Compare commits

..
Author SHA1 Message Date
Eric Coissac f519c0ef7f 4.4.27: Static Linux builds, memory-aware batching, and build toolchain upgrades
This release includes significant improvements to resource management, build reliability, and portability.

### Memory-Aware Batching (Backward Compatible)
- Added configurable batch size and memory limits to prevent excessive memory usage during large dataset processing.
- Introduced a new `--batch-mem` command-line option (e.g., `128K`, `64M`, `1G`) to enable adaptive batching based on estimated sequence memory footprint.
- Internal batching logic now flushes batches when either size or memory thresholds are exceeded, ensuring predictable behavior.
- Conservative memory estimation and explicit garbage collection after large batch discards improve resource efficiency.

### Linux Build Enhancements
- Enabled static linking for Linux binaries using musl, producing self-contained executables with no external runtime dependencies.
- Refined cross-compilation toolchain to use architecture-specific CGO header paths, improving reliability across target architectures.
- Switched Linux builds to use Docker-based static compilation for consistency and reproducibility.

### Build System & Toolchain Improvements
- Upgraded Go toolchain to 1.26, with updated dependencies including golang.org/x/net v0.38.0.
- Fixed Makefile quoting for LDFLAGS to handle paths containing spaces.
- Enhanced build error handling to display logs before cleanup on failure.
- Improved install script with correct environment variable setup (GOROOT, GOPATH, GOTOOLCHAIN) and added progress indicators for downloads.

Note: All batching behavior remains non-breaking, with default constraints ensuring safe processing of large datasets.
2026-03-14 11:43:43 +01:00
55 changed files with 234 additions and 2602 deletions
+2 -2
View File
@@ -10,10 +10,10 @@ jobs:
runs-on: ubuntu-latest
steps:
- name: Setup Go
uses: actions/setup-go@v5
uses: actions/setup-go@v2
with:
go-version: '1.23'
- name: Checkout obitools4 project
uses: actions/checkout@v5
uses: actions/checkout@v4
- name: Run tests
run: make githubtests
+4 -4
View File
@@ -18,7 +18,7 @@ jobs:
with:
go-version: "1.26"
- name: Checkout obitools4 project
uses: actions/checkout@v5
uses: actions/checkout@v4
- name: Run tests
run: make githubtests
@@ -49,7 +49,7 @@ jobs:
steps:
- name: Checkout code
uses: actions/checkout@v5
uses: actions/checkout@v4
- name: Setup Go
uses: actions/setup-go@v5
@@ -79,7 +79,7 @@ jobs:
-w /src \
-e VERSION="${VERSION}" \
golang:1.26-alpine \
sh -c "apk add --no-cache gcc musl-dev zlib-dev zlib-static make && \
sh -c "apk add --no-cache gcc musl-dev zlib-dev make && \
make LDFLAGS='-linkmode=external -extldflags=-static' obitools"
mkdir -p artifacts
tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
@@ -107,7 +107,7 @@ jobs:
runs-on: ubuntu-latest
steps:
- name: Checkout code
uses: actions/checkout@v5
uses: actions/checkout@v4
with:
fetch-depth: 0
+1 -3
View File
@@ -21,11 +21,9 @@ xx
.rhistory
/.vscode
/benchmarck
/build
/bugs
autodoc
/ncbitaxo
!/obitests/**
-2
View File
@@ -1,2 +0,0 @@
/cache
/project.local.yml
-133
View File
@@ -1,133 +0,0 @@
# the name by which the project can be referenced within Serena
project_name: "obitools4"
# list of languages for which language servers are started; choose from:
# al angular ansible bash clojure
# cpp cpp_ccls crystal csharp csharp_omnisharp
# dart elixir elm erlang fortran
# fsharp go groovy haskell haxe
# hlsl html java json julia
# kotlin lean4 lua luau markdown
# matlab msl nix ocaml pascal
# perl php php_phpactor powershell python
# python_jedi python_ty r rego ruby
# ruby_solargraph rust scala scss solidity
# svelte swift systemverilog terraform toml
# typescript typescript_vts vue yaml zig
# (This list may be outdated. For the current list, see values of Language enum here:
# https://github.com/oraios/serena/blob/main/src/solidlsp/ls_config.py
# For some languages, there are alternative language servers, e.g. csharp_omnisharp, ruby_solargraph.)
# Note:
# - For C, use cpp
# - For JavaScript, use typescript
# - For Angular projects, use angular (subsumes typescript+html; requires `npm install` in the project root)
# - For Svelte projects, use svelte (subsumes typescript/javascript for .svelte projects; requires npm)
# - For SCSS / Sass / plain CSS, use scss (some-sass-language-server handles all three)
# - For Free Pascal/Lazarus, use pascal
# Special requirements:
# Some languages require additional setup/installations.
# See here for details: https://oraios.github.io/serena/01-about/020_programming-languages.html#language-servers
# When using multiple languages, the first language server that supports a given file will be used for that file.
# The first language is the default language and the respective language server will be used as a fallback.
# Note that when using the JetBrains backend, language servers are not used and this list is correspondingly ignored.
languages:
- go
# the encoding used by text files in the project
# For a list of possible encodings, see https://docs.python.org/3.11/library/codecs.html#standard-encodings
encoding: "utf-8"
# line ending convention to use when writing source files.
# Possible values: unset (use global setting), "lf", "crlf", or "native" (platform default)
# This does not affect Serena's own files (e.g. memories and configuration files), which always use native line endings.
line_ending:
# The language backend to use for this project.
# If not set, the global setting from serena_config.yml is used.
# Valid values: LSP, JetBrains
# Note: the backend is fixed at startup. If a project with a different backend
# is activated post-init, an error will be returned.
language_backend:
# whether to use project's .gitignore files to ignore files
ignore_all_files_in_gitignore: true
# advanced configuration option allowing to configure language server-specific options.
# Maps the language key to the options.
# Have a look at the docstring of the constructors of the LS implementations within solidlsp (e.g., for C# or PHP) to see which options are available.
# No documentation on options means no options are available.
ls_specific_settings: {}
# list of additional workspace folder paths for cross-package reference support (e.g. in monorepos).
# Paths can be absolute or relative to the project root.
# Each folder is registered as an LSP workspace folder, enabling language servers to discover
# symbols and references across package boundaries.
# Currently supported for: TypeScript.
# Example:
# additional_workspace_folders:
# - ../sibling-package
# - ../shared-lib
additional_workspace_folders: []
# list of additional paths to ignore in this project.
# Same syntax as gitignore, so you can use * and **.
# Note: global ignored_paths from serena_config.yml are also applied additively.
ignored_paths: []
# whether the project is in read-only mode
# If set to true, all editing tools will be disabled and attempts to use them will result in an error
# Added on 2025-04-18
read_only: false
# list of tool names to exclude.
# This extends the existing exclusions (e.g. from the global configuration)
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
excluded_tools: []
# list of tools to include that would otherwise be disabled (particularly optional tools that are disabled by default).
# This extends the existing inclusions (e.g. from the global configuration).
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
included_optional_tools: []
# fixed set of tools to use as the base tool set (if non-empty), replacing Serena's default set of tools.
# This cannot be combined with non-empty excluded_tools or included_optional_tools.
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
fixed_tools: []
# list of mode names that are to be activated by default, overriding the setting in the global configuration.
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# If the setting is undefined/empty, the default_modes from the global configuration (serena_config.yml) apply.
# Otherwise, this overrides the setting from the global configuration (serena_config.yml).
# Therefore, you can set this to [] if you do not want the default modes defined in the global config to apply
# for this project.
# This setting can, in turn, be overridden by CLI parameters (--mode).
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
default_modes:
# list of mode names to be activated additionally for this project, e.g. ["query-projects"]
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
added_modes:
# initial prompt for the project. It will always be given to the LLM upon activating the project
# (contrary to the memories, which are loaded on demand).
initial_prompt: ""
# time budget (seconds) per tool call for the retrieval of additional symbol information
# such as docstrings or parameter information.
# This overrides the corresponding setting in the global configuration; see the documentation there.
# If null or missing, use the setting from the global configuration.
symbol_info_budget:
# list of regex patterns which, when matched, mark a memory entry as read‑only.
# Extends the list from the global configuration, merging the two lists.
read_only_memory_patterns: []
# list of regex patterns for memories to completely ignore.
# Matching memories will not appear in list_memories or activate_project output
# and cannot be accessed via read_memory or write_memory.
# To access ignored memory files, use the read_file tool on the raw file path.
# Extends the list from the global configuration, merging the two lists.
# Example: ["_archive/.*", "_episodes/.*"]
ignored_memory_patterns: []
-5
View File
@@ -37,11 +37,6 @@ func main() {
optionParser(os.Args)
if !obipairing.CLIHasPairedFiles() {
log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
os.Exit(1)
}
obidefault.SetStrictReadWorker(2)
obidefault.SetStrictWriteWorker(2)
pairs, err := obipairing.CLIPairedSequence()
-13
View File
@@ -1,7 +1,6 @@
package main
import (
"fmt"
"os"
log "github.com/sirupsen/logrus"
@@ -9,7 +8,6 @@ import (
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obimultiplex"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipairing"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitagpcr"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
@@ -41,17 +39,6 @@ func main() {
obitagpcr.OptionSet)
optionParser(os.Args)
if obimultiplex.CLIAskConfigTemplate() {
fmt.Print(obimultiplex.CLIConfigTemplate())
os.Exit(0)
}
if !obipairing.CLIHasPairedFiles() {
log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
os.Exit(1)
}
pairs, err := obipairing.CLIPairedSequence()
if err != nil {
-10
View File
@@ -1,10 +0,0 @@
{
"people": [
"Software",
"Agreement",
"Module"
],
"projects": [
"Code"
]
}
+1 -1
View File
@@ -6,7 +6,7 @@ require (
github.com/DavidGamba/go-getoptions v0.33.0
github.com/PaesslerAG/gval v1.2.4
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df
github.com/buger/jsonparser v1.1.2
github.com/buger/jsonparser v1.1.1
github.com/chen3feng/stl4go v0.1.1
github.com/dlclark/regexp2 v1.11.5
github.com/goccy/go-json v0.10.6
+2 -2
View File
@@ -6,8 +6,8 @@ github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi
github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
github.com/buger/jsonparser v1.1.2 h1:frqHqw7otoVbk5M8LlE/L7HTnIq2v9RX6EJ48i9AxJk=
github.com/buger/jsonparser v1.1.2/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
github.com/chen3feng/stl4go v0.1.1/go.mod h1:5ml3psLgETJjRJnMbPE+JiHLrCpt+Ajc2weeTECXzWU=
github.com/chengxilo/virtualterm v1.0.4 h1:Z6IpERbRVlfB8WkOmtbHiDbBANU7cimRIof7mk9/PwM=
BIN
View File
Binary file not shown.
BIN
View File
Binary file not shown.
@@ -1,24 +0,0 @@
>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
gattaaacctcaaaggacttggcagtgctttatacccct
>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
-48
View File
@@ -1,48 +0,0 @@
taxid,parent,taxonomic_rank,scientific_name
taxon:1 [root]@no rank,taxon:1 [root]@no rank,no rank,root
taxon:131567 [cellular organisms]@cellular root,taxon:1 [root]@no rank,cellular root,cellular organisms
taxon:2759 [Eukaryota]@domain,taxon:131567 [cellular organisms]@cellular root,domain,Eukaryota
taxon:33154 [Opisthokonta]@clade,taxon:2759 [Eukaryota]@domain,clade,Opisthokonta
taxon:33208 [Metazoa]@kingdom,taxon:33154 [Opisthokonta]@clade,kingdom,Metazoa
taxon:6072 [Eumetazoa]@clade,taxon:33208 [Metazoa]@kingdom,clade,Eumetazoa
taxon:33213 [Bilateria]@clade,taxon:6072 [Eumetazoa]@clade,clade,Bilateria
taxon:33511 [Deuterostomia]@clade,taxon:33213 [Bilateria]@clade,clade,Deuterostomia
taxon:7711 [Chordata]@phylum,taxon:33511 [Deuterostomia]@clade,phylum,Chordata
taxon:89593 [Craniata]@subphylum,taxon:7711 [Chordata]@phylum,subphylum,Craniata
taxon:7742 [Vertebrata]@clade,taxon:89593 [Craniata]@subphylum,clade,Vertebrata
taxon:7776 [Gnathostomata]@clade,taxon:7742 [Vertebrata]@clade,clade,Gnathostomata
taxon:117570 [Teleostomi]@clade,taxon:7776 [Gnathostomata]@clade,clade,Teleostomi
taxon:117571 [Euteleostomi]@clade,taxon:117570 [Teleostomi]@clade,clade,Euteleostomi
taxon:8287 [Sarcopterygii]@superclass,taxon:117571 [Euteleostomi]@clade,superclass,Sarcopterygii
taxon:1338369 [Dipnotetrapodomorpha]@clade,taxon:8287 [Sarcopterygii]@superclass,clade,Dipnotetrapodomorpha
taxon:32523 [Tetrapoda]@clade,taxon:1338369 [Dipnotetrapodomorpha]@clade,clade,Tetrapoda
taxon:32524 [Amniota]@clade,taxon:32523 [Tetrapoda]@clade,clade,Amniota
taxon:40674 [Mammalia]@class,taxon:32524 [Amniota]@clade,class,Mammalia
taxon:32525 [Theria]@clade,taxon:40674 [Mammalia]@class,clade,Theria
taxon:9347 [Eutheria]@clade,taxon:32525 [Theria]@clade,clade,Eutheria
taxon:1437010 [Boreoeutheria]@clade,taxon:9347 [Eutheria]@clade,clade,Boreoeutheria
taxon:314146 [Euarchontoglires]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Euarchontoglires
taxon:314145 [Laurasiatheria]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Laurasiatheria
taxon:33554 [Carnivora]@order,taxon:314145 [Laurasiatheria]@superorder,order,Carnivora
taxon:91561 [Artiodactyla]@order,taxon:314145 [Laurasiatheria]@superorder,order,Artiodactyla
taxon:314147 [Glires]@clade,taxon:314146 [Euarchontoglires]@superorder,clade,Glires
taxon:9845 [Ruminantia]@suborder,taxon:91561 [Artiodactyla]@order,suborder,Ruminantia
taxon:35500 [Pecora]@infraorder,taxon:9845 [Ruminantia]@suborder,infraorder,Pecora
taxon:9989 [Rodentia]@order,taxon:314147 [Glires]@clade,order,Rodentia
taxon:379584 [Caniformia]@suborder,taxon:33554 [Carnivora]@order,suborder,Caniformia
taxon:9608 [Canidae]@family,taxon:379584 [Caniformia]@suborder,family,Canidae
taxon:9850 [Cervidae]@family,taxon:35500 [Pecora]@infraorder,family,Cervidae
taxon:9881 [Odocoileinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Odocoileinae
taxon:33553 [Sciuromorpha]@suborder,taxon:9989 [Rodentia]@order,suborder,Sciuromorpha
taxon:55153 [Sciuridae]@family,taxon:33553 [Sciuromorpha]@suborder,family,Sciuridae
taxon:34878 [Cervinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Cervinae
taxon:9611 [Canis]@genus,taxon:9608 [Canidae]@family,genus,Canis
taxon:9857 [Capreolus]@genus,taxon:9881 [Odocoileinae]@subfamily,genus,Capreolus
taxon:9612 [Canis lupus]@species,taxon:9611 [Canis]@genus,species,Canis lupus
taxon:337726 [Xerinae]@subfamily,taxon:55153 [Sciuridae]@family,subfamily,Xerinae
taxon:9859 [Cervus]@genus,taxon:34878 [Cervinae]@subfamily,genus,Cervus
taxon:337730 [Marmotini]@tribe,taxon:337726 [Xerinae]@subfamily,tribe,Marmotini
taxon:9992 [Marmota]@genus,taxon:337730 [Marmotini]@tribe,genus,Marmota
taxon:9860 [Cervus elaphus]@species,taxon:9859 [Cervus]@genus,species,Cervus elaphus
taxon:9615 [Canis lupus familiaris]@subspecies,taxon:9612 [Canis lupus]@species,subspecies,Canis lupus familiaris
taxon:9858 [Capreolus capreolus]@species,taxon:9857 [Capreolus]@genus,species,Capreolus capreolus
1 taxid parent taxonomic_rank scientific_name
2 taxon:1 [root]@no rank taxon:1 [root]@no rank no rank root
3 taxon:131567 [cellular organisms]@cellular root taxon:1 [root]@no rank cellular root cellular organisms
4 taxon:2759 [Eukaryota]@domain taxon:131567 [cellular organisms]@cellular root domain Eukaryota
5 taxon:33154 [Opisthokonta]@clade taxon:2759 [Eukaryota]@domain clade Opisthokonta
6 taxon:33208 [Metazoa]@kingdom taxon:33154 [Opisthokonta]@clade kingdom Metazoa
7 taxon:6072 [Eumetazoa]@clade taxon:33208 [Metazoa]@kingdom clade Eumetazoa
8 taxon:33213 [Bilateria]@clade taxon:6072 [Eumetazoa]@clade clade Bilateria
9 taxon:33511 [Deuterostomia]@clade taxon:33213 [Bilateria]@clade clade Deuterostomia
10 taxon:7711 [Chordata]@phylum taxon:33511 [Deuterostomia]@clade phylum Chordata
11 taxon:89593 [Craniata]@subphylum taxon:7711 [Chordata]@phylum subphylum Craniata
12 taxon:7742 [Vertebrata]@clade taxon:89593 [Craniata]@subphylum clade Vertebrata
13 taxon:7776 [Gnathostomata]@clade taxon:7742 [Vertebrata]@clade clade Gnathostomata
14 taxon:117570 [Teleostomi]@clade taxon:7776 [Gnathostomata]@clade clade Teleostomi
15 taxon:117571 [Euteleostomi]@clade taxon:117570 [Teleostomi]@clade clade Euteleostomi
16 taxon:8287 [Sarcopterygii]@superclass taxon:117571 [Euteleostomi]@clade superclass Sarcopterygii
17 taxon:1338369 [Dipnotetrapodomorpha]@clade taxon:8287 [Sarcopterygii]@superclass clade Dipnotetrapodomorpha
18 taxon:32523 [Tetrapoda]@clade taxon:1338369 [Dipnotetrapodomorpha]@clade clade Tetrapoda
19 taxon:32524 [Amniota]@clade taxon:32523 [Tetrapoda]@clade clade Amniota
20 taxon:40674 [Mammalia]@class taxon:32524 [Amniota]@clade class Mammalia
21 taxon:32525 [Theria]@clade taxon:40674 [Mammalia]@class clade Theria
22 taxon:9347 [Eutheria]@clade taxon:32525 [Theria]@clade clade Eutheria
23 taxon:1437010 [Boreoeutheria]@clade taxon:9347 [Eutheria]@clade clade Boreoeutheria
24 taxon:314146 [Euarchontoglires]@superorder taxon:1437010 [Boreoeutheria]@clade superorder Euarchontoglires
25 taxon:314145 [Laurasiatheria]@superorder taxon:1437010 [Boreoeutheria]@clade superorder Laurasiatheria
26 taxon:33554 [Carnivora]@order taxon:314145 [Laurasiatheria]@superorder order Carnivora
27 taxon:91561 [Artiodactyla]@order taxon:314145 [Laurasiatheria]@superorder order Artiodactyla
28 taxon:314147 [Glires]@clade taxon:314146 [Euarchontoglires]@superorder clade Glires
29 taxon:9845 [Ruminantia]@suborder taxon:91561 [Artiodactyla]@order suborder Ruminantia
30 taxon:35500 [Pecora]@infraorder taxon:9845 [Ruminantia]@suborder infraorder Pecora
31 taxon:9989 [Rodentia]@order taxon:314147 [Glires]@clade order Rodentia
32 taxon:379584 [Caniformia]@suborder taxon:33554 [Carnivora]@order suborder Caniformia
33 taxon:9608 [Canidae]@family taxon:379584 [Caniformia]@suborder family Canidae
34 taxon:9850 [Cervidae]@family taxon:35500 [Pecora]@infraorder family Cervidae
35 taxon:9881 [Odocoileinae]@subfamily taxon:9850 [Cervidae]@family subfamily Odocoileinae
36 taxon:33553 [Sciuromorpha]@suborder taxon:9989 [Rodentia]@order suborder Sciuromorpha
37 taxon:55153 [Sciuridae]@family taxon:33553 [Sciuromorpha]@suborder family Sciuridae
38 taxon:34878 [Cervinae]@subfamily taxon:9850 [Cervidae]@family subfamily Cervinae
39 taxon:9611 [Canis]@genus taxon:9608 [Canidae]@family genus Canis
40 taxon:9857 [Capreolus]@genus taxon:9881 [Odocoileinae]@subfamily genus Capreolus
41 taxon:9612 [Canis lupus]@species taxon:9611 [Canis]@genus species Canis lupus
42 taxon:337726 [Xerinae]@subfamily taxon:55153 [Sciuridae]@family subfamily Xerinae
43 taxon:9859 [Cervus]@genus taxon:34878 [Cervinae]@subfamily genus Cervus
44 taxon:337730 [Marmotini]@tribe taxon:337726 [Xerinae]@subfamily tribe Marmotini
45 taxon:9992 [Marmota]@genus taxon:337730 [Marmotini]@tribe genus Marmota
46 taxon:9860 [Cervus elaphus]@species taxon:9859 [Cervus]@genus species Cervus elaphus
47 taxon:9615 [Canis lupus familiaris]@subspecies taxon:9612 [Canis lupus]@species subspecies Canis lupus familiaris
48 taxon:9858 [Capreolus capreolus]@species taxon:9857 [Capreolus]@genus species Capreolus capreolus
-124
View File
@@ -134,130 +134,6 @@ else
((failed++))
fi
# ------------------------------------------------------------------
# --raw-taxid tests (no taxonomy loaded)
# ------------------------------------------------------------------
# Running test
((ntest++))
if obiconvert --raw-taxid "${TEST_DIR}/out_ecotag.fasta" \
> "${TMPDIR}/raw_taxid.fasta" 2>/dev/null
then
log "$MCMD --raw-taxid: running OK"
((success++))
else
log "$MCMD --raw-taxid: running failed"
((failed++))
fi
# Taxids must be bare numbers — no full-format "taxon:ID [Name]@rank" strings
((ntest++))
if grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
then
log "$MCMD --raw-taxid: taxid format check failed (full-format taxid found)"
((failed++))
else
log "$MCMD --raw-taxid: taxid format OK (all taxids are bare numbers)"
((success++))
fi
# --raw-taxid is idempotent: piping through a second obiconvert --raw-taxid must
# produce bit-for-bit identical output.
((ntest++))
if obiconvert --raw-taxid "${TMPDIR}/raw_taxid.fasta" \
> "${TMPDIR}/raw_taxid2.fasta" 2>/dev/null
then
log "$MCMD --raw-taxid piped: running OK"
((success++))
else
log "$MCMD --raw-taxid piped: running failed"
((failed++))
fi
((ntest++))
if diff "${TMPDIR}/raw_taxid.fasta" \
"${TMPDIR}/raw_taxid2.fasta" > /dev/null
then
log "$MCMD --raw-taxid piped: idempotency OK"
((success++))
else
log "$MCMD --raw-taxid piped: idempotency failed (outputs differ)"
((failed++))
fi
# ------------------------------------------------------------------
# --taxonomy tests (full-format taxid, no --raw-taxid)
# ------------------------------------------------------------------
# Running test
((ntest++))
if obiconvert --taxonomy "${TEST_DIR}/taxonomy.csv" \
"${TEST_DIR}/out_ecotag.fasta" \
> "${TMPDIR}/taxo.fasta" 2>/dev/null
then
log "$MCMD --taxonomy: running OK"
((success++))
else
log "$MCMD --taxonomy: running failed"
((failed++))
fi
# Taxids must be in full "taxon:ID [Name]@rank" format
((ntest++))
if grep '"taxid"' "${TMPDIR}/taxo.fasta" | grep -q '"taxid":"taxon:[0-9]'
then
log "$MCMD --taxonomy: taxid format OK (full-format taxids present)"
((success++))
else
log "$MCMD --taxonomy: taxid format check failed (no full-format taxid found)"
((failed++))
fi
# ------------------------------------------------------------------
# --raw-taxid --taxonomy tests
# ------------------------------------------------------------------
# Running test
((ntest++))
if obiconvert --raw-taxid --taxonomy "${TEST_DIR}/taxonomy.csv" \
"${TEST_DIR}/out_ecotag.fasta" \
> "${TMPDIR}/raw_taxid_taxo.fasta" 2>/dev/null
then
log "$MCMD --raw-taxid --taxonomy: running OK"
((success++))
else
log "$MCMD --raw-taxid --taxonomy: running failed"
((failed++))
fi
# Taxids must be bare numbers even when taxonomy is loaded
((ntest++))
if grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
then
log "$MCMD --raw-taxid --taxonomy: taxid format check failed (full-format taxid found)"
((failed++))
else
log "$MCMD --raw-taxid --taxonomy: taxid format OK (all taxids are bare numbers)"
((success++))
fi
# --raw-taxid with or without taxonomy must yield identical taxid values
((ntest++))
if diff <(grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
<(grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
> /dev/null
then
log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values match OK"
((success++))
else
log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values differ (unexpected)"
((failed++))
fi
#########################################
#
# At the end of the tests
-24
View File
@@ -1,24 +0,0 @@
>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
gattaaacctcaaaggacttggcagtgctttatacccct
>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
+29 -106
View File
@@ -17,7 +17,7 @@ import (
)
var __obi_header_value_string_pattern__ = regexp.MustCompile(`^'\s*([^']*'|"[^"]*")\s*;`)
var __obi_header_value_numeric_pattern__ = regexp.MustCompile(`^\s*[+-]?(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?\s*;`)
var __obi_header_value_numeric_pattern__ = regexp.MustCompile(`^\s*([+-]?\.\d+|[+-]?\d+(\.\d*)?([eE][+-]?\d+)?)\s*;`)
var __obi_header_map_int_key__ = regexp.MustCompile("([{,])([0-9]+):")
func __match__dict__(text []byte) []int {
@@ -146,65 +146,6 @@ func __match__key__(text []byte) []int {
return []int{} // Not a key
}
func __match__array__(text []byte) []int {
state := 0
level := 0
start := 0
instring := byte(0)
for i, r := range text {
if state == 2 {
if r == ';' {
return []int{start, i + 1}
}
if r != ' ' && r != '\t' {
return []int{}
}
}
if state == 0 {
if r == '[' {
level++
state++
start = i
continue
}
if r != ' ' && r != '\t' {
return []int{}
}
continue
}
// state == 1: inside the array
if instring != 0 {
if r == instring {
instring = 0
}
continue
}
if r == '"' || r == '\'' {
instring = r
continue
}
if r == '[' || r == '{' {
level++
continue
}
if r == ']' || r == '}' {
level--
if level == 0 {
state++
}
}
}
return []int{}
}
func __match__general__(text []byte) []int {
for i, r := range text {
@@ -301,44 +242,28 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
stop = m[1] + 1
} else {
// array value
m = __match__array__(part)
// Generic value
// m = __obi_header_value_general_pattern__.FindIndex(part)
m = __match__general__(part)
if len(m) > 0 {
bvalue = bytes.TrimSpace(part[m[0]:(m[1] - 1)])
j := bytes.ReplaceAll(bvalue, []byte("'"), []byte(`"`))
j = __obi_header_map_int_key__.ReplaceAll(j, []byte(`$1"$2":`))
arr, err := _parse_json_array_interface(j)
if err != nil {
value = string(bvalue)
if __is_false__(bvalue) {
value = false
} else {
value = arr
if __is_true__(bvalue) {
value = true
} else {
value = string(bvalue)
}
}
stop = m[1] + 1
} else {
// Generic value
// m = __obi_header_value_general_pattern__.FindIndex(part)
m = __match__general__(part)
if len(m) > 0 {
bvalue = bytes.TrimSpace(part[m[0]:(m[1] - 1)])
if __is_false__(bvalue) {
value = false
} else {
if __is_true__(bvalue) {
value = true
} else {
value = string(bvalue)
}
}
stop = m[1] + 1
} else {
// no value
break
} // End of No value
} // End of not array
// no value
break
} // End of No value
} // End of not dict
} // End of not string
} // End of not numeric
@@ -347,8 +272,6 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
case float64:
if vt == math.Floor(vt) {
annotations[key] = int(vt)
} else {
annotations[key] = vt
}
default:
annotations[key] = value
@@ -404,19 +327,19 @@ func WriteFastSeqOBIHeade(buffer *bytes.Buffer, sequence *obiseq.BioSequence) {
buffer.WriteString(fmt.Sprintf("%s=", key))
buffer.Write(tv)
buffer.WriteString("; ")
default:
if obiutils.IsAMap(value) || obiutils.IsASlice(value) || obiutils.IsAnArray(value) {
tv, err := obiutils.JsonMarshal(t)
if err != nil {
log.Fatalf("Cannot convert %v value", value)
}
tv = bytes.ReplaceAll(tv, []byte(`"`), []byte("'"))
buffer.WriteString(fmt.Sprintf("%s=", key))
buffer.Write(tv)
buffer.WriteString("; ")
} else {
buffer.WriteString(fmt.Sprintf("%s=%v; ", key, value))
case map[string]int,
map[string]string,
map[string]interface{}:
tv, err := obiutils.JsonMarshal(t)
if err != nil {
log.Fatalf("Cannot convert %v value", value)
}
tv = bytes.ReplaceAll(tv, []byte(`"`), []byte("'"))
buffer.WriteString(fmt.Sprintf("%s=", key))
buffer.Write(tv)
buffer.WriteString("; ")
default:
buffer.WriteString(fmt.Sprintf("%s=%v; ", key, value))
}
}
}
-3
View File
@@ -90,9 +90,6 @@ func FormatFastaBatch(batch obiiter.BioSequenceBatch, formater FormatHeader, ski
log.Debugf("FormatFastaBatch: #%d : %d seqs", batch.Order(), batch.Len())
for _, seq := range batch.Slice() {
if len(seq.Id()) == 0 {
log.Fatalf("Sequence identifier is empty")
}
if seq.Len() > 0 {
// Write header directly into bs — no intermediate string
bs.WriteByte('>')
-3
View File
@@ -64,9 +64,6 @@ func FormatFastqBatch(batch obiiter.BioSequenceBatch,
first := true
for _, seq := range batch.Slice() {
if len(seq.Id()) == 0 {
log.Fatalf("Sequence identifier is empty")
}
if seq.Len() > 0 {
_formatFastq(&bs, seq, formater)
+5 -5
View File
@@ -631,9 +631,9 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
return nil, fmt.Errorf("row %d has %d columns, expected %d", len(data), len(fields), len(header))
}
forward_primer := strings.TrimSpace(fields[forward_primerColIndex])
reverse_primer := strings.TrimSpace(fields[reverse_primerColIndex])
tags := _parseMainNGSFilterTags(strings.TrimSpace(fields[sample_tagColIndex]))
forward_primer := fields[forward_primerColIndex]
reverse_primer := fields[reverse_primerColIndex]
tags := _parseMainNGSFilterTags(fields[sample_tagColIndex])
marker, _ := ngsfilter.GetMarker(forward_primer, reverse_primer)
pcr, ok := marker.GetPCR(tags.Forward, tags.Reverse)
@@ -644,8 +644,8 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
i, tags.Forward, tags.Reverse, forward_primer, reverse_primer)
}
pcr.Experiment = strings.TrimSpace(fields[experimentColIndex])
pcr.Sample = strings.TrimSpace(fields[sampleColIndex])
pcr.Experiment = fields[experimentColIndex]
pcr.Sample = fields[sampleColIndex]
if extraColumns != nil {
pcr.Annotations = make(obiseq.Annotation)
+24 -18
View File
@@ -57,21 +57,34 @@ func (dist *IDistribute) Classifier() *obiseq.BioSequenceClassifier {
}
// Distribute organizes the biosequences from the iterator into batches
// based on the provided classifier. It returns an IDistribute instance
// that manages the distribution of the sequences.
// based on the provided classifier and batch sizes. It returns an
// IDistribute instance that manages the distribution of the sequences.
//
// Batches are flushed when either BatchSizeMax() sequences or BatchMem()
// bytes are accumulated per key, mirroring the RebatchBySize strategy.
func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier) IDistribute {
maxCount := obidefault.BatchSizeMax()
maxBytes := obidefault.BatchMem()
// Parameters:
// - class: A pointer to a BioSequenceClassifier used to classify
// the biosequences during distribution.
// - sizes: Optional integer values specifying the batch size. If
// no sizes are provided, a default batch size of 5000 is used.
//
// Returns:
// An IDistribute instance that contains the outputs of the
// classified biosequences, a channel for new data notifications,
// and the classifier used for distribution. The method operates
// asynchronously, processing the sequences in separate goroutines.
// It ensures that the outputs are closed and cleaned up once
// processing is complete.
func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, sizes ...int) IDistribute {
batchsize := obidefault.BatchSize()
outputs := make(map[int]IBioSequence, 100)
slices := make(map[int]*obiseq.BioSequenceSlice, 100)
bufBytes := make(map[int]int, 100)
orders := make(map[int]int, 100)
news := make(chan int)
if len(sizes) > 0 {
batchsize = sizes[0]
}
jobDone := sync.WaitGroup{}
lock := sync.Mutex{}
@@ -102,7 +115,6 @@ func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier) IDi
slice = &s
slices[key] = slice
orders[key] = 0
bufBytes[key] = 0
lock.Lock()
outputs[key] = MakeIBioSequence()
@@ -111,20 +123,14 @@ func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier) IDi
news <- key
}
sz := s.MemorySize()
countFull := maxCount > 0 && len(*slice) >= maxCount
memFull := maxBytes > 0 && bufBytes[key]+sz > maxBytes && len(*slice) > 0
if countFull || memFull {
*slice = append(*slice, s)
if len(*slice) == batchsize {
outputs[key].Push(MakeBioSequenceBatch(source, orders[key], *slice))
orders[key]++
s := obiseq.MakeBioSequenceSlice()
slices[key] = &s
slice = &s
bufBytes[key] = 0
}
*slice = append(*slice, s)
bufBytes[key] += sz
}
}
+1 -1
View File
@@ -47,7 +47,7 @@ func Encode4mer(seq *obiseq.BioSequence, buffer *[]byte) []byte {
length := slength - 3
rawseq := seq.Sequence()
if length <= 0 {
if length < 0 {
return nil
}
+55 -90
View File
@@ -4,21 +4,22 @@ import "math"
// KmerEntropy computes the entropy of a single encoded k-mer.
//
// The algorithm mirrors the Rust obiskbuilder entropy: it decodes the k-mer
// The algorithm mirrors the lowmask entropy calculation: it decodes the k-mer
// to a DNA sequence, extracts all sub-words of each size from 1 to levelMax,
// normalizes them by circular canonical form, counts their frequencies, and
// computes Shannon entropy corrected for class sizes, normalized by the
// maximum possible entropy over 4^ws raw bins.
// computes Shannon entropy normalized by the maximum possible entropy.
// The returned value is the minimum entropy across all word sizes.
//
// Correction for small sequences: the raw entropy H = log(N) - Σ f·log(f)/N
// under-estimates the true complexity when many raw words collapse to the same
// canonical form. Adding Σ f·log(class_size)/N recovers the entropy of the
// underlying uncollapsed distribution (assuming uniform mixing within each
// equivalence class).
//
// A value close to 0 indicates very low complexity (e.g. "AAAA..."),
// while a value close to 1 indicates high complexity.
//
// Parameters:
// - kmer: the encoded k-mer (2 bits per base)
// - k: the k-mer size
// - levelMax: maximum sub-word size for entropy (typically 6)
//
// Returns:
// - minimum normalized entropy across all word sizes 1..levelMax
func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
if k < 1 || levelMax < 1 {
return 1.0
@@ -34,7 +35,7 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
var seqBuf [32]byte
seq := DecodeKmer(kmer, k, seqBuf[:])
// Pre-compute nLogN lookup
// Pre-compute nLogN lookup (same as lowmask)
nLogN := make([]float64, k+1)
for i := 1; i <= k; i++ {
nLogN[i] = float64(i) * math.Log(float64(i))
@@ -50,23 +51,6 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
}
}
// Build ln(class_size) tables: for each canonical form, how many raw
// words map to it under circular normalization.
classLogSizeTables := make([][]float64, levelMax+1)
for ws := 1; ws <= levelMax; ws++ {
tableSize := 1 << (ws * 2)
classSize := make([]int, tableSize)
for code := 0; code < tableSize; code++ {
classSize[normTables[ws][code]]++
}
classLogSizeTables[ws] = make([]float64, tableSize)
for j := 0; j < tableSize; j++ {
if classSize[j] > 0 {
classLogSizeTables[ws][j] = math.Log(float64(classSize[j]))
}
}
}
minEntropy := math.MaxFloat64
for ws := 1; ws <= levelMax; ws++ {
@@ -91,13 +75,23 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
table[normWord]++
}
// Compute emax over 4^ws raw bins (uncollapsed distribution).
// Compute Shannon entropy
floatNwords := float64(nwords)
logNwords := math.Log(floatNwords)
na := tableSize // 4^ws
var sumNLogN float64
for j := 0; j < tableSize; j++ {
n := table[j]
if n > 0 {
sumNLogN += nLogN[n]
}
}
// Compute emax (maximum possible entropy for this word size)
na := CanonicalCircularKmerCount(ws)
var emax float64
if nwords < na {
emax = logNwords
emax = math.Log(float64(nwords))
} else {
cov := nwords / na
remains := nwords - (na * cov)
@@ -111,19 +105,7 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
continue
}
// Accumulate Σ f·log(f) and Σ f·log(class_size) over canonical forms.
classLogSize := classLogSizeTables[ws]
var sumNLogN, sumClassLogN float64
for j := 0; j < tableSize; j++ {
n := table[j]
if n > 0 {
sumNLogN += nLogN[n]
sumClassLogN += float64(n) * classLogSize[j]
}
}
// Corrected entropy: H_raw ≈ log(N) + (Σf·log(s) - Σf·log(f)) / N
entropy := (logNwords + sumClassLogN/floatNwords - sumNLogN/floatNwords) / emax
entropy := (logNwords - sumNLogN/floatNwords) / emax
if entropy < 0 {
entropy = 0
}
@@ -147,20 +129,24 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
// IMPORTANT: a KmerEntropyFilter is NOT safe for concurrent use.
// Each goroutine must create its own instance via NewKmerEntropyFilter.
type KmerEntropyFilter struct {
k int
levelMax int
threshold float64
nLogN []float64
normTables [][]int
classLogSizeTables [][]float64
emaxValues []float64
logNwords []float64
k int
levelMax int
threshold float64
nLogN []float64
normTables [][]int
emaxValues []float64
logNwords []float64
// Pre-allocated frequency tables reused across Entropy() calls.
// One per word size (index 0 unused). Reset to zero before each use.
freqTables [][]int
}
// NewKmerEntropyFilter creates an entropy filter with pre-computed tables.
//
// Parameters:
// - k: the k-mer size
// - levelMax: maximum sub-word size for entropy (typically 6)
// - threshold: entropy threshold (k-mers with entropy <= threshold are rejected)
func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter {
if levelMax >= k {
levelMax = k - 1
@@ -183,38 +169,20 @@ func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter
}
}
// ln(class_size) for each canonical form under circular normalization.
classLogSizeTables := make([][]float64, levelMax+1)
for ws := 1; ws <= levelMax; ws++ {
tableSize := 1 << (ws * 2)
classSize := make([]int, tableSize)
for code := 0; code < tableSize; code++ {
classSize[normTables[ws][code]]++
}
classLogSizeTables[ws] = make([]float64, tableSize)
for j := 0; j < tableSize; j++ {
if classSize[j] > 0 {
classLogSizeTables[ws][j] = math.Log(float64(classSize[j]))
}
}
}
// Pre-compute emax and logNwords per word size.
// emax uses 4^ws raw bins to match the corrected entropy.
emaxValues := make([]float64, levelMax+1)
logNwords := make([]float64, levelMax+1)
for ws := 1; ws <= levelMax; ws++ {
nw := k - ws + 1
na := 1 << (ws * 2) // 4^ws raw bins
floatNw := float64(nw)
logNwords[ws] = math.Log(floatNw)
na := CanonicalCircularKmerCount(ws)
if nw < na {
emaxValues[ws] = logNwords[ws]
logNwords[ws] = math.Log(float64(nw))
emaxValues[ws] = math.Log(float64(nw))
} else {
cov := nw / na
remains := nw - (na * cov)
f1 := float64(cov) / floatNw
f2 := float64(cov+1) / floatNw
f1 := float64(cov) / float64(nw)
f2 := float64(cov+1) / float64(nw)
logNwords[ws] = math.Log(float64(nw))
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
float64(remains)*f2*math.Log(f2))
}
@@ -227,15 +195,14 @@ func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter
}
return &KmerEntropyFilter{
k: k,
levelMax: levelMax,
threshold: threshold,
nLogN: nLogN,
normTables: normTables,
classLogSizeTables: classLogSizeTables,
emaxValues: emaxValues,
logNwords: logNwords,
freqTables: freqTables,
k: k,
levelMax: levelMax,
threshold: threshold,
nLogN: nLogN,
normTables: normTables,
emaxValues: emaxValues,
logNwords: logNwords,
freqTables: freqTables,
}
}
@@ -269,7 +236,7 @@ func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
// Count circular-canonical sub-word frequencies
tableSize := 1 << (ws * 2)
table := ef.freqTables[ws]
clear(table)
clear(table) // reset to zero
mask := (1 << (ws * 2)) - 1
normTable := ef.normTables[ws]
@@ -284,21 +251,19 @@ func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
table[normWord]++
}
// Compute Shannon entropy
floatNwords := float64(nwords)
logNwords := ef.logNwords[ws]
classLogSize := ef.classLogSizeTables[ws]
var sumNLogN, sumClassLogN float64
var sumNLogN float64
for j := 0; j < tableSize; j++ {
n := table[j]
if n > 0 {
sumNLogN += ef.nLogN[n]
sumClassLogN += float64(n) * classLogSize[j]
}
}
// Corrected entropy: H_raw ≈ log(N) + (Σf·log(s) - Σf·log(f)) / N
entropy := (logNwords + sumClassLogN/floatNwords - sumNLogN/floatNwords) / emax
entropy := (logNwords - sumNLogN/floatNwords) / emax
if entropy < 0 {
entropy = 0
}
+7 -90
View File
@@ -91,7 +91,7 @@ func LuaWorker(proto *lua.FunctionProto) obiseq.SeqWorker {
err := interpreter.PCall(0, lua.MultRet, nil)
if err != nil {
log.Fatalf("Error in executing the lua script: %v", err)
log.Fatalf("Error in executing the lua script")
}
result := interpreter.GetGlobal("worker")
@@ -141,69 +141,6 @@ func LuaWorker(proto *lua.FunctionProto) obiseq.SeqWorker {
return nil
}
// LuaSliceWorker creates a SeqSliceWorker that calls the Lua function
// named "slice_worker". Unlike LuaWorker, the entire batch (BioSequenceSlice)
// is passed to the Lua function at once, enabling batch-level processing
// (e.g. a single HTTP request per batch instead of one per sequence).
//
// The Lua function signature:
//
// function slice_worker(slice) -- receives a BioSequenceSlice
// -- process the batch
// return slice -- returns a BioSequenceSlice (or nil)
// end
func LuaSliceWorker(proto *lua.FunctionProto) obiseq.SeqSliceWorker {
interpreter := NewInterpreter()
lfunc := interpreter.NewFunctionFromProto(proto)
interpreter.Push(lfunc)
err := interpreter.PCall(0, lua.MultRet, nil)
if err != nil {
log.Fatalf("Error in executing the lua script: %v", err)
}
result := interpreter.GetGlobal("slice_worker")
if lua_worker, ok := result.(*lua.LFunction); ok {
f := func(slice obiseq.BioSequenceSlice) (obiseq.BioSequenceSlice, error) {
if err := interpreter.CallByParam(lua.P{
Fn: lua_worker,
NRet: 1,
Protect: true,
}, obiseqslice2Lua(interpreter, &slice)); err != nil {
log.Fatal(err)
}
lreponse := interpreter.Get(-1)
defer interpreter.Pop(1)
if reponse, ok := lreponse.(*lua.LUserData); ok {
s := reponse.Value
switch val := s.(type) {
case *obiseq.BioSequenceSlice:
return *val, nil
case *obiseq.BioSequence:
return obiseq.BioSequenceSlice{val}, nil
default:
r := reflect.TypeOf(val)
return nil, fmt.Errorf("slice_worker function doesn't return the correct type %s", r)
}
}
if _, ok = lreponse.(*lua.LNilType); ok {
return nil, nil
}
return nil, fmt.Errorf("slice_worker function doesn't return the correct type %T", lreponse)
}
return f
}
log.Fatalf("The slice_worker object is not a function")
return nil
}
// LuaProcessor processes a Lua script on a sequence iterator and returns a new iterator.
//
// Parameters:
@@ -236,7 +173,7 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
err = interpreter.PCall(0, lua.MultRet, nil)
if err != nil {
log.Fatalf("Error in executing the lua script: %v", err)
log.Fatalf("Error in executing the lua script")
}
result := interpreter.GetGlobal("begin")
@@ -261,7 +198,7 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
err = interpreter.PCall(0, lua.MultRet, nil)
if err != nil {
log.Fatalf("Error in executing the lua script: %v", err)
log.Fatalf("Error in executing the lua script")
}
result := interpreter.GetGlobal("finish")
@@ -279,27 +216,11 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
}()
// Detect whether the script defines slice_worker (batch-level) or worker (per-sequence).
hasSliceWorker := func() bool {
interpreter := NewInterpreter()
lfunc := interpreter.NewFunctionFromProto(proto)
interpreter.Push(lfunc)
if err := interpreter.PCall(0, lua.MultRet, nil); err != nil {
return false
}
result := interpreter.GetGlobal("slice_worker")
interpreter.Close()
_, ok := result.(*lua.LFunction)
return ok
}()
ff := func(iterator obiiter.IBioSequence) {
var sw obiseq.SeqSliceWorker
if hasSliceWorker {
sw = LuaSliceWorker(proto)
} else {
sw = obiseq.SeqToSliceWorker(LuaWorker(proto), false)
}
w := LuaWorker(proto)
sw := obiseq.SeqToSliceWorker(w, false)
// iterator = iterator.SortBatches()
for iterator.Next() {
seqs := iterator.Get()
@@ -314,10 +235,6 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
}
}
if ns == nil {
ns = obiseq.BioSequenceSlice{}
}
newIter.Push(obiiter.MakeBioSequenceBatch(seqs.Source(), seqs.Order(), ns))
}
+48 -38
View File
@@ -17,7 +17,15 @@ import (
// No return values. This function operates directly on the Lua state stack.
func pushInterfaceToLua(L *lua.LState, val interface{}) {
switch v := val.(type) {
// Typed slices and maps from internal OBITools code — not produced by json.Unmarshal
case string:
L.Push(lua.LString(v))
case bool:
L.Push(lua.LBool(v))
case int:
L.Push(lua.LNumber(v))
case float64:
L.Push(lua.LNumber(v))
// Add other cases as needed for different types
case map[string]int:
pushMapStringIntToLua(L, v)
case map[string]string:
@@ -26,6 +34,8 @@ func pushInterfaceToLua(L *lua.LState, val interface{}) {
pushMapStringBoolToLua(L, v)
case map[string]float64:
pushMapStringFloat64ToLua(L, v)
case map[string]interface{}:
pushMapStringInterfaceToLua(L, v)
case []string:
pushSliceStringToLua(L, v)
case []int:
@@ -36,61 +46,61 @@ func pushInterfaceToLua(L *lua.LState, val interface{}) {
pushSliceNumericToLua(L, v)
case []bool:
pushSliceBoolToLua(L, v)
case []interface{}:
pushSliceInterfaceToLua(L, v)
case nil:
L.Push(lua.LNil)
case *sync.Mutex:
pushMutexToLua(L, v)
default:
// Handles nil, bool, int, float64, string, map[string]interface{},
// []interface{} — all recursively via lvalueFromInterface.
L.Push(lvalueFromInterface(L, v))
log.Fatalf("Cannot deal with value (%T) : %v", val, val)
}
}
func pushMapStringInterfaceToLua(L *lua.LState, m map[string]interface{}) {
// Create a new Lua table
luaTable := L.NewTable()
// Iterate over the Go map and set the key-value pairs in the Lua table
for key, value := range m {
L.SetField(luaTable, key, lvalueFromInterface(L, value))
switch v := value.(type) {
case int:
luaTable.RawSetString(key, lua.LNumber(v))
case float64:
luaTable.RawSetString(key, lua.LNumber(v))
case bool:
luaTable.RawSetString(key, lua.LBool(v))
case string:
luaTable.RawSetString(key, lua.LString(v))
default:
log.Fatalf("Doesn't deal with map containing value %v of type %T", v, v)
}
}
// Push the Lua table onto the stack
L.Push(luaTable)
}
func pushSliceInterfaceToLua(L *lua.LState, s []interface{}) {
// Create a new Lua table
luaTable := L.NewTable()
// Iterate over the Go map and set the key-value pairs in the Lua table
for _, value := range s {
luaTable.Append(lvalueFromInterface(L, value))
switch v := value.(type) {
case int:
luaTable.Append(lua.LNumber(v))
case float64:
luaTable.Append(lua.LNumber(v))
case bool:
luaTable.Append(lua.LBool(v))
case string:
luaTable.Append(lua.LString(v))
default:
log.Fatalf("Doesn't deal with slice containing value %v of type %T", v, v)
}
}
L.Push(luaTable)
}
// lvalueFromInterface converts a Go interface{} value (as produced by json.Unmarshal)
// to the corresponding lua.LValue, handling nested maps and slices recursively.
func lvalueFromInterface(L *lua.LState, value interface{}) lua.LValue {
switch v := value.(type) {
case nil:
return lua.LNil
case bool:
return lua.LBool(v)
case int:
return lua.LNumber(v)
case float64:
return lua.LNumber(v)
case string:
return lua.LString(v)
case map[string]interface{}:
t := L.NewTable()
for key, val := range v {
L.SetField(t, key, lvalueFromInterface(L, val))
}
return t
case []interface{}:
t := L.NewTable()
for _, val := range v {
t.Append(lvalueFromInterface(L, val))
}
return t
default:
log.Fatalf("lvalueFromInterface: unsupported type %T: %v", v, v)
return lua.LNil
}
// Push the Lua table onto the stack
L.Push(luaTable)
}
// pushMapStringIntToLua creates a new Lua table and iterates over the Go map to set key-value pairs in the Lua table. It then pushes the Lua table onto the stack.
-4
View File
@@ -28,8 +28,6 @@ func Table2Interface(interpreter *lua.LState, table *lua.LTable) interface{} {
val[i-1] = float64(v.(lua.LNumber))
case lua.LTString:
val[i-1] = string(v.(lua.LString))
case lua.LTTable:
val[i-1] = Table2Interface(interpreter, v.(*lua.LTable))
}
}
return val
@@ -47,8 +45,6 @@ func Table2Interface(interpreter *lua.LState, table *lua.LTable) interface{} {
val[string(ks)] = float64(v.(lua.LNumber))
case lua.LTString:
val[string(ks)] = string(v.(lua.LString))
case lua.LTTable:
val[string(ks)] = Table2Interface(interpreter, v.(*lua.LTable))
}
}
})
-128
View File
@@ -1,128 +0,0 @@
package obilua
import (
"context"
"io"
"net/http"
"strings"
"sync"
"time"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
lua "github.com/yuin/gopher-lua"
)
const httpClientTimeout = 300 * time.Second
var (
_httpClient *http.Client
_httpClientOnce sync.Once
// _httpSemaphore limits the number of concurrent HTTP requests.
// Initialised lazily alongside the client.
_httpSemaphore chan struct{}
)
func getHTTPClient() *http.Client {
_httpClientOnce.Do(func() {
conns := 2 * obidefault.ParallelWorkers()
_httpClient = &http.Client{
Transport: &http.Transport{
MaxIdleConnsPerHost: conns,
MaxConnsPerHost: conns,
IdleConnTimeout: 90 * time.Second,
},
Timeout: httpClientTimeout,
}
_httpSemaphore = make(chan struct{}, obidefault.ParallelWorkers())
})
return _httpClient
}
// RegisterHTTP registers the http module in the Lua state as a global,
// consistent with obicontext and BioSequence.
//
// Exposes:
//
// http.post(url, body [, timeout_ms]) → response string (on success)
// http.post(url, body [, timeout_ms]) → nil, err string (on error)
// http.set_concurrency(n) → set max simultaneous requests
func RegisterHTTP(luaState *lua.LState) {
table := luaState.NewTable()
luaState.SetField(table, "post", luaState.NewFunction(luaHTTPPost))
luaState.SetField(table, "set_concurrency", luaState.NewFunction(luaHTTPSetConcurrency))
luaState.SetGlobal("http", table)
}
// luaHTTPPost implements http.post(url, body [, timeout_ms]) for Lua.
//
// The optional third argument overrides the default timeout (in milliseconds).
// Concurrent requests are throttled through _httpSemaphore so that a
// single-threaded backend server is not overwhelmed by K parallel workers.
//
// Lua signature:
//
// local response = http.post(url, body)
// local response = http.post(url, body, 5000) -- 5 s timeout
// local response, err = http.post(url, body)
func luaHTTPPost(L *lua.LState) int {
url := L.CheckString(1)
body := L.CheckString(2)
client := getHTTPClient()
timeout := httpClientTimeout
if L.GetTop() >= 3 {
ms := L.CheckInt(3)
timeout = time.Duration(ms) * time.Millisecond
}
// Acquire semaphore slot — blocks until a slot is free.
_httpSemaphore <- struct{}{}
defer func() { <-_httpSemaphore }()
ctx, cancel := context.WithTimeout(context.Background(), timeout)
defer cancel()
req, err := http.NewRequestWithContext(ctx, http.MethodPost, url, strings.NewReader(body))
if err != nil {
L.Push(lua.LNil)
L.Push(lua.LString(err.Error()))
return 2
}
req.Header.Set("Content-Type", "application/json")
resp, err := client.Do(req)
if err != nil {
L.Push(lua.LNil)
L.Push(lua.LString(err.Error()))
return 2
}
defer resp.Body.Close()
respBytes, err := io.ReadAll(resp.Body)
if err != nil {
L.Push(lua.LNil)
L.Push(lua.LString(err.Error()))
return 2
}
L.Push(lua.LString(respBytes))
return 1
}
// luaHTTPSetConcurrency replaces the semaphore with a new one of size n.
// Must be called before the first http.post (e.g. in begin()).
//
// Lua signature:
//
// http.set_concurrency(1) -- serialise all HTTP requests
func luaHTTPSetConcurrency(L *lua.LState) int {
n := L.CheckInt(1)
if n < 1 {
n = 1
}
getHTTPClient() // ensure singleton is initialised
_httpSemaphore = make(chan struct{}, n)
return 0
}
-71
View File
@@ -1,71 +0,0 @@
package obilua
import (
"encoding/json"
lua "github.com/yuin/gopher-lua"
)
// RegisterJSON registers the json module in the Lua state as a global,
// consistent with obicontext, BioSequence, and http.
//
// Exposes:
//
// json.encode(data) → string (on success)
// json.encode(data) → nil, err (on error)
// json.decode(string) → value (on success)
// json.decode(string) → nil, err (on error)
func RegisterJSON(luaState *lua.LState) {
table := luaState.NewTable()
luaState.SetField(table, "encode", luaState.NewFunction(luaJSONEncode))
luaState.SetField(table, "decode", luaState.NewFunction(luaJSONDecode))
luaState.SetGlobal("json", table)
}
// luaJSONEncode implements json.encode(data) for Lua.
func luaJSONEncode(L *lua.LState) int {
val := L.CheckAny(1)
var goVal interface{}
switch v := val.(type) {
case *lua.LTable:
goVal = Table2Interface(L, v)
case lua.LString:
goVal = string(v)
case lua.LNumber:
goVal = float64(v)
case lua.LBool:
goVal = bool(v)
case *lua.LNilType:
goVal = nil
default:
L.Push(lua.LNil)
L.Push(lua.LString("json.encode: unsupported type"))
return 2
}
b, err := json.Marshal(goVal)
if err != nil {
L.Push(lua.LNil)
L.Push(lua.LString(err.Error()))
return 2
}
L.Push(lua.LString(b))
return 1
}
// luaJSONDecode implements json.decode(string) for Lua.
func luaJSONDecode(L *lua.LState) int {
s := L.CheckString(1)
var goVal interface{}
if err := json.Unmarshal([]byte(s), &goVal); err != nil {
L.Push(lua.LNil)
L.Push(lua.LString(err.Error()))
return 2
}
pushInterfaceToLua(L, goVal)
return 1
}
-184
View File
@@ -1,184 +0,0 @@
package obilua
import (
"testing"
lua "github.com/yuin/gopher-lua"
)
// runLua executes a Lua snippet inside a fresh interpreter and returns the
// LState so the caller can inspect the stack.
func runLua(t *testing.T, script string) *lua.LState {
t.Helper()
L := NewInterpreter()
if err := L.DoString(script); err != nil {
t.Fatalf("Lua error: %v", err)
}
return L
}
// TestJSONEncodeScalar verifies that simple scalars are encoded correctly.
func TestJSONEncodeScalar(t *testing.T) {
cases := []struct {
script string
expected string
}{
{`result = json.encode("hello")`, `"hello"`},
{`result = json.encode(42)`, `42`},
{`result = json.encode(true)`, `true`},
}
for _, tc := range cases {
L := runLua(t, tc.script)
got := string(L.GetGlobal("result").(lua.LString))
if got != tc.expected {
t.Errorf("encode(%s): got %q, want %q", tc.script, got, tc.expected)
}
L.Close()
}
}
// TestJSONEncodeTable verifies that a Lua table (array and map) encodes to JSON.
func TestJSONEncodeTable(t *testing.T) {
L := runLua(t, `result = json.encode({a = 1, b = "x"})`)
got := string(L.GetGlobal("result").(lua.LString))
// json.Marshal produces deterministic output for maps in Go 1.12+... actually not.
// Just check it round-trips via decode instead.
L.Close()
if got == "" {
t.Fatal("encode returned empty string")
}
}
// TestJSONDecodeScalar verifies that JSON scalars decode to the right Lua types.
func TestJSONDecodeScalar(t *testing.T) {
L := runLua(t, `
s = json.decode('"hello"')
n = json.decode('3.14')
b = json.decode('true')
`)
if s, ok := L.GetGlobal("s").(lua.LString); !ok || string(s) != "hello" {
t.Errorf("decode string: got %v", L.GetGlobal("s"))
}
if n, ok := L.GetGlobal("n").(lua.LNumber); !ok || float64(n) != 3.14 {
t.Errorf("decode number: got %v", L.GetGlobal("n"))
}
if b, ok := L.GetGlobal("b").(lua.LBool); !ok || !bool(b) {
t.Errorf("decode bool: got %v", L.GetGlobal("b"))
}
L.Close()
}
// TestJSONRoundTripFlat verifies a flat table survives encode → decode.
func TestJSONRoundTripFlat(t *testing.T) {
L := runLua(t, `
original = {name = "Homo_sapiens", score = 1.0, valid = true}
encoded = json.encode(original)
decoded = json.decode(encoded)
`)
decoded, ok := L.GetGlobal("decoded").(*lua.LTable)
if !ok {
t.Fatal("decoded is not a table")
}
if v := decoded.RawGetString("name"); string(v.(lua.LString)) != "Homo_sapiens" {
t.Errorf("name: got %v", v)
}
if v := decoded.RawGetString("score"); float64(v.(lua.LNumber)) != 1.0 {
t.Errorf("score: got %v", v)
}
if v := decoded.RawGetString("valid"); !bool(v.(lua.LBool)) {
t.Errorf("valid: got %v", v)
}
L.Close()
}
// TestJSONRoundTripNested verifies a 3-level nested structure (kmindex response)
// survives encode → decode with correct values at every level.
func TestJSONRoundTripNested(t *testing.T) {
L := NewInterpreter()
// Inject the JSON string as a Lua global to avoid quoting issues.
L.SetGlobal("kmindex_json", lua.LString(
`{"Human":{"query_001":{"Homo_sapiens--GCF_000001405_40":1.0}}}`,
))
if err := L.DoString(`
data = json.decode(kmindex_json)
reencoded = json.encode(data)
data2 = json.decode(reencoded)
`); err != nil {
t.Fatalf("Lua error: %v", err)
}
// Navigate data["Human"]["query_001"]["Homo_sapiens--GCF_000001405_40"]
data, ok := L.GetGlobal("data").(*lua.LTable)
if !ok {
t.Fatal("data is not a table")
}
human, ok := data.RawGetString("Human").(*lua.LTable)
if !ok {
t.Fatal("data.Human is not a table")
}
query, ok := human.RawGetString("query_001").(*lua.LTable)
if !ok {
t.Fatal("data.Human.query_001 is not a table")
}
score, ok := query.RawGetString("Homo_sapiens--GCF_000001405_40").(lua.LNumber)
if !ok || float64(score) != 1.0 {
t.Errorf("score: got %v, want 1.0", query.RawGetString("Homo_sapiens--GCF_000001405_40"))
}
// Same check on the re-encoded+decoded version
data2, ok := L.GetGlobal("data2").(*lua.LTable)
if !ok {
t.Fatal("data2 is not a table")
}
score2 := data2.RawGetString("Human").(*lua.LTable).
RawGetString("query_001").(*lua.LTable).
RawGetString("Homo_sapiens--GCF_000001405_40").(lua.LNumber)
if float64(score2) != 1.0 {
t.Errorf("data2 score: got %v, want 1.0", score2)
}
L.Close()
}
// TestJSONDecodeArray verifies that a JSON array decodes to a Lua array table.
func TestJSONDecodeArray(t *testing.T) {
L := runLua(t, `arr = json.decode('[1, 2, 3]')`)
arr, ok := L.GetGlobal("arr").(*lua.LTable)
if !ok {
t.Fatal("arr is not a table")
}
for i, expected := range []float64{1, 2, 3} {
v, ok := arr.RawGetInt(i + 1).(lua.LNumber)
if !ok || float64(v) != expected {
t.Errorf("arr[%d]: got %v, want %v", i+1, arr.RawGetInt(i+1), expected)
}
}
L.Close()
}
// TestJSONEncodeError verifies that json.encode on an unsupported type returns nil + error.
func TestJSONEncodeError(t *testing.T) {
L := runLua(t, `
local result, err = json.encode(nil)
`)
// nil encodes to JSON "null" — not an error
L.Close()
}
// TestJSONDecodeError verifies that malformed JSON returns nil + error string.
func TestJSONDecodeError(t *testing.T) {
L := runLua(t, `
local result, err = json.decode("not valid json")
decode_ok = (result == nil)
decode_has_err = (err ~= nil)
`)
if L.GetGlobal("decode_ok") != lua.LTrue {
t.Error("expected nil result on decode error")
}
if L.GetGlobal("decode_has_err") != lua.LTrue {
t.Error("expected error string on decode error")
}
L.Close()
}
-2
View File
@@ -5,6 +5,4 @@ import lua "github.com/yuin/gopher-lua"
func RegisterObilib(luaState *lua.LState) {
RegisterObiSeq(luaState)
RegisterObiTaxonomy(luaState)
RegisterHTTP(luaState)
RegisterJSON(luaState)
}
+1 -2
View File
@@ -31,8 +31,7 @@ func obiseqslice2Lua(interpreter *lua.LState,
}
func newObiSeqSlice(luaState *lua.LState) int {
capacity := luaState.OptInt(1, 0)
seqslice := obiseq.NewBioSequenceSlice(capacity)
seqslice := obiseq.NewBioSequenceSlice()
luaState.Push(obiseqslice2Lua(luaState, seqslice))
return 1
}
+1 -1
View File
@@ -3,7 +3,7 @@ package obioptions
// Version is automatically updated by the Makefile from version.txt
// The patch number (third digit) is incremented on each push to the repository
var _Version = "Release 4.4.46"
var _Version = "Release 4.4.27"
// Version returns the version of the obitools package.
//
-18
View File
@@ -364,24 +364,6 @@ func (s *BioSequence) GetIntSlice(key string) ([]int, bool) {
return val, ok
}
func (s *BioSequence) GetMapOfIntSlice(key string) (map[string][]int, bool) {
v, ok := s.GetAttribute(key)
if !ok {
return nil, false
}
val, err := obiutils.InterfaceToMapOfIntSlice(v)
return val, err == nil
}
func (s *BioSequence) GetMapOfStringSlice(key string) (map[string][]string, bool) {
v, ok := s.GetAttribute(key)
if !ok {
return nil, false
}
val, err := obiutils.InterfaceToMapOfStringSlice(v)
return val, err == nil
}
// Count returns the value of the "count" attribute of the BioSequence.
//
// The count of a sequence is the number of times it has been observed in the dataset.
-6
View File
@@ -499,9 +499,6 @@ func (s *BioSequence) SetQualities(qualities Quality) {
if s.qualities != nil {
RecycleSlice(&s.qualities)
}
if len(qualities) > 0 && len(qualities) != len(s.sequence) {
log.Panicf("[BioSequence.SetQualities] Sequence %s has a length of %d and qualities a length of %d", s.id, len(s.sequence), len(qualities))
}
s.qualities = CopySlice(qualities)
}
@@ -511,9 +508,6 @@ func (s *BioSequence) TakeQualities(qualities Quality) {
if s.qualities != nil {
RecycleSlice(&s.qualities)
}
if len(qualities) > 0 && len(qualities) != len(s.sequence) {
log.Panicf("[BioSequence.TakeQualities] Sequence %s has a length of %d and qualities a length of %d", s.id, len(s.sequence), len(qualities))
}
s.qualities = qualities
}
+1 -1
View File
@@ -103,7 +103,7 @@ func TestNewBioSequence(t *testing.T) {
// Return type: None.
func TestNewBioSequenceWithQualities(t *testing.T) {
id := "123"
sequence := []byte("atgc")
sequence := []byte("ATGC")
definition := "DNA sequence"
qualities := []byte("1234")
-27
View File
@@ -141,33 +141,6 @@ var OBILang = gval.NewLanguage(
gval.Function("max", func(args ...interface{}) (interface{}, error) {
return obiutils.Max(args[0])
}),
gval.Function("whichmax", func(args ...interface{}) (interface{}, error) {
result, err := obiutils.WhichMax(args[0])
if idx, ok := result.(int); ok {
return float64(idx), nil
}
return result, err
}),
gval.Function("whichmin", func(args ...interface{}) (interface{}, error) {
result, err := obiutils.WhichMin(args[0])
if idx, ok := result.(int); ok {
return float64(idx), nil
}
return result, err
}),
gval.Function("filtermin", func(args ...interface{}) (interface{}, error) {
return obiutils.FilterMin(args[0], args[1])
}),
gval.Function("filtermax", func(args ...interface{}) (interface{}, error) {
return obiutils.FilterMax(args[0], args[1])
}),
gval.Function("saturatingsub", func(args ...interface{}) (interface{}, error) {
return obiutils.SaturatingSub(args[0], args[1])
}),
gval.Function("contains", func(args ...interface{}) (interface{}, error) {
if obiutils.IsAMap(args[0]) {
val := reflect.ValueOf(args[0]).MapIndex(reflect.ValueOf(args[1]))
-3
View File
@@ -118,9 +118,6 @@ func (sequence *BioSequence) _revcmpMutation() *BioSequence {
*/
func ReverseComplementWorker(inplace bool) SeqWorker {
f := func(input *BioSequence) (BioSequenceSlice, error) {
if input.IsPaired() {
input.PairedWith().ReverseComplement(inplace)
}
return BioSequenceSlice{input.ReverseComplement(inplace)}, nil
}
+2 -20
View File
@@ -48,16 +48,7 @@ func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSeque
newSeq.sequence = CopySlice(sequence.Sequence()[from:to])
if sequence.HasQualities() {
qual := sequence.Qualities()
if len(qual) != sequence.Len() {
log.Panicf(
"[BioSequence.Subsequence] Sequence %s has a length of %d and qualities a length of %d",
sequence.Id(),
sequence.Len(),
len(qual),
)
}
newSeq.qualities = CopySlice(qual[from:to])
newSeq.qualities = CopySlice(sequence.Qualities()[from:to])
}
newSeq.id = fmt.Sprintf("%s_sub[%d..%d]", sequence.Id(), from+1, to)
@@ -67,16 +58,7 @@ func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSeque
newSeq.Write(sequence.Sequence()[0:to])
if sequence.HasQualities() {
qual := sequence.Qualities()
if len(qual) != sequence.Len() {
log.Panicf(
"[BioSequence.Subsequence] Sequence %s has a length of %d and qualities a length of %d",
sequence.Id(),
sequence.Len(),
len(qual),
)
}
newSeq.WriteQualities(qual[0:to])
newSeq.WriteQualities(sequence.Qualities()[0:to])
}
}
+1 -7
View File
@@ -70,12 +70,6 @@ func (s *BioSequence) SetTaxid(taxid string, rank ...string) {
}
}
} else if obidefault.UseRawTaxids() {
// Without a loaded taxonomy, extract the bare ID from full-format strings
// like "code:12345 [Name]@rank" so that --raw-taxid is honoured everywhere.
if _, rawID, _, _, parseErr := obitax.ParseTaxonString(taxid); parseErr == nil {
taxid = rawID
}
}
}
@@ -183,7 +177,7 @@ func (sequence *BioSequence) SetPath(taxonomy *obitax.Taxonomy) []string {
lpath := path.Len() - 1
for i := lpath; i >= 0; i-- {
spath[lpath-i] = path.Get(i).FullString(taxonomy.Code())
spath[lpath-i] = path.Get(i).String(taxonomy.Code())
}
sequence.SetAttribute("taxonomic_path", spath)
+4 -4
View File
@@ -104,11 +104,11 @@ func SeqToSliceWorker(worker SeqWorker,
for _, s := range input {
r, err := worker(s)
if err == nil {
if i+len(r) > cap(output) {
output = slices.Grow(output[:i], len(r))
output = output[:cap(output)]
}
for _, rs := range r {
if i == len(output) {
output = slices.Grow(output, cap(output))
output = output[:cap(output)]
}
output[i] = rs
i++
}
+13 -19
View File
@@ -29,24 +29,6 @@ type TaxNode struct {
alternatenames *map[*string]*string
}
// FullString returns the full string representation of the TaxNode in the form
// "taxonomyCode:id [scientificName]@rank", regardless of the UseRawTaxids setting.
// This is used internally when a parseable format is required (e.g. taxonomic_path).
func (node *TaxNode) FullString(taxonomyCode string) string {
if node.HasScientificName() {
return fmt.Sprintf("%s:%v [%s]@%s",
taxonomyCode,
*node.id,
node.ScientificName(),
node.Rank(),
)
}
return fmt.Sprintf("%s:%v",
taxonomyCode,
*node.id)
}
// String returns a string representation of the TaxNode, including the taxonomy code,
// the node ID, and the scientific name. The output format is "taxonomyCode:id [scientificName]".
//
@@ -60,7 +42,19 @@ func (node *TaxNode) String(taxonomyCode string) string {
return *node.id
}
return node.FullString(taxonomyCode)
if node.HasScientificName() {
return fmt.Sprintf("%s:%v [%s]@%s",
taxonomyCode,
*node.id,
node.ScientificName(),
node.Rank(),
)
}
return fmt.Sprintf("%s:%v",
taxonomyCode,
*node.id)
}
// Id returns the unique identifier of the TaxNode.
-1
View File
@@ -33,7 +33,6 @@ func CLIWriteSequenceCSV(iterator obiiter.IBioSequence,
CSVSequence(CLIPrintSequence()),
CSVQuality(CLIPrintQuality()),
CSVAutoColumn(CLIAutoColumns()),
CSVNAValue(CLINAValue()),
)
csvIter := NewCSVSequenceIterator(iterator, opts...)
+1 -13
View File
@@ -1,7 +1,6 @@
package obicsv
import (
"fmt"
"log"
"slices"
@@ -68,19 +67,8 @@ func CSVBatchFromSequences(batch obiiter.BioSequenceBatch, opt Options) obiiterc
if taxon != nil {
taxid = taxon.String()
} else if ta, ok := sequence.GetAttribute("taxid"); ok {
switch tv := ta.(type) {
case string:
taxid = tv
case int:
taxid = fmt.Sprintf("%d", tv)
case float64:
taxid = fmt.Sprintf("%d", int(tv))
default:
taxid = opt.CSVNAValue()
}
} else {
taxid = opt.CSVNAValue()
taxid = sequence.Taxid()
}
record["taxid"] = taxid
+2 -1
View File
@@ -46,7 +46,8 @@ func CLIDistributeSequence(sequences obiiter.IBioSequence) {
formater = obiformats.WriteSequencesToFile
}
dispatcher := sequences.Distribute(CLISequenceClassifier())
dispatcher := sequences.Distribute(CLISequenceClassifier(),
obidefault.BatchSize())
obiformats.WriterDispatcher(CLIFileNamePattern(),
dispatcher, formater, opts...,
+2 -4
View File
@@ -21,10 +21,12 @@ func PairingOptionSet(options *getoptions.GetOpt) {
options.StringVar(&_ForwardFile, "forward-reads", "",
options.Alias("F"),
options.ArgName("FILENAME_F"),
options.Required("You must provide at a forward file"),
options.Description("The file names containing the forward reads"))
options.StringVar(&_ReverseFile, "reverse-reads", "",
options.Alias("R"),
options.ArgName("FILENAME_R"),
options.Required("You must provide a reverse file"),
options.Description("The file names containing the reverse reads"))
options.IntVar(&_Delta, "delta", _Delta,
options.Alias("D"),
@@ -70,10 +72,6 @@ func CLIPairedSequence() (obiiter.IBioSequence, error) {
return paired, nil
}
func CLIHasPairedFiles() bool {
return _ForwardFile != "" && _ReverseFile != ""
}
func CLIDelta() int {
return _Delta
}
+3 -27
View File
@@ -99,17 +99,6 @@ func (data1 *DataSummary) Add(data2 *DataSummary) *DataSummary {
rep.sample_singletons = sumUpdateIntMap(data1.sample_singletons, data2.sample_singletons)
rep.sample_obiclean_bad = sumUpdateIntMap(data1.sample_obiclean_bad, data2.sample_obiclean_bad)
for k, m1 := range data1.map_summaries {
rep.map_summaries[k] = m1
}
for k, m2 := range data2.map_summaries {
if m1, ok := rep.map_summaries[k]; ok {
rep.map_summaries[k] = sumUpdateIntMap(m1, m2)
} else {
rep.map_summaries[k] = m2
}
}
return rep
}
@@ -174,9 +163,8 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
summaries := make([]*DataSummary, nproc)
for n := 0; n < nproc; n++ {
summaries[n] = NewDataSummary()
for _, v := range summarise {
summaries[n].map_summaries[v] = make(map[string]int)
summaries[n].map_summaries[v] = make(map[string]int, 0)
}
}
@@ -186,11 +174,6 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
batch := iseq.Get()
for _, seq := range batch.Slice() {
summary.Update(seq)
for _, attr := range summarise {
if m, ok := seq.GetIntMap(attr); ok {
summary.map_summaries[attr] = sumUpdateIntMap(summary.map_summaries[attr], m)
}
}
}
}
waiter.Done()
@@ -198,9 +181,11 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
waiter.Add(nproc)
summaries[0] = NewDataSummary()
go ff(iterator, summaries[0])
for i := 1; i < nproc; i++ {
summaries[i] = NewDataSummary()
go ff(iterator.Split(), summaries[i])
}
@@ -261,14 +246,5 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
}
}
}
if len(rep.map_summaries) > 0 {
mapDict := make(map[string]interface{}, len(rep.map_summaries))
for attr, counts := range rep.map_summaries {
mapDict[attr] = counts
}
dict["map_summaries"] = mapDict
}
return dict
}
+4 -4
View File
@@ -114,10 +114,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
aanot["obimultiplex_direction"] = direction
aanot["obimultiplex_forward_match"] = forward_match
aanot["obimultiplex_forward_error"] = forward_mismatches
aanot["obimultiplex_forward_mismatches"] = forward_mismatches
aanot["obimultiplex_reverse_match"] = reverse_match
aanot["obimultiplex_reverse_error"] = reverse_mismatches
aanot["obimultiplex_reverse_mismatches"] = reverse_mismatches
aanot["sample"] = sample
aanot["experiment"] = experiment
@@ -125,10 +125,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
banot["obimultiplex_direction"] = direction
banot["obimultiplex_forward_match"] = forward_match
banot["obimultiplex_forward_error"] = forward_mismatches
banot["obimultiplex_forward_mismatches"] = forward_mismatches
banot["obimultiplex_reverse_match"] = reverse_match
banot["obimultiplex_reverse_error"] = reverse_mismatches
banot["obimultiplex_reverse_mismatches"] = reverse_mismatches
banot["sample"] = sample
banot["experiment"] = experiment
-38
View File
@@ -276,44 +276,6 @@ func InterfaceToStringMap(i interface{}) (val map[string]string, err error) {
return
}
func InterfaceToMapOfIntSlice(i interface{}) (val map[string][]int, err error) {
err = nil
switch m := i.(type) {
case map[string][]int:
val = m
case map[string]interface{}:
val = make(map[string][]int, len(m))
for k, v := range m {
val[k], err = InterfaceToIntSlice(v)
if err != nil {
return
}
}
default:
err = &NotAMapInt{"value attribute cannot be casted to a map[string][]int"}
}
return
}
func InterfaceToMapOfStringSlice(i interface{}) (val map[string][]string, err error) {
err = nil
switch m := i.(type) {
case map[string][]string:
val = m
case map[string]interface{}:
val = make(map[string][]string, len(m))
for k, v := range m {
val[k], err = InterfaceToStringSlice(v)
if err != nil {
return
}
}
default:
err = &NotAMapInt{"value attribute cannot be casted to a map[string][]string"}
}
return
}
func InterfaceToStringSlice(i interface{}) (val []string, err error) {
err = nil
+4 -365
View File
@@ -34,26 +34,6 @@ func MinMaxSlice[T constraints.Ordered](vec []T) (min, max T) {
return
}
func FilterMinSlice[T constraints.Ordered](vec []T, minimum T) []T {
result := make([]T, 0, len(vec))
for _, v := range vec {
if v >= minimum {
result = append(result, v)
}
}
return result
}
func FilterMaxSlice[T constraints.Ordered](vec []T, maximum T) []T {
result := make([]T, 0, len(vec))
for _, v := range vec {
if v <= maximum {
result = append(result, v)
}
}
return result
}
func MaxMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
var maxKey K
var maxValue T
@@ -93,46 +73,6 @@ func MinMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
return minKey, minValue, nil
}
func FilterMinMap[K comparable, T constraints.Ordered](values map[K]T, minimum T) map[K]T {
result := make(map[K]T)
for k, v := range values {
if v >= minimum {
result[k] = v
}
}
return result
}
func FilterMaxMap[K comparable, T constraints.Ordered](values map[K]T, maximum T) map[K]T {
result := make(map[K]T)
for k, v := range values {
if v <= maximum {
result[k] = v
}
}
return result
}
func SaturatingSubSlice[T Numeric](vec []T, sub T) []T {
result := make([]T, len(vec))
for i, v := range vec {
if v > sub {
result[i] = v - sub
}
}
return result
}
func SaturatingSubMap[K comparable, T Numeric](values map[K]T, sub T) map[K]T {
result := make(map[K]T)
for k, v := range values {
if v > sub {
result[k] = v - sub
}
}
return result
}
// Min returns the smallest element in a slice/array or map,
// or the value itself if data is a single comparable value.
// Returns an error if the container is empty or the type is unsupported.
@@ -195,121 +135,11 @@ func Max(data interface{}) (interface{}, error) {
}
}
func FilterMin(data interface{}, minimum interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return filterMinFromIterable(v, minimum)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return filterMinFromMap(v, minimum)
default:
if !isOrderedKind(v.Kind()) {
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
return data, nil
}
}
func FilterMax(data interface{}, maximum interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return filterMaxFromIterable(v, maximum)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return filterMaxFromMap(v, maximum)
default:
if !isOrderedKind(v.Kind()) {
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
return data, nil
}
}
func SaturatingSub(data interface{}, sub interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
return saturatingSubFromIterable(v, sub)
case reflect.Map:
return saturatingSubFromMap(v, sub)
default:
if !isNumericKind(v.Kind()) {
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
r, err := saturatingSubValues(v, reflect.ValueOf(sub))
if err != nil {
return nil, err
}
return r.Interface(), nil
}
}
func saturatingSubFromIterable(v reflect.Value, sub interface{}) (interface{}, error) {
subVal := reflect.ValueOf(sub)
result := reflect.MakeSlice(v.Type(), v.Len(), v.Len())
for i := 0; i < v.Len(); i++ {
r, err := saturatingSubValues(v.Index(i), subVal)
if err != nil {
return nil, err
}
result.Index(i).Set(r)
}
return result.Interface(), nil
}
func saturatingSubFromMap(v reflect.Value, sub interface{}) (interface{}, error) {
subVal := reflect.ValueOf(sub)
result := reflect.MakeMap(v.Type())
for _, key := range v.MapKeys() {
r, err := saturatingSubValues(v.MapIndex(key), subVal)
if err != nil {
return nil, err
}
if !r.IsZero() {
result.SetMapIndex(key, r)
}
}
return result.Interface(), nil
}
func saturatingSubValues(a, b reflect.Value) (reflect.Value, error) {
result := reflect.New(a.Type()).Elem()
switch a.Kind() {
case reflect.Int, reflect.Int8, reflect.Int16, reflect.Int32, reflect.Int64:
if av, bv := a.Int(), b.Int(); av > bv {
result.SetInt(av - bv)
}
case reflect.Uint, reflect.Uint8, reflect.Uint16, reflect.Uint32, reflect.Uint64:
if av, bv := a.Uint(), b.Uint(); av > bv {
result.SetUint(av - bv)
}
case reflect.Float32, reflect.Float64:
if av, bv := a.Float(), b.Float(); av > bv {
result.SetFloat(av - bv)
}
default:
return reflect.Value{}, fmt.Errorf("unsupported type for saturating subtraction: %s", a.Kind())
}
return result, nil
}
// maxFromIterable scans a slice/array to find the maximum.
func maxFromIterable(v reflect.Value) (interface{}, error) {
var best reflect.Value
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
elem := v.Index(i)
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
@@ -324,7 +154,7 @@ func maxFromIterable(v reflect.Value) (interface{}, error) {
func minFromIterable(v reflect.Value) (interface{}, error) {
var minVal reflect.Value
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
elem := v.Index(i)
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
@@ -335,182 +165,12 @@ func minFromIterable(v reflect.Value) (interface{}, error) {
return minVal.Interface(), nil
}
func filterMinFromIterable(v reflect.Value, minimum interface{}) (interface{}, error) {
minVal := reflect.ValueOf(minimum)
result := reflect.MakeSlice(v.Type(), 0, v.Len())
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !less(elem, minVal) { // elem >= minimum
result = reflect.Append(result, elem)
}
}
return result.Interface(), nil
}
func filterMaxFromIterable(v reflect.Value, maximum interface{}) (interface{}, error) {
maxVal := reflect.ValueOf(maximum)
result := reflect.MakeSlice(v.Type(), 0, v.Len())
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !greater(elem, maxVal) { // elem <= maximum
result = reflect.Append(result, elem)
}
}
return result.Interface(), nil
}
// whichMaxFromIterable returns the index of the maximum element in a slice/array.
func whichMaxFromIterable(v reflect.Value) (int, error) {
var best reflect.Value
bestIdx := 0
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if i == 0 || greater(elem, best) {
best = elem
bestIdx = i
}
}
return bestIdx, nil
}
// whichMinFromIterable returns the index of the minimum element in a slice/array.
func whichMinFromIterable(v reflect.Value) (int, error) {
var minVal reflect.Value
minIdx := 0
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if i == 0 || less(elem, minVal) {
minVal = elem
minIdx = i
}
}
return minIdx, nil
}
// whichMaxFromMap returns the key associated with the maximum value in a map.
func whichMaxFromMap(v reflect.Value) (interface{}, error) {
var best reflect.Value
var bestKey reflect.Value
first := true
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if first || greater(elem, best) {
best = elem
bestKey = key
first = false
}
}
return bestKey.Interface(), nil
}
// whichMinFromMap returns the key associated with the minimum value in a map.
func whichMinFromMap(v reflect.Value) (interface{}, error) {
var minVal reflect.Value
var minKey reflect.Value
first := true
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if first || less(elem, minVal) {
minVal = elem
minKey = key
first = false
}
}
return minKey.Interface(), nil
}
// WhichMax returns the key (for a map) or index (for a slice/array) of the maximum value.
func WhichMax(data interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return whichMaxFromIterable(v)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return whichMaxFromMap(v)
default:
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
}
// WhichMin returns the key (for a map) or index (for a slice/array) of the minimum value.
func WhichMin(data interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return whichMinFromIterable(v)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return whichMinFromMap(v)
default:
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
}
func filterMinFromMap(v reflect.Value, minimum interface{}) (interface{}, error) {
minVal := reflect.ValueOf(minimum)
result := reflect.MakeMap(v.Type())
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !less(elem, minVal) { // elem >= minimum
result.SetMapIndex(key, elem)
}
}
return result.Interface(), nil
}
func filterMaxFromMap(v reflect.Value, maximum interface{}) (interface{}, error) {
maxVal := reflect.ValueOf(maximum)
result := reflect.MakeMap(v.Type())
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !greater(elem, maxVal) { // elem <= maximum
result.SetMapIndex(key, elem)
}
}
return result.Interface(), nil
}
// maxFromMap scans map values to find the maximum.
func maxFromMap(v reflect.Value) (interface{}, error) {
var best reflect.Value
first := true
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
elem := v.MapIndex(key)
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
@@ -527,7 +187,7 @@ func minFromMap(v reflect.Value) (interface{}, error) {
var minVal reflect.Value
first := true
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
elem := v.MapIndex(key)
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
@@ -539,27 +199,6 @@ func minFromMap(v reflect.Value) (interface{}, error) {
return minVal.Interface(), nil
}
func isNumericKind(k reflect.Kind) bool {
switch k {
case reflect.Int, reflect.Int8, reflect.Int16, reflect.Int32, reflect.Int64,
reflect.Uint, reflect.Uint8, reflect.Uint16, reflect.Uint32, reflect.Uint64,
reflect.Float32, reflect.Float64:
return true
default:
return false
}
}
// unwrapInterface returns v.Elem() when v holds an interface value, otherwise v unchanged.
// This is necessary when iterating map[string]interface{} or []interface{} via reflection:
// the element Kind is reflect.Interface, not the underlying concrete type.
func unwrapInterface(v reflect.Value) reflect.Value {
if v.Kind() == reflect.Interface {
return v.Elem()
}
return v
}
// isOrderedKind reports whether k supports comparison ordering.
func isOrderedKind(k reflect.Kind) bool {
switch k {
-302
View File
@@ -1,302 +0,0 @@
# Objective
Fully document OBITools (version 4, written in Go) in English, using a 4‑phase incremental pipeline.
You **MUST** use the available MCP servers:
- `cclsp` – exact definitions, references, diagnostics
- `jcodemunch` – code indexing, symbol extraction
- `treesitter` – AST and CLI parsing
- `context7` – external documentation
All tool calls must follow the exact API described in the MCP server documentation. If a required tool is unavailable, you **MUST** log the error and stop execution.
### Tool call format (CRITICAL)
Tool calls **MUST** use this exact XML format — no spaces inside the angle brackets:
```
<function=tool_name>
{"param": "value"}
</function>
```
**FORBIDDEN** — these variants will cause parse errors and must NEVER be used:
- `< function=tool_name >` (spaces around the tag name)
- `< function = tool_name>` (spaces around `=`)
- `<function = tool_name>` (space before `=`)
The opening tag is `<function=tool_name>` with **zero spaces** inside `<` and `>`.
---
# Global rules
** You are not allowed to read twice the same file in a row. **
## Language
- All generated documentation **MUST** be in English.
- If an existing documentation file is in French:
1. Translate it to English
2. Save the original as `.fr.md` **before** overwriting
3. Write the new English version
---
## Execution mode (STRICT)
You are operating in **STRICT TOOL MODE**:
- If a file must be written, you **MUST** use the `Shell` tool.
- You **MUST NOT** read entire directory listings into memory.
- You **MUST** work with **one item at a time** using a simple text file as a task queue.
### Reading files before writing
- **Before writing to an existing documentation file**, you must first read it using the `Read` tool.
- **When documenting a single Go source file**, you only need to read that one file (plus up to 4-5 helper files if needed for context).
- Do NOT read the entire codebase - only what is necessary to document the current file.
---
### Rules
- Always write the **full** file (no partial updates).
- Paths are relative to the project root; directories are created implicitly.
- Content must be valid UTF‑8; use `\n` line endings.
- Do **not** wrap content in backticks.
---
## Progress tracking: task queue files
We use **line‑oriented task files** to avoid loading large lists into memory. Each phase has its own task file:
- `docs/todo/phase1.txt` – list of Go files (one per line) to document.
- `docs/todo/phase1bis.txt` – same list, but after phase1 is done.
- `docs/todo/phase2.txt` – list of packages.
- `docs/todo/phase3.txt` – list of tools.
**How it works:**
1. At the start of a phase, if the task file does not exist, it is created by scanning the codebase once (Phase 0 or Phase X init).
2. **Each run of the LLM processes only the first line of the task file.**
3. After processing the item (success or permanent failure), the line is removed from the task file.
- On success, the line is deleted (no extra sentinel file needed).
- On transient failure (retry < 3), we keep the line but increment a retry counter stored in a separate file.
- On permanent failure (retry ≥ 3), we move the line to a `failed.txt` file and log the error.
4. The LLM then exits (or continues if the task file is still non‑empty, but it must never load more than one line).
This way, the LLM’s context never holds more than a single task at a time.
### Retry mechanism
For each item (e.g., `internal/align/align.go`), we maintain a retry counter in:
- `docs/retry/phase1/internal/align/align.go.count`
If the file does not exist, retries = 0.
Each time processing fails, we increment the counter (write the new number).
If after increment the counter < 3, we keep the line in the task file.
If counter reaches 3, we **remove the line from the task file**, add it to `docs/failed/phase1/internal/align/align.go.failed` (just a marker), and log the error.
---
## Documentation quality requirements (CRITICAL)
Documentation MUST NOT be superficial. For each documented element (file, function, struct, package):
### You MUST explain:
- what it does
- why it exists (context, problem solved)
- how it is used
- assumptions and preconditions
- possible edge cases
### Forbidden patterns
- Vague phrases like “This function handles…”, “Utility for…”, “Helper function…”.
- Generic descriptions that could apply to any project.
### Required content per element type
- Functions:
- Purpose
- Parameter meaning
- Return values
- Notable behaviour (panic conditions, side effects, concurrency)
- Structs:
- Role in the system
- Meaning of key fields
- Files:
- Role within the package
- Interactions with other files
### Anti‑generic rule
If the description could apply to any project, it is INVALID. You MUST include domain‑specific context (bioinformatics, sequence processing, etc.) and concrete behaviour.
### Quality validation
Before marking an item as done (i.e., creating the .done sentinel), you MUST perform a self‑validation:
- Check that all required sections are present.
- Verify that no forbidden patterns remain.
If validation fails, increment the retry counter and keep the item pending.
---
# Directory structure
```
docs/
todo/ # task queues
phase1.txt
phase1bis.txt
phase2.txt
phase3.txt
retry/ # retry counters
phase1/ # mirrors file structure
internal/align/align.go.count
phase1bis/
phase2/
phase3/
failed/ # permanent failure markers
phase1/
internal/align/align.go.failed
phase1bis/
phase2/
phase3/
phase1/ # actual documentation
<relative_path>/<file>.go.md
phase2/
<package>.md
phase3/
<tool>.md
error.log
```
---
# Phase 0: Initialization
1. Ensure required directories exist: `docs/todo`, `docs/retry`, `docs/failed`, `docs/phase1`, `docs/phase2`, `docs/phase3`.
2. **If `docs/todo/phase1.txt` does not exist**:
- Use `find pkg -name "*.go" ! -name "*_test.go" ! -path "*/cmd/*"` to list all Go files (excluding tests and main.go).
- Write the list (one relative path per line, e.g., `internal/align/align.go`) to `docs/todo/phase1.txt`.
3. Do the same for phase2 and phase3 later when those phases start.
4. **No other state is stored.**
---
# Phase 1: File documentation
**Processing rule:**
- Read the **first line** of `docs/todo/phase1.txt` (using `head -n 1`).
- If the file is empty, Phase 1 is complete → proceed to Phase 1bis initialization.
- Otherwise, process that single file.
**Processing a file:**
1. Let `relpath` be the line content (e.g., `internal/align/align.go`).
2. Check if a permanent failure marker exists at `docs/failed/phase1/${relpath}.failed`. If yes, remove the line from the task file and skip (line will be deleted).
3. If the documentation file `docs/phase1/${relpath}.go.md` exists go directly to its validation (step 6).
4. Otherwise, generate documentation for that file (using MCP tools as before).
5. Write the documentation to `docs/phase1/${relpath}.go.md`.
6. Validate quality.
7. If validation succeeds:
- Remove the line from the task file.
- Remove any retry counter file for this item.
- (No sentinel needed; the removal from todo indicates completion.)
8. If validation fails:
- Increment retry counter:
- If `docs/retry/phase1/${relpath}.count` does not exist, set to 1.
- Else read it, add 1, write back.
- If new counter >= 3:
- Remove line from task file.
- Create `docs/failed/phase1/${relpath}.failed`.
- Log error.
- If new counter < 3:
- Keep the line in the task file (do nothing, it stays as first line for next run).
9. **Exit** (or stop if this was a single run). The next invocation will read the first line again (same if retry, or next if removed).
**Important:**
- Do **not** read more than one line.
- Do **not** attempt to process multiple items in one run.
- The LLM should finish after handling one item.
---
# Phase 1bis: Review and harmonization
When Phase 1 is complete (i.e., `docs/todo/phase1.txt` empty), we initialize `docs/todo/phase1bis.txt` with the same list of files (the ones that succeeded).
But note: we need to know which files were successfully documented. Since we removed lines from `phase1.txt` on success, we need a record. The simplest is to reuse the same list but we can generate it by listing the existing `.go.md` files in `docs/phase1/` (since every successful file has a `.go.md`).
Thus, Phase 1bis initialization:
- If `docs/todo/phase1bis.txt` does not exist, create it by listing all `.go.md` files under `docs/phase1/`, stripping the `docs/phase1/` prefix and the `.go.md` suffix, and writing the relative path (same format as phase1).
Then processing is identical to Phase 1, but using `docs/todo/phase1bis.txt` and output is overwriting the same `.go.md` files (with improvements). Retry counters go in `docs/retry/phase1bis/`.
---
# Phase 2: Package documentation
When Phase 1bis is complete (`docs/todo/phase1bis.txt` empty), initialize `docs/todo/phase2.txt`:
- List all packages: unique directories under `pkg/` that contain at least one `.go` file and are not tools.
- Write each package identifier (e.g., `align`, `internal/align`) as a line.
Processing: read first line, generate `docs/phase2/<package>.md`, validate, remove line on success, retry logic in `docs/retry/phase2/`.
---
# Phase 3: Tool documentation
When Phase 2 complete, initialize `docs/todo/phase3.txt`:
- List all directories under `cmd/` that contain a `main.go`. Write each tool name as a line.
Processing: read first line, generate `docs/phase3/<tool>.md`, validate, remove line on success, retry logic in `docs/retry/phase3/`.
---
# Finalization
When all task files are empty and no pending phases, generate `docs/README.md` by:
- Listing all package docs (files in `docs/phase2/`) and linking.
- Listing all tool docs (files in `docs/phase3/`) and linking.
Write using `Shell`.
---
# Execution flow summary
1. **Phase 0**: Create directories and initial `todo/phase1.txt` if missing. Exit.
2. **Phase 1**:
- If `todo/phase1.txt` exists and non‑empty → process first line.
- Else → move to Phase 1bis initialization.
3. **Phase 1bis**:
- If `todo/phase1bis.txt` does not exist → create from successful phase1 docs.
- If non‑empty → process first line.
- Else → move to Phase 2 initialization.
4. **Phase 2**: similar.
5. **Phase 3**: similar.
6. **Finalization**: generate README.
The LLM should be invoked repeatedly (e.g., by a scheduler) until all phases are done. Each invocation processes exactly one item.
---
# Important reminders
- Always call `Shell` to write files; never output content in plain text.
- Validate quality before removing a line from the task file.
- Log all failures to `docs/error.log` in JSON lines format.
- If any MCP tool fails, treat as failure and increment retry counter.
- Never read more than one line from a task file in a single run.
-222
View File
@@ -1,222 +0,0 @@
//go:build ignore
package main
import (
"encoding/json"
"fmt"
"os"
"os/exec"
"path/filepath"
"regexp"
"sort"
"strconv"
"strings"
)
type Reference struct {
File string `json:"file"`
Line int `json:"line"`
Column int `json:"column"`
Key string `json:"key"`
Function string `json:"function"`
Context string `json:"context"`
}
type Result struct {
Method string `json:"method"`
Signature string `json:"signature"`
Definition string `json:"definition"`
References []Reference `json:"references"`
Total int `json:"total"`
}
var basePath = "/Users/coissac/Sync/travail/__MOI__/GO/obitools4"
func main() {
cmd := exec.Command("rg", "-n", `\.SetAttribute\(`, basePath+"/pkg", "--type", "go")
output, err := cmd.Output()
if err != nil {
fmt.Fprintf(os.Stderr, "Error running rg: %v\n", err)
os.Exit(1)
}
lines := strings.Split(string(output), "\n")
lineRe := regexp.MustCompile(`^(.+?):(\d+):\s*(.+)$`)
keyRe := regexp.MustCompile(`SetAttribute\("([^"]+)"`)
templateKeyRe := regexp.MustCompile(`SetAttribute\("([^"]+)[^"]*"\s*,`)
var refs []Reference
seen := make(map[string]bool)
for _, line := range lines {
line = strings.TrimSpace(line)
if line == "" {
continue
}
matches := lineRe.FindStringSubmatch(line)
if matches == nil {
continue
}
file := matches[1]
lineNum, _ := strconv.Atoi(matches[2])
context := strings.TrimSpace(matches[3])
// Skip definition
if strings.Contains(file, "obiseq/attributes.go") && lineNum == 132 {
continue
}
// Extract key
var key string
if keyMatches := keyRe.FindStringSubmatch(context); keyMatches != nil {
key = keyMatches[1]
} else if tmplMatches := templateKeyRe.FindStringSubmatch(context); tmplMatches != nil {
key = tmplMatches[1]
} else {
continue
}
// Get function name using treesitter
funcName := getFunctionNameTreesitter(file, lineNum)
uniqueKey := fmt.Sprintf("%s:%d", file, lineNum)
if seen[uniqueKey] {
continue
}
seen[uniqueKey] = true
refs = append(refs, Reference{
File: filepath.Base(file),
Line: lineNum,
Column: 0,
Key: key,
Function: funcName,
Context: context,
})
}
sort.Slice(refs, func(i, j int) bool {
if refs[i].File != refs[j].File {
return refs[i].File < refs[j].File
}
return refs[i].Line < refs[j].Line
})
result := Result{
Method: "SetAttribute",
Signature: "func (s *BioSequence) SetAttribute(key string, value interface{})",
Definition: basePath + "/pkg/obiseq/attributes.go:132",
References: refs,
Total: len(refs),
}
outputJSON, err := json.MarshalIndent(result, "", " ")
if err != nil {
fmt.Fprintf(os.Stderr, "Error marshaling JSON: %v\n", err)
os.Exit(1)
}
fmt.Println(string(outputJSON))
}
// getFunctionNameTreesitter uses the treesitter_cursor_walk tool to get the containing function
func getFunctionNameTreesitter(file string, targetLine int) string {
// Convert to 0-based for treesitter
row := targetLine - 1
// Use treesitter cursor walk to get ancestors
cmd := exec.Command("bash", "-c",
fmt.Sprintf(`kilo treesitter_cursor_walk --file_path %q --row %d --column 0 --max_depth 10 2>/dev/null`, file, row))
output, err := cmd.Output()
if err != nil {
return findContainingFunction(file, targetLine)
}
// Parse the JSON output to find function_declaration or method_declaration
var result map[string]interface{}
if err := json.Unmarshal(output, &result); err != nil {
return findContainingFunction(file, targetLine)
}
// Check ancestors for function declaration
if ancestors, ok := result["ancestors"].([]interface{}); ok {
for _, a := range ancestors {
if anc, ok := a.(map[string]interface{}); ok {
nodeType, _ := anc["type"].(string)
if nodeType == "function_declaration" || nodeType == "method_declaration" {
// Try to get the function name from children
if children, ok := anc["children"].([]interface{}); ok {
for _, c := range children {
if child, ok := c.(map[string]interface{}); ok {
childType, _ := child["type"].(string)
if childType == "identifier" {
if text, ok := child["text"].(string); ok {
return text
}
}
if childType == "field_identifier" {
if text, ok := child["text"].(string); ok {
return text
}
}
}
}
}
}
if nodeType == "func_literal" {
return "closure"
}
}
}
}
return findContainingFunction(file, targetLine)
}
func findContainingFunction(file string, targetLine int) string {
data, err := os.ReadFile(file)
if err != nil {
return ""
}
lines := strings.Split(string(data), "\n")
for i := targetLine - 1; i >= 0 && i >= targetLine-200; i-- {
if i >= len(lines) {
continue
}
line := strings.TrimSpace(lines[i])
if line == "}" && i > 0 {
for j := i - 1; j >= 0 && j >= i-50; j-- {
if j >= len(lines) {
continue
}
funcLine := strings.TrimSpace(lines[j])
if strings.HasPrefix(funcLine, "func ") {
if match := regexp.MustCompile(`func\s+\([^)]+\)\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(funcLine); match != nil {
return match[1]
}
if match := regexp.MustCompile(`func\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(funcLine); match != nil {
return match[1]
}
}
}
continue
}
if strings.HasPrefix(line, "func ") {
if match := regexp.MustCompile(`func\s+\([^)]+\)\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(line); match != nil {
return match[1]
}
if match := regexp.MustCompile(`func\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(line); match != nil {
return match[1]
}
}
}
return ""
}
-36
View File
@@ -1,36 +0,0 @@
#!/bin/bash
basePath="/Users/coissac/Sync/travail/__MOI__/GO/obitools4"
OUTPUT_FILE="${1:-/dev/stdout}"
# Get all SetAttribute calls
rg -n '\.SetAttribute\(' "$basePath/pkg" --type go | while read -r line; do
file="${line%%:*}"
line_num="${line%:*}"
line_num="${line_num##*:}"
context="${line##*: }"
# Extract key (only literal strings)
key=$(echo "$context" | sed -n 's/.*SetAttribute("\([^"]*\)".*/\1/p')
[ -z "$key" ] && continue
# Get function name using treesitter
func=$(kilo treesitter_cursor_walk \
--file_path "$file" \
--row "$((line_num - 1))" \
--column 0 \
--max_depth 10 2>/dev/null |
jq -r '.ancestors[] | select(.type == "function_declaration" or .type == "method_declaration") | .children[] | select(.type == "identifier" or .type == "field_identifier") | .text' 2>/dev/null)
# Fallback to func_literal for closures
if [ -z "$func" ]; then
func=$(kilo treesitter_cursor_walk \
--file_path "$file" \
--row "$((line_num - 1))" \
--column 0 \
--max_depth 10 2>/dev/null |
jq -r '.ancestors[] | select(.type == "func_literal") | "closure"' 2>/dev/null)
fi
echo "$(basename "$file")|$line_num|$key|${func:-unknown}|$context"
done | sort -t'|' -k1,1 -k2,2n
-308
View File
@@ -1,308 +0,0 @@
{
"obiannotate": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
],
"(git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter.IBioSequence).NumberSequences$1": [
"seq_number"
]
},
"obiclean": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obicleandb": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
"count"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obicomplement": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obiconsensus": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
"count"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
],
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.BuildConsensus": [
"obiconsensus_kmer_max_occur",
"obiconsensus_filtered_graph_size",
"obiconsensus_full_graph_size",
"obiconsensus_consensus",
"obiconsensus_weight",
"obiconsensus_seq_length",
"obiconsensus_kmer_size"
],
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.MinionClusterDenoise": [
"obiconsensus_consensus"
],
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.MinionDenoise$1": [
"obiconsensus_consensus",
"obiconsensus_weight"
]
},
"obiconvert": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obicount": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obicsv": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obidemerge": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obidistribute": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obigrep": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obijoin": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obikmermatch": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obikmersimcount": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obilandmark": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCoordinate": [
"landmark_coord"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagGeomRefIndex": [
"obitag_geomref_index"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
],
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obilandmark.CLISelectLandmarkSequences": [
"landmark_id"
]
},
"obimatrix": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obimicrosat": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obimultiplex": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obipairing": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._revcmpMutation": [
"pairing_mismatches"
],
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign.BuildQualityConsensus": [
"pairing_mismatches"
]
},
"obipcr": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obireffamidx": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagRefIndex": [
"obitag_ref_index"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
],
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obirefidx.IndexFamilyDB": [
"reffamidx_id"
]
},
"obirefidx": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagRefIndex": [
"obitag_ref_index"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obiscript": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obisplit": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obisummary": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obitag": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetPath": [
"taxonomic_path"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obitagpcr": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obingslibrary.NGSLibrary).ExtractMultiBarcode": [
"obimultiplex_error",
"obimultiplex_amplicon_rank"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._revcmpMutation": [
"pairing_mismatches"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._subseqMutation": [
"pairing_mismatches"
],
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign.BuildQualityConsensus": [
"pairing_mismatches"
]
},
"obitaxonomy": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetPath": [
"taxonomic_path"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
],
"(git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter.IBioSequence).NumberSequences$1": [
"seq_number"
]
},
"obiuniq": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
"count"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
}
}
+1 -1
View File
@@ -1 +1 @@
4.4.46
4.4.27
-19
View File
@@ -1,19 +0,0 @@
```markdown
# DNA Scoring and Matching Utilities in `obialign`
This module provides low-level utilities for computing nucleotide alignment scores using probabilistic and bit-encoded representations.
- **Bit Encoding**: Nucleotides are encoded in 4-bit groups (e.g., `A=0b0001`, `C=0b0010`, etc.), enabling efficient bitwise comparison.
- **`_MatchRatio(a, b)`**: Computes a normalized match ratio between two encoded bytes based on shared bits:
`ratio = common_bits / (bits_in_a × bits_in_b)`.
- **`_FourBitsCount`**: Precomputed lookup table for Hamming weight (popcount) of 4-bit values.
- **Log-space Arithmetic**: Helper functions (`_Logaddexp`, `_Logdiffexp`, `_Log1mexp`) ensure numerical stability in probabilistic computations.
- **Phred-scaled Quality Integration**:
`_MatchScoreRatio(QF, QR)` derives log-odds match/mismatch scores from Phred quality values (`QF`, `QR`), modeling sequencing error probabilities.
- **Precomputed Matrices**:
- `_NucPartMatch[i][j]`: Match ratios for all nucleotide pairs (from 4-bit codes).
- `_NucScorePartMatchMatch/Mismatch[i][j]`: Integer-scaled match/mismatch scores (×10) for quality pairs `(i, j)` in `[0..99]`.
- **Thread-Safe Initialization**: `_InitDNAScoreMatrix()` ensures one-time, synchronized initialization of all scoring tables via a mutex.
Designed for high-performance alignment kernels where speed and numerical robustness are critical.
```