Compare commits

..

24 Commits

Author SHA1 Message Date
Eric Coissac 578445f38a Release 4.4.45 2026-06-02 15:01:32 +02:00
Eric Coissac 2edb33ad08 fix: correct duplicated typos in GVal function names
Corrects duplicated typos in the registered GVal function names, changing "which_maxwhichmax" and "which_minwhichmin" to "which_max" and "which_min". The underlying obiutils.WhichMax/WhichMin logic and its int-to-float64 index conversion remain unchanged.
2026-06-02 15:00:48 +02:00
coissac b108d4978e Merge pull request #118 from metabarcoding/push-twztopkvxyop
Release 4.4.44
2026-06-02 14:42:00 +02:00
Eric Coissac e9210e28a3 Release 4.4.44 2026-06-02 14:40:09 +02:00
Eric Coissac 13a93fce11 feat: add which_max and which_min to retrieve extreme element indices
Implement reflection-based WhichMax and WhichMin to dynamically find the index or key of the maximum/minimum element in slices, arrays, or maps. Functions validate orderability, handle empty collections, and dispatch via reflect.Kind. Expose as which_max and which_min GVal functions, with float64 type assertions for compatibility and preserved error handling.
2026-06-02 14:39:31 +02:00
Eric Coissac 14064c919e fix(obiutils): correctly unwrap interface values in min/max
Introduces an `unwrapInterface` reflection helper to dereference `interface{}`-wrapped values before type validation. Updates slice and map iteration loops in min/max functions to apply this helper, ensuring `isOrderedKind` accurately identifies underlying concrete types instead of incorrectly rejecting `reflect.Interface` elements.
2026-06-02 14:34:00 +02:00
coissac 1dfd68aa6d Merge pull request #117 from metabarcoding/push-wvlmzvomslzv
Release 4.4.43
2026-06-01 14:14:40 +02:00
Eric Coissac 930fe5f1ba Release 4.4.43 2026-06-01 13:22:58 +02:00
Eric Coissac dcdaf9e372 feat: support map and slice types in OBI attributes
Extends OBI header parsing to recognize and deserialize JSON-like arrays and objects. Introduces safe conversion utilities in `obiutils` to cast generic interface values into typed maps, and exposes them via new `BioSequence` methods. Header values are now marshaled, quote-normalized, and formatted for map and slice types.
2026-06-01 13:21:11 +02:00
Eric Coissac af7ae3d60c Correct Shannon entropy bias for canonical k-mers
Multiple raw k-mers collapsing into identical circular canonical forms introduce bias into complexity estimates. This change pre-computes `log(class_size)` tables and per-word-size maximum entropy bounds. The `KmerEntropy` function and `KmerEntropyFilter` are updated to apply the corrected formula `(log(N) + Σf·log(s) - Σf·log(f))/N / emax`, ensuring accurate sequence complexity estimation.
2026-05-17 14:54:57 +08:00
Eric Coissac cecf90fa40 feat: add min/max filtering and saturating subtraction utilities
Introduce generic and reflection-based utilities for filtering slices and maps by minimum/maximum thresholds, along with saturating subtraction. The `obiutils` package provides type-safe generic implementations alongside dynamic reflection dispatchers to handle arbitrary ordered and numeric types. These are exposed as GVAL expression functions in `obiseq`, extending the language's built-in filtering and numeric capabilities.
2026-05-14 20:58:24 +08:00
Eric Coissac a186bd1c92 fix: validate non-empty sequence IDs in FASTA and FASTQ writers
Adds a pre-processing guard that checks for empty sequence identifiers before formatting. This prevents malformed FASTA output and stops downstream processing of invalid FASTQ data by terminating early. The check is placed before existing sequence-length validations to enforce non-empty IDs during batch processing.
2026-05-05 18:07:58 +02:00
coissac 46d60c1a44 Merge pull request #115 from metabarcoding/push-lkzqoskvyqtr
[4.4.2] Enhanced taxonomy handling, input robustness & PCR tag validation
2026-04-30 16:59:49 +02:00
Eric Coissac 6c4a6c697c [4.4.2] Enhanced taxonomy handling, input robustness & PCR tag validation
- **obiconvert**: Added `--raw-taxid` mode to output numeric taxIDs without formatting (e.g., "12345" instead of ":tax:NCBI_0987@species"). Introduced `TaxNode.FullString()` to reliably return full formatted strings regardless of global settings, and improved fallback behavior when taxonomy DB is unavailable.
- **ngsfilter**: Input fields (primers, sample tags/IDs) are now automatically trimmed of leading/trailing whitespace to prevent parsing failures from inconsistent formatting.
- **obitools (pcrtag)**: Mismatch-related fields (`forward_mismatches`, `reverse_mishaps`) renamed to "error" for consistency across annotation dictionaries.
- **obipairing & obtagpcr**: Enforced mandatory paired-end file input (`--forward` and `reverse`) in obipairing; added CLI support for generating config templates via AskConfigTemplate(); removed redundant `Required()` constraints and introduced helper function CLIHasPairedFiles().
2026-04-30 16:57:45 +02:00
Eric Coissac 60b3753673 feat(obiconvert): add --raw-taxid option and refactor taxID formatting
- Add new `--tax-id` mode (`obiconvert --raw-taxid`) to output bare numeric taxIDs instead of full-format strings.
- Introduce `TaxNode.FullString()` to always return the complete "code:id [name]@rank" format, regardless of global `UseRawTaxids()` setting.
- Update `.String(taxonomyCode)` to respect the global flag, returning bare ID when `--raw-taxid` is active.
- Extract raw taxID from full-format strings in taxonomy methods when needed (e.g., fallback without loaded DB).
- Add comprehensive test suite covering:
a) `--raw-taxid` execution and idempotency
b) full-format taxID output with `--taxonomy`
c interaction of both flags
d format validation
- Add test data: new reference files `out_ecotag.fasta`, taxonomy.csv, and updated shell script.
2026-04-30 16:57:38 +02:00
Eric Coissac 14e2840a2d [ngsfilter] Trim whitespace from primer and sample fields
Trim leading/trailing whitespaces in forward/reverse primers, tags (via sample_tag), experiment andsample fields to prevent parsing errors due to formatting inconsistencies in input data.
2026-04-30 08:14:39 +02:00
Eric Coissac 42910c7db9 🔧 Rename mismatch fields to error in pcrtag.go
- Renamed `obimultiplex_forward_mismatches` to "error" for consistency
- Similarly renamed 
  `obimultiplex_reverse_mismatches` to "error"
- Applied changes in both annotation dictionaries (aanot, banot)
2026-04-29 15:29:25 +02:00
Eric Coissac 8b4cf677c6 [obitools] Add validation for paired files and config template support
- Enforce requirement of both forward (-F) and reverse files in obipairing/main.go
- Add config template support to obtagpcr via CLIAskConfigTemplate()
- Remove redundant Required() constraints in options.go
- Introduce new helper CLIHasPairedFiles()
2026-04-29 15:01:37 +02:00
coissac 02765f154f Merge pull request #113 from metabarcoding/push-oxowomxlnlnx
Push oxowomxlnlnx
2026-04-16 15:04:55 +02:00
Eric Coissac 449544bd63 [obiseq] Quality validation and new map_summaries aggregation
- Added strict length matching between sequences and quality scores in `SetQualities`, `Take Qualites` (note: likely intended as " TakeQuantiles" or similar, but preserved per commit), and `Subsequence` operations; an error is now raised if lengths do not match.
- Introduced a new `map_summaries` aggregation feature in obisummary to merge map summary data across datasets, supporting safe concurrent access and inclusion of non-empty results in the final output.
- Centralized string reversal logic via a new `inverser_chaine()` utility function, replacing duplicated inline implementations throughout the codebase.
2026-04-16 14:58:23 +02:00
Eric Coissac 434d2e5930 +feat: add support for map_summaries aggregation in obisummary
- Implement merging logic of `map summaries` across datasets
  - Ensure proper initialization and population in multi-threaded context
- Add `map_summaries` to final output dictionary when non-empty
2026-04-16 14:58:18 +02:00
Eric Coissac 7cb02ded69 Refactor: Extract utility function for string reversal
- Introduce `inverser_chaine()` helper to centralize logic
 - Replace inline reverse implementations across modules
2026-04-16 13:42:51 +02:00
Eric Coissac 6d469bd711 [obiseq] Add length validation for qualities in SetQualities, Take Qualites and Subsequence
[obiseq] Add length validation for qualities in SetQualities, Take Qualites and Subsequence
- Panic if sequence/qualities length mismatch when setting or taking qualities in BioSequence.
 - Add same check before slicing Qualities() for Subsequence to ensure consistency.
2026-04-15 18:20:53 +02:00
coissac 3d8e4a3a4e Merge pull request #112 from metabarcoding/push-yvqvqrxyktoz
Push yvqvqrxyktoz
2026-04-14 14:49:08 +02:00
28 changed files with 996 additions and 120 deletions
+5
View File
@@ -37,6 +37,11 @@ func main() {
optionParser(os.Args)
if !obipairing.CLIHasPairedFiles() {
log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
os.Exit(1)
}
obidefault.SetStrictReadWorker(2)
obidefault.SetStrictWriteWorker(2)
pairs, err := obipairing.CLIPairedSequence()
+13
View File
@@ -1,6 +1,7 @@
package main
import (
"fmt"
"os"
log "github.com/sirupsen/logrus"
@@ -8,6 +9,7 @@ import (
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obimultiplex"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipairing"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitagpcr"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
@@ -39,6 +41,17 @@ func main() {
obitagpcr.OptionSet)
optionParser(os.Args)
if obimultiplex.CLIAskConfigTemplate() {
fmt.Print(obimultiplex.CLIConfigTemplate())
os.Exit(0)
}
if !obipairing.CLIHasPairedFiles() {
log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
os.Exit(1)
}
pairs, err := obipairing.CLIPairedSequence()
if err != nil {
@@ -0,0 +1,24 @@
>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
gattaaacctcaaaggacttggcagtgctttatacccct
>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
+48
View File
@@ -0,0 +1,48 @@
taxid,parent,taxonomic_rank,scientific_name
taxon:1 [root]@no rank,taxon:1 [root]@no rank,no rank,root
taxon:131567 [cellular organisms]@cellular root,taxon:1 [root]@no rank,cellular root,cellular organisms
taxon:2759 [Eukaryota]@domain,taxon:131567 [cellular organisms]@cellular root,domain,Eukaryota
taxon:33154 [Opisthokonta]@clade,taxon:2759 [Eukaryota]@domain,clade,Opisthokonta
taxon:33208 [Metazoa]@kingdom,taxon:33154 [Opisthokonta]@clade,kingdom,Metazoa
taxon:6072 [Eumetazoa]@clade,taxon:33208 [Metazoa]@kingdom,clade,Eumetazoa
taxon:33213 [Bilateria]@clade,taxon:6072 [Eumetazoa]@clade,clade,Bilateria
taxon:33511 [Deuterostomia]@clade,taxon:33213 [Bilateria]@clade,clade,Deuterostomia
taxon:7711 [Chordata]@phylum,taxon:33511 [Deuterostomia]@clade,phylum,Chordata
taxon:89593 [Craniata]@subphylum,taxon:7711 [Chordata]@phylum,subphylum,Craniata
taxon:7742 [Vertebrata]@clade,taxon:89593 [Craniata]@subphylum,clade,Vertebrata
taxon:7776 [Gnathostomata]@clade,taxon:7742 [Vertebrata]@clade,clade,Gnathostomata
taxon:117570 [Teleostomi]@clade,taxon:7776 [Gnathostomata]@clade,clade,Teleostomi
taxon:117571 [Euteleostomi]@clade,taxon:117570 [Teleostomi]@clade,clade,Euteleostomi
taxon:8287 [Sarcopterygii]@superclass,taxon:117571 [Euteleostomi]@clade,superclass,Sarcopterygii
taxon:1338369 [Dipnotetrapodomorpha]@clade,taxon:8287 [Sarcopterygii]@superclass,clade,Dipnotetrapodomorpha
taxon:32523 [Tetrapoda]@clade,taxon:1338369 [Dipnotetrapodomorpha]@clade,clade,Tetrapoda
taxon:32524 [Amniota]@clade,taxon:32523 [Tetrapoda]@clade,clade,Amniota
taxon:40674 [Mammalia]@class,taxon:32524 [Amniota]@clade,class,Mammalia
taxon:32525 [Theria]@clade,taxon:40674 [Mammalia]@class,clade,Theria
taxon:9347 [Eutheria]@clade,taxon:32525 [Theria]@clade,clade,Eutheria
taxon:1437010 [Boreoeutheria]@clade,taxon:9347 [Eutheria]@clade,clade,Boreoeutheria
taxon:314146 [Euarchontoglires]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Euarchontoglires
taxon:314145 [Laurasiatheria]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Laurasiatheria
taxon:33554 [Carnivora]@order,taxon:314145 [Laurasiatheria]@superorder,order,Carnivora
taxon:91561 [Artiodactyla]@order,taxon:314145 [Laurasiatheria]@superorder,order,Artiodactyla
taxon:314147 [Glires]@clade,taxon:314146 [Euarchontoglires]@superorder,clade,Glires
taxon:9845 [Ruminantia]@suborder,taxon:91561 [Artiodactyla]@order,suborder,Ruminantia
taxon:35500 [Pecora]@infraorder,taxon:9845 [Ruminantia]@suborder,infraorder,Pecora
taxon:9989 [Rodentia]@order,taxon:314147 [Glires]@clade,order,Rodentia
taxon:379584 [Caniformia]@suborder,taxon:33554 [Carnivora]@order,suborder,Caniformia
taxon:9608 [Canidae]@family,taxon:379584 [Caniformia]@suborder,family,Canidae
taxon:9850 [Cervidae]@family,taxon:35500 [Pecora]@infraorder,family,Cervidae
taxon:9881 [Odocoileinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Odocoileinae
taxon:33553 [Sciuromorpha]@suborder,taxon:9989 [Rodentia]@order,suborder,Sciuromorpha
taxon:55153 [Sciuridae]@family,taxon:33553 [Sciuromorpha]@suborder,family,Sciuridae
taxon:34878 [Cervinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Cervinae
taxon:9611 [Canis]@genus,taxon:9608 [Canidae]@family,genus,Canis
taxon:9857 [Capreolus]@genus,taxon:9881 [Odocoileinae]@subfamily,genus,Capreolus
taxon:9612 [Canis lupus]@species,taxon:9611 [Canis]@genus,species,Canis lupus
taxon:337726 [Xerinae]@subfamily,taxon:55153 [Sciuridae]@family,subfamily,Xerinae
taxon:9859 [Cervus]@genus,taxon:34878 [Cervinae]@subfamily,genus,Cervus
taxon:337730 [Marmotini]@tribe,taxon:337726 [Xerinae]@subfamily,tribe,Marmotini
taxon:9992 [Marmota]@genus,taxon:337730 [Marmotini]@tribe,genus,Marmota
taxon:9860 [Cervus elaphus]@species,taxon:9859 [Cervus]@genus,species,Cervus elaphus
taxon:9615 [Canis lupus familiaris]@subspecies,taxon:9612 [Canis lupus]@species,subspecies,Canis lupus familiaris
taxon:9858 [Capreolus capreolus]@species,taxon:9857 [Capreolus]@genus,species,Capreolus capreolus
1 taxid parent taxonomic_rank scientific_name
2 taxon:1 [root]@no rank taxon:1 [root]@no rank no rank root
3 taxon:131567 [cellular organisms]@cellular root taxon:1 [root]@no rank cellular root cellular organisms
4 taxon:2759 [Eukaryota]@domain taxon:131567 [cellular organisms]@cellular root domain Eukaryota
5 taxon:33154 [Opisthokonta]@clade taxon:2759 [Eukaryota]@domain clade Opisthokonta
6 taxon:33208 [Metazoa]@kingdom taxon:33154 [Opisthokonta]@clade kingdom Metazoa
7 taxon:6072 [Eumetazoa]@clade taxon:33208 [Metazoa]@kingdom clade Eumetazoa
8 taxon:33213 [Bilateria]@clade taxon:6072 [Eumetazoa]@clade clade Bilateria
9 taxon:33511 [Deuterostomia]@clade taxon:33213 [Bilateria]@clade clade Deuterostomia
10 taxon:7711 [Chordata]@phylum taxon:33511 [Deuterostomia]@clade phylum Chordata
11 taxon:89593 [Craniata]@subphylum taxon:7711 [Chordata]@phylum subphylum Craniata
12 taxon:7742 [Vertebrata]@clade taxon:89593 [Craniata]@subphylum clade Vertebrata
13 taxon:7776 [Gnathostomata]@clade taxon:7742 [Vertebrata]@clade clade Gnathostomata
14 taxon:117570 [Teleostomi]@clade taxon:7776 [Gnathostomata]@clade clade Teleostomi
15 taxon:117571 [Euteleostomi]@clade taxon:117570 [Teleostomi]@clade clade Euteleostomi
16 taxon:8287 [Sarcopterygii]@superclass taxon:117571 [Euteleostomi]@clade superclass Sarcopterygii
17 taxon:1338369 [Dipnotetrapodomorpha]@clade taxon:8287 [Sarcopterygii]@superclass clade Dipnotetrapodomorpha
18 taxon:32523 [Tetrapoda]@clade taxon:1338369 [Dipnotetrapodomorpha]@clade clade Tetrapoda
19 taxon:32524 [Amniota]@clade taxon:32523 [Tetrapoda]@clade clade Amniota
20 taxon:40674 [Mammalia]@class taxon:32524 [Amniota]@clade class Mammalia
21 taxon:32525 [Theria]@clade taxon:40674 [Mammalia]@class clade Theria
22 taxon:9347 [Eutheria]@clade taxon:32525 [Theria]@clade clade Eutheria
23 taxon:1437010 [Boreoeutheria]@clade taxon:9347 [Eutheria]@clade clade Boreoeutheria
24 taxon:314146 [Euarchontoglires]@superorder taxon:1437010 [Boreoeutheria]@clade superorder Euarchontoglires
25 taxon:314145 [Laurasiatheria]@superorder taxon:1437010 [Boreoeutheria]@clade superorder Laurasiatheria
26 taxon:33554 [Carnivora]@order taxon:314145 [Laurasiatheria]@superorder order Carnivora
27 taxon:91561 [Artiodactyla]@order taxon:314145 [Laurasiatheria]@superorder order Artiodactyla
28 taxon:314147 [Glires]@clade taxon:314146 [Euarchontoglires]@superorder clade Glires
29 taxon:9845 [Ruminantia]@suborder taxon:91561 [Artiodactyla]@order suborder Ruminantia
30 taxon:35500 [Pecora]@infraorder taxon:9845 [Ruminantia]@suborder infraorder Pecora
31 taxon:9989 [Rodentia]@order taxon:314147 [Glires]@clade order Rodentia
32 taxon:379584 [Caniformia]@suborder taxon:33554 [Carnivora]@order suborder Caniformia
33 taxon:9608 [Canidae]@family taxon:379584 [Caniformia]@suborder family Canidae
34 taxon:9850 [Cervidae]@family taxon:35500 [Pecora]@infraorder family Cervidae
35 taxon:9881 [Odocoileinae]@subfamily taxon:9850 [Cervidae]@family subfamily Odocoileinae
36 taxon:33553 [Sciuromorpha]@suborder taxon:9989 [Rodentia]@order suborder Sciuromorpha
37 taxon:55153 [Sciuridae]@family taxon:33553 [Sciuromorpha]@suborder family Sciuridae
38 taxon:34878 [Cervinae]@subfamily taxon:9850 [Cervidae]@family subfamily Cervinae
39 taxon:9611 [Canis]@genus taxon:9608 [Canidae]@family genus Canis
40 taxon:9857 [Capreolus]@genus taxon:9881 [Odocoileinae]@subfamily genus Capreolus
41 taxon:9612 [Canis lupus]@species taxon:9611 [Canis]@genus species Canis lupus
42 taxon:337726 [Xerinae]@subfamily taxon:55153 [Sciuridae]@family subfamily Xerinae
43 taxon:9859 [Cervus]@genus taxon:34878 [Cervinae]@subfamily genus Cervus
44 taxon:337730 [Marmotini]@tribe taxon:337726 [Xerinae]@subfamily tribe Marmotini
45 taxon:9992 [Marmota]@genus taxon:337730 [Marmotini]@tribe genus Marmota
46 taxon:9860 [Cervus elaphus]@species taxon:9859 [Cervus]@genus species Cervus elaphus
47 taxon:9615 [Canis lupus familiaris]@subspecies taxon:9612 [Canis lupus]@species subspecies Canis lupus familiaris
48 taxon:9858 [Capreolus capreolus]@species taxon:9857 [Capreolus]@genus species Capreolus capreolus
+124
View File
@@ -134,6 +134,130 @@ else
((failed++))
fi
# ------------------------------------------------------------------
# --raw-taxid tests (no taxonomy loaded)
# ------------------------------------------------------------------
# Running test
((ntest++))
if obiconvert --raw-taxid "${TEST_DIR}/out_ecotag.fasta" \
> "${TMPDIR}/raw_taxid.fasta" 2>/dev/null
then
log "$MCMD --raw-taxid: running OK"
((success++))
else
log "$MCMD --raw-taxid: running failed"
((failed++))
fi
# Taxids must be bare numbers — no full-format "taxon:ID [Name]@rank" strings
((ntest++))
if grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
then
log "$MCMD --raw-taxid: taxid format check failed (full-format taxid found)"
((failed++))
else
log "$MCMD --raw-taxid: taxid format OK (all taxids are bare numbers)"
((success++))
fi
# --raw-taxid is idempotent: piping through a second obiconvert --raw-taxid must
# produce bit-for-bit identical output.
((ntest++))
if obiconvert --raw-taxid "${TMPDIR}/raw_taxid.fasta" \
> "${TMPDIR}/raw_taxid2.fasta" 2>/dev/null
then
log "$MCMD --raw-taxid piped: running OK"
((success++))
else
log "$MCMD --raw-taxid piped: running failed"
((failed++))
fi
((ntest++))
if diff "${TMPDIR}/raw_taxid.fasta" \
"${TMPDIR}/raw_taxid2.fasta" > /dev/null
then
log "$MCMD --raw-taxid piped: idempotency OK"
((success++))
else
log "$MCMD --raw-taxid piped: idempotency failed (outputs differ)"
((failed++))
fi
# ------------------------------------------------------------------
# --taxonomy tests (full-format taxid, no --raw-taxid)
# ------------------------------------------------------------------
# Running test
((ntest++))
if obiconvert --taxonomy "${TEST_DIR}/taxonomy.csv" \
"${TEST_DIR}/out_ecotag.fasta" \
> "${TMPDIR}/taxo.fasta" 2>/dev/null
then
log "$MCMD --taxonomy: running OK"
((success++))
else
log "$MCMD --taxonomy: running failed"
((failed++))
fi
# Taxids must be in full "taxon:ID [Name]@rank" format
((ntest++))
if grep '"taxid"' "${TMPDIR}/taxo.fasta" | grep -q '"taxid":"taxon:[0-9]'
then
log "$MCMD --taxonomy: taxid format OK (full-format taxids present)"
((success++))
else
log "$MCMD --taxonomy: taxid format check failed (no full-format taxid found)"
((failed++))
fi
# ------------------------------------------------------------------
# --raw-taxid --taxonomy tests
# ------------------------------------------------------------------
# Running test
((ntest++))
if obiconvert --raw-taxid --taxonomy "${TEST_DIR}/taxonomy.csv" \
"${TEST_DIR}/out_ecotag.fasta" \
> "${TMPDIR}/raw_taxid_taxo.fasta" 2>/dev/null
then
log "$MCMD --raw-taxid --taxonomy: running OK"
((success++))
else
log "$MCMD --raw-taxid --taxonomy: running failed"
((failed++))
fi
# Taxids must be bare numbers even when taxonomy is loaded
((ntest++))
if grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
then
log "$MCMD --raw-taxid --taxonomy: taxid format check failed (full-format taxid found)"
((failed++))
else
log "$MCMD --raw-taxid --taxonomy: taxid format OK (all taxids are bare numbers)"
((success++))
fi
# --raw-taxid with or without taxonomy must yield identical taxid values
((ntest++))
if diff <(grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
<(grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
> /dev/null
then
log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values match OK"
((success++))
else
log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values differ (unexpected)"
((failed++))
fi
#########################################
#
# At the end of the tests
+24
View File
@@ -0,0 +1,24 @@
>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
gattaaacctcaaaggacttggcagtgctttatacccct
>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
+87 -12
View File
@@ -146,6 +146,65 @@ func __match__key__(text []byte) []int {
return []int{} // Not a key
}
func __match__array__(text []byte) []int {
state := 0
level := 0
start := 0
instring := byte(0)
for i, r := range text {
if state == 2 {
if r == ';' {
return []int{start, i + 1}
}
if r != ' ' && r != '\t' {
return []int{}
}
}
if state == 0 {
if r == '[' {
level++
state++
start = i
continue
}
if r != ' ' && r != '\t' {
return []int{}
}
continue
}
// state == 1: inside the array
if instring != 0 {
if r == instring {
instring = 0
}
continue
}
if r == '"' || r == '\'' {
instring = r
continue
}
if r == '[' || r == '{' {
level++
continue
}
if r == ']' || r == '}' {
level--
if level == 0 {
state++
}
}
}
return []int{}
}
func __match__general__(text []byte) []int {
for i, r := range text {
@@ -242,6 +301,21 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
stop = m[1] + 1
} else {
// array value
m = __match__array__(part)
if len(m) > 0 {
bvalue = bytes.TrimSpace(part[m[0]:(m[1] - 1)])
j := bytes.ReplaceAll(bvalue, []byte("'"), []byte(`"`))
j = __obi_header_map_int_key__.ReplaceAll(j, []byte(`$1"$2":`))
arr, err := _parse_json_array_interface(j)
if err != nil {
value = string(bvalue)
} else {
value = arr
}
stop = m[1] + 1
} else {
// Generic value
// m = __obi_header_value_general_pattern__.FindIndex(part)
@@ -264,6 +338,7 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
// no value
break
} // End of No value
} // End of not array
} // End of not dict
} // End of not string
} // End of not numeric
@@ -327,19 +402,19 @@ func WriteFastSeqOBIHeade(buffer *bytes.Buffer, sequence *obiseq.BioSequence) {
buffer.WriteString(fmt.Sprintf("%s=", key))
buffer.Write(tv)
buffer.WriteString("; ")
case map[string]int,
map[string]string,
map[string]interface{}:
tv, err := obiutils.JsonMarshal(t)
if err != nil {
log.Fatalf("Cannot convert %v value", value)
}
tv = bytes.ReplaceAll(tv, []byte(`"`), []byte("'"))
buffer.WriteString(fmt.Sprintf("%s=", key))
buffer.Write(tv)
buffer.WriteString("; ")
default:
buffer.WriteString(fmt.Sprintf("%s=%v; ", key, value))
if obiutils.IsAMap(value) || obiutils.IsASlice(value) || obiutils.IsAnArray(value) {
tv, err := obiutils.JsonMarshal(t)
if err != nil {
log.Fatalf("Cannot convert %v value", value)
}
tv = bytes.ReplaceAll(tv, []byte(`"`), []byte("'"))
buffer.WriteString(fmt.Sprintf("%s=", key))
buffer.Write(tv)
buffer.WriteString("; ")
} else {
buffer.WriteString(fmt.Sprintf("%s=%v; ", key, value))
}
}
}
}
+3
View File
@@ -90,6 +90,9 @@ func FormatFastaBatch(batch obiiter.BioSequenceBatch, formater FormatHeader, ski
log.Debugf("FormatFastaBatch: #%d : %d seqs", batch.Order(), batch.Len())
for _, seq := range batch.Slice() {
if len(seq.Id()) == 0 {
log.Fatalf("Sequence identifier is empty")
}
if seq.Len() > 0 {
// Write header directly into bs — no intermediate string
bs.WriteByte('>')
+3
View File
@@ -64,6 +64,9 @@ func FormatFastqBatch(batch obiiter.BioSequenceBatch,
first := true
for _, seq := range batch.Slice() {
if len(seq.Id()) == 0 {
log.Fatalf("Sequence identifier is empty")
}
if seq.Len() > 0 {
_formatFastq(&bs, seq, formater)
+5 -5
View File
@@ -631,9 +631,9 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
return nil, fmt.Errorf("row %d has %d columns, expected %d", len(data), len(fields), len(header))
}
forward_primer := fields[forward_primerColIndex]
reverse_primer := fields[reverse_primerColIndex]
tags := _parseMainNGSFilterTags(fields[sample_tagColIndex])
forward_primer := strings.TrimSpace(fields[forward_primerColIndex])
reverse_primer := strings.TrimSpace(fields[reverse_primerColIndex])
tags := _parseMainNGSFilterTags(strings.TrimSpace(fields[sample_tagColIndex]))
marker, _ := ngsfilter.GetMarker(forward_primer, reverse_primer)
pcr, ok := marker.GetPCR(tags.Forward, tags.Reverse)
@@ -644,8 +644,8 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
i, tags.Forward, tags.Reverse, forward_primer, reverse_primer)
}
pcr.Experiment = fields[experimentColIndex]
pcr.Sample = fields[sampleColIndex]
pcr.Experiment = strings.TrimSpace(fields[experimentColIndex])
pcr.Sample = strings.TrimSpace(fields[sampleColIndex])
if extraColumns != nil {
pcr.Annotations = make(obiseq.Annotation)
+90 -55
View File
@@ -4,22 +4,21 @@ import "math"
// KmerEntropy computes the entropy of a single encoded k-mer.
//
// The algorithm mirrors the lowmask entropy calculation: it decodes the k-mer
// The algorithm mirrors the Rust obiskbuilder entropy: it decodes the k-mer
// to a DNA sequence, extracts all sub-words of each size from 1 to levelMax,
// normalizes them by circular canonical form, counts their frequencies, and
// computes Shannon entropy normalized by the maximum possible entropy.
// computes Shannon entropy corrected for class sizes, normalized by the
// maximum possible entropy over 4^ws raw bins.
// The returned value is the minimum entropy across all word sizes.
//
// Correction for small sequences: the raw entropy H = log(N) - Σ f·log(f)/N
// under-estimates the true complexity when many raw words collapse to the same
// canonical form. Adding Σ f·log(class_size)/N recovers the entropy of the
// underlying uncollapsed distribution (assuming uniform mixing within each
// equivalence class).
//
// A value close to 0 indicates very low complexity (e.g. "AAAA..."),
// while a value close to 1 indicates high complexity.
//
// Parameters:
// - kmer: the encoded k-mer (2 bits per base)
// - k: the k-mer size
// - levelMax: maximum sub-word size for entropy (typically 6)
//
// Returns:
// - minimum normalized entropy across all word sizes 1..levelMax
func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
if k < 1 || levelMax < 1 {
return 1.0
@@ -35,7 +34,7 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
var seqBuf [32]byte
seq := DecodeKmer(kmer, k, seqBuf[:])
// Pre-compute nLogN lookup (same as lowmask)
// Pre-compute nLogN lookup
nLogN := make([]float64, k+1)
for i := 1; i <= k; i++ {
nLogN[i] = float64(i) * math.Log(float64(i))
@@ -51,6 +50,23 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
}
}
// Build ln(class_size) tables: for each canonical form, how many raw
// words map to it under circular normalization.
classLogSizeTables := make([][]float64, levelMax+1)
for ws := 1; ws <= levelMax; ws++ {
tableSize := 1 << (ws * 2)
classSize := make([]int, tableSize)
for code := 0; code < tableSize; code++ {
classSize[normTables[ws][code]]++
}
classLogSizeTables[ws] = make([]float64, tableSize)
for j := 0; j < tableSize; j++ {
if classSize[j] > 0 {
classLogSizeTables[ws][j] = math.Log(float64(classSize[j]))
}
}
}
minEntropy := math.MaxFloat64
for ws := 1; ws <= levelMax; ws++ {
@@ -75,23 +91,13 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
table[normWord]++
}
// Compute Shannon entropy
// Compute emax over 4^ws raw bins (uncollapsed distribution).
floatNwords := float64(nwords)
logNwords := math.Log(floatNwords)
var sumNLogN float64
for j := 0; j < tableSize; j++ {
n := table[j]
if n > 0 {
sumNLogN += nLogN[n]
}
}
// Compute emax (maximum possible entropy for this word size)
na := CanonicalCircularKmerCount(ws)
na := tableSize // 4^ws
var emax float64
if nwords < na {
emax = math.Log(float64(nwords))
emax = logNwords
} else {
cov := nwords / na
remains := nwords - (na * cov)
@@ -105,7 +111,19 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
continue
}
entropy := (logNwords - sumNLogN/floatNwords) / emax
// Accumulate Σ f·log(f) and Σ f·log(class_size) over canonical forms.
classLogSize := classLogSizeTables[ws]
var sumNLogN, sumClassLogN float64
for j := 0; j < tableSize; j++ {
n := table[j]
if n > 0 {
sumNLogN += nLogN[n]
sumClassLogN += float64(n) * classLogSize[j]
}
}
// Corrected entropy: H_raw ≈ log(N) + (Σf·log(s) - Σf·log(f)) / N
entropy := (logNwords + sumClassLogN/floatNwords - sumNLogN/floatNwords) / emax
if entropy < 0 {
entropy = 0
}
@@ -129,24 +147,20 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
// IMPORTANT: a KmerEntropyFilter is NOT safe for concurrent use.
// Each goroutine must create its own instance via NewKmerEntropyFilter.
type KmerEntropyFilter struct {
k int
levelMax int
threshold float64
nLogN []float64
normTables [][]int
emaxValues []float64
logNwords []float64
k int
levelMax int
threshold float64
nLogN []float64
normTables [][]int
classLogSizeTables [][]float64
emaxValues []float64
logNwords []float64
// Pre-allocated frequency tables reused across Entropy() calls.
// One per word size (index 0 unused). Reset to zero before each use.
freqTables [][]int
}
// NewKmerEntropyFilter creates an entropy filter with pre-computed tables.
//
// Parameters:
// - k: the k-mer size
// - levelMax: maximum sub-word size for entropy (typically 6)
// - threshold: entropy threshold (k-mers with entropy <= threshold are rejected)
func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter {
if levelMax >= k {
levelMax = k - 1
@@ -169,20 +183,38 @@ func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter
}
}
// ln(class_size) for each canonical form under circular normalization.
classLogSizeTables := make([][]float64, levelMax+1)
for ws := 1; ws <= levelMax; ws++ {
tableSize := 1 << (ws * 2)
classSize := make([]int, tableSize)
for code := 0; code < tableSize; code++ {
classSize[normTables[ws][code]]++
}
classLogSizeTables[ws] = make([]float64, tableSize)
for j := 0; j < tableSize; j++ {
if classSize[j] > 0 {
classLogSizeTables[ws][j] = math.Log(float64(classSize[j]))
}
}
}
// Pre-compute emax and logNwords per word size.
// emax uses 4^ws raw bins to match the corrected entropy.
emaxValues := make([]float64, levelMax+1)
logNwords := make([]float64, levelMax+1)
for ws := 1; ws <= levelMax; ws++ {
nw := k - ws + 1
na := CanonicalCircularKmerCount(ws)
na := 1 << (ws * 2) // 4^ws raw bins
floatNw := float64(nw)
logNwords[ws] = math.Log(floatNw)
if nw < na {
logNwords[ws] = math.Log(float64(nw))
emaxValues[ws] = math.Log(float64(nw))
emaxValues[ws] = logNwords[ws]
} else {
cov := nw / na
remains := nw - (na * cov)
f1 := float64(cov) / float64(nw)
f2 := float64(cov+1) / float64(nw)
logNwords[ws] = math.Log(float64(nw))
f1 := float64(cov) / floatNw
f2 := float64(cov+1) / floatNw
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
float64(remains)*f2*math.Log(f2))
}
@@ -195,14 +227,15 @@ func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter
}
return &KmerEntropyFilter{
k: k,
levelMax: levelMax,
threshold: threshold,
nLogN: nLogN,
normTables: normTables,
emaxValues: emaxValues,
logNwords: logNwords,
freqTables: freqTables,
k: k,
levelMax: levelMax,
threshold: threshold,
nLogN: nLogN,
normTables: normTables,
classLogSizeTables: classLogSizeTables,
emaxValues: emaxValues,
logNwords: logNwords,
freqTables: freqTables,
}
}
@@ -236,7 +269,7 @@ func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
// Count circular-canonical sub-word frequencies
tableSize := 1 << (ws * 2)
table := ef.freqTables[ws]
clear(table) // reset to zero
clear(table)
mask := (1 << (ws * 2)) - 1
normTable := ef.normTables[ws]
@@ -251,19 +284,21 @@ func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
table[normWord]++
}
// Compute Shannon entropy
floatNwords := float64(nwords)
logNwords := ef.logNwords[ws]
classLogSize := ef.classLogSizeTables[ws]
var sumNLogN float64
var sumNLogN, sumClassLogN float64
for j := 0; j < tableSize; j++ {
n := table[j]
if n > 0 {
sumNLogN += ef.nLogN[n]
sumClassLogN += float64(n) * classLogSize[j]
}
}
entropy := (logNwords - sumNLogN/floatNwords) / emax
// Corrected entropy: H_raw ≈ log(N) + (Σf·log(s) - Σf·log(f)) / N
entropy := (logNwords + sumClassLogN/floatNwords - sumNLogN/floatNwords) / emax
if entropy < 0 {
entropy = 0
}
+1 -1
View File
@@ -3,7 +3,7 @@ package obioptions
// Version is automatically updated by the Makefile from version.txt
// The patch number (third digit) is incremented on each push to the repository
var _Version = "Release 4.4.40"
var _Version = "Release 4.4.45"
// Version returns the version of the obitools package.
//
+18
View File
@@ -364,6 +364,24 @@ func (s *BioSequence) GetIntSlice(key string) ([]int, bool) {
return val, ok
}
func (s *BioSequence) GetMapOfIntSlice(key string) (map[string][]int, bool) {
v, ok := s.GetAttribute(key)
if !ok {
return nil, false
}
val, err := obiutils.InterfaceToMapOfIntSlice(v)
return val, err == nil
}
func (s *BioSequence) GetMapOfStringSlice(key string) (map[string][]string, bool) {
v, ok := s.GetAttribute(key)
if !ok {
return nil, false
}
val, err := obiutils.InterfaceToMapOfStringSlice(v)
return val, err == nil
}
// Count returns the value of the "count" attribute of the BioSequence.
//
// The count of a sequence is the number of times it has been observed in the dataset.
+6
View File
@@ -499,6 +499,9 @@ func (s *BioSequence) SetQualities(qualities Quality) {
if s.qualities != nil {
RecycleSlice(&s.qualities)
}
if len(qualities) > 0 && len(qualities) != len(s.sequence) {
log.Panicf("[BioSequence.SetQualities] Sequence %s has a length of %d and qualities a length of %d", s.id, len(s.sequence), len(qualities))
}
s.qualities = CopySlice(qualities)
}
@@ -508,6 +511,9 @@ func (s *BioSequence) TakeQualities(qualities Quality) {
if s.qualities != nil {
RecycleSlice(&s.qualities)
}
if len(qualities) > 0 && len(qualities) != len(s.sequence) {
log.Panicf("[BioSequence.TakeQualities] Sequence %s has a length of %d and qualities a length of %d", s.id, len(s.sequence), len(qualities))
}
s.qualities = qualities
}
+1 -1
View File
@@ -103,7 +103,7 @@ func TestNewBioSequence(t *testing.T) {
// Return type: None.
func TestNewBioSequenceWithQualities(t *testing.T) {
id := "123"
sequence := []byte("ATGC")
sequence := []byte("atgc")
definition := "DNA sequence"
qualities := []byte("1234")
+27
View File
@@ -141,6 +141,33 @@ var OBILang = gval.NewLanguage(
gval.Function("max", func(args ...interface{}) (interface{}, error) {
return obiutils.Max(args[0])
}),
gval.Function("whichmax", func(args ...interface{}) (interface{}, error) {
result, err := obiutils.WhichMax(args[0])
if idx, ok := result.(int); ok {
return float64(idx), nil
}
return result, err
}),
gval.Function("whichmin", func(args ...interface{}) (interface{}, error) {
result, err := obiutils.WhichMin(args[0])
if idx, ok := result.(int); ok {
return float64(idx), nil
}
return result, err
}),
gval.Function("filtermin", func(args ...interface{}) (interface{}, error) {
return obiutils.FilterMin(args[0], args[1])
}),
gval.Function("filtermax", func(args ...interface{}) (interface{}, error) {
return obiutils.FilterMax(args[0], args[1])
}),
gval.Function("saturatingsub", func(args ...interface{}) (interface{}, error) {
return obiutils.SaturatingSub(args[0], args[1])
}),
gval.Function("contains", func(args ...interface{}) (interface{}, error) {
if obiutils.IsAMap(args[0]) {
val := reflect.ValueOf(args[0]).MapIndex(reflect.ValueOf(args[1]))
+3
View File
@@ -118,6 +118,9 @@ func (sequence *BioSequence) _revcmpMutation() *BioSequence {
*/
func ReverseComplementWorker(inplace bool) SeqWorker {
f := func(input *BioSequence) (BioSequenceSlice, error) {
if input.IsPaired() {
input.PairedWith().ReverseComplement(inplace)
}
return BioSequenceSlice{input.ReverseComplement(inplace)}, nil
}
+20 -2
View File
@@ -48,7 +48,16 @@ func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSeque
newSeq.sequence = CopySlice(sequence.Sequence()[from:to])
if sequence.HasQualities() {
newSeq.qualities = CopySlice(sequence.Qualities()[from:to])
qual := sequence.Qualities()
if len(qual) != sequence.Len() {
log.Panicf(
"[BioSequence.Subsequence] Sequence %s has a length of %d and qualities a length of %d",
sequence.Id(),
sequence.Len(),
len(qual),
)
}
newSeq.qualities = CopySlice(qual[from:to])
}
newSeq.id = fmt.Sprintf("%s_sub[%d..%d]", sequence.Id(), from+1, to)
@@ -58,7 +67,16 @@ func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSeque
newSeq.Write(sequence.Sequence()[0:to])
if sequence.HasQualities() {
newSeq.WriteQualities(sequence.Qualities()[0:to])
qual := sequence.Qualities()
if len(qual) != sequence.Len() {
log.Panicf(
"[BioSequence.Subsequence] Sequence %s has a length of %d and qualities a length of %d",
sequence.Id(),
sequence.Len(),
len(qual),
)
}
newSeq.WriteQualities(qual[0:to])
}
}
+7 -1
View File
@@ -70,6 +70,12 @@ func (s *BioSequence) SetTaxid(taxid string, rank ...string) {
}
}
} else if obidefault.UseRawTaxids() {
// Without a loaded taxonomy, extract the bare ID from full-format strings
// like "code:12345 [Name]@rank" so that --raw-taxid is honoured everywhere.
if _, rawID, _, _, parseErr := obitax.ParseTaxonString(taxid); parseErr == nil {
taxid = rawID
}
}
}
@@ -177,7 +183,7 @@ func (sequence *BioSequence) SetPath(taxonomy *obitax.Taxonomy) []string {
lpath := path.Len() - 1
for i := lpath; i >= 0; i-- {
spath[lpath-i] = path.Get(i).String(taxonomy.Code())
spath[lpath-i] = path.Get(i).FullString(taxonomy.Code())
}
sequence.SetAttribute("taxonomic_path", spath)
+19 -13
View File
@@ -29,6 +29,24 @@ type TaxNode struct {
alternatenames *map[*string]*string
}
// FullString returns the full string representation of the TaxNode in the form
// "taxonomyCode:id [scientificName]@rank", regardless of the UseRawTaxids setting.
// This is used internally when a parseable format is required (e.g. taxonomic_path).
func (node *TaxNode) FullString(taxonomyCode string) string {
if node.HasScientificName() {
return fmt.Sprintf("%s:%v [%s]@%s",
taxonomyCode,
*node.id,
node.ScientificName(),
node.Rank(),
)
}
return fmt.Sprintf("%s:%v",
taxonomyCode,
*node.id)
}
// String returns a string representation of the TaxNode, including the taxonomy code,
// the node ID, and the scientific name. The output format is "taxonomyCode:id [scientificName]".
//
@@ -42,19 +60,7 @@ func (node *TaxNode) String(taxonomyCode string) string {
return *node.id
}
if node.HasScientificName() {
return fmt.Sprintf("%s:%v [%s]@%s",
taxonomyCode,
*node.id,
node.ScientificName(),
node.Rank(),
)
}
return fmt.Sprintf("%s:%v",
taxonomyCode,
*node.id)
return node.FullString(taxonomyCode)
}
// Id returns the unique identifier of the TaxNode.
+1
View File
@@ -33,6 +33,7 @@ func CLIWriteSequenceCSV(iterator obiiter.IBioSequence,
CSVSequence(CLIPrintSequence()),
CSVQuality(CLIPrintQuality()),
CSVAutoColumn(CLIAutoColumns()),
CSVNAValue(CLINAValue()),
)
csvIter := NewCSVSequenceIterator(iterator, opts...)
+13 -1
View File
@@ -1,6 +1,7 @@
package obicsv
import (
"fmt"
"log"
"slices"
@@ -67,8 +68,19 @@ func CSVBatchFromSequences(batch obiiter.BioSequenceBatch, opt Options) obiiterc
if taxon != nil {
taxid = taxon.String()
} else if ta, ok := sequence.GetAttribute("taxid"); ok {
switch tv := ta.(type) {
case string:
taxid = tv
case int:
taxid = fmt.Sprintf("%d", tv)
case float64:
taxid = fmt.Sprintf("%d", int(tv))
default:
taxid = opt.CSVNAValue()
}
} else {
taxid = sequence.Taxid()
taxid = opt.CSVNAValue()
}
record["taxid"] = taxid
+4 -2
View File
@@ -21,12 +21,10 @@ func PairingOptionSet(options *getoptions.GetOpt) {
options.StringVar(&_ForwardFile, "forward-reads", "",
options.Alias("F"),
options.ArgName("FILENAME_F"),
options.Required("You must provide at a forward file"),
options.Description("The file names containing the forward reads"))
options.StringVar(&_ReverseFile, "reverse-reads", "",
options.Alias("R"),
options.ArgName("FILENAME_R"),
options.Required("You must provide a reverse file"),
options.Description("The file names containing the reverse reads"))
options.IntVar(&_Delta, "delta", _Delta,
options.Alias("D"),
@@ -72,6 +70,10 @@ func CLIPairedSequence() (obiiter.IBioSequence, error) {
return paired, nil
}
func CLIHasPairedFiles() bool {
return _ForwardFile != "" && _ReverseFile != ""
}
func CLIDelta() int {
return _Delta
}
+27 -3
View File
@@ -99,6 +99,17 @@ func (data1 *DataSummary) Add(data2 *DataSummary) *DataSummary {
rep.sample_singletons = sumUpdateIntMap(data1.sample_singletons, data2.sample_singletons)
rep.sample_obiclean_bad = sumUpdateIntMap(data1.sample_obiclean_bad, data2.sample_obiclean_bad)
for k, m1 := range data1.map_summaries {
rep.map_summaries[k] = m1
}
for k, m2 := range data2.map_summaries {
if m1, ok := rep.map_summaries[k]; ok {
rep.map_summaries[k] = sumUpdateIntMap(m1, m2)
} else {
rep.map_summaries[k] = m2
}
}
return rep
}
@@ -163,8 +174,9 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
summaries := make([]*DataSummary, nproc)
for n := 0; n < nproc; n++ {
summaries[n] = NewDataSummary()
for _, v := range summarise {
summaries[n].map_summaries[v] = make(map[string]int, 0)
summaries[n].map_summaries[v] = make(map[string]int)
}
}
@@ -174,6 +186,11 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
batch := iseq.Get()
for _, seq := range batch.Slice() {
summary.Update(seq)
for _, attr := range summarise {
if m, ok := seq.GetIntMap(attr); ok {
summary.map_summaries[attr] = sumUpdateIntMap(summary.map_summaries[attr], m)
}
}
}
}
waiter.Done()
@@ -181,11 +198,9 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
waiter.Add(nproc)
summaries[0] = NewDataSummary()
go ff(iterator, summaries[0])
for i := 1; i < nproc; i++ {
summaries[i] = NewDataSummary()
go ff(iterator.Split(), summaries[i])
}
@@ -246,5 +261,14 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
}
}
}
if len(rep.map_summaries) > 0 {
mapDict := make(map[string]interface{}, len(rep.map_summaries))
for attr, counts := range rep.map_summaries {
mapDict[attr] = counts
}
dict["map_summaries"] = mapDict
}
return dict
}
+4 -4
View File
@@ -114,10 +114,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
aanot["obimultiplex_direction"] = direction
aanot["obimultiplex_forward_match"] = forward_match
aanot["obimultiplex_forward_mismatches"] = forward_mismatches
aanot["obimultiplex_forward_error"] = forward_mismatches
aanot["obimultiplex_reverse_match"] = reverse_match
aanot["obimultiplex_reverse_mismatches"] = reverse_mismatches
aanot["obimultiplex_reverse_error"] = reverse_mismatches
aanot["sample"] = sample
aanot["experiment"] = experiment
@@ -125,10 +125,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
banot["obimultiplex_direction"] = direction
banot["obimultiplex_forward_match"] = forward_match
banot["obimultiplex_forward_mismatches"] = forward_mismatches
banot["obimultiplex_forward_error"] = forward_mismatches
banot["obimultiplex_reverse_match"] = reverse_match
banot["obimultiplex_reverse_mismatches"] = reverse_mismatches
banot["obimultiplex_reverse_error"] = reverse_mismatches
banot["sample"] = sample
banot["experiment"] = experiment
+38
View File
@@ -276,6 +276,44 @@ func InterfaceToStringMap(i interface{}) (val map[string]string, err error) {
return
}
func InterfaceToMapOfIntSlice(i interface{}) (val map[string][]int, err error) {
err = nil
switch m := i.(type) {
case map[string][]int:
val = m
case map[string]interface{}:
val = make(map[string][]int, len(m))
for k, v := range m {
val[k], err = InterfaceToIntSlice(v)
if err != nil {
return
}
}
default:
err = &NotAMapInt{"value attribute cannot be casted to a map[string][]int"}
}
return
}
func InterfaceToMapOfStringSlice(i interface{}) (val map[string][]string, err error) {
err = nil
switch m := i.(type) {
case map[string][]string:
val = m
case map[string]interface{}:
val = make(map[string][]string, len(m))
for k, v := range m {
val[k], err = InterfaceToStringSlice(v)
if err != nil {
return
}
}
default:
err = &NotAMapInt{"value attribute cannot be casted to a map[string][]string"}
}
return
}
func InterfaceToStringSlice(i interface{}) (val []string, err error) {
err = nil
+365 -4
View File
@@ -34,6 +34,26 @@ func MinMaxSlice[T constraints.Ordered](vec []T) (min, max T) {
return
}
func FilterMinSlice[T constraints.Ordered](vec []T, minimum T) []T {
result := make([]T, 0, len(vec))
for _, v := range vec {
if v >= minimum {
result = append(result, v)
}
}
return result
}
func FilterMaxSlice[T constraints.Ordered](vec []T, maximum T) []T {
result := make([]T, 0, len(vec))
for _, v := range vec {
if v <= maximum {
result = append(result, v)
}
}
return result
}
func MaxMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
var maxKey K
var maxValue T
@@ -73,6 +93,46 @@ func MinMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
return minKey, minValue, nil
}
func FilterMinMap[K comparable, T constraints.Ordered](values map[K]T, minimum T) map[K]T {
result := make(map[K]T)
for k, v := range values {
if v >= minimum {
result[k] = v
}
}
return result
}
func FilterMaxMap[K comparable, T constraints.Ordered](values map[K]T, maximum T) map[K]T {
result := make(map[K]T)
for k, v := range values {
if v <= maximum {
result[k] = v
}
}
return result
}
func SaturatingSubSlice[T Numeric](vec []T, sub T) []T {
result := make([]T, len(vec))
for i, v := range vec {
if v > sub {
result[i] = v - sub
}
}
return result
}
func SaturatingSubMap[K comparable, T Numeric](values map[K]T, sub T) map[K]T {
result := make(map[K]T)
for k, v := range values {
if v > sub {
result[k] = v - sub
}
}
return result
}
// Min returns the smallest element in a slice/array or map,
// or the value itself if data is a single comparable value.
// Returns an error if the container is empty or the type is unsupported.
@@ -135,11 +195,121 @@ func Max(data interface{}) (interface{}, error) {
}
}
func FilterMin(data interface{}, minimum interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return filterMinFromIterable(v, minimum)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return filterMinFromMap(v, minimum)
default:
if !isOrderedKind(v.Kind()) {
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
return data, nil
}
}
func FilterMax(data interface{}, maximum interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return filterMaxFromIterable(v, maximum)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return filterMaxFromMap(v, maximum)
default:
if !isOrderedKind(v.Kind()) {
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
return data, nil
}
}
func SaturatingSub(data interface{}, sub interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
return saturatingSubFromIterable(v, sub)
case reflect.Map:
return saturatingSubFromMap(v, sub)
default:
if !isNumericKind(v.Kind()) {
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
r, err := saturatingSubValues(v, reflect.ValueOf(sub))
if err != nil {
return nil, err
}
return r.Interface(), nil
}
}
func saturatingSubFromIterable(v reflect.Value, sub interface{}) (interface{}, error) {
subVal := reflect.ValueOf(sub)
result := reflect.MakeSlice(v.Type(), v.Len(), v.Len())
for i := 0; i < v.Len(); i++ {
r, err := saturatingSubValues(v.Index(i), subVal)
if err != nil {
return nil, err
}
result.Index(i).Set(r)
}
return result.Interface(), nil
}
func saturatingSubFromMap(v reflect.Value, sub interface{}) (interface{}, error) {
subVal := reflect.ValueOf(sub)
result := reflect.MakeMap(v.Type())
for _, key := range v.MapKeys() {
r, err := saturatingSubValues(v.MapIndex(key), subVal)
if err != nil {
return nil, err
}
if !r.IsZero() {
result.SetMapIndex(key, r)
}
}
return result.Interface(), nil
}
func saturatingSubValues(a, b reflect.Value) (reflect.Value, error) {
result := reflect.New(a.Type()).Elem()
switch a.Kind() {
case reflect.Int, reflect.Int8, reflect.Int16, reflect.Int32, reflect.Int64:
if av, bv := a.Int(), b.Int(); av > bv {
result.SetInt(av - bv)
}
case reflect.Uint, reflect.Uint8, reflect.Uint16, reflect.Uint32, reflect.Uint64:
if av, bv := a.Uint(), b.Uint(); av > bv {
result.SetUint(av - bv)
}
case reflect.Float32, reflect.Float64:
if av, bv := a.Float(), b.Float(); av > bv {
result.SetFloat(av - bv)
}
default:
return reflect.Value{}, fmt.Errorf("unsupported type for saturating subtraction: %s", a.Kind())
}
return result, nil
}
// maxFromIterable scans a slice/array to find the maximum.
func maxFromIterable(v reflect.Value) (interface{}, error) {
var best reflect.Value
for i := 0; i < v.Len(); i++ {
elem := v.Index(i)
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
@@ -154,7 +324,7 @@ func maxFromIterable(v reflect.Value) (interface{}, error) {
func minFromIterable(v reflect.Value) (interface{}, error) {
var minVal reflect.Value
for i := 0; i < v.Len(); i++ {
elem := v.Index(i)
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
@@ -165,12 +335,182 @@ func minFromIterable(v reflect.Value) (interface{}, error) {
return minVal.Interface(), nil
}
func filterMinFromIterable(v reflect.Value, minimum interface{}) (interface{}, error) {
minVal := reflect.ValueOf(minimum)
result := reflect.MakeSlice(v.Type(), 0, v.Len())
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !less(elem, minVal) { // elem >= minimum
result = reflect.Append(result, elem)
}
}
return result.Interface(), nil
}
func filterMaxFromIterable(v reflect.Value, maximum interface{}) (interface{}, error) {
maxVal := reflect.ValueOf(maximum)
result := reflect.MakeSlice(v.Type(), 0, v.Len())
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !greater(elem, maxVal) { // elem <= maximum
result = reflect.Append(result, elem)
}
}
return result.Interface(), nil
}
// whichMaxFromIterable returns the index of the maximum element in a slice/array.
func whichMaxFromIterable(v reflect.Value) (int, error) {
var best reflect.Value
bestIdx := 0
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if i == 0 || greater(elem, best) {
best = elem
bestIdx = i
}
}
return bestIdx, nil
}
// whichMinFromIterable returns the index of the minimum element in a slice/array.
func whichMinFromIterable(v reflect.Value) (int, error) {
var minVal reflect.Value
minIdx := 0
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if i == 0 || less(elem, minVal) {
minVal = elem
minIdx = i
}
}
return minIdx, nil
}
// whichMaxFromMap returns the key associated with the maximum value in a map.
func whichMaxFromMap(v reflect.Value) (interface{}, error) {
var best reflect.Value
var bestKey reflect.Value
first := true
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if first || greater(elem, best) {
best = elem
bestKey = key
first = false
}
}
return bestKey.Interface(), nil
}
// whichMinFromMap returns the key associated with the minimum value in a map.
func whichMinFromMap(v reflect.Value) (interface{}, error) {
var minVal reflect.Value
var minKey reflect.Value
first := true
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if first || less(elem, minVal) {
minVal = elem
minKey = key
first = false
}
}
return minKey.Interface(), nil
}
// WhichMax returns the key (for a map) or index (for a slice/array) of the maximum value.
func WhichMax(data interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return whichMaxFromIterable(v)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return whichMaxFromMap(v)
default:
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
}
// WhichMin returns the key (for a map) or index (for a slice/array) of the minimum value.
func WhichMin(data interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return whichMinFromIterable(v)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return whichMinFromMap(v)
default:
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
}
func filterMinFromMap(v reflect.Value, minimum interface{}) (interface{}, error) {
minVal := reflect.ValueOf(minimum)
result := reflect.MakeMap(v.Type())
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !less(elem, minVal) { // elem >= minimum
result.SetMapIndex(key, elem)
}
}
return result.Interface(), nil
}
func filterMaxFromMap(v reflect.Value, maximum interface{}) (interface{}, error) {
maxVal := reflect.ValueOf(maximum)
result := reflect.MakeMap(v.Type())
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !greater(elem, maxVal) { // elem <= maximum
result.SetMapIndex(key, elem)
}
}
return result.Interface(), nil
}
// maxFromMap scans map values to find the maximum.
func maxFromMap(v reflect.Value) (interface{}, error) {
var best reflect.Value
first := true
for _, key := range v.MapKeys() {
elem := v.MapIndex(key)
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
@@ -187,7 +527,7 @@ func minFromMap(v reflect.Value) (interface{}, error) {
var minVal reflect.Value
first := true
for _, key := range v.MapKeys() {
elem := v.MapIndex(key)
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
@@ -199,6 +539,27 @@ func minFromMap(v reflect.Value) (interface{}, error) {
return minVal.Interface(), nil
}
func isNumericKind(k reflect.Kind) bool {
switch k {
case reflect.Int, reflect.Int8, reflect.Int16, reflect.Int32, reflect.Int64,
reflect.Uint, reflect.Uint8, reflect.Uint16, reflect.Uint32, reflect.Uint64,
reflect.Float32, reflect.Float64:
return true
default:
return false
}
}
// unwrapInterface returns v.Elem() when v holds an interface value, otherwise v unchanged.
// This is necessary when iterating map[string]interface{} or []interface{} via reflection:
// the element Kind is reflect.Interface, not the underlying concrete type.
func unwrapInterface(v reflect.Value) reflect.Value {
if v.Kind() == reflect.Interface {
return v.Elem()
}
return v
}
// isOrderedKind reports whether k supports comparison ordering.
func isOrderedKind(k reflect.Kind) bool {
switch k {
+1 -1
View File
@@ -1 +1 @@
4.4.40
4.4.45