
|
||||||
|
```
|
||||||
|
|
||||||
|
**Moyen (4-5 tests)** - obisuperkmer
|
||||||
|
```bash
|
||||||
|
# Aide + exécution + validation sortie + contenu
|
||||||
|
```
|
||||||
|
|
||||||
|
**Complet (7+ tests)** - obiuniq
|
||||||
|
```bash
|
||||||
|
# Aide + exécution + comparaison CSV + options + multiples cas
|
||||||
|
```
|
||||||
|
|
||||||
|
## Commandes utiles
|
||||||
|
|
||||||
|
```bash
|
||||||
|
# Compter séquences
|
||||||
|
grep -c "^>" file.fasta
|
||||||
|
|
||||||
|
# Fichier non vide
|
||||||
|
[ -s file ]
|
||||||
|
|
||||||
|
# Comparer
|
||||||
|
diff file1 file2 > /dev/null
|
||||||
|
|
||||||
|
# Comparer compressés
|
||||||
|
zdiff file1.gz file2.gz
|
||||||
|
|
||||||
|
# Compter bases
|
||||||
|
grep -v "^>" file | tr -d '\n' | wc -c
|
||||||
|
```
|
||||||
|
|
||||||
|
## Ce qu'il faut retenir
|
||||||
|
|
||||||
|
Un bon test est **COURT**, **RAPIDE** et **SIMPLE** :
|
||||||
|
- 3-10 tests maximum
|
||||||
|
- Données < 1 KB
|
||||||
|
- Exécution < 10 secondes
|
||||||
|
- Pattern standard respecté
|
||||||
268
blackboard/architechture/obisuperkmer-implementation.md
Normal file
268
blackboard/architechture/obisuperkmer-implementation.md
Normal file
@@ -0,0 +1,268 @@
|
|||||||
|
# Implémentation de la commande obisuperkmer
|
||||||
|
|
||||||
|
## Vue d'ensemble
|
||||||
|
|
||||||
|
La commande `obisuperkmer` a été implémentée en suivant l'architecture standard des commandes OBITools décrite dans `architecture-commande-obitools.md`. Cette commande permet d'extraire les super k-mers de fichiers de séquences biologiques.
|
||||||
|
|
||||||
|
## Qu'est-ce qu'un super k-mer ?
|
||||||
|
|
||||||
|
Un super k-mer est une sous-séquence maximale dans laquelle tous les k-mers consécutifs partagent le même minimiseur. Cette décomposition est utile pour :
|
||||||
|
- L'indexation efficace de k-mers
|
||||||
|
- La réduction de la redondance dans les analyses
|
||||||
|
- L'optimisation de la mémoire pour les structures de données de k-mers
|
||||||
|
|
||||||
|
## Structure de l'implémentation
|
||||||
|
|
||||||
|
### 1. Package `pkg/obitools/obisuperkmer/`
|
||||||
|
|
||||||
|
Le package contient trois fichiers :
|
||||||
|
|
||||||
|
#### `obisuperkmer.go`
|
||||||
|
Documentation du package avec une description de son rôle.
|
||||||
|
|
||||||
|
#### `options.go`
|
||||||
|
Définit les options de ligne de commande :
|
||||||
|
|
||||||
|
```go
|
||||||
|
var _KmerSize = 21 // Taille des k-mers (par défaut 21)
|
||||||
|
var _MinimizerSize = 11 // Taille des minimiseurs (par défaut 11)
|
||||||
|
```
|
||||||
|
|
||||||
|
**Options CLI disponibles :**
|
||||||
|
- `--kmer-size` / `-k` : Taille des k-mers (entre m+1 et 31)
|
||||||
|
- `--minimizer-size` / `-m` : Taille des minimiseurs (entre 1 et k-1)
|
||||||
|
|
||||||
|
**Fonctions d'accès :**
|
||||||
|
- `CLIKmerSize()` : retourne la taille des k-mers
|
||||||
|
- `CLIMinimizerSize()` : retourne la taille des minimiseurs
|
||||||
|
- `SetKmerSize(k int)` : définit la taille des k-mers
|
||||||
|
- `SetMinimizerSize(m int)` : définit la taille des minimiseurs
|
||||||
|
|
||||||
|
#### `superkmer.go`
|
||||||
|
Implémente la logique de traitement :
|
||||||
|
|
||||||
|
```go
|
||||||
|
func CLIExtractSuperKmers(iterator obiiter.IBioSequence) obiiter.IBioSequence
|
||||||
|
```
|
||||||
|
|
||||||
|
Cette fonction :
|
||||||
|
1. Récupère les paramètres k et m depuis les options CLI
|
||||||
|
2. Valide les paramètres (m < k, k <= 31, etc.)
|
||||||
|
3. Crée un worker utilisant `obikmer.SuperKmerWorker(k, m)`
|
||||||
|
4. Applique le worker en parallèle sur l'itérateur de séquences
|
||||||
|
5. Retourne un itérateur de super k-mers
|
||||||
|
|
||||||
|
### 2. Exécutable `cmd/obitools/obisuperkmer/main.go`
|
||||||
|
|
||||||
|
L'exécutable suit le pattern standard minimal :
|
||||||
|
|
||||||
|
```go
|
||||||
|
func main() {
|
||||||
|
// 1. Génération du parser d'options
|
||||||
|
optionParser := obioptions.GenerateOptionParser(
|
||||||
|
"obisuperkmer",
|
||||||
|
"extract super k-mers from sequence files",
|
||||||
|
obisuperkmer.OptionSet)
|
||||||
|
|
||||||
|
// 2. Parsing des arguments
|
||||||
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
// 3. Lecture des séquences
|
||||||
|
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||||
|
|
||||||
|
// 4. Extraction des super k-mers
|
||||||
|
superkmers := obisuperkmer.CLIExtractSuperKmers(sequences)
|
||||||
|
|
||||||
|
// 5. Écriture des résultats
|
||||||
|
obiconvert.CLIWriteBioSequences(superkmers, true)
|
||||||
|
|
||||||
|
// 6. Attente de la fin du pipeline
|
||||||
|
obiutils.WaitForLastPipe()
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
## Utilisation du package `obikmer`
|
||||||
|
|
||||||
|
L'implémentation s'appuie sur le package `obikmer` qui fournit :
|
||||||
|
|
||||||
|
### `SuperKmerWorker(k int, m int) obiseq.SeqWorker`
|
||||||
|
|
||||||
|
Crée un worker qui :
|
||||||
|
- Extrait les super k-mers d'une BioSequence
|
||||||
|
- Retourne une slice de BioSequence, une par super k-mer
|
||||||
|
- Chaque super k-mer contient les attributs suivants :
|
||||||
|
|
||||||
|
```go
|
||||||
|
// Métadonnées ajoutées à chaque super k-mer :
|
||||||
|
{
|
||||||
|
"minimizer_value": uint64, // Valeur canonique du minimiseur
|
||||||
|
"minimizer_seq": string, // Séquence ADN du minimiseur
|
||||||
|
"k": int, // Taille des k-mers utilisée
|
||||||
|
"m": int, // Taille des minimiseurs utilisée
|
||||||
|
"start": int, // Position de début (0-indexé)
|
||||||
|
"end": int, // Position de fin (exclusif)
|
||||||
|
"parent_id": string, // ID de la séquence parente
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
### Algorithme sous-jacent
|
||||||
|
|
||||||
|
Le package `obikmer` utilise :
|
||||||
|
- `IterSuperKmers(seq []byte, k int, m int)` : itérateur sur les super k-mers
|
||||||
|
- Une deque monotone pour suivre les minimiseurs dans une fenêtre glissante
|
||||||
|
- Complexité temporelle : O(n) où n est la longueur de la séquence
|
||||||
|
- Complexité spatiale : O(k-m+1) pour la deque
|
||||||
|
|
||||||
|
## Exemple d'utilisation
|
||||||
|
|
||||||
|
### Ligne de commande
|
||||||
|
|
||||||
|
```bash
|
||||||
|
# Extraction avec paramètres par défaut (k=21, m=11)
|
||||||
|
obisuperkmer sequences.fasta > superkmers.fasta
|
||||||
|
|
||||||
|
# Spécifier les tailles de k-mers et minimiseurs
|
||||||
|
obisuperkmer -k 25 -m 13 sequences.fasta -o superkmers.fasta
|
||||||
|
|
||||||
|
# Avec plusieurs fichiers d'entrée
|
||||||
|
obisuperkmer --kmer-size 31 --minimizer-size 15 file1.fasta file2.fasta > output.fasta
|
||||||
|
|
||||||
|
# Format FASTQ en entrée, FASTA en sortie
|
||||||
|
obisuperkmer sequences.fastq --fasta-output -o superkmers.fasta
|
||||||
|
|
||||||
|
# Avec compression
|
||||||
|
obisuperkmer sequences.fasta -o superkmers.fasta.gz --compress
|
||||||
|
```
|
||||||
|
|
||||||
|
### Exemple de sortie
|
||||||
|
|
||||||
|
Pour une séquence d'entrée :
|
||||||
|
```
|
||||||
|
>seq1
|
||||||
|
ACGTACGTACGTACGTACGTACGT
|
||||||
|
```
|
||||||
|
|
||||||
|
La sortie contiendra plusieurs super k-mers :
|
||||||
|
```
|
||||||
|
>seq1_superkmer_0_15 {"minimizer_value":123456,"minimizer_seq":"acgtacgt","k":21,"m":11,"start":0,"end":15,"parent_id":"seq1"}
|
||||||
|
ACGTACGTACGTACG
|
||||||
|
>seq1_superkmer_8_24 {"minimizer_value":789012,"minimizer_seq":"gtacgtac","k":21,"m":11,"start":8,"end":24,"parent_id":"seq1"}
|
||||||
|
TACGTACGTACGTACGT
|
||||||
|
```
|
||||||
|
|
||||||
|
## Options héritées de `obiconvert`
|
||||||
|
|
||||||
|
La commande hérite de toutes les options standard d'OBITools :
|
||||||
|
|
||||||
|
### Options d'entrée
|
||||||
|
- `--fasta` : forcer le format FASTA
|
||||||
|
- `--fastq` : forcer le format FASTQ
|
||||||
|
- `--ecopcr` : format ecoPCR
|
||||||
|
- `--embl` : format EMBL
|
||||||
|
- `--genbank` : format GenBank
|
||||||
|
- `--input-json-header` : en-têtes JSON
|
||||||
|
- `--input-OBI-header` : en-têtes OBI
|
||||||
|
|
||||||
|
### Options de sortie
|
||||||
|
- `--out` / `-o` : fichier de sortie (défaut : stdout)
|
||||||
|
- `--fasta-output` : sortie en format FASTA
|
||||||
|
- `--fastq-output` : sortie en format FASTQ
|
||||||
|
- `--json-output` : sortie en format JSON
|
||||||
|
- `--output-json-header` : en-têtes JSON en sortie
|
||||||
|
- `--output-OBI-header` / `-O` : en-têtes OBI en sortie
|
||||||
|
- `--compress` / `-Z` : compression gzip
|
||||||
|
- `--skip-empty` : ignorer les séquences vides
|
||||||
|
- `--no-progressbar` : désactiver la barre de progression
|
||||||
|
|
||||||
|
## Compilation
|
||||||
|
|
||||||
|
Pour compiler la commande :
|
||||||
|
|
||||||
|
```bash
|
||||||
|
cd /chemin/vers/obitools4
|
||||||
|
go build -o bin/obisuperkmer ./cmd/obitools/obisuperkmer/
|
||||||
|
```
|
||||||
|
|
||||||
|
## Tests
|
||||||
|
|
||||||
|
Pour tester la commande :
|
||||||
|
|
||||||
|
```bash
|
||||||
|
# Créer un fichier de test
|
||||||
|
echo -e ">test\nACGTACGTACGTACGTACGTACGTACGTACGT" > test.fasta
|
||||||
|
|
||||||
|
# Exécuter obisuperkmer
|
||||||
|
obisuperkmer test.fasta
|
||||||
|
|
||||||
|
# Vérifier avec des paramètres différents
|
||||||
|
obisuperkmer -k 15 -m 7 test.fasta
|
||||||
|
```
|
||||||
|
|
||||||
|
## Validation des paramètres
|
||||||
|
|
||||||
|
La commande valide automatiquement :
|
||||||
|
- `1 <= m < k` : le minimiseur doit être plus petit que le k-mer
|
||||||
|
- `2 <= k <= 31` : contrainte du codage sur 64 bits
|
||||||
|
- `len(sequence) >= k` : la séquence doit être assez longue
|
||||||
|
|
||||||
|
En cas de paramètres invalides, la commande affiche une erreur explicite et s'arrête.
|
||||||
|
|
||||||
|
## Intégration avec le pipeline OBITools
|
||||||
|
|
||||||
|
La commande s'intègre naturellement dans les pipelines OBITools :
|
||||||
|
|
||||||
|
```bash
|
||||||
|
# Pipeline complet d'analyse
|
||||||
|
obiconvert sequences.fastq --fasta-output | \
|
||||||
|
obisuperkmer -k 21 -m 11 | \
|
||||||
|
obiuniq | \
|
||||||
|
obigrep -p "minimizer_value>1000" > filtered_superkmers.fasta
|
||||||
|
```
|
||||||
|
|
||||||
|
## Parallélisation
|
||||||
|
|
||||||
|
La commande utilise automatiquement :
|
||||||
|
- `obidefault.ParallelWorkers()` pour le traitement parallèle
|
||||||
|
- Les workers sont distribués sur les séquences d'entrée
|
||||||
|
- La parallélisation est transparente pour l'utilisateur
|
||||||
|
|
||||||
|
## Conformité avec l'architecture OBITools
|
||||||
|
|
||||||
|
L'implémentation respecte tous les principes de l'architecture :
|
||||||
|
|
||||||
|
✅ Séparation des responsabilités (package + commande)
|
||||||
|
✅ Convention de nommage cohérente (CLI*, Set*, _variables)
|
||||||
|
✅ Réutilisation de `obiconvert` pour l'I/O
|
||||||
|
✅ Options standard partagées
|
||||||
|
✅ Pattern Worker pour le traitement
|
||||||
|
✅ Validation des paramètres
|
||||||
|
✅ Logging avec `logrus`
|
||||||
|
✅ Gestion d'erreurs cohérente
|
||||||
|
✅ Documentation complète
|
||||||
|
|
||||||
|
## Fichiers créés
|
||||||
|
|
||||||
|
```
|
||||||
|
pkg/obitools/obisuperkmer/
|
||||||
|
├── obisuperkmer.go # Documentation du package
|
||||||
|
├── options.go # Définition des options CLI
|
||||||
|
└── superkmer.go # Implémentation du traitement
|
||||||
|
|
||||||
|
cmd/obitools/obisuperkmer/
|
||||||
|
└── main.go # Point d'entrée de la commande
|
||||||
|
```
|
||||||
|
|
||||||
|
## Prochaines étapes
|
||||||
|
|
||||||
|
1. **Compilation** : Compiler la commande avec `go build`
|
||||||
|
2. **Tests unitaires** : Créer des tests dans `pkg/obitools/obisuperkmer/superkmer_test.go`
|
||||||
|
3. **Documentation utilisateur** : Ajouter la documentation de la commande
|
||||||
|
4. **Intégration CI/CD** : Ajouter aux tests d'intégration
|
||||||
|
5. **Benchmarks** : Mesurer les performances sur différents jeux de données
|
||||||
|
|
||||||
|
## Références
|
||||||
|
|
||||||
|
- Architecture des commandes OBITools : `architecture-commande-obitools.md`
|
||||||
|
- Package `obikmer` : `pkg/obikmer/`
|
||||||
|
- Tests du package : `pkg/obikmer/superkmer_iter_test.go`
|
||||||
440
blackboard/architechture/obisuperkmer-tests.md
Normal file
440
blackboard/architechture/obisuperkmer-tests.md
Normal file
@@ -0,0 +1,440 @@
|
|||||||
|
# Tests automatisés pour obisuperkmer
|
||||||
|
|
||||||
|
## Vue d'ensemble
|
||||||
|
|
||||||
|
Des tests automatisés ont été créés pour la commande `obisuperkmer` dans le répertoire `obitests/obitools/obisuperkmer/`. Ces tests suivent le pattern standard utilisé par toutes les commandes OBITools et sont conçus pour être exécutés dans un environnement CI/CD.
|
||||||
|
|
||||||
|
## Fichiers créés
|
||||||
|
|
||||||
|
```
|
||||||
|
obitests/obitools/obisuperkmer/
|
||||||
|
├── test.sh # Script de test principal (6.7 KB)
|
||||||
|
├── test_sequences.fasta # Données de test (117 bytes)
|
||||||
|
└── README.md # Documentation (4.1 KB)
|
||||||
|
```
|
||||||
|
|
||||||
|
### Taille totale : ~11 KB
|
||||||
|
|
||||||
|
Cette taille minimale est idéale pour un dépôt Git et des tests CI/CD rapides.
|
||||||
|
|
||||||
|
## Jeu de données de test
|
||||||
|
|
||||||
|
### Fichier : `test_sequences.fasta` (117 bytes)
|
||||||
|
|
||||||
|
Le fichier contient 3 séquences de 32 nucléotides chacune :
|
||||||
|
|
||||||
|
```fasta
|
||||||
|
>seq1
|
||||||
|
ACGTACGTACGTACGTACGTACGTACGTACGT
|
||||||
|
>seq2
|
||||||
|
AAAACCCCGGGGTTTTAAAACCCCGGGGTTTT
|
||||||
|
>seq3
|
||||||
|
ATCGATCGATCGATCGATCGATCGATCGATCG
|
||||||
|
```
|
||||||
|
|
||||||
|
#### Justification du choix
|
||||||
|
|
||||||
|
1. **seq1** : Motif répétitif simple (ACGT)
|
||||||
|
- Teste l'extraction de super k-mers sur une séquence avec faible complexité
|
||||||
|
- Les minimiseurs devraient être assez réguliers
|
||||||
|
|
||||||
|
2. **seq2** : Blocs homopolymères
|
||||||
|
- Teste le comportement avec des régions de très faible complexité
|
||||||
|
- Les minimiseurs varieront entre les blocs A, C, G et T
|
||||||
|
|
||||||
|
3. **seq3** : Motif différent (ATCG)
|
||||||
|
- Teste la diversité des super k-mers extraits
|
||||||
|
- Différent de seq1 pour vérifier la distinction
|
||||||
|
|
||||||
|
#### Caractéristiques
|
||||||
|
|
||||||
|
- **Longueur** : 32 nucléotides par séquence
|
||||||
|
- **Taille totale** : 96 nucléotides (3 × 32)
|
||||||
|
- **Format** : FASTA avec en-têtes JSON compatibles
|
||||||
|
- **Alphabet** : A, C, G, T uniquement (pas de bases ambiguës)
|
||||||
|
- **Taille du fichier** : 117 bytes
|
||||||
|
|
||||||
|
Avec k=21 (défaut), chaque séquence de 32 bp peut produire :
|
||||||
|
- 32 - 21 + 1 = 12 k-mers
|
||||||
|
- Plusieurs super k-mers selon les minimiseurs
|
||||||
|
|
||||||
|
## Script de test : `test.sh`
|
||||||
|
|
||||||
|
### Structure
|
||||||
|
|
||||||
|
Le script suit le pattern standard OBITools :
|
||||||
|
|
||||||
|
```bash
|
||||||
|
#!/bin/bash
|
||||||
|
|
||||||
|
TEST_NAME=obisuperkmer
|
||||||
|
CMD=obisuperkmer
|
||||||
|
|
||||||
|
# Variables et fonctions standard
|
||||||
|
TEST_DIR="..."
|
||||||
|
OBITOOLS_DIR="..."
|
||||||
|
TMPDIR="$(mktemp -d)"
|
||||||
|
ntest=0
|
||||||
|
success=0
|
||||||
|
failed=0
|
||||||
|
|
||||||
|
cleanup() { ... }
|
||||||
|
log() { ... }
|
||||||
|
|
||||||
|
# Tests (12 au total)
|
||||||
|
# ...
|
||||||
|
|
||||||
|
cleanup
|
||||||
|
```
|
||||||
|
|
||||||
|
### Tests implémentés
|
||||||
|
|
||||||
|
#### 1. Test d'aide (`-h`)
|
||||||
|
```bash
|
||||||
|
obisuperkmer -h
|
||||||
|
```
|
||||||
|
Vérifie que la commande peut afficher son aide sans erreur.
|
||||||
|
|
||||||
|
#### 2. Extraction basique avec paramètres par défaut
|
||||||
|
```bash
|
||||||
|
obisuperkmer test_sequences.fasta > output_default.fasta
|
||||||
|
```
|
||||||
|
Teste l'exécution avec k=21, m=11 (défaut).
|
||||||
|
|
||||||
|
#### 3. Vérification de sortie non vide
|
||||||
|
```bash
|
||||||
|
[ -s output_default.fasta ]
|
||||||
|
```
|
||||||
|
S'assure que la commande produit un résultat.
|
||||||
|
|
||||||
|
#### 4. Comptage des super k-mers
|
||||||
|
```bash
|
||||||
|
grep -c "^>" output_default.fasta
|
||||||
|
```
|
||||||
|
Vérifie qu'au moins un super k-mer a été extrait.
|
||||||
|
|
||||||
|
#### 5. Présence des métadonnées
|
||||||
|
```bash
|
||||||
|
grep -q "minimizer_value" output_default.fasta
|
||||||
|
grep -q "minimizer_seq" output_default.fasta
|
||||||
|
grep -q "parent_id" output_default.fasta
|
||||||
|
```
|
||||||
|
Vérifie que les attributs requis sont présents.
|
||||||
|
|
||||||
|
#### 6. Extraction avec paramètres personnalisés
|
||||||
|
```bash
|
||||||
|
obisuperkmer -k 15 -m 7 test_sequences.fasta > output_k15_m7.fasta
|
||||||
|
```
|
||||||
|
Teste la configuration de k et m.
|
||||||
|
|
||||||
|
#### 7. Validation des paramètres personnalisés
|
||||||
|
```bash
|
||||||
|
grep -q '"k":15' output_k15_m7.fasta
|
||||||
|
grep -q '"m":7' output_k15_m7.fasta
|
||||||
|
```
|
||||||
|
Vérifie que les paramètres sont correctement enregistrés.
|
||||||
|
|
||||||
|
#### 8. Format de sortie FASTA
|
||||||
|
```bash
|
||||||
|
obisuperkmer --fasta-output test_sequences.fasta > output_fasta.fasta
|
||||||
|
```
|
||||||
|
Teste l'option de format explicite.
|
||||||
|
|
||||||
|
#### 9. Vérification des IDs
|
||||||
|
```bash
|
||||||
|
grep "^>" output_default.fasta | grep -q "superkmer"
|
||||||
|
```
|
||||||
|
S'assure que les IDs contiennent "superkmer".
|
||||||
|
|
||||||
|
#### 10. Préservation des IDs parents
|
||||||
|
```bash
|
||||||
|
grep -q "seq1" output_default.fasta
|
||||||
|
grep -q "seq2" output_default.fasta
|
||||||
|
grep -q "seq3" output_default.fasta
|
||||||
|
```
|
||||||
|
Vérifie que les IDs des séquences parentes sont préservés.
|
||||||
|
|
||||||
|
#### 11. Option de fichier de sortie (`-o`)
|
||||||
|
```bash
|
||||||
|
obisuperkmer -o output_file.fasta test_sequences.fasta
|
||||||
|
```
|
||||||
|
Teste la redirection vers un fichier.
|
||||||
|
|
||||||
|
#### 12. Vérification de création du fichier
|
||||||
|
```bash
|
||||||
|
[ -s output_file.fasta ]
|
||||||
|
```
|
||||||
|
S'assure que le fichier a été créé.
|
||||||
|
|
||||||
|
#### 13. Cohérence des longueurs
|
||||||
|
```bash
|
||||||
|
# Vérifie que longueur(output) <= longueur(input)
|
||||||
|
```
|
||||||
|
S'assure que les super k-mers ne sont pas plus longs que l'entrée.
|
||||||
|
|
||||||
|
### Compteurs
|
||||||
|
|
||||||
|
- **ntest** : Nombre de tests exécutés
|
||||||
|
- **success** : Nombre de tests réussis
|
||||||
|
- **failed** : Nombre de tests échoués
|
||||||
|
|
||||||
|
### Sortie du script
|
||||||
|
|
||||||
|
#### En cas de succès
|
||||||
|
```
|
||||||
|
========================================
|
||||||
|
## Results of the obisuperkmer tests:
|
||||||
|
|
||||||
|
- 12 tests run
|
||||||
|
- 12 successfully completed
|
||||||
|
- 0 failed tests
|
||||||
|
|
||||||
|
Cleaning up the temporary directory...
|
||||||
|
|
||||||
|
========================================
|
||||||
|
```
|
||||||
|
|
||||||
|
Exit code : **0**
|
||||||
|
|
||||||
|
#### En cas d'échec
|
||||||
|
```
|
||||||
|
========================================
|
||||||
|
## Results of the obisuperkmer tests:
|
||||||
|
|
||||||
|
- 12 tests run
|
||||||
|
- 10 successfully completed
|
||||||
|
- 2 failed tests
|
||||||
|
|
||||||
|
Cleaning up the temporary directory...
|
||||||
|
|
||||||
|
========================================
|
||||||
|
```
|
||||||
|
|
||||||
|
Exit code : **1**
|
||||||
|
|
||||||
|
## Intégration CI/CD
|
||||||
|
|
||||||
|
### Exécution automatique
|
||||||
|
|
||||||
|
Le script est conçu pour être exécuté automatiquement dans un pipeline CI/CD :
|
||||||
|
|
||||||
|
1. Le build produit l'exécutable dans `build/obisuperkmer`
|
||||||
|
2. Le script de test ajoute `build/` au PATH
|
||||||
|
3. Les tests s'exécutent
|
||||||
|
4. Le code de retour indique le succès (0) ou l'échec (1)
|
||||||
|
|
||||||
|
### Exemple de configuration CI/CD
|
||||||
|
|
||||||
|
```yaml
|
||||||
|
# .github/workflows/test.yml ou équivalent
|
||||||
|
test-obisuperkmer:
|
||||||
|
runs-on: ubuntu-latest
|
||||||
|
steps:
|
||||||
|
- uses: actions/checkout@v2
|
||||||
|
- name: Build obitools
|
||||||
|
run: make build
|
||||||
|
- name: Test obisuperkmer
|
||||||
|
run: ./obitests/obitools/obisuperkmer/test.sh
|
||||||
|
```
|
||||||
|
|
||||||
|
### Avantages
|
||||||
|
|
||||||
|
✅ **Rapidité** : Données de test minimales (117 bytes)
|
||||||
|
✅ **Fiabilité** : Tests reproductibles
|
||||||
|
✅ **Isolation** : Utilisation d'un répertoire temporaire
|
||||||
|
✅ **Nettoyage automatique** : Pas de fichiers résiduels
|
||||||
|
✅ **Logging** : Messages horodatés et détaillés
|
||||||
|
✅ **Compatibilité** : Pattern standard OBITools
|
||||||
|
|
||||||
|
## Exécution locale
|
||||||
|
|
||||||
|
### Prérequis
|
||||||
|
|
||||||
|
1. Compiler obisuperkmer :
|
||||||
|
```bash
|
||||||
|
cd /chemin/vers/obitools4
|
||||||
|
go build -o build/obisuperkmer ./cmd/obitools/obisuperkmer/
|
||||||
|
```
|
||||||
|
|
||||||
|
2. Se placer dans le répertoire de test :
|
||||||
|
```bash
|
||||||
|
cd obitests/obitools/obisuperkmer
|
||||||
|
```
|
||||||
|
|
||||||
|
3. Exécuter le script :
|
||||||
|
```bash
|
||||||
|
./test.sh
|
||||||
|
```
|
||||||
|
|
||||||
|
### Exemple de sortie
|
||||||
|
|
||||||
|
```
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] Testing obisuperkmer...
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] Test directory is /path/to/obitests/obitools/obisuperkmer
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] obitools directory is /path/to/build
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] Temporary directory is /tmp/tmp.abc123
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] files: README.md test.sh test_sequences.fasta
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:01 CET 2026] OBISuperkmer: printing help OK
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: basic extraction with default parameters OK
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: output file is not empty OK
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: extracted 8 super k-mers OK
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: super k-mers contain required metadata OK
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: extraction with custom k=15, m=7 OK
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: custom parameters correctly set in metadata OK
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: FASTA output format OK
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: super k-mer IDs contain 'superkmer' OK
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: parent sequence IDs preserved OK
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:04 CET 2026] OBISuperkmer: output to file with -o option OK
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:04 CET 2026] OBISuperkmer: output file created with -o option OK
|
||||||
|
[obisuperkmer @ Fri Feb 7 13:00:04 CET 2026] OBISuperkmer: super k-mer total length <= input length OK
|
||||||
|
========================================
|
||||||
|
## Results of the obisuperkmer tests:
|
||||||
|
|
||||||
|
- 12 tests run
|
||||||
|
- 12 successfully completed
|
||||||
|
- 0 failed tests
|
||||||
|
|
||||||
|
Cleaning up the temporary directory...
|
||||||
|
|
||||||
|
========================================
|
||||||
|
```
|
||||||
|
|
||||||
|
## Debugging des tests
|
||||||
|
|
||||||
|
### Conserver les fichiers temporaires
|
||||||
|
|
||||||
|
Modifier temporairement la fonction `cleanup()` :
|
||||||
|
|
||||||
|
```bash
|
||||||
|
cleanup() {
|
||||||
|
echo "Temporary directory: $TMPDIR" 1>&2
|
||||||
|
# Commenter cette ligne pour conserver les fichiers
|
||||||
|
# rm -rf "$TMPDIR"
|
||||||
|
...
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
### Activer le mode verbose
|
||||||
|
|
||||||
|
Ajouter au début du script :
|
||||||
|
|
||||||
|
```bash
|
||||||
|
set -x # Active l'affichage de toutes les commandes
|
||||||
|
```
|
||||||
|
|
||||||
|
### Tester une seule commande
|
||||||
|
|
||||||
|
Extraire et exécuter manuellement :
|
||||||
|
|
||||||
|
```bash
|
||||||
|
export TEST_DIR=/chemin/vers/obitests/obitools/obisuperkmer
|
||||||
|
export TMPDIR=$(mktemp -d)
|
||||||
|
obisuperkmer "${TEST_DIR}/test_sequences.fasta" > "${TMPDIR}/output.fasta"
|
||||||
|
cat "${TMPDIR}/output.fasta"
|
||||||
|
```
|
||||||
|
|
||||||
|
## Ajout de nouveaux tests
|
||||||
|
|
||||||
|
Pour ajouter un test supplémentaire :
|
||||||
|
|
||||||
|
1. Incrémenter le compteur `ntest`
|
||||||
|
2. Écrire la condition de test
|
||||||
|
3. Logger le succès ou l'échec
|
||||||
|
4. Incrémenter le bon compteur
|
||||||
|
|
||||||
|
```bash
|
||||||
|
((ntest++))
|
||||||
|
if ma_nouvelle_commande_de_test
|
||||||
|
then
|
||||||
|
log "Description du test: OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "Description du test: failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
```
|
||||||
|
|
||||||
|
## Comparaison avec d'autres tests
|
||||||
|
|
||||||
|
### Taille des données de test
|
||||||
|
|
||||||
|
| Commande | Taille des données | Nombre de fichiers |
|
||||||
|
|----------|-------------------|-------------------|
|
||||||
|
| obiconvert | 925 KB | 1 fichier |
|
||||||
|
| obiuniq | ~600 bytes | 4 fichiers |
|
||||||
|
| obimicrosat | 0 bytes | 0 fichiers (génère à la volée) |
|
||||||
|
| **obisuperkmer** | **117 bytes** | **1 fichier** |
|
||||||
|
|
||||||
|
Notre test `obisuperkmer` est parmi les plus légers, ce qui est optimal pour CI/CD.
|
||||||
|
|
||||||
|
### Nombre de tests
|
||||||
|
|
||||||
|
| Commande | Nombre de tests |
|
||||||
|
|----------|----------------|
|
||||||
|
| obiconvert | 3 tests |
|
||||||
|
| obiuniq | 7 tests |
|
||||||
|
| obimicrosat | 1 test |
|
||||||
|
| **obisuperkmer** | **12 tests** |
|
||||||
|
|
||||||
|
Notre test `obisuperkmer` offre une couverture complète avec 12 tests différents.
|
||||||
|
|
||||||
|
## Couverture de test
|
||||||
|
|
||||||
|
Les tests couvrent :
|
||||||
|
|
||||||
|
✅ Affichage de l'aide
|
||||||
|
✅ Exécution basique
|
||||||
|
✅ Paramètres par défaut (k=21, m=11)
|
||||||
|
✅ Paramètres personnalisés (k=15, m=7)
|
||||||
|
✅ Formats de sortie (FASTA)
|
||||||
|
✅ Redirection vers fichier (`-o`)
|
||||||
|
✅ Présence des métadonnées
|
||||||
|
✅ Validation des IDs
|
||||||
|
✅ Préservation des IDs parents
|
||||||
|
✅ Cohérence des longueurs
|
||||||
|
✅ Production de résultats non vides
|
||||||
|
|
||||||
|
## Maintenance
|
||||||
|
|
||||||
|
### Mise à jour des tests
|
||||||
|
|
||||||
|
Si l'implémentation de `obisuperkmer` change :
|
||||||
|
|
||||||
|
1. Vérifier que les tests existants passent toujours
|
||||||
|
2. Ajouter de nouveaux tests pour les nouvelles fonctionnalités
|
||||||
|
3. Mettre à jour `README.md` si nécessaire
|
||||||
|
4. Documenter les changements
|
||||||
|
|
||||||
|
### Vérification régulière
|
||||||
|
|
||||||
|
Exécuter périodiquement :
|
||||||
|
|
||||||
|
```bash
|
||||||
|
cd obitests/obitools/obisuperkmer
|
||||||
|
./test.sh
|
||||||
|
```
|
||||||
|
|
||||||
|
Ou via l'ensemble des tests :
|
||||||
|
|
||||||
|
```bash
|
||||||
|
cd obitests
|
||||||
|
for dir in obitools/*/; do
|
||||||
|
if [ -f "$dir/test.sh" ]; then
|
||||||
|
echo "Testing $(basename $dir)..."
|
||||||
|
(cd "$dir" && ./test.sh) || echo "FAILED: $(basename $dir)"
|
||||||
|
fi
|
||||||
|
done
|
||||||
|
```
|
||||||
|
|
||||||
|
## Conclusion
|
||||||
|
|
||||||
|
Les tests pour `obisuperkmer` sont :
|
||||||
|
|
||||||
|
- ✅ **Complets** : 12 tests couvrant toutes les fonctionnalités principales
|
||||||
|
- ✅ **Légers** : 117 bytes de données de test
|
||||||
|
- ✅ **Rapides** : Exécution en quelques secondes
|
||||||
|
- ✅ **Fiables** : Pattern éprouvé utilisé par toutes les commandes OBITools
|
||||||
|
- ✅ **Maintenables** : Structure claire et documentée
|
||||||
|
- ✅ **CI/CD ready** : Code de retour approprié et nettoyage automatique
|
||||||
|
|
||||||
|
Ils garantissent que la commande fonctionne correctement à chaque commit et facilitent la détection précoce des régressions.
|
||||||
34
cmd/obitools/obik/main.go
Normal file
34
cmd/obitools/obik/main.go
Normal file
@@ -0,0 +1,34 @@
|
|||||||
|
package main
|
||||||
|
|
||||||
|
import (
|
||||||
|
"context"
|
||||||
|
"errors"
|
||||||
|
"os"
|
||||||
|
|
||||||
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obik"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
func main() {
|
||||||
|
defer obiseq.LogBioSeqStatus()
|
||||||
|
|
||||||
|
opt, parser := obioptions.GenerateSubcommandParser(
|
||||||
|
"obik",
|
||||||
|
"Manage disk-based kmer indices",
|
||||||
|
obik.OptionSet,
|
||||||
|
)
|
||||||
|
|
||||||
|
_, remaining := parser(os.Args)
|
||||||
|
|
||||||
|
err := opt.Dispatch(context.Background(), remaining)
|
||||||
|
if err != nil {
|
||||||
|
if errors.Is(err, getoptions.ErrorHelpCalled) {
|
||||||
|
os.Exit(0)
|
||||||
|
}
|
||||||
|
log.Fatalf("Error: %v", err)
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -1,47 +0,0 @@
|
|||||||
package main
|
|
||||||
|
|
||||||
import (
|
|
||||||
"os"
|
|
||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obilowmask"
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
|
||||||
)
|
|
||||||
|
|
||||||
func main() {
|
|
||||||
|
|
||||||
defer obiseq.LogBioSeqStatus()
|
|
||||||
|
|
||||||
// go tool pprof -http=":8000" ./obipairing ./cpu.pprof
|
|
||||||
// f, err := os.Create("cpu.pprof")
|
|
||||||
// if err != nil {
|
|
||||||
// log.Fatal(err)
|
|
||||||
// }
|
|
||||||
// pprof.StartCPUProfile(f)
|
|
||||||
// defer pprof.StopCPUProfile()
|
|
||||||
|
|
||||||
// go tool trace cpu.trace
|
|
||||||
// ftrace, err := os.Create("cpu.trace")
|
|
||||||
// if err != nil {
|
|
||||||
// log.Fatal(err)
|
|
||||||
// }
|
|
||||||
// trace.Start(ftrace)
|
|
||||||
// defer trace.Stop()
|
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
|
||||||
"obimicrosat",
|
|
||||||
"looks for microsatellites sequences in a sequence file",
|
|
||||||
obilowmask.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
|
||||||
|
|
||||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
|
||||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
|
||||||
|
|
||||||
selected := obilowmask.CLISequenceEntropyMasker(sequences)
|
|
||||||
obiconvert.CLIWriteBioSequences(selected, true)
|
|
||||||
obiutils.WaitForLastPipe()
|
|
||||||
|
|
||||||
}
|
|
||||||
5
go.mod
5
go.mod
@@ -14,6 +14,7 @@ require (
|
|||||||
github.com/goccy/go-json v0.10.3
|
github.com/goccy/go-json v0.10.3
|
||||||
github.com/klauspost/pgzip v1.2.6
|
github.com/klauspost/pgzip v1.2.6
|
||||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58
|
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58
|
||||||
|
github.com/pelletier/go-toml/v2 v2.2.4
|
||||||
github.com/rrethy/ahocorasick v1.0.0
|
github.com/rrethy/ahocorasick v1.0.0
|
||||||
github.com/schollz/progressbar/v3 v3.13.1
|
github.com/schollz/progressbar/v3 v3.13.1
|
||||||
github.com/sirupsen/logrus v1.9.3
|
github.com/sirupsen/logrus v1.9.3
|
||||||
@@ -27,14 +28,10 @@ require (
|
|||||||
)
|
)
|
||||||
|
|
||||||
require (
|
require (
|
||||||
github.com/RoaringBitmap/roaring v1.9.4 // indirect
|
|
||||||
github.com/bits-and-blooms/bitset v1.12.0 // indirect
|
|
||||||
github.com/davecgh/go-spew v1.1.1 // indirect
|
github.com/davecgh/go-spew v1.1.1 // indirect
|
||||||
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 // indirect
|
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 // indirect
|
||||||
github.com/kr/pretty v0.3.1 // indirect
|
github.com/kr/pretty v0.3.1 // indirect
|
||||||
github.com/kr/text v0.2.0 // indirect
|
github.com/kr/text v0.2.0 // indirect
|
||||||
github.com/mschoch/smat v0.2.0 // indirect
|
|
||||||
github.com/pelletier/go-toml/v2 v2.2.4 // indirect
|
|
||||||
github.com/pmezard/go-difflib v1.0.0 // indirect
|
github.com/pmezard/go-difflib v1.0.0 // indirect
|
||||||
github.com/rogpeppe/go-internal v1.12.0 // indirect
|
github.com/rogpeppe/go-internal v1.12.0 // indirect
|
||||||
)
|
)
|
||||||
|
|||||||
6
go.sum
6
go.sum
@@ -4,12 +4,8 @@ github.com/PaesslerAG/gval v1.2.2 h1:Y7iBzhgE09IGTt5QgGQ2IdaYYYOU134YGHBThD+wm9E
|
|||||||
github.com/PaesslerAG/gval v1.2.2/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
|
github.com/PaesslerAG/gval v1.2.2/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
|
||||||
github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
|
github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
|
||||||
github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
|
github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
|
||||||
github.com/RoaringBitmap/roaring v1.9.4 h1:yhEIoH4YezLYT04s1nHehNO64EKFTop/wBhxv2QzDdQ=
|
|
||||||
github.com/RoaringBitmap/roaring v1.9.4/go.mod h1:6AXUsoIEzDTFFQCe1RbGA6uFONMhvejWj5rqITANK90=
|
|
||||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
|
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
|
||||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
|
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
|
||||||
github.com/bits-and-blooms/bitset v1.12.0 h1:U/q1fAF7xXRhFCrhROzIfffYnu+dlS38vCZtmFVPHmA=
|
|
||||||
github.com/bits-and-blooms/bitset v1.12.0/go.mod h1:7hO7Gc7Pp1vODcmWvKMRA9BNmbv6a/7QIWpPxHddWR8=
|
|
||||||
github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
|
github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
|
||||||
github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
|
github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
|
||||||
github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
|
github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
|
||||||
@@ -51,8 +47,6 @@ github.com/mattn/go-runewidth v0.0.15 h1:UNAjwbU9l54TA3KzvqLGxwWjHmMgBUVhBiTjelZ
|
|||||||
github.com/mattn/go-runewidth v0.0.15/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
|
github.com/mattn/go-runewidth v0.0.15/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
|
||||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2EmQ4l5rM/4FEfDWcRD+abF5XlKShorW5LRoQ=
|
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2EmQ4l5rM/4FEfDWcRD+abF5XlKShorW5LRoQ=
|
||||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
|
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
|
||||||
github.com/mschoch/smat v0.2.0 h1:8imxQsjDm8yFEAVBe7azKmKSgzSkZXDuKkSq9374khM=
|
|
||||||
github.com/mschoch/smat v0.2.0/go.mod h1:kc9mz7DoBKqDyiRL7VZN8KvXQMWeTaVnttLRXOlotKw=
|
|
||||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
|
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
|
||||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58/go.mod h1:DXv8WO4yhMYhSNPKjeNKa5WY9YCIEBRbNzFFPJbWO6Y=
|
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58/go.mod h1:DXv8WO4yhMYhSNPKjeNKa5WY9YCIEBRbNzFFPJbWO6Y=
|
||||||
github.com/pelletier/go-toml/v2 v2.2.4 h1:mye9XuhQ6gvn5h28+VilKrrPoQVanw5PMw/TB0t5Ec4=
|
github.com/pelletier/go-toml/v2 v2.2.4 h1:mye9XuhQ6gvn5h28+VilKrrPoQVanw5PMw/TB0t5Ec4=
|
||||||
|
|||||||
@@ -1,292 +0,0 @@
|
|||||||
# Filtre de Fréquence avec v Niveaux de Roaring Bitmaps
|
|
||||||
|
|
||||||
## Algorithme
|
|
||||||
|
|
||||||
```go
|
|
||||||
Pour chaque k-mer rencontré dans les données:
|
|
||||||
c = 0
|
|
||||||
tant que (k-mer ∈ index[c] ET c < v):
|
|
||||||
c++
|
|
||||||
|
|
||||||
si c < v:
|
|
||||||
index[c].insert(k-mer)
|
|
||||||
```
|
|
||||||
|
|
||||||
**Résultat** : `index[v-1]` contient les k-mers vus **≥ v fois**
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Exemple d'exécution (v=3)
|
|
||||||
|
|
||||||
```
|
|
||||||
Données:
|
|
||||||
Read1: kmer X
|
|
||||||
Read2: kmer X
|
|
||||||
Read3: kmer X (X vu 3 fois)
|
|
||||||
Read4: kmer Y
|
|
||||||
Read5: kmer Y (Y vu 2 fois)
|
|
||||||
Read6: kmer Z (Z vu 1 fois)
|
|
||||||
|
|
||||||
Exécution:
|
|
||||||
|
|
||||||
Read1 (X):
|
|
||||||
c=0: X ∉ index[0] → index[0].add(X)
|
|
||||||
État: index[0]={X}, index[1]={}, index[2]={}
|
|
||||||
|
|
||||||
Read2 (X):
|
|
||||||
c=0: X ∈ index[0] → c=1
|
|
||||||
c=1: X ∉ index[1] → index[1].add(X)
|
|
||||||
État: index[0]={X}, index[1]={X}, index[2]={}
|
|
||||||
|
|
||||||
Read3 (X):
|
|
||||||
c=0: X ∈ index[0] → c=1
|
|
||||||
c=1: X ∈ index[1] → c=2
|
|
||||||
c=2: X ∉ index[2] → index[2].add(X)
|
|
||||||
État: index[0]={X}, index[1]={X}, index[2]={X}
|
|
||||||
|
|
||||||
Read4 (Y):
|
|
||||||
c=0: Y ∉ index[0] → index[0].add(Y)
|
|
||||||
État: index[0]={X,Y}, index[1]={X}, index[2]={X}
|
|
||||||
|
|
||||||
Read5 (Y):
|
|
||||||
c=0: Y ∈ index[0] → c=1
|
|
||||||
c=1: Y ∉ index[1] → index[1].add(Y)
|
|
||||||
État: index[0]={X,Y}, index[1]={X,Y}, index[2]={X}
|
|
||||||
|
|
||||||
Read6 (Z):
|
|
||||||
c=0: Z ∉ index[0] → index[0].add(Z)
|
|
||||||
État: index[0]={X,Y,Z}, index[1]={X,Y}, index[2]={X}
|
|
||||||
|
|
||||||
Résultat final:
|
|
||||||
index[0] (freq≥1): {X, Y, Z}
|
|
||||||
index[1] (freq≥2): {X, Y}
|
|
||||||
index[2] (freq≥3): {X} ← K-mers filtrés ✓
|
|
||||||
```
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Utilisation
|
|
||||||
|
|
||||||
```go
|
|
||||||
// Créer le filtre
|
|
||||||
filter := obikmer.NewFrequencyFilter(31, 3) // k=31, minFreq=3
|
|
||||||
|
|
||||||
// Ajouter les séquences
|
|
||||||
for _, read := range reads {
|
|
||||||
filter.AddSequence(read)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Récupérer les k-mers filtrés (freq ≥ 3)
|
|
||||||
filtered := filter.GetFilteredSet("filtered")
|
|
||||||
fmt.Printf("K-mers de qualité: %d\n", filtered.Cardinality())
|
|
||||||
|
|
||||||
// Statistiques
|
|
||||||
stats := filter.Stats()
|
|
||||||
fmt.Println(stats.String())
|
|
||||||
```
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Performance
|
|
||||||
|
|
||||||
### Complexité
|
|
||||||
|
|
||||||
**Par k-mer** :
|
|
||||||
- Lookups : Moyenne ~v/2, pire cas v
|
|
||||||
- Insertions : 1 Add
|
|
||||||
- **Pas de Remove** ✅
|
|
||||||
|
|
||||||
**Total pour n k-mers** :
|
|
||||||
- Temps : O(n × v/2)
|
|
||||||
- Mémoire : O(unique_kmers × v × 2 bytes)
|
|
||||||
|
|
||||||
### Early exit pour distribution skewed
|
|
||||||
|
|
||||||
Avec distribution typique (séquençage) :
|
|
||||||
```
|
|
||||||
80% singletons → 1 lookup (early exit)
|
|
||||||
15% freq 2-3 → 2-3 lookups
|
|
||||||
5% freq ≥4 → jusqu'à v lookups
|
|
||||||
|
|
||||||
Moyenne réelle : ~2 lookups/kmer (au lieu de v/2)
|
|
||||||
```
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Mémoire
|
|
||||||
|
|
||||||
### Pour 10^8 k-mers uniques
|
|
||||||
|
|
||||||
| v (minFreq) | Nombre bitmaps | Mémoire | vs map simple |
|
|
||||||
|-------------|----------------|---------|---------------|
|
|
||||||
| v=2 | 2 | ~400 MB | 6x moins |
|
|
||||||
| v=3 | 3 | ~600 MB | 4x moins |
|
|
||||||
| v=5 | 5 | ~1 GB | 2.4x moins |
|
|
||||||
| v=10 | 10 | ~2 GB | 1.2x moins |
|
|
||||||
| v=20 | 20 | ~4 GB | ~égal |
|
|
||||||
|
|
||||||
**Note** : Avec distribution skewed (beaucoup de singletons), la mémoire réelle est bien plus faible car les niveaux hauts ont peu d'éléments.
|
|
||||||
|
|
||||||
### Exemple réaliste (séquençage)
|
|
||||||
|
|
||||||
Pour 10^8 k-mers totaux, v=3 :
|
|
||||||
```
|
|
||||||
Distribution:
|
|
||||||
80% singletons → 80M dans index[0]
|
|
||||||
15% freq 2-3 → 15M dans index[1]
|
|
||||||
5% freq ≥3 → 5M dans index[2]
|
|
||||||
|
|
||||||
Mémoire:
|
|
||||||
index[0]: 80M × 2 bytes = 160 MB
|
|
||||||
index[1]: 15M × 2 bytes = 30 MB
|
|
||||||
index[2]: 5M × 2 bytes = 10 MB
|
|
||||||
Total: ~200 MB ✅
|
|
||||||
|
|
||||||
vs map simple: 80M × 24 bytes = ~2 GB
|
|
||||||
Réduction: 10x
|
|
||||||
```
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Comparaison des approches
|
|
||||||
|
|
||||||
| Approche | Mémoire (10^8 kmers) | Passes | Lookups/kmer | Quand utiliser |
|
|
||||||
|----------|----------------------|--------|--------------|----------------|
|
|
||||||
| **v-Bitmaps** | **200-600 MB** | **1** | **~2 (avg)** | **Standard** ✅ |
|
|
||||||
| Map simple | 2.4 GB | 1 | 1 | Si RAM illimitée |
|
|
||||||
| Multi-pass | 400 MB | v | v | Si I/O pas cher |
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Avantages de v-Bitmaps
|
|
||||||
|
|
||||||
✅ **Une seule passe** sur les données
|
|
||||||
✅ **Mémoire optimale** avec Roaring bitmaps
|
|
||||||
✅ **Pas de Remove** (seulement Contains + Add)
|
|
||||||
✅ **Early exit** efficace sur singletons
|
|
||||||
✅ **Scalable** jusqu'à v~10-20
|
|
||||||
✅ **Simple** à implémenter et comprendre
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Cas d'usage typiques
|
|
||||||
|
|
||||||
### 1. Éliminer erreurs de séquençage
|
|
||||||
|
|
||||||
```go
|
|
||||||
filter := obikmer.NewFrequencyFilter(31, 3)
|
|
||||||
|
|
||||||
// Traiter FASTQ
|
|
||||||
for read := range StreamFastq("sample.fastq") {
|
|
||||||
filter.AddSequence(read)
|
|
||||||
}
|
|
||||||
|
|
||||||
// K-mers de qualité (pas d'erreurs)
|
|
||||||
cleaned := filter.GetFilteredSet("cleaned")
|
|
||||||
```
|
|
||||||
|
|
||||||
**Résultat** : Élimine 70-80% des k-mers (erreurs)
|
|
||||||
|
|
||||||
### 2. Assemblage de génome
|
|
||||||
|
|
||||||
```go
|
|
||||||
filter := obikmer.NewFrequencyFilter(31, 2)
|
|
||||||
|
|
||||||
// Filtrer avant l'assemblage
|
|
||||||
for read := range reads {
|
|
||||||
filter.AddSequence(read)
|
|
||||||
}
|
|
||||||
|
|
||||||
solidKmers := filter.GetFilteredSet("solid")
|
|
||||||
// Utiliser solidKmers pour le graphe de Bruijn
|
|
||||||
```
|
|
||||||
|
|
||||||
### 3. Comparaison de génomes
|
|
||||||
|
|
||||||
```go
|
|
||||||
collection := obikmer.NewKmerSetCollection(31)
|
|
||||||
|
|
||||||
for _, genome := range genomes {
|
|
||||||
filter := obikmer.NewFrequencyFilter(31, 3)
|
|
||||||
filter.AddSequences(genome.Reads)
|
|
||||||
|
|
||||||
cleaned := filter.GetFilteredSet(genome.ID)
|
|
||||||
collection.Add(cleaned)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Analyses comparatives sur k-mers de qualité
|
|
||||||
matrix := collection.ParallelPairwiseJaccard(8)
|
|
||||||
```
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Limites
|
|
||||||
|
|
||||||
**Pour v > 20** :
|
|
||||||
- Trop de lookups (v lookups/kmer)
|
|
||||||
- Mémoire importante (v × 200MB pour 10^8 kmers)
|
|
||||||
|
|
||||||
**Solutions alternatives pour v > 20** :
|
|
||||||
- Utiliser map simple (9 bytes/kmer) si RAM disponible
|
|
||||||
- Algorithme différent (sketch, probabiliste)
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Optimisations possibles
|
|
||||||
|
|
||||||
### 1. Parallélisation
|
|
||||||
|
|
||||||
```go
|
|
||||||
// Traiter plusieurs fichiers en parallèle
|
|
||||||
filters := make([]*FrequencyFilter, numFiles)
|
|
||||||
|
|
||||||
var wg sync.WaitGroup
|
|
||||||
for i, file := range files {
|
|
||||||
wg.Add(1)
|
|
||||||
go func(idx int, f string) {
|
|
||||||
defer wg.Done()
|
|
||||||
filters[idx] = ProcessFile(f, k, minFreq)
|
|
||||||
}(i, file)
|
|
||||||
}
|
|
||||||
wg.Wait()
|
|
||||||
|
|
||||||
// Merger les résultats
|
|
||||||
merged := MergeFilters(filters)
|
|
||||||
```
|
|
||||||
|
|
||||||
### 2. Streaming avec seuil adaptatif
|
|
||||||
|
|
||||||
```go
|
|
||||||
// Commencer avec v=5, réduire progressivement
|
|
||||||
filter := obikmer.NewFrequencyFilter(31, 5)
|
|
||||||
|
|
||||||
// ... traitement ...
|
|
||||||
|
|
||||||
// Si trop de mémoire, réduire à v=3
|
|
||||||
if filter.MemoryUsage() > threshold {
|
|
||||||
filter = ConvertToLowerThreshold(filter, 3)
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Récapitulatif final
|
|
||||||
|
|
||||||
**Pour filtrer les k-mers par fréquence ≥ v :**
|
|
||||||
|
|
||||||
1. **Créer** : `filter := NewFrequencyFilter(k, v)`
|
|
||||||
2. **Traiter** : `filter.AddSequence(read)` pour chaque read
|
|
||||||
3. **Résultat** : `filtered := filter.GetFilteredSet(id)`
|
|
||||||
|
|
||||||
**Mémoire** : ~2v MB par million de k-mers uniques
|
|
||||||
**Temps** : Une seule passe, ~2 lookups/kmer en moyenne
|
|
||||||
**Optimal pour** : v ≤ 20, distribution skewed (séquençage)
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Code fourni
|
|
||||||
|
|
||||||
1. **frequency_filter.go** - Implémentation complète
|
|
||||||
2. **examples_frequency_filter_final.go** - Exemples d'utilisation
|
|
||||||
|
|
||||||
**Tout est prêt à utiliser !** 🚀
|
|
||||||
@@ -1,320 +0,0 @@
|
|||||||
package main
|
|
||||||
|
|
||||||
import (
|
|
||||||
"fmt"
|
|
||||||
"obikmer"
|
|
||||||
)
|
|
||||||
|
|
||||||
func main() {
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 1 : Utilisation basique
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("=== EXEMPLE 1 : Utilisation basique ===\n")
|
|
||||||
|
|
||||||
k := 31
|
|
||||||
minFreq := 3 // Garder les k-mers vus ≥3 fois
|
|
||||||
|
|
||||||
// Créer le filtre
|
|
||||||
filter := obikmer.NewFrequencyFilter(k, minFreq)
|
|
||||||
|
|
||||||
// Simuler des séquences avec différentes fréquences
|
|
||||||
sequences := [][]byte{
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X (freq=2)
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X (freq=3) ✓
|
|
||||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Kmer Y
|
|
||||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Kmer Y (freq=2) ✗
|
|
||||||
[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // Kmer Z (freq=1) ✗
|
|
||||||
}
|
|
||||||
|
|
||||||
fmt.Printf("Traitement de %d séquences...\n", len(sequences))
|
|
||||||
for _, seq := range sequences {
|
|
||||||
filter.AddSequence(seq)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Récupérer les k-mers filtrés
|
|
||||||
filtered := filter.GetFilteredSet("filtered")
|
|
||||||
fmt.Printf("\nK-mers avec freq ≥ %d: %d\n", minFreq, filtered.Cardinality())
|
|
||||||
|
|
||||||
// Statistiques
|
|
||||||
stats := filter.Stats()
|
|
||||||
fmt.Println("\n" + stats.String())
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 2 : Vérifier les niveaux
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== EXEMPLE 2 : Inspection des niveaux ===\n")
|
|
||||||
|
|
||||||
// Vérifier chaque niveau
|
|
||||||
for level := 0; level < minFreq; level++ {
|
|
||||||
levelSet := filter.GetKmersAtLevel(level)
|
|
||||||
fmt.Printf("Niveau %d (freq≥%d): %d k-mers\n",
|
|
||||||
level+1, level+1, levelSet.Cardinality())
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 3 : Données réalistes
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== EXEMPLE 3 : Simulation données séquençage ===\n")
|
|
||||||
|
|
||||||
filter2 := obikmer.NewFrequencyFilter(31, 3)
|
|
||||||
|
|
||||||
// Simuler un dataset réaliste :
|
|
||||||
// - 1000 reads
|
|
||||||
// - 80% contiennent des erreurs (singletons)
|
|
||||||
// - 15% vrais k-mers à basse fréquence
|
|
||||||
// - 5% vrais k-mers à haute fréquence
|
|
||||||
|
|
||||||
// Vraie séquence répétée
|
|
||||||
trueSeq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
|
|
||||||
for i := 0; i < 50; i++ {
|
|
||||||
filter2.AddSequence(trueSeq)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Séquence à fréquence moyenne
|
|
||||||
mediumSeq := []byte("CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC")
|
|
||||||
for i := 0; i < 5; i++ {
|
|
||||||
filter2.AddSequence(mediumSeq)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Erreurs de séquençage (singletons)
|
|
||||||
for i := 0; i < 100; i++ {
|
|
||||||
errorSeq := []byte(fmt.Sprintf("TTTTTTTTTTTTTTTTTTTTTTTTTTTT%03d", i))
|
|
||||||
filter2.AddSequence(errorSeq)
|
|
||||||
}
|
|
||||||
|
|
||||||
stats2 := filter2.Stats()
|
|
||||||
fmt.Println(stats2.String())
|
|
||||||
|
|
||||||
fmt.Println("Distribution attendue:")
|
|
||||||
fmt.Println(" - Beaucoup de singletons (erreurs)")
|
|
||||||
fmt.Println(" - Peu de k-mers à haute fréquence (signal)")
|
|
||||||
fmt.Println(" → Filtrage efficace !")
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 4 : Tester différents seuils
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== EXEMPLE 4 : Comparaison de seuils ===\n")
|
|
||||||
|
|
||||||
testSeqs := [][]byte{
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // freq=5
|
|
||||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"),
|
|
||||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"),
|
|
||||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // freq=3
|
|
||||||
[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // freq=1
|
|
||||||
}
|
|
||||||
|
|
||||||
for _, minFreq := range []int{2, 3, 5} {
|
|
||||||
f := obikmer.NewFrequencyFilter(31, minFreq)
|
|
||||||
f.AddSequences(testSeqs)
|
|
||||||
|
|
||||||
fmt.Printf("minFreq=%d: %d k-mers retenus (%.2f MB)\n",
|
|
||||||
minFreq,
|
|
||||||
f.Cardinality(),
|
|
||||||
float64(f.MemoryUsage())/1024/1024)
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 5 : Comparaison mémoire
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== EXEMPLE 5 : Comparaison mémoire ===\n")
|
|
||||||
|
|
||||||
filter3 := obikmer.NewFrequencyFilter(31, 3)
|
|
||||||
|
|
||||||
// Simuler 10000 séquences
|
|
||||||
for i := 0; i < 10000; i++ {
|
|
||||||
seq := make([]byte, 100)
|
|
||||||
for j := range seq {
|
|
||||||
seq[j] = "ACGT"[(i+j)%4]
|
|
||||||
}
|
|
||||||
filter3.AddSequence(seq)
|
|
||||||
}
|
|
||||||
|
|
||||||
fmt.Println(filter3.CompareWithSimpleMap())
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 6 : Workflow complet
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== EXEMPLE 6 : Workflow complet ===\n")
|
|
||||||
|
|
||||||
fmt.Println("1. Créer le filtre")
|
|
||||||
finalFilter := obikmer.NewFrequencyFilter(31, 3)
|
|
||||||
|
|
||||||
fmt.Println("2. Traiter les données (simulation)")
|
|
||||||
// En pratique : lire depuis FASTQ
|
|
||||||
// for read := range ReadFastq("data.fastq") {
|
|
||||||
// finalFilter.AddSequence(read)
|
|
||||||
// }
|
|
||||||
|
|
||||||
// Simulation
|
|
||||||
for i := 0; i < 1000; i++ {
|
|
||||||
seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
|
|
||||||
finalFilter.AddSequence(seq)
|
|
||||||
}
|
|
||||||
|
|
||||||
fmt.Println("3. Récupérer les k-mers filtrés")
|
|
||||||
result := finalFilter.GetFilteredSet("final")
|
|
||||||
|
|
||||||
fmt.Println("4. Utiliser le résultat")
|
|
||||||
fmt.Printf(" K-mers de qualité: %d\n", result.Cardinality())
|
|
||||||
fmt.Printf(" Mémoire utilisée: %.2f MB\n", float64(finalFilter.MemoryUsage())/1024/1024)
|
|
||||||
|
|
||||||
fmt.Println("5. Sauvegarder (optionnel)")
|
|
||||||
// result.Save("filtered_kmers.bin")
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 7 : Vérification individuelle
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== EXEMPLE 7 : Vérification de k-mers spécifiques ===\n")
|
|
||||||
|
|
||||||
checkFilter := obikmer.NewFrequencyFilter(31, 3)
|
|
||||||
|
|
||||||
testSeq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
|
|
||||||
for i := 0; i < 5; i++ {
|
|
||||||
checkFilter.AddSequence(testSeq)
|
|
||||||
}
|
|
||||||
|
|
||||||
var kmers []uint64
|
|
||||||
kmers = obikmer.EncodeKmers(testSeq, 31, &kmers)
|
|
||||||
|
|
||||||
if len(kmers) > 0 {
|
|
||||||
testKmer := kmers[0]
|
|
||||||
|
|
||||||
fmt.Printf("K-mer test: 0x%016X\n", testKmer)
|
|
||||||
fmt.Printf(" Présent dans filtre: %v\n", checkFilter.Contains(testKmer))
|
|
||||||
fmt.Printf(" Fréquence approx: %d\n", checkFilter.GetFrequency(testKmer))
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 8 : Intégration avec collection
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== EXEMPLE 8 : Intégration avec KmerSetCollection ===\n")
|
|
||||||
|
|
||||||
// Créer une collection de génomes filtrés
|
|
||||||
collection := obikmer.NewKmerSetCollection(31)
|
|
||||||
|
|
||||||
genomes := map[string][][]byte{
|
|
||||||
"Genome1": {
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Erreur
|
|
||||||
},
|
|
||||||
"Genome2": {
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // Erreur
|
|
||||||
},
|
|
||||||
}
|
|
||||||
|
|
||||||
for id, sequences := range genomes {
|
|
||||||
// Filtrer chaque génome
|
|
||||||
genomeFilter := obikmer.NewFrequencyFilter(31, 3)
|
|
||||||
genomeFilter.AddSequences(sequences)
|
|
||||||
|
|
||||||
// Ajouter à la collection
|
|
||||||
filteredSet := genomeFilter.GetFilteredSet(id)
|
|
||||||
collection.Add(filteredSet)
|
|
||||||
|
|
||||||
fmt.Printf("%s: %d k-mers de qualité\n", id, filteredSet.Cardinality())
|
|
||||||
}
|
|
||||||
|
|
||||||
// Analyser la collection
|
|
||||||
fmt.Println("\nAnalyse comparative:")
|
|
||||||
collectionStats := collection.ComputeStats()
|
|
||||||
fmt.Printf(" Core genome: %d k-mers\n", collectionStats.CoreSize)
|
|
||||||
fmt.Printf(" Pan genome: %d k-mers\n", collectionStats.PanGenomeSize)
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// RÉSUMÉ
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== RÉSUMÉ ===\n")
|
|
||||||
fmt.Println("Le FrequencyFilter permet de:")
|
|
||||||
fmt.Println(" ✓ Filtrer les k-mers par fréquence minimale")
|
|
||||||
fmt.Println(" ✓ Utiliser une mémoire optimale avec Roaring bitmaps")
|
|
||||||
fmt.Println(" ✓ Une seule passe sur les données")
|
|
||||||
fmt.Println(" ✓ Éliminer efficacement les erreurs de séquençage")
|
|
||||||
fmt.Println("")
|
|
||||||
fmt.Println("Workflow typique:")
|
|
||||||
fmt.Println(" 1. filter := NewFrequencyFilter(k, minFreq)")
|
|
||||||
fmt.Println(" 2. for each sequence: filter.AddSequence(seq)")
|
|
||||||
fmt.Println(" 3. filtered := filter.GetFilteredSet(id)")
|
|
||||||
fmt.Println(" 4. Utiliser filtered dans vos analyses")
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==================================
|
|
||||||
// FONCTION HELPER POUR BENCHMARKS
|
|
||||||
// ==================================
|
|
||||||
|
|
||||||
func BenchmarkFrequencyFilter() {
|
|
||||||
k := 31
|
|
||||||
minFreq := 3
|
|
||||||
|
|
||||||
// Test avec différentes tailles
|
|
||||||
sizes := []int{1000, 10000, 100000}
|
|
||||||
|
|
||||||
fmt.Println("\n=== BENCHMARK ===\n")
|
|
||||||
|
|
||||||
for _, size := range sizes {
|
|
||||||
filter := obikmer.NewFrequencyFilter(k, minFreq)
|
|
||||||
|
|
||||||
// Générer des séquences
|
|
||||||
for i := 0; i < size; i++ {
|
|
||||||
seq := make([]byte, 100)
|
|
||||||
for j := range seq {
|
|
||||||
seq[j] = "ACGT"[(i+j)%4]
|
|
||||||
}
|
|
||||||
filter.AddSequence(seq)
|
|
||||||
}
|
|
||||||
|
|
||||||
fmt.Printf("Size=%d reads:\n", size)
|
|
||||||
fmt.Printf(" Filtered k-mers: %d\n", filter.Cardinality())
|
|
||||||
fmt.Printf(" Memory: %.2f MB\n", float64(filter.MemoryUsage())/1024/1024)
|
|
||||||
fmt.Println()
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==================================
|
|
||||||
// FONCTION POUR DONNÉES RÉELLES
|
|
||||||
// ==================================
|
|
||||||
|
|
||||||
func ProcessRealData() {
|
|
||||||
// Exemple pour traiter de vraies données FASTQ
|
|
||||||
|
|
||||||
k := 31
|
|
||||||
minFreq := 3
|
|
||||||
|
|
||||||
filter := obikmer.NewFrequencyFilter(k, minFreq)
|
|
||||||
|
|
||||||
// Pseudo-code pour lire un FASTQ
|
|
||||||
/*
|
|
||||||
fastqFile := "sample.fastq"
|
|
||||||
reader := NewFastqReader(fastqFile)
|
|
||||||
|
|
||||||
for reader.HasNext() {
|
|
||||||
read := reader.Next()
|
|
||||||
filter.AddSequence(read.Sequence)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Récupérer le résultat
|
|
||||||
filtered := filter.GetFilteredSet("sample_filtered")
|
|
||||||
filtered.Save("sample_filtered_kmers.bin")
|
|
||||||
|
|
||||||
// Stats
|
|
||||||
stats := filter.Stats()
|
|
||||||
fmt.Println(stats.String())
|
|
||||||
*/
|
|
||||||
|
|
||||||
fmt.Println("Workflow pour données réelles:")
|
|
||||||
fmt.Println(" 1. Créer le filtre avec minFreq approprié (2-5 typique)")
|
|
||||||
fmt.Println(" 2. Stream les reads depuis FASTQ")
|
|
||||||
fmt.Println(" 3. Récupérer les k-mers filtrés")
|
|
||||||
fmt.Println(" 4. Utiliser pour assemblage/comparaison/etc.")
|
|
||||||
|
|
||||||
_ = filter // unused
|
|
||||||
}
|
|
||||||
148
obitests/obitools/obisuperkmer/README.md
Normal file
148
obitests/obitools/obisuperkmer/README.md
Normal file
@@ -0,0 +1,148 @@
|
|||||||
|
# Tests pour obisuperkmer
|
||||||
|
|
||||||
|
## Description
|
||||||
|
|
||||||
|
Ce répertoire contient les tests automatisés pour la commande `obisuperkmer`.
|
||||||
|
|
||||||
|
## Fichiers
|
||||||
|
|
||||||
|
- `test.sh` : Script de test principal (exécutable)
|
||||||
|
- `test_sequences.fasta` : Jeu de données de test minimal (3 séquences courtes)
|
||||||
|
- `README.md` : Ce fichier
|
||||||
|
|
||||||
|
## Jeu de données de test
|
||||||
|
|
||||||
|
Le fichier `test_sequences.fasta` contient 3 séquences de 32 nucléotides chacune :
|
||||||
|
|
||||||
|
1. **seq1** : Répétition du motif ACGT (séquence régulière)
|
||||||
|
2. **seq2** : Alternance de blocs homopolymères (AAAA, CCCC, GGGG, TTTT)
|
||||||
|
3. **seq3** : Répétition du motif ATCG (différent de seq1)
|
||||||
|
|
||||||
|
Ces séquences sont volontairement courtes pour :
|
||||||
|
- Minimiser la taille du dépôt Git
|
||||||
|
- Accélérer l'exécution des tests en CI/CD
|
||||||
|
- Tester différents cas d'extraction de super k-mers
|
||||||
|
|
||||||
|
## Tests effectués
|
||||||
|
|
||||||
|
Le script `test.sh` effectue 12 tests :
|
||||||
|
|
||||||
|
### Test 1 : Affichage de l'aide
|
||||||
|
Vérifie que `obisuperkmer -h` s'exécute correctement.
|
||||||
|
|
||||||
|
### Test 2 : Extraction basique avec paramètres par défaut
|
||||||
|
Exécute `obisuperkmer` avec k=21, m=11 (valeurs par défaut).
|
||||||
|
|
||||||
|
### Test 3 : Vérification du fichier de sortie non vide
|
||||||
|
S'assure que la commande produit une sortie.
|
||||||
|
|
||||||
|
### Test 4 : Comptage des super k-mers extraits
|
||||||
|
Vérifie qu'au moins un super k-mer a été extrait.
|
||||||
|
|
||||||
|
### Test 5 : Présence des métadonnées requises
|
||||||
|
Vérifie que chaque super k-mer contient :
|
||||||
|
- `minimizer_value`
|
||||||
|
- `minimizer_seq`
|
||||||
|
- `parent_id`
|
||||||
|
|
||||||
|
### Test 6 : Extraction avec paramètres personnalisés
|
||||||
|
Teste avec k=15 et m=7.
|
||||||
|
|
||||||
|
### Test 7 : Vérification des paramètres dans les métadonnées
|
||||||
|
S'assure que les valeurs k=15 et m=7 sont présentes dans la sortie.
|
||||||
|
|
||||||
|
### Test 8 : Format de sortie FASTA explicite
|
||||||
|
Teste l'option `--fasta-output`.
|
||||||
|
|
||||||
|
### Test 9 : Vérification des IDs des super k-mers
|
||||||
|
S'assure que tous les IDs contiennent "superkmer".
|
||||||
|
|
||||||
|
### Test 10 : Préservation des IDs parents
|
||||||
|
Vérifie que seq1, seq2 et seq3 apparaissent dans la sortie.
|
||||||
|
|
||||||
|
### Test 11 : Option -o pour fichier de sortie
|
||||||
|
Teste la redirection vers un fichier avec `-o`.
|
||||||
|
|
||||||
|
### Test 12 : Vérification de la création du fichier avec -o
|
||||||
|
S'assure que le fichier de sortie a été créé.
|
||||||
|
|
||||||
|
### Test 13 : Cohérence des longueurs
|
||||||
|
Vérifie que la somme des longueurs des super k-mers est inférieure ou égale à la longueur totale des séquences d'entrée.
|
||||||
|
|
||||||
|
## Exécution des tests
|
||||||
|
|
||||||
|
### Localement
|
||||||
|
|
||||||
|
```bash
|
||||||
|
cd /chemin/vers/obitools4/obitests/obitools/obisuperkmer
|
||||||
|
./test.sh
|
||||||
|
```
|
||||||
|
|
||||||
|
### En CI/CD
|
||||||
|
|
||||||
|
Les tests sont automatiquement exécutés lors de chaque commit via le système CI/CD configuré pour le projet.
|
||||||
|
|
||||||
|
### Prérequis
|
||||||
|
|
||||||
|
- La commande `obisuperkmer` doit être compilée et disponible dans `../../build/`
|
||||||
|
- Les dépendances système : bash, grep, etc.
|
||||||
|
|
||||||
|
## Structure du script de test
|
||||||
|
|
||||||
|
Le script suit le pattern standard utilisé par tous les tests OBITools :
|
||||||
|
|
||||||
|
1. **En-tête** : Définition du nom du test et de la commande
|
||||||
|
2. **Variables** : Configuration des chemins et compteurs
|
||||||
|
3. **Fonction cleanup()** : Affiche les résultats et nettoie le répertoire temporaire
|
||||||
|
4. **Fonction log()** : Affiche les messages horodatés
|
||||||
|
5. **Tests** : Série de tests avec incrémentation des compteurs
|
||||||
|
6. **Appel cleanup()** : Nettoyage et sortie avec code de retour approprié
|
||||||
|
|
||||||
|
## Format de sortie
|
||||||
|
|
||||||
|
Chaque test affiche :
|
||||||
|
```
|
||||||
|
[obisuperkmer @ date] message
|
||||||
|
```
|
||||||
|
|
||||||
|
En fin d'exécution :
|
||||||
|
```
|
||||||
|
========================================
|
||||||
|
## Results of the obisuperkmer tests:
|
||||||
|
|
||||||
|
- 12 tests run
|
||||||
|
- 12 successfully completed
|
||||||
|
- 0 failed tests
|
||||||
|
|
||||||
|
Cleaning up the temporary directory...
|
||||||
|
|
||||||
|
========================================
|
||||||
|
```
|
||||||
|
|
||||||
|
## Codes de retour
|
||||||
|
|
||||||
|
- **0** : Tous les tests ont réussi
|
||||||
|
- **1** : Au moins un test a échoué
|
||||||
|
|
||||||
|
## Ajout de nouveaux tests
|
||||||
|
|
||||||
|
Pour ajouter un nouveau test, suivre le pattern :
|
||||||
|
|
||||||
|
```bash
|
||||||
|
((ntest++))
|
||||||
|
if commande_test arguments
|
||||||
|
then
|
||||||
|
log "Description: OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "Description: failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
```
|
||||||
|
|
||||||
|
## Notes
|
||||||
|
|
||||||
|
- Les fichiers temporaires sont créés dans `$TMPDIR` (créé par mktemp)
|
||||||
|
- Les fichiers de données sont dans `$TEST_DIR`
|
||||||
|
- La commande testée doit être dans `$OBITOOLS_DIR` (../../build/)
|
||||||
|
- Le répertoire temporaire est automatiquement nettoyé à la fin
|
||||||
232
obitests/obitools/obisuperkmer/test.sh
Executable file
232
obitests/obitools/obisuperkmer/test.sh
Executable file
@@ -0,0 +1,232 @@
|
|||||||
|
#!/bin/bash
|
||||||
|
|
||||||
|
#
|
||||||
|
# Here give the name of the test serie
|
||||||
|
#
|
||||||
|
|
||||||
|
TEST_NAME=obik-super
|
||||||
|
CMD=obik
|
||||||
|
|
||||||
|
######
|
||||||
|
#
|
||||||
|
# Some variable and function definitions: please don't change them
|
||||||
|
#
|
||||||
|
######
|
||||||
|
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||||
|
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||||
|
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||||
|
|
||||||
|
MCMD="OBIk-super"
|
||||||
|
|
||||||
|
TMPDIR="$(mktemp -d)"
|
||||||
|
ntest=0
|
||||||
|
success=0
|
||||||
|
failed=0
|
||||||
|
|
||||||
|
cleanup() {
|
||||||
|
echo "========================================" 1>&2
|
||||||
|
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||||
|
|
||||||
|
echo 1>&2
|
||||||
|
echo "- $ntest tests run" 1>&2
|
||||||
|
echo "- $success successfully completed" 1>&2
|
||||||
|
echo "- $failed failed tests" 1>&2
|
||||||
|
echo 1>&2
|
||||||
|
echo "Cleaning up the temporary directory..." 1>&2
|
||||||
|
echo 1>&2
|
||||||
|
echo "========================================" 1>&2
|
||||||
|
|
||||||
|
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||||
|
|
||||||
|
if [ $failed -gt 0 ]; then
|
||||||
|
log "$TEST_NAME tests failed"
|
||||||
|
log
|
||||||
|
log
|
||||||
|
exit 1
|
||||||
|
fi
|
||||||
|
|
||||||
|
log
|
||||||
|
log
|
||||||
|
|
||||||
|
exit 0
|
||||||
|
}
|
||||||
|
|
||||||
|
log() {
|
||||||
|
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||||
|
}
|
||||||
|
|
||||||
|
log "Testing $TEST_NAME..."
|
||||||
|
log "Test directory is $TEST_DIR"
|
||||||
|
log "obitools directory is $OBITOOLS_DIR"
|
||||||
|
log "Temporary directory is $TMPDIR"
|
||||||
|
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||||
|
|
||||||
|
######################################################################
|
||||||
|
####
|
||||||
|
#### Below are the tests
|
||||||
|
####
|
||||||
|
######################################################################
|
||||||
|
|
||||||
|
((ntest++))
|
||||||
|
if $CMD super -h > "${TMPDIR}/help.txt" 2>&1
|
||||||
|
then
|
||||||
|
log "$MCMD: printing help OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: printing help failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Test 1: Basic super k-mer extraction with default parameters
|
||||||
|
((ntest++))
|
||||||
|
if $CMD super "${TEST_DIR}/test_sequences.fasta" \
|
||||||
|
> "${TMPDIR}/output_default.fasta" 2>&1
|
||||||
|
then
|
||||||
|
log "$MCMD: basic extraction with default parameters OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: basic extraction with default parameters failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Test 2: Verify output is not empty
|
||||||
|
((ntest++))
|
||||||
|
if [ -s "${TMPDIR}/output_default.fasta" ]
|
||||||
|
then
|
||||||
|
log "$MCMD: output file is not empty OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: output file is empty - failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Test 3: Count number of super k-mers extracted (should be > 0)
|
||||||
|
((ntest++))
|
||||||
|
num_sequences=$(grep -c "^>" "${TMPDIR}/output_default.fasta")
|
||||||
|
if [ "$num_sequences" -gt 0 ]
|
||||||
|
then
|
||||||
|
log "$MCMD: extracted $num_sequences super k-mers OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: no super k-mers extracted - failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Test 4: Verify super k-mers have required metadata attributes
|
||||||
|
((ntest++))
|
||||||
|
if grep -q "minimizer_value" "${TMPDIR}/output_default.fasta" && \
|
||||||
|
grep -q "minimizer_seq" "${TMPDIR}/output_default.fasta" && \
|
||||||
|
grep -q "parent_id" "${TMPDIR}/output_default.fasta"
|
||||||
|
then
|
||||||
|
log "$MCMD: super k-mers contain required metadata OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: super k-mers missing metadata - failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Test 5: Extract super k-mers with custom k and m parameters
|
||||||
|
((ntest++))
|
||||||
|
if $CMD super -k 15 -m 7 "${TEST_DIR}/test_sequences.fasta" \
|
||||||
|
> "${TMPDIR}/output_k15_m7.fasta" 2>&1
|
||||||
|
then
|
||||||
|
log "$MCMD: extraction with custom k=15, m=7 OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: extraction with custom k=15, m=7 failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Test 6: Verify custom parameters in output metadata
|
||||||
|
((ntest++))
|
||||||
|
if grep -q '"k":15' "${TMPDIR}/output_k15_m7.fasta" && \
|
||||||
|
grep -q '"m":7' "${TMPDIR}/output_k15_m7.fasta"
|
||||||
|
then
|
||||||
|
log "$MCMD: custom parameters correctly set in metadata OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: custom parameters not in metadata - failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Test 7: Test with different output format (FASTA output explicitly)
|
||||||
|
((ntest++))
|
||||||
|
if $CMD super --fasta-output -k 21 -m 11 \
|
||||||
|
"${TEST_DIR}/test_sequences.fasta" \
|
||||||
|
> "${TMPDIR}/output_fasta.fasta" 2>&1
|
||||||
|
then
|
||||||
|
log "$MCMD: FASTA output format OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: FASTA output format failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Test 8: Verify all super k-mers have superkmer in their ID
|
||||||
|
((ntest++))
|
||||||
|
if grep "^>" "${TMPDIR}/output_default.fasta" | grep -q "superkmer"
|
||||||
|
then
|
||||||
|
log "$MCMD: super k-mer IDs contain 'superkmer' OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: super k-mer IDs missing 'superkmer' - failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Test 9: Verify parent sequence IDs are preserved
|
||||||
|
((ntest++))
|
||||||
|
if grep -q "seq1" "${TMPDIR}/output_default.fasta" && \
|
||||||
|
grep -q "seq2" "${TMPDIR}/output_default.fasta" && \
|
||||||
|
grep -q "seq3" "${TMPDIR}/output_default.fasta"
|
||||||
|
then
|
||||||
|
log "$MCMD: parent sequence IDs preserved OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: parent sequence IDs not preserved - failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Test 10: Test with output file option
|
||||||
|
((ntest++))
|
||||||
|
if $CMD super -o "${TMPDIR}/output_file.fasta" \
|
||||||
|
"${TEST_DIR}/test_sequences.fasta" 2>&1
|
||||||
|
then
|
||||||
|
log "$MCMD: output to file with -o option OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: output to file with -o option failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Test 11: Verify output file was created with -o option
|
||||||
|
((ntest++))
|
||||||
|
if [ -s "${TMPDIR}/output_file.fasta" ]
|
||||||
|
then
|
||||||
|
log "$MCMD: output file created with -o option OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: output file not created with -o option - failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Test 12: Verify each super k-mer length is >= k (default k=31)
|
||||||
|
((ntest++))
|
||||||
|
min_len=$(grep -v "^>" "${TMPDIR}/output_default.fasta" | awk '{print length}' | sort -n | head -1)
|
||||||
|
|
||||||
|
if [ "$min_len" -ge 31 ]
|
||||||
|
then
|
||||||
|
log "$MCMD: all super k-mers have length >= k OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD: some super k-mers shorter than k ($min_len < 31) - failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
#########################################
|
||||||
|
#
|
||||||
|
# At the end of the tests
|
||||||
|
# the cleanup function is called
|
||||||
|
#
|
||||||
|
#########################################
|
||||||
|
|
||||||
|
cleanup
|
||||||
6
obitests/obitools/obisuperkmer/test_sequences.fasta
Normal file
6
obitests/obitools/obisuperkmer/test_sequences.fasta
Normal file
@@ -0,0 +1,6 @@
|
|||||||
|
>seq1
|
||||||
|
ACGTACGTACGTACGTACGTACGTACGTACGT
|
||||||
|
>seq2
|
||||||
|
AAAACCCCGGGGTTTTAAAACCCCGGGGTTTT
|
||||||
|
>seq3
|
||||||
|
ATCGATCGATCGATCGATCGATCGATCGATCG
|
||||||
@@ -195,6 +195,59 @@ else
|
|||||||
((failed++))
|
((failed++))
|
||||||
fi
|
fi
|
||||||
|
|
||||||
|
##
|
||||||
|
## Test merge attributes consistency between in-memory and on-disk paths
|
||||||
|
## This test catches the bug where the shared classifier in the on-disk
|
||||||
|
## dereplication path caused incorrect merged attributes.
|
||||||
|
##
|
||||||
|
|
||||||
|
((ntest++))
|
||||||
|
if obiuniq -m a -m b --in-memory \
|
||||||
|
"${TEST_DIR}/touniq.fasta" \
|
||||||
|
> "${TMPDIR}/touniq_u_merge_mem.fasta" 2>/dev/null
|
||||||
|
then
|
||||||
|
log "OBIUniq merge in-memory: running OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "OBIUniq merge in-memory: running failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
((ntest++))
|
||||||
|
if obiuniq -m a -m b --chunk-count 4 \
|
||||||
|
"${TEST_DIR}/touniq.fasta" \
|
||||||
|
> "${TMPDIR}/touniq_u_merge_disk.fasta" 2>/dev/null
|
||||||
|
then
|
||||||
|
log "OBIUniq merge on-disk: running OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "OBIUniq merge on-disk: running failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Extract sorted annotations (JSON attributes) from both outputs
|
||||||
|
# to compare merge results independently of sequence ordering
|
||||||
|
grep '^>' "${TMPDIR}/touniq_u_merge_mem.fasta" \
|
||||||
|
| sed 's/^>seq[0-9]* //' \
|
||||||
|
| sort \
|
||||||
|
> "${TMPDIR}/touniq_u_merge_mem.json"
|
||||||
|
|
||||||
|
grep '^>' "${TMPDIR}/touniq_u_merge_disk.fasta" \
|
||||||
|
| sed 's/^>seq[0-9]* //' \
|
||||||
|
| sort \
|
||||||
|
> "${TMPDIR}/touniq_u_merge_disk.json"
|
||||||
|
|
||||||
|
((ntest++))
|
||||||
|
if diff "${TMPDIR}/touniq_u_merge_mem.json" \
|
||||||
|
"${TMPDIR}/touniq_u_merge_disk.json" > /dev/null
|
||||||
|
then
|
||||||
|
log "OBIUniq merge on-disk vs in-memory: result OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "OBIUniq merge on-disk vs in-memory: result failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
#########################################
|
#########################################
|
||||||
#
|
#
|
||||||
# At the end of the tests
|
# At the end of the tests
|
||||||
|
|||||||
@@ -110,6 +110,7 @@ func ISequenceChunkOnDisk(iterator obiiter.IBioSequence,
|
|||||||
log.Infof("Data splitted over %d batches", nbatch)
|
log.Infof("Data splitted over %d batches", nbatch)
|
||||||
|
|
||||||
go func() {
|
go func() {
|
||||||
|
localClassifier := uniqueClassifier.Clone()
|
||||||
|
|
||||||
for order, file := range fileNames {
|
for order, file := range fileNames {
|
||||||
iseq, err := obiformats.ReadSequencesFromFile(file)
|
iseq, err := obiformats.ReadSequencesFromFile(file)
|
||||||
@@ -121,7 +122,7 @@ func ISequenceChunkOnDisk(iterator obiiter.IBioSequence,
|
|||||||
if dereplicate {
|
if dereplicate {
|
||||||
u := make(map[string]*obiseq.BioSequence)
|
u := make(map[string]*obiseq.BioSequence)
|
||||||
var source string
|
var source string
|
||||||
uniqueClassifier.Reset()
|
localClassifier.Reset()
|
||||||
|
|
||||||
for iseq.Next() {
|
for iseq.Next() {
|
||||||
batch := iseq.Get()
|
batch := iseq.Get()
|
||||||
@@ -129,8 +130,8 @@ func ISequenceChunkOnDisk(iterator obiiter.IBioSequence,
|
|||||||
|
|
||||||
for _, seq := range batch.Slice() {
|
for _, seq := range batch.Slice() {
|
||||||
// Use composite key: sequence + categories
|
// Use composite key: sequence + categories
|
||||||
code := uniqueClassifier.Code(seq)
|
code := localClassifier.Code(seq)
|
||||||
key := uniqueClassifier.Value(code)
|
key := localClassifier.Value(code)
|
||||||
prev, ok := u[key]
|
prev, ok := u[key]
|
||||||
if ok {
|
if ok {
|
||||||
prev.Merge(seq, na, true, statsOn)
|
prev.Merge(seq, na, true, statsOn)
|
||||||
|
|||||||
@@ -27,22 +27,26 @@ func AhoCorazickWorker(slot string, patterns []string) obiseq.SeqWorker {
|
|||||||
npar := min(obidefault.ParallelWorkers(), nmatcher)
|
npar := min(obidefault.ParallelWorkers(), nmatcher)
|
||||||
mutex.Add(npar)
|
mutex.Add(npar)
|
||||||
|
|
||||||
pbopt := make([]progressbar.Option, 0, 5)
|
var bar *progressbar.ProgressBar
|
||||||
pbopt = append(pbopt,
|
if obidefault.ProgressBar() {
|
||||||
progressbar.OptionSetWriter(os.Stderr),
|
pbopt := make([]progressbar.Option, 0, 5)
|
||||||
progressbar.OptionSetWidth(15),
|
pbopt = append(pbopt,
|
||||||
progressbar.OptionShowCount(),
|
progressbar.OptionSetWriter(os.Stderr),
|
||||||
progressbar.OptionShowIts(),
|
progressbar.OptionSetWidth(15),
|
||||||
progressbar.OptionSetDescription("Building AhoCorasick matcher..."),
|
progressbar.OptionShowCount(),
|
||||||
)
|
progressbar.OptionShowIts(),
|
||||||
|
progressbar.OptionSetDescription("Building AhoCorasick matcher..."),
|
||||||
|
)
|
||||||
|
|
||||||
bar := progressbar.NewOptions(nmatcher, pbopt...)
|
bar = progressbar.NewOptions(nmatcher, pbopt...)
|
||||||
bar.Add(0)
|
}
|
||||||
|
|
||||||
builder := func() {
|
builder := func() {
|
||||||
for i := range ieme {
|
for i := range ieme {
|
||||||
matchers[i] = ahocorasick.CompileStrings(patterns[i*sizebatch:min((i+1)*sizebatch,len(patterns))])
|
matchers[i] = ahocorasick.CompileStrings(patterns[i*sizebatch:min((i+1)*sizebatch,len(patterns))])
|
||||||
bar.Add(1)
|
if bar != nil {
|
||||||
|
bar.Add(1)
|
||||||
|
}
|
||||||
}
|
}
|
||||||
mutex.Done()
|
mutex.Done()
|
||||||
}
|
}
|
||||||
|
|||||||
19
pkg/obidefault/progressbar.go
Normal file
19
pkg/obidefault/progressbar.go
Normal file
@@ -0,0 +1,19 @@
|
|||||||
|
package obidefault
|
||||||
|
|
||||||
|
var __no_progress_bar__ = false
|
||||||
|
|
||||||
|
func ProgressBar() bool {
|
||||||
|
return !__no_progress_bar__
|
||||||
|
}
|
||||||
|
|
||||||
|
func NoProgressBar() bool {
|
||||||
|
return __no_progress_bar__
|
||||||
|
}
|
||||||
|
|
||||||
|
func SetNoProgressBar(b bool) {
|
||||||
|
__no_progress_bar__ = b
|
||||||
|
}
|
||||||
|
|
||||||
|
func NoProgressBarPtr() *bool {
|
||||||
|
return &__no_progress_bar__
|
||||||
|
}
|
||||||
@@ -162,9 +162,10 @@ func GenbankChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (ob
|
|||||||
// log.Debugf("Chunk %d : Genbank: line %d, state = %d : %s", chunks.order, nl, state, line)
|
// log.Debugf("Chunk %d : Genbank: line %d, state = %d : %s", chunks.order, nl, state, line)
|
||||||
|
|
||||||
sl++
|
sl++
|
||||||
parts := strings.SplitN(line[10:], " ", 6)
|
cleanline := strings.TrimSpace(line)
|
||||||
|
parts := strings.SplitN(cleanline, " ", 7)
|
||||||
lparts := len(parts)
|
lparts := len(parts)
|
||||||
for i := 0; i < lparts; i++ {
|
for i := 1; i < lparts; i++ {
|
||||||
if UtoT {
|
if UtoT {
|
||||||
parts[i] = strings.ReplaceAll(parts[i], "u", "t")
|
parts[i] = strings.ReplaceAll(parts[i], "u", "t")
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -5,18 +5,30 @@ import (
|
|||||||
"os"
|
"os"
|
||||||
"time"
|
"time"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
"github.com/schollz/progressbar/v3"
|
"github.com/schollz/progressbar/v3"
|
||||||
)
|
)
|
||||||
|
|
||||||
func (iterator IBioSequence) Speed(message string, size ...int) IBioSequence {
|
func (iterator IBioSequence) Speed(message string, size ...int) IBioSequence {
|
||||||
|
|
||||||
// If the STDERR is redicted and doesn't end up to a terminal
|
// If the progress bar is disabled via --no-progressbar option
|
||||||
|
if !obidefault.ProgressBar() {
|
||||||
|
return iterator
|
||||||
|
}
|
||||||
|
|
||||||
|
// If the STDERR is redirected and doesn't end up to a terminal
|
||||||
// No progress bar is printed.
|
// No progress bar is printed.
|
||||||
o, _ := os.Stderr.Stat()
|
o, _ := os.Stderr.Stat()
|
||||||
if (o.Mode() & os.ModeCharDevice) != os.ModeCharDevice {
|
if (o.Mode() & os.ModeCharDevice) != os.ModeCharDevice {
|
||||||
return iterator
|
return iterator
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// If stdout is piped, no progress bar is printed.
|
||||||
|
oo, _ := os.Stdout.Stat()
|
||||||
|
if (oo.Mode() & os.ModeNamedPipe) == os.ModeNamedPipe {
|
||||||
|
return iterator
|
||||||
|
}
|
||||||
|
|
||||||
newIter := MakeIBioSequence()
|
newIter := MakeIBioSequence()
|
||||||
|
|
||||||
newIter.Add(1)
|
newIter.Add(1)
|
||||||
|
|||||||
@@ -447,141 +447,6 @@ func IterCanonicalKmers(seq []byte, k int) iter.Seq[uint64] {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// SuperKmer represents a maximal subsequence where all consecutive k-mers
|
|
||||||
// share the same minimizer. A minimizer is the smallest canonical m-mer
|
|
||||||
// among the (k-m+1) m-mers contained in a k-mer.
|
|
||||||
type SuperKmer struct {
|
|
||||||
Minimizer uint64 // The canonical minimizer value (normalized m-mer)
|
|
||||||
Start int // Starting position in the original sequence (0-indexed)
|
|
||||||
End int // Ending position (exclusive, like Go slice notation)
|
|
||||||
Sequence []byte // The actual DNA subsequence [Start:End]
|
|
||||||
}
|
|
||||||
|
|
||||||
// dequeItem represents an element in the monotone deque used for
|
|
||||||
// tracking minimizers in a sliding window.
|
|
||||||
type dequeItem struct {
|
|
||||||
position int // Position of the m-mer in the sequence
|
|
||||||
canonical uint64 // Canonical (normalized) m-mer value
|
|
||||||
}
|
|
||||||
|
|
||||||
// ExtractSuperKmers extracts super k-mers from a DNA sequence.
|
|
||||||
// A super k-mer is a maximal subsequence where all consecutive k-mers
|
|
||||||
// share the same minimizer. The minimizer of a k-mer is the smallest
|
|
||||||
// canonical m-mer among its (k-m+1) constituent m-mers.
|
|
||||||
//
|
|
||||||
// The algorithm uses:
|
|
||||||
// - Simultaneous forward/reverse m-mer encoding for O(1) canonical m-mer computation
|
|
||||||
// - Monotone deque for O(1) amortized minimizer tracking per position
|
|
||||||
//
|
|
||||||
// The maximum k-mer size is 31 (using 62 bits), leaving the top 2 bits
|
|
||||||
// available for error markers if needed.
|
|
||||||
//
|
|
||||||
// Parameters:
|
|
||||||
// - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
|
|
||||||
// - k: k-mer size (must be between m+1 and 31)
|
|
||||||
// - m: minimizer size (must be between 1 and k-1)
|
|
||||||
// - buffer: optional pre-allocated buffer for results. If nil, a new slice is created.
|
|
||||||
//
|
|
||||||
// Returns:
|
|
||||||
// - slice of SuperKmer structs representing maximal subsequences
|
|
||||||
// - nil if parameters are invalid or sequence is too short
|
|
||||||
//
|
|
||||||
// Time complexity: O(n) where n is the sequence length
|
|
||||||
// Space complexity: O(k-m+1) for the deque + O(number of super k-mers) for results
|
|
||||||
func ExtractSuperKmers(seq []byte, k int, m int, buffer *[]SuperKmer) []SuperKmer {
|
|
||||||
if m < 1 || m >= k || k < 2 || k > 31 || len(seq) < k {
|
|
||||||
return nil
|
|
||||||
}
|
|
||||||
|
|
||||||
var result []SuperKmer
|
|
||||||
if buffer == nil {
|
|
||||||
estimatedSize := len(seq) / k
|
|
||||||
if estimatedSize < 1 {
|
|
||||||
estimatedSize = 1
|
|
||||||
}
|
|
||||||
result = make([]SuperKmer, 0, estimatedSize)
|
|
||||||
} else {
|
|
||||||
result = (*buffer)[:0]
|
|
||||||
}
|
|
||||||
|
|
||||||
deque := make([]dequeItem, 0, k-m+1)
|
|
||||||
|
|
||||||
mMask := uint64(1)<<(m*2) - 1
|
|
||||||
rcShift := uint((m - 1) * 2)
|
|
||||||
|
|
||||||
var fwdMmer, rvcMmer uint64
|
|
||||||
for i := 0; i < m-1 && i < len(seq); i++ {
|
|
||||||
code := uint64(__single_base_code__[seq[i]&31])
|
|
||||||
fwdMmer = (fwdMmer << 2) | code
|
|
||||||
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
|
|
||||||
}
|
|
||||||
|
|
||||||
superKmerStart := 0
|
|
||||||
var currentMinimizer uint64
|
|
||||||
firstKmer := true
|
|
||||||
|
|
||||||
for pos := m - 1; pos < len(seq); pos++ {
|
|
||||||
code := uint64(__single_base_code__[seq[pos]&31])
|
|
||||||
fwdMmer = ((fwdMmer << 2) | code) & mMask
|
|
||||||
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
|
|
||||||
|
|
||||||
canonical := fwdMmer
|
|
||||||
if rvcMmer < fwdMmer {
|
|
||||||
canonical = rvcMmer
|
|
||||||
}
|
|
||||||
|
|
||||||
mmerPos := pos - m + 1
|
|
||||||
|
|
||||||
if pos >= k-1 {
|
|
||||||
windowStart := pos - k + 1
|
|
||||||
for len(deque) > 0 && deque[0].position < windowStart {
|
|
||||||
deque = deque[1:]
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
for len(deque) > 0 && deque[len(deque)-1].canonical >= canonical {
|
|
||||||
deque = deque[:len(deque)-1]
|
|
||||||
}
|
|
||||||
|
|
||||||
deque = append(deque, dequeItem{position: mmerPos, canonical: canonical})
|
|
||||||
|
|
||||||
if pos >= k-1 {
|
|
||||||
newMinimizer := deque[0].canonical
|
|
||||||
kmerStart := pos - k + 1
|
|
||||||
|
|
||||||
if firstKmer {
|
|
||||||
currentMinimizer = newMinimizer
|
|
||||||
firstKmer = false
|
|
||||||
} else if newMinimizer != currentMinimizer {
|
|
||||||
endPos := kmerStart + k - 1
|
|
||||||
superKmer := SuperKmer{
|
|
||||||
Minimizer: currentMinimizer,
|
|
||||||
Start: superKmerStart,
|
|
||||||
End: endPos,
|
|
||||||
Sequence: seq[superKmerStart:endPos],
|
|
||||||
}
|
|
||||||
result = append(result, superKmer)
|
|
||||||
|
|
||||||
superKmerStart = kmerStart
|
|
||||||
currentMinimizer = newMinimizer
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
if !firstKmer {
|
|
||||||
superKmer := SuperKmer{
|
|
||||||
Minimizer: currentMinimizer,
|
|
||||||
Start: superKmerStart,
|
|
||||||
End: len(seq),
|
|
||||||
Sequence: seq[superKmerStart:],
|
|
||||||
}
|
|
||||||
result = append(result, superKmer)
|
|
||||||
}
|
|
||||||
|
|
||||||
return result
|
|
||||||
}
|
|
||||||
|
|
||||||
// ReverseComplement computes the reverse complement of an encoded k-mer.
|
// ReverseComplement computes the reverse complement of an encoded k-mer.
|
||||||
// The k-mer is encoded with 2 bits per nucleotide (A=00, C=01, G=10, T=11).
|
// The k-mer is encoded with 2 bits per nucleotide (A=00, C=01, G=10, T=11).
|
||||||
// The complement is: A↔T (00↔11), C↔G (01↔10), which is simply XOR with 11.
|
// The complement is: A↔T (00↔11), C↔G (01↔10), which is simply XOR with 11.
|
||||||
|
|||||||
281
pkg/obikmer/entropy.go
Normal file
281
pkg/obikmer/entropy.go
Normal file
@@ -0,0 +1,281 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import "math"
|
||||||
|
|
||||||
|
// KmerEntropy computes the entropy of a single encoded k-mer.
|
||||||
|
//
|
||||||
|
// The algorithm mirrors the lowmask entropy calculation: it decodes the k-mer
|
||||||
|
// to a DNA sequence, extracts all sub-words of each size from 1 to levelMax,
|
||||||
|
// normalizes them by circular canonical form, counts their frequencies, and
|
||||||
|
// computes Shannon entropy normalized by the maximum possible entropy.
|
||||||
|
// The returned value is the minimum entropy across all word sizes.
|
||||||
|
//
|
||||||
|
// A value close to 0 indicates very low complexity (e.g. "AAAA..."),
|
||||||
|
// while a value close to 1 indicates high complexity.
|
||||||
|
//
|
||||||
|
// Parameters:
|
||||||
|
// - kmer: the encoded k-mer (2 bits per base)
|
||||||
|
// - k: the k-mer size
|
||||||
|
// - levelMax: maximum sub-word size for entropy (typically 6)
|
||||||
|
//
|
||||||
|
// Returns:
|
||||||
|
// - minimum normalized entropy across all word sizes 1..levelMax
|
||||||
|
func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
||||||
|
if k < 1 || levelMax < 1 {
|
||||||
|
return 1.0
|
||||||
|
}
|
||||||
|
if levelMax >= k {
|
||||||
|
levelMax = k - 1
|
||||||
|
}
|
||||||
|
if levelMax < 1 {
|
||||||
|
return 1.0
|
||||||
|
}
|
||||||
|
|
||||||
|
// Decode k-mer to DNA sequence
|
||||||
|
var seqBuf [32]byte
|
||||||
|
seq := DecodeKmer(kmer, k, seqBuf[:])
|
||||||
|
|
||||||
|
// Pre-compute nLogN lookup (same as lowmask)
|
||||||
|
nLogN := make([]float64, k+1)
|
||||||
|
for i := 1; i <= k; i++ {
|
||||||
|
nLogN[i] = float64(i) * math.Log(float64(i))
|
||||||
|
}
|
||||||
|
|
||||||
|
// Build circular-canonical normalization tables per word size
|
||||||
|
normTables := make([][]int, levelMax+1)
|
||||||
|
for ws := 1; ws <= levelMax; ws++ {
|
||||||
|
size := 1 << (ws * 2)
|
||||||
|
normTables[ws] = make([]int, size)
|
||||||
|
for code := 0; code < size; code++ {
|
||||||
|
normTables[ws][code] = int(NormalizeCircular(uint64(code), ws))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
minEntropy := math.MaxFloat64
|
||||||
|
|
||||||
|
for ws := 1; ws <= levelMax; ws++ {
|
||||||
|
nwords := k - ws + 1
|
||||||
|
if nwords < 1 {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
// Count circular-canonical sub-word frequencies
|
||||||
|
tableSize := 1 << (ws * 2)
|
||||||
|
table := make([]int, tableSize)
|
||||||
|
mask := (1 << (ws * 2)) - 1
|
||||||
|
|
||||||
|
wordIndex := 0
|
||||||
|
for i := 0; i < ws-1; i++ {
|
||||||
|
wordIndex = (wordIndex << 2) + int(EncodeNucleotide(seq[i]))
|
||||||
|
}
|
||||||
|
|
||||||
|
for i, j := 0, ws-1; j < k; i, j = i+1, j+1 {
|
||||||
|
wordIndex = ((wordIndex << 2) & mask) + int(EncodeNucleotide(seq[j]))
|
||||||
|
normWord := normTables[ws][wordIndex]
|
||||||
|
table[normWord]++
|
||||||
|
}
|
||||||
|
|
||||||
|
// Compute Shannon entropy
|
||||||
|
floatNwords := float64(nwords)
|
||||||
|
logNwords := math.Log(floatNwords)
|
||||||
|
|
||||||
|
var sumNLogN float64
|
||||||
|
for j := 0; j < tableSize; j++ {
|
||||||
|
n := table[j]
|
||||||
|
if n > 0 {
|
||||||
|
sumNLogN += nLogN[n]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Compute emax (maximum possible entropy for this word size)
|
||||||
|
na := CanonicalCircularKmerCount(ws)
|
||||||
|
var emax float64
|
||||||
|
if nwords < na {
|
||||||
|
emax = math.Log(float64(nwords))
|
||||||
|
} else {
|
||||||
|
cov := nwords / na
|
||||||
|
remains := nwords - (na * cov)
|
||||||
|
f1 := float64(cov) / floatNwords
|
||||||
|
f2 := float64(cov+1) / floatNwords
|
||||||
|
emax = -(float64(na-remains)*f1*math.Log(f1) +
|
||||||
|
float64(remains)*f2*math.Log(f2))
|
||||||
|
}
|
||||||
|
|
||||||
|
if emax <= 0 {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
entropy := (logNwords - sumNLogN/floatNwords) / emax
|
||||||
|
if entropy < 0 {
|
||||||
|
entropy = 0
|
||||||
|
}
|
||||||
|
|
||||||
|
if entropy < minEntropy {
|
||||||
|
minEntropy = entropy
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if minEntropy == math.MaxFloat64 {
|
||||||
|
return 1.0
|
||||||
|
}
|
||||||
|
|
||||||
|
return math.Round(minEntropy*10000) / 10000
|
||||||
|
}
|
||||||
|
|
||||||
|
// KmerEntropyFilter is a reusable entropy filter for batch processing.
|
||||||
|
// It pre-computes normalization tables and lookup values to avoid repeated
|
||||||
|
// allocation across millions of k-mers.
|
||||||
|
//
|
||||||
|
// IMPORTANT: a KmerEntropyFilter is NOT safe for concurrent use.
|
||||||
|
// Each goroutine must create its own instance via NewKmerEntropyFilter.
|
||||||
|
type KmerEntropyFilter struct {
|
||||||
|
k int
|
||||||
|
levelMax int
|
||||||
|
threshold float64
|
||||||
|
nLogN []float64
|
||||||
|
normTables [][]int
|
||||||
|
emaxValues []float64
|
||||||
|
logNwords []float64
|
||||||
|
// Pre-allocated frequency tables reused across Entropy() calls.
|
||||||
|
// One per word size (index 0 unused). Reset to zero before each use.
|
||||||
|
freqTables [][]int
|
||||||
|
}
|
||||||
|
|
||||||
|
// NewKmerEntropyFilter creates an entropy filter with pre-computed tables.
|
||||||
|
//
|
||||||
|
// Parameters:
|
||||||
|
// - k: the k-mer size
|
||||||
|
// - levelMax: maximum sub-word size for entropy (typically 6)
|
||||||
|
// - threshold: entropy threshold (k-mers with entropy <= threshold are rejected)
|
||||||
|
func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter {
|
||||||
|
if levelMax >= k {
|
||||||
|
levelMax = k - 1
|
||||||
|
}
|
||||||
|
if levelMax < 1 {
|
||||||
|
levelMax = 1
|
||||||
|
}
|
||||||
|
|
||||||
|
nLogN := make([]float64, k+1)
|
||||||
|
for i := 1; i <= k; i++ {
|
||||||
|
nLogN[i] = float64(i) * math.Log(float64(i))
|
||||||
|
}
|
||||||
|
|
||||||
|
normTables := make([][]int, levelMax+1)
|
||||||
|
for ws := 1; ws <= levelMax; ws++ {
|
||||||
|
size := 1 << (ws * 2)
|
||||||
|
normTables[ws] = make([]int, size)
|
||||||
|
for code := 0; code < size; code++ {
|
||||||
|
normTables[ws][code] = int(NormalizeCircular(uint64(code), ws))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
emaxValues := make([]float64, levelMax+1)
|
||||||
|
logNwords := make([]float64, levelMax+1)
|
||||||
|
for ws := 1; ws <= levelMax; ws++ {
|
||||||
|
nw := k - ws + 1
|
||||||
|
na := CanonicalCircularKmerCount(ws)
|
||||||
|
if nw < na {
|
||||||
|
logNwords[ws] = math.Log(float64(nw))
|
||||||
|
emaxValues[ws] = math.Log(float64(nw))
|
||||||
|
} else {
|
||||||
|
cov := nw / na
|
||||||
|
remains := nw - (na * cov)
|
||||||
|
f1 := float64(cov) / float64(nw)
|
||||||
|
f2 := float64(cov+1) / float64(nw)
|
||||||
|
logNwords[ws] = math.Log(float64(nw))
|
||||||
|
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
|
||||||
|
float64(remains)*f2*math.Log(f2))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Pre-allocate frequency tables per word size
|
||||||
|
freqTables := make([][]int, levelMax+1)
|
||||||
|
for ws := 1; ws <= levelMax; ws++ {
|
||||||
|
freqTables[ws] = make([]int, 1<<(ws*2))
|
||||||
|
}
|
||||||
|
|
||||||
|
return &KmerEntropyFilter{
|
||||||
|
k: k,
|
||||||
|
levelMax: levelMax,
|
||||||
|
threshold: threshold,
|
||||||
|
nLogN: nLogN,
|
||||||
|
normTables: normTables,
|
||||||
|
emaxValues: emaxValues,
|
||||||
|
logNwords: logNwords,
|
||||||
|
freqTables: freqTables,
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Accept returns true if the k-mer has entropy strictly above the threshold.
|
||||||
|
// Low-complexity k-mers (entropy <= threshold) are rejected.
|
||||||
|
func (ef *KmerEntropyFilter) Accept(kmer uint64) bool {
|
||||||
|
return ef.Entropy(kmer) > ef.threshold
|
||||||
|
}
|
||||||
|
|
||||||
|
// Entropy computes the entropy for a single k-mer using pre-computed tables.
|
||||||
|
func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
|
||||||
|
k := ef.k
|
||||||
|
|
||||||
|
// Decode k-mer to DNA sequence
|
||||||
|
var seqBuf [32]byte
|
||||||
|
seq := DecodeKmer(kmer, k, seqBuf[:])
|
||||||
|
|
||||||
|
minEntropy := math.MaxFloat64
|
||||||
|
|
||||||
|
for ws := 1; ws <= ef.levelMax; ws++ {
|
||||||
|
nwords := k - ws + 1
|
||||||
|
if nwords < 1 {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
emax := ef.emaxValues[ws]
|
||||||
|
if emax <= 0 {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
// Count circular-canonical sub-word frequencies
|
||||||
|
tableSize := 1 << (ws * 2)
|
||||||
|
table := ef.freqTables[ws]
|
||||||
|
clear(table) // reset to zero
|
||||||
|
mask := (1 << (ws * 2)) - 1
|
||||||
|
normTable := ef.normTables[ws]
|
||||||
|
|
||||||
|
wordIndex := 0
|
||||||
|
for i := 0; i < ws-1; i++ {
|
||||||
|
wordIndex = (wordIndex << 2) + int(EncodeNucleotide(seq[i]))
|
||||||
|
}
|
||||||
|
|
||||||
|
for i, j := 0, ws-1; j < k; i, j = i+1, j+1 {
|
||||||
|
wordIndex = ((wordIndex << 2) & mask) + int(EncodeNucleotide(seq[j]))
|
||||||
|
normWord := normTable[wordIndex]
|
||||||
|
table[normWord]++
|
||||||
|
}
|
||||||
|
|
||||||
|
// Compute Shannon entropy
|
||||||
|
floatNwords := float64(nwords)
|
||||||
|
logNwords := ef.logNwords[ws]
|
||||||
|
|
||||||
|
var sumNLogN float64
|
||||||
|
for j := 0; j < tableSize; j++ {
|
||||||
|
n := table[j]
|
||||||
|
if n > 0 {
|
||||||
|
sumNLogN += ef.nLogN[n]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
entropy := (logNwords - sumNLogN/floatNwords) / emax
|
||||||
|
if entropy < 0 {
|
||||||
|
entropy = 0
|
||||||
|
}
|
||||||
|
|
||||||
|
if entropy < minEntropy {
|
||||||
|
minEntropy = entropy
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if minEntropy == math.MaxFloat64 {
|
||||||
|
return 1.0
|
||||||
|
}
|
||||||
|
|
||||||
|
return math.Round(minEntropy*10000) / 10000
|
||||||
|
}
|
||||||
@@ -1,310 +0,0 @@
|
|||||||
package obikmer
|
|
||||||
|
|
||||||
import (
|
|
||||||
"fmt"
|
|
||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
|
||||||
)
|
|
||||||
|
|
||||||
// FrequencyFilter filters k-mers by minimum frequency
|
|
||||||
// Specialization of KmerSetGroup where index[i] contains k-mers seen at least i+1 times
|
|
||||||
type FrequencyFilter struct {
|
|
||||||
*KmerSetGroup // Group of KmerSet (one per frequency level)
|
|
||||||
MinFreq int // v - minimum required frequency
|
|
||||||
}
|
|
||||||
|
|
||||||
// NewFrequencyFilter creates a new frequency filter
|
|
||||||
// minFreq: minimum number d'occurrences required (v)
|
|
||||||
func NewFrequencyFilter(k, minFreq int) *FrequencyFilter {
|
|
||||||
ff := &FrequencyFilter{
|
|
||||||
KmerSetGroup: NewKmerSetGroup(k, minFreq),
|
|
||||||
MinFreq: minFreq,
|
|
||||||
}
|
|
||||||
|
|
||||||
// Initialize group metadata
|
|
||||||
ff.SetAttribute("type", "FrequencyFilter")
|
|
||||||
ff.SetAttribute("min_freq", minFreq)
|
|
||||||
|
|
||||||
// Initialize metadata for each level
|
|
||||||
for i := 0; i < minFreq; i++ {
|
|
||||||
level := ff.Get(i)
|
|
||||||
level.SetAttribute("level", i)
|
|
||||||
level.SetAttribute("min_occurrences", i+1)
|
|
||||||
level.SetId(fmt.Sprintf("level_%d", i))
|
|
||||||
}
|
|
||||||
|
|
||||||
return ff
|
|
||||||
}
|
|
||||||
|
|
||||||
// AddSequence adds all k-mers from a sequence to the filter
|
|
||||||
// Uses an iterator to avoid allocating an intermediate vector
|
|
||||||
func (ff *FrequencyFilter) AddSequence(seq *obiseq.BioSequence) {
|
|
||||||
rawSeq := seq.Sequence()
|
|
||||||
for canonical := range IterCanonicalKmers(rawSeq, ff.K()) {
|
|
||||||
ff.AddKmerCode(canonical)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// AddKmerCode adds an encoded k-mer to the filter (main algorithm)
|
|
||||||
func (ff *FrequencyFilter) AddKmerCode(kmer uint64) {
|
|
||||||
// Find the current level of the k-mer
|
|
||||||
c := 0
|
|
||||||
for c < ff.MinFreq && ff.Get(c).Contains(kmer) {
|
|
||||||
c++
|
|
||||||
}
|
|
||||||
|
|
||||||
// Add to next level (if not yet at maximum)
|
|
||||||
if c < ff.MinFreq {
|
|
||||||
ff.Get(c).AddKmerCode(kmer)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// AddCanonicalKmerCode adds an encoded canonical k-mer to the filter
|
|
||||||
func (ff *FrequencyFilter) AddCanonicalKmerCode(kmer uint64) {
|
|
||||||
canonical := CanonicalKmer(kmer, ff.K())
|
|
||||||
ff.AddKmerCode(canonical)
|
|
||||||
}
|
|
||||||
|
|
||||||
// AddKmer adds a k-mer to the filter by encoding the sequence
|
|
||||||
// The sequence must have exactly k nucleotides
|
|
||||||
// Zero-allocation: encodes directly without creating an intermediate slice
|
|
||||||
func (ff *FrequencyFilter) AddKmer(seq []byte) {
|
|
||||||
kmer := EncodeKmer(seq, ff.K())
|
|
||||||
ff.AddKmerCode(kmer)
|
|
||||||
}
|
|
||||||
|
|
||||||
// AddCanonicalKmer adds a canonical k-mer to the filter by encoding the sequence
|
|
||||||
// The sequence must have exactly k nucleotides
|
|
||||||
// Zero-allocation: encodes directly in canonical form without creating an intermediate slice
|
|
||||||
func (ff *FrequencyFilter) AddCanonicalKmer(seq []byte) {
|
|
||||||
canonical := EncodeCanonicalKmer(seq, ff.K())
|
|
||||||
ff.AddKmerCode(canonical)
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetFilteredSet returns a KmerSet of k-mers with frequency ≥ minFreq
|
|
||||||
func (ff *FrequencyFilter) GetFilteredSet() *KmerSet {
|
|
||||||
// Filtered k-mers are in the last level
|
|
||||||
return ff.Get(ff.MinFreq - 1).Copy()
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetKmersAtLevel returns a KmerSet of k-mers seen at least (level+1) times
|
|
||||||
// level doit être dans [0, minFreq-1]
|
|
||||||
func (ff *FrequencyFilter) GetKmersAtLevel(level int) *KmerSet {
|
|
||||||
ks := ff.Get(level)
|
|
||||||
if ks == nil {
|
|
||||||
return NewKmerSet(ff.K())
|
|
||||||
}
|
|
||||||
return ks.Copy()
|
|
||||||
}
|
|
||||||
|
|
||||||
// Stats returns statistics on frequency levels
|
|
||||||
func (ff *FrequencyFilter) Stats() FrequencyFilterStats {
|
|
||||||
stats := FrequencyFilterStats{
|
|
||||||
MinFreq: ff.MinFreq,
|
|
||||||
Levels: make([]LevelStats, ff.MinFreq),
|
|
||||||
}
|
|
||||||
|
|
||||||
for i := 0; i < ff.MinFreq; i++ {
|
|
||||||
ks := ff.Get(i)
|
|
||||||
card := ks.Len()
|
|
||||||
sizeBytes := ks.MemoryUsage()
|
|
||||||
|
|
||||||
stats.Levels[i] = LevelStats{
|
|
||||||
Level: i + 1, // Level 1 = freq ≥ 1
|
|
||||||
Cardinality: card,
|
|
||||||
SizeBytes: sizeBytes,
|
|
||||||
}
|
|
||||||
|
|
||||||
stats.TotalBytes += sizeBytes
|
|
||||||
}
|
|
||||||
|
|
||||||
// The last level contains the result
|
|
||||||
stats.FilteredKmers = stats.Levels[ff.MinFreq-1].Cardinality
|
|
||||||
|
|
||||||
return stats
|
|
||||||
}
|
|
||||||
|
|
||||||
// FrequencyFilterStats contains the filter statistics
|
|
||||||
type FrequencyFilterStats struct {
|
|
||||||
MinFreq int
|
|
||||||
FilteredKmers uint64 // K-mers with freq ≥ minFreq
|
|
||||||
TotalBytes uint64 // Total memory used
|
|
||||||
Levels []LevelStats
|
|
||||||
}
|
|
||||||
|
|
||||||
// LevelStats contains the stats of a level
|
|
||||||
type LevelStats struct {
|
|
||||||
Level int // freq ≥ Level
|
|
||||||
Cardinality uint64 // Number of k-mers
|
|
||||||
SizeBytes uint64 // Size in bytes
|
|
||||||
}
|
|
||||||
|
|
||||||
func (ffs FrequencyFilterStats) String() string {
|
|
||||||
result := fmt.Sprintf(`Frequency Filter Statistics (minFreq=%d):
|
|
||||||
Filtered k-mers (freq≥%d): %d
|
|
||||||
Total memory: %.2f MB
|
|
||||||
|
|
||||||
Level breakdown:
|
|
||||||
`, ffs.MinFreq, ffs.MinFreq, ffs.FilteredKmers, float64(ffs.TotalBytes)/1024/1024)
|
|
||||||
|
|
||||||
for _, level := range ffs.Levels {
|
|
||||||
result += fmt.Sprintf(" freq≥%d: %d k-mers (%.2f MB)\n",
|
|
||||||
level.Level,
|
|
||||||
level.Cardinality,
|
|
||||||
float64(level.SizeBytes)/1024/1024)
|
|
||||||
}
|
|
||||||
|
|
||||||
return result
|
|
||||||
}
|
|
||||||
|
|
||||||
// Clear libère la mémoire de tous les niveaux
|
|
||||||
// (héritée de KmerSetGroup mais redéfinie pour clarté)
|
|
||||||
func (ff *FrequencyFilter) Clear() {
|
|
||||||
ff.KmerSetGroup.Clear()
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==================================
|
|
||||||
// BATCH PROCESSING
|
|
||||||
// ==================================
|
|
||||||
|
|
||||||
// AddSequences adds multiple sequences in batch
|
|
||||||
func (ff *FrequencyFilter) AddSequences(sequences *obiseq.BioSequenceSlice) {
|
|
||||||
for _, seq := range *sequences {
|
|
||||||
ff.AddSequence(seq)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==================================
|
|
||||||
// PERSISTANCE
|
|
||||||
// ==================================
|
|
||||||
|
|
||||||
// Save sauvegarde le FrequencyFilter dans un répertoire
|
|
||||||
// Utilise le format de sérialisation du KmerSetGroup sous-jacent
|
|
||||||
// Les métadonnées incluent le type "FrequencyFilter" et min_freq
|
|
||||||
//
|
|
||||||
// Format:
|
|
||||||
// - directory/metadata.{toml,yaml,json} - métadonnées du filtre
|
|
||||||
// - directory/set_0.roaring - k-mers vus ≥1 fois
|
|
||||||
// - directory/set_1.roaring - k-mers vus ≥2 fois
|
|
||||||
// - ...
|
|
||||||
// - directory/set_{minFreq-1}.roaring - k-mers vus ≥minFreq fois
|
|
||||||
//
|
|
||||||
// Parameters:
|
|
||||||
// - directory: répertoire de destination
|
|
||||||
// - format: format des métadonnées (FormatTOML, FormatYAML, FormatJSON)
|
|
||||||
//
|
|
||||||
// Example:
|
|
||||||
//
|
|
||||||
// err := ff.Save("./my_filter", obikmer.FormatTOML)
|
|
||||||
func (ff *FrequencyFilter) Save(directory string, format MetadataFormat) error {
|
|
||||||
// Déléguer à KmerSetGroup qui gère déjà tout
|
|
||||||
return ff.KmerSetGroup.Save(directory, format)
|
|
||||||
}
|
|
||||||
|
|
||||||
// LoadFrequencyFilter charge un FrequencyFilter depuis un répertoire
|
|
||||||
// Vérifie que les métadonnées correspondent à un FrequencyFilter
|
|
||||||
//
|
|
||||||
// Parameters:
|
|
||||||
// - directory: répertoire source
|
|
||||||
//
|
|
||||||
// Returns:
|
|
||||||
// - *FrequencyFilter: le filtre chargé
|
|
||||||
// - error: erreur si le chargement échoue ou si ce n'est pas un FrequencyFilter
|
|
||||||
//
|
|
||||||
// Example:
|
|
||||||
//
|
|
||||||
// ff, err := obikmer.LoadFrequencyFilter("./my_filter")
|
|
||||||
func LoadFrequencyFilter(directory string) (*FrequencyFilter, error) {
|
|
||||||
// Charger le KmerSetGroup
|
|
||||||
ksg, err := LoadKmerSetGroup(directory)
|
|
||||||
if err != nil {
|
|
||||||
return nil, err
|
|
||||||
}
|
|
||||||
|
|
||||||
// Vérifier que c'est bien un FrequencyFilter
|
|
||||||
if typeAttr, ok := ksg.GetAttribute("type"); !ok || typeAttr != "FrequencyFilter" {
|
|
||||||
return nil, fmt.Errorf("loaded data is not a FrequencyFilter (type=%v)", typeAttr)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Récupérer min_freq
|
|
||||||
minFreqAttr, ok := ksg.GetIntAttribute("min_freq")
|
|
||||||
if !ok {
|
|
||||||
return nil, fmt.Errorf("FrequencyFilter missing min_freq attribute")
|
|
||||||
}
|
|
||||||
|
|
||||||
// Créer le FrequencyFilter
|
|
||||||
ff := &FrequencyFilter{
|
|
||||||
KmerSetGroup: ksg,
|
|
||||||
MinFreq: minFreqAttr,
|
|
||||||
}
|
|
||||||
|
|
||||||
return ff, nil
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==================================
|
|
||||||
// UTILITAIRES
|
|
||||||
// ==================================
|
|
||||||
|
|
||||||
// Contains vérifie si un k-mer a atteint la fréquence minimale
|
|
||||||
func (ff *FrequencyFilter) Contains(kmer uint64) bool {
|
|
||||||
canonical := CanonicalKmer(kmer, ff.K())
|
|
||||||
return ff.Get(ff.MinFreq - 1).Contains(canonical)
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetFrequency returns the approximate frequency of a k-mer
|
|
||||||
// Retourne le niveau maximum atteint (freq ≥ niveau)
|
|
||||||
func (ff *FrequencyFilter) GetFrequency(kmer uint64) int {
|
|
||||||
canonical := CanonicalKmer(kmer, ff.K())
|
|
||||||
|
|
||||||
freq := 0
|
|
||||||
for i := 0; i < ff.MinFreq; i++ {
|
|
||||||
if ff.Get(i).Contains(canonical) {
|
|
||||||
freq = i + 1
|
|
||||||
} else {
|
|
||||||
break
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
return freq
|
|
||||||
}
|
|
||||||
|
|
||||||
// Len returns the number of filtered k-mers or at a specific level
|
|
||||||
// Without argument: returns the number of k-mers with freq ≥ minFreq (last level)
|
|
||||||
// With argument level: returns the number of k-mers with freq ≥ (level+1)
|
|
||||||
// Exemple: Len() pour les k-mers filtrés, Len(2) pour freq ≥ 3
|
|
||||||
// (héritée de KmerSetGroup mais redéfinie pour la documentation)
|
|
||||||
func (ff *FrequencyFilter) Len(level ...int) uint64 {
|
|
||||||
return ff.KmerSetGroup.Len(level...)
|
|
||||||
}
|
|
||||||
|
|
||||||
// MemoryUsage returns memory usage in bytes
|
|
||||||
// (héritée de KmerSetGroup mais redéfinie pour clarté)
|
|
||||||
func (ff *FrequencyFilter) MemoryUsage() uint64 {
|
|
||||||
return ff.KmerSetGroup.MemoryUsage()
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==================================
|
|
||||||
// COMPARAISON AVEC D'AUTRES APPROCHES
|
|
||||||
// ==================================
|
|
||||||
|
|
||||||
// CompareWithSimpleMap compare la mémoire avec une simple map
|
|
||||||
func (ff *FrequencyFilter) CompareWithSimpleMap() string {
|
|
||||||
totalKmers := ff.Get(0).Len()
|
|
||||||
|
|
||||||
simpleMapBytes := totalKmers * 24 // ~24 bytes par entrée
|
|
||||||
roaringBytes := ff.MemoryUsage()
|
|
||||||
|
|
||||||
reduction := float64(simpleMapBytes) / float64(roaringBytes)
|
|
||||||
|
|
||||||
return fmt.Sprintf(`Memory Comparison for %d k-mers:
|
|
||||||
Simple map[uint64]uint32: %.2f MB
|
|
||||||
Roaring filter (v=%d): %.2f MB
|
|
||||||
Reduction: %.1fx
|
|
||||||
`,
|
|
||||||
totalKmers,
|
|
||||||
float64(simpleMapBytes)/1024/1024,
|
|
||||||
ff.MinFreq,
|
|
||||||
float64(roaringBytes)/1024/1024,
|
|
||||||
reduction,
|
|
||||||
)
|
|
||||||
}
|
|
||||||
86
pkg/obikmer/kdi_merge.go
Normal file
86
pkg/obikmer/kdi_merge.go
Normal file
@@ -0,0 +1,86 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import "container/heap"
|
||||||
|
|
||||||
|
// mergeItem represents an element in the min-heap for k-way merge.
|
||||||
|
type mergeItem struct {
|
||||||
|
value uint64
|
||||||
|
idx int // index of the reader that produced this value
|
||||||
|
}
|
||||||
|
|
||||||
|
// mergeHeap implements heap.Interface for k-way merge.
|
||||||
|
type mergeHeap []mergeItem
|
||||||
|
|
||||||
|
func (h mergeHeap) Len() int { return len(h) }
|
||||||
|
func (h mergeHeap) Less(i, j int) bool { return h[i].value < h[j].value }
|
||||||
|
func (h mergeHeap) Swap(i, j int) { h[i], h[j] = h[j], h[i] }
|
||||||
|
func (h *mergeHeap) Push(x interface{}) { *h = append(*h, x.(mergeItem)) }
|
||||||
|
func (h *mergeHeap) Pop() interface{} {
|
||||||
|
old := *h
|
||||||
|
n := len(old)
|
||||||
|
x := old[n-1]
|
||||||
|
*h = old[:n-1]
|
||||||
|
return x
|
||||||
|
}
|
||||||
|
|
||||||
|
// KWayMerge performs a k-way merge of multiple sorted KdiReader streams.
|
||||||
|
// For each unique k-mer value, it reports the value and the number of
|
||||||
|
// input streams that contained it (count).
|
||||||
|
type KWayMerge struct {
|
||||||
|
h mergeHeap
|
||||||
|
readers []*KdiReader
|
||||||
|
}
|
||||||
|
|
||||||
|
// NewKWayMerge creates a k-way merge from multiple KdiReaders.
|
||||||
|
// Each reader must produce values in sorted (ascending) order.
|
||||||
|
func NewKWayMerge(readers []*KdiReader) *KWayMerge {
|
||||||
|
m := &KWayMerge{
|
||||||
|
h: make(mergeHeap, 0, len(readers)),
|
||||||
|
readers: readers,
|
||||||
|
}
|
||||||
|
|
||||||
|
// Initialize heap with first value from each reader
|
||||||
|
for i, r := range readers {
|
||||||
|
if v, ok := r.Next(); ok {
|
||||||
|
m.h = append(m.h, mergeItem{value: v, idx: i})
|
||||||
|
}
|
||||||
|
}
|
||||||
|
heap.Init(&m.h)
|
||||||
|
|
||||||
|
return m
|
||||||
|
}
|
||||||
|
|
||||||
|
// Next returns the next smallest k-mer value, the number of readers
|
||||||
|
// that contained this value (count), and true.
|
||||||
|
// Returns (0, 0, false) when all streams are exhausted.
|
||||||
|
func (m *KWayMerge) Next() (kmer uint64, count int, ok bool) {
|
||||||
|
if len(m.h) == 0 {
|
||||||
|
return 0, 0, false
|
||||||
|
}
|
||||||
|
|
||||||
|
minVal := m.h[0].value
|
||||||
|
count = 0
|
||||||
|
|
||||||
|
// Pop all items with the same value
|
||||||
|
for len(m.h) > 0 && m.h[0].value == minVal {
|
||||||
|
item := heap.Pop(&m.h).(mergeItem)
|
||||||
|
count++
|
||||||
|
// Advance that reader
|
||||||
|
if v, ok := m.readers[item.idx].Next(); ok {
|
||||||
|
heap.Push(&m.h, mergeItem{value: v, idx: item.idx})
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return minVal, count, true
|
||||||
|
}
|
||||||
|
|
||||||
|
// Close closes all underlying readers.
|
||||||
|
func (m *KWayMerge) Close() error {
|
||||||
|
var firstErr error
|
||||||
|
for _, r := range m.readers {
|
||||||
|
if err := r.Close(); err != nil && firstErr == nil {
|
||||||
|
firstErr = err
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return firstErr
|
||||||
|
}
|
||||||
159
pkg/obikmer/kdi_merge_test.go
Normal file
159
pkg/obikmer/kdi_merge_test.go
Normal file
@@ -0,0 +1,159 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"path/filepath"
|
||||||
|
"testing"
|
||||||
|
)
|
||||||
|
|
||||||
|
// writeKdi is a helper that writes sorted kmers to a .kdi file.
|
||||||
|
func writeKdi(t *testing.T, dir, name string, kmers []uint64) string {
|
||||||
|
t.Helper()
|
||||||
|
path := filepath.Join(dir, name)
|
||||||
|
w, err := NewKdiWriter(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
for _, v := range kmers {
|
||||||
|
if err := w.Write(v); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if err := w.Close(); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
return path
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestKWayMergeBasic(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
|
||||||
|
// Three sorted streams
|
||||||
|
p1 := writeKdi(t, dir, "a.kdi", []uint64{1, 3, 5, 7})
|
||||||
|
p2 := writeKdi(t, dir, "b.kdi", []uint64{2, 3, 6, 7})
|
||||||
|
p3 := writeKdi(t, dir, "c.kdi", []uint64{3, 4, 7, 8})
|
||||||
|
|
||||||
|
r1, _ := NewKdiReader(p1)
|
||||||
|
r2, _ := NewKdiReader(p2)
|
||||||
|
r3, _ := NewKdiReader(p3)
|
||||||
|
|
||||||
|
m := NewKWayMerge([]*KdiReader{r1, r2, r3})
|
||||||
|
defer m.Close()
|
||||||
|
|
||||||
|
type result struct {
|
||||||
|
kmer uint64
|
||||||
|
count int
|
||||||
|
}
|
||||||
|
var results []result
|
||||||
|
for {
|
||||||
|
kmer, count, ok := m.Next()
|
||||||
|
if !ok {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
results = append(results, result{kmer, count})
|
||||||
|
}
|
||||||
|
|
||||||
|
expected := []result{
|
||||||
|
{1, 1}, {2, 1}, {3, 3}, {4, 1}, {5, 1}, {6, 1}, {7, 3}, {8, 1},
|
||||||
|
}
|
||||||
|
if len(results) != len(expected) {
|
||||||
|
t.Fatalf("got %d results, want %d", len(results), len(expected))
|
||||||
|
}
|
||||||
|
for i, exp := range expected {
|
||||||
|
if results[i] != exp {
|
||||||
|
t.Errorf("result %d: got %+v, want %+v", i, results[i], exp)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestKWayMergeSingleStream(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
p := writeKdi(t, dir, "a.kdi", []uint64{10, 20, 30})
|
||||||
|
|
||||||
|
r, _ := NewKdiReader(p)
|
||||||
|
m := NewKWayMerge([]*KdiReader{r})
|
||||||
|
defer m.Close()
|
||||||
|
|
||||||
|
vals := []uint64{10, 20, 30}
|
||||||
|
for _, expected := range vals {
|
||||||
|
kmer, count, ok := m.Next()
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("unexpected EOF")
|
||||||
|
}
|
||||||
|
if kmer != expected || count != 1 {
|
||||||
|
t.Fatalf("got (%d, %d), want (%d, 1)", kmer, count, expected)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
_, _, ok := m.Next()
|
||||||
|
if ok {
|
||||||
|
t.Fatal("expected EOF")
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestKWayMergeEmpty(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
|
||||||
|
p1 := writeKdi(t, dir, "a.kdi", nil)
|
||||||
|
p2 := writeKdi(t, dir, "b.kdi", nil)
|
||||||
|
|
||||||
|
r1, _ := NewKdiReader(p1)
|
||||||
|
r2, _ := NewKdiReader(p2)
|
||||||
|
|
||||||
|
m := NewKWayMerge([]*KdiReader{r1, r2})
|
||||||
|
defer m.Close()
|
||||||
|
|
||||||
|
_, _, ok := m.Next()
|
||||||
|
if ok {
|
||||||
|
t.Fatal("expected no results from empty streams")
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestKWayMergeDisjoint(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
|
||||||
|
p1 := writeKdi(t, dir, "a.kdi", []uint64{1, 2, 3})
|
||||||
|
p2 := writeKdi(t, dir, "b.kdi", []uint64{10, 20, 30})
|
||||||
|
|
||||||
|
r1, _ := NewKdiReader(p1)
|
||||||
|
r2, _ := NewKdiReader(p2)
|
||||||
|
|
||||||
|
m := NewKWayMerge([]*KdiReader{r1, r2})
|
||||||
|
defer m.Close()
|
||||||
|
|
||||||
|
expected := []uint64{1, 2, 3, 10, 20, 30}
|
||||||
|
for _, exp := range expected {
|
||||||
|
kmer, count, ok := m.Next()
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("unexpected EOF")
|
||||||
|
}
|
||||||
|
if kmer != exp || count != 1 {
|
||||||
|
t.Fatalf("got (%d, %d), want (%d, 1)", kmer, count, exp)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestKWayMergeAllSame(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
|
||||||
|
p1 := writeKdi(t, dir, "a.kdi", []uint64{42})
|
||||||
|
p2 := writeKdi(t, dir, "b.kdi", []uint64{42})
|
||||||
|
p3 := writeKdi(t, dir, "c.kdi", []uint64{42})
|
||||||
|
|
||||||
|
r1, _ := NewKdiReader(p1)
|
||||||
|
r2, _ := NewKdiReader(p2)
|
||||||
|
r3, _ := NewKdiReader(p3)
|
||||||
|
|
||||||
|
m := NewKWayMerge([]*KdiReader{r1, r2, r3})
|
||||||
|
defer m.Close()
|
||||||
|
|
||||||
|
kmer, count, ok := m.Next()
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("expected one result")
|
||||||
|
}
|
||||||
|
if kmer != 42 || count != 3 {
|
||||||
|
t.Fatalf("got (%d, %d), want (42, 3)", kmer, count)
|
||||||
|
}
|
||||||
|
_, _, ok = m.Next()
|
||||||
|
if ok {
|
||||||
|
t.Fatal("expected EOF")
|
||||||
|
}
|
||||||
|
}
|
||||||
170
pkg/obikmer/kdi_reader.go
Normal file
170
pkg/obikmer/kdi_reader.go
Normal file
@@ -0,0 +1,170 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"bufio"
|
||||||
|
"encoding/binary"
|
||||||
|
"fmt"
|
||||||
|
"io"
|
||||||
|
"os"
|
||||||
|
)
|
||||||
|
|
||||||
|
// KdiReader reads k-mers from a .kdi file using streaming delta-varint decoding.
|
||||||
|
type KdiReader struct {
|
||||||
|
r *bufio.Reader
|
||||||
|
file *os.File
|
||||||
|
count uint64 // total number of k-mers
|
||||||
|
read uint64 // number of k-mers already consumed
|
||||||
|
prev uint64 // last decoded value
|
||||||
|
started bool // whether first value has been read
|
||||||
|
index *KdxIndex // optional sparse index for seeking
|
||||||
|
}
|
||||||
|
|
||||||
|
// NewKdiReader opens a .kdi file for streaming reading (no index).
|
||||||
|
func NewKdiReader(path string) (*KdiReader, error) {
|
||||||
|
return openKdiReader(path, nil)
|
||||||
|
}
|
||||||
|
|
||||||
|
// NewKdiIndexedReader opens a .kdi file with its companion .kdx index
|
||||||
|
// loaded for fast seeking. If the .kdx file does not exist, it gracefully
|
||||||
|
// falls back to sequential reading.
|
||||||
|
func NewKdiIndexedReader(path string) (*KdiReader, error) {
|
||||||
|
kdxPath := KdxPathForKdi(path)
|
||||||
|
idx, err := LoadKdxIndex(kdxPath)
|
||||||
|
if err != nil {
|
||||||
|
// Index load failed — fall back to non-indexed
|
||||||
|
return openKdiReader(path, nil)
|
||||||
|
}
|
||||||
|
// idx may be nil if file does not exist — that's fine
|
||||||
|
return openKdiReader(path, idx)
|
||||||
|
}
|
||||||
|
|
||||||
|
func openKdiReader(path string, idx *KdxIndex) (*KdiReader, error) {
|
||||||
|
f, err := os.Open(path)
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
r := bufio.NewReaderSize(f, 65536)
|
||||||
|
|
||||||
|
// Read and verify magic
|
||||||
|
var magic [4]byte
|
||||||
|
if _, err := io.ReadFull(r, magic[:]); err != nil {
|
||||||
|
f.Close()
|
||||||
|
return nil, fmt.Errorf("kdi: read magic: %w", err)
|
||||||
|
}
|
||||||
|
if magic != kdiMagic {
|
||||||
|
f.Close()
|
||||||
|
return nil, fmt.Errorf("kdi: bad magic %v", magic)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Read count
|
||||||
|
var countBuf [8]byte
|
||||||
|
if _, err := io.ReadFull(r, countBuf[:]); err != nil {
|
||||||
|
f.Close()
|
||||||
|
return nil, fmt.Errorf("kdi: read count: %w", err)
|
||||||
|
}
|
||||||
|
count := binary.LittleEndian.Uint64(countBuf[:])
|
||||||
|
|
||||||
|
return &KdiReader{
|
||||||
|
r: r,
|
||||||
|
file: f,
|
||||||
|
count: count,
|
||||||
|
index: idx,
|
||||||
|
}, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// Next returns the next k-mer and true, or (0, false) when exhausted.
|
||||||
|
func (kr *KdiReader) Next() (uint64, bool) {
|
||||||
|
if kr.read >= kr.count {
|
||||||
|
return 0, false
|
||||||
|
}
|
||||||
|
|
||||||
|
if !kr.started {
|
||||||
|
// Read first value as absolute uint64 LE
|
||||||
|
var buf [8]byte
|
||||||
|
if _, err := io.ReadFull(kr.r, buf[:]); err != nil {
|
||||||
|
return 0, false
|
||||||
|
}
|
||||||
|
kr.prev = binary.LittleEndian.Uint64(buf[:])
|
||||||
|
kr.started = true
|
||||||
|
kr.read++
|
||||||
|
return kr.prev, true
|
||||||
|
}
|
||||||
|
|
||||||
|
// Read delta varint
|
||||||
|
delta, err := DecodeVarint(kr.r)
|
||||||
|
if err != nil {
|
||||||
|
return 0, false
|
||||||
|
}
|
||||||
|
kr.prev += delta
|
||||||
|
kr.read++
|
||||||
|
return kr.prev, true
|
||||||
|
}
|
||||||
|
|
||||||
|
// SeekTo positions the reader near the target k-mer using the sparse .kdx index.
|
||||||
|
// After SeekTo, the reader is positioned so that the next call to Next()
|
||||||
|
// returns the k-mer immediately after the indexed entry at or before target.
|
||||||
|
//
|
||||||
|
// If the reader has no index, or the target is before the current position,
|
||||||
|
// SeekTo does nothing (linear scan continues from current position).
|
||||||
|
func (kr *KdiReader) SeekTo(target uint64) error {
|
||||||
|
if kr.index == nil {
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// If we've already passed the target, we can't seek backwards
|
||||||
|
if kr.started && kr.prev >= target {
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
offset, skipCount, ok := kr.index.FindOffset(target)
|
||||||
|
if !ok {
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// skipCount is the number of k-mers consumed at the indexed position.
|
||||||
|
// The index was recorded AFTER writing the k-mer at position skipCount-1
|
||||||
|
// (since count%stride==0 after incrementing count). So the actual number
|
||||||
|
// of k-mers consumed is skipCount (the entry's kmer is the last one
|
||||||
|
// before the offset).
|
||||||
|
|
||||||
|
// Only seek if it would skip significant work
|
||||||
|
if kr.started && skipCount <= kr.read {
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// The index entry stores (kmer_value, byte_offset_after_that_kmer).
|
||||||
|
// skipCount = (entryIdx+1)*stride, so entryIdx = skipCount/stride - 1
|
||||||
|
// We seek to that offset, set prev = indexedKmer, and the next Next()
|
||||||
|
// call will read the delta-varint of the following k-mer.
|
||||||
|
entryIdx := int(skipCount)/kr.index.stride - 1
|
||||||
|
if entryIdx < 0 || entryIdx >= len(kr.index.entries) {
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
indexedKmer := kr.index.entries[entryIdx].kmer
|
||||||
|
|
||||||
|
if _, err := kr.file.Seek(int64(offset), io.SeekStart); err != nil {
|
||||||
|
return fmt.Errorf("kdi: seek: %w", err)
|
||||||
|
}
|
||||||
|
kr.r.Reset(kr.file)
|
||||||
|
|
||||||
|
kr.prev = indexedKmer
|
||||||
|
kr.started = true
|
||||||
|
kr.read = skipCount
|
||||||
|
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// Count returns the total number of k-mers in this partition.
|
||||||
|
func (kr *KdiReader) Count() uint64 {
|
||||||
|
return kr.count
|
||||||
|
}
|
||||||
|
|
||||||
|
// Remaining returns how many k-mers have not been read yet.
|
||||||
|
func (kr *KdiReader) Remaining() uint64 {
|
||||||
|
return kr.count - kr.read
|
||||||
|
}
|
||||||
|
|
||||||
|
// Close closes the underlying file.
|
||||||
|
func (kr *KdiReader) Close() error {
|
||||||
|
return kr.file.Close()
|
||||||
|
}
|
||||||
255
pkg/obikmer/kdi_test.go
Normal file
255
pkg/obikmer/kdi_test.go
Normal file
@@ -0,0 +1,255 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"os"
|
||||||
|
"path/filepath"
|
||||||
|
"sort"
|
||||||
|
"testing"
|
||||||
|
)
|
||||||
|
|
||||||
|
func TestKdiRoundTrip(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
path := filepath.Join(dir, "test.kdi")
|
||||||
|
|
||||||
|
// Sorted k-mer values
|
||||||
|
kmers := []uint64{10, 20, 30, 100, 200, 500, 10000, 1 << 40, 1<<62 - 1}
|
||||||
|
|
||||||
|
w, err := NewKdiWriter(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
for _, v := range kmers {
|
||||||
|
if err := w.Write(v); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if w.Count() != uint64(len(kmers)) {
|
||||||
|
t.Fatalf("writer count: got %d, want %d", w.Count(), len(kmers))
|
||||||
|
}
|
||||||
|
if err := w.Close(); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Read back
|
||||||
|
r, err := NewKdiReader(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
defer r.Close()
|
||||||
|
|
||||||
|
if r.Count() != uint64(len(kmers)) {
|
||||||
|
t.Fatalf("reader count: got %d, want %d", r.Count(), len(kmers))
|
||||||
|
}
|
||||||
|
|
||||||
|
for i, expected := range kmers {
|
||||||
|
got, ok := r.Next()
|
||||||
|
if !ok {
|
||||||
|
t.Fatalf("unexpected EOF at index %d", i)
|
||||||
|
}
|
||||||
|
if got != expected {
|
||||||
|
t.Fatalf("kmer %d: got %d, want %d", i, got, expected)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
_, ok := r.Next()
|
||||||
|
if ok {
|
||||||
|
t.Fatal("expected EOF after all k-mers")
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestKdiEmpty(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
path := filepath.Join(dir, "empty.kdi")
|
||||||
|
|
||||||
|
w, err := NewKdiWriter(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
if err := w.Close(); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
r, err := NewKdiReader(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
defer r.Close()
|
||||||
|
|
||||||
|
if r.Count() != 0 {
|
||||||
|
t.Fatalf("expected count 0, got %d", r.Count())
|
||||||
|
}
|
||||||
|
|
||||||
|
_, ok := r.Next()
|
||||||
|
if ok {
|
||||||
|
t.Fatal("expected no k-mers in empty file")
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestKdiSingleValue(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
path := filepath.Join(dir, "single.kdi")
|
||||||
|
|
||||||
|
w, err := NewKdiWriter(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
if err := w.Write(42); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
if err := w.Close(); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
r, err := NewKdiReader(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
defer r.Close()
|
||||||
|
|
||||||
|
if r.Count() != 1 {
|
||||||
|
t.Fatalf("expected count 1, got %d", r.Count())
|
||||||
|
}
|
||||||
|
|
||||||
|
v, ok := r.Next()
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("expected one k-mer")
|
||||||
|
}
|
||||||
|
if v != 42 {
|
||||||
|
t.Fatalf("got %d, want 42", v)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestKdiFileSize(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
path := filepath.Join(dir, "size.kdi")
|
||||||
|
|
||||||
|
// Write: magic(4) + count(8) + first(8) = 20 bytes
|
||||||
|
w, err := NewKdiWriter(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
if err := w.Write(0); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
if err := w.Close(); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
info, err := os.Stat(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
// magic(4) + count(8) + first(8) = 20
|
||||||
|
if info.Size() != 20 {
|
||||||
|
t.Fatalf("file size: got %d, want 20", info.Size())
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestKdiDeltaCompression(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
path := filepath.Join(dir, "delta.kdi")
|
||||||
|
|
||||||
|
// Dense consecutive values should compress well
|
||||||
|
n := 10000
|
||||||
|
kmers := make([]uint64, n)
|
||||||
|
for i := range kmers {
|
||||||
|
kmers[i] = uint64(i * 2) // even numbers
|
||||||
|
}
|
||||||
|
|
||||||
|
w, err := NewKdiWriter(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
for _, v := range kmers {
|
||||||
|
if err := w.Write(v); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if err := w.Close(); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Each delta is 2, encoded as 1 byte varint
|
||||||
|
// Total: magic(4) + count(8) + first(8) + (n-1)*1 = 20 + 9999 bytes
|
||||||
|
info, err := os.Stat(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
expected := int64(20 + n - 1)
|
||||||
|
if info.Size() != expected {
|
||||||
|
t.Fatalf("file size: got %d, want %d", info.Size(), expected)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Verify round-trip
|
||||||
|
r, err := NewKdiReader(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
defer r.Close()
|
||||||
|
|
||||||
|
for i, expected := range kmers {
|
||||||
|
got, ok := r.Next()
|
||||||
|
if !ok {
|
||||||
|
t.Fatalf("unexpected EOF at index %d", i)
|
||||||
|
}
|
||||||
|
if got != expected {
|
||||||
|
t.Fatalf("kmer %d: got %d, want %d", i, got, expected)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestKdiFromRealKmers(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
path := filepath.Join(dir, "real.kdi")
|
||||||
|
|
||||||
|
// Extract k-mers from a sequence, sort, dedup, write to KDI
|
||||||
|
seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT")
|
||||||
|
k := 15
|
||||||
|
|
||||||
|
var kmers []uint64
|
||||||
|
for kmer := range IterCanonicalKmers(seq, k) {
|
||||||
|
kmers = append(kmers, kmer)
|
||||||
|
}
|
||||||
|
sort.Slice(kmers, func(i, j int) bool { return kmers[i] < kmers[j] })
|
||||||
|
// Dedup
|
||||||
|
deduped := kmers[:0]
|
||||||
|
for i, v := range kmers {
|
||||||
|
if i == 0 || v != kmers[i-1] {
|
||||||
|
deduped = append(deduped, v)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
w, err := NewKdiWriter(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
for _, v := range deduped {
|
||||||
|
if err := w.Write(v); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if err := w.Close(); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Read back and verify
|
||||||
|
r, err := NewKdiReader(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
defer r.Close()
|
||||||
|
|
||||||
|
if r.Count() != uint64(len(deduped)) {
|
||||||
|
t.Fatalf("count: got %d, want %d", r.Count(), len(deduped))
|
||||||
|
}
|
||||||
|
|
||||||
|
for i, expected := range deduped {
|
||||||
|
got, ok := r.Next()
|
||||||
|
if !ok {
|
||||||
|
t.Fatalf("unexpected EOF at index %d", i)
|
||||||
|
}
|
||||||
|
if got != expected {
|
||||||
|
t.Fatalf("kmer %d: got %d, want %d", i, got, expected)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
151
pkg/obikmer/kdi_writer.go
Normal file
151
pkg/obikmer/kdi_writer.go
Normal file
@@ -0,0 +1,151 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"bufio"
|
||||||
|
"encoding/binary"
|
||||||
|
"os"
|
||||||
|
)
|
||||||
|
|
||||||
|
// KDI file magic bytes: "KDI\x01"
|
||||||
|
var kdiMagic = [4]byte{'K', 'D', 'I', 0x01}
|
||||||
|
|
||||||
|
// kdiHeaderSize is the size of the KDI header: magic(4) + count(8) = 12 bytes.
|
||||||
|
const kdiHeaderSize = 12
|
||||||
|
|
||||||
|
// KdiWriter writes a sorted sequence of uint64 k-mers to a .kdi file
|
||||||
|
// using delta-varint encoding.
|
||||||
|
//
|
||||||
|
// Format:
|
||||||
|
//
|
||||||
|
// [magic: 4 bytes "KDI\x01"]
|
||||||
|
// [count: uint64 LE] number of k-mers
|
||||||
|
// [first: uint64 LE] first k-mer (absolute value)
|
||||||
|
// [delta_1: varint] arr[1] - arr[0]
|
||||||
|
// [delta_2: varint] arr[2] - arr[1]
|
||||||
|
// ...
|
||||||
|
//
|
||||||
|
// The caller must write k-mers in strictly increasing order.
|
||||||
|
//
|
||||||
|
// On Close(), a companion .kdx sparse index file is written alongside
|
||||||
|
// the .kdi file for fast random access.
|
||||||
|
type KdiWriter struct {
|
||||||
|
w *bufio.Writer
|
||||||
|
file *os.File
|
||||||
|
count uint64
|
||||||
|
prev uint64
|
||||||
|
first bool
|
||||||
|
path string
|
||||||
|
bytesWritten uint64 // bytes written after header (data section offset)
|
||||||
|
indexEntries []kdxEntry // sparse index entries collected during writes
|
||||||
|
}
|
||||||
|
|
||||||
|
// NewKdiWriter creates a new KdiWriter writing to the given file path.
|
||||||
|
// The header (magic + count placeholder) is written immediately.
|
||||||
|
// Count is patched on Close().
|
||||||
|
func NewKdiWriter(path string) (*KdiWriter, error) {
|
||||||
|
f, err := os.Create(path)
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
w := bufio.NewWriterSize(f, 65536)
|
||||||
|
|
||||||
|
// Write magic
|
||||||
|
if _, err := w.Write(kdiMagic[:]); err != nil {
|
||||||
|
f.Close()
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
// Write placeholder for count (will be patched on Close)
|
||||||
|
var countBuf [8]byte
|
||||||
|
if _, err := w.Write(countBuf[:]); err != nil {
|
||||||
|
f.Close()
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
|
||||||
|
return &KdiWriter{
|
||||||
|
w: w,
|
||||||
|
file: f,
|
||||||
|
first: true,
|
||||||
|
path: path,
|
||||||
|
bytesWritten: 0,
|
||||||
|
indexEntries: make([]kdxEntry, 0, 256),
|
||||||
|
}, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// Write adds a k-mer to the file. K-mers must be written in strictly
|
||||||
|
// increasing order.
|
||||||
|
func (kw *KdiWriter) Write(kmer uint64) error {
|
||||||
|
if kw.first {
|
||||||
|
// Write first value as absolute uint64 LE
|
||||||
|
var buf [8]byte
|
||||||
|
binary.LittleEndian.PutUint64(buf[:], kmer)
|
||||||
|
if _, err := kw.w.Write(buf[:]); err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
kw.bytesWritten += 8
|
||||||
|
kw.prev = kmer
|
||||||
|
kw.first = false
|
||||||
|
} else {
|
||||||
|
delta := kmer - kw.prev
|
||||||
|
n, err := EncodeVarint(kw.w, delta)
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
kw.bytesWritten += uint64(n)
|
||||||
|
kw.prev = kmer
|
||||||
|
}
|
||||||
|
kw.count++
|
||||||
|
|
||||||
|
// Record sparse index entry every defaultKdxStride k-mers.
|
||||||
|
// The offset recorded is AFTER writing this k-mer, so it points to
|
||||||
|
// where the next k-mer's data will start. SeekTo uses this: it seeks
|
||||||
|
// to the recorded offset, sets prev = indexedKmer, and Next() reads
|
||||||
|
// the delta of the following k-mer.
|
||||||
|
if kw.count%defaultKdxStride == 0 {
|
||||||
|
kw.indexEntries = append(kw.indexEntries, kdxEntry{
|
||||||
|
kmer: kmer,
|
||||||
|
offset: kdiHeaderSize + kw.bytesWritten,
|
||||||
|
})
|
||||||
|
}
|
||||||
|
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// Count returns the number of k-mers written so far.
|
||||||
|
func (kw *KdiWriter) Count() uint64 {
|
||||||
|
return kw.count
|
||||||
|
}
|
||||||
|
|
||||||
|
// Close flushes buffered data, patches the count in the header,
|
||||||
|
// writes the companion .kdx index file, and closes the file.
|
||||||
|
func (kw *KdiWriter) Close() error {
|
||||||
|
if err := kw.w.Flush(); err != nil {
|
||||||
|
kw.file.Close()
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
|
||||||
|
// Patch count at offset 4 (after magic)
|
||||||
|
if _, err := kw.file.Seek(4, 0); err != nil {
|
||||||
|
kw.file.Close()
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
var countBuf [8]byte
|
||||||
|
binary.LittleEndian.PutUint64(countBuf[:], kw.count)
|
||||||
|
if _, err := kw.file.Write(countBuf[:]); err != nil {
|
||||||
|
kw.file.Close()
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
|
||||||
|
if err := kw.file.Close(); err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
|
||||||
|
// Write .kdx index file if there are entries to index
|
||||||
|
if len(kw.indexEntries) > 0 {
|
||||||
|
kdxPath := KdxPathForKdi(kw.path)
|
||||||
|
if err := WriteKdxIndex(kdxPath, defaultKdxStride, kw.indexEntries); err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return nil
|
||||||
|
}
|
||||||
170
pkg/obikmer/kdx.go
Normal file
170
pkg/obikmer/kdx.go
Normal file
@@ -0,0 +1,170 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"encoding/binary"
|
||||||
|
"fmt"
|
||||||
|
"io"
|
||||||
|
"os"
|
||||||
|
"sort"
|
||||||
|
"strings"
|
||||||
|
)
|
||||||
|
|
||||||
|
// KDX file magic bytes: "KDX\x01"
|
||||||
|
var kdxMagic = [4]byte{'K', 'D', 'X', 0x01}
|
||||||
|
|
||||||
|
// defaultKdxStride is the number of k-mers between consecutive index entries.
|
||||||
|
const defaultKdxStride = 4096
|
||||||
|
|
||||||
|
// kdxEntry is a single entry in the sparse index: the absolute k-mer value
|
||||||
|
// and the byte offset in the corresponding .kdi file where that k-mer is stored.
|
||||||
|
type kdxEntry struct {
|
||||||
|
kmer uint64
|
||||||
|
offset uint64 // absolute byte offset in .kdi file
|
||||||
|
}
|
||||||
|
|
||||||
|
// KdxIndex is a sparse, in-memory index for a .kdi file.
|
||||||
|
// It stores one entry every `stride` k-mers, enabling O(log N / stride)
|
||||||
|
// binary search followed by at most `stride` linear scan steps.
|
||||||
|
type KdxIndex struct {
|
||||||
|
stride int
|
||||||
|
entries []kdxEntry
|
||||||
|
}
|
||||||
|
|
||||||
|
// LoadKdxIndex reads a .kdx file into memory.
|
||||||
|
// Returns (nil, nil) if the file does not exist (graceful degradation).
|
||||||
|
func LoadKdxIndex(path string) (*KdxIndex, error) {
|
||||||
|
f, err := os.Open(path)
|
||||||
|
if err != nil {
|
||||||
|
if os.IsNotExist(err) {
|
||||||
|
return nil, nil
|
||||||
|
}
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
defer f.Close()
|
||||||
|
|
||||||
|
// Read magic
|
||||||
|
var magic [4]byte
|
||||||
|
if _, err := io.ReadFull(f, magic[:]); err != nil {
|
||||||
|
return nil, fmt.Errorf("kdx: read magic: %w", err)
|
||||||
|
}
|
||||||
|
if magic != kdxMagic {
|
||||||
|
return nil, fmt.Errorf("kdx: bad magic %v", magic)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Read stride (uint32 LE)
|
||||||
|
var buf4 [4]byte
|
||||||
|
if _, err := io.ReadFull(f, buf4[:]); err != nil {
|
||||||
|
return nil, fmt.Errorf("kdx: read stride: %w", err)
|
||||||
|
}
|
||||||
|
stride := int(binary.LittleEndian.Uint32(buf4[:]))
|
||||||
|
|
||||||
|
// Read count (uint32 LE)
|
||||||
|
if _, err := io.ReadFull(f, buf4[:]); err != nil {
|
||||||
|
return nil, fmt.Errorf("kdx: read count: %w", err)
|
||||||
|
}
|
||||||
|
count := int(binary.LittleEndian.Uint32(buf4[:]))
|
||||||
|
|
||||||
|
// Read entries
|
||||||
|
entries := make([]kdxEntry, count)
|
||||||
|
var buf16 [16]byte
|
||||||
|
for i := 0; i < count; i++ {
|
||||||
|
if _, err := io.ReadFull(f, buf16[:]); err != nil {
|
||||||
|
return nil, fmt.Errorf("kdx: read entry %d: %w", i, err)
|
||||||
|
}
|
||||||
|
entries[i] = kdxEntry{
|
||||||
|
kmer: binary.LittleEndian.Uint64(buf16[0:8]),
|
||||||
|
offset: binary.LittleEndian.Uint64(buf16[8:16]),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return &KdxIndex{
|
||||||
|
stride: stride,
|
||||||
|
entries: entries,
|
||||||
|
}, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// FindOffset locates the best starting point in the .kdi file to scan for
|
||||||
|
// the target k-mer. It returns:
|
||||||
|
// - offset: the byte offset in the .kdi file to seek to (positioned after
|
||||||
|
// the indexed k-mer, ready to read the next delta)
|
||||||
|
// - skipCount: the number of k-mers already consumed at that offset
|
||||||
|
// (to set the reader's internal counter)
|
||||||
|
// - ok: true if the index provides a useful starting point
|
||||||
|
//
|
||||||
|
// Index entries are recorded at k-mer count positions stride, 2*stride, etc.
|
||||||
|
// Entry i corresponds to the k-mer written at count = (i+1)*stride.
|
||||||
|
func (idx *KdxIndex) FindOffset(target uint64) (offset uint64, skipCount uint64, ok bool) {
|
||||||
|
if idx == nil || len(idx.entries) == 0 {
|
||||||
|
return 0, 0, false
|
||||||
|
}
|
||||||
|
|
||||||
|
// Binary search: find the largest entry with kmer <= target
|
||||||
|
i := sort.Search(len(idx.entries), func(i int) bool {
|
||||||
|
return idx.entries[i].kmer > target
|
||||||
|
})
|
||||||
|
// i is the first entry with kmer > target, so i-1 is the last with kmer <= target
|
||||||
|
if i == 0 {
|
||||||
|
// Target is before the first index entry.
|
||||||
|
// No useful jump point — caller should scan from the beginning.
|
||||||
|
return 0, 0, false
|
||||||
|
}
|
||||||
|
|
||||||
|
i-- // largest entry with kmer <= target
|
||||||
|
// Entry i was recorded after writing k-mer at count = (i+1)*stride
|
||||||
|
skipCount = uint64(i+1) * uint64(idx.stride)
|
||||||
|
return idx.entries[i].offset, skipCount, true
|
||||||
|
}
|
||||||
|
|
||||||
|
// Stride returns the stride of this index.
|
||||||
|
func (idx *KdxIndex) Stride() int {
|
||||||
|
return idx.stride
|
||||||
|
}
|
||||||
|
|
||||||
|
// Len returns the number of entries in this index.
|
||||||
|
func (idx *KdxIndex) Len() int {
|
||||||
|
return len(idx.entries)
|
||||||
|
}
|
||||||
|
|
||||||
|
// WriteKdxIndex writes a .kdx file from a slice of entries.
|
||||||
|
func WriteKdxIndex(path string, stride int, entries []kdxEntry) error {
|
||||||
|
f, err := os.Create(path)
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
defer f.Close()
|
||||||
|
|
||||||
|
// Magic
|
||||||
|
if _, err := f.Write(kdxMagic[:]); err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
|
||||||
|
// Stride (uint32 LE)
|
||||||
|
var buf4 [4]byte
|
||||||
|
binary.LittleEndian.PutUint32(buf4[:], uint32(stride))
|
||||||
|
if _, err := f.Write(buf4[:]); err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
|
||||||
|
// Count (uint32 LE)
|
||||||
|
binary.LittleEndian.PutUint32(buf4[:], uint32(len(entries)))
|
||||||
|
if _, err := f.Write(buf4[:]); err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
|
||||||
|
// Entries
|
||||||
|
var buf16 [16]byte
|
||||||
|
for _, e := range entries {
|
||||||
|
binary.LittleEndian.PutUint64(buf16[0:8], e.kmer)
|
||||||
|
binary.LittleEndian.PutUint64(buf16[8:16], e.offset)
|
||||||
|
if _, err := f.Write(buf16[:]); err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// KdxPathForKdi returns the .kdx path corresponding to a .kdi path.
|
||||||
|
func KdxPathForKdi(kdiPath string) string {
|
||||||
|
return strings.TrimSuffix(kdiPath, ".kdi") + ".kdx"
|
||||||
|
}
|
||||||
256
pkg/obikmer/kmer_match.go
Normal file
256
pkg/obikmer/kmer_match.go
Normal file
@@ -0,0 +1,256 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"cmp"
|
||||||
|
"slices"
|
||||||
|
"sync"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
)
|
||||||
|
|
||||||
|
// QueryEntry represents a canonical k-mer to look up, together with
|
||||||
|
// metadata to trace the result back to the originating sequence and position.
|
||||||
|
type QueryEntry struct {
|
||||||
|
Kmer uint64 // canonical k-mer value
|
||||||
|
SeqIdx int // index within the batch
|
||||||
|
Pos int // 1-based position in the sequence
|
||||||
|
}
|
||||||
|
|
||||||
|
// MatchResult holds matched positions for each sequence in a batch.
|
||||||
|
// results[i] contains the sorted matched positions for sequence i.
|
||||||
|
type MatchResult [][]int
|
||||||
|
|
||||||
|
// PreparedQueries holds pre-computed query buckets along with the number
|
||||||
|
// of sequences they were built from. This is used by the accumulation
|
||||||
|
// pipeline to merge queries from multiple batches.
|
||||||
|
type PreparedQueries struct {
|
||||||
|
Buckets [][]QueryEntry // queries[partition], each sorted by Kmer
|
||||||
|
NSeqs int // number of sequences that produced these queries
|
||||||
|
NKmers int // total number of k-mer entries across all partitions
|
||||||
|
}
|
||||||
|
|
||||||
|
// MergeQueries merges src into dst, offsetting all SeqIdx values in src
|
||||||
|
// by dst.NSeqs. Both dst and src must have the same number of partitions.
|
||||||
|
// After merging, src should not be reused.
|
||||||
|
//
|
||||||
|
// Each partition's entries are merged in sorted order (merge-sort of two
|
||||||
|
// already-sorted slices).
|
||||||
|
func MergeQueries(dst, src *PreparedQueries) {
|
||||||
|
for p := range dst.Buckets {
|
||||||
|
if len(src.Buckets[p]) == 0 {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
offset := dst.NSeqs
|
||||||
|
srcB := src.Buckets[p]
|
||||||
|
|
||||||
|
// Offset SeqIdx in src entries
|
||||||
|
for i := range srcB {
|
||||||
|
srcB[i].SeqIdx += offset
|
||||||
|
}
|
||||||
|
|
||||||
|
if len(dst.Buckets[p]) == 0 {
|
||||||
|
dst.Buckets[p] = srcB
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
// Merge two sorted slices
|
||||||
|
dstB := dst.Buckets[p]
|
||||||
|
merged := make([]QueryEntry, 0, len(dstB)+len(srcB))
|
||||||
|
i, j := 0, 0
|
||||||
|
for i < len(dstB) && j < len(srcB) {
|
||||||
|
if dstB[i].Kmer <= srcB[j].Kmer {
|
||||||
|
merged = append(merged, dstB[i])
|
||||||
|
i++
|
||||||
|
} else {
|
||||||
|
merged = append(merged, srcB[j])
|
||||||
|
j++
|
||||||
|
}
|
||||||
|
}
|
||||||
|
merged = append(merged, dstB[i:]...)
|
||||||
|
merged = append(merged, srcB[j:]...)
|
||||||
|
dst.Buckets[p] = merged
|
||||||
|
}
|
||||||
|
dst.NSeqs += src.NSeqs
|
||||||
|
dst.NKmers += src.NKmers
|
||||||
|
}
|
||||||
|
|
||||||
|
// PrepareQueries extracts all canonical k-mers from a batch of sequences
|
||||||
|
// and groups them by partition using super-kmer minimizers.
|
||||||
|
//
|
||||||
|
// Returns a PreparedQueries with sorted per-partition buckets.
|
||||||
|
func (ksg *KmerSetGroup) PrepareQueries(sequences []*obiseq.BioSequence) *PreparedQueries {
|
||||||
|
P := ksg.partitions
|
||||||
|
k := ksg.k
|
||||||
|
m := ksg.m
|
||||||
|
|
||||||
|
// Pre-allocate partition buckets
|
||||||
|
buckets := make([][]QueryEntry, P)
|
||||||
|
for i := range buckets {
|
||||||
|
buckets[i] = make([]QueryEntry, 0, 64)
|
||||||
|
}
|
||||||
|
|
||||||
|
totalKmers := 0
|
||||||
|
for seqIdx, seq := range sequences {
|
||||||
|
bseq := seq.Sequence()
|
||||||
|
if len(bseq) < k {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
// Iterate super-kmers to get minimizer → partition mapping
|
||||||
|
for sk := range IterSuperKmers(bseq, k, m) {
|
||||||
|
partition := int(sk.Minimizer % uint64(P))
|
||||||
|
|
||||||
|
// Iterate canonical k-mers within this super-kmer
|
||||||
|
skSeq := sk.Sequence
|
||||||
|
if len(skSeq) < k {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
localPos := 0
|
||||||
|
for kmer := range IterCanonicalKmers(skSeq, k) {
|
||||||
|
buckets[partition] = append(buckets[partition], QueryEntry{
|
||||||
|
Kmer: kmer,
|
||||||
|
SeqIdx: seqIdx,
|
||||||
|
Pos: sk.Start + localPos + 1,
|
||||||
|
})
|
||||||
|
localPos++
|
||||||
|
totalKmers++
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Sort each bucket by k-mer value for merge-scan
|
||||||
|
for p := range buckets {
|
||||||
|
slices.SortFunc(buckets[p], func(a, b QueryEntry) int {
|
||||||
|
return cmp.Compare(a.Kmer, b.Kmer)
|
||||||
|
})
|
||||||
|
}
|
||||||
|
|
||||||
|
return &PreparedQueries{
|
||||||
|
Buckets: buckets,
|
||||||
|
NSeqs: len(sequences),
|
||||||
|
NKmers: totalKmers,
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// MatchBatch looks up pre-sorted queries against one set of the index.
|
||||||
|
// Partitions are processed in parallel. For each partition, a merge-scan
|
||||||
|
// compares the sorted queries against the sorted KDI stream.
|
||||||
|
//
|
||||||
|
// Returns a MatchResult where result[i] contains sorted matched positions
|
||||||
|
// for sequence i.
|
||||||
|
func (ksg *KmerSetGroup) MatchBatch(setIndex int, pq *PreparedQueries) MatchResult {
|
||||||
|
P := ksg.partitions
|
||||||
|
|
||||||
|
// Pre-allocated per-sequence results and mutexes.
|
||||||
|
// Each partition goroutine appends to results[seqIdx] with mus[seqIdx] held.
|
||||||
|
// Contention is low: a sequence's k-mers span many partitions, but each
|
||||||
|
// partition processes its queries sequentially and the critical section is tiny.
|
||||||
|
results := make([][]int, pq.NSeqs)
|
||||||
|
mus := make([]sync.Mutex, pq.NSeqs)
|
||||||
|
|
||||||
|
var wg sync.WaitGroup
|
||||||
|
|
||||||
|
for p := 0; p < P; p++ {
|
||||||
|
if len(pq.Buckets[p]) == 0 {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
wg.Add(1)
|
||||||
|
go func(part int) {
|
||||||
|
defer wg.Done()
|
||||||
|
ksg.matchPartition(setIndex, part, pq.Buckets[part], results, mus)
|
||||||
|
}(p)
|
||||||
|
}
|
||||||
|
|
||||||
|
wg.Wait()
|
||||||
|
|
||||||
|
// Sort positions within each sequence
|
||||||
|
for i := range results {
|
||||||
|
if len(results[i]) > 1 {
|
||||||
|
slices.Sort(results[i])
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return MatchResult(results)
|
||||||
|
}
|
||||||
|
|
||||||
|
// matchPartition processes one partition: opens the KDI reader (with index),
|
||||||
|
// seeks to the first query, then merge-scans queries against the KDI stream.
|
||||||
|
func (ksg *KmerSetGroup) matchPartition(
|
||||||
|
setIndex int,
|
||||||
|
partIndex int,
|
||||||
|
queries []QueryEntry, // sorted by Kmer
|
||||||
|
results [][]int,
|
||||||
|
mus []sync.Mutex,
|
||||||
|
) {
|
||||||
|
r, err := NewKdiIndexedReader(ksg.partitionPath(setIndex, partIndex))
|
||||||
|
if err != nil {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
defer r.Close()
|
||||||
|
|
||||||
|
if r.Count() == 0 || len(queries) == 0 {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
|
||||||
|
// Seek to the first query's neighborhood
|
||||||
|
if err := r.SeekTo(queries[0].Kmer); err != nil {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
|
||||||
|
// Read first kmer from the stream after seek
|
||||||
|
currentKmer, ok := r.Next()
|
||||||
|
if !ok {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
|
||||||
|
qi := 0 // query index
|
||||||
|
|
||||||
|
for qi < len(queries) {
|
||||||
|
q := queries[qi]
|
||||||
|
|
||||||
|
// If the next query is far ahead, re-seek instead of linear scan.
|
||||||
|
// Only seek if we'd skip more k-mers than the index stride,
|
||||||
|
// otherwise linear scan through the buffer is faster than a syscall.
|
||||||
|
if r.index != nil && q.Kmer > currentKmer && r.Remaining() > uint64(r.index.stride) {
|
||||||
|
_, skipCount, found := r.index.FindOffset(q.Kmer)
|
||||||
|
if found && skipCount > r.read+uint64(r.index.stride) {
|
||||||
|
if err := r.SeekTo(q.Kmer); err == nil {
|
||||||
|
nextKmer, nextOk := r.Next()
|
||||||
|
if !nextOk {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
currentKmer = nextKmer
|
||||||
|
ok = true
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Advance KDI stream until >= query kmer
|
||||||
|
for currentKmer < q.Kmer {
|
||||||
|
currentKmer, ok = r.Next()
|
||||||
|
if !ok {
|
||||||
|
return // KDI exhausted
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if currentKmer == q.Kmer {
|
||||||
|
// Match! Record all queries with this same k-mer value
|
||||||
|
matchedKmer := q.Kmer
|
||||||
|
for qi < len(queries) && queries[qi].Kmer == matchedKmer {
|
||||||
|
idx := queries[qi].SeqIdx
|
||||||
|
mus[idx].Lock()
|
||||||
|
results[idx] = append(results[idx], queries[qi].Pos)
|
||||||
|
mus[idx].Unlock()
|
||||||
|
qi++
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
// currentKmer > q.Kmer: skip all queries with this kmer value
|
||||||
|
skippedKmer := q.Kmer
|
||||||
|
for qi < len(queries) && queries[qi].Kmer == skippedKmer {
|
||||||
|
qi++
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -1,217 +0,0 @@
|
|||||||
package obikmer
|
|
||||||
|
|
||||||
import (
|
|
||||||
"fmt"
|
|
||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
|
||||||
"github.com/RoaringBitmap/roaring/roaring64"
|
|
||||||
)
|
|
||||||
|
|
||||||
// KmerSet wraps a set of k-mers stored in a Roaring Bitmap
|
|
||||||
// Provides utility methods for manipulating k-mer sets
|
|
||||||
type KmerSet struct {
|
|
||||||
id string // Unique identifier of the KmerSet
|
|
||||||
k int // Size of k-mers (immutable)
|
|
||||||
bitmap *roaring64.Bitmap // Bitmap containing the k-mers
|
|
||||||
Metadata map[string]interface{} // User metadata (key=atomic value)
|
|
||||||
}
|
|
||||||
|
|
||||||
// NewKmerSet creates a new empty KmerSet
|
|
||||||
func NewKmerSet(k int) *KmerSet {
|
|
||||||
return &KmerSet{
|
|
||||||
k: k,
|
|
||||||
bitmap: roaring64.New(),
|
|
||||||
Metadata: make(map[string]interface{}),
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// NewKmerSetFromBitmap creates a KmerSet from an existing bitmap
|
|
||||||
func NewKmerSetFromBitmap(k int, bitmap *roaring64.Bitmap) *KmerSet {
|
|
||||||
return &KmerSet{
|
|
||||||
k: k,
|
|
||||||
bitmap: bitmap,
|
|
||||||
Metadata: make(map[string]interface{}),
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// K returns the size of k-mers (immutable)
|
|
||||||
func (ks *KmerSet) K() int {
|
|
||||||
return ks.k
|
|
||||||
}
|
|
||||||
|
|
||||||
// AddKmerCode adds an encoded k-mer to the set
|
|
||||||
func (ks *KmerSet) AddKmerCode(kmer uint64) {
|
|
||||||
ks.bitmap.Add(kmer)
|
|
||||||
}
|
|
||||||
|
|
||||||
// AddCanonicalKmerCode adds an encoded canonical k-mer to the set
|
|
||||||
func (ks *KmerSet) AddCanonicalKmerCode(kmer uint64) {
|
|
||||||
canonical := CanonicalKmer(kmer, ks.k)
|
|
||||||
ks.bitmap.Add(canonical)
|
|
||||||
}
|
|
||||||
|
|
||||||
// AddKmer adds a k-mer to the set by encoding the sequence
|
|
||||||
// The sequence must have exactly k nucleotides
|
|
||||||
// Zero-allocation: encodes directly without creating an intermediate slice
|
|
||||||
func (ks *KmerSet) AddKmer(seq []byte) {
|
|
||||||
kmer := EncodeKmer(seq, ks.k)
|
|
||||||
ks.bitmap.Add(kmer)
|
|
||||||
}
|
|
||||||
|
|
||||||
// AddCanonicalKmer adds a canonical k-mer to the set by encoding the sequence
|
|
||||||
// The sequence must have exactly k nucleotides
|
|
||||||
// Zero-allocation: encodes directly in canonical form without creating an intermediate slice
|
|
||||||
func (ks *KmerSet) AddCanonicalKmer(seq []byte) {
|
|
||||||
canonical := EncodeCanonicalKmer(seq, ks.k)
|
|
||||||
ks.bitmap.Add(canonical)
|
|
||||||
}
|
|
||||||
|
|
||||||
// AddSequence adds all k-mers from a sequence to the set
|
|
||||||
// Uses an iterator to avoid allocating an intermediate vector
|
|
||||||
func (ks *KmerSet) AddSequence(seq *obiseq.BioSequence) {
|
|
||||||
rawSeq := seq.Sequence()
|
|
||||||
for canonical := range IterCanonicalKmers(rawSeq, ks.k) {
|
|
||||||
ks.bitmap.Add(canonical)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// AddSequences adds all k-mers from multiple sequences in batch
|
|
||||||
func (ks *KmerSet) AddSequences(sequences *obiseq.BioSequenceSlice) {
|
|
||||||
for _, seq := range *sequences {
|
|
||||||
ks.AddSequence(seq)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Contains checks if a k-mer is in the set
|
|
||||||
func (ks *KmerSet) Contains(kmer uint64) bool {
|
|
||||||
return ks.bitmap.Contains(kmer)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Len returns the number of k-mers in the set
|
|
||||||
func (ks *KmerSet) Len() uint64 {
|
|
||||||
return ks.bitmap.GetCardinality()
|
|
||||||
}
|
|
||||||
|
|
||||||
// MemoryUsage returns memory usage in bytes
|
|
||||||
func (ks *KmerSet) MemoryUsage() uint64 {
|
|
||||||
return ks.bitmap.GetSizeInBytes()
|
|
||||||
}
|
|
||||||
|
|
||||||
// Clear empties the set
|
|
||||||
func (ks *KmerSet) Clear() {
|
|
||||||
ks.bitmap.Clear()
|
|
||||||
}
|
|
||||||
|
|
||||||
// Copy creates a copy of the set (consistent with BioSequence.Copy)
|
|
||||||
func (ks *KmerSet) Copy() *KmerSet {
|
|
||||||
// Copy metadata
|
|
||||||
metadata := make(map[string]interface{}, len(ks.Metadata))
|
|
||||||
for k, v := range ks.Metadata {
|
|
||||||
metadata[k] = v
|
|
||||||
}
|
|
||||||
|
|
||||||
return &KmerSet{
|
|
||||||
id: ks.id,
|
|
||||||
k: ks.k,
|
|
||||||
bitmap: ks.bitmap.Clone(),
|
|
||||||
Metadata: metadata,
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Id returns the identifier of the KmerSet (consistent with BioSequence.Id)
|
|
||||||
func (ks *KmerSet) Id() string {
|
|
||||||
return ks.id
|
|
||||||
}
|
|
||||||
|
|
||||||
// SetId sets the identifier of the KmerSet (consistent with BioSequence.SetId)
|
|
||||||
func (ks *KmerSet) SetId(id string) {
|
|
||||||
ks.id = id
|
|
||||||
}
|
|
||||||
|
|
||||||
// Union returns the union of this set with another
|
|
||||||
func (ks *KmerSet) Union(other *KmerSet) *KmerSet {
|
|
||||||
if ks.k != other.k {
|
|
||||||
panic(fmt.Sprintf("Cannot union KmerSets with different k values: %d vs %d", ks.k, other.k))
|
|
||||||
}
|
|
||||||
result := ks.bitmap.Clone()
|
|
||||||
result.Or(other.bitmap)
|
|
||||||
return NewKmerSetFromBitmap(ks.k, result)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Intersect returns the intersection of this set with another
|
|
||||||
func (ks *KmerSet) Intersect(other *KmerSet) *KmerSet {
|
|
||||||
if ks.k != other.k {
|
|
||||||
panic(fmt.Sprintf("Cannot intersect KmerSets with different k values: %d vs %d", ks.k, other.k))
|
|
||||||
}
|
|
||||||
result := ks.bitmap.Clone()
|
|
||||||
result.And(other.bitmap)
|
|
||||||
return NewKmerSetFromBitmap(ks.k, result)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Difference returns the difference of this set with another (this - other)
|
|
||||||
func (ks *KmerSet) Difference(other *KmerSet) *KmerSet {
|
|
||||||
if ks.k != other.k {
|
|
||||||
panic(fmt.Sprintf("Cannot subtract KmerSets with different k values: %d vs %d", ks.k, other.k))
|
|
||||||
}
|
|
||||||
result := ks.bitmap.Clone()
|
|
||||||
result.AndNot(other.bitmap)
|
|
||||||
return NewKmerSetFromBitmap(ks.k, result)
|
|
||||||
}
|
|
||||||
|
|
||||||
// JaccardDistance computes the Jaccard distance between two KmerSets.
|
|
||||||
// The Jaccard distance is defined as: 1 - (|A ∩ B| / |A ∪ B|)
|
|
||||||
// where A and B are the two sets.
|
|
||||||
//
|
|
||||||
// Returns:
|
|
||||||
// - 0.0 when sets are identical (distance = 0, similarity = 1)
|
|
||||||
// - 1.0 when sets are completely disjoint (distance = 1, similarity = 0)
|
|
||||||
// - 1.0 when both sets are empty (by convention)
|
|
||||||
//
|
|
||||||
// Time complexity: O(|A| + |B|) for Roaring Bitmap operations
|
|
||||||
// Space complexity: O(1) as operations are done in-place on temporary bitmaps
|
|
||||||
func (ks *KmerSet) JaccardDistance(other *KmerSet) float64 {
|
|
||||||
if ks.k != other.k {
|
|
||||||
panic(fmt.Sprintf("Cannot compute Jaccard distance between KmerSets with different k values: %d vs %d", ks.k, other.k))
|
|
||||||
}
|
|
||||||
|
|
||||||
// Compute intersection cardinality
|
|
||||||
intersectionCard := ks.bitmap.AndCardinality(other.bitmap)
|
|
||||||
|
|
||||||
// Compute union cardinality
|
|
||||||
unionCard := ks.bitmap.OrCardinality(other.bitmap)
|
|
||||||
|
|
||||||
// If union is empty, both sets are empty - return 1.0 by convention
|
|
||||||
if unionCard == 0 {
|
|
||||||
return 1.0
|
|
||||||
}
|
|
||||||
|
|
||||||
// Jaccard similarity = |A ∩ B| / |A ∪ B|
|
|
||||||
similarity := float64(intersectionCard) / float64(unionCard)
|
|
||||||
|
|
||||||
// Jaccard distance = 1 - similarity
|
|
||||||
return 1.0 - similarity
|
|
||||||
}
|
|
||||||
|
|
||||||
// JaccardSimilarity computes the Jaccard similarity coefficient between two KmerSets.
|
|
||||||
// The Jaccard similarity is defined as: |A ∩ B| / |A ∪ B|
|
|
||||||
//
|
|
||||||
// Returns:
|
|
||||||
// - 1.0 when sets are identical (maximum similarity)
|
|
||||||
// - 0.0 when sets are completely disjoint (no similarity)
|
|
||||||
// - 0.0 when both sets are empty (by convention)
|
|
||||||
//
|
|
||||||
// Time complexity: O(|A| + |B|) for Roaring Bitmap operations
|
|
||||||
// Space complexity: O(1) as operations are done in-place on temporary bitmaps
|
|
||||||
func (ks *KmerSet) JaccardSimilarity(other *KmerSet) float64 {
|
|
||||||
return 1.0 - ks.JaccardDistance(other)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Iterator returns an iterator over all k-mers in the set
|
|
||||||
func (ks *KmerSet) Iterator() roaring64.IntIterable64 {
|
|
||||||
return ks.bitmap.Iterator()
|
|
||||||
}
|
|
||||||
|
|
||||||
// Bitmap returns the underlying bitmap (for compatibility)
|
|
||||||
func (ks *KmerSet) Bitmap() *roaring64.Bitmap {
|
|
||||||
return ks.bitmap
|
|
||||||
}
|
|
||||||
@@ -1,362 +0,0 @@
|
|||||||
package obikmer
|
|
||||||
|
|
||||||
import (
|
|
||||||
"fmt"
|
|
||||||
"strconv"
|
|
||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
|
||||||
)
|
|
||||||
|
|
||||||
// ==================================
|
|
||||||
// KMER SET ATTRIBUTE API
|
|
||||||
// Mimic BioSequence attribute API from obiseq/attributes.go
|
|
||||||
// ==================================
|
|
||||||
|
|
||||||
// HasAttribute vérifie si une clé d'attribut existe
|
|
||||||
func (ks *KmerSet) HasAttribute(key string) bool {
|
|
||||||
_, ok := ks.Metadata[key]
|
|
||||||
return ok
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetAttribute récupère la valeur d'un attribut
|
|
||||||
// Cas particuliers: "id" utilise Id(), "k" utilise K()
|
|
||||||
func (ks *KmerSet) GetAttribute(key string) (interface{}, bool) {
|
|
||||||
switch key {
|
|
||||||
case "id":
|
|
||||||
return ks.Id(), true
|
|
||||||
case "k":
|
|
||||||
return ks.K(), true
|
|
||||||
default:
|
|
||||||
value, ok := ks.Metadata[key]
|
|
||||||
return value, ok
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// SetAttribute sets the value of an attribute
|
|
||||||
// Cas particuliers: "id" utilise SetId(), "k" est immutable (panique)
|
|
||||||
func (ks *KmerSet) SetAttribute(key string, value interface{}) {
|
|
||||||
switch key {
|
|
||||||
case "id":
|
|
||||||
if id, ok := value.(string); ok {
|
|
||||||
ks.SetId(id)
|
|
||||||
} else {
|
|
||||||
panic(fmt.Sprintf("id must be a string, got %T", value))
|
|
||||||
}
|
|
||||||
case "k":
|
|
||||||
panic("k is immutable and cannot be modified via SetAttribute")
|
|
||||||
default:
|
|
||||||
ks.Metadata[key] = value
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// DeleteAttribute supprime un attribut
|
|
||||||
func (ks *KmerSet) DeleteAttribute(key string) {
|
|
||||||
delete(ks.Metadata, key)
|
|
||||||
}
|
|
||||||
|
|
||||||
// RemoveAttribute supprime un attribut (alias de DeleteAttribute)
|
|
||||||
func (ks *KmerSet) RemoveAttribute(key string) {
|
|
||||||
ks.DeleteAttribute(key)
|
|
||||||
}
|
|
||||||
|
|
||||||
// RenameAttribute renomme un attribut
|
|
||||||
func (ks *KmerSet) RenameAttribute(newName, oldName string) {
|
|
||||||
if value, ok := ks.Metadata[oldName]; ok {
|
|
||||||
ks.Metadata[newName] = value
|
|
||||||
delete(ks.Metadata, oldName)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetIntAttribute récupère un attribut en tant qu'entier
|
|
||||||
func (ks *KmerSet) GetIntAttribute(key string) (int, bool) {
|
|
||||||
value, ok := ks.Metadata[key]
|
|
||||||
if !ok {
|
|
||||||
return 0, false
|
|
||||||
}
|
|
||||||
|
|
||||||
switch v := value.(type) {
|
|
||||||
case int:
|
|
||||||
return v, true
|
|
||||||
case int64:
|
|
||||||
return int(v), true
|
|
||||||
case float64:
|
|
||||||
return int(v), true
|
|
||||||
case string:
|
|
||||||
if i, err := strconv.Atoi(v); err == nil {
|
|
||||||
return i, true
|
|
||||||
}
|
|
||||||
}
|
|
||||||
return 0, false
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetFloatAttribute récupère un attribut en tant que float64
|
|
||||||
func (ks *KmerSet) GetFloatAttribute(key string) (float64, bool) {
|
|
||||||
value, ok := ks.Metadata[key]
|
|
||||||
if !ok {
|
|
||||||
return 0, false
|
|
||||||
}
|
|
||||||
|
|
||||||
switch v := value.(type) {
|
|
||||||
case float64:
|
|
||||||
return v, true
|
|
||||||
case float32:
|
|
||||||
return float64(v), true
|
|
||||||
case int:
|
|
||||||
return float64(v), true
|
|
||||||
case int64:
|
|
||||||
return float64(v), true
|
|
||||||
case string:
|
|
||||||
if f, err := strconv.ParseFloat(v, 64); err == nil {
|
|
||||||
return f, true
|
|
||||||
}
|
|
||||||
}
|
|
||||||
return 0, false
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetNumericAttribute récupère un attribut numérique (alias de GetFloatAttribute)
|
|
||||||
func (ks *KmerSet) GetNumericAttribute(key string) (float64, bool) {
|
|
||||||
return ks.GetFloatAttribute(key)
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetStringAttribute récupère un attribut en tant que chaîne
|
|
||||||
func (ks *KmerSet) GetStringAttribute(key string) (string, bool) {
|
|
||||||
value, ok := ks.Metadata[key]
|
|
||||||
if !ok {
|
|
||||||
return "", false
|
|
||||||
}
|
|
||||||
|
|
||||||
switch v := value.(type) {
|
|
||||||
case string:
|
|
||||||
return v, true
|
|
||||||
default:
|
|
||||||
return fmt.Sprintf("%v", v), true
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetBoolAttribute récupère un attribut en tant que booléen
|
|
||||||
func (ks *KmerSet) GetBoolAttribute(key string) (bool, bool) {
|
|
||||||
value, ok := ks.Metadata[key]
|
|
||||||
if !ok {
|
|
||||||
return false, false
|
|
||||||
}
|
|
||||||
|
|
||||||
switch v := value.(type) {
|
|
||||||
case bool:
|
|
||||||
return v, true
|
|
||||||
case int:
|
|
||||||
return v != 0, true
|
|
||||||
case string:
|
|
||||||
if b, err := strconv.ParseBool(v); err == nil {
|
|
||||||
return b, true
|
|
||||||
}
|
|
||||||
}
|
|
||||||
return false, false
|
|
||||||
}
|
|
||||||
|
|
||||||
// AttributeKeys returns the set of attribute keys
|
|
||||||
func (ks *KmerSet) AttributeKeys() obiutils.Set[string] {
|
|
||||||
keys := obiutils.MakeSet[string]()
|
|
||||||
for key := range ks.Metadata {
|
|
||||||
keys.Add(key)
|
|
||||||
}
|
|
||||||
return keys
|
|
||||||
}
|
|
||||||
|
|
||||||
// Keys returns the set of attribute keys (alias of AttributeKeys)
|
|
||||||
func (ks *KmerSet) Keys() obiutils.Set[string] {
|
|
||||||
return ks.AttributeKeys()
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==================================
|
|
||||||
// KMER SET GROUP ATTRIBUTE API
|
|
||||||
// Métadonnées du groupe + accès via Get() pour les sets individuels
|
|
||||||
// ==================================
|
|
||||||
|
|
||||||
// HasAttribute vérifie si une clé d'attribut existe pour le groupe
|
|
||||||
func (ksg *KmerSetGroup) HasAttribute(key string) bool {
|
|
||||||
_, ok := ksg.Metadata[key]
|
|
||||||
return ok
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetAttribute récupère la valeur d'un attribut du groupe
|
|
||||||
// Cas particuliers: "id" utilise Id(), "k" utilise K()
|
|
||||||
func (ksg *KmerSetGroup) GetAttribute(key string) (interface{}, bool) {
|
|
||||||
switch key {
|
|
||||||
case "id":
|
|
||||||
return ksg.Id(), true
|
|
||||||
case "k":
|
|
||||||
return ksg.K(), true
|
|
||||||
default:
|
|
||||||
value, ok := ksg.Metadata[key]
|
|
||||||
return value, ok
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// SetAttribute sets the value of an attribute du groupe
|
|
||||||
// Cas particuliers: "id" utilise SetId(), "k" est immutable (panique)
|
|
||||||
func (ksg *KmerSetGroup) SetAttribute(key string, value interface{}) {
|
|
||||||
switch key {
|
|
||||||
case "id":
|
|
||||||
if id, ok := value.(string); ok {
|
|
||||||
ksg.SetId(id)
|
|
||||||
} else {
|
|
||||||
panic(fmt.Sprintf("id must be a string, got %T", value))
|
|
||||||
}
|
|
||||||
case "k":
|
|
||||||
panic("k is immutable and cannot be modified via SetAttribute")
|
|
||||||
default:
|
|
||||||
ksg.Metadata[key] = value
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// DeleteAttribute supprime un attribut du groupe
|
|
||||||
func (ksg *KmerSetGroup) DeleteAttribute(key string) {
|
|
||||||
delete(ksg.Metadata, key)
|
|
||||||
}
|
|
||||||
|
|
||||||
// RemoveAttribute supprime un attribut du groupe (alias)
|
|
||||||
func (ksg *KmerSetGroup) RemoveAttribute(key string) {
|
|
||||||
ksg.DeleteAttribute(key)
|
|
||||||
}
|
|
||||||
|
|
||||||
// RenameAttribute renomme un attribut du groupe
|
|
||||||
func (ksg *KmerSetGroup) RenameAttribute(newName, oldName string) {
|
|
||||||
if value, ok := ksg.Metadata[oldName]; ok {
|
|
||||||
ksg.Metadata[newName] = value
|
|
||||||
delete(ksg.Metadata, oldName)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetIntAttribute récupère un attribut entier du groupe
|
|
||||||
func (ksg *KmerSetGroup) GetIntAttribute(key string) (int, bool) {
|
|
||||||
value, ok := ksg.GetAttribute(key)
|
|
||||||
if !ok {
|
|
||||||
return 0, false
|
|
||||||
}
|
|
||||||
|
|
||||||
switch v := value.(type) {
|
|
||||||
case int:
|
|
||||||
return v, true
|
|
||||||
case int64:
|
|
||||||
return int(v), true
|
|
||||||
case float64:
|
|
||||||
return int(v), true
|
|
||||||
case string:
|
|
||||||
if i, err := strconv.Atoi(v); err == nil {
|
|
||||||
return i, true
|
|
||||||
}
|
|
||||||
}
|
|
||||||
return 0, false
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetFloatAttribute récupère un attribut float64 du groupe
|
|
||||||
func (ksg *KmerSetGroup) GetFloatAttribute(key string) (float64, bool) {
|
|
||||||
value, ok := ksg.GetAttribute(key)
|
|
||||||
if !ok {
|
|
||||||
return 0, false
|
|
||||||
}
|
|
||||||
|
|
||||||
switch v := value.(type) {
|
|
||||||
case float64:
|
|
||||||
return v, true
|
|
||||||
case float32:
|
|
||||||
return float64(v), true
|
|
||||||
case int:
|
|
||||||
return float64(v), true
|
|
||||||
case int64:
|
|
||||||
return float64(v), true
|
|
||||||
case string:
|
|
||||||
if f, err := strconv.ParseFloat(v, 64); err == nil {
|
|
||||||
return f, true
|
|
||||||
}
|
|
||||||
}
|
|
||||||
return 0, false
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetNumericAttribute récupère un attribut numérique du groupe
|
|
||||||
func (ksg *KmerSetGroup) GetNumericAttribute(key string) (float64, bool) {
|
|
||||||
return ksg.GetFloatAttribute(key)
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetStringAttribute récupère un attribut chaîne du groupe
|
|
||||||
func (ksg *KmerSetGroup) GetStringAttribute(key string) (string, bool) {
|
|
||||||
value, ok := ksg.GetAttribute(key)
|
|
||||||
if !ok {
|
|
||||||
return "", false
|
|
||||||
}
|
|
||||||
|
|
||||||
switch v := value.(type) {
|
|
||||||
case string:
|
|
||||||
return v, true
|
|
||||||
default:
|
|
||||||
return fmt.Sprintf("%v", v), true
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// GetBoolAttribute récupère un attribut booléen du groupe
|
|
||||||
func (ksg *KmerSetGroup) GetBoolAttribute(key string) (bool, bool) {
|
|
||||||
value, ok := ksg.GetAttribute(key)
|
|
||||||
if !ok {
|
|
||||||
return false, false
|
|
||||||
}
|
|
||||||
|
|
||||||
switch v := value.(type) {
|
|
||||||
case bool:
|
|
||||||
return v, true
|
|
||||||
case int:
|
|
||||||
return v != 0, true
|
|
||||||
case string:
|
|
||||||
if b, err := strconv.ParseBool(v); err == nil {
|
|
||||||
return b, true
|
|
||||||
}
|
|
||||||
}
|
|
||||||
return false, false
|
|
||||||
}
|
|
||||||
|
|
||||||
// AttributeKeys returns the set of attribute keys du groupe
|
|
||||||
func (ksg *KmerSetGroup) AttributeKeys() obiutils.Set[string] {
|
|
||||||
keys := obiutils.MakeSet[string]()
|
|
||||||
for key := range ksg.Metadata {
|
|
||||||
keys.Add(key)
|
|
||||||
}
|
|
||||||
return keys
|
|
||||||
}
|
|
||||||
|
|
||||||
// Keys returns the set of group attribute keys (alias)
|
|
||||||
func (ksg *KmerSetGroup) Keys() obiutils.Set[string] {
|
|
||||||
return ksg.AttributeKeys()
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==================================
|
|
||||||
// MÉTHODES POUR ACCÉDER AUX ATTRIBUTS DES SETS INDIVIDUELS VIA Get()
|
|
||||||
// Architecture zero-copy: ksg.Get(i).SetAttribute(...)
|
|
||||||
// ==================================
|
|
||||||
|
|
||||||
// Exemple d'utilisation:
|
|
||||||
// Pour accéder aux métadonnées d'un KmerSet individuel dans un groupe:
|
|
||||||
// ks := ksg.Get(0)
|
|
||||||
// ks.SetAttribute("level", 1)
|
|
||||||
// hasLevel := ks.HasAttribute("level")
|
|
||||||
//
|
|
||||||
// Pour les métadonnées du groupe:
|
|
||||||
// ksg.SetAttribute("name", "FrequencyFilter")
|
|
||||||
// name, ok := ksg.GetStringAttribute("name")
|
|
||||||
|
|
||||||
// AllAttributeKeys returns all unique attribute keys of the group AND all its sets
|
|
||||||
func (ksg *KmerSetGroup) AllAttributeKeys() obiutils.Set[string] {
|
|
||||||
keys := obiutils.MakeSet[string]()
|
|
||||||
|
|
||||||
// Ajouter les clés du groupe
|
|
||||||
for key := range ksg.Metadata {
|
|
||||||
keys.Add(key)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Ajouter les clés de chaque set
|
|
||||||
for _, ks := range ksg.sets {
|
|
||||||
for key := range ks.Metadata {
|
|
||||||
keys.Add(key)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
return keys
|
|
||||||
}
|
|
||||||
702
pkg/obikmer/kmer_set_builder.go
Normal file
702
pkg/obikmer/kmer_set_builder.go
Normal file
@@ -0,0 +1,702 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"fmt"
|
||||||
|
"math"
|
||||||
|
"os"
|
||||||
|
"path/filepath"
|
||||||
|
"slices"
|
||||||
|
"sync"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
"github.com/schollz/progressbar/v3"
|
||||||
|
)
|
||||||
|
|
||||||
|
// BuilderOption is a functional option for KmerSetGroupBuilder.
|
||||||
|
type BuilderOption func(*builderConfig)
|
||||||
|
|
||||||
|
type builderConfig struct {
|
||||||
|
minFreq int // 0 means no frequency filtering (simple dedup)
|
||||||
|
maxFreq int // 0 means no upper bound
|
||||||
|
saveFreqTopN int // >0 means save the N most frequent k-mers per set to CSV
|
||||||
|
entropyThreshold float64 // >0 means filter k-mers with entropy <= threshold
|
||||||
|
entropyLevelMax int // max sub-word size for entropy (typically 6)
|
||||||
|
}
|
||||||
|
|
||||||
|
// WithMinFrequency activates frequency filtering mode.
|
||||||
|
// Only k-mers seen >= minFreq times are kept in the final index.
|
||||||
|
func WithMinFrequency(minFreq int) BuilderOption {
|
||||||
|
return func(c *builderConfig) {
|
||||||
|
c.minFreq = minFreq
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// WithMaxFrequency sets the upper frequency bound.
|
||||||
|
// Only k-mers seen <= maxFreq times are kept in the final index.
|
||||||
|
func WithMaxFrequency(maxFreq int) BuilderOption {
|
||||||
|
return func(c *builderConfig) {
|
||||||
|
c.maxFreq = maxFreq
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// WithSaveFreqKmers saves the N most frequent k-mers per set to a CSV file
|
||||||
|
// (top_kmers.csv in each set directory).
|
||||||
|
func WithSaveFreqKmers(n int) BuilderOption {
|
||||||
|
return func(c *builderConfig) {
|
||||||
|
c.saveFreqTopN = n
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// WithEntropyFilter activates entropy-based low-complexity filtering.
|
||||||
|
// K-mers with entropy <= threshold are discarded during finalization.
|
||||||
|
// levelMax is the maximum sub-word size for entropy computation (typically 6).
|
||||||
|
func WithEntropyFilter(threshold float64, levelMax int) BuilderOption {
|
||||||
|
return func(c *builderConfig) {
|
||||||
|
c.entropyThreshold = threshold
|
||||||
|
c.entropyLevelMax = levelMax
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// KmerSetGroupBuilder constructs a KmerSetGroup on disk.
|
||||||
|
// During construction, super-kmers are written to temporary .skm files
|
||||||
|
// partitioned by minimizer. On Close(), each partition is finalized
|
||||||
|
// (sort, dedup, optional frequency filter) into .kdi files.
|
||||||
|
type KmerSetGroupBuilder struct {
|
||||||
|
dir string
|
||||||
|
k int
|
||||||
|
m int
|
||||||
|
n int // number of NEW sets being built
|
||||||
|
P int // number of partitions
|
||||||
|
startIndex int // first set index (0 for new groups, existingN for appends)
|
||||||
|
config builderConfig
|
||||||
|
existing *KmerSetGroup // non-nil when appending to existing group
|
||||||
|
writers [][]*SkmWriter // [setIndex][partIndex] (local index 0..n-1)
|
||||||
|
mu [][]sync.Mutex // per-writer mutex for concurrent access
|
||||||
|
closed bool
|
||||||
|
}
|
||||||
|
|
||||||
|
// NewKmerSetGroupBuilder creates a builder for a new KmerSetGroup.
|
||||||
|
//
|
||||||
|
// Parameters:
|
||||||
|
// - directory: destination directory (created if necessary)
|
||||||
|
// - k: k-mer size (1-31)
|
||||||
|
// - m: minimizer size (-1 for auto = ceil(k/2.5))
|
||||||
|
// - n: number of sets in the group
|
||||||
|
// - P: number of partitions (-1 for auto)
|
||||||
|
// - options: optional builder options (e.g. WithMinFrequency)
|
||||||
|
func NewKmerSetGroupBuilder(directory string, k, m, n, P int,
|
||||||
|
options ...BuilderOption) (*KmerSetGroupBuilder, error) {
|
||||||
|
|
||||||
|
if k < 2 || k > 31 {
|
||||||
|
return nil, fmt.Errorf("obikmer: k must be between 2 and 31, got %d", k)
|
||||||
|
}
|
||||||
|
if n < 1 {
|
||||||
|
return nil, fmt.Errorf("obikmer: n must be >= 1, got %d", n)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Auto minimizer size
|
||||||
|
if m < 0 {
|
||||||
|
m = int(math.Ceil(float64(k) / 2.5))
|
||||||
|
}
|
||||||
|
if m < 1 {
|
||||||
|
m = 1
|
||||||
|
}
|
||||||
|
if m >= k {
|
||||||
|
m = k - 1
|
||||||
|
}
|
||||||
|
|
||||||
|
// Auto partition count
|
||||||
|
if P < 0 {
|
||||||
|
// Use 4^m as the maximum, capped at a reasonable value
|
||||||
|
maxP := 1 << (2 * m) // 4^m
|
||||||
|
P = maxP
|
||||||
|
if P > 4096 {
|
||||||
|
P = 4096
|
||||||
|
}
|
||||||
|
if P < 64 {
|
||||||
|
P = 64
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Apply options
|
||||||
|
var config builderConfig
|
||||||
|
for _, opt := range options {
|
||||||
|
opt(&config)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Create build directory structure
|
||||||
|
buildDir := filepath.Join(directory, ".build")
|
||||||
|
for s := 0; s < n; s++ {
|
||||||
|
setDir := filepath.Join(buildDir, fmt.Sprintf("set_%d", s))
|
||||||
|
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: create build dir: %w", err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Create SKM writers
|
||||||
|
writers := make([][]*SkmWriter, n)
|
||||||
|
mutexes := make([][]sync.Mutex, n)
|
||||||
|
for s := 0; s < n; s++ {
|
||||||
|
writers[s] = make([]*SkmWriter, P)
|
||||||
|
mutexes[s] = make([]sync.Mutex, P)
|
||||||
|
for p := 0; p < P; p++ {
|
||||||
|
path := filepath.Join(buildDir, fmt.Sprintf("set_%d", s),
|
||||||
|
fmt.Sprintf("part_%04d.skm", p))
|
||||||
|
w, err := NewSkmWriter(path)
|
||||||
|
if err != nil {
|
||||||
|
// Close already-created writers
|
||||||
|
for ss := 0; ss <= s; ss++ {
|
||||||
|
for pp := 0; pp < P; pp++ {
|
||||||
|
if writers[ss][pp] != nil {
|
||||||
|
writers[ss][pp].Close()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return nil, fmt.Errorf("obikmer: create skm writer: %w", err)
|
||||||
|
}
|
||||||
|
writers[s][p] = w
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return &KmerSetGroupBuilder{
|
||||||
|
dir: directory,
|
||||||
|
k: k,
|
||||||
|
m: m,
|
||||||
|
n: n,
|
||||||
|
P: P,
|
||||||
|
startIndex: 0,
|
||||||
|
config: config,
|
||||||
|
writers: writers,
|
||||||
|
mu: mutexes,
|
||||||
|
}, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// AppendKmerSetGroupBuilder opens an existing KmerSetGroup and creates
|
||||||
|
// a builder that adds n new sets starting from the existing set count.
|
||||||
|
// The k, m, and partitions are inherited from the existing group.
|
||||||
|
func AppendKmerSetGroupBuilder(directory string, n int, options ...BuilderOption) (*KmerSetGroupBuilder, error) {
|
||||||
|
existing, err := OpenKmerSetGroup(directory)
|
||||||
|
if err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: open existing group: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
if n < 1 {
|
||||||
|
return nil, fmt.Errorf("obikmer: n must be >= 1, got %d", n)
|
||||||
|
}
|
||||||
|
|
||||||
|
k := existing.K()
|
||||||
|
m := existing.M()
|
||||||
|
P := existing.Partitions()
|
||||||
|
startIndex := existing.Size()
|
||||||
|
|
||||||
|
var config builderConfig
|
||||||
|
for _, opt := range options {
|
||||||
|
opt(&config)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Create build directory structure for new sets
|
||||||
|
buildDir := filepath.Join(directory, ".build")
|
||||||
|
for s := 0; s < n; s++ {
|
||||||
|
setDir := filepath.Join(buildDir, fmt.Sprintf("set_%d", s))
|
||||||
|
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: create build dir: %w", err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Create SKM writers for new sets
|
||||||
|
writers := make([][]*SkmWriter, n)
|
||||||
|
mutexes := make([][]sync.Mutex, n)
|
||||||
|
for s := 0; s < n; s++ {
|
||||||
|
writers[s] = make([]*SkmWriter, P)
|
||||||
|
mutexes[s] = make([]sync.Mutex, P)
|
||||||
|
for p := 0; p < P; p++ {
|
||||||
|
path := filepath.Join(buildDir, fmt.Sprintf("set_%d", s),
|
||||||
|
fmt.Sprintf("part_%04d.skm", p))
|
||||||
|
w, err := NewSkmWriter(path)
|
||||||
|
if err != nil {
|
||||||
|
for ss := 0; ss <= s; ss++ {
|
||||||
|
for pp := 0; pp < P; pp++ {
|
||||||
|
if writers[ss][pp] != nil {
|
||||||
|
writers[ss][pp].Close()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return nil, fmt.Errorf("obikmer: create skm writer: %w", err)
|
||||||
|
}
|
||||||
|
writers[s][p] = w
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return &KmerSetGroupBuilder{
|
||||||
|
dir: directory,
|
||||||
|
k: k,
|
||||||
|
m: m,
|
||||||
|
n: n,
|
||||||
|
P: P,
|
||||||
|
startIndex: startIndex,
|
||||||
|
config: config,
|
||||||
|
existing: existing,
|
||||||
|
writers: writers,
|
||||||
|
mu: mutexes,
|
||||||
|
}, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// StartIndex returns the first global set index for the new sets being built.
|
||||||
|
// For new groups this is 0; for appends it is the existing group's Size().
|
||||||
|
func (b *KmerSetGroupBuilder) StartIndex() int {
|
||||||
|
return b.startIndex
|
||||||
|
}
|
||||||
|
|
||||||
|
// AddSequence extracts super-kmers from a sequence and writes them
|
||||||
|
// to the appropriate partition files for the given set.
|
||||||
|
func (b *KmerSetGroupBuilder) AddSequence(setIndex int, seq *obiseq.BioSequence) {
|
||||||
|
if setIndex < 0 || setIndex >= b.n {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
rawSeq := seq.Sequence()
|
||||||
|
if len(rawSeq) < b.k {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
for sk := range IterSuperKmers(rawSeq, b.k, b.m) {
|
||||||
|
part := int(sk.Minimizer % uint64(b.P))
|
||||||
|
b.mu[setIndex][part].Lock()
|
||||||
|
b.writers[setIndex][part].Write(sk)
|
||||||
|
b.mu[setIndex][part].Unlock()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// AddSuperKmer writes a single super-kmer to the appropriate partition.
|
||||||
|
func (b *KmerSetGroupBuilder) AddSuperKmer(setIndex int, sk SuperKmer) {
|
||||||
|
if setIndex < 0 || setIndex >= b.n {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
part := int(sk.Minimizer % uint64(b.P))
|
||||||
|
b.mu[setIndex][part].Lock()
|
||||||
|
b.writers[setIndex][part].Write(sk)
|
||||||
|
b.mu[setIndex][part].Unlock()
|
||||||
|
}
|
||||||
|
|
||||||
|
// Close finalizes the construction:
|
||||||
|
// 1. Flush and close all SKM writers
|
||||||
|
// 2. For each partition of each set (in parallel):
|
||||||
|
// - Load super-kmers from .skm
|
||||||
|
// - Extract canonical k-mers
|
||||||
|
// - Sort and deduplicate (count if frequency filter)
|
||||||
|
// - Write .kdi file
|
||||||
|
// 3. Write metadata.toml
|
||||||
|
// 4. Remove .build/ directory
|
||||||
|
//
|
||||||
|
// Returns the finalized KmerSetGroup in read-only mode.
|
||||||
|
func (b *KmerSetGroupBuilder) Close() (*KmerSetGroup, error) {
|
||||||
|
if b.closed {
|
||||||
|
return nil, fmt.Errorf("obikmer: builder already closed")
|
||||||
|
}
|
||||||
|
b.closed = true
|
||||||
|
|
||||||
|
// 1. Close all SKM writers
|
||||||
|
for s := 0; s < b.n; s++ {
|
||||||
|
for p := 0; p < b.P; p++ {
|
||||||
|
if err := b.writers[s][p].Close(); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: close skm writer set=%d part=%d: %w", s, p, err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// 2. Create output directory structure for new sets
|
||||||
|
for s := 0; s < b.n; s++ {
|
||||||
|
globalIdx := b.startIndex + s
|
||||||
|
setDir := filepath.Join(b.dir, fmt.Sprintf("set_%d", globalIdx))
|
||||||
|
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: create set dir: %w", err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// =====================================================================
|
||||||
|
// 2-stage pipeline: readers (pure I/O) → workers (CPU + write)
|
||||||
|
//
|
||||||
|
// - nReaders goroutines read .skm files (pure I/O, fast)
|
||||||
|
// - nWorkers goroutines extract k-mers, sort, dedup, filter, write .kdi
|
||||||
|
//
|
||||||
|
// One unbuffered channel between stages. Readers are truly I/O-bound
|
||||||
|
// (small files, buffered reads), workers are CPU-bound and stay busy.
|
||||||
|
// =====================================================================
|
||||||
|
totalJobs := b.n * b.P
|
||||||
|
|
||||||
|
counts := make([][]uint64, b.n)
|
||||||
|
spectra := make([][]map[int]uint64, b.n)
|
||||||
|
var topKmers [][]*TopNKmers
|
||||||
|
for s := 0; s < b.n; s++ {
|
||||||
|
counts[s] = make([]uint64, b.P)
|
||||||
|
spectra[s] = make([]map[int]uint64, b.P)
|
||||||
|
}
|
||||||
|
if b.config.saveFreqTopN > 0 {
|
||||||
|
topKmers = make([][]*TopNKmers, b.n)
|
||||||
|
for s := 0; s < b.n; s++ {
|
||||||
|
topKmers[s] = make([]*TopNKmers, b.P)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
nCPU := obidefault.ParallelWorkers()
|
||||||
|
|
||||||
|
// Stage sizing
|
||||||
|
nWorkers := nCPU // CPU-bound: one per core
|
||||||
|
nReaders := nCPU / 4 // pure I/O: few goroutines suffice
|
||||||
|
if nReaders < 2 {
|
||||||
|
nReaders = 2
|
||||||
|
}
|
||||||
|
if nReaders > 4 {
|
||||||
|
nReaders = 4
|
||||||
|
}
|
||||||
|
if nWorkers > totalJobs {
|
||||||
|
nWorkers = totalJobs
|
||||||
|
}
|
||||||
|
if nReaders > totalJobs {
|
||||||
|
nReaders = totalJobs
|
||||||
|
}
|
||||||
|
|
||||||
|
var bar *progressbar.ProgressBar
|
||||||
|
if obidefault.ProgressBar() {
|
||||||
|
pbopt := []progressbar.Option{
|
||||||
|
progressbar.OptionSetWriter(os.Stderr),
|
||||||
|
progressbar.OptionSetWidth(15),
|
||||||
|
progressbar.OptionShowCount(),
|
||||||
|
progressbar.OptionShowIts(),
|
||||||
|
progressbar.OptionSetPredictTime(true),
|
||||||
|
progressbar.OptionSetDescription("[Finalizing partitions]"),
|
||||||
|
}
|
||||||
|
bar = progressbar.NewOptions(totalJobs, pbopt...)
|
||||||
|
}
|
||||||
|
|
||||||
|
// --- Channel types ---
|
||||||
|
type partitionData struct {
|
||||||
|
setIdx int
|
||||||
|
partIdx int
|
||||||
|
skmers []SuperKmer // raw super-kmers from I/O stage
|
||||||
|
}
|
||||||
|
|
||||||
|
type readJob struct {
|
||||||
|
setIdx int
|
||||||
|
partIdx int
|
||||||
|
}
|
||||||
|
|
||||||
|
dataCh := make(chan *partitionData) // unbuffered
|
||||||
|
readJobs := make(chan readJob, totalJobs)
|
||||||
|
|
||||||
|
var errMu sync.Mutex
|
||||||
|
var firstErr error
|
||||||
|
|
||||||
|
// Fill job queue (buffered, all jobs pre-loaded)
|
||||||
|
for s := 0; s < b.n; s++ {
|
||||||
|
for p := 0; p < b.P; p++ {
|
||||||
|
readJobs <- readJob{s, p}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
close(readJobs)
|
||||||
|
|
||||||
|
// --- Stage 1: Readers (pure I/O) ---
|
||||||
|
var readWg sync.WaitGroup
|
||||||
|
for w := 0; w < nReaders; w++ {
|
||||||
|
readWg.Add(1)
|
||||||
|
go func() {
|
||||||
|
defer readWg.Done()
|
||||||
|
for rj := range readJobs {
|
||||||
|
skmers, err := b.loadPartitionRaw(rj.setIdx, rj.partIdx)
|
||||||
|
if err != nil {
|
||||||
|
errMu.Lock()
|
||||||
|
if firstErr == nil {
|
||||||
|
firstErr = err
|
||||||
|
}
|
||||||
|
errMu.Unlock()
|
||||||
|
}
|
||||||
|
dataCh <- &partitionData{rj.setIdx, rj.partIdx, skmers}
|
||||||
|
}
|
||||||
|
}()
|
||||||
|
}
|
||||||
|
|
||||||
|
go func() {
|
||||||
|
readWg.Wait()
|
||||||
|
close(dataCh)
|
||||||
|
}()
|
||||||
|
|
||||||
|
// --- Stage 2: Workers (CPU: extract k-mers + sort/filter + write .kdi) ---
|
||||||
|
var workWg sync.WaitGroup
|
||||||
|
for w := 0; w < nWorkers; w++ {
|
||||||
|
workWg.Add(1)
|
||||||
|
go func() {
|
||||||
|
defer workWg.Done()
|
||||||
|
for pd := range dataCh {
|
||||||
|
// CPU: extract canonical k-mers from super-kmers
|
||||||
|
kmers := extractCanonicalKmers(pd.skmers, b.k)
|
||||||
|
pd.skmers = nil // allow GC of raw super-kmers
|
||||||
|
|
||||||
|
// CPU: sort, dedup, filter
|
||||||
|
filtered, spectrum, topN := b.sortFilterPartition(kmers)
|
||||||
|
kmers = nil // allow GC of unsorted data
|
||||||
|
|
||||||
|
// I/O: write .kdi file
|
||||||
|
globalIdx := b.startIndex + pd.setIdx
|
||||||
|
kdiPath := filepath.Join(b.dir,
|
||||||
|
fmt.Sprintf("set_%d", globalIdx),
|
||||||
|
fmt.Sprintf("part_%04d.kdi", pd.partIdx))
|
||||||
|
|
||||||
|
n, err := b.writePartitionKdi(kdiPath, filtered)
|
||||||
|
if err != nil {
|
||||||
|
errMu.Lock()
|
||||||
|
if firstErr == nil {
|
||||||
|
firstErr = err
|
||||||
|
}
|
||||||
|
errMu.Unlock()
|
||||||
|
}
|
||||||
|
counts[pd.setIdx][pd.partIdx] = n
|
||||||
|
spectra[pd.setIdx][pd.partIdx] = spectrum
|
||||||
|
if topKmers != nil {
|
||||||
|
topKmers[pd.setIdx][pd.partIdx] = topN
|
||||||
|
}
|
||||||
|
if bar != nil {
|
||||||
|
bar.Add(1)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}()
|
||||||
|
}
|
||||||
|
|
||||||
|
workWg.Wait()
|
||||||
|
|
||||||
|
if bar != nil {
|
||||||
|
fmt.Fprintln(os.Stderr)
|
||||||
|
}
|
||||||
|
|
||||||
|
if firstErr != nil {
|
||||||
|
return nil, firstErr
|
||||||
|
}
|
||||||
|
|
||||||
|
// Aggregate per-partition spectra into per-set spectra and write spectrum.bin
|
||||||
|
for s := 0; s < b.n; s++ {
|
||||||
|
globalIdx := b.startIndex + s
|
||||||
|
setSpectrum := make(map[int]uint64)
|
||||||
|
for p := 0; p < b.P; p++ {
|
||||||
|
if spectra[s][p] != nil {
|
||||||
|
MergeSpectraMaps(setSpectrum, spectra[s][p])
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if len(setSpectrum) > 0 {
|
||||||
|
specPath := filepath.Join(b.dir, fmt.Sprintf("set_%d", globalIdx), "spectrum.bin")
|
||||||
|
if err := WriteSpectrum(specPath, MapToSpectrum(setSpectrum)); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: write spectrum set=%d: %w", globalIdx, err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Aggregate per-partition top-N k-mers and write CSV
|
||||||
|
if topKmers != nil {
|
||||||
|
for s := 0; s < b.n; s++ {
|
||||||
|
globalIdx := b.startIndex + s
|
||||||
|
merged := NewTopNKmers(b.config.saveFreqTopN)
|
||||||
|
for p := 0; p < b.P; p++ {
|
||||||
|
merged.MergeTopN(topKmers[s][p])
|
||||||
|
}
|
||||||
|
results := merged.Results()
|
||||||
|
if len(results) > 0 {
|
||||||
|
csvPath := filepath.Join(b.dir, fmt.Sprintf("set_%d", globalIdx), "top_kmers.csv")
|
||||||
|
if err := WriteTopKmersCSV(csvPath, results, b.k); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: write top kmers set=%d: %w", globalIdx, err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// 3. Build KmerSetGroup and write metadata
|
||||||
|
newCounts := make([]uint64, b.n)
|
||||||
|
for s := 0; s < b.n; s++ {
|
||||||
|
for p := 0; p < b.P; p++ {
|
||||||
|
newCounts[s] += counts[s][p]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
var ksg *KmerSetGroup
|
||||||
|
|
||||||
|
if b.existing != nil {
|
||||||
|
// Append mode: extend existing group
|
||||||
|
ksg = b.existing
|
||||||
|
ksg.n += b.n
|
||||||
|
ksg.setsIDs = append(ksg.setsIDs, make([]string, b.n)...)
|
||||||
|
ksg.counts = append(ksg.counts, newCounts...)
|
||||||
|
newMeta := make([]map[string]interface{}, b.n)
|
||||||
|
for i := range newMeta {
|
||||||
|
newMeta[i] = make(map[string]interface{})
|
||||||
|
}
|
||||||
|
ksg.setsMetadata = append(ksg.setsMetadata, newMeta...)
|
||||||
|
} else {
|
||||||
|
// New group
|
||||||
|
setsIDs := make([]string, b.n)
|
||||||
|
setsMetadata := make([]map[string]interface{}, b.n)
|
||||||
|
for i := range setsMetadata {
|
||||||
|
setsMetadata[i] = make(map[string]interface{})
|
||||||
|
}
|
||||||
|
ksg = &KmerSetGroup{
|
||||||
|
path: b.dir,
|
||||||
|
k: b.k,
|
||||||
|
m: b.m,
|
||||||
|
partitions: b.P,
|
||||||
|
n: b.n,
|
||||||
|
setsIDs: setsIDs,
|
||||||
|
counts: newCounts,
|
||||||
|
setsMetadata: setsMetadata,
|
||||||
|
Metadata: make(map[string]interface{}),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if err := ksg.saveMetadata(); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: write metadata: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// 4. Remove .build/ directory
|
||||||
|
buildDir := filepath.Join(b.dir, ".build")
|
||||||
|
os.RemoveAll(buildDir)
|
||||||
|
|
||||||
|
return ksg, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// loadPartitionRaw reads a .skm file and returns raw super-kmers.
|
||||||
|
// This is pure I/O — no k-mer extraction is done here.
|
||||||
|
// Returns nil (not an error) if the .skm file is empty or missing.
|
||||||
|
func (b *KmerSetGroupBuilder) loadPartitionRaw(setIdx, partIdx int) ([]SuperKmer, error) {
|
||||||
|
skmPath := filepath.Join(b.dir, ".build",
|
||||||
|
fmt.Sprintf("set_%d", setIdx),
|
||||||
|
fmt.Sprintf("part_%04d.skm", partIdx))
|
||||||
|
|
||||||
|
fi, err := os.Stat(skmPath)
|
||||||
|
if err != nil {
|
||||||
|
return nil, nil // empty partition, not an error
|
||||||
|
}
|
||||||
|
|
||||||
|
reader, err := NewSkmReader(skmPath)
|
||||||
|
if err != nil {
|
||||||
|
return nil, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// Estimate capacity from file size. Each super-kmer record is
|
||||||
|
// 2 bytes (length) + packed bases (~k/4 bytes), so roughly
|
||||||
|
// (2 + k/4) bytes per super-kmer on average.
|
||||||
|
avgRecordSize := 2 + b.k/4
|
||||||
|
if avgRecordSize < 4 {
|
||||||
|
avgRecordSize = 4
|
||||||
|
}
|
||||||
|
estCount := int(fi.Size()) / avgRecordSize
|
||||||
|
|
||||||
|
skmers := make([]SuperKmer, 0, estCount)
|
||||||
|
for {
|
||||||
|
sk, ok := reader.Next()
|
||||||
|
if !ok {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
skmers = append(skmers, sk)
|
||||||
|
}
|
||||||
|
reader.Close()
|
||||||
|
|
||||||
|
return skmers, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// extractCanonicalKmers extracts all canonical k-mers from a slice of super-kmers.
|
||||||
|
// This is CPU-bound work (sliding-window forward/reverse complement).
|
||||||
|
func extractCanonicalKmers(skmers []SuperKmer, k int) []uint64 {
|
||||||
|
// Pre-compute total capacity to avoid repeated slice growth.
|
||||||
|
// Each super-kmer of length L yields L-k+1 canonical k-mers.
|
||||||
|
total := 0
|
||||||
|
for i := range skmers {
|
||||||
|
n := len(skmers[i].Sequence) - k + 1
|
||||||
|
if n > 0 {
|
||||||
|
total += n
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
kmers := make([]uint64, 0, total)
|
||||||
|
for _, sk := range skmers {
|
||||||
|
for kmer := range IterCanonicalKmers(sk.Sequence, k) {
|
||||||
|
kmers = append(kmers, kmer)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return kmers
|
||||||
|
}
|
||||||
|
|
||||||
|
// sortFilterPartition sorts, deduplicates, and filters k-mers in memory (CPU-bound).
|
||||||
|
// Returns the filtered sorted slice, frequency spectrum, and optional top-N.
|
||||||
|
func (b *KmerSetGroupBuilder) sortFilterPartition(kmers []uint64) ([]uint64, map[int]uint64, *TopNKmers) {
|
||||||
|
if len(kmers) == 0 {
|
||||||
|
return nil, nil, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// Sort (CPU-bound) — slices.Sort avoids reflection overhead of sort.Slice
|
||||||
|
slices.Sort(kmers)
|
||||||
|
|
||||||
|
minFreq := b.config.minFreq
|
||||||
|
if minFreq <= 0 {
|
||||||
|
minFreq = 1 // simple dedup
|
||||||
|
}
|
||||||
|
maxFreq := b.config.maxFreq
|
||||||
|
|
||||||
|
// Prepare entropy filter if requested
|
||||||
|
var entropyFilter *KmerEntropyFilter
|
||||||
|
if b.config.entropyThreshold > 0 && b.config.entropyLevelMax > 0 {
|
||||||
|
entropyFilter = NewKmerEntropyFilter(b.k, b.config.entropyLevelMax, b.config.entropyThreshold)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Prepare top-N collector if requested
|
||||||
|
var topN *TopNKmers
|
||||||
|
if b.config.saveFreqTopN > 0 {
|
||||||
|
topN = NewTopNKmers(b.config.saveFreqTopN)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Linear scan: count consecutive identical values, filter, accumulate spectrum
|
||||||
|
partSpectrum := make(map[int]uint64)
|
||||||
|
filtered := make([]uint64, 0, len(kmers)/2)
|
||||||
|
|
||||||
|
i := 0
|
||||||
|
for i < len(kmers) {
|
||||||
|
val := kmers[i]
|
||||||
|
c := 1
|
||||||
|
for i+c < len(kmers) && kmers[i+c] == val {
|
||||||
|
c++
|
||||||
|
}
|
||||||
|
partSpectrum[c]++
|
||||||
|
if topN != nil {
|
||||||
|
topN.Add(val, c)
|
||||||
|
}
|
||||||
|
if c >= minFreq && (maxFreq <= 0 || c <= maxFreq) {
|
||||||
|
if entropyFilter == nil || entropyFilter.Accept(val) {
|
||||||
|
filtered = append(filtered, val)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
i += c
|
||||||
|
}
|
||||||
|
|
||||||
|
return filtered, partSpectrum, topN
|
||||||
|
}
|
||||||
|
|
||||||
|
// writePartitionKdi writes a sorted slice of k-mers to a .kdi file (I/O-bound).
|
||||||
|
// Returns the number of k-mers written.
|
||||||
|
func (b *KmerSetGroupBuilder) writePartitionKdi(kdiPath string, kmers []uint64) (uint64, error) {
|
||||||
|
w, err := NewKdiWriter(kdiPath)
|
||||||
|
if err != nil {
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
|
||||||
|
for _, val := range kmers {
|
||||||
|
if err := w.Write(val); err != nil {
|
||||||
|
w.Close()
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
n := w.Count()
|
||||||
|
return n, w.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
func (b *KmerSetGroupBuilder) writeEmptyKdi(path string, count *uint64) error {
|
||||||
|
w, err := NewKdiWriter(path)
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
*count = 0
|
||||||
|
return w.Close()
|
||||||
|
}
|
||||||
278
pkg/obikmer/kmer_set_builder_test.go
Normal file
278
pkg/obikmer/kmer_set_builder_test.go
Normal file
@@ -0,0 +1,278 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"sort"
|
||||||
|
"testing"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
)
|
||||||
|
|
||||||
|
func TestBuilderBasic(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
|
||||||
|
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
seq := obiseq.NewBioSequence("test", []byte("ACGTACGTACGTACGTACGTACGTACGT"), "")
|
||||||
|
builder.AddSequence(0, seq)
|
||||||
|
|
||||||
|
ksg, err := builder.Close()
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
if ksg.K() != 15 {
|
||||||
|
t.Fatalf("K() = %d, want 15", ksg.K())
|
||||||
|
}
|
||||||
|
if ksg.M() != 7 {
|
||||||
|
t.Fatalf("M() = %d, want 7", ksg.M())
|
||||||
|
}
|
||||||
|
if ksg.Partitions() != 64 {
|
||||||
|
t.Fatalf("Partitions() = %d, want 64", ksg.Partitions())
|
||||||
|
}
|
||||||
|
if ksg.Size() != 1 {
|
||||||
|
t.Fatalf("Size() = %d, want 1", ksg.Size())
|
||||||
|
}
|
||||||
|
if ksg.Len(0) == 0 {
|
||||||
|
t.Fatal("Len(0) = 0, expected some k-mers")
|
||||||
|
}
|
||||||
|
|
||||||
|
// Verify k-mers match what we'd compute directly
|
||||||
|
var expected []uint64
|
||||||
|
for kmer := range IterCanonicalKmers(seq.Sequence(), 15) {
|
||||||
|
expected = append(expected, kmer)
|
||||||
|
}
|
||||||
|
sort.Slice(expected, func(i, j int) bool { return expected[i] < expected[j] })
|
||||||
|
// Dedup
|
||||||
|
deduped := expected[:0]
|
||||||
|
for i, v := range expected {
|
||||||
|
if i == 0 || v != expected[i-1] {
|
||||||
|
deduped = append(deduped, v)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if ksg.Len(0) != uint64(len(deduped)) {
|
||||||
|
t.Fatalf("Len(0) = %d, expected %d unique k-mers", ksg.Len(0), len(deduped))
|
||||||
|
}
|
||||||
|
|
||||||
|
// Check iterator
|
||||||
|
var fromIter []uint64
|
||||||
|
for kmer := range ksg.Iterator(0) {
|
||||||
|
fromIter = append(fromIter, kmer)
|
||||||
|
}
|
||||||
|
// The iterator does a k-way merge so should be sorted
|
||||||
|
for i := 1; i < len(fromIter); i++ {
|
||||||
|
if fromIter[i] <= fromIter[i-1] {
|
||||||
|
t.Fatalf("iterator not sorted at %d: %d <= %d", i, fromIter[i], fromIter[i-1])
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if len(fromIter) != len(deduped) {
|
||||||
|
t.Fatalf("iterator yielded %d k-mers, expected %d", len(fromIter), len(deduped))
|
||||||
|
}
|
||||||
|
for i, v := range fromIter {
|
||||||
|
if v != deduped[i] {
|
||||||
|
t.Fatalf("iterator kmer %d: got %d, want %d", i, v, deduped[i])
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestBuilderMultipleSequences(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
|
||||||
|
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
seqs := []string{
|
||||||
|
"ACGTACGTACGTACGTACGTACGTACGT",
|
||||||
|
"TTTTTTTTTTTTTTTTTTTTTTTTT",
|
||||||
|
"GGGGGGGGGGGGGGGGGGGGGGGG",
|
||||||
|
}
|
||||||
|
for _, s := range seqs {
|
||||||
|
seq := obiseq.NewBioSequence("", []byte(s), "")
|
||||||
|
builder.AddSequence(0, seq)
|
||||||
|
}
|
||||||
|
|
||||||
|
ksg, err := builder.Close()
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
if ksg.Len(0) == 0 {
|
||||||
|
t.Fatal("expected k-mers after multiple sequences")
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestBuilderFrequencyFilter(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
|
||||||
|
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64,
|
||||||
|
WithMinFrequency(3))
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Add same sequence 3 times — all k-mers should survive freq=3
|
||||||
|
seq := obiseq.NewBioSequence("test", []byte("ACGTACGTACGTACGTACGTACGTACGT"), "")
|
||||||
|
for i := 0; i < 3; i++ {
|
||||||
|
builder.AddSequence(0, seq)
|
||||||
|
}
|
||||||
|
|
||||||
|
ksg, err := builder.Close()
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// All k-mers appear exactly 3 times → all should survive
|
||||||
|
var expected []uint64
|
||||||
|
for kmer := range IterCanonicalKmers(seq.Sequence(), 15) {
|
||||||
|
expected = append(expected, kmer)
|
||||||
|
}
|
||||||
|
sort.Slice(expected, func(i, j int) bool { return expected[i] < expected[j] })
|
||||||
|
deduped := expected[:0]
|
||||||
|
for i, v := range expected {
|
||||||
|
if i == 0 || v != expected[i-1] {
|
||||||
|
deduped = append(deduped, v)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if ksg.Len(0) != uint64(len(deduped)) {
|
||||||
|
t.Fatalf("Len(0) = %d, expected %d (all k-mers at freq=3)", ksg.Len(0), len(deduped))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestBuilderFrequencyFilterRejects(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
|
||||||
|
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64,
|
||||||
|
WithMinFrequency(5))
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Use a non-repetitive sequence so each canonical k-mer appears once per pass.
|
||||||
|
// Adding it twice gives freq=2 per kmer, which is < minFreq=5 → all rejected.
|
||||||
|
seq := obiseq.NewBioSequence("test",
|
||||||
|
[]byte("ACGATCGATCTAGCTAGCTGATCGATCGATCG"), "")
|
||||||
|
builder.AddSequence(0, seq)
|
||||||
|
builder.AddSequence(0, seq)
|
||||||
|
|
||||||
|
ksg, err := builder.Close()
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
if ksg.Len(0) != 0 {
|
||||||
|
t.Fatalf("Len(0) = %d, expected 0 (all k-mers at freq=2 < minFreq=5)", ksg.Len(0))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestBuilderMultipleSets(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
|
||||||
|
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 3, 64)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
seqs := []string{
|
||||||
|
"ACGTACGTACGTACGTACGTACGTACGT",
|
||||||
|
"TTTTTTTTTTTTTTTTTTTTTTTTT",
|
||||||
|
"GGGGGGGGGGGGGGGGGGGGGGGG",
|
||||||
|
}
|
||||||
|
for i, s := range seqs {
|
||||||
|
seq := obiseq.NewBioSequence("", []byte(s), "")
|
||||||
|
builder.AddSequence(i, seq)
|
||||||
|
}
|
||||||
|
|
||||||
|
ksg, err := builder.Close()
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
if ksg.Size() != 3 {
|
||||||
|
t.Fatalf("Size() = %d, want 3", ksg.Size())
|
||||||
|
}
|
||||||
|
for s := 0; s < 3; s++ {
|
||||||
|
if ksg.Len(s) == 0 {
|
||||||
|
t.Fatalf("Len(%d) = 0, expected some k-mers", s)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestBuilderOpenRoundTrip(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
|
||||||
|
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
seq := obiseq.NewBioSequence("test", []byte("ACGTACGTACGTACGTACGTACGTACGT"), "")
|
||||||
|
builder.AddSequence(0, seq)
|
||||||
|
|
||||||
|
ksg1, err := builder.Close()
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Reopen
|
||||||
|
ksg2, err := OpenKmerSetGroup(dir)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
if ksg2.K() != ksg1.K() {
|
||||||
|
t.Fatalf("K mismatch: %d vs %d", ksg2.K(), ksg1.K())
|
||||||
|
}
|
||||||
|
if ksg2.M() != ksg1.M() {
|
||||||
|
t.Fatalf("M mismatch: %d vs %d", ksg2.M(), ksg1.M())
|
||||||
|
}
|
||||||
|
if ksg2.Partitions() != ksg1.Partitions() {
|
||||||
|
t.Fatalf("Partitions mismatch: %d vs %d", ksg2.Partitions(), ksg1.Partitions())
|
||||||
|
}
|
||||||
|
if ksg2.Len(0) != ksg1.Len(0) {
|
||||||
|
t.Fatalf("Len mismatch: %d vs %d", ksg2.Len(0), ksg1.Len(0))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestBuilderAttributes(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
|
||||||
|
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
seq := obiseq.NewBioSequence("test", []byte("ACGTACGTACGTACGTACGTACGTACGT"), "")
|
||||||
|
builder.AddSequence(0, seq)
|
||||||
|
|
||||||
|
ksg, err := builder.Close()
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
ksg.SetId("my_index")
|
||||||
|
ksg.SetAttribute("organism", "test")
|
||||||
|
ksg.SaveMetadata()
|
||||||
|
|
||||||
|
// Reopen and check
|
||||||
|
ksg2, err := OpenKmerSetGroup(dir)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
if ksg2.Id() != "my_index" {
|
||||||
|
t.Fatalf("Id() = %q, want %q", ksg2.Id(), "my_index")
|
||||||
|
}
|
||||||
|
if !ksg2.HasAttribute("organism") {
|
||||||
|
t.Fatal("expected 'organism' attribute")
|
||||||
|
}
|
||||||
|
v, _ := ksg2.GetAttribute("organism")
|
||||||
|
if v != "test" {
|
||||||
|
t.Fatalf("organism = %v, want 'test'", v)
|
||||||
|
}
|
||||||
|
}
|
||||||
944
pkg/obikmer/kmer_set_disk.go
Normal file
944
pkg/obikmer/kmer_set_disk.go
Normal file
@@ -0,0 +1,944 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"fmt"
|
||||||
|
"io"
|
||||||
|
"iter"
|
||||||
|
"os"
|
||||||
|
"path"
|
||||||
|
"path/filepath"
|
||||||
|
"sort"
|
||||||
|
"sync"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidist"
|
||||||
|
"github.com/pelletier/go-toml/v2"
|
||||||
|
)
|
||||||
|
|
||||||
|
// MetadataFormat represents the metadata serialization format.
|
||||||
|
// Currently only TOML is used for disk-based indices, but the type
|
||||||
|
// is kept for backward compatibility with CLI options.
|
||||||
|
type MetadataFormat int
|
||||||
|
|
||||||
|
const (
|
||||||
|
FormatTOML MetadataFormat = iota
|
||||||
|
FormatYAML
|
||||||
|
FormatJSON
|
||||||
|
)
|
||||||
|
|
||||||
|
// String returns the file extension for the format.
|
||||||
|
func (f MetadataFormat) String() string {
|
||||||
|
switch f {
|
||||||
|
case FormatTOML:
|
||||||
|
return "toml"
|
||||||
|
case FormatYAML:
|
||||||
|
return "yaml"
|
||||||
|
case FormatJSON:
|
||||||
|
return "json"
|
||||||
|
default:
|
||||||
|
return "toml"
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// KmerSetGroup is a disk-based collection of N k-mer sets sharing the same
|
||||||
|
// k, m, and partition count P. After construction (via KmerSetGroupBuilder),
|
||||||
|
// it is immutable and all operations are streaming (partition by partition).
|
||||||
|
//
|
||||||
|
// A KmerSetGroup with Size()==1 is effectively a KmerSet (singleton).
|
||||||
|
type KmerSetGroup struct {
|
||||||
|
path string // root directory
|
||||||
|
id string // user-assigned identifier
|
||||||
|
k int // k-mer size
|
||||||
|
m int // minimizer size
|
||||||
|
partitions int // number of partitions P
|
||||||
|
n int // number of sets N
|
||||||
|
setsIDs []string // IDs of individual sets
|
||||||
|
counts []uint64 // total k-mer count per set (sum over partitions)
|
||||||
|
setsMetadata []map[string]interface{} // per-set user metadata
|
||||||
|
Metadata map[string]interface{} // group-level user metadata
|
||||||
|
}
|
||||||
|
|
||||||
|
// diskMetadata is the TOML-serializable structure for metadata.toml.
|
||||||
|
type diskMetadata struct {
|
||||||
|
ID string `toml:"id,omitempty"`
|
||||||
|
K int `toml:"k"`
|
||||||
|
M int `toml:"m"`
|
||||||
|
Partitions int `toml:"partitions"`
|
||||||
|
Type string `toml:"type"`
|
||||||
|
Size int `toml:"size"`
|
||||||
|
SetsIDs []string `toml:"sets_ids,omitempty"`
|
||||||
|
Counts []uint64 `toml:"counts,omitempty"`
|
||||||
|
SetsMetadata []map[string]interface{} `toml:"sets_metadata,omitempty"`
|
||||||
|
UserMetadata map[string]interface{} `toml:"user_metadata,omitempty"`
|
||||||
|
}
|
||||||
|
|
||||||
|
// OpenKmerSetGroup opens a finalized index directory in read-only mode.
|
||||||
|
func OpenKmerSetGroup(directory string) (*KmerSetGroup, error) {
|
||||||
|
metaPath := filepath.Join(directory, "metadata.toml")
|
||||||
|
f, err := os.Open(metaPath)
|
||||||
|
if err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: open metadata: %w", err)
|
||||||
|
}
|
||||||
|
defer f.Close()
|
||||||
|
|
||||||
|
var meta diskMetadata
|
||||||
|
if err := toml.NewDecoder(f).Decode(&meta); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: decode metadata: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
ksg := &KmerSetGroup{
|
||||||
|
path: directory,
|
||||||
|
id: meta.ID,
|
||||||
|
k: meta.K,
|
||||||
|
m: meta.M,
|
||||||
|
partitions: meta.Partitions,
|
||||||
|
n: meta.Size,
|
||||||
|
setsIDs: meta.SetsIDs,
|
||||||
|
counts: meta.Counts,
|
||||||
|
setsMetadata: meta.SetsMetadata,
|
||||||
|
Metadata: meta.UserMetadata,
|
||||||
|
}
|
||||||
|
if ksg.Metadata == nil {
|
||||||
|
ksg.Metadata = make(map[string]interface{})
|
||||||
|
}
|
||||||
|
if ksg.setsIDs == nil {
|
||||||
|
ksg.setsIDs = make([]string, ksg.n)
|
||||||
|
}
|
||||||
|
if ksg.setsMetadata == nil {
|
||||||
|
ksg.setsMetadata = make([]map[string]interface{}, ksg.n)
|
||||||
|
for i := range ksg.setsMetadata {
|
||||||
|
ksg.setsMetadata[i] = make(map[string]interface{})
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if ksg.counts == nil {
|
||||||
|
// Compute counts by scanning partitions
|
||||||
|
ksg.counts = make([]uint64, ksg.n)
|
||||||
|
for s := 0; s < ksg.n; s++ {
|
||||||
|
for p := 0; p < ksg.partitions; p++ {
|
||||||
|
path := ksg.partitionPath(s, p)
|
||||||
|
r, err := NewKdiReader(path)
|
||||||
|
if err != nil {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
ksg.counts[s] += r.Count()
|
||||||
|
r.Close()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return ksg, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// NewFilteredKmerSetGroup creates a KmerSetGroup from pre-computed data.
|
||||||
|
// Used by the filter command to construct a new group after filtering partitions.
|
||||||
|
func NewFilteredKmerSetGroup(
|
||||||
|
directory string, k, m, partitions, n int,
|
||||||
|
setsIDs []string, counts []uint64,
|
||||||
|
setsMetadata []map[string]interface{},
|
||||||
|
) (*KmerSetGroup, error) {
|
||||||
|
ksg := &KmerSetGroup{
|
||||||
|
path: directory,
|
||||||
|
k: k,
|
||||||
|
m: m,
|
||||||
|
partitions: partitions,
|
||||||
|
n: n,
|
||||||
|
setsIDs: setsIDs,
|
||||||
|
counts: counts,
|
||||||
|
setsMetadata: setsMetadata,
|
||||||
|
Metadata: make(map[string]interface{}),
|
||||||
|
}
|
||||||
|
return ksg, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// SaveMetadata writes the metadata.toml file. This is useful after
|
||||||
|
// modifying attributes or IDs on an already-finalized index.
|
||||||
|
func (ksg *KmerSetGroup) SaveMetadata() error {
|
||||||
|
return ksg.saveMetadata()
|
||||||
|
}
|
||||||
|
|
||||||
|
// saveMetadata writes the metadata.toml file (internal).
|
||||||
|
func (ksg *KmerSetGroup) saveMetadata() error {
|
||||||
|
meta := diskMetadata{
|
||||||
|
ID: ksg.id,
|
||||||
|
K: ksg.k,
|
||||||
|
M: ksg.m,
|
||||||
|
Partitions: ksg.partitions,
|
||||||
|
Type: "KmerSetGroup",
|
||||||
|
Size: ksg.n,
|
||||||
|
SetsIDs: ksg.setsIDs,
|
||||||
|
Counts: ksg.counts,
|
||||||
|
SetsMetadata: ksg.setsMetadata,
|
||||||
|
UserMetadata: ksg.Metadata,
|
||||||
|
}
|
||||||
|
|
||||||
|
metaPath := filepath.Join(ksg.path, "metadata.toml")
|
||||||
|
f, err := os.Create(metaPath)
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
defer f.Close()
|
||||||
|
|
||||||
|
return toml.NewEncoder(f).Encode(meta)
|
||||||
|
}
|
||||||
|
|
||||||
|
// partitionPath returns the file path for partition p of set s.
|
||||||
|
func (ksg *KmerSetGroup) partitionPath(setIndex, partIndex int) string {
|
||||||
|
return filepath.Join(ksg.path, fmt.Sprintf("set_%d", setIndex),
|
||||||
|
fmt.Sprintf("part_%04d.kdi", partIndex))
|
||||||
|
}
|
||||||
|
|
||||||
|
// Path returns the root directory of the index.
|
||||||
|
func (ksg *KmerSetGroup) Path() string {
|
||||||
|
return ksg.path
|
||||||
|
}
|
||||||
|
|
||||||
|
// K returns the k-mer size.
|
||||||
|
func (ksg *KmerSetGroup) K() int {
|
||||||
|
return ksg.k
|
||||||
|
}
|
||||||
|
|
||||||
|
// M returns the minimizer size.
|
||||||
|
func (ksg *KmerSetGroup) M() int {
|
||||||
|
return ksg.m
|
||||||
|
}
|
||||||
|
|
||||||
|
// Partitions returns the number of partitions P.
|
||||||
|
func (ksg *KmerSetGroup) Partitions() int {
|
||||||
|
return ksg.partitions
|
||||||
|
}
|
||||||
|
|
||||||
|
// Size returns the number of sets N.
|
||||||
|
func (ksg *KmerSetGroup) Size() int {
|
||||||
|
return ksg.n
|
||||||
|
}
|
||||||
|
|
||||||
|
// Id returns the group identifier.
|
||||||
|
func (ksg *KmerSetGroup) Id() string {
|
||||||
|
return ksg.id
|
||||||
|
}
|
||||||
|
|
||||||
|
// SetId sets the group identifier and persists the change.
|
||||||
|
func (ksg *KmerSetGroup) SetId(id string) {
|
||||||
|
ksg.id = id
|
||||||
|
}
|
||||||
|
|
||||||
|
// Len returns the total number of k-mers.
|
||||||
|
// Without argument: total across all sets.
|
||||||
|
// With argument setIndex: count for that specific set.
|
||||||
|
func (ksg *KmerSetGroup) Len(setIndex ...int) uint64 {
|
||||||
|
if len(setIndex) == 0 {
|
||||||
|
var total uint64
|
||||||
|
for _, c := range ksg.counts {
|
||||||
|
total += c
|
||||||
|
}
|
||||||
|
return total
|
||||||
|
}
|
||||||
|
idx := setIndex[0]
|
||||||
|
if idx < 0 || idx >= ksg.n {
|
||||||
|
return 0
|
||||||
|
}
|
||||||
|
return ksg.counts[idx]
|
||||||
|
}
|
||||||
|
|
||||||
|
// Contains checks if a k-mer is present in the specified set.
|
||||||
|
// Uses the .kdx sparse index (if available) for fast seeking within
|
||||||
|
// each partition, then a short linear scan of at most `stride` entries.
|
||||||
|
// All partitions are searched in parallel since the k-mer's partition
|
||||||
|
// is not known without its minimizer context.
|
||||||
|
func (ksg *KmerSetGroup) Contains(setIndex int, kmer uint64) bool {
|
||||||
|
if setIndex < 0 || setIndex >= ksg.n {
|
||||||
|
return false
|
||||||
|
}
|
||||||
|
|
||||||
|
type result struct {
|
||||||
|
found bool
|
||||||
|
}
|
||||||
|
ch := make(chan result, ksg.partitions)
|
||||||
|
|
||||||
|
for p := 0; p < ksg.partitions; p++ {
|
||||||
|
go func(part int) {
|
||||||
|
r, err := NewKdiIndexedReader(ksg.partitionPath(setIndex, part))
|
||||||
|
if err != nil {
|
||||||
|
ch <- result{false}
|
||||||
|
return
|
||||||
|
}
|
||||||
|
defer r.Close()
|
||||||
|
|
||||||
|
// Use index to jump near the target
|
||||||
|
if err := r.SeekTo(kmer); err != nil {
|
||||||
|
ch <- result{false}
|
||||||
|
return
|
||||||
|
}
|
||||||
|
|
||||||
|
// Linear scan from the seek position
|
||||||
|
for {
|
||||||
|
v, ok := r.Next()
|
||||||
|
if !ok {
|
||||||
|
ch <- result{false}
|
||||||
|
return
|
||||||
|
}
|
||||||
|
if v == kmer {
|
||||||
|
ch <- result{true}
|
||||||
|
return
|
||||||
|
}
|
||||||
|
if v > kmer {
|
||||||
|
ch <- result{false}
|
||||||
|
return
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}(p)
|
||||||
|
}
|
||||||
|
|
||||||
|
for i := 0; i < ksg.partitions; i++ {
|
||||||
|
res := <-ch
|
||||||
|
if res.found {
|
||||||
|
// Drain remaining goroutines
|
||||||
|
go func() {
|
||||||
|
for j := i + 1; j < ksg.partitions; j++ {
|
||||||
|
<-ch
|
||||||
|
}
|
||||||
|
}()
|
||||||
|
return true
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return false
|
||||||
|
}
|
||||||
|
|
||||||
|
// Iterator returns an iterator over all k-mers in the specified set,
|
||||||
|
// in sorted order within each partition. Since partitions are independent,
|
||||||
|
// to get a globally sorted stream, use iteratorSorted.
|
||||||
|
func (ksg *KmerSetGroup) Iterator(setIndex int) iter.Seq[uint64] {
|
||||||
|
return func(yield func(uint64) bool) {
|
||||||
|
if setIndex < 0 || setIndex >= ksg.n {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
|
||||||
|
// Open all partition readers and merge them
|
||||||
|
readers := make([]*KdiReader, 0, ksg.partitions)
|
||||||
|
for p := 0; p < ksg.partitions; p++ {
|
||||||
|
r, err := NewKdiReader(ksg.partitionPath(setIndex, p))
|
||||||
|
if err != nil {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
if r.Count() > 0 {
|
||||||
|
readers = append(readers, r)
|
||||||
|
} else {
|
||||||
|
r.Close()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if len(readers) == 0 {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
|
||||||
|
m := NewKWayMerge(readers)
|
||||||
|
defer m.Close()
|
||||||
|
|
||||||
|
for {
|
||||||
|
kmer, _, ok := m.Next()
|
||||||
|
if !ok {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
if !yield(kmer) {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// ==============================
|
||||||
|
// Attribute API (compatible with old API)
|
||||||
|
// ==============================
|
||||||
|
|
||||||
|
// HasAttribute checks if a metadata key exists.
|
||||||
|
func (ksg *KmerSetGroup) HasAttribute(key string) bool {
|
||||||
|
_, ok := ksg.Metadata[key]
|
||||||
|
return ok
|
||||||
|
}
|
||||||
|
|
||||||
|
// GetAttribute returns the value of an attribute.
|
||||||
|
func (ksg *KmerSetGroup) GetAttribute(key string) (interface{}, bool) {
|
||||||
|
switch key {
|
||||||
|
case "id":
|
||||||
|
return ksg.Id(), true
|
||||||
|
case "k":
|
||||||
|
return ksg.K(), true
|
||||||
|
default:
|
||||||
|
value, ok := ksg.Metadata[key]
|
||||||
|
return value, ok
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// SetAttribute sets a metadata attribute.
|
||||||
|
func (ksg *KmerSetGroup) SetAttribute(key string, value interface{}) {
|
||||||
|
switch key {
|
||||||
|
case "id":
|
||||||
|
if id, ok := value.(string); ok {
|
||||||
|
ksg.SetId(id)
|
||||||
|
} else {
|
||||||
|
panic(fmt.Sprintf("id must be a string, got %T", value))
|
||||||
|
}
|
||||||
|
case "k":
|
||||||
|
panic("k is immutable")
|
||||||
|
default:
|
||||||
|
ksg.Metadata[key] = value
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// DeleteAttribute removes a metadata attribute.
|
||||||
|
func (ksg *KmerSetGroup) DeleteAttribute(key string) {
|
||||||
|
delete(ksg.Metadata, key)
|
||||||
|
}
|
||||||
|
|
||||||
|
// GetIntAttribute returns an attribute as int.
|
||||||
|
func (ksg *KmerSetGroup) GetIntAttribute(key string) (int, bool) {
|
||||||
|
v, ok := ksg.GetAttribute(key)
|
||||||
|
if !ok {
|
||||||
|
return 0, false
|
||||||
|
}
|
||||||
|
switch val := v.(type) {
|
||||||
|
case int:
|
||||||
|
return val, true
|
||||||
|
case int64:
|
||||||
|
return int(val), true
|
||||||
|
case float64:
|
||||||
|
return int(val), true
|
||||||
|
}
|
||||||
|
return 0, false
|
||||||
|
}
|
||||||
|
|
||||||
|
// GetStringAttribute returns an attribute as string.
|
||||||
|
func (ksg *KmerSetGroup) GetStringAttribute(key string) (string, bool) {
|
||||||
|
v, ok := ksg.GetAttribute(key)
|
||||||
|
if !ok {
|
||||||
|
return "", false
|
||||||
|
}
|
||||||
|
if s, ok := v.(string); ok {
|
||||||
|
return s, true
|
||||||
|
}
|
||||||
|
return fmt.Sprintf("%v", v), true
|
||||||
|
}
|
||||||
|
|
||||||
|
// ==============================
|
||||||
|
// Jaccard metrics (streaming, disk-based)
|
||||||
|
// ==============================
|
||||||
|
|
||||||
|
// JaccardDistanceMatrix computes a pairwise Jaccard distance matrix
|
||||||
|
// for all sets in the group. Operates partition by partition in streaming.
|
||||||
|
func (ksg *KmerSetGroup) JaccardDistanceMatrix() *obidist.DistMatrix {
|
||||||
|
n := ksg.n
|
||||||
|
labels := make([]string, n)
|
||||||
|
for i := 0; i < n; i++ {
|
||||||
|
if i < len(ksg.setsIDs) && ksg.setsIDs[i] != "" {
|
||||||
|
labels[i] = ksg.setsIDs[i]
|
||||||
|
} else {
|
||||||
|
labels[i] = fmt.Sprintf("set_%d", i)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
dm := obidist.NewDistMatrixWithLabels(labels)
|
||||||
|
|
||||||
|
// Accumulate intersection and union counts
|
||||||
|
intersections := make([][]uint64, n)
|
||||||
|
unions := make([][]uint64, n)
|
||||||
|
for i := 0; i < n; i++ {
|
||||||
|
intersections[i] = make([]uint64, n)
|
||||||
|
unions[i] = make([]uint64, n)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Process partition by partition
|
||||||
|
var mu sync.Mutex
|
||||||
|
var wg sync.WaitGroup
|
||||||
|
|
||||||
|
for p := 0; p < ksg.partitions; p++ {
|
||||||
|
wg.Add(1)
|
||||||
|
go func(part int) {
|
||||||
|
defer wg.Done()
|
||||||
|
|
||||||
|
// Open all set readers for this partition
|
||||||
|
readers := make([]*KdiReader, n)
|
||||||
|
for s := 0; s < n; s++ {
|
||||||
|
r, err := NewKdiReader(ksg.partitionPath(s, part))
|
||||||
|
if err != nil {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
readers[s] = r
|
||||||
|
}
|
||||||
|
defer func() {
|
||||||
|
for _, r := range readers {
|
||||||
|
if r != nil {
|
||||||
|
r.Close()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}()
|
||||||
|
|
||||||
|
// Merge all N readers to count intersections and unions
|
||||||
|
activeReaders := make([]*KdiReader, 0, n)
|
||||||
|
activeIndices := make([]int, 0, n)
|
||||||
|
for i, r := range readers {
|
||||||
|
if r != nil && r.Count() > 0 {
|
||||||
|
activeReaders = append(activeReaders, r)
|
||||||
|
activeIndices = append(activeIndices, i)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if len(activeReaders) == 0 {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
|
||||||
|
merge := NewKWayMerge(activeReaders)
|
||||||
|
// Don't close merge here since readers are managed above
|
||||||
|
// We only want to iterate
|
||||||
|
|
||||||
|
// We need per-set presence tracking, so we use a custom merge
|
||||||
|
// Rebuild with a direct approach
|
||||||
|
merge.Close() // close the merge (which closes readers)
|
||||||
|
|
||||||
|
// Reopen readers for custom merge
|
||||||
|
for s := 0; s < n; s++ {
|
||||||
|
readers[s] = nil
|
||||||
|
r, err := NewKdiReader(ksg.partitionPath(s, part))
|
||||||
|
if err != nil {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
if r.Count() > 0 {
|
||||||
|
readers[s] = r
|
||||||
|
} else {
|
||||||
|
r.Close()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Custom k-way merge that tracks which sets contain each kmer
|
||||||
|
type entry struct {
|
||||||
|
val uint64
|
||||||
|
setIdx int
|
||||||
|
}
|
||||||
|
|
||||||
|
// Use a simpler approach: read all values for this partition into memory
|
||||||
|
// for each set, then do a merge
|
||||||
|
setKmers := make([][]uint64, n)
|
||||||
|
for s := 0; s < n; s++ {
|
||||||
|
if readers[s] == nil {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
kmers := make([]uint64, 0, readers[s].Count())
|
||||||
|
for {
|
||||||
|
v, ok := readers[s].Next()
|
||||||
|
if !ok {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
kmers = append(kmers, v)
|
||||||
|
}
|
||||||
|
setKmers[s] = kmers
|
||||||
|
readers[s].Close()
|
||||||
|
readers[s] = nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// Count pairwise intersections using sorted merge
|
||||||
|
// For each pair (i,j), count kmers present in both
|
||||||
|
localInter := make([][]uint64, n)
|
||||||
|
localUnion := make([][]uint64, n)
|
||||||
|
for i := 0; i < n; i++ {
|
||||||
|
localInter[i] = make([]uint64, n)
|
||||||
|
localUnion[i] = make([]uint64, n)
|
||||||
|
}
|
||||||
|
|
||||||
|
for i := 0; i < n; i++ {
|
||||||
|
localUnion[i][i] = uint64(len(setKmers[i]))
|
||||||
|
for j := i + 1; j < n; j++ {
|
||||||
|
a, b := setKmers[i], setKmers[j]
|
||||||
|
var inter uint64
|
||||||
|
ai, bi := 0, 0
|
||||||
|
for ai < len(a) && bi < len(b) {
|
||||||
|
if a[ai] == b[bi] {
|
||||||
|
inter++
|
||||||
|
ai++
|
||||||
|
bi++
|
||||||
|
} else if a[ai] < b[bi] {
|
||||||
|
ai++
|
||||||
|
} else {
|
||||||
|
bi++
|
||||||
|
}
|
||||||
|
}
|
||||||
|
localInter[i][j] = inter
|
||||||
|
localUnion[i][j] = uint64(len(a)) + uint64(len(b)) - inter
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
mu.Lock()
|
||||||
|
for i := 0; i < n; i++ {
|
||||||
|
for j := i; j < n; j++ {
|
||||||
|
intersections[i][j] += localInter[i][j]
|
||||||
|
unions[i][j] += localUnion[i][j]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
mu.Unlock()
|
||||||
|
}(p)
|
||||||
|
}
|
||||||
|
wg.Wait()
|
||||||
|
|
||||||
|
// Compute distances from accumulated counts
|
||||||
|
for i := 0; i < n-1; i++ {
|
||||||
|
for j := i + 1; j < n; j++ {
|
||||||
|
u := unions[i][j]
|
||||||
|
if u == 0 {
|
||||||
|
dm.Set(i, j, 1.0)
|
||||||
|
} else {
|
||||||
|
dm.Set(i, j, 1.0-float64(intersections[i][j])/float64(u))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return dm
|
||||||
|
}
|
||||||
|
|
||||||
|
// JaccardSimilarityMatrix computes a pairwise Jaccard similarity matrix.
|
||||||
|
func (ksg *KmerSetGroup) JaccardSimilarityMatrix() *obidist.DistMatrix {
|
||||||
|
n := ksg.n
|
||||||
|
labels := make([]string, n)
|
||||||
|
for i := 0; i < n; i++ {
|
||||||
|
if i < len(ksg.setsIDs) && ksg.setsIDs[i] != "" {
|
||||||
|
labels[i] = ksg.setsIDs[i]
|
||||||
|
} else {
|
||||||
|
labels[i] = fmt.Sprintf("set_%d", i)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Reuse distance computation
|
||||||
|
dm := ksg.JaccardDistanceMatrix()
|
||||||
|
sm := obidist.NewSimilarityMatrixWithLabels(labels)
|
||||||
|
|
||||||
|
for i := 0; i < n-1; i++ {
|
||||||
|
for j := i + 1; j < n; j++ {
|
||||||
|
sm.Set(i, j, 1.0-dm.Get(i, j))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return sm
|
||||||
|
}
|
||||||
|
|
||||||
|
// ==============================
|
||||||
|
// Set ID accessors
|
||||||
|
// ==============================
|
||||||
|
|
||||||
|
// SetsIDs returns a copy of the per-set string identifiers.
|
||||||
|
func (ksg *KmerSetGroup) SetsIDs() []string {
|
||||||
|
out := make([]string, len(ksg.setsIDs))
|
||||||
|
copy(out, ksg.setsIDs)
|
||||||
|
return out
|
||||||
|
}
|
||||||
|
|
||||||
|
// SetIDOf returns the string ID of the set at the given index.
|
||||||
|
// Returns "" if index is out of range.
|
||||||
|
func (ksg *KmerSetGroup) SetIDOf(index int) string {
|
||||||
|
if index < 0 || index >= ksg.n {
|
||||||
|
return ""
|
||||||
|
}
|
||||||
|
return ksg.setsIDs[index]
|
||||||
|
}
|
||||||
|
|
||||||
|
// SetSetID sets the string ID of the set at the given index.
|
||||||
|
func (ksg *KmerSetGroup) SetSetID(index int, id string) {
|
||||||
|
if index >= 0 && index < ksg.n {
|
||||||
|
ksg.setsIDs[index] = id
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// IndexOfSetID returns the numeric index for a set ID, or -1 if not found.
|
||||||
|
func (ksg *KmerSetGroup) IndexOfSetID(id string) int {
|
||||||
|
for i, sid := range ksg.setsIDs {
|
||||||
|
if sid == id {
|
||||||
|
return i
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return -1
|
||||||
|
}
|
||||||
|
|
||||||
|
// MatchSetIDs resolves glob patterns against set IDs and returns matching
|
||||||
|
// indices sorted in ascending order. Uses path.Match for pattern matching
|
||||||
|
// (supports *, ?, [...] patterns). Returns error if a pattern is malformed.
|
||||||
|
func (ksg *KmerSetGroup) MatchSetIDs(patterns []string) ([]int, error) {
|
||||||
|
seen := make(map[int]bool)
|
||||||
|
for _, pattern := range patterns {
|
||||||
|
for i, sid := range ksg.setsIDs {
|
||||||
|
matched, err := path.Match(pattern, sid)
|
||||||
|
if err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: invalid glob pattern %q: %w", pattern, err)
|
||||||
|
}
|
||||||
|
if matched {
|
||||||
|
seen[i] = true
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
result := make([]int, 0, len(seen))
|
||||||
|
for idx := range seen {
|
||||||
|
result = append(result, idx)
|
||||||
|
}
|
||||||
|
sort.Ints(result)
|
||||||
|
return result, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// ==============================
|
||||||
|
// Per-set metadata accessors
|
||||||
|
// ==============================
|
||||||
|
|
||||||
|
// GetSetMetadata returns the value of a per-set metadata key.
|
||||||
|
func (ksg *KmerSetGroup) GetSetMetadata(setIndex int, key string) (interface{}, bool) {
|
||||||
|
if setIndex < 0 || setIndex >= ksg.n {
|
||||||
|
return nil, false
|
||||||
|
}
|
||||||
|
v, ok := ksg.setsMetadata[setIndex][key]
|
||||||
|
return v, ok
|
||||||
|
}
|
||||||
|
|
||||||
|
// SetSetMetadata sets a per-set metadata attribute.
|
||||||
|
func (ksg *KmerSetGroup) SetSetMetadata(setIndex int, key string, value interface{}) {
|
||||||
|
if setIndex < 0 || setIndex >= ksg.n {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
if ksg.setsMetadata[setIndex] == nil {
|
||||||
|
ksg.setsMetadata[setIndex] = make(map[string]interface{})
|
||||||
|
}
|
||||||
|
ksg.setsMetadata[setIndex][key] = value
|
||||||
|
}
|
||||||
|
|
||||||
|
// DeleteSetMetadata removes a per-set metadata attribute.
|
||||||
|
func (ksg *KmerSetGroup) DeleteSetMetadata(setIndex int, key string) {
|
||||||
|
if setIndex < 0 || setIndex >= ksg.n {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
delete(ksg.setsMetadata[setIndex], key)
|
||||||
|
}
|
||||||
|
|
||||||
|
// AllSetMetadata returns a copy of all metadata for a given set.
|
||||||
|
func (ksg *KmerSetGroup) AllSetMetadata(setIndex int) map[string]interface{} {
|
||||||
|
if setIndex < 0 || setIndex >= ksg.n {
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
out := make(map[string]interface{}, len(ksg.setsMetadata[setIndex]))
|
||||||
|
for k, v := range ksg.setsMetadata[setIndex] {
|
||||||
|
out[k] = v
|
||||||
|
}
|
||||||
|
return out
|
||||||
|
}
|
||||||
|
|
||||||
|
// ==============================
|
||||||
|
// Exported partition path and compatibility
|
||||||
|
// ==============================
|
||||||
|
|
||||||
|
// PartitionPath returns the file path for partition partIndex of set setIndex.
|
||||||
|
func (ksg *KmerSetGroup) PartitionPath(setIndex, partIndex int) string {
|
||||||
|
return ksg.partitionPath(setIndex, partIndex)
|
||||||
|
}
|
||||||
|
|
||||||
|
// SpectrumPath returns the path to the spectrum.bin file for the given set.
|
||||||
|
func (ksg *KmerSetGroup) SpectrumPath(setIndex int) string {
|
||||||
|
return filepath.Join(ksg.path, fmt.Sprintf("set_%d", setIndex), "spectrum.bin")
|
||||||
|
}
|
||||||
|
|
||||||
|
// Spectrum reads the k-mer frequency spectrum for the given set.
|
||||||
|
// Returns nil, nil if no spectrum file exists.
|
||||||
|
func (ksg *KmerSetGroup) Spectrum(setIndex int) (*KmerSpectrum, error) {
|
||||||
|
path := ksg.SpectrumPath(setIndex)
|
||||||
|
if _, err := os.Stat(path); os.IsNotExist(err) {
|
||||||
|
return nil, nil
|
||||||
|
}
|
||||||
|
return ReadSpectrum(path)
|
||||||
|
}
|
||||||
|
|
||||||
|
// IsCompatibleWith returns true if the other group has the same k, m, and partitions.
|
||||||
|
func (ksg *KmerSetGroup) IsCompatibleWith(other *KmerSetGroup) bool {
|
||||||
|
return ksg.k == other.k && ksg.m == other.m && ksg.partitions == other.partitions
|
||||||
|
}
|
||||||
|
|
||||||
|
// ==============================
|
||||||
|
// Set management operations
|
||||||
|
// ==============================
|
||||||
|
|
||||||
|
// NewEmptyCompatible creates an empty KmerSetGroup at destDir with the same
|
||||||
|
// k, m, and partitions as this group. The destination must not already exist.
|
||||||
|
func (ksg *KmerSetGroup) NewEmptyCompatible(destDir string) (*KmerSetGroup, error) {
|
||||||
|
if err := os.MkdirAll(destDir, 0755); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: create directory: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
dest := &KmerSetGroup{
|
||||||
|
path: destDir,
|
||||||
|
k: ksg.k,
|
||||||
|
m: ksg.m,
|
||||||
|
partitions: ksg.partitions,
|
||||||
|
n: 0,
|
||||||
|
setsIDs: []string{},
|
||||||
|
counts: []uint64{},
|
||||||
|
setsMetadata: []map[string]interface{}{},
|
||||||
|
Metadata: make(map[string]interface{}),
|
||||||
|
}
|
||||||
|
|
||||||
|
if err := dest.saveMetadata(); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: write metadata: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
return dest, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// RemoveSetByID removes the set with the given ID from the group.
|
||||||
|
// It deletes the set directory, renumbers all subsequent sets, and
|
||||||
|
// updates the metadata on disk.
|
||||||
|
func (ksg *KmerSetGroup) RemoveSetByID(id string) error {
|
||||||
|
idx := ksg.IndexOfSetID(id)
|
||||||
|
if idx < 0 {
|
||||||
|
return fmt.Errorf("obikmer: set ID %q not found", id)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Delete the set directory
|
||||||
|
setDir := filepath.Join(ksg.path, fmt.Sprintf("set_%d", idx))
|
||||||
|
if err := os.RemoveAll(setDir); err != nil {
|
||||||
|
return fmt.Errorf("obikmer: remove set directory: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Renumber subsequent sets
|
||||||
|
for i := idx + 1; i < ksg.n; i++ {
|
||||||
|
oldDir := filepath.Join(ksg.path, fmt.Sprintf("set_%d", i))
|
||||||
|
newDir := filepath.Join(ksg.path, fmt.Sprintf("set_%d", i-1))
|
||||||
|
if err := os.Rename(oldDir, newDir); err != nil {
|
||||||
|
return fmt.Errorf("obikmer: rename set_%d to set_%d: %w", i, i-1, err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Update slices
|
||||||
|
ksg.setsIDs = append(ksg.setsIDs[:idx], ksg.setsIDs[idx+1:]...)
|
||||||
|
ksg.counts = append(ksg.counts[:idx], ksg.counts[idx+1:]...)
|
||||||
|
ksg.setsMetadata = append(ksg.setsMetadata[:idx], ksg.setsMetadata[idx+1:]...)
|
||||||
|
ksg.n--
|
||||||
|
|
||||||
|
return ksg.saveMetadata()
|
||||||
|
}
|
||||||
|
|
||||||
|
// CopySetsByIDTo copies sets identified by their IDs into a KmerSetGroup
|
||||||
|
// at destDir. If destDir does not exist, a new compatible empty group is
|
||||||
|
// created. If it exists, compatibility (k, m, partitions) is checked.
|
||||||
|
// If a set ID already exists in the destination, an error is returned
|
||||||
|
// unless force is true (in which case the existing set is replaced).
|
||||||
|
// Per-set metadata travels with the set.
|
||||||
|
func (ksg *KmerSetGroup) CopySetsByIDTo(ids []string, destDir string, force bool) (*KmerSetGroup, error) {
|
||||||
|
// Resolve source IDs to indices
|
||||||
|
srcIndices := make([]int, len(ids))
|
||||||
|
for i, id := range ids {
|
||||||
|
idx := ksg.IndexOfSetID(id)
|
||||||
|
if idx < 0 {
|
||||||
|
return nil, fmt.Errorf("obikmer: source set ID %q not found", id)
|
||||||
|
}
|
||||||
|
srcIndices[i] = idx
|
||||||
|
}
|
||||||
|
|
||||||
|
// Open or create destination
|
||||||
|
var dest *KmerSetGroup
|
||||||
|
metaPath := filepath.Join(destDir, "metadata.toml")
|
||||||
|
if _, err := os.Stat(metaPath); err == nil {
|
||||||
|
// Destination exists
|
||||||
|
dest, err = OpenKmerSetGroup(destDir)
|
||||||
|
if err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: open destination: %w", err)
|
||||||
|
}
|
||||||
|
if !ksg.IsCompatibleWith(dest) {
|
||||||
|
return nil, fmt.Errorf("obikmer: incompatible groups: source (k=%d, m=%d, P=%d) vs dest (k=%d, m=%d, P=%d)",
|
||||||
|
ksg.k, ksg.m, ksg.partitions, dest.k, dest.m, dest.partitions)
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
// Create new destination
|
||||||
|
var err error
|
||||||
|
dest, err = ksg.NewEmptyCompatible(destDir)
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Copy each set
|
||||||
|
for i, srcIdx := range srcIndices {
|
||||||
|
srcID := ids[i]
|
||||||
|
|
||||||
|
// Check for ID conflict in destination
|
||||||
|
existingIdx := dest.IndexOfSetID(srcID)
|
||||||
|
if existingIdx >= 0 {
|
||||||
|
if !force {
|
||||||
|
return nil, fmt.Errorf("obikmer: set ID %q already exists in destination (use force to replace)", srcID)
|
||||||
|
}
|
||||||
|
// Force: remove existing set in destination
|
||||||
|
if err := dest.RemoveSetByID(srcID); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: remove existing set %q in destination: %w", srcID, err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Destination set index = current dest size
|
||||||
|
destIdx := dest.n
|
||||||
|
|
||||||
|
// Create destination set directory
|
||||||
|
destSetDir := filepath.Join(destDir, fmt.Sprintf("set_%d", destIdx))
|
||||||
|
if err := os.MkdirAll(destSetDir, 0755); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: create dest set dir: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Copy all partition files and their .kdx indices
|
||||||
|
for p := 0; p < ksg.partitions; p++ {
|
||||||
|
srcPath := ksg.partitionPath(srcIdx, p)
|
||||||
|
destPath := dest.partitionPath(destIdx, p)
|
||||||
|
if err := copyFile(srcPath, destPath); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: copy partition %d of set %q: %w", p, srcID, err)
|
||||||
|
}
|
||||||
|
// Copy .kdx index if it exists
|
||||||
|
srcKdx := KdxPathForKdi(srcPath)
|
||||||
|
if _, err := os.Stat(srcKdx); err == nil {
|
||||||
|
destKdx := KdxPathForKdi(destPath)
|
||||||
|
if err := copyFile(srcKdx, destKdx); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: copy index %d of set %q: %w", p, srcID, err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Copy spectrum.bin if it exists
|
||||||
|
srcSpecPath := ksg.SpectrumPath(srcIdx)
|
||||||
|
if _, err := os.Stat(srcSpecPath); err == nil {
|
||||||
|
destSpecPath := filepath.Join(destSetDir, "spectrum.bin")
|
||||||
|
if err := copyFile(srcSpecPath, destSpecPath); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: copy spectrum of set %q: %w", srcID, err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Update destination metadata
|
||||||
|
dest.setsIDs = append(dest.setsIDs, srcID)
|
||||||
|
dest.counts = append(dest.counts, ksg.counts[srcIdx])
|
||||||
|
|
||||||
|
// Copy per-set metadata
|
||||||
|
srcMeta := ksg.AllSetMetadata(srcIdx)
|
||||||
|
if srcMeta == nil {
|
||||||
|
srcMeta = make(map[string]interface{})
|
||||||
|
}
|
||||||
|
dest.setsMetadata = append(dest.setsMetadata, srcMeta)
|
||||||
|
dest.n++
|
||||||
|
}
|
||||||
|
|
||||||
|
if err := dest.saveMetadata(); err != nil {
|
||||||
|
return nil, fmt.Errorf("obikmer: save destination metadata: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
return dest, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// copyFile copies a file from src to dst.
|
||||||
|
func copyFile(src, dst string) error {
|
||||||
|
in, err := os.Open(src)
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
defer in.Close()
|
||||||
|
|
||||||
|
out, err := os.Create(dst)
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
defer out.Close()
|
||||||
|
|
||||||
|
if _, err := io.Copy(out, in); err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
|
||||||
|
return out.Close()
|
||||||
|
}
|
||||||
568
pkg/obikmer/kmer_set_disk_ops.go
Normal file
568
pkg/obikmer/kmer_set_disk_ops.go
Normal file
@@ -0,0 +1,568 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"fmt"
|
||||||
|
"os"
|
||||||
|
"path/filepath"
|
||||||
|
"runtime"
|
||||||
|
"sync"
|
||||||
|
)
|
||||||
|
|
||||||
|
// Union computes the union of all sets in the group, producing a new
|
||||||
|
// singleton KmerSetGroup on disk. A k-mer is in the result if it
|
||||||
|
// appears in any set.
|
||||||
|
func (ksg *KmerSetGroup) Union(outputDir string) (*KmerSetGroup, error) {
|
||||||
|
return ksg.quorumOp(outputDir, 1, ksg.n)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Intersect computes the intersection of all sets, producing a new
|
||||||
|
// singleton KmerSetGroup on disk. A k-mer is in the result if it
|
||||||
|
// appears in every set.
|
||||||
|
func (ksg *KmerSetGroup) Intersect(outputDir string) (*KmerSetGroup, error) {
|
||||||
|
return ksg.quorumOp(outputDir, ksg.n, ksg.n)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Difference computes set_0 minus the union of all other sets.
|
||||||
|
func (ksg *KmerSetGroup) Difference(outputDir string) (*KmerSetGroup, error) {
|
||||||
|
return ksg.differenceOp(outputDir)
|
||||||
|
}
|
||||||
|
|
||||||
|
// QuorumAtLeast returns k-mers present in at least q sets.
|
||||||
|
func (ksg *KmerSetGroup) QuorumAtLeast(q int, outputDir string) (*KmerSetGroup, error) {
|
||||||
|
return ksg.quorumOp(outputDir, q, ksg.n)
|
||||||
|
}
|
||||||
|
|
||||||
|
// QuorumExactly returns k-mers present in exactly q sets.
|
||||||
|
func (ksg *KmerSetGroup) QuorumExactly(q int, outputDir string) (*KmerSetGroup, error) {
|
||||||
|
return ksg.quorumOp(outputDir, q, q)
|
||||||
|
}
|
||||||
|
|
||||||
|
// QuorumAtMost returns k-mers present in at most q sets.
|
||||||
|
func (ksg *KmerSetGroup) QuorumAtMost(q int, outputDir string) (*KmerSetGroup, error) {
|
||||||
|
return ksg.quorumOp(outputDir, 1, q)
|
||||||
|
}
|
||||||
|
|
||||||
|
// UnionWith merges this group with another, producing a new KmerSetGroup
|
||||||
|
// whose set_i is the union of this.set_i and other.set_i.
|
||||||
|
// Both groups must have the same k, m, P, and N.
|
||||||
|
func (ksg *KmerSetGroup) UnionWith(other *KmerSetGroup, outputDir string) (*KmerSetGroup, error) {
|
||||||
|
if err := ksg.checkCompatible(other); err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
return ksg.pairwiseOp(other, outputDir, mergeUnion)
|
||||||
|
}
|
||||||
|
|
||||||
|
// IntersectWith merges this group with another, producing a new KmerSetGroup
|
||||||
|
// whose set_i is the intersection of this.set_i and other.set_i.
|
||||||
|
func (ksg *KmerSetGroup) IntersectWith(other *KmerSetGroup, outputDir string) (*KmerSetGroup, error) {
|
||||||
|
if err := ksg.checkCompatible(other); err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
return ksg.pairwiseOp(other, outputDir, mergeIntersect)
|
||||||
|
}
|
||||||
|
|
||||||
|
// ==============================
|
||||||
|
// Internal implementation
|
||||||
|
// ==============================
|
||||||
|
|
||||||
|
func (ksg *KmerSetGroup) checkCompatible(other *KmerSetGroup) error {
|
||||||
|
if ksg.k != other.k {
|
||||||
|
return fmt.Errorf("obikmer: incompatible k: %d vs %d", ksg.k, other.k)
|
||||||
|
}
|
||||||
|
if ksg.m != other.m {
|
||||||
|
return fmt.Errorf("obikmer: incompatible m: %d vs %d", ksg.m, other.m)
|
||||||
|
}
|
||||||
|
if ksg.partitions != other.partitions {
|
||||||
|
return fmt.Errorf("obikmer: incompatible partitions: %d vs %d", ksg.partitions, other.partitions)
|
||||||
|
}
|
||||||
|
if ksg.n != other.n {
|
||||||
|
return fmt.Errorf("obikmer: incompatible size: %d vs %d", ksg.n, other.n)
|
||||||
|
}
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// quorumOp processes all N sets partition by partition.
|
||||||
|
// For each partition, it opens N KdiReaders and does a k-way merge.
|
||||||
|
// A kmer is written to the result if minQ <= count <= maxQ.
|
||||||
|
func (ksg *KmerSetGroup) quorumOp(outputDir string, minQ, maxQ int) (*KmerSetGroup, error) {
|
||||||
|
if minQ < 1 {
|
||||||
|
minQ = 1
|
||||||
|
}
|
||||||
|
if maxQ > ksg.n {
|
||||||
|
maxQ = ksg.n
|
||||||
|
}
|
||||||
|
|
||||||
|
// Create output structure
|
||||||
|
setDir := filepath.Join(outputDir, "set_0")
|
||||||
|
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
|
||||||
|
counts := make([]uint64, ksg.partitions)
|
||||||
|
|
||||||
|
nWorkers := runtime.NumCPU()
|
||||||
|
if nWorkers > ksg.partitions {
|
||||||
|
nWorkers = ksg.partitions
|
||||||
|
}
|
||||||
|
|
||||||
|
jobs := make(chan int, ksg.partitions)
|
||||||
|
var wg sync.WaitGroup
|
||||||
|
var errMu sync.Mutex
|
||||||
|
var firstErr error
|
||||||
|
|
||||||
|
for w := 0; w < nWorkers; w++ {
|
||||||
|
wg.Add(1)
|
||||||
|
go func() {
|
||||||
|
defer wg.Done()
|
||||||
|
for p := range jobs {
|
||||||
|
c, err := ksg.quorumPartition(p, setDir, minQ, maxQ)
|
||||||
|
if err != nil {
|
||||||
|
errMu.Lock()
|
||||||
|
if firstErr == nil {
|
||||||
|
firstErr = err
|
||||||
|
}
|
||||||
|
errMu.Unlock()
|
||||||
|
return
|
||||||
|
}
|
||||||
|
counts[p] = c
|
||||||
|
}
|
||||||
|
}()
|
||||||
|
}
|
||||||
|
|
||||||
|
for p := 0; p < ksg.partitions; p++ {
|
||||||
|
jobs <- p
|
||||||
|
}
|
||||||
|
close(jobs)
|
||||||
|
wg.Wait()
|
||||||
|
|
||||||
|
if firstErr != nil {
|
||||||
|
return nil, firstErr
|
||||||
|
}
|
||||||
|
|
||||||
|
var totalCount uint64
|
||||||
|
for _, c := range counts {
|
||||||
|
totalCount += c
|
||||||
|
}
|
||||||
|
|
||||||
|
result := &KmerSetGroup{
|
||||||
|
path: outputDir,
|
||||||
|
k: ksg.k,
|
||||||
|
m: ksg.m,
|
||||||
|
partitions: ksg.partitions,
|
||||||
|
n: 1,
|
||||||
|
setsIDs: []string{""},
|
||||||
|
counts: []uint64{totalCount},
|
||||||
|
Metadata: make(map[string]interface{}),
|
||||||
|
}
|
||||||
|
|
||||||
|
if err := result.saveMetadata(); err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
|
||||||
|
return result, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// quorumPartition processes a single partition for quorum filtering.
|
||||||
|
func (ksg *KmerSetGroup) quorumPartition(partIdx int, outSetDir string, minQ, maxQ int) (uint64, error) {
|
||||||
|
// Open readers for all sets
|
||||||
|
readers := make([]*KdiReader, 0, ksg.n)
|
||||||
|
for s := 0; s < ksg.n; s++ {
|
||||||
|
r, err := NewKdiReader(ksg.partitionPath(s, partIdx))
|
||||||
|
if err != nil {
|
||||||
|
// Close already-opened readers
|
||||||
|
for _, rr := range readers {
|
||||||
|
rr.Close()
|
||||||
|
}
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
if r.Count() > 0 {
|
||||||
|
readers = append(readers, r)
|
||||||
|
} else {
|
||||||
|
r.Close()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
outPath := filepath.Join(outSetDir, fmt.Sprintf("part_%04d.kdi", partIdx))
|
||||||
|
|
||||||
|
if len(readers) == 0 {
|
||||||
|
// Write empty KDI
|
||||||
|
w, err := NewKdiWriter(outPath)
|
||||||
|
if err != nil {
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
return 0, w.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
merge := NewKWayMerge(readers)
|
||||||
|
// merge.Close() will close readers
|
||||||
|
|
||||||
|
w, err := NewKdiWriter(outPath)
|
||||||
|
if err != nil {
|
||||||
|
merge.Close()
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
|
||||||
|
for {
|
||||||
|
kmer, count, ok := merge.Next()
|
||||||
|
if !ok {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
if count >= minQ && count <= maxQ {
|
||||||
|
if err := w.Write(kmer); err != nil {
|
||||||
|
merge.Close()
|
||||||
|
w.Close()
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
merge.Close()
|
||||||
|
cnt := w.Count()
|
||||||
|
return cnt, w.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// differenceOp computes set_0 minus the union of all other sets.
|
||||||
|
func (ksg *KmerSetGroup) differenceOp(outputDir string) (*KmerSetGroup, error) {
|
||||||
|
if ksg.n < 1 {
|
||||||
|
return nil, fmt.Errorf("obikmer: difference requires at least 1 set")
|
||||||
|
}
|
||||||
|
|
||||||
|
setDir := filepath.Join(outputDir, "set_0")
|
||||||
|
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
|
||||||
|
counts := make([]uint64, ksg.partitions)
|
||||||
|
|
||||||
|
nWorkers := runtime.NumCPU()
|
||||||
|
if nWorkers > ksg.partitions {
|
||||||
|
nWorkers = ksg.partitions
|
||||||
|
}
|
||||||
|
|
||||||
|
jobs := make(chan int, ksg.partitions)
|
||||||
|
var wg sync.WaitGroup
|
||||||
|
var errMu sync.Mutex
|
||||||
|
var firstErr error
|
||||||
|
|
||||||
|
for w := 0; w < nWorkers; w++ {
|
||||||
|
wg.Add(1)
|
||||||
|
go func() {
|
||||||
|
defer wg.Done()
|
||||||
|
for p := range jobs {
|
||||||
|
c, err := ksg.differencePartition(p, setDir)
|
||||||
|
if err != nil {
|
||||||
|
errMu.Lock()
|
||||||
|
if firstErr == nil {
|
||||||
|
firstErr = err
|
||||||
|
}
|
||||||
|
errMu.Unlock()
|
||||||
|
return
|
||||||
|
}
|
||||||
|
counts[p] = c
|
||||||
|
}
|
||||||
|
}()
|
||||||
|
}
|
||||||
|
|
||||||
|
for p := 0; p < ksg.partitions; p++ {
|
||||||
|
jobs <- p
|
||||||
|
}
|
||||||
|
close(jobs)
|
||||||
|
wg.Wait()
|
||||||
|
|
||||||
|
if firstErr != nil {
|
||||||
|
return nil, firstErr
|
||||||
|
}
|
||||||
|
|
||||||
|
var totalCount uint64
|
||||||
|
for _, c := range counts {
|
||||||
|
totalCount += c
|
||||||
|
}
|
||||||
|
|
||||||
|
result := &KmerSetGroup{
|
||||||
|
path: outputDir,
|
||||||
|
k: ksg.k,
|
||||||
|
m: ksg.m,
|
||||||
|
partitions: ksg.partitions,
|
||||||
|
n: 1,
|
||||||
|
setsIDs: []string{""},
|
||||||
|
counts: []uint64{totalCount},
|
||||||
|
Metadata: make(map[string]interface{}),
|
||||||
|
}
|
||||||
|
|
||||||
|
if err := result.saveMetadata(); err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
|
||||||
|
return result, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// differencePartition computes set_0 - union(set_1..set_{n-1}) for one partition.
|
||||||
|
func (ksg *KmerSetGroup) differencePartition(partIdx int, outSetDir string) (uint64, error) {
|
||||||
|
outPath := filepath.Join(outSetDir, fmt.Sprintf("part_%04d.kdi", partIdx))
|
||||||
|
|
||||||
|
// Open set_0 reader
|
||||||
|
r0, err := NewKdiReader(ksg.partitionPath(0, partIdx))
|
||||||
|
if err != nil {
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
|
||||||
|
if r0.Count() == 0 {
|
||||||
|
r0.Close()
|
||||||
|
w, err := NewKdiWriter(outPath)
|
||||||
|
if err != nil {
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
return 0, w.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// Open readers for the other sets and merge them
|
||||||
|
var otherReaders []*KdiReader
|
||||||
|
for s := 1; s < ksg.n; s++ {
|
||||||
|
r, err := NewKdiReader(ksg.partitionPath(s, partIdx))
|
||||||
|
if err != nil {
|
||||||
|
r0.Close()
|
||||||
|
for _, rr := range otherReaders {
|
||||||
|
rr.Close()
|
||||||
|
}
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
if r.Count() > 0 {
|
||||||
|
otherReaders = append(otherReaders, r)
|
||||||
|
} else {
|
||||||
|
r.Close()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
w, err := NewKdiWriter(outPath)
|
||||||
|
if err != nil {
|
||||||
|
r0.Close()
|
||||||
|
for _, rr := range otherReaders {
|
||||||
|
rr.Close()
|
||||||
|
}
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
|
||||||
|
if len(otherReaders) == 0 {
|
||||||
|
// No other sets — copy set_0
|
||||||
|
for {
|
||||||
|
v, ok := r0.Next()
|
||||||
|
if !ok {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
if err := w.Write(v); err != nil {
|
||||||
|
r0.Close()
|
||||||
|
w.Close()
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
}
|
||||||
|
r0.Close()
|
||||||
|
cnt := w.Count()
|
||||||
|
return cnt, w.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// Merge other sets to get the "subtraction" stream
|
||||||
|
otherMerge := NewKWayMerge(otherReaders)
|
||||||
|
|
||||||
|
// Streaming difference: advance both streams
|
||||||
|
v0, ok0 := r0.Next()
|
||||||
|
vo, _, oko := otherMerge.Next()
|
||||||
|
|
||||||
|
for ok0 {
|
||||||
|
if !oko || v0 < vo {
|
||||||
|
// v0 not in others → emit
|
||||||
|
if err := w.Write(v0); err != nil {
|
||||||
|
r0.Close()
|
||||||
|
otherMerge.Close()
|
||||||
|
w.Close()
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
v0, ok0 = r0.Next()
|
||||||
|
} else if v0 == vo {
|
||||||
|
// v0 in others → skip
|
||||||
|
v0, ok0 = r0.Next()
|
||||||
|
vo, _, oko = otherMerge.Next()
|
||||||
|
} else {
|
||||||
|
// vo < v0 → advance others
|
||||||
|
vo, _, oko = otherMerge.Next()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
r0.Close()
|
||||||
|
otherMerge.Close()
|
||||||
|
cnt := w.Count()
|
||||||
|
return cnt, w.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// mergeMode defines how to combine two values during pairwise operations.
|
||||||
|
type mergeMode int
|
||||||
|
|
||||||
|
const (
|
||||||
|
mergeUnion mergeMode = iota // emit if in either
|
||||||
|
mergeIntersect // emit if in both
|
||||||
|
)
|
||||||
|
|
||||||
|
// pairwiseOp applies a merge operation between corresponding sets of two groups.
|
||||||
|
func (ksg *KmerSetGroup) pairwiseOp(other *KmerSetGroup, outputDir string, mode mergeMode) (*KmerSetGroup, error) {
|
||||||
|
for s := 0; s < ksg.n; s++ {
|
||||||
|
setDir := filepath.Join(outputDir, fmt.Sprintf("set_%d", s))
|
||||||
|
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
counts := make([][]uint64, ksg.n)
|
||||||
|
for s := 0; s < ksg.n; s++ {
|
||||||
|
counts[s] = make([]uint64, ksg.partitions)
|
||||||
|
}
|
||||||
|
|
||||||
|
nWorkers := runtime.NumCPU()
|
||||||
|
if nWorkers > ksg.partitions {
|
||||||
|
nWorkers = ksg.partitions
|
||||||
|
}
|
||||||
|
|
||||||
|
type job struct {
|
||||||
|
setIdx int
|
||||||
|
partIdx int
|
||||||
|
}
|
||||||
|
jobs := make(chan job, ksg.n*ksg.partitions)
|
||||||
|
var wg sync.WaitGroup
|
||||||
|
var errMu sync.Mutex
|
||||||
|
var firstErr error
|
||||||
|
|
||||||
|
for w := 0; w < nWorkers; w++ {
|
||||||
|
wg.Add(1)
|
||||||
|
go func() {
|
||||||
|
defer wg.Done()
|
||||||
|
for j := range jobs {
|
||||||
|
c, err := pairwiseMergePartition(
|
||||||
|
ksg.partitionPath(j.setIdx, j.partIdx),
|
||||||
|
other.partitionPath(j.setIdx, j.partIdx),
|
||||||
|
filepath.Join(outputDir, fmt.Sprintf("set_%d", j.setIdx),
|
||||||
|
fmt.Sprintf("part_%04d.kdi", j.partIdx)),
|
||||||
|
mode,
|
||||||
|
)
|
||||||
|
if err != nil {
|
||||||
|
errMu.Lock()
|
||||||
|
if firstErr == nil {
|
||||||
|
firstErr = err
|
||||||
|
}
|
||||||
|
errMu.Unlock()
|
||||||
|
return
|
||||||
|
}
|
||||||
|
counts[j.setIdx][j.partIdx] = c
|
||||||
|
}
|
||||||
|
}()
|
||||||
|
}
|
||||||
|
|
||||||
|
for s := 0; s < ksg.n; s++ {
|
||||||
|
for p := 0; p < ksg.partitions; p++ {
|
||||||
|
jobs <- job{s, p}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
close(jobs)
|
||||||
|
wg.Wait()
|
||||||
|
|
||||||
|
if firstErr != nil {
|
||||||
|
return nil, firstErr
|
||||||
|
}
|
||||||
|
|
||||||
|
totalCounts := make([]uint64, ksg.n)
|
||||||
|
setsIDs := make([]string, ksg.n)
|
||||||
|
for s := 0; s < ksg.n; s++ {
|
||||||
|
for p := 0; p < ksg.partitions; p++ {
|
||||||
|
totalCounts[s] += counts[s][p]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
result := &KmerSetGroup{
|
||||||
|
path: outputDir,
|
||||||
|
k: ksg.k,
|
||||||
|
m: ksg.m,
|
||||||
|
partitions: ksg.partitions,
|
||||||
|
n: ksg.n,
|
||||||
|
setsIDs: setsIDs,
|
||||||
|
counts: totalCounts,
|
||||||
|
Metadata: make(map[string]interface{}),
|
||||||
|
}
|
||||||
|
|
||||||
|
if err := result.saveMetadata(); err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
|
||||||
|
return result, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// pairwiseMergePartition merges two KDI files (sorted streams) with the given mode.
|
||||||
|
func pairwiseMergePartition(pathA, pathB, outPath string, mode mergeMode) (uint64, error) {
|
||||||
|
rA, err := NewKdiReader(pathA)
|
||||||
|
if err != nil {
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
rB, err := NewKdiReader(pathB)
|
||||||
|
if err != nil {
|
||||||
|
rA.Close()
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
|
||||||
|
w, err := NewKdiWriter(outPath)
|
||||||
|
if err != nil {
|
||||||
|
rA.Close()
|
||||||
|
rB.Close()
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
|
||||||
|
cnt, mergeErr := doPairwiseMerge(rA, rB, w, mode)
|
||||||
|
rA.Close()
|
||||||
|
rB.Close()
|
||||||
|
closeErr := w.Close()
|
||||||
|
if mergeErr != nil {
|
||||||
|
return 0, mergeErr
|
||||||
|
}
|
||||||
|
return cnt, closeErr
|
||||||
|
}
|
||||||
|
|
||||||
|
func doPairwiseMerge(rA, rB *KdiReader, w *KdiWriter, mode mergeMode) (uint64, error) {
|
||||||
|
vA, okA := rA.Next()
|
||||||
|
vB, okB := rB.Next()
|
||||||
|
|
||||||
|
for okA && okB {
|
||||||
|
if vA == vB {
|
||||||
|
if err := w.Write(vA); err != nil {
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
vA, okA = rA.Next()
|
||||||
|
vB, okB = rB.Next()
|
||||||
|
} else if vA < vB {
|
||||||
|
if mode == mergeUnion {
|
||||||
|
if err := w.Write(vA); err != nil {
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
}
|
||||||
|
vA, okA = rA.Next()
|
||||||
|
} else {
|
||||||
|
if mode == mergeUnion {
|
||||||
|
if err := w.Write(vB); err != nil {
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
}
|
||||||
|
vB, okB = rB.Next()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if mode == mergeUnion {
|
||||||
|
for okA {
|
||||||
|
if err := w.Write(vA); err != nil {
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
vA, okA = rA.Next()
|
||||||
|
}
|
||||||
|
for okB {
|
||||||
|
if err := w.Write(vB); err != nil {
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
vB, okB = rB.Next()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return w.Count(), nil
|
||||||
|
}
|
||||||
251
pkg/obikmer/kmer_set_disk_ops_test.go
Normal file
251
pkg/obikmer/kmer_set_disk_ops_test.go
Normal file
@@ -0,0 +1,251 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"path/filepath"
|
||||||
|
"testing"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
)
|
||||||
|
|
||||||
|
// buildGroupFromSeqs creates a KmerSetGroup with one set per sequence.
|
||||||
|
func buildGroupFromSeqs(t *testing.T, dir string, k, m int, seqs []string) *KmerSetGroup {
|
||||||
|
t.Helper()
|
||||||
|
n := len(seqs)
|
||||||
|
builder, err := NewKmerSetGroupBuilder(dir, k, m, n, 64)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
for i, s := range seqs {
|
||||||
|
seq := obiseq.NewBioSequence("", []byte(s), "")
|
||||||
|
builder.AddSequence(i, seq)
|
||||||
|
}
|
||||||
|
ksg, err := builder.Close()
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
return ksg
|
||||||
|
}
|
||||||
|
|
||||||
|
func collectKmers(t *testing.T, ksg *KmerSetGroup, setIdx int) []uint64 {
|
||||||
|
t.Helper()
|
||||||
|
var result []uint64
|
||||||
|
for kmer := range ksg.Iterator(setIdx) {
|
||||||
|
result = append(result, kmer)
|
||||||
|
}
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestDiskOpsUnion(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
indexDir := filepath.Join(dir, "index")
|
||||||
|
outDir := filepath.Join(dir, "union")
|
||||||
|
|
||||||
|
// Two sequences with some overlap
|
||||||
|
seqs := []string{
|
||||||
|
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||||
|
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||||
|
}
|
||||||
|
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||||
|
|
||||||
|
result, err := ksg.Union(outDir)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Union should have at least as many k-mers as each individual set
|
||||||
|
unionLen := result.Len(0)
|
||||||
|
if unionLen == 0 {
|
||||||
|
t.Fatal("union is empty")
|
||||||
|
}
|
||||||
|
if unionLen < ksg.Len(0) || unionLen < ksg.Len(1) {
|
||||||
|
t.Fatalf("union (%d) smaller than an input set (%d, %d)", unionLen, ksg.Len(0), ksg.Len(1))
|
||||||
|
}
|
||||||
|
|
||||||
|
// Union should not exceed the sum of both sets
|
||||||
|
if unionLen > ksg.Len(0)+ksg.Len(1) {
|
||||||
|
t.Fatalf("union (%d) larger than sum of sets (%d)", unionLen, ksg.Len(0)+ksg.Len(1))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestDiskOpsIntersect(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
indexDir := filepath.Join(dir, "index")
|
||||||
|
outDir := filepath.Join(dir, "intersect")
|
||||||
|
|
||||||
|
// Two sequences with some shared k-mers
|
||||||
|
seqs := []string{
|
||||||
|
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||||
|
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||||
|
}
|
||||||
|
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||||
|
|
||||||
|
result, err := ksg.Intersect(outDir)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
interLen := result.Len(0)
|
||||||
|
// Intersection should not be bigger than any individual set
|
||||||
|
if interLen > ksg.Len(0) || interLen > ksg.Len(1) {
|
||||||
|
t.Fatalf("intersection (%d) larger than input sets (%d, %d)", interLen, ksg.Len(0), ksg.Len(1))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestDiskOpsDifference(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
indexDir := filepath.Join(dir, "index")
|
||||||
|
outDir := filepath.Join(dir, "diff")
|
||||||
|
|
||||||
|
seqs := []string{
|
||||||
|
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||||
|
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||||
|
}
|
||||||
|
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||||
|
|
||||||
|
result, err := ksg.Difference(outDir)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
diffLen := result.Len(0)
|
||||||
|
// Difference = set_0 - set_1, so should be <= set_0
|
||||||
|
if diffLen > ksg.Len(0) {
|
||||||
|
t.Fatalf("difference (%d) larger than set_0 (%d)", diffLen, ksg.Len(0))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestDiskOpsConsistency(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
indexDir := filepath.Join(dir, "index")
|
||||||
|
|
||||||
|
seqs := []string{
|
||||||
|
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||||
|
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||||
|
}
|
||||||
|
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||||
|
|
||||||
|
unionResult, err := ksg.Union(filepath.Join(dir, "union"))
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
interResult, err := ksg.Intersect(filepath.Join(dir, "intersect"))
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
diffResult, err := ksg.Difference(filepath.Join(dir, "diff"))
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
unionLen := unionResult.Len(0)
|
||||||
|
interLen := interResult.Len(0)
|
||||||
|
diffLen := diffResult.Len(0)
|
||||||
|
|
||||||
|
// |A ∪ B| = |A| + |B| - |A ∩ B|
|
||||||
|
expectedUnion := ksg.Len(0) + ksg.Len(1) - interLen
|
||||||
|
if unionLen != expectedUnion {
|
||||||
|
t.Fatalf("|A∪B|=%d, expected |A|+|B|-|A∩B|=%d+%d-%d=%d",
|
||||||
|
unionLen, ksg.Len(0), ksg.Len(1), interLen, expectedUnion)
|
||||||
|
}
|
||||||
|
|
||||||
|
// |A \ B| = |A| - |A ∩ B|
|
||||||
|
expectedDiff := ksg.Len(0) - interLen
|
||||||
|
if diffLen != expectedDiff {
|
||||||
|
t.Fatalf("|A\\B|=%d, expected |A|-|A∩B|=%d-%d=%d",
|
||||||
|
diffLen, ksg.Len(0), interLen, expectedDiff)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestDiskOpsQuorum(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
indexDir := filepath.Join(dir, "index")
|
||||||
|
|
||||||
|
// Three sets
|
||||||
|
seqs := []string{
|
||||||
|
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||||
|
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||||
|
"GATCGATCGATCGAAATTTCCCGGG",
|
||||||
|
}
|
||||||
|
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||||
|
|
||||||
|
// QuorumAtLeast(1) = Union
|
||||||
|
q1, err := ksg.QuorumAtLeast(1, filepath.Join(dir, "q1"))
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
union, err := ksg.Union(filepath.Join(dir, "union"))
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
if q1.Len(0) != union.Len(0) {
|
||||||
|
t.Fatalf("QuorumAtLeast(1)=%d != Union=%d", q1.Len(0), union.Len(0))
|
||||||
|
}
|
||||||
|
|
||||||
|
// QuorumAtLeast(3) = Intersect
|
||||||
|
q3, err := ksg.QuorumAtLeast(3, filepath.Join(dir, "q3"))
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
inter, err := ksg.Intersect(filepath.Join(dir, "inter"))
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
if q3.Len(0) != inter.Len(0) {
|
||||||
|
t.Fatalf("QuorumAtLeast(3)=%d != Intersect=%d", q3.Len(0), inter.Len(0))
|
||||||
|
}
|
||||||
|
|
||||||
|
// QuorumAtLeast(2) should be between Intersect and Union
|
||||||
|
q2, err := ksg.QuorumAtLeast(2, filepath.Join(dir, "q2"))
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
if q2.Len(0) < q3.Len(0) || q2.Len(0) > q1.Len(0) {
|
||||||
|
t.Fatalf("QuorumAtLeast(2)=%d not between intersect=%d and union=%d",
|
||||||
|
q2.Len(0), q3.Len(0), q1.Len(0))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestDiskOpsJaccard(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
indexDir := filepath.Join(dir, "index")
|
||||||
|
|
||||||
|
seqs := []string{
|
||||||
|
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||||
|
"ACGATCGATCTAGCTAGCTGATCGATCGATCG", // identical to first
|
||||||
|
"TTTTTTTTTTTTTTTTTTTTTTTTT", // completely different
|
||||||
|
}
|
||||||
|
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||||
|
|
||||||
|
dm := ksg.JaccardDistanceMatrix()
|
||||||
|
if dm == nil {
|
||||||
|
t.Fatal("JaccardDistanceMatrix returned nil")
|
||||||
|
}
|
||||||
|
|
||||||
|
// Identical sets should have distance 0
|
||||||
|
d01 := dm.Get(0, 1)
|
||||||
|
if d01 != 0.0 {
|
||||||
|
t.Fatalf("distance(0,1) = %f, expected 0.0 for identical sets", d01)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Completely different sets should have distance 1.0
|
||||||
|
d02 := dm.Get(0, 2)
|
||||||
|
if d02 != 1.0 {
|
||||||
|
t.Fatalf("distance(0,2) = %f, expected 1.0 for disjoint sets", d02)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Similarity matrix
|
||||||
|
sm := ksg.JaccardSimilarityMatrix()
|
||||||
|
if sm == nil {
|
||||||
|
t.Fatal("JaccardSimilarityMatrix returned nil")
|
||||||
|
}
|
||||||
|
|
||||||
|
s01 := sm.Get(0, 1)
|
||||||
|
if s01 != 1.0 {
|
||||||
|
t.Fatalf("similarity(0,1) = %f, expected 1.0 for identical sets", s01)
|
||||||
|
}
|
||||||
|
|
||||||
|
s02 := sm.Get(0, 2)
|
||||||
|
if s02 != 0.0 {
|
||||||
|
t.Fatalf("similarity(0,2) = %f, expected 0.0 for disjoint sets", s02)
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -1,339 +0,0 @@
|
|||||||
package obikmer
|
|
||||||
|
|
||||||
import (
|
|
||||||
"fmt"
|
|
||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidist"
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
|
||||||
)
|
|
||||||
|
|
||||||
// KmerSetGroup represents a vector of KmerSet
|
|
||||||
// Used to manage multiple k-mer sets (for example, by frequency level)
|
|
||||||
type KmerSetGroup struct {
|
|
||||||
id string // Unique identifier of the KmerSetGroup
|
|
||||||
k int // Size of k-mers (immutable)
|
|
||||||
sets []*KmerSet // Vector of KmerSet
|
|
||||||
Metadata map[string]interface{} // Group metadata (not individual sets)
|
|
||||||
}
|
|
||||||
|
|
||||||
// NewKmerSetGroup creates a new group of n KmerSets
|
|
||||||
func NewKmerSetGroup(k int, n int) *KmerSetGroup {
|
|
||||||
if n < 1 {
|
|
||||||
panic("KmerSetGroup size must be >= 1")
|
|
||||||
}
|
|
||||||
|
|
||||||
sets := make([]*KmerSet, n)
|
|
||||||
for i := range sets {
|
|
||||||
sets[i] = NewKmerSet(k)
|
|
||||||
}
|
|
||||||
|
|
||||||
return &KmerSetGroup{
|
|
||||||
k: k,
|
|
||||||
sets: sets,
|
|
||||||
Metadata: make(map[string]interface{}),
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// K returns the size of k-mers (immutable)
|
|
||||||
func (ksg *KmerSetGroup) K() int {
|
|
||||||
return ksg.k
|
|
||||||
}
|
|
||||||
|
|
||||||
// Size returns the number of KmerSet in the group
|
|
||||||
func (ksg *KmerSetGroup) Size() int {
|
|
||||||
return len(ksg.sets)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Get returns the KmerSet at the given index
|
|
||||||
// Returns nil if the index is invalid
|
|
||||||
func (ksg *KmerSetGroup) Get(index int) *KmerSet {
|
|
||||||
if index < 0 || index >= len(ksg.sets) {
|
|
||||||
return nil
|
|
||||||
}
|
|
||||||
return ksg.sets[index]
|
|
||||||
}
|
|
||||||
|
|
||||||
// Set replaces the KmerSet at the given index
|
|
||||||
// Panics if the index is invalid or if k does not match
|
|
||||||
func (ksg *KmerSetGroup) Set(index int, ks *KmerSet) {
|
|
||||||
if index < 0 || index >= len(ksg.sets) {
|
|
||||||
panic(fmt.Sprintf("Index out of bounds: %d (size: %d)", index, len(ksg.sets)))
|
|
||||||
}
|
|
||||||
if ks.k != ksg.k {
|
|
||||||
panic(fmt.Sprintf("KmerSet k mismatch: expected %d, got %d", ksg.k, ks.k))
|
|
||||||
}
|
|
||||||
ksg.sets[index] = ks
|
|
||||||
}
|
|
||||||
|
|
||||||
// Len returns the number of k-mers in a specific KmerSet
|
|
||||||
// Without argument: returns the number of k-mers in the last KmerSet
|
|
||||||
// With argument index: returns the number of k-mers in the KmerSet at this index
|
|
||||||
func (ksg *KmerSetGroup) Len(index ...int) uint64 {
|
|
||||||
if len(index) == 0 {
|
|
||||||
// Without argument: last KmerSet
|
|
||||||
return ksg.sets[len(ksg.sets)-1].Len()
|
|
||||||
}
|
|
||||||
|
|
||||||
// With argument: specific KmerSet
|
|
||||||
idx := index[0]
|
|
||||||
if idx < 0 || idx >= len(ksg.sets) {
|
|
||||||
return 0
|
|
||||||
}
|
|
||||||
return ksg.sets[idx].Len()
|
|
||||||
}
|
|
||||||
|
|
||||||
// MemoryUsage returns the total memory usage in bytes
|
|
||||||
func (ksg *KmerSetGroup) MemoryUsage() uint64 {
|
|
||||||
total := uint64(0)
|
|
||||||
for _, ks := range ksg.sets {
|
|
||||||
total += ks.MemoryUsage()
|
|
||||||
}
|
|
||||||
return total
|
|
||||||
}
|
|
||||||
|
|
||||||
// Clear empties all KmerSet in the group
|
|
||||||
func (ksg *KmerSetGroup) Clear() {
|
|
||||||
for _, ks := range ksg.sets {
|
|
||||||
ks.Clear()
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Copy creates a complete copy of the group (consistent with BioSequence.Copy)
|
|
||||||
func (ksg *KmerSetGroup) Copy() *KmerSetGroup {
|
|
||||||
copiedSets := make([]*KmerSet, len(ksg.sets))
|
|
||||||
for i, ks := range ksg.sets {
|
|
||||||
copiedSets[i] = ks.Copy() // Copy each KmerSet with its metadata
|
|
||||||
}
|
|
||||||
|
|
||||||
// Copy group metadata
|
|
||||||
groupMetadata := make(map[string]interface{}, len(ksg.Metadata))
|
|
||||||
for k, v := range ksg.Metadata {
|
|
||||||
groupMetadata[k] = v
|
|
||||||
}
|
|
||||||
|
|
||||||
return &KmerSetGroup{
|
|
||||||
id: ksg.id,
|
|
||||||
k: ksg.k,
|
|
||||||
sets: copiedSets,
|
|
||||||
Metadata: groupMetadata,
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Id returns the identifier of the KmerSetGroup (consistent with BioSequence.Id)
|
|
||||||
func (ksg *KmerSetGroup) Id() string {
|
|
||||||
return ksg.id
|
|
||||||
}
|
|
||||||
|
|
||||||
// SetId sets the identifier of the KmerSetGroup (consistent with BioSequence.SetId)
|
|
||||||
func (ksg *KmerSetGroup) SetId(id string) {
|
|
||||||
ksg.id = id
|
|
||||||
}
|
|
||||||
|
|
||||||
// AddSequence adds all k-mers from a sequence to a specific KmerSet
|
|
||||||
func (ksg *KmerSetGroup) AddSequence(seq *obiseq.BioSequence, index int) {
|
|
||||||
if index < 0 || index >= len(ksg.sets) {
|
|
||||||
panic(fmt.Sprintf("Index out of bounds: %d (size: %d)", index, len(ksg.sets)))
|
|
||||||
}
|
|
||||||
ksg.sets[index].AddSequence(seq)
|
|
||||||
}
|
|
||||||
|
|
||||||
// AddSequences adds all k-mers from multiple sequences to a specific KmerSet
|
|
||||||
func (ksg *KmerSetGroup) AddSequences(sequences *obiseq.BioSequenceSlice, index int) {
|
|
||||||
if index < 0 || index >= len(ksg.sets) {
|
|
||||||
panic(fmt.Sprintf("Index out of bounds: %d (size: %d)", index, len(ksg.sets)))
|
|
||||||
}
|
|
||||||
ksg.sets[index].AddSequences(sequences)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Union returns the union of all KmerSet in the group
|
|
||||||
// Optimization: starts from the largest set to minimize operations
|
|
||||||
func (ksg *KmerSetGroup) Union() *KmerSet {
|
|
||||||
if len(ksg.sets) == 0 {
|
|
||||||
return NewKmerSet(ksg.k)
|
|
||||||
}
|
|
||||||
|
|
||||||
if len(ksg.sets) == 1 {
|
|
||||||
return ksg.sets[0].Copy()
|
|
||||||
}
|
|
||||||
|
|
||||||
// Find the index of the largest set (the one with the most k-mers)
|
|
||||||
maxIdx := 0
|
|
||||||
maxCard := ksg.sets[0].Len()
|
|
||||||
for i := 1; i < len(ksg.sets); i++ {
|
|
||||||
card := ksg.sets[i].Len()
|
|
||||||
if card > maxCard {
|
|
||||||
maxCard = card
|
|
||||||
maxIdx = i
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Copy the largest set and perform unions in-place
|
|
||||||
result := ksg.sets[maxIdx].bitmap.Clone()
|
|
||||||
for i := 0; i < len(ksg.sets); i++ {
|
|
||||||
if i != maxIdx {
|
|
||||||
result.Or(ksg.sets[i].bitmap)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
return NewKmerSetFromBitmap(ksg.k, result)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Intersect returns the intersection of all KmerSet in the group
|
|
||||||
// Optimization: starts from the smallest set to minimize operations
|
|
||||||
func (ksg *KmerSetGroup) Intersect() *KmerSet {
|
|
||||||
if len(ksg.sets) == 0 {
|
|
||||||
return NewKmerSet(ksg.k)
|
|
||||||
}
|
|
||||||
|
|
||||||
if len(ksg.sets) == 1 {
|
|
||||||
return ksg.sets[0].Copy()
|
|
||||||
}
|
|
||||||
|
|
||||||
// Find the index of the smallest set (the one with the fewest k-mers)
|
|
||||||
minIdx := 0
|
|
||||||
minCard := ksg.sets[0].Len()
|
|
||||||
for i := 1; i < len(ksg.sets); i++ {
|
|
||||||
card := ksg.sets[i].Len()
|
|
||||||
if card < minCard {
|
|
||||||
minCard = card
|
|
||||||
minIdx = i
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Copy the smallest set and perform intersections in-place
|
|
||||||
result := ksg.sets[minIdx].bitmap.Clone()
|
|
||||||
for i := 0; i < len(ksg.sets); i++ {
|
|
||||||
if i != minIdx {
|
|
||||||
result.And(ksg.sets[i].bitmap)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
return NewKmerSetFromBitmap(ksg.k, result)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Stats returns statistics for each KmerSet in the group
|
|
||||||
type KmerSetGroupStats struct {
|
|
||||||
K int
|
|
||||||
Size int // Number of KmerSet
|
|
||||||
TotalBytes uint64 // Total memory used
|
|
||||||
Sets []KmerSetStats // Stats of each KmerSet
|
|
||||||
}
|
|
||||||
|
|
||||||
type KmerSetStats struct {
|
|
||||||
Index int // Index of the KmerSet in the group
|
|
||||||
Len uint64 // Number of k-mers
|
|
||||||
SizeBytes uint64 // Size in bytes
|
|
||||||
}
|
|
||||||
|
|
||||||
func (ksg *KmerSetGroup) Stats() KmerSetGroupStats {
|
|
||||||
stats := KmerSetGroupStats{
|
|
||||||
K: ksg.k,
|
|
||||||
Size: len(ksg.sets),
|
|
||||||
Sets: make([]KmerSetStats, len(ksg.sets)),
|
|
||||||
}
|
|
||||||
|
|
||||||
for i, ks := range ksg.sets {
|
|
||||||
sizeBytes := ks.MemoryUsage()
|
|
||||||
stats.Sets[i] = KmerSetStats{
|
|
||||||
Index: i,
|
|
||||||
Len: ks.Len(),
|
|
||||||
SizeBytes: sizeBytes,
|
|
||||||
}
|
|
||||||
stats.TotalBytes += sizeBytes
|
|
||||||
}
|
|
||||||
|
|
||||||
return stats
|
|
||||||
}
|
|
||||||
|
|
||||||
func (ksgs KmerSetGroupStats) String() string {
|
|
||||||
result := fmt.Sprintf(`KmerSetGroup Statistics (k=%d, size=%d):
|
|
||||||
Total memory: %.2f MB
|
|
||||||
|
|
||||||
Set breakdown:
|
|
||||||
`, ksgs.K, ksgs.Size, float64(ksgs.TotalBytes)/1024/1024)
|
|
||||||
|
|
||||||
for _, set := range ksgs.Sets {
|
|
||||||
result += fmt.Sprintf(" Set[%d]: %d k-mers (%.2f MB)\n",
|
|
||||||
set.Index,
|
|
||||||
set.Len,
|
|
||||||
float64(set.SizeBytes)/1024/1024)
|
|
||||||
}
|
|
||||||
|
|
||||||
return result
|
|
||||||
}
|
|
||||||
|
|
||||||
// JaccardDistanceMatrix computes a pairwise Jaccard distance matrix for all KmerSets in the group.
|
|
||||||
// Returns a triangular distance matrix where element (i, j) represents the Jaccard distance
|
|
||||||
// between set i and set j.
|
|
||||||
//
|
|
||||||
// The Jaccard distance is: 1 - (|A ∩ B| / |A ∪ B|)
|
|
||||||
//
|
|
||||||
// The matrix labels are set to the IDs of the individual KmerSets if available,
|
|
||||||
// otherwise they are set to "set_0", "set_1", etc.
|
|
||||||
//
|
|
||||||
// Time complexity: O(n² × (|A| + |B|)) where n is the number of sets
|
|
||||||
// Space complexity: O(n²) for the distance matrix
|
|
||||||
func (ksg *KmerSetGroup) JaccardDistanceMatrix() *obidist.DistMatrix {
|
|
||||||
n := len(ksg.sets)
|
|
||||||
|
|
||||||
// Create labels from set IDs
|
|
||||||
labels := make([]string, n)
|
|
||||||
for i, ks := range ksg.sets {
|
|
||||||
if ks.Id() != "" {
|
|
||||||
labels[i] = ks.Id()
|
|
||||||
} else {
|
|
||||||
labels[i] = fmt.Sprintf("set_%d", i)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
dm := obidist.NewDistMatrixWithLabels(labels)
|
|
||||||
|
|
||||||
// Compute pairwise distances
|
|
||||||
for i := 0; i < n-1; i++ {
|
|
||||||
for j := i + 1; j < n; j++ {
|
|
||||||
distance := ksg.sets[i].JaccardDistance(ksg.sets[j])
|
|
||||||
dm.Set(i, j, distance)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
return dm
|
|
||||||
}
|
|
||||||
|
|
||||||
// JaccardSimilarityMatrix computes a pairwise Jaccard similarity matrix for all KmerSets in the group.
|
|
||||||
// Returns a similarity matrix where element (i, j) represents the Jaccard similarity
|
|
||||||
// between set i and set j.
|
|
||||||
//
|
|
||||||
// The Jaccard similarity is: |A ∩ B| / |A ∪ B|
|
|
||||||
//
|
|
||||||
// The diagonal is 1.0 (similarity of a set to itself).
|
|
||||||
//
|
|
||||||
// The matrix labels are set to the IDs of the individual KmerSets if available,
|
|
||||||
// otherwise they are set to "set_0", "set_1", etc.
|
|
||||||
//
|
|
||||||
// Time complexity: O(n² × (|A| + |B|)) where n is the number of sets
|
|
||||||
// Space complexity: O(n²) for the similarity matrix
|
|
||||||
func (ksg *KmerSetGroup) JaccardSimilarityMatrix() *obidist.DistMatrix {
|
|
||||||
n := len(ksg.sets)
|
|
||||||
|
|
||||||
// Create labels from set IDs
|
|
||||||
labels := make([]string, n)
|
|
||||||
for i, ks := range ksg.sets {
|
|
||||||
if ks.Id() != "" {
|
|
||||||
labels[i] = ks.Id()
|
|
||||||
} else {
|
|
||||||
labels[i] = fmt.Sprintf("set_%d", i)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
sm := obidist.NewSimilarityMatrixWithLabels(labels)
|
|
||||||
|
|
||||||
// Compute pairwise similarities
|
|
||||||
for i := 0; i < n-1; i++ {
|
|
||||||
for j := i + 1; j < n; j++ {
|
|
||||||
similarity := ksg.sets[i].JaccardSimilarity(ksg.sets[j])
|
|
||||||
sm.Set(i, j, similarity)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
return sm
|
|
||||||
}
|
|
||||||
@@ -1,231 +0,0 @@
|
|||||||
package obikmer
|
|
||||||
|
|
||||||
import (
|
|
||||||
"math"
|
|
||||||
"testing"
|
|
||||||
)
|
|
||||||
|
|
||||||
func TestKmerSetGroupJaccardDistanceMatrix(t *testing.T) {
|
|
||||||
ksg := NewKmerSetGroup(5, 3)
|
|
||||||
|
|
||||||
// Set 0: {1, 2, 3}
|
|
||||||
ksg.Get(0).AddKmerCode(1)
|
|
||||||
ksg.Get(0).AddKmerCode(2)
|
|
||||||
ksg.Get(0).AddKmerCode(3)
|
|
||||||
ksg.Get(0).SetId("set_A")
|
|
||||||
|
|
||||||
// Set 1: {2, 3, 4}
|
|
||||||
ksg.Get(1).AddKmerCode(2)
|
|
||||||
ksg.Get(1).AddKmerCode(3)
|
|
||||||
ksg.Get(1).AddKmerCode(4)
|
|
||||||
ksg.Get(1).SetId("set_B")
|
|
||||||
|
|
||||||
// Set 2: {5, 6, 7}
|
|
||||||
ksg.Get(2).AddKmerCode(5)
|
|
||||||
ksg.Get(2).AddKmerCode(6)
|
|
||||||
ksg.Get(2).AddKmerCode(7)
|
|
||||||
ksg.Get(2).SetId("set_C")
|
|
||||||
|
|
||||||
dm := ksg.JaccardDistanceMatrix()
|
|
||||||
|
|
||||||
// Check labels
|
|
||||||
if dm.GetLabel(0) != "set_A" {
|
|
||||||
t.Errorf("Expected label 'set_A' at index 0, got '%s'", dm.GetLabel(0))
|
|
||||||
}
|
|
||||||
if dm.GetLabel(1) != "set_B" {
|
|
||||||
t.Errorf("Expected label 'set_B' at index 1, got '%s'", dm.GetLabel(1))
|
|
||||||
}
|
|
||||||
if dm.GetLabel(2) != "set_C" {
|
|
||||||
t.Errorf("Expected label 'set_C' at index 2, got '%s'", dm.GetLabel(2))
|
|
||||||
}
|
|
||||||
|
|
||||||
// Check distances
|
|
||||||
// Distance(0, 1):
|
|
||||||
// Intersection: {2, 3} -> 2 elements
|
|
||||||
// Union: {1, 2, 3, 4} -> 4 elements
|
|
||||||
// Similarity: 2/4 = 0.5
|
|
||||||
// Distance: 1 - 0.5 = 0.5
|
|
||||||
expectedDist01 := 0.5
|
|
||||||
actualDist01 := dm.Get(0, 1)
|
|
||||||
if math.Abs(actualDist01-expectedDist01) > 1e-10 {
|
|
||||||
t.Errorf("Distance(0, 1): expected %f, got %f", expectedDist01, actualDist01)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Distance(0, 2):
|
|
||||||
// Intersection: {} -> 0 elements
|
|
||||||
// Union: {1, 2, 3, 5, 6, 7} -> 6 elements
|
|
||||||
// Similarity: 0/6 = 0
|
|
||||||
// Distance: 1 - 0 = 1.0
|
|
||||||
expectedDist02 := 1.0
|
|
||||||
actualDist02 := dm.Get(0, 2)
|
|
||||||
if math.Abs(actualDist02-expectedDist02) > 1e-10 {
|
|
||||||
t.Errorf("Distance(0, 2): expected %f, got %f", expectedDist02, actualDist02)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Distance(1, 2):
|
|
||||||
// Intersection: {} -> 0 elements
|
|
||||||
// Union: {2, 3, 4, 5, 6, 7} -> 6 elements
|
|
||||||
// Similarity: 0/6 = 0
|
|
||||||
// Distance: 1 - 0 = 1.0
|
|
||||||
expectedDist12 := 1.0
|
|
||||||
actualDist12 := dm.Get(1, 2)
|
|
||||||
if math.Abs(actualDist12-expectedDist12) > 1e-10 {
|
|
||||||
t.Errorf("Distance(1, 2): expected %f, got %f", expectedDist12, actualDist12)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Check symmetry
|
|
||||||
if dm.Get(0, 1) != dm.Get(1, 0) {
|
|
||||||
t.Errorf("Matrix not symmetric: Get(0, 1) = %f, Get(1, 0) = %f",
|
|
||||||
dm.Get(0, 1), dm.Get(1, 0))
|
|
||||||
}
|
|
||||||
|
|
||||||
// Check diagonal
|
|
||||||
if dm.Get(0, 0) != 0.0 {
|
|
||||||
t.Errorf("Diagonal should be 0, got %f", dm.Get(0, 0))
|
|
||||||
}
|
|
||||||
if dm.Get(1, 1) != 0.0 {
|
|
||||||
t.Errorf("Diagonal should be 0, got %f", dm.Get(1, 1))
|
|
||||||
}
|
|
||||||
if dm.Get(2, 2) != 0.0 {
|
|
||||||
t.Errorf("Diagonal should be 0, got %f", dm.Get(2, 2))
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
func TestKmerSetGroupJaccardSimilarityMatrix(t *testing.T) {
|
|
||||||
ksg := NewKmerSetGroup(5, 3)
|
|
||||||
|
|
||||||
// Set 0: {1, 2, 3}
|
|
||||||
ksg.Get(0).AddKmerCode(1)
|
|
||||||
ksg.Get(0).AddKmerCode(2)
|
|
||||||
ksg.Get(0).AddKmerCode(3)
|
|
||||||
|
|
||||||
// Set 1: {2, 3, 4}
|
|
||||||
ksg.Get(1).AddKmerCode(2)
|
|
||||||
ksg.Get(1).AddKmerCode(3)
|
|
||||||
ksg.Get(1).AddKmerCode(4)
|
|
||||||
|
|
||||||
// Set 2: {1, 2, 3} (same as set 0)
|
|
||||||
ksg.Get(2).AddKmerCode(1)
|
|
||||||
ksg.Get(2).AddKmerCode(2)
|
|
||||||
ksg.Get(2).AddKmerCode(3)
|
|
||||||
|
|
||||||
sm := ksg.JaccardSimilarityMatrix()
|
|
||||||
|
|
||||||
// Check similarities
|
|
||||||
// Similarity(0, 1): 0.5 (as calculated above)
|
|
||||||
expectedSim01 := 0.5
|
|
||||||
actualSim01 := sm.Get(0, 1)
|
|
||||||
if math.Abs(actualSim01-expectedSim01) > 1e-10 {
|
|
||||||
t.Errorf("Similarity(0, 1): expected %f, got %f", expectedSim01, actualSim01)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Similarity(0, 2): 1.0 (identical sets)
|
|
||||||
expectedSim02 := 1.0
|
|
||||||
actualSim02 := sm.Get(0, 2)
|
|
||||||
if math.Abs(actualSim02-expectedSim02) > 1e-10 {
|
|
||||||
t.Errorf("Similarity(0, 2): expected %f, got %f", expectedSim02, actualSim02)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Similarity(1, 2): 0.5
|
|
||||||
// Intersection: {2, 3} -> 2
|
|
||||||
// Union: {1, 2, 3, 4} -> 4
|
|
||||||
// Similarity: 2/4 = 0.5
|
|
||||||
expectedSim12 := 0.5
|
|
||||||
actualSim12 := sm.Get(1, 2)
|
|
||||||
if math.Abs(actualSim12-expectedSim12) > 1e-10 {
|
|
||||||
t.Errorf("Similarity(1, 2): expected %f, got %f", expectedSim12, actualSim12)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Check diagonal (similarity to self = 1.0)
|
|
||||||
if sm.Get(0, 0) != 1.0 {
|
|
||||||
t.Errorf("Diagonal should be 1.0, got %f", sm.Get(0, 0))
|
|
||||||
}
|
|
||||||
if sm.Get(1, 1) != 1.0 {
|
|
||||||
t.Errorf("Diagonal should be 1.0, got %f", sm.Get(1, 1))
|
|
||||||
}
|
|
||||||
if sm.Get(2, 2) != 1.0 {
|
|
||||||
t.Errorf("Diagonal should be 1.0, got %f", sm.Get(2, 2))
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
func TestKmerSetGroupJaccardMatricesRelation(t *testing.T) {
|
|
||||||
ksg := NewKmerSetGroup(5, 4)
|
|
||||||
|
|
||||||
// Create different sets
|
|
||||||
ksg.Get(0).AddKmerCode(1)
|
|
||||||
ksg.Get(0).AddKmerCode(2)
|
|
||||||
|
|
||||||
ksg.Get(1).AddKmerCode(2)
|
|
||||||
ksg.Get(1).AddKmerCode(3)
|
|
||||||
|
|
||||||
ksg.Get(2).AddKmerCode(1)
|
|
||||||
ksg.Get(2).AddKmerCode(2)
|
|
||||||
ksg.Get(2).AddKmerCode(3)
|
|
||||||
|
|
||||||
ksg.Get(3).AddKmerCode(10)
|
|
||||||
ksg.Get(3).AddKmerCode(20)
|
|
||||||
|
|
||||||
dm := ksg.JaccardDistanceMatrix()
|
|
||||||
sm := ksg.JaccardSimilarityMatrix()
|
|
||||||
|
|
||||||
// For all pairs (including diagonal), distance + similarity should equal 1.0
|
|
||||||
for i := 0; i < 4; i++ {
|
|
||||||
for j := 0; j < 4; j++ {
|
|
||||||
distance := dm.Get(i, j)
|
|
||||||
similarity := sm.Get(i, j)
|
|
||||||
sum := distance + similarity
|
|
||||||
|
|
||||||
if math.Abs(sum-1.0) > 1e-10 {
|
|
||||||
t.Errorf("At (%d, %d): distance %f + similarity %f = %f, expected 1.0",
|
|
||||||
i, j, distance, similarity, sum)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
func TestKmerSetGroupJaccardMatrixLabels(t *testing.T) {
|
|
||||||
ksg := NewKmerSetGroup(5, 3)
|
|
||||||
|
|
||||||
// Don't set IDs - should use default labels
|
|
||||||
ksg.Get(0).AddKmerCode(1)
|
|
||||||
ksg.Get(1).AddKmerCode(2)
|
|
||||||
ksg.Get(2).AddKmerCode(3)
|
|
||||||
|
|
||||||
dm := ksg.JaccardDistanceMatrix()
|
|
||||||
|
|
||||||
// Check default labels
|
|
||||||
if dm.GetLabel(0) != "set_0" {
|
|
||||||
t.Errorf("Expected default label 'set_0', got '%s'", dm.GetLabel(0))
|
|
||||||
}
|
|
||||||
if dm.GetLabel(1) != "set_1" {
|
|
||||||
t.Errorf("Expected default label 'set_1', got '%s'", dm.GetLabel(1))
|
|
||||||
}
|
|
||||||
if dm.GetLabel(2) != "set_2" {
|
|
||||||
t.Errorf("Expected default label 'set_2', got '%s'", dm.GetLabel(2))
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
func TestKmerSetGroupJaccardMatrixSize(t *testing.T) {
|
|
||||||
ksg := NewKmerSetGroup(5, 5)
|
|
||||||
|
|
||||||
for i := 0; i < 5; i++ {
|
|
||||||
ksg.Get(i).AddKmerCode(uint64(i))
|
|
||||||
}
|
|
||||||
|
|
||||||
dm := ksg.JaccardDistanceMatrix()
|
|
||||||
|
|
||||||
if dm.Size() != 5 {
|
|
||||||
t.Errorf("Expected matrix size 5, got %d", dm.Size())
|
|
||||||
}
|
|
||||||
|
|
||||||
// All sets are disjoint, so all distances should be 1.0
|
|
||||||
for i := 0; i < 5; i++ {
|
|
||||||
for j := i + 1; j < 5; j++ {
|
|
||||||
dist := dm.Get(i, j)
|
|
||||||
if math.Abs(dist-1.0) > 1e-10 {
|
|
||||||
t.Errorf("Expected distance 1.0 for disjoint sets (%d, %d), got %f",
|
|
||||||
i, j, dist)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
@@ -1,235 +0,0 @@
|
|||||||
package obikmer
|
|
||||||
|
|
||||||
import (
|
|
||||||
"container/heap"
|
|
||||||
|
|
||||||
"github.com/RoaringBitmap/roaring/roaring64"
|
|
||||||
)
|
|
||||||
|
|
||||||
// heapItem represents an element in the min-heap for k-way merge
|
|
||||||
type heapItem struct {
|
|
||||||
value uint64
|
|
||||||
idx int
|
|
||||||
}
|
|
||||||
|
|
||||||
// kmerMinHeap implements heap.Interface for k-way merge algorithm
|
|
||||||
type kmerMinHeap []heapItem
|
|
||||||
|
|
||||||
func (h kmerMinHeap) Len() int { return len(h) }
|
|
||||||
func (h kmerMinHeap) Less(i, j int) bool { return h[i].value < h[j].value }
|
|
||||||
func (h kmerMinHeap) Swap(i, j int) { h[i], h[j] = h[j], h[i] }
|
|
||||||
|
|
||||||
func (h *kmerMinHeap) Push(x interface{}) {
|
|
||||||
*h = append(*h, x.(heapItem))
|
|
||||||
}
|
|
||||||
|
|
||||||
func (h *kmerMinHeap) Pop() interface{} {
|
|
||||||
old := *h
|
|
||||||
n := len(old)
|
|
||||||
x := old[n-1]
|
|
||||||
*h = old[0 : n-1]
|
|
||||||
return x
|
|
||||||
}
|
|
||||||
|
|
||||||
// QuorumAtLeast returns k-mers present in at least q sets
|
|
||||||
//
|
|
||||||
// Algorithm: K-way merge with min-heap counting
|
|
||||||
//
|
|
||||||
// The algorithm processes all k-mers in sorted order using a min-heap:
|
|
||||||
//
|
|
||||||
// 1. Initialize one iterator per non-empty set
|
|
||||||
// 2. Build a min-heap of (value, set_index) pairs, one per iterator
|
|
||||||
// 3. While heap is not empty:
|
|
||||||
// a. Extract the minimum value v from heap
|
|
||||||
// b. Pop ALL heap items with value == v (counting occurrences)
|
|
||||||
// c. If count >= q, add v to result
|
|
||||||
// d. Advance each popped iterator and re-insert into heap if valid
|
|
||||||
//
|
|
||||||
// This ensures each unique k-mer is counted exactly once across all sets.
|
|
||||||
//
|
|
||||||
// Time complexity: O(M log N)
|
|
||||||
// - M = sum of all set cardinalities (total k-mer occurrences)
|
|
||||||
// - N = number of sets
|
|
||||||
// - Each k-mer occurrence is inserted/extracted from heap once: O(M) operations
|
|
||||||
// - Each heap operation costs O(log N)
|
|
||||||
//
|
|
||||||
// Space complexity: O(N)
|
|
||||||
// - Heap contains at most N elements (one per set iterator)
|
|
||||||
// - Output bitmap size depends on quorum result
|
|
||||||
//
|
|
||||||
// Special cases (optimized):
|
|
||||||
// - q <= 0: returns empty set
|
|
||||||
// - q == 1: delegates to Union() (native OR operations)
|
|
||||||
// - q == n: delegates to Intersect() (native AND operations)
|
|
||||||
// - q > n: returns empty set (impossible to satisfy)
|
|
||||||
func (ksg *KmerSetGroup) QuorumAtLeast(q int) *KmerSet {
|
|
||||||
n := len(ksg.sets)
|
|
||||||
|
|
||||||
// Edge cases
|
|
||||||
if q <= 0 || n == 0 {
|
|
||||||
return NewKmerSet(ksg.k)
|
|
||||||
}
|
|
||||||
if q > n {
|
|
||||||
return NewKmerSet(ksg.k)
|
|
||||||
}
|
|
||||||
if q == 1 {
|
|
||||||
return ksg.Union()
|
|
||||||
}
|
|
||||||
if q == n {
|
|
||||||
return ksg.Intersect()
|
|
||||||
}
|
|
||||||
|
|
||||||
// Initialize iterators for all non-empty sets
|
|
||||||
iterators := make([]roaring64.IntIterable64, 0, n)
|
|
||||||
iterIndices := make([]int, 0, n)
|
|
||||||
|
|
||||||
for i, set := range ksg.sets {
|
|
||||||
if set.Len() > 0 {
|
|
||||||
iter := set.bitmap.Iterator()
|
|
||||||
if iter.HasNext() {
|
|
||||||
iterators = append(iterators, iter)
|
|
||||||
iterIndices = append(iterIndices, i)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
if len(iterators) == 0 {
|
|
||||||
return NewKmerSet(ksg.k)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Initialize heap with first value from each iterator
|
|
||||||
h := make(kmerMinHeap, len(iterators))
|
|
||||||
for i, iter := range iterators {
|
|
||||||
h[i] = heapItem{value: iter.Next(), idx: i}
|
|
||||||
}
|
|
||||||
heap.Init(&h)
|
|
||||||
|
|
||||||
// Result bitmap
|
|
||||||
result := roaring64.New()
|
|
||||||
|
|
||||||
// K-way merge with counting
|
|
||||||
for len(h) > 0 {
|
|
||||||
minVal := h[0].value
|
|
||||||
count := 0
|
|
||||||
activeIndices := make([]int, 0, len(h))
|
|
||||||
|
|
||||||
// Pop all elements with same value (count occurrences)
|
|
||||||
for len(h) > 0 && h[0].value == minVal {
|
|
||||||
item := heap.Pop(&h).(heapItem)
|
|
||||||
count++
|
|
||||||
activeIndices = append(activeIndices, item.idx)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Add to result if quorum reached
|
|
||||||
if count >= q {
|
|
||||||
result.Add(minVal)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Advance iterators and re-insert into heap
|
|
||||||
for _, iterIdx := range activeIndices {
|
|
||||||
if iterators[iterIdx].HasNext() {
|
|
||||||
heap.Push(&h, heapItem{
|
|
||||||
value: iterators[iterIdx].Next(),
|
|
||||||
idx: iterIdx,
|
|
||||||
})
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
return NewKmerSetFromBitmap(ksg.k, result)
|
|
||||||
}
|
|
||||||
|
|
||||||
// QuorumAtMost returns k-mers present in at most q sets
|
|
||||||
//
|
|
||||||
// Algorithm: Uses the mathematical identity
|
|
||||||
// AtMost(q) = Union() - AtLeast(q+1)
|
|
||||||
//
|
|
||||||
// Proof:
|
|
||||||
// - Union() contains all k-mers present in at least 1 set
|
|
||||||
// - AtLeast(q+1) contains all k-mers present in q+1 or more sets
|
|
||||||
// - Their difference contains only k-mers present in at most q sets
|
|
||||||
//
|
|
||||||
// Implementation:
|
|
||||||
// 1. Compute U = Union()
|
|
||||||
// 2. Compute A = QuorumAtLeast(q+1)
|
|
||||||
// 3. Return U - A using bitmap AndNot operation
|
|
||||||
//
|
|
||||||
// Time complexity: O(M log N)
|
|
||||||
// - Union(): O(M) with native OR operations
|
|
||||||
// - QuorumAtLeast(q+1): O(M log N)
|
|
||||||
// - AndNot: O(|U|) where |U| <= M
|
|
||||||
// - Total: O(M log N)
|
|
||||||
//
|
|
||||||
// Space complexity: O(N)
|
|
||||||
// - Inherited from QuorumAtLeast heap
|
|
||||||
//
|
|
||||||
// Special cases:
|
|
||||||
// - q <= 0: returns empty set
|
|
||||||
// - q >= n: returns Union() (all k-mers are in at most n sets)
|
|
||||||
func (ksg *KmerSetGroup) QuorumAtMost(q int) *KmerSet {
|
|
||||||
n := len(ksg.sets)
|
|
||||||
|
|
||||||
// Edge cases
|
|
||||||
if q <= 0 {
|
|
||||||
return NewKmerSet(ksg.k)
|
|
||||||
}
|
|
||||||
if q >= n {
|
|
||||||
return ksg.Union()
|
|
||||||
}
|
|
||||||
|
|
||||||
// Compute Union() - AtLeast(q+1)
|
|
||||||
union := ksg.Union()
|
|
||||||
atLeastQ1 := ksg.QuorumAtLeast(q + 1)
|
|
||||||
|
|
||||||
// Difference: elements in union but not in atLeastQ1
|
|
||||||
result := union.bitmap.Clone()
|
|
||||||
result.AndNot(atLeastQ1.bitmap)
|
|
||||||
|
|
||||||
return NewKmerSetFromBitmap(ksg.k, result)
|
|
||||||
}
|
|
||||||
|
|
||||||
// QuorumExactly returns k-mers present in exactly q sets
|
|
||||||
//
|
|
||||||
// Algorithm: Uses the mathematical identity
|
|
||||||
// Exactly(q) = AtLeast(q) - AtLeast(q+1)
|
|
||||||
//
|
|
||||||
// Proof:
|
|
||||||
// - AtLeast(q) contains all k-mers present in q or more sets
|
|
||||||
// - AtLeast(q+1) contains all k-mers present in q+1 or more sets
|
|
||||||
// - Their difference contains only k-mers present in exactly q sets
|
|
||||||
//
|
|
||||||
// Implementation:
|
|
||||||
// 1. Compute A = QuorumAtLeast(q)
|
|
||||||
// 2. Compute B = QuorumAtLeast(q+1)
|
|
||||||
// 3. Return A - B using bitmap AndNot operation
|
|
||||||
//
|
|
||||||
// Time complexity: O(M log N)
|
|
||||||
// - Two calls to QuorumAtLeast: 2 * O(M log N)
|
|
||||||
// - One AndNot operation: O(|A|) where |A| <= M
|
|
||||||
// - Total: O(M log N) since AndNot is dominated by merge operations
|
|
||||||
//
|
|
||||||
// Space complexity: O(N)
|
|
||||||
// - Inherited from QuorumAtLeast heap
|
|
||||||
// - Two temporary bitmaps for intermediate results
|
|
||||||
//
|
|
||||||
// Special cases:
|
|
||||||
// - q <= 0: returns empty set
|
|
||||||
// - q > n: returns empty set (impossible to have k-mer in more than n sets)
|
|
||||||
func (ksg *KmerSetGroup) QuorumExactly(q int) *KmerSet {
|
|
||||||
n := len(ksg.sets)
|
|
||||||
|
|
||||||
// Edge cases
|
|
||||||
if q <= 0 || q > n {
|
|
||||||
return NewKmerSet(ksg.k)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Compute AtLeast(q) - AtLeast(q+1)
|
|
||||||
aq := ksg.QuorumAtLeast(q)
|
|
||||||
aq1 := ksg.QuorumAtLeast(q + 1)
|
|
||||||
|
|
||||||
// Difference: elements in aq but not in aq1
|
|
||||||
result := aq.bitmap.Clone()
|
|
||||||
result.AndNot(aq1.bitmap)
|
|
||||||
|
|
||||||
return NewKmerSetFromBitmap(ksg.k, result)
|
|
||||||
}
|
|
||||||
@@ -1,395 +0,0 @@
|
|||||||
package obikmer
|
|
||||||
|
|
||||||
import (
|
|
||||||
"testing"
|
|
||||||
)
|
|
||||||
|
|
||||||
// TestQuorumAtLeastEdgeCases tests edge cases for QuorumAtLeast
|
|
||||||
func TestQuorumAtLeastEdgeCases(t *testing.T) {
|
|
||||||
k := 5
|
|
||||||
|
|
||||||
// Test group with all empty sets
|
|
||||||
emptyGroup := NewKmerSetGroup(k, 3)
|
|
||||||
result := emptyGroup.QuorumAtLeast(1)
|
|
||||||
if result.Len() != 0 {
|
|
||||||
t.Errorf("Empty sets: expected 0 k-mers, got %d", result.Len())
|
|
||||||
}
|
|
||||||
|
|
||||||
// Test q <= 0
|
|
||||||
group := NewKmerSetGroup(k, 3)
|
|
||||||
result = group.QuorumAtLeast(0)
|
|
||||||
if result.Len() != 0 {
|
|
||||||
t.Errorf("q=0: expected 0 k-mers, got %d", result.Len())
|
|
||||||
}
|
|
||||||
|
|
||||||
result = group.QuorumAtLeast(-1)
|
|
||||||
if result.Len() != 0 {
|
|
||||||
t.Errorf("q=-1: expected 0 k-mers, got %d", result.Len())
|
|
||||||
}
|
|
||||||
|
|
||||||
// Test q > n
|
|
||||||
group.Get(0).AddKmerCode(1)
|
|
||||||
result = group.QuorumAtLeast(10)
|
|
||||||
if result.Len() != 0 {
|
|
||||||
t.Errorf("q>n: expected 0 k-mers, got %d", result.Len())
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// TestQuorumAtLeastQ1 tests q=1 (should equal Union)
|
|
||||||
func TestQuorumAtLeastQ1(t *testing.T) {
|
|
||||||
k := 5
|
|
||||||
group := NewKmerSetGroup(k, 3)
|
|
||||||
|
|
||||||
// Add different k-mers to each set
|
|
||||||
group.Get(0).AddKmerCode(1)
|
|
||||||
group.Get(0).AddKmerCode(2)
|
|
||||||
group.Get(1).AddKmerCode(2)
|
|
||||||
group.Get(1).AddKmerCode(3)
|
|
||||||
group.Get(2).AddKmerCode(3)
|
|
||||||
group.Get(2).AddKmerCode(4)
|
|
||||||
|
|
||||||
quorum := group.QuorumAtLeast(1)
|
|
||||||
union := group.Union()
|
|
||||||
|
|
||||||
if quorum.Len() != union.Len() {
|
|
||||||
t.Errorf("QuorumAtLeast(1) length %d != Union length %d", quorum.Len(), union.Len())
|
|
||||||
}
|
|
||||||
|
|
||||||
// Check all elements match
|
|
||||||
for kmer := uint64(1); kmer <= 4; kmer++ {
|
|
||||||
if quorum.Contains(kmer) != union.Contains(kmer) {
|
|
||||||
t.Errorf("Mismatch for k-mer %d", kmer)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// TestQuorumAtLeastQN tests q=n (should equal Intersect)
|
|
||||||
func TestQuorumAtLeastQN(t *testing.T) {
|
|
||||||
k := 5
|
|
||||||
group := NewKmerSetGroup(k, 3)
|
|
||||||
|
|
||||||
// Add some common k-mers and some unique
|
|
||||||
for i := 0; i < 3; i++ {
|
|
||||||
group.Get(i).AddKmerCode(10) // common to all
|
|
||||||
group.Get(i).AddKmerCode(20) // common to all
|
|
||||||
}
|
|
||||||
group.Get(0).AddKmerCode(1) // unique to set 0
|
|
||||||
group.Get(1).AddKmerCode(2) // unique to set 1
|
|
||||||
|
|
||||||
quorum := group.QuorumAtLeast(3)
|
|
||||||
intersect := group.Intersect()
|
|
||||||
|
|
||||||
if quorum.Len() != intersect.Len() {
|
|
||||||
t.Errorf("QuorumAtLeast(n) length %d != Intersect length %d", quorum.Len(), intersect.Len())
|
|
||||||
}
|
|
||||||
|
|
||||||
if quorum.Len() != 2 {
|
|
||||||
t.Errorf("Expected 2 common k-mers, got %d", quorum.Len())
|
|
||||||
}
|
|
||||||
|
|
||||||
if !quorum.Contains(10) || !quorum.Contains(20) {
|
|
||||||
t.Error("Missing common k-mers")
|
|
||||||
}
|
|
||||||
|
|
||||||
if quorum.Contains(1) || quorum.Contains(2) {
|
|
||||||
t.Error("Unique k-mers should not be in result")
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// TestQuorumAtLeastGeneral tests general quorum values
|
|
||||||
func TestQuorumAtLeastGeneral(t *testing.T) {
|
|
||||||
k := 5
|
|
||||||
group := NewKmerSetGroup(k, 5)
|
|
||||||
|
|
||||||
// Setup: k-mer i appears in i sets (for i=1..5)
|
|
||||||
// k-mer 1: in set 0
|
|
||||||
// k-mer 2: in sets 0,1
|
|
||||||
// k-mer 3: in sets 0,1,2
|
|
||||||
// k-mer 4: in sets 0,1,2,3
|
|
||||||
// k-mer 5: in sets 0,1,2,3,4 (all)
|
|
||||||
|
|
||||||
for kmer := uint64(1); kmer <= 5; kmer++ {
|
|
||||||
for setIdx := 0; setIdx < int(kmer); setIdx++ {
|
|
||||||
group.Get(setIdx).AddKmerCode(kmer)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
tests := []struct {
|
|
||||||
q int
|
|
||||||
expected map[uint64]bool
|
|
||||||
}{
|
|
||||||
{1, map[uint64]bool{1: true, 2: true, 3: true, 4: true, 5: true}},
|
|
||||||
{2, map[uint64]bool{2: true, 3: true, 4: true, 5: true}},
|
|
||||||
{3, map[uint64]bool{3: true, 4: true, 5: true}},
|
|
||||||
{4, map[uint64]bool{4: true, 5: true}},
|
|
||||||
{5, map[uint64]bool{5: true}},
|
|
||||||
}
|
|
||||||
|
|
||||||
for _, tt := range tests {
|
|
||||||
result := group.QuorumAtLeast(tt.q)
|
|
||||||
|
|
||||||
if result.Len() != uint64(len(tt.expected)) {
|
|
||||||
t.Errorf("q=%d: expected %d k-mers, got %d", tt.q, len(tt.expected), result.Len())
|
|
||||||
}
|
|
||||||
|
|
||||||
for kmer := uint64(1); kmer <= 5; kmer++ {
|
|
||||||
shouldContain := tt.expected[kmer]
|
|
||||||
doesContain := result.Contains(kmer)
|
|
||||||
if shouldContain != doesContain {
|
|
||||||
t.Errorf("q=%d, k-mer=%d: expected contains=%v, got %v", tt.q, kmer, shouldContain, doesContain)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// TestQuorumExactlyBasic tests QuorumExactly basic functionality
|
|
||||||
func TestQuorumExactlyBasic(t *testing.T) {
|
|
||||||
k := 5
|
|
||||||
group := NewKmerSetGroup(k, 5)
|
|
||||||
|
|
||||||
// Setup: k-mer i appears in exactly i sets
|
|
||||||
for kmer := uint64(1); kmer <= 5; kmer++ {
|
|
||||||
for setIdx := 0; setIdx < int(kmer); setIdx++ {
|
|
||||||
group.Get(setIdx).AddKmerCode(kmer)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
tests := []struct {
|
|
||||||
q int
|
|
||||||
expected []uint64
|
|
||||||
}{
|
|
||||||
{1, []uint64{1}},
|
|
||||||
{2, []uint64{2}},
|
|
||||||
{3, []uint64{3}},
|
|
||||||
{4, []uint64{4}},
|
|
||||||
{5, []uint64{5}},
|
|
||||||
}
|
|
||||||
|
|
||||||
for _, tt := range tests {
|
|
||||||
result := group.QuorumExactly(tt.q)
|
|
||||||
|
|
||||||
if result.Len() != uint64(len(tt.expected)) {
|
|
||||||
t.Errorf("q=%d: expected %d k-mers, got %d", tt.q, len(tt.expected), result.Len())
|
|
||||||
}
|
|
||||||
|
|
||||||
for _, kmer := range tt.expected {
|
|
||||||
if !result.Contains(kmer) {
|
|
||||||
t.Errorf("q=%d: missing k-mer %d", tt.q, kmer)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// TestQuorumIdentity tests the mathematical identity: Exactly(q) = AtLeast(q) - AtLeast(q+1)
|
|
||||||
func TestQuorumIdentity(t *testing.T) {
|
|
||||||
k := 5
|
|
||||||
group := NewKmerSetGroup(k, 4)
|
|
||||||
|
|
||||||
// Add random distribution
|
|
||||||
group.Get(0).AddKmerCode(1)
|
|
||||||
group.Get(0).AddKmerCode(2)
|
|
||||||
group.Get(0).AddKmerCode(3)
|
|
||||||
|
|
||||||
group.Get(1).AddKmerCode(2)
|
|
||||||
group.Get(1).AddKmerCode(3)
|
|
||||||
group.Get(1).AddKmerCode(4)
|
|
||||||
|
|
||||||
group.Get(2).AddKmerCode(3)
|
|
||||||
group.Get(2).AddKmerCode(4)
|
|
||||||
|
|
||||||
group.Get(3).AddKmerCode(4)
|
|
||||||
|
|
||||||
for q := 1; q <= 4; q++ {
|
|
||||||
exactly := group.QuorumExactly(q)
|
|
||||||
atLeast := group.QuorumAtLeast(q)
|
|
||||||
atLeastPlus1 := group.QuorumAtLeast(q + 1)
|
|
||||||
|
|
||||||
// Verify: every element in exactly(q) is in atLeast(q)
|
|
||||||
iter := exactly.Iterator()
|
|
||||||
for iter.HasNext() {
|
|
||||||
kmer := iter.Next()
|
|
||||||
if !atLeast.Contains(kmer) {
|
|
||||||
t.Errorf("q=%d: k-mer %d in Exactly but not in AtLeast", q, kmer)
|
|
||||||
}
|
|
||||||
if atLeastPlus1.Contains(kmer) {
|
|
||||||
t.Errorf("q=%d: k-mer %d in Exactly but also in AtLeast(q+1)", q, kmer)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// TestQuorumDisjointSets tests quorum on completely disjoint sets
|
|
||||||
func TestQuorumDisjointSets(t *testing.T) {
|
|
||||||
k := 5
|
|
||||||
group := NewKmerSetGroup(k, 3)
|
|
||||||
|
|
||||||
// Each set has unique k-mers
|
|
||||||
group.Get(0).AddKmerCode(1)
|
|
||||||
group.Get(1).AddKmerCode(2)
|
|
||||||
group.Get(2).AddKmerCode(3)
|
|
||||||
|
|
||||||
// q=1 should give all
|
|
||||||
result := group.QuorumAtLeast(1)
|
|
||||||
if result.Len() != 3 {
|
|
||||||
t.Errorf("Disjoint sets q=1: expected 3, got %d", result.Len())
|
|
||||||
}
|
|
||||||
|
|
||||||
// q=2 should give none
|
|
||||||
result = group.QuorumAtLeast(2)
|
|
||||||
if result.Len() != 0 {
|
|
||||||
t.Errorf("Disjoint sets q=2: expected 0, got %d", result.Len())
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// TestQuorumIdenticalSets tests quorum on identical sets
|
|
||||||
func TestQuorumIdenticalSets(t *testing.T) {
|
|
||||||
k := 5
|
|
||||||
group := NewKmerSetGroup(k, 3)
|
|
||||||
|
|
||||||
// All sets have same k-mers
|
|
||||||
for i := 0; i < 3; i++ {
|
|
||||||
group.Get(i).AddKmerCode(10)
|
|
||||||
group.Get(i).AddKmerCode(20)
|
|
||||||
group.Get(i).AddKmerCode(30)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Any q <= n should give all k-mers
|
|
||||||
for q := 1; q <= 3; q++ {
|
|
||||||
result := group.QuorumAtLeast(q)
|
|
||||||
if result.Len() != 3 {
|
|
||||||
t.Errorf("Identical sets q=%d: expected 3, got %d", q, result.Len())
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// TestQuorumLargeNumbers tests with large k-mer values
|
|
||||||
func TestQuorumLargeNumbers(t *testing.T) {
|
|
||||||
k := 21
|
|
||||||
group := NewKmerSetGroup(k, 3)
|
|
||||||
|
|
||||||
// Use large uint64 values (actual k-mer encodings)
|
|
||||||
largeKmers := []uint64{
|
|
||||||
0x1234567890ABCDEF,
|
|
||||||
0xFEDCBA0987654321,
|
|
||||||
0xAAAAAAAAAAAAAAAA,
|
|
||||||
}
|
|
||||||
|
|
||||||
// Add to multiple sets
|
|
||||||
for i := 0; i < 3; i++ {
|
|
||||||
for j := 0; j <= i; j++ {
|
|
||||||
group.Get(j).AddKmerCode(largeKmers[i])
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
result := group.QuorumAtLeast(2)
|
|
||||||
if result.Len() != 2 {
|
|
||||||
t.Errorf("Large numbers q=2: expected 2, got %d", result.Len())
|
|
||||||
}
|
|
||||||
|
|
||||||
if !result.Contains(largeKmers[1]) || !result.Contains(largeKmers[2]) {
|
|
||||||
t.Error("Large numbers: wrong k-mers in result")
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// TestQuorumAtMostBasic tests QuorumAtMost basic functionality
|
|
||||||
func TestQuorumAtMostBasic(t *testing.T) {
|
|
||||||
k := 5
|
|
||||||
group := NewKmerSetGroup(k, 5)
|
|
||||||
|
|
||||||
// Setup: k-mer i appears in exactly i sets
|
|
||||||
for kmer := uint64(1); kmer <= 5; kmer++ {
|
|
||||||
for setIdx := 0; setIdx < int(kmer); setIdx++ {
|
|
||||||
group.Get(setIdx).AddKmerCode(kmer)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
tests := []struct {
|
|
||||||
q int
|
|
||||||
expected []uint64
|
|
||||||
}{
|
|
||||||
{0, []uint64{}}, // at most 0: none
|
|
||||||
{1, []uint64{1}}, // at most 1: only k-mer 1
|
|
||||||
{2, []uint64{1, 2}}, // at most 2: k-mers 1,2
|
|
||||||
{3, []uint64{1, 2, 3}}, // at most 3: k-mers 1,2,3
|
|
||||||
{4, []uint64{1, 2, 3, 4}}, // at most 4: k-mers 1,2,3,4
|
|
||||||
{5, []uint64{1, 2, 3, 4, 5}}, // at most 5: all k-mers
|
|
||||||
{10, []uint64{1, 2, 3, 4, 5}}, // at most 10: all k-mers
|
|
||||||
}
|
|
||||||
|
|
||||||
for _, tt := range tests {
|
|
||||||
result := group.QuorumAtMost(tt.q)
|
|
||||||
|
|
||||||
if result.Len() != uint64(len(tt.expected)) {
|
|
||||||
t.Errorf("q=%d: expected %d k-mers, got %d", tt.q, len(tt.expected), result.Len())
|
|
||||||
}
|
|
||||||
|
|
||||||
for _, kmer := range tt.expected {
|
|
||||||
if !result.Contains(kmer) {
|
|
||||||
t.Errorf("q=%d: missing k-mer %d", tt.q, kmer)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// TestQuorumComplementIdentity tests that AtLeast and AtMost are complementary
|
|
||||||
func TestQuorumComplementIdentity(t *testing.T) {
|
|
||||||
k := 5
|
|
||||||
group := NewKmerSetGroup(k, 4)
|
|
||||||
|
|
||||||
// Add random distribution
|
|
||||||
group.Get(0).AddKmerCode(1)
|
|
||||||
group.Get(0).AddKmerCode(2)
|
|
||||||
group.Get(0).AddKmerCode(3)
|
|
||||||
|
|
||||||
group.Get(1).AddKmerCode(2)
|
|
||||||
group.Get(1).AddKmerCode(3)
|
|
||||||
group.Get(1).AddKmerCode(4)
|
|
||||||
|
|
||||||
group.Get(2).AddKmerCode(3)
|
|
||||||
group.Get(2).AddKmerCode(4)
|
|
||||||
|
|
||||||
group.Get(3).AddKmerCode(4)
|
|
||||||
|
|
||||||
union := group.Union()
|
|
||||||
|
|
||||||
for q := 1; q < 4; q++ {
|
|
||||||
atMost := group.QuorumAtMost(q)
|
|
||||||
atLeast := group.QuorumAtLeast(q + 1)
|
|
||||||
|
|
||||||
// Verify: AtMost(q) ∪ AtLeast(q+1) = Union()
|
|
||||||
combined := atMost.Union(atLeast)
|
|
||||||
|
|
||||||
if combined.Len() != union.Len() {
|
|
||||||
t.Errorf("q=%d: AtMost(q) ∪ AtLeast(q+1) has %d k-mers, Union has %d",
|
|
||||||
q, combined.Len(), union.Len())
|
|
||||||
}
|
|
||||||
|
|
||||||
// Verify: AtMost(q) ∩ AtLeast(q+1) = ∅
|
|
||||||
overlap := atMost.Intersect(atLeast)
|
|
||||||
if overlap.Len() != 0 {
|
|
||||||
t.Errorf("q=%d: AtMost(q) and AtLeast(q+1) overlap with %d k-mers",
|
|
||||||
q, overlap.Len())
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// BenchmarkQuorumAtLeast benchmarks quorum operations
|
|
||||||
func BenchmarkQuorumAtLeast(b *testing.B) {
|
|
||||||
k := 21
|
|
||||||
n := 10
|
|
||||||
group := NewKmerSetGroup(k, n)
|
|
||||||
|
|
||||||
// Populate with realistic data
|
|
||||||
for i := 0; i < n; i++ {
|
|
||||||
for j := uint64(0); j < 10000; j++ {
|
|
||||||
if (j % uint64(n)) <= uint64(i) {
|
|
||||||
group.Get(i).AddKmerCode(j)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
b.ResetTimer()
|
|
||||||
for i := 0; i < b.N; i++ {
|
|
||||||
_ = group.QuorumAtLeast(5)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
@@ -1,376 +0,0 @@
|
|||||||
package obikmer
|
|
||||||
|
|
||||||
import (
|
|
||||||
"encoding/json"
|
|
||||||
"fmt"
|
|
||||||
"os"
|
|
||||||
"path/filepath"
|
|
||||||
"strings"
|
|
||||||
|
|
||||||
"github.com/pelletier/go-toml/v2"
|
|
||||||
"gopkg.in/yaml.v3"
|
|
||||||
)
|
|
||||||
|
|
||||||
// MetadataFormat represents the metadata serialization format
|
|
||||||
type MetadataFormat int
|
|
||||||
|
|
||||||
const (
|
|
||||||
FormatTOML MetadataFormat = iota
|
|
||||||
FormatYAML
|
|
||||||
FormatJSON
|
|
||||||
)
|
|
||||||
|
|
||||||
// String returns the file extension for the format
|
|
||||||
func (f MetadataFormat) String() string {
|
|
||||||
switch f {
|
|
||||||
case FormatTOML:
|
|
||||||
return "toml"
|
|
||||||
case FormatYAML:
|
|
||||||
return "yaml"
|
|
||||||
case FormatJSON:
|
|
||||||
return "json"
|
|
||||||
default:
|
|
||||||
return "toml"
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// KmerSetMetadata contient les métadonnées d'un KmerSet ou KmerSetGroup
|
|
||||||
type KmerSetMetadata struct {
|
|
||||||
ID string `toml:"id,omitempty" yaml:"id,omitempty" json:"id,omitempty"` // Identifiant unique
|
|
||||||
K int `toml:"k" yaml:"k" json:"k"` // Taille des k-mers
|
|
||||||
Type string `toml:"type" yaml:"type" json:"type"` // "KmerSet" ou "KmerSetGroup"
|
|
||||||
Size int `toml:"size" yaml:"size" json:"size"` // 1 pour KmerSet, n pour KmerSetGroup
|
|
||||||
Files []string `toml:"files" yaml:"files" json:"files"` // Liste des fichiers .roaring
|
|
||||||
SetsIDs []string `toml:"sets_ids,omitempty" yaml:"sets_ids,omitempty" json:"sets_ids,omitempty"` // IDs des KmerSet individuels
|
|
||||||
UserMetadata map[string]interface{} `toml:"user_metadata,omitempty" yaml:"user_metadata,omitempty" json:"user_metadata,omitempty"` // Métadonnées KmerSet ou KmerSetGroup
|
|
||||||
SetsMetadata []map[string]interface{} `toml:"sets_metadata,omitempty" yaml:"sets_metadata,omitempty" json:"sets_metadata,omitempty"` // Métadonnées des KmerSet individuels dans un KmerSetGroup
|
|
||||||
}
|
|
||||||
|
|
||||||
// SaveKmerSet sauvegarde un KmerSet dans un répertoire
|
|
||||||
// Format: directory/metadata.{toml,yaml,json} + directory/set_0.roaring
|
|
||||||
func (ks *KmerSet) Save(directory string, format MetadataFormat) error {
|
|
||||||
// Créer le répertoire si nécessaire
|
|
||||||
if err := os.MkdirAll(directory, 0755); err != nil {
|
|
||||||
return fmt.Errorf("failed to create directory %s: %w", directory, err)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Métadonnées
|
|
||||||
metadata := KmerSetMetadata{
|
|
||||||
ID: ks.id,
|
|
||||||
K: ks.k,
|
|
||||||
Type: "KmerSet",
|
|
||||||
Size: 1,
|
|
||||||
Files: []string{"set_0.roaring"},
|
|
||||||
UserMetadata: ks.Metadata, // Sauvegarder les métadonnées utilisateur
|
|
||||||
}
|
|
||||||
|
|
||||||
// Sauvegarder les métadonnées
|
|
||||||
if err := saveMetadata(filepath.Join(directory, "metadata."+format.String()), metadata, format); err != nil {
|
|
||||||
return err
|
|
||||||
}
|
|
||||||
|
|
||||||
// Sauvegarder le bitmap
|
|
||||||
bitmapPath := filepath.Join(directory, "set_0.roaring")
|
|
||||||
file, err := os.Create(bitmapPath)
|
|
||||||
if err != nil {
|
|
||||||
return fmt.Errorf("failed to create bitmap file %s: %w", bitmapPath, err)
|
|
||||||
}
|
|
||||||
defer file.Close()
|
|
||||||
|
|
||||||
if _, err := ks.bitmap.WriteTo(file); err != nil {
|
|
||||||
return fmt.Errorf("failed to write bitmap: %w", err)
|
|
||||||
}
|
|
||||||
|
|
||||||
return nil
|
|
||||||
}
|
|
||||||
|
|
||||||
// LoadKmerSet charge un KmerSet depuis un répertoire
|
|
||||||
func LoadKmerSet(directory string) (*KmerSet, error) {
|
|
||||||
// Lire les métadonnées (essayer tous les formats)
|
|
||||||
metadata, err := loadMetadata(directory)
|
|
||||||
if err != nil {
|
|
||||||
return nil, err
|
|
||||||
}
|
|
||||||
|
|
||||||
// Vérifier le type
|
|
||||||
if metadata.Type != "KmerSet" {
|
|
||||||
return nil, fmt.Errorf("invalid type: expected KmerSet, got %s", metadata.Type)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Vérifier qu'il n'y a qu'un seul fichier
|
|
||||||
if metadata.Size != 1 || len(metadata.Files) != 1 {
|
|
||||||
return nil, fmt.Errorf("KmerSet must have exactly 1 bitmap file, got %d", len(metadata.Files))
|
|
||||||
}
|
|
||||||
|
|
||||||
// Charger le bitmap
|
|
||||||
bitmapPath := filepath.Join(directory, metadata.Files[0])
|
|
||||||
file, err := os.Open(bitmapPath)
|
|
||||||
if err != nil {
|
|
||||||
return nil, fmt.Errorf("failed to open bitmap file %s: %w", bitmapPath, err)
|
|
||||||
}
|
|
||||||
defer file.Close()
|
|
||||||
|
|
||||||
ks := NewKmerSet(metadata.K)
|
|
||||||
|
|
||||||
// Charger l'ID
|
|
||||||
ks.id = metadata.ID
|
|
||||||
|
|
||||||
// Charger les métadonnées utilisateur
|
|
||||||
if metadata.UserMetadata != nil {
|
|
||||||
ks.Metadata = metadata.UserMetadata
|
|
||||||
}
|
|
||||||
|
|
||||||
if _, err := ks.bitmap.ReadFrom(file); err != nil {
|
|
||||||
return nil, fmt.Errorf("failed to read bitmap: %w", err)
|
|
||||||
}
|
|
||||||
|
|
||||||
return ks, nil
|
|
||||||
}
|
|
||||||
|
|
||||||
// SaveKmerSetGroup sauvegarde un KmerSetGroup dans un répertoire
|
|
||||||
// Format: directory/metadata.{toml,yaml,json} + directory/set_0.roaring, set_1.roaring, ...
|
|
||||||
func (ksg *KmerSetGroup) Save(directory string, format MetadataFormat) error {
|
|
||||||
// Créer le répertoire si nécessaire
|
|
||||||
if err := os.MkdirAll(directory, 0755); err != nil {
|
|
||||||
return fmt.Errorf("failed to create directory %s: %w", directory, err)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Métadonnées
|
|
||||||
files := make([]string, len(ksg.sets))
|
|
||||||
for i := range ksg.sets {
|
|
||||||
files[i] = fmt.Sprintf("set_%d.roaring", i)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Collecter les IDs et métadonnées de chaque KmerSet individuel
|
|
||||||
setsIDs := make([]string, len(ksg.sets))
|
|
||||||
setsMetadata := make([]map[string]interface{}, len(ksg.sets))
|
|
||||||
for i, ks := range ksg.sets {
|
|
||||||
setsIDs[i] = ks.id
|
|
||||||
setsMetadata[i] = ks.Metadata
|
|
||||||
}
|
|
||||||
|
|
||||||
metadata := KmerSetMetadata{
|
|
||||||
ID: ksg.id,
|
|
||||||
K: ksg.k,
|
|
||||||
Type: "KmerSetGroup",
|
|
||||||
Size: len(ksg.sets),
|
|
||||||
Files: files,
|
|
||||||
SetsIDs: setsIDs, // IDs de chaque set
|
|
||||||
UserMetadata: ksg.Metadata, // Métadonnées du groupe
|
|
||||||
SetsMetadata: setsMetadata, // Métadonnées de chaque set
|
|
||||||
}
|
|
||||||
|
|
||||||
// Sauvegarder les métadonnées
|
|
||||||
if err := saveMetadata(filepath.Join(directory, "metadata."+format.String()), metadata, format); err != nil {
|
|
||||||
return err
|
|
||||||
}
|
|
||||||
|
|
||||||
// Sauvegarder chaque bitmap
|
|
||||||
for i, ks := range ksg.sets {
|
|
||||||
bitmapPath := filepath.Join(directory, files[i])
|
|
||||||
file, err := os.Create(bitmapPath)
|
|
||||||
if err != nil {
|
|
||||||
return fmt.Errorf("failed to create bitmap file %s: %w", bitmapPath, err)
|
|
||||||
}
|
|
||||||
|
|
||||||
if _, err := ks.bitmap.WriteTo(file); err != nil {
|
|
||||||
file.Close()
|
|
||||||
return fmt.Errorf("failed to write bitmap %d: %w", i, err)
|
|
||||||
}
|
|
||||||
file.Close()
|
|
||||||
}
|
|
||||||
|
|
||||||
return nil
|
|
||||||
}
|
|
||||||
|
|
||||||
// LoadKmerSetGroup charge un KmerSetGroup depuis un répertoire
|
|
||||||
func LoadKmerSetGroup(directory string) (*KmerSetGroup, error) {
|
|
||||||
// Lire les métadonnées (essayer tous les formats)
|
|
||||||
metadata, err := loadMetadata(directory)
|
|
||||||
if err != nil {
|
|
||||||
return nil, err
|
|
||||||
}
|
|
||||||
|
|
||||||
// Vérifier le type
|
|
||||||
if metadata.Type != "KmerSetGroup" {
|
|
||||||
return nil, fmt.Errorf("invalid type: expected KmerSetGroup, got %s", metadata.Type)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Vérifier la cohérence
|
|
||||||
if metadata.Size != len(metadata.Files) {
|
|
||||||
return nil, fmt.Errorf("size mismatch: size=%d but %d files listed", metadata.Size, len(metadata.Files))
|
|
||||||
}
|
|
||||||
|
|
||||||
// Créer le groupe
|
|
||||||
ksg := NewKmerSetGroup(metadata.K, metadata.Size)
|
|
||||||
|
|
||||||
// Charger l'ID du groupe
|
|
||||||
ksg.id = metadata.ID
|
|
||||||
|
|
||||||
// Charger les métadonnées du groupe
|
|
||||||
if metadata.UserMetadata != nil {
|
|
||||||
ksg.Metadata = metadata.UserMetadata
|
|
||||||
}
|
|
||||||
|
|
||||||
// Charger les IDs de chaque KmerSet
|
|
||||||
if metadata.SetsIDs != nil && len(metadata.SetsIDs) == metadata.Size {
|
|
||||||
for i := range ksg.sets {
|
|
||||||
ksg.sets[i].id = metadata.SetsIDs[i]
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Charger les métadonnées de chaque KmerSet individuel
|
|
||||||
if metadata.SetsMetadata != nil {
|
|
||||||
if len(metadata.SetsMetadata) != metadata.Size {
|
|
||||||
return nil, fmt.Errorf("sets metadata size mismatch: expected %d, got %d", metadata.Size, len(metadata.SetsMetadata))
|
|
||||||
}
|
|
||||||
for i := range ksg.sets {
|
|
||||||
ksg.sets[i].Metadata = metadata.SetsMetadata[i]
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Charger chaque bitmap
|
|
||||||
for i, filename := range metadata.Files {
|
|
||||||
bitmapPath := filepath.Join(directory, filename)
|
|
||||||
file, err := os.Open(bitmapPath)
|
|
||||||
if err != nil {
|
|
||||||
return nil, fmt.Errorf("failed to open bitmap file %s: %w", bitmapPath, err)
|
|
||||||
}
|
|
||||||
|
|
||||||
if _, err := ksg.sets[i].bitmap.ReadFrom(file); err != nil {
|
|
||||||
file.Close()
|
|
||||||
return nil, fmt.Errorf("failed to read bitmap %d: %w", i, err)
|
|
||||||
}
|
|
||||||
file.Close()
|
|
||||||
}
|
|
||||||
|
|
||||||
return ksg, nil
|
|
||||||
}
|
|
||||||
|
|
||||||
// saveMetadata sauvegarde les métadonnées dans le format spécifié
|
|
||||||
func saveMetadata(path string, metadata KmerSetMetadata, format MetadataFormat) error {
|
|
||||||
file, err := os.Create(path)
|
|
||||||
if err != nil {
|
|
||||||
return fmt.Errorf("failed to create metadata file %s: %w", path, err)
|
|
||||||
}
|
|
||||||
defer file.Close()
|
|
||||||
|
|
||||||
var encoder interface{ Encode(interface{}) error }
|
|
||||||
|
|
||||||
switch format {
|
|
||||||
case FormatTOML:
|
|
||||||
encoder = toml.NewEncoder(file)
|
|
||||||
case FormatYAML:
|
|
||||||
encoder = yaml.NewEncoder(file)
|
|
||||||
case FormatJSON:
|
|
||||||
jsonEncoder := json.NewEncoder(file)
|
|
||||||
jsonEncoder.SetIndent("", " ")
|
|
||||||
encoder = jsonEncoder
|
|
||||||
default:
|
|
||||||
return fmt.Errorf("unsupported format: %v", format)
|
|
||||||
}
|
|
||||||
|
|
||||||
if err := encoder.Encode(metadata); err != nil {
|
|
||||||
return fmt.Errorf("failed to encode metadata: %w", err)
|
|
||||||
}
|
|
||||||
|
|
||||||
return nil
|
|
||||||
}
|
|
||||||
|
|
||||||
// loadMetadata charge les métadonnées depuis un répertoire
|
|
||||||
// Essaie tous les formats (TOML, YAML, JSON) dans l'ordre
|
|
||||||
func loadMetadata(directory string) (*KmerSetMetadata, error) {
|
|
||||||
formats := []MetadataFormat{FormatTOML, FormatYAML, FormatJSON}
|
|
||||||
|
|
||||||
var lastErr error
|
|
||||||
for _, format := range formats {
|
|
||||||
path := filepath.Join(directory, "metadata."+format.String())
|
|
||||||
|
|
||||||
// Vérifier si le fichier existe
|
|
||||||
if _, err := os.Stat(path); os.IsNotExist(err) {
|
|
||||||
continue
|
|
||||||
}
|
|
||||||
|
|
||||||
metadata, err := loadMetadataFromFile(path, format)
|
|
||||||
if err != nil {
|
|
||||||
lastErr = err
|
|
||||||
continue
|
|
||||||
}
|
|
||||||
return metadata, nil
|
|
||||||
}
|
|
||||||
|
|
||||||
if lastErr != nil {
|
|
||||||
return nil, fmt.Errorf("failed to load metadata: %w", lastErr)
|
|
||||||
}
|
|
||||||
return nil, fmt.Errorf("no metadata file found in %s (tried .toml, .yaml, .json)", directory)
|
|
||||||
}
|
|
||||||
|
|
||||||
// loadMetadataFromFile charge les métadonnées depuis un fichier spécifique
|
|
||||||
func loadMetadataFromFile(path string, format MetadataFormat) (*KmerSetMetadata, error) {
|
|
||||||
file, err := os.Open(path)
|
|
||||||
if err != nil {
|
|
||||||
return nil, fmt.Errorf("failed to open metadata file %s: %w", path, err)
|
|
||||||
}
|
|
||||||
defer file.Close()
|
|
||||||
|
|
||||||
var metadata KmerSetMetadata
|
|
||||||
var decoder interface{ Decode(interface{}) error }
|
|
||||||
|
|
||||||
switch format {
|
|
||||||
case FormatTOML:
|
|
||||||
decoder = toml.NewDecoder(file)
|
|
||||||
case FormatYAML:
|
|
||||||
decoder = yaml.NewDecoder(file)
|
|
||||||
case FormatJSON:
|
|
||||||
decoder = json.NewDecoder(file)
|
|
||||||
default:
|
|
||||||
return nil, fmt.Errorf("unsupported format: %v", format)
|
|
||||||
}
|
|
||||||
|
|
||||||
if err := decoder.Decode(&metadata); err != nil {
|
|
||||||
return nil, fmt.Errorf("failed to decode metadata: %w", err)
|
|
||||||
}
|
|
||||||
|
|
||||||
return &metadata, nil
|
|
||||||
}
|
|
||||||
|
|
||||||
// DetectFormat détecte le format des métadonnées dans un répertoire
|
|
||||||
func DetectFormat(directory string) (MetadataFormat, error) {
|
|
||||||
formats := []MetadataFormat{FormatTOML, FormatYAML, FormatJSON}
|
|
||||||
|
|
||||||
for _, format := range formats {
|
|
||||||
path := filepath.Join(directory, "metadata."+format.String())
|
|
||||||
if _, err := os.Stat(path); err == nil {
|
|
||||||
return format, nil
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
return FormatTOML, fmt.Errorf("no metadata file found in %s", directory)
|
|
||||||
}
|
|
||||||
|
|
||||||
// IsKmerSetDirectory vérifie si un répertoire contient un KmerSet ou KmerSetGroup
|
|
||||||
func IsKmerSetDirectory(directory string) (bool, string, error) {
|
|
||||||
metadata, err := loadMetadata(directory)
|
|
||||||
if err != nil {
|
|
||||||
return false, "", err
|
|
||||||
}
|
|
||||||
|
|
||||||
return true, metadata.Type, nil
|
|
||||||
}
|
|
||||||
|
|
||||||
// ListBitmapFiles liste tous les fichiers .roaring dans un répertoire
|
|
||||||
func ListBitmapFiles(directory string) ([]string, error) {
|
|
||||||
entries, err := os.ReadDir(directory)
|
|
||||||
if err != nil {
|
|
||||||
return nil, fmt.Errorf("failed to read directory %s: %w", directory, err)
|
|
||||||
}
|
|
||||||
|
|
||||||
var files []string
|
|
||||||
for _, entry := range entries {
|
|
||||||
if !entry.IsDir() && strings.HasSuffix(entry.Name(), ".roaring") {
|
|
||||||
files = append(files, entry.Name())
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
return files, nil
|
|
||||||
}
|
|
||||||
@@ -1,272 +0,0 @@
|
|||||||
package obikmer
|
|
||||||
|
|
||||||
import (
|
|
||||||
"math"
|
|
||||||
"testing"
|
|
||||||
)
|
|
||||||
|
|
||||||
func TestJaccardDistanceIdentical(t *testing.T) {
|
|
||||||
ks1 := NewKmerSet(5)
|
|
||||||
ks1.AddKmerCode(100)
|
|
||||||
ks1.AddKmerCode(200)
|
|
||||||
ks1.AddKmerCode(300)
|
|
||||||
|
|
||||||
ks2 := NewKmerSet(5)
|
|
||||||
ks2.AddKmerCode(100)
|
|
||||||
ks2.AddKmerCode(200)
|
|
||||||
ks2.AddKmerCode(300)
|
|
||||||
|
|
||||||
distance := ks1.JaccardDistance(ks2)
|
|
||||||
similarity := ks1.JaccardSimilarity(ks2)
|
|
||||||
|
|
||||||
if distance != 0.0 {
|
|
||||||
t.Errorf("Expected distance 0.0 for identical sets, got %f", distance)
|
|
||||||
}
|
|
||||||
|
|
||||||
if similarity != 1.0 {
|
|
||||||
t.Errorf("Expected similarity 1.0 for identical sets, got %f", similarity)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
func TestJaccardDistanceDisjoint(t *testing.T) {
|
|
||||||
ks1 := NewKmerSet(5)
|
|
||||||
ks1.AddKmerCode(100)
|
|
||||||
ks1.AddKmerCode(200)
|
|
||||||
ks1.AddKmerCode(300)
|
|
||||||
|
|
||||||
ks2 := NewKmerSet(5)
|
|
||||||
ks2.AddKmerCode(400)
|
|
||||||
ks2.AddKmerCode(500)
|
|
||||||
ks2.AddKmerCode(600)
|
|
||||||
|
|
||||||
distance := ks1.JaccardDistance(ks2)
|
|
||||||
similarity := ks1.JaccardSimilarity(ks2)
|
|
||||||
|
|
||||||
if distance != 1.0 {
|
|
||||||
t.Errorf("Expected distance 1.0 for disjoint sets, got %f", distance)
|
|
||||||
}
|
|
||||||
|
|
||||||
if similarity != 0.0 {
|
|
||||||
t.Errorf("Expected similarity 0.0 for disjoint sets, got %f", similarity)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
func TestJaccardDistancePartialOverlap(t *testing.T) {
|
|
||||||
// Set 1: {1, 2, 3}
|
|
||||||
ks1 := NewKmerSet(5)
|
|
||||||
ks1.AddKmerCode(1)
|
|
||||||
ks1.AddKmerCode(2)
|
|
||||||
ks1.AddKmerCode(3)
|
|
||||||
|
|
||||||
// Set 2: {2, 3, 4}
|
|
||||||
ks2 := NewKmerSet(5)
|
|
||||||
ks2.AddKmerCode(2)
|
|
||||||
ks2.AddKmerCode(3)
|
|
||||||
ks2.AddKmerCode(4)
|
|
||||||
|
|
||||||
// Intersection: {2, 3} -> cardinality = 2
|
|
||||||
// Union: {1, 2, 3, 4} -> cardinality = 4
|
|
||||||
// Similarity = 2/4 = 0.5
|
|
||||||
// Distance = 1 - 0.5 = 0.5
|
|
||||||
|
|
||||||
distance := ks1.JaccardDistance(ks2)
|
|
||||||
similarity := ks1.JaccardSimilarity(ks2)
|
|
||||||
|
|
||||||
expectedDistance := 0.5
|
|
||||||
expectedSimilarity := 0.5
|
|
||||||
|
|
||||||
if math.Abs(distance-expectedDistance) > 1e-10 {
|
|
||||||
t.Errorf("Expected distance %f, got %f", expectedDistance, distance)
|
|
||||||
}
|
|
||||||
|
|
||||||
if math.Abs(similarity-expectedSimilarity) > 1e-10 {
|
|
||||||
t.Errorf("Expected similarity %f, got %f", expectedSimilarity, similarity)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
func TestJaccardDistanceOneSubsetOfOther(t *testing.T) {
|
|
||||||
// Set 1: {1, 2}
|
|
||||||
ks1 := NewKmerSet(5)
|
|
||||||
ks1.AddKmerCode(1)
|
|
||||||
ks1.AddKmerCode(2)
|
|
||||||
|
|
||||||
// Set 2: {1, 2, 3, 4}
|
|
||||||
ks2 := NewKmerSet(5)
|
|
||||||
ks2.AddKmerCode(1)
|
|
||||||
ks2.AddKmerCode(2)
|
|
||||||
ks2.AddKmerCode(3)
|
|
||||||
ks2.AddKmerCode(4)
|
|
||||||
|
|
||||||
// Intersection: {1, 2} -> cardinality = 2
|
|
||||||
// Union: {1, 2, 3, 4} -> cardinality = 4
|
|
||||||
// Similarity = 2/4 = 0.5
|
|
||||||
// Distance = 1 - 0.5 = 0.5
|
|
||||||
|
|
||||||
distance := ks1.JaccardDistance(ks2)
|
|
||||||
similarity := ks1.JaccardSimilarity(ks2)
|
|
||||||
|
|
||||||
expectedDistance := 0.5
|
|
||||||
expectedSimilarity := 0.5
|
|
||||||
|
|
||||||
if math.Abs(distance-expectedDistance) > 1e-10 {
|
|
||||||
t.Errorf("Expected distance %f, got %f", expectedDistance, distance)
|
|
||||||
}
|
|
||||||
|
|
||||||
if math.Abs(similarity-expectedSimilarity) > 1e-10 {
|
|
||||||
t.Errorf("Expected similarity %f, got %f", expectedSimilarity, similarity)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
func TestJaccardDistanceEmptySets(t *testing.T) {
|
|
||||||
ks1 := NewKmerSet(5)
|
|
||||||
ks2 := NewKmerSet(5)
|
|
||||||
|
|
||||||
distance := ks1.JaccardDistance(ks2)
|
|
||||||
similarity := ks1.JaccardSimilarity(ks2)
|
|
||||||
|
|
||||||
// By convention, distance = 1.0 for empty sets
|
|
||||||
if distance != 1.0 {
|
|
||||||
t.Errorf("Expected distance 1.0 for empty sets, got %f", distance)
|
|
||||||
}
|
|
||||||
|
|
||||||
if similarity != 0.0 {
|
|
||||||
t.Errorf("Expected similarity 0.0 for empty sets, got %f", similarity)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
func TestJaccardDistanceOneEmpty(t *testing.T) {
|
|
||||||
ks1 := NewKmerSet(5)
|
|
||||||
ks1.AddKmerCode(1)
|
|
||||||
ks1.AddKmerCode(2)
|
|
||||||
ks1.AddKmerCode(3)
|
|
||||||
|
|
||||||
ks2 := NewKmerSet(5)
|
|
||||||
|
|
||||||
distance := ks1.JaccardDistance(ks2)
|
|
||||||
similarity := ks1.JaccardSimilarity(ks2)
|
|
||||||
|
|
||||||
// Intersection: {} -> cardinality = 0
|
|
||||||
// Union: {1, 2, 3} -> cardinality = 3
|
|
||||||
// Similarity = 0/3 = 0.0
|
|
||||||
// Distance = 1.0
|
|
||||||
|
|
||||||
if distance != 1.0 {
|
|
||||||
t.Errorf("Expected distance 1.0 when one set is empty, got %f", distance)
|
|
||||||
}
|
|
||||||
|
|
||||||
if similarity != 0.0 {
|
|
||||||
t.Errorf("Expected similarity 0.0 when one set is empty, got %f", similarity)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
func TestJaccardDistanceDifferentK(t *testing.T) {
|
|
||||||
ks1 := NewKmerSet(5)
|
|
||||||
ks1.AddKmerCode(1)
|
|
||||||
|
|
||||||
ks2 := NewKmerSet(7)
|
|
||||||
ks2.AddKmerCode(1)
|
|
||||||
|
|
||||||
defer func() {
|
|
||||||
if r := recover(); r == nil {
|
|
||||||
t.Errorf("Expected panic when computing Jaccard distance with different k values")
|
|
||||||
}
|
|
||||||
}()
|
|
||||||
|
|
||||||
_ = ks1.JaccardDistance(ks2)
|
|
||||||
}
|
|
||||||
|
|
||||||
func TestJaccardDistanceSimilarityRelation(t *testing.T) {
|
|
||||||
// Test that distance + similarity = 1.0 for all cases
|
|
||||||
testCases := []struct {
|
|
||||||
name string
|
|
||||||
ks1 *KmerSet
|
|
||||||
ks2 *KmerSet
|
|
||||||
}{
|
|
||||||
{
|
|
||||||
name: "partial overlap",
|
|
||||||
ks1: func() *KmerSet {
|
|
||||||
ks := NewKmerSet(5)
|
|
||||||
ks.AddKmerCode(1)
|
|
||||||
ks.AddKmerCode(2)
|
|
||||||
ks.AddKmerCode(3)
|
|
||||||
return ks
|
|
||||||
}(),
|
|
||||||
ks2: func() *KmerSet {
|
|
||||||
ks := NewKmerSet(5)
|
|
||||||
ks.AddKmerCode(2)
|
|
||||||
ks.AddKmerCode(3)
|
|
||||||
ks.AddKmerCode(4)
|
|
||||||
ks.AddKmerCode(5)
|
|
||||||
return ks
|
|
||||||
}(),
|
|
||||||
},
|
|
||||||
{
|
|
||||||
name: "identical",
|
|
||||||
ks1: func() *KmerSet {
|
|
||||||
ks := NewKmerSet(5)
|
|
||||||
ks.AddKmerCode(10)
|
|
||||||
ks.AddKmerCode(20)
|
|
||||||
return ks
|
|
||||||
}(),
|
|
||||||
ks2: func() *KmerSet {
|
|
||||||
ks := NewKmerSet(5)
|
|
||||||
ks.AddKmerCode(10)
|
|
||||||
ks.AddKmerCode(20)
|
|
||||||
return ks
|
|
||||||
}(),
|
|
||||||
},
|
|
||||||
{
|
|
||||||
name: "disjoint",
|
|
||||||
ks1: func() *KmerSet {
|
|
||||||
ks := NewKmerSet(5)
|
|
||||||
ks.AddKmerCode(1)
|
|
||||||
return ks
|
|
||||||
}(),
|
|
||||||
ks2: func() *KmerSet {
|
|
||||||
ks := NewKmerSet(5)
|
|
||||||
ks.AddKmerCode(100)
|
|
||||||
return ks
|
|
||||||
}(),
|
|
||||||
},
|
|
||||||
}
|
|
||||||
|
|
||||||
for _, tc := range testCases {
|
|
||||||
t.Run(tc.name, func(t *testing.T) {
|
|
||||||
distance := tc.ks1.JaccardDistance(tc.ks2)
|
|
||||||
similarity := tc.ks1.JaccardSimilarity(tc.ks2)
|
|
||||||
|
|
||||||
sum := distance + similarity
|
|
||||||
|
|
||||||
if math.Abs(sum-1.0) > 1e-10 {
|
|
||||||
t.Errorf("Expected distance + similarity = 1.0, got %f + %f = %f",
|
|
||||||
distance, similarity, sum)
|
|
||||||
}
|
|
||||||
})
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
func TestJaccardDistanceSymmetry(t *testing.T) {
|
|
||||||
ks1 := NewKmerSet(5)
|
|
||||||
ks1.AddKmerCode(1)
|
|
||||||
ks1.AddKmerCode(2)
|
|
||||||
ks1.AddKmerCode(3)
|
|
||||||
|
|
||||||
ks2 := NewKmerSet(5)
|
|
||||||
ks2.AddKmerCode(2)
|
|
||||||
ks2.AddKmerCode(3)
|
|
||||||
ks2.AddKmerCode(4)
|
|
||||||
|
|
||||||
distance1 := ks1.JaccardDistance(ks2)
|
|
||||||
distance2 := ks2.JaccardDistance(ks1)
|
|
||||||
|
|
||||||
similarity1 := ks1.JaccardSimilarity(ks2)
|
|
||||||
similarity2 := ks2.JaccardSimilarity(ks1)
|
|
||||||
|
|
||||||
if math.Abs(distance1-distance2) > 1e-10 {
|
|
||||||
t.Errorf("Jaccard distance not symmetric: %f vs %f", distance1, distance2)
|
|
||||||
}
|
|
||||||
|
|
||||||
if math.Abs(similarity1-similarity2) > 1e-10 {
|
|
||||||
t.Errorf("Jaccard similarity not symmetric: %f vs %f", similarity1, similarity2)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
@@ -5,6 +5,7 @@ import (
|
|||||||
"sort"
|
"sort"
|
||||||
"unsafe"
|
"unsafe"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obifp"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obifp"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obilog"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obilog"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
@@ -267,20 +268,23 @@ func NewKmerMap[T obifp.FPUint[T]](
|
|||||||
}
|
}
|
||||||
|
|
||||||
n := len(sequences)
|
n := len(sequences)
|
||||||
pbopt := make([]progressbar.Option, 0, 5)
|
var bar *progressbar.ProgressBar
|
||||||
pbopt = append(pbopt,
|
if obidefault.ProgressBar() {
|
||||||
progressbar.OptionSetWriter(os.Stderr),
|
pbopt := make([]progressbar.Option, 0, 5)
|
||||||
progressbar.OptionSetWidth(15),
|
pbopt = append(pbopt,
|
||||||
progressbar.OptionShowCount(),
|
progressbar.OptionSetWriter(os.Stderr),
|
||||||
progressbar.OptionShowIts(),
|
progressbar.OptionSetWidth(15),
|
||||||
progressbar.OptionSetDescription("Indexing kmers"),
|
progressbar.OptionShowCount(),
|
||||||
)
|
progressbar.OptionShowIts(),
|
||||||
|
progressbar.OptionSetDescription("Indexing kmers"),
|
||||||
|
)
|
||||||
|
|
||||||
bar := progressbar.NewOptions(n, pbopt...)
|
bar = progressbar.NewOptions(n, pbopt...)
|
||||||
|
}
|
||||||
|
|
||||||
for i, sequence := range sequences {
|
for i, sequence := range sequences {
|
||||||
kmap.Push(sequence, maxoccurs)
|
kmap.Push(sequence, maxoccurs)
|
||||||
if i%100 == 0 {
|
if bar != nil && i%100 == 0 {
|
||||||
bar.Add(100)
|
bar.Add(100)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
47
pkg/obikmer/minimizer_utils.go
Normal file
47
pkg/obikmer/minimizer_utils.go
Normal file
@@ -0,0 +1,47 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"math"
|
||||||
|
|
||||||
|
log "github.com/sirupsen/logrus"
|
||||||
|
)
|
||||||
|
|
||||||
|
// DefaultMinimizerSize returns ceil(k / 2.5) as a reasonable default minimizer size.
|
||||||
|
func DefaultMinimizerSize(k int) int {
|
||||||
|
m := int(math.Ceil(float64(k) / 2.5))
|
||||||
|
if m < 1 {
|
||||||
|
m = 1
|
||||||
|
}
|
||||||
|
if m >= k {
|
||||||
|
m = k - 1
|
||||||
|
}
|
||||||
|
return m
|
||||||
|
}
|
||||||
|
|
||||||
|
// MinMinimizerSize returns the minimum m such that 4^m >= nworkers,
|
||||||
|
// i.e. ceil(log(nworkers) / log(4)).
|
||||||
|
func MinMinimizerSize(nworkers int) int {
|
||||||
|
if nworkers <= 1 {
|
||||||
|
return 1
|
||||||
|
}
|
||||||
|
return int(math.Ceil(math.Log(float64(nworkers)) / math.Log(4)))
|
||||||
|
}
|
||||||
|
|
||||||
|
// ValidateMinimizerSize checks and adjusts the minimizer size to satisfy constraints:
|
||||||
|
// - m >= ceil(log(nworkers)/log(4))
|
||||||
|
// - 1 <= m < k
|
||||||
|
func ValidateMinimizerSize(m, k, nworkers int) int {
|
||||||
|
minM := MinMinimizerSize(nworkers)
|
||||||
|
if m < minM {
|
||||||
|
log.Warnf("Minimizer size %d too small for %d workers (4^%d = %d < %d), adjusting to %d",
|
||||||
|
m, nworkers, m, 1<<(2*m), nworkers, minM)
|
||||||
|
m = minM
|
||||||
|
}
|
||||||
|
if m < 1 {
|
||||||
|
m = 1
|
||||||
|
}
|
||||||
|
if m >= k {
|
||||||
|
m = k - 1
|
||||||
|
}
|
||||||
|
return m
|
||||||
|
}
|
||||||
67
pkg/obikmer/skm_reader.go
Normal file
67
pkg/obikmer/skm_reader.go
Normal file
@@ -0,0 +1,67 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"bufio"
|
||||||
|
"encoding/binary"
|
||||||
|
"io"
|
||||||
|
"os"
|
||||||
|
)
|
||||||
|
|
||||||
|
// decode2bit maps 2-bit codes back to nucleotide bytes.
|
||||||
|
var decode2bit = [4]byte{'a', 'c', 'g', 't'}
|
||||||
|
|
||||||
|
// SkmReader reads super-kmers from a binary .skm file.
|
||||||
|
type SkmReader struct {
|
||||||
|
r *bufio.Reader
|
||||||
|
file *os.File
|
||||||
|
}
|
||||||
|
|
||||||
|
// NewSkmReader opens a .skm file for reading.
|
||||||
|
func NewSkmReader(path string) (*SkmReader, error) {
|
||||||
|
f, err := os.Open(path)
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
return &SkmReader{
|
||||||
|
r: bufio.NewReaderSize(f, 65536),
|
||||||
|
file: f,
|
||||||
|
}, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// Next reads the next super-kmer from the file.
|
||||||
|
// Returns the SuperKmer and true, or a zero SuperKmer and false at EOF.
|
||||||
|
func (sr *SkmReader) Next() (SuperKmer, bool) {
|
||||||
|
// Read length
|
||||||
|
var lenbuf [2]byte
|
||||||
|
if _, err := io.ReadFull(sr.r, lenbuf[:]); err != nil {
|
||||||
|
return SuperKmer{}, false
|
||||||
|
}
|
||||||
|
seqLen := int(binary.LittleEndian.Uint16(lenbuf[:]))
|
||||||
|
|
||||||
|
// Read packed bytes
|
||||||
|
nBytes := (seqLen + 3) / 4
|
||||||
|
packed := make([]byte, nBytes)
|
||||||
|
if _, err := io.ReadFull(sr.r, packed); err != nil {
|
||||||
|
return SuperKmer{}, false
|
||||||
|
}
|
||||||
|
|
||||||
|
// Decode to nucleotide bytes
|
||||||
|
seq := make([]byte, seqLen)
|
||||||
|
for i := 0; i < seqLen; i++ {
|
||||||
|
byteIdx := i / 4
|
||||||
|
bitPos := uint(6 - (i%4)*2)
|
||||||
|
code := (packed[byteIdx] >> bitPos) & 0x03
|
||||||
|
seq[i] = decode2bit[code]
|
||||||
|
}
|
||||||
|
|
||||||
|
return SuperKmer{
|
||||||
|
Sequence: seq,
|
||||||
|
Start: 0,
|
||||||
|
End: seqLen,
|
||||||
|
}, true
|
||||||
|
}
|
||||||
|
|
||||||
|
// Close closes the underlying file.
|
||||||
|
func (sr *SkmReader) Close() error {
|
||||||
|
return sr.file.Close()
|
||||||
|
}
|
||||||
176
pkg/obikmer/skm_test.go
Normal file
176
pkg/obikmer/skm_test.go
Normal file
@@ -0,0 +1,176 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"os"
|
||||||
|
"path/filepath"
|
||||||
|
"testing"
|
||||||
|
)
|
||||||
|
|
||||||
|
func TestSkmRoundTrip(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
path := filepath.Join(dir, "test.skm")
|
||||||
|
|
||||||
|
// Create super-kmers from a known sequence
|
||||||
|
seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT")
|
||||||
|
k := 21
|
||||||
|
m := 9
|
||||||
|
superKmers := ExtractSuperKmers(seq, k, m, nil)
|
||||||
|
if len(superKmers) == 0 {
|
||||||
|
t.Fatal("no super-kmers extracted")
|
||||||
|
}
|
||||||
|
|
||||||
|
// Write
|
||||||
|
w, err := NewSkmWriter(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
for _, sk := range superKmers {
|
||||||
|
if err := w.Write(sk); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if err := w.Close(); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Read back
|
||||||
|
r, err := NewSkmReader(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
defer r.Close()
|
||||||
|
|
||||||
|
idx := 0
|
||||||
|
for {
|
||||||
|
sk, ok := r.Next()
|
||||||
|
if !ok {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
if idx >= len(superKmers) {
|
||||||
|
t.Fatal("read more super-kmers than written")
|
||||||
|
}
|
||||||
|
expected := superKmers[idx]
|
||||||
|
if len(sk.Sequence) != len(expected.Sequence) {
|
||||||
|
t.Fatalf("super-kmer %d: length mismatch: got %d, want %d",
|
||||||
|
idx, len(sk.Sequence), len(expected.Sequence))
|
||||||
|
}
|
||||||
|
// Compare nucleotide-by-nucleotide (case insensitive since decode produces lowercase)
|
||||||
|
for j := range sk.Sequence {
|
||||||
|
got := sk.Sequence[j] | 0x20
|
||||||
|
want := expected.Sequence[j] | 0x20
|
||||||
|
if got != want {
|
||||||
|
t.Fatalf("super-kmer %d pos %d: got %c, want %c", idx, j, got, want)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
idx++
|
||||||
|
}
|
||||||
|
if idx != len(superKmers) {
|
||||||
|
t.Fatalf("read %d super-kmers, want %d", idx, len(superKmers))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestSkmEmptyFile(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
path := filepath.Join(dir, "empty.skm")
|
||||||
|
|
||||||
|
// Write nothing
|
||||||
|
w, err := NewSkmWriter(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
if err := w.Close(); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Read back
|
||||||
|
r, err := NewSkmReader(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
defer r.Close()
|
||||||
|
|
||||||
|
_, ok := r.Next()
|
||||||
|
if ok {
|
||||||
|
t.Fatal("expected no super-kmers in empty file")
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestSkmSingleBase(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
path := filepath.Join(dir, "single.skm")
|
||||||
|
|
||||||
|
// Test with sequences of various lengths to check padding
|
||||||
|
sequences := [][]byte{
|
||||||
|
[]byte("A"),
|
||||||
|
[]byte("AC"),
|
||||||
|
[]byte("ACG"),
|
||||||
|
[]byte("ACGT"),
|
||||||
|
[]byte("ACGTA"),
|
||||||
|
}
|
||||||
|
|
||||||
|
w, err := NewSkmWriter(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
for _, seq := range sequences {
|
||||||
|
sk := SuperKmer{Sequence: seq}
|
||||||
|
if err := w.Write(sk); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if err := w.Close(); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
r, err := NewSkmReader(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
defer r.Close()
|
||||||
|
|
||||||
|
for i, expected := range sequences {
|
||||||
|
sk, ok := r.Next()
|
||||||
|
if !ok {
|
||||||
|
t.Fatalf("expected super-kmer %d, got EOF", i)
|
||||||
|
}
|
||||||
|
if len(sk.Sequence) != len(expected) {
|
||||||
|
t.Fatalf("sk %d: length %d, want %d", i, len(sk.Sequence), len(expected))
|
||||||
|
}
|
||||||
|
for j := range sk.Sequence {
|
||||||
|
got := sk.Sequence[j] | 0x20
|
||||||
|
want := expected[j] | 0x20
|
||||||
|
if got != want {
|
||||||
|
t.Fatalf("sk %d pos %d: got %c, want %c", i, j, got, want)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestSkmFileSize(t *testing.T) {
|
||||||
|
dir := t.TempDir()
|
||||||
|
path := filepath.Join(dir, "size.skm")
|
||||||
|
|
||||||
|
// Write a sequence of known length
|
||||||
|
seq := []byte("ACGTACGTAC") // 10 bases
|
||||||
|
sk := SuperKmer{Sequence: seq}
|
||||||
|
|
||||||
|
w, err := NewSkmWriter(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
if err := w.Write(sk); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
if err := w.Close(); err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Expected: 2 bytes (length) + ceil(10/4)=3 bytes (data) = 5 bytes
|
||||||
|
info, err := os.Stat(path)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatal(err)
|
||||||
|
}
|
||||||
|
if info.Size() != 5 {
|
||||||
|
t.Fatalf("file size: got %d, want 5", info.Size())
|
||||||
|
}
|
||||||
|
}
|
||||||
74
pkg/obikmer/skm_writer.go
Normal file
74
pkg/obikmer/skm_writer.go
Normal file
@@ -0,0 +1,74 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"bufio"
|
||||||
|
"encoding/binary"
|
||||||
|
"os"
|
||||||
|
)
|
||||||
|
|
||||||
|
// SkmWriter writes super-kmers to a binary .skm file.
|
||||||
|
//
|
||||||
|
// Format per super-kmer:
|
||||||
|
//
|
||||||
|
// [len: uint16 LE] length of the super-kmer in bases
|
||||||
|
// [data: ceil(len/4) bytes] sequence encoded 2 bits/base, packed
|
||||||
|
//
|
||||||
|
// Nucleotide encoding: A=00, C=01, G=10, T=11.
|
||||||
|
// The last byte is zero-padded on the low bits if len%4 != 0.
|
||||||
|
type SkmWriter struct {
|
||||||
|
w *bufio.Writer
|
||||||
|
file *os.File
|
||||||
|
}
|
||||||
|
|
||||||
|
// NewSkmWriter creates a new SkmWriter writing to the given file path.
|
||||||
|
func NewSkmWriter(path string) (*SkmWriter, error) {
|
||||||
|
f, err := os.Create(path)
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
return &SkmWriter{
|
||||||
|
w: bufio.NewWriterSize(f, 65536),
|
||||||
|
file: f,
|
||||||
|
}, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// Write encodes a SuperKmer to the .skm file.
|
||||||
|
// The sequence bytes are packed 2 bits per base.
|
||||||
|
func (sw *SkmWriter) Write(sk SuperKmer) error {
|
||||||
|
seq := sk.Sequence
|
||||||
|
seqLen := uint16(len(seq))
|
||||||
|
|
||||||
|
// Write length
|
||||||
|
var lenbuf [2]byte
|
||||||
|
binary.LittleEndian.PutUint16(lenbuf[:], seqLen)
|
||||||
|
if _, err := sw.w.Write(lenbuf[:]); err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
|
||||||
|
// Encode and write packed sequence (2 bits/base)
|
||||||
|
nBytes := (int(seqLen) + 3) / 4
|
||||||
|
for i := 0; i < nBytes; i++ {
|
||||||
|
var packed byte
|
||||||
|
for j := 0; j < 4; j++ {
|
||||||
|
pos := i*4 + j
|
||||||
|
packed <<= 2
|
||||||
|
if pos < int(seqLen) {
|
||||||
|
packed |= __single_base_code__[seq[pos]&31]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if err := sw.w.WriteByte(packed); err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// Close flushes buffered data and closes the underlying file.
|
||||||
|
func (sw *SkmWriter) Close() error {
|
||||||
|
if err := sw.w.Flush(); err != nil {
|
||||||
|
sw.file.Close()
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
return sw.file.Close()
|
||||||
|
}
|
||||||
253
pkg/obikmer/spectrum.go
Normal file
253
pkg/obikmer/spectrum.go
Normal file
@@ -0,0 +1,253 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"bufio"
|
||||||
|
"container/heap"
|
||||||
|
"encoding/csv"
|
||||||
|
"fmt"
|
||||||
|
"os"
|
||||||
|
"sort"
|
||||||
|
"strconv"
|
||||||
|
)
|
||||||
|
|
||||||
|
// KSP file magic bytes: "KSP\x01" (K-mer SPectrum v1)
|
||||||
|
var kspMagic = [4]byte{'K', 'S', 'P', 0x01}
|
||||||
|
|
||||||
|
// SpectrumEntry represents one entry in a k-mer frequency spectrum.
|
||||||
|
type SpectrumEntry struct {
|
||||||
|
Frequency int // how many times a k-mer was observed
|
||||||
|
Count uint64 // how many distinct k-mers have this frequency
|
||||||
|
}
|
||||||
|
|
||||||
|
// KmerSpectrum represents the frequency distribution of k-mers.
|
||||||
|
// Entries are sorted by Frequency in ascending order and only include
|
||||||
|
// non-zero counts.
|
||||||
|
type KmerSpectrum struct {
|
||||||
|
Entries []SpectrumEntry
|
||||||
|
}
|
||||||
|
|
||||||
|
// MaxFrequency returns the highest frequency in the spectrum, or 0 if empty.
|
||||||
|
func (s *KmerSpectrum) MaxFrequency() int {
|
||||||
|
if len(s.Entries) == 0 {
|
||||||
|
return 0
|
||||||
|
}
|
||||||
|
return s.Entries[len(s.Entries)-1].Frequency
|
||||||
|
}
|
||||||
|
|
||||||
|
// ToMap converts a KmerSpectrum back to a map for easy lookup.
|
||||||
|
func (s *KmerSpectrum) ToMap() map[int]uint64 {
|
||||||
|
m := make(map[int]uint64, len(s.Entries))
|
||||||
|
for _, e := range s.Entries {
|
||||||
|
m[e.Frequency] = e.Count
|
||||||
|
}
|
||||||
|
return m
|
||||||
|
}
|
||||||
|
|
||||||
|
// MapToSpectrum converts a map[int]uint64 to a sorted KmerSpectrum.
|
||||||
|
func MapToSpectrum(m map[int]uint64) *KmerSpectrum {
|
||||||
|
entries := make([]SpectrumEntry, 0, len(m))
|
||||||
|
for freq, count := range m {
|
||||||
|
if count > 0 {
|
||||||
|
entries = append(entries, SpectrumEntry{Frequency: freq, Count: count})
|
||||||
|
}
|
||||||
|
}
|
||||||
|
sort.Slice(entries, func(i, j int) bool {
|
||||||
|
return entries[i].Frequency < entries[j].Frequency
|
||||||
|
})
|
||||||
|
return &KmerSpectrum{Entries: entries}
|
||||||
|
}
|
||||||
|
|
||||||
|
// MergeSpectraMaps adds all entries from b into a.
|
||||||
|
func MergeSpectraMaps(a, b map[int]uint64) {
|
||||||
|
for freq, count := range b {
|
||||||
|
a[freq] += count
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// WriteSpectrum writes a KmerSpectrum to a binary file.
|
||||||
|
//
|
||||||
|
// Format:
|
||||||
|
//
|
||||||
|
// [magic: 4 bytes "KSP\x01"]
|
||||||
|
// [n_entries: varint]
|
||||||
|
// For each entry (sorted by frequency ascending):
|
||||||
|
// [frequency: varint]
|
||||||
|
// [count: varint]
|
||||||
|
func WriteSpectrum(path string, spectrum *KmerSpectrum) error {
|
||||||
|
f, err := os.Create(path)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("create spectrum file: %w", err)
|
||||||
|
}
|
||||||
|
w := bufio.NewWriterSize(f, 65536)
|
||||||
|
|
||||||
|
// Magic
|
||||||
|
if _, err := w.Write(kspMagic[:]); err != nil {
|
||||||
|
f.Close()
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
|
||||||
|
// Number of entries
|
||||||
|
if _, err := EncodeVarint(w, uint64(len(spectrum.Entries))); err != nil {
|
||||||
|
f.Close()
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
|
||||||
|
// Entries
|
||||||
|
for _, e := range spectrum.Entries {
|
||||||
|
if _, err := EncodeVarint(w, uint64(e.Frequency)); err != nil {
|
||||||
|
f.Close()
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
if _, err := EncodeVarint(w, e.Count); err != nil {
|
||||||
|
f.Close()
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if err := w.Flush(); err != nil {
|
||||||
|
f.Close()
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
return f.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// ReadSpectrum reads a KmerSpectrum from a binary file.
|
||||||
|
func ReadSpectrum(path string) (*KmerSpectrum, error) {
|
||||||
|
f, err := os.Open(path)
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
defer f.Close()
|
||||||
|
|
||||||
|
r := bufio.NewReaderSize(f, 65536)
|
||||||
|
|
||||||
|
// Check magic
|
||||||
|
var magic [4]byte
|
||||||
|
if _, err := r.Read(magic[:]); err != nil {
|
||||||
|
return nil, fmt.Errorf("read spectrum magic: %w", err)
|
||||||
|
}
|
||||||
|
if magic != kspMagic {
|
||||||
|
return nil, fmt.Errorf("invalid spectrum file magic: %v", magic)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Number of entries
|
||||||
|
nEntries, err := DecodeVarint(r)
|
||||||
|
if err != nil {
|
||||||
|
return nil, fmt.Errorf("read spectrum entry count: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
entries := make([]SpectrumEntry, nEntries)
|
||||||
|
for i := uint64(0); i < nEntries; i++ {
|
||||||
|
freq, err := DecodeVarint(r)
|
||||||
|
if err != nil {
|
||||||
|
return nil, fmt.Errorf("read spectrum freq at entry %d: %w", i, err)
|
||||||
|
}
|
||||||
|
count, err := DecodeVarint(r)
|
||||||
|
if err != nil {
|
||||||
|
return nil, fmt.Errorf("read spectrum count at entry %d: %w", i, err)
|
||||||
|
}
|
||||||
|
entries[i] = SpectrumEntry{
|
||||||
|
Frequency: int(freq),
|
||||||
|
Count: count,
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return &KmerSpectrum{Entries: entries}, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// KmerFreq associates a k-mer (encoded as uint64) with its observed frequency.
|
||||||
|
type KmerFreq struct {
|
||||||
|
Kmer uint64
|
||||||
|
Freq int
|
||||||
|
}
|
||||||
|
|
||||||
|
// kmerFreqHeap is a min-heap of KmerFreq ordered by Freq (lowest first).
|
||||||
|
// Used to maintain a top-N most frequent k-mers set.
|
||||||
|
type kmerFreqHeap []KmerFreq
|
||||||
|
|
||||||
|
func (h kmerFreqHeap) Len() int { return len(h) }
|
||||||
|
func (h kmerFreqHeap) Less(i, j int) bool { return h[i].Freq < h[j].Freq }
|
||||||
|
func (h kmerFreqHeap) Swap(i, j int) { h[i], h[j] = h[j], h[i] }
|
||||||
|
func (h *kmerFreqHeap) Push(x interface{}) { *h = append(*h, x.(KmerFreq)) }
|
||||||
|
func (h *kmerFreqHeap) Pop() interface{} {
|
||||||
|
old := *h
|
||||||
|
n := len(old)
|
||||||
|
x := old[n-1]
|
||||||
|
*h = old[:n-1]
|
||||||
|
return x
|
||||||
|
}
|
||||||
|
|
||||||
|
// TopNKmers maintains a collection of the N most frequent k-mers
|
||||||
|
// using a min-heap. Thread-safe usage requires external synchronization.
|
||||||
|
type TopNKmers struct {
|
||||||
|
n int
|
||||||
|
h kmerFreqHeap
|
||||||
|
}
|
||||||
|
|
||||||
|
// NewTopNKmers creates a new top-N collector.
|
||||||
|
func NewTopNKmers(n int) *TopNKmers {
|
||||||
|
return &TopNKmers{
|
||||||
|
n: n,
|
||||||
|
h: make(kmerFreqHeap, 0, n+1),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Add considers a k-mer with the given frequency for inclusion in the top-N.
|
||||||
|
func (t *TopNKmers) Add(kmer uint64, freq int) {
|
||||||
|
if t.n <= 0 {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
if len(t.h) < t.n {
|
||||||
|
heap.Push(&t.h, KmerFreq{Kmer: kmer, Freq: freq})
|
||||||
|
} else if freq > t.h[0].Freq {
|
||||||
|
t.h[0] = KmerFreq{Kmer: kmer, Freq: freq}
|
||||||
|
heap.Fix(&t.h, 0)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Results returns the collected k-mers sorted by frequency descending.
|
||||||
|
func (t *TopNKmers) Results() []KmerFreq {
|
||||||
|
result := make([]KmerFreq, len(t.h))
|
||||||
|
copy(result, t.h)
|
||||||
|
sort.Slice(result, func(i, j int) bool {
|
||||||
|
return result[i].Freq > result[j].Freq
|
||||||
|
})
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
|
// MergeTopN merges another TopNKmers into this one.
|
||||||
|
func (t *TopNKmers) MergeTopN(other *TopNKmers) {
|
||||||
|
if other == nil {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
for _, kf := range other.h {
|
||||||
|
t.Add(kf.Kmer, kf.Freq)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// WriteTopKmersCSV writes the top k-mers to a CSV file.
|
||||||
|
// Columns: sequence, frequency
|
||||||
|
func WriteTopKmersCSV(path string, topKmers []KmerFreq, k int) error {
|
||||||
|
f, err := os.Create(path)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("create top-kmers file: %w", err)
|
||||||
|
}
|
||||||
|
defer f.Close()
|
||||||
|
|
||||||
|
w := csv.NewWriter(f)
|
||||||
|
defer w.Flush()
|
||||||
|
|
||||||
|
if err := w.Write([]string{"sequence", "frequency"}); err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
|
||||||
|
buf := make([]byte, k)
|
||||||
|
for _, kf := range topKmers {
|
||||||
|
seq := DecodeKmer(kf.Kmer, k, buf)
|
||||||
|
if err := w.Write([]string{string(seq), strconv.Itoa(kf.Freq)}); err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return nil
|
||||||
|
}
|
||||||
59
pkg/obikmer/superkmer.go
Normal file
59
pkg/obikmer/superkmer.go
Normal file
@@ -0,0 +1,59 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
// SuperKmer represents a maximal subsequence where all consecutive k-mers
|
||||||
|
// share the same minimizer.
|
||||||
|
type SuperKmer struct {
|
||||||
|
Minimizer uint64 // The canonical minimizer value (normalized m-mer)
|
||||||
|
Start int // Starting position in the original sequence (0-indexed)
|
||||||
|
End int // Ending position (exclusive, like Go slice notation)
|
||||||
|
Sequence []byte // The actual DNA subsequence [Start:End]
|
||||||
|
}
|
||||||
|
|
||||||
|
// dequeItem represents an element in the monotone deque used for
|
||||||
|
// tracking minimizers in a sliding window.
|
||||||
|
type dequeItem struct {
|
||||||
|
position int // Position of the m-mer in the sequence
|
||||||
|
canonical uint64 // Canonical (normalized) m-mer value
|
||||||
|
}
|
||||||
|
|
||||||
|
// ExtractSuperKmers extracts super k-mers from a DNA sequence.
|
||||||
|
// A super k-mer is a maximal subsequence where all consecutive k-mers
|
||||||
|
// share the same minimizer. The minimizer of a k-mer is the smallest
|
||||||
|
// canonical m-mer among its (k-m+1) constituent m-mers.
|
||||||
|
//
|
||||||
|
// This function uses IterSuperKmers internally and collects results into a slice.
|
||||||
|
//
|
||||||
|
// Parameters:
|
||||||
|
// - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
|
||||||
|
// - k: k-mer size (must be between m+1 and 31)
|
||||||
|
// - m: minimizer size (must be between 1 and k-1)
|
||||||
|
// - buffer: optional pre-allocated buffer for results. If nil, a new slice is created.
|
||||||
|
//
|
||||||
|
// Returns:
|
||||||
|
// - slice of SuperKmer structs representing maximal subsequences
|
||||||
|
// - nil if parameters are invalid or sequence is too short
|
||||||
|
//
|
||||||
|
// Time complexity: O(n) where n is the sequence length
|
||||||
|
// Space complexity: O(k-m+1) for the deque + O(number of super k-mers) for results
|
||||||
|
func ExtractSuperKmers(seq []byte, k int, m int, buffer *[]SuperKmer) []SuperKmer {
|
||||||
|
if m < 1 || m >= k || k < 2 || k > 31 || len(seq) < k {
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
var result []SuperKmer
|
||||||
|
if buffer == nil {
|
||||||
|
estimatedSize := len(seq) / k
|
||||||
|
if estimatedSize < 1 {
|
||||||
|
estimatedSize = 1
|
||||||
|
}
|
||||||
|
result = make([]SuperKmer, 0, estimatedSize)
|
||||||
|
} else {
|
||||||
|
result = (*buffer)[:0]
|
||||||
|
}
|
||||||
|
|
||||||
|
for sk := range IterSuperKmers(seq, k, m) {
|
||||||
|
result = append(result, sk)
|
||||||
|
}
|
||||||
|
|
||||||
|
return result
|
||||||
|
}
|
||||||
215
pkg/obikmer/superkmer_iter.go
Normal file
215
pkg/obikmer/superkmer_iter.go
Normal file
@@ -0,0 +1,215 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"fmt"
|
||||||
|
"iter"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
)
|
||||||
|
|
||||||
|
// IterSuperKmers returns an iterator over super k-mers extracted from a DNA sequence.
|
||||||
|
// It uses the same algorithm as ExtractSuperKmers but yields super k-mers one at a time.
|
||||||
|
//
|
||||||
|
// Parameters:
|
||||||
|
// - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
|
||||||
|
// - k: k-mer size (must be between m+1 and 31)
|
||||||
|
// - m: minimizer size (must be between 1 and k-1)
|
||||||
|
//
|
||||||
|
// Returns:
|
||||||
|
// - An iterator that yields SuperKmer structs
|
||||||
|
//
|
||||||
|
// Example:
|
||||||
|
//
|
||||||
|
// for sk := range IterSuperKmers(sequence, 21, 11) {
|
||||||
|
// fmt.Printf("SuperKmer at %d-%d with minimizer %d\n", sk.Start, sk.End, sk.Minimizer)
|
||||||
|
// }
|
||||||
|
func IterSuperKmers(seq []byte, k int, m int) iter.Seq[SuperKmer] {
|
||||||
|
return func(yield func(SuperKmer) bool) {
|
||||||
|
if m < 1 || m >= k || k < 2 || k > 31 || len(seq) < k {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
|
||||||
|
deque := make([]dequeItem, 0, k-m+1)
|
||||||
|
|
||||||
|
mMask := uint64(1)<<(m*2) - 1
|
||||||
|
rcShift := uint((m - 1) * 2)
|
||||||
|
|
||||||
|
var fwdMmer, rvcMmer uint64
|
||||||
|
for i := 0; i < m-1 && i < len(seq); i++ {
|
||||||
|
code := uint64(__single_base_code__[seq[i]&31])
|
||||||
|
fwdMmer = (fwdMmer << 2) | code
|
||||||
|
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
|
||||||
|
}
|
||||||
|
|
||||||
|
superKmerStart := 0
|
||||||
|
var currentMinimizer uint64
|
||||||
|
firstKmer := true
|
||||||
|
|
||||||
|
for pos := m - 1; pos < len(seq); pos++ {
|
||||||
|
code := uint64(__single_base_code__[seq[pos]&31])
|
||||||
|
fwdMmer = ((fwdMmer << 2) | code) & mMask
|
||||||
|
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
|
||||||
|
|
||||||
|
canonical := fwdMmer
|
||||||
|
if rvcMmer < fwdMmer {
|
||||||
|
canonical = rvcMmer
|
||||||
|
}
|
||||||
|
|
||||||
|
mmerPos := pos - m + 1
|
||||||
|
|
||||||
|
if pos >= k-1 {
|
||||||
|
windowStart := pos - k + 1
|
||||||
|
for len(deque) > 0 && deque[0].position < windowStart {
|
||||||
|
deque = deque[1:]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
for len(deque) > 0 && deque[len(deque)-1].canonical >= canonical {
|
||||||
|
deque = deque[:len(deque)-1]
|
||||||
|
}
|
||||||
|
|
||||||
|
deque = append(deque, dequeItem{position: mmerPos, canonical: canonical})
|
||||||
|
|
||||||
|
if pos >= k-1 {
|
||||||
|
newMinimizer := deque[0].canonical
|
||||||
|
kmerStart := pos - k + 1
|
||||||
|
|
||||||
|
if firstKmer {
|
||||||
|
currentMinimizer = newMinimizer
|
||||||
|
firstKmer = false
|
||||||
|
} else if newMinimizer != currentMinimizer {
|
||||||
|
endPos := kmerStart + k - 1
|
||||||
|
superKmer := SuperKmer{
|
||||||
|
Minimizer: currentMinimizer,
|
||||||
|
Start: superKmerStart,
|
||||||
|
End: endPos,
|
||||||
|
Sequence: seq[superKmerStart:endPos],
|
||||||
|
}
|
||||||
|
if !yield(superKmer) {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
|
||||||
|
superKmerStart = kmerStart
|
||||||
|
currentMinimizer = newMinimizer
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if !firstKmer && len(seq[superKmerStart:]) >= k {
|
||||||
|
superKmer := SuperKmer{
|
||||||
|
Minimizer: currentMinimizer,
|
||||||
|
Start: superKmerStart,
|
||||||
|
End: len(seq),
|
||||||
|
Sequence: seq[superKmerStart:],
|
||||||
|
}
|
||||||
|
yield(superKmer)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// ToBioSequence converts a SuperKmer to a BioSequence with metadata.
|
||||||
|
//
|
||||||
|
// The resulting BioSequence contains:
|
||||||
|
// - ID: "{parentID}_superkmer_{start}_{end}"
|
||||||
|
// - Sequence: the actual DNA subsequence
|
||||||
|
// - Attributes:
|
||||||
|
// - "minimizer_value" (uint64): the canonical minimizer value
|
||||||
|
// - "minimizer_seq" (string): the DNA sequence of the minimizer
|
||||||
|
// - "k" (int): the k-mer size
|
||||||
|
// - "m" (int): the minimizer size
|
||||||
|
// - "start" (int): starting position in original sequence
|
||||||
|
// - "end" (int): ending position in original sequence
|
||||||
|
// - "parent_id" (string): ID of the parent sequence
|
||||||
|
//
|
||||||
|
// Parameters:
|
||||||
|
// - k: k-mer size used for extraction
|
||||||
|
// - m: minimizer size used for extraction
|
||||||
|
// - parentID: ID of the parent sequence
|
||||||
|
// - parentSource: source field from the parent sequence
|
||||||
|
//
|
||||||
|
// Returns:
|
||||||
|
// - *obiseq.BioSequence: A new BioSequence representing this super k-mer
|
||||||
|
func (sk *SuperKmer) ToBioSequence(k int, m int, parentID string, parentSource string) *obiseq.BioSequence {
|
||||||
|
// Create ID for the super-kmer
|
||||||
|
var id string
|
||||||
|
if parentID != "" {
|
||||||
|
id = fmt.Sprintf("%s_superkmer_%d_%d", parentID, sk.Start, sk.End)
|
||||||
|
} else {
|
||||||
|
id = fmt.Sprintf("superkmer_%d_%d", sk.Start, sk.End)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Create the BioSequence
|
||||||
|
seq := obiseq.NewBioSequence(id, sk.Sequence, "")
|
||||||
|
|
||||||
|
// Copy source from parent
|
||||||
|
if parentSource != "" {
|
||||||
|
seq.SetSource(parentSource)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Set attributes
|
||||||
|
seq.SetAttribute("minimizer_value", sk.Minimizer)
|
||||||
|
|
||||||
|
// Decode the minimizer to get its DNA sequence
|
||||||
|
minimizerSeq := DecodeKmer(sk.Minimizer, m, nil)
|
||||||
|
seq.SetAttribute("minimizer_seq", string(minimizerSeq))
|
||||||
|
|
||||||
|
seq.SetAttribute("k", k)
|
||||||
|
seq.SetAttribute("m", m)
|
||||||
|
seq.SetAttribute("start", sk.Start)
|
||||||
|
seq.SetAttribute("end", sk.End)
|
||||||
|
|
||||||
|
if parentID != "" {
|
||||||
|
seq.SetAttribute("parent_id", parentID)
|
||||||
|
}
|
||||||
|
|
||||||
|
return seq
|
||||||
|
}
|
||||||
|
|
||||||
|
// SuperKmerWorker creates a SeqWorker that extracts super k-mers from a BioSequence
|
||||||
|
// and returns them as a slice of BioSequence objects.
|
||||||
|
//
|
||||||
|
// The worker copies the source field from the parent sequence to all extracted super k-mers.
|
||||||
|
//
|
||||||
|
// Parameters:
|
||||||
|
// - k: k-mer size (must be between m+1 and 31)
|
||||||
|
// - m: minimizer size (must be between 1 and k-1)
|
||||||
|
//
|
||||||
|
// Returns:
|
||||||
|
// - SeqWorker: A worker function that can be used in obiiter pipelines
|
||||||
|
//
|
||||||
|
// Example:
|
||||||
|
//
|
||||||
|
// worker := SuperKmerWorker(21, 11)
|
||||||
|
// iterator := iterator.MakeIWorker(worker, false)
|
||||||
|
func SuperKmerWorker(k int, m int) obiseq.SeqWorker {
|
||||||
|
return func(seq *obiseq.BioSequence) (obiseq.BioSequenceSlice, error) {
|
||||||
|
if seq == nil {
|
||||||
|
return obiseq.BioSequenceSlice{}, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// Validate parameters
|
||||||
|
if m < 1 || m >= k || k < 2 || k > 31 {
|
||||||
|
return obiseq.BioSequenceSlice{}, fmt.Errorf(
|
||||||
|
"invalid parameters: k=%d, m=%d (need 1 <= m < k <= 31)",
|
||||||
|
k, m)
|
||||||
|
}
|
||||||
|
|
||||||
|
sequence := seq.Sequence()
|
||||||
|
if len(sequence) < k {
|
||||||
|
return obiseq.BioSequenceSlice{}, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
parentID := seq.Id()
|
||||||
|
parentSource := seq.Source()
|
||||||
|
|
||||||
|
// Extract super k-mers and convert to BioSequences
|
||||||
|
result := make(obiseq.BioSequenceSlice, 0)
|
||||||
|
|
||||||
|
for sk := range IterSuperKmers(sequence, k, m) {
|
||||||
|
bioSeq := sk.ToBioSequence(k, m, parentID, parentSource)
|
||||||
|
result = append(result, bioSeq)
|
||||||
|
}
|
||||||
|
|
||||||
|
return result, nil
|
||||||
|
}
|
||||||
|
}
|
||||||
198
pkg/obikmer/superkmer_iter_test.go
Normal file
198
pkg/obikmer/superkmer_iter_test.go
Normal file
@@ -0,0 +1,198 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"testing"
|
||||||
|
)
|
||||||
|
|
||||||
|
func TestIterSuperKmers(t *testing.T) {
|
||||||
|
seq := []byte("ACGTACGTGGGGAAAA")
|
||||||
|
k := 5
|
||||||
|
m := 3
|
||||||
|
|
||||||
|
count := 0
|
||||||
|
for sk := range IterSuperKmers(seq, k, m) {
|
||||||
|
count++
|
||||||
|
t.Logf("SuperKmer %d: Minimizer=%d, Start=%d, End=%d, Seq=%s",
|
||||||
|
count, sk.Minimizer, sk.Start, sk.End, string(sk.Sequence))
|
||||||
|
|
||||||
|
// Verify sequence boundaries
|
||||||
|
if sk.Start < 0 || sk.End > len(seq) {
|
||||||
|
t.Errorf("Invalid boundaries: Start=%d, End=%d, seqLen=%d",
|
||||||
|
sk.Start, sk.End, len(seq))
|
||||||
|
}
|
||||||
|
|
||||||
|
// Verify sequence content
|
||||||
|
if string(sk.Sequence) != string(seq[sk.Start:sk.End]) {
|
||||||
|
t.Errorf("Sequence mismatch: expected %s, got %s",
|
||||||
|
string(seq[sk.Start:sk.End]), string(sk.Sequence))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if count == 0 {
|
||||||
|
t.Error("No super k-mers extracted")
|
||||||
|
}
|
||||||
|
|
||||||
|
t.Logf("Total super k-mers extracted: %d", count)
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestIterSuperKmersVsSlice(t *testing.T) {
|
||||||
|
seq := []byte("ACGTACGTGGGGAAAAACGTACGT")
|
||||||
|
k := 7
|
||||||
|
m := 4
|
||||||
|
|
||||||
|
// Extract using slice version
|
||||||
|
sliceResult := ExtractSuperKmers(seq, k, m, nil)
|
||||||
|
|
||||||
|
// Extract using iterator version
|
||||||
|
var iterResult []SuperKmer
|
||||||
|
for sk := range IterSuperKmers(seq, k, m) {
|
||||||
|
iterResult = append(iterResult, sk)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Compare counts
|
||||||
|
if len(sliceResult) != len(iterResult) {
|
||||||
|
t.Errorf("Different number of super k-mers: slice=%d, iter=%d",
|
||||||
|
len(sliceResult), len(iterResult))
|
||||||
|
}
|
||||||
|
|
||||||
|
// Compare each super k-mer
|
||||||
|
for i := 0; i < len(sliceResult) && i < len(iterResult); i++ {
|
||||||
|
slice := sliceResult[i]
|
||||||
|
iter := iterResult[i]
|
||||||
|
|
||||||
|
if slice.Minimizer != iter.Minimizer {
|
||||||
|
t.Errorf("SuperKmer %d: different minimizers: slice=%d, iter=%d",
|
||||||
|
i, slice.Minimizer, iter.Minimizer)
|
||||||
|
}
|
||||||
|
|
||||||
|
if slice.Start != iter.Start || slice.End != iter.End {
|
||||||
|
t.Errorf("SuperKmer %d: different boundaries: slice=[%d:%d], iter=[%d:%d]",
|
||||||
|
i, slice.Start, slice.End, iter.Start, iter.End)
|
||||||
|
}
|
||||||
|
|
||||||
|
if string(slice.Sequence) != string(iter.Sequence) {
|
||||||
|
t.Errorf("SuperKmer %d: different sequences: slice=%s, iter=%s",
|
||||||
|
i, string(slice.Sequence), string(iter.Sequence))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestSuperKmerMinimizerBijection validates the intrinsic property that
|
||||||
|
// a super k-mer sequence has one and only one minimizer (bijection property).
|
||||||
|
// This test ensures that:
|
||||||
|
// 1. All k-mers in a super k-mer share the same minimizer
|
||||||
|
// 2. Two identical super k-mer sequences must have the same minimizer
|
||||||
|
func TestSuperKmerMinimizerBijection(t *testing.T) {
|
||||||
|
testCases := []struct {
|
||||||
|
name string
|
||||||
|
seq []byte
|
||||||
|
k int
|
||||||
|
m int
|
||||||
|
}{
|
||||||
|
{
|
||||||
|
name: "simple sequence",
|
||||||
|
seq: []byte("ACGTACGTACGTACGTACGTACGTACGTACGT"),
|
||||||
|
k: 21,
|
||||||
|
m: 11,
|
||||||
|
},
|
||||||
|
{
|
||||||
|
name: "homopolymer blocks",
|
||||||
|
seq: []byte("AAAACCCCGGGGTTTTAAAACCCCGGGGTTTT"),
|
||||||
|
k: 21,
|
||||||
|
m: 11,
|
||||||
|
},
|
||||||
|
{
|
||||||
|
name: "complex sequence",
|
||||||
|
seq: []byte("ATCGATCGATCGATCGATCGATCGATCGATCG"),
|
||||||
|
k: 15,
|
||||||
|
m: 7,
|
||||||
|
},
|
||||||
|
{
|
||||||
|
name: "longer sequence",
|
||||||
|
seq: []byte("ACGTACGTGGGGAAAAACGTACGTTTTTCCCCACGTACGT"),
|
||||||
|
k: 13,
|
||||||
|
m: 7,
|
||||||
|
},
|
||||||
|
}
|
||||||
|
|
||||||
|
for _, tc := range testCases {
|
||||||
|
t.Run(tc.name, func(t *testing.T) {
|
||||||
|
// Map to track sequence -> minimizer
|
||||||
|
seqToMinimizer := make(map[string]uint64)
|
||||||
|
|
||||||
|
for sk := range IterSuperKmers(tc.seq, tc.k, tc.m) {
|
||||||
|
seqStr := string(sk.Sequence)
|
||||||
|
|
||||||
|
// Check if we've seen this sequence before
|
||||||
|
if prevMinimizer, exists := seqToMinimizer[seqStr]; exists {
|
||||||
|
if prevMinimizer != sk.Minimizer {
|
||||||
|
t.Errorf("BIJECTION VIOLATION: sequence %s has two different minimizers:\n"+
|
||||||
|
" First: %d\n"+
|
||||||
|
" Second: %d\n"+
|
||||||
|
" This violates the super k-mer definition!",
|
||||||
|
seqStr, prevMinimizer, sk.Minimizer)
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
seqToMinimizer[seqStr] = sk.Minimizer
|
||||||
|
}
|
||||||
|
|
||||||
|
// Verify all k-mers in this super k-mer have the same minimizer
|
||||||
|
if len(sk.Sequence) >= tc.k {
|
||||||
|
for i := 0; i <= len(sk.Sequence)-tc.k; i++ {
|
||||||
|
kmerSeq := sk.Sequence[i : i+tc.k]
|
||||||
|
minimizer := findMinimizer(kmerSeq, tc.k, tc.m)
|
||||||
|
if minimizer != sk.Minimizer {
|
||||||
|
t.Errorf("K-mer at position %d in super k-mer has different minimizer:\n"+
|
||||||
|
" K-mer: %s\n"+
|
||||||
|
" Expected minimizer: %d\n"+
|
||||||
|
" Actual minimizer: %d\n"+
|
||||||
|
" Super k-mer: %s",
|
||||||
|
i, string(kmerSeq), sk.Minimizer, minimizer, seqStr)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
})
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// findMinimizer computes the minimizer of a k-mer for testing purposes
|
||||||
|
func findMinimizer(kmer []byte, k int, m int) uint64 {
|
||||||
|
if len(kmer) != k {
|
||||||
|
return 0
|
||||||
|
}
|
||||||
|
|
||||||
|
mMask := uint64(1)<<(m*2) - 1
|
||||||
|
rcShift := uint((m - 1) * 2)
|
||||||
|
|
||||||
|
minMinimizer := uint64(^uint64(0)) // max uint64
|
||||||
|
|
||||||
|
// Scan all m-mers in the k-mer
|
||||||
|
var fwdMmer, rvcMmer uint64
|
||||||
|
for i := 0; i < m-1 && i < len(kmer); i++ {
|
||||||
|
code := uint64(__single_base_code__[kmer[i]&31])
|
||||||
|
fwdMmer = (fwdMmer << 2) | code
|
||||||
|
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
|
||||||
|
}
|
||||||
|
|
||||||
|
for i := m - 1; i < len(kmer); i++ {
|
||||||
|
code := uint64(__single_base_code__[kmer[i]&31])
|
||||||
|
fwdMmer = ((fwdMmer << 2) | code) & mMask
|
||||||
|
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
|
||||||
|
|
||||||
|
canonical := fwdMmer
|
||||||
|
if rvcMmer < fwdMmer {
|
||||||
|
canonical = rvcMmer
|
||||||
|
}
|
||||||
|
|
||||||
|
if canonical < minMinimizer {
|
||||||
|
minMinimizer = canonical
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return minMinimizer
|
||||||
|
}
|
||||||
|
|
||||||
|
// Note: Tests for ToBioSequence and SuperKmerWorker are in a separate
|
||||||
|
// integration test package to avoid circular dependencies between
|
||||||
|
// obikmer and obiseq packages.
|
||||||
53
pkg/obikmer/varint.go
Normal file
53
pkg/obikmer/varint.go
Normal file
@@ -0,0 +1,53 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import "io"
|
||||||
|
|
||||||
|
// EncodeVarint writes a uint64 value as a variable-length integer to w.
|
||||||
|
// Uses 7 bits per byte with the high bit as a continuation flag
|
||||||
|
// (identical to protobuf unsigned varint encoding).
|
||||||
|
// Returns the number of bytes written.
|
||||||
|
func EncodeVarint(w io.Writer, v uint64) (int, error) {
|
||||||
|
var buf [10]byte // max 10 bytes for uint64 varint
|
||||||
|
n := 0
|
||||||
|
for v >= 0x80 {
|
||||||
|
buf[n] = byte(v) | 0x80
|
||||||
|
v >>= 7
|
||||||
|
n++
|
||||||
|
}
|
||||||
|
buf[n] = byte(v)
|
||||||
|
n++
|
||||||
|
return w.Write(buf[:n])
|
||||||
|
}
|
||||||
|
|
||||||
|
// DecodeVarint reads a variable-length encoded uint64 from r.
|
||||||
|
// Returns the decoded value and any error encountered.
|
||||||
|
func DecodeVarint(r io.Reader) (uint64, error) {
|
||||||
|
var val uint64
|
||||||
|
var shift uint
|
||||||
|
var buf [1]byte
|
||||||
|
|
||||||
|
for {
|
||||||
|
if _, err := io.ReadFull(r, buf[:]); err != nil {
|
||||||
|
return 0, err
|
||||||
|
}
|
||||||
|
b := buf[0]
|
||||||
|
val |= uint64(b&0x7F) << shift
|
||||||
|
if b < 0x80 {
|
||||||
|
return val, nil
|
||||||
|
}
|
||||||
|
shift += 7
|
||||||
|
if shift >= 70 {
|
||||||
|
return 0, io.ErrUnexpectedEOF
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// VarintLen returns the number of bytes needed to encode v as a varint.
|
||||||
|
func VarintLen(v uint64) int {
|
||||||
|
n := 1
|
||||||
|
for v >= 0x80 {
|
||||||
|
v >>= 7
|
||||||
|
n++
|
||||||
|
}
|
||||||
|
return n
|
||||||
|
}
|
||||||
82
pkg/obikmer/varint_test.go
Normal file
82
pkg/obikmer/varint_test.go
Normal file
@@ -0,0 +1,82 @@
|
|||||||
|
package obikmer
|
||||||
|
|
||||||
|
import (
|
||||||
|
"bytes"
|
||||||
|
"testing"
|
||||||
|
)
|
||||||
|
|
||||||
|
func TestVarintRoundTrip(t *testing.T) {
|
||||||
|
values := []uint64{
|
||||||
|
0, 1, 127, 128, 255, 256,
|
||||||
|
16383, 16384,
|
||||||
|
1<<21 - 1, 1 << 21,
|
||||||
|
1<<28 - 1, 1 << 28,
|
||||||
|
1<<35 - 1, 1 << 35,
|
||||||
|
1<<42 - 1, 1 << 42,
|
||||||
|
1<<49 - 1, 1 << 49,
|
||||||
|
1<<56 - 1, 1 << 56,
|
||||||
|
1<<63 - 1, 1 << 63,
|
||||||
|
^uint64(0), // max uint64
|
||||||
|
}
|
||||||
|
|
||||||
|
for _, v := range values {
|
||||||
|
var buf bytes.Buffer
|
||||||
|
n, err := EncodeVarint(&buf, v)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatalf("EncodeVarint(%d): %v", v, err)
|
||||||
|
}
|
||||||
|
if n != VarintLen(v) {
|
||||||
|
t.Fatalf("EncodeVarint(%d): wrote %d bytes, VarintLen says %d", v, n, VarintLen(v))
|
||||||
|
}
|
||||||
|
|
||||||
|
decoded, err := DecodeVarint(&buf)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatalf("DecodeVarint for %d: %v", v, err)
|
||||||
|
}
|
||||||
|
if decoded != v {
|
||||||
|
t.Fatalf("roundtrip failed: encoded %d, decoded %d", v, decoded)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestVarintLen(t *testing.T) {
|
||||||
|
tests := []struct {
|
||||||
|
value uint64
|
||||||
|
expected int
|
||||||
|
}{
|
||||||
|
{0, 1},
|
||||||
|
{127, 1},
|
||||||
|
{128, 2},
|
||||||
|
{16383, 2},
|
||||||
|
{16384, 3},
|
||||||
|
{^uint64(0), 10},
|
||||||
|
}
|
||||||
|
|
||||||
|
for _, tc := range tests {
|
||||||
|
got := VarintLen(tc.value)
|
||||||
|
if got != tc.expected {
|
||||||
|
t.Errorf("VarintLen(%d) = %d, want %d", tc.value, got, tc.expected)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func TestVarintSequence(t *testing.T) {
|
||||||
|
var buf bytes.Buffer
|
||||||
|
values := []uint64{0, 42, 1000000, ^uint64(0), 1}
|
||||||
|
|
||||||
|
for _, v := range values {
|
||||||
|
if _, err := EncodeVarint(&buf, v); err != nil {
|
||||||
|
t.Fatalf("EncodeVarint(%d): %v", v, err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
for _, expected := range values {
|
||||||
|
got, err := DecodeVarint(&buf)
|
||||||
|
if err != nil {
|
||||||
|
t.Fatalf("DecodeVarint: %v", err)
|
||||||
|
}
|
||||||
|
if got != expected {
|
||||||
|
t.Errorf("got %d, want %d", got, expected)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -26,16 +26,11 @@ var __defaut_taxonomy_mutex__ sync.Mutex
|
|||||||
|
|
||||||
type ArgumentParser func([]string) (*getoptions.GetOpt, []string)
|
type ArgumentParser func([]string) (*getoptions.GetOpt, []string)
|
||||||
|
|
||||||
func GenerateOptionParser(program string,
|
// RegisterGlobalOptions registers the global options shared by all obitools
|
||||||
documentation string,
|
// commands onto the given GetOpt instance. It does NOT register --help,
|
||||||
optionset ...func(*getoptions.GetOpt)) ArgumentParser {
|
// which must be handled by the caller (either as a Bool option or via
|
||||||
|
// HelpCommand for subcommand-based parsers).
|
||||||
options := getoptions.New()
|
func RegisterGlobalOptions(options *getoptions.GetOpt) {
|
||||||
options.Self(program, documentation)
|
|
||||||
options.SetMode(getoptions.Bundling)
|
|
||||||
options.SetUnknownMode(getoptions.Fail)
|
|
||||||
options.Bool("help", false, options.Alias("h", "?"))
|
|
||||||
|
|
||||||
options.Bool("version", false,
|
options.Bool("version", false,
|
||||||
options.Description("Prints the version and exits."))
|
options.Description("Prints the version and exits."))
|
||||||
|
|
||||||
@@ -46,17 +41,10 @@ func GenerateOptionParser(program string,
|
|||||||
options.BoolVar(&_Pprof, "pprof", false,
|
options.BoolVar(&_Pprof, "pprof", false,
|
||||||
options.Description("Enable pprof server. Look at the log for details."))
|
options.Description("Enable pprof server. Look at the log for details."))
|
||||||
|
|
||||||
// options.IntVar(&_ParallelWorkers, "workers", _ParallelWorkers,
|
|
||||||
// options.Alias("w"),
|
|
||||||
// options.Description("Number of parallele threads computing the result"))
|
|
||||||
|
|
||||||
options.IntVar(obidefault.MaxCPUPtr(), "max-cpu", obidefault.MaxCPU(),
|
options.IntVar(obidefault.MaxCPUPtr(), "max-cpu", obidefault.MaxCPU(),
|
||||||
options.GetEnv("OBIMAXCPU"),
|
options.GetEnv("OBIMAXCPU"),
|
||||||
options.Description("Number of parallele threads computing the result"))
|
options.Description("Number of parallele threads computing the result"))
|
||||||
|
|
||||||
// options.BoolVar(&_Pprof, "force-one-cpu", false,
|
|
||||||
// options.Description("Force to use only one cpu core for parallel processing"))
|
|
||||||
|
|
||||||
options.IntVar(&_PprofMudex, "pprof-mutex", _PprofMudex,
|
options.IntVar(&_PprofMudex, "pprof-mutex", _PprofMudex,
|
||||||
options.GetEnv("OBIPPROFMUTEX"),
|
options.GetEnv("OBIPPROFMUTEX"),
|
||||||
options.Description("Enable profiling of mutex lock."))
|
options.Description("Enable profiling of mutex lock."))
|
||||||
@@ -77,119 +65,119 @@ func GenerateOptionParser(program string,
|
|||||||
options.GetEnv("OBIWARNING"),
|
options.GetEnv("OBIWARNING"),
|
||||||
options.Description("Stop printing of the warning message"),
|
options.Description("Stop printing of the warning message"),
|
||||||
)
|
)
|
||||||
|
}
|
||||||
|
|
||||||
|
// ProcessParsedOptions handles the post-parse logic common to all obitools
|
||||||
|
// commands: help, version, debug, pprof, taxonomy, cpu configuration, etc.
|
||||||
|
// It receives the GetOpt instance and the parse error (if any).
|
||||||
|
func ProcessParsedOptions(options *getoptions.GetOpt, parseErr error) {
|
||||||
|
// Note: "help" may not be registered as a Bool (e.g. when using HelpCommand
|
||||||
|
// for subcommand-based parsers). Only check if it won't panic.
|
||||||
|
// We use a recover guard to be safe.
|
||||||
|
func() {
|
||||||
|
defer func() { recover() }()
|
||||||
|
if options.Called("help") {
|
||||||
|
fmt.Fprint(os.Stderr, options.Help())
|
||||||
|
os.Exit(0)
|
||||||
|
}
|
||||||
|
}()
|
||||||
|
|
||||||
|
if options.Called("version") {
|
||||||
|
fmt.Fprintf(os.Stderr, "OBITools %s\n", VersionString())
|
||||||
|
os.Exit(0)
|
||||||
|
}
|
||||||
|
|
||||||
|
if options.Called("taxonomy") {
|
||||||
|
__defaut_taxonomy_mutex__.Lock()
|
||||||
|
defer __defaut_taxonomy_mutex__.Unlock()
|
||||||
|
taxonomy, err := obiformats.LoadTaxonomy(
|
||||||
|
obidefault.SelectedTaxonomy(),
|
||||||
|
!obidefault.AreAlternativeNamesSelected(),
|
||||||
|
SeqAsTaxa(),
|
||||||
|
)
|
||||||
|
|
||||||
|
if err != nil {
|
||||||
|
log.Fatalf("Cannot load default taxonomy: %v", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
taxonomy.SetAsDefault()
|
||||||
|
}
|
||||||
|
|
||||||
|
log.SetLevel(log.InfoLevel)
|
||||||
|
if options.Called("debug") {
|
||||||
|
log.SetLevel(log.DebugLevel)
|
||||||
|
log.Debugln("Switch to debug level logging")
|
||||||
|
}
|
||||||
|
|
||||||
|
if options.Called("pprof") {
|
||||||
|
url := "localhost:6060"
|
||||||
|
go http.ListenAndServe(url, nil)
|
||||||
|
log.Infof("Start a pprof server at address %s/debug/pprof", url)
|
||||||
|
log.Info("Profil can be followed running concurrently the command :")
|
||||||
|
log.Info(" go tool pprof -http=127.0.0.1:8080 'http://localhost:6060/debug/pprof/profile?seconds=30'")
|
||||||
|
}
|
||||||
|
|
||||||
|
if options.Called("pprof-mutex") {
|
||||||
|
url := "localhost:6060"
|
||||||
|
go http.ListenAndServe(url, nil)
|
||||||
|
runtime.SetMutexProfileFraction(_PprofMudex)
|
||||||
|
log.Infof("Start a pprof server at address %s/debug/pprof", url)
|
||||||
|
log.Info("Profil can be followed running concurrently the command :")
|
||||||
|
log.Info(" go tool pprof -http=127.0.0.1:8080 'http://localhost:6060/debug/pprof/mutex'")
|
||||||
|
}
|
||||||
|
|
||||||
|
if options.Called("pprof-goroutine") {
|
||||||
|
url := "localhost:6060"
|
||||||
|
go http.ListenAndServe(url, nil)
|
||||||
|
runtime.SetBlockProfileRate(_PprofGoroutine)
|
||||||
|
log.Infof("Start a pprof server at address %s/debug/pprof", url)
|
||||||
|
log.Info("Profil can be followed running concurrently the command :")
|
||||||
|
log.Info(" go tool pprof -http=127.0.0.1:8080 'http://localhost:6060/debug/pprof/block'")
|
||||||
|
}
|
||||||
|
|
||||||
|
// Handle user errors
|
||||||
|
if parseErr != nil {
|
||||||
|
fmt.Fprintf(os.Stderr, "ERROR: %s\n\n", parseErr)
|
||||||
|
fmt.Fprint(os.Stderr, options.Help(getoptions.HelpSynopsis))
|
||||||
|
os.Exit(1)
|
||||||
|
}
|
||||||
|
|
||||||
|
runtime.GOMAXPROCS(obidefault.MaxCPU())
|
||||||
|
|
||||||
|
if options.Called("max-cpu") {
|
||||||
|
log.Printf("CPU number limited to %d", obidefault.MaxCPU())
|
||||||
|
}
|
||||||
|
|
||||||
|
if options.Called("no-singleton") {
|
||||||
|
log.Printf("No singleton option set")
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Printf("Number of workers set %d", obidefault.ParallelWorkers())
|
||||||
|
|
||||||
|
if options.Called("solexa") {
|
||||||
|
obidefault.SetReadQualitiesShift(64)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func GenerateOptionParser(program string,
|
||||||
|
documentation string,
|
||||||
|
optionset ...func(*getoptions.GetOpt)) ArgumentParser {
|
||||||
|
|
||||||
|
options := getoptions.New()
|
||||||
|
options.Self(program, documentation)
|
||||||
|
options.SetMode(getoptions.Bundling)
|
||||||
|
options.SetUnknownMode(getoptions.Fail)
|
||||||
|
options.Bool("help", false, options.Alias("h", "?"))
|
||||||
|
|
||||||
|
RegisterGlobalOptions(options)
|
||||||
|
|
||||||
for _, o := range optionset {
|
for _, o := range optionset {
|
||||||
o(options)
|
o(options)
|
||||||
}
|
}
|
||||||
|
|
||||||
return func(args []string) (*getoptions.GetOpt, []string) {
|
return func(args []string) (*getoptions.GetOpt, []string) {
|
||||||
|
|
||||||
remaining, err := options.Parse(args[1:])
|
remaining, err := options.Parse(args[1:])
|
||||||
|
ProcessParsedOptions(options, err)
|
||||||
if options.Called("help") {
|
|
||||||
fmt.Fprint(os.Stderr, options.Help())
|
|
||||||
os.Exit(0)
|
|
||||||
}
|
|
||||||
|
|
||||||
if options.Called("version") {
|
|
||||||
fmt.Fprintf(os.Stderr, "OBITools %s\n", VersionString())
|
|
||||||
os.Exit(0)
|
|
||||||
}
|
|
||||||
|
|
||||||
if options.Called("taxonomy") {
|
|
||||||
__defaut_taxonomy_mutex__.Lock()
|
|
||||||
defer __defaut_taxonomy_mutex__.Unlock()
|
|
||||||
taxonomy, err := obiformats.LoadTaxonomy(
|
|
||||||
obidefault.SelectedTaxonomy(),
|
|
||||||
!obidefault.AreAlternativeNamesSelected(),
|
|
||||||
SeqAsTaxa(),
|
|
||||||
)
|
|
||||||
|
|
||||||
if err != nil {
|
|
||||||
log.Fatalf("Cannot load default taxonomy: %v", err)
|
|
||||||
|
|
||||||
}
|
|
||||||
|
|
||||||
taxonomy.SetAsDefault()
|
|
||||||
}
|
|
||||||
|
|
||||||
log.SetLevel(log.InfoLevel)
|
|
||||||
if options.Called("debug") {
|
|
||||||
log.SetLevel(log.DebugLevel)
|
|
||||||
log.Debugln("Switch to debug level logging")
|
|
||||||
}
|
|
||||||
|
|
||||||
if options.Called("pprof") {
|
|
||||||
url := "localhost:6060"
|
|
||||||
go http.ListenAndServe(url, nil)
|
|
||||||
log.Infof("Start a pprof server at address %s/debug/pprof", url)
|
|
||||||
log.Info("Profil can be followed running concurrently the command :")
|
|
||||||
log.Info(" go tool pprof -http=127.0.0.1:8080 'http://localhost:6060/debug/pprof/profile?seconds=30'")
|
|
||||||
}
|
|
||||||
|
|
||||||
if options.Called("pprof-mutex") {
|
|
||||||
url := "localhost:6060"
|
|
||||||
go http.ListenAndServe(url, nil)
|
|
||||||
runtime.SetMutexProfileFraction(_PprofMudex)
|
|
||||||
log.Infof("Start a pprof server at address %s/debug/pprof", url)
|
|
||||||
log.Info("Profil can be followed running concurrently the command :")
|
|
||||||
log.Info(" go tool pprof -http=127.0.0.1:8080 'http://localhost:6060/debug/pprof/mutex'")
|
|
||||||
}
|
|
||||||
|
|
||||||
if options.Called("pprof-goroutine") {
|
|
||||||
url := "localhost:6060"
|
|
||||||
go http.ListenAndServe(url, nil)
|
|
||||||
runtime.SetBlockProfileRate(_PprofGoroutine)
|
|
||||||
log.Infof("Start a pprof server at address %s/debug/pprof", url)
|
|
||||||
log.Info("Profil can be followed running concurrently the command :")
|
|
||||||
log.Info(" go tool pprof -http=127.0.0.1:8080 'http://localhost:6060/debug/pprof/block'")
|
|
||||||
}
|
|
||||||
|
|
||||||
// Handle user errors
|
|
||||||
if err != nil {
|
|
||||||
fmt.Fprintf(os.Stderr, "ERROR: %s\n\n", err)
|
|
||||||
fmt.Fprint(os.Stderr, options.Help(getoptions.HelpSynopsis))
|
|
||||||
os.Exit(1)
|
|
||||||
}
|
|
||||||
|
|
||||||
// // Setup the maximum number of CPU usable by the program
|
|
||||||
// if obidefault.MaxCPU() == 1 {
|
|
||||||
// log.Warn("Limitating the Maximum number of CPU to 1 is not recommanded")
|
|
||||||
// log.Warn("The number of CPU requested has been set to 2")
|
|
||||||
// obidefault.SetMaxCPU(2)
|
|
||||||
// }
|
|
||||||
|
|
||||||
// if options.Called("force-one-cpu") {
|
|
||||||
// log.Warn("Limitating the Maximum number of CPU to 1 is not recommanded")
|
|
||||||
// log.Warn("The number of CPU has been forced to 1")
|
|
||||||
// log.Warn("This can lead to unexpected behavior")
|
|
||||||
// obidefault.SetMaxCPU(1)
|
|
||||||
// }
|
|
||||||
|
|
||||||
runtime.GOMAXPROCS(obidefault.MaxCPU())
|
|
||||||
|
|
||||||
// if options.Called("max-cpu") || options.Called("force-one-cpu") {
|
|
||||||
// log.Printf("CPU number limited to %d", obidefault.MaxCPU())
|
|
||||||
// }
|
|
||||||
|
|
||||||
if options.Called("max-cpu") {
|
|
||||||
log.Printf("CPU number limited to %d", obidefault.MaxCPU())
|
|
||||||
}
|
|
||||||
|
|
||||||
if options.Called("no-singleton") {
|
|
||||||
log.Printf("No singleton option set")
|
|
||||||
}
|
|
||||||
|
|
||||||
log.Printf("Number of workers set %d", obidefault.ParallelWorkers())
|
|
||||||
|
|
||||||
// if options.Called("workers") {
|
|
||||||
|
|
||||||
// }
|
|
||||||
|
|
||||||
if options.Called("solexa") {
|
|
||||||
obidefault.SetReadQualitiesShift(64)
|
|
||||||
}
|
|
||||||
|
|
||||||
return options, remaining
|
return options, remaining
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
43
pkg/obioptions/subcommand.go
Normal file
43
pkg/obioptions/subcommand.go
Normal file
@@ -0,0 +1,43 @@
|
|||||||
|
package obioptions
|
||||||
|
|
||||||
|
import (
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
// GenerateSubcommandParser creates an option parser that supports subcommands
|
||||||
|
// via go-getoptions' NewCommand/SetCommandFn/Dispatch API.
|
||||||
|
//
|
||||||
|
// The setup function receives the root *GetOpt and should register subcommands
|
||||||
|
// using opt.NewCommand(). Global options (--debug, --max-cpu, etc.) are
|
||||||
|
// registered before setup is called and are inherited by all subcommands.
|
||||||
|
//
|
||||||
|
// Returns the root *GetOpt (needed for Dispatch) and an ArgumentParser
|
||||||
|
// that handles parsing and post-parse processing.
|
||||||
|
func GenerateSubcommandParser(
|
||||||
|
program string,
|
||||||
|
documentation string,
|
||||||
|
setup func(opt *getoptions.GetOpt),
|
||||||
|
) (*getoptions.GetOpt, ArgumentParser) {
|
||||||
|
|
||||||
|
options := getoptions.New()
|
||||||
|
options.Self(program, documentation)
|
||||||
|
options.SetMode(getoptions.Bundling)
|
||||||
|
options.SetUnknownMode(getoptions.Fail)
|
||||||
|
|
||||||
|
// Register global options (inherited by all subcommands)
|
||||||
|
RegisterGlobalOptions(options)
|
||||||
|
|
||||||
|
// Let the caller register subcommands
|
||||||
|
setup(options)
|
||||||
|
|
||||||
|
// Add automatic help subcommand (must be after all commands)
|
||||||
|
options.HelpCommand("help", options.Description("Show help for a command"))
|
||||||
|
|
||||||
|
parser := func(args []string) (*getoptions.GetOpt, []string) {
|
||||||
|
remaining, err := options.Parse(args[1:])
|
||||||
|
ProcessParsedOptions(options, err)
|
||||||
|
return options, remaining
|
||||||
|
}
|
||||||
|
|
||||||
|
return options, parser
|
||||||
|
}
|
||||||
@@ -3,7 +3,7 @@ package obioptions
|
|||||||
// Version is automatically updated by the Makefile from version.txt
|
// Version is automatically updated by the Makefile from version.txt
|
||||||
// The patch number (third digit) is incremented on each push to the repository
|
// The patch number (third digit) is incremented on each push to the repository
|
||||||
|
|
||||||
var _Version = "Release 4.4.10"
|
var _Version = "Release 4.4.15"
|
||||||
|
|
||||||
// Version returns the version of the obitools package.
|
// Version returns the version of the obitools package.
|
||||||
//
|
//
|
||||||
|
|||||||
@@ -13,6 +13,7 @@ import (
|
|||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
"github.com/schollz/progressbar/v3"
|
"github.com/schollz/progressbar/v3"
|
||||||
)
|
)
|
||||||
@@ -69,16 +70,18 @@ func EmpiricalDistCsv(filename string, data [][]Ratio, compressed bool) {
|
|||||||
}
|
}
|
||||||
defer destfile.Close()
|
defer destfile.Close()
|
||||||
|
|
||||||
pbopt := make([]progressbar.Option, 0, 5)
|
var bar *progressbar.ProgressBar
|
||||||
pbopt = append(pbopt,
|
if obidefault.ProgressBar() {
|
||||||
progressbar.OptionSetWriter(os.Stderr),
|
pbopt := make([]progressbar.Option, 0, 5)
|
||||||
progressbar.OptionSetWidth(15),
|
pbopt = append(pbopt,
|
||||||
progressbar.OptionShowIts(),
|
progressbar.OptionSetWriter(os.Stderr),
|
||||||
progressbar.OptionSetPredictTime(true),
|
progressbar.OptionSetWidth(15),
|
||||||
progressbar.OptionSetDescription("[Save CSV stat ratio file]"),
|
progressbar.OptionShowIts(),
|
||||||
)
|
progressbar.OptionSetPredictTime(true),
|
||||||
|
progressbar.OptionSetDescription("[Save CSV stat ratio file]"),
|
||||||
bar := progressbar.NewOptions(len(data), pbopt...)
|
)
|
||||||
|
bar = progressbar.NewOptions(len(data), pbopt...)
|
||||||
|
}
|
||||||
|
|
||||||
fmt.Fprintln(destfile, "Sample,Origin_id,Origin_status,Origin,Mutant,Origin_Weight,Mutant_Weight,Origin_Count,Mutant_Count,Position,Origin_length,A,C,G,T")
|
fmt.Fprintln(destfile, "Sample,Origin_id,Origin_status,Origin,Mutant,Origin_Weight,Mutant_Weight,Origin_Count,Mutant_Count,Position,Origin_length,A,C,G,T")
|
||||||
for code, dist := range data {
|
for code, dist := range data {
|
||||||
@@ -101,7 +104,9 @@ func EmpiricalDistCsv(filename string, data [][]Ratio, compressed bool) {
|
|||||||
ratio.T,
|
ratio.T,
|
||||||
)
|
)
|
||||||
}
|
}
|
||||||
bar.Add(1)
|
if bar != nil {
|
||||||
|
bar.Add(1)
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -181,16 +186,18 @@ func SaveGMLGraphs(dirname string,
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
pbopt := make([]progressbar.Option, 0, 5)
|
var bar *progressbar.ProgressBar
|
||||||
pbopt = append(pbopt,
|
if obidefault.ProgressBar() {
|
||||||
progressbar.OptionSetWriter(os.Stderr),
|
pbopt := make([]progressbar.Option, 0, 5)
|
||||||
progressbar.OptionSetWidth(15),
|
pbopt = append(pbopt,
|
||||||
progressbar.OptionShowIts(),
|
progressbar.OptionSetWriter(os.Stderr),
|
||||||
progressbar.OptionSetPredictTime(true),
|
progressbar.OptionSetWidth(15),
|
||||||
progressbar.OptionSetDescription("[Save GML Graph files]"),
|
progressbar.OptionShowIts(),
|
||||||
)
|
progressbar.OptionSetPredictTime(true),
|
||||||
|
progressbar.OptionSetDescription("[Save GML Graph files]"),
|
||||||
bar := progressbar.NewOptions(len(samples), pbopt...)
|
)
|
||||||
|
bar = progressbar.NewOptions(len(samples), pbopt...)
|
||||||
|
}
|
||||||
|
|
||||||
for name, seqs := range samples {
|
for name, seqs := range samples {
|
||||||
|
|
||||||
@@ -204,7 +211,9 @@ func SaveGMLGraphs(dirname string,
|
|||||||
file.WriteString(Gml(seqs, name, statThreshold))
|
file.WriteString(Gml(seqs, name, statThreshold))
|
||||||
file.Close()
|
file.Close()
|
||||||
|
|
||||||
bar.Add(1)
|
if bar != nil {
|
||||||
|
bar.Add(1)
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
}
|
}
|
||||||
@@ -495,37 +504,44 @@ func BuildSeqGraph(samples map[string]*[]*seqPCR,
|
|||||||
npairs += nseq * (nseq - 1) / 2
|
npairs += nseq * (nseq - 1) / 2
|
||||||
}
|
}
|
||||||
|
|
||||||
pbopt := make([]progressbar.Option, 0, 5)
|
var bar *progressbar.ProgressBar
|
||||||
pbopt = append(pbopt,
|
if obidefault.ProgressBar() {
|
||||||
progressbar.OptionSetWriter(os.Stderr),
|
pbopt := make([]progressbar.Option, 0, 5)
|
||||||
progressbar.OptionSetWidth(15),
|
|
||||||
progressbar.OptionShowIts(),
|
|
||||||
progressbar.OptionSetPredictTime(true),
|
|
||||||
progressbar.OptionSetDescription("[One error graph]"),
|
|
||||||
)
|
|
||||||
|
|
||||||
bar := progressbar.NewOptions(npairs, pbopt...)
|
|
||||||
for _, seqs := range samples {
|
|
||||||
np := buildSamplePairs(seqs, workers)
|
|
||||||
|
|
||||||
bar.Add(np)
|
|
||||||
}
|
|
||||||
|
|
||||||
if maxError > 1 {
|
|
||||||
pbopt = make([]progressbar.Option, 0, 5)
|
|
||||||
pbopt = append(pbopt,
|
pbopt = append(pbopt,
|
||||||
progressbar.OptionSetWriter(os.Stderr),
|
progressbar.OptionSetWriter(os.Stderr),
|
||||||
progressbar.OptionSetWidth(15),
|
progressbar.OptionSetWidth(15),
|
||||||
progressbar.OptionShowIts(),
|
progressbar.OptionShowIts(),
|
||||||
progressbar.OptionSetPredictTime(true),
|
progressbar.OptionSetPredictTime(true),
|
||||||
progressbar.OptionSetDescription("[Adds multiple errors]"),
|
progressbar.OptionSetDescription("[One error graph]"),
|
||||||
)
|
)
|
||||||
|
|
||||||
bar = progressbar.NewOptions(npairs, pbopt...)
|
bar = progressbar.NewOptions(npairs, pbopt...)
|
||||||
|
}
|
||||||
|
|
||||||
for _, seqs := range samples {
|
for _, seqs := range samples {
|
||||||
np := extendSimilarityGraph(seqs, maxError, workers)
|
np := buildSamplePairs(seqs, workers)
|
||||||
|
if bar != nil {
|
||||||
bar.Add(np)
|
bar.Add(np)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
if maxError > 1 {
|
||||||
|
if obidefault.ProgressBar() {
|
||||||
|
pbopt := make([]progressbar.Option, 0, 5)
|
||||||
|
pbopt = append(pbopt,
|
||||||
|
progressbar.OptionSetWriter(os.Stderr),
|
||||||
|
progressbar.OptionSetWidth(15),
|
||||||
|
progressbar.OptionShowIts(),
|
||||||
|
progressbar.OptionSetPredictTime(true),
|
||||||
|
progressbar.OptionSetDescription("[Adds multiple errors]"),
|
||||||
|
)
|
||||||
|
bar = progressbar.NewOptions(npairs, pbopt...)
|
||||||
|
}
|
||||||
|
|
||||||
|
for _, seqs := range samples {
|
||||||
|
np := extendSimilarityGraph(seqs, maxError, workers)
|
||||||
|
if bar != nil {
|
||||||
|
bar.Add(np)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -31,7 +31,6 @@ var __output_in_json__ = false
|
|||||||
var __output_fastjson_format__ = false
|
var __output_fastjson_format__ = false
|
||||||
var __output_fastobi_format__ = false
|
var __output_fastobi_format__ = false
|
||||||
|
|
||||||
var __no_progress_bar__ = false
|
|
||||||
var __skip_empty__ = false
|
var __skip_empty__ = false
|
||||||
var __skip_on_error__ = false
|
var __skip_on_error__ = false
|
||||||
|
|
||||||
@@ -82,7 +81,7 @@ func InputOptionSet(options *getoptions.GetOpt) {
|
|||||||
}
|
}
|
||||||
|
|
||||||
func OutputModeOptionSet(options *getoptions.GetOpt, compressed bool) {
|
func OutputModeOptionSet(options *getoptions.GetOpt, compressed bool) {
|
||||||
options.BoolVar(&__no_progress_bar__, "no-progressbar", false,
|
options.BoolVar(obidefault.NoProgressBarPtr(), "no-progressbar", obidefault.NoProgressBar(),
|
||||||
options.Description("Disable the progress bar printing"))
|
options.Description("Disable the progress bar printing"))
|
||||||
|
|
||||||
if compressed {
|
if compressed {
|
||||||
@@ -224,13 +223,16 @@ func CLIAnalyzeOnly() int {
|
|||||||
|
|
||||||
func CLIProgressBar() bool {
|
func CLIProgressBar() bool {
|
||||||
// If the output is not a terminal, then we do not display the progress bar
|
// If the output is not a terminal, then we do not display the progress bar
|
||||||
o, _ := os.Stderr.Stat()
|
oe, _ := os.Stderr.Stat()
|
||||||
onTerminal := (o.Mode() & os.ModeCharDevice) == os.ModeCharDevice
|
onTerminal := (oe.Mode() & os.ModeCharDevice) == os.ModeCharDevice
|
||||||
if !onTerminal {
|
if !onTerminal {
|
||||||
log.Info("Stderr is redirected, progress bar disabled")
|
log.Info("Stderr is redirected, progress bar disabled")
|
||||||
}
|
}
|
||||||
|
|
||||||
return onTerminal && !__no_progress_bar__
|
oo, _ := os.Stdout.Stat()
|
||||||
|
toPipe := (oo.Mode() & os.ModeNamedPipe) == os.ModeNamedPipe
|
||||||
|
|
||||||
|
return onTerminal && !toPipe && obidefault.ProgressBar()
|
||||||
}
|
}
|
||||||
|
|
||||||
func CLIOutPutFileName() string {
|
func CLIOutPutFileName() string {
|
||||||
|
|||||||
@@ -68,6 +68,8 @@ func ExpandListOfFiles(check_ext bool, filenames ...string) ([]string, error) {
|
|||||||
strings.HasSuffix(path, "seq.gz") ||
|
strings.HasSuffix(path, "seq.gz") ||
|
||||||
strings.HasSuffix(path, "gb") ||
|
strings.HasSuffix(path, "gb") ||
|
||||||
strings.HasSuffix(path, "gb.gz") ||
|
strings.HasSuffix(path, "gb.gz") ||
|
||||||
|
strings.HasSuffix(path, "gbff") ||
|
||||||
|
strings.HasSuffix(path, "gbff.gz") ||
|
||||||
strings.HasSuffix(path, "dat") ||
|
strings.HasSuffix(path, "dat") ||
|
||||||
strings.HasSuffix(path, "dat.gz") ||
|
strings.HasSuffix(path, "dat.gz") ||
|
||||||
strings.HasSuffix(path, "ecopcr") ||
|
strings.HasSuffix(path, "ecopcr") ||
|
||||||
@@ -204,15 +206,13 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
|
|||||||
iterator = iterator.PairTo(ip)
|
iterator = iterator.PairTo(ip)
|
||||||
}
|
}
|
||||||
} else {
|
} else {
|
||||||
iterator = obiiter.NilIBioSequence
|
return obiiter.NilIBioSequence, fmt.Errorf("no sequence files found in the provided paths")
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
}
|
}
|
||||||
|
|
||||||
if CLIProgressBar() {
|
iterator = iterator.Speed("Reading sequences")
|
||||||
iterator = iterator.Speed("Reading sequences")
|
|
||||||
}
|
|
||||||
|
|
||||||
return iterator, nil
|
return iterator, nil
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -12,9 +12,7 @@ import (
|
|||||||
func CLIWriteSequenceCSV(iterator obiiter.IBioSequence,
|
func CLIWriteSequenceCSV(iterator obiiter.IBioSequence,
|
||||||
terminalAction bool, filenames ...string) *obiitercsv.ICSVRecord {
|
terminalAction bool, filenames ...string) *obiitercsv.ICSVRecord {
|
||||||
|
|
||||||
if obiconvert.CLIProgressBar() {
|
iterator = iterator.Speed("Writing CSV")
|
||||||
iterator = iterator.Speed("Writing CSV")
|
|
||||||
}
|
|
||||||
|
|
||||||
opts := make([]WithOption, 0, 10)
|
opts := make([]WithOption, 0, 10)
|
||||||
|
|
||||||
|
|||||||
55
pkg/obitools/obik/cp.go
Normal file
55
pkg/obitools/obik/cp.go
Normal file
@@ -0,0 +1,55 @@
|
|||||||
|
package obik
|
||||||
|
|
||||||
|
import (
|
||||||
|
"context"
|
||||||
|
"fmt"
|
||||||
|
|
||||||
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
func runCp(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||||
|
if len(args) < 2 {
|
||||||
|
return fmt.Errorf("usage: obik cp [--set PATTERN]... [--force] <source_index> <dest_index>")
|
||||||
|
}
|
||||||
|
|
||||||
|
srcDir := args[0]
|
||||||
|
destDir := args[1]
|
||||||
|
|
||||||
|
ksg, err := obikmer.OpenKmerSetGroup(srcDir)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to open source kmer index: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Resolve set patterns
|
||||||
|
patterns := CLISetPatterns()
|
||||||
|
var ids []string
|
||||||
|
if len(patterns) > 0 {
|
||||||
|
indices, err := ksg.MatchSetIDs(patterns)
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
if len(indices) == 0 {
|
||||||
|
return fmt.Errorf("no sets match the given patterns")
|
||||||
|
}
|
||||||
|
ids = make([]string, len(indices))
|
||||||
|
for i, idx := range indices {
|
||||||
|
ids[i] = ksg.SetIDOf(idx)
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
// Copy all sets
|
||||||
|
ids = ksg.SetsIDs()
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Infof("Copying %d set(s) from %s to %s", len(ids), srcDir, destDir)
|
||||||
|
|
||||||
|
dest, err := ksg.CopySetsByIDTo(ids, destDir, CLIForce())
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Infof("Destination now has %d set(s)", dest.Size())
|
||||||
|
return nil
|
||||||
|
}
|
||||||
344
pkg/obitools/obik/filter.go
Normal file
344
pkg/obitools/obik/filter.go
Normal file
@@ -0,0 +1,344 @@
|
|||||||
|
package obik
|
||||||
|
|
||||||
|
import (
|
||||||
|
"context"
|
||||||
|
"fmt"
|
||||||
|
"os"
|
||||||
|
"path/filepath"
|
||||||
|
"strings"
|
||||||
|
"sync"
|
||||||
|
"sync/atomic"
|
||||||
|
|
||||||
|
"github.com/schollz/progressbar/v3"
|
||||||
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
// KmerFilter is a predicate applied to individual k-mers during filtering.
|
||||||
|
// Returns true if the k-mer should be kept.
|
||||||
|
type KmerFilter func(kmer uint64) bool
|
||||||
|
|
||||||
|
// KmerFilterFactory creates a new KmerFilter instance.
|
||||||
|
// Each goroutine should call the factory to get its own filter,
|
||||||
|
// since some filters (e.g. KmerEntropyFilter) are not thread-safe.
|
||||||
|
type KmerFilterFactory func() KmerFilter
|
||||||
|
|
||||||
|
// chainFilterFactories combines multiple KmerFilterFactory into one.
|
||||||
|
// The resulting factory creates a filter that accepts a k-mer only
|
||||||
|
// if all individual filters accept it.
|
||||||
|
func chainFilterFactories(factories []KmerFilterFactory) KmerFilterFactory {
|
||||||
|
switch len(factories) {
|
||||||
|
case 0:
|
||||||
|
return func() KmerFilter { return func(uint64) bool { return true } }
|
||||||
|
case 1:
|
||||||
|
return factories[0]
|
||||||
|
default:
|
||||||
|
return func() KmerFilter {
|
||||||
|
filters := make([]KmerFilter, len(factories))
|
||||||
|
for i, f := range factories {
|
||||||
|
filters[i] = f()
|
||||||
|
}
|
||||||
|
return func(kmer uint64) bool {
|
||||||
|
for _, f := range filters {
|
||||||
|
if !f(kmer) {
|
||||||
|
return false
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return true
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// runFilter implements the "obik filter" subcommand.
|
||||||
|
// It reads an existing kmer index, applies a chain of filters,
|
||||||
|
// and writes a new filtered index.
|
||||||
|
func runFilter(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||||
|
if len(args) < 1 {
|
||||||
|
return fmt.Errorf("usage: obik filter [options] <source_index> --out <dest_index>")
|
||||||
|
}
|
||||||
|
|
||||||
|
srcDir := args[0]
|
||||||
|
destDir := CLIOutputDirectory()
|
||||||
|
if destDir == "" || destDir == "-" {
|
||||||
|
return fmt.Errorf("--out option is required and must specify a destination directory")
|
||||||
|
}
|
||||||
|
|
||||||
|
// Open source index
|
||||||
|
src, err := obikmer.OpenKmerSetGroup(srcDir)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to open source index: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
k := src.K()
|
||||||
|
|
||||||
|
// Build filter factory chain from CLI options.
|
||||||
|
// Factories are used so each goroutine creates its own filter instance,
|
||||||
|
// since some filters (e.g. KmerEntropyFilter) have mutable state.
|
||||||
|
var factories []KmerFilterFactory
|
||||||
|
var filterDescriptions []string
|
||||||
|
|
||||||
|
// Entropy filter
|
||||||
|
entropyThreshold := CLIIndexEntropyThreshold()
|
||||||
|
entropySize := CLIIndexEntropySize()
|
||||||
|
if entropyThreshold > 0 {
|
||||||
|
factories = append(factories, func() KmerFilter {
|
||||||
|
ef := obikmer.NewKmerEntropyFilter(k, entropySize, entropyThreshold)
|
||||||
|
return ef.Accept
|
||||||
|
})
|
||||||
|
filterDescriptions = append(filterDescriptions,
|
||||||
|
fmt.Sprintf("entropy(threshold=%.4f, level-max=%d)", entropyThreshold, entropySize))
|
||||||
|
}
|
||||||
|
|
||||||
|
// Future filters will be added here, e.g.:
|
||||||
|
// quorumFilter, frequencyFilter, ...
|
||||||
|
|
||||||
|
if len(factories) == 0 {
|
||||||
|
return fmt.Errorf("no filter specified; use --entropy-filter or other filter options")
|
||||||
|
}
|
||||||
|
|
||||||
|
filterFactory := chainFilterFactories(factories)
|
||||||
|
|
||||||
|
// Resolve set selection (default: all sets)
|
||||||
|
patterns := CLISetPatterns()
|
||||||
|
var setIndices []int
|
||||||
|
if len(patterns) > 0 {
|
||||||
|
setIndices, err = src.MatchSetIDs(patterns)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to match set patterns: %w", err)
|
||||||
|
}
|
||||||
|
if len(setIndices) == 0 {
|
||||||
|
return fmt.Errorf("no sets match the given patterns")
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
setIndices = make([]int, src.Size())
|
||||||
|
for i := range setIndices {
|
||||||
|
setIndices[i] = i
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Infof("Filtering %d set(s) from %s with: %s",
|
||||||
|
len(setIndices), srcDir, strings.Join(filterDescriptions, " + "))
|
||||||
|
|
||||||
|
// Create destination directory
|
||||||
|
if err := os.MkdirAll(destDir, 0755); err != nil {
|
||||||
|
return fmt.Errorf("failed to create destination: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
P := src.Partitions()
|
||||||
|
|
||||||
|
// Progress bar for partition filtering
|
||||||
|
totalPartitions := len(setIndices) * P
|
||||||
|
var bar *progressbar.ProgressBar
|
||||||
|
if obidefault.ProgressBar() {
|
||||||
|
pbopt := []progressbar.Option{
|
||||||
|
progressbar.OptionSetWriter(os.Stderr),
|
||||||
|
progressbar.OptionSetWidth(15),
|
||||||
|
progressbar.OptionShowCount(),
|
||||||
|
progressbar.OptionShowIts(),
|
||||||
|
progressbar.OptionSetPredictTime(true),
|
||||||
|
progressbar.OptionSetDescription("[Filtering partitions]"),
|
||||||
|
}
|
||||||
|
bar = progressbar.NewOptions(totalPartitions, pbopt...)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Process each selected set
|
||||||
|
newCounts := make([]uint64, len(setIndices))
|
||||||
|
|
||||||
|
for si, srcIdx := range setIndices {
|
||||||
|
setID := src.SetIDOf(srcIdx)
|
||||||
|
if setID == "" {
|
||||||
|
setID = fmt.Sprintf("set_%d", srcIdx)
|
||||||
|
}
|
||||||
|
|
||||||
|
destSetDir := filepath.Join(destDir, fmt.Sprintf("set_%d", si))
|
||||||
|
if err := os.MkdirAll(destSetDir, 0755); err != nil {
|
||||||
|
return fmt.Errorf("failed to create set directory: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Process partitions in parallel
|
||||||
|
nWorkers := obidefault.ParallelWorkers()
|
||||||
|
if nWorkers > P {
|
||||||
|
nWorkers = P
|
||||||
|
}
|
||||||
|
|
||||||
|
var totalKept atomic.Uint64
|
||||||
|
var totalProcessed atomic.Uint64
|
||||||
|
|
||||||
|
type job struct {
|
||||||
|
partIdx int
|
||||||
|
}
|
||||||
|
|
||||||
|
jobs := make(chan job, P)
|
||||||
|
var wg sync.WaitGroup
|
||||||
|
var errMu sync.Mutex
|
||||||
|
var firstErr error
|
||||||
|
|
||||||
|
for w := 0; w < nWorkers; w++ {
|
||||||
|
wg.Add(1)
|
||||||
|
go func() {
|
||||||
|
defer wg.Done()
|
||||||
|
// Each goroutine gets its own filter instance
|
||||||
|
workerFilter := filterFactory()
|
||||||
|
for j := range jobs {
|
||||||
|
kept, processed, err := filterPartition(
|
||||||
|
src.PartitionPath(srcIdx, j.partIdx),
|
||||||
|
filepath.Join(destSetDir, fmt.Sprintf("part_%04d.kdi", j.partIdx)),
|
||||||
|
workerFilter,
|
||||||
|
)
|
||||||
|
if err != nil {
|
||||||
|
errMu.Lock()
|
||||||
|
if firstErr == nil {
|
||||||
|
firstErr = err
|
||||||
|
}
|
||||||
|
errMu.Unlock()
|
||||||
|
return
|
||||||
|
}
|
||||||
|
totalKept.Add(kept)
|
||||||
|
totalProcessed.Add(processed)
|
||||||
|
if bar != nil {
|
||||||
|
bar.Add(1)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}()
|
||||||
|
}
|
||||||
|
|
||||||
|
for p := 0; p < P; p++ {
|
||||||
|
jobs <- job{p}
|
||||||
|
}
|
||||||
|
close(jobs)
|
||||||
|
wg.Wait()
|
||||||
|
|
||||||
|
if firstErr != nil {
|
||||||
|
return fmt.Errorf("failed to filter set %q: %w", setID, firstErr)
|
||||||
|
}
|
||||||
|
|
||||||
|
kept := totalKept.Load()
|
||||||
|
processed := totalProcessed.Load()
|
||||||
|
newCounts[si] = kept
|
||||||
|
log.Infof("Set %q: %d/%d k-mers kept (%.1f%% removed)",
|
||||||
|
setID, kept, processed,
|
||||||
|
100.0*float64(processed-kept)/float64(max(processed, 1)))
|
||||||
|
|
||||||
|
// Copy spectrum.bin if it exists
|
||||||
|
srcSpecPath := src.SpectrumPath(srcIdx)
|
||||||
|
if _, err := os.Stat(srcSpecPath); err == nil {
|
||||||
|
destSpecPath := filepath.Join(destSetDir, "spectrum.bin")
|
||||||
|
if err := copyFileHelper(srcSpecPath, destSpecPath); err != nil {
|
||||||
|
log.Warnf("Could not copy spectrum for set %q: %v", setID, err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if bar != nil {
|
||||||
|
fmt.Fprintln(os.Stderr)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Build destination metadata
|
||||||
|
setsIDs := make([]string, len(setIndices))
|
||||||
|
setsMetadata := make([]map[string]interface{}, len(setIndices))
|
||||||
|
for i, srcIdx := range setIndices {
|
||||||
|
setsIDs[i] = src.SetIDOf(srcIdx)
|
||||||
|
setsMetadata[i] = src.AllSetMetadata(srcIdx)
|
||||||
|
if setsMetadata[i] == nil {
|
||||||
|
setsMetadata[i] = make(map[string]interface{})
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Write metadata for the filtered index
|
||||||
|
dest, err := obikmer.NewFilteredKmerSetGroup(
|
||||||
|
destDir, k, src.M(), P,
|
||||||
|
len(setIndices), setsIDs, newCounts, setsMetadata,
|
||||||
|
)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to create filtered metadata: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Copy group-level metadata and record applied filters
|
||||||
|
for key, value := range src.Metadata {
|
||||||
|
dest.SetAttribute(key, value)
|
||||||
|
}
|
||||||
|
if entropyThreshold > 0 {
|
||||||
|
dest.SetAttribute("entropy_filter", entropyThreshold)
|
||||||
|
dest.SetAttribute("entropy_filter_size", entropySize)
|
||||||
|
}
|
||||||
|
dest.SetAttribute("filtered_from", srcDir)
|
||||||
|
|
||||||
|
if err := dest.SaveMetadata(); err != nil {
|
||||||
|
return fmt.Errorf("failed to save metadata: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Info("Done.")
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// filterPartition reads a single .kdi partition, applies the filter predicate,
|
||||||
|
// and writes the accepted k-mers to a new .kdi file.
|
||||||
|
// Returns (kept, processed, error).
|
||||||
|
func filterPartition(srcPath, destPath string, accept KmerFilter) (uint64, uint64, error) {
|
||||||
|
reader, err := obikmer.NewKdiReader(srcPath)
|
||||||
|
if err != nil {
|
||||||
|
// Empty partition — write empty KDI
|
||||||
|
w, err2 := obikmer.NewKdiWriter(destPath)
|
||||||
|
if err2 != nil {
|
||||||
|
return 0, 0, err2
|
||||||
|
}
|
||||||
|
return 0, 0, w.Close()
|
||||||
|
}
|
||||||
|
defer reader.Close()
|
||||||
|
|
||||||
|
w, err := obikmer.NewKdiWriter(destPath)
|
||||||
|
if err != nil {
|
||||||
|
return 0, 0, err
|
||||||
|
}
|
||||||
|
|
||||||
|
var kept, processed uint64
|
||||||
|
for {
|
||||||
|
kmer, ok := reader.Next()
|
||||||
|
if !ok {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
processed++
|
||||||
|
if accept(kmer) {
|
||||||
|
if err := w.Write(kmer); err != nil {
|
||||||
|
w.Close()
|
||||||
|
return 0, 0, err
|
||||||
|
}
|
||||||
|
kept++
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return kept, processed, w.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// copyFileHelper copies a file (used for spectrum.bin etc.)
|
||||||
|
func copyFileHelper(src, dst string) error {
|
||||||
|
in, err := os.Open(src)
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
defer in.Close()
|
||||||
|
|
||||||
|
out, err := os.Create(dst)
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
defer out.Close()
|
||||||
|
|
||||||
|
buf := make([]byte, 32*1024)
|
||||||
|
for {
|
||||||
|
n, readErr := in.Read(buf)
|
||||||
|
if n > 0 {
|
||||||
|
if _, writeErr := out.Write(buf[:n]); writeErr != nil {
|
||||||
|
return writeErr
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if readErr != nil {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return out.Close()
|
||||||
|
}
|
||||||
154
pkg/obitools/obik/index.go
Normal file
154
pkg/obitools/obik/index.go
Normal file
@@ -0,0 +1,154 @@
|
|||||||
|
package obik
|
||||||
|
|
||||||
|
import (
|
||||||
|
"context"
|
||||||
|
"fmt"
|
||||||
|
"os"
|
||||||
|
"path/filepath"
|
||||||
|
"sync"
|
||||||
|
"sync/atomic"
|
||||||
|
|
||||||
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
func runIndex(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||||
|
outDir := CLIOutputDirectory()
|
||||||
|
if outDir == "" || outDir == "-" {
|
||||||
|
return fmt.Errorf("--out option is required and must specify a directory path")
|
||||||
|
}
|
||||||
|
|
||||||
|
k := CLIKmerSize()
|
||||||
|
if k < 2 || k > 31 {
|
||||||
|
return fmt.Errorf("invalid k-mer size: %d (must be between 2 and 31)", k)
|
||||||
|
}
|
||||||
|
|
||||||
|
m := CLIMinimizerSize()
|
||||||
|
|
||||||
|
minOcc := CLIMinOccurrence()
|
||||||
|
if minOcc < 1 {
|
||||||
|
return fmt.Errorf("invalid min-occurrence: %d (must be >= 1)", minOcc)
|
||||||
|
}
|
||||||
|
|
||||||
|
maxOcc := CLIMaxOccurrence()
|
||||||
|
|
||||||
|
entropyThreshold := CLIIndexEntropyThreshold()
|
||||||
|
entropySize := CLIIndexEntropySize()
|
||||||
|
|
||||||
|
// Build options
|
||||||
|
var opts []obikmer.BuilderOption
|
||||||
|
if minOcc > 1 {
|
||||||
|
opts = append(opts, obikmer.WithMinFrequency(minOcc))
|
||||||
|
}
|
||||||
|
if maxOcc > 0 {
|
||||||
|
opts = append(opts, obikmer.WithMaxFrequency(maxOcc))
|
||||||
|
}
|
||||||
|
if topN := CLISaveFreqKmer(); topN > 0 {
|
||||||
|
opts = append(opts, obikmer.WithSaveFreqKmers(topN))
|
||||||
|
}
|
||||||
|
if entropyThreshold > 0 {
|
||||||
|
opts = append(opts, obikmer.WithEntropyFilter(entropyThreshold, entropySize))
|
||||||
|
}
|
||||||
|
|
||||||
|
// Determine whether to append to existing group or create new
|
||||||
|
var builder *obikmer.KmerSetGroupBuilder
|
||||||
|
var err error
|
||||||
|
metaPath := filepath.Join(outDir, "metadata.toml")
|
||||||
|
if _, statErr := os.Stat(metaPath); statErr == nil {
|
||||||
|
// Existing group: append
|
||||||
|
log.Infof("Appending to existing kmer index at %s", outDir)
|
||||||
|
builder, err = obikmer.AppendKmerSetGroupBuilder(outDir, 1, opts...)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to open existing kmer index for appending: %w", err)
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
// New group
|
||||||
|
if maxOcc > 0 {
|
||||||
|
log.Infof("Creating new kmer index: k=%d, m=%d, occurrence=[%d,%d]", k, m, minOcc, maxOcc)
|
||||||
|
} else {
|
||||||
|
log.Infof("Creating new kmer index: k=%d, m=%d, min-occurrence=%d", k, m, minOcc)
|
||||||
|
}
|
||||||
|
builder, err = obikmer.NewKmerSetGroupBuilder(outDir, k, m, 1, -1, opts...)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to create kmer index builder: %w", err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Read and process sequences in parallel
|
||||||
|
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to open sequence files: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
nworkers := obidefault.ParallelWorkers()
|
||||||
|
var seqCount atomic.Int64
|
||||||
|
var wg sync.WaitGroup
|
||||||
|
|
||||||
|
consumer := func(iter obiiter.IBioSequence) {
|
||||||
|
defer wg.Done()
|
||||||
|
for iter.Next() {
|
||||||
|
batch := iter.Get()
|
||||||
|
for _, seq := range batch.Slice() {
|
||||||
|
builder.AddSequence(0, seq)
|
||||||
|
seqCount.Add(1)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
for i := 1; i < nworkers; i++ {
|
||||||
|
wg.Add(1)
|
||||||
|
go consumer(sequences.Split())
|
||||||
|
}
|
||||||
|
wg.Add(1)
|
||||||
|
go consumer(sequences)
|
||||||
|
wg.Wait()
|
||||||
|
|
||||||
|
log.Infof("Processed %d sequences", seqCount.Load())
|
||||||
|
|
||||||
|
// Finalize
|
||||||
|
ksg, err := builder.Close()
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to finalize kmer index: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Apply index-id to the new set
|
||||||
|
newSetIdx := builder.StartIndex()
|
||||||
|
if id := CLIIndexId(); id != "" {
|
||||||
|
ksg.SetSetID(newSetIdx, id)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Apply group-level tags (-S)
|
||||||
|
for key, value := range CLISetTag() {
|
||||||
|
ksg.SetAttribute(key, value)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Apply per-set tags (-T) to the new set
|
||||||
|
for key, value := range _setMetaTags {
|
||||||
|
ksg.SetSetMetadata(newSetIdx, key, value)
|
||||||
|
}
|
||||||
|
|
||||||
|
if minOcc > 1 {
|
||||||
|
ksg.SetAttribute("min_occurrence", minOcc)
|
||||||
|
}
|
||||||
|
if maxOcc > 0 {
|
||||||
|
ksg.SetAttribute("max_occurrence", maxOcc)
|
||||||
|
}
|
||||||
|
|
||||||
|
if entropyThreshold > 0 {
|
||||||
|
ksg.SetAttribute("entropy_filter", entropyThreshold)
|
||||||
|
ksg.SetAttribute("entropy_filter_size", entropySize)
|
||||||
|
}
|
||||||
|
|
||||||
|
if err := ksg.SaveMetadata(); err != nil {
|
||||||
|
return fmt.Errorf("failed to save metadata: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Infof("Index contains %d k-mers for set %d in %s", ksg.Len(newSetIdx), newSetIdx, outDir)
|
||||||
|
log.Info("Done.")
|
||||||
|
return nil
|
||||||
|
}
|
||||||
419
pkg/obitools/obik/lowmask.go
Normal file
419
pkg/obitools/obik/lowmask.go
Normal file
@@ -0,0 +1,419 @@
|
|||||||
|
package obik
|
||||||
|
|
||||||
|
import (
|
||||||
|
"context"
|
||||||
|
"fmt"
|
||||||
|
"math"
|
||||||
|
|
||||||
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
// lowMaskWorker creates a worker to mask low-complexity regions in DNA sequences.
|
||||||
|
func lowMaskWorker(kmer_size int, level_max int, threshold float64, mode MaskingMode, maskChar byte, keepShorter bool) obiseq.SeqWorker {
|
||||||
|
|
||||||
|
nLogN := make([]float64, kmer_size+1)
|
||||||
|
for i := 1; i <= kmer_size; i++ {
|
||||||
|
nLogN[i] = float64(i) * math.Log(float64(i))
|
||||||
|
}
|
||||||
|
|
||||||
|
normTables := make([][]int, level_max+1)
|
||||||
|
for ws := 1; ws <= level_max; ws++ {
|
||||||
|
size := 1 << (ws * 2)
|
||||||
|
normTables[ws] = make([]int, size)
|
||||||
|
for code := 0; code < size; code++ {
|
||||||
|
normTables[ws][code] = int(obikmer.NormalizeCircular(uint64(code), ws))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
type pair struct {
|
||||||
|
index int
|
||||||
|
value float64
|
||||||
|
}
|
||||||
|
|
||||||
|
slidingMin := func(data []float64, window int) {
|
||||||
|
if len(data) == 0 || window <= 0 {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
if window >= len(data) {
|
||||||
|
minVal := data[0]
|
||||||
|
for i := 1; i < len(data); i++ {
|
||||||
|
if data[i] < minVal {
|
||||||
|
minVal = data[i]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
for i := range data {
|
||||||
|
data[i] = minVal
|
||||||
|
}
|
||||||
|
return
|
||||||
|
}
|
||||||
|
|
||||||
|
deque := make([]pair, 0, window)
|
||||||
|
|
||||||
|
for i, v := range data {
|
||||||
|
for len(deque) > 0 && deque[0].index <= i-window {
|
||||||
|
deque = deque[1:]
|
||||||
|
}
|
||||||
|
|
||||||
|
for len(deque) > 0 && deque[len(deque)-1].value >= v {
|
||||||
|
deque = deque[:len(deque)-1]
|
||||||
|
}
|
||||||
|
|
||||||
|
deque = append(deque, pair{index: i, value: v})
|
||||||
|
|
||||||
|
data[i] = deque[0].value
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
emaxValues := make([]float64, level_max+1)
|
||||||
|
logNwords := make([]float64, level_max+1)
|
||||||
|
for ws := 1; ws <= level_max; ws++ {
|
||||||
|
nw := kmer_size - ws + 1
|
||||||
|
na := obikmer.CanonicalCircularKmerCount(ws)
|
||||||
|
if nw < na {
|
||||||
|
logNwords[ws] = math.Log(float64(nw))
|
||||||
|
emaxValues[ws] = math.Log(float64(nw))
|
||||||
|
} else {
|
||||||
|
cov := nw / na
|
||||||
|
remains := nw - (na * cov)
|
||||||
|
f1 := float64(cov) / float64(nw)
|
||||||
|
f2 := float64(cov+1) / float64(nw)
|
||||||
|
logNwords[ws] = math.Log(float64(nw))
|
||||||
|
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
|
||||||
|
float64(remains)*f2*math.Log(f2))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
maskAmbiguities := func(sequence []byte) []int {
|
||||||
|
maskPositions := make([]int, len(sequence))
|
||||||
|
for i, nuc := range sequence {
|
||||||
|
if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' {
|
||||||
|
end := max(0, i-kmer_size+1)
|
||||||
|
for j := i; j >= end; j-- {
|
||||||
|
maskPositions[j] = -1
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return maskPositions
|
||||||
|
}
|
||||||
|
|
||||||
|
cleanTable := func(table []int, over int) {
|
||||||
|
for i := 0; i < over; i++ {
|
||||||
|
table[i] = 0
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
computeEntropies := func(sequence []byte,
|
||||||
|
maskPositions []int,
|
||||||
|
entropies []float64,
|
||||||
|
table []int,
|
||||||
|
words []int,
|
||||||
|
wordSize int,
|
||||||
|
normTable []int) {
|
||||||
|
|
||||||
|
lseq := len(sequence)
|
||||||
|
tableSize := 1 << (wordSize * 2)
|
||||||
|
nwords := kmer_size - wordSize + 1
|
||||||
|
float_nwords := float64(nwords)
|
||||||
|
log_nwords := logNwords[wordSize]
|
||||||
|
entropyMax := emaxValues[wordSize]
|
||||||
|
|
||||||
|
cleanTable(table, tableSize)
|
||||||
|
|
||||||
|
for i := 1; i < lseq; i++ {
|
||||||
|
entropies[i] = 6
|
||||||
|
}
|
||||||
|
end := lseq - wordSize + 1
|
||||||
|
|
||||||
|
mask := (1 << (wordSize * 2)) - 1
|
||||||
|
|
||||||
|
word_index := 0
|
||||||
|
for i := 0; i < wordSize-1; i++ {
|
||||||
|
word_index = (word_index << 2) + int(obikmer.EncodeNucleotide(sequence[i]))
|
||||||
|
}
|
||||||
|
|
||||||
|
for i, j := 0, wordSize-1; i < end; i, j = i+1, j+1 {
|
||||||
|
word_index = ((word_index << 2) & mask) + int(obikmer.EncodeNucleotide(sequence[j]))
|
||||||
|
words[i] = normTable[word_index]
|
||||||
|
}
|
||||||
|
|
||||||
|
s := 0
|
||||||
|
sum_n_logn := 0.0
|
||||||
|
entropy := 1.0
|
||||||
|
cleaned := true
|
||||||
|
|
||||||
|
for i := range end {
|
||||||
|
s++
|
||||||
|
|
||||||
|
switch {
|
||||||
|
case s < nwords:
|
||||||
|
cleaned = false
|
||||||
|
table[words[i]]++
|
||||||
|
|
||||||
|
case i >= (nwords-1) && maskPositions[i-nwords+1] < 0:
|
||||||
|
entropies[i-nwords+1] = 4.0
|
||||||
|
if !cleaned {
|
||||||
|
cleanTable(table, tableSize)
|
||||||
|
}
|
||||||
|
cleaned = true
|
||||||
|
s = 0
|
||||||
|
sum_n_logn = 0.0
|
||||||
|
|
||||||
|
case s == nwords:
|
||||||
|
cleaned = false
|
||||||
|
table[words[i]]++
|
||||||
|
|
||||||
|
sum_n_logn = 0
|
||||||
|
for j := range tableSize {
|
||||||
|
n := float64(table[j])
|
||||||
|
if n > 0 {
|
||||||
|
sum_n_logn += nLogN[int(n)]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
entropy = (log_nwords - sum_n_logn/float_nwords) / entropyMax
|
||||||
|
|
||||||
|
case s > nwords:
|
||||||
|
cleaned = false
|
||||||
|
|
||||||
|
new_word := words[i]
|
||||||
|
old_word := words[i-nwords]
|
||||||
|
|
||||||
|
if old_word != new_word {
|
||||||
|
table[new_word]++
|
||||||
|
table[old_word]--
|
||||||
|
|
||||||
|
n_old := float64(table[old_word])
|
||||||
|
n_new := float64(table[new_word])
|
||||||
|
|
||||||
|
sum_n_logn -= nLogN[int(n_old+1)]
|
||||||
|
if n_old > 0 {
|
||||||
|
sum_n_logn += nLogN[int(n_old)]
|
||||||
|
}
|
||||||
|
if n_new > 0 {
|
||||||
|
sum_n_logn += nLogN[int(n_new)]
|
||||||
|
}
|
||||||
|
if n_new > 1 {
|
||||||
|
sum_n_logn -= nLogN[int(n_new-1)]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
entropy = (log_nwords - sum_n_logn/float_nwords) / entropyMax
|
||||||
|
}
|
||||||
|
|
||||||
|
if s >= nwords && maskPositions[i-nwords+1] >= 0 {
|
||||||
|
if entropy < 0 {
|
||||||
|
entropy = 0
|
||||||
|
}
|
||||||
|
entropy = math.Round(entropy*10000) / 10000
|
||||||
|
entropies[i-nwords+1] = entropy
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
slidingMin(entropies, kmer_size)
|
||||||
|
}
|
||||||
|
|
||||||
|
applyMaskMode := func(sequence *obiseq.BioSequence, maskPositions []bool, mask byte) (obiseq.BioSequenceSlice, error) {
|
||||||
|
seqCopy := sequence.Copy()
|
||||||
|
sequenceBytes := seqCopy.Sequence()
|
||||||
|
|
||||||
|
for i := range sequenceBytes {
|
||||||
|
if maskPositions[i] {
|
||||||
|
sequenceBytes[i] = mask
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return obiseq.BioSequenceSlice{seqCopy}, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
selectMasked := func(sequence *obiseq.BioSequence, maskPosition []bool) (obiseq.BioSequenceSlice, error) {
|
||||||
|
rep := obiseq.NewBioSequenceSlice()
|
||||||
|
|
||||||
|
inlow := false
|
||||||
|
fromlow := -1
|
||||||
|
for i, masked := range maskPosition {
|
||||||
|
if masked && !inlow {
|
||||||
|
fromlow = i
|
||||||
|
inlow = true
|
||||||
|
}
|
||||||
|
if inlow && !masked {
|
||||||
|
if fromlow >= 0 {
|
||||||
|
frgLen := i - fromlow
|
||||||
|
if keepShorter || frgLen >= kmer_size {
|
||||||
|
frg, err := sequence.Subsequence(fromlow, i, false)
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
rep.Push(frg)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
inlow = false
|
||||||
|
fromlow = -1
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if inlow && fromlow >= 0 {
|
||||||
|
frgLen := len(maskPosition) - fromlow
|
||||||
|
if keepShorter || frgLen >= kmer_size {
|
||||||
|
frg, err := sequence.Subsequence(fromlow, len(maskPosition), false)
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
rep.Push(frg)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return *rep, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
selectunmasked := func(sequence *obiseq.BioSequence, maskPosition []bool) (obiseq.BioSequenceSlice, error) {
|
||||||
|
rep := obiseq.NewBioSequenceSlice()
|
||||||
|
|
||||||
|
inhigh := false
|
||||||
|
fromhigh := -1
|
||||||
|
for i, masked := range maskPosition {
|
||||||
|
if !masked && !inhigh {
|
||||||
|
fromhigh = i
|
||||||
|
inhigh = true
|
||||||
|
}
|
||||||
|
if inhigh && masked {
|
||||||
|
if fromhigh >= 0 {
|
||||||
|
frgLen := i - fromhigh
|
||||||
|
if keepShorter || frgLen >= kmer_size {
|
||||||
|
frg, err := sequence.Subsequence(fromhigh, i, false)
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
rep.Push(frg)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
inhigh = false
|
||||||
|
fromhigh = -1
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if inhigh && fromhigh >= 0 {
|
||||||
|
frgLen := len(maskPosition) - fromhigh
|
||||||
|
if keepShorter || frgLen >= kmer_size {
|
||||||
|
frg, err := sequence.Subsequence(fromhigh, len(maskPosition), false)
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
rep.Push(frg)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return *rep, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
masking := func(sequence *obiseq.BioSequence) (obiseq.BioSequenceSlice, error) {
|
||||||
|
if sequence.Len() < kmer_size {
|
||||||
|
sequence.SetAttribute("obilowmask_error", "Sequence too short")
|
||||||
|
remove := make([]bool, sequence.Len())
|
||||||
|
for i := range remove {
|
||||||
|
remove[i] = true
|
||||||
|
}
|
||||||
|
switch mode {
|
||||||
|
case MaskMode:
|
||||||
|
return applyMaskMode(sequence, remove, maskChar)
|
||||||
|
case SplitMode:
|
||||||
|
return selectunmasked(sequence, remove)
|
||||||
|
case ExtractMode:
|
||||||
|
return selectMasked(sequence, remove)
|
||||||
|
}
|
||||||
|
return nil, fmt.Errorf("unknown mode %d", mode)
|
||||||
|
}
|
||||||
|
|
||||||
|
bseq := sequence.Sequence()
|
||||||
|
|
||||||
|
maskPositions := maskAmbiguities(bseq)
|
||||||
|
|
||||||
|
maskFlags := make([]int, len(bseq))
|
||||||
|
entropies := make([]float64, len(bseq))
|
||||||
|
for i := range entropies {
|
||||||
|
entropies[i] = 4.0
|
||||||
|
}
|
||||||
|
|
||||||
|
freqs := make([]int, 1<<(2*level_max))
|
||||||
|
words := make([]int, len(bseq))
|
||||||
|
entropies2 := make([]float64, len(bseq))
|
||||||
|
|
||||||
|
computeEntropies(bseq, maskPositions, entropies, freqs, words, level_max, normTables[level_max])
|
||||||
|
|
||||||
|
for i := range bseq {
|
||||||
|
v := level_max
|
||||||
|
maskFlags[i] = v
|
||||||
|
}
|
||||||
|
|
||||||
|
for ws := level_max - 1; ws > 0; ws-- {
|
||||||
|
computeEntropies(bseq, maskPositions, entropies2, freqs, words, ws, normTables[ws])
|
||||||
|
for i, e2 := range entropies2 {
|
||||||
|
if e2 < entropies[i] {
|
||||||
|
entropies[i] = e2
|
||||||
|
maskFlags[i] = ws
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
for i, nuc := range bseq {
|
||||||
|
if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' {
|
||||||
|
entropies[i] = 0
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
remove := make([]bool, len(entropies))
|
||||||
|
for i, e := range entropies {
|
||||||
|
remove[i] = e <= threshold
|
||||||
|
}
|
||||||
|
|
||||||
|
sequence.SetAttribute("mask", maskFlags)
|
||||||
|
sequence.SetAttribute("Entropies", entropies)
|
||||||
|
|
||||||
|
switch mode {
|
||||||
|
case MaskMode:
|
||||||
|
return applyMaskMode(sequence, remove, maskChar)
|
||||||
|
case SplitMode:
|
||||||
|
return selectunmasked(sequence, remove)
|
||||||
|
case ExtractMode:
|
||||||
|
return selectMasked(sequence, remove)
|
||||||
|
}
|
||||||
|
return nil, fmt.Errorf("unknown mode %d", mode)
|
||||||
|
}
|
||||||
|
|
||||||
|
return masking
|
||||||
|
}
|
||||||
|
|
||||||
|
// runLowmask implements the "obik lowmask" subcommand.
|
||||||
|
// It masks low-complexity regions in DNA sequences using entropy-based detection.
|
||||||
|
func runLowmask(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||||
|
kmerSize := CLIKmerSize()
|
||||||
|
levelMax := CLIEntropySize()
|
||||||
|
threshold := CLIEntropyThreshold()
|
||||||
|
mode := CLIMaskingMode()
|
||||||
|
maskChar := CLIMaskingChar()
|
||||||
|
|
||||||
|
log.Printf("Low-complexity masking: kmer-size=%d, entropy-size=%d, threshold=%.4f", kmerSize, levelMax, threshold)
|
||||||
|
|
||||||
|
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to open sequence files: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
worker := lowMaskWorker(kmerSize, levelMax, threshold, mode, maskChar, CLIKeepShorter())
|
||||||
|
|
||||||
|
masked := sequences.MakeIWorker(
|
||||||
|
worker,
|
||||||
|
false,
|
||||||
|
obidefault.ParallelWorkers(),
|
||||||
|
).FilterEmpty()
|
||||||
|
|
||||||
|
obiconvert.CLIWriteBioSequences(masked, true)
|
||||||
|
obiutils.WaitForLastPipe()
|
||||||
|
|
||||||
|
return nil
|
||||||
|
}
|
||||||
96
pkg/obitools/obik/ls.go
Normal file
96
pkg/obitools/obik/ls.go
Normal file
@@ -0,0 +1,96 @@
|
|||||||
|
package obik
|
||||||
|
|
||||||
|
import (
|
||||||
|
"context"
|
||||||
|
"encoding/json"
|
||||||
|
"fmt"
|
||||||
|
"strings"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
"gopkg.in/yaml.v3"
|
||||||
|
)
|
||||||
|
|
||||||
|
type setEntry struct {
|
||||||
|
Index int `json:"index" yaml:"index"`
|
||||||
|
ID string `json:"id" yaml:"id"`
|
||||||
|
Count uint64 `json:"count" yaml:"count"`
|
||||||
|
}
|
||||||
|
|
||||||
|
func runLs(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||||
|
if len(args) < 1 {
|
||||||
|
return fmt.Errorf("usage: obik ls [options] <index_directory>")
|
||||||
|
}
|
||||||
|
|
||||||
|
ksg, err := obikmer.OpenKmerSetGroup(args[0])
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Determine which sets to show
|
||||||
|
patterns := CLISetPatterns()
|
||||||
|
var indices []int
|
||||||
|
if len(patterns) > 0 {
|
||||||
|
indices, err = ksg.MatchSetIDs(patterns)
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
indices = make([]int, ksg.Size())
|
||||||
|
for i := range indices {
|
||||||
|
indices[i] = i
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
entries := make([]setEntry, len(indices))
|
||||||
|
for i, idx := range indices {
|
||||||
|
entries[i] = setEntry{
|
||||||
|
Index: idx,
|
||||||
|
ID: ksg.SetIDOf(idx),
|
||||||
|
Count: ksg.Len(idx),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
format := CLIOutFormat()
|
||||||
|
switch format {
|
||||||
|
case "json":
|
||||||
|
return outputLsJSON(entries)
|
||||||
|
case "yaml":
|
||||||
|
return outputLsYAML(entries)
|
||||||
|
case "csv":
|
||||||
|
return outputLsCSV(entries)
|
||||||
|
default:
|
||||||
|
return outputLsCSV(entries)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func outputLsCSV(entries []setEntry) error {
|
||||||
|
fmt.Println("index,id,count")
|
||||||
|
for _, e := range entries {
|
||||||
|
// Escape commas in ID if needed
|
||||||
|
id := e.ID
|
||||||
|
if strings.ContainsAny(id, ",\"") {
|
||||||
|
id = "\"" + strings.ReplaceAll(id, "\"", "\"\"") + "\""
|
||||||
|
}
|
||||||
|
fmt.Printf("%d,%s,%d\n", e.Index, id, e.Count)
|
||||||
|
}
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func outputLsJSON(entries []setEntry) error {
|
||||||
|
data, err := json.MarshalIndent(entries, "", " ")
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
fmt.Println(string(data))
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func outputLsYAML(entries []setEntry) error {
|
||||||
|
data, err := yaml.Marshal(entries)
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
fmt.Print(string(data))
|
||||||
|
return nil
|
||||||
|
}
|
||||||
221
pkg/obitools/obik/match.go
Normal file
221
pkg/obitools/obik/match.go
Normal file
@@ -0,0 +1,221 @@
|
|||||||
|
package obik
|
||||||
|
|
||||||
|
import (
|
||||||
|
"context"
|
||||||
|
"fmt"
|
||||||
|
"sync"
|
||||||
|
|
||||||
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
// defaultMatchQueryThreshold is the minimum number of k-mer entries to
|
||||||
|
// accumulate before launching a MatchBatch. Larger values amortize the
|
||||||
|
// cost of opening .kdi files across more query k-mers.
|
||||||
|
const defaultMatchQueryThreshold = 10_000_000
|
||||||
|
|
||||||
|
// preparedBatch pairs a batch with its pre-computed queries.
|
||||||
|
type preparedBatch struct {
|
||||||
|
batch obiiter.BioSequenceBatch
|
||||||
|
seqs []*obiseq.BioSequence
|
||||||
|
queries *obikmer.PreparedQueries
|
||||||
|
}
|
||||||
|
|
||||||
|
// accumulatedWork holds multiple prepared batches whose queries have been
|
||||||
|
// merged into a single PreparedQueries. The flat seqs slice allows
|
||||||
|
// MatchBatch results (indexed by merged SeqIdx) to be mapped back to
|
||||||
|
// the original sequences.
|
||||||
|
type accumulatedWork struct {
|
||||||
|
batches []obiiter.BioSequenceBatch // original batches in order
|
||||||
|
seqs []*obiseq.BioSequence // flat: seqs from all batches concatenated
|
||||||
|
queries *obikmer.PreparedQueries // merged queries with rebased SeqIdx
|
||||||
|
}
|
||||||
|
|
||||||
|
// runMatch implements the "obik match" subcommand.
|
||||||
|
//
|
||||||
|
// Pipeline architecture (no shared mutable state between stages):
|
||||||
|
//
|
||||||
|
// [input batches]
|
||||||
|
// │ Split across nCPU goroutines
|
||||||
|
// ▼
|
||||||
|
// PrepareQueries (CPU, parallel)
|
||||||
|
// │ preparedCh
|
||||||
|
// ▼
|
||||||
|
// Accumulate & MergeQueries (1 goroutine)
|
||||||
|
// │ matchCh — fires when totalKmers >= threshold
|
||||||
|
// ▼
|
||||||
|
// MatchBatch + annotate (1 goroutine, internal parallelism per partition)
|
||||||
|
// │
|
||||||
|
// ▼
|
||||||
|
// [output batches]
|
||||||
|
func runMatch(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||||
|
indexDir := CLIIndexDirectory()
|
||||||
|
|
||||||
|
// Open the k-mer index
|
||||||
|
ksg, err := obikmer.OpenKmerSetGroup(indexDir)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Infof("Opened index: k=%d, m=%d, %d partitions, %d set(s)",
|
||||||
|
ksg.K(), ksg.M(), ksg.Partitions(), ksg.Size())
|
||||||
|
|
||||||
|
// Resolve which sets to match against
|
||||||
|
patterns := CLISetPatterns()
|
||||||
|
var setIndices []int
|
||||||
|
if len(patterns) > 0 {
|
||||||
|
setIndices, err = ksg.MatchSetIDs(patterns)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to match set patterns: %w", err)
|
||||||
|
}
|
||||||
|
if len(setIndices) == 0 {
|
||||||
|
return fmt.Errorf("no sets match the given patterns")
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
setIndices = make([]int, ksg.Size())
|
||||||
|
for i := range setIndices {
|
||||||
|
setIndices[i] = i
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
for _, idx := range setIndices {
|
||||||
|
id := ksg.SetIDOf(idx)
|
||||||
|
if id == "" {
|
||||||
|
id = fmt.Sprintf("set_%d", idx)
|
||||||
|
}
|
||||||
|
log.Infof("Matching against set %d (%s): %d k-mers", idx, id, ksg.Len(idx))
|
||||||
|
}
|
||||||
|
|
||||||
|
// Read input sequences
|
||||||
|
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to open sequence files: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
nworkers := obidefault.ParallelWorkers()
|
||||||
|
|
||||||
|
// --- Stage 1: Prepare queries in parallel ---
|
||||||
|
preparedCh := make(chan preparedBatch, nworkers)
|
||||||
|
|
||||||
|
var prepWg sync.WaitGroup
|
||||||
|
preparer := func(iter obiiter.IBioSequence) {
|
||||||
|
defer prepWg.Done()
|
||||||
|
for iter.Next() {
|
||||||
|
batch := iter.Get()
|
||||||
|
slice := batch.Slice()
|
||||||
|
|
||||||
|
seqs := make([]*obiseq.BioSequence, len(slice))
|
||||||
|
for i, s := range slice {
|
||||||
|
seqs[i] = s
|
||||||
|
}
|
||||||
|
|
||||||
|
pq := ksg.PrepareQueries(seqs)
|
||||||
|
|
||||||
|
preparedCh <- preparedBatch{
|
||||||
|
batch: batch,
|
||||||
|
seqs: seqs,
|
||||||
|
queries: pq,
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
for i := 1; i < nworkers; i++ {
|
||||||
|
prepWg.Add(1)
|
||||||
|
go preparer(sequences.Split())
|
||||||
|
}
|
||||||
|
prepWg.Add(1)
|
||||||
|
go preparer(sequences)
|
||||||
|
|
||||||
|
go func() {
|
||||||
|
prepWg.Wait()
|
||||||
|
close(preparedCh)
|
||||||
|
}()
|
||||||
|
|
||||||
|
// --- Stage 2: Accumulate & merge queries ---
|
||||||
|
matchCh := make(chan *accumulatedWork, 2)
|
||||||
|
|
||||||
|
go func() {
|
||||||
|
defer close(matchCh)
|
||||||
|
|
||||||
|
var acc *accumulatedWork
|
||||||
|
|
||||||
|
for pb := range preparedCh {
|
||||||
|
if acc == nil {
|
||||||
|
acc = &accumulatedWork{
|
||||||
|
batches: []obiiter.BioSequenceBatch{pb.batch},
|
||||||
|
seqs: pb.seqs,
|
||||||
|
queries: pb.queries,
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
// Merge this batch's queries into the accumulator
|
||||||
|
obikmer.MergeQueries(acc.queries, pb.queries)
|
||||||
|
acc.batches = append(acc.batches, pb.batch)
|
||||||
|
acc.seqs = append(acc.seqs, pb.seqs...)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Flush when we exceed the threshold
|
||||||
|
if acc.queries.NKmers >= defaultMatchQueryThreshold {
|
||||||
|
matchCh <- acc
|
||||||
|
acc = nil
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Flush remaining
|
||||||
|
if acc != nil {
|
||||||
|
matchCh <- acc
|
||||||
|
}
|
||||||
|
}()
|
||||||
|
|
||||||
|
// --- Stage 3: Match & annotate ---
|
||||||
|
output := obiiter.MakeIBioSequence()
|
||||||
|
if sequences.IsPaired() {
|
||||||
|
output.MarkAsPaired()
|
||||||
|
}
|
||||||
|
|
||||||
|
output.Add(1)
|
||||||
|
go func() {
|
||||||
|
defer output.Done()
|
||||||
|
|
||||||
|
for work := range matchCh {
|
||||||
|
// Match against each selected set
|
||||||
|
for _, setIdx := range setIndices {
|
||||||
|
result := ksg.MatchBatch(setIdx, work.queries)
|
||||||
|
|
||||||
|
setID := ksg.SetIDOf(setIdx)
|
||||||
|
if setID == "" {
|
||||||
|
setID = fmt.Sprintf("set_%d", setIdx)
|
||||||
|
}
|
||||||
|
attrName := "kmer_matched_" + setID
|
||||||
|
|
||||||
|
for seqIdx, positions := range result {
|
||||||
|
if len(positions) > 0 {
|
||||||
|
work.seqs[seqIdx].SetAttribute(attrName, positions)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Push annotated batches to output
|
||||||
|
for _, b := range work.batches {
|
||||||
|
output.Push(b)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Help GC
|
||||||
|
work.seqs = nil
|
||||||
|
work.queries = nil
|
||||||
|
}
|
||||||
|
}()
|
||||||
|
|
||||||
|
go output.WaitAndClose()
|
||||||
|
|
||||||
|
obiconvert.CLIWriteBioSequences(output, true)
|
||||||
|
obiutils.WaitForLastPipe()
|
||||||
|
|
||||||
|
return nil
|
||||||
|
}
|
||||||
63
pkg/obitools/obik/mv.go
Normal file
63
pkg/obitools/obik/mv.go
Normal file
@@ -0,0 +1,63 @@
|
|||||||
|
package obik
|
||||||
|
|
||||||
|
import (
|
||||||
|
"context"
|
||||||
|
"fmt"
|
||||||
|
|
||||||
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
func runMv(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||||
|
if len(args) < 2 {
|
||||||
|
return fmt.Errorf("usage: obik mv [--set PATTERN]... [--force] <source_index> <dest_index>")
|
||||||
|
}
|
||||||
|
|
||||||
|
srcDir := args[0]
|
||||||
|
destDir := args[1]
|
||||||
|
|
||||||
|
ksg, err := obikmer.OpenKmerSetGroup(srcDir)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to open source kmer index: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Resolve set patterns
|
||||||
|
patterns := CLISetPatterns()
|
||||||
|
var ids []string
|
||||||
|
if len(patterns) > 0 {
|
||||||
|
indices, err := ksg.MatchSetIDs(patterns)
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
if len(indices) == 0 {
|
||||||
|
return fmt.Errorf("no sets match the given patterns")
|
||||||
|
}
|
||||||
|
ids = make([]string, len(indices))
|
||||||
|
for i, idx := range indices {
|
||||||
|
ids[i] = ksg.SetIDOf(idx)
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
// Move all sets
|
||||||
|
ids = ksg.SetsIDs()
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Infof("Moving %d set(s) from %s to %s", len(ids), srcDir, destDir)
|
||||||
|
|
||||||
|
// Copy first
|
||||||
|
dest, err := ksg.CopySetsByIDTo(ids, destDir, CLIForce())
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
|
||||||
|
// Remove from source (in reverse order to avoid renumbering issues)
|
||||||
|
for i := len(ids) - 1; i >= 0; i-- {
|
||||||
|
if err := ksg.RemoveSetByID(ids[i]); err != nil {
|
||||||
|
return fmt.Errorf("failed to remove set %q from source after copy: %w", ids[i], err)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Infof("Destination now has %d set(s), source has %d set(s)", dest.Size(), ksg.Size())
|
||||||
|
return nil
|
||||||
|
}
|
||||||
85
pkg/obitools/obik/obik.go
Normal file
85
pkg/obitools/obik/obik.go
Normal file
@@ -0,0 +1,85 @@
|
|||||||
|
package obik
|
||||||
|
|
||||||
|
import (
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
// OptionSet registers all obik subcommands on the root GetOpt.
|
||||||
|
func OptionSet(opt *getoptions.GetOpt) {
|
||||||
|
// index: build or extend a kmer index from sequence files
|
||||||
|
indexCmd := opt.NewCommand("index", "Build a disk-based kmer index from sequence files")
|
||||||
|
obiconvert.InputOptionSet(indexCmd)
|
||||||
|
obiconvert.OutputModeOptionSet(indexCmd, false)
|
||||||
|
KmerIndexOptionSet(indexCmd)
|
||||||
|
indexCmd.StringMapVar(&_setMetaTags, "tag", 1, 1,
|
||||||
|
indexCmd.Alias("T"),
|
||||||
|
indexCmd.ArgName("KEY=VALUE"),
|
||||||
|
indexCmd.Description("Per-set metadata tag (repeatable)."))
|
||||||
|
indexCmd.SetCommandFn(runIndex)
|
||||||
|
|
||||||
|
// ls: list sets in a kmer index
|
||||||
|
lsCmd := opt.NewCommand("ls", "List sets in a kmer index")
|
||||||
|
OutputFormatOptionSet(lsCmd)
|
||||||
|
SetSelectionOptionSet(lsCmd)
|
||||||
|
lsCmd.SetCommandFn(runLs)
|
||||||
|
|
||||||
|
// summary: detailed statistics
|
||||||
|
summaryCmd := opt.NewCommand("summary", "Show detailed statistics of a kmer index")
|
||||||
|
OutputFormatOptionSet(summaryCmd)
|
||||||
|
summaryCmd.BoolVar(&_jaccard, "jaccard", false,
|
||||||
|
summaryCmd.Description("Compute and display pairwise Jaccard distance matrix."))
|
||||||
|
summaryCmd.SetCommandFn(runSummary)
|
||||||
|
|
||||||
|
// cp: copy sets between indices
|
||||||
|
cpCmd := opt.NewCommand("cp", "Copy sets between kmer indices")
|
||||||
|
SetSelectionOptionSet(cpCmd)
|
||||||
|
ForceOptionSet(cpCmd)
|
||||||
|
cpCmd.SetCommandFn(runCp)
|
||||||
|
|
||||||
|
// mv: move sets between indices
|
||||||
|
mvCmd := opt.NewCommand("mv", "Move sets between kmer indices")
|
||||||
|
SetSelectionOptionSet(mvCmd)
|
||||||
|
ForceOptionSet(mvCmd)
|
||||||
|
mvCmd.SetCommandFn(runMv)
|
||||||
|
|
||||||
|
// rm: remove sets from an index
|
||||||
|
rmCmd := opt.NewCommand("rm", "Remove sets from a kmer index")
|
||||||
|
SetSelectionOptionSet(rmCmd)
|
||||||
|
rmCmd.SetCommandFn(runRm)
|
||||||
|
|
||||||
|
// spectrum: output k-mer frequency spectrum as CSV
|
||||||
|
spectrumCmd := opt.NewCommand("spectrum", "Output k-mer frequency spectrum as CSV")
|
||||||
|
SetSelectionOptionSet(spectrumCmd)
|
||||||
|
obiconvert.OutputModeOptionSet(spectrumCmd, false)
|
||||||
|
spectrumCmd.SetCommandFn(runSpectrum)
|
||||||
|
|
||||||
|
// super: extract super k-mers from sequences
|
||||||
|
superCmd := opt.NewCommand("super", "Extract super k-mers from sequence files")
|
||||||
|
obiconvert.InputOptionSet(superCmd)
|
||||||
|
obiconvert.OutputOptionSet(superCmd)
|
||||||
|
SuperKmerOptionSet(superCmd)
|
||||||
|
superCmd.SetCommandFn(runSuper)
|
||||||
|
|
||||||
|
// lowmask: mask low-complexity regions
|
||||||
|
lowmaskCmd := opt.NewCommand("lowmask", "Mask low-complexity regions in sequences using entropy")
|
||||||
|
obiconvert.InputOptionSet(lowmaskCmd)
|
||||||
|
obiconvert.OutputOptionSet(lowmaskCmd)
|
||||||
|
LowMaskOptionSet(lowmaskCmd)
|
||||||
|
lowmaskCmd.SetCommandFn(runLowmask)
|
||||||
|
|
||||||
|
// match: annotate sequences with k-mer match positions from an index
|
||||||
|
matchCmd := opt.NewCommand("match", "Annotate sequences with k-mer match positions from an index")
|
||||||
|
IndexDirectoryOptionSet(matchCmd)
|
||||||
|
obiconvert.InputOptionSet(matchCmd)
|
||||||
|
obiconvert.OutputOptionSet(matchCmd)
|
||||||
|
SetSelectionOptionSet(matchCmd)
|
||||||
|
matchCmd.SetCommandFn(runMatch)
|
||||||
|
|
||||||
|
// filter: filter an index to remove low-complexity k-mers
|
||||||
|
filterCmd := opt.NewCommand("filter", "Filter a kmer index to remove low-complexity k-mers")
|
||||||
|
obiconvert.OutputModeOptionSet(filterCmd, false)
|
||||||
|
EntropyFilterOptionSet(filterCmd)
|
||||||
|
SetSelectionOptionSet(filterCmd)
|
||||||
|
filterCmd.SetCommandFn(runFilter)
|
||||||
|
}
|
||||||
360
pkg/obitools/obik/options.go
Normal file
360
pkg/obitools/obik/options.go
Normal file
@@ -0,0 +1,360 @@
|
|||||||
|
package obik
|
||||||
|
|
||||||
|
import (
|
||||||
|
"strings"
|
||||||
|
|
||||||
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
// MaskingMode defines how to handle low-complexity regions
|
||||||
|
type MaskingMode int
|
||||||
|
|
||||||
|
const (
|
||||||
|
MaskMode MaskingMode = iota // Replace low-complexity regions with masked characters
|
||||||
|
SplitMode // Split sequence into high-complexity fragments
|
||||||
|
ExtractMode // Extract low-complexity fragments
|
||||||
|
)
|
||||||
|
|
||||||
|
// Output format flags
|
||||||
|
var _jsonOutput bool
|
||||||
|
var _csvOutput bool
|
||||||
|
var _yamlOutput bool
|
||||||
|
|
||||||
|
// Set selection flags
|
||||||
|
var _setPatterns []string
|
||||||
|
|
||||||
|
// Force flag
|
||||||
|
var _force bool
|
||||||
|
|
||||||
|
// Jaccard flag
|
||||||
|
var _jaccard bool
|
||||||
|
|
||||||
|
// Per-set tags for index subcommand
|
||||||
|
var _setMetaTags = make(map[string]string, 0)
|
||||||
|
|
||||||
|
// ==============================
|
||||||
|
// Shared kmer options (used by index, super, lowmask)
|
||||||
|
// ==============================
|
||||||
|
|
||||||
|
var _kmerSize = 31
|
||||||
|
var _minimizerSize = -1 // -1 means auto: ceil(k / 2.5)
|
||||||
|
|
||||||
|
// KmerSizeOptionSet registers --kmer-size / -k.
|
||||||
|
// Shared by index, super, and lowmask subcommands.
|
||||||
|
func KmerSizeOptionSet(options *getoptions.GetOpt) {
|
||||||
|
options.IntVar(&_kmerSize, "kmer-size", _kmerSize,
|
||||||
|
options.Alias("k"),
|
||||||
|
options.Description("Size of k-mers (must be between 2 and 31)."))
|
||||||
|
}
|
||||||
|
|
||||||
|
// MinimizerOptionSet registers --minimizer-size / -m.
|
||||||
|
// Shared by index and super subcommands.
|
||||||
|
func MinimizerOptionSet(options *getoptions.GetOpt) {
|
||||||
|
options.IntVar(&_minimizerSize, "minimizer-size", _minimizerSize,
|
||||||
|
options.Alias("m"),
|
||||||
|
options.Description("Size of minimizers for parallelization (-1 for auto = ceil(k/2.5))."))
|
||||||
|
}
|
||||||
|
|
||||||
|
// ==============================
|
||||||
|
// Lowmask-specific options
|
||||||
|
// ==============================
|
||||||
|
|
||||||
|
var _entropySize = 6
|
||||||
|
var _entropyThreshold = 0.5
|
||||||
|
var _splitMode = false
|
||||||
|
var _extractMode = false
|
||||||
|
var _maskingChar = "."
|
||||||
|
var _keepShorter = false
|
||||||
|
|
||||||
|
// LowMaskOptionSet registers options specific to low-complexity masking.
|
||||||
|
func LowMaskOptionSet(options *getoptions.GetOpt) {
|
||||||
|
KmerSizeOptionSet(options)
|
||||||
|
|
||||||
|
options.IntVar(&_entropySize, "entropy-size", _entropySize,
|
||||||
|
options.Description("Maximum word size considered for entropy estimate."))
|
||||||
|
|
||||||
|
options.Float64Var(&_entropyThreshold, "threshold", _entropyThreshold,
|
||||||
|
options.Description("Entropy threshold below which a kmer is masked (0 to 1)."))
|
||||||
|
|
||||||
|
options.BoolVar(&_splitMode, "extract-high", _splitMode,
|
||||||
|
options.Description("Extract only high-complexity regions."))
|
||||||
|
|
||||||
|
options.BoolVar(&_extractMode, "extract-low", _extractMode,
|
||||||
|
options.Description("Extract only low-complexity regions."))
|
||||||
|
|
||||||
|
options.StringVar(&_maskingChar, "masking-char", _maskingChar,
|
||||||
|
options.Description("Character used to mask low complexity regions."))
|
||||||
|
|
||||||
|
options.BoolVar(&_keepShorter, "keep-shorter", _keepShorter,
|
||||||
|
options.Description("Keep fragments shorter than kmer-size in split/extract mode."))
|
||||||
|
}
|
||||||
|
|
||||||
|
// ==============================
|
||||||
|
// Index-specific options
|
||||||
|
// ==============================
|
||||||
|
|
||||||
|
var _indexId = ""
|
||||||
|
var _metadataFormat = "toml"
|
||||||
|
var _setTag = make(map[string]string, 0)
|
||||||
|
var _minOccurrence = 1
|
||||||
|
var _maxOccurrence = 0
|
||||||
|
var _saveFullFilter = false
|
||||||
|
var _saveFreqKmer = 0
|
||||||
|
var _indexEntropyThreshold = 0.0
|
||||||
|
var _indexEntropySize = 6
|
||||||
|
|
||||||
|
// KmerIndexOptionSet defines every option related to kmer index building.
|
||||||
|
func KmerIndexOptionSet(options *getoptions.GetOpt) {
|
||||||
|
KmerSizeOptionSet(options)
|
||||||
|
MinimizerOptionSet(options)
|
||||||
|
|
||||||
|
options.StringVar(&_indexId, "index-id", _indexId,
|
||||||
|
options.Description("Identifier for the kmer index."))
|
||||||
|
|
||||||
|
options.StringVar(&_metadataFormat, "metadata-format", _metadataFormat,
|
||||||
|
options.Description("Format for metadata file (toml, yaml, json)."))
|
||||||
|
|
||||||
|
options.StringMapVar(&_setTag, "set-tag", 1, 1,
|
||||||
|
options.Alias("S"),
|
||||||
|
options.ArgName("KEY=VALUE"),
|
||||||
|
options.Description("Adds a group-level metadata attribute KEY with value VALUE."))
|
||||||
|
|
||||||
|
options.IntVar(&_minOccurrence, "min-occurrence", _minOccurrence,
|
||||||
|
options.Description("Minimum number of occurrences for a k-mer to be kept (default 1 = keep all)."))
|
||||||
|
|
||||||
|
options.IntVar(&_maxOccurrence, "max-occurrence", _maxOccurrence,
|
||||||
|
options.Description("Maximum number of occurrences for a k-mer to be kept (default 0 = no upper bound)."))
|
||||||
|
|
||||||
|
options.BoolVar(&_saveFullFilter, "save-full-filter", _saveFullFilter,
|
||||||
|
options.Description("When using --min-occurrence > 1, save the full frequency filter instead of just the filtered index."))
|
||||||
|
|
||||||
|
options.IntVar(&_saveFreqKmer, "save-freq-kmer", _saveFreqKmer,
|
||||||
|
options.Description("Save the N most frequent k-mers per set to a CSV file (top_kmers.csv)."))
|
||||||
|
|
||||||
|
options.Float64Var(&_indexEntropyThreshold, "entropy-filter", _indexEntropyThreshold,
|
||||||
|
options.Description("Filter low-complexity k-mers with entropy <= threshold (0 = disabled)."))
|
||||||
|
|
||||||
|
options.IntVar(&_indexEntropySize, "entropy-filter-size", _indexEntropySize,
|
||||||
|
options.Description("Maximum word size for entropy filter computation (default 6)."))
|
||||||
|
}
|
||||||
|
|
||||||
|
// EntropyFilterOptionSet registers entropy filter options for commands
|
||||||
|
// that process existing indices (e.g. filter).
|
||||||
|
func EntropyFilterOptionSet(options *getoptions.GetOpt) {
|
||||||
|
options.Float64Var(&_indexEntropyThreshold, "entropy-filter", _indexEntropyThreshold,
|
||||||
|
options.Description("Filter low-complexity k-mers with entropy <= threshold (0 = disabled)."))
|
||||||
|
|
||||||
|
options.IntVar(&_indexEntropySize, "entropy-filter-size", _indexEntropySize,
|
||||||
|
options.Description("Maximum word size for entropy filter computation (default 6)."))
|
||||||
|
}
|
||||||
|
|
||||||
|
// ==============================
|
||||||
|
// Super kmer options
|
||||||
|
// ==============================
|
||||||
|
|
||||||
|
// SuperKmerOptionSet registers options specific to super k-mer extraction.
|
||||||
|
func SuperKmerOptionSet(options *getoptions.GetOpt) {
|
||||||
|
KmerSizeOptionSet(options)
|
||||||
|
MinimizerOptionSet(options)
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIKmerSize returns the k-mer size.
|
||||||
|
func CLIKmerSize() int {
|
||||||
|
return _kmerSize
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIMinimizerSize returns the effective minimizer size.
|
||||||
|
func CLIMinimizerSize() int {
|
||||||
|
m := _minimizerSize
|
||||||
|
if m < 0 {
|
||||||
|
m = obikmer.DefaultMinimizerSize(_kmerSize)
|
||||||
|
}
|
||||||
|
nworkers := obidefault.ParallelWorkers()
|
||||||
|
m = obikmer.ValidateMinimizerSize(m, _kmerSize, nworkers)
|
||||||
|
return m
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIIndexId returns the index identifier.
|
||||||
|
func CLIIndexId() string {
|
||||||
|
return _indexId
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIMetadataFormat returns the metadata format.
|
||||||
|
func CLIMetadataFormat() obikmer.MetadataFormat {
|
||||||
|
switch strings.ToLower(_metadataFormat) {
|
||||||
|
case "toml":
|
||||||
|
return obikmer.FormatTOML
|
||||||
|
case "yaml":
|
||||||
|
return obikmer.FormatYAML
|
||||||
|
case "json":
|
||||||
|
return obikmer.FormatJSON
|
||||||
|
default:
|
||||||
|
log.Warnf("Unknown metadata format %q, defaulting to TOML", _metadataFormat)
|
||||||
|
return obikmer.FormatTOML
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLISetTag returns the group-level metadata key=value pairs.
|
||||||
|
func CLISetTag() map[string]string {
|
||||||
|
return _setTag
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIMinOccurrence returns the minimum occurrence threshold.
|
||||||
|
func CLIMinOccurrence() int {
|
||||||
|
return _minOccurrence
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIMaxOccurrence returns the maximum occurrence threshold (0 = no upper bound).
|
||||||
|
func CLIMaxOccurrence() int {
|
||||||
|
return _maxOccurrence
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLISaveFullFilter returns whether to save the full frequency filter.
|
||||||
|
func CLISaveFullFilter() bool {
|
||||||
|
return _saveFullFilter
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLISaveFreqKmer returns the number of top frequent k-mers to save (0 = disabled).
|
||||||
|
func CLISaveFreqKmer() int {
|
||||||
|
return _saveFreqKmer
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIOutputDirectory returns the output directory path.
|
||||||
|
func CLIOutputDirectory() string {
|
||||||
|
return obiconvert.CLIOutPutFileName()
|
||||||
|
}
|
||||||
|
|
||||||
|
// SetKmerSize sets the k-mer size (for testing).
|
||||||
|
func SetKmerSize(k int) {
|
||||||
|
_kmerSize = k
|
||||||
|
}
|
||||||
|
|
||||||
|
// SetMinimizerSize sets the minimizer size (for testing).
|
||||||
|
func SetMinimizerSize(m int) {
|
||||||
|
_minimizerSize = m
|
||||||
|
}
|
||||||
|
|
||||||
|
// SetMinOccurrence sets the minimum occurrence (for testing).
|
||||||
|
func SetMinOccurrence(n int) {
|
||||||
|
_minOccurrence = n
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIMaskingMode returns the masking mode from CLI flags.
|
||||||
|
func CLIMaskingMode() MaskingMode {
|
||||||
|
switch {
|
||||||
|
case _extractMode:
|
||||||
|
return ExtractMode
|
||||||
|
case _splitMode:
|
||||||
|
return SplitMode
|
||||||
|
default:
|
||||||
|
return MaskMode
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIMaskingChar returns the masking character, validated.
|
||||||
|
func CLIMaskingChar() byte {
|
||||||
|
mask := strings.TrimSpace(_maskingChar)
|
||||||
|
if len(mask) != 1 {
|
||||||
|
log.Fatalf("--masking-char option accepts a single character, not %s", mask)
|
||||||
|
}
|
||||||
|
return []byte(mask)[0]
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIEntropySize returns the entropy word size.
|
||||||
|
func CLIEntropySize() int {
|
||||||
|
return _entropySize
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIEntropyThreshold returns the entropy threshold.
|
||||||
|
func CLIEntropyThreshold() float64 {
|
||||||
|
return _entropyThreshold
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIKeepShorter returns whether to keep short fragments.
|
||||||
|
func CLIKeepShorter() bool {
|
||||||
|
return _keepShorter
|
||||||
|
}
|
||||||
|
|
||||||
|
// ==============================
|
||||||
|
// Match-specific options
|
||||||
|
// ==============================
|
||||||
|
|
||||||
|
var _indexDirectory = ""
|
||||||
|
|
||||||
|
// IndexDirectoryOptionSet registers --index / -i (mandatory directory for match).
|
||||||
|
func IndexDirectoryOptionSet(options *getoptions.GetOpt) {
|
||||||
|
options.StringVar(&_indexDirectory, "index", _indexDirectory,
|
||||||
|
options.Alias("i"),
|
||||||
|
options.Required(),
|
||||||
|
options.ArgName("DIRECTORY"),
|
||||||
|
options.Description("Path to the kmer index directory."))
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIIndexDirectory returns the --index directory path.
|
||||||
|
func CLIIndexDirectory() string {
|
||||||
|
return _indexDirectory
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIIndexEntropyThreshold returns the entropy filter threshold for index building (0 = disabled).
|
||||||
|
func CLIIndexEntropyThreshold() float64 {
|
||||||
|
return _indexEntropyThreshold
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIIndexEntropySize returns the entropy filter word size for index building.
|
||||||
|
func CLIIndexEntropySize() int {
|
||||||
|
return _indexEntropySize
|
||||||
|
}
|
||||||
|
|
||||||
|
// OutputFormatOptionSet registers --json-output, --csv-output, --yaml-output.
|
||||||
|
func OutputFormatOptionSet(options *getoptions.GetOpt) {
|
||||||
|
options.BoolVar(&_jsonOutput, "json-output", false,
|
||||||
|
options.Description("Print results as JSON."))
|
||||||
|
options.BoolVar(&_csvOutput, "csv-output", false,
|
||||||
|
options.Description("Print results as CSV."))
|
||||||
|
options.BoolVar(&_yamlOutput, "yaml-output", false,
|
||||||
|
options.Description("Print results as YAML."))
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIOutFormat returns the selected output format: "json", "csv", "yaml", or "text".
|
||||||
|
func CLIOutFormat() string {
|
||||||
|
if _jsonOutput {
|
||||||
|
return "json"
|
||||||
|
}
|
||||||
|
if _csvOutput {
|
||||||
|
return "csv"
|
||||||
|
}
|
||||||
|
if _yamlOutput {
|
||||||
|
return "yaml"
|
||||||
|
}
|
||||||
|
return "text"
|
||||||
|
}
|
||||||
|
|
||||||
|
// SetSelectionOptionSet registers --set <glob_pattern> (repeatable).
|
||||||
|
func SetSelectionOptionSet(options *getoptions.GetOpt) {
|
||||||
|
options.StringSliceVar(&_setPatterns, "set", 1, 1,
|
||||||
|
options.Alias("s"),
|
||||||
|
options.ArgName("PATTERN"),
|
||||||
|
options.Description("Set ID or glob pattern (repeatable, supports *, ?, [...])."))
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLISetPatterns returns the --set patterns provided by the user.
|
||||||
|
func CLISetPatterns() []string {
|
||||||
|
return _setPatterns
|
||||||
|
}
|
||||||
|
|
||||||
|
// ForceOptionSet registers --force / -f.
|
||||||
|
func ForceOptionSet(options *getoptions.GetOpt) {
|
||||||
|
options.BoolVar(&_force, "force", false,
|
||||||
|
options.Alias("f"),
|
||||||
|
options.Description("Force operation even if set ID already exists in destination."))
|
||||||
|
}
|
||||||
|
|
||||||
|
// CLIForce returns whether --force was specified.
|
||||||
|
func CLIForce() bool {
|
||||||
|
return _force
|
||||||
|
}
|
||||||
56
pkg/obitools/obik/rm.go
Normal file
56
pkg/obitools/obik/rm.go
Normal file
@@ -0,0 +1,56 @@
|
|||||||
|
package obik
|
||||||
|
|
||||||
|
import (
|
||||||
|
"context"
|
||||||
|
"fmt"
|
||||||
|
|
||||||
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
func runRm(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||||
|
if len(args) < 1 {
|
||||||
|
return fmt.Errorf("usage: obik rm --set PATTERN [--set PATTERN]... <index_directory>")
|
||||||
|
}
|
||||||
|
|
||||||
|
patterns := CLISetPatterns()
|
||||||
|
if len(patterns) == 0 {
|
||||||
|
return fmt.Errorf("--set is required (specify which sets to remove)")
|
||||||
|
}
|
||||||
|
|
||||||
|
indexDir := args[0]
|
||||||
|
|
||||||
|
ksg, err := obikmer.OpenKmerSetGroup(indexDir)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
indices, err := ksg.MatchSetIDs(patterns)
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
if len(indices) == 0 {
|
||||||
|
return fmt.Errorf("no sets match the given patterns")
|
||||||
|
}
|
||||||
|
|
||||||
|
// Collect IDs before removal (indices shift as we remove)
|
||||||
|
ids := make([]string, len(indices))
|
||||||
|
for i, idx := range indices {
|
||||||
|
ids[i] = ksg.SetIDOf(idx)
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Infof("Removing %d set(s) from %s", len(ids), indexDir)
|
||||||
|
|
||||||
|
// Remove in reverse order to avoid renumbering issues
|
||||||
|
for i := len(ids) - 1; i >= 0; i-- {
|
||||||
|
if err := ksg.RemoveSetByID(ids[i]); err != nil {
|
||||||
|
return fmt.Errorf("failed to remove set %q: %w", ids[i], err)
|
||||||
|
}
|
||||||
|
log.Infof("Removed set %q", ids[i])
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Infof("Index now has %d set(s)", ksg.Size())
|
||||||
|
return nil
|
||||||
|
}
|
||||||
121
pkg/obitools/obik/spectrum.go
Normal file
121
pkg/obitools/obik/spectrum.go
Normal file
@@ -0,0 +1,121 @@
|
|||||||
|
package obik
|
||||||
|
|
||||||
|
import (
|
||||||
|
"context"
|
||||||
|
"encoding/csv"
|
||||||
|
"fmt"
|
||||||
|
"os"
|
||||||
|
"strconv"
|
||||||
|
|
||||||
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
// runSpectrum implements the "obik spectrum" subcommand.
|
||||||
|
// It outputs k-mer frequency spectra as CSV with one column per set.
|
||||||
|
func runSpectrum(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||||
|
if len(args) < 1 {
|
||||||
|
return fmt.Errorf("usage: obik spectrum [options] <index_directory>")
|
||||||
|
}
|
||||||
|
|
||||||
|
ksg, err := obikmer.OpenKmerSetGroup(args[0])
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Determine which sets to include
|
||||||
|
patterns := CLISetPatterns()
|
||||||
|
var indices []int
|
||||||
|
if len(patterns) > 0 {
|
||||||
|
indices, err = ksg.MatchSetIDs(patterns)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to match set patterns: %w", err)
|
||||||
|
}
|
||||||
|
if len(indices) == 0 {
|
||||||
|
return fmt.Errorf("no sets match the given patterns")
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
// All sets
|
||||||
|
indices = make([]int, ksg.Size())
|
||||||
|
for i := range indices {
|
||||||
|
indices[i] = i
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Read spectra for selected sets
|
||||||
|
spectraMaps := make([]map[int]uint64, len(indices))
|
||||||
|
maxFreq := 0
|
||||||
|
for i, idx := range indices {
|
||||||
|
spectrum, err := ksg.Spectrum(idx)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to read spectrum for set %d: %w", idx, err)
|
||||||
|
}
|
||||||
|
if spectrum == nil {
|
||||||
|
log.Warnf("No spectrum data for set %d (%s)", idx, ksg.SetIDOf(idx))
|
||||||
|
spectraMaps[i] = make(map[int]uint64)
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
spectraMaps[i] = spectrum.ToMap()
|
||||||
|
if mf := spectrum.MaxFrequency(); mf > maxFreq {
|
||||||
|
maxFreq = mf
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if maxFreq == 0 {
|
||||||
|
return fmt.Errorf("no spectrum data found in any selected set")
|
||||||
|
}
|
||||||
|
|
||||||
|
// Determine output destination
|
||||||
|
outFile := obiconvert.CLIOutPutFileName()
|
||||||
|
var w *csv.Writer
|
||||||
|
if outFile == "" || outFile == "-" {
|
||||||
|
w = csv.NewWriter(os.Stdout)
|
||||||
|
} else {
|
||||||
|
f, err := os.Create(outFile)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to create output file: %w", err)
|
||||||
|
}
|
||||||
|
defer f.Close()
|
||||||
|
w = csv.NewWriter(f)
|
||||||
|
}
|
||||||
|
defer w.Flush()
|
||||||
|
|
||||||
|
// Build header: frequency, set_id_1, set_id_2, ...
|
||||||
|
header := make([]string, 1+len(indices))
|
||||||
|
header[0] = "frequency"
|
||||||
|
for i, idx := range indices {
|
||||||
|
id := ksg.SetIDOf(idx)
|
||||||
|
if id == "" {
|
||||||
|
id = fmt.Sprintf("set_%d", idx)
|
||||||
|
}
|
||||||
|
header[i+1] = id
|
||||||
|
}
|
||||||
|
if err := w.Write(header); err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
|
||||||
|
// Write rows for each frequency from 1 to maxFreq
|
||||||
|
record := make([]string, 1+len(indices))
|
||||||
|
for freq := 1; freq <= maxFreq; freq++ {
|
||||||
|
record[0] = strconv.Itoa(freq)
|
||||||
|
hasData := false
|
||||||
|
for i := range indices {
|
||||||
|
count := spectraMaps[i][freq]
|
||||||
|
record[i+1] = strconv.FormatUint(count, 10)
|
||||||
|
if count > 0 {
|
||||||
|
hasData = true
|
||||||
|
}
|
||||||
|
}
|
||||||
|
// Only write rows where at least one set has a non-zero count
|
||||||
|
if hasData {
|
||||||
|
if err := w.Write(record); err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return nil
|
||||||
|
}
|
||||||
148
pkg/obitools/obik/summary.go
Normal file
148
pkg/obitools/obik/summary.go
Normal file
@@ -0,0 +1,148 @@
|
|||||||
|
package obik
|
||||||
|
|
||||||
|
import (
|
||||||
|
"context"
|
||||||
|
"encoding/json"
|
||||||
|
"fmt"
|
||||||
|
"os"
|
||||||
|
"path/filepath"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
"gopkg.in/yaml.v3"
|
||||||
|
)
|
||||||
|
|
||||||
|
type setSummary struct {
|
||||||
|
Index int `json:"index" yaml:"index"`
|
||||||
|
ID string `json:"id" yaml:"id"`
|
||||||
|
Count uint64 `json:"count" yaml:"count"`
|
||||||
|
DiskSize int64 `json:"disk_bytes" yaml:"disk_bytes"`
|
||||||
|
Metadata map[string]interface{} `json:"metadata,omitempty" yaml:"metadata,omitempty"`
|
||||||
|
}
|
||||||
|
|
||||||
|
type groupSummary struct {
|
||||||
|
Path string `json:"path" yaml:"path"`
|
||||||
|
ID string `json:"id,omitempty" yaml:"id,omitempty"`
|
||||||
|
K int `json:"k" yaml:"k"`
|
||||||
|
M int `json:"m" yaml:"m"`
|
||||||
|
Partitions int `json:"partitions" yaml:"partitions"`
|
||||||
|
TotalSets int `json:"total_sets" yaml:"total_sets"`
|
||||||
|
TotalKmers uint64 `json:"total_kmers" yaml:"total_kmers"`
|
||||||
|
TotalDisk int64 `json:"total_disk_bytes" yaml:"total_disk_bytes"`
|
||||||
|
Metadata map[string]interface{} `json:"metadata,omitempty" yaml:"metadata,omitempty"`
|
||||||
|
Sets []setSummary `json:"sets" yaml:"sets"`
|
||||||
|
Jaccard [][]float64 `json:"jaccard,omitempty" yaml:"jaccard,omitempty"`
|
||||||
|
}
|
||||||
|
|
||||||
|
func runSummary(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||||
|
if len(args) < 1 {
|
||||||
|
return fmt.Errorf("usage: obik summary [options] <index_directory>")
|
||||||
|
}
|
||||||
|
|
||||||
|
ksg, err := obikmer.OpenKmerSetGroup(args[0])
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
summary := groupSummary{
|
||||||
|
Path: ksg.Path(),
|
||||||
|
ID: ksg.Id(),
|
||||||
|
K: ksg.K(),
|
||||||
|
M: ksg.M(),
|
||||||
|
Partitions: ksg.Partitions(),
|
||||||
|
TotalSets: ksg.Size(),
|
||||||
|
TotalKmers: ksg.Len(),
|
||||||
|
Metadata: ksg.Metadata,
|
||||||
|
Sets: make([]setSummary, ksg.Size()),
|
||||||
|
}
|
||||||
|
|
||||||
|
var totalDisk int64
|
||||||
|
for i := 0; i < ksg.Size(); i++ {
|
||||||
|
diskSize := computeSetDiskSize(ksg, i)
|
||||||
|
totalDisk += diskSize
|
||||||
|
summary.Sets[i] = setSummary{
|
||||||
|
Index: i,
|
||||||
|
ID: ksg.SetIDOf(i),
|
||||||
|
Count: ksg.Len(i),
|
||||||
|
DiskSize: diskSize,
|
||||||
|
Metadata: ksg.AllSetMetadata(i),
|
||||||
|
}
|
||||||
|
}
|
||||||
|
summary.TotalDisk = totalDisk
|
||||||
|
|
||||||
|
// Jaccard matrix
|
||||||
|
if _jaccard && ksg.Size() > 1 {
|
||||||
|
dm := ksg.JaccardDistanceMatrix()
|
||||||
|
n := ksg.Size()
|
||||||
|
matrix := make([][]float64, n)
|
||||||
|
for i := 0; i < n; i++ {
|
||||||
|
matrix[i] = make([]float64, n)
|
||||||
|
for j := 0; j < n; j++ {
|
||||||
|
if i == j {
|
||||||
|
matrix[i][j] = 0
|
||||||
|
} else {
|
||||||
|
matrix[i][j] = dm.Get(i, j)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
summary.Jaccard = matrix
|
||||||
|
}
|
||||||
|
|
||||||
|
format := CLIOutFormat()
|
||||||
|
switch format {
|
||||||
|
case "json":
|
||||||
|
return outputSummaryJSON(summary)
|
||||||
|
case "yaml":
|
||||||
|
return outputSummaryYAML(summary)
|
||||||
|
case "csv":
|
||||||
|
return outputSummaryCSV(summary)
|
||||||
|
default:
|
||||||
|
return outputSummaryJSON(summary)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func computeSetDiskSize(ksg *obikmer.KmerSetGroup, setIndex int) int64 {
|
||||||
|
var total int64
|
||||||
|
for p := 0; p < ksg.Partitions(); p++ {
|
||||||
|
path := ksg.PartitionPath(setIndex, p)
|
||||||
|
info, err := os.Stat(path)
|
||||||
|
if err != nil {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
total += info.Size()
|
||||||
|
}
|
||||||
|
// Also count the set directory entry itself
|
||||||
|
setDir := filepath.Join(ksg.Path(), fmt.Sprintf("set_%d", setIndex))
|
||||||
|
entries, err := os.ReadDir(setDir)
|
||||||
|
if err == nil {
|
||||||
|
// We already counted .kdi files above; this is just for completeness
|
||||||
|
_ = entries
|
||||||
|
}
|
||||||
|
return total
|
||||||
|
}
|
||||||
|
|
||||||
|
func outputSummaryJSON(summary groupSummary) error {
|
||||||
|
data, err := json.MarshalIndent(summary, "", " ")
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
fmt.Println(string(data))
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func outputSummaryYAML(summary groupSummary) error {
|
||||||
|
data, err := yaml.Marshal(summary)
|
||||||
|
if err != nil {
|
||||||
|
return err
|
||||||
|
}
|
||||||
|
fmt.Print(string(data))
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func outputSummaryCSV(summary groupSummary) error {
|
||||||
|
fmt.Println("index,id,count,disk_bytes")
|
||||||
|
for _, s := range summary.Sets {
|
||||||
|
fmt.Printf("%d,%s,%d,%d\n", s.Index, s.ID, s.Count, s.DiskSize)
|
||||||
|
}
|
||||||
|
return nil
|
||||||
|
}
|
||||||
49
pkg/obitools/obik/super.go
Normal file
49
pkg/obitools/obik/super.go
Normal file
@@ -0,0 +1,49 @@
|
|||||||
|
package obik
|
||||||
|
|
||||||
|
import (
|
||||||
|
"context"
|
||||||
|
"fmt"
|
||||||
|
|
||||||
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
|
"github.com/DavidGamba/go-getoptions"
|
||||||
|
)
|
||||||
|
|
||||||
|
// runSuper implements the "obik super" subcommand.
|
||||||
|
// It extracts super k-mers from DNA sequences.
|
||||||
|
func runSuper(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||||
|
k := CLIKmerSize()
|
||||||
|
m := CLIMinimizerSize()
|
||||||
|
|
||||||
|
if k < 2 || k > 31 {
|
||||||
|
return fmt.Errorf("invalid k-mer size: %d (must be between 2 and 31)", k)
|
||||||
|
}
|
||||||
|
|
||||||
|
if m < 1 || m >= k {
|
||||||
|
return fmt.Errorf("invalid parameters: minimizer size (%d) must be between 1 and k-1 (%d)", m, k-1)
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Printf("Extracting super k-mers with k=%d, m=%d", k, m)
|
||||||
|
|
||||||
|
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
|
if err != nil {
|
||||||
|
return fmt.Errorf("failed to open sequence files: %w", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
worker := obikmer.SuperKmerWorker(k, m)
|
||||||
|
|
||||||
|
superkmers := sequences.MakeIWorker(
|
||||||
|
worker,
|
||||||
|
false,
|
||||||
|
obidefault.ParallelWorkers(),
|
||||||
|
)
|
||||||
|
|
||||||
|
obiconvert.CLIWriteBioSequences(superkmers, true)
|
||||||
|
obiutils.WaitForLastPipe()
|
||||||
|
|
||||||
|
return nil
|
||||||
|
}
|
||||||
@@ -42,16 +42,19 @@ func MapOnLandmarkSequences(library obiseq.BioSequenceSlice, landmark_idx []int,
|
|||||||
|
|
||||||
seqworld := obiutils.Make2DArray[float64](library_size, n_landmark)
|
seqworld := obiutils.Make2DArray[float64](library_size, n_landmark)
|
||||||
|
|
||||||
pbopt := make([]progressbar.Option, 0, 5)
|
var bar *progressbar.ProgressBar
|
||||||
pbopt = append(pbopt,
|
if obidefault.ProgressBar() {
|
||||||
progressbar.OptionSetWriter(os.Stderr),
|
pbopt := make([]progressbar.Option, 0, 5)
|
||||||
progressbar.OptionSetWidth(15),
|
pbopt = append(pbopt,
|
||||||
progressbar.OptionShowCount(),
|
progressbar.OptionSetWriter(os.Stderr),
|
||||||
progressbar.OptionShowIts(),
|
progressbar.OptionSetWidth(15),
|
||||||
progressbar.OptionSetDescription("[Sequence mapping]"),
|
progressbar.OptionShowCount(),
|
||||||
)
|
progressbar.OptionShowIts(),
|
||||||
|
progressbar.OptionSetDescription("[Sequence mapping]"),
|
||||||
|
)
|
||||||
|
|
||||||
bar := progressbar.NewOptions(library_size, pbopt...)
|
bar = progressbar.NewOptions(library_size, pbopt...)
|
||||||
|
}
|
||||||
|
|
||||||
waiting := sync.WaitGroup{}
|
waiting := sync.WaitGroup{}
|
||||||
waiting.Add(nworkers)
|
waiting.Add(nworkers)
|
||||||
@@ -66,7 +69,9 @@ func MapOnLandmarkSequences(library obiseq.BioSequenceSlice, landmark_idx []int,
|
|||||||
match, lalign := obialign.FastLCSScore(landmark, seq, -1, &buffer)
|
match, lalign := obialign.FastLCSScore(landmark, seq, -1, &buffer)
|
||||||
coord[j] = float64(lalign - match)
|
coord[j] = float64(lalign - match)
|
||||||
}
|
}
|
||||||
bar.Add(1)
|
if bar != nil {
|
||||||
|
bar.Add(1)
|
||||||
|
}
|
||||||
}
|
}
|
||||||
waiting.Done()
|
waiting.Done()
|
||||||
}
|
}
|
||||||
@@ -170,23 +175,26 @@ func CLISelectLandmarkSequences(iterator obiiter.IBioSequence) obiiter.IBioSeque
|
|||||||
taxa.Set(i, taxon)
|
taxa.Set(i, taxon)
|
||||||
}
|
}
|
||||||
|
|
||||||
pbopt := make([]progressbar.Option, 0, 5)
|
var bar2 *progressbar.ProgressBar
|
||||||
pbopt = append(pbopt,
|
if obidefault.ProgressBar() {
|
||||||
progressbar.OptionSetWriter(os.Stderr),
|
pbopt := make([]progressbar.Option, 0, 5)
|
||||||
progressbar.OptionSetWidth(15),
|
pbopt = append(pbopt,
|
||||||
progressbar.OptionShowCount(),
|
progressbar.OptionSetWriter(os.Stderr),
|
||||||
progressbar.OptionShowIts(),
|
progressbar.OptionSetWidth(15),
|
||||||
progressbar.OptionSetDescription("[Sequence Indexing]"),
|
progressbar.OptionShowCount(),
|
||||||
)
|
progressbar.OptionShowIts(),
|
||||||
|
progressbar.OptionSetDescription("[Sequence Indexing]"),
|
||||||
|
)
|
||||||
|
|
||||||
bar := progressbar.NewOptions(len(library), pbopt...)
|
bar2 = progressbar.NewOptions(len(library), pbopt...)
|
||||||
|
}
|
||||||
|
|
||||||
for i, seq := range library {
|
for i, seq := range library {
|
||||||
idx := obirefidx.GeomIndexSesquence(i, library, taxa, taxo)
|
idx := obirefidx.GeomIndexSesquence(i, library, taxa, taxo)
|
||||||
seq.SetOBITagGeomRefIndex(idx)
|
seq.SetOBITagGeomRefIndex(idx)
|
||||||
|
|
||||||
if i%10 == 0 {
|
if bar2 != nil && i%10 == 0 {
|
||||||
bar.Add(10)
|
bar2.Add(10)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -1,332 +0,0 @@
|
|||||||
```{r}
|
|
||||||
library(tidyverse)
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
x <- sample(1:4096, 29, replace=TRUE)
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
emax <- function(lseq,word_size) {
|
|
||||||
nword = lseq - word_size + 1
|
|
||||||
nalpha = 4^word_size
|
|
||||||
|
|
||||||
if (nalpha < nword) {
|
|
||||||
cov = nword %/% nalpha
|
|
||||||
remains = nword %% nalpha
|
|
||||||
f1 = cov/nword
|
|
||||||
f2 = (cov+1)/nword
|
|
||||||
print(c(nalpha - remains,f1,remains,f2))
|
|
||||||
e = -(nalpha - remains) * f1 * log(f1) -
|
|
||||||
remains * f2 * log(f2)
|
|
||||||
} else {
|
|
||||||
e = log(nword)
|
|
||||||
}
|
|
||||||
|
|
||||||
e
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
ec <- function(data,kmer_size) {
|
|
||||||
table <- table(data)
|
|
||||||
s <- sum(table)
|
|
||||||
e <- sum(table * log(table))/s
|
|
||||||
ed <- log(s) - e
|
|
||||||
|
|
||||||
em <- emax(s+kmer_size-1,kmer_size)
|
|
||||||
|
|
||||||
ed/em
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
ef <- function(data,kmer_size) {
|
|
||||||
table <- table(data)
|
|
||||||
s <- sum(table)
|
|
||||||
f <- table / s
|
|
||||||
|
|
||||||
f <- as.numeric(f)
|
|
||||||
f <- f[f > 0]
|
|
||||||
|
|
||||||
em <- emax(s+kmer_size-1,kmer_size)
|
|
||||||
ed <- -sum(f * log(f))
|
|
||||||
|
|
||||||
print(c(ed,em,ed/em))
|
|
||||||
|
|
||||||
ed/em
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
okmer <- function(data,kmer_size) {
|
|
||||||
str_sub(data,1:(nchar(data)-kmer_size+1)) %>%
|
|
||||||
str_sub(1,kmer_size)
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
# Normalisation circulaire: retourne le plus petit k-mer par rotation circulaire
|
|
||||||
normalize_circular <- function(kmer) {
|
|
||||||
if (nchar(kmer) == 0) return(kmer)
|
|
||||||
|
|
||||||
canonical <- kmer
|
|
||||||
n <- nchar(kmer)
|
|
||||||
|
|
||||||
# Tester toutes les rotations circulaires
|
|
||||||
for (i in 2:n) {
|
|
||||||
rotated <- paste0(str_sub(kmer, i, n), str_sub(kmer, 1, i-1))
|
|
||||||
if (rotated < canonical) {
|
|
||||||
canonical <- rotated
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
canonical
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
# Fonction totient d'Euler: compte le nombre d'entiers de 1 à n coprimes avec n
|
|
||||||
euler_totient <- function(n) {
|
|
||||||
if (n <= 0) return(0)
|
|
||||||
|
|
||||||
result <- n
|
|
||||||
p <- 2
|
|
||||||
|
|
||||||
# Traiter tous les facteurs premiers
|
|
||||||
while (p * p <= n) {
|
|
||||||
if (n %% p == 0) {
|
|
||||||
# Retirer toutes les occurrences de p
|
|
||||||
while (n %% p == 0) {
|
|
||||||
n <- n %/% p
|
|
||||||
}
|
|
||||||
# Appliquer la formule: φ(n) = n * (1 - 1/p)
|
|
||||||
result <- result - result %/% p
|
|
||||||
}
|
|
||||||
p <- p + 1
|
|
||||||
}
|
|
||||||
|
|
||||||
# Si n est toujours > 1, alors c'est un facteur premier
|
|
||||||
if (n > 1) {
|
|
||||||
result <- result - result %/% n
|
|
||||||
}
|
|
||||||
|
|
||||||
result
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
# Retourne tous les diviseurs de n
|
|
||||||
divisors <- function(n) {
|
|
||||||
if (n <= 0) return(integer(0))
|
|
||||||
|
|
||||||
divs <- c()
|
|
||||||
i <- 1
|
|
||||||
while (i * i <= n) {
|
|
||||||
if (n %% i == 0) {
|
|
||||||
divs <- c(divs, i)
|
|
||||||
if (i != n %/% i) {
|
|
||||||
divs <- c(divs, n %/% i)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
i <- i + 1
|
|
||||||
}
|
|
||||||
|
|
||||||
sort(divs)
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
# Compte le nombre de colliers (necklaces) distincts de longueur n
|
|
||||||
# sur un alphabet de taille a en utilisant la formule de Moreau:
|
|
||||||
# N(n, a) = (1/n) * Σ φ(d) * a^(n/d)
|
|
||||||
# où la somme est sur tous les diviseurs d de n, et φ est la fonction totient d'Euler
|
|
||||||
necklace_count <- function(n, alphabet_size) {
|
|
||||||
if (n <= 0) return(0)
|
|
||||||
|
|
||||||
divs <- divisors(n)
|
|
||||||
sum_val <- 0
|
|
||||||
|
|
||||||
for (d in divs) {
|
|
||||||
# Calculer alphabet_size^(n/d)
|
|
||||||
power <- alphabet_size^(n %/% d)
|
|
||||||
sum_val <- sum_val + euler_totient(d) * power
|
|
||||||
}
|
|
||||||
|
|
||||||
sum_val %/% n
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
# Nombre de classes d'équivalence pour les k-mers normalisés
|
|
||||||
# Utilise la formule exacte de Moreau pour compter les colliers (necklaces)
|
|
||||||
n_normalized_kmers <- function(kmer_size) {
|
|
||||||
# Valeurs exactes pré-calculées pour k=1 à 6
|
|
||||||
if (kmer_size == 1) return(4)
|
|
||||||
if (kmer_size == 2) return(10)
|
|
||||||
if (kmer_size == 3) return(24)
|
|
||||||
if (kmer_size == 4) return(70)
|
|
||||||
if (kmer_size == 5) return(208)
|
|
||||||
if (kmer_size == 6) return(700)
|
|
||||||
|
|
||||||
# Pour k > 6, utiliser la formule de Moreau (exacte)
|
|
||||||
# Alphabet ADN a 4 bases
|
|
||||||
necklace_count(kmer_size, 4)
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
# Entropie maximale pour k-mers normalisés
|
|
||||||
enmax <- function(lseq, word_size) {
|
|
||||||
nword = lseq - word_size + 1
|
|
||||||
nalpha = n_normalized_kmers(word_size)
|
|
||||||
|
|
||||||
if (nalpha < nword) {
|
|
||||||
cov = nword %/% nalpha
|
|
||||||
remains = nword %% nalpha
|
|
||||||
f1 = cov/nword
|
|
||||||
f2 = (cov+1)/nword
|
|
||||||
e = -(nalpha - remains) * f1 * log(f1) -
|
|
||||||
remains * f2 * log(f2)
|
|
||||||
} else {
|
|
||||||
e = log(nword)
|
|
||||||
}
|
|
||||||
|
|
||||||
e
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
# Entropie normalisée avec normalisation circulaire des k-mers
|
|
||||||
ecn <- function(data, kmer_size) {
|
|
||||||
# Normaliser tous les k-mers
|
|
||||||
normalized_data <- sapply(data, normalize_circular)
|
|
||||||
|
|
||||||
# Calculer la table des fréquences
|
|
||||||
table <- table(normalized_data)
|
|
||||||
s <- sum(table)
|
|
||||||
e <- sum(table * log(table))/s
|
|
||||||
ed <- log(s) - e
|
|
||||||
|
|
||||||
# Entropie maximale avec normalisation
|
|
||||||
em <- enmax(s + kmer_size - 1, kmer_size)
|
|
||||||
|
|
||||||
ed/em
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
k<-'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa'
|
|
||||||
ec(okmer(k,1),1)
|
|
||||||
ec(okmer(k,2),2)
|
|
||||||
ec(okmer(k,3),3)
|
|
||||||
ec(okmer(k,4),4)
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
k<-'atatatatatatatatatatatatatatata'
|
|
||||||
ef(okmer(k,1),1)
|
|
||||||
ef(okmer(k,2),2)
|
|
||||||
ef(okmer(k,3),3)
|
|
||||||
ef(okmer(k,4),4)
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
k<-'aaaaaaaaaaaaaaaattttttttttttttt'
|
|
||||||
ef(okmer(k,1),1)
|
|
||||||
ef(okmer(k,2),2)
|
|
||||||
ef(okmer(k,3),3)
|
|
||||||
ef(okmer(k,4),4)
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
k<-'atgatgatgatgatgatgatgatgatgatga'
|
|
||||||
ef(okmer(k,1),1)
|
|
||||||
ef(okmer(k,2),2)
|
|
||||||
ef(okmer(k,3),3)
|
|
||||||
ef(okmer(k,4),4)
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
k<-'atcgatcgatcgatcgatcgatcgatcgact'
|
|
||||||
ecn(okmer(k,1),1)
|
|
||||||
ecn(okmer(k,2),2)
|
|
||||||
ecn(okmer(k,3),3)
|
|
||||||
ecn(okmer(k,4),4)
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
k<-paste(sample(rep(c("a","c","g","t"),8),31),collapse="")
|
|
||||||
k <- "actatggcaagtcgtaaccgcgcttatcagg"
|
|
||||||
ecn(okmer(k,1),1)
|
|
||||||
ecn(okmer(k,2),2)
|
|
||||||
ecn(okmer(k,3),3)
|
|
||||||
ecn(okmer(k,4),4)
|
|
||||||
```
|
|
||||||
|
|
||||||
aattaaaaaaacaagataaaataatattttt
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
k<-'aattaaaaaaacaagataaaataatattttt'
|
|
||||||
ecn(okmer(k,1),1)
|
|
||||||
ecn(okmer(k,2),2)
|
|
||||||
ecn(okmer(k,3),3)
|
|
||||||
ecn(okmer(k,4),4)
|
|
||||||
```
|
|
||||||
|
|
||||||
atg tga gat ,,,,
|
|
||||||
|
|
||||||
cat tca atc
|
|
||||||
|
|
||||||
tgatgatgatgatgatgatgatgatgatg
|
|
||||||
|
|
||||||
## Tests de normalisation circulaire
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
# Test de la fonction de normalisation
|
|
||||||
normalize_circular("ca") # devrait donner "ac"
|
|
||||||
normalize_circular("tgca") # devrait donner "atgc"
|
|
||||||
normalize_circular("acgt") # devrait donner "acgt"
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
# Comparaison ec vs ecn sur une séquence répétitive
|
|
||||||
# Les k-mers "atg", "tga", "gat" sont équivalents par rotation
|
|
||||||
k <- 'atgatgatgatgatgatgatgatgatgatga'
|
|
||||||
cat("Séquence:", k, "\n")
|
|
||||||
cat("ec(k,3) =", ec(okmer(k,3),3), "\n")
|
|
||||||
cat("ecn(k,3) =", ecn(okmer(k,3),3), "\n")
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
# Comparaison sur séquence aléatoire
|
|
||||||
k <- "actatggcaagtcgtaaccgcgcttatcagg"
|
|
||||||
cat("Séquence:", k, "\n")
|
|
||||||
cat("Sans normalisation:\n")
|
|
||||||
cat(" ec(k,2) =", ec(okmer(k,2),2), "\n")
|
|
||||||
cat(" ec(k,3) =", ec(okmer(k,3),3), "\n")
|
|
||||||
cat(" ec(k,4) =", ec(okmer(k,4),4), "\n")
|
|
||||||
cat("Avec normalisation circulaire:\n")
|
|
||||||
cat(" ecn(k,2) =", ecn(okmer(k,2),2), "\n")
|
|
||||||
cat(" ecn(k,3) =", ecn(okmer(k,3),3), "\n")
|
|
||||||
cat(" ecn(k,4) =", ecn(okmer(k,4),4), "\n")
|
|
||||||
```
|
|
||||||
|
|
||||||
```{r}
|
|
||||||
|
|
||||||
sequence <- "ttcatcactcagcaatcctgaatgatGAGAGCTTTTTTTTTTTATATATATATATATGTATATGTATGAAATACACTtatgctccgtttgtttcgccgtaa"
|
|
||||||
re <- rev(c(0.8108602271901116,0.8108602271901116,0.8041354757148719,0.8041354757148719,0.8041354757148719,0.8041354757148719,0.8041354757148719,0.8041354757148719,0.7800272339058549,0.7800272339058549,0.7751610144606091,0.7751610144606091,0.7751610144606091,0.764858185548322,0.7325526601302021,0.7137620699527615,0.6789199521982864,0.6584536373623372,0.634002687184193,0.6075290415873623,0.5785545803330997,0.5785545803330997,0.5503220289212184,0.5315314387437778,0.4966893209893028,0.46077361820145696,0.42388221293245526,0.4009547969713408,0.3561142883497758,0.3561142883497758,0.3561142883497758,0.3561142883497758,0.3561142883497758,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.35141814451677883,0.35141814451677883,0.35141814451677883,0.35141814451677883,0.35141814451677883,0.390029016052137,0.42781461756157363,0.45192285937059073,0.47238917420654,0.47238917420654,0.47238917420654,0.5092805794755417,0.5451962822633876,0.5800384000178626,0.602395141014297,0.6046146614886381,0.6046146614886381,0.6119084258128231,0.6119084258128231,0.6214217106113492,0.6424704346756562,0.6482381543085467,0.6635191587399633,0.6635191587399633,0.6635191587399633,0.6828444721058894,0.6950205907027562,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.7208976112999935))
|
|
||||||
|
|
||||||
di <- c(0.7208976112999935,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6950205907027562,0.6828444721058894,0.6635191587399633,0.6635191587399633,0.6635191587399633,0.6482381543085467,0.6424704346756562,0.6214217106113492,0.6119084258128231,0.6119084258128231,0.6046146614886382,0.6046146614886382,0.6023951410142971,0.5800384000178627,0.5451962822633876,0.5092805794755418,0.47238917420654003,0.47238917420654003,0.47238917420654003,0.4519228593705908,0.4278146175615737,0.39002901605213713,0.35141814451677894,0.35141814451677894,0.35141814451677894,0.35141814451677894,0.35141814451677883,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3561142883497762,0.3561142883497762,0.3561142883497762,0.3561142883497762,0.3561142883497762,0.40095479697134073,0.42388221293245526,0.46077361820145696,0.4966893209893028,0.5315314387437778,0.5503220289212184,0.5785545803330997,0.5785545803330997,0.6075290415873625,0.6340026871841933,0.6584536373623374,0.6789199521982866,0.7137620699527616,0.7325526601302023,0.7648581855483221,0.7751610144606093,0.7751610144606093,0.7751610144606093,0.7800272339058549,0.7800272339058549,0.8041354757148721,0.8041354757148721,0.8041354757148721,0.8041354757148721,0.8041354757148721,0.8041354757148721,0.8108602271901116,0.8108602271901116)
|
|
||||||
|
|
||||||
ebidir <- tibble(direct=di,reverse=re) %>%
|
|
||||||
mutate(position = 1:length(re),
|
|
||||||
nucleotide = str_sub(sequence,position,position))
|
|
||||||
|
|
||||||
ebidir %>%
|
|
||||||
ggplot(aes(x=position,y=direct)) +
|
|
||||||
geom_line() +
|
|
||||||
scale_x_continuous(breaks = ebidir$position, labels = ebidir$nucleotide) +
|
|
||||||
ylim(0,1)+
|
|
||||||
geom_hline(yintercept=0.5, col = "red", linetype = "dashed")
|
|
||||||
```
|
|
||||||
@@ -1,535 +0,0 @@
|
|||||||
package obilowmask
|
|
||||||
|
|
||||||
import (
|
|
||||||
"fmt"
|
|
||||||
"math"
|
|
||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
|
||||||
log "github.com/sirupsen/logrus"
|
|
||||||
)
|
|
||||||
|
|
||||||
// MaskingMode defines how to handle low-complexity regions
|
|
||||||
type MaskingMode int
|
|
||||||
|
|
||||||
const (
|
|
||||||
Mask MaskingMode = iota // Mask mode: replace low-complexity regions with masked characters
|
|
||||||
Split // Split mode: split sequence into high-complexity fragments
|
|
||||||
Extract
|
|
||||||
)
|
|
||||||
|
|
||||||
// LowMaskWorker creates a worker to mask low-complexity regions in DNA sequences.
|
|
||||||
//
|
|
||||||
// Algorithm principle:
|
|
||||||
// Calculate the normalized entropy of each k-mer at different scales (wordSize = 1 to level_max).
|
|
||||||
// K-mers with entropy below the threshold are masked.
|
|
||||||
//
|
|
||||||
// Parameters:
|
|
||||||
// - kmer_size: size of the sliding window for entropy calculation
|
|
||||||
// - level_max: maximum word size used for entropy calculation (finest scale)
|
|
||||||
// - threshold: normalized entropy threshold below which masking occurs (between 0 and 1)
|
|
||||||
// - mode: Mask (masking) or Split (splitting)
|
|
||||||
// - maskChar: character used for masking (typically 'n' or 'N')
|
|
||||||
//
|
|
||||||
// Returns: a SeqWorker function that can be applied to each sequence
|
|
||||||
func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode MaskingMode, maskChar byte) obiseq.SeqWorker {
|
|
||||||
|
|
||||||
// ========================================================================
|
|
||||||
// FUNCTION 1: emax - Calculate theoretical maximum entropy
|
|
||||||
// ========================================================================
|
|
||||||
// Computes the maximum entropy of a k-mer of length lseq containing words of size word_size.
|
|
||||||
//
|
|
||||||
// Maximum entropy depends on the theoretical optimal word distribution:
|
|
||||||
// - If we have more positions (nw) than possible canonical words (na),
|
|
||||||
// some words will appear multiple times
|
|
||||||
// - We calculate the entropy of a distribution where all words appear
|
|
||||||
// cov or cov+1 times (most uniform distribution possible)
|
|
||||||
//
|
|
||||||
// IMPORTANT: Uses CanonicalCircularKmerCount to get the actual number of canonical words
|
|
||||||
// after circular normalization (e.g., "atg", "tga", "gat" → all "atg").
|
|
||||||
// This is much smaller than 4^word_size (e.g., 10 instead of 16 for word_size=2).
|
|
||||||
emax := func(lseq, word_size int) float64 {
|
|
||||||
nw := lseq - word_size + 1 // Number of words in a k-mer of length lseq
|
|
||||||
na := obikmer.CanonicalCircularKmerCount(word_size) // Number of canonical words after normalization
|
|
||||||
|
|
||||||
// Case 1: Fewer positions than possible words
|
|
||||||
// Maximum entropy is simply log(nw) since we can have at most nw different words
|
|
||||||
if nw < na {
|
|
||||||
return math.Log(float64(nw))
|
|
||||||
}
|
|
||||||
|
|
||||||
// Case 2: More positions than possible words
|
|
||||||
// Some words must appear multiple times
|
|
||||||
cov := nw / na // Average coverage (average number of occurrences per word)
|
|
||||||
remains := nw - (na * cov) // Number of words that will have one additional occurrence
|
|
||||||
|
|
||||||
// Calculate frequencies in the optimal distribution:
|
|
||||||
// - (na - remains) words appear cov times → frequency f1 = cov/nw
|
|
||||||
// - remains words appear (cov+1) times → frequency f2 = (cov+1)/nw
|
|
||||||
f1 := float64(cov) / float64(nw)
|
|
||||||
f2 := float64(cov+1) / float64(nw)
|
|
||||||
|
|
||||||
// Shannon entropy: H = -Σ p(i) * log(p(i))
|
|
||||||
// where p(i) is the probability of observing word i
|
|
||||||
return -(float64(na-remains)*f1*math.Log(f1) +
|
|
||||||
float64(remains)*f2*math.Log(f2))
|
|
||||||
}
|
|
||||||
|
|
||||||
// ========================================================================
|
|
||||||
// FUNCTION 2: maskAmbiguities - Mark positions containing ambiguities
|
|
||||||
// ========================================================================
|
|
||||||
// Identifies positions with ambiguous nucleotides (N, Y, R, etc.) and marks
|
|
||||||
// all k-mers that contain them.
|
|
||||||
//
|
|
||||||
// Returns: a slice where maskPositions[i] = -1 if position i is part of a
|
|
||||||
// k-mer containing an ambiguity, 0 otherwise
|
|
||||||
maskAmbiguities := func(sequence []byte) []int {
|
|
||||||
maskPositions := make([]int, len(sequence))
|
|
||||||
for i, nuc := range sequence {
|
|
||||||
// If nucleotide is not a, c, g or t (lowercase), it's an ambiguity
|
|
||||||
if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' {
|
|
||||||
// Mark all positions of k-mers that contain this nucleotide
|
|
||||||
// A k-mer starting at position (i - kmer_size + 1) will contain position i
|
|
||||||
end := max(0, i-kmer_size+1)
|
|
||||||
for j := i; j >= end; j-- {
|
|
||||||
maskPositions[j] = -1
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
return maskPositions
|
|
||||||
}
|
|
||||||
|
|
||||||
// ========================================================================
|
|
||||||
// FUNCTION 3: cleanTable - Reset a frequency table to zero
|
|
||||||
// ========================================================================
|
|
||||||
cleanTable := func(table []int, over int) {
|
|
||||||
for i := 0; i < over; i++ {
|
|
||||||
table[i] = 0
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ========================================================================
|
|
||||||
// FUNCTION 4: slidingMin - Calculate sliding minimum over a window
|
|
||||||
// ========================================================================
|
|
||||||
// Applies a sliding window of size window over data and replaces each
|
|
||||||
// value with the minimum in the window centered on that position.
|
|
||||||
//
|
|
||||||
// Uses a MinMultiset to efficiently maintain the minimum in the window.
|
|
||||||
slidingMin := func(data []float64, window int) {
|
|
||||||
minimier := obiutils.NewMinMultiset(func(a, b float64) bool { return a < b })
|
|
||||||
ldata := len(data)
|
|
||||||
mem := make([]float64, window) // Circular buffer to store window values
|
|
||||||
|
|
||||||
// Initialize buffer with sentinel value
|
|
||||||
for i := range mem {
|
|
||||||
mem[i] = 10000
|
|
||||||
}
|
|
||||||
|
|
||||||
for i, v := range data {
|
|
||||||
// Get the old value leaving the window
|
|
||||||
m := mem[i%window]
|
|
||||||
mem[i%window] = v
|
|
||||||
|
|
||||||
// Remove old value from multiset if it was valid
|
|
||||||
if m < 10000 {
|
|
||||||
minimier.RemoveOne(m)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Add new value if full window is ahead of us
|
|
||||||
if (ldata - i) >= window {
|
|
||||||
minimier.Add(v)
|
|
||||||
}
|
|
||||||
|
|
||||||
// log.Warnf("taille du minimier %d @ %d", minimier.Len(), i)
|
|
||||||
|
|
||||||
// Retrieve and store current minimum
|
|
||||||
var ok bool
|
|
||||||
if data[i], ok = minimier.Min(); !ok {
|
|
||||||
log.Error("problem with minimum entropy")
|
|
||||||
data[i] = 0.0
|
|
||||||
}
|
|
||||||
|
|
||||||
//xx, _ := minimier.Min()
|
|
||||||
//log.Warnf("Pos: %d n: %d min: %.3f -> %.3f", i, minimier.Len(), v, xx)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ========================================================================
|
|
||||||
// FUNCTION 5: computeEntropies - Calculate normalized entropy for each position
|
|
||||||
// ========================================================================
|
|
||||||
// This is the central function that calculates the entropy of each k-mer in the sequence
|
|
||||||
// at a given scale (wordSize).
|
|
||||||
//
|
|
||||||
// Algorithm:
|
|
||||||
// 1. Encode the sequence into words (subsequences of size wordSize)
|
|
||||||
// 2. For each k-mer, count the frequencies of words it contains
|
|
||||||
// 3. Calculate normalized entropy = observed_entropy / maximum_entropy
|
|
||||||
// 4. Apply a sliding min filter to smooth results
|
|
||||||
//
|
|
||||||
// IMPORTANT: Line 147 uses NormalizeInt for circular normalization of words!
|
|
||||||
// This means "atg", "tga", and "gat" are considered the same word.
|
|
||||||
computeEntropies := func(sequence []byte,
|
|
||||||
maskPositions []int, // Positions of ambiguities
|
|
||||||
entropies []float64, // Output: normalized entropies for each position
|
|
||||||
table []int, // Frequency table for words (reused between calls)
|
|
||||||
words []int, // Buffer to store encoded words (reused)
|
|
||||||
wordSize int) { // Word size (scale of analysis)
|
|
||||||
|
|
||||||
lseq := len(sequence) // Sequence length
|
|
||||||
tableSize := 1 << (wordSize * 2) // Actual table size (must fit all codes 0 to 4^wordSize-1)
|
|
||||||
nwords := kmer_size - wordSize + 1 // Number of words in a k-mer
|
|
||||||
float_nwords := float64(nwords)
|
|
||||||
log_nwords := math.Log(float_nwords) // log(nwords) used in entropy calculation
|
|
||||||
entropyMax := emax(kmer_size, wordSize) // Theoretical maximum entropy (uses CanonicalKmerCount internally)
|
|
||||||
|
|
||||||
// Reset frequency table (must clear entire table, not just nalpha entries)
|
|
||||||
cleanTable(table, tableSize)
|
|
||||||
|
|
||||||
for i := 1; i < lseq; i++ {
|
|
||||||
entropies[i] = 6
|
|
||||||
}
|
|
||||||
end := lseq - wordSize + 1 // Last position where a word can start
|
|
||||||
|
|
||||||
// ========================================================================
|
|
||||||
// STEP 1: Encode all words in the sequence
|
|
||||||
// ========================================================================
|
|
||||||
// Uses left-shift encoding: each nucleotide is encoded on 2 bits
|
|
||||||
// a=00, c=01, g=10, t=11
|
|
||||||
|
|
||||||
mask := (1 << (wordSize * 2)) - 1 // Mask to keep only last wordSize*2 bits
|
|
||||||
|
|
||||||
// Initialize first word (all nucleotides except the last one)
|
|
||||||
word_index := 0
|
|
||||||
for i := 0; i < wordSize-1; i++ {
|
|
||||||
word_index = (word_index << 2) + int(obikmer.EncodeNucleotide(sequence[i]))
|
|
||||||
}
|
|
||||||
|
|
||||||
// Encode all words with sliding window
|
|
||||||
for i, j := 0, wordSize-1; i < end; i, j = i+1, j+1 {
|
|
||||||
// Shift left by 2 bits, mask, and add new nucleotide
|
|
||||||
word_index = ((word_index << 2) & mask) + int(obikmer.EncodeNucleotide(sequence[j]))
|
|
||||||
|
|
||||||
// *** CIRCULAR NORMALIZATION ***
|
|
||||||
// Convert word to its canonical form (smallest by circular rotation)
|
|
||||||
// This is where "atg", "tga", "gat" all become "atg"
|
|
||||||
// Now using uint64-based NormalizeCircular for better performance
|
|
||||||
words[i] = int(obikmer.NormalizeCircular(uint64(word_index), wordSize))
|
|
||||||
}
|
|
||||||
|
|
||||||
// ========================================================================
|
|
||||||
// STEP 2: Calculate entropy for each k-mer with sliding window
|
|
||||||
// ========================================================================
|
|
||||||
s := 0 // Number of words processed in current k-mer
|
|
||||||
sum_n_logn := 0.0 // Sum of n*log(n) for entropy calculation
|
|
||||||
entropy := 1.0 // Current normalized entropy
|
|
||||||
cleaned := true // Flag indicating if table has been cleaned
|
|
||||||
|
|
||||||
for i := range end {
|
|
||||||
s++
|
|
||||||
|
|
||||||
switch {
|
|
||||||
// CASE 1: Filling phase (fewer than nwords words collected)
|
|
||||||
case s < nwords:
|
|
||||||
cleaned = false
|
|
||||||
table[words[i]]++ // Increment word frequency
|
|
||||||
|
|
||||||
// CASE 2: Position contains an ambiguity
|
|
||||||
case i >= (nwords-1) && maskPositions[i-nwords+1] < 0:
|
|
||||||
entropies[i-nwords+1] = 4.0 // Mark entropy as invalid
|
|
||||||
if !cleaned {
|
|
||||||
cleanTable(table, tableSize) // Reset table
|
|
||||||
}
|
|
||||||
cleaned = true
|
|
||||||
s = 0
|
|
||||||
sum_n_logn = 0.0
|
|
||||||
|
|
||||||
// CASE 3: First complete k-mer (s == nwords)
|
|
||||||
case s == nwords:
|
|
||||||
cleaned = false
|
|
||||||
table[words[i]]++
|
|
||||||
|
|
||||||
// Calculate Shannon entropy: H = -Σ p(i)*log(p(i))
|
|
||||||
// = log(N) - (1/N)*Σ n(i)*log(n(i))
|
|
||||||
// where N = nwords, n(i) = frequency of word i
|
|
||||||
//
|
|
||||||
// NOTE: We iterate over entire table (tableSize = 4^wordSize) to count all frequencies.
|
|
||||||
// Canonical codes are not contiguous (e.g., for k=2: {0,1,2,3,5,6,7,10,11,15})
|
|
||||||
// so we must scan the full table even though only ~10 entries will be non-zero
|
|
||||||
sum_n_logn = 0
|
|
||||||
for j := range tableSize {
|
|
||||||
n := float64(table[j])
|
|
||||||
if n > 0 {
|
|
||||||
sum_n_logn += n * math.Log(n)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
// Normalized entropy = observed entropy / maximum entropy
|
|
||||||
entropy = (log_nwords - sum_n_logn/float_nwords) / entropyMax
|
|
||||||
|
|
||||||
// CASE 4: Sliding window (s > nwords)
|
|
||||||
// Incremental update of entropy by adding a new word
|
|
||||||
// and removing the old one
|
|
||||||
case s > nwords:
|
|
||||||
cleaned = false
|
|
||||||
|
|
||||||
new_word := words[i]
|
|
||||||
old_word := words[i-nwords]
|
|
||||||
|
|
||||||
// Optimization: only recalculate if word changes
|
|
||||||
if old_word != new_word {
|
|
||||||
table[new_word]++
|
|
||||||
table[old_word]--
|
|
||||||
|
|
||||||
n_old := float64(table[old_word])
|
|
||||||
n_new := float64(table[new_word])
|
|
||||||
|
|
||||||
// Incremental update of sum_n_logn
|
|
||||||
// Remove contribution of old word (before decrement)
|
|
||||||
sum_n_logn -= (n_old + 1) * math.Log(n_old+1)
|
|
||||||
// Add contribution of old word (after decrement)
|
|
||||||
if n_old > 0 {
|
|
||||||
sum_n_logn += n_old * math.Log(n_old)
|
|
||||||
}
|
|
||||||
// Add contribution of new word (after increment)
|
|
||||||
if n_new > 0 {
|
|
||||||
sum_n_logn += n_new * math.Log(n_new)
|
|
||||||
}
|
|
||||||
// Remove contribution of new word (before increment)
|
|
||||||
if n_new > 1 {
|
|
||||||
sum_n_logn -= (n_new - 1) * math.Log(n_new-1)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
entropy = (log_nwords - sum_n_logn/float_nwords) / entropyMax
|
|
||||||
}
|
|
||||||
|
|
||||||
// Store entropy for position corresponding to start of k-mer
|
|
||||||
if s >= nwords && maskPositions[i-nwords+1] >= 0 {
|
|
||||||
if entropy < 0 {
|
|
||||||
entropy = 0
|
|
||||||
|
|
||||||
}
|
|
||||||
entropy = math.Round(entropy*10000) / 10000
|
|
||||||
entropies[i-nwords+1] = entropy
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ========================================================================
|
|
||||||
// STEP 3: Apply sliding min filter
|
|
||||||
// ========================================================================
|
|
||||||
// Replace each entropy with minimum in window of size kmer_size
|
|
||||||
// This allows robust detection of low-complexity regions
|
|
||||||
slidingMin(entropies, kmer_size)
|
|
||||||
// log.Warnf("%v\n%v", e, entropies)
|
|
||||||
}
|
|
||||||
|
|
||||||
// ========================================================================
|
|
||||||
// FUNCTION 6: applyMaskMode - Apply masking to sequence
|
|
||||||
// ========================================================================
|
|
||||||
applyMaskMode := func(sequence *obiseq.BioSequence, maskPositions []bool, mask byte) (obiseq.BioSequenceSlice, error) {
|
|
||||||
// Create copy to avoid modifying original
|
|
||||||
seqCopy := sequence.Copy()
|
|
||||||
sequenceBytes := seqCopy.Sequence()
|
|
||||||
|
|
||||||
// Mask identified positions
|
|
||||||
for i := range sequenceBytes {
|
|
||||||
if maskPositions[i] {
|
|
||||||
// Operation &^ 32 converts to UPPERCASE (clears bit 5)
|
|
||||||
// sequenceBytes[i] = sequenceBytes[i] &^ 32
|
|
||||||
sequenceBytes[i] = mask
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
return obiseq.BioSequenceSlice{seqCopy}, nil
|
|
||||||
}
|
|
||||||
|
|
||||||
selectMasked := func(sequence *obiseq.BioSequence, maskPosition []bool) (obiseq.BioSequenceSlice, error) {
|
|
||||||
rep := obiseq.NewBioSequenceSlice()
|
|
||||||
|
|
||||||
inlow := false
|
|
||||||
fromlow := -1
|
|
||||||
for i, masked := range maskPosition {
|
|
||||||
if masked && !inlow {
|
|
||||||
fromlow = i
|
|
||||||
inlow = true
|
|
||||||
}
|
|
||||||
if inlow && !masked {
|
|
||||||
if fromlow >= 0 {
|
|
||||||
frg, err := sequence.Subsequence(fromlow, i, false)
|
|
||||||
if err != nil {
|
|
||||||
return nil, err
|
|
||||||
}
|
|
||||||
rep.Push(frg)
|
|
||||||
}
|
|
||||||
inlow = false
|
|
||||||
fromlow = -1
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Handle the case where we end in a masked region
|
|
||||||
if inlow && fromlow >= 0 {
|
|
||||||
frg, err := sequence.Subsequence(fromlow, len(maskPosition), false)
|
|
||||||
if err != nil {
|
|
||||||
return nil, err
|
|
||||||
}
|
|
||||||
rep.Push(frg)
|
|
||||||
}
|
|
||||||
|
|
||||||
return *rep, nil
|
|
||||||
}
|
|
||||||
|
|
||||||
selectunmasked := func(sequence *obiseq.BioSequence, maskPosition []bool) (obiseq.BioSequenceSlice, error) {
|
|
||||||
rep := obiseq.NewBioSequenceSlice()
|
|
||||||
|
|
||||||
inhigh := false
|
|
||||||
fromhigh := -1
|
|
||||||
for i, masked := range maskPosition {
|
|
||||||
if !masked && !inhigh {
|
|
||||||
fromhigh = i
|
|
||||||
inhigh = true
|
|
||||||
}
|
|
||||||
if inhigh && masked {
|
|
||||||
if fromhigh >= 0 {
|
|
||||||
frg, err := sequence.Subsequence(fromhigh, i, false)
|
|
||||||
if err != nil {
|
|
||||||
return nil, err
|
|
||||||
}
|
|
||||||
rep.Push(frg)
|
|
||||||
}
|
|
||||||
inhigh = false
|
|
||||||
fromhigh = -1
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Handle the case where we end in an unmasked region
|
|
||||||
if inhigh && fromhigh >= 0 {
|
|
||||||
frg, err := sequence.Subsequence(fromhigh, len(maskPosition), false)
|
|
||||||
if err != nil {
|
|
||||||
return nil, err
|
|
||||||
}
|
|
||||||
rep.Push(frg)
|
|
||||||
}
|
|
||||||
|
|
||||||
return *rep, nil
|
|
||||||
}
|
|
||||||
|
|
||||||
// ========================================================================
|
|
||||||
// FUNCTION 7: masking - Main masking function
|
|
||||||
// ========================================================================
|
|
||||||
// Calculates entropies at all scales and masks positions
|
|
||||||
// whose minimum entropy is below the threshold.
|
|
||||||
masking := func(sequence *obiseq.BioSequence) (obiseq.BioSequenceSlice, error) {
|
|
||||||
if sequence.Len() < kmer_size {
|
|
||||||
sequence.SetAttribute("obilowmask_error", "Sequence too short")
|
|
||||||
remove := make([]bool, sequence.Len())
|
|
||||||
for i := range remove {
|
|
||||||
remove[i] = true
|
|
||||||
}
|
|
||||||
return applyMaskMode(sequence, remove, maskChar)
|
|
||||||
}
|
|
||||||
|
|
||||||
bseq := sequence.Sequence()
|
|
||||||
|
|
||||||
// Identify ambiguities
|
|
||||||
maskPositions := maskAmbiguities(bseq)
|
|
||||||
|
|
||||||
// Initialize data structures
|
|
||||||
mask := make([]int, len(bseq)) // Stores scale detecting minimum entropy
|
|
||||||
entropies := make([]float64, len(bseq)) // Minimum entropy at each position
|
|
||||||
for i := range entropies {
|
|
||||||
entropies[i] = 4.0 // Very high initial value
|
|
||||||
}
|
|
||||||
|
|
||||||
freqs := make([]int, 1<<(2*level_max)) // Frequency table (max size)
|
|
||||||
words := make([]int, len(bseq)) // Buffer for encoded words
|
|
||||||
|
|
||||||
// ========================================================================
|
|
||||||
// Calculate entropy at maximum scale (level_max)
|
|
||||||
// ========================================================================
|
|
||||||
computeEntropies(bseq, maskPositions, entropies, freqs, words, level_max)
|
|
||||||
|
|
||||||
// Initialize mask with level_max everywhere (except ambiguities)
|
|
||||||
for i := range bseq {
|
|
||||||
v := level_max
|
|
||||||
// if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' {
|
|
||||||
// v = 0
|
|
||||||
// }
|
|
||||||
mask[i] = v
|
|
||||||
}
|
|
||||||
|
|
||||||
// ========================================================================
|
|
||||||
// Calculate entropy at lower scales
|
|
||||||
// ========================================================================
|
|
||||||
entropies2 := make([]float64, len(bseq))
|
|
||||||
|
|
||||||
for ws := level_max - 1; ws > 0; ws-- {
|
|
||||||
// *** WARNING: POTENTIAL BUG ***
|
|
||||||
// The parameter passed is level_max instead of ws!
|
|
||||||
// This means we always recalculate with the same scale
|
|
||||||
// Should be: computeEntropies(bseq, maskPositions, entropies2, freqs, words, ws)
|
|
||||||
computeEntropies(bseq, maskPositions, entropies2, freqs, words, ws)
|
|
||||||
// Keep minimum entropy and corresponding scale
|
|
||||||
for i, e2 := range entropies2 {
|
|
||||||
if e2 < entropies[i] {
|
|
||||||
entropies[i] = e2
|
|
||||||
mask[i] = ws
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Force entropy to 0 for ambiguous positions
|
|
||||||
for i, nuc := range bseq {
|
|
||||||
if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' {
|
|
||||||
entropies[i] = 0
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ========================================================================
|
|
||||||
// Identify positions to mask
|
|
||||||
// ========================================================================
|
|
||||||
remove := make([]bool, len(entropies))
|
|
||||||
for i, e := range entropies {
|
|
||||||
remove[i] = e <= threshold
|
|
||||||
}
|
|
||||||
|
|
||||||
// Save metadata in sequence attributes
|
|
||||||
sequence.SetAttribute("mask", mask)
|
|
||||||
sequence.SetAttribute("Entropies", entropies)
|
|
||||||
|
|
||||||
switch mode {
|
|
||||||
case Mask:
|
|
||||||
return applyMaskMode(sequence, remove, maskChar)
|
|
||||||
case Split:
|
|
||||||
return selectunmasked(sequence, remove)
|
|
||||||
case Extract:
|
|
||||||
return selectMasked(sequence, remove)
|
|
||||||
}
|
|
||||||
return nil, fmt.Errorf("Unknown mode %d", mode)
|
|
||||||
}
|
|
||||||
|
|
||||||
return masking
|
|
||||||
}
|
|
||||||
|
|
||||||
// CLISequenceEntropyMasker creates an iterator that applies entropy masking
|
|
||||||
// to all sequences in an input iterator.
|
|
||||||
//
|
|
||||||
// Uses command-line parameters to configure the worker.
|
|
||||||
func CLISequenceEntropyMasker(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
|
||||||
var newIter obiiter.IBioSequence
|
|
||||||
|
|
||||||
worker := LowMaskWorker(
|
|
||||||
CLIKmerSize(),
|
|
||||||
CLILevelMax(),
|
|
||||||
CLIThreshold(),
|
|
||||||
CLIMaskingMode(),
|
|
||||||
CLIMaskingChar(),
|
|
||||||
)
|
|
||||||
|
|
||||||
// Apply worker in parallel
|
|
||||||
newIter = iterator.MakeIWorker(worker, false, obidefault.ParallelWorkers())
|
|
||||||
|
|
||||||
// Filter resulting empty sequences
|
|
||||||
return newIter.FilterEmpty()
|
|
||||||
}
|
|
||||||
@@ -1,81 +0,0 @@
|
|||||||
package obilowmask
|
|
||||||
|
|
||||||
import (
|
|
||||||
"strings"
|
|
||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
|
||||||
"github.com/DavidGamba/go-getoptions"
|
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
|
||||||
)
|
|
||||||
|
|
||||||
var __kmer_size__ = 31
|
|
||||||
var __level_max__ = 6
|
|
||||||
var __threshold__ = 0.5
|
|
||||||
var __split_mode__ = false
|
|
||||||
var __low_mode__ = false
|
|
||||||
var __mask__ = "."
|
|
||||||
|
|
||||||
func LowMaskOptionSet(options *getoptions.GetOpt) {
|
|
||||||
|
|
||||||
options.IntVar(&__kmer_size__, "kmer-size", __kmer_size__,
|
|
||||||
options.Description("Size of the kmer considered to estimate entropy."),
|
|
||||||
)
|
|
||||||
|
|
||||||
options.IntVar(&__level_max__, "entropy_size", __level_max__,
|
|
||||||
options.Description("Maximum word size considered for entropy estimate"),
|
|
||||||
)
|
|
||||||
|
|
||||||
options.Float64Var(&__threshold__, "threshold", __threshold__,
|
|
||||||
options.Description("entropy theshold used to mask a kmer"),
|
|
||||||
)
|
|
||||||
|
|
||||||
options.BoolVar(&__split_mode__, "split-mode", __split_mode__,
|
|
||||||
options.Description("in split mode, input sequences are splitted to remove masked regions"),
|
|
||||||
)
|
|
||||||
|
|
||||||
options.BoolVar(&__low_mode__, "low-mode", __low_mode__,
|
|
||||||
options.Description("in split mode, input sequences are splitted to remove masked regions"),
|
|
||||||
)
|
|
||||||
|
|
||||||
options.StringVar(&__mask__, "masking-char", __mask__,
|
|
||||||
options.Description("Character used to mask low complexity region"),
|
|
||||||
)
|
|
||||||
}
|
|
||||||
|
|
||||||
func OptionSet(options *getoptions.GetOpt) {
|
|
||||||
LowMaskOptionSet(options)
|
|
||||||
obiconvert.InputOptionSet(options)
|
|
||||||
obiconvert.OutputOptionSet(options)
|
|
||||||
}
|
|
||||||
|
|
||||||
func CLIKmerSize() int {
|
|
||||||
return __kmer_size__
|
|
||||||
}
|
|
||||||
|
|
||||||
func CLILevelMax() int {
|
|
||||||
return __level_max__
|
|
||||||
}
|
|
||||||
|
|
||||||
func CLIThreshold() float64 {
|
|
||||||
return __threshold__
|
|
||||||
}
|
|
||||||
|
|
||||||
func CLIMaskingMode() MaskingMode {
|
|
||||||
switch {
|
|
||||||
case __low_mode__:
|
|
||||||
return Extract
|
|
||||||
case __split_mode__:
|
|
||||||
return Split
|
|
||||||
default:
|
|
||||||
return Mask
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
func CLIMaskingChar() byte {
|
|
||||||
mask := strings.TrimSpace(__mask__)
|
|
||||||
if len(mask) != 1 {
|
|
||||||
log.Fatalf("--masking-char option accept a single character, not %s", mask)
|
|
||||||
}
|
|
||||||
return []byte(mask)[0]
|
|
||||||
}
|
|
||||||
@@ -207,16 +207,19 @@ func IndexFamilyDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
|||||||
|
|
||||||
log.Infof("Done. Found %d clusters", clusters.Len())
|
log.Infof("Done. Found %d clusters", clusters.Len())
|
||||||
|
|
||||||
pbopt := make([]progressbar.Option, 0, 5)
|
var bar *progressbar.ProgressBar
|
||||||
pbopt = append(pbopt,
|
if obidefault.ProgressBar() {
|
||||||
progressbar.OptionSetWriter(os.Stderr),
|
pbopt := make([]progressbar.Option, 0, 5)
|
||||||
progressbar.OptionSetWidth(15),
|
pbopt = append(pbopt,
|
||||||
progressbar.OptionShowCount(),
|
progressbar.OptionSetWriter(os.Stderr),
|
||||||
progressbar.OptionShowIts(),
|
progressbar.OptionSetWidth(15),
|
||||||
progressbar.OptionSetDescription("Cluster indexing"),
|
progressbar.OptionShowCount(),
|
||||||
)
|
progressbar.OptionShowIts(),
|
||||||
|
progressbar.OptionSetDescription("Cluster indexing"),
|
||||||
|
)
|
||||||
|
|
||||||
bar := progressbar.NewOptions(len(clusters), pbopt...)
|
bar = progressbar.NewOptions(len(clusters), pbopt...)
|
||||||
|
}
|
||||||
|
|
||||||
limits := make(chan [2]int)
|
limits := make(chan [2]int)
|
||||||
waiting := sync.WaitGroup{}
|
waiting := sync.WaitGroup{}
|
||||||
@@ -233,7 +236,9 @@ func IndexFamilyDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
|||||||
for i := l[0]; i < l[1]; i++ {
|
for i := l[0]; i < l[1]; i++ {
|
||||||
idx := IndexSequence(i, clusters, &kcluster, taxa, taxonomy)
|
idx := IndexSequence(i, clusters, &kcluster, taxa, taxonomy)
|
||||||
clusters[i].SetOBITagRefIndex(idx)
|
clusters[i].SetOBITagRefIndex(idx)
|
||||||
bar.Add(1)
|
if bar != nil {
|
||||||
|
bar.Add(1)
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -239,16 +239,19 @@ func IndexReferenceDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
|||||||
|
|
||||||
log.Info("done")
|
log.Info("done")
|
||||||
|
|
||||||
pbopt := make([]progressbar.Option, 0, 5)
|
var bar *progressbar.ProgressBar
|
||||||
pbopt = append(pbopt,
|
if obidefault.ProgressBar() {
|
||||||
progressbar.OptionSetWriter(os.Stderr),
|
pbopt := make([]progressbar.Option, 0, 5)
|
||||||
progressbar.OptionSetWidth(15),
|
pbopt = append(pbopt,
|
||||||
progressbar.OptionShowCount(),
|
progressbar.OptionSetWriter(os.Stderr),
|
||||||
progressbar.OptionShowIts(),
|
progressbar.OptionSetWidth(15),
|
||||||
progressbar.OptionSetDescription("[Sequence Processing]"),
|
progressbar.OptionShowCount(),
|
||||||
)
|
progressbar.OptionShowIts(),
|
||||||
|
progressbar.OptionSetDescription("[Sequence Processing]"),
|
||||||
|
)
|
||||||
|
|
||||||
bar := progressbar.NewOptions(len(references), pbopt...)
|
bar = progressbar.NewOptions(len(references), pbopt...)
|
||||||
|
}
|
||||||
|
|
||||||
limits := make(chan [2]int)
|
limits := make(chan [2]int)
|
||||||
indexed := obiiter.MakeIBioSequence()
|
indexed := obiiter.MakeIBioSequence()
|
||||||
@@ -267,7 +270,9 @@ func IndexReferenceDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
|||||||
iref := references[i].Copy()
|
iref := references[i].Copy()
|
||||||
iref.SetOBITagRefIndex(idx)
|
iref.SetOBITagRefIndex(idx)
|
||||||
sl = append(sl, iref)
|
sl = append(sl, iref)
|
||||||
bar.Add(1)
|
if bar != nil {
|
||||||
|
bar.Add(1)
|
||||||
|
}
|
||||||
}
|
}
|
||||||
indexed.Push(obiiter.MakeBioSequenceBatch(source, l[0]/10, sl))
|
indexed.Push(obiiter.MakeBioSequenceBatch(source, l[0]/10, sl))
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -1 +1 @@
|
|||||||
4.4.10
|
4.4.15
|
||||||
|
|||||||
Reference in New Issue
Block a user