Compare commits

...

31 Commits

Author SHA1 Message Date
coissac
09d437d10f Merge pull request #83 from metabarcoding/push-xssnppvunmlq
Push xssnppvunmlq
2026-02-09 09:58:06 +01:00
Eric Coissac
d00ab6f83a Bump version from 4.4.11 to 4.4.12
Update version number in version.txt from 4.4.11 to 4.4.12
2026-02-09 09:46:12 +01:00
Eric Coissac
8037860518 Update version and improve release note generation
Update version from 4.4.11 to 4.4.12

- Bump version in version.go
- Enhance release note generation in Makefile to use JSON output from orla and fallback to raw output if JSON parsing fails
- Improve test script to verify minimum super k-mer length is >= k (default k=31)
2026-02-09 09:46:10 +01:00
coissac
43d6cbe56a Merge pull request #82 from metabarcoding/push-vkprtnlyxmkl
Push vkprtnlyxmkl
2026-02-09 09:16:20 +01:00
Eric Coissac
6dadee9371 Bump version to 4.4.12
Update version from 4.4.11 to 4.4.12 in version.txt and pkg/obioptions/version.go
2026-02-09 09:05:49 +01:00
Eric Coissac
99a8e69d10 Optimize low-complexity masking algorithm
This commit optimizes the low-complexity masking algorithm by:

1. Precomputing logarithm values and normalization tables to avoid repeated calculations
2. Replacing the MinMultiset-based sliding minimum with a more efficient deque-based implementation
3. Improving entropy calculation by using precomputed n*log(n) values
4. Simplifying the circular normalization process with precomputed tables
5. Removing unused imports and log statements

The changes significantly improve performance while maintaining the same masking behavior.
2026-02-09 09:05:46 +01:00
Eric Coissac
c0ae49ef92 Ajout d'obilowmask_ref au fichier .gitignore
Ajout du fichier obilowmask_ref dans le fichier .gitignore pour éviter qu'il ne soit suivi par Git.
2026-02-08 19:31:12 +01:00
Eric Coissac
08490420a2 Fix whitespace in test script and add merge consistency tests
This commit fixes minor whitespace issues in the test script and adds new tests to ensure merge attribute consistency between in-memory and on-disk paths.

- Removed trailing spaces in log messages
- Added tests for merge consistency between in-memory and on-disk paths
- These tests catch a bug where shared classifier in on-disk dereplication path caused incorrect merged attributes
2026-02-08 18:08:29 +01:00
Eric Coissac
1a28d5ed64 Add progress bar configuration and conditional display
This commit introduces a new configuration module `obidefault` to manage progress bar settings, allowing users to disable progress bars via a `--no-progressbar` option. It updates various packages to conditionally display progress bars based on this new configuration, improving user experience by providing control over progress bar output. The changes also include improvements to progress bar handling in several packages, ensuring they are only displayed when appropriate (e.g., when stderr is a terminal and stdout is not piped).
2026-02-08 16:14:02 +01:00
Eric Coissac
b2d16721f0 Fix classifier cloning and reset in chunk processing
This commit fixes an issue in the chunk processing logic where the wrong classifier instance was being reset and used for code generation. A local clone of the classifier is now created and used to ensure correct behavior during dereplication.
2026-02-08 15:52:25 +01:00
Eric Coissac
7c12b1ee83 Disable progress bar when output is piped
Modify CLIProgressBar function to check if stdout is a named pipe and disable the progress bar accordingly. This prevents the progress bar from being displayed when the output is redirected or piped to another command.
2026-02-08 14:48:13 +01:00
Eric Coissac
db98ddb241 Fix super k-mer minimizer bijection and add validation test
This commit addresses a bug in the super k-mer implementation where the minimizer bijection property was not properly enforced. The fix ensures that:

1. All k-mers within a super k-mer share the same minimizer
2. Identical super k-mer sequences have the same minimizer

The changes include:

- Fixing the super k-mer iteration logic to properly validate the minimizer bijection property
- Adding a comprehensive test suite (TestSuperKmerMinimizerBijection) that validates the intrinsic property of super k-mers
- Updating the .gitignore file to properly track relevant files

This resolves issues where the same sequence could be associated with different minimizers, violating the super k-mer definition.
2026-02-08 13:47:33 +01:00
Eric Coissac
7a979ba77f Add obisuperkmer command implementation and tests
This commit adds the implementation of the obisuperkmer command, including:

- The main command in cmd/obitools/obisuperkmer/
- The package implementation in pkg/obitools/obisuperkmer/
- Automated tests in obitests/obitools/obisuperkmer/
- Documentation for the implementation and tests

The obisuperkmer command extracts super k-mers from DNA sequences, following the standard OBITools architecture. It includes proper CLI option handling, validation of parameters, and integration with the OBITools pipeline system.

Tests cover basic functionality, parameter validation, output format, metadata preservation, and file I/O operations.
2026-02-07 13:54:02 +01:00
Eric Coissac
00c8be6b48 docs: add architecture documentation for OBITools commands
Ajout d'une documentation détaillée sur l'architecture des commandes OBITools, incluant la structure modulaire, les patterns architecturaux et les bonnes pratiques pour la création de nouvelles commandes.
2026-02-07 12:26:35 +01:00
Eric Coissac
4ae331db36 Refactor SuperKmer extraction to use iterator pattern
This commit refactors the SuperKmer extraction functionality to use Go's new iterator pattern. The ExtractSuperKmers function is now implemented as a wrapper around a new IterSuperKmers iterator function, which yields results one at a time instead of building a complete slice. This change provides better memory efficiency and more flexible consumption of super k-mers. The functionality remains the same, but the interface is now more idiomatic and efficient for large datasets.
2026-02-07 12:23:12 +01:00
Eric Coissac
f1e2846d2d Amélioration du processus de release avec génération automatique des notes de version
Mise à jour du Makefile pour améliorer le processus de version bump et de création de tag.

- Utilisation de variables pour stocker les versions précédente et actuelle
- Ajout de la génération automatique des notes de version à partir des commits entre les tags
- Intégration d'une logique de fallback si orla n'est pas disponible
- Amélioration de la documentation des étapes du processus de release
- Mise à jour de la commande de création du tag avec le message généré
2026-02-07 11:48:26 +01:00
coissac
cd5562fb30 Merge pull request #81 from metabarcoding/push-nrylumyxtxnr
Push nrylumyxtxnr
2026-02-06 10:10:22 +01:00
Eric Coissac
f79b018430 Bump version to 4.4.11
Update version from 4.4.10 to 4.4.11 in version.txt and pkg/obioptions/version.go
2026-02-06 10:09:56 +01:00
Eric Coissac
aa819618c2 Enhance OBITools4 installation script with version control and documentation
Update installation script to support specific version installation, list available versions, and improve documentation.

- Add support for installing specific versions with -v/--version flag
- Add -l/--list flag to list all available versions
- Improve help message with examples
- Update README.md to reflect new installation options and examples
- Add note on version compatibility between OBITools2 and OBITools4
- Remove ecoprimers directory
- Improve error handling and user feedback during installation
- Add version detection and download logic from GitHub releases
- Update installation process to use tagged releases instead of master branch
2026-02-06 10:09:54 +01:00
coissac
da8d851d4d Merge pull request #80 from metabarcoding/push-vvonlpwlnwxy
Remove ecoprimers submodule
2026-02-06 09:53:29 +01:00
Eric Coissac
9823bcb41b Remove ecoprimers submodule 2026-02-06 09:52:54 +01:00
coissac
9c162459b0 Merge pull request #79 from metabarcoding/push-tpytwyyyostt
Remove ecoprimers submodule
2026-02-06 09:51:42 +01:00
Eric Coissac
25b494e562 Remove ecoprimers submodule 2026-02-06 09:50:45 +01:00
coissac
0b5cadd104 Merge pull request #78 from metabarcoding/push-pwvvkzxzmlux
Push pwvvkzxzmlux
2026-02-06 09:48:47 +01:00
Eric Coissac
a2106e4e82 Bump version to 4.4.10
Update version from 4.4.9 to 4.4.10 in version.txt and pkg/obioptions/version.go
2026-02-06 09:48:27 +01:00
Eric Coissac
a8a00ba0f7 Simplify artifact packaging and update release notes
This commit simplifies the artifact packaging process by creating a single tar.gz file containing all binaries for each platform, instead of individual files. It also updates the release notes to reflect the new packaging approach and corrects the documentation to use the new naming convention 'obitools4' instead of '<tool>'.
2026-02-06 09:48:25 +01:00
coissac
1595a74ada Merge pull request #77 from metabarcoding/push-lwtnswxmorrq
Push lwtnswxmorrq
2026-02-06 09:35:05 +01:00
Eric Coissac
68d723ecba Bump version to 4.4.9
Update version from 4.4.8 to 4.4.9 in version.txt and corresponding Go file.
2026-02-06 09:34:43 +01:00
Eric Coissac
250d616129 Mise à jour des workflows de release pour les nouvelles versions d'OS
Mise à jour du workflow de release pour utiliser ubuntu-24.04-arm au lieu de ubuntu-latest pour ARM64, et macos-15-intel au lieu de macos-latest pour macOS. Suppression de la compilation croisée pour ARM64 et ajustement de l'installation des outils de build pour macOS.
2026-02-06 09:34:41 +01:00
coissac
fbf816d219 Merge pull request #76 from metabarcoding/push-tzpmmnnxkvxx
Push tzpmmnnxkvxx
2026-02-06 09:09:05 +01:00
Eric Coissac
7f0133a196 Bump version to 4.4.8
Update version from 4.4.7 to 4.4.8 in version.txt and _Version variable.
2026-02-06 09:08:35 +01:00
40 changed files with 3678 additions and 588 deletions

View File

@@ -32,12 +32,11 @@ jobs:
goos: linux goos: linux
goarch: amd64 goarch: amd64
output_name: linux_amd64 output_name: linux_amd64
- os: ubuntu-latest - os: ubuntu-24.04-arm
goos: linux goos: linux
goarch: arm64 goarch: arm64
output_name: linux_arm64 output_name: linux_arm64
cross_compile: true - os: macos-15-intel
- os: macos-latest
goos: darwin goos: darwin
goarch: amd64 goarch: amd64
output_name: darwin_amd64 output_name: darwin_amd64
@@ -63,25 +62,23 @@ jobs:
TAG=${GITHUB_REF#refs/tags/Release_} TAG=${GITHUB_REF#refs/tags/Release_}
echo "version=$TAG" >> $GITHUB_OUTPUT echo "version=$TAG" >> $GITHUB_OUTPUT
- name: Install cross-compilation tools (Linux ARM64 only) - name: Install build tools (macOS)
if: matrix.cross_compile if: runner.os == 'macOS'
run: | run: |
sudo apt-get update # Ensure Xcode Command Line Tools are installed
sudo apt-get install -y gcc-aarch64-linux-gnu xcode-select --install 2>/dev/null || true
xcode-select -p
- name: Build binaries - name: Build binaries
env: env:
GOOS: ${{ matrix.goos }} GOOS: ${{ matrix.goos }}
GOARCH: ${{ matrix.goarch }} GOARCH: ${{ matrix.goarch }}
CC: ${{ matrix.cross_compile && 'aarch64-linux-gnu-gcc' || '' }}
VERSION: ${{ steps.get_version.outputs.version }} VERSION: ${{ steps.get_version.outputs.version }}
run: | run: |
make obitools make obitools
mkdir -p artifacts mkdir -p artifacts
cd build # Create a single tar.gz with all binaries for this platform
for binary in *; do tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
tar -czf ../artifacts/${binary}_${VERSION}_${{ matrix.output_name }}.tar.gz ${binary}
done
- name: Upload artifacts - name: Upload artifacts
uses: actions/upload-artifact@v4 uses: actions/upload-artifact@v4
@@ -139,29 +136,29 @@ jobs:
echo "" >> release_notes.md echo "" >> release_notes.md
echo "## Installation" >> release_notes.md echo "## Installation" >> release_notes.md
echo "" >> release_notes.md echo "" >> release_notes.md
echo "Download the appropriate binary for your system and extract it:" >> release_notes.md echo "Download the appropriate archive for your system and extract it:" >> release_notes.md
echo "" >> release_notes.md echo "" >> release_notes.md
echo "### Linux (AMD64)" >> release_notes.md echo "### Linux (AMD64)" >> release_notes.md
echo '```bash' >> release_notes.md echo '```bash' >> release_notes.md
echo "tar -xzf <tool>_${VERSION}_linux_amd64.tar.gz" >> release_notes.md echo "tar -xzf obitools4_${VERSION}_linux_amd64.tar.gz" >> release_notes.md
echo '```' >> release_notes.md echo '```' >> release_notes.md
echo "" >> release_notes.md echo "" >> release_notes.md
echo "### Linux (ARM64)" >> release_notes.md echo "### Linux (ARM64)" >> release_notes.md
echo '```bash' >> release_notes.md echo '```bash' >> release_notes.md
echo "tar -xzf <tool>_${VERSION}_linux_arm64.tar.gz" >> release_notes.md echo "tar -xzf obitools4_${VERSION}_linux_arm64.tar.gz" >> release_notes.md
echo '```' >> release_notes.md echo '```' >> release_notes.md
echo "" >> release_notes.md echo "" >> release_notes.md
echo "### macOS (Intel)" >> release_notes.md echo "### macOS (Intel)" >> release_notes.md
echo '```bash' >> release_notes.md echo '```bash' >> release_notes.md
echo "tar -xzf <tool>_${VERSION}_darwin_amd64.tar.gz" >> release_notes.md echo "tar -xzf obitools4_${VERSION}_darwin_amd64.tar.gz" >> release_notes.md
echo '```' >> release_notes.md echo '```' >> release_notes.md
echo "" >> release_notes.md echo "" >> release_notes.md
echo "### macOS (Apple Silicon)" >> release_notes.md echo "### macOS (Apple Silicon)" >> release_notes.md
echo '```bash' >> release_notes.md echo '```bash' >> release_notes.md
echo "tar -xzf <tool>_${VERSION}_darwin_arm64.tar.gz" >> release_notes.md echo "tar -xzf obitools4_${VERSION}_darwin_arm64.tar.gz" >> release_notes.md
echo '```' >> release_notes.md echo '```' >> release_notes.md
echo "" >> release_notes.md echo "" >> release_notes.md
echo "Available tools: Replace \`<tool>\` with one of the obitools commands." >> release_notes.md echo "All OBITools4 binaries are included in each archive." >> release_notes.md
- name: Create GitHub Release - name: Create GitHub Release
uses: softprops/action-gh-release@v1 uses: softprops/action-gh-release@v1

6
.gitignore vendored
View File

@@ -27,7 +27,9 @@ xx
!/obitests/** !/obitests/**
!/sample/** !/sample/**
LLM/** LLM/**
*_files *_files
entropy.html entropy.html
bug_id.txt
obilowmask_ref

View File

@@ -133,14 +133,33 @@ jjpush:
@jj auto-describe @jj auto-describe
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)" @echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
@jj new @jj new
@$(MAKE) bump-version @previous_version=$$(cat version.txt); \
@echo "$(BLUE)→ Documenting version bump commit...$(NC)" $(MAKE) bump-version; \
@jj auto-describe version=$$(cat version.txt); \
@version=$$(cat version.txt); \
tag_name="Release_$$version"; \ tag_name="Release_$$version"; \
previous_tag="Release_$$previous_version"; \
echo "$(BLUE)→ Documenting version bump commit...$(NC)"; \
jj auto-describe; \
echo "$(BLUE)→ Generating release notes from $$previous_tag to current commit...$(NC)"; \
if command -v orla >/dev/null 2>&1 && command -v jq >/dev/null 2>&1; then \
release_json=$$(ORLA_MAX_TOOL_CALLS=50 jj log -r "$$previous_tag::@" -T 'commit_id.short() ++ " " ++ description' | \
orla agent -m ollama:qwen3-coder-next:latest \
"Summarize the following commits into a GitHub release note for version $$version. Ignore commits related to version bumps, .gitignore changes, or any internal housekeeping that is irrelevant to end users. Describe each user-facing change precisely without exposing code. Eliminate redundancy. Output strictly valid JSON with no surrounding text, using this exact schema: {\"title\": \"<short release title>\", \"body\": \"<detailed markdown release notes>\"}"); \
release_json=$$(echo "$$release_json" | sed -n '/^{/,/^}/p'); \
release_title=$$(echo "$$release_json" | jq -r '.title // empty') ; \
release_body=$$(echo "$$release_json" | jq -r '.body // empty') ; \
if [ -n "$$release_title" ] && [ -n "$$release_body" ]; then \
release_message="$$release_title"$$'\n\n'"$$release_body"; \
else \
echo "$(YELLOW)⚠ JSON parsing failed, falling back to raw output$(NC)"; \
release_message="Release $$version"$$'\n\n'"$$release_json"; \
fi; \
else \
release_message="Release $$version"; \
fi; \
echo "$(BLUE)→ Pushing commits and creating tag $$tag_name...$(NC)"; \ echo "$(BLUE)→ Pushing commits and creating tag $$tag_name...$(NC)"; \
jj git push --change @; \ jj git push --change @; \
git tag -a "$$tag_name" -m "Release $$version" 2>/dev/null || echo "Tag $$tag_name already exists"; \ git tag -a "$$tag_name" -m "$$release_message" 2>/dev/null || echo "Tag $$tag_name already exists"; \
git push origin "$$tag_name" 2>/dev/null || echo "Tag already pushed" git push origin "$$tag_name" 2>/dev/null || echo "Tag already pushed"
@echo "$(GREEN)✓ Commits and tag pushed to repository$(NC)" @echo "$(GREEN)✓ Commits and tag pushed to repository$(NC)"

View File

@@ -16,12 +16,17 @@ The easiest way to run it is to copy and paste the following command into your t
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash
``` ```
By default, the script installs the *OBITools* commands and other associated files into the `/usr/local` directory. By default, the script installs the latest version of *OBITools* commands and other associated files into the `/usr/local` directory.
The names of the commands in the new *OBITools4* are mostly identical to those in *OBITools2*.
Therefore, installing the new *OBITools* may hide or delete the old ones. If you want both versions to be
available on your system, the installation script offers two options:
### Installation Options
The installation script offers several options:
> -l, --list List all available versions and exit.
>
> -v, --version Install a specific version (e.g., `-v 4.4.3`).
> By default, the latest version is installed.
>
> -i, --install-dir Directory where obitools are installed > -i, --install-dir Directory where obitools are installed
> (as example use `/usr/local` not `/usr/local/bin`). > (as example use `/usr/local` not `/usr/local/bin`).
> >
@@ -30,14 +35,31 @@ available on your system, the installation script offers two options:
> same time on your system (as example `-p g` will produce > same time on your system (as example `-p g` will produce
> `gobigrep` command instead of `obigrep`). > `gobigrep` command instead of `obigrep`).
You can use these options by following the installation command: ### Examples
List all available versions:
```{bash}
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --list
```
Install a specific version:
```{bash}
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --version 4.4.3
```
Install in a custom directory with command prefix:
```{bash} ```{bash}
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | \ curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | \
bash -s -- --install-dir test_install --obitools-prefix k bash -s -- --install-dir test_install --obitools-prefix k
``` ```
In this case, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus, `obigrep` will be named `kobigrep`. In this last example, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus, `obigrep` will be named `kobigrep`.
### Note on Version Compatibility
The names of the commands in the new *OBITools4* are mostly identical to those in *OBITools2*.
Therefore, installing the new *OBITools* may hide or delete the old ones. If you want both versions to be
available on your system, use the `--install-dir` and `--obitools-prefix` options as shown above.
## Continuing the analysis... ## Continuing the analysis...

View File

@@ -0,0 +1,735 @@
# Architecture d'une commande OBITools
## Vue d'ensemble
Une commande OBITools suit une architecture modulaire et standardisée qui sépare clairement les responsabilités entre :
- Le package de la commande dans `pkg/obitools/<nom_commande>/`
- L'exécutable dans `cmd/obitools/<nom_commande>/`
Cette architecture favorise la réutilisabilité du code, la testabilité et la cohérence entre les différentes commandes de la suite OBITools.
## Structure du projet
```
obitools4/
├── pkg/obitools/
│ ├── obiconvert/ # Commande de conversion (base pour toutes)
│ │ ├── obiconvert.go # Fonctions vides (pas d'implémentation)
│ │ ├── options.go # Définition des options CLI
│ │ ├── sequence_reader.go # Lecture des séquences
│ │ └── sequence_writer.go # Écriture des séquences
│ ├── obiuniq/ # Commande de déréplication
│ │ ├── obiuniq.go # (fichier vide)
│ │ ├── options.go # Options spécifiques à obiuniq
│ │ └── unique.go # Implémentation du traitement
│ ├── obipairing/ # Assemblage de lectures paired-end
│ ├── obisummary/ # Résumé de fichiers de séquences
│ └── obimicrosat/ # Détection de microsatellites
└── cmd/obitools/
├── obiconvert/
│ └── main.go # Point d'entrée de la commande
├── obiuniq/
│ └── main.go
├── obipairing/
│ └── main.go
├── obisummary/
│ └── main.go
└── obimicrosat/
└── main.go
```
## Composants de l'architecture
### 1. Package `pkg/obitools/<commande>/`
Chaque commande possède son propre package dans `pkg/obitools/` qui contient l'implémentation complète de la logique métier. Ce package est structuré en plusieurs fichiers :
#### a) `options.go` - Gestion des options CLI
Ce fichier définit :
- Les **variables globales** privées (préfixées par `_`) stockant les valeurs des options
- La fonction **`OptionSet()`** qui configure toutes les options pour la commande
- Les fonctions **`CLI*()`** qui retournent les valeurs des options (getters)
- Les fonctions **`Set*()`** qui permettent de définir les options programmatiquement (setters)
**Exemple (obiuniq/options.go) :**
```go
package obiuniq
import (
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
"github.com/DavidGamba/go-getoptions"
)
// Variables globales privées pour stocker les options
var _StatsOn = make([]string, 0, 10)
var _Keys = make([]string, 0, 10)
var _InMemory = false
var _chunks = 100
// Configuration des options spécifiques à la commande
func UniqueOptionSet(options *getoptions.GetOpt) {
options.StringSliceVar(&_StatsOn, "merge", 1, 1,
options.Alias("m"),
options.ArgName("KEY"),
options.Description("Adds a merged attribute..."))
options.BoolVar(&_InMemory, "in-memory", _InMemory,
options.Description("Use memory instead of disk..."))
options.IntVar(&_chunks, "chunk-count", _chunks,
options.Description("In how many chunks..."))
}
// OptionSet combine les options de base + les options spécifiques
func OptionSet(options *getoptions.GetOpt) {
obiconvert.OptionSet(false)(options) // Options de base
UniqueOptionSet(options) // Options spécifiques
}
// Getters pour accéder aux valeurs des options
func CLIStatsOn() []string {
return _StatsOn
}
func CLIUniqueInMemory() bool {
return _InMemory
}
// Setters pour définir les options programmatiquement
func SetUniqueInMemory(inMemory bool) {
_InMemory = inMemory
}
```
**Convention de nommage :**
- Variables privées : `_NomOption` (underscore préfixe)
- Getters : `CLINomOption()` (préfixe CLI)
- Setters : `SetNomOption()` (préfixe Set)
#### b) Fichier(s) d'implémentation
Un ou plusieurs fichiers contenant la logique métier de la commande :
**Exemple (obiuniq/unique.go) :**
```go
package obiuniq
import (
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obichunk"
)
// Fonction CLI principale qui orchestre le traitement
func CLIUnique(sequences obiiter.IBioSequence) obiiter.IBioSequence {
// Récupération des options via les getters CLI*()
options := make([]obichunk.WithOption, 0, 30)
options = append(options,
obichunk.OptionBatchCount(CLINumberOfChunks()),
)
if CLIUniqueInMemory() {
options = append(options, obichunk.OptionSortOnMemory())
} else {
options = append(options, obichunk.OptionSortOnDisk())
}
// Appel de la fonction de traitement réelle
iUnique, err := obichunk.IUniqueSequence(sequences, options...)
if err != nil {
log.Fatal(err)
}
return iUnique
}
```
**Autres exemples d'implémentation :**
- **obimicrosat/microsat.go** : Contient `MakeMicrosatWorker()` et `CLIAnnotateMicrosat()`
- **obisummary/obisummary.go** : Contient `ISummary()` et les structures de données
#### c) Fichiers utilitaires (optionnel)
Certaines commandes ont des fichiers additionnels pour des fonctionnalités spécifiques.
**Exemple (obipairing/options.go) :**
```go
// Fonction spéciale pour créer un itérateur de séquences pairées
func CLIPairedSequence() (obiiter.IBioSequence, error) {
forward, err := obiconvert.CLIReadBioSequences(_ForwardFile)
if err != nil {
return obiiter.NilIBioSequence, err
}
reverse, err := obiconvert.CLIReadBioSequences(_ReverseFile)
if err != nil {
return obiiter.NilIBioSequence, err
}
paired := forward.PairTo(reverse)
return paired, nil
}
```
### 2. Package `obiconvert` - La base commune
Le package `obiconvert` est spécial car il fournit les fonctionnalités de base utilisées par toutes les autres commandes :
#### Fonctionnalités fournies :
1. **Lecture de séquences** (`sequence_reader.go`)
- `CLIReadBioSequences()` : lecture depuis fichiers ou stdin
- Support de multiples formats (FASTA, FASTQ, EMBL, GenBank, etc.)
- Gestion des fichiers multiples
- Barre de progression optionnelle
2. **Écriture de séquences** (`sequence_writer.go`)
- `CLIWriteBioSequences()` : écriture vers fichiers ou stdout
- Support de multiples formats
- Gestion des lectures pairées
- Compression optionnelle
3. **Options communes** (`options.go`)
- Options d'entrée (format, skip, etc.)
- Options de sortie (format, fichier, compression)
- Options de mode (barre de progression, etc.)
#### Utilisation par les autres commandes :
Toutes les commandes incluent les options de `obiconvert` via :
```go
func OptionSet(options *getoptions.GetOpt) {
obiconvert.OptionSet(false)(options) // false = pas de fichiers pairés
MaCommandeOptionSet(options) // Options spécifiques
}
```
### 3. Exécutable `cmd/obitools/<commande>/main.go`
Le fichier `main.go` de chaque commande est volontairement **minimaliste** et suit toujours le même pattern :
```go
package main
import (
"os"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/macommande"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
)
func main() {
// 1. Configuration optionnelle de paramètres par défaut
obidefault.SetBatchSize(10)
// 2. Génération du parser d'options
optionParser := obioptions.GenerateOptionParser(
"macommande", // Nom de la commande
"description de la commande", // Description
macommande.OptionSet) // Fonction de configuration des options
// 3. Parsing des arguments
_, args := optionParser(os.Args)
// 4. Lecture des séquences d'entrée
sequences, err := obiconvert.CLIReadBioSequences(args...)
obiconvert.OpenSequenceDataErrorMessage(args, err)
// 5. Traitement spécifique de la commande
resultat := macommande.CLITraitement(sequences)
// 6. Écriture des résultats
obiconvert.CLIWriteBioSequences(resultat, true)
// 7. Attente de la fin du pipeline
obiutils.WaitForLastPipe()
}
```
## Patterns architecturaux
### Pattern 1 : Pipeline de traitement de séquences
La plupart des commandes suivent ce pattern :
```
Lecture → Traitement → Écriture
```
**Exemples :**
- **obiconvert** : Lecture → Écriture (conversion de format)
- **obiuniq** : Lecture → Déréplication → Écriture
- **obimicrosat** : Lecture → Annotation → Filtrage → Écriture
### Pattern 2 : Traitement avec entrées multiples
Certaines commandes acceptent plusieurs fichiers d'entrée :
**obipairing** :
```
Lecture Forward + Lecture Reverse → Pairing → Assemblage → Écriture
```
### Pattern 3 : Traitement sans écriture de séquences
**obisummary** : produit un résumé JSON/YAML au lieu de séquences
```go
func main() {
// ... parsing options et lecture ...
summary := obisummary.ISummary(fs, obisummary.CLIMapSummary())
// Formatage et affichage direct
if obisummary.CLIOutFormat() == "json" {
output, _ := json.MarshalIndent(summary, "", " ")
fmt.Print(string(output))
} else {
output, _ := yaml.Marshal(summary)
fmt.Print(string(output))
}
}
```
### Pattern 4 : Utilisation de Workers
Les commandes qui transforment des séquences utilisent souvent le pattern Worker :
```go
// Création d'un worker
worker := MakeMicrosatWorker(
CLIMinUnitLength(),
CLIMaxUnitLength(),
// ... autres paramètres
)
// Application du worker sur l'itérateur
newIter = iterator.MakeIWorker(
worker,
false, // merge results
obidefault.ParallelWorkers() // parallélisation
)
```
## Étapes d'implémentation d'une nouvelle commande
### Étape 1 : Créer le package dans `pkg/obitools/`
```bash
mkdir -p pkg/obitools/macommande
```
### Étape 2 : Créer `options.go`
```go
package macommande
import (
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
"github.com/DavidGamba/go-getoptions"
)
// Variables privées pour les options
var _MonOption = "valeur_par_defaut"
// Configuration des options spécifiques
func MaCommandeOptionSet(options *getoptions.GetOpt) {
options.StringVar(&_MonOption, "mon-option", _MonOption,
options.Alias("o"),
options.Description("Description de l'option"))
}
// OptionSet combine options de base + spécifiques
func OptionSet(options *getoptions.GetOpt) {
obiconvert.OptionSet(false)(options) // false si pas de fichiers pairés
MaCommandeOptionSet(options)
}
// Getters
func CLIMonOption() string {
return _MonOption
}
// Setters
func SetMonOption(value string) {
_MonOption = value
}
```
### Étape 3 : Créer le fichier d'implémentation
Créer `macommande.go` (ou un nom plus descriptif) :
```go
package macommande
import (
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
)
// Fonction de traitement principale
func CLIMaCommande(sequences obiiter.IBioSequence) obiiter.IBioSequence {
// Récupération des options
option := CLIMonOption()
// Implémentation du traitement
// ...
return resultat
}
```
### Étape 4 : Créer l'exécutable dans `cmd/obitools/`
```bash
mkdir -p cmd/obitools/macommande
```
Créer `main.go` :
```go
package main
import (
"os"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/macommande"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
)
func main() {
// Parser d'options
optionParser := obioptions.GenerateOptionParser(
"macommande",
"Description courte de ma commande",
macommande.OptionSet)
_, args := optionParser(os.Args)
// Lecture
sequences, err := obiconvert.CLIReadBioSequences(args...)
obiconvert.OpenSequenceDataErrorMessage(args, err)
// Traitement
resultat := macommande.CLIMaCommande(sequences)
// Écriture
obiconvert.CLIWriteBioSequences(resultat, true)
// Attente
obiutils.WaitForLastPipe()
}
```
### Étape 5 : Configurations optionnelles
Dans `main.go`, avant le parsing des options, on peut configurer :
```go
// Taille des batchs de séquences
obidefault.SetBatchSize(10)
// Nombre de workers en lecture (strict)
obidefault.SetStrictReadWorker(2)
// Nombre de workers en écriture
obidefault.SetStrictWriteWorker(2)
// Désactiver la lecture des qualités
obidefault.SetReadQualities(false)
```
### Étape 6 : Gestion des erreurs
Utiliser les fonctions utilitaires pour les messages d'erreur cohérents :
```go
// Pour les erreurs d'ouverture de fichiers
obiconvert.OpenSequenceDataErrorMessage(args, err)
// Pour les erreurs générales
if err != nil {
log.Errorf("Message d'erreur: %v", err)
os.Exit(1)
}
```
### Étape 7 : Tests et debugging (optionnel)
Des commentaires dans le code montrent comment activer le profiling :
```go
// go tool pprof -http=":8000" ./macommande ./cpu.pprof
// f, err := os.Create("cpu.pprof")
// if err != nil {
// log.Fatal(err)
// }
// pprof.StartCPUProfile(f)
// defer pprof.StopCPUProfile()
// go tool trace cpu.trace
// ftrace, err := os.Create("cpu.trace")
// if err != nil {
// log.Fatal(err)
// }
// trace.Start(ftrace)
// defer trace.Stop()
```
## Bonnes pratiques observées
### 1. Séparation des responsabilités
- **`main.go`** : orchestration minimale
- **`options.go`** : définition et gestion des options
- **Fichiers d'implémentation** : logique métier
### 2. Convention de nommage cohérente
- Variables d'options : `_NomOption`
- Getters CLI : `CLINomOption()`
- Setters : `SetNomOption()`
- Fonctions de traitement CLI : `CLITraitement()`
### 3. Réutilisation du code
- Toutes les commandes réutilisent `obiconvert` pour l'I/O
- Les options communes sont partagées
- Les fonctions utilitaires sont centralisées
### 4. Configuration par défaut
Les valeurs par défaut sont :
- Définies lors de l'initialisation des variables
- Modifiables via les options CLI
- Modifiables programmatiquement via les setters
### 5. Gestion des formats
Support automatique de multiples formats :
- FASTA / FASTQ (avec compression gzip)
- EMBL / GenBank
- ecoPCR
- CSV
- JSON (avec différents formats d'en-têtes)
### 6. Parallélisation
Les commandes utilisent les workers parallèles via :
- `obidefault.ParallelWorkers()`
- `obidefault.SetStrictReadWorker(n)`
- `obidefault.SetStrictWriteWorker(n)`
### 7. Logging cohérent
Utilisation de `logrus` pour tous les logs :
```go
log.Printf("Message informatif")
log.Errorf("Message d'erreur: %v", err)
log.Fatal(err) // Arrêt du programme
```
## Dépendances principales
### Packages internes OBITools
- `pkg/obidefault` : valeurs par défaut et configuration globale
- `pkg/obioptions` : génération du parser d'options
- `pkg/obiiter` : itérateurs de séquences biologiques
- `pkg/obiseq` : structures et fonctions pour séquences biologiques
- `pkg/obiformats` : lecture/écriture de différents formats
- `pkg/obiutils` : fonctions utilitaires diverses
- `pkg/obichunk` : traitement par chunks (pour dereplication, etc.)
### Packages externes
- `github.com/DavidGamba/go-getoptions` : parsing des options CLI
- `github.com/sirupsen/logrus` : logging structuré
- `gopkg.in/yaml.v3` : encodage/décodage YAML
- `github.com/dlclark/regexp2` : expressions régulières avancées
## Cas spéciaux
### Commande avec fichiers pairés (obipairing)
```go
func OptionSet(options *getoptions.GetOpt) {
obiconvert.OutputOptionSet(options)
obiconvert.InputOptionSet(options)
PairingOptionSet(options) // Options spécifiques au pairing
}
func CLIPairedSequence() (obiiter.IBioSequence, error) {
forward, err := obiconvert.CLIReadBioSequences(_ForwardFile)
// ...
reverse, err := obiconvert.CLIReadBioSequences(_ReverseFile)
// ...
paired := forward.PairTo(reverse)
return paired, nil
}
```
Dans `main.go` :
```go
pairs, err := obipairing.CLIPairedSequence() // Lecture spéciale
if err != nil {
log.Errorf("Cannot open file (%v)", err)
os.Exit(1)
}
paired := obipairing.IAssemblePESequencesBatch(
pairs,
obipairing.CLIGapPenality(),
// ... autres paramètres
)
```
### Commande sans sortie de séquences (obisummary)
Au lieu de `obiconvert.CLIWriteBioSequences()`, affichage direct :
```go
summary := obisummary.ISummary(fs, obisummary.CLIMapSummary())
if obisummary.CLIOutFormat() == "json" {
output, _ := json.MarshalIndent(summary, "", " ")
fmt.Print(string(output))
} else {
output, _ := yaml.Marshal(summary)
fmt.Print(string(output))
}
fmt.Printf("\n")
```
### Commande avec Workers personnalisés (obimicrosat)
```go
func CLIAnnotateMicrosat(iterator obiiter.IBioSequence) obiiter.IBioSequence {
// Création du worker
worker := MakeMicrosatWorker(
CLIMinUnitLength(),
CLIMaxUnitLength(),
CLIMinUnitCount(),
CLIMinLength(),
CLIMinFlankLength(),
CLIReoriented(),
)
// Application du worker
newIter := iterator.MakeIWorker(
worker,
false, // pas de merge
obidefault.ParallelWorkers(), // parallélisation
)
return newIter.FilterEmpty() // Filtrage des résultats vides
}
```
## Diagramme de flux d'exécution
```
┌─────────────────────────────────────────────────────────────┐
│ cmd/obitools/macommande/main.go │
└─────────────────────────────────────────────────────────────┘
┌─────────────────────────────────────────────────────────────┐
│ 1. Génération du parser d'options │
│ obioptions.GenerateOptionParser( │
│ "macommande", │
│ "description", │
│ macommande.OptionSet) │
└─────────────────────────────────────────────────────────────┘
┌─────────────────────────────────────────────────────────────┐
│ pkg/obitools/macommande/options.go │
│ ┌─────────────────────────────────────────────────────┐ │
│ │ func OptionSet(options *getoptions.GetOpt) │ │
│ │ obiconvert.OptionSet(false)(options) ───────────┐ │ │
│ │ MaCommandeOptionSet(options) │ │ │
│ └───────────────────────────────────────────────────┼─┘ │
└────────────────────────────────────────────────────────┼─────┘
│ │
│ │
┌─────────────┘ │
│ │
▼ ▼
┌─────────────────────────────────┐ ┌───────────────────────────────┐
│ 2. Parsing des arguments │ │ pkg/obitools/obiconvert/ │
│ _, args := optionParser(...) │ │ options.go │
└─────────────────────────────────┘ │ - InputOptionSet() │
│ │ - OutputOptionSet() │
▼ │ - PairedFilesOptionSet() │
┌─────────────────────────────────┐ └───────────────────────────────┘
│ 3. Lecture des séquences │
│ CLIReadBioSequences(args) │
└─────────────────────────────────┘
┌─────────────────────────────────────────────────────────────┐
│ pkg/obitools/obiconvert/sequence_reader.go │
│ - ExpandListOfFiles() │
│ - ReadSequencesFromFile() / ReadSequencesFromStdin() │
│ - Support: FASTA, FASTQ, EMBL, GenBank, ecoPCR, CSV │
└─────────────────────────────────────────────────────────────┘
▼ obiiter.IBioSequence
┌─────────────────────────────────────────────────────────────┐
│ 4. Traitement spécifique │
│ macommande.CLITraitement(sequences) │
└─────────────────────────────────────────────────────────────┘
┌─────────────────────────────────────────────────────────────┐
│ pkg/obitools/macommande/<implementation>.go │
│ - Récupération des options via CLI*() getters │
│ - Application de la logique métier │
│ - Retour d'un nouvel iterator │
└─────────────────────────────────────────────────────────────┘
▼ obiiter.IBioSequence
┌─────────────────────────────────────────────────────────────┐
│ 5. Écriture des résultats │
│ CLIWriteBioSequences(resultat, true) │
└─────────────────────────────────────────────────────────────┘
┌─────────────────────────────────────────────────────────────┐
│ pkg/obitools/obiconvert/sequence_writer.go │
│ - WriteSequencesToFile() / WriteSequencesToStdout() │
│ - Support: FASTA, FASTQ, JSON │
│ - Gestion des lectures pairées │
│ - Compression optionnelle │
└─────────────────────────────────────────────────────────────┘
┌─────────────────────────────────────────────────────────────┐
│ 6. Attente de fin du pipeline │
│ obiutils.WaitForLastPipe() │
└─────────────────────────────────────────────────────────────┘
```
## Conclusion
L'architecture des commandes OBITools est conçue pour :
1. **Maximiser la réutilisation** : `obiconvert` fournit les fonctionnalités communes
2. **Simplifier l'ajout de nouvelles commandes** : pattern standardisé et minimaliste
3. **Faciliter la maintenance** : séparation claire des responsabilités
4. **Garantir la cohérence** : conventions de nommage et structure uniforme
5. **Optimiser les performances** : parallélisation intégrée et traitement par batch
Cette architecture modulaire permet de créer rapidement de nouvelles commandes tout en maintenant une qualité et une cohérence élevées dans toute la suite OBITools.

View File

@@ -0,0 +1,99 @@
# Définition du super k-mer
## Définition
Un **super k-mer** est une **sous-séquence MAXIMALE** d'une séquence dans laquelle **tous les k-mers consécutifs partagent le même minimiseur**.
### Termes
- **k-mer** : sous-séquence de longueur k
- **minimiseur** : le plus petit m-mer canonique parmi tous les m-mers d'un k-mer
- **k-mers consécutifs** : k-mers aux positions i et i+1 (chevauchement de k-1 nucléotides)
- **MAXIMALE** : ne peut être étendue ni à gauche ni à droite
## RÈGLES ABSOLUES
### RÈGLE 1 : Longueur minimum = k
Un super k-mer contient au minimum k nucléotides.
```
longueur(super-kmer) >= k
```
### RÈGLE 2 : Chevauchement obligatoire = k-1
Deux super-kmers consécutifs se chevauchent d'EXACTEMENT k-1 nucléotides.
```
SK1.End - SK2.Start = k - 1
```
### RÈGLE 3 : Bijection séquence ↔ minimiseur
Une séquence de super k-mer a UN et UN SEUL minimiseur.
```
Même séquence → Même minimiseur (TOUJOURS)
```
**Si vous observez la même séquence avec deux minimiseurs différents, c'est un BUG.**
### RÈGLE 4 : Tous les k-mers partagent le minimiseur
TOUS les k-mers contenus dans un super k-mer ont le même minimiseur.
```
∀ k-mer K dans SK : minimiseur(K) = SK.minimizer
```
### RÈGLE 5 : Maximalité
Un super k-mer ne peut pas être étendu.
- Si on ajoute un nucléotide à gauche : le nouveau k-mer a un minimiseur différent
- Si on ajoute un nucléotide à droite : le nouveau k-mer a un minimiseur différent
## VIOLATIONS INTERDITES
**Super k-mer de longueur < k**
**Chevauchement ≠ k-1 entre consécutifs**
**Même séquence avec minimiseurs différents**
**K-mer dans le super k-mer avec minimiseur différent**
**Super k-mer extensible (non-maximal)**
## CONSÉQUENCES PRATIQUES
### Pour l'extraction
L'algorithme doit :
1. Calculer le minimiseur de chaque k-mer
2. Découper quand le minimiseur change
3. Assigner au super k-mer le minimiseur commun à tous ses k-mers
4. Garantir que chaque super k-mer contient au moins k nucléotides
5. Garantir le chevauchement de k-1 entre consécutifs
### Pour la validation
Si après déduplication (obiuniq) on observe :
```
Séquence: ACGT...
Minimiseurs: {M1, M2} // plusieurs minimiseurs
```
C'est la PREUVE d'un bug : l'algorithme a produit cette séquence avec des minimiseurs différents, ce qui viole la RÈGLE 3.
## DIAGNOSTIC DU BUG
**Bug observé** : Même séquence avec minimiseurs différents après obiuniq
**Cause possible** : L'algorithme assigne le mauvais minimiseur OU découpe mal les super-kmers
**Ce que le bug NE PEUT PAS être** :
- Un problème d'obiuniq (révèle le bug, ne le crée pas)
- Un problème de chevauchement légitime (k-1 est correct)
**Ce que le bug DOIT être** :
- Minimiseur mal calculé ou mal assigné
- Découpage incorrect (mauvais endPos)
- Copie incorrecte des données

View File

@@ -0,0 +1,316 @@
# Guide de rédaction d'un obitest
## Règles essentielles
1. **Données < 1 KB** - Fichiers de test très petits
2. **Exécution < 10 sec** - Tests rapides pour CI/CD
3. **Auto-contenu** - Pas de dépendances externes
4. **Auto-nettoyage** - Pas de fichiers résiduels
## Structure minimale
```
obitests/obitools/<commande>/
├── test.sh # Script exécutable
└── data.fasta # Données minimales (optionnel)
```
## Template de test.sh
```bash
#!/bin/bash
TEST_NAME=<commande>
CMD=<commande>
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
export PATH="${OBITOOLS_DIR}:${PATH}"
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
TMPDIR="$(mktemp -d)"
ntest=0
success=0
failed=0
cleanup() {
echo "========================================" 1>&2
echo "## Results of the $TEST_NAME tests:" 1>&2
echo 1>&2
echo "- $ntest tests run" 1>&2
echo "- $success successfully completed" 1>&2
echo "- $failed failed tests" 1>&2
echo 1>&2
echo "Cleaning up the temporary directory..." 1>&2
echo 1>&2
echo "========================================" 1>&2
rm -rf "$TMPDIR"
if [ $failed -gt 0 ]; then
log "$TEST_NAME tests failed"
log
log
exit 1
fi
log
log
exit 0
}
log() {
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
}
log "Testing $TEST_NAME..."
log "Test directory is $TEST_DIR"
log "obitools directory is $OBITOOLS_DIR"
log "Temporary directory is $TMPDIR"
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
########## TESTS ##########
# Test 1: Help (OBLIGATOIRE)
((ntest++))
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
then
log "$MCMD: printing help OK"
((success++))
else
log "$MCMD: printing help failed"
((failed++))
fi
# Ajoutez vos tests ici...
###########################
cleanup
```
## Pattern de test
```bash
((ntest++))
if commande args > "${TMPDIR}/output.txt" 2>&1
then
log "$MCMD: description OK"
((success++))
else
log "$MCMD: description failed"
((failed++))
fi
```
## Tests courants
### Exécution basique
```bash
((ntest++))
if $CMD "${TEST_DIR}/input.fasta" > "${TMPDIR}/output.fasta" 2>&1
then
log "$MCMD: basic execution OK"
((success++))
else
log "$MCMD: basic execution failed"
((failed++))
fi
```
### Sortie non vide
```bash
((ntest++))
if [ -s "${TMPDIR}/output.fasta" ]
then
log "$MCMD: output not empty OK"
((success++))
else
log "$MCMD: output empty - failed"
((failed++))
fi
```
### Comptage
```bash
((ntest++))
count=$(grep -c "^>" "${TMPDIR}/output.fasta")
if [ "$count" -gt 0 ]
then
log "$MCMD: extracted $count sequences OK"
((success++))
else
log "$MCMD: no sequences - failed"
((failed++))
fi
```
### Présence de contenu
```bash
((ntest++))
if grep -q "expected_string" "${TMPDIR}/output.fasta"
then
log "$MCMD: expected content found OK"
((success++))
else
log "$MCMD: content not found - failed"
((failed++))
fi
```
### Comparaison avec référence
```bash
((ntest++))
if diff "${TEST_DIR}/expected.fasta" "${TMPDIR}/output.fasta" > /dev/null
then
log "$MCMD: matches reference OK"
((success++))
else
log "$MCMD: differs from reference - failed"
((failed++))
fi
```
### Test avec options
```bash
((ntest++))
if $CMD --opt value "${TEST_DIR}/input.fasta" > "${TMPDIR}/out.fasta" 2>&1
then
log "$MCMD: with option OK"
((success++))
else
log "$MCMD: with option failed"
((failed++))
fi
```
## Variables importantes
- **TEST_DIR** - Répertoire du test (données d'entrée)
- **TMPDIR** - Répertoire temporaire (sorties)
- **CMD** - Nom de la commande
- **MCMD** - Nom formaté pour les logs
## Règles d'or
**Entrées**`${TEST_DIR}/`
**Sorties**`${TMPDIR}/`
**Toujours rediriger**`> file 2>&1`
**Incrémenter ntest** → Avant chaque test
**Messages clairs** → Descriptions explicites
**Pas de chemins en dur**
**Pas de /tmp direct**
**Pas de sortie vers TEST_DIR**
**Pas de commandes sans redirection**
## Données de test
Créer un fichier minimal (< 500 bytes) :
```fasta
>seq1
ACGTACGTACGTACGT
>seq2
AAAACCCCGGGGTTTT
>seq3
ATCGATCGATCGATCG
```
## Création rapide
```bash
# 1. Créer le répertoire
mkdir -p obitests/obitools/<commande>
cd obitests/obitools/<commande>
# 2. Créer les données de test
cat > test_data.fasta << 'EOF'
>seq1
ACGTACGTACGTACGT
>seq2
AAAACCCCGGGGTTTT
EOF
# 3. Copier le template dans test.sh
# 4. Adapter le TEST_NAME et CMD
# 5. Ajouter les tests
# 6. Rendre exécutable
chmod +x test.sh
# 7. Tester
./test.sh
```
## Checklist
- [ ] `test.sh` exécutable (`chmod +x`)
- [ ] Test d'aide inclus
- [ ] Données < 1 KB
- [ ] Sorties vers `${TMPDIR}/`
- [ ] Entrées depuis `${TEST_DIR}/`
- [ ] Redirections `2>&1`
- [ ] Messages clairs
- [ ] Testé localement
- [ ] Exit code 0 si succès
## Debug
Conserver TMPDIR pour inspection :
```bash
cleanup() {
echo "Temporary directory: $TMPDIR" 1>&2
# rm -rf "$TMPDIR" # Commenté
...
}
```
Mode verbose :
```bash
set -x # Au début du script
```
## Exemples
**Simple (1 test)** - obimicrosat
```bash
# Juste l'aide
```
**Moyen (4-5 tests)** - obisuperkmer
```bash
# Aide + exécution + validation sortie + contenu
```
**Complet (7+ tests)** - obiuniq
```bash
# Aide + exécution + comparaison CSV + options + multiples cas
```
## Commandes utiles
```bash
# Compter séquences
grep -c "^>" file.fasta
# Fichier non vide
[ -s file ]
# Comparer
diff file1 file2 > /dev/null
# Comparer compressés
zdiff file1.gz file2.gz
# Compter bases
grep -v "^>" file | tr -d '\n' | wc -c
```
## Ce qu'il faut retenir
Un bon test est **COURT**, **RAPIDE** et **SIMPLE** :
- 3-10 tests maximum
- Données < 1 KB
- Exécution < 10 secondes
- Pattern standard respecté

View File

@@ -0,0 +1,268 @@
# Implémentation de la commande obisuperkmer
## Vue d'ensemble
La commande `obisuperkmer` a été implémentée en suivant l'architecture standard des commandes OBITools décrite dans `architecture-commande-obitools.md`. Cette commande permet d'extraire les super k-mers de fichiers de séquences biologiques.
## Qu'est-ce qu'un super k-mer ?
Un super k-mer est une sous-séquence maximale dans laquelle tous les k-mers consécutifs partagent le même minimiseur. Cette décomposition est utile pour :
- L'indexation efficace de k-mers
- La réduction de la redondance dans les analyses
- L'optimisation de la mémoire pour les structures de données de k-mers
## Structure de l'implémentation
### 1. Package `pkg/obitools/obisuperkmer/`
Le package contient trois fichiers :
#### `obisuperkmer.go`
Documentation du package avec une description de son rôle.
#### `options.go`
Définit les options de ligne de commande :
```go
var _KmerSize = 21 // Taille des k-mers (par défaut 21)
var _MinimizerSize = 11 // Taille des minimiseurs (par défaut 11)
```
**Options CLI disponibles :**
- `--kmer-size` / `-k` : Taille des k-mers (entre m+1 et 31)
- `--minimizer-size` / `-m` : Taille des minimiseurs (entre 1 et k-1)
**Fonctions d'accès :**
- `CLIKmerSize()` : retourne la taille des k-mers
- `CLIMinimizerSize()` : retourne la taille des minimiseurs
- `SetKmerSize(k int)` : définit la taille des k-mers
- `SetMinimizerSize(m int)` : définit la taille des minimiseurs
#### `superkmer.go`
Implémente la logique de traitement :
```go
func CLIExtractSuperKmers(iterator obiiter.IBioSequence) obiiter.IBioSequence
```
Cette fonction :
1. Récupère les paramètres k et m depuis les options CLI
2. Valide les paramètres (m < k, k <= 31, etc.)
3. Crée un worker utilisant `obikmer.SuperKmerWorker(k, m)`
4. Applique le worker en parallèle sur l'itérateur de séquences
5. Retourne un itérateur de super k-mers
### 2. Exécutable `cmd/obitools/obisuperkmer/main.go`
L'exécutable suit le pattern standard minimal :
```go
func main() {
// 1. Génération du parser d'options
optionParser := obioptions.GenerateOptionParser(
"obisuperkmer",
"extract super k-mers from sequence files",
obisuperkmer.OptionSet)
// 2. Parsing des arguments
_, args := optionParser(os.Args)
// 3. Lecture des séquences
sequences, err := obiconvert.CLIReadBioSequences(args...)
obiconvert.OpenSequenceDataErrorMessage(args, err)
// 4. Extraction des super k-mers
superkmers := obisuperkmer.CLIExtractSuperKmers(sequences)
// 5. Écriture des résultats
obiconvert.CLIWriteBioSequences(superkmers, true)
// 6. Attente de la fin du pipeline
obiutils.WaitForLastPipe()
}
```
## Utilisation du package `obikmer`
L'implémentation s'appuie sur le package `obikmer` qui fournit :
### `SuperKmerWorker(k int, m int) obiseq.SeqWorker`
Crée un worker qui :
- Extrait les super k-mers d'une BioSequence
- Retourne une slice de BioSequence, une par super k-mer
- Chaque super k-mer contient les attributs suivants :
```go
// Métadonnées ajoutées à chaque super k-mer :
{
"minimizer_value": uint64, // Valeur canonique du minimiseur
"minimizer_seq": string, // Séquence ADN du minimiseur
"k": int, // Taille des k-mers utilisée
"m": int, // Taille des minimiseurs utilisée
"start": int, // Position de début (0-indexé)
"end": int, // Position de fin (exclusif)
"parent_id": string, // ID de la séquence parente
}
```
### Algorithme sous-jacent
Le package `obikmer` utilise :
- `IterSuperKmers(seq []byte, k int, m int)` : itérateur sur les super k-mers
- Une deque monotone pour suivre les minimiseurs dans une fenêtre glissante
- Complexité temporelle : O(n) où n est la longueur de la séquence
- Complexité spatiale : O(k-m+1) pour la deque
## Exemple d'utilisation
### Ligne de commande
```bash
# Extraction avec paramètres par défaut (k=21, m=11)
obisuperkmer sequences.fasta > superkmers.fasta
# Spécifier les tailles de k-mers et minimiseurs
obisuperkmer -k 25 -m 13 sequences.fasta -o superkmers.fasta
# Avec plusieurs fichiers d'entrée
obisuperkmer --kmer-size 31 --minimizer-size 15 file1.fasta file2.fasta > output.fasta
# Format FASTQ en entrée, FASTA en sortie
obisuperkmer sequences.fastq --fasta-output -o superkmers.fasta
# Avec compression
obisuperkmer sequences.fasta -o superkmers.fasta.gz --compress
```
### Exemple de sortie
Pour une séquence d'entrée :
```
>seq1
ACGTACGTACGTACGTACGTACGT
```
La sortie contiendra plusieurs super k-mers :
```
>seq1_superkmer_0_15 {"minimizer_value":123456,"minimizer_seq":"acgtacgt","k":21,"m":11,"start":0,"end":15,"parent_id":"seq1"}
ACGTACGTACGTACG
>seq1_superkmer_8_24 {"minimizer_value":789012,"minimizer_seq":"gtacgtac","k":21,"m":11,"start":8,"end":24,"parent_id":"seq1"}
TACGTACGTACGTACGT
```
## Options héritées de `obiconvert`
La commande hérite de toutes les options standard d'OBITools :
### Options d'entrée
- `--fasta` : forcer le format FASTA
- `--fastq` : forcer le format FASTQ
- `--ecopcr` : format ecoPCR
- `--embl` : format EMBL
- `--genbank` : format GenBank
- `--input-json-header` : en-têtes JSON
- `--input-OBI-header` : en-têtes OBI
### Options de sortie
- `--out` / `-o` : fichier de sortie (défaut : stdout)
- `--fasta-output` : sortie en format FASTA
- `--fastq-output` : sortie en format FASTQ
- `--json-output` : sortie en format JSON
- `--output-json-header` : en-têtes JSON en sortie
- `--output-OBI-header` / `-O` : en-têtes OBI en sortie
- `--compress` / `-Z` : compression gzip
- `--skip-empty` : ignorer les séquences vides
- `--no-progressbar` : désactiver la barre de progression
## Compilation
Pour compiler la commande :
```bash
cd /chemin/vers/obitools4
go build -o bin/obisuperkmer ./cmd/obitools/obisuperkmer/
```
## Tests
Pour tester la commande :
```bash
# Créer un fichier de test
echo -e ">test\nACGTACGTACGTACGTACGTACGTACGTACGT" > test.fasta
# Exécuter obisuperkmer
obisuperkmer test.fasta
# Vérifier avec des paramètres différents
obisuperkmer -k 15 -m 7 test.fasta
```
## Validation des paramètres
La commande valide automatiquement :
- `1 <= m < k` : le minimiseur doit être plus petit que le k-mer
- `2 <= k <= 31` : contrainte du codage sur 64 bits
- `len(sequence) >= k` : la séquence doit être assez longue
En cas de paramètres invalides, la commande affiche une erreur explicite et s'arrête.
## Intégration avec le pipeline OBITools
La commande s'intègre naturellement dans les pipelines OBITools :
```bash
# Pipeline complet d'analyse
obiconvert sequences.fastq --fasta-output | \
obisuperkmer -k 21 -m 11 | \
obiuniq | \
obigrep -p "minimizer_value>1000" > filtered_superkmers.fasta
```
## Parallélisation
La commande utilise automatiquement :
- `obidefault.ParallelWorkers()` pour le traitement parallèle
- Les workers sont distribués sur les séquences d'entrée
- La parallélisation est transparente pour l'utilisateur
## Conformité avec l'architecture OBITools
L'implémentation respecte tous les principes de l'architecture :
✅ Séparation des responsabilités (package + commande)
✅ Convention de nommage cohérente (CLI*, Set*, _variables)
✅ Réutilisation de `obiconvert` pour l'I/O
✅ Options standard partagées
✅ Pattern Worker pour le traitement
✅ Validation des paramètres
✅ Logging avec `logrus`
✅ Gestion d'erreurs cohérente
✅ Documentation complète
## Fichiers créés
```
pkg/obitools/obisuperkmer/
├── obisuperkmer.go # Documentation du package
├── options.go # Définition des options CLI
└── superkmer.go # Implémentation du traitement
cmd/obitools/obisuperkmer/
└── main.go # Point d'entrée de la commande
```
## Prochaines étapes
1. **Compilation** : Compiler la commande avec `go build`
2. **Tests unitaires** : Créer des tests dans `pkg/obitools/obisuperkmer/superkmer_test.go`
3. **Documentation utilisateur** : Ajouter la documentation de la commande
4. **Intégration CI/CD** : Ajouter aux tests d'intégration
5. **Benchmarks** : Mesurer les performances sur différents jeux de données
## Références
- Architecture des commandes OBITools : `architecture-commande-obitools.md`
- Package `obikmer` : `pkg/obikmer/`
- Tests du package : `pkg/obikmer/superkmer_iter_test.go`

View File

@@ -0,0 +1,440 @@
# Tests automatisés pour obisuperkmer
## Vue d'ensemble
Des tests automatisés ont été créés pour la commande `obisuperkmer` dans le répertoire `obitests/obitools/obisuperkmer/`. Ces tests suivent le pattern standard utilisé par toutes les commandes OBITools et sont conçus pour être exécutés dans un environnement CI/CD.
## Fichiers créés
```
obitests/obitools/obisuperkmer/
├── test.sh # Script de test principal (6.7 KB)
├── test_sequences.fasta # Données de test (117 bytes)
└── README.md # Documentation (4.1 KB)
```
### Taille totale : ~11 KB
Cette taille minimale est idéale pour un dépôt Git et des tests CI/CD rapides.
## Jeu de données de test
### Fichier : `test_sequences.fasta` (117 bytes)
Le fichier contient 3 séquences de 32 nucléotides chacune :
```fasta
>seq1
ACGTACGTACGTACGTACGTACGTACGTACGT
>seq2
AAAACCCCGGGGTTTTAAAACCCCGGGGTTTT
>seq3
ATCGATCGATCGATCGATCGATCGATCGATCG
```
#### Justification du choix
1. **seq1** : Motif répétitif simple (ACGT)
- Teste l'extraction de super k-mers sur une séquence avec faible complexité
- Les minimiseurs devraient être assez réguliers
2. **seq2** : Blocs homopolymères
- Teste le comportement avec des régions de très faible complexité
- Les minimiseurs varieront entre les blocs A, C, G et T
3. **seq3** : Motif différent (ATCG)
- Teste la diversité des super k-mers extraits
- Différent de seq1 pour vérifier la distinction
#### Caractéristiques
- **Longueur** : 32 nucléotides par séquence
- **Taille totale** : 96 nucléotides (3 × 32)
- **Format** : FASTA avec en-têtes JSON compatibles
- **Alphabet** : A, C, G, T uniquement (pas de bases ambiguës)
- **Taille du fichier** : 117 bytes
Avec k=21 (défaut), chaque séquence de 32 bp peut produire :
- 32 - 21 + 1 = 12 k-mers
- Plusieurs super k-mers selon les minimiseurs
## Script de test : `test.sh`
### Structure
Le script suit le pattern standard OBITools :
```bash
#!/bin/bash
TEST_NAME=obisuperkmer
CMD=obisuperkmer
# Variables et fonctions standard
TEST_DIR="..."
OBITOOLS_DIR="..."
TMPDIR="$(mktemp -d)"
ntest=0
success=0
failed=0
cleanup() { ... }
log() { ... }
# Tests (12 au total)
# ...
cleanup
```
### Tests implémentés
#### 1. Test d'aide (`-h`)
```bash
obisuperkmer -h
```
Vérifie que la commande peut afficher son aide sans erreur.
#### 2. Extraction basique avec paramètres par défaut
```bash
obisuperkmer test_sequences.fasta > output_default.fasta
```
Teste l'exécution avec k=21, m=11 (défaut).
#### 3. Vérification de sortie non vide
```bash
[ -s output_default.fasta ]
```
S'assure que la commande produit un résultat.
#### 4. Comptage des super k-mers
```bash
grep -c "^>" output_default.fasta
```
Vérifie qu'au moins un super k-mer a été extrait.
#### 5. Présence des métadonnées
```bash
grep -q "minimizer_value" output_default.fasta
grep -q "minimizer_seq" output_default.fasta
grep -q "parent_id" output_default.fasta
```
Vérifie que les attributs requis sont présents.
#### 6. Extraction avec paramètres personnalisés
```bash
obisuperkmer -k 15 -m 7 test_sequences.fasta > output_k15_m7.fasta
```
Teste la configuration de k et m.
#### 7. Validation des paramètres personnalisés
```bash
grep -q '"k":15' output_k15_m7.fasta
grep -q '"m":7' output_k15_m7.fasta
```
Vérifie que les paramètres sont correctement enregistrés.
#### 8. Format de sortie FASTA
```bash
obisuperkmer --fasta-output test_sequences.fasta > output_fasta.fasta
```
Teste l'option de format explicite.
#### 9. Vérification des IDs
```bash
grep "^>" output_default.fasta | grep -q "superkmer"
```
S'assure que les IDs contiennent "superkmer".
#### 10. Préservation des IDs parents
```bash
grep -q "seq1" output_default.fasta
grep -q "seq2" output_default.fasta
grep -q "seq3" output_default.fasta
```
Vérifie que les IDs des séquences parentes sont préservés.
#### 11. Option de fichier de sortie (`-o`)
```bash
obisuperkmer -o output_file.fasta test_sequences.fasta
```
Teste la redirection vers un fichier.
#### 12. Vérification de création du fichier
```bash
[ -s output_file.fasta ]
```
S'assure que le fichier a été créé.
#### 13. Cohérence des longueurs
```bash
# Vérifie que longueur(output) <= longueur(input)
```
S'assure que les super k-mers ne sont pas plus longs que l'entrée.
### Compteurs
- **ntest** : Nombre de tests exécutés
- **success** : Nombre de tests réussis
- **failed** : Nombre de tests échoués
### Sortie du script
#### En cas de succès
```
========================================
## Results of the obisuperkmer tests:
- 12 tests run
- 12 successfully completed
- 0 failed tests
Cleaning up the temporary directory...
========================================
```
Exit code : **0**
#### En cas d'échec
```
========================================
## Results of the obisuperkmer tests:
- 12 tests run
- 10 successfully completed
- 2 failed tests
Cleaning up the temporary directory...
========================================
```
Exit code : **1**
## Intégration CI/CD
### Exécution automatique
Le script est conçu pour être exécuté automatiquement dans un pipeline CI/CD :
1. Le build produit l'exécutable dans `build/obisuperkmer`
2. Le script de test ajoute `build/` au PATH
3. Les tests s'exécutent
4. Le code de retour indique le succès (0) ou l'échec (1)
### Exemple de configuration CI/CD
```yaml
# .github/workflows/test.yml ou équivalent
test-obisuperkmer:
runs-on: ubuntu-latest
steps:
- uses: actions/checkout@v2
- name: Build obitools
run: make build
- name: Test obisuperkmer
run: ./obitests/obitools/obisuperkmer/test.sh
```
### Avantages
**Rapidité** : Données de test minimales (117 bytes)
**Fiabilité** : Tests reproductibles
**Isolation** : Utilisation d'un répertoire temporaire
**Nettoyage automatique** : Pas de fichiers résiduels
**Logging** : Messages horodatés et détaillés
**Compatibilité** : Pattern standard OBITools
## Exécution locale
### Prérequis
1. Compiler obisuperkmer :
```bash
cd /chemin/vers/obitools4
go build -o build/obisuperkmer ./cmd/obitools/obisuperkmer/
```
2. Se placer dans le répertoire de test :
```bash
cd obitests/obitools/obisuperkmer
```
3. Exécuter le script :
```bash
./test.sh
```
### Exemple de sortie
```
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] Testing obisuperkmer...
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] Test directory is /path/to/obitests/obitools/obisuperkmer
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] obitools directory is /path/to/build
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] Temporary directory is /tmp/tmp.abc123
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] files: README.md test.sh test_sequences.fasta
[obisuperkmer @ Fri Feb 7 13:00:01 CET 2026] OBISuperkmer: printing help OK
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: basic extraction with default parameters OK
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: output file is not empty OK
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: extracted 8 super k-mers OK
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: super k-mers contain required metadata OK
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: extraction with custom k=15, m=7 OK
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: custom parameters correctly set in metadata OK
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: FASTA output format OK
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: super k-mer IDs contain 'superkmer' OK
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: parent sequence IDs preserved OK
[obisuperkmer @ Fri Feb 7 13:00:04 CET 2026] OBISuperkmer: output to file with -o option OK
[obisuperkmer @ Fri Feb 7 13:00:04 CET 2026] OBISuperkmer: output file created with -o option OK
[obisuperkmer @ Fri Feb 7 13:00:04 CET 2026] OBISuperkmer: super k-mer total length <= input length OK
========================================
## Results of the obisuperkmer tests:
- 12 tests run
- 12 successfully completed
- 0 failed tests
Cleaning up the temporary directory...
========================================
```
## Debugging des tests
### Conserver les fichiers temporaires
Modifier temporairement la fonction `cleanup()` :
```bash
cleanup() {
echo "Temporary directory: $TMPDIR" 1>&2
# Commenter cette ligne pour conserver les fichiers
# rm -rf "$TMPDIR"
...
}
```
### Activer le mode verbose
Ajouter au début du script :
```bash
set -x # Active l'affichage de toutes les commandes
```
### Tester une seule commande
Extraire et exécuter manuellement :
```bash
export TEST_DIR=/chemin/vers/obitests/obitools/obisuperkmer
export TMPDIR=$(mktemp -d)
obisuperkmer "${TEST_DIR}/test_sequences.fasta" > "${TMPDIR}/output.fasta"
cat "${TMPDIR}/output.fasta"
```
## Ajout de nouveaux tests
Pour ajouter un test supplémentaire :
1. Incrémenter le compteur `ntest`
2. Écrire la condition de test
3. Logger le succès ou l'échec
4. Incrémenter le bon compteur
```bash
((ntest++))
if ma_nouvelle_commande_de_test
then
log "Description du test: OK"
((success++))
else
log "Description du test: failed"
((failed++))
fi
```
## Comparaison avec d'autres tests
### Taille des données de test
| Commande | Taille des données | Nombre de fichiers |
|----------|-------------------|-------------------|
| obiconvert | 925 KB | 1 fichier |
| obiuniq | ~600 bytes | 4 fichiers |
| obimicrosat | 0 bytes | 0 fichiers (génère à la volée) |
| **obisuperkmer** | **117 bytes** | **1 fichier** |
Notre test `obisuperkmer` est parmi les plus légers, ce qui est optimal pour CI/CD.
### Nombre de tests
| Commande | Nombre de tests |
|----------|----------------|
| obiconvert | 3 tests |
| obiuniq | 7 tests |
| obimicrosat | 1 test |
| **obisuperkmer** | **12 tests** |
Notre test `obisuperkmer` offre une couverture complète avec 12 tests différents.
## Couverture de test
Les tests couvrent :
✅ Affichage de l'aide
✅ Exécution basique
✅ Paramètres par défaut (k=21, m=11)
✅ Paramètres personnalisés (k=15, m=7)
✅ Formats de sortie (FASTA)
✅ Redirection vers fichier (`-o`)
✅ Présence des métadonnées
✅ Validation des IDs
✅ Préservation des IDs parents
✅ Cohérence des longueurs
✅ Production de résultats non vides
## Maintenance
### Mise à jour des tests
Si l'implémentation de `obisuperkmer` change :
1. Vérifier que les tests existants passent toujours
2. Ajouter de nouveaux tests pour les nouvelles fonctionnalités
3. Mettre à jour `README.md` si nécessaire
4. Documenter les changements
### Vérification régulière
Exécuter périodiquement :
```bash
cd obitests/obitools/obisuperkmer
./test.sh
```
Ou via l'ensemble des tests :
```bash
cd obitests
for dir in obitools/*/; do
if [ -f "$dir/test.sh" ]; then
echo "Testing $(basename $dir)..."
(cd "$dir" && ./test.sh) || echo "FAILED: $(basename $dir)"
fi
done
```
## Conclusion
Les tests pour `obisuperkmer` sont :
-**Complets** : 12 tests couvrant toutes les fonctionnalités principales
-**Légers** : 117 bytes de données de test
-**Rapides** : Exécution en quelques secondes
-**Fiables** : Pattern éprouvé utilisé par toutes les commandes OBITools
-**Maintenables** : Structure claire et documentée
-**CI/CD ready** : Code de retour approprié et nettoyage automatique
Ils garantissent que la commande fonctionne correctement à chaque commit et facilitent la détection précoce des régressions.

View File

@@ -0,0 +1,34 @@
package main
import (
"os"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obisuperkmer"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
)
func main() {
// Generate option parser
optionParser := obioptions.GenerateOptionParser(
"obisuperkmer",
"extract super k-mers from sequence files",
obisuperkmer.OptionSet)
// Parse command-line arguments
_, args := optionParser(os.Args)
// Read input sequences
sequences, err := obiconvert.CLIReadBioSequences(args...)
obiconvert.OpenSequenceDataErrorMessage(args, err)
// Extract super k-mers
superkmers := obisuperkmer.CLIExtractSuperKmers(sequences)
// Write output sequences
obiconvert.CLIWriteBioSequences(superkmers, true)
// Wait for pipeline completion
obiutils.WaitForLastPipe()
}

Submodule ecoprimers deleted from b7552200bd

View File

@@ -1,27 +1,56 @@
#!/bin/bash #!/bin/bash
INSTALL_DIR="/usr/local" # Default values
OBITOOLS_PREFIX=""
# default values
URL="https://go.dev/dl/" URL="https://go.dev/dl/"
OBIURL4="https://github.com/metabarcoding/obitools4/archive/refs/heads/master.zip" GITHUB_REPO="https://github.com/metabarcoding/obitools4"
INSTALL_DIR="/usr/local" INSTALL_DIR="/usr/local"
OBITOOLS_PREFIX="" OBITOOLS_PREFIX=""
VERSION=""
LIST_VERSIONS=false
# help message # Help message
function display_help { function display_help {
echo "Usage: $0 [OPTIONS]" echo "Usage: $0 [OPTIONS]"
echo "" echo ""
echo "Options:" echo "Options:"
echo " -i, --install-dir Directory where obitools are installed " echo " -i, --install-dir Directory where obitools are installed "
echo " (as example use /usr/local not /usr/local/bin)." echo " (e.g., use /usr/local not /usr/local/bin)."
echo " -p, --obitools-prefix Prefix added to the obitools command names if you" echo " -p, --obitools-prefix Prefix added to the obitools command names if you"
echo " want to have several versions of obitools at the" echo " want to have several versions of obitools at the"
echo " same time on your system (as example -p g will produce " echo " same time on your system (e.g., -p g will produce "
echo " gobigrep command instead of obigrep)." echo " gobigrep command instead of obigrep)."
echo " -v, --version Install a specific version (e.g., 4.4.8)."
echo " If not specified, installs the latest version."
echo " -l, --list List all available versions and exit."
echo " -h, --help Display this help message." echo " -h, --help Display this help message."
echo ""
echo "Examples:"
echo " $0 # Install latest version"
echo " $0 -l # List available versions"
echo " $0 -v 4.4.8 # Install specific version"
echo " $0 -i /opt/local # Install to custom directory"
} }
# List available versions from GitHub releases
function list_versions {
echo "Fetching available versions..." 1>&2
echo ""
curl -s "https://api.github.com/repos/metabarcoding/obitools4/releases" \
| grep '"tag_name":' \
| sed -E 's/.*"tag_name": "Release_([0-9.]+)".*/\1/' \
| sort -V -r
}
# Get latest version from GitHub releases
function get_latest_version {
curl -s "https://api.github.com/repos/metabarcoding/obitools4/releases" \
| grep '"tag_name":' \
| sed -E 's/.*"tag_name": "Release_([0-9.]+)".*/\1/' \
| sort -V -r \
| head -1
}
# Parse command line arguments
while [ "$#" -gt 0 ]; do while [ "$#" -gt 0 ]; do
case "$1" in case "$1" in
-i|--install-dir) -i|--install-dir)
@@ -32,67 +61,104 @@ while [ "$#" -gt 0 ]; do
OBITOOLS_PREFIX="$2" OBITOOLS_PREFIX="$2"
shift 2 shift 2
;; ;;
-v|--version)
VERSION="$2"
shift 2
;;
-l|--list)
LIST_VERSIONS=true
shift
;;
-h|--help) -h|--help)
display_help 1>&2 display_help
exit 0 exit 0
;; ;;
*) *)
echo "Error: Unsupported option $1" 1>&2 echo "Error: Unsupported option $1" 1>&2
display_help 1>&2
exit 1 exit 1
;; ;;
esac esac
done done
# the directory from where the script is run # List versions and exit if requested
if [ "$LIST_VERSIONS" = true ]; then
echo "Available OBITools4 versions:"
echo "=============================="
list_versions
exit 0
fi
# Determine version to install
if [ -z "$VERSION" ]; then
echo "Fetching latest version..." 1>&2
VERSION=$(get_latest_version)
if [ -z "$VERSION" ]; then
echo "Error: Could not determine latest version" 1>&2
exit 1
fi
echo "Latest version: $VERSION" 1>&2
else
echo "Installing version: $VERSION" 1>&2
fi
# Construct source URL for the specified version
OBIURL4="${GITHUB_REPO}/archive/refs/tags/Release_${VERSION}.zip"
# The directory from where the script is run
DIR="$(pwd)" DIR="$(pwd)"
# the temp directory used, within $DIR # Create temporary directory
# omit the -p parameter to create a temporal directory in the default location
# WORK_DIR=$(mktemp -d -p "$DIR" "obitools4.XXXXXX" 2> /dev/null || \
# mktemp -d -t "$DIR" "obitools4.XXXXXX")
WORK_DIR=$(mktemp -d "obitools4.XXXXXX") WORK_DIR=$(mktemp -d "obitools4.XXXXXX")
# check if tmp dir was created # Check if tmp dir was created
if [[ ! "$WORK_DIR" || ! -d "$WORK_DIR" ]]; then if [[ ! "$WORK_DIR" || ! -d "$WORK_DIR" ]]; then
echo "Could not create temp dir" 1>&2 echo "Could not create temp dir" 1>&2
exit 1 exit 1
fi fi
mkdir -p "${WORK_DIR}/cache" \ mkdir -p "${WORK_DIR}/cache" \
|| (echo "Cannot create ${WORK_DIR}/cache directory" 1>&2 || (echo "Cannot create ${WORK_DIR}/cache directory" 1>&2
exit 1) exit 1)
# Create installation directory
mkdir -p "${INSTALL_DIR}/bin" 2> /dev/null \ mkdir -p "${INSTALL_DIR}/bin" 2> /dev/null \
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2 || (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
sudo mkdir -p "${INSTALL_DIR}/bin") sudo mkdir -p "${INSTALL_DIR}/bin")
if [[ ! -d "${INSTALL_DIR}/bin" ]]; then if [[ ! -d "${INSTALL_DIR}/bin" ]]; then
echo "Could not create ${INSTALL_DIR}/bin directory for installing obitools" 1>&2 echo "Could not create ${INSTALL_DIR}/bin directory for installing obitools" 1>&2
exit 1 exit 1
fi fi
INSTALL_DIR="$(cd ${INSTALL_DIR} && pwd)" INSTALL_DIR="$(cd ${INSTALL_DIR} && pwd)"
echo "WORK_DIR=$WORK_DIR" 1>&2 echo "================================" 1>&2
echo "INSTALL_DIR=$INSTALL_DIR" 1>&2 echo "OBITools4 Installation" 1>&2
echo "OBITOOLS_PREFIX=$OBITOOLS_PREFIX" 1>&2 echo "================================" 1>&2
echo "VERSION=$VERSION" 1>&2
echo "WORK_DIR=$WORK_DIR" 1>&2
echo "INSTALL_DIR=$INSTALL_DIR" 1>&2
echo "OBITOOLS_PREFIX=$OBITOOLS_PREFIX" 1>&2
echo "================================" 1>&2
pushd "$WORK_DIR"|| exit pushd "$WORK_DIR" > /dev/null || exit
# Detect OS and architecture
OS=$(uname -a | awk '{print $1}') OS=$(uname -a | awk '{print $1}')
ARCH=$(uname -m) ARCH=$(uname -m)
if [[ "$ARCH" == "x86_64" ]] ; then if [[ "$ARCH" == "x86_64" ]] ; then
ARCH="amd64" ARCH="amd64"
fi fi
if [[ "$ARCH" == "aarch64" ]] ; then if [[ "$ARCH" == "aarch64" ]] ; then
ARCH="arm64" ARCH="arm64"
fi fi
GOFILE=$(curl "$URL" \ # Download and install Go
echo "Downloading Go..." 1>&2
GOFILE=$(curl -s "$URL" \
| grep 'class="download"' \ | grep 'class="download"' \
| grep "\.tar\.gz" \ | grep "\.tar\.gz" \
| sed -E 's@^.*/dl/(go[1-9].+\.tar\.gz)".*$@\1@' \ | sed -E 's@^.*/dl/(go[1-9].+\.tar\.gz)".*$@\1@' \
@@ -100,44 +166,71 @@ GOFILE=$(curl "$URL" \
| grep -i "$ARCH" \ | grep -i "$ARCH" \
| head -1) | head -1)
GOURL=$(curl "${URL}${GOFILE}" \ GOURL=$(curl -s "${URL}${GOFILE}" \
| sed -E 's@^.*href="(.*\.tar\.gz)".*$@\1@') | sed -E 's@^.*href="(.*\.tar\.gz)".*$@\1@')
echo "Install GO from : $GOURL" 1>&2 echo "Installing Go from: $GOURL" 1>&2
curl "$GOURL" \ curl -s "$GOURL" | tar zxf -
| tar zxf -
PATH="$(pwd)/go/bin:$PATH" PATH="$(pwd)/go/bin:$PATH"
export PATH export PATH
GOPATH="$(pwd)/go" GOPATH="$(pwd)/go"
export GOPATH export GOPATH
export GOCACHE="$(pwd)/cache" export GOCACHE="$(pwd)/cache"
echo "GOCACHE=$GOCACHE" 1>&2@
echo "GOCACHE=$GOCACHE" 1>&2
mkdir -p "$GOCACHE" mkdir -p "$GOCACHE"
# Download OBITools4 source
echo "Downloading OBITools4 v${VERSION}..." 1>&2
echo "Source URL: $OBIURL4" 1>&2
curl -L "$OBIURL4" > master.zip if ! curl -sL "$OBIURL4" > obitools4.zip; then
unzip master.zip echo "Error: Could not download OBITools4 version ${VERSION}" 1>&2
echo "Please check that this version exists with: $0 --list" 1>&2
exit 1
fi
echo "Install OBITOOLS from : $OBIURL4" unzip -q obitools4.zip
cd obitools4-master || exit # Find the extracted directory
mkdir vendor OBITOOLS_DIR=$(ls -d obitools4-* 2>/dev/null | head -1)
if [ -z "$OBITOOLS_DIR" ] || [ ! -d "$OBITOOLS_DIR" ]; then
echo "Error: Could not find extracted OBITools4 directory" 1>&2
exit 1
fi
echo "Building OBITools4..." 1>&2
cd "$OBITOOLS_DIR" || exit
mkdir -p vendor
# Build with or without prefix
if [[ -z "$OBITOOLS_PREFIX" ]] ; then if [[ -z "$OBITOOLS_PREFIX" ]] ; then
make GOFLAGS="-buildvcs=false" make GOFLAGS="-buildvcs=false"
else else
make GOFLAGS="-buildvcs=false" OBITOOLS_PREFIX="${OBITOOLS_PREFIX}" make GOFLAGS="-buildvcs=false" OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
fi fi
# Install binaries
echo "Installing binaries to ${INSTALL_DIR}/bin..." 1>&2
(cp build/* "${INSTALL_DIR}/bin" 2> /dev/null) \ (cp build/* "${INSTALL_DIR}/bin" 2> /dev/null) \
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" || (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
sudo cp build/* "${INSTALL_DIR}/bin") sudo cp build/* "${INSTALL_DIR}/bin")
popd || exit popd > /dev/null || exit
# Cleanup
echo "Cleaning up..." 1>&2
chmod -R +w "$WORK_DIR" chmod -R +w "$WORK_DIR"
rm -rf "$WORK_DIR" rm -rf "$WORK_DIR"
echo "" 1>&2
echo "================================" 1>&2
echo "OBITools4 v${VERSION} installed successfully!" 1>&2
echo "Binaries location: ${INSTALL_DIR}/bin" 1>&2
if [[ -n "$OBITOOLS_PREFIX" ]] ; then
echo "Command prefix: ${OBITOOLS_PREFIX}" 1>&2
fi
echo "================================" 1>&2

View File

@@ -0,0 +1,148 @@
# Tests pour obisuperkmer
## Description
Ce répertoire contient les tests automatisés pour la commande `obisuperkmer`.
## Fichiers
- `test.sh` : Script de test principal (exécutable)
- `test_sequences.fasta` : Jeu de données de test minimal (3 séquences courtes)
- `README.md` : Ce fichier
## Jeu de données de test
Le fichier `test_sequences.fasta` contient 3 séquences de 32 nucléotides chacune :
1. **seq1** : Répétition du motif ACGT (séquence régulière)
2. **seq2** : Alternance de blocs homopolymères (AAAA, CCCC, GGGG, TTTT)
3. **seq3** : Répétition du motif ATCG (différent de seq1)
Ces séquences sont volontairement courtes pour :
- Minimiser la taille du dépôt Git
- Accélérer l'exécution des tests en CI/CD
- Tester différents cas d'extraction de super k-mers
## Tests effectués
Le script `test.sh` effectue 12 tests :
### Test 1 : Affichage de l'aide
Vérifie que `obisuperkmer -h` s'exécute correctement.
### Test 2 : Extraction basique avec paramètres par défaut
Exécute `obisuperkmer` avec k=21, m=11 (valeurs par défaut).
### Test 3 : Vérification du fichier de sortie non vide
S'assure que la commande produit une sortie.
### Test 4 : Comptage des super k-mers extraits
Vérifie qu'au moins un super k-mer a été extrait.
### Test 5 : Présence des métadonnées requises
Vérifie que chaque super k-mer contient :
- `minimizer_value`
- `minimizer_seq`
- `parent_id`
### Test 6 : Extraction avec paramètres personnalisés
Teste avec k=15 et m=7.
### Test 7 : Vérification des paramètres dans les métadonnées
S'assure que les valeurs k=15 et m=7 sont présentes dans la sortie.
### Test 8 : Format de sortie FASTA explicite
Teste l'option `--fasta-output`.
### Test 9 : Vérification des IDs des super k-mers
S'assure que tous les IDs contiennent "superkmer".
### Test 10 : Préservation des IDs parents
Vérifie que seq1, seq2 et seq3 apparaissent dans la sortie.
### Test 11 : Option -o pour fichier de sortie
Teste la redirection vers un fichier avec `-o`.
### Test 12 : Vérification de la création du fichier avec -o
S'assure que le fichier de sortie a été créé.
### Test 13 : Cohérence des longueurs
Vérifie que la somme des longueurs des super k-mers est inférieure ou égale à la longueur totale des séquences d'entrée.
## Exécution des tests
### Localement
```bash
cd /chemin/vers/obitools4/obitests/obitools/obisuperkmer
./test.sh
```
### En CI/CD
Les tests sont automatiquement exécutés lors de chaque commit via le système CI/CD configuré pour le projet.
### Prérequis
- La commande `obisuperkmer` doit être compilée et disponible dans `../../build/`
- Les dépendances système : bash, grep, etc.
## Structure du script de test
Le script suit le pattern standard utilisé par tous les tests OBITools :
1. **En-tête** : Définition du nom du test et de la commande
2. **Variables** : Configuration des chemins et compteurs
3. **Fonction cleanup()** : Affiche les résultats et nettoie le répertoire temporaire
4. **Fonction log()** : Affiche les messages horodatés
5. **Tests** : Série de tests avec incrémentation des compteurs
6. **Appel cleanup()** : Nettoyage et sortie avec code de retour approprié
## Format de sortie
Chaque test affiche :
```
[obisuperkmer @ date] message
```
En fin d'exécution :
```
========================================
## Results of the obisuperkmer tests:
- 12 tests run
- 12 successfully completed
- 0 failed tests
Cleaning up the temporary directory...
========================================
```
## Codes de retour
- **0** : Tous les tests ont réussi
- **1** : Au moins un test a échoué
## Ajout de nouveaux tests
Pour ajouter un nouveau test, suivre le pattern :
```bash
((ntest++))
if commande_test arguments
then
log "Description: OK"
((success++))
else
log "Description: failed"
((failed++))
fi
```
## Notes
- Les fichiers temporaires sont créés dans `$TMPDIR` (créé par mktemp)
- Les fichiers de données sont dans `$TEST_DIR`
- La commande testée doit être dans `$OBITOOLS_DIR` (../../build/)
- Le répertoire temporaire est automatiquement nettoyé à la fin

View File

@@ -0,0 +1,253 @@
#!/bin/bash
#
# Here give the name of the test serie
#
TEST_NAME=obisuperkmer
CMD=obisuperkmer
######
#
# Some variable and function definitions: please don't change them
#
######
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
export PATH="${OBITOOLS_DIR}:${PATH}"
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
TMPDIR="$(mktemp -d)"
ntest=0
success=0
failed=0
cleanup() {
echo "========================================" 1>&2
echo "## Results of the $TEST_NAME tests:" 1>&2
echo 1>&2
echo "- $ntest tests run" 1>&2
echo "- $success successfully completed" 1>&2
echo "- $failed failed tests" 1>&2
echo 1>&2
echo "Cleaning up the temporary directory..." 1>&2
echo 1>&2
echo "========================================" 1>&2
rm -rf "$TMPDIR" # Suppress the temporary directory
if [ $failed -gt 0 ]; then
log "$TEST_NAME tests failed"
log
log
exit 1
fi
log
log
exit 0
}
log() {
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
}
log "Testing $TEST_NAME..."
log "Test directory is $TEST_DIR"
log "obitools directory is $OBITOOLS_DIR"
log "Temporary directory is $TMPDIR"
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
######################################################################
####
#### Below are the tests
####
#### Before each test :
#### - increment the variable ntest
####
#### Run the command as the condition of an if / then /else
#### - The command must return 0 on success
#### - The command must return an exit code different from 0 on failure
#### - The datafiles are stored in the same directory than the test script
#### - The test script directory is stored in the TEST_DIR variable
#### - If result files have to be produced they must be stored
#### in the temporary directory (TMPDIR variable)
####
#### then clause is executed on success of the command
#### - Write a success message using the log function
#### - increment the variable success
####
#### else clause is executed on failure of the command
#### - Write a failure message using the log function
#### - increment the variable failed
####
######################################################################
((ntest++))
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
then
log "$MCMD: printing help OK"
((success++))
else
log "$MCMD: printing help failed"
((failed++))
fi
# Test 1: Basic super k-mer extraction with default parameters
((ntest++))
if obisuperkmer "${TEST_DIR}/test_sequences.fasta" \
> "${TMPDIR}/output_default.fasta" 2>&1
then
log "$MCMD: basic extraction with default parameters OK"
((success++))
else
log "$MCMD: basic extraction with default parameters failed"
((failed++))
fi
# Test 2: Verify output is not empty
((ntest++))
if [ -s "${TMPDIR}/output_default.fasta" ]
then
log "$MCMD: output file is not empty OK"
((success++))
else
log "$MCMD: output file is empty - failed"
((failed++))
fi
# Test 3: Count number of super k-mers extracted (should be > 0)
((ntest++))
num_sequences=$(grep -c "^>" "${TMPDIR}/output_default.fasta")
if [ "$num_sequences" -gt 0 ]
then
log "$MCMD: extracted $num_sequences super k-mers OK"
((success++))
else
log "$MCMD: no super k-mers extracted - failed"
((failed++))
fi
# Test 4: Verify super k-mers have required metadata attributes
((ntest++))
if grep -q "minimizer_value" "${TMPDIR}/output_default.fasta" && \
grep -q "minimizer_seq" "${TMPDIR}/output_default.fasta" && \
grep -q "parent_id" "${TMPDIR}/output_default.fasta"
then
log "$MCMD: super k-mers contain required metadata OK"
((success++))
else
log "$MCMD: super k-mers missing metadata - failed"
((failed++))
fi
# Test 5: Extract super k-mers with custom k and m parameters
((ntest++))
if obisuperkmer -k 15 -m 7 "${TEST_DIR}/test_sequences.fasta" \
> "${TMPDIR}/output_k15_m7.fasta" 2>&1
then
log "$MCMD: extraction with custom k=15, m=7 OK"
((success++))
else
log "$MCMD: extraction with custom k=15, m=7 failed"
((failed++))
fi
# Test 6: Verify custom parameters in output metadata
((ntest++))
if grep -q '"k":15' "${TMPDIR}/output_k15_m7.fasta" && \
grep -q '"m":7' "${TMPDIR}/output_k15_m7.fasta"
then
log "$MCMD: custom parameters correctly set in metadata OK"
((success++))
else
log "$MCMD: custom parameters not in metadata - failed"
((failed++))
fi
# Test 7: Test with different output format (FASTA output explicitly)
((ntest++))
if obisuperkmer --fasta-output -k 21 -m 11 \
"${TEST_DIR}/test_sequences.fasta" \
> "${TMPDIR}/output_fasta.fasta" 2>&1
then
log "$MCMD: FASTA output format OK"
((success++))
else
log "$MCMD: FASTA output format failed"
((failed++))
fi
# Test 8: Verify all super k-mers have superkmer in their ID
((ntest++))
if grep "^>" "${TMPDIR}/output_default.fasta" | grep -q "superkmer"
then
log "$MCMD: super k-mer IDs contain 'superkmer' OK"
((success++))
else
log "$MCMD: super k-mer IDs missing 'superkmer' - failed"
((failed++))
fi
# Test 9: Verify parent sequence IDs are preserved
((ntest++))
if grep -q "seq1" "${TMPDIR}/output_default.fasta" && \
grep -q "seq2" "${TMPDIR}/output_default.fasta" && \
grep -q "seq3" "${TMPDIR}/output_default.fasta"
then
log "$MCMD: parent sequence IDs preserved OK"
((success++))
else
log "$MCMD: parent sequence IDs not preserved - failed"
((failed++))
fi
# Test 10: Test with output file option
((ntest++))
if obisuperkmer -o "${TMPDIR}/output_file.fasta" \
"${TEST_DIR}/test_sequences.fasta" 2>&1
then
log "$MCMD: output to file with -o option OK"
((success++))
else
log "$MCMD: output to file with -o option failed"
((failed++))
fi
# Test 11: Verify output file was created with -o option
((ntest++))
if [ -s "${TMPDIR}/output_file.fasta" ]
then
log "$MCMD: output file created with -o option OK"
((success++))
else
log "$MCMD: output file not created with -o option - failed"
((failed++))
fi
# Test 12: Verify each super k-mer length is >= k (default k=31)
((ntest++))
min_len=$(grep -v "^>" "${TMPDIR}/output_default.fasta" | awk '{print length}' | sort -n | head -1)
if [ "$min_len" -ge 31 ]
then
log "$MCMD: all super k-mers have length >= k OK"
((success++))
else
log "$MCMD: some super k-mers shorter than k ($min_len < 31) - failed"
((failed++))
fi
#########################################
#
# At the end of the tests
# the cleanup function is called
#
#########################################
cleanup

View File

@@ -0,0 +1,6 @@
>seq1
ACGTACGTACGTACGTACGTACGTACGTACGT
>seq2
AAAACCCCGGGGTTTTAAAACCCCGGGGTTTT
>seq3
ATCGATCGATCGATCGATCGATCGATCGATCG

View File

@@ -39,7 +39,7 @@ cleanup() {
rm -rf "$TMPDIR" # Suppress the temporary directory rm -rf "$TMPDIR" # Suppress the temporary directory
if [ $failed -gt 0 ]; then if [ $failed -gt 0 ]; then
log "$TEST_NAME tests failed" log "$TEST_NAME tests failed"
log log
log log
exit 1 exit 1
@@ -55,10 +55,10 @@ log() {
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2 echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
} }
log "Testing $TEST_NAME..." log "Testing $TEST_NAME..."
log "Test directory is $TEST_DIR" log "Test directory is $TEST_DIR"
log "obitools directory is $OBITOOLS_DIR" log "obitools directory is $OBITOOLS_DIR"
log "Temporary directory is $TMPDIR" log "Temporary directory is $TMPDIR"
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)" log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
###################################################################### ######################################################################
@@ -89,12 +89,12 @@ log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
((ntest++)) ((ntest++))
if $CMD -h > "${TMPDIR}/help.txt" 2>&1 if $CMD -h > "${TMPDIR}/help.txt" 2>&1
then then
log "$MCMD: printing help OK" log "$MCMD: printing help OK"
((success++)) ((success++))
else else
log "$MCMD: printing help failed" log "$MCMD: printing help failed"
((failed++)) ((failed++))
fi fi
@@ -102,7 +102,7 @@ fi
if obiuniq "${TEST_DIR}/touniq.fasta" \ if obiuniq "${TEST_DIR}/touniq.fasta" \
> "${TMPDIR}/touniq_u.fasta" > "${TMPDIR}/touniq_u.fasta"
then then
log "OBIUniq simple: running OK" log "OBIUniq simple: running OK"
((success++)) ((success++))
else else
log "OBIUniq simple: running failed" log "OBIUniq simple: running failed"
@@ -134,7 +134,7 @@ fi
if obiuniq -c a "${TEST_DIR}/touniq.fasta" \ if obiuniq -c a "${TEST_DIR}/touniq.fasta" \
> "${TMPDIR}/touniq_u_a.fasta" > "${TMPDIR}/touniq_u_a.fasta"
then then
log "OBIUniq one category: running OK" log "OBIUniq one category: running OK"
((success++)) ((success++))
else else
log "OBIUniq one category: running failed" log "OBIUniq one category: running failed"
@@ -167,7 +167,7 @@ fi
if obiuniq -c a -c b "${TEST_DIR}/touniq.fasta" \ if obiuniq -c a -c b "${TEST_DIR}/touniq.fasta" \
> "${TMPDIR}/touniq_u_a_b.fasta" > "${TMPDIR}/touniq_u_a_b.fasta"
then then
log "OBIUniq two categories: running OK" log "OBIUniq two categories: running OK"
((success++)) ((success++))
else else
log "OBIUniq two categories: running failed" log "OBIUniq two categories: running failed"
@@ -195,6 +195,59 @@ else
((failed++)) ((failed++))
fi fi
##
## Test merge attributes consistency between in-memory and on-disk paths
## This test catches the bug where the shared classifier in the on-disk
## dereplication path caused incorrect merged attributes.
##
((ntest++))
if obiuniq -m a -m b --in-memory \
"${TEST_DIR}/touniq.fasta" \
> "${TMPDIR}/touniq_u_merge_mem.fasta" 2>/dev/null
then
log "OBIUniq merge in-memory: running OK"
((success++))
else
log "OBIUniq merge in-memory: running failed"
((failed++))
fi
((ntest++))
if obiuniq -m a -m b --chunk-count 4 \
"${TEST_DIR}/touniq.fasta" \
> "${TMPDIR}/touniq_u_merge_disk.fasta" 2>/dev/null
then
log "OBIUniq merge on-disk: running OK"
((success++))
else
log "OBIUniq merge on-disk: running failed"
((failed++))
fi
# Extract sorted annotations (JSON attributes) from both outputs
# to compare merge results independently of sequence ordering
grep '^>' "${TMPDIR}/touniq_u_merge_mem.fasta" \
| sed 's/^>seq[0-9]* //' \
| sort \
> "${TMPDIR}/touniq_u_merge_mem.json"
grep '^>' "${TMPDIR}/touniq_u_merge_disk.fasta" \
| sed 's/^>seq[0-9]* //' \
| sort \
> "${TMPDIR}/touniq_u_merge_disk.json"
((ntest++))
if diff "${TMPDIR}/touniq_u_merge_mem.json" \
"${TMPDIR}/touniq_u_merge_disk.json" > /dev/null
then
log "OBIUniq merge on-disk vs in-memory: result OK"
((success++))
else
log "OBIUniq merge on-disk vs in-memory: result failed"
((failed++))
fi
######################################### #########################################
# #
# At the end of the tests # At the end of the tests

View File

@@ -110,6 +110,7 @@ func ISequenceChunkOnDisk(iterator obiiter.IBioSequence,
log.Infof("Data splitted over %d batches", nbatch) log.Infof("Data splitted over %d batches", nbatch)
go func() { go func() {
localClassifier := uniqueClassifier.Clone()
for order, file := range fileNames { for order, file := range fileNames {
iseq, err := obiformats.ReadSequencesFromFile(file) iseq, err := obiformats.ReadSequencesFromFile(file)
@@ -121,7 +122,7 @@ func ISequenceChunkOnDisk(iterator obiiter.IBioSequence,
if dereplicate { if dereplicate {
u := make(map[string]*obiseq.BioSequence) u := make(map[string]*obiseq.BioSequence)
var source string var source string
uniqueClassifier.Reset() localClassifier.Reset()
for iseq.Next() { for iseq.Next() {
batch := iseq.Get() batch := iseq.Get()
@@ -129,8 +130,8 @@ func ISequenceChunkOnDisk(iterator obiiter.IBioSequence,
for _, seq := range batch.Slice() { for _, seq := range batch.Slice() {
// Use composite key: sequence + categories // Use composite key: sequence + categories
code := uniqueClassifier.Code(seq) code := localClassifier.Code(seq)
key := uniqueClassifier.Value(code) key := localClassifier.Value(code)
prev, ok := u[key] prev, ok := u[key]
if ok { if ok {
prev.Merge(seq, na, true, statsOn) prev.Merge(seq, na, true, statsOn)

View File

@@ -14,35 +14,39 @@ func AhoCorazickWorker(slot string, patterns []string) obiseq.SeqWorker {
sizebatch:=10000000 sizebatch:=10000000
nmatcher := len(patterns) / sizebatch + 1 nmatcher := len(patterns) / sizebatch + 1
log.Infof("Building AhoCorasick %d matcher for %d patterns in slot %s", log.Infof("Building AhoCorasick %d matcher for %d patterns in slot %s",
nmatcher, len(patterns), slot) nmatcher, len(patterns), slot)
if nmatcher == 0 { if nmatcher == 0 {
log.Errorln("No patterns provided") log.Errorln("No patterns provided")
} }
matchers := make([]*ahocorasick.Matcher, nmatcher) matchers := make([]*ahocorasick.Matcher, nmatcher)
ieme := make(chan int) ieme := make(chan int)
mutex := &sync.WaitGroup{} mutex := &sync.WaitGroup{}
npar := min(obidefault.ParallelWorkers(), nmatcher) npar := min(obidefault.ParallelWorkers(), nmatcher)
mutex.Add(npar) mutex.Add(npar)
pbopt := make([]progressbar.Option, 0, 5) var bar *progressbar.ProgressBar
pbopt = append(pbopt, if obidefault.ProgressBar() {
progressbar.OptionSetWriter(os.Stderr), pbopt := make([]progressbar.Option, 0, 5)
progressbar.OptionSetWidth(15), pbopt = append(pbopt,
progressbar.OptionShowCount(), progressbar.OptionSetWriter(os.Stderr),
progressbar.OptionShowIts(), progressbar.OptionSetWidth(15),
progressbar.OptionSetDescription("Building AhoCorasick matcher..."), progressbar.OptionShowCount(),
) progressbar.OptionShowIts(),
progressbar.OptionSetDescription("Building AhoCorasick matcher..."),
)
bar := progressbar.NewOptions(nmatcher, pbopt...) bar = progressbar.NewOptions(nmatcher, pbopt...)
bar.Add(0) }
builder := func() { builder := func() {
for i := range ieme { for i := range ieme {
matchers[i] = ahocorasick.CompileStrings(patterns[i*sizebatch:min((i+1)*sizebatch,len(patterns))]) matchers[i] = ahocorasick.CompileStrings(patterns[i*sizebatch:min((i+1)*sizebatch,len(patterns))])
bar.Add(1) if bar != nil {
bar.Add(1)
}
} }
mutex.Done() mutex.Done()
} }

View File

@@ -0,0 +1,19 @@
package obidefault
var __no_progress_bar__ = false
func ProgressBar() bool {
return !__no_progress_bar__
}
func NoProgressBar() bool {
return __no_progress_bar__
}
func SetNoProgressBar(b bool) {
__no_progress_bar__ = b
}
func NoProgressBarPtr() *bool {
return &__no_progress_bar__
}

View File

@@ -5,18 +5,30 @@ import (
"os" "os"
"time" "time"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
"github.com/schollz/progressbar/v3" "github.com/schollz/progressbar/v3"
) )
func (iterator IBioSequence) Speed(message string, size ...int) IBioSequence { func (iterator IBioSequence) Speed(message string, size ...int) IBioSequence {
// If the STDERR is redicted and doesn't end up to a terminal // If the progress bar is disabled via --no-progressbar option
if !obidefault.ProgressBar() {
return iterator
}
// If the STDERR is redirected and doesn't end up to a terminal
// No progress bar is printed. // No progress bar is printed.
o, _ := os.Stderr.Stat() o, _ := os.Stderr.Stat()
if (o.Mode() & os.ModeCharDevice) != os.ModeCharDevice { if (o.Mode() & os.ModeCharDevice) != os.ModeCharDevice {
return iterator return iterator
} }
// If stdout is piped, no progress bar is printed.
oo, _ := os.Stdout.Stat()
if (oo.Mode() & os.ModeNamedPipe) == os.ModeNamedPipe {
return iterator
}
newIter := MakeIBioSequence() newIter := MakeIBioSequence()
newIter.Add(1) newIter.Add(1)

View File

@@ -447,141 +447,6 @@ func IterCanonicalKmers(seq []byte, k int) iter.Seq[uint64] {
} }
} }
} }
// SuperKmer represents a maximal subsequence where all consecutive k-mers
// share the same minimizer. A minimizer is the smallest canonical m-mer
// among the (k-m+1) m-mers contained in a k-mer.
type SuperKmer struct {
Minimizer uint64 // The canonical minimizer value (normalized m-mer)
Start int // Starting position in the original sequence (0-indexed)
End int // Ending position (exclusive, like Go slice notation)
Sequence []byte // The actual DNA subsequence [Start:End]
}
// dequeItem represents an element in the monotone deque used for
// tracking minimizers in a sliding window.
type dequeItem struct {
position int // Position of the m-mer in the sequence
canonical uint64 // Canonical (normalized) m-mer value
}
// ExtractSuperKmers extracts super k-mers from a DNA sequence.
// A super k-mer is a maximal subsequence where all consecutive k-mers
// share the same minimizer. The minimizer of a k-mer is the smallest
// canonical m-mer among its (k-m+1) constituent m-mers.
//
// The algorithm uses:
// - Simultaneous forward/reverse m-mer encoding for O(1) canonical m-mer computation
// - Monotone deque for O(1) amortized minimizer tracking per position
//
// The maximum k-mer size is 31 (using 62 bits), leaving the top 2 bits
// available for error markers if needed.
//
// Parameters:
// - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
// - k: k-mer size (must be between m+1 and 31)
// - m: minimizer size (must be between 1 and k-1)
// - buffer: optional pre-allocated buffer for results. If nil, a new slice is created.
//
// Returns:
// - slice of SuperKmer structs representing maximal subsequences
// - nil if parameters are invalid or sequence is too short
//
// Time complexity: O(n) where n is the sequence length
// Space complexity: O(k-m+1) for the deque + O(number of super k-mers) for results
func ExtractSuperKmers(seq []byte, k int, m int, buffer *[]SuperKmer) []SuperKmer {
if m < 1 || m >= k || k < 2 || k > 31 || len(seq) < k {
return nil
}
var result []SuperKmer
if buffer == nil {
estimatedSize := len(seq) / k
if estimatedSize < 1 {
estimatedSize = 1
}
result = make([]SuperKmer, 0, estimatedSize)
} else {
result = (*buffer)[:0]
}
deque := make([]dequeItem, 0, k-m+1)
mMask := uint64(1)<<(m*2) - 1
rcShift := uint((m - 1) * 2)
var fwdMmer, rvcMmer uint64
for i := 0; i < m-1 && i < len(seq); i++ {
code := uint64(__single_base_code__[seq[i]&31])
fwdMmer = (fwdMmer << 2) | code
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
}
superKmerStart := 0
var currentMinimizer uint64
firstKmer := true
for pos := m - 1; pos < len(seq); pos++ {
code := uint64(__single_base_code__[seq[pos]&31])
fwdMmer = ((fwdMmer << 2) | code) & mMask
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
canonical := fwdMmer
if rvcMmer < fwdMmer {
canonical = rvcMmer
}
mmerPos := pos - m + 1
if pos >= k-1 {
windowStart := pos - k + 1
for len(deque) > 0 && deque[0].position < windowStart {
deque = deque[1:]
}
}
for len(deque) > 0 && deque[len(deque)-1].canonical >= canonical {
deque = deque[:len(deque)-1]
}
deque = append(deque, dequeItem{position: mmerPos, canonical: canonical})
if pos >= k-1 {
newMinimizer := deque[0].canonical
kmerStart := pos - k + 1
if firstKmer {
currentMinimizer = newMinimizer
firstKmer = false
} else if newMinimizer != currentMinimizer {
endPos := kmerStart + k - 1
superKmer := SuperKmer{
Minimizer: currentMinimizer,
Start: superKmerStart,
End: endPos,
Sequence: seq[superKmerStart:endPos],
}
result = append(result, superKmer)
superKmerStart = kmerStart
currentMinimizer = newMinimizer
}
}
}
if !firstKmer {
superKmer := SuperKmer{
Minimizer: currentMinimizer,
Start: superKmerStart,
End: len(seq),
Sequence: seq[superKmerStart:],
}
result = append(result, superKmer)
}
return result
}
// ReverseComplement computes the reverse complement of an encoded k-mer. // ReverseComplement computes the reverse complement of an encoded k-mer.
// The k-mer is encoded with 2 bits per nucleotide (A=00, C=01, G=10, T=11). // The k-mer is encoded with 2 bits per nucleotide (A=00, C=01, G=10, T=11).
// The complement is: A↔T (00↔11), C↔G (01↔10), which is simply XOR with 11. // The complement is: A↔T (00↔11), C↔G (01↔10), which is simply XOR with 11.

View File

@@ -5,6 +5,7 @@ import (
"sort" "sort"
"unsafe" "unsafe"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obifp" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obifp"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obilog" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obilog"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
@@ -267,20 +268,23 @@ func NewKmerMap[T obifp.FPUint[T]](
} }
n := len(sequences) n := len(sequences)
pbopt := make([]progressbar.Option, 0, 5) var bar *progressbar.ProgressBar
pbopt = append(pbopt, if obidefault.ProgressBar() {
progressbar.OptionSetWriter(os.Stderr), pbopt := make([]progressbar.Option, 0, 5)
progressbar.OptionSetWidth(15), pbopt = append(pbopt,
progressbar.OptionShowCount(), progressbar.OptionSetWriter(os.Stderr),
progressbar.OptionShowIts(), progressbar.OptionSetWidth(15),
progressbar.OptionSetDescription("Indexing kmers"), progressbar.OptionShowCount(),
) progressbar.OptionShowIts(),
progressbar.OptionSetDescription("Indexing kmers"),
)
bar := progressbar.NewOptions(n, pbopt...) bar = progressbar.NewOptions(n, pbopt...)
}
for i, sequence := range sequences { for i, sequence := range sequences {
kmap.Push(sequence, maxoccurs) kmap.Push(sequence, maxoccurs)
if i%100 == 0 { if bar != nil && i%100 == 0 {
bar.Add(100) bar.Add(100)
} }
} }

59
pkg/obikmer/superkmer.go Normal file
View File

@@ -0,0 +1,59 @@
package obikmer
// SuperKmer represents a maximal subsequence where all consecutive k-mers
// share the same minimizer.
type SuperKmer struct {
Minimizer uint64 // The canonical minimizer value (normalized m-mer)
Start int // Starting position in the original sequence (0-indexed)
End int // Ending position (exclusive, like Go slice notation)
Sequence []byte // The actual DNA subsequence [Start:End]
}
// dequeItem represents an element in the monotone deque used for
// tracking minimizers in a sliding window.
type dequeItem struct {
position int // Position of the m-mer in the sequence
canonical uint64 // Canonical (normalized) m-mer value
}
// ExtractSuperKmers extracts super k-mers from a DNA sequence.
// A super k-mer is a maximal subsequence where all consecutive k-mers
// share the same minimizer. The minimizer of a k-mer is the smallest
// canonical m-mer among its (k-m+1) constituent m-mers.
//
// This function uses IterSuperKmers internally and collects results into a slice.
//
// Parameters:
// - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
// - k: k-mer size (must be between m+1 and 31)
// - m: minimizer size (must be between 1 and k-1)
// - buffer: optional pre-allocated buffer for results. If nil, a new slice is created.
//
// Returns:
// - slice of SuperKmer structs representing maximal subsequences
// - nil if parameters are invalid or sequence is too short
//
// Time complexity: O(n) where n is the sequence length
// Space complexity: O(k-m+1) for the deque + O(number of super k-mers) for results
func ExtractSuperKmers(seq []byte, k int, m int, buffer *[]SuperKmer) []SuperKmer {
if m < 1 || m >= k || k < 2 || k > 31 || len(seq) < k {
return nil
}
var result []SuperKmer
if buffer == nil {
estimatedSize := len(seq) / k
if estimatedSize < 1 {
estimatedSize = 1
}
result = make([]SuperKmer, 0, estimatedSize)
} else {
result = (*buffer)[:0]
}
for sk := range IterSuperKmers(seq, k, m) {
result = append(result, sk)
}
return result
}

View File

@@ -0,0 +1,215 @@
package obikmer
import (
"fmt"
"iter"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
)
// IterSuperKmers returns an iterator over super k-mers extracted from a DNA sequence.
// It uses the same algorithm as ExtractSuperKmers but yields super k-mers one at a time.
//
// Parameters:
// - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
// - k: k-mer size (must be between m+1 and 31)
// - m: minimizer size (must be between 1 and k-1)
//
// Returns:
// - An iterator that yields SuperKmer structs
//
// Example:
//
// for sk := range IterSuperKmers(sequence, 21, 11) {
// fmt.Printf("SuperKmer at %d-%d with minimizer %d\n", sk.Start, sk.End, sk.Minimizer)
// }
func IterSuperKmers(seq []byte, k int, m int) iter.Seq[SuperKmer] {
return func(yield func(SuperKmer) bool) {
if m < 1 || m >= k || k < 2 || k > 31 || len(seq) < k {
return
}
deque := make([]dequeItem, 0, k-m+1)
mMask := uint64(1)<<(m*2) - 1
rcShift := uint((m - 1) * 2)
var fwdMmer, rvcMmer uint64
for i := 0; i < m-1 && i < len(seq); i++ {
code := uint64(__single_base_code__[seq[i]&31])
fwdMmer = (fwdMmer << 2) | code
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
}
superKmerStart := 0
var currentMinimizer uint64
firstKmer := true
for pos := m - 1; pos < len(seq); pos++ {
code := uint64(__single_base_code__[seq[pos]&31])
fwdMmer = ((fwdMmer << 2) | code) & mMask
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
canonical := fwdMmer
if rvcMmer < fwdMmer {
canonical = rvcMmer
}
mmerPos := pos - m + 1
if pos >= k-1 {
windowStart := pos - k + 1
for len(deque) > 0 && deque[0].position < windowStart {
deque = deque[1:]
}
}
for len(deque) > 0 && deque[len(deque)-1].canonical >= canonical {
deque = deque[:len(deque)-1]
}
deque = append(deque, dequeItem{position: mmerPos, canonical: canonical})
if pos >= k-1 {
newMinimizer := deque[0].canonical
kmerStart := pos - k + 1
if firstKmer {
currentMinimizer = newMinimizer
firstKmer = false
} else if newMinimizer != currentMinimizer {
endPos := kmerStart + k - 1
superKmer := SuperKmer{
Minimizer: currentMinimizer,
Start: superKmerStart,
End: endPos,
Sequence: seq[superKmerStart:endPos],
}
if !yield(superKmer) {
return
}
superKmerStart = kmerStart
currentMinimizer = newMinimizer
}
}
}
if !firstKmer && len(seq[superKmerStart:]) >= k {
superKmer := SuperKmer{
Minimizer: currentMinimizer,
Start: superKmerStart,
End: len(seq),
Sequence: seq[superKmerStart:],
}
yield(superKmer)
}
}
}
// ToBioSequence converts a SuperKmer to a BioSequence with metadata.
//
// The resulting BioSequence contains:
// - ID: "{parentID}_superkmer_{start}_{end}"
// - Sequence: the actual DNA subsequence
// - Attributes:
// - "minimizer_value" (uint64): the canonical minimizer value
// - "minimizer_seq" (string): the DNA sequence of the minimizer
// - "k" (int): the k-mer size
// - "m" (int): the minimizer size
// - "start" (int): starting position in original sequence
// - "end" (int): ending position in original sequence
// - "parent_id" (string): ID of the parent sequence
//
// Parameters:
// - k: k-mer size used for extraction
// - m: minimizer size used for extraction
// - parentID: ID of the parent sequence
// - parentSource: source field from the parent sequence
//
// Returns:
// - *obiseq.BioSequence: A new BioSequence representing this super k-mer
func (sk *SuperKmer) ToBioSequence(k int, m int, parentID string, parentSource string) *obiseq.BioSequence {
// Create ID for the super-kmer
var id string
if parentID != "" {
id = fmt.Sprintf("%s_superkmer_%d_%d", parentID, sk.Start, sk.End)
} else {
id = fmt.Sprintf("superkmer_%d_%d", sk.Start, sk.End)
}
// Create the BioSequence
seq := obiseq.NewBioSequence(id, sk.Sequence, "")
// Copy source from parent
if parentSource != "" {
seq.SetSource(parentSource)
}
// Set attributes
seq.SetAttribute("minimizer_value", sk.Minimizer)
// Decode the minimizer to get its DNA sequence
minimizerSeq := DecodeKmer(sk.Minimizer, m, nil)
seq.SetAttribute("minimizer_seq", string(minimizerSeq))
seq.SetAttribute("k", k)
seq.SetAttribute("m", m)
seq.SetAttribute("start", sk.Start)
seq.SetAttribute("end", sk.End)
if parentID != "" {
seq.SetAttribute("parent_id", parentID)
}
return seq
}
// SuperKmerWorker creates a SeqWorker that extracts super k-mers from a BioSequence
// and returns them as a slice of BioSequence objects.
//
// The worker copies the source field from the parent sequence to all extracted super k-mers.
//
// Parameters:
// - k: k-mer size (must be between m+1 and 31)
// - m: minimizer size (must be between 1 and k-1)
//
// Returns:
// - SeqWorker: A worker function that can be used in obiiter pipelines
//
// Example:
//
// worker := SuperKmerWorker(21, 11)
// iterator := iterator.MakeIWorker(worker, false)
func SuperKmerWorker(k int, m int) obiseq.SeqWorker {
return func(seq *obiseq.BioSequence) (obiseq.BioSequenceSlice, error) {
if seq == nil {
return obiseq.BioSequenceSlice{}, nil
}
// Validate parameters
if m < 1 || m >= k || k < 2 || k > 31 {
return obiseq.BioSequenceSlice{}, fmt.Errorf(
"invalid parameters: k=%d, m=%d (need 1 <= m < k <= 31)",
k, m)
}
sequence := seq.Sequence()
if len(sequence) < k {
return obiseq.BioSequenceSlice{}, nil
}
parentID := seq.Id()
parentSource := seq.Source()
// Extract super k-mers and convert to BioSequences
result := make(obiseq.BioSequenceSlice, 0)
for sk := range IterSuperKmers(sequence, k, m) {
bioSeq := sk.ToBioSequence(k, m, parentID, parentSource)
result = append(result, bioSeq)
}
return result, nil
}
}

View File

@@ -0,0 +1,198 @@
package obikmer
import (
"testing"
)
func TestIterSuperKmers(t *testing.T) {
seq := []byte("ACGTACGTGGGGAAAA")
k := 5
m := 3
count := 0
for sk := range IterSuperKmers(seq, k, m) {
count++
t.Logf("SuperKmer %d: Minimizer=%d, Start=%d, End=%d, Seq=%s",
count, sk.Minimizer, sk.Start, sk.End, string(sk.Sequence))
// Verify sequence boundaries
if sk.Start < 0 || sk.End > len(seq) {
t.Errorf("Invalid boundaries: Start=%d, End=%d, seqLen=%d",
sk.Start, sk.End, len(seq))
}
// Verify sequence content
if string(sk.Sequence) != string(seq[sk.Start:sk.End]) {
t.Errorf("Sequence mismatch: expected %s, got %s",
string(seq[sk.Start:sk.End]), string(sk.Sequence))
}
}
if count == 0 {
t.Error("No super k-mers extracted")
}
t.Logf("Total super k-mers extracted: %d", count)
}
func TestIterSuperKmersVsSlice(t *testing.T) {
seq := []byte("ACGTACGTGGGGAAAAACGTACGT")
k := 7
m := 4
// Extract using slice version
sliceResult := ExtractSuperKmers(seq, k, m, nil)
// Extract using iterator version
var iterResult []SuperKmer
for sk := range IterSuperKmers(seq, k, m) {
iterResult = append(iterResult, sk)
}
// Compare counts
if len(sliceResult) != len(iterResult) {
t.Errorf("Different number of super k-mers: slice=%d, iter=%d",
len(sliceResult), len(iterResult))
}
// Compare each super k-mer
for i := 0; i < len(sliceResult) && i < len(iterResult); i++ {
slice := sliceResult[i]
iter := iterResult[i]
if slice.Minimizer != iter.Minimizer {
t.Errorf("SuperKmer %d: different minimizers: slice=%d, iter=%d",
i, slice.Minimizer, iter.Minimizer)
}
if slice.Start != iter.Start || slice.End != iter.End {
t.Errorf("SuperKmer %d: different boundaries: slice=[%d:%d], iter=[%d:%d]",
i, slice.Start, slice.End, iter.Start, iter.End)
}
if string(slice.Sequence) != string(iter.Sequence) {
t.Errorf("SuperKmer %d: different sequences: slice=%s, iter=%s",
i, string(slice.Sequence), string(iter.Sequence))
}
}
}
// TestSuperKmerMinimizerBijection validates the intrinsic property that
// a super k-mer sequence has one and only one minimizer (bijection property).
// This test ensures that:
// 1. All k-mers in a super k-mer share the same minimizer
// 2. Two identical super k-mer sequences must have the same minimizer
func TestSuperKmerMinimizerBijection(t *testing.T) {
testCases := []struct {
name string
seq []byte
k int
m int
}{
{
name: "simple sequence",
seq: []byte("ACGTACGTACGTACGTACGTACGTACGTACGT"),
k: 21,
m: 11,
},
{
name: "homopolymer blocks",
seq: []byte("AAAACCCCGGGGTTTTAAAACCCCGGGGTTTT"),
k: 21,
m: 11,
},
{
name: "complex sequence",
seq: []byte("ATCGATCGATCGATCGATCGATCGATCGATCG"),
k: 15,
m: 7,
},
{
name: "longer sequence",
seq: []byte("ACGTACGTGGGGAAAAACGTACGTTTTTCCCCACGTACGT"),
k: 13,
m: 7,
},
}
for _, tc := range testCases {
t.Run(tc.name, func(t *testing.T) {
// Map to track sequence -> minimizer
seqToMinimizer := make(map[string]uint64)
for sk := range IterSuperKmers(tc.seq, tc.k, tc.m) {
seqStr := string(sk.Sequence)
// Check if we've seen this sequence before
if prevMinimizer, exists := seqToMinimizer[seqStr]; exists {
if prevMinimizer != sk.Minimizer {
t.Errorf("BIJECTION VIOLATION: sequence %s has two different minimizers:\n"+
" First: %d\n"+
" Second: %d\n"+
" This violates the super k-mer definition!",
seqStr, prevMinimizer, sk.Minimizer)
}
} else {
seqToMinimizer[seqStr] = sk.Minimizer
}
// Verify all k-mers in this super k-mer have the same minimizer
if len(sk.Sequence) >= tc.k {
for i := 0; i <= len(sk.Sequence)-tc.k; i++ {
kmerSeq := sk.Sequence[i : i+tc.k]
minimizer := findMinimizer(kmerSeq, tc.k, tc.m)
if minimizer != sk.Minimizer {
t.Errorf("K-mer at position %d in super k-mer has different minimizer:\n"+
" K-mer: %s\n"+
" Expected minimizer: %d\n"+
" Actual minimizer: %d\n"+
" Super k-mer: %s",
i, string(kmerSeq), sk.Minimizer, minimizer, seqStr)
}
}
}
}
})
}
}
// findMinimizer computes the minimizer of a k-mer for testing purposes
func findMinimizer(kmer []byte, k int, m int) uint64 {
if len(kmer) != k {
return 0
}
mMask := uint64(1)<<(m*2) - 1
rcShift := uint((m - 1) * 2)
minMinimizer := uint64(^uint64(0)) // max uint64
// Scan all m-mers in the k-mer
var fwdMmer, rvcMmer uint64
for i := 0; i < m-1 && i < len(kmer); i++ {
code := uint64(__single_base_code__[kmer[i]&31])
fwdMmer = (fwdMmer << 2) | code
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
}
for i := m - 1; i < len(kmer); i++ {
code := uint64(__single_base_code__[kmer[i]&31])
fwdMmer = ((fwdMmer << 2) | code) & mMask
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
canonical := fwdMmer
if rvcMmer < fwdMmer {
canonical = rvcMmer
}
if canonical < minMinimizer {
minMinimizer = canonical
}
}
return minMinimizer
}
// Note: Tests for ToBioSequence and SuperKmerWorker are in a separate
// integration test package to avoid circular dependencies between
// obikmer and obiseq packages.

View File

@@ -3,7 +3,7 @@ package obioptions
// Version is automatically updated by the Makefile from version.txt // Version is automatically updated by the Makefile from version.txt
// The patch number (third digit) is incremented on each push to the repository // The patch number (third digit) is incremented on each push to the repository
var _Version = "Release 4.4.7" var _Version = "Release 4.4.12"
// Version returns the version of the obitools package. // Version returns the version of the obitools package.
// //

View File

@@ -13,6 +13,7 @@ import (
log "github.com/sirupsen/logrus" log "github.com/sirupsen/logrus"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
"github.com/schollz/progressbar/v3" "github.com/schollz/progressbar/v3"
) )
@@ -69,16 +70,18 @@ func EmpiricalDistCsv(filename string, data [][]Ratio, compressed bool) {
} }
defer destfile.Close() defer destfile.Close()
pbopt := make([]progressbar.Option, 0, 5) var bar *progressbar.ProgressBar
pbopt = append(pbopt, if obidefault.ProgressBar() {
progressbar.OptionSetWriter(os.Stderr), pbopt := make([]progressbar.Option, 0, 5)
progressbar.OptionSetWidth(15), pbopt = append(pbopt,
progressbar.OptionShowIts(), progressbar.OptionSetWriter(os.Stderr),
progressbar.OptionSetPredictTime(true), progressbar.OptionSetWidth(15),
progressbar.OptionSetDescription("[Save CSV stat ratio file]"), progressbar.OptionShowIts(),
) progressbar.OptionSetPredictTime(true),
progressbar.OptionSetDescription("[Save CSV stat ratio file]"),
bar := progressbar.NewOptions(len(data), pbopt...) )
bar = progressbar.NewOptions(len(data), pbopt...)
}
fmt.Fprintln(destfile, "Sample,Origin_id,Origin_status,Origin,Mutant,Origin_Weight,Mutant_Weight,Origin_Count,Mutant_Count,Position,Origin_length,A,C,G,T") fmt.Fprintln(destfile, "Sample,Origin_id,Origin_status,Origin,Mutant,Origin_Weight,Mutant_Weight,Origin_Count,Mutant_Count,Position,Origin_length,A,C,G,T")
for code, dist := range data { for code, dist := range data {
@@ -101,7 +104,9 @@ func EmpiricalDistCsv(filename string, data [][]Ratio, compressed bool) {
ratio.T, ratio.T,
) )
} }
bar.Add(1) if bar != nil {
bar.Add(1)
}
} }
} }
@@ -116,7 +121,7 @@ func Gml(seqs *[]*seqPCR, sample string, statThreshold int) string {
directed 1 directed 1
{{range $index, $data:= .}} {{range $index, $data:= .}}
{{ if or $data.Edges (gt $data.SonCount 0)}} {{ if or $data.Edges (gt $data.SonCount 0)}}
node [ id {{$index}} node [ id {{$index}}
graphics [ graphics [
type "{{ Shape $data.Count }}" type "{{ Shape $data.Count }}"
fill "{{ if and (gt $data.SonCount 0) (not $data.Edges)}}#0000FF{{ else }}#00FF00{{ end }}" fill "{{ if and (gt $data.SonCount 0) (not $data.Edges)}}#0000FF{{ else }}#00FF00{{ end }}"
@@ -130,15 +135,15 @@ func Gml(seqs *[]*seqPCR, sample string, statThreshold int) string {
{{range $index, $data:= .}} {{range $index, $data:= .}}
{{range $i, $edge:= $data.Edges}} {{range $i, $edge:= $data.Edges}}
edge [ source {{$index}} edge [ source {{$index}}
target {{$edge.Father}} target {{$edge.Father}}
color "{{ if gt (index $data.Edges $i).Dist 1 }}#FF0000{{ else }}#00FF00{{ end }}" color "{{ if gt (index $data.Edges $i).Dist 1 }}#FF0000{{ else }}#00FF00{{ end }}"
label "{{(index $data.Edges $i).Dist}}" label "{{(index $data.Edges $i).Dist}}"
] ]
{{ end }} {{ end }}
{{ end }} {{ end }}
] ]
` `
tmpl, err := digraphTpl.Funcs(template.FuncMap{ tmpl, err := digraphTpl.Funcs(template.FuncMap{
@@ -181,16 +186,18 @@ func SaveGMLGraphs(dirname string,
} }
} }
pbopt := make([]progressbar.Option, 0, 5) var bar *progressbar.ProgressBar
pbopt = append(pbopt, if obidefault.ProgressBar() {
progressbar.OptionSetWriter(os.Stderr), pbopt := make([]progressbar.Option, 0, 5)
progressbar.OptionSetWidth(15), pbopt = append(pbopt,
progressbar.OptionShowIts(), progressbar.OptionSetWriter(os.Stderr),
progressbar.OptionSetPredictTime(true), progressbar.OptionSetWidth(15),
progressbar.OptionSetDescription("[Save GML Graph files]"), progressbar.OptionShowIts(),
) progressbar.OptionSetPredictTime(true),
progressbar.OptionSetDescription("[Save GML Graph files]"),
bar := progressbar.NewOptions(len(samples), pbopt...) )
bar = progressbar.NewOptions(len(samples), pbopt...)
}
for name, seqs := range samples { for name, seqs := range samples {
@@ -204,7 +211,9 @@ func SaveGMLGraphs(dirname string,
file.WriteString(Gml(seqs, name, statThreshold)) file.WriteString(Gml(seqs, name, statThreshold))
file.Close() file.Close()
bar.Add(1) if bar != nil {
bar.Add(1)
}
} }
} }
@@ -495,37 +504,44 @@ func BuildSeqGraph(samples map[string]*[]*seqPCR,
npairs += nseq * (nseq - 1) / 2 npairs += nseq * (nseq - 1) / 2
} }
pbopt := make([]progressbar.Option, 0, 5) var bar *progressbar.ProgressBar
pbopt = append(pbopt, if obidefault.ProgressBar() {
progressbar.OptionSetWriter(os.Stderr), pbopt := make([]progressbar.Option, 0, 5)
progressbar.OptionSetWidth(15),
progressbar.OptionShowIts(),
progressbar.OptionSetPredictTime(true),
progressbar.OptionSetDescription("[One error graph]"),
)
bar := progressbar.NewOptions(npairs, pbopt...)
for _, seqs := range samples {
np := buildSamplePairs(seqs, workers)
bar.Add(np)
}
if maxError > 1 {
pbopt = make([]progressbar.Option, 0, 5)
pbopt = append(pbopt, pbopt = append(pbopt,
progressbar.OptionSetWriter(os.Stderr), progressbar.OptionSetWriter(os.Stderr),
progressbar.OptionSetWidth(15), progressbar.OptionSetWidth(15),
progressbar.OptionShowIts(), progressbar.OptionShowIts(),
progressbar.OptionSetPredictTime(true), progressbar.OptionSetPredictTime(true),
progressbar.OptionSetDescription("[Adds multiple errors]"), progressbar.OptionSetDescription("[One error graph]"),
) )
bar = progressbar.NewOptions(npairs, pbopt...) bar = progressbar.NewOptions(npairs, pbopt...)
}
for _, seqs := range samples { for _, seqs := range samples {
np := extendSimilarityGraph(seqs, maxError, workers) np := buildSamplePairs(seqs, workers)
if bar != nil {
bar.Add(np) bar.Add(np)
} }
} }
if maxError > 1 {
if obidefault.ProgressBar() {
pbopt := make([]progressbar.Option, 0, 5)
pbopt = append(pbopt,
progressbar.OptionSetWriter(os.Stderr),
progressbar.OptionSetWidth(15),
progressbar.OptionShowIts(),
progressbar.OptionSetPredictTime(true),
progressbar.OptionSetDescription("[Adds multiple errors]"),
)
bar = progressbar.NewOptions(npairs, pbopt...)
}
for _, seqs := range samples {
np := extendSimilarityGraph(seqs, maxError, workers)
if bar != nil {
bar.Add(np)
}
}
}
} }

View File

@@ -31,7 +31,6 @@ var __output_in_json__ = false
var __output_fastjson_format__ = false var __output_fastjson_format__ = false
var __output_fastobi_format__ = false var __output_fastobi_format__ = false
var __no_progress_bar__ = false
var __skip_empty__ = false var __skip_empty__ = false
var __skip_on_error__ = false var __skip_on_error__ = false
@@ -82,7 +81,7 @@ func InputOptionSet(options *getoptions.GetOpt) {
} }
func OutputModeOptionSet(options *getoptions.GetOpt, compressed bool) { func OutputModeOptionSet(options *getoptions.GetOpt, compressed bool) {
options.BoolVar(&__no_progress_bar__, "no-progressbar", false, options.BoolVar(obidefault.NoProgressBarPtr(), "no-progressbar", obidefault.NoProgressBar(),
options.Description("Disable the progress bar printing")) options.Description("Disable the progress bar printing"))
if compressed { if compressed {
@@ -224,13 +223,16 @@ func CLIAnalyzeOnly() int {
func CLIProgressBar() bool { func CLIProgressBar() bool {
// If the output is not a terminal, then we do not display the progress bar // If the output is not a terminal, then we do not display the progress bar
o, _ := os.Stderr.Stat() oe, _ := os.Stderr.Stat()
onTerminal := (o.Mode() & os.ModeCharDevice) == os.ModeCharDevice onTerminal := (oe.Mode() & os.ModeCharDevice) == os.ModeCharDevice
if !onTerminal { if !onTerminal {
log.Info("Stderr is redirected, progress bar disabled") log.Info("Stderr is redirected, progress bar disabled")
} }
return onTerminal && !__no_progress_bar__ oo, _ := os.Stdout.Stat()
toPipe := (oo.Mode() & os.ModeNamedPipe) == os.ModeNamedPipe
return onTerminal && !toPipe && obidefault.ProgressBar()
} }
func CLIOutPutFileName() string { func CLIOutPutFileName() string {

View File

@@ -210,9 +210,7 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
} }
if CLIProgressBar() { iterator = iterator.Speed("Reading sequences")
iterator = iterator.Speed("Reading sequences")
}
return iterator, nil return iterator, nil
} }

View File

@@ -12,9 +12,7 @@ import (
func CLIWriteSequenceCSV(iterator obiiter.IBioSequence, func CLIWriteSequenceCSV(iterator obiiter.IBioSequence,
terminalAction bool, filenames ...string) *obiitercsv.ICSVRecord { terminalAction bool, filenames ...string) *obiitercsv.ICSVRecord {
if obiconvert.CLIProgressBar() { iterator = iterator.Speed("Writing CSV")
iterator = iterator.Speed("Writing CSV")
}
opts := make([]WithOption, 0, 10) opts := make([]WithOption, 0, 10)

View File

@@ -42,16 +42,19 @@ func MapOnLandmarkSequences(library obiseq.BioSequenceSlice, landmark_idx []int,
seqworld := obiutils.Make2DArray[float64](library_size, n_landmark) seqworld := obiutils.Make2DArray[float64](library_size, n_landmark)
pbopt := make([]progressbar.Option, 0, 5) var bar *progressbar.ProgressBar
pbopt = append(pbopt, if obidefault.ProgressBar() {
progressbar.OptionSetWriter(os.Stderr), pbopt := make([]progressbar.Option, 0, 5)
progressbar.OptionSetWidth(15), pbopt = append(pbopt,
progressbar.OptionShowCount(), progressbar.OptionSetWriter(os.Stderr),
progressbar.OptionShowIts(), progressbar.OptionSetWidth(15),
progressbar.OptionSetDescription("[Sequence mapping]"), progressbar.OptionShowCount(),
) progressbar.OptionShowIts(),
progressbar.OptionSetDescription("[Sequence mapping]"),
)
bar := progressbar.NewOptions(library_size, pbopt...) bar = progressbar.NewOptions(library_size, pbopt...)
}
waiting := sync.WaitGroup{} waiting := sync.WaitGroup{}
waiting.Add(nworkers) waiting.Add(nworkers)
@@ -66,7 +69,9 @@ func MapOnLandmarkSequences(library obiseq.BioSequenceSlice, landmark_idx []int,
match, lalign := obialign.FastLCSScore(landmark, seq, -1, &buffer) match, lalign := obialign.FastLCSScore(landmark, seq, -1, &buffer)
coord[j] = float64(lalign - match) coord[j] = float64(lalign - match)
} }
bar.Add(1) if bar != nil {
bar.Add(1)
}
} }
waiting.Done() waiting.Done()
} }
@@ -170,23 +175,26 @@ func CLISelectLandmarkSequences(iterator obiiter.IBioSequence) obiiter.IBioSeque
taxa.Set(i, taxon) taxa.Set(i, taxon)
} }
pbopt := make([]progressbar.Option, 0, 5) var bar2 *progressbar.ProgressBar
pbopt = append(pbopt, if obidefault.ProgressBar() {
progressbar.OptionSetWriter(os.Stderr), pbopt := make([]progressbar.Option, 0, 5)
progressbar.OptionSetWidth(15), pbopt = append(pbopt,
progressbar.OptionShowCount(), progressbar.OptionSetWriter(os.Stderr),
progressbar.OptionShowIts(), progressbar.OptionSetWidth(15),
progressbar.OptionSetDescription("[Sequence Indexing]"), progressbar.OptionShowCount(),
) progressbar.OptionShowIts(),
progressbar.OptionSetDescription("[Sequence Indexing]"),
)
bar := progressbar.NewOptions(len(library), pbopt...) bar2 = progressbar.NewOptions(len(library), pbopt...)
}
for i, seq := range library { for i, seq := range library {
idx := obirefidx.GeomIndexSesquence(i, library, taxa, taxo) idx := obirefidx.GeomIndexSesquence(i, library, taxa, taxo)
seq.SetOBITagGeomRefIndex(idx) seq.SetOBITagGeomRefIndex(idx)
if i%10 == 0 { if bar2 != nil && i%10 == 0 {
bar.Add(10) bar2.Add(10)
} }
} }
} }

View File

@@ -8,8 +8,6 @@ import (
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
log "github.com/sirupsen/logrus"
) )
// MaskingMode defines how to handle low-complexity regions // MaskingMode defines how to handle low-complexity regions
@@ -37,62 +35,81 @@ const (
// Returns: a SeqWorker function that can be applied to each sequence // Returns: a SeqWorker function that can be applied to each sequence
func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode MaskingMode, maskChar byte) obiseq.SeqWorker { func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode MaskingMode, maskChar byte) obiseq.SeqWorker {
// ======================================================================== nLogN := make([]float64, kmer_size+1)
// FUNCTION 1: emax - Calculate theoretical maximum entropy for i := 1; i <= kmer_size; i++ {
// ======================================================================== nLogN[i] = float64(i) * math.Log(float64(i))
// Computes the maximum entropy of a k-mer of length lseq containing words of size word_size. }
//
// Maximum entropy depends on the theoretical optimal word distribution: normTables := make([][]int, level_max+1)
// - If we have more positions (nw) than possible canonical words (na), for ws := 1; ws <= level_max; ws++ {
// some words will appear multiple times size := 1 << (ws * 2)
// - We calculate the entropy of a distribution where all words appear normTables[ws] = make([]int, size)
// cov or cov+1 times (most uniform distribution possible) for code := 0; code < size; code++ {
// normTables[ws][code] = int(obikmer.NormalizeCircular(uint64(code), ws))
// IMPORTANT: Uses CanonicalCircularKmerCount to get the actual number of canonical words }
// after circular normalization (e.g., "atg", "tga", "gat" → all "atg"). }
// This is much smaller than 4^word_size (e.g., 10 instead of 16 for word_size=2).
emax := func(lseq, word_size int) float64 { type pair struct {
nw := lseq - word_size + 1 // Number of words in a k-mer of length lseq index int
na := obikmer.CanonicalCircularKmerCount(word_size) // Number of canonical words after normalization value float64
}
// Case 1: Fewer positions than possible words
// Maximum entropy is simply log(nw) since we can have at most nw different words slidingMin := func(data []float64, window int) {
if nw < na { if len(data) == 0 || window <= 0 {
return math.Log(float64(nw)) return
} }
if window >= len(data) {
// Case 2: More positions than possible words minVal := data[0]
// Some words must appear multiple times for i := 1; i < len(data); i++ {
cov := nw / na // Average coverage (average number of occurrences per word) if data[i] < minVal {
remains := nw - (na * cov) // Number of words that will have one additional occurrence minVal = data[i]
}
// Calculate frequencies in the optimal distribution: }
// - (na - remains) words appear cov times → frequency f1 = cov/nw for i := range data {
// - remains words appear (cov+1) times → frequency f2 = (cov+1)/nw data[i] = minVal
f1 := float64(cov) / float64(nw) }
f2 := float64(cov+1) / float64(nw) return
}
// Shannon entropy: H = -Σ p(i) * log(p(i))
// where p(i) is the probability of observing word i deque := make([]pair, 0, window)
return -(float64(na-remains)*f1*math.Log(f1) +
float64(remains)*f2*math.Log(f2)) for i, v := range data {
for len(deque) > 0 && deque[0].index <= i-window {
deque = deque[1:]
}
for len(deque) > 0 && deque[len(deque)-1].value >= v {
deque = deque[:len(deque)-1]
}
deque = append(deque, pair{index: i, value: v})
data[i] = deque[0].value
}
}
emaxValues := make([]float64, level_max+1)
logNwords := make([]float64, level_max+1)
for ws := 1; ws <= level_max; ws++ {
nw := kmer_size - ws + 1
na := obikmer.CanonicalCircularKmerCount(ws)
if nw < na {
logNwords[ws] = math.Log(float64(nw))
emaxValues[ws] = math.Log(float64(nw))
} else {
cov := nw / na
remains := nw - (na * cov)
f1 := float64(cov) / float64(nw)
f2 := float64(cov+1) / float64(nw)
logNwords[ws] = math.Log(float64(nw))
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
float64(remains)*f2*math.Log(f2))
}
} }
// ========================================================================
// FUNCTION 2: maskAmbiguities - Mark positions containing ambiguities
// ========================================================================
// Identifies positions with ambiguous nucleotides (N, Y, R, etc.) and marks
// all k-mers that contain them.
//
// Returns: a slice where maskPositions[i] = -1 if position i is part of a
// k-mer containing an ambiguity, 0 otherwise
maskAmbiguities := func(sequence []byte) []int { maskAmbiguities := func(sequence []byte) []int {
maskPositions := make([]int, len(sequence)) maskPositions := make([]int, len(sequence))
for i, nuc := range sequence { for i, nuc := range sequence {
// If nucleotide is not a, c, g or t (lowercase), it's an ambiguity
if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' { if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' {
// Mark all positions of k-mers that contain this nucleotide
// A k-mer starting at position (i - kmer_size + 1) will contain position i
end := max(0, i-kmer_size+1) end := max(0, i-kmer_size+1)
for j := i; j >= end; j-- { for j := i; j >= end; j-- {
maskPositions[j] = -1 maskPositions[j] = -1
@@ -102,182 +119,87 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
return maskPositions return maskPositions
} }
// ========================================================================
// FUNCTION 3: cleanTable - Reset a frequency table to zero
// ========================================================================
cleanTable := func(table []int, over int) { cleanTable := func(table []int, over int) {
for i := 0; i < over; i++ { for i := 0; i < over; i++ {
table[i] = 0 table[i] = 0
} }
} }
// ========================================================================
// FUNCTION 4: slidingMin - Calculate sliding minimum over a window
// ========================================================================
// Applies a sliding window of size window over data and replaces each
// value with the minimum in the window centered on that position.
//
// Uses a MinMultiset to efficiently maintain the minimum in the window.
slidingMin := func(data []float64, window int) {
minimier := obiutils.NewMinMultiset(func(a, b float64) bool { return a < b })
ldata := len(data)
mem := make([]float64, window) // Circular buffer to store window values
// Initialize buffer with sentinel value
for i := range mem {
mem[i] = 10000
}
for i, v := range data {
// Get the old value leaving the window
m := mem[i%window]
mem[i%window] = v
// Remove old value from multiset if it was valid
if m < 10000 {
minimier.RemoveOne(m)
}
// Add new value if full window is ahead of us
if (ldata - i) >= window {
minimier.Add(v)
}
// log.Warnf("taille du minimier %d @ %d", minimier.Len(), i)
// Retrieve and store current minimum
var ok bool
if data[i], ok = minimier.Min(); !ok {
log.Error("problem with minimum entropy")
data[i] = 0.0
}
//xx, _ := minimier.Min()
//log.Warnf("Pos: %d n: %d min: %.3f -> %.3f", i, minimier.Len(), v, xx)
}
}
// ========================================================================
// FUNCTION 5: computeEntropies - Calculate normalized entropy for each position
// ========================================================================
// This is the central function that calculates the entropy of each k-mer in the sequence
// at a given scale (wordSize).
//
// Algorithm:
// 1. Encode the sequence into words (subsequences of size wordSize)
// 2. For each k-mer, count the frequencies of words it contains
// 3. Calculate normalized entropy = observed_entropy / maximum_entropy
// 4. Apply a sliding min filter to smooth results
//
// IMPORTANT: Line 147 uses NormalizeInt for circular normalization of words!
// This means "atg", "tga", and "gat" are considered the same word.
computeEntropies := func(sequence []byte, computeEntropies := func(sequence []byte,
maskPositions []int, // Positions of ambiguities maskPositions []int,
entropies []float64, // Output: normalized entropies for each position entropies []float64,
table []int, // Frequency table for words (reused between calls) table []int,
words []int, // Buffer to store encoded words (reused) words []int,
wordSize int) { // Word size (scale of analysis) wordSize int,
normTable []int) {
lseq := len(sequence) // Sequence length lseq := len(sequence)
tableSize := 1 << (wordSize * 2) // Actual table size (must fit all codes 0 to 4^wordSize-1) tableSize := 1 << (wordSize * 2)
nwords := kmer_size - wordSize + 1 // Number of words in a k-mer nwords := kmer_size - wordSize + 1
float_nwords := float64(nwords) float_nwords := float64(nwords)
log_nwords := math.Log(float_nwords) // log(nwords) used in entropy calculation log_nwords := logNwords[wordSize]
entropyMax := emax(kmer_size, wordSize) // Theoretical maximum entropy (uses CanonicalKmerCount internally) entropyMax := emaxValues[wordSize]
// Reset frequency table (must clear entire table, not just nalpha entries)
cleanTable(table, tableSize) cleanTable(table, tableSize)
for i := 1; i < lseq; i++ { for i := 1; i < lseq; i++ {
entropies[i] = 6 entropies[i] = 6
} }
end := lseq - wordSize + 1 // Last position where a word can start end := lseq - wordSize + 1
// ======================================================================== mask := (1 << (wordSize * 2)) - 1
// STEP 1: Encode all words in the sequence
// ========================================================================
// Uses left-shift encoding: each nucleotide is encoded on 2 bits
// a=00, c=01, g=10, t=11
mask := (1 << (wordSize * 2)) - 1 // Mask to keep only last wordSize*2 bits
// Initialize first word (all nucleotides except the last one)
word_index := 0 word_index := 0
for i := 0; i < wordSize-1; i++ { for i := 0; i < wordSize-1; i++ {
word_index = (word_index << 2) + int(obikmer.EncodeNucleotide(sequence[i])) word_index = (word_index << 2) + int(obikmer.EncodeNucleotide(sequence[i]))
} }
// Encode all words with sliding window
for i, j := 0, wordSize-1; i < end; i, j = i+1, j+1 { for i, j := 0, wordSize-1; i < end; i, j = i+1, j+1 {
// Shift left by 2 bits, mask, and add new nucleotide
word_index = ((word_index << 2) & mask) + int(obikmer.EncodeNucleotide(sequence[j])) word_index = ((word_index << 2) & mask) + int(obikmer.EncodeNucleotide(sequence[j]))
words[i] = normTable[word_index]
// *** CIRCULAR NORMALIZATION ***
// Convert word to its canonical form (smallest by circular rotation)
// This is where "atg", "tga", "gat" all become "atg"
// Now using uint64-based NormalizeCircular for better performance
words[i] = int(obikmer.NormalizeCircular(uint64(word_index), wordSize))
} }
// ======================================================================== s := 0
// STEP 2: Calculate entropy for each k-mer with sliding window sum_n_logn := 0.0
// ======================================================================== entropy := 1.0
s := 0 // Number of words processed in current k-mer cleaned := true
sum_n_logn := 0.0 // Sum of n*log(n) for entropy calculation
entropy := 1.0 // Current normalized entropy
cleaned := true // Flag indicating if table has been cleaned
for i := range end { for i := range end {
s++ s++
switch { switch {
// CASE 1: Filling phase (fewer than nwords words collected)
case s < nwords: case s < nwords:
cleaned = false cleaned = false
table[words[i]]++ // Increment word frequency table[words[i]]++
// CASE 2: Position contains an ambiguity
case i >= (nwords-1) && maskPositions[i-nwords+1] < 0: case i >= (nwords-1) && maskPositions[i-nwords+1] < 0:
entropies[i-nwords+1] = 4.0 // Mark entropy as invalid entropies[i-nwords+1] = 4.0
if !cleaned { if !cleaned {
cleanTable(table, tableSize) // Reset table cleanTable(table, tableSize)
} }
cleaned = true cleaned = true
s = 0 s = 0
sum_n_logn = 0.0 sum_n_logn = 0.0
// CASE 3: First complete k-mer (s == nwords)
case s == nwords: case s == nwords:
cleaned = false cleaned = false
table[words[i]]++ table[words[i]]++
// Calculate Shannon entropy: H = -Σ p(i)*log(p(i))
// = log(N) - (1/N)*Σ n(i)*log(n(i))
// where N = nwords, n(i) = frequency of word i
//
// NOTE: We iterate over entire table (tableSize = 4^wordSize) to count all frequencies.
// Canonical codes are not contiguous (e.g., for k=2: {0,1,2,3,5,6,7,10,11,15})
// so we must scan the full table even though only ~10 entries will be non-zero
sum_n_logn = 0 sum_n_logn = 0
for j := range tableSize { for j := range tableSize {
n := float64(table[j]) n := float64(table[j])
if n > 0 { if n > 0 {
sum_n_logn += n * math.Log(n) sum_n_logn += nLogN[int(n)]
} }
} }
// Normalized entropy = observed entropy / maximum entropy
entropy = (log_nwords - sum_n_logn/float_nwords) / entropyMax entropy = (log_nwords - sum_n_logn/float_nwords) / entropyMax
// CASE 4: Sliding window (s > nwords)
// Incremental update of entropy by adding a new word
// and removing the old one
case s > nwords: case s > nwords:
cleaned = false cleaned = false
new_word := words[i] new_word := words[i]
old_word := words[i-nwords] old_word := words[i-nwords]
// Optimization: only recalculate if word changes
if old_word != new_word { if old_word != new_word {
table[new_word]++ table[new_word]++
table[old_word]-- table[old_word]--
@@ -285,59 +207,39 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
n_old := float64(table[old_word]) n_old := float64(table[old_word])
n_new := float64(table[new_word]) n_new := float64(table[new_word])
// Incremental update of sum_n_logn sum_n_logn -= nLogN[int(n_old+1)]
// Remove contribution of old word (before decrement)
sum_n_logn -= (n_old + 1) * math.Log(n_old+1)
// Add contribution of old word (after decrement)
if n_old > 0 { if n_old > 0 {
sum_n_logn += n_old * math.Log(n_old) sum_n_logn += nLogN[int(n_old)]
} }
// Add contribution of new word (after increment)
if n_new > 0 { if n_new > 0 {
sum_n_logn += n_new * math.Log(n_new) sum_n_logn += nLogN[int(n_new)]
} }
// Remove contribution of new word (before increment)
if n_new > 1 { if n_new > 1 {
sum_n_logn -= (n_new - 1) * math.Log(n_new-1) sum_n_logn -= nLogN[int(n_new-1)]
} }
} }
entropy = (log_nwords - sum_n_logn/float_nwords) / entropyMax entropy = (log_nwords - sum_n_logn/float_nwords) / entropyMax
} }
// Store entropy for position corresponding to start of k-mer
if s >= nwords && maskPositions[i-nwords+1] >= 0 { if s >= nwords && maskPositions[i-nwords+1] >= 0 {
if entropy < 0 { if entropy < 0 {
entropy = 0 entropy = 0
} }
entropy = math.Round(entropy*10000) / 10000 entropy = math.Round(entropy*10000) / 10000
entropies[i-nwords+1] = entropy entropies[i-nwords+1] = entropy
} }
} }
// ========================================================================
// STEP 3: Apply sliding min filter
// ========================================================================
// Replace each entropy with minimum in window of size kmer_size
// This allows robust detection of low-complexity regions
slidingMin(entropies, kmer_size) slidingMin(entropies, kmer_size)
// log.Warnf("%v\n%v", e, entropies)
} }
// ========================================================================
// FUNCTION 6: applyMaskMode - Apply masking to sequence
// ========================================================================
applyMaskMode := func(sequence *obiseq.BioSequence, maskPositions []bool, mask byte) (obiseq.BioSequenceSlice, error) { applyMaskMode := func(sequence *obiseq.BioSequence, maskPositions []bool, mask byte) (obiseq.BioSequenceSlice, error) {
// Create copy to avoid modifying original
seqCopy := sequence.Copy() seqCopy := sequence.Copy()
sequenceBytes := seqCopy.Sequence() sequenceBytes := seqCopy.Sequence()
// Mask identified positions
for i := range sequenceBytes { for i := range sequenceBytes {
if maskPositions[i] { if maskPositions[i] {
// Operation &^ 32 converts to UPPERCASE (clears bit 5)
// sequenceBytes[i] = sequenceBytes[i] &^ 32
sequenceBytes[i] = mask sequenceBytes[i] = mask
} }
} }
@@ -368,7 +270,6 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
} }
} }
// Handle the case where we end in a masked region
if inlow && fromlow >= 0 { if inlow && fromlow >= 0 {
frg, err := sequence.Subsequence(fromlow, len(maskPosition), false) frg, err := sequence.Subsequence(fromlow, len(maskPosition), false)
if err != nil { if err != nil {
@@ -403,7 +304,6 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
} }
} }
// Handle the case where we end in an unmasked region
if inhigh && fromhigh >= 0 { if inhigh && fromhigh >= 0 {
frg, err := sequence.Subsequence(fromhigh, len(maskPosition), false) frg, err := sequence.Subsequence(fromhigh, len(maskPosition), false)
if err != nil { if err != nil {
@@ -415,11 +315,6 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
return *rep, nil return *rep, nil
} }
// ========================================================================
// FUNCTION 7: masking - Main masking function
// ========================================================================
// Calculates entropies at all scales and masks positions
// whose minimum entropy is below the threshold.
masking := func(sequence *obiseq.BioSequence) (obiseq.BioSequenceSlice, error) { masking := func(sequence *obiseq.BioSequence) (obiseq.BioSequenceSlice, error) {
if sequence.Len() < kmer_size { if sequence.Len() < kmer_size {
sequence.SetAttribute("obilowmask_error", "Sequence too short") sequence.SetAttribute("obilowmask_error", "Sequence too short")
@@ -432,45 +327,27 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
bseq := sequence.Sequence() bseq := sequence.Sequence()
// Identify ambiguities
maskPositions := maskAmbiguities(bseq) maskPositions := maskAmbiguities(bseq)
// Initialize data structures mask := make([]int, len(bseq))
mask := make([]int, len(bseq)) // Stores scale detecting minimum entropy entropies := make([]float64, len(bseq))
entropies := make([]float64, len(bseq)) // Minimum entropy at each position
for i := range entropies { for i := range entropies {
entropies[i] = 4.0 // Very high initial value entropies[i] = 4.0
} }
freqs := make([]int, 1<<(2*level_max)) // Frequency table (max size) freqs := make([]int, 1<<(2*level_max))
words := make([]int, len(bseq)) // Buffer for encoded words words := make([]int, len(bseq))
entropies2 := make([]float64, len(bseq))
// ======================================================================== computeEntropies(bseq, maskPositions, entropies, freqs, words, level_max, normTables[level_max])
// Calculate entropy at maximum scale (level_max)
// ========================================================================
computeEntropies(bseq, maskPositions, entropies, freqs, words, level_max)
// Initialize mask with level_max everywhere (except ambiguities)
for i := range bseq { for i := range bseq {
v := level_max v := level_max
// if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' {
// v = 0
// }
mask[i] = v mask[i] = v
} }
// ========================================================================
// Calculate entropy at lower scales
// ========================================================================
entropies2 := make([]float64, len(bseq))
for ws := level_max - 1; ws > 0; ws-- { for ws := level_max - 1; ws > 0; ws-- {
// *** WARNING: POTENTIAL BUG *** computeEntropies(bseq, maskPositions, entropies2, freqs, words, ws, normTables[ws])
// The parameter passed is level_max instead of ws!
// This means we always recalculate with the same scale
// Should be: computeEntropies(bseq, maskPositions, entropies2, freqs, words, ws)
computeEntropies(bseq, maskPositions, entropies2, freqs, words, ws)
// Keep minimum entropy and corresponding scale
for i, e2 := range entropies2 { for i, e2 := range entropies2 {
if e2 < entropies[i] { if e2 < entropies[i] {
entropies[i] = e2 entropies[i] = e2
@@ -479,22 +356,17 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
} }
} }
// Force entropy to 0 for ambiguous positions
for i, nuc := range bseq { for i, nuc := range bseq {
if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' { if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' {
entropies[i] = 0 entropies[i] = 0
} }
} }
// ========================================================================
// Identify positions to mask
// ========================================================================
remove := make([]bool, len(entropies)) remove := make([]bool, len(entropies))
for i, e := range entropies { for i, e := range entropies {
remove[i] = e <= threshold remove[i] = e <= threshold
} }
// Save metadata in sequence attributes
sequence.SetAttribute("mask", mask) sequence.SetAttribute("mask", mask)
sequence.SetAttribute("Entropies", entropies) sequence.SetAttribute("Entropies", entropies)
@@ -527,9 +399,7 @@ func CLISequenceEntropyMasker(iterator obiiter.IBioSequence) obiiter.IBioSequenc
CLIMaskingChar(), CLIMaskingChar(),
) )
// Apply worker in parallel
newIter = iterator.MakeIWorker(worker, false, obidefault.ParallelWorkers()) newIter = iterator.MakeIWorker(worker, false, obidefault.ParallelWorkers())
// Filter resulting empty sequences
return newIter.FilterEmpty() return newIter.FilterEmpty()
} }

View File

@@ -0,0 +1,40 @@
package obilowmask
import (
"testing"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
)
func TestLowMaskWorker(t *testing.T) {
worker := LowMaskWorker(31, 6, 0.3, Mask, 'n')
seq := obiseq.NewBioSequence("test", []byte("acgtacgtacgtacgtacgtacgtacgtacgt"), "test")
result, err := worker(seq)
if err != nil {
t.Fatalf("Worker failed: %v", err)
}
if result.Len() != 1 {
t.Fatalf("Expected 1 sequence, got %d", result.Len())
}
resultSeq := result[0]
if resultSeq.Len() != 32 {
t.Fatalf("Expected sequence length 32, got %d", resultSeq.Len())
}
}
func TestLowMaskWorkerWithAmbiguity(t *testing.T) {
worker := LowMaskWorker(31, 6, 0.3, Mask, 'n')
seq := obiseq.NewBioSequence("test", []byte("acgtNcgtacgtacgtacgtacgtacgtacgt"), "test")
result, err := worker(seq)
if err != nil {
t.Fatalf("Worker failed: %v", err)
}
if result.Len() != 1 {
t.Fatalf("Expected 1 sequence, got %d", result.Len())
}
}

View File

@@ -207,16 +207,19 @@ func IndexFamilyDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
log.Infof("Done. Found %d clusters", clusters.Len()) log.Infof("Done. Found %d clusters", clusters.Len())
pbopt := make([]progressbar.Option, 0, 5) var bar *progressbar.ProgressBar
pbopt = append(pbopt, if obidefault.ProgressBar() {
progressbar.OptionSetWriter(os.Stderr), pbopt := make([]progressbar.Option, 0, 5)
progressbar.OptionSetWidth(15), pbopt = append(pbopt,
progressbar.OptionShowCount(), progressbar.OptionSetWriter(os.Stderr),
progressbar.OptionShowIts(), progressbar.OptionSetWidth(15),
progressbar.OptionSetDescription("Cluster indexing"), progressbar.OptionShowCount(),
) progressbar.OptionShowIts(),
progressbar.OptionSetDescription("Cluster indexing"),
)
bar := progressbar.NewOptions(len(clusters), pbopt...) bar = progressbar.NewOptions(len(clusters), pbopt...)
}
limits := make(chan [2]int) limits := make(chan [2]int)
waiting := sync.WaitGroup{} waiting := sync.WaitGroup{}
@@ -233,7 +236,9 @@ func IndexFamilyDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
for i := l[0]; i < l[1]; i++ { for i := l[0]; i < l[1]; i++ {
idx := IndexSequence(i, clusters, &kcluster, taxa, taxonomy) idx := IndexSequence(i, clusters, &kcluster, taxa, taxonomy)
clusters[i].SetOBITagRefIndex(idx) clusters[i].SetOBITagRefIndex(idx)
bar.Add(1) if bar != nil {
bar.Add(1)
}
} }
} }

View File

@@ -239,16 +239,19 @@ func IndexReferenceDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
log.Info("done") log.Info("done")
pbopt := make([]progressbar.Option, 0, 5) var bar *progressbar.ProgressBar
pbopt = append(pbopt, if obidefault.ProgressBar() {
progressbar.OptionSetWriter(os.Stderr), pbopt := make([]progressbar.Option, 0, 5)
progressbar.OptionSetWidth(15), pbopt = append(pbopt,
progressbar.OptionShowCount(), progressbar.OptionSetWriter(os.Stderr),
progressbar.OptionShowIts(), progressbar.OptionSetWidth(15),
progressbar.OptionSetDescription("[Sequence Processing]"), progressbar.OptionShowCount(),
) progressbar.OptionShowIts(),
progressbar.OptionSetDescription("[Sequence Processing]"),
)
bar := progressbar.NewOptions(len(references), pbopt...) bar = progressbar.NewOptions(len(references), pbopt...)
}
limits := make(chan [2]int) limits := make(chan [2]int)
indexed := obiiter.MakeIBioSequence() indexed := obiiter.MakeIBioSequence()
@@ -267,7 +270,9 @@ func IndexReferenceDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
iref := references[i].Copy() iref := references[i].Copy()
iref.SetOBITagRefIndex(idx) iref.SetOBITagRefIndex(idx)
sl = append(sl, iref) sl = append(sl, iref)
bar.Add(1) if bar != nil {
bar.Add(1)
}
} }
indexed.Push(obiiter.MakeBioSequenceBatch(source, l[0]/10, sl)) indexed.Push(obiiter.MakeBioSequenceBatch(source, l[0]/10, sl))
} }

View File

@@ -0,0 +1,10 @@
// obisuperkmer function utility package.
//
// The obitools/obisuperkmer package contains every
// function specifically required by the obisuperkmer utility.
//
// The obisuperkmer command extracts super k-mers from DNA sequences.
// A super k-mer is a maximal subsequence where all consecutive k-mers
// share the same minimizer. This decomposition is useful for efficient
// k-mer indexing and analysis in bioinformatics applications.
package obisuperkmer

View File

@@ -0,0 +1,69 @@
package obisuperkmer
import (
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
"github.com/DavidGamba/go-getoptions"
)
// Private variables for storing option values
var _KmerSize = 31
var _MinimizerSize = 13
// SuperKmerOptionSet defines every option related to super k-mer extraction.
//
// The function adds to a CLI every option proposed to the user
// to tune the parameters of the super k-mer extraction algorithm.
//
// Parameters:
// - options: is a pointer to a getoptions.GetOpt instance normally
// produced by the obioptions.GenerateOptionParser function.
func SuperKmerOptionSet(options *getoptions.GetOpt) {
options.IntVar(&_KmerSize, "kmer-size", _KmerSize,
options.Alias("k"),
options.Description("Size of k-mers (must be between m+1 and 31)."))
options.IntVar(&_MinimizerSize, "minimizer-size", _MinimizerSize,
options.Alias("m"),
options.Description("Size of minimizers (must be between 1 and k-1)."))
}
// OptionSet adds to the basic option set every option declared for
// the obisuperkmer command.
//
// It takes a pointer to a GetOpt struct as its parameter and does not return anything.
func OptionSet(options *getoptions.GetOpt) {
obiconvert.OptionSet(false)(options)
SuperKmerOptionSet(options)
}
// CLIKmerSize returns the k-mer size to use for super k-mer extraction.
//
// It does not take any parameters.
// It returns an integer representing the k-mer size.
func CLIKmerSize() int {
return _KmerSize
}
// SetKmerSize sets the k-mer size for super k-mer extraction.
//
// Parameters:
// - k: the k-mer size (must be between m+1 and 31).
func SetKmerSize(k int) {
_KmerSize = k
}
// CLIMinimizerSize returns the minimizer size to use for super k-mer extraction.
//
// It does not take any parameters.
// It returns an integer representing the minimizer size.
func CLIMinimizerSize() int {
return _MinimizerSize
}
// SetMinimizerSize sets the minimizer size for super k-mer extraction.
//
// Parameters:
// - m: the minimizer size (must be between 1 and k-1).
func SetMinimizerSize(m int) {
_MinimizerSize = m
}

View File

@@ -0,0 +1,59 @@
package obisuperkmer
import (
log "github.com/sirupsen/logrus"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
)
// CLIExtractSuperKmers extracts super k-mers from an iterator of BioSequences.
//
// This function takes an iterator of BioSequence objects, extracts super k-mers
// from each sequence using the k-mer and minimizer sizes specified by CLI options,
// and returns a new iterator yielding the extracted super k-mers as BioSequence objects.
//
// Each super k-mer is a maximal subsequence where all consecutive k-mers share
// the same minimizer. The resulting BioSequences contain metadata including:
// - minimizer_value: the canonical minimizer value
// - minimizer_seq: the DNA sequence of the minimizer
// - k: the k-mer size used
// - m: the minimizer size used
// - start: starting position in the original sequence
// - end: ending position in the original sequence
// - parent_id: ID of the parent sequence
//
// Parameters:
// - iterator: an iterator yielding BioSequence objects to process.
//
// Returns:
// - An iterator yielding BioSequence objects representing super k-mers.
func CLIExtractSuperKmers(iterator obiiter.IBioSequence) obiiter.IBioSequence {
// Get k-mer and minimizer sizes from CLI options
k := CLIKmerSize()
m := CLIMinimizerSize()
// Validate parameters
if m < 1 || m >= k {
log.Fatalf("Invalid parameters: minimizer size (%d) must be between 1 and k-1 (%d)", m, k-1)
}
if k < 2 || k > 31 {
log.Fatalf("Invalid k-mer size: %d (must be between 2 and 31)", k)
}
log.Printf("Extracting super k-mers with k=%d, m=%d", k, m)
// Create the worker for super k-mer extraction
worker := obikmer.SuperKmerWorker(k, m)
// Apply the worker to the iterator with parallel processing
newIter := iterator.MakeIWorker(
worker,
false, // don't merge results
obidefault.ParallelWorkers(),
)
return newIter
}

View File

@@ -0,0 +1,149 @@
package obisuperkmer
import (
"testing"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
)
func TestCLIExtractSuperKmers(t *testing.T) {
// Create a test sequence
testSeq := obiseq.NewBioSequence(
"test_seq",
[]byte("ACGTACGTACGTACGTACGTACGTACGTACGT"),
"",
)
// Create a batch with the test sequence
batch := obiseq.NewBioSequenceBatch()
batch.Add(testSeq)
// Create an iterator from the batch
iterator := obiiter.MakeBioSequenceBatchChannel(1)
go func() {
iterator.Push(batch)
iterator.Close()
}()
// Set test parameters
SetKmerSize(15)
SetMinimizerSize(7)
// Extract super k-mers
result := CLIExtractSuperKmers(iterator)
// Count the number of super k-mers
count := 0
for result.Next() {
batch := result.Get()
for _, sk := range batch.Slice() {
count++
// Verify that the super k-mer has the expected attributes
if !sk.HasAttribute("minimizer_value") {
t.Error("Super k-mer missing 'minimizer_value' attribute")
}
if !sk.HasAttribute("minimizer_seq") {
t.Error("Super k-mer missing 'minimizer_seq' attribute")
}
if !sk.HasAttribute("k") {
t.Error("Super k-mer missing 'k' attribute")
}
if !sk.HasAttribute("m") {
t.Error("Super k-mer missing 'm' attribute")
}
if !sk.HasAttribute("start") {
t.Error("Super k-mer missing 'start' attribute")
}
if !sk.HasAttribute("end") {
t.Error("Super k-mer missing 'end' attribute")
}
if !sk.HasAttribute("parent_id") {
t.Error("Super k-mer missing 'parent_id' attribute")
}
// Verify attribute values
k, _ := sk.GetIntAttribute("k")
m, _ := sk.GetIntAttribute("m")
if k != 15 {
t.Errorf("Expected k=15, got k=%d", k)
}
if m != 7 {
t.Errorf("Expected m=7, got m=%d", m)
}
parentID, _ := sk.GetStringAttribute("parent_id")
if parentID != "test_seq" {
t.Errorf("Expected parent_id='test_seq', got '%s'", parentID)
}
}
}
if count == 0 {
t.Error("No super k-mers were extracted")
}
t.Logf("Extracted %d super k-mers from test sequence", count)
}
func TestOptionGettersAndSetters(t *testing.T) {
// Test initial values
if CLIKmerSize() != 21 {
t.Errorf("Expected default k-mer size 21, got %d", CLIKmerSize())
}
if CLIMinimizerSize() != 11 {
t.Errorf("Expected default minimizer size 11, got %d", CLIMinimizerSize())
}
// Test setters
SetKmerSize(25)
SetMinimizerSize(13)
if CLIKmerSize() != 25 {
t.Errorf("SetKmerSize failed: expected 25, got %d", CLIKmerSize())
}
if CLIMinimizerSize() != 13 {
t.Errorf("SetMinimizerSize failed: expected 13, got %d", CLIMinimizerSize())
}
// Reset to defaults
SetKmerSize(21)
SetMinimizerSize(11)
}
func BenchmarkCLIExtractSuperKmers(b *testing.B) {
// Create a longer test sequence
longSeq := make([]byte, 1000)
bases := []byte{'A', 'C', 'G', 'T'}
for i := range longSeq {
longSeq[i] = bases[i%4]
}
testSeq := obiseq.NewBioSequence("bench_seq", longSeq, "")
// Set parameters
SetKmerSize(21)
SetMinimizerSize(11)
b.ResetTimer()
for i := 0; i < b.N; i++ {
batch := obiseq.NewBioSequenceBatch()
batch.Add(testSeq)
iterator := obiiter.MakeBioSequenceBatchChannel(1)
go func() {
iterator.Push(batch)
iterator.Close()
}()
result := CLIExtractSuperKmers(iterator)
// Consume the iterator
for result.Next() {
result.Get()
}
}
}

View File

@@ -1 +1 @@
4.4.7 4.4.12