mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-03-26 14:00:51 +00:00
Compare commits
50 Commits
Release_4.
...
Release_4.
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
b05404721e | ||
|
|
c57e788459 | ||
|
|
1cecf23978 | ||
|
|
4c824ef9b7 | ||
|
|
1ce5da9bee | ||
|
|
dc23d9de9a | ||
|
|
aa9d7bbf72 | ||
|
|
db22d20d0a | ||
|
|
7c05bdb01c | ||
|
|
b6542c4523 | ||
|
|
ac41dd8a22 | ||
|
|
bebbbbfe7d | ||
|
|
c6e04265f1 | ||
|
|
9babcc0fae | ||
|
|
e775f7e256 | ||
|
|
f2937af1ad | ||
|
|
56c1f4180c | ||
|
|
f78543ee75 | ||
|
|
a016ad5b8a | ||
|
|
09d437d10f | ||
|
|
d00ab6f83a | ||
|
|
8037860518 | ||
|
|
43d6cbe56a | ||
|
|
6dadee9371 | ||
|
|
99a8e69d10 | ||
|
|
c0ae49ef92 | ||
|
|
08490420a2 | ||
|
|
1a28d5ed64 | ||
|
|
b2d16721f0 | ||
|
|
7c12b1ee83 | ||
|
|
db98ddb241 | ||
|
|
7a979ba77f | ||
|
|
00c8be6b48 | ||
|
|
4ae331db36 | ||
|
|
f1e2846d2d | ||
|
|
cd5562fb30 | ||
|
|
f79b018430 | ||
|
|
aa819618c2 | ||
|
|
da8d851d4d | ||
|
|
9823bcb41b | ||
|
|
9c162459b0 | ||
|
|
25b494e562 | ||
|
|
0b5cadd104 | ||
|
|
a2106e4e82 | ||
|
|
a8a00ba0f7 | ||
|
|
1595a74ada | ||
|
|
68d723ecba | ||
|
|
250d616129 | ||
|
|
fbf816d219 | ||
|
|
7f0133a196 |
33
.github/workflows/release.yml
vendored
33
.github/workflows/release.yml
vendored
@@ -32,12 +32,11 @@ jobs:
|
||||
goos: linux
|
||||
goarch: amd64
|
||||
output_name: linux_amd64
|
||||
- os: ubuntu-latest
|
||||
- os: ubuntu-24.04-arm
|
||||
goos: linux
|
||||
goarch: arm64
|
||||
output_name: linux_arm64
|
||||
cross_compile: true
|
||||
- os: macos-latest
|
||||
- os: macos-15-intel
|
||||
goos: darwin
|
||||
goarch: amd64
|
||||
output_name: darwin_amd64
|
||||
@@ -63,25 +62,23 @@ jobs:
|
||||
TAG=${GITHUB_REF#refs/tags/Release_}
|
||||
echo "version=$TAG" >> $GITHUB_OUTPUT
|
||||
|
||||
- name: Install cross-compilation tools (Linux ARM64 only)
|
||||
if: matrix.cross_compile
|
||||
- name: Install build tools (macOS)
|
||||
if: runner.os == 'macOS'
|
||||
run: |
|
||||
sudo apt-get update
|
||||
sudo apt-get install -y gcc-aarch64-linux-gnu
|
||||
# Ensure Xcode Command Line Tools are installed
|
||||
xcode-select --install 2>/dev/null || true
|
||||
xcode-select -p
|
||||
|
||||
- name: Build binaries
|
||||
env:
|
||||
GOOS: ${{ matrix.goos }}
|
||||
GOARCH: ${{ matrix.goarch }}
|
||||
CC: ${{ matrix.cross_compile && 'aarch64-linux-gnu-gcc' || '' }}
|
||||
VERSION: ${{ steps.get_version.outputs.version }}
|
||||
run: |
|
||||
make obitools
|
||||
mkdir -p artifacts
|
||||
cd build
|
||||
for binary in *; do
|
||||
tar -czf ../artifacts/${binary}_${VERSION}_${{ matrix.output_name }}.tar.gz ${binary}
|
||||
done
|
||||
# Create a single tar.gz with all binaries for this platform
|
||||
tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
|
||||
|
||||
- name: Upload artifacts
|
||||
uses: actions/upload-artifact@v4
|
||||
@@ -139,29 +136,29 @@ jobs:
|
||||
echo "" >> release_notes.md
|
||||
echo "## Installation" >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
echo "Download the appropriate binary for your system and extract it:" >> release_notes.md
|
||||
echo "Download the appropriate archive for your system and extract it:" >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
echo "### Linux (AMD64)" >> release_notes.md
|
||||
echo '```bash' >> release_notes.md
|
||||
echo "tar -xzf <tool>_${VERSION}_linux_amd64.tar.gz" >> release_notes.md
|
||||
echo "tar -xzf obitools4_${VERSION}_linux_amd64.tar.gz" >> release_notes.md
|
||||
echo '```' >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
echo "### Linux (ARM64)" >> release_notes.md
|
||||
echo '```bash' >> release_notes.md
|
||||
echo "tar -xzf <tool>_${VERSION}_linux_arm64.tar.gz" >> release_notes.md
|
||||
echo "tar -xzf obitools4_${VERSION}_linux_arm64.tar.gz" >> release_notes.md
|
||||
echo '```' >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
echo "### macOS (Intel)" >> release_notes.md
|
||||
echo '```bash' >> release_notes.md
|
||||
echo "tar -xzf <tool>_${VERSION}_darwin_amd64.tar.gz" >> release_notes.md
|
||||
echo "tar -xzf obitools4_${VERSION}_darwin_amd64.tar.gz" >> release_notes.md
|
||||
echo '```' >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
echo "### macOS (Apple Silicon)" >> release_notes.md
|
||||
echo '```bash' >> release_notes.md
|
||||
echo "tar -xzf <tool>_${VERSION}_darwin_arm64.tar.gz" >> release_notes.md
|
||||
echo "tar -xzf obitools4_${VERSION}_darwin_arm64.tar.gz" >> release_notes.md
|
||||
echo '```' >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
echo "Available tools: Replace \`<tool>\` with one of the obitools commands." >> release_notes.md
|
||||
echo "All OBITools4 binaries are included in each archive." >> release_notes.md
|
||||
|
||||
- name: Create GitHub Release
|
||||
uses: softprops/action-gh-release@v1
|
||||
|
||||
3
.gitignore
vendored
3
.gitignore
vendored
@@ -31,3 +31,6 @@ LLM/**
|
||||
*_files
|
||||
|
||||
entropy.html
|
||||
bug_id.txt
|
||||
obilowmask_ref
|
||||
test_*
|
||||
|
||||
29
Makefile
29
Makefile
@@ -133,14 +133,33 @@ jjpush:
|
||||
@jj auto-describe
|
||||
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
|
||||
@jj new
|
||||
@$(MAKE) bump-version
|
||||
@echo "$(BLUE)→ Documenting version bump commit...$(NC)"
|
||||
@jj auto-describe
|
||||
@version=$$(cat version.txt); \
|
||||
@previous_version=$$(cat version.txt); \
|
||||
$(MAKE) bump-version; \
|
||||
version=$$(cat version.txt); \
|
||||
tag_name="Release_$$version"; \
|
||||
previous_tag="Release_$$previous_version"; \
|
||||
echo "$(BLUE)→ Documenting version bump commit...$(NC)"; \
|
||||
jj auto-describe; \
|
||||
echo "$(BLUE)→ Generating release notes from $$previous_tag to current commit...$(NC)"; \
|
||||
if command -v orla >/dev/null 2>&1 && command -v jq >/dev/null 2>&1; then \
|
||||
release_json=$$(ORLA_MAX_TOOL_CALLS=50 jj log -r "$$previous_tag::@" -T 'commit_id.short() ++ " " ++ description' | \
|
||||
orla agent -m ollama:qwen3-coder-next:latest \
|
||||
"Summarize the following commits into a GitHub release note for version $$version. Ignore commits related to version bumps, .gitignore changes, or any internal housekeeping that is irrelevant to end users. Describe each user-facing change precisely without exposing code. Eliminate redundancy. Output strictly valid JSON with no surrounding text, using this exact schema: {\"title\": \"<short release title>\", \"body\": \"<detailed markdown release notes>\"}"); \
|
||||
release_json=$$(echo "$$release_json" | sed -n '/^{/,/^}/p'); \
|
||||
release_title=$$(echo "$$release_json" | jq -r '.title // empty') ; \
|
||||
release_body=$$(echo "$$release_json" | jq -r '.body // empty') ; \
|
||||
if [ -n "$$release_title" ] && [ -n "$$release_body" ]; then \
|
||||
release_message="$$release_title"$$'\n\n'"$$release_body"; \
|
||||
else \
|
||||
echo "$(YELLOW)⚠ JSON parsing failed, falling back to raw output$(NC)"; \
|
||||
release_message="Release $$version"$$'\n\n'"$$release_json"; \
|
||||
fi; \
|
||||
else \
|
||||
release_message="Release $$version"; \
|
||||
fi; \
|
||||
echo "$(BLUE)→ Pushing commits and creating tag $$tag_name...$(NC)"; \
|
||||
jj git push --change @; \
|
||||
git tag -a "$$tag_name" -m "Release $$version" 2>/dev/null || echo "Tag $$tag_name already exists"; \
|
||||
git tag -a "$$tag_name" -m "$$release_message" 2>/dev/null || echo "Tag $$tag_name already exists"; \
|
||||
git push origin "$$tag_name" 2>/dev/null || echo "Tag already pushed"
|
||||
@echo "$(GREEN)✓ Commits and tag pushed to repository$(NC)"
|
||||
|
||||
|
||||
34
README.md
34
README.md
@@ -16,12 +16,17 @@ The easiest way to run it is to copy and paste the following command into your t
|
||||
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash
|
||||
```
|
||||
|
||||
By default, the script installs the *OBITools* commands and other associated files into the `/usr/local` directory.
|
||||
The names of the commands in the new *OBITools4* are mostly identical to those in *OBITools2*.
|
||||
Therefore, installing the new *OBITools* may hide or delete the old ones. If you want both versions to be
|
||||
available on your system, the installation script offers two options:
|
||||
By default, the script installs the latest version of *OBITools* commands and other associated files into the `/usr/local` directory.
|
||||
|
||||
### Installation Options
|
||||
|
||||
The installation script offers several options:
|
||||
|
||||
> -l, --list List all available versions and exit.
|
||||
>
|
||||
> -v, --version Install a specific version (e.g., `-v 4.4.3`).
|
||||
> By default, the latest version is installed.
|
||||
>
|
||||
> -i, --install-dir Directory where obitools are installed
|
||||
> (as example use `/usr/local` not `/usr/local/bin`).
|
||||
>
|
||||
@@ -30,14 +35,31 @@ available on your system, the installation script offers two options:
|
||||
> same time on your system (as example `-p g` will produce
|
||||
> `gobigrep` command instead of `obigrep`).
|
||||
|
||||
You can use these options by following the installation command:
|
||||
### Examples
|
||||
|
||||
List all available versions:
|
||||
```{bash}
|
||||
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --list
|
||||
```
|
||||
|
||||
Install a specific version:
|
||||
```{bash}
|
||||
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --version 4.4.3
|
||||
```
|
||||
|
||||
Install in a custom directory with command prefix:
|
||||
```{bash}
|
||||
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | \
|
||||
bash -s -- --install-dir test_install --obitools-prefix k
|
||||
```
|
||||
|
||||
In this case, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus, `obigrep` will be named `kobigrep`.
|
||||
In this last example, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus, `obigrep` will be named `kobigrep`.
|
||||
|
||||
### Note on Version Compatibility
|
||||
|
||||
The names of the commands in the new *OBITools4* are mostly identical to those in *OBITools2*.
|
||||
Therefore, installing the new *OBITools* may hide or delete the old ones. If you want both versions to be
|
||||
available on your system, use the `--install-dir` and `--obitools-prefix` options as shown above.
|
||||
|
||||
## Continuing the analysis...
|
||||
|
||||
|
||||
508
blackboard/Prospective/kmer_disk_index_plan.md
Normal file
508
blackboard/Prospective/kmer_disk_index_plan.md
Normal file
@@ -0,0 +1,508 @@
|
||||
# Plan de refonte du package obikmer : index disk-based par partitions minimizer
|
||||
|
||||
## Constat
|
||||
|
||||
Les roaring64 bitmaps ne sont pas adaptés au stockage de 10^10 k-mers
|
||||
(k=31) dispersés sur un espace de 2^62. L'overhead structurel (containers
|
||||
roaring par high key 32 bits) dépasse la taille des données elles-mêmes,
|
||||
et les opérations `Or()` entre bitmaps fragmentés ne terminent pas en
|
||||
temps raisonnable.
|
||||
|
||||
## Principe de la nouvelle architecture
|
||||
|
||||
Un `KmerSet` est un ensemble trié de k-mers canoniques (uint64) stocké
|
||||
sur disque, partitionné par minimizer. Chaque partition est un fichier
|
||||
binaire contenant des uint64 triés, compressés par delta-varint.
|
||||
|
||||
Un `KmerSetGroup` est un répertoire contenant N ensembles partitionnés
|
||||
de la même façon (même k, même m, même P).
|
||||
|
||||
Un `KmerSet` est un `KmerSetGroup` de taille 1 (singleton).
|
||||
|
||||
Les opérations ensemblistes se font partition par partition, en merge
|
||||
streaming, sans charger l'index complet en mémoire.
|
||||
|
||||
## Cycle de vie d'un index
|
||||
|
||||
L'index a deux phases distinctes :
|
||||
|
||||
1. **Phase de construction (mutable)** : on ouvre un index, on y ajoute
|
||||
des séquences. Pour chaque séquence, les super-kmers sont extraits
|
||||
et écrits de manière compacte (2 bits/base) dans le fichier
|
||||
temporaire de partition correspondant (`minimizer % P`). Les
|
||||
super-kmers sont une représentation compressée naturelle des k-mers
|
||||
chevauchants : un super-kmer de longueur L encode L-k+1 k-mers en
|
||||
ne stockant que ~L/4 bytes au lieu de (L-k+1) × 8 bytes.
|
||||
|
||||
2. **Phase de clôture (optimisation)** : on ferme l'index, ce qui
|
||||
déclenche le traitement **partition par partition** (indépendant,
|
||||
parallélisable) :
|
||||
- Charger les super-kmers de la partition
|
||||
- En extraire tous les k-mers canoniques
|
||||
- Trier le tableau de k-mers
|
||||
- Dédupliquer (et compter si FrequencyFilter)
|
||||
- Delta-encoder et écrire le fichier .kdi final
|
||||
Après clôture, l'index est statique et immuable.
|
||||
|
||||
3. **Phase de lecture (immutable)** : opérations ensemblistes,
|
||||
Jaccard, Quorum, Contains, itération. Toutes en streaming.
|
||||
|
||||
---
|
||||
|
||||
## Format sur disque
|
||||
|
||||
### Index finalisé
|
||||
|
||||
```
|
||||
index_dir/
|
||||
metadata.toml
|
||||
set_0/
|
||||
part_0000.kdi
|
||||
part_0001.kdi
|
||||
...
|
||||
part_{P-1}.kdi
|
||||
set_1/
|
||||
part_0000.kdi
|
||||
...
|
||||
...
|
||||
set_{N-1}/
|
||||
...
|
||||
```
|
||||
|
||||
### Fichiers temporaires pendant la construction
|
||||
|
||||
```
|
||||
index_dir/
|
||||
.build/
|
||||
set_0/
|
||||
part_0000.skm # super-kmers encodés 2 bits/base
|
||||
part_0001.skm
|
||||
...
|
||||
set_1/
|
||||
...
|
||||
```
|
||||
|
||||
Le répertoire `.build/` est supprimé après Close().
|
||||
|
||||
### metadata.toml
|
||||
|
||||
```toml
|
||||
id = "mon_index"
|
||||
k = 31
|
||||
m = 13
|
||||
partitions = 1024
|
||||
type = "KmerSetGroup" # ou "KmerSet" (N=1)
|
||||
size = 3 # nombre de sets (N)
|
||||
sets_ids = ["genome_A", "genome_B", "genome_C"]
|
||||
|
||||
[user_metadata]
|
||||
organism = "Triticum aestivum"
|
||||
|
||||
[sets_metadata]
|
||||
# métadonnées individuelles par set si nécessaire
|
||||
```
|
||||
|
||||
### Fichier .kdi (Kmer Delta Index)
|
||||
|
||||
Format binaire :
|
||||
|
||||
```
|
||||
[magic: 4 bytes "KDI\x01"]
|
||||
[count: uint64 little-endian] # nombre de k-mers dans cette partition
|
||||
[first: uint64 little-endian] # premier k-mer (valeur absolue)
|
||||
[delta_1: varint] # arr[1] - arr[0]
|
||||
[delta_2: varint] # arr[2] - arr[1]
|
||||
...
|
||||
[delta_{count-1}: varint] # arr[count-1] - arr[count-2]
|
||||
```
|
||||
|
||||
Varint : encoding unsigned, 7 bits utiles par byte, bit de poids fort
|
||||
= continuation (identique au varint protobuf).
|
||||
|
||||
Fichier vide (partition sans k-mer) : magic + count=0.
|
||||
|
||||
### Fichier .skm (Super-Kmer temporaire)
|
||||
|
||||
Format binaire, séquence de super-kmers encodés :
|
||||
|
||||
```
|
||||
[len: uint16 little-endian] # longueur du super-kmer en bases
|
||||
[sequence: ceil(len/4) bytes] # séquence encodée 2 bits/base, packed
|
||||
...
|
||||
```
|
||||
|
||||
**Compression par rapport au stockage de k-mers bruts** :
|
||||
|
||||
Un super-kmer de longueur L contient L-k+1 k-mers.
|
||||
- Stockage super-kmer : 2 + ceil(L/4) bytes
|
||||
- Stockage k-mers bruts : (L-k+1) × 8 bytes
|
||||
|
||||
Exemple avec k=31, super-kmer typique L=50 :
|
||||
- Super-kmer : 2 + 13 = 15 bytes → encode 20 k-mers
|
||||
- K-mers bruts : 20 × 8 = 160 bytes
|
||||
- **Facteur de compression : ~10×**
|
||||
|
||||
Pour un génome de 10 Gbases (~10^10 k-mers bruts) :
|
||||
- K-mers bruts : ~80 Go par set temporaire
|
||||
- Super-kmers : **~8 Go** par set temporaire
|
||||
|
||||
Avec FrequencyFilter et couverture 30× :
|
||||
- K-mers bruts : ~2.4 To
|
||||
- Super-kmers : **~240 Go**
|
||||
|
||||
---
|
||||
|
||||
## FrequencyFilter
|
||||
|
||||
Le FrequencyFilter n'est plus un type de données séparé. C'est un
|
||||
**mode de construction** du builder. Le résultat est un KmerSetGroup
|
||||
standard.
|
||||
|
||||
### Principe
|
||||
|
||||
Pendant la construction, tous les super-kmers sont écrits dans les
|
||||
fichiers temporaires .skm, y compris les doublons (chaque occurrence
|
||||
de chaque séquence est écrite).
|
||||
|
||||
Pendant Close(), pour chaque partition :
|
||||
1. Charger tous les super-kmers de la partition
|
||||
2. Extraire tous les k-mers canoniques dans un tableau []uint64
|
||||
3. Trier le tableau
|
||||
4. Parcourir linéairement : les k-mers identiques sont consécutifs
|
||||
5. Compter les occurrences de chaque k-mer
|
||||
6. Si count >= minFreq → écrire dans le .kdi final (une seule fois)
|
||||
7. Sinon → ignorer
|
||||
|
||||
### Dimensionnement
|
||||
|
||||
Pour un génome de 10 Gbases avec couverture 30× :
|
||||
- N_brut ≈ 3×10^11 k-mers bruts
|
||||
- Espace temporaire .skm ≈ 240 Go (compressé super-kmer)
|
||||
- RAM par partition pendant Close() :
|
||||
Avec P=1024 : ~3×10^8 k-mers/partition × 8 = **~2.4 Go**
|
||||
Avec P=4096 : ~7.3×10^7 k-mers/partition × 8 = **~600 Mo**
|
||||
|
||||
Le choix de P détermine le compromis nombre de fichiers vs RAM par
|
||||
partition.
|
||||
|
||||
### Sans FrequencyFilter (déduplication simple)
|
||||
|
||||
Pour de la déduplication simple (chaque k-mer écrit une fois), le
|
||||
builder peut dédupliquer au niveau des buffers en RAM avant flush.
|
||||
Cela réduit significativement l'espace temporaire car les doublons
|
||||
au sein d'un même buffer (provenant de séquences proches) sont
|
||||
éliminés immédiatement.
|
||||
|
||||
---
|
||||
|
||||
## API publique visée
|
||||
|
||||
### Structures
|
||||
|
||||
```go
|
||||
// KmerSetGroup est l'entité de base.
|
||||
// Un KmerSet est un KmerSetGroup avec Size() == 1.
|
||||
type KmerSetGroup struct {
|
||||
// champs internes : path, k, m, P, N, metadata, état
|
||||
}
|
||||
|
||||
// KmerSetGroupBuilder construit un KmerSetGroup mutable.
|
||||
type KmerSetGroupBuilder struct {
|
||||
// champs internes : buffers I/O par partition et par set,
|
||||
// fichiers temporaires .skm, paramètres (minFreq, etc.)
|
||||
}
|
||||
```
|
||||
|
||||
### Construction
|
||||
|
||||
```go
|
||||
// NewKmerSetGroupBuilder crée un builder pour un nouveau KmerSetGroup.
|
||||
// directory : répertoire de destination
|
||||
// k : taille des k-mers (1-31)
|
||||
// m : taille des minimizers (-1 pour auto = ceil(k/2.5))
|
||||
// n : nombre de sets dans le groupe
|
||||
// P : nombre de partitions (-1 pour auto)
|
||||
// options : options de construction (FrequencyFilter, etc.)
|
||||
func NewKmerSetGroupBuilder(directory string, k, m, n, P int,
|
||||
options ...BuilderOption) (*KmerSetGroupBuilder, error)
|
||||
|
||||
// WithMinFrequency active le mode FrequencyFilter.
|
||||
// Seuls les k-mers vus >= minFreq fois sont conservés dans l'index
|
||||
// final. Les super-kmers sont écrits avec leurs doublons pendant
|
||||
// la construction ; le comptage exact se fait au Close().
|
||||
func WithMinFrequency(minFreq int) BuilderOption
|
||||
|
||||
// AddSequence extrait les super-kmers d'une séquence et les écrit
|
||||
// dans les fichiers temporaires de partition du set i.
|
||||
func (b *KmerSetGroupBuilder) AddSequence(setIndex int, seq *obiseq.BioSequence)
|
||||
|
||||
// AddSuperKmer écrit un super-kmer dans le fichier temporaire de
|
||||
// sa partition pour le set i.
|
||||
func (b *KmerSetGroupBuilder) AddSuperKmer(setIndex int, sk SuperKmer)
|
||||
|
||||
// Close finalise la construction :
|
||||
// - flush des buffers d'écriture
|
||||
// - pour chaque partition de chaque set (parallélisable) :
|
||||
// - charger les super-kmers depuis le .skm
|
||||
// - extraire les k-mers canoniques
|
||||
// - trier, dédupliquer (compter si freq filter)
|
||||
// - delta-encoder et écrire le .kdi
|
||||
// - écrire metadata.toml
|
||||
// - supprimer le répertoire .build/
|
||||
// Retourne le KmerSetGroup en lecture seule.
|
||||
func (b *KmerSetGroupBuilder) Close() (*KmerSetGroup, error)
|
||||
```
|
||||
|
||||
### Lecture et opérations
|
||||
|
||||
```go
|
||||
// OpenKmerSetGroup ouvre un index finalisé en lecture seule.
|
||||
func OpenKmerSetGroup(directory string) (*KmerSetGroup, error)
|
||||
|
||||
// --- Métadonnées (API inchangée) ---
|
||||
func (ksg *KmerSetGroup) K() int
|
||||
func (ksg *KmerSetGroup) M() int // nouveau : taille du minimizer
|
||||
func (ksg *KmerSetGroup) Partitions() int // nouveau : nombre de partitions
|
||||
func (ksg *KmerSetGroup) Size() int
|
||||
func (ksg *KmerSetGroup) Id() string
|
||||
func (ksg *KmerSetGroup) SetId(id string)
|
||||
func (ksg *KmerSetGroup) HasAttribute(key string) bool
|
||||
func (ksg *KmerSetGroup) GetAttribute(key string) (interface{}, bool)
|
||||
func (ksg *KmerSetGroup) SetAttribute(key string, value interface{})
|
||||
// ... etc (toute l'API attributs actuelle est conservée)
|
||||
|
||||
// --- Opérations ensemblistes ---
|
||||
// Toutes produisent un nouveau KmerSetGroup singleton sur disque.
|
||||
// Opèrent partition par partition en streaming.
|
||||
|
||||
func (ksg *KmerSetGroup) Union(outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) Intersect(outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) Difference(outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) QuorumAtLeast(q int, outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) QuorumExactly(q int, outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) QuorumAtMost(q int, outputDir string) (*KmerSetGroup, error)
|
||||
|
||||
// --- Opérations entre deux KmerSetGroups ---
|
||||
// Les deux groupes doivent avoir les mêmes k, m, P.
|
||||
|
||||
func (ksg *KmerSetGroup) UnionWith(other *KmerSetGroup, outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) IntersectWith(other *KmerSetGroup, outputDir string) (*KmerSetGroup, error)
|
||||
|
||||
// --- Métriques (résultat en mémoire, pas de sortie disque) ---
|
||||
|
||||
func (ksg *KmerSetGroup) JaccardDistanceMatrix() *obidist.DistMatrix
|
||||
func (ksg *KmerSetGroup) JaccardSimilarityMatrix() *obidist.DistMatrix
|
||||
|
||||
// --- Accès individuel ---
|
||||
|
||||
func (ksg *KmerSetGroup) Len(setIndex ...int) uint64
|
||||
func (ksg *KmerSetGroup) Contains(setIndex int, kmer uint64) bool
|
||||
func (ksg *KmerSetGroup) Iterator(setIndex int) iter.Seq[uint64]
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Implémentation interne
|
||||
|
||||
### Primitives bas niveau
|
||||
|
||||
**`varint.go`** : encode/decode varint uint64
|
||||
|
||||
```go
|
||||
func EncodeVarint(w io.Writer, v uint64) (int, error)
|
||||
func DecodeVarint(r io.Reader) (uint64, error)
|
||||
```
|
||||
|
||||
### Format .kdi
|
||||
|
||||
**`kdi_writer.go`** : écriture d'un fichier .kdi à partir d'un flux
|
||||
trié de uint64 (delta-encode au vol).
|
||||
|
||||
```go
|
||||
type KdiWriter struct { ... }
|
||||
func NewKdiWriter(path string) (*KdiWriter, error)
|
||||
func (w *KdiWriter) Write(kmer uint64) error
|
||||
func (w *KdiWriter) Close() error
|
||||
```
|
||||
|
||||
**`kdi_reader.go`** : lecture streaming d'un fichier .kdi (décode
|
||||
les deltas au vol).
|
||||
|
||||
```go
|
||||
type KdiReader struct { ... }
|
||||
func NewKdiReader(path string) (*KdiReader, error)
|
||||
func (r *KdiReader) Next() (uint64, bool)
|
||||
func (r *KdiReader) Count() uint64
|
||||
func (r *KdiReader) Close() error
|
||||
```
|
||||
|
||||
### Format .skm
|
||||
|
||||
**`skm_writer.go`** : écriture de super-kmers encodés 2 bits/base.
|
||||
|
||||
```go
|
||||
type SkmWriter struct { ... }
|
||||
func NewSkmWriter(path string) (*SkmWriter, error)
|
||||
func (w *SkmWriter) Write(sk SuperKmer) error
|
||||
func (w *SkmWriter) Close() error
|
||||
```
|
||||
|
||||
**`skm_reader.go`** : lecture de super-kmers depuis un fichier .skm.
|
||||
|
||||
```go
|
||||
type SkmReader struct { ... }
|
||||
func NewSkmReader(path string) (*SkmReader, error)
|
||||
func (r *SkmReader) Next() (SuperKmer, bool)
|
||||
func (r *SkmReader) Close() error
|
||||
```
|
||||
|
||||
### Merge streaming
|
||||
|
||||
**`kdi_merge.go`** : k-way merge de plusieurs flux triés.
|
||||
|
||||
```go
|
||||
type KWayMerge struct { ... }
|
||||
func NewKWayMerge(readers []*KdiReader) *KWayMerge
|
||||
func (m *KWayMerge) Next() (kmer uint64, count int, ok bool)
|
||||
func (m *KWayMerge) Close() error
|
||||
```
|
||||
|
||||
### Builder
|
||||
|
||||
**`kmer_set_builder.go`** : construction d'un KmerSetGroup.
|
||||
|
||||
Le builder gère :
|
||||
- P × N écrivains .skm bufferisés (un par partition × set)
|
||||
- À la clôture : traitement partition par partition
|
||||
(parallélisable sur plusieurs cores)
|
||||
|
||||
Gestion mémoire des buffers d'écriture :
|
||||
- Chaque SkmWriter a un buffer I/O de taille raisonnable (~64 Ko)
|
||||
- Avec P=1024 et N=1 : 1024 × 64 Ko = 64 Mo de buffers
|
||||
- Avec P=1024 et N=10 : 640 Mo de buffers
|
||||
- Pas de buffer de k-mers en RAM : tout est écrit sur disque
|
||||
immédiatement via les super-kmers
|
||||
|
||||
RAM pendant Close() (tri d'une partition) :
|
||||
- Charger les super-kmers → extraire les k-mers → tableau []uint64
|
||||
- Avec P=1024 et 10^10 k-mers/set : ~10^7 k-mers/partition × 8 = ~80 Mo
|
||||
- Avec FrequencyFilter (doublons) et couverture 30× :
|
||||
~3×10^8/partition × 8 = ~2.4 Go (ajustable via P)
|
||||
|
||||
### Structure disk-based
|
||||
|
||||
**`kmer_set_disk.go`** : KmerSetGroup en lecture seule.
|
||||
|
||||
**`kmer_set_disk_ops.go`** : opérations ensemblistes par merge
|
||||
streaming partition par partition.
|
||||
|
||||
---
|
||||
|
||||
## Ce qui change par rapport à l'API actuelle
|
||||
|
||||
### Changements de sémantique
|
||||
|
||||
| Aspect | Ancien (roaring) | Nouveau (disk-based) |
|
||||
|---|---|---|
|
||||
| Stockage | En mémoire (roaring64.Bitmap) | Sur disque (.kdi delta-encoded) |
|
||||
| Temporaire construction | En mémoire | Super-kmers sur disque (.skm 2 bits/base) |
|
||||
| Mutabilité | Mutable à tout moment | Builder → Close() → immutable |
|
||||
| Opérations ensemblistes | Résultat en mémoire | Résultat sur disque (nouveau répertoire) |
|
||||
| Contains | O(1) roaring lookup | O(log n) recherche binaire sur .kdi |
|
||||
| Itération | Roaring iterator | Streaming décodage delta-varint |
|
||||
|
||||
### API conservée (signatures identiques ou quasi-identiques)
|
||||
|
||||
- `KmerSetGroup` : `K()`, `Size()`, `Id()`, `SetId()`
|
||||
- Toute l'API attributs
|
||||
- `JaccardDistanceMatrix()`, `JaccardSimilarityMatrix()`
|
||||
- `Len()`, `Contains()`
|
||||
|
||||
### API modifiée
|
||||
|
||||
- `Union()`, `Intersect()`, etc. : ajout du paramètre `outputDir`
|
||||
- `QuorumAtLeast()`, etc. : idem
|
||||
- Construction : `NewKmerSetGroupBuilder()` + `AddSequence()` + `Close()`
|
||||
au lieu de manipulation directe
|
||||
|
||||
### API supprimée
|
||||
|
||||
- `KmerSet` comme type distinct (remplacé par KmerSetGroup singleton)
|
||||
- `FrequencyFilter` comme type distinct (mode du Builder)
|
||||
- Tout accès direct à `roaring64.Bitmap`
|
||||
- `KmerSet.Copy()` (copie de répertoire à la place)
|
||||
- `KmerSet.Union()`, `.Intersect()`, `.Difference()` (deviennent méthodes
|
||||
de KmerSetGroup avec outputDir)
|
||||
|
||||
---
|
||||
|
||||
## Fichiers à créer / modifier dans pkg/obikmer
|
||||
|
||||
### Nouveaux fichiers
|
||||
|
||||
| Fichier | Contenu |
|
||||
|---|---|
|
||||
| `varint.go` | Encode/Decode varint uint64 |
|
||||
| `kdi_writer.go` | Écrivain de fichiers .kdi (delta-encoded) |
|
||||
| `kdi_reader.go` | Lecteur streaming de fichiers .kdi |
|
||||
| `skm_writer.go` | Écrivain de super-kmers encodés 2 bits/base |
|
||||
| `skm_reader.go` | Lecteur de super-kmers depuis .skm |
|
||||
| `kdi_merge.go` | K-way merge streaming de flux triés |
|
||||
| `kmer_set_builder.go` | KmerSetGroupBuilder (construction) |
|
||||
| `kmer_set_disk.go` | KmerSetGroup disk-based (lecture, métadonnées) |
|
||||
| `kmer_set_disk_ops.go` | Opérations ensemblistes streaming |
|
||||
|
||||
### Fichiers à supprimer
|
||||
|
||||
| Fichier | Raison |
|
||||
|---|---|
|
||||
| `kmer_set.go` | Remplacé par kmer_set_disk.go |
|
||||
| `kmer_set_group.go` | Idem |
|
||||
| `kmer_set_attributes.go` | Intégré dans kmer_set_disk.go |
|
||||
| `kmer_set_persistence.go` | L'index est nativement sur disque |
|
||||
| `kmer_set_group_quorum.go` | Intégré dans kmer_set_disk_ops.go |
|
||||
| `frequency_filter.go` | Mode du Builder, plus de type séparé |
|
||||
| `kmer_index_builder.go` | Remplacé par kmer_set_builder.go |
|
||||
|
||||
### Fichiers conservés tels quels
|
||||
|
||||
| Fichier | Contenu |
|
||||
|---|---|
|
||||
| `encodekmer.go` | Encodage/décodage k-mers |
|
||||
| `superkmer.go` | Structure SuperKmer |
|
||||
| `superkmer_iter.go` | IterSuperKmers, IterCanonicalKmers |
|
||||
| `encodefourmer.go` | Encode4mer |
|
||||
| `counting.go` | Count4Mer |
|
||||
| `kmermap.go` | KmerMap (usage indépendant) |
|
||||
| `debruijn.go` | Graphe de de Bruijn |
|
||||
|
||||
---
|
||||
|
||||
## Ordre d'implémentation
|
||||
|
||||
1. `varint.go` + tests
|
||||
2. `skm_writer.go` + `skm_reader.go` + tests
|
||||
3. `kdi_writer.go` + `kdi_reader.go` + tests
|
||||
4. `kdi_merge.go` + tests
|
||||
5. `kmer_set_builder.go` + tests (construction + Close)
|
||||
6. `kmer_set_disk.go` (structure, métadonnées, Open)
|
||||
7. `kmer_set_disk_ops.go` + tests (Union, Intersect, Quorum, Jaccard)
|
||||
8. Adaptation de `pkg/obitools/obikindex/`
|
||||
9. Suppression des anciens fichiers roaring
|
||||
10. Adaptation des tests existants
|
||||
|
||||
Chaque étape est testable indépendamment.
|
||||
|
||||
---
|
||||
|
||||
## Dépendances externes
|
||||
|
||||
### Supprimées
|
||||
|
||||
- `github.com/RoaringBitmap/roaring` : plus nécessaire pour les
|
||||
index k-mers (vérifier si d'autres packages l'utilisent encore)
|
||||
|
||||
### Ajoutées
|
||||
|
||||
- Aucune. Varint, delta-encoding, merge, encodage 2 bits/base :
|
||||
tout est implémentable en Go standard.
|
||||
735
blackboard/architechture/architecture-commande-obitools.md
Normal file
735
blackboard/architechture/architecture-commande-obitools.md
Normal file
@@ -0,0 +1,735 @@
|
||||
# Architecture d'une commande OBITools
|
||||
|
||||
## Vue d'ensemble
|
||||
|
||||
Une commande OBITools suit une architecture modulaire et standardisée qui sépare clairement les responsabilités entre :
|
||||
- Le package de la commande dans `pkg/obitools/<nom_commande>/`
|
||||
- L'exécutable dans `cmd/obitools/<nom_commande>/`
|
||||
|
||||
Cette architecture favorise la réutilisabilité du code, la testabilité et la cohérence entre les différentes commandes de la suite OBITools.
|
||||
|
||||
## Structure du projet
|
||||
|
||||
```
|
||||
obitools4/
|
||||
├── pkg/obitools/
|
||||
│ ├── obiconvert/ # Commande de conversion (base pour toutes)
|
||||
│ │ ├── obiconvert.go # Fonctions vides (pas d'implémentation)
|
||||
│ │ ├── options.go # Définition des options CLI
|
||||
│ │ ├── sequence_reader.go # Lecture des séquences
|
||||
│ │ └── sequence_writer.go # Écriture des séquences
|
||||
│ ├── obiuniq/ # Commande de déréplication
|
||||
│ │ ├── obiuniq.go # (fichier vide)
|
||||
│ │ ├── options.go # Options spécifiques à obiuniq
|
||||
│ │ └── unique.go # Implémentation du traitement
|
||||
│ ├── obipairing/ # Assemblage de lectures paired-end
|
||||
│ ├── obisummary/ # Résumé de fichiers de séquences
|
||||
│ └── obimicrosat/ # Détection de microsatellites
|
||||
└── cmd/obitools/
|
||||
├── obiconvert/
|
||||
│ └── main.go # Point d'entrée de la commande
|
||||
├── obiuniq/
|
||||
│ └── main.go
|
||||
├── obipairing/
|
||||
│ └── main.go
|
||||
├── obisummary/
|
||||
│ └── main.go
|
||||
└── obimicrosat/
|
||||
└── main.go
|
||||
```
|
||||
|
||||
## Composants de l'architecture
|
||||
|
||||
### 1. Package `pkg/obitools/<commande>/`
|
||||
|
||||
Chaque commande possède son propre package dans `pkg/obitools/` qui contient l'implémentation complète de la logique métier. Ce package est structuré en plusieurs fichiers :
|
||||
|
||||
#### a) `options.go` - Gestion des options CLI
|
||||
|
||||
Ce fichier définit :
|
||||
- Les **variables globales** privées (préfixées par `_`) stockant les valeurs des options
|
||||
- La fonction **`OptionSet()`** qui configure toutes les options pour la commande
|
||||
- Les fonctions **`CLI*()`** qui retournent les valeurs des options (getters)
|
||||
- Les fonctions **`Set*()`** qui permettent de définir les options programmatiquement (setters)
|
||||
|
||||
**Exemple (obiuniq/options.go) :**
|
||||
|
||||
```go
|
||||
package obiuniq
|
||||
|
||||
import (
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// Variables globales privées pour stocker les options
|
||||
var _StatsOn = make([]string, 0, 10)
|
||||
var _Keys = make([]string, 0, 10)
|
||||
var _InMemory = false
|
||||
var _chunks = 100
|
||||
|
||||
// Configuration des options spécifiques à la commande
|
||||
func UniqueOptionSet(options *getoptions.GetOpt) {
|
||||
options.StringSliceVar(&_StatsOn, "merge", 1, 1,
|
||||
options.Alias("m"),
|
||||
options.ArgName("KEY"),
|
||||
options.Description("Adds a merged attribute..."))
|
||||
|
||||
options.BoolVar(&_InMemory, "in-memory", _InMemory,
|
||||
options.Description("Use memory instead of disk..."))
|
||||
|
||||
options.IntVar(&_chunks, "chunk-count", _chunks,
|
||||
options.Description("In how many chunks..."))
|
||||
}
|
||||
|
||||
// OptionSet combine les options de base + les options spécifiques
|
||||
func OptionSet(options *getoptions.GetOpt) {
|
||||
obiconvert.OptionSet(false)(options) // Options de base
|
||||
UniqueOptionSet(options) // Options spécifiques
|
||||
}
|
||||
|
||||
// Getters pour accéder aux valeurs des options
|
||||
func CLIStatsOn() []string {
|
||||
return _StatsOn
|
||||
}
|
||||
|
||||
func CLIUniqueInMemory() bool {
|
||||
return _InMemory
|
||||
}
|
||||
|
||||
// Setters pour définir les options programmatiquement
|
||||
func SetUniqueInMemory(inMemory bool) {
|
||||
_InMemory = inMemory
|
||||
}
|
||||
```
|
||||
|
||||
**Convention de nommage :**
|
||||
- Variables privées : `_NomOption` (underscore préfixe)
|
||||
- Getters : `CLINomOption()` (préfixe CLI)
|
||||
- Setters : `SetNomOption()` (préfixe Set)
|
||||
|
||||
#### b) Fichier(s) d'implémentation
|
||||
|
||||
Un ou plusieurs fichiers contenant la logique métier de la commande :
|
||||
|
||||
**Exemple (obiuniq/unique.go) :**
|
||||
|
||||
```go
|
||||
package obiuniq
|
||||
|
||||
import (
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obichunk"
|
||||
)
|
||||
|
||||
// Fonction CLI principale qui orchestre le traitement
|
||||
func CLIUnique(sequences obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
// Récupération des options via les getters CLI*()
|
||||
options := make([]obichunk.WithOption, 0, 30)
|
||||
|
||||
options = append(options,
|
||||
obichunk.OptionBatchCount(CLINumberOfChunks()),
|
||||
)
|
||||
|
||||
if CLIUniqueInMemory() {
|
||||
options = append(options, obichunk.OptionSortOnMemory())
|
||||
} else {
|
||||
options = append(options, obichunk.OptionSortOnDisk())
|
||||
}
|
||||
|
||||
// Appel de la fonction de traitement réelle
|
||||
iUnique, err := obichunk.IUniqueSequence(sequences, options...)
|
||||
|
||||
if err != nil {
|
||||
log.Fatal(err)
|
||||
}
|
||||
|
||||
return iUnique
|
||||
}
|
||||
```
|
||||
|
||||
**Autres exemples d'implémentation :**
|
||||
|
||||
- **obimicrosat/microsat.go** : Contient `MakeMicrosatWorker()` et `CLIAnnotateMicrosat()`
|
||||
- **obisummary/obisummary.go** : Contient `ISummary()` et les structures de données
|
||||
|
||||
#### c) Fichiers utilitaires (optionnel)
|
||||
|
||||
Certaines commandes ont des fichiers additionnels pour des fonctionnalités spécifiques.
|
||||
|
||||
**Exemple (obipairing/options.go) :**
|
||||
|
||||
```go
|
||||
// Fonction spéciale pour créer un itérateur de séquences pairées
|
||||
func CLIPairedSequence() (obiiter.IBioSequence, error) {
|
||||
forward, err := obiconvert.CLIReadBioSequences(_ForwardFile)
|
||||
if err != nil {
|
||||
return obiiter.NilIBioSequence, err
|
||||
}
|
||||
|
||||
reverse, err := obiconvert.CLIReadBioSequences(_ReverseFile)
|
||||
if err != nil {
|
||||
return obiiter.NilIBioSequence, err
|
||||
}
|
||||
|
||||
paired := forward.PairTo(reverse)
|
||||
return paired, nil
|
||||
}
|
||||
```
|
||||
|
||||
### 2. Package `obiconvert` - La base commune
|
||||
|
||||
Le package `obiconvert` est spécial car il fournit les fonctionnalités de base utilisées par toutes les autres commandes :
|
||||
|
||||
#### Fonctionnalités fournies :
|
||||
|
||||
1. **Lecture de séquences** (`sequence_reader.go`)
|
||||
- `CLIReadBioSequences()` : lecture depuis fichiers ou stdin
|
||||
- Support de multiples formats (FASTA, FASTQ, EMBL, GenBank, etc.)
|
||||
- Gestion des fichiers multiples
|
||||
- Barre de progression optionnelle
|
||||
|
||||
2. **Écriture de séquences** (`sequence_writer.go`)
|
||||
- `CLIWriteBioSequences()` : écriture vers fichiers ou stdout
|
||||
- Support de multiples formats
|
||||
- Gestion des lectures pairées
|
||||
- Compression optionnelle
|
||||
|
||||
3. **Options communes** (`options.go`)
|
||||
- Options d'entrée (format, skip, etc.)
|
||||
- Options de sortie (format, fichier, compression)
|
||||
- Options de mode (barre de progression, etc.)
|
||||
|
||||
#### Utilisation par les autres commandes :
|
||||
|
||||
Toutes les commandes incluent les options de `obiconvert` via :
|
||||
|
||||
```go
|
||||
func OptionSet(options *getoptions.GetOpt) {
|
||||
obiconvert.OptionSet(false)(options) // false = pas de fichiers pairés
|
||||
MaCommandeOptionSet(options) // Options spécifiques
|
||||
}
|
||||
```
|
||||
|
||||
### 3. Exécutable `cmd/obitools/<commande>/main.go`
|
||||
|
||||
Le fichier `main.go` de chaque commande est volontairement **minimaliste** et suit toujours le même pattern :
|
||||
|
||||
```go
|
||||
package main
|
||||
|
||||
import (
|
||||
"os"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/macommande"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
)
|
||||
|
||||
func main() {
|
||||
// 1. Configuration optionnelle de paramètres par défaut
|
||||
obidefault.SetBatchSize(10)
|
||||
|
||||
// 2. Génération du parser d'options
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"macommande", // Nom de la commande
|
||||
"description de la commande", // Description
|
||||
macommande.OptionSet) // Fonction de configuration des options
|
||||
|
||||
// 3. Parsing des arguments
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
// 4. Lecture des séquences d'entrée
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||
|
||||
// 5. Traitement spécifique de la commande
|
||||
resultat := macommande.CLITraitement(sequences)
|
||||
|
||||
// 6. Écriture des résultats
|
||||
obiconvert.CLIWriteBioSequences(resultat, true)
|
||||
|
||||
// 7. Attente de la fin du pipeline
|
||||
obiutils.WaitForLastPipe()
|
||||
}
|
||||
```
|
||||
|
||||
## Patterns architecturaux
|
||||
|
||||
### Pattern 1 : Pipeline de traitement de séquences
|
||||
|
||||
La plupart des commandes suivent ce pattern :
|
||||
|
||||
```
|
||||
Lecture → Traitement → Écriture
|
||||
```
|
||||
|
||||
**Exemples :**
|
||||
- **obiconvert** : Lecture → Écriture (conversion de format)
|
||||
- **obiuniq** : Lecture → Déréplication → Écriture
|
||||
- **obimicrosat** : Lecture → Annotation → Filtrage → Écriture
|
||||
|
||||
### Pattern 2 : Traitement avec entrées multiples
|
||||
|
||||
Certaines commandes acceptent plusieurs fichiers d'entrée :
|
||||
|
||||
**obipairing** :
|
||||
```
|
||||
Lecture Forward + Lecture Reverse → Pairing → Assemblage → Écriture
|
||||
```
|
||||
|
||||
### Pattern 3 : Traitement sans écriture de séquences
|
||||
|
||||
**obisummary** : produit un résumé JSON/YAML au lieu de séquences
|
||||
|
||||
```go
|
||||
func main() {
|
||||
// ... parsing options et lecture ...
|
||||
|
||||
summary := obisummary.ISummary(fs, obisummary.CLIMapSummary())
|
||||
|
||||
// Formatage et affichage direct
|
||||
if obisummary.CLIOutFormat() == "json" {
|
||||
output, _ := json.MarshalIndent(summary, "", " ")
|
||||
fmt.Print(string(output))
|
||||
} else {
|
||||
output, _ := yaml.Marshal(summary)
|
||||
fmt.Print(string(output))
|
||||
}
|
||||
}
|
||||
```
|
||||
|
||||
### Pattern 4 : Utilisation de Workers
|
||||
|
||||
Les commandes qui transforment des séquences utilisent souvent le pattern Worker :
|
||||
|
||||
```go
|
||||
// Création d'un worker
|
||||
worker := MakeMicrosatWorker(
|
||||
CLIMinUnitLength(),
|
||||
CLIMaxUnitLength(),
|
||||
// ... autres paramètres
|
||||
)
|
||||
|
||||
// Application du worker sur l'itérateur
|
||||
newIter = iterator.MakeIWorker(
|
||||
worker,
|
||||
false, // merge results
|
||||
obidefault.ParallelWorkers() // parallélisation
|
||||
)
|
||||
```
|
||||
|
||||
## Étapes d'implémentation d'une nouvelle commande
|
||||
|
||||
### Étape 1 : Créer le package dans `pkg/obitools/`
|
||||
|
||||
```bash
|
||||
mkdir -p pkg/obitools/macommande
|
||||
```
|
||||
|
||||
### Étape 2 : Créer `options.go`
|
||||
|
||||
```go
|
||||
package macommande
|
||||
|
||||
import (
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// Variables privées pour les options
|
||||
var _MonOption = "valeur_par_defaut"
|
||||
|
||||
// Configuration des options spécifiques
|
||||
func MaCommandeOptionSet(options *getoptions.GetOpt) {
|
||||
options.StringVar(&_MonOption, "mon-option", _MonOption,
|
||||
options.Alias("o"),
|
||||
options.Description("Description de l'option"))
|
||||
}
|
||||
|
||||
// OptionSet combine options de base + spécifiques
|
||||
func OptionSet(options *getoptions.GetOpt) {
|
||||
obiconvert.OptionSet(false)(options) // false si pas de fichiers pairés
|
||||
MaCommandeOptionSet(options)
|
||||
}
|
||||
|
||||
// Getters
|
||||
func CLIMonOption() string {
|
||||
return _MonOption
|
||||
}
|
||||
|
||||
// Setters
|
||||
func SetMonOption(value string) {
|
||||
_MonOption = value
|
||||
}
|
||||
```
|
||||
|
||||
### Étape 3 : Créer le fichier d'implémentation
|
||||
|
||||
Créer `macommande.go` (ou un nom plus descriptif) :
|
||||
|
||||
```go
|
||||
package macommande
|
||||
|
||||
import (
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
// Fonction de traitement principale
|
||||
func CLIMaCommande(sequences obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
// Récupération des options
|
||||
option := CLIMonOption()
|
||||
|
||||
// Implémentation du traitement
|
||||
// ...
|
||||
|
||||
return resultat
|
||||
}
|
||||
```
|
||||
|
||||
### Étape 4 : Créer l'exécutable dans `cmd/obitools/`
|
||||
|
||||
```bash
|
||||
mkdir -p cmd/obitools/macommande
|
||||
```
|
||||
|
||||
Créer `main.go` :
|
||||
|
||||
```go
|
||||
package main
|
||||
|
||||
import (
|
||||
"os"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/macommande"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
)
|
||||
|
||||
func main() {
|
||||
// Parser d'options
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"macommande",
|
||||
"Description courte de ma commande",
|
||||
macommande.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
// Lecture
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||
|
||||
// Traitement
|
||||
resultat := macommande.CLIMaCommande(sequences)
|
||||
|
||||
// Écriture
|
||||
obiconvert.CLIWriteBioSequences(resultat, true)
|
||||
|
||||
// Attente
|
||||
obiutils.WaitForLastPipe()
|
||||
}
|
||||
```
|
||||
|
||||
### Étape 5 : Configurations optionnelles
|
||||
|
||||
Dans `main.go`, avant le parsing des options, on peut configurer :
|
||||
|
||||
```go
|
||||
// Taille des batchs de séquences
|
||||
obidefault.SetBatchSize(10)
|
||||
|
||||
// Nombre de workers en lecture (strict)
|
||||
obidefault.SetStrictReadWorker(2)
|
||||
|
||||
// Nombre de workers en écriture
|
||||
obidefault.SetStrictWriteWorker(2)
|
||||
|
||||
// Désactiver la lecture des qualités
|
||||
obidefault.SetReadQualities(false)
|
||||
```
|
||||
|
||||
### Étape 6 : Gestion des erreurs
|
||||
|
||||
Utiliser les fonctions utilitaires pour les messages d'erreur cohérents :
|
||||
|
||||
```go
|
||||
// Pour les erreurs d'ouverture de fichiers
|
||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||
|
||||
// Pour les erreurs générales
|
||||
if err != nil {
|
||||
log.Errorf("Message d'erreur: %v", err)
|
||||
os.Exit(1)
|
||||
}
|
||||
```
|
||||
|
||||
### Étape 7 : Tests et debugging (optionnel)
|
||||
|
||||
Des commentaires dans le code montrent comment activer le profiling :
|
||||
|
||||
```go
|
||||
// go tool pprof -http=":8000" ./macommande ./cpu.pprof
|
||||
// f, err := os.Create("cpu.pprof")
|
||||
// if err != nil {
|
||||
// log.Fatal(err)
|
||||
// }
|
||||
// pprof.StartCPUProfile(f)
|
||||
// defer pprof.StopCPUProfile()
|
||||
|
||||
// go tool trace cpu.trace
|
||||
// ftrace, err := os.Create("cpu.trace")
|
||||
// if err != nil {
|
||||
// log.Fatal(err)
|
||||
// }
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
```
|
||||
|
||||
## Bonnes pratiques observées
|
||||
|
||||
### 1. Séparation des responsabilités
|
||||
|
||||
- **`main.go`** : orchestration minimale
|
||||
- **`options.go`** : définition et gestion des options
|
||||
- **Fichiers d'implémentation** : logique métier
|
||||
|
||||
### 2. Convention de nommage cohérente
|
||||
|
||||
- Variables d'options : `_NomOption`
|
||||
- Getters CLI : `CLINomOption()`
|
||||
- Setters : `SetNomOption()`
|
||||
- Fonctions de traitement CLI : `CLITraitement()`
|
||||
|
||||
### 3. Réutilisation du code
|
||||
|
||||
- Toutes les commandes réutilisent `obiconvert` pour l'I/O
|
||||
- Les options communes sont partagées
|
||||
- Les fonctions utilitaires sont centralisées
|
||||
|
||||
### 4. Configuration par défaut
|
||||
|
||||
Les valeurs par défaut sont :
|
||||
- Définies lors de l'initialisation des variables
|
||||
- Modifiables via les options CLI
|
||||
- Modifiables programmatiquement via les setters
|
||||
|
||||
### 5. Gestion des formats
|
||||
|
||||
Support automatique de multiples formats :
|
||||
- FASTA / FASTQ (avec compression gzip)
|
||||
- EMBL / GenBank
|
||||
- ecoPCR
|
||||
- CSV
|
||||
- JSON (avec différents formats d'en-têtes)
|
||||
|
||||
### 6. Parallélisation
|
||||
|
||||
Les commandes utilisent les workers parallèles via :
|
||||
- `obidefault.ParallelWorkers()`
|
||||
- `obidefault.SetStrictReadWorker(n)`
|
||||
- `obidefault.SetStrictWriteWorker(n)`
|
||||
|
||||
### 7. Logging cohérent
|
||||
|
||||
Utilisation de `logrus` pour tous les logs :
|
||||
```go
|
||||
log.Printf("Message informatif")
|
||||
log.Errorf("Message d'erreur: %v", err)
|
||||
log.Fatal(err) // Arrêt du programme
|
||||
```
|
||||
|
||||
## Dépendances principales
|
||||
|
||||
### Packages internes OBITools
|
||||
|
||||
- `pkg/obidefault` : valeurs par défaut et configuration globale
|
||||
- `pkg/obioptions` : génération du parser d'options
|
||||
- `pkg/obiiter` : itérateurs de séquences biologiques
|
||||
- `pkg/obiseq` : structures et fonctions pour séquences biologiques
|
||||
- `pkg/obiformats` : lecture/écriture de différents formats
|
||||
- `pkg/obiutils` : fonctions utilitaires diverses
|
||||
- `pkg/obichunk` : traitement par chunks (pour dereplication, etc.)
|
||||
|
||||
### Packages externes
|
||||
|
||||
- `github.com/DavidGamba/go-getoptions` : parsing des options CLI
|
||||
- `github.com/sirupsen/logrus` : logging structuré
|
||||
- `gopkg.in/yaml.v3` : encodage/décodage YAML
|
||||
- `github.com/dlclark/regexp2` : expressions régulières avancées
|
||||
|
||||
## Cas spéciaux
|
||||
|
||||
### Commande avec fichiers pairés (obipairing)
|
||||
|
||||
```go
|
||||
func OptionSet(options *getoptions.GetOpt) {
|
||||
obiconvert.OutputOptionSet(options)
|
||||
obiconvert.InputOptionSet(options)
|
||||
PairingOptionSet(options) // Options spécifiques au pairing
|
||||
}
|
||||
|
||||
func CLIPairedSequence() (obiiter.IBioSequence, error) {
|
||||
forward, err := obiconvert.CLIReadBioSequences(_ForwardFile)
|
||||
// ...
|
||||
reverse, err := obiconvert.CLIReadBioSequences(_ReverseFile)
|
||||
// ...
|
||||
paired := forward.PairTo(reverse)
|
||||
return paired, nil
|
||||
}
|
||||
```
|
||||
|
||||
Dans `main.go` :
|
||||
```go
|
||||
pairs, err := obipairing.CLIPairedSequence() // Lecture spéciale
|
||||
if err != nil {
|
||||
log.Errorf("Cannot open file (%v)", err)
|
||||
os.Exit(1)
|
||||
}
|
||||
|
||||
paired := obipairing.IAssemblePESequencesBatch(
|
||||
pairs,
|
||||
obipairing.CLIGapPenality(),
|
||||
// ... autres paramètres
|
||||
)
|
||||
```
|
||||
|
||||
### Commande sans sortie de séquences (obisummary)
|
||||
|
||||
Au lieu de `obiconvert.CLIWriteBioSequences()`, affichage direct :
|
||||
|
||||
```go
|
||||
summary := obisummary.ISummary(fs, obisummary.CLIMapSummary())
|
||||
|
||||
if obisummary.CLIOutFormat() == "json" {
|
||||
output, _ := json.MarshalIndent(summary, "", " ")
|
||||
fmt.Print(string(output))
|
||||
} else {
|
||||
output, _ := yaml.Marshal(summary)
|
||||
fmt.Print(string(output))
|
||||
}
|
||||
fmt.Printf("\n")
|
||||
```
|
||||
|
||||
### Commande avec Workers personnalisés (obimicrosat)
|
||||
|
||||
```go
|
||||
func CLIAnnotateMicrosat(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
// Création du worker
|
||||
worker := MakeMicrosatWorker(
|
||||
CLIMinUnitLength(),
|
||||
CLIMaxUnitLength(),
|
||||
CLIMinUnitCount(),
|
||||
CLIMinLength(),
|
||||
CLIMinFlankLength(),
|
||||
CLIReoriented(),
|
||||
)
|
||||
|
||||
// Application du worker
|
||||
newIter := iterator.MakeIWorker(
|
||||
worker,
|
||||
false, // pas de merge
|
||||
obidefault.ParallelWorkers(), // parallélisation
|
||||
)
|
||||
|
||||
return newIter.FilterEmpty() // Filtrage des résultats vides
|
||||
}
|
||||
```
|
||||
|
||||
## Diagramme de flux d'exécution
|
||||
|
||||
```
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ cmd/obitools/macommande/main.go │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
│
|
||||
▼
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ 1. Génération du parser d'options │
|
||||
│ obioptions.GenerateOptionParser( │
|
||||
│ "macommande", │
|
||||
│ "description", │
|
||||
│ macommande.OptionSet) │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
│
|
||||
▼
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ pkg/obitools/macommande/options.go │
|
||||
│ ┌─────────────────────────────────────────────────────┐ │
|
||||
│ │ func OptionSet(options *getoptions.GetOpt) │ │
|
||||
│ │ obiconvert.OptionSet(false)(options) ───────────┐ │ │
|
||||
│ │ MaCommandeOptionSet(options) │ │ │
|
||||
│ └───────────────────────────────────────────────────┼─┘ │
|
||||
└────────────────────────────────────────────────────────┼─────┘
|
||||
│ │
|
||||
│ │
|
||||
┌─────────────┘ │
|
||||
│ │
|
||||
▼ ▼
|
||||
┌─────────────────────────────────┐ ┌───────────────────────────────┐
|
||||
│ 2. Parsing des arguments │ │ pkg/obitools/obiconvert/ │
|
||||
│ _, args := optionParser(...) │ │ options.go │
|
||||
└─────────────────────────────────┘ │ - InputOptionSet() │
|
||||
│ │ - OutputOptionSet() │
|
||||
▼ │ - PairedFilesOptionSet() │
|
||||
┌─────────────────────────────────┐ └───────────────────────────────┘
|
||||
│ 3. Lecture des séquences │
|
||||
│ CLIReadBioSequences(args) │
|
||||
└─────────────────────────────────┘
|
||||
│
|
||||
▼
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ pkg/obitools/obiconvert/sequence_reader.go │
|
||||
│ - ExpandListOfFiles() │
|
||||
│ - ReadSequencesFromFile() / ReadSequencesFromStdin() │
|
||||
│ - Support: FASTA, FASTQ, EMBL, GenBank, ecoPCR, CSV │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
│
|
||||
▼ obiiter.IBioSequence
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ 4. Traitement spécifique │
|
||||
│ macommande.CLITraitement(sequences) │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
│
|
||||
▼
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ pkg/obitools/macommande/<implementation>.go │
|
||||
│ - Récupération des options via CLI*() getters │
|
||||
│ - Application de la logique métier │
|
||||
│ - Retour d'un nouvel iterator │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
│
|
||||
▼ obiiter.IBioSequence
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ 5. Écriture des résultats │
|
||||
│ CLIWriteBioSequences(resultat, true) │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
│
|
||||
▼
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ pkg/obitools/obiconvert/sequence_writer.go │
|
||||
│ - WriteSequencesToFile() / WriteSequencesToStdout() │
|
||||
│ - Support: FASTA, FASTQ, JSON │
|
||||
│ - Gestion des lectures pairées │
|
||||
│ - Compression optionnelle │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
│
|
||||
▼
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ 6. Attente de fin du pipeline │
|
||||
│ obiutils.WaitForLastPipe() │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
```
|
||||
|
||||
## Conclusion
|
||||
|
||||
L'architecture des commandes OBITools est conçue pour :
|
||||
|
||||
1. **Maximiser la réutilisation** : `obiconvert` fournit les fonctionnalités communes
|
||||
2. **Simplifier l'ajout de nouvelles commandes** : pattern standardisé et minimaliste
|
||||
3. **Faciliter la maintenance** : séparation claire des responsabilités
|
||||
4. **Garantir la cohérence** : conventions de nommage et structure uniforme
|
||||
5. **Optimiser les performances** : parallélisation intégrée et traitement par batch
|
||||
|
||||
Cette architecture modulaire permet de créer rapidement de nouvelles commandes tout en maintenant une qualité et une cohérence élevées dans toute la suite OBITools.
|
||||
99
blackboard/architechture/definition-superkmer.md
Normal file
99
blackboard/architechture/definition-superkmer.md
Normal file
@@ -0,0 +1,99 @@
|
||||
# Définition du super k-mer
|
||||
|
||||
## Définition
|
||||
|
||||
Un **super k-mer** est une **sous-séquence MAXIMALE** d'une séquence dans laquelle **tous les k-mers consécutifs partagent le même minimiseur**.
|
||||
|
||||
### Termes
|
||||
|
||||
- **k-mer** : sous-séquence de longueur k
|
||||
- **minimiseur** : le plus petit m-mer canonique parmi tous les m-mers d'un k-mer
|
||||
- **k-mers consécutifs** : k-mers aux positions i et i+1 (chevauchement de k-1 nucléotides)
|
||||
- **MAXIMALE** : ne peut être étendue ni à gauche ni à droite
|
||||
|
||||
## RÈGLES ABSOLUES
|
||||
|
||||
### RÈGLE 1 : Longueur minimum = k
|
||||
|
||||
Un super k-mer contient au minimum k nucléotides.
|
||||
|
||||
```
|
||||
longueur(super-kmer) >= k
|
||||
```
|
||||
|
||||
### RÈGLE 2 : Chevauchement obligatoire = k-1
|
||||
|
||||
Deux super-kmers consécutifs se chevauchent d'EXACTEMENT k-1 nucléotides.
|
||||
|
||||
```
|
||||
SK1.End - SK2.Start = k - 1
|
||||
```
|
||||
|
||||
### RÈGLE 3 : Bijection séquence ↔ minimiseur
|
||||
|
||||
Une séquence de super k-mer a UN et UN SEUL minimiseur.
|
||||
|
||||
```
|
||||
Même séquence → Même minimiseur (TOUJOURS)
|
||||
```
|
||||
|
||||
**Si vous observez la même séquence avec deux minimiseurs différents, c'est un BUG.**
|
||||
|
||||
### RÈGLE 4 : Tous les k-mers partagent le minimiseur
|
||||
|
||||
TOUS les k-mers contenus dans un super k-mer ont le même minimiseur.
|
||||
|
||||
```
|
||||
∀ k-mer K dans SK : minimiseur(K) = SK.minimizer
|
||||
```
|
||||
|
||||
### RÈGLE 5 : Maximalité
|
||||
|
||||
Un super k-mer ne peut pas être étendu.
|
||||
|
||||
- Si on ajoute un nucléotide à gauche : le nouveau k-mer a un minimiseur différent
|
||||
- Si on ajoute un nucléotide à droite : le nouveau k-mer a un minimiseur différent
|
||||
|
||||
## VIOLATIONS INTERDITES
|
||||
|
||||
❌ **Super k-mer de longueur < k**
|
||||
❌ **Chevauchement ≠ k-1 entre consécutifs**
|
||||
❌ **Même séquence avec minimiseurs différents**
|
||||
❌ **K-mer dans le super k-mer avec minimiseur différent**
|
||||
❌ **Super k-mer extensible (non-maximal)**
|
||||
|
||||
## CONSÉQUENCES PRATIQUES
|
||||
|
||||
### Pour l'extraction
|
||||
|
||||
L'algorithme doit :
|
||||
1. Calculer le minimiseur de chaque k-mer
|
||||
2. Découper quand le minimiseur change
|
||||
3. Assigner au super k-mer le minimiseur commun à tous ses k-mers
|
||||
4. Garantir que chaque super k-mer contient au moins k nucléotides
|
||||
5. Garantir le chevauchement de k-1 entre consécutifs
|
||||
|
||||
### Pour la validation
|
||||
|
||||
Si après déduplication (obiuniq) on observe :
|
||||
```
|
||||
Séquence: ACGT...
|
||||
Minimiseurs: {M1, M2} // plusieurs minimiseurs
|
||||
```
|
||||
|
||||
C'est la PREUVE d'un bug : l'algorithme a produit cette séquence avec des minimiseurs différents, ce qui viole la RÈGLE 3.
|
||||
|
||||
## DIAGNOSTIC DU BUG
|
||||
|
||||
**Bug observé** : Même séquence avec minimiseurs différents après obiuniq
|
||||
|
||||
**Cause possible** : L'algorithme assigne le mauvais minimiseur OU découpe mal les super-kmers
|
||||
|
||||
**Ce que le bug NE PEUT PAS être** :
|
||||
- Un problème d'obiuniq (révèle le bug, ne le crée pas)
|
||||
- Un problème de chevauchement légitime (k-1 est correct)
|
||||
|
||||
**Ce que le bug DOIT être** :
|
||||
- Minimiseur mal calculé ou mal assigné
|
||||
- Découpage incorrect (mauvais endPos)
|
||||
- Copie incorrecte des données
|
||||
316
blackboard/architechture/guide-redaction-obitest.md
Normal file
316
blackboard/architechture/guide-redaction-obitest.md
Normal file
@@ -0,0 +1,316 @@
|
||||
# Guide de rédaction d'un obitest
|
||||
|
||||
## Règles essentielles
|
||||
|
||||
1. **Données < 1 KB** - Fichiers de test très petits
|
||||
2. **Exécution < 10 sec** - Tests rapides pour CI/CD
|
||||
3. **Auto-contenu** - Pas de dépendances externes
|
||||
4. **Auto-nettoyage** - Pas de fichiers résiduels
|
||||
|
||||
## Structure minimale
|
||||
|
||||
```
|
||||
obitests/obitools/<commande>/
|
||||
├── test.sh # Script exécutable
|
||||
└── data.fasta # Données minimales (optionnel)
|
||||
```
|
||||
|
||||
## Template de test.sh
|
||||
|
||||
```bash
|
||||
#!/bin/bash
|
||||
|
||||
TEST_NAME=<commande>
|
||||
CMD=<commande>
|
||||
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR"
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
########## TESTS ##########
|
||||
|
||||
# Test 1: Help (OBLIGATOIRE)
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Ajoutez vos tests ici...
|
||||
|
||||
###########################
|
||||
|
||||
cleanup
|
||||
```
|
||||
|
||||
## Pattern de test
|
||||
|
||||
```bash
|
||||
((ntest++))
|
||||
if commande args > "${TMPDIR}/output.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: description OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: description failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
## Tests courants
|
||||
|
||||
### Exécution basique
|
||||
```bash
|
||||
((ntest++))
|
||||
if $CMD "${TEST_DIR}/input.fasta" > "${TMPDIR}/output.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: basic execution OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: basic execution failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
### Sortie non vide
|
||||
```bash
|
||||
((ntest++))
|
||||
if [ -s "${TMPDIR}/output.fasta" ]
|
||||
then
|
||||
log "$MCMD: output not empty OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: output empty - failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
### Comptage
|
||||
```bash
|
||||
((ntest++))
|
||||
count=$(grep -c "^>" "${TMPDIR}/output.fasta")
|
||||
if [ "$count" -gt 0 ]
|
||||
then
|
||||
log "$MCMD: extracted $count sequences OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: no sequences - failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
### Présence de contenu
|
||||
```bash
|
||||
((ntest++))
|
||||
if grep -q "expected_string" "${TMPDIR}/output.fasta"
|
||||
then
|
||||
log "$MCMD: expected content found OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: content not found - failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
### Comparaison avec référence
|
||||
```bash
|
||||
((ntest++))
|
||||
if diff "${TEST_DIR}/expected.fasta" "${TMPDIR}/output.fasta" > /dev/null
|
||||
then
|
||||
log "$MCMD: matches reference OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: differs from reference - failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
### Test avec options
|
||||
```bash
|
||||
((ntest++))
|
||||
if $CMD --opt value "${TEST_DIR}/input.fasta" > "${TMPDIR}/out.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: with option OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: with option failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
## Variables importantes
|
||||
|
||||
- **TEST_DIR** - Répertoire du test (données d'entrée)
|
||||
- **TMPDIR** - Répertoire temporaire (sorties)
|
||||
- **CMD** - Nom de la commande
|
||||
- **MCMD** - Nom formaté pour les logs
|
||||
|
||||
## Règles d'or
|
||||
|
||||
✅ **Entrées** → `${TEST_DIR}/`
|
||||
✅ **Sorties** → `${TMPDIR}/`
|
||||
✅ **Toujours rediriger** → `> file 2>&1`
|
||||
✅ **Incrémenter ntest** → Avant chaque test
|
||||
✅ **Messages clairs** → Descriptions explicites
|
||||
|
||||
❌ **Pas de chemins en dur**
|
||||
❌ **Pas de /tmp direct**
|
||||
❌ **Pas de sortie vers TEST_DIR**
|
||||
❌ **Pas de commandes sans redirection**
|
||||
|
||||
## Données de test
|
||||
|
||||
Créer un fichier minimal (< 500 bytes) :
|
||||
|
||||
```fasta
|
||||
>seq1
|
||||
ACGTACGTACGTACGT
|
||||
>seq2
|
||||
AAAACCCCGGGGTTTT
|
||||
>seq3
|
||||
ATCGATCGATCGATCG
|
||||
```
|
||||
|
||||
## Création rapide
|
||||
|
||||
```bash
|
||||
# 1. Créer le répertoire
|
||||
mkdir -p obitests/obitools/<commande>
|
||||
cd obitests/obitools/<commande>
|
||||
|
||||
# 2. Créer les données de test
|
||||
cat > test_data.fasta << 'EOF'
|
||||
>seq1
|
||||
ACGTACGTACGTACGT
|
||||
>seq2
|
||||
AAAACCCCGGGGTTTT
|
||||
EOF
|
||||
|
||||
# 3. Copier le template dans test.sh
|
||||
# 4. Adapter le TEST_NAME et CMD
|
||||
# 5. Ajouter les tests
|
||||
# 6. Rendre exécutable
|
||||
chmod +x test.sh
|
||||
|
||||
# 7. Tester
|
||||
./test.sh
|
||||
```
|
||||
|
||||
## Checklist
|
||||
|
||||
- [ ] `test.sh` exécutable (`chmod +x`)
|
||||
- [ ] Test d'aide inclus
|
||||
- [ ] Données < 1 KB
|
||||
- [ ] Sorties vers `${TMPDIR}/`
|
||||
- [ ] Entrées depuis `${TEST_DIR}/`
|
||||
- [ ] Redirections `2>&1`
|
||||
- [ ] Messages clairs
|
||||
- [ ] Testé localement
|
||||
- [ ] Exit code 0 si succès
|
||||
|
||||
## Debug
|
||||
|
||||
Conserver TMPDIR pour inspection :
|
||||
```bash
|
||||
cleanup() {
|
||||
echo "Temporary directory: $TMPDIR" 1>&2
|
||||
# rm -rf "$TMPDIR" # Commenté
|
||||
...
|
||||
}
|
||||
```
|
||||
|
||||
Mode verbose :
|
||||
```bash
|
||||
set -x # Au début du script
|
||||
```
|
||||
|
||||
## Exemples
|
||||
|
||||
**Simple (1 test)** - obimicrosat
|
||||
```bash
|
||||
# Juste l'aide
|
||||
```
|
||||
|
||||
**Moyen (4-5 tests)** - obisuperkmer
|
||||
```bash
|
||||
# Aide + exécution + validation sortie + contenu
|
||||
```
|
||||
|
||||
**Complet (7+ tests)** - obiuniq
|
||||
```bash
|
||||
# Aide + exécution + comparaison CSV + options + multiples cas
|
||||
```
|
||||
|
||||
## Commandes utiles
|
||||
|
||||
```bash
|
||||
# Compter séquences
|
||||
grep -c "^>" file.fasta
|
||||
|
||||
# Fichier non vide
|
||||
[ -s file ]
|
||||
|
||||
# Comparer
|
||||
diff file1 file2 > /dev/null
|
||||
|
||||
# Comparer compressés
|
||||
zdiff file1.gz file2.gz
|
||||
|
||||
# Compter bases
|
||||
grep -v "^>" file | tr -d '\n' | wc -c
|
||||
```
|
||||
|
||||
## Ce qu'il faut retenir
|
||||
|
||||
Un bon test est **COURT**, **RAPIDE** et **SIMPLE** :
|
||||
- 3-10 tests maximum
|
||||
- Données < 1 KB
|
||||
- Exécution < 10 secondes
|
||||
- Pattern standard respecté
|
||||
268
blackboard/architechture/obisuperkmer-implementation.md
Normal file
268
blackboard/architechture/obisuperkmer-implementation.md
Normal file
@@ -0,0 +1,268 @@
|
||||
# Implémentation de la commande obisuperkmer
|
||||
|
||||
## Vue d'ensemble
|
||||
|
||||
La commande `obisuperkmer` a été implémentée en suivant l'architecture standard des commandes OBITools décrite dans `architecture-commande-obitools.md`. Cette commande permet d'extraire les super k-mers de fichiers de séquences biologiques.
|
||||
|
||||
## Qu'est-ce qu'un super k-mer ?
|
||||
|
||||
Un super k-mer est une sous-séquence maximale dans laquelle tous les k-mers consécutifs partagent le même minimiseur. Cette décomposition est utile pour :
|
||||
- L'indexation efficace de k-mers
|
||||
- La réduction de la redondance dans les analyses
|
||||
- L'optimisation de la mémoire pour les structures de données de k-mers
|
||||
|
||||
## Structure de l'implémentation
|
||||
|
||||
### 1. Package `pkg/obitools/obisuperkmer/`
|
||||
|
||||
Le package contient trois fichiers :
|
||||
|
||||
#### `obisuperkmer.go`
|
||||
Documentation du package avec une description de son rôle.
|
||||
|
||||
#### `options.go`
|
||||
Définit les options de ligne de commande :
|
||||
|
||||
```go
|
||||
var _KmerSize = 21 // Taille des k-mers (par défaut 21)
|
||||
var _MinimizerSize = 11 // Taille des minimiseurs (par défaut 11)
|
||||
```
|
||||
|
||||
**Options CLI disponibles :**
|
||||
- `--kmer-size` / `-k` : Taille des k-mers (entre m+1 et 31)
|
||||
- `--minimizer-size` / `-m` : Taille des minimiseurs (entre 1 et k-1)
|
||||
|
||||
**Fonctions d'accès :**
|
||||
- `CLIKmerSize()` : retourne la taille des k-mers
|
||||
- `CLIMinimizerSize()` : retourne la taille des minimiseurs
|
||||
- `SetKmerSize(k int)` : définit la taille des k-mers
|
||||
- `SetMinimizerSize(m int)` : définit la taille des minimiseurs
|
||||
|
||||
#### `superkmer.go`
|
||||
Implémente la logique de traitement :
|
||||
|
||||
```go
|
||||
func CLIExtractSuperKmers(iterator obiiter.IBioSequence) obiiter.IBioSequence
|
||||
```
|
||||
|
||||
Cette fonction :
|
||||
1. Récupère les paramètres k et m depuis les options CLI
|
||||
2. Valide les paramètres (m < k, k <= 31, etc.)
|
||||
3. Crée un worker utilisant `obikmer.SuperKmerWorker(k, m)`
|
||||
4. Applique le worker en parallèle sur l'itérateur de séquences
|
||||
5. Retourne un itérateur de super k-mers
|
||||
|
||||
### 2. Exécutable `cmd/obitools/obisuperkmer/main.go`
|
||||
|
||||
L'exécutable suit le pattern standard minimal :
|
||||
|
||||
```go
|
||||
func main() {
|
||||
// 1. Génération du parser d'options
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obisuperkmer",
|
||||
"extract super k-mers from sequence files",
|
||||
obisuperkmer.OptionSet)
|
||||
|
||||
// 2. Parsing des arguments
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
// 3. Lecture des séquences
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||
|
||||
// 4. Extraction des super k-mers
|
||||
superkmers := obisuperkmer.CLIExtractSuperKmers(sequences)
|
||||
|
||||
// 5. Écriture des résultats
|
||||
obiconvert.CLIWriteBioSequences(superkmers, true)
|
||||
|
||||
// 6. Attente de la fin du pipeline
|
||||
obiutils.WaitForLastPipe()
|
||||
}
|
||||
```
|
||||
|
||||
## Utilisation du package `obikmer`
|
||||
|
||||
L'implémentation s'appuie sur le package `obikmer` qui fournit :
|
||||
|
||||
### `SuperKmerWorker(k int, m int) obiseq.SeqWorker`
|
||||
|
||||
Crée un worker qui :
|
||||
- Extrait les super k-mers d'une BioSequence
|
||||
- Retourne une slice de BioSequence, une par super k-mer
|
||||
- Chaque super k-mer contient les attributs suivants :
|
||||
|
||||
```go
|
||||
// Métadonnées ajoutées à chaque super k-mer :
|
||||
{
|
||||
"minimizer_value": uint64, // Valeur canonique du minimiseur
|
||||
"minimizer_seq": string, // Séquence ADN du minimiseur
|
||||
"k": int, // Taille des k-mers utilisée
|
||||
"m": int, // Taille des minimiseurs utilisée
|
||||
"start": int, // Position de début (0-indexé)
|
||||
"end": int, // Position de fin (exclusif)
|
||||
"parent_id": string, // ID de la séquence parente
|
||||
}
|
||||
```
|
||||
|
||||
### Algorithme sous-jacent
|
||||
|
||||
Le package `obikmer` utilise :
|
||||
- `IterSuperKmers(seq []byte, k int, m int)` : itérateur sur les super k-mers
|
||||
- Une deque monotone pour suivre les minimiseurs dans une fenêtre glissante
|
||||
- Complexité temporelle : O(n) où n est la longueur de la séquence
|
||||
- Complexité spatiale : O(k-m+1) pour la deque
|
||||
|
||||
## Exemple d'utilisation
|
||||
|
||||
### Ligne de commande
|
||||
|
||||
```bash
|
||||
# Extraction avec paramètres par défaut (k=21, m=11)
|
||||
obisuperkmer sequences.fasta > superkmers.fasta
|
||||
|
||||
# Spécifier les tailles de k-mers et minimiseurs
|
||||
obisuperkmer -k 25 -m 13 sequences.fasta -o superkmers.fasta
|
||||
|
||||
# Avec plusieurs fichiers d'entrée
|
||||
obisuperkmer --kmer-size 31 --minimizer-size 15 file1.fasta file2.fasta > output.fasta
|
||||
|
||||
# Format FASTQ en entrée, FASTA en sortie
|
||||
obisuperkmer sequences.fastq --fasta-output -o superkmers.fasta
|
||||
|
||||
# Avec compression
|
||||
obisuperkmer sequences.fasta -o superkmers.fasta.gz --compress
|
||||
```
|
||||
|
||||
### Exemple de sortie
|
||||
|
||||
Pour une séquence d'entrée :
|
||||
```
|
||||
>seq1
|
||||
ACGTACGTACGTACGTACGTACGT
|
||||
```
|
||||
|
||||
La sortie contiendra plusieurs super k-mers :
|
||||
```
|
||||
>seq1_superkmer_0_15 {"minimizer_value":123456,"minimizer_seq":"acgtacgt","k":21,"m":11,"start":0,"end":15,"parent_id":"seq1"}
|
||||
ACGTACGTACGTACG
|
||||
>seq1_superkmer_8_24 {"minimizer_value":789012,"minimizer_seq":"gtacgtac","k":21,"m":11,"start":8,"end":24,"parent_id":"seq1"}
|
||||
TACGTACGTACGTACGT
|
||||
```
|
||||
|
||||
## Options héritées de `obiconvert`
|
||||
|
||||
La commande hérite de toutes les options standard d'OBITools :
|
||||
|
||||
### Options d'entrée
|
||||
- `--fasta` : forcer le format FASTA
|
||||
- `--fastq` : forcer le format FASTQ
|
||||
- `--ecopcr` : format ecoPCR
|
||||
- `--embl` : format EMBL
|
||||
- `--genbank` : format GenBank
|
||||
- `--input-json-header` : en-têtes JSON
|
||||
- `--input-OBI-header` : en-têtes OBI
|
||||
|
||||
### Options de sortie
|
||||
- `--out` / `-o` : fichier de sortie (défaut : stdout)
|
||||
- `--fasta-output` : sortie en format FASTA
|
||||
- `--fastq-output` : sortie en format FASTQ
|
||||
- `--json-output` : sortie en format JSON
|
||||
- `--output-json-header` : en-têtes JSON en sortie
|
||||
- `--output-OBI-header` / `-O` : en-têtes OBI en sortie
|
||||
- `--compress` / `-Z` : compression gzip
|
||||
- `--skip-empty` : ignorer les séquences vides
|
||||
- `--no-progressbar` : désactiver la barre de progression
|
||||
|
||||
## Compilation
|
||||
|
||||
Pour compiler la commande :
|
||||
|
||||
```bash
|
||||
cd /chemin/vers/obitools4
|
||||
go build -o bin/obisuperkmer ./cmd/obitools/obisuperkmer/
|
||||
```
|
||||
|
||||
## Tests
|
||||
|
||||
Pour tester la commande :
|
||||
|
||||
```bash
|
||||
# Créer un fichier de test
|
||||
echo -e ">test\nACGTACGTACGTACGTACGTACGTACGTACGT" > test.fasta
|
||||
|
||||
# Exécuter obisuperkmer
|
||||
obisuperkmer test.fasta
|
||||
|
||||
# Vérifier avec des paramètres différents
|
||||
obisuperkmer -k 15 -m 7 test.fasta
|
||||
```
|
||||
|
||||
## Validation des paramètres
|
||||
|
||||
La commande valide automatiquement :
|
||||
- `1 <= m < k` : le minimiseur doit être plus petit que le k-mer
|
||||
- `2 <= k <= 31` : contrainte du codage sur 64 bits
|
||||
- `len(sequence) >= k` : la séquence doit être assez longue
|
||||
|
||||
En cas de paramètres invalides, la commande affiche une erreur explicite et s'arrête.
|
||||
|
||||
## Intégration avec le pipeline OBITools
|
||||
|
||||
La commande s'intègre naturellement dans les pipelines OBITools :
|
||||
|
||||
```bash
|
||||
# Pipeline complet d'analyse
|
||||
obiconvert sequences.fastq --fasta-output | \
|
||||
obisuperkmer -k 21 -m 11 | \
|
||||
obiuniq | \
|
||||
obigrep -p "minimizer_value>1000" > filtered_superkmers.fasta
|
||||
```
|
||||
|
||||
## Parallélisation
|
||||
|
||||
La commande utilise automatiquement :
|
||||
- `obidefault.ParallelWorkers()` pour le traitement parallèle
|
||||
- Les workers sont distribués sur les séquences d'entrée
|
||||
- La parallélisation est transparente pour l'utilisateur
|
||||
|
||||
## Conformité avec l'architecture OBITools
|
||||
|
||||
L'implémentation respecte tous les principes de l'architecture :
|
||||
|
||||
✅ Séparation des responsabilités (package + commande)
|
||||
✅ Convention de nommage cohérente (CLI*, Set*, _variables)
|
||||
✅ Réutilisation de `obiconvert` pour l'I/O
|
||||
✅ Options standard partagées
|
||||
✅ Pattern Worker pour le traitement
|
||||
✅ Validation des paramètres
|
||||
✅ Logging avec `logrus`
|
||||
✅ Gestion d'erreurs cohérente
|
||||
✅ Documentation complète
|
||||
|
||||
## Fichiers créés
|
||||
|
||||
```
|
||||
pkg/obitools/obisuperkmer/
|
||||
├── obisuperkmer.go # Documentation du package
|
||||
├── options.go # Définition des options CLI
|
||||
└── superkmer.go # Implémentation du traitement
|
||||
|
||||
cmd/obitools/obisuperkmer/
|
||||
└── main.go # Point d'entrée de la commande
|
||||
```
|
||||
|
||||
## Prochaines étapes
|
||||
|
||||
1. **Compilation** : Compiler la commande avec `go build`
|
||||
2. **Tests unitaires** : Créer des tests dans `pkg/obitools/obisuperkmer/superkmer_test.go`
|
||||
3. **Documentation utilisateur** : Ajouter la documentation de la commande
|
||||
4. **Intégration CI/CD** : Ajouter aux tests d'intégration
|
||||
5. **Benchmarks** : Mesurer les performances sur différents jeux de données
|
||||
|
||||
## Références
|
||||
|
||||
- Architecture des commandes OBITools : `architecture-commande-obitools.md`
|
||||
- Package `obikmer` : `pkg/obikmer/`
|
||||
- Tests du package : `pkg/obikmer/superkmer_iter_test.go`
|
||||
440
blackboard/architechture/obisuperkmer-tests.md
Normal file
440
blackboard/architechture/obisuperkmer-tests.md
Normal file
@@ -0,0 +1,440 @@
|
||||
# Tests automatisés pour obisuperkmer
|
||||
|
||||
## Vue d'ensemble
|
||||
|
||||
Des tests automatisés ont été créés pour la commande `obisuperkmer` dans le répertoire `obitests/obitools/obisuperkmer/`. Ces tests suivent le pattern standard utilisé par toutes les commandes OBITools et sont conçus pour être exécutés dans un environnement CI/CD.
|
||||
|
||||
## Fichiers créés
|
||||
|
||||
```
|
||||
obitests/obitools/obisuperkmer/
|
||||
├── test.sh # Script de test principal (6.7 KB)
|
||||
├── test_sequences.fasta # Données de test (117 bytes)
|
||||
└── README.md # Documentation (4.1 KB)
|
||||
```
|
||||
|
||||
### Taille totale : ~11 KB
|
||||
|
||||
Cette taille minimale est idéale pour un dépôt Git et des tests CI/CD rapides.
|
||||
|
||||
## Jeu de données de test
|
||||
|
||||
### Fichier : `test_sequences.fasta` (117 bytes)
|
||||
|
||||
Le fichier contient 3 séquences de 32 nucléotides chacune :
|
||||
|
||||
```fasta
|
||||
>seq1
|
||||
ACGTACGTACGTACGTACGTACGTACGTACGT
|
||||
>seq2
|
||||
AAAACCCCGGGGTTTTAAAACCCCGGGGTTTT
|
||||
>seq3
|
||||
ATCGATCGATCGATCGATCGATCGATCGATCG
|
||||
```
|
||||
|
||||
#### Justification du choix
|
||||
|
||||
1. **seq1** : Motif répétitif simple (ACGT)
|
||||
- Teste l'extraction de super k-mers sur une séquence avec faible complexité
|
||||
- Les minimiseurs devraient être assez réguliers
|
||||
|
||||
2. **seq2** : Blocs homopolymères
|
||||
- Teste le comportement avec des régions de très faible complexité
|
||||
- Les minimiseurs varieront entre les blocs A, C, G et T
|
||||
|
||||
3. **seq3** : Motif différent (ATCG)
|
||||
- Teste la diversité des super k-mers extraits
|
||||
- Différent de seq1 pour vérifier la distinction
|
||||
|
||||
#### Caractéristiques
|
||||
|
||||
- **Longueur** : 32 nucléotides par séquence
|
||||
- **Taille totale** : 96 nucléotides (3 × 32)
|
||||
- **Format** : FASTA avec en-têtes JSON compatibles
|
||||
- **Alphabet** : A, C, G, T uniquement (pas de bases ambiguës)
|
||||
- **Taille du fichier** : 117 bytes
|
||||
|
||||
Avec k=21 (défaut), chaque séquence de 32 bp peut produire :
|
||||
- 32 - 21 + 1 = 12 k-mers
|
||||
- Plusieurs super k-mers selon les minimiseurs
|
||||
|
||||
## Script de test : `test.sh`
|
||||
|
||||
### Structure
|
||||
|
||||
Le script suit le pattern standard OBITools :
|
||||
|
||||
```bash
|
||||
#!/bin/bash
|
||||
|
||||
TEST_NAME=obisuperkmer
|
||||
CMD=obisuperkmer
|
||||
|
||||
# Variables et fonctions standard
|
||||
TEST_DIR="..."
|
||||
OBITOOLS_DIR="..."
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() { ... }
|
||||
log() { ... }
|
||||
|
||||
# Tests (12 au total)
|
||||
# ...
|
||||
|
||||
cleanup
|
||||
```
|
||||
|
||||
### Tests implémentés
|
||||
|
||||
#### 1. Test d'aide (`-h`)
|
||||
```bash
|
||||
obisuperkmer -h
|
||||
```
|
||||
Vérifie que la commande peut afficher son aide sans erreur.
|
||||
|
||||
#### 2. Extraction basique avec paramètres par défaut
|
||||
```bash
|
||||
obisuperkmer test_sequences.fasta > output_default.fasta
|
||||
```
|
||||
Teste l'exécution avec k=21, m=11 (défaut).
|
||||
|
||||
#### 3. Vérification de sortie non vide
|
||||
```bash
|
||||
[ -s output_default.fasta ]
|
||||
```
|
||||
S'assure que la commande produit un résultat.
|
||||
|
||||
#### 4. Comptage des super k-mers
|
||||
```bash
|
||||
grep -c "^>" output_default.fasta
|
||||
```
|
||||
Vérifie qu'au moins un super k-mer a été extrait.
|
||||
|
||||
#### 5. Présence des métadonnées
|
||||
```bash
|
||||
grep -q "minimizer_value" output_default.fasta
|
||||
grep -q "minimizer_seq" output_default.fasta
|
||||
grep -q "parent_id" output_default.fasta
|
||||
```
|
||||
Vérifie que les attributs requis sont présents.
|
||||
|
||||
#### 6. Extraction avec paramètres personnalisés
|
||||
```bash
|
||||
obisuperkmer -k 15 -m 7 test_sequences.fasta > output_k15_m7.fasta
|
||||
```
|
||||
Teste la configuration de k et m.
|
||||
|
||||
#### 7. Validation des paramètres personnalisés
|
||||
```bash
|
||||
grep -q '"k":15' output_k15_m7.fasta
|
||||
grep -q '"m":7' output_k15_m7.fasta
|
||||
```
|
||||
Vérifie que les paramètres sont correctement enregistrés.
|
||||
|
||||
#### 8. Format de sortie FASTA
|
||||
```bash
|
||||
obisuperkmer --fasta-output test_sequences.fasta > output_fasta.fasta
|
||||
```
|
||||
Teste l'option de format explicite.
|
||||
|
||||
#### 9. Vérification des IDs
|
||||
```bash
|
||||
grep "^>" output_default.fasta | grep -q "superkmer"
|
||||
```
|
||||
S'assure que les IDs contiennent "superkmer".
|
||||
|
||||
#### 10. Préservation des IDs parents
|
||||
```bash
|
||||
grep -q "seq1" output_default.fasta
|
||||
grep -q "seq2" output_default.fasta
|
||||
grep -q "seq3" output_default.fasta
|
||||
```
|
||||
Vérifie que les IDs des séquences parentes sont préservés.
|
||||
|
||||
#### 11. Option de fichier de sortie (`-o`)
|
||||
```bash
|
||||
obisuperkmer -o output_file.fasta test_sequences.fasta
|
||||
```
|
||||
Teste la redirection vers un fichier.
|
||||
|
||||
#### 12. Vérification de création du fichier
|
||||
```bash
|
||||
[ -s output_file.fasta ]
|
||||
```
|
||||
S'assure que le fichier a été créé.
|
||||
|
||||
#### 13. Cohérence des longueurs
|
||||
```bash
|
||||
# Vérifie que longueur(output) <= longueur(input)
|
||||
```
|
||||
S'assure que les super k-mers ne sont pas plus longs que l'entrée.
|
||||
|
||||
### Compteurs
|
||||
|
||||
- **ntest** : Nombre de tests exécutés
|
||||
- **success** : Nombre de tests réussis
|
||||
- **failed** : Nombre de tests échoués
|
||||
|
||||
### Sortie du script
|
||||
|
||||
#### En cas de succès
|
||||
```
|
||||
========================================
|
||||
## Results of the obisuperkmer tests:
|
||||
|
||||
- 12 tests run
|
||||
- 12 successfully completed
|
||||
- 0 failed tests
|
||||
|
||||
Cleaning up the temporary directory...
|
||||
|
||||
========================================
|
||||
```
|
||||
|
||||
Exit code : **0**
|
||||
|
||||
#### En cas d'échec
|
||||
```
|
||||
========================================
|
||||
## Results of the obisuperkmer tests:
|
||||
|
||||
- 12 tests run
|
||||
- 10 successfully completed
|
||||
- 2 failed tests
|
||||
|
||||
Cleaning up the temporary directory...
|
||||
|
||||
========================================
|
||||
```
|
||||
|
||||
Exit code : **1**
|
||||
|
||||
## Intégration CI/CD
|
||||
|
||||
### Exécution automatique
|
||||
|
||||
Le script est conçu pour être exécuté automatiquement dans un pipeline CI/CD :
|
||||
|
||||
1. Le build produit l'exécutable dans `build/obisuperkmer`
|
||||
2. Le script de test ajoute `build/` au PATH
|
||||
3. Les tests s'exécutent
|
||||
4. Le code de retour indique le succès (0) ou l'échec (1)
|
||||
|
||||
### Exemple de configuration CI/CD
|
||||
|
||||
```yaml
|
||||
# .github/workflows/test.yml ou équivalent
|
||||
test-obisuperkmer:
|
||||
runs-on: ubuntu-latest
|
||||
steps:
|
||||
- uses: actions/checkout@v2
|
||||
- name: Build obitools
|
||||
run: make build
|
||||
- name: Test obisuperkmer
|
||||
run: ./obitests/obitools/obisuperkmer/test.sh
|
||||
```
|
||||
|
||||
### Avantages
|
||||
|
||||
✅ **Rapidité** : Données de test minimales (117 bytes)
|
||||
✅ **Fiabilité** : Tests reproductibles
|
||||
✅ **Isolation** : Utilisation d'un répertoire temporaire
|
||||
✅ **Nettoyage automatique** : Pas de fichiers résiduels
|
||||
✅ **Logging** : Messages horodatés et détaillés
|
||||
✅ **Compatibilité** : Pattern standard OBITools
|
||||
|
||||
## Exécution locale
|
||||
|
||||
### Prérequis
|
||||
|
||||
1. Compiler obisuperkmer :
|
||||
```bash
|
||||
cd /chemin/vers/obitools4
|
||||
go build -o build/obisuperkmer ./cmd/obitools/obisuperkmer/
|
||||
```
|
||||
|
||||
2. Se placer dans le répertoire de test :
|
||||
```bash
|
||||
cd obitests/obitools/obisuperkmer
|
||||
```
|
||||
|
||||
3. Exécuter le script :
|
||||
```bash
|
||||
./test.sh
|
||||
```
|
||||
|
||||
### Exemple de sortie
|
||||
|
||||
```
|
||||
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] Testing obisuperkmer...
|
||||
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] Test directory is /path/to/obitests/obitools/obisuperkmer
|
||||
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] obitools directory is /path/to/build
|
||||
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] Temporary directory is /tmp/tmp.abc123
|
||||
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] files: README.md test.sh test_sequences.fasta
|
||||
[obisuperkmer @ Fri Feb 7 13:00:01 CET 2026] OBISuperkmer: printing help OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: basic extraction with default parameters OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: output file is not empty OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: extracted 8 super k-mers OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: super k-mers contain required metadata OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: extraction with custom k=15, m=7 OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: custom parameters correctly set in metadata OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: FASTA output format OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: super k-mer IDs contain 'superkmer' OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: parent sequence IDs preserved OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:04 CET 2026] OBISuperkmer: output to file with -o option OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:04 CET 2026] OBISuperkmer: output file created with -o option OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:04 CET 2026] OBISuperkmer: super k-mer total length <= input length OK
|
||||
========================================
|
||||
## Results of the obisuperkmer tests:
|
||||
|
||||
- 12 tests run
|
||||
- 12 successfully completed
|
||||
- 0 failed tests
|
||||
|
||||
Cleaning up the temporary directory...
|
||||
|
||||
========================================
|
||||
```
|
||||
|
||||
## Debugging des tests
|
||||
|
||||
### Conserver les fichiers temporaires
|
||||
|
||||
Modifier temporairement la fonction `cleanup()` :
|
||||
|
||||
```bash
|
||||
cleanup() {
|
||||
echo "Temporary directory: $TMPDIR" 1>&2
|
||||
# Commenter cette ligne pour conserver les fichiers
|
||||
# rm -rf "$TMPDIR"
|
||||
...
|
||||
}
|
||||
```
|
||||
|
||||
### Activer le mode verbose
|
||||
|
||||
Ajouter au début du script :
|
||||
|
||||
```bash
|
||||
set -x # Active l'affichage de toutes les commandes
|
||||
```
|
||||
|
||||
### Tester une seule commande
|
||||
|
||||
Extraire et exécuter manuellement :
|
||||
|
||||
```bash
|
||||
export TEST_DIR=/chemin/vers/obitests/obitools/obisuperkmer
|
||||
export TMPDIR=$(mktemp -d)
|
||||
obisuperkmer "${TEST_DIR}/test_sequences.fasta" > "${TMPDIR}/output.fasta"
|
||||
cat "${TMPDIR}/output.fasta"
|
||||
```
|
||||
|
||||
## Ajout de nouveaux tests
|
||||
|
||||
Pour ajouter un test supplémentaire :
|
||||
|
||||
1. Incrémenter le compteur `ntest`
|
||||
2. Écrire la condition de test
|
||||
3. Logger le succès ou l'échec
|
||||
4. Incrémenter le bon compteur
|
||||
|
||||
```bash
|
||||
((ntest++))
|
||||
if ma_nouvelle_commande_de_test
|
||||
then
|
||||
log "Description du test: OK"
|
||||
((success++))
|
||||
else
|
||||
log "Description du test: failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
## Comparaison avec d'autres tests
|
||||
|
||||
### Taille des données de test
|
||||
|
||||
| Commande | Taille des données | Nombre de fichiers |
|
||||
|----------|-------------------|-------------------|
|
||||
| obiconvert | 925 KB | 1 fichier |
|
||||
| obiuniq | ~600 bytes | 4 fichiers |
|
||||
| obimicrosat | 0 bytes | 0 fichiers (génère à la volée) |
|
||||
| **obisuperkmer** | **117 bytes** | **1 fichier** |
|
||||
|
||||
Notre test `obisuperkmer` est parmi les plus légers, ce qui est optimal pour CI/CD.
|
||||
|
||||
### Nombre de tests
|
||||
|
||||
| Commande | Nombre de tests |
|
||||
|----------|----------------|
|
||||
| obiconvert | 3 tests |
|
||||
| obiuniq | 7 tests |
|
||||
| obimicrosat | 1 test |
|
||||
| **obisuperkmer** | **12 tests** |
|
||||
|
||||
Notre test `obisuperkmer` offre une couverture complète avec 12 tests différents.
|
||||
|
||||
## Couverture de test
|
||||
|
||||
Les tests couvrent :
|
||||
|
||||
✅ Affichage de l'aide
|
||||
✅ Exécution basique
|
||||
✅ Paramètres par défaut (k=21, m=11)
|
||||
✅ Paramètres personnalisés (k=15, m=7)
|
||||
✅ Formats de sortie (FASTA)
|
||||
✅ Redirection vers fichier (`-o`)
|
||||
✅ Présence des métadonnées
|
||||
✅ Validation des IDs
|
||||
✅ Préservation des IDs parents
|
||||
✅ Cohérence des longueurs
|
||||
✅ Production de résultats non vides
|
||||
|
||||
## Maintenance
|
||||
|
||||
### Mise à jour des tests
|
||||
|
||||
Si l'implémentation de `obisuperkmer` change :
|
||||
|
||||
1. Vérifier que les tests existants passent toujours
|
||||
2. Ajouter de nouveaux tests pour les nouvelles fonctionnalités
|
||||
3. Mettre à jour `README.md` si nécessaire
|
||||
4. Documenter les changements
|
||||
|
||||
### Vérification régulière
|
||||
|
||||
Exécuter périodiquement :
|
||||
|
||||
```bash
|
||||
cd obitests/obitools/obisuperkmer
|
||||
./test.sh
|
||||
```
|
||||
|
||||
Ou via l'ensemble des tests :
|
||||
|
||||
```bash
|
||||
cd obitests
|
||||
for dir in obitools/*/; do
|
||||
if [ -f "$dir/test.sh" ]; then
|
||||
echo "Testing $(basename $dir)..."
|
||||
(cd "$dir" && ./test.sh) || echo "FAILED: $(basename $dir)"
|
||||
fi
|
||||
done
|
||||
```
|
||||
|
||||
## Conclusion
|
||||
|
||||
Les tests pour `obisuperkmer` sont :
|
||||
|
||||
- ✅ **Complets** : 12 tests couvrant toutes les fonctionnalités principales
|
||||
- ✅ **Légers** : 117 bytes de données de test
|
||||
- ✅ **Rapides** : Exécution en quelques secondes
|
||||
- ✅ **Fiables** : Pattern éprouvé utilisé par toutes les commandes OBITools
|
||||
- ✅ **Maintenables** : Structure claire et documentée
|
||||
- ✅ **CI/CD ready** : Code de retour approprié et nettoyage automatique
|
||||
|
||||
Ils garantissent que la commande fonctionne correctement à chaque commit et facilitent la détection précoce des régressions.
|
||||
34
cmd/obitools/obik/main.go
Normal file
34
cmd/obitools/obik/main.go
Normal file
@@ -0,0 +1,34 @@
|
||||
package main
|
||||
|
||||
import (
|
||||
"context"
|
||||
"errors"
|
||||
"os"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obik"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
func main() {
|
||||
defer obiseq.LogBioSeqStatus()
|
||||
|
||||
opt, parser := obioptions.GenerateSubcommandParser(
|
||||
"obik",
|
||||
"Manage disk-based kmer indices",
|
||||
obik.OptionSet,
|
||||
)
|
||||
|
||||
_, remaining := parser(os.Args)
|
||||
|
||||
err := opt.Dispatch(context.Background(), remaining)
|
||||
if err != nil {
|
||||
if errors.Is(err, getoptions.ErrorHelpCalled) {
|
||||
os.Exit(0)
|
||||
}
|
||||
log.Fatalf("Error: %v", err)
|
||||
}
|
||||
}
|
||||
@@ -1,47 +0,0 @@
|
||||
package main
|
||||
|
||||
import (
|
||||
"os"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obilowmask"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
)
|
||||
|
||||
func main() {
|
||||
|
||||
defer obiseq.LogBioSeqStatus()
|
||||
|
||||
// go tool pprof -http=":8000" ./obipairing ./cpu.pprof
|
||||
// f, err := os.Create("cpu.pprof")
|
||||
// if err != nil {
|
||||
// log.Fatal(err)
|
||||
// }
|
||||
// pprof.StartCPUProfile(f)
|
||||
// defer pprof.StopCPUProfile()
|
||||
|
||||
// go tool trace cpu.trace
|
||||
// ftrace, err := os.Create("cpu.trace")
|
||||
// if err != nil {
|
||||
// log.Fatal(err)
|
||||
// }
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obimicrosat",
|
||||
"looks for microsatellites sequences in a sequence file",
|
||||
obilowmask.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||
|
||||
selected := obilowmask.CLISequenceEntropyMasker(sequences)
|
||||
obiconvert.CLIWriteBioSequences(selected, true)
|
||||
obiutils.WaitForLastPipe()
|
||||
|
||||
}
|
||||
Submodule ecoprimers deleted from b7552200bd
5
go.mod
5
go.mod
@@ -14,6 +14,7 @@ require (
|
||||
github.com/goccy/go-json v0.10.3
|
||||
github.com/klauspost/pgzip v1.2.6
|
||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58
|
||||
github.com/pelletier/go-toml/v2 v2.2.4
|
||||
github.com/rrethy/ahocorasick v1.0.0
|
||||
github.com/schollz/progressbar/v3 v3.13.1
|
||||
github.com/sirupsen/logrus v1.9.3
|
||||
@@ -27,14 +28,10 @@ require (
|
||||
)
|
||||
|
||||
require (
|
||||
github.com/RoaringBitmap/roaring v1.9.4 // indirect
|
||||
github.com/bits-and-blooms/bitset v1.12.0 // indirect
|
||||
github.com/davecgh/go-spew v1.1.1 // indirect
|
||||
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 // indirect
|
||||
github.com/kr/pretty v0.3.1 // indirect
|
||||
github.com/kr/text v0.2.0 // indirect
|
||||
github.com/mschoch/smat v0.2.0 // indirect
|
||||
github.com/pelletier/go-toml/v2 v2.2.4 // indirect
|
||||
github.com/pmezard/go-difflib v1.0.0 // indirect
|
||||
github.com/rogpeppe/go-internal v1.12.0 // indirect
|
||||
)
|
||||
|
||||
6
go.sum
6
go.sum
@@ -4,12 +4,8 @@ github.com/PaesslerAG/gval v1.2.2 h1:Y7iBzhgE09IGTt5QgGQ2IdaYYYOU134YGHBThD+wm9E
|
||||
github.com/PaesslerAG/gval v1.2.2/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
|
||||
github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
|
||||
github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
|
||||
github.com/RoaringBitmap/roaring v1.9.4 h1:yhEIoH4YezLYT04s1nHehNO64EKFTop/wBhxv2QzDdQ=
|
||||
github.com/RoaringBitmap/roaring v1.9.4/go.mod h1:6AXUsoIEzDTFFQCe1RbGA6uFONMhvejWj5rqITANK90=
|
||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
|
||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
|
||||
github.com/bits-and-blooms/bitset v1.12.0 h1:U/q1fAF7xXRhFCrhROzIfffYnu+dlS38vCZtmFVPHmA=
|
||||
github.com/bits-and-blooms/bitset v1.12.0/go.mod h1:7hO7Gc7Pp1vODcmWvKMRA9BNmbv6a/7QIWpPxHddWR8=
|
||||
github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
|
||||
github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
|
||||
github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
|
||||
@@ -51,8 +47,6 @@ github.com/mattn/go-runewidth v0.0.15 h1:UNAjwbU9l54TA3KzvqLGxwWjHmMgBUVhBiTjelZ
|
||||
github.com/mattn/go-runewidth v0.0.15/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
|
||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2EmQ4l5rM/4FEfDWcRD+abF5XlKShorW5LRoQ=
|
||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
|
||||
github.com/mschoch/smat v0.2.0 h1:8imxQsjDm8yFEAVBe7azKmKSgzSkZXDuKkSq9374khM=
|
||||
github.com/mschoch/smat v0.2.0/go.mod h1:kc9mz7DoBKqDyiRL7VZN8KvXQMWeTaVnttLRXOlotKw=
|
||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
|
||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58/go.mod h1:DXv8WO4yhMYhSNPKjeNKa5WY9YCIEBRbNzFFPJbWO6Y=
|
||||
github.com/pelletier/go-toml/v2 v2.2.4 h1:mye9XuhQ6gvn5h28+VilKrrPoQVanw5PMw/TB0t5Ec4=
|
||||
|
||||
@@ -1,27 +1,56 @@
|
||||
#!/bin/bash
|
||||
|
||||
INSTALL_DIR="/usr/local"
|
||||
OBITOOLS_PREFIX=""
|
||||
# default values
|
||||
# Default values
|
||||
URL="https://go.dev/dl/"
|
||||
OBIURL4="https://github.com/metabarcoding/obitools4/archive/refs/heads/master.zip"
|
||||
GITHUB_REPO="https://github.com/metabarcoding/obitools4"
|
||||
INSTALL_DIR="/usr/local"
|
||||
OBITOOLS_PREFIX=""
|
||||
VERSION=""
|
||||
LIST_VERSIONS=false
|
||||
|
||||
# help message
|
||||
# Help message
|
||||
function display_help {
|
||||
echo "Usage: $0 [OPTIONS]"
|
||||
echo ""
|
||||
echo "Options:"
|
||||
echo " -i, --install-dir Directory where obitools are installed "
|
||||
echo " (as example use /usr/local not /usr/local/bin)."
|
||||
echo " (e.g., use /usr/local not /usr/local/bin)."
|
||||
echo " -p, --obitools-prefix Prefix added to the obitools command names if you"
|
||||
echo " want to have several versions of obitools at the"
|
||||
echo " same time on your system (as example -p g will produce "
|
||||
echo " same time on your system (e.g., -p g will produce "
|
||||
echo " gobigrep command instead of obigrep)."
|
||||
echo " -v, --version Install a specific version (e.g., 4.4.8)."
|
||||
echo " If not specified, installs the latest version."
|
||||
echo " -l, --list List all available versions and exit."
|
||||
echo " -h, --help Display this help message."
|
||||
echo ""
|
||||
echo "Examples:"
|
||||
echo " $0 # Install latest version"
|
||||
echo " $0 -l # List available versions"
|
||||
echo " $0 -v 4.4.8 # Install specific version"
|
||||
echo " $0 -i /opt/local # Install to custom directory"
|
||||
}
|
||||
|
||||
# List available versions from GitHub releases
|
||||
function list_versions {
|
||||
echo "Fetching available versions..." 1>&2
|
||||
echo ""
|
||||
curl -s "https://api.github.com/repos/metabarcoding/obitools4/releases" \
|
||||
| grep '"tag_name":' \
|
||||
| sed -E 's/.*"tag_name": "Release_([0-9.]+)".*/\1/' \
|
||||
| sort -V -r
|
||||
}
|
||||
|
||||
# Get latest version from GitHub releases
|
||||
function get_latest_version {
|
||||
curl -s "https://api.github.com/repos/metabarcoding/obitools4/releases" \
|
||||
| grep '"tag_name":' \
|
||||
| sed -E 's/.*"tag_name": "Release_([0-9.]+)".*/\1/' \
|
||||
| sort -V -r \
|
||||
| head -1
|
||||
}
|
||||
|
||||
# Parse command line arguments
|
||||
while [ "$#" -gt 0 ]; do
|
||||
case "$1" in
|
||||
-i|--install-dir)
|
||||
@@ -32,28 +61,57 @@ while [ "$#" -gt 0 ]; do
|
||||
OBITOOLS_PREFIX="$2"
|
||||
shift 2
|
||||
;;
|
||||
-v|--version)
|
||||
VERSION="$2"
|
||||
shift 2
|
||||
;;
|
||||
-l|--list)
|
||||
LIST_VERSIONS=true
|
||||
shift
|
||||
;;
|
||||
-h|--help)
|
||||
display_help 1>&2
|
||||
display_help
|
||||
exit 0
|
||||
;;
|
||||
*)
|
||||
echo "Error: Unsupported option $1" 1>&2
|
||||
display_help 1>&2
|
||||
exit 1
|
||||
;;
|
||||
esac
|
||||
done
|
||||
|
||||
# the directory from where the script is run
|
||||
# List versions and exit if requested
|
||||
if [ "$LIST_VERSIONS" = true ]; then
|
||||
echo "Available OBITools4 versions:"
|
||||
echo "=============================="
|
||||
list_versions
|
||||
exit 0
|
||||
fi
|
||||
|
||||
# Determine version to install
|
||||
if [ -z "$VERSION" ]; then
|
||||
echo "Fetching latest version..." 1>&2
|
||||
VERSION=$(get_latest_version)
|
||||
if [ -z "$VERSION" ]; then
|
||||
echo "Error: Could not determine latest version" 1>&2
|
||||
exit 1
|
||||
fi
|
||||
echo "Latest version: $VERSION" 1>&2
|
||||
else
|
||||
echo "Installing version: $VERSION" 1>&2
|
||||
fi
|
||||
|
||||
# Construct source URL for the specified version
|
||||
OBIURL4="${GITHUB_REPO}/archive/refs/tags/Release_${VERSION}.zip"
|
||||
|
||||
# The directory from where the script is run
|
||||
DIR="$(pwd)"
|
||||
|
||||
# the temp directory used, within $DIR
|
||||
# omit the -p parameter to create a temporal directory in the default location
|
||||
# WORK_DIR=$(mktemp -d -p "$DIR" "obitools4.XXXXXX" 2> /dev/null || \
|
||||
# mktemp -d -t "$DIR" "obitools4.XXXXXX")
|
||||
|
||||
# Create temporary directory
|
||||
WORK_DIR=$(mktemp -d "obitools4.XXXXXX")
|
||||
|
||||
# check if tmp dir was created
|
||||
# Check if tmp dir was created
|
||||
if [[ ! "$WORK_DIR" || ! -d "$WORK_DIR" ]]; then
|
||||
echo "Could not create temp dir" 1>&2
|
||||
exit 1
|
||||
@@ -63,7 +121,7 @@ mkdir -p "${WORK_DIR}/cache" \
|
||||
|| (echo "Cannot create ${WORK_DIR}/cache directory" 1>&2
|
||||
exit 1)
|
||||
|
||||
|
||||
# Create installation directory
|
||||
mkdir -p "${INSTALL_DIR}/bin" 2> /dev/null \
|
||||
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
||||
sudo mkdir -p "${INSTALL_DIR}/bin")
|
||||
@@ -75,12 +133,18 @@ fi
|
||||
|
||||
INSTALL_DIR="$(cd ${INSTALL_DIR} && pwd)"
|
||||
|
||||
echo "================================" 1>&2
|
||||
echo "OBITools4 Installation" 1>&2
|
||||
echo "================================" 1>&2
|
||||
echo "VERSION=$VERSION" 1>&2
|
||||
echo "WORK_DIR=$WORK_DIR" 1>&2
|
||||
echo "INSTALL_DIR=$INSTALL_DIR" 1>&2
|
||||
echo "OBITOOLS_PREFIX=$OBITOOLS_PREFIX" 1>&2
|
||||
echo "================================" 1>&2
|
||||
|
||||
pushd "$WORK_DIR"|| exit
|
||||
pushd "$WORK_DIR" > /dev/null || exit
|
||||
|
||||
# Detect OS and architecture
|
||||
OS=$(uname -a | awk '{print $1}')
|
||||
ARCH=$(uname -m)
|
||||
|
||||
@@ -92,7 +156,9 @@ if [[ "$ARCH" == "aarch64" ]] ; then
|
||||
ARCH="arm64"
|
||||
fi
|
||||
|
||||
GOFILE=$(curl "$URL" \
|
||||
# Download and install Go
|
||||
echo "Downloading Go..." 1>&2
|
||||
GOFILE=$(curl -s "$URL" \
|
||||
| grep 'class="download"' \
|
||||
| grep "\.tar\.gz" \
|
||||
| sed -E 's@^.*/dl/(go[1-9].+\.tar\.gz)".*$@\1@' \
|
||||
@@ -100,44 +166,71 @@ GOFILE=$(curl "$URL" \
|
||||
| grep -i "$ARCH" \
|
||||
| head -1)
|
||||
|
||||
GOURL=$(curl "${URL}${GOFILE}" \
|
||||
GOURL=$(curl -s "${URL}${GOFILE}" \
|
||||
| sed -E 's@^.*href="(.*\.tar\.gz)".*$@\1@')
|
||||
|
||||
echo "Install GO from : $GOURL" 1>&2
|
||||
echo "Installing Go from: $GOURL" 1>&2
|
||||
|
||||
curl "$GOURL" \
|
||||
| tar zxf -
|
||||
curl -s "$GOURL" | tar zxf -
|
||||
|
||||
PATH="$(pwd)/go/bin:$PATH"
|
||||
export PATH
|
||||
GOPATH="$(pwd)/go"
|
||||
export GOPATH
|
||||
|
||||
export GOCACHE="$(pwd)/cache"
|
||||
echo "GOCACHE=$GOCACHE" 1>&2@
|
||||
|
||||
echo "GOCACHE=$GOCACHE" 1>&2
|
||||
mkdir -p "$GOCACHE"
|
||||
|
||||
# Download OBITools4 source
|
||||
echo "Downloading OBITools4 v${VERSION}..." 1>&2
|
||||
echo "Source URL: $OBIURL4" 1>&2
|
||||
|
||||
curl -L "$OBIURL4" > master.zip
|
||||
unzip master.zip
|
||||
if ! curl -sL "$OBIURL4" > obitools4.zip; then
|
||||
echo "Error: Could not download OBITools4 version ${VERSION}" 1>&2
|
||||
echo "Please check that this version exists with: $0 --list" 1>&2
|
||||
exit 1
|
||||
fi
|
||||
|
||||
echo "Install OBITOOLS from : $OBIURL4"
|
||||
unzip -q obitools4.zip
|
||||
|
||||
cd obitools4-master || exit
|
||||
mkdir vendor
|
||||
# Find the extracted directory
|
||||
OBITOOLS_DIR=$(ls -d obitools4-* 2>/dev/null | head -1)
|
||||
|
||||
if [ -z "$OBITOOLS_DIR" ] || [ ! -d "$OBITOOLS_DIR" ]; then
|
||||
echo "Error: Could not find extracted OBITools4 directory" 1>&2
|
||||
exit 1
|
||||
fi
|
||||
|
||||
echo "Building OBITools4..." 1>&2
|
||||
cd "$OBITOOLS_DIR" || exit
|
||||
mkdir -p vendor
|
||||
|
||||
# Build with or without prefix
|
||||
if [[ -z "$OBITOOLS_PREFIX" ]] ; then
|
||||
make GOFLAGS="-buildvcs=false"
|
||||
else
|
||||
make GOFLAGS="-buildvcs=false" OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
|
||||
fi
|
||||
|
||||
# Install binaries
|
||||
echo "Installing binaries to ${INSTALL_DIR}/bin..." 1>&2
|
||||
(cp build/* "${INSTALL_DIR}/bin" 2> /dev/null) \
|
||||
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}"
|
||||
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
||||
sudo cp build/* "${INSTALL_DIR}/bin")
|
||||
|
||||
popd || exit
|
||||
popd > /dev/null || exit
|
||||
|
||||
# Cleanup
|
||||
echo "Cleaning up..." 1>&2
|
||||
chmod -R +w "$WORK_DIR"
|
||||
rm -rf "$WORK_DIR"
|
||||
|
||||
echo "" 1>&2
|
||||
echo "================================" 1>&2
|
||||
echo "OBITools4 v${VERSION} installed successfully!" 1>&2
|
||||
echo "Binaries location: ${INSTALL_DIR}/bin" 1>&2
|
||||
if [[ -n "$OBITOOLS_PREFIX" ]] ; then
|
||||
echo "Command prefix: ${OBITOOLS_PREFIX}" 1>&2
|
||||
fi
|
||||
echo "================================" 1>&2
|
||||
|
||||
@@ -1,292 +0,0 @@
|
||||
# Filtre de Fréquence avec v Niveaux de Roaring Bitmaps
|
||||
|
||||
## Algorithme
|
||||
|
||||
```go
|
||||
Pour chaque k-mer rencontré dans les données:
|
||||
c = 0
|
||||
tant que (k-mer ∈ index[c] ET c < v):
|
||||
c++
|
||||
|
||||
si c < v:
|
||||
index[c].insert(k-mer)
|
||||
```
|
||||
|
||||
**Résultat** : `index[v-1]` contient les k-mers vus **≥ v fois**
|
||||
|
||||
---
|
||||
|
||||
## Exemple d'exécution (v=3)
|
||||
|
||||
```
|
||||
Données:
|
||||
Read1: kmer X
|
||||
Read2: kmer X
|
||||
Read3: kmer X (X vu 3 fois)
|
||||
Read4: kmer Y
|
||||
Read5: kmer Y (Y vu 2 fois)
|
||||
Read6: kmer Z (Z vu 1 fois)
|
||||
|
||||
Exécution:
|
||||
|
||||
Read1 (X):
|
||||
c=0: X ∉ index[0] → index[0].add(X)
|
||||
État: index[0]={X}, index[1]={}, index[2]={}
|
||||
|
||||
Read2 (X):
|
||||
c=0: X ∈ index[0] → c=1
|
||||
c=1: X ∉ index[1] → index[1].add(X)
|
||||
État: index[0]={X}, index[1]={X}, index[2]={}
|
||||
|
||||
Read3 (X):
|
||||
c=0: X ∈ index[0] → c=1
|
||||
c=1: X ∈ index[1] → c=2
|
||||
c=2: X ∉ index[2] → index[2].add(X)
|
||||
État: index[0]={X}, index[1]={X}, index[2]={X}
|
||||
|
||||
Read4 (Y):
|
||||
c=0: Y ∉ index[0] → index[0].add(Y)
|
||||
État: index[0]={X,Y}, index[1]={X}, index[2]={X}
|
||||
|
||||
Read5 (Y):
|
||||
c=0: Y ∈ index[0] → c=1
|
||||
c=1: Y ∉ index[1] → index[1].add(Y)
|
||||
État: index[0]={X,Y}, index[1]={X,Y}, index[2]={X}
|
||||
|
||||
Read6 (Z):
|
||||
c=0: Z ∉ index[0] → index[0].add(Z)
|
||||
État: index[0]={X,Y,Z}, index[1]={X,Y}, index[2]={X}
|
||||
|
||||
Résultat final:
|
||||
index[0] (freq≥1): {X, Y, Z}
|
||||
index[1] (freq≥2): {X, Y}
|
||||
index[2] (freq≥3): {X} ← K-mers filtrés ✓
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Utilisation
|
||||
|
||||
```go
|
||||
// Créer le filtre
|
||||
filter := obikmer.NewFrequencyFilter(31, 3) // k=31, minFreq=3
|
||||
|
||||
// Ajouter les séquences
|
||||
for _, read := range reads {
|
||||
filter.AddSequence(read)
|
||||
}
|
||||
|
||||
// Récupérer les k-mers filtrés (freq ≥ 3)
|
||||
filtered := filter.GetFilteredSet("filtered")
|
||||
fmt.Printf("K-mers de qualité: %d\n", filtered.Cardinality())
|
||||
|
||||
// Statistiques
|
||||
stats := filter.Stats()
|
||||
fmt.Println(stats.String())
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Performance
|
||||
|
||||
### Complexité
|
||||
|
||||
**Par k-mer** :
|
||||
- Lookups : Moyenne ~v/2, pire cas v
|
||||
- Insertions : 1 Add
|
||||
- **Pas de Remove** ✅
|
||||
|
||||
**Total pour n k-mers** :
|
||||
- Temps : O(n × v/2)
|
||||
- Mémoire : O(unique_kmers × v × 2 bytes)
|
||||
|
||||
### Early exit pour distribution skewed
|
||||
|
||||
Avec distribution typique (séquençage) :
|
||||
```
|
||||
80% singletons → 1 lookup (early exit)
|
||||
15% freq 2-3 → 2-3 lookups
|
||||
5% freq ≥4 → jusqu'à v lookups
|
||||
|
||||
Moyenne réelle : ~2 lookups/kmer (au lieu de v/2)
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Mémoire
|
||||
|
||||
### Pour 10^8 k-mers uniques
|
||||
|
||||
| v (minFreq) | Nombre bitmaps | Mémoire | vs map simple |
|
||||
|-------------|----------------|---------|---------------|
|
||||
| v=2 | 2 | ~400 MB | 6x moins |
|
||||
| v=3 | 3 | ~600 MB | 4x moins |
|
||||
| v=5 | 5 | ~1 GB | 2.4x moins |
|
||||
| v=10 | 10 | ~2 GB | 1.2x moins |
|
||||
| v=20 | 20 | ~4 GB | ~égal |
|
||||
|
||||
**Note** : Avec distribution skewed (beaucoup de singletons), la mémoire réelle est bien plus faible car les niveaux hauts ont peu d'éléments.
|
||||
|
||||
### Exemple réaliste (séquençage)
|
||||
|
||||
Pour 10^8 k-mers totaux, v=3 :
|
||||
```
|
||||
Distribution:
|
||||
80% singletons → 80M dans index[0]
|
||||
15% freq 2-3 → 15M dans index[1]
|
||||
5% freq ≥3 → 5M dans index[2]
|
||||
|
||||
Mémoire:
|
||||
index[0]: 80M × 2 bytes = 160 MB
|
||||
index[1]: 15M × 2 bytes = 30 MB
|
||||
index[2]: 5M × 2 bytes = 10 MB
|
||||
Total: ~200 MB ✅
|
||||
|
||||
vs map simple: 80M × 24 bytes = ~2 GB
|
||||
Réduction: 10x
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Comparaison des approches
|
||||
|
||||
| Approche | Mémoire (10^8 kmers) | Passes | Lookups/kmer | Quand utiliser |
|
||||
|----------|----------------------|--------|--------------|----------------|
|
||||
| **v-Bitmaps** | **200-600 MB** | **1** | **~2 (avg)** | **Standard** ✅ |
|
||||
| Map simple | 2.4 GB | 1 | 1 | Si RAM illimitée |
|
||||
| Multi-pass | 400 MB | v | v | Si I/O pas cher |
|
||||
|
||||
---
|
||||
|
||||
## Avantages de v-Bitmaps
|
||||
|
||||
✅ **Une seule passe** sur les données
|
||||
✅ **Mémoire optimale** avec Roaring bitmaps
|
||||
✅ **Pas de Remove** (seulement Contains + Add)
|
||||
✅ **Early exit** efficace sur singletons
|
||||
✅ **Scalable** jusqu'à v~10-20
|
||||
✅ **Simple** à implémenter et comprendre
|
||||
|
||||
---
|
||||
|
||||
## Cas d'usage typiques
|
||||
|
||||
### 1. Éliminer erreurs de séquençage
|
||||
|
||||
```go
|
||||
filter := obikmer.NewFrequencyFilter(31, 3)
|
||||
|
||||
// Traiter FASTQ
|
||||
for read := range StreamFastq("sample.fastq") {
|
||||
filter.AddSequence(read)
|
||||
}
|
||||
|
||||
// K-mers de qualité (pas d'erreurs)
|
||||
cleaned := filter.GetFilteredSet("cleaned")
|
||||
```
|
||||
|
||||
**Résultat** : Élimine 70-80% des k-mers (erreurs)
|
||||
|
||||
### 2. Assemblage de génome
|
||||
|
||||
```go
|
||||
filter := obikmer.NewFrequencyFilter(31, 2)
|
||||
|
||||
// Filtrer avant l'assemblage
|
||||
for read := range reads {
|
||||
filter.AddSequence(read)
|
||||
}
|
||||
|
||||
solidKmers := filter.GetFilteredSet("solid")
|
||||
// Utiliser solidKmers pour le graphe de Bruijn
|
||||
```
|
||||
|
||||
### 3. Comparaison de génomes
|
||||
|
||||
```go
|
||||
collection := obikmer.NewKmerSetCollection(31)
|
||||
|
||||
for _, genome := range genomes {
|
||||
filter := obikmer.NewFrequencyFilter(31, 3)
|
||||
filter.AddSequences(genome.Reads)
|
||||
|
||||
cleaned := filter.GetFilteredSet(genome.ID)
|
||||
collection.Add(cleaned)
|
||||
}
|
||||
|
||||
// Analyses comparatives sur k-mers de qualité
|
||||
matrix := collection.ParallelPairwiseJaccard(8)
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Limites
|
||||
|
||||
**Pour v > 20** :
|
||||
- Trop de lookups (v lookups/kmer)
|
||||
- Mémoire importante (v × 200MB pour 10^8 kmers)
|
||||
|
||||
**Solutions alternatives pour v > 20** :
|
||||
- Utiliser map simple (9 bytes/kmer) si RAM disponible
|
||||
- Algorithme différent (sketch, probabiliste)
|
||||
|
||||
---
|
||||
|
||||
## Optimisations possibles
|
||||
|
||||
### 1. Parallélisation
|
||||
|
||||
```go
|
||||
// Traiter plusieurs fichiers en parallèle
|
||||
filters := make([]*FrequencyFilter, numFiles)
|
||||
|
||||
var wg sync.WaitGroup
|
||||
for i, file := range files {
|
||||
wg.Add(1)
|
||||
go func(idx int, f string) {
|
||||
defer wg.Done()
|
||||
filters[idx] = ProcessFile(f, k, minFreq)
|
||||
}(i, file)
|
||||
}
|
||||
wg.Wait()
|
||||
|
||||
// Merger les résultats
|
||||
merged := MergeFilters(filters)
|
||||
```
|
||||
|
||||
### 2. Streaming avec seuil adaptatif
|
||||
|
||||
```go
|
||||
// Commencer avec v=5, réduire progressivement
|
||||
filter := obikmer.NewFrequencyFilter(31, 5)
|
||||
|
||||
// ... traitement ...
|
||||
|
||||
// Si trop de mémoire, réduire à v=3
|
||||
if filter.MemoryUsage() > threshold {
|
||||
filter = ConvertToLowerThreshold(filter, 3)
|
||||
}
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Récapitulatif final
|
||||
|
||||
**Pour filtrer les k-mers par fréquence ≥ v :**
|
||||
|
||||
1. **Créer** : `filter := NewFrequencyFilter(k, v)`
|
||||
2. **Traiter** : `filter.AddSequence(read)` pour chaque read
|
||||
3. **Résultat** : `filtered := filter.GetFilteredSet(id)`
|
||||
|
||||
**Mémoire** : ~2v MB par million de k-mers uniques
|
||||
**Temps** : Une seule passe, ~2 lookups/kmer en moyenne
|
||||
**Optimal pour** : v ≤ 20, distribution skewed (séquençage)
|
||||
|
||||
---
|
||||
|
||||
## Code fourni
|
||||
|
||||
1. **frequency_filter.go** - Implémentation complète
|
||||
2. **examples_frequency_filter_final.go** - Exemples d'utilisation
|
||||
|
||||
**Tout est prêt à utiliser !** 🚀
|
||||
@@ -1,320 +0,0 @@
|
||||
package main
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"obikmer"
|
||||
)
|
||||
|
||||
func main() {
|
||||
// ==========================================
|
||||
// EXEMPLE 1 : Utilisation basique
|
||||
// ==========================================
|
||||
fmt.Println("=== EXEMPLE 1 : Utilisation basique ===\n")
|
||||
|
||||
k := 31
|
||||
minFreq := 3 // Garder les k-mers vus ≥3 fois
|
||||
|
||||
// Créer le filtre
|
||||
filter := obikmer.NewFrequencyFilter(k, minFreq)
|
||||
|
||||
// Simuler des séquences avec différentes fréquences
|
||||
sequences := [][]byte{
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X (freq=2)
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X (freq=3) ✓
|
||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Kmer Y
|
||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Kmer Y (freq=2) ✗
|
||||
[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // Kmer Z (freq=1) ✗
|
||||
}
|
||||
|
||||
fmt.Printf("Traitement de %d séquences...\n", len(sequences))
|
||||
for _, seq := range sequences {
|
||||
filter.AddSequence(seq)
|
||||
}
|
||||
|
||||
// Récupérer les k-mers filtrés
|
||||
filtered := filter.GetFilteredSet("filtered")
|
||||
fmt.Printf("\nK-mers avec freq ≥ %d: %d\n", minFreq, filtered.Cardinality())
|
||||
|
||||
// Statistiques
|
||||
stats := filter.Stats()
|
||||
fmt.Println("\n" + stats.String())
|
||||
|
||||
// ==========================================
|
||||
// EXEMPLE 2 : Vérifier les niveaux
|
||||
// ==========================================
|
||||
fmt.Println("\n=== EXEMPLE 2 : Inspection des niveaux ===\n")
|
||||
|
||||
// Vérifier chaque niveau
|
||||
for level := 0; level < minFreq; level++ {
|
||||
levelSet := filter.GetKmersAtLevel(level)
|
||||
fmt.Printf("Niveau %d (freq≥%d): %d k-mers\n",
|
||||
level+1, level+1, levelSet.Cardinality())
|
||||
}
|
||||
|
||||
// ==========================================
|
||||
// EXEMPLE 3 : Données réalistes
|
||||
// ==========================================
|
||||
fmt.Println("\n=== EXEMPLE 3 : Simulation données séquençage ===\n")
|
||||
|
||||
filter2 := obikmer.NewFrequencyFilter(31, 3)
|
||||
|
||||
// Simuler un dataset réaliste :
|
||||
// - 1000 reads
|
||||
// - 80% contiennent des erreurs (singletons)
|
||||
// - 15% vrais k-mers à basse fréquence
|
||||
// - 5% vrais k-mers à haute fréquence
|
||||
|
||||
// Vraie séquence répétée
|
||||
trueSeq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
|
||||
for i := 0; i < 50; i++ {
|
||||
filter2.AddSequence(trueSeq)
|
||||
}
|
||||
|
||||
// Séquence à fréquence moyenne
|
||||
mediumSeq := []byte("CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC")
|
||||
for i := 0; i < 5; i++ {
|
||||
filter2.AddSequence(mediumSeq)
|
||||
}
|
||||
|
||||
// Erreurs de séquençage (singletons)
|
||||
for i := 0; i < 100; i++ {
|
||||
errorSeq := []byte(fmt.Sprintf("TTTTTTTTTTTTTTTTTTTTTTTTTTTT%03d", i))
|
||||
filter2.AddSequence(errorSeq)
|
||||
}
|
||||
|
||||
stats2 := filter2.Stats()
|
||||
fmt.Println(stats2.String())
|
||||
|
||||
fmt.Println("Distribution attendue:")
|
||||
fmt.Println(" - Beaucoup de singletons (erreurs)")
|
||||
fmt.Println(" - Peu de k-mers à haute fréquence (signal)")
|
||||
fmt.Println(" → Filtrage efficace !")
|
||||
|
||||
// ==========================================
|
||||
// EXEMPLE 4 : Tester différents seuils
|
||||
// ==========================================
|
||||
fmt.Println("\n=== EXEMPLE 4 : Comparaison de seuils ===\n")
|
||||
|
||||
testSeqs := [][]byte{
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // freq=5
|
||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"),
|
||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"),
|
||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // freq=3
|
||||
[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // freq=1
|
||||
}
|
||||
|
||||
for _, minFreq := range []int{2, 3, 5} {
|
||||
f := obikmer.NewFrequencyFilter(31, minFreq)
|
||||
f.AddSequences(testSeqs)
|
||||
|
||||
fmt.Printf("minFreq=%d: %d k-mers retenus (%.2f MB)\n",
|
||||
minFreq,
|
||||
f.Cardinality(),
|
||||
float64(f.MemoryUsage())/1024/1024)
|
||||
}
|
||||
|
||||
// ==========================================
|
||||
// EXEMPLE 5 : Comparaison mémoire
|
||||
// ==========================================
|
||||
fmt.Println("\n=== EXEMPLE 5 : Comparaison mémoire ===\n")
|
||||
|
||||
filter3 := obikmer.NewFrequencyFilter(31, 3)
|
||||
|
||||
// Simuler 10000 séquences
|
||||
for i := 0; i < 10000; i++ {
|
||||
seq := make([]byte, 100)
|
||||
for j := range seq {
|
||||
seq[j] = "ACGT"[(i+j)%4]
|
||||
}
|
||||
filter3.AddSequence(seq)
|
||||
}
|
||||
|
||||
fmt.Println(filter3.CompareWithSimpleMap())
|
||||
|
||||
// ==========================================
|
||||
// EXEMPLE 6 : Workflow complet
|
||||
// ==========================================
|
||||
fmt.Println("\n=== EXEMPLE 6 : Workflow complet ===\n")
|
||||
|
||||
fmt.Println("1. Créer le filtre")
|
||||
finalFilter := obikmer.NewFrequencyFilter(31, 3)
|
||||
|
||||
fmt.Println("2. Traiter les données (simulation)")
|
||||
// En pratique : lire depuis FASTQ
|
||||
// for read := range ReadFastq("data.fastq") {
|
||||
// finalFilter.AddSequence(read)
|
||||
// }
|
||||
|
||||
// Simulation
|
||||
for i := 0; i < 1000; i++ {
|
||||
seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
|
||||
finalFilter.AddSequence(seq)
|
||||
}
|
||||
|
||||
fmt.Println("3. Récupérer les k-mers filtrés")
|
||||
result := finalFilter.GetFilteredSet("final")
|
||||
|
||||
fmt.Println("4. Utiliser le résultat")
|
||||
fmt.Printf(" K-mers de qualité: %d\n", result.Cardinality())
|
||||
fmt.Printf(" Mémoire utilisée: %.2f MB\n", float64(finalFilter.MemoryUsage())/1024/1024)
|
||||
|
||||
fmt.Println("5. Sauvegarder (optionnel)")
|
||||
// result.Save("filtered_kmers.bin")
|
||||
|
||||
// ==========================================
|
||||
// EXEMPLE 7 : Vérification individuelle
|
||||
// ==========================================
|
||||
fmt.Println("\n=== EXEMPLE 7 : Vérification de k-mers spécifiques ===\n")
|
||||
|
||||
checkFilter := obikmer.NewFrequencyFilter(31, 3)
|
||||
|
||||
testSeq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
|
||||
for i := 0; i < 5; i++ {
|
||||
checkFilter.AddSequence(testSeq)
|
||||
}
|
||||
|
||||
var kmers []uint64
|
||||
kmers = obikmer.EncodeKmers(testSeq, 31, &kmers)
|
||||
|
||||
if len(kmers) > 0 {
|
||||
testKmer := kmers[0]
|
||||
|
||||
fmt.Printf("K-mer test: 0x%016X\n", testKmer)
|
||||
fmt.Printf(" Présent dans filtre: %v\n", checkFilter.Contains(testKmer))
|
||||
fmt.Printf(" Fréquence approx: %d\n", checkFilter.GetFrequency(testKmer))
|
||||
}
|
||||
|
||||
// ==========================================
|
||||
// EXEMPLE 8 : Intégration avec collection
|
||||
// ==========================================
|
||||
fmt.Println("\n=== EXEMPLE 8 : Intégration avec KmerSetCollection ===\n")
|
||||
|
||||
// Créer une collection de génomes filtrés
|
||||
collection := obikmer.NewKmerSetCollection(31)
|
||||
|
||||
genomes := map[string][][]byte{
|
||||
"Genome1": {
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Erreur
|
||||
},
|
||||
"Genome2": {
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // Erreur
|
||||
},
|
||||
}
|
||||
|
||||
for id, sequences := range genomes {
|
||||
// Filtrer chaque génome
|
||||
genomeFilter := obikmer.NewFrequencyFilter(31, 3)
|
||||
genomeFilter.AddSequences(sequences)
|
||||
|
||||
// Ajouter à la collection
|
||||
filteredSet := genomeFilter.GetFilteredSet(id)
|
||||
collection.Add(filteredSet)
|
||||
|
||||
fmt.Printf("%s: %d k-mers de qualité\n", id, filteredSet.Cardinality())
|
||||
}
|
||||
|
||||
// Analyser la collection
|
||||
fmt.Println("\nAnalyse comparative:")
|
||||
collectionStats := collection.ComputeStats()
|
||||
fmt.Printf(" Core genome: %d k-mers\n", collectionStats.CoreSize)
|
||||
fmt.Printf(" Pan genome: %d k-mers\n", collectionStats.PanGenomeSize)
|
||||
|
||||
// ==========================================
|
||||
// RÉSUMÉ
|
||||
// ==========================================
|
||||
fmt.Println("\n=== RÉSUMÉ ===\n")
|
||||
fmt.Println("Le FrequencyFilter permet de:")
|
||||
fmt.Println(" ✓ Filtrer les k-mers par fréquence minimale")
|
||||
fmt.Println(" ✓ Utiliser une mémoire optimale avec Roaring bitmaps")
|
||||
fmt.Println(" ✓ Une seule passe sur les données")
|
||||
fmt.Println(" ✓ Éliminer efficacement les erreurs de séquençage")
|
||||
fmt.Println("")
|
||||
fmt.Println("Workflow typique:")
|
||||
fmt.Println(" 1. filter := NewFrequencyFilter(k, minFreq)")
|
||||
fmt.Println(" 2. for each sequence: filter.AddSequence(seq)")
|
||||
fmt.Println(" 3. filtered := filter.GetFilteredSet(id)")
|
||||
fmt.Println(" 4. Utiliser filtered dans vos analyses")
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// FONCTION HELPER POUR BENCHMARKS
|
||||
// ==================================
|
||||
|
||||
func BenchmarkFrequencyFilter() {
|
||||
k := 31
|
||||
minFreq := 3
|
||||
|
||||
// Test avec différentes tailles
|
||||
sizes := []int{1000, 10000, 100000}
|
||||
|
||||
fmt.Println("\n=== BENCHMARK ===\n")
|
||||
|
||||
for _, size := range sizes {
|
||||
filter := obikmer.NewFrequencyFilter(k, minFreq)
|
||||
|
||||
// Générer des séquences
|
||||
for i := 0; i < size; i++ {
|
||||
seq := make([]byte, 100)
|
||||
for j := range seq {
|
||||
seq[j] = "ACGT"[(i+j)%4]
|
||||
}
|
||||
filter.AddSequence(seq)
|
||||
}
|
||||
|
||||
fmt.Printf("Size=%d reads:\n", size)
|
||||
fmt.Printf(" Filtered k-mers: %d\n", filter.Cardinality())
|
||||
fmt.Printf(" Memory: %.2f MB\n", float64(filter.MemoryUsage())/1024/1024)
|
||||
fmt.Println()
|
||||
}
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// FONCTION POUR DONNÉES RÉELLES
|
||||
// ==================================
|
||||
|
||||
func ProcessRealData() {
|
||||
// Exemple pour traiter de vraies données FASTQ
|
||||
|
||||
k := 31
|
||||
minFreq := 3
|
||||
|
||||
filter := obikmer.NewFrequencyFilter(k, minFreq)
|
||||
|
||||
// Pseudo-code pour lire un FASTQ
|
||||
/*
|
||||
fastqFile := "sample.fastq"
|
||||
reader := NewFastqReader(fastqFile)
|
||||
|
||||
for reader.HasNext() {
|
||||
read := reader.Next()
|
||||
filter.AddSequence(read.Sequence)
|
||||
}
|
||||
|
||||
// Récupérer le résultat
|
||||
filtered := filter.GetFilteredSet("sample_filtered")
|
||||
filtered.Save("sample_filtered_kmers.bin")
|
||||
|
||||
// Stats
|
||||
stats := filter.Stats()
|
||||
fmt.Println(stats.String())
|
||||
*/
|
||||
|
||||
fmt.Println("Workflow pour données réelles:")
|
||||
fmt.Println(" 1. Créer le filtre avec minFreq approprié (2-5 typique)")
|
||||
fmt.Println(" 2. Stream les reads depuis FASTQ")
|
||||
fmt.Println(" 3. Récupérer les k-mers filtrés")
|
||||
fmt.Println(" 4. Utiliser pour assemblage/comparaison/etc.")
|
||||
|
||||
_ = filter // unused
|
||||
}
|
||||
148
obitests/obitools/obisuperkmer/README.md
Normal file
148
obitests/obitools/obisuperkmer/README.md
Normal file
@@ -0,0 +1,148 @@
|
||||
# Tests pour obisuperkmer
|
||||
|
||||
## Description
|
||||
|
||||
Ce répertoire contient les tests automatisés pour la commande `obisuperkmer`.
|
||||
|
||||
## Fichiers
|
||||
|
||||
- `test.sh` : Script de test principal (exécutable)
|
||||
- `test_sequences.fasta` : Jeu de données de test minimal (3 séquences courtes)
|
||||
- `README.md` : Ce fichier
|
||||
|
||||
## Jeu de données de test
|
||||
|
||||
Le fichier `test_sequences.fasta` contient 3 séquences de 32 nucléotides chacune :
|
||||
|
||||
1. **seq1** : Répétition du motif ACGT (séquence régulière)
|
||||
2. **seq2** : Alternance de blocs homopolymères (AAAA, CCCC, GGGG, TTTT)
|
||||
3. **seq3** : Répétition du motif ATCG (différent de seq1)
|
||||
|
||||
Ces séquences sont volontairement courtes pour :
|
||||
- Minimiser la taille du dépôt Git
|
||||
- Accélérer l'exécution des tests en CI/CD
|
||||
- Tester différents cas d'extraction de super k-mers
|
||||
|
||||
## Tests effectués
|
||||
|
||||
Le script `test.sh` effectue 12 tests :
|
||||
|
||||
### Test 1 : Affichage de l'aide
|
||||
Vérifie que `obisuperkmer -h` s'exécute correctement.
|
||||
|
||||
### Test 2 : Extraction basique avec paramètres par défaut
|
||||
Exécute `obisuperkmer` avec k=21, m=11 (valeurs par défaut).
|
||||
|
||||
### Test 3 : Vérification du fichier de sortie non vide
|
||||
S'assure que la commande produit une sortie.
|
||||
|
||||
### Test 4 : Comptage des super k-mers extraits
|
||||
Vérifie qu'au moins un super k-mer a été extrait.
|
||||
|
||||
### Test 5 : Présence des métadonnées requises
|
||||
Vérifie que chaque super k-mer contient :
|
||||
- `minimizer_value`
|
||||
- `minimizer_seq`
|
||||
- `parent_id`
|
||||
|
||||
### Test 6 : Extraction avec paramètres personnalisés
|
||||
Teste avec k=15 et m=7.
|
||||
|
||||
### Test 7 : Vérification des paramètres dans les métadonnées
|
||||
S'assure que les valeurs k=15 et m=7 sont présentes dans la sortie.
|
||||
|
||||
### Test 8 : Format de sortie FASTA explicite
|
||||
Teste l'option `--fasta-output`.
|
||||
|
||||
### Test 9 : Vérification des IDs des super k-mers
|
||||
S'assure que tous les IDs contiennent "superkmer".
|
||||
|
||||
### Test 10 : Préservation des IDs parents
|
||||
Vérifie que seq1, seq2 et seq3 apparaissent dans la sortie.
|
||||
|
||||
### Test 11 : Option -o pour fichier de sortie
|
||||
Teste la redirection vers un fichier avec `-o`.
|
||||
|
||||
### Test 12 : Vérification de la création du fichier avec -o
|
||||
S'assure que le fichier de sortie a été créé.
|
||||
|
||||
### Test 13 : Cohérence des longueurs
|
||||
Vérifie que la somme des longueurs des super k-mers est inférieure ou égale à la longueur totale des séquences d'entrée.
|
||||
|
||||
## Exécution des tests
|
||||
|
||||
### Localement
|
||||
|
||||
```bash
|
||||
cd /chemin/vers/obitools4/obitests/obitools/obisuperkmer
|
||||
./test.sh
|
||||
```
|
||||
|
||||
### En CI/CD
|
||||
|
||||
Les tests sont automatiquement exécutés lors de chaque commit via le système CI/CD configuré pour le projet.
|
||||
|
||||
### Prérequis
|
||||
|
||||
- La commande `obisuperkmer` doit être compilée et disponible dans `../../build/`
|
||||
- Les dépendances système : bash, grep, etc.
|
||||
|
||||
## Structure du script de test
|
||||
|
||||
Le script suit le pattern standard utilisé par tous les tests OBITools :
|
||||
|
||||
1. **En-tête** : Définition du nom du test et de la commande
|
||||
2. **Variables** : Configuration des chemins et compteurs
|
||||
3. **Fonction cleanup()** : Affiche les résultats et nettoie le répertoire temporaire
|
||||
4. **Fonction log()** : Affiche les messages horodatés
|
||||
5. **Tests** : Série de tests avec incrémentation des compteurs
|
||||
6. **Appel cleanup()** : Nettoyage et sortie avec code de retour approprié
|
||||
|
||||
## Format de sortie
|
||||
|
||||
Chaque test affiche :
|
||||
```
|
||||
[obisuperkmer @ date] message
|
||||
```
|
||||
|
||||
En fin d'exécution :
|
||||
```
|
||||
========================================
|
||||
## Results of the obisuperkmer tests:
|
||||
|
||||
- 12 tests run
|
||||
- 12 successfully completed
|
||||
- 0 failed tests
|
||||
|
||||
Cleaning up the temporary directory...
|
||||
|
||||
========================================
|
||||
```
|
||||
|
||||
## Codes de retour
|
||||
|
||||
- **0** : Tous les tests ont réussi
|
||||
- **1** : Au moins un test a échoué
|
||||
|
||||
## Ajout de nouveaux tests
|
||||
|
||||
Pour ajouter un nouveau test, suivre le pattern :
|
||||
|
||||
```bash
|
||||
((ntest++))
|
||||
if commande_test arguments
|
||||
then
|
||||
log "Description: OK"
|
||||
((success++))
|
||||
else
|
||||
log "Description: failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
## Notes
|
||||
|
||||
- Les fichiers temporaires sont créés dans `$TMPDIR` (créé par mktemp)
|
||||
- Les fichiers de données sont dans `$TEST_DIR`
|
||||
- La commande testée doit être dans `$OBITOOLS_DIR` (../../build/)
|
||||
- Le répertoire temporaire est automatiquement nettoyé à la fin
|
||||
232
obitests/obitools/obisuperkmer/test.sh
Executable file
232
obitests/obitools/obisuperkmer/test.sh
Executable file
@@ -0,0 +1,232 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obik-super
|
||||
CMD=obik
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="OBIk-super"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
######################################################################
|
||||
|
||||
((ntest++))
|
||||
if $CMD super -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 1: Basic super k-mer extraction with default parameters
|
||||
((ntest++))
|
||||
if $CMD super "${TEST_DIR}/test_sequences.fasta" \
|
||||
> "${TMPDIR}/output_default.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: basic extraction with default parameters OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: basic extraction with default parameters failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 2: Verify output is not empty
|
||||
((ntest++))
|
||||
if [ -s "${TMPDIR}/output_default.fasta" ]
|
||||
then
|
||||
log "$MCMD: output file is not empty OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: output file is empty - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 3: Count number of super k-mers extracted (should be > 0)
|
||||
((ntest++))
|
||||
num_sequences=$(grep -c "^>" "${TMPDIR}/output_default.fasta")
|
||||
if [ "$num_sequences" -gt 0 ]
|
||||
then
|
||||
log "$MCMD: extracted $num_sequences super k-mers OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: no super k-mers extracted - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 4: Verify super k-mers have required metadata attributes
|
||||
((ntest++))
|
||||
if grep -q "minimizer_value" "${TMPDIR}/output_default.fasta" && \
|
||||
grep -q "minimizer_seq" "${TMPDIR}/output_default.fasta" && \
|
||||
grep -q "parent_id" "${TMPDIR}/output_default.fasta"
|
||||
then
|
||||
log "$MCMD: super k-mers contain required metadata OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: super k-mers missing metadata - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 5: Extract super k-mers with custom k and m parameters
|
||||
((ntest++))
|
||||
if $CMD super -k 15 -m 7 "${TEST_DIR}/test_sequences.fasta" \
|
||||
> "${TMPDIR}/output_k15_m7.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: extraction with custom k=15, m=7 OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: extraction with custom k=15, m=7 failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 6: Verify custom parameters in output metadata
|
||||
((ntest++))
|
||||
if grep -q '"k":15' "${TMPDIR}/output_k15_m7.fasta" && \
|
||||
grep -q '"m":7' "${TMPDIR}/output_k15_m7.fasta"
|
||||
then
|
||||
log "$MCMD: custom parameters correctly set in metadata OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: custom parameters not in metadata - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 7: Test with different output format (FASTA output explicitly)
|
||||
((ntest++))
|
||||
if $CMD super --fasta-output -k 21 -m 11 \
|
||||
"${TEST_DIR}/test_sequences.fasta" \
|
||||
> "${TMPDIR}/output_fasta.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: FASTA output format OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: FASTA output format failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 8: Verify all super k-mers have superkmer in their ID
|
||||
((ntest++))
|
||||
if grep "^>" "${TMPDIR}/output_default.fasta" | grep -q "superkmer"
|
||||
then
|
||||
log "$MCMD: super k-mer IDs contain 'superkmer' OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: super k-mer IDs missing 'superkmer' - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 9: Verify parent sequence IDs are preserved
|
||||
((ntest++))
|
||||
if grep -q "seq1" "${TMPDIR}/output_default.fasta" && \
|
||||
grep -q "seq2" "${TMPDIR}/output_default.fasta" && \
|
||||
grep -q "seq3" "${TMPDIR}/output_default.fasta"
|
||||
then
|
||||
log "$MCMD: parent sequence IDs preserved OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: parent sequence IDs not preserved - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 10: Test with output file option
|
||||
((ntest++))
|
||||
if $CMD super -o "${TMPDIR}/output_file.fasta" \
|
||||
"${TEST_DIR}/test_sequences.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: output to file with -o option OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: output to file with -o option failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 11: Verify output file was created with -o option
|
||||
((ntest++))
|
||||
if [ -s "${TMPDIR}/output_file.fasta" ]
|
||||
then
|
||||
log "$MCMD: output file created with -o option OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: output file not created with -o option - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 12: Verify each super k-mer length is >= k (default k=31)
|
||||
((ntest++))
|
||||
min_len=$(grep -v "^>" "${TMPDIR}/output_default.fasta" | awk '{print length}' | sort -n | head -1)
|
||||
|
||||
if [ "$min_len" -ge 31 ]
|
||||
then
|
||||
log "$MCMD: all super k-mers have length >= k OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: some super k-mers shorter than k ($min_len < 31) - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
6
obitests/obitools/obisuperkmer/test_sequences.fasta
Normal file
6
obitests/obitools/obisuperkmer/test_sequences.fasta
Normal file
@@ -0,0 +1,6 @@
|
||||
>seq1
|
||||
ACGTACGTACGTACGTACGTACGTACGTACGT
|
||||
>seq2
|
||||
AAAACCCCGGGGTTTTAAAACCCCGGGGTTTT
|
||||
>seq3
|
||||
ATCGATCGATCGATCGATCGATCGATCGATCG
|
||||
@@ -195,6 +195,59 @@ else
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
##
|
||||
## Test merge attributes consistency between in-memory and on-disk paths
|
||||
## This test catches the bug where the shared classifier in the on-disk
|
||||
## dereplication path caused incorrect merged attributes.
|
||||
##
|
||||
|
||||
((ntest++))
|
||||
if obiuniq -m a -m b --in-memory \
|
||||
"${TEST_DIR}/touniq.fasta" \
|
||||
> "${TMPDIR}/touniq_u_merge_mem.fasta" 2>/dev/null
|
||||
then
|
||||
log "OBIUniq merge in-memory: running OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIUniq merge in-memory: running failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if obiuniq -m a -m b --chunk-count 4 \
|
||||
"${TEST_DIR}/touniq.fasta" \
|
||||
> "${TMPDIR}/touniq_u_merge_disk.fasta" 2>/dev/null
|
||||
then
|
||||
log "OBIUniq merge on-disk: running OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIUniq merge on-disk: running failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Extract sorted annotations (JSON attributes) from both outputs
|
||||
# to compare merge results independently of sequence ordering
|
||||
grep '^>' "${TMPDIR}/touniq_u_merge_mem.fasta" \
|
||||
| sed 's/^>seq[0-9]* //' \
|
||||
| sort \
|
||||
> "${TMPDIR}/touniq_u_merge_mem.json"
|
||||
|
||||
grep '^>' "${TMPDIR}/touniq_u_merge_disk.fasta" \
|
||||
| sed 's/^>seq[0-9]* //' \
|
||||
| sort \
|
||||
> "${TMPDIR}/touniq_u_merge_disk.json"
|
||||
|
||||
((ntest++))
|
||||
if diff "${TMPDIR}/touniq_u_merge_mem.json" \
|
||||
"${TMPDIR}/touniq_u_merge_disk.json" > /dev/null
|
||||
then
|
||||
log "OBIUniq merge on-disk vs in-memory: result OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIUniq merge on-disk vs in-memory: result failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
|
||||
@@ -110,6 +110,7 @@ func ISequenceChunkOnDisk(iterator obiiter.IBioSequence,
|
||||
log.Infof("Data splitted over %d batches", nbatch)
|
||||
|
||||
go func() {
|
||||
localClassifier := uniqueClassifier.Clone()
|
||||
|
||||
for order, file := range fileNames {
|
||||
iseq, err := obiformats.ReadSequencesFromFile(file)
|
||||
@@ -121,7 +122,7 @@ func ISequenceChunkOnDisk(iterator obiiter.IBioSequence,
|
||||
if dereplicate {
|
||||
u := make(map[string]*obiseq.BioSequence)
|
||||
var source string
|
||||
uniqueClassifier.Reset()
|
||||
localClassifier.Reset()
|
||||
|
||||
for iseq.Next() {
|
||||
batch := iseq.Get()
|
||||
@@ -129,8 +130,8 @@ func ISequenceChunkOnDisk(iterator obiiter.IBioSequence,
|
||||
|
||||
for _, seq := range batch.Slice() {
|
||||
// Use composite key: sequence + categories
|
||||
code := uniqueClassifier.Code(seq)
|
||||
key := uniqueClassifier.Value(code)
|
||||
code := localClassifier.Code(seq)
|
||||
key := localClassifier.Value(code)
|
||||
prev, ok := u[key]
|
||||
if ok {
|
||||
prev.Merge(seq, na, true, statsOn)
|
||||
|
||||
@@ -27,6 +27,8 @@ func AhoCorazickWorker(slot string, patterns []string) obiseq.SeqWorker {
|
||||
npar := min(obidefault.ParallelWorkers(), nmatcher)
|
||||
mutex.Add(npar)
|
||||
|
||||
var bar *progressbar.ProgressBar
|
||||
if obidefault.ProgressBar() {
|
||||
pbopt := make([]progressbar.Option, 0, 5)
|
||||
pbopt = append(pbopt,
|
||||
progressbar.OptionSetWriter(os.Stderr),
|
||||
@@ -36,14 +38,16 @@ func AhoCorazickWorker(slot string, patterns []string) obiseq.SeqWorker {
|
||||
progressbar.OptionSetDescription("Building AhoCorasick matcher..."),
|
||||
)
|
||||
|
||||
bar := progressbar.NewOptions(nmatcher, pbopt...)
|
||||
bar.Add(0)
|
||||
bar = progressbar.NewOptions(nmatcher, pbopt...)
|
||||
}
|
||||
|
||||
builder := func() {
|
||||
for i := range ieme {
|
||||
matchers[i] = ahocorasick.CompileStrings(patterns[i*sizebatch:min((i+1)*sizebatch,len(patterns))])
|
||||
if bar != nil {
|
||||
bar.Add(1)
|
||||
}
|
||||
}
|
||||
mutex.Done()
|
||||
}
|
||||
|
||||
|
||||
19
pkg/obidefault/progressbar.go
Normal file
19
pkg/obidefault/progressbar.go
Normal file
@@ -0,0 +1,19 @@
|
||||
package obidefault
|
||||
|
||||
var __no_progress_bar__ = false
|
||||
|
||||
func ProgressBar() bool {
|
||||
return !__no_progress_bar__
|
||||
}
|
||||
|
||||
func NoProgressBar() bool {
|
||||
return __no_progress_bar__
|
||||
}
|
||||
|
||||
func SetNoProgressBar(b bool) {
|
||||
__no_progress_bar__ = b
|
||||
}
|
||||
|
||||
func NoProgressBarPtr() *bool {
|
||||
return &__no_progress_bar__
|
||||
}
|
||||
@@ -162,9 +162,10 @@ func GenbankChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (ob
|
||||
// log.Debugf("Chunk %d : Genbank: line %d, state = %d : %s", chunks.order, nl, state, line)
|
||||
|
||||
sl++
|
||||
parts := strings.SplitN(line[10:], " ", 6)
|
||||
cleanline := strings.TrimSpace(line)
|
||||
parts := strings.SplitN(cleanline, " ", 7)
|
||||
lparts := len(parts)
|
||||
for i := 0; i < lparts; i++ {
|
||||
for i := 1; i < lparts; i++ {
|
||||
if UtoT {
|
||||
parts[i] = strings.ReplaceAll(parts[i], "u", "t")
|
||||
}
|
||||
|
||||
@@ -5,18 +5,30 @@ import (
|
||||
"os"
|
||||
"time"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"github.com/schollz/progressbar/v3"
|
||||
)
|
||||
|
||||
func (iterator IBioSequence) Speed(message string, size ...int) IBioSequence {
|
||||
|
||||
// If the STDERR is redicted and doesn't end up to a terminal
|
||||
// If the progress bar is disabled via --no-progressbar option
|
||||
if !obidefault.ProgressBar() {
|
||||
return iterator
|
||||
}
|
||||
|
||||
// If the STDERR is redirected and doesn't end up to a terminal
|
||||
// No progress bar is printed.
|
||||
o, _ := os.Stderr.Stat()
|
||||
if (o.Mode() & os.ModeCharDevice) != os.ModeCharDevice {
|
||||
return iterator
|
||||
}
|
||||
|
||||
// If stdout is piped, no progress bar is printed.
|
||||
oo, _ := os.Stdout.Stat()
|
||||
if (oo.Mode() & os.ModeNamedPipe) == os.ModeNamedPipe {
|
||||
return iterator
|
||||
}
|
||||
|
||||
newIter := MakeIBioSequence()
|
||||
|
||||
newIter.Add(1)
|
||||
|
||||
@@ -447,141 +447,6 @@ func IterCanonicalKmers(seq []byte, k int) iter.Seq[uint64] {
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// SuperKmer represents a maximal subsequence where all consecutive k-mers
|
||||
// share the same minimizer. A minimizer is the smallest canonical m-mer
|
||||
// among the (k-m+1) m-mers contained in a k-mer.
|
||||
type SuperKmer struct {
|
||||
Minimizer uint64 // The canonical minimizer value (normalized m-mer)
|
||||
Start int // Starting position in the original sequence (0-indexed)
|
||||
End int // Ending position (exclusive, like Go slice notation)
|
||||
Sequence []byte // The actual DNA subsequence [Start:End]
|
||||
}
|
||||
|
||||
// dequeItem represents an element in the monotone deque used for
|
||||
// tracking minimizers in a sliding window.
|
||||
type dequeItem struct {
|
||||
position int // Position of the m-mer in the sequence
|
||||
canonical uint64 // Canonical (normalized) m-mer value
|
||||
}
|
||||
|
||||
// ExtractSuperKmers extracts super k-mers from a DNA sequence.
|
||||
// A super k-mer is a maximal subsequence where all consecutive k-mers
|
||||
// share the same minimizer. The minimizer of a k-mer is the smallest
|
||||
// canonical m-mer among its (k-m+1) constituent m-mers.
|
||||
//
|
||||
// The algorithm uses:
|
||||
// - Simultaneous forward/reverse m-mer encoding for O(1) canonical m-mer computation
|
||||
// - Monotone deque for O(1) amortized minimizer tracking per position
|
||||
//
|
||||
// The maximum k-mer size is 31 (using 62 bits), leaving the top 2 bits
|
||||
// available for error markers if needed.
|
||||
//
|
||||
// Parameters:
|
||||
// - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
|
||||
// - k: k-mer size (must be between m+1 and 31)
|
||||
// - m: minimizer size (must be between 1 and k-1)
|
||||
// - buffer: optional pre-allocated buffer for results. If nil, a new slice is created.
|
||||
//
|
||||
// Returns:
|
||||
// - slice of SuperKmer structs representing maximal subsequences
|
||||
// - nil if parameters are invalid or sequence is too short
|
||||
//
|
||||
// Time complexity: O(n) where n is the sequence length
|
||||
// Space complexity: O(k-m+1) for the deque + O(number of super k-mers) for results
|
||||
func ExtractSuperKmers(seq []byte, k int, m int, buffer *[]SuperKmer) []SuperKmer {
|
||||
if m < 1 || m >= k || k < 2 || k > 31 || len(seq) < k {
|
||||
return nil
|
||||
}
|
||||
|
||||
var result []SuperKmer
|
||||
if buffer == nil {
|
||||
estimatedSize := len(seq) / k
|
||||
if estimatedSize < 1 {
|
||||
estimatedSize = 1
|
||||
}
|
||||
result = make([]SuperKmer, 0, estimatedSize)
|
||||
} else {
|
||||
result = (*buffer)[:0]
|
||||
}
|
||||
|
||||
deque := make([]dequeItem, 0, k-m+1)
|
||||
|
||||
mMask := uint64(1)<<(m*2) - 1
|
||||
rcShift := uint((m - 1) * 2)
|
||||
|
||||
var fwdMmer, rvcMmer uint64
|
||||
for i := 0; i < m-1 && i < len(seq); i++ {
|
||||
code := uint64(__single_base_code__[seq[i]&31])
|
||||
fwdMmer = (fwdMmer << 2) | code
|
||||
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
|
||||
}
|
||||
|
||||
superKmerStart := 0
|
||||
var currentMinimizer uint64
|
||||
firstKmer := true
|
||||
|
||||
for pos := m - 1; pos < len(seq); pos++ {
|
||||
code := uint64(__single_base_code__[seq[pos]&31])
|
||||
fwdMmer = ((fwdMmer << 2) | code) & mMask
|
||||
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
|
||||
|
||||
canonical := fwdMmer
|
||||
if rvcMmer < fwdMmer {
|
||||
canonical = rvcMmer
|
||||
}
|
||||
|
||||
mmerPos := pos - m + 1
|
||||
|
||||
if pos >= k-1 {
|
||||
windowStart := pos - k + 1
|
||||
for len(deque) > 0 && deque[0].position < windowStart {
|
||||
deque = deque[1:]
|
||||
}
|
||||
}
|
||||
|
||||
for len(deque) > 0 && deque[len(deque)-1].canonical >= canonical {
|
||||
deque = deque[:len(deque)-1]
|
||||
}
|
||||
|
||||
deque = append(deque, dequeItem{position: mmerPos, canonical: canonical})
|
||||
|
||||
if pos >= k-1 {
|
||||
newMinimizer := deque[0].canonical
|
||||
kmerStart := pos - k + 1
|
||||
|
||||
if firstKmer {
|
||||
currentMinimizer = newMinimizer
|
||||
firstKmer = false
|
||||
} else if newMinimizer != currentMinimizer {
|
||||
endPos := kmerStart + k - 1
|
||||
superKmer := SuperKmer{
|
||||
Minimizer: currentMinimizer,
|
||||
Start: superKmerStart,
|
||||
End: endPos,
|
||||
Sequence: seq[superKmerStart:endPos],
|
||||
}
|
||||
result = append(result, superKmer)
|
||||
|
||||
superKmerStart = kmerStart
|
||||
currentMinimizer = newMinimizer
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
if !firstKmer {
|
||||
superKmer := SuperKmer{
|
||||
Minimizer: currentMinimizer,
|
||||
Start: superKmerStart,
|
||||
End: len(seq),
|
||||
Sequence: seq[superKmerStart:],
|
||||
}
|
||||
result = append(result, superKmer)
|
||||
}
|
||||
|
||||
return result
|
||||
}
|
||||
|
||||
// ReverseComplement computes the reverse complement of an encoded k-mer.
|
||||
// The k-mer is encoded with 2 bits per nucleotide (A=00, C=01, G=10, T=11).
|
||||
// The complement is: A↔T (00↔11), C↔G (01↔10), which is simply XOR with 11.
|
||||
|
||||
281
pkg/obikmer/entropy.go
Normal file
281
pkg/obikmer/entropy.go
Normal file
@@ -0,0 +1,281 @@
|
||||
package obikmer
|
||||
|
||||
import "math"
|
||||
|
||||
// KmerEntropy computes the entropy of a single encoded k-mer.
|
||||
//
|
||||
// The algorithm mirrors the lowmask entropy calculation: it decodes the k-mer
|
||||
// to a DNA sequence, extracts all sub-words of each size from 1 to levelMax,
|
||||
// normalizes them by circular canonical form, counts their frequencies, and
|
||||
// computes Shannon entropy normalized by the maximum possible entropy.
|
||||
// The returned value is the minimum entropy across all word sizes.
|
||||
//
|
||||
// A value close to 0 indicates very low complexity (e.g. "AAAA..."),
|
||||
// while a value close to 1 indicates high complexity.
|
||||
//
|
||||
// Parameters:
|
||||
// - kmer: the encoded k-mer (2 bits per base)
|
||||
// - k: the k-mer size
|
||||
// - levelMax: maximum sub-word size for entropy (typically 6)
|
||||
//
|
||||
// Returns:
|
||||
// - minimum normalized entropy across all word sizes 1..levelMax
|
||||
func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
||||
if k < 1 || levelMax < 1 {
|
||||
return 1.0
|
||||
}
|
||||
if levelMax >= k {
|
||||
levelMax = k - 1
|
||||
}
|
||||
if levelMax < 1 {
|
||||
return 1.0
|
||||
}
|
||||
|
||||
// Decode k-mer to DNA sequence
|
||||
var seqBuf [32]byte
|
||||
seq := DecodeKmer(kmer, k, seqBuf[:])
|
||||
|
||||
// Pre-compute nLogN lookup (same as lowmask)
|
||||
nLogN := make([]float64, k+1)
|
||||
for i := 1; i <= k; i++ {
|
||||
nLogN[i] = float64(i) * math.Log(float64(i))
|
||||
}
|
||||
|
||||
// Build circular-canonical normalization tables per word size
|
||||
normTables := make([][]int, levelMax+1)
|
||||
for ws := 1; ws <= levelMax; ws++ {
|
||||
size := 1 << (ws * 2)
|
||||
normTables[ws] = make([]int, size)
|
||||
for code := 0; code < size; code++ {
|
||||
normTables[ws][code] = int(NormalizeCircular(uint64(code), ws))
|
||||
}
|
||||
}
|
||||
|
||||
minEntropy := math.MaxFloat64
|
||||
|
||||
for ws := 1; ws <= levelMax; ws++ {
|
||||
nwords := k - ws + 1
|
||||
if nwords < 1 {
|
||||
continue
|
||||
}
|
||||
|
||||
// Count circular-canonical sub-word frequencies
|
||||
tableSize := 1 << (ws * 2)
|
||||
table := make([]int, tableSize)
|
||||
mask := (1 << (ws * 2)) - 1
|
||||
|
||||
wordIndex := 0
|
||||
for i := 0; i < ws-1; i++ {
|
||||
wordIndex = (wordIndex << 2) + int(EncodeNucleotide(seq[i]))
|
||||
}
|
||||
|
||||
for i, j := 0, ws-1; j < k; i, j = i+1, j+1 {
|
||||
wordIndex = ((wordIndex << 2) & mask) + int(EncodeNucleotide(seq[j]))
|
||||
normWord := normTables[ws][wordIndex]
|
||||
table[normWord]++
|
||||
}
|
||||
|
||||
// Compute Shannon entropy
|
||||
floatNwords := float64(nwords)
|
||||
logNwords := math.Log(floatNwords)
|
||||
|
||||
var sumNLogN float64
|
||||
for j := 0; j < tableSize; j++ {
|
||||
n := table[j]
|
||||
if n > 0 {
|
||||
sumNLogN += nLogN[n]
|
||||
}
|
||||
}
|
||||
|
||||
// Compute emax (maximum possible entropy for this word size)
|
||||
na := CanonicalCircularKmerCount(ws)
|
||||
var emax float64
|
||||
if nwords < na {
|
||||
emax = math.Log(float64(nwords))
|
||||
} else {
|
||||
cov := nwords / na
|
||||
remains := nwords - (na * cov)
|
||||
f1 := float64(cov) / floatNwords
|
||||
f2 := float64(cov+1) / floatNwords
|
||||
emax = -(float64(na-remains)*f1*math.Log(f1) +
|
||||
float64(remains)*f2*math.Log(f2))
|
||||
}
|
||||
|
||||
if emax <= 0 {
|
||||
continue
|
||||
}
|
||||
|
||||
entropy := (logNwords - sumNLogN/floatNwords) / emax
|
||||
if entropy < 0 {
|
||||
entropy = 0
|
||||
}
|
||||
|
||||
if entropy < minEntropy {
|
||||
minEntropy = entropy
|
||||
}
|
||||
}
|
||||
|
||||
if minEntropy == math.MaxFloat64 {
|
||||
return 1.0
|
||||
}
|
||||
|
||||
return math.Round(minEntropy*10000) / 10000
|
||||
}
|
||||
|
||||
// KmerEntropyFilter is a reusable entropy filter for batch processing.
|
||||
// It pre-computes normalization tables and lookup values to avoid repeated
|
||||
// allocation across millions of k-mers.
|
||||
//
|
||||
// IMPORTANT: a KmerEntropyFilter is NOT safe for concurrent use.
|
||||
// Each goroutine must create its own instance via NewKmerEntropyFilter.
|
||||
type KmerEntropyFilter struct {
|
||||
k int
|
||||
levelMax int
|
||||
threshold float64
|
||||
nLogN []float64
|
||||
normTables [][]int
|
||||
emaxValues []float64
|
||||
logNwords []float64
|
||||
// Pre-allocated frequency tables reused across Entropy() calls.
|
||||
// One per word size (index 0 unused). Reset to zero before each use.
|
||||
freqTables [][]int
|
||||
}
|
||||
|
||||
// NewKmerEntropyFilter creates an entropy filter with pre-computed tables.
|
||||
//
|
||||
// Parameters:
|
||||
// - k: the k-mer size
|
||||
// - levelMax: maximum sub-word size for entropy (typically 6)
|
||||
// - threshold: entropy threshold (k-mers with entropy <= threshold are rejected)
|
||||
func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter {
|
||||
if levelMax >= k {
|
||||
levelMax = k - 1
|
||||
}
|
||||
if levelMax < 1 {
|
||||
levelMax = 1
|
||||
}
|
||||
|
||||
nLogN := make([]float64, k+1)
|
||||
for i := 1; i <= k; i++ {
|
||||
nLogN[i] = float64(i) * math.Log(float64(i))
|
||||
}
|
||||
|
||||
normTables := make([][]int, levelMax+1)
|
||||
for ws := 1; ws <= levelMax; ws++ {
|
||||
size := 1 << (ws * 2)
|
||||
normTables[ws] = make([]int, size)
|
||||
for code := 0; code < size; code++ {
|
||||
normTables[ws][code] = int(NormalizeCircular(uint64(code), ws))
|
||||
}
|
||||
}
|
||||
|
||||
emaxValues := make([]float64, levelMax+1)
|
||||
logNwords := make([]float64, levelMax+1)
|
||||
for ws := 1; ws <= levelMax; ws++ {
|
||||
nw := k - ws + 1
|
||||
na := CanonicalCircularKmerCount(ws)
|
||||
if nw < na {
|
||||
logNwords[ws] = math.Log(float64(nw))
|
||||
emaxValues[ws] = math.Log(float64(nw))
|
||||
} else {
|
||||
cov := nw / na
|
||||
remains := nw - (na * cov)
|
||||
f1 := float64(cov) / float64(nw)
|
||||
f2 := float64(cov+1) / float64(nw)
|
||||
logNwords[ws] = math.Log(float64(nw))
|
||||
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
|
||||
float64(remains)*f2*math.Log(f2))
|
||||
}
|
||||
}
|
||||
|
||||
// Pre-allocate frequency tables per word size
|
||||
freqTables := make([][]int, levelMax+1)
|
||||
for ws := 1; ws <= levelMax; ws++ {
|
||||
freqTables[ws] = make([]int, 1<<(ws*2))
|
||||
}
|
||||
|
||||
return &KmerEntropyFilter{
|
||||
k: k,
|
||||
levelMax: levelMax,
|
||||
threshold: threshold,
|
||||
nLogN: nLogN,
|
||||
normTables: normTables,
|
||||
emaxValues: emaxValues,
|
||||
logNwords: logNwords,
|
||||
freqTables: freqTables,
|
||||
}
|
||||
}
|
||||
|
||||
// Accept returns true if the k-mer has entropy strictly above the threshold.
|
||||
// Low-complexity k-mers (entropy <= threshold) are rejected.
|
||||
func (ef *KmerEntropyFilter) Accept(kmer uint64) bool {
|
||||
return ef.Entropy(kmer) > ef.threshold
|
||||
}
|
||||
|
||||
// Entropy computes the entropy for a single k-mer using pre-computed tables.
|
||||
func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
|
||||
k := ef.k
|
||||
|
||||
// Decode k-mer to DNA sequence
|
||||
var seqBuf [32]byte
|
||||
seq := DecodeKmer(kmer, k, seqBuf[:])
|
||||
|
||||
minEntropy := math.MaxFloat64
|
||||
|
||||
for ws := 1; ws <= ef.levelMax; ws++ {
|
||||
nwords := k - ws + 1
|
||||
if nwords < 1 {
|
||||
continue
|
||||
}
|
||||
|
||||
emax := ef.emaxValues[ws]
|
||||
if emax <= 0 {
|
||||
continue
|
||||
}
|
||||
|
||||
// Count circular-canonical sub-word frequencies
|
||||
tableSize := 1 << (ws * 2)
|
||||
table := ef.freqTables[ws]
|
||||
clear(table) // reset to zero
|
||||
mask := (1 << (ws * 2)) - 1
|
||||
normTable := ef.normTables[ws]
|
||||
|
||||
wordIndex := 0
|
||||
for i := 0; i < ws-1; i++ {
|
||||
wordIndex = (wordIndex << 2) + int(EncodeNucleotide(seq[i]))
|
||||
}
|
||||
|
||||
for i, j := 0, ws-1; j < k; i, j = i+1, j+1 {
|
||||
wordIndex = ((wordIndex << 2) & mask) + int(EncodeNucleotide(seq[j]))
|
||||
normWord := normTable[wordIndex]
|
||||
table[normWord]++
|
||||
}
|
||||
|
||||
// Compute Shannon entropy
|
||||
floatNwords := float64(nwords)
|
||||
logNwords := ef.logNwords[ws]
|
||||
|
||||
var sumNLogN float64
|
||||
for j := 0; j < tableSize; j++ {
|
||||
n := table[j]
|
||||
if n > 0 {
|
||||
sumNLogN += ef.nLogN[n]
|
||||
}
|
||||
}
|
||||
|
||||
entropy := (logNwords - sumNLogN/floatNwords) / emax
|
||||
if entropy < 0 {
|
||||
entropy = 0
|
||||
}
|
||||
|
||||
if entropy < minEntropy {
|
||||
minEntropy = entropy
|
||||
}
|
||||
}
|
||||
|
||||
if minEntropy == math.MaxFloat64 {
|
||||
return 1.0
|
||||
}
|
||||
|
||||
return math.Round(minEntropy*10000) / 10000
|
||||
}
|
||||
@@ -1,310 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
// FrequencyFilter filters k-mers by minimum frequency
|
||||
// Specialization of KmerSetGroup where index[i] contains k-mers seen at least i+1 times
|
||||
type FrequencyFilter struct {
|
||||
*KmerSetGroup // Group of KmerSet (one per frequency level)
|
||||
MinFreq int // v - minimum required frequency
|
||||
}
|
||||
|
||||
// NewFrequencyFilter creates a new frequency filter
|
||||
// minFreq: minimum number d'occurrences required (v)
|
||||
func NewFrequencyFilter(k, minFreq int) *FrequencyFilter {
|
||||
ff := &FrequencyFilter{
|
||||
KmerSetGroup: NewKmerSetGroup(k, minFreq),
|
||||
MinFreq: minFreq,
|
||||
}
|
||||
|
||||
// Initialize group metadata
|
||||
ff.SetAttribute("type", "FrequencyFilter")
|
||||
ff.SetAttribute("min_freq", minFreq)
|
||||
|
||||
// Initialize metadata for each level
|
||||
for i := 0; i < minFreq; i++ {
|
||||
level := ff.Get(i)
|
||||
level.SetAttribute("level", i)
|
||||
level.SetAttribute("min_occurrences", i+1)
|
||||
level.SetId(fmt.Sprintf("level_%d", i))
|
||||
}
|
||||
|
||||
return ff
|
||||
}
|
||||
|
||||
// AddSequence adds all k-mers from a sequence to the filter
|
||||
// Uses an iterator to avoid allocating an intermediate vector
|
||||
func (ff *FrequencyFilter) AddSequence(seq *obiseq.BioSequence) {
|
||||
rawSeq := seq.Sequence()
|
||||
for canonical := range IterCanonicalKmers(rawSeq, ff.K()) {
|
||||
ff.AddKmerCode(canonical)
|
||||
}
|
||||
}
|
||||
|
||||
// AddKmerCode adds an encoded k-mer to the filter (main algorithm)
|
||||
func (ff *FrequencyFilter) AddKmerCode(kmer uint64) {
|
||||
// Find the current level of the k-mer
|
||||
c := 0
|
||||
for c < ff.MinFreq && ff.Get(c).Contains(kmer) {
|
||||
c++
|
||||
}
|
||||
|
||||
// Add to next level (if not yet at maximum)
|
||||
if c < ff.MinFreq {
|
||||
ff.Get(c).AddKmerCode(kmer)
|
||||
}
|
||||
}
|
||||
|
||||
// AddCanonicalKmerCode adds an encoded canonical k-mer to the filter
|
||||
func (ff *FrequencyFilter) AddCanonicalKmerCode(kmer uint64) {
|
||||
canonical := CanonicalKmer(kmer, ff.K())
|
||||
ff.AddKmerCode(canonical)
|
||||
}
|
||||
|
||||
// AddKmer adds a k-mer to the filter by encoding the sequence
|
||||
// The sequence must have exactly k nucleotides
|
||||
// Zero-allocation: encodes directly without creating an intermediate slice
|
||||
func (ff *FrequencyFilter) AddKmer(seq []byte) {
|
||||
kmer := EncodeKmer(seq, ff.K())
|
||||
ff.AddKmerCode(kmer)
|
||||
}
|
||||
|
||||
// AddCanonicalKmer adds a canonical k-mer to the filter by encoding the sequence
|
||||
// The sequence must have exactly k nucleotides
|
||||
// Zero-allocation: encodes directly in canonical form without creating an intermediate slice
|
||||
func (ff *FrequencyFilter) AddCanonicalKmer(seq []byte) {
|
||||
canonical := EncodeCanonicalKmer(seq, ff.K())
|
||||
ff.AddKmerCode(canonical)
|
||||
}
|
||||
|
||||
// GetFilteredSet returns a KmerSet of k-mers with frequency ≥ minFreq
|
||||
func (ff *FrequencyFilter) GetFilteredSet() *KmerSet {
|
||||
// Filtered k-mers are in the last level
|
||||
return ff.Get(ff.MinFreq - 1).Copy()
|
||||
}
|
||||
|
||||
// GetKmersAtLevel returns a KmerSet of k-mers seen at least (level+1) times
|
||||
// level doit être dans [0, minFreq-1]
|
||||
func (ff *FrequencyFilter) GetKmersAtLevel(level int) *KmerSet {
|
||||
ks := ff.Get(level)
|
||||
if ks == nil {
|
||||
return NewKmerSet(ff.K())
|
||||
}
|
||||
return ks.Copy()
|
||||
}
|
||||
|
||||
// Stats returns statistics on frequency levels
|
||||
func (ff *FrequencyFilter) Stats() FrequencyFilterStats {
|
||||
stats := FrequencyFilterStats{
|
||||
MinFreq: ff.MinFreq,
|
||||
Levels: make([]LevelStats, ff.MinFreq),
|
||||
}
|
||||
|
||||
for i := 0; i < ff.MinFreq; i++ {
|
||||
ks := ff.Get(i)
|
||||
card := ks.Len()
|
||||
sizeBytes := ks.MemoryUsage()
|
||||
|
||||
stats.Levels[i] = LevelStats{
|
||||
Level: i + 1, // Level 1 = freq ≥ 1
|
||||
Cardinality: card,
|
||||
SizeBytes: sizeBytes,
|
||||
}
|
||||
|
||||
stats.TotalBytes += sizeBytes
|
||||
}
|
||||
|
||||
// The last level contains the result
|
||||
stats.FilteredKmers = stats.Levels[ff.MinFreq-1].Cardinality
|
||||
|
||||
return stats
|
||||
}
|
||||
|
||||
// FrequencyFilterStats contains the filter statistics
|
||||
type FrequencyFilterStats struct {
|
||||
MinFreq int
|
||||
FilteredKmers uint64 // K-mers with freq ≥ minFreq
|
||||
TotalBytes uint64 // Total memory used
|
||||
Levels []LevelStats
|
||||
}
|
||||
|
||||
// LevelStats contains the stats of a level
|
||||
type LevelStats struct {
|
||||
Level int // freq ≥ Level
|
||||
Cardinality uint64 // Number of k-mers
|
||||
SizeBytes uint64 // Size in bytes
|
||||
}
|
||||
|
||||
func (ffs FrequencyFilterStats) String() string {
|
||||
result := fmt.Sprintf(`Frequency Filter Statistics (minFreq=%d):
|
||||
Filtered k-mers (freq≥%d): %d
|
||||
Total memory: %.2f MB
|
||||
|
||||
Level breakdown:
|
||||
`, ffs.MinFreq, ffs.MinFreq, ffs.FilteredKmers, float64(ffs.TotalBytes)/1024/1024)
|
||||
|
||||
for _, level := range ffs.Levels {
|
||||
result += fmt.Sprintf(" freq≥%d: %d k-mers (%.2f MB)\n",
|
||||
level.Level,
|
||||
level.Cardinality,
|
||||
float64(level.SizeBytes)/1024/1024)
|
||||
}
|
||||
|
||||
return result
|
||||
}
|
||||
|
||||
// Clear libère la mémoire de tous les niveaux
|
||||
// (héritée de KmerSetGroup mais redéfinie pour clarté)
|
||||
func (ff *FrequencyFilter) Clear() {
|
||||
ff.KmerSetGroup.Clear()
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// BATCH PROCESSING
|
||||
// ==================================
|
||||
|
||||
// AddSequences adds multiple sequences in batch
|
||||
func (ff *FrequencyFilter) AddSequences(sequences *obiseq.BioSequenceSlice) {
|
||||
for _, seq := range *sequences {
|
||||
ff.AddSequence(seq)
|
||||
}
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// PERSISTANCE
|
||||
// ==================================
|
||||
|
||||
// Save sauvegarde le FrequencyFilter dans un répertoire
|
||||
// Utilise le format de sérialisation du KmerSetGroup sous-jacent
|
||||
// Les métadonnées incluent le type "FrequencyFilter" et min_freq
|
||||
//
|
||||
// Format:
|
||||
// - directory/metadata.{toml,yaml,json} - métadonnées du filtre
|
||||
// - directory/set_0.roaring - k-mers vus ≥1 fois
|
||||
// - directory/set_1.roaring - k-mers vus ≥2 fois
|
||||
// - ...
|
||||
// - directory/set_{minFreq-1}.roaring - k-mers vus ≥minFreq fois
|
||||
//
|
||||
// Parameters:
|
||||
// - directory: répertoire de destination
|
||||
// - format: format des métadonnées (FormatTOML, FormatYAML, FormatJSON)
|
||||
//
|
||||
// Example:
|
||||
//
|
||||
// err := ff.Save("./my_filter", obikmer.FormatTOML)
|
||||
func (ff *FrequencyFilter) Save(directory string, format MetadataFormat) error {
|
||||
// Déléguer à KmerSetGroup qui gère déjà tout
|
||||
return ff.KmerSetGroup.Save(directory, format)
|
||||
}
|
||||
|
||||
// LoadFrequencyFilter charge un FrequencyFilter depuis un répertoire
|
||||
// Vérifie que les métadonnées correspondent à un FrequencyFilter
|
||||
//
|
||||
// Parameters:
|
||||
// - directory: répertoire source
|
||||
//
|
||||
// Returns:
|
||||
// - *FrequencyFilter: le filtre chargé
|
||||
// - error: erreur si le chargement échoue ou si ce n'est pas un FrequencyFilter
|
||||
//
|
||||
// Example:
|
||||
//
|
||||
// ff, err := obikmer.LoadFrequencyFilter("./my_filter")
|
||||
func LoadFrequencyFilter(directory string) (*FrequencyFilter, error) {
|
||||
// Charger le KmerSetGroup
|
||||
ksg, err := LoadKmerSetGroup(directory)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
// Vérifier que c'est bien un FrequencyFilter
|
||||
if typeAttr, ok := ksg.GetAttribute("type"); !ok || typeAttr != "FrequencyFilter" {
|
||||
return nil, fmt.Errorf("loaded data is not a FrequencyFilter (type=%v)", typeAttr)
|
||||
}
|
||||
|
||||
// Récupérer min_freq
|
||||
minFreqAttr, ok := ksg.GetIntAttribute("min_freq")
|
||||
if !ok {
|
||||
return nil, fmt.Errorf("FrequencyFilter missing min_freq attribute")
|
||||
}
|
||||
|
||||
// Créer le FrequencyFilter
|
||||
ff := &FrequencyFilter{
|
||||
KmerSetGroup: ksg,
|
||||
MinFreq: minFreqAttr,
|
||||
}
|
||||
|
||||
return ff, nil
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// UTILITAIRES
|
||||
// ==================================
|
||||
|
||||
// Contains vérifie si un k-mer a atteint la fréquence minimale
|
||||
func (ff *FrequencyFilter) Contains(kmer uint64) bool {
|
||||
canonical := CanonicalKmer(kmer, ff.K())
|
||||
return ff.Get(ff.MinFreq - 1).Contains(canonical)
|
||||
}
|
||||
|
||||
// GetFrequency returns the approximate frequency of a k-mer
|
||||
// Retourne le niveau maximum atteint (freq ≥ niveau)
|
||||
func (ff *FrequencyFilter) GetFrequency(kmer uint64) int {
|
||||
canonical := CanonicalKmer(kmer, ff.K())
|
||||
|
||||
freq := 0
|
||||
for i := 0; i < ff.MinFreq; i++ {
|
||||
if ff.Get(i).Contains(canonical) {
|
||||
freq = i + 1
|
||||
} else {
|
||||
break
|
||||
}
|
||||
}
|
||||
|
||||
return freq
|
||||
}
|
||||
|
||||
// Len returns the number of filtered k-mers or at a specific level
|
||||
// Without argument: returns the number of k-mers with freq ≥ minFreq (last level)
|
||||
// With argument level: returns the number of k-mers with freq ≥ (level+1)
|
||||
// Exemple: Len() pour les k-mers filtrés, Len(2) pour freq ≥ 3
|
||||
// (héritée de KmerSetGroup mais redéfinie pour la documentation)
|
||||
func (ff *FrequencyFilter) Len(level ...int) uint64 {
|
||||
return ff.KmerSetGroup.Len(level...)
|
||||
}
|
||||
|
||||
// MemoryUsage returns memory usage in bytes
|
||||
// (héritée de KmerSetGroup mais redéfinie pour clarté)
|
||||
func (ff *FrequencyFilter) MemoryUsage() uint64 {
|
||||
return ff.KmerSetGroup.MemoryUsage()
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// COMPARAISON AVEC D'AUTRES APPROCHES
|
||||
// ==================================
|
||||
|
||||
// CompareWithSimpleMap compare la mémoire avec une simple map
|
||||
func (ff *FrequencyFilter) CompareWithSimpleMap() string {
|
||||
totalKmers := ff.Get(0).Len()
|
||||
|
||||
simpleMapBytes := totalKmers * 24 // ~24 bytes par entrée
|
||||
roaringBytes := ff.MemoryUsage()
|
||||
|
||||
reduction := float64(simpleMapBytes) / float64(roaringBytes)
|
||||
|
||||
return fmt.Sprintf(`Memory Comparison for %d k-mers:
|
||||
Simple map[uint64]uint32: %.2f MB
|
||||
Roaring filter (v=%d): %.2f MB
|
||||
Reduction: %.1fx
|
||||
`,
|
||||
totalKmers,
|
||||
float64(simpleMapBytes)/1024/1024,
|
||||
ff.MinFreq,
|
||||
float64(roaringBytes)/1024/1024,
|
||||
reduction,
|
||||
)
|
||||
}
|
||||
86
pkg/obikmer/kdi_merge.go
Normal file
86
pkg/obikmer/kdi_merge.go
Normal file
@@ -0,0 +1,86 @@
|
||||
package obikmer
|
||||
|
||||
import "container/heap"
|
||||
|
||||
// mergeItem represents an element in the min-heap for k-way merge.
|
||||
type mergeItem struct {
|
||||
value uint64
|
||||
idx int // index of the reader that produced this value
|
||||
}
|
||||
|
||||
// mergeHeap implements heap.Interface for k-way merge.
|
||||
type mergeHeap []mergeItem
|
||||
|
||||
func (h mergeHeap) Len() int { return len(h) }
|
||||
func (h mergeHeap) Less(i, j int) bool { return h[i].value < h[j].value }
|
||||
func (h mergeHeap) Swap(i, j int) { h[i], h[j] = h[j], h[i] }
|
||||
func (h *mergeHeap) Push(x interface{}) { *h = append(*h, x.(mergeItem)) }
|
||||
func (h *mergeHeap) Pop() interface{} {
|
||||
old := *h
|
||||
n := len(old)
|
||||
x := old[n-1]
|
||||
*h = old[:n-1]
|
||||
return x
|
||||
}
|
||||
|
||||
// KWayMerge performs a k-way merge of multiple sorted KdiReader streams.
|
||||
// For each unique k-mer value, it reports the value and the number of
|
||||
// input streams that contained it (count).
|
||||
type KWayMerge struct {
|
||||
h mergeHeap
|
||||
readers []*KdiReader
|
||||
}
|
||||
|
||||
// NewKWayMerge creates a k-way merge from multiple KdiReaders.
|
||||
// Each reader must produce values in sorted (ascending) order.
|
||||
func NewKWayMerge(readers []*KdiReader) *KWayMerge {
|
||||
m := &KWayMerge{
|
||||
h: make(mergeHeap, 0, len(readers)),
|
||||
readers: readers,
|
||||
}
|
||||
|
||||
// Initialize heap with first value from each reader
|
||||
for i, r := range readers {
|
||||
if v, ok := r.Next(); ok {
|
||||
m.h = append(m.h, mergeItem{value: v, idx: i})
|
||||
}
|
||||
}
|
||||
heap.Init(&m.h)
|
||||
|
||||
return m
|
||||
}
|
||||
|
||||
// Next returns the next smallest k-mer value, the number of readers
|
||||
// that contained this value (count), and true.
|
||||
// Returns (0, 0, false) when all streams are exhausted.
|
||||
func (m *KWayMerge) Next() (kmer uint64, count int, ok bool) {
|
||||
if len(m.h) == 0 {
|
||||
return 0, 0, false
|
||||
}
|
||||
|
||||
minVal := m.h[0].value
|
||||
count = 0
|
||||
|
||||
// Pop all items with the same value
|
||||
for len(m.h) > 0 && m.h[0].value == minVal {
|
||||
item := heap.Pop(&m.h).(mergeItem)
|
||||
count++
|
||||
// Advance that reader
|
||||
if v, ok := m.readers[item.idx].Next(); ok {
|
||||
heap.Push(&m.h, mergeItem{value: v, idx: item.idx})
|
||||
}
|
||||
}
|
||||
|
||||
return minVal, count, true
|
||||
}
|
||||
|
||||
// Close closes all underlying readers.
|
||||
func (m *KWayMerge) Close() error {
|
||||
var firstErr error
|
||||
for _, r := range m.readers {
|
||||
if err := r.Close(); err != nil && firstErr == nil {
|
||||
firstErr = err
|
||||
}
|
||||
}
|
||||
return firstErr
|
||||
}
|
||||
159
pkg/obikmer/kdi_merge_test.go
Normal file
159
pkg/obikmer/kdi_merge_test.go
Normal file
@@ -0,0 +1,159 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"path/filepath"
|
||||
"testing"
|
||||
)
|
||||
|
||||
// writeKdi is a helper that writes sorted kmers to a .kdi file.
|
||||
func writeKdi(t *testing.T, dir, name string, kmers []uint64) string {
|
||||
t.Helper()
|
||||
path := filepath.Join(dir, name)
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
for _, v := range kmers {
|
||||
if err := w.Write(v); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
return path
|
||||
}
|
||||
|
||||
func TestKWayMergeBasic(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
// Three sorted streams
|
||||
p1 := writeKdi(t, dir, "a.kdi", []uint64{1, 3, 5, 7})
|
||||
p2 := writeKdi(t, dir, "b.kdi", []uint64{2, 3, 6, 7})
|
||||
p3 := writeKdi(t, dir, "c.kdi", []uint64{3, 4, 7, 8})
|
||||
|
||||
r1, _ := NewKdiReader(p1)
|
||||
r2, _ := NewKdiReader(p2)
|
||||
r3, _ := NewKdiReader(p3)
|
||||
|
||||
m := NewKWayMerge([]*KdiReader{r1, r2, r3})
|
||||
defer m.Close()
|
||||
|
||||
type result struct {
|
||||
kmer uint64
|
||||
count int
|
||||
}
|
||||
var results []result
|
||||
for {
|
||||
kmer, count, ok := m.Next()
|
||||
if !ok {
|
||||
break
|
||||
}
|
||||
results = append(results, result{kmer, count})
|
||||
}
|
||||
|
||||
expected := []result{
|
||||
{1, 1}, {2, 1}, {3, 3}, {4, 1}, {5, 1}, {6, 1}, {7, 3}, {8, 1},
|
||||
}
|
||||
if len(results) != len(expected) {
|
||||
t.Fatalf("got %d results, want %d", len(results), len(expected))
|
||||
}
|
||||
for i, exp := range expected {
|
||||
if results[i] != exp {
|
||||
t.Errorf("result %d: got %+v, want %+v", i, results[i], exp)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestKWayMergeSingleStream(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
p := writeKdi(t, dir, "a.kdi", []uint64{10, 20, 30})
|
||||
|
||||
r, _ := NewKdiReader(p)
|
||||
m := NewKWayMerge([]*KdiReader{r})
|
||||
defer m.Close()
|
||||
|
||||
vals := []uint64{10, 20, 30}
|
||||
for _, expected := range vals {
|
||||
kmer, count, ok := m.Next()
|
||||
if !ok {
|
||||
t.Fatal("unexpected EOF")
|
||||
}
|
||||
if kmer != expected || count != 1 {
|
||||
t.Fatalf("got (%d, %d), want (%d, 1)", kmer, count, expected)
|
||||
}
|
||||
}
|
||||
_, _, ok := m.Next()
|
||||
if ok {
|
||||
t.Fatal("expected EOF")
|
||||
}
|
||||
}
|
||||
|
||||
func TestKWayMergeEmpty(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
p1 := writeKdi(t, dir, "a.kdi", nil)
|
||||
p2 := writeKdi(t, dir, "b.kdi", nil)
|
||||
|
||||
r1, _ := NewKdiReader(p1)
|
||||
r2, _ := NewKdiReader(p2)
|
||||
|
||||
m := NewKWayMerge([]*KdiReader{r1, r2})
|
||||
defer m.Close()
|
||||
|
||||
_, _, ok := m.Next()
|
||||
if ok {
|
||||
t.Fatal("expected no results from empty streams")
|
||||
}
|
||||
}
|
||||
|
||||
func TestKWayMergeDisjoint(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
p1 := writeKdi(t, dir, "a.kdi", []uint64{1, 2, 3})
|
||||
p2 := writeKdi(t, dir, "b.kdi", []uint64{10, 20, 30})
|
||||
|
||||
r1, _ := NewKdiReader(p1)
|
||||
r2, _ := NewKdiReader(p2)
|
||||
|
||||
m := NewKWayMerge([]*KdiReader{r1, r2})
|
||||
defer m.Close()
|
||||
|
||||
expected := []uint64{1, 2, 3, 10, 20, 30}
|
||||
for _, exp := range expected {
|
||||
kmer, count, ok := m.Next()
|
||||
if !ok {
|
||||
t.Fatal("unexpected EOF")
|
||||
}
|
||||
if kmer != exp || count != 1 {
|
||||
t.Fatalf("got (%d, %d), want (%d, 1)", kmer, count, exp)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestKWayMergeAllSame(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
p1 := writeKdi(t, dir, "a.kdi", []uint64{42})
|
||||
p2 := writeKdi(t, dir, "b.kdi", []uint64{42})
|
||||
p3 := writeKdi(t, dir, "c.kdi", []uint64{42})
|
||||
|
||||
r1, _ := NewKdiReader(p1)
|
||||
r2, _ := NewKdiReader(p2)
|
||||
r3, _ := NewKdiReader(p3)
|
||||
|
||||
m := NewKWayMerge([]*KdiReader{r1, r2, r3})
|
||||
defer m.Close()
|
||||
|
||||
kmer, count, ok := m.Next()
|
||||
if !ok {
|
||||
t.Fatal("expected one result")
|
||||
}
|
||||
if kmer != 42 || count != 3 {
|
||||
t.Fatalf("got (%d, %d), want (42, 3)", kmer, count)
|
||||
}
|
||||
_, _, ok = m.Next()
|
||||
if ok {
|
||||
t.Fatal("expected EOF")
|
||||
}
|
||||
}
|
||||
170
pkg/obikmer/kdi_reader.go
Normal file
170
pkg/obikmer/kdi_reader.go
Normal file
@@ -0,0 +1,170 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"bufio"
|
||||
"encoding/binary"
|
||||
"fmt"
|
||||
"io"
|
||||
"os"
|
||||
)
|
||||
|
||||
// KdiReader reads k-mers from a .kdi file using streaming delta-varint decoding.
|
||||
type KdiReader struct {
|
||||
r *bufio.Reader
|
||||
file *os.File
|
||||
count uint64 // total number of k-mers
|
||||
read uint64 // number of k-mers already consumed
|
||||
prev uint64 // last decoded value
|
||||
started bool // whether first value has been read
|
||||
index *KdxIndex // optional sparse index for seeking
|
||||
}
|
||||
|
||||
// NewKdiReader opens a .kdi file for streaming reading (no index).
|
||||
func NewKdiReader(path string) (*KdiReader, error) {
|
||||
return openKdiReader(path, nil)
|
||||
}
|
||||
|
||||
// NewKdiIndexedReader opens a .kdi file with its companion .kdx index
|
||||
// loaded for fast seeking. If the .kdx file does not exist, it gracefully
|
||||
// falls back to sequential reading.
|
||||
func NewKdiIndexedReader(path string) (*KdiReader, error) {
|
||||
kdxPath := KdxPathForKdi(path)
|
||||
idx, err := LoadKdxIndex(kdxPath)
|
||||
if err != nil {
|
||||
// Index load failed — fall back to non-indexed
|
||||
return openKdiReader(path, nil)
|
||||
}
|
||||
// idx may be nil if file does not exist — that's fine
|
||||
return openKdiReader(path, idx)
|
||||
}
|
||||
|
||||
func openKdiReader(path string, idx *KdxIndex) (*KdiReader, error) {
|
||||
f, err := os.Open(path)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
r := bufio.NewReaderSize(f, 65536)
|
||||
|
||||
// Read and verify magic
|
||||
var magic [4]byte
|
||||
if _, err := io.ReadFull(r, magic[:]); err != nil {
|
||||
f.Close()
|
||||
return nil, fmt.Errorf("kdi: read magic: %w", err)
|
||||
}
|
||||
if magic != kdiMagic {
|
||||
f.Close()
|
||||
return nil, fmt.Errorf("kdi: bad magic %v", magic)
|
||||
}
|
||||
|
||||
// Read count
|
||||
var countBuf [8]byte
|
||||
if _, err := io.ReadFull(r, countBuf[:]); err != nil {
|
||||
f.Close()
|
||||
return nil, fmt.Errorf("kdi: read count: %w", err)
|
||||
}
|
||||
count := binary.LittleEndian.Uint64(countBuf[:])
|
||||
|
||||
return &KdiReader{
|
||||
r: r,
|
||||
file: f,
|
||||
count: count,
|
||||
index: idx,
|
||||
}, nil
|
||||
}
|
||||
|
||||
// Next returns the next k-mer and true, or (0, false) when exhausted.
|
||||
func (kr *KdiReader) Next() (uint64, bool) {
|
||||
if kr.read >= kr.count {
|
||||
return 0, false
|
||||
}
|
||||
|
||||
if !kr.started {
|
||||
// Read first value as absolute uint64 LE
|
||||
var buf [8]byte
|
||||
if _, err := io.ReadFull(kr.r, buf[:]); err != nil {
|
||||
return 0, false
|
||||
}
|
||||
kr.prev = binary.LittleEndian.Uint64(buf[:])
|
||||
kr.started = true
|
||||
kr.read++
|
||||
return kr.prev, true
|
||||
}
|
||||
|
||||
// Read delta varint
|
||||
delta, err := DecodeVarint(kr.r)
|
||||
if err != nil {
|
||||
return 0, false
|
||||
}
|
||||
kr.prev += delta
|
||||
kr.read++
|
||||
return kr.prev, true
|
||||
}
|
||||
|
||||
// SeekTo positions the reader near the target k-mer using the sparse .kdx index.
|
||||
// After SeekTo, the reader is positioned so that the next call to Next()
|
||||
// returns the k-mer immediately after the indexed entry at or before target.
|
||||
//
|
||||
// If the reader has no index, or the target is before the current position,
|
||||
// SeekTo does nothing (linear scan continues from current position).
|
||||
func (kr *KdiReader) SeekTo(target uint64) error {
|
||||
if kr.index == nil {
|
||||
return nil
|
||||
}
|
||||
|
||||
// If we've already passed the target, we can't seek backwards
|
||||
if kr.started && kr.prev >= target {
|
||||
return nil
|
||||
}
|
||||
|
||||
offset, skipCount, ok := kr.index.FindOffset(target)
|
||||
if !ok {
|
||||
return nil
|
||||
}
|
||||
|
||||
// skipCount is the number of k-mers consumed at the indexed position.
|
||||
// The index was recorded AFTER writing the k-mer at position skipCount-1
|
||||
// (since count%stride==0 after incrementing count). So the actual number
|
||||
// of k-mers consumed is skipCount (the entry's kmer is the last one
|
||||
// before the offset).
|
||||
|
||||
// Only seek if it would skip significant work
|
||||
if kr.started && skipCount <= kr.read {
|
||||
return nil
|
||||
}
|
||||
|
||||
// The index entry stores (kmer_value, byte_offset_after_that_kmer).
|
||||
// skipCount = (entryIdx+1)*stride, so entryIdx = skipCount/stride - 1
|
||||
// We seek to that offset, set prev = indexedKmer, and the next Next()
|
||||
// call will read the delta-varint of the following k-mer.
|
||||
entryIdx := int(skipCount)/kr.index.stride - 1
|
||||
if entryIdx < 0 || entryIdx >= len(kr.index.entries) {
|
||||
return nil
|
||||
}
|
||||
indexedKmer := kr.index.entries[entryIdx].kmer
|
||||
|
||||
if _, err := kr.file.Seek(int64(offset), io.SeekStart); err != nil {
|
||||
return fmt.Errorf("kdi: seek: %w", err)
|
||||
}
|
||||
kr.r.Reset(kr.file)
|
||||
|
||||
kr.prev = indexedKmer
|
||||
kr.started = true
|
||||
kr.read = skipCount
|
||||
|
||||
return nil
|
||||
}
|
||||
|
||||
// Count returns the total number of k-mers in this partition.
|
||||
func (kr *KdiReader) Count() uint64 {
|
||||
return kr.count
|
||||
}
|
||||
|
||||
// Remaining returns how many k-mers have not been read yet.
|
||||
func (kr *KdiReader) Remaining() uint64 {
|
||||
return kr.count - kr.read
|
||||
}
|
||||
|
||||
// Close closes the underlying file.
|
||||
func (kr *KdiReader) Close() error {
|
||||
return kr.file.Close()
|
||||
}
|
||||
255
pkg/obikmer/kdi_test.go
Normal file
255
pkg/obikmer/kdi_test.go
Normal file
@@ -0,0 +1,255 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"os"
|
||||
"path/filepath"
|
||||
"sort"
|
||||
"testing"
|
||||
)
|
||||
|
||||
func TestKdiRoundTrip(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "test.kdi")
|
||||
|
||||
// Sorted k-mer values
|
||||
kmers := []uint64{10, 20, 30, 100, 200, 500, 10000, 1 << 40, 1<<62 - 1}
|
||||
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
for _, v := range kmers {
|
||||
if err := w.Write(v); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
}
|
||||
if w.Count() != uint64(len(kmers)) {
|
||||
t.Fatalf("writer count: got %d, want %d", w.Count(), len(kmers))
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Read back
|
||||
r, err := NewKdiReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
if r.Count() != uint64(len(kmers)) {
|
||||
t.Fatalf("reader count: got %d, want %d", r.Count(), len(kmers))
|
||||
}
|
||||
|
||||
for i, expected := range kmers {
|
||||
got, ok := r.Next()
|
||||
if !ok {
|
||||
t.Fatalf("unexpected EOF at index %d", i)
|
||||
}
|
||||
if got != expected {
|
||||
t.Fatalf("kmer %d: got %d, want %d", i, got, expected)
|
||||
}
|
||||
}
|
||||
|
||||
_, ok := r.Next()
|
||||
if ok {
|
||||
t.Fatal("expected EOF after all k-mers")
|
||||
}
|
||||
}
|
||||
|
||||
func TestKdiEmpty(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "empty.kdi")
|
||||
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
r, err := NewKdiReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
if r.Count() != 0 {
|
||||
t.Fatalf("expected count 0, got %d", r.Count())
|
||||
}
|
||||
|
||||
_, ok := r.Next()
|
||||
if ok {
|
||||
t.Fatal("expected no k-mers in empty file")
|
||||
}
|
||||
}
|
||||
|
||||
func TestKdiSingleValue(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "single.kdi")
|
||||
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Write(42); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
r, err := NewKdiReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
if r.Count() != 1 {
|
||||
t.Fatalf("expected count 1, got %d", r.Count())
|
||||
}
|
||||
|
||||
v, ok := r.Next()
|
||||
if !ok {
|
||||
t.Fatal("expected one k-mer")
|
||||
}
|
||||
if v != 42 {
|
||||
t.Fatalf("got %d, want 42", v)
|
||||
}
|
||||
}
|
||||
|
||||
func TestKdiFileSize(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "size.kdi")
|
||||
|
||||
// Write: magic(4) + count(8) + first(8) = 20 bytes
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Write(0); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
info, err := os.Stat(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
// magic(4) + count(8) + first(8) = 20
|
||||
if info.Size() != 20 {
|
||||
t.Fatalf("file size: got %d, want 20", info.Size())
|
||||
}
|
||||
}
|
||||
|
||||
func TestKdiDeltaCompression(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "delta.kdi")
|
||||
|
||||
// Dense consecutive values should compress well
|
||||
n := 10000
|
||||
kmers := make([]uint64, n)
|
||||
for i := range kmers {
|
||||
kmers[i] = uint64(i * 2) // even numbers
|
||||
}
|
||||
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
for _, v := range kmers {
|
||||
if err := w.Write(v); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Each delta is 2, encoded as 1 byte varint
|
||||
// Total: magic(4) + count(8) + first(8) + (n-1)*1 = 20 + 9999 bytes
|
||||
info, err := os.Stat(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
expected := int64(20 + n - 1)
|
||||
if info.Size() != expected {
|
||||
t.Fatalf("file size: got %d, want %d", info.Size(), expected)
|
||||
}
|
||||
|
||||
// Verify round-trip
|
||||
r, err := NewKdiReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
for i, expected := range kmers {
|
||||
got, ok := r.Next()
|
||||
if !ok {
|
||||
t.Fatalf("unexpected EOF at index %d", i)
|
||||
}
|
||||
if got != expected {
|
||||
t.Fatalf("kmer %d: got %d, want %d", i, got, expected)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestKdiFromRealKmers(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "real.kdi")
|
||||
|
||||
// Extract k-mers from a sequence, sort, dedup, write to KDI
|
||||
seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT")
|
||||
k := 15
|
||||
|
||||
var kmers []uint64
|
||||
for kmer := range IterCanonicalKmers(seq, k) {
|
||||
kmers = append(kmers, kmer)
|
||||
}
|
||||
sort.Slice(kmers, func(i, j int) bool { return kmers[i] < kmers[j] })
|
||||
// Dedup
|
||||
deduped := kmers[:0]
|
||||
for i, v := range kmers {
|
||||
if i == 0 || v != kmers[i-1] {
|
||||
deduped = append(deduped, v)
|
||||
}
|
||||
}
|
||||
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
for _, v := range deduped {
|
||||
if err := w.Write(v); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Read back and verify
|
||||
r, err := NewKdiReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
if r.Count() != uint64(len(deduped)) {
|
||||
t.Fatalf("count: got %d, want %d", r.Count(), len(deduped))
|
||||
}
|
||||
|
||||
for i, expected := range deduped {
|
||||
got, ok := r.Next()
|
||||
if !ok {
|
||||
t.Fatalf("unexpected EOF at index %d", i)
|
||||
}
|
||||
if got != expected {
|
||||
t.Fatalf("kmer %d: got %d, want %d", i, got, expected)
|
||||
}
|
||||
}
|
||||
}
|
||||
151
pkg/obikmer/kdi_writer.go
Normal file
151
pkg/obikmer/kdi_writer.go
Normal file
@@ -0,0 +1,151 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"bufio"
|
||||
"encoding/binary"
|
||||
"os"
|
||||
)
|
||||
|
||||
// KDI file magic bytes: "KDI\x01"
|
||||
var kdiMagic = [4]byte{'K', 'D', 'I', 0x01}
|
||||
|
||||
// kdiHeaderSize is the size of the KDI header: magic(4) + count(8) = 12 bytes.
|
||||
const kdiHeaderSize = 12
|
||||
|
||||
// KdiWriter writes a sorted sequence of uint64 k-mers to a .kdi file
|
||||
// using delta-varint encoding.
|
||||
//
|
||||
// Format:
|
||||
//
|
||||
// [magic: 4 bytes "KDI\x01"]
|
||||
// [count: uint64 LE] number of k-mers
|
||||
// [first: uint64 LE] first k-mer (absolute value)
|
||||
// [delta_1: varint] arr[1] - arr[0]
|
||||
// [delta_2: varint] arr[2] - arr[1]
|
||||
// ...
|
||||
//
|
||||
// The caller must write k-mers in strictly increasing order.
|
||||
//
|
||||
// On Close(), a companion .kdx sparse index file is written alongside
|
||||
// the .kdi file for fast random access.
|
||||
type KdiWriter struct {
|
||||
w *bufio.Writer
|
||||
file *os.File
|
||||
count uint64
|
||||
prev uint64
|
||||
first bool
|
||||
path string
|
||||
bytesWritten uint64 // bytes written after header (data section offset)
|
||||
indexEntries []kdxEntry // sparse index entries collected during writes
|
||||
}
|
||||
|
||||
// NewKdiWriter creates a new KdiWriter writing to the given file path.
|
||||
// The header (magic + count placeholder) is written immediately.
|
||||
// Count is patched on Close().
|
||||
func NewKdiWriter(path string) (*KdiWriter, error) {
|
||||
f, err := os.Create(path)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
w := bufio.NewWriterSize(f, 65536)
|
||||
|
||||
// Write magic
|
||||
if _, err := w.Write(kdiMagic[:]); err != nil {
|
||||
f.Close()
|
||||
return nil, err
|
||||
}
|
||||
// Write placeholder for count (will be patched on Close)
|
||||
var countBuf [8]byte
|
||||
if _, err := w.Write(countBuf[:]); err != nil {
|
||||
f.Close()
|
||||
return nil, err
|
||||
}
|
||||
|
||||
return &KdiWriter{
|
||||
w: w,
|
||||
file: f,
|
||||
first: true,
|
||||
path: path,
|
||||
bytesWritten: 0,
|
||||
indexEntries: make([]kdxEntry, 0, 256),
|
||||
}, nil
|
||||
}
|
||||
|
||||
// Write adds a k-mer to the file. K-mers must be written in strictly
|
||||
// increasing order.
|
||||
func (kw *KdiWriter) Write(kmer uint64) error {
|
||||
if kw.first {
|
||||
// Write first value as absolute uint64 LE
|
||||
var buf [8]byte
|
||||
binary.LittleEndian.PutUint64(buf[:], kmer)
|
||||
if _, err := kw.w.Write(buf[:]); err != nil {
|
||||
return err
|
||||
}
|
||||
kw.bytesWritten += 8
|
||||
kw.prev = kmer
|
||||
kw.first = false
|
||||
} else {
|
||||
delta := kmer - kw.prev
|
||||
n, err := EncodeVarint(kw.w, delta)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
kw.bytesWritten += uint64(n)
|
||||
kw.prev = kmer
|
||||
}
|
||||
kw.count++
|
||||
|
||||
// Record sparse index entry every defaultKdxStride k-mers.
|
||||
// The offset recorded is AFTER writing this k-mer, so it points to
|
||||
// where the next k-mer's data will start. SeekTo uses this: it seeks
|
||||
// to the recorded offset, sets prev = indexedKmer, and Next() reads
|
||||
// the delta of the following k-mer.
|
||||
if kw.count%defaultKdxStride == 0 {
|
||||
kw.indexEntries = append(kw.indexEntries, kdxEntry{
|
||||
kmer: kmer,
|
||||
offset: kdiHeaderSize + kw.bytesWritten,
|
||||
})
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
|
||||
// Count returns the number of k-mers written so far.
|
||||
func (kw *KdiWriter) Count() uint64 {
|
||||
return kw.count
|
||||
}
|
||||
|
||||
// Close flushes buffered data, patches the count in the header,
|
||||
// writes the companion .kdx index file, and closes the file.
|
||||
func (kw *KdiWriter) Close() error {
|
||||
if err := kw.w.Flush(); err != nil {
|
||||
kw.file.Close()
|
||||
return err
|
||||
}
|
||||
|
||||
// Patch count at offset 4 (after magic)
|
||||
if _, err := kw.file.Seek(4, 0); err != nil {
|
||||
kw.file.Close()
|
||||
return err
|
||||
}
|
||||
var countBuf [8]byte
|
||||
binary.LittleEndian.PutUint64(countBuf[:], kw.count)
|
||||
if _, err := kw.file.Write(countBuf[:]); err != nil {
|
||||
kw.file.Close()
|
||||
return err
|
||||
}
|
||||
|
||||
if err := kw.file.Close(); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Write .kdx index file if there are entries to index
|
||||
if len(kw.indexEntries) > 0 {
|
||||
kdxPath := KdxPathForKdi(kw.path)
|
||||
if err := WriteKdxIndex(kdxPath, defaultKdxStride, kw.indexEntries); err != nil {
|
||||
return err
|
||||
}
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
170
pkg/obikmer/kdx.go
Normal file
170
pkg/obikmer/kdx.go
Normal file
@@ -0,0 +1,170 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"encoding/binary"
|
||||
"fmt"
|
||||
"io"
|
||||
"os"
|
||||
"sort"
|
||||
"strings"
|
||||
)
|
||||
|
||||
// KDX file magic bytes: "KDX\x01"
|
||||
var kdxMagic = [4]byte{'K', 'D', 'X', 0x01}
|
||||
|
||||
// defaultKdxStride is the number of k-mers between consecutive index entries.
|
||||
const defaultKdxStride = 4096
|
||||
|
||||
// kdxEntry is a single entry in the sparse index: the absolute k-mer value
|
||||
// and the byte offset in the corresponding .kdi file where that k-mer is stored.
|
||||
type kdxEntry struct {
|
||||
kmer uint64
|
||||
offset uint64 // absolute byte offset in .kdi file
|
||||
}
|
||||
|
||||
// KdxIndex is a sparse, in-memory index for a .kdi file.
|
||||
// It stores one entry every `stride` k-mers, enabling O(log N / stride)
|
||||
// binary search followed by at most `stride` linear scan steps.
|
||||
type KdxIndex struct {
|
||||
stride int
|
||||
entries []kdxEntry
|
||||
}
|
||||
|
||||
// LoadKdxIndex reads a .kdx file into memory.
|
||||
// Returns (nil, nil) if the file does not exist (graceful degradation).
|
||||
func LoadKdxIndex(path string) (*KdxIndex, error) {
|
||||
f, err := os.Open(path)
|
||||
if err != nil {
|
||||
if os.IsNotExist(err) {
|
||||
return nil, nil
|
||||
}
|
||||
return nil, err
|
||||
}
|
||||
defer f.Close()
|
||||
|
||||
// Read magic
|
||||
var magic [4]byte
|
||||
if _, err := io.ReadFull(f, magic[:]); err != nil {
|
||||
return nil, fmt.Errorf("kdx: read magic: %w", err)
|
||||
}
|
||||
if magic != kdxMagic {
|
||||
return nil, fmt.Errorf("kdx: bad magic %v", magic)
|
||||
}
|
||||
|
||||
// Read stride (uint32 LE)
|
||||
var buf4 [4]byte
|
||||
if _, err := io.ReadFull(f, buf4[:]); err != nil {
|
||||
return nil, fmt.Errorf("kdx: read stride: %w", err)
|
||||
}
|
||||
stride := int(binary.LittleEndian.Uint32(buf4[:]))
|
||||
|
||||
// Read count (uint32 LE)
|
||||
if _, err := io.ReadFull(f, buf4[:]); err != nil {
|
||||
return nil, fmt.Errorf("kdx: read count: %w", err)
|
||||
}
|
||||
count := int(binary.LittleEndian.Uint32(buf4[:]))
|
||||
|
||||
// Read entries
|
||||
entries := make([]kdxEntry, count)
|
||||
var buf16 [16]byte
|
||||
for i := 0; i < count; i++ {
|
||||
if _, err := io.ReadFull(f, buf16[:]); err != nil {
|
||||
return nil, fmt.Errorf("kdx: read entry %d: %w", i, err)
|
||||
}
|
||||
entries[i] = kdxEntry{
|
||||
kmer: binary.LittleEndian.Uint64(buf16[0:8]),
|
||||
offset: binary.LittleEndian.Uint64(buf16[8:16]),
|
||||
}
|
||||
}
|
||||
|
||||
return &KdxIndex{
|
||||
stride: stride,
|
||||
entries: entries,
|
||||
}, nil
|
||||
}
|
||||
|
||||
// FindOffset locates the best starting point in the .kdi file to scan for
|
||||
// the target k-mer. It returns:
|
||||
// - offset: the byte offset in the .kdi file to seek to (positioned after
|
||||
// the indexed k-mer, ready to read the next delta)
|
||||
// - skipCount: the number of k-mers already consumed at that offset
|
||||
// (to set the reader's internal counter)
|
||||
// - ok: true if the index provides a useful starting point
|
||||
//
|
||||
// Index entries are recorded at k-mer count positions stride, 2*stride, etc.
|
||||
// Entry i corresponds to the k-mer written at count = (i+1)*stride.
|
||||
func (idx *KdxIndex) FindOffset(target uint64) (offset uint64, skipCount uint64, ok bool) {
|
||||
if idx == nil || len(idx.entries) == 0 {
|
||||
return 0, 0, false
|
||||
}
|
||||
|
||||
// Binary search: find the largest entry with kmer <= target
|
||||
i := sort.Search(len(idx.entries), func(i int) bool {
|
||||
return idx.entries[i].kmer > target
|
||||
})
|
||||
// i is the first entry with kmer > target, so i-1 is the last with kmer <= target
|
||||
if i == 0 {
|
||||
// Target is before the first index entry.
|
||||
// No useful jump point — caller should scan from the beginning.
|
||||
return 0, 0, false
|
||||
}
|
||||
|
||||
i-- // largest entry with kmer <= target
|
||||
// Entry i was recorded after writing k-mer at count = (i+1)*stride
|
||||
skipCount = uint64(i+1) * uint64(idx.stride)
|
||||
return idx.entries[i].offset, skipCount, true
|
||||
}
|
||||
|
||||
// Stride returns the stride of this index.
|
||||
func (idx *KdxIndex) Stride() int {
|
||||
return idx.stride
|
||||
}
|
||||
|
||||
// Len returns the number of entries in this index.
|
||||
func (idx *KdxIndex) Len() int {
|
||||
return len(idx.entries)
|
||||
}
|
||||
|
||||
// WriteKdxIndex writes a .kdx file from a slice of entries.
|
||||
func WriteKdxIndex(path string, stride int, entries []kdxEntry) error {
|
||||
f, err := os.Create(path)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
defer f.Close()
|
||||
|
||||
// Magic
|
||||
if _, err := f.Write(kdxMagic[:]); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Stride (uint32 LE)
|
||||
var buf4 [4]byte
|
||||
binary.LittleEndian.PutUint32(buf4[:], uint32(stride))
|
||||
if _, err := f.Write(buf4[:]); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Count (uint32 LE)
|
||||
binary.LittleEndian.PutUint32(buf4[:], uint32(len(entries)))
|
||||
if _, err := f.Write(buf4[:]); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Entries
|
||||
var buf16 [16]byte
|
||||
for _, e := range entries {
|
||||
binary.LittleEndian.PutUint64(buf16[0:8], e.kmer)
|
||||
binary.LittleEndian.PutUint64(buf16[8:16], e.offset)
|
||||
if _, err := f.Write(buf16[:]); err != nil {
|
||||
return err
|
||||
}
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
|
||||
// KdxPathForKdi returns the .kdx path corresponding to a .kdi path.
|
||||
func KdxPathForKdi(kdiPath string) string {
|
||||
return strings.TrimSuffix(kdiPath, ".kdi") + ".kdx"
|
||||
}
|
||||
256
pkg/obikmer/kmer_match.go
Normal file
256
pkg/obikmer/kmer_match.go
Normal file
@@ -0,0 +1,256 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"cmp"
|
||||
"slices"
|
||||
"sync"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
// QueryEntry represents a canonical k-mer to look up, together with
|
||||
// metadata to trace the result back to the originating sequence and position.
|
||||
type QueryEntry struct {
|
||||
Kmer uint64 // canonical k-mer value
|
||||
SeqIdx int // index within the batch
|
||||
Pos int // 1-based position in the sequence
|
||||
}
|
||||
|
||||
// MatchResult holds matched positions for each sequence in a batch.
|
||||
// results[i] contains the sorted matched positions for sequence i.
|
||||
type MatchResult [][]int
|
||||
|
||||
// PreparedQueries holds pre-computed query buckets along with the number
|
||||
// of sequences they were built from. This is used by the accumulation
|
||||
// pipeline to merge queries from multiple batches.
|
||||
type PreparedQueries struct {
|
||||
Buckets [][]QueryEntry // queries[partition], each sorted by Kmer
|
||||
NSeqs int // number of sequences that produced these queries
|
||||
NKmers int // total number of k-mer entries across all partitions
|
||||
}
|
||||
|
||||
// MergeQueries merges src into dst, offsetting all SeqIdx values in src
|
||||
// by dst.NSeqs. Both dst and src must have the same number of partitions.
|
||||
// After merging, src should not be reused.
|
||||
//
|
||||
// Each partition's entries are merged in sorted order (merge-sort of two
|
||||
// already-sorted slices).
|
||||
func MergeQueries(dst, src *PreparedQueries) {
|
||||
for p := range dst.Buckets {
|
||||
if len(src.Buckets[p]) == 0 {
|
||||
continue
|
||||
}
|
||||
|
||||
offset := dst.NSeqs
|
||||
srcB := src.Buckets[p]
|
||||
|
||||
// Offset SeqIdx in src entries
|
||||
for i := range srcB {
|
||||
srcB[i].SeqIdx += offset
|
||||
}
|
||||
|
||||
if len(dst.Buckets[p]) == 0 {
|
||||
dst.Buckets[p] = srcB
|
||||
continue
|
||||
}
|
||||
|
||||
// Merge two sorted slices
|
||||
dstB := dst.Buckets[p]
|
||||
merged := make([]QueryEntry, 0, len(dstB)+len(srcB))
|
||||
i, j := 0, 0
|
||||
for i < len(dstB) && j < len(srcB) {
|
||||
if dstB[i].Kmer <= srcB[j].Kmer {
|
||||
merged = append(merged, dstB[i])
|
||||
i++
|
||||
} else {
|
||||
merged = append(merged, srcB[j])
|
||||
j++
|
||||
}
|
||||
}
|
||||
merged = append(merged, dstB[i:]...)
|
||||
merged = append(merged, srcB[j:]...)
|
||||
dst.Buckets[p] = merged
|
||||
}
|
||||
dst.NSeqs += src.NSeqs
|
||||
dst.NKmers += src.NKmers
|
||||
}
|
||||
|
||||
// PrepareQueries extracts all canonical k-mers from a batch of sequences
|
||||
// and groups them by partition using super-kmer minimizers.
|
||||
//
|
||||
// Returns a PreparedQueries with sorted per-partition buckets.
|
||||
func (ksg *KmerSetGroup) PrepareQueries(sequences []*obiseq.BioSequence) *PreparedQueries {
|
||||
P := ksg.partitions
|
||||
k := ksg.k
|
||||
m := ksg.m
|
||||
|
||||
// Pre-allocate partition buckets
|
||||
buckets := make([][]QueryEntry, P)
|
||||
for i := range buckets {
|
||||
buckets[i] = make([]QueryEntry, 0, 64)
|
||||
}
|
||||
|
||||
totalKmers := 0
|
||||
for seqIdx, seq := range sequences {
|
||||
bseq := seq.Sequence()
|
||||
if len(bseq) < k {
|
||||
continue
|
||||
}
|
||||
|
||||
// Iterate super-kmers to get minimizer → partition mapping
|
||||
for sk := range IterSuperKmers(bseq, k, m) {
|
||||
partition := int(sk.Minimizer % uint64(P))
|
||||
|
||||
// Iterate canonical k-mers within this super-kmer
|
||||
skSeq := sk.Sequence
|
||||
if len(skSeq) < k {
|
||||
continue
|
||||
}
|
||||
|
||||
localPos := 0
|
||||
for kmer := range IterCanonicalKmers(skSeq, k) {
|
||||
buckets[partition] = append(buckets[partition], QueryEntry{
|
||||
Kmer: kmer,
|
||||
SeqIdx: seqIdx,
|
||||
Pos: sk.Start + localPos + 1,
|
||||
})
|
||||
localPos++
|
||||
totalKmers++
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// Sort each bucket by k-mer value for merge-scan
|
||||
for p := range buckets {
|
||||
slices.SortFunc(buckets[p], func(a, b QueryEntry) int {
|
||||
return cmp.Compare(a.Kmer, b.Kmer)
|
||||
})
|
||||
}
|
||||
|
||||
return &PreparedQueries{
|
||||
Buckets: buckets,
|
||||
NSeqs: len(sequences),
|
||||
NKmers: totalKmers,
|
||||
}
|
||||
}
|
||||
|
||||
// MatchBatch looks up pre-sorted queries against one set of the index.
|
||||
// Partitions are processed in parallel. For each partition, a merge-scan
|
||||
// compares the sorted queries against the sorted KDI stream.
|
||||
//
|
||||
// Returns a MatchResult where result[i] contains sorted matched positions
|
||||
// for sequence i.
|
||||
func (ksg *KmerSetGroup) MatchBatch(setIndex int, pq *PreparedQueries) MatchResult {
|
||||
P := ksg.partitions
|
||||
|
||||
// Pre-allocated per-sequence results and mutexes.
|
||||
// Each partition goroutine appends to results[seqIdx] with mus[seqIdx] held.
|
||||
// Contention is low: a sequence's k-mers span many partitions, but each
|
||||
// partition processes its queries sequentially and the critical section is tiny.
|
||||
results := make([][]int, pq.NSeqs)
|
||||
mus := make([]sync.Mutex, pq.NSeqs)
|
||||
|
||||
var wg sync.WaitGroup
|
||||
|
||||
for p := 0; p < P; p++ {
|
||||
if len(pq.Buckets[p]) == 0 {
|
||||
continue
|
||||
}
|
||||
wg.Add(1)
|
||||
go func(part int) {
|
||||
defer wg.Done()
|
||||
ksg.matchPartition(setIndex, part, pq.Buckets[part], results, mus)
|
||||
}(p)
|
||||
}
|
||||
|
||||
wg.Wait()
|
||||
|
||||
// Sort positions within each sequence
|
||||
for i := range results {
|
||||
if len(results[i]) > 1 {
|
||||
slices.Sort(results[i])
|
||||
}
|
||||
}
|
||||
|
||||
return MatchResult(results)
|
||||
}
|
||||
|
||||
// matchPartition processes one partition: opens the KDI reader (with index),
|
||||
// seeks to the first query, then merge-scans queries against the KDI stream.
|
||||
func (ksg *KmerSetGroup) matchPartition(
|
||||
setIndex int,
|
||||
partIndex int,
|
||||
queries []QueryEntry, // sorted by Kmer
|
||||
results [][]int,
|
||||
mus []sync.Mutex,
|
||||
) {
|
||||
r, err := NewKdiIndexedReader(ksg.partitionPath(setIndex, partIndex))
|
||||
if err != nil {
|
||||
return
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
if r.Count() == 0 || len(queries) == 0 {
|
||||
return
|
||||
}
|
||||
|
||||
// Seek to the first query's neighborhood
|
||||
if err := r.SeekTo(queries[0].Kmer); err != nil {
|
||||
return
|
||||
}
|
||||
|
||||
// Read first kmer from the stream after seek
|
||||
currentKmer, ok := r.Next()
|
||||
if !ok {
|
||||
return
|
||||
}
|
||||
|
||||
qi := 0 // query index
|
||||
|
||||
for qi < len(queries) {
|
||||
q := queries[qi]
|
||||
|
||||
// If the next query is far ahead, re-seek instead of linear scan.
|
||||
// Only seek if we'd skip more k-mers than the index stride,
|
||||
// otherwise linear scan through the buffer is faster than a syscall.
|
||||
if r.index != nil && q.Kmer > currentKmer && r.Remaining() > uint64(r.index.stride) {
|
||||
_, skipCount, found := r.index.FindOffset(q.Kmer)
|
||||
if found && skipCount > r.read+uint64(r.index.stride) {
|
||||
if err := r.SeekTo(q.Kmer); err == nil {
|
||||
nextKmer, nextOk := r.Next()
|
||||
if !nextOk {
|
||||
return
|
||||
}
|
||||
currentKmer = nextKmer
|
||||
ok = true
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// Advance KDI stream until >= query kmer
|
||||
for currentKmer < q.Kmer {
|
||||
currentKmer, ok = r.Next()
|
||||
if !ok {
|
||||
return // KDI exhausted
|
||||
}
|
||||
}
|
||||
|
||||
if currentKmer == q.Kmer {
|
||||
// Match! Record all queries with this same k-mer value
|
||||
matchedKmer := q.Kmer
|
||||
for qi < len(queries) && queries[qi].Kmer == matchedKmer {
|
||||
idx := queries[qi].SeqIdx
|
||||
mus[idx].Lock()
|
||||
results[idx] = append(results[idx], queries[qi].Pos)
|
||||
mus[idx].Unlock()
|
||||
qi++
|
||||
}
|
||||
} else {
|
||||
// currentKmer > q.Kmer: skip all queries with this kmer value
|
||||
skippedKmer := q.Kmer
|
||||
for qi < len(queries) && queries[qi].Kmer == skippedKmer {
|
||||
qi++
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
@@ -1,217 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"github.com/RoaringBitmap/roaring/roaring64"
|
||||
)
|
||||
|
||||
// KmerSet wraps a set of k-mers stored in a Roaring Bitmap
|
||||
// Provides utility methods for manipulating k-mer sets
|
||||
type KmerSet struct {
|
||||
id string // Unique identifier of the KmerSet
|
||||
k int // Size of k-mers (immutable)
|
||||
bitmap *roaring64.Bitmap // Bitmap containing the k-mers
|
||||
Metadata map[string]interface{} // User metadata (key=atomic value)
|
||||
}
|
||||
|
||||
// NewKmerSet creates a new empty KmerSet
|
||||
func NewKmerSet(k int) *KmerSet {
|
||||
return &KmerSet{
|
||||
k: k,
|
||||
bitmap: roaring64.New(),
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
}
|
||||
|
||||
// NewKmerSetFromBitmap creates a KmerSet from an existing bitmap
|
||||
func NewKmerSetFromBitmap(k int, bitmap *roaring64.Bitmap) *KmerSet {
|
||||
return &KmerSet{
|
||||
k: k,
|
||||
bitmap: bitmap,
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
}
|
||||
|
||||
// K returns the size of k-mers (immutable)
|
||||
func (ks *KmerSet) K() int {
|
||||
return ks.k
|
||||
}
|
||||
|
||||
// AddKmerCode adds an encoded k-mer to the set
|
||||
func (ks *KmerSet) AddKmerCode(kmer uint64) {
|
||||
ks.bitmap.Add(kmer)
|
||||
}
|
||||
|
||||
// AddCanonicalKmerCode adds an encoded canonical k-mer to the set
|
||||
func (ks *KmerSet) AddCanonicalKmerCode(kmer uint64) {
|
||||
canonical := CanonicalKmer(kmer, ks.k)
|
||||
ks.bitmap.Add(canonical)
|
||||
}
|
||||
|
||||
// AddKmer adds a k-mer to the set by encoding the sequence
|
||||
// The sequence must have exactly k nucleotides
|
||||
// Zero-allocation: encodes directly without creating an intermediate slice
|
||||
func (ks *KmerSet) AddKmer(seq []byte) {
|
||||
kmer := EncodeKmer(seq, ks.k)
|
||||
ks.bitmap.Add(kmer)
|
||||
}
|
||||
|
||||
// AddCanonicalKmer adds a canonical k-mer to the set by encoding the sequence
|
||||
// The sequence must have exactly k nucleotides
|
||||
// Zero-allocation: encodes directly in canonical form without creating an intermediate slice
|
||||
func (ks *KmerSet) AddCanonicalKmer(seq []byte) {
|
||||
canonical := EncodeCanonicalKmer(seq, ks.k)
|
||||
ks.bitmap.Add(canonical)
|
||||
}
|
||||
|
||||
// AddSequence adds all k-mers from a sequence to the set
|
||||
// Uses an iterator to avoid allocating an intermediate vector
|
||||
func (ks *KmerSet) AddSequence(seq *obiseq.BioSequence) {
|
||||
rawSeq := seq.Sequence()
|
||||
for canonical := range IterCanonicalKmers(rawSeq, ks.k) {
|
||||
ks.bitmap.Add(canonical)
|
||||
}
|
||||
}
|
||||
|
||||
// AddSequences adds all k-mers from multiple sequences in batch
|
||||
func (ks *KmerSet) AddSequences(sequences *obiseq.BioSequenceSlice) {
|
||||
for _, seq := range *sequences {
|
||||
ks.AddSequence(seq)
|
||||
}
|
||||
}
|
||||
|
||||
// Contains checks if a k-mer is in the set
|
||||
func (ks *KmerSet) Contains(kmer uint64) bool {
|
||||
return ks.bitmap.Contains(kmer)
|
||||
}
|
||||
|
||||
// Len returns the number of k-mers in the set
|
||||
func (ks *KmerSet) Len() uint64 {
|
||||
return ks.bitmap.GetCardinality()
|
||||
}
|
||||
|
||||
// MemoryUsage returns memory usage in bytes
|
||||
func (ks *KmerSet) MemoryUsage() uint64 {
|
||||
return ks.bitmap.GetSizeInBytes()
|
||||
}
|
||||
|
||||
// Clear empties the set
|
||||
func (ks *KmerSet) Clear() {
|
||||
ks.bitmap.Clear()
|
||||
}
|
||||
|
||||
// Copy creates a copy of the set (consistent with BioSequence.Copy)
|
||||
func (ks *KmerSet) Copy() *KmerSet {
|
||||
// Copy metadata
|
||||
metadata := make(map[string]interface{}, len(ks.Metadata))
|
||||
for k, v := range ks.Metadata {
|
||||
metadata[k] = v
|
||||
}
|
||||
|
||||
return &KmerSet{
|
||||
id: ks.id,
|
||||
k: ks.k,
|
||||
bitmap: ks.bitmap.Clone(),
|
||||
Metadata: metadata,
|
||||
}
|
||||
}
|
||||
|
||||
// Id returns the identifier of the KmerSet (consistent with BioSequence.Id)
|
||||
func (ks *KmerSet) Id() string {
|
||||
return ks.id
|
||||
}
|
||||
|
||||
// SetId sets the identifier of the KmerSet (consistent with BioSequence.SetId)
|
||||
func (ks *KmerSet) SetId(id string) {
|
||||
ks.id = id
|
||||
}
|
||||
|
||||
// Union returns the union of this set with another
|
||||
func (ks *KmerSet) Union(other *KmerSet) *KmerSet {
|
||||
if ks.k != other.k {
|
||||
panic(fmt.Sprintf("Cannot union KmerSets with different k values: %d vs %d", ks.k, other.k))
|
||||
}
|
||||
result := ks.bitmap.Clone()
|
||||
result.Or(other.bitmap)
|
||||
return NewKmerSetFromBitmap(ks.k, result)
|
||||
}
|
||||
|
||||
// Intersect returns the intersection of this set with another
|
||||
func (ks *KmerSet) Intersect(other *KmerSet) *KmerSet {
|
||||
if ks.k != other.k {
|
||||
panic(fmt.Sprintf("Cannot intersect KmerSets with different k values: %d vs %d", ks.k, other.k))
|
||||
}
|
||||
result := ks.bitmap.Clone()
|
||||
result.And(other.bitmap)
|
||||
return NewKmerSetFromBitmap(ks.k, result)
|
||||
}
|
||||
|
||||
// Difference returns the difference of this set with another (this - other)
|
||||
func (ks *KmerSet) Difference(other *KmerSet) *KmerSet {
|
||||
if ks.k != other.k {
|
||||
panic(fmt.Sprintf("Cannot subtract KmerSets with different k values: %d vs %d", ks.k, other.k))
|
||||
}
|
||||
result := ks.bitmap.Clone()
|
||||
result.AndNot(other.bitmap)
|
||||
return NewKmerSetFromBitmap(ks.k, result)
|
||||
}
|
||||
|
||||
// JaccardDistance computes the Jaccard distance between two KmerSets.
|
||||
// The Jaccard distance is defined as: 1 - (|A ∩ B| / |A ∪ B|)
|
||||
// where A and B are the two sets.
|
||||
//
|
||||
// Returns:
|
||||
// - 0.0 when sets are identical (distance = 0, similarity = 1)
|
||||
// - 1.0 when sets are completely disjoint (distance = 1, similarity = 0)
|
||||
// - 1.0 when both sets are empty (by convention)
|
||||
//
|
||||
// Time complexity: O(|A| + |B|) for Roaring Bitmap operations
|
||||
// Space complexity: O(1) as operations are done in-place on temporary bitmaps
|
||||
func (ks *KmerSet) JaccardDistance(other *KmerSet) float64 {
|
||||
if ks.k != other.k {
|
||||
panic(fmt.Sprintf("Cannot compute Jaccard distance between KmerSets with different k values: %d vs %d", ks.k, other.k))
|
||||
}
|
||||
|
||||
// Compute intersection cardinality
|
||||
intersectionCard := ks.bitmap.AndCardinality(other.bitmap)
|
||||
|
||||
// Compute union cardinality
|
||||
unionCard := ks.bitmap.OrCardinality(other.bitmap)
|
||||
|
||||
// If union is empty, both sets are empty - return 1.0 by convention
|
||||
if unionCard == 0 {
|
||||
return 1.0
|
||||
}
|
||||
|
||||
// Jaccard similarity = |A ∩ B| / |A ∪ B|
|
||||
similarity := float64(intersectionCard) / float64(unionCard)
|
||||
|
||||
// Jaccard distance = 1 - similarity
|
||||
return 1.0 - similarity
|
||||
}
|
||||
|
||||
// JaccardSimilarity computes the Jaccard similarity coefficient between two KmerSets.
|
||||
// The Jaccard similarity is defined as: |A ∩ B| / |A ∪ B|
|
||||
//
|
||||
// Returns:
|
||||
// - 1.0 when sets are identical (maximum similarity)
|
||||
// - 0.0 when sets are completely disjoint (no similarity)
|
||||
// - 0.0 when both sets are empty (by convention)
|
||||
//
|
||||
// Time complexity: O(|A| + |B|) for Roaring Bitmap operations
|
||||
// Space complexity: O(1) as operations are done in-place on temporary bitmaps
|
||||
func (ks *KmerSet) JaccardSimilarity(other *KmerSet) float64 {
|
||||
return 1.0 - ks.JaccardDistance(other)
|
||||
}
|
||||
|
||||
// Iterator returns an iterator over all k-mers in the set
|
||||
func (ks *KmerSet) Iterator() roaring64.IntIterable64 {
|
||||
return ks.bitmap.Iterator()
|
||||
}
|
||||
|
||||
// Bitmap returns the underlying bitmap (for compatibility)
|
||||
func (ks *KmerSet) Bitmap() *roaring64.Bitmap {
|
||||
return ks.bitmap
|
||||
}
|
||||
@@ -1,362 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"strconv"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
)
|
||||
|
||||
// ==================================
|
||||
// KMER SET ATTRIBUTE API
|
||||
// Mimic BioSequence attribute API from obiseq/attributes.go
|
||||
// ==================================
|
||||
|
||||
// HasAttribute vérifie si une clé d'attribut existe
|
||||
func (ks *KmerSet) HasAttribute(key string) bool {
|
||||
_, ok := ks.Metadata[key]
|
||||
return ok
|
||||
}
|
||||
|
||||
// GetAttribute récupère la valeur d'un attribut
|
||||
// Cas particuliers: "id" utilise Id(), "k" utilise K()
|
||||
func (ks *KmerSet) GetAttribute(key string) (interface{}, bool) {
|
||||
switch key {
|
||||
case "id":
|
||||
return ks.Id(), true
|
||||
case "k":
|
||||
return ks.K(), true
|
||||
default:
|
||||
value, ok := ks.Metadata[key]
|
||||
return value, ok
|
||||
}
|
||||
}
|
||||
|
||||
// SetAttribute sets the value of an attribute
|
||||
// Cas particuliers: "id" utilise SetId(), "k" est immutable (panique)
|
||||
func (ks *KmerSet) SetAttribute(key string, value interface{}) {
|
||||
switch key {
|
||||
case "id":
|
||||
if id, ok := value.(string); ok {
|
||||
ks.SetId(id)
|
||||
} else {
|
||||
panic(fmt.Sprintf("id must be a string, got %T", value))
|
||||
}
|
||||
case "k":
|
||||
panic("k is immutable and cannot be modified via SetAttribute")
|
||||
default:
|
||||
ks.Metadata[key] = value
|
||||
}
|
||||
}
|
||||
|
||||
// DeleteAttribute supprime un attribut
|
||||
func (ks *KmerSet) DeleteAttribute(key string) {
|
||||
delete(ks.Metadata, key)
|
||||
}
|
||||
|
||||
// RemoveAttribute supprime un attribut (alias de DeleteAttribute)
|
||||
func (ks *KmerSet) RemoveAttribute(key string) {
|
||||
ks.DeleteAttribute(key)
|
||||
}
|
||||
|
||||
// RenameAttribute renomme un attribut
|
||||
func (ks *KmerSet) RenameAttribute(newName, oldName string) {
|
||||
if value, ok := ks.Metadata[oldName]; ok {
|
||||
ks.Metadata[newName] = value
|
||||
delete(ks.Metadata, oldName)
|
||||
}
|
||||
}
|
||||
|
||||
// GetIntAttribute récupère un attribut en tant qu'entier
|
||||
func (ks *KmerSet) GetIntAttribute(key string) (int, bool) {
|
||||
value, ok := ks.Metadata[key]
|
||||
if !ok {
|
||||
return 0, false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case int:
|
||||
return v, true
|
||||
case int64:
|
||||
return int(v), true
|
||||
case float64:
|
||||
return int(v), true
|
||||
case string:
|
||||
if i, err := strconv.Atoi(v); err == nil {
|
||||
return i, true
|
||||
}
|
||||
}
|
||||
return 0, false
|
||||
}
|
||||
|
||||
// GetFloatAttribute récupère un attribut en tant que float64
|
||||
func (ks *KmerSet) GetFloatAttribute(key string) (float64, bool) {
|
||||
value, ok := ks.Metadata[key]
|
||||
if !ok {
|
||||
return 0, false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case float64:
|
||||
return v, true
|
||||
case float32:
|
||||
return float64(v), true
|
||||
case int:
|
||||
return float64(v), true
|
||||
case int64:
|
||||
return float64(v), true
|
||||
case string:
|
||||
if f, err := strconv.ParseFloat(v, 64); err == nil {
|
||||
return f, true
|
||||
}
|
||||
}
|
||||
return 0, false
|
||||
}
|
||||
|
||||
// GetNumericAttribute récupère un attribut numérique (alias de GetFloatAttribute)
|
||||
func (ks *KmerSet) GetNumericAttribute(key string) (float64, bool) {
|
||||
return ks.GetFloatAttribute(key)
|
||||
}
|
||||
|
||||
// GetStringAttribute récupère un attribut en tant que chaîne
|
||||
func (ks *KmerSet) GetStringAttribute(key string) (string, bool) {
|
||||
value, ok := ks.Metadata[key]
|
||||
if !ok {
|
||||
return "", false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case string:
|
||||
return v, true
|
||||
default:
|
||||
return fmt.Sprintf("%v", v), true
|
||||
}
|
||||
}
|
||||
|
||||
// GetBoolAttribute récupère un attribut en tant que booléen
|
||||
func (ks *KmerSet) GetBoolAttribute(key string) (bool, bool) {
|
||||
value, ok := ks.Metadata[key]
|
||||
if !ok {
|
||||
return false, false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case bool:
|
||||
return v, true
|
||||
case int:
|
||||
return v != 0, true
|
||||
case string:
|
||||
if b, err := strconv.ParseBool(v); err == nil {
|
||||
return b, true
|
||||
}
|
||||
}
|
||||
return false, false
|
||||
}
|
||||
|
||||
// AttributeKeys returns the set of attribute keys
|
||||
func (ks *KmerSet) AttributeKeys() obiutils.Set[string] {
|
||||
keys := obiutils.MakeSet[string]()
|
||||
for key := range ks.Metadata {
|
||||
keys.Add(key)
|
||||
}
|
||||
return keys
|
||||
}
|
||||
|
||||
// Keys returns the set of attribute keys (alias of AttributeKeys)
|
||||
func (ks *KmerSet) Keys() obiutils.Set[string] {
|
||||
return ks.AttributeKeys()
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// KMER SET GROUP ATTRIBUTE API
|
||||
// Métadonnées du groupe + accès via Get() pour les sets individuels
|
||||
// ==================================
|
||||
|
||||
// HasAttribute vérifie si une clé d'attribut existe pour le groupe
|
||||
func (ksg *KmerSetGroup) HasAttribute(key string) bool {
|
||||
_, ok := ksg.Metadata[key]
|
||||
return ok
|
||||
}
|
||||
|
||||
// GetAttribute récupère la valeur d'un attribut du groupe
|
||||
// Cas particuliers: "id" utilise Id(), "k" utilise K()
|
||||
func (ksg *KmerSetGroup) GetAttribute(key string) (interface{}, bool) {
|
||||
switch key {
|
||||
case "id":
|
||||
return ksg.Id(), true
|
||||
case "k":
|
||||
return ksg.K(), true
|
||||
default:
|
||||
value, ok := ksg.Metadata[key]
|
||||
return value, ok
|
||||
}
|
||||
}
|
||||
|
||||
// SetAttribute sets the value of an attribute du groupe
|
||||
// Cas particuliers: "id" utilise SetId(), "k" est immutable (panique)
|
||||
func (ksg *KmerSetGroup) SetAttribute(key string, value interface{}) {
|
||||
switch key {
|
||||
case "id":
|
||||
if id, ok := value.(string); ok {
|
||||
ksg.SetId(id)
|
||||
} else {
|
||||
panic(fmt.Sprintf("id must be a string, got %T", value))
|
||||
}
|
||||
case "k":
|
||||
panic("k is immutable and cannot be modified via SetAttribute")
|
||||
default:
|
||||
ksg.Metadata[key] = value
|
||||
}
|
||||
}
|
||||
|
||||
// DeleteAttribute supprime un attribut du groupe
|
||||
func (ksg *KmerSetGroup) DeleteAttribute(key string) {
|
||||
delete(ksg.Metadata, key)
|
||||
}
|
||||
|
||||
// RemoveAttribute supprime un attribut du groupe (alias)
|
||||
func (ksg *KmerSetGroup) RemoveAttribute(key string) {
|
||||
ksg.DeleteAttribute(key)
|
||||
}
|
||||
|
||||
// RenameAttribute renomme un attribut du groupe
|
||||
func (ksg *KmerSetGroup) RenameAttribute(newName, oldName string) {
|
||||
if value, ok := ksg.Metadata[oldName]; ok {
|
||||
ksg.Metadata[newName] = value
|
||||
delete(ksg.Metadata, oldName)
|
||||
}
|
||||
}
|
||||
|
||||
// GetIntAttribute récupère un attribut entier du groupe
|
||||
func (ksg *KmerSetGroup) GetIntAttribute(key string) (int, bool) {
|
||||
value, ok := ksg.GetAttribute(key)
|
||||
if !ok {
|
||||
return 0, false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case int:
|
||||
return v, true
|
||||
case int64:
|
||||
return int(v), true
|
||||
case float64:
|
||||
return int(v), true
|
||||
case string:
|
||||
if i, err := strconv.Atoi(v); err == nil {
|
||||
return i, true
|
||||
}
|
||||
}
|
||||
return 0, false
|
||||
}
|
||||
|
||||
// GetFloatAttribute récupère un attribut float64 du groupe
|
||||
func (ksg *KmerSetGroup) GetFloatAttribute(key string) (float64, bool) {
|
||||
value, ok := ksg.GetAttribute(key)
|
||||
if !ok {
|
||||
return 0, false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case float64:
|
||||
return v, true
|
||||
case float32:
|
||||
return float64(v), true
|
||||
case int:
|
||||
return float64(v), true
|
||||
case int64:
|
||||
return float64(v), true
|
||||
case string:
|
||||
if f, err := strconv.ParseFloat(v, 64); err == nil {
|
||||
return f, true
|
||||
}
|
||||
}
|
||||
return 0, false
|
||||
}
|
||||
|
||||
// GetNumericAttribute récupère un attribut numérique du groupe
|
||||
func (ksg *KmerSetGroup) GetNumericAttribute(key string) (float64, bool) {
|
||||
return ksg.GetFloatAttribute(key)
|
||||
}
|
||||
|
||||
// GetStringAttribute récupère un attribut chaîne du groupe
|
||||
func (ksg *KmerSetGroup) GetStringAttribute(key string) (string, bool) {
|
||||
value, ok := ksg.GetAttribute(key)
|
||||
if !ok {
|
||||
return "", false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case string:
|
||||
return v, true
|
||||
default:
|
||||
return fmt.Sprintf("%v", v), true
|
||||
}
|
||||
}
|
||||
|
||||
// GetBoolAttribute récupère un attribut booléen du groupe
|
||||
func (ksg *KmerSetGroup) GetBoolAttribute(key string) (bool, bool) {
|
||||
value, ok := ksg.GetAttribute(key)
|
||||
if !ok {
|
||||
return false, false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case bool:
|
||||
return v, true
|
||||
case int:
|
||||
return v != 0, true
|
||||
case string:
|
||||
if b, err := strconv.ParseBool(v); err == nil {
|
||||
return b, true
|
||||
}
|
||||
}
|
||||
return false, false
|
||||
}
|
||||
|
||||
// AttributeKeys returns the set of attribute keys du groupe
|
||||
func (ksg *KmerSetGroup) AttributeKeys() obiutils.Set[string] {
|
||||
keys := obiutils.MakeSet[string]()
|
||||
for key := range ksg.Metadata {
|
||||
keys.Add(key)
|
||||
}
|
||||
return keys
|
||||
}
|
||||
|
||||
// Keys returns the set of group attribute keys (alias)
|
||||
func (ksg *KmerSetGroup) Keys() obiutils.Set[string] {
|
||||
return ksg.AttributeKeys()
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// MÉTHODES POUR ACCÉDER AUX ATTRIBUTS DES SETS INDIVIDUELS VIA Get()
|
||||
// Architecture zero-copy: ksg.Get(i).SetAttribute(...)
|
||||
// ==================================
|
||||
|
||||
// Exemple d'utilisation:
|
||||
// Pour accéder aux métadonnées d'un KmerSet individuel dans un groupe:
|
||||
// ks := ksg.Get(0)
|
||||
// ks.SetAttribute("level", 1)
|
||||
// hasLevel := ks.HasAttribute("level")
|
||||
//
|
||||
// Pour les métadonnées du groupe:
|
||||
// ksg.SetAttribute("name", "FrequencyFilter")
|
||||
// name, ok := ksg.GetStringAttribute("name")
|
||||
|
||||
// AllAttributeKeys returns all unique attribute keys of the group AND all its sets
|
||||
func (ksg *KmerSetGroup) AllAttributeKeys() obiutils.Set[string] {
|
||||
keys := obiutils.MakeSet[string]()
|
||||
|
||||
// Ajouter les clés du groupe
|
||||
for key := range ksg.Metadata {
|
||||
keys.Add(key)
|
||||
}
|
||||
|
||||
// Ajouter les clés de chaque set
|
||||
for _, ks := range ksg.sets {
|
||||
for key := range ks.Metadata {
|
||||
keys.Add(key)
|
||||
}
|
||||
}
|
||||
|
||||
return keys
|
||||
}
|
||||
702
pkg/obikmer/kmer_set_builder.go
Normal file
702
pkg/obikmer/kmer_set_builder.go
Normal file
@@ -0,0 +1,702 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"math"
|
||||
"os"
|
||||
"path/filepath"
|
||||
"slices"
|
||||
"sync"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"github.com/schollz/progressbar/v3"
|
||||
)
|
||||
|
||||
// BuilderOption is a functional option for KmerSetGroupBuilder.
|
||||
type BuilderOption func(*builderConfig)
|
||||
|
||||
type builderConfig struct {
|
||||
minFreq int // 0 means no frequency filtering (simple dedup)
|
||||
maxFreq int // 0 means no upper bound
|
||||
saveFreqTopN int // >0 means save the N most frequent k-mers per set to CSV
|
||||
entropyThreshold float64 // >0 means filter k-mers with entropy <= threshold
|
||||
entropyLevelMax int // max sub-word size for entropy (typically 6)
|
||||
}
|
||||
|
||||
// WithMinFrequency activates frequency filtering mode.
|
||||
// Only k-mers seen >= minFreq times are kept in the final index.
|
||||
func WithMinFrequency(minFreq int) BuilderOption {
|
||||
return func(c *builderConfig) {
|
||||
c.minFreq = minFreq
|
||||
}
|
||||
}
|
||||
|
||||
// WithMaxFrequency sets the upper frequency bound.
|
||||
// Only k-mers seen <= maxFreq times are kept in the final index.
|
||||
func WithMaxFrequency(maxFreq int) BuilderOption {
|
||||
return func(c *builderConfig) {
|
||||
c.maxFreq = maxFreq
|
||||
}
|
||||
}
|
||||
|
||||
// WithSaveFreqKmers saves the N most frequent k-mers per set to a CSV file
|
||||
// (top_kmers.csv in each set directory).
|
||||
func WithSaveFreqKmers(n int) BuilderOption {
|
||||
return func(c *builderConfig) {
|
||||
c.saveFreqTopN = n
|
||||
}
|
||||
}
|
||||
|
||||
// WithEntropyFilter activates entropy-based low-complexity filtering.
|
||||
// K-mers with entropy <= threshold are discarded during finalization.
|
||||
// levelMax is the maximum sub-word size for entropy computation (typically 6).
|
||||
func WithEntropyFilter(threshold float64, levelMax int) BuilderOption {
|
||||
return func(c *builderConfig) {
|
||||
c.entropyThreshold = threshold
|
||||
c.entropyLevelMax = levelMax
|
||||
}
|
||||
}
|
||||
|
||||
// KmerSetGroupBuilder constructs a KmerSetGroup on disk.
|
||||
// During construction, super-kmers are written to temporary .skm files
|
||||
// partitioned by minimizer. On Close(), each partition is finalized
|
||||
// (sort, dedup, optional frequency filter) into .kdi files.
|
||||
type KmerSetGroupBuilder struct {
|
||||
dir string
|
||||
k int
|
||||
m int
|
||||
n int // number of NEW sets being built
|
||||
P int // number of partitions
|
||||
startIndex int // first set index (0 for new groups, existingN for appends)
|
||||
config builderConfig
|
||||
existing *KmerSetGroup // non-nil when appending to existing group
|
||||
writers [][]*SkmWriter // [setIndex][partIndex] (local index 0..n-1)
|
||||
mu [][]sync.Mutex // per-writer mutex for concurrent access
|
||||
closed bool
|
||||
}
|
||||
|
||||
// NewKmerSetGroupBuilder creates a builder for a new KmerSetGroup.
|
||||
//
|
||||
// Parameters:
|
||||
// - directory: destination directory (created if necessary)
|
||||
// - k: k-mer size (1-31)
|
||||
// - m: minimizer size (-1 for auto = ceil(k/2.5))
|
||||
// - n: number of sets in the group
|
||||
// - P: number of partitions (-1 for auto)
|
||||
// - options: optional builder options (e.g. WithMinFrequency)
|
||||
func NewKmerSetGroupBuilder(directory string, k, m, n, P int,
|
||||
options ...BuilderOption) (*KmerSetGroupBuilder, error) {
|
||||
|
||||
if k < 2 || k > 31 {
|
||||
return nil, fmt.Errorf("obikmer: k must be between 2 and 31, got %d", k)
|
||||
}
|
||||
if n < 1 {
|
||||
return nil, fmt.Errorf("obikmer: n must be >= 1, got %d", n)
|
||||
}
|
||||
|
||||
// Auto minimizer size
|
||||
if m < 0 {
|
||||
m = int(math.Ceil(float64(k) / 2.5))
|
||||
}
|
||||
if m < 1 {
|
||||
m = 1
|
||||
}
|
||||
if m >= k {
|
||||
m = k - 1
|
||||
}
|
||||
|
||||
// Auto partition count
|
||||
if P < 0 {
|
||||
// Use 4^m as the maximum, capped at a reasonable value
|
||||
maxP := 1 << (2 * m) // 4^m
|
||||
P = maxP
|
||||
if P > 4096 {
|
||||
P = 4096
|
||||
}
|
||||
if P < 64 {
|
||||
P = 64
|
||||
}
|
||||
}
|
||||
|
||||
// Apply options
|
||||
var config builderConfig
|
||||
for _, opt := range options {
|
||||
opt(&config)
|
||||
}
|
||||
|
||||
// Create build directory structure
|
||||
buildDir := filepath.Join(directory, ".build")
|
||||
for s := 0; s < n; s++ {
|
||||
setDir := filepath.Join(buildDir, fmt.Sprintf("set_%d", s))
|
||||
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: create build dir: %w", err)
|
||||
}
|
||||
}
|
||||
|
||||
// Create SKM writers
|
||||
writers := make([][]*SkmWriter, n)
|
||||
mutexes := make([][]sync.Mutex, n)
|
||||
for s := 0; s < n; s++ {
|
||||
writers[s] = make([]*SkmWriter, P)
|
||||
mutexes[s] = make([]sync.Mutex, P)
|
||||
for p := 0; p < P; p++ {
|
||||
path := filepath.Join(buildDir, fmt.Sprintf("set_%d", s),
|
||||
fmt.Sprintf("part_%04d.skm", p))
|
||||
w, err := NewSkmWriter(path)
|
||||
if err != nil {
|
||||
// Close already-created writers
|
||||
for ss := 0; ss <= s; ss++ {
|
||||
for pp := 0; pp < P; pp++ {
|
||||
if writers[ss][pp] != nil {
|
||||
writers[ss][pp].Close()
|
||||
}
|
||||
}
|
||||
}
|
||||
return nil, fmt.Errorf("obikmer: create skm writer: %w", err)
|
||||
}
|
||||
writers[s][p] = w
|
||||
}
|
||||
}
|
||||
|
||||
return &KmerSetGroupBuilder{
|
||||
dir: directory,
|
||||
k: k,
|
||||
m: m,
|
||||
n: n,
|
||||
P: P,
|
||||
startIndex: 0,
|
||||
config: config,
|
||||
writers: writers,
|
||||
mu: mutexes,
|
||||
}, nil
|
||||
}
|
||||
|
||||
// AppendKmerSetGroupBuilder opens an existing KmerSetGroup and creates
|
||||
// a builder that adds n new sets starting from the existing set count.
|
||||
// The k, m, and partitions are inherited from the existing group.
|
||||
func AppendKmerSetGroupBuilder(directory string, n int, options ...BuilderOption) (*KmerSetGroupBuilder, error) {
|
||||
existing, err := OpenKmerSetGroup(directory)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("obikmer: open existing group: %w", err)
|
||||
}
|
||||
|
||||
if n < 1 {
|
||||
return nil, fmt.Errorf("obikmer: n must be >= 1, got %d", n)
|
||||
}
|
||||
|
||||
k := existing.K()
|
||||
m := existing.M()
|
||||
P := existing.Partitions()
|
||||
startIndex := existing.Size()
|
||||
|
||||
var config builderConfig
|
||||
for _, opt := range options {
|
||||
opt(&config)
|
||||
}
|
||||
|
||||
// Create build directory structure for new sets
|
||||
buildDir := filepath.Join(directory, ".build")
|
||||
for s := 0; s < n; s++ {
|
||||
setDir := filepath.Join(buildDir, fmt.Sprintf("set_%d", s))
|
||||
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: create build dir: %w", err)
|
||||
}
|
||||
}
|
||||
|
||||
// Create SKM writers for new sets
|
||||
writers := make([][]*SkmWriter, n)
|
||||
mutexes := make([][]sync.Mutex, n)
|
||||
for s := 0; s < n; s++ {
|
||||
writers[s] = make([]*SkmWriter, P)
|
||||
mutexes[s] = make([]sync.Mutex, P)
|
||||
for p := 0; p < P; p++ {
|
||||
path := filepath.Join(buildDir, fmt.Sprintf("set_%d", s),
|
||||
fmt.Sprintf("part_%04d.skm", p))
|
||||
w, err := NewSkmWriter(path)
|
||||
if err != nil {
|
||||
for ss := 0; ss <= s; ss++ {
|
||||
for pp := 0; pp < P; pp++ {
|
||||
if writers[ss][pp] != nil {
|
||||
writers[ss][pp].Close()
|
||||
}
|
||||
}
|
||||
}
|
||||
return nil, fmt.Errorf("obikmer: create skm writer: %w", err)
|
||||
}
|
||||
writers[s][p] = w
|
||||
}
|
||||
}
|
||||
|
||||
return &KmerSetGroupBuilder{
|
||||
dir: directory,
|
||||
k: k,
|
||||
m: m,
|
||||
n: n,
|
||||
P: P,
|
||||
startIndex: startIndex,
|
||||
config: config,
|
||||
existing: existing,
|
||||
writers: writers,
|
||||
mu: mutexes,
|
||||
}, nil
|
||||
}
|
||||
|
||||
// StartIndex returns the first global set index for the new sets being built.
|
||||
// For new groups this is 0; for appends it is the existing group's Size().
|
||||
func (b *KmerSetGroupBuilder) StartIndex() int {
|
||||
return b.startIndex
|
||||
}
|
||||
|
||||
// AddSequence extracts super-kmers from a sequence and writes them
|
||||
// to the appropriate partition files for the given set.
|
||||
func (b *KmerSetGroupBuilder) AddSequence(setIndex int, seq *obiseq.BioSequence) {
|
||||
if setIndex < 0 || setIndex >= b.n {
|
||||
return
|
||||
}
|
||||
rawSeq := seq.Sequence()
|
||||
if len(rawSeq) < b.k {
|
||||
return
|
||||
}
|
||||
for sk := range IterSuperKmers(rawSeq, b.k, b.m) {
|
||||
part := int(sk.Minimizer % uint64(b.P))
|
||||
b.mu[setIndex][part].Lock()
|
||||
b.writers[setIndex][part].Write(sk)
|
||||
b.mu[setIndex][part].Unlock()
|
||||
}
|
||||
}
|
||||
|
||||
// AddSuperKmer writes a single super-kmer to the appropriate partition.
|
||||
func (b *KmerSetGroupBuilder) AddSuperKmer(setIndex int, sk SuperKmer) {
|
||||
if setIndex < 0 || setIndex >= b.n {
|
||||
return
|
||||
}
|
||||
part := int(sk.Minimizer % uint64(b.P))
|
||||
b.mu[setIndex][part].Lock()
|
||||
b.writers[setIndex][part].Write(sk)
|
||||
b.mu[setIndex][part].Unlock()
|
||||
}
|
||||
|
||||
// Close finalizes the construction:
|
||||
// 1. Flush and close all SKM writers
|
||||
// 2. For each partition of each set (in parallel):
|
||||
// - Load super-kmers from .skm
|
||||
// - Extract canonical k-mers
|
||||
// - Sort and deduplicate (count if frequency filter)
|
||||
// - Write .kdi file
|
||||
// 3. Write metadata.toml
|
||||
// 4. Remove .build/ directory
|
||||
//
|
||||
// Returns the finalized KmerSetGroup in read-only mode.
|
||||
func (b *KmerSetGroupBuilder) Close() (*KmerSetGroup, error) {
|
||||
if b.closed {
|
||||
return nil, fmt.Errorf("obikmer: builder already closed")
|
||||
}
|
||||
b.closed = true
|
||||
|
||||
// 1. Close all SKM writers
|
||||
for s := 0; s < b.n; s++ {
|
||||
for p := 0; p < b.P; p++ {
|
||||
if err := b.writers[s][p].Close(); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: close skm writer set=%d part=%d: %w", s, p, err)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// 2. Create output directory structure for new sets
|
||||
for s := 0; s < b.n; s++ {
|
||||
globalIdx := b.startIndex + s
|
||||
setDir := filepath.Join(b.dir, fmt.Sprintf("set_%d", globalIdx))
|
||||
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: create set dir: %w", err)
|
||||
}
|
||||
}
|
||||
|
||||
// =====================================================================
|
||||
// 2-stage pipeline: readers (pure I/O) → workers (CPU + write)
|
||||
//
|
||||
// - nReaders goroutines read .skm files (pure I/O, fast)
|
||||
// - nWorkers goroutines extract k-mers, sort, dedup, filter, write .kdi
|
||||
//
|
||||
// One unbuffered channel between stages. Readers are truly I/O-bound
|
||||
// (small files, buffered reads), workers are CPU-bound and stay busy.
|
||||
// =====================================================================
|
||||
totalJobs := b.n * b.P
|
||||
|
||||
counts := make([][]uint64, b.n)
|
||||
spectra := make([][]map[int]uint64, b.n)
|
||||
var topKmers [][]*TopNKmers
|
||||
for s := 0; s < b.n; s++ {
|
||||
counts[s] = make([]uint64, b.P)
|
||||
spectra[s] = make([]map[int]uint64, b.P)
|
||||
}
|
||||
if b.config.saveFreqTopN > 0 {
|
||||
topKmers = make([][]*TopNKmers, b.n)
|
||||
for s := 0; s < b.n; s++ {
|
||||
topKmers[s] = make([]*TopNKmers, b.P)
|
||||
}
|
||||
}
|
||||
|
||||
nCPU := obidefault.ParallelWorkers()
|
||||
|
||||
// Stage sizing
|
||||
nWorkers := nCPU // CPU-bound: one per core
|
||||
nReaders := nCPU / 4 // pure I/O: few goroutines suffice
|
||||
if nReaders < 2 {
|
||||
nReaders = 2
|
||||
}
|
||||
if nReaders > 4 {
|
||||
nReaders = 4
|
||||
}
|
||||
if nWorkers > totalJobs {
|
||||
nWorkers = totalJobs
|
||||
}
|
||||
if nReaders > totalJobs {
|
||||
nReaders = totalJobs
|
||||
}
|
||||
|
||||
var bar *progressbar.ProgressBar
|
||||
if obidefault.ProgressBar() {
|
||||
pbopt := []progressbar.Option{
|
||||
progressbar.OptionSetWriter(os.Stderr),
|
||||
progressbar.OptionSetWidth(15),
|
||||
progressbar.OptionShowCount(),
|
||||
progressbar.OptionShowIts(),
|
||||
progressbar.OptionSetPredictTime(true),
|
||||
progressbar.OptionSetDescription("[Finalizing partitions]"),
|
||||
}
|
||||
bar = progressbar.NewOptions(totalJobs, pbopt...)
|
||||
}
|
||||
|
||||
// --- Channel types ---
|
||||
type partitionData struct {
|
||||
setIdx int
|
||||
partIdx int
|
||||
skmers []SuperKmer // raw super-kmers from I/O stage
|
||||
}
|
||||
|
||||
type readJob struct {
|
||||
setIdx int
|
||||
partIdx int
|
||||
}
|
||||
|
||||
dataCh := make(chan *partitionData) // unbuffered
|
||||
readJobs := make(chan readJob, totalJobs)
|
||||
|
||||
var errMu sync.Mutex
|
||||
var firstErr error
|
||||
|
||||
// Fill job queue (buffered, all jobs pre-loaded)
|
||||
for s := 0; s < b.n; s++ {
|
||||
for p := 0; p < b.P; p++ {
|
||||
readJobs <- readJob{s, p}
|
||||
}
|
||||
}
|
||||
close(readJobs)
|
||||
|
||||
// --- Stage 1: Readers (pure I/O) ---
|
||||
var readWg sync.WaitGroup
|
||||
for w := 0; w < nReaders; w++ {
|
||||
readWg.Add(1)
|
||||
go func() {
|
||||
defer readWg.Done()
|
||||
for rj := range readJobs {
|
||||
skmers, err := b.loadPartitionRaw(rj.setIdx, rj.partIdx)
|
||||
if err != nil {
|
||||
errMu.Lock()
|
||||
if firstErr == nil {
|
||||
firstErr = err
|
||||
}
|
||||
errMu.Unlock()
|
||||
}
|
||||
dataCh <- &partitionData{rj.setIdx, rj.partIdx, skmers}
|
||||
}
|
||||
}()
|
||||
}
|
||||
|
||||
go func() {
|
||||
readWg.Wait()
|
||||
close(dataCh)
|
||||
}()
|
||||
|
||||
// --- Stage 2: Workers (CPU: extract k-mers + sort/filter + write .kdi) ---
|
||||
var workWg sync.WaitGroup
|
||||
for w := 0; w < nWorkers; w++ {
|
||||
workWg.Add(1)
|
||||
go func() {
|
||||
defer workWg.Done()
|
||||
for pd := range dataCh {
|
||||
// CPU: extract canonical k-mers from super-kmers
|
||||
kmers := extractCanonicalKmers(pd.skmers, b.k)
|
||||
pd.skmers = nil // allow GC of raw super-kmers
|
||||
|
||||
// CPU: sort, dedup, filter
|
||||
filtered, spectrum, topN := b.sortFilterPartition(kmers)
|
||||
kmers = nil // allow GC of unsorted data
|
||||
|
||||
// I/O: write .kdi file
|
||||
globalIdx := b.startIndex + pd.setIdx
|
||||
kdiPath := filepath.Join(b.dir,
|
||||
fmt.Sprintf("set_%d", globalIdx),
|
||||
fmt.Sprintf("part_%04d.kdi", pd.partIdx))
|
||||
|
||||
n, err := b.writePartitionKdi(kdiPath, filtered)
|
||||
if err != nil {
|
||||
errMu.Lock()
|
||||
if firstErr == nil {
|
||||
firstErr = err
|
||||
}
|
||||
errMu.Unlock()
|
||||
}
|
||||
counts[pd.setIdx][pd.partIdx] = n
|
||||
spectra[pd.setIdx][pd.partIdx] = spectrum
|
||||
if topKmers != nil {
|
||||
topKmers[pd.setIdx][pd.partIdx] = topN
|
||||
}
|
||||
if bar != nil {
|
||||
bar.Add(1)
|
||||
}
|
||||
}
|
||||
}()
|
||||
}
|
||||
|
||||
workWg.Wait()
|
||||
|
||||
if bar != nil {
|
||||
fmt.Fprintln(os.Stderr)
|
||||
}
|
||||
|
||||
if firstErr != nil {
|
||||
return nil, firstErr
|
||||
}
|
||||
|
||||
// Aggregate per-partition spectra into per-set spectra and write spectrum.bin
|
||||
for s := 0; s < b.n; s++ {
|
||||
globalIdx := b.startIndex + s
|
||||
setSpectrum := make(map[int]uint64)
|
||||
for p := 0; p < b.P; p++ {
|
||||
if spectra[s][p] != nil {
|
||||
MergeSpectraMaps(setSpectrum, spectra[s][p])
|
||||
}
|
||||
}
|
||||
if len(setSpectrum) > 0 {
|
||||
specPath := filepath.Join(b.dir, fmt.Sprintf("set_%d", globalIdx), "spectrum.bin")
|
||||
if err := WriteSpectrum(specPath, MapToSpectrum(setSpectrum)); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: write spectrum set=%d: %w", globalIdx, err)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// Aggregate per-partition top-N k-mers and write CSV
|
||||
if topKmers != nil {
|
||||
for s := 0; s < b.n; s++ {
|
||||
globalIdx := b.startIndex + s
|
||||
merged := NewTopNKmers(b.config.saveFreqTopN)
|
||||
for p := 0; p < b.P; p++ {
|
||||
merged.MergeTopN(topKmers[s][p])
|
||||
}
|
||||
results := merged.Results()
|
||||
if len(results) > 0 {
|
||||
csvPath := filepath.Join(b.dir, fmt.Sprintf("set_%d", globalIdx), "top_kmers.csv")
|
||||
if err := WriteTopKmersCSV(csvPath, results, b.k); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: write top kmers set=%d: %w", globalIdx, err)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// 3. Build KmerSetGroup and write metadata
|
||||
newCounts := make([]uint64, b.n)
|
||||
for s := 0; s < b.n; s++ {
|
||||
for p := 0; p < b.P; p++ {
|
||||
newCounts[s] += counts[s][p]
|
||||
}
|
||||
}
|
||||
|
||||
var ksg *KmerSetGroup
|
||||
|
||||
if b.existing != nil {
|
||||
// Append mode: extend existing group
|
||||
ksg = b.existing
|
||||
ksg.n += b.n
|
||||
ksg.setsIDs = append(ksg.setsIDs, make([]string, b.n)...)
|
||||
ksg.counts = append(ksg.counts, newCounts...)
|
||||
newMeta := make([]map[string]interface{}, b.n)
|
||||
for i := range newMeta {
|
||||
newMeta[i] = make(map[string]interface{})
|
||||
}
|
||||
ksg.setsMetadata = append(ksg.setsMetadata, newMeta...)
|
||||
} else {
|
||||
// New group
|
||||
setsIDs := make([]string, b.n)
|
||||
setsMetadata := make([]map[string]interface{}, b.n)
|
||||
for i := range setsMetadata {
|
||||
setsMetadata[i] = make(map[string]interface{})
|
||||
}
|
||||
ksg = &KmerSetGroup{
|
||||
path: b.dir,
|
||||
k: b.k,
|
||||
m: b.m,
|
||||
partitions: b.P,
|
||||
n: b.n,
|
||||
setsIDs: setsIDs,
|
||||
counts: newCounts,
|
||||
setsMetadata: setsMetadata,
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
}
|
||||
|
||||
if err := ksg.saveMetadata(); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: write metadata: %w", err)
|
||||
}
|
||||
|
||||
// 4. Remove .build/ directory
|
||||
buildDir := filepath.Join(b.dir, ".build")
|
||||
os.RemoveAll(buildDir)
|
||||
|
||||
return ksg, nil
|
||||
}
|
||||
|
||||
// loadPartitionRaw reads a .skm file and returns raw super-kmers.
|
||||
// This is pure I/O — no k-mer extraction is done here.
|
||||
// Returns nil (not an error) if the .skm file is empty or missing.
|
||||
func (b *KmerSetGroupBuilder) loadPartitionRaw(setIdx, partIdx int) ([]SuperKmer, error) {
|
||||
skmPath := filepath.Join(b.dir, ".build",
|
||||
fmt.Sprintf("set_%d", setIdx),
|
||||
fmt.Sprintf("part_%04d.skm", partIdx))
|
||||
|
||||
fi, err := os.Stat(skmPath)
|
||||
if err != nil {
|
||||
return nil, nil // empty partition, not an error
|
||||
}
|
||||
|
||||
reader, err := NewSkmReader(skmPath)
|
||||
if err != nil {
|
||||
return nil, nil
|
||||
}
|
||||
|
||||
// Estimate capacity from file size. Each super-kmer record is
|
||||
// 2 bytes (length) + packed bases (~k/4 bytes), so roughly
|
||||
// (2 + k/4) bytes per super-kmer on average.
|
||||
avgRecordSize := 2 + b.k/4
|
||||
if avgRecordSize < 4 {
|
||||
avgRecordSize = 4
|
||||
}
|
||||
estCount := int(fi.Size()) / avgRecordSize
|
||||
|
||||
skmers := make([]SuperKmer, 0, estCount)
|
||||
for {
|
||||
sk, ok := reader.Next()
|
||||
if !ok {
|
||||
break
|
||||
}
|
||||
skmers = append(skmers, sk)
|
||||
}
|
||||
reader.Close()
|
||||
|
||||
return skmers, nil
|
||||
}
|
||||
|
||||
// extractCanonicalKmers extracts all canonical k-mers from a slice of super-kmers.
|
||||
// This is CPU-bound work (sliding-window forward/reverse complement).
|
||||
func extractCanonicalKmers(skmers []SuperKmer, k int) []uint64 {
|
||||
// Pre-compute total capacity to avoid repeated slice growth.
|
||||
// Each super-kmer of length L yields L-k+1 canonical k-mers.
|
||||
total := 0
|
||||
for i := range skmers {
|
||||
n := len(skmers[i].Sequence) - k + 1
|
||||
if n > 0 {
|
||||
total += n
|
||||
}
|
||||
}
|
||||
|
||||
kmers := make([]uint64, 0, total)
|
||||
for _, sk := range skmers {
|
||||
for kmer := range IterCanonicalKmers(sk.Sequence, k) {
|
||||
kmers = append(kmers, kmer)
|
||||
}
|
||||
}
|
||||
return kmers
|
||||
}
|
||||
|
||||
// sortFilterPartition sorts, deduplicates, and filters k-mers in memory (CPU-bound).
|
||||
// Returns the filtered sorted slice, frequency spectrum, and optional top-N.
|
||||
func (b *KmerSetGroupBuilder) sortFilterPartition(kmers []uint64) ([]uint64, map[int]uint64, *TopNKmers) {
|
||||
if len(kmers) == 0 {
|
||||
return nil, nil, nil
|
||||
}
|
||||
|
||||
// Sort (CPU-bound) — slices.Sort avoids reflection overhead of sort.Slice
|
||||
slices.Sort(kmers)
|
||||
|
||||
minFreq := b.config.minFreq
|
||||
if minFreq <= 0 {
|
||||
minFreq = 1 // simple dedup
|
||||
}
|
||||
maxFreq := b.config.maxFreq
|
||||
|
||||
// Prepare entropy filter if requested
|
||||
var entropyFilter *KmerEntropyFilter
|
||||
if b.config.entropyThreshold > 0 && b.config.entropyLevelMax > 0 {
|
||||
entropyFilter = NewKmerEntropyFilter(b.k, b.config.entropyLevelMax, b.config.entropyThreshold)
|
||||
}
|
||||
|
||||
// Prepare top-N collector if requested
|
||||
var topN *TopNKmers
|
||||
if b.config.saveFreqTopN > 0 {
|
||||
topN = NewTopNKmers(b.config.saveFreqTopN)
|
||||
}
|
||||
|
||||
// Linear scan: count consecutive identical values, filter, accumulate spectrum
|
||||
partSpectrum := make(map[int]uint64)
|
||||
filtered := make([]uint64, 0, len(kmers)/2)
|
||||
|
||||
i := 0
|
||||
for i < len(kmers) {
|
||||
val := kmers[i]
|
||||
c := 1
|
||||
for i+c < len(kmers) && kmers[i+c] == val {
|
||||
c++
|
||||
}
|
||||
partSpectrum[c]++
|
||||
if topN != nil {
|
||||
topN.Add(val, c)
|
||||
}
|
||||
if c >= minFreq && (maxFreq <= 0 || c <= maxFreq) {
|
||||
if entropyFilter == nil || entropyFilter.Accept(val) {
|
||||
filtered = append(filtered, val)
|
||||
}
|
||||
}
|
||||
i += c
|
||||
}
|
||||
|
||||
return filtered, partSpectrum, topN
|
||||
}
|
||||
|
||||
// writePartitionKdi writes a sorted slice of k-mers to a .kdi file (I/O-bound).
|
||||
// Returns the number of k-mers written.
|
||||
func (b *KmerSetGroupBuilder) writePartitionKdi(kdiPath string, kmers []uint64) (uint64, error) {
|
||||
w, err := NewKdiWriter(kdiPath)
|
||||
if err != nil {
|
||||
return 0, err
|
||||
}
|
||||
|
||||
for _, val := range kmers {
|
||||
if err := w.Write(val); err != nil {
|
||||
w.Close()
|
||||
return 0, err
|
||||
}
|
||||
}
|
||||
|
||||
n := w.Count()
|
||||
return n, w.Close()
|
||||
}
|
||||
|
||||
func (b *KmerSetGroupBuilder) writeEmptyKdi(path string, count *uint64) error {
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
*count = 0
|
||||
return w.Close()
|
||||
}
|
||||
278
pkg/obikmer/kmer_set_builder_test.go
Normal file
278
pkg/obikmer/kmer_set_builder_test.go
Normal file
@@ -0,0 +1,278 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"sort"
|
||||
"testing"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
func TestBuilderBasic(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
seq := obiseq.NewBioSequence("test", []byte("ACGTACGTACGTACGTACGTACGTACGT"), "")
|
||||
builder.AddSequence(0, seq)
|
||||
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
if ksg.K() != 15 {
|
||||
t.Fatalf("K() = %d, want 15", ksg.K())
|
||||
}
|
||||
if ksg.M() != 7 {
|
||||
t.Fatalf("M() = %d, want 7", ksg.M())
|
||||
}
|
||||
if ksg.Partitions() != 64 {
|
||||
t.Fatalf("Partitions() = %d, want 64", ksg.Partitions())
|
||||
}
|
||||
if ksg.Size() != 1 {
|
||||
t.Fatalf("Size() = %d, want 1", ksg.Size())
|
||||
}
|
||||
if ksg.Len(0) == 0 {
|
||||
t.Fatal("Len(0) = 0, expected some k-mers")
|
||||
}
|
||||
|
||||
// Verify k-mers match what we'd compute directly
|
||||
var expected []uint64
|
||||
for kmer := range IterCanonicalKmers(seq.Sequence(), 15) {
|
||||
expected = append(expected, kmer)
|
||||
}
|
||||
sort.Slice(expected, func(i, j int) bool { return expected[i] < expected[j] })
|
||||
// Dedup
|
||||
deduped := expected[:0]
|
||||
for i, v := range expected {
|
||||
if i == 0 || v != expected[i-1] {
|
||||
deduped = append(deduped, v)
|
||||
}
|
||||
}
|
||||
|
||||
if ksg.Len(0) != uint64(len(deduped)) {
|
||||
t.Fatalf("Len(0) = %d, expected %d unique k-mers", ksg.Len(0), len(deduped))
|
||||
}
|
||||
|
||||
// Check iterator
|
||||
var fromIter []uint64
|
||||
for kmer := range ksg.Iterator(0) {
|
||||
fromIter = append(fromIter, kmer)
|
||||
}
|
||||
// The iterator does a k-way merge so should be sorted
|
||||
for i := 1; i < len(fromIter); i++ {
|
||||
if fromIter[i] <= fromIter[i-1] {
|
||||
t.Fatalf("iterator not sorted at %d: %d <= %d", i, fromIter[i], fromIter[i-1])
|
||||
}
|
||||
}
|
||||
if len(fromIter) != len(deduped) {
|
||||
t.Fatalf("iterator yielded %d k-mers, expected %d", len(fromIter), len(deduped))
|
||||
}
|
||||
for i, v := range fromIter {
|
||||
if v != deduped[i] {
|
||||
t.Fatalf("iterator kmer %d: got %d, want %d", i, v, deduped[i])
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestBuilderMultipleSequences(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
seqs := []string{
|
||||
"ACGTACGTACGTACGTACGTACGTACGT",
|
||||
"TTTTTTTTTTTTTTTTTTTTTTTTT",
|
||||
"GGGGGGGGGGGGGGGGGGGGGGGG",
|
||||
}
|
||||
for _, s := range seqs {
|
||||
seq := obiseq.NewBioSequence("", []byte(s), "")
|
||||
builder.AddSequence(0, seq)
|
||||
}
|
||||
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
if ksg.Len(0) == 0 {
|
||||
t.Fatal("expected k-mers after multiple sequences")
|
||||
}
|
||||
}
|
||||
|
||||
func TestBuilderFrequencyFilter(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64,
|
||||
WithMinFrequency(3))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Add same sequence 3 times — all k-mers should survive freq=3
|
||||
seq := obiseq.NewBioSequence("test", []byte("ACGTACGTACGTACGTACGTACGTACGT"), "")
|
||||
for i := 0; i < 3; i++ {
|
||||
builder.AddSequence(0, seq)
|
||||
}
|
||||
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// All k-mers appear exactly 3 times → all should survive
|
||||
var expected []uint64
|
||||
for kmer := range IterCanonicalKmers(seq.Sequence(), 15) {
|
||||
expected = append(expected, kmer)
|
||||
}
|
||||
sort.Slice(expected, func(i, j int) bool { return expected[i] < expected[j] })
|
||||
deduped := expected[:0]
|
||||
for i, v := range expected {
|
||||
if i == 0 || v != expected[i-1] {
|
||||
deduped = append(deduped, v)
|
||||
}
|
||||
}
|
||||
|
||||
if ksg.Len(0) != uint64(len(deduped)) {
|
||||
t.Fatalf("Len(0) = %d, expected %d (all k-mers at freq=3)", ksg.Len(0), len(deduped))
|
||||
}
|
||||
}
|
||||
|
||||
func TestBuilderFrequencyFilterRejects(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64,
|
||||
WithMinFrequency(5))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Use a non-repetitive sequence so each canonical k-mer appears once per pass.
|
||||
// Adding it twice gives freq=2 per kmer, which is < minFreq=5 → all rejected.
|
||||
seq := obiseq.NewBioSequence("test",
|
||||
[]byte("ACGATCGATCTAGCTAGCTGATCGATCGATCG"), "")
|
||||
builder.AddSequence(0, seq)
|
||||
builder.AddSequence(0, seq)
|
||||
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
if ksg.Len(0) != 0 {
|
||||
t.Fatalf("Len(0) = %d, expected 0 (all k-mers at freq=2 < minFreq=5)", ksg.Len(0))
|
||||
}
|
||||
}
|
||||
|
||||
func TestBuilderMultipleSets(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 3, 64)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
seqs := []string{
|
||||
"ACGTACGTACGTACGTACGTACGTACGT",
|
||||
"TTTTTTTTTTTTTTTTTTTTTTTTT",
|
||||
"GGGGGGGGGGGGGGGGGGGGGGGG",
|
||||
}
|
||||
for i, s := range seqs {
|
||||
seq := obiseq.NewBioSequence("", []byte(s), "")
|
||||
builder.AddSequence(i, seq)
|
||||
}
|
||||
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
if ksg.Size() != 3 {
|
||||
t.Fatalf("Size() = %d, want 3", ksg.Size())
|
||||
}
|
||||
for s := 0; s < 3; s++ {
|
||||
if ksg.Len(s) == 0 {
|
||||
t.Fatalf("Len(%d) = 0, expected some k-mers", s)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestBuilderOpenRoundTrip(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
seq := obiseq.NewBioSequence("test", []byte("ACGTACGTACGTACGTACGTACGTACGT"), "")
|
||||
builder.AddSequence(0, seq)
|
||||
|
||||
ksg1, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Reopen
|
||||
ksg2, err := OpenKmerSetGroup(dir)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
if ksg2.K() != ksg1.K() {
|
||||
t.Fatalf("K mismatch: %d vs %d", ksg2.K(), ksg1.K())
|
||||
}
|
||||
if ksg2.M() != ksg1.M() {
|
||||
t.Fatalf("M mismatch: %d vs %d", ksg2.M(), ksg1.M())
|
||||
}
|
||||
if ksg2.Partitions() != ksg1.Partitions() {
|
||||
t.Fatalf("Partitions mismatch: %d vs %d", ksg2.Partitions(), ksg1.Partitions())
|
||||
}
|
||||
if ksg2.Len(0) != ksg1.Len(0) {
|
||||
t.Fatalf("Len mismatch: %d vs %d", ksg2.Len(0), ksg1.Len(0))
|
||||
}
|
||||
}
|
||||
|
||||
func TestBuilderAttributes(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
seq := obiseq.NewBioSequence("test", []byte("ACGTACGTACGTACGTACGTACGTACGT"), "")
|
||||
builder.AddSequence(0, seq)
|
||||
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
ksg.SetId("my_index")
|
||||
ksg.SetAttribute("organism", "test")
|
||||
ksg.SaveMetadata()
|
||||
|
||||
// Reopen and check
|
||||
ksg2, err := OpenKmerSetGroup(dir)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
if ksg2.Id() != "my_index" {
|
||||
t.Fatalf("Id() = %q, want %q", ksg2.Id(), "my_index")
|
||||
}
|
||||
if !ksg2.HasAttribute("organism") {
|
||||
t.Fatal("expected 'organism' attribute")
|
||||
}
|
||||
v, _ := ksg2.GetAttribute("organism")
|
||||
if v != "test" {
|
||||
t.Fatalf("organism = %v, want 'test'", v)
|
||||
}
|
||||
}
|
||||
944
pkg/obikmer/kmer_set_disk.go
Normal file
944
pkg/obikmer/kmer_set_disk.go
Normal file
@@ -0,0 +1,944 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"io"
|
||||
"iter"
|
||||
"os"
|
||||
"path"
|
||||
"path/filepath"
|
||||
"sort"
|
||||
"sync"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidist"
|
||||
"github.com/pelletier/go-toml/v2"
|
||||
)
|
||||
|
||||
// MetadataFormat represents the metadata serialization format.
|
||||
// Currently only TOML is used for disk-based indices, but the type
|
||||
// is kept for backward compatibility with CLI options.
|
||||
type MetadataFormat int
|
||||
|
||||
const (
|
||||
FormatTOML MetadataFormat = iota
|
||||
FormatYAML
|
||||
FormatJSON
|
||||
)
|
||||
|
||||
// String returns the file extension for the format.
|
||||
func (f MetadataFormat) String() string {
|
||||
switch f {
|
||||
case FormatTOML:
|
||||
return "toml"
|
||||
case FormatYAML:
|
||||
return "yaml"
|
||||
case FormatJSON:
|
||||
return "json"
|
||||
default:
|
||||
return "toml"
|
||||
}
|
||||
}
|
||||
|
||||
// KmerSetGroup is a disk-based collection of N k-mer sets sharing the same
|
||||
// k, m, and partition count P. After construction (via KmerSetGroupBuilder),
|
||||
// it is immutable and all operations are streaming (partition by partition).
|
||||
//
|
||||
// A KmerSetGroup with Size()==1 is effectively a KmerSet (singleton).
|
||||
type KmerSetGroup struct {
|
||||
path string // root directory
|
||||
id string // user-assigned identifier
|
||||
k int // k-mer size
|
||||
m int // minimizer size
|
||||
partitions int // number of partitions P
|
||||
n int // number of sets N
|
||||
setsIDs []string // IDs of individual sets
|
||||
counts []uint64 // total k-mer count per set (sum over partitions)
|
||||
setsMetadata []map[string]interface{} // per-set user metadata
|
||||
Metadata map[string]interface{} // group-level user metadata
|
||||
}
|
||||
|
||||
// diskMetadata is the TOML-serializable structure for metadata.toml.
|
||||
type diskMetadata struct {
|
||||
ID string `toml:"id,omitempty"`
|
||||
K int `toml:"k"`
|
||||
M int `toml:"m"`
|
||||
Partitions int `toml:"partitions"`
|
||||
Type string `toml:"type"`
|
||||
Size int `toml:"size"`
|
||||
SetsIDs []string `toml:"sets_ids,omitempty"`
|
||||
Counts []uint64 `toml:"counts,omitempty"`
|
||||
SetsMetadata []map[string]interface{} `toml:"sets_metadata,omitempty"`
|
||||
UserMetadata map[string]interface{} `toml:"user_metadata,omitempty"`
|
||||
}
|
||||
|
||||
// OpenKmerSetGroup opens a finalized index directory in read-only mode.
|
||||
func OpenKmerSetGroup(directory string) (*KmerSetGroup, error) {
|
||||
metaPath := filepath.Join(directory, "metadata.toml")
|
||||
f, err := os.Open(metaPath)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("obikmer: open metadata: %w", err)
|
||||
}
|
||||
defer f.Close()
|
||||
|
||||
var meta diskMetadata
|
||||
if err := toml.NewDecoder(f).Decode(&meta); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: decode metadata: %w", err)
|
||||
}
|
||||
|
||||
ksg := &KmerSetGroup{
|
||||
path: directory,
|
||||
id: meta.ID,
|
||||
k: meta.K,
|
||||
m: meta.M,
|
||||
partitions: meta.Partitions,
|
||||
n: meta.Size,
|
||||
setsIDs: meta.SetsIDs,
|
||||
counts: meta.Counts,
|
||||
setsMetadata: meta.SetsMetadata,
|
||||
Metadata: meta.UserMetadata,
|
||||
}
|
||||
if ksg.Metadata == nil {
|
||||
ksg.Metadata = make(map[string]interface{})
|
||||
}
|
||||
if ksg.setsIDs == nil {
|
||||
ksg.setsIDs = make([]string, ksg.n)
|
||||
}
|
||||
if ksg.setsMetadata == nil {
|
||||
ksg.setsMetadata = make([]map[string]interface{}, ksg.n)
|
||||
for i := range ksg.setsMetadata {
|
||||
ksg.setsMetadata[i] = make(map[string]interface{})
|
||||
}
|
||||
}
|
||||
if ksg.counts == nil {
|
||||
// Compute counts by scanning partitions
|
||||
ksg.counts = make([]uint64, ksg.n)
|
||||
for s := 0; s < ksg.n; s++ {
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
path := ksg.partitionPath(s, p)
|
||||
r, err := NewKdiReader(path)
|
||||
if err != nil {
|
||||
continue
|
||||
}
|
||||
ksg.counts[s] += r.Count()
|
||||
r.Close()
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
return ksg, nil
|
||||
}
|
||||
|
||||
// NewFilteredKmerSetGroup creates a KmerSetGroup from pre-computed data.
|
||||
// Used by the filter command to construct a new group after filtering partitions.
|
||||
func NewFilteredKmerSetGroup(
|
||||
directory string, k, m, partitions, n int,
|
||||
setsIDs []string, counts []uint64,
|
||||
setsMetadata []map[string]interface{},
|
||||
) (*KmerSetGroup, error) {
|
||||
ksg := &KmerSetGroup{
|
||||
path: directory,
|
||||
k: k,
|
||||
m: m,
|
||||
partitions: partitions,
|
||||
n: n,
|
||||
setsIDs: setsIDs,
|
||||
counts: counts,
|
||||
setsMetadata: setsMetadata,
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
return ksg, nil
|
||||
}
|
||||
|
||||
// SaveMetadata writes the metadata.toml file. This is useful after
|
||||
// modifying attributes or IDs on an already-finalized index.
|
||||
func (ksg *KmerSetGroup) SaveMetadata() error {
|
||||
return ksg.saveMetadata()
|
||||
}
|
||||
|
||||
// saveMetadata writes the metadata.toml file (internal).
|
||||
func (ksg *KmerSetGroup) saveMetadata() error {
|
||||
meta := diskMetadata{
|
||||
ID: ksg.id,
|
||||
K: ksg.k,
|
||||
M: ksg.m,
|
||||
Partitions: ksg.partitions,
|
||||
Type: "KmerSetGroup",
|
||||
Size: ksg.n,
|
||||
SetsIDs: ksg.setsIDs,
|
||||
Counts: ksg.counts,
|
||||
SetsMetadata: ksg.setsMetadata,
|
||||
UserMetadata: ksg.Metadata,
|
||||
}
|
||||
|
||||
metaPath := filepath.Join(ksg.path, "metadata.toml")
|
||||
f, err := os.Create(metaPath)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
defer f.Close()
|
||||
|
||||
return toml.NewEncoder(f).Encode(meta)
|
||||
}
|
||||
|
||||
// partitionPath returns the file path for partition p of set s.
|
||||
func (ksg *KmerSetGroup) partitionPath(setIndex, partIndex int) string {
|
||||
return filepath.Join(ksg.path, fmt.Sprintf("set_%d", setIndex),
|
||||
fmt.Sprintf("part_%04d.kdi", partIndex))
|
||||
}
|
||||
|
||||
// Path returns the root directory of the index.
|
||||
func (ksg *KmerSetGroup) Path() string {
|
||||
return ksg.path
|
||||
}
|
||||
|
||||
// K returns the k-mer size.
|
||||
func (ksg *KmerSetGroup) K() int {
|
||||
return ksg.k
|
||||
}
|
||||
|
||||
// M returns the minimizer size.
|
||||
func (ksg *KmerSetGroup) M() int {
|
||||
return ksg.m
|
||||
}
|
||||
|
||||
// Partitions returns the number of partitions P.
|
||||
func (ksg *KmerSetGroup) Partitions() int {
|
||||
return ksg.partitions
|
||||
}
|
||||
|
||||
// Size returns the number of sets N.
|
||||
func (ksg *KmerSetGroup) Size() int {
|
||||
return ksg.n
|
||||
}
|
||||
|
||||
// Id returns the group identifier.
|
||||
func (ksg *KmerSetGroup) Id() string {
|
||||
return ksg.id
|
||||
}
|
||||
|
||||
// SetId sets the group identifier and persists the change.
|
||||
func (ksg *KmerSetGroup) SetId(id string) {
|
||||
ksg.id = id
|
||||
}
|
||||
|
||||
// Len returns the total number of k-mers.
|
||||
// Without argument: total across all sets.
|
||||
// With argument setIndex: count for that specific set.
|
||||
func (ksg *KmerSetGroup) Len(setIndex ...int) uint64 {
|
||||
if len(setIndex) == 0 {
|
||||
var total uint64
|
||||
for _, c := range ksg.counts {
|
||||
total += c
|
||||
}
|
||||
return total
|
||||
}
|
||||
idx := setIndex[0]
|
||||
if idx < 0 || idx >= ksg.n {
|
||||
return 0
|
||||
}
|
||||
return ksg.counts[idx]
|
||||
}
|
||||
|
||||
// Contains checks if a k-mer is present in the specified set.
|
||||
// Uses the .kdx sparse index (if available) for fast seeking within
|
||||
// each partition, then a short linear scan of at most `stride` entries.
|
||||
// All partitions are searched in parallel since the k-mer's partition
|
||||
// is not known without its minimizer context.
|
||||
func (ksg *KmerSetGroup) Contains(setIndex int, kmer uint64) bool {
|
||||
if setIndex < 0 || setIndex >= ksg.n {
|
||||
return false
|
||||
}
|
||||
|
||||
type result struct {
|
||||
found bool
|
||||
}
|
||||
ch := make(chan result, ksg.partitions)
|
||||
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
go func(part int) {
|
||||
r, err := NewKdiIndexedReader(ksg.partitionPath(setIndex, part))
|
||||
if err != nil {
|
||||
ch <- result{false}
|
||||
return
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
// Use index to jump near the target
|
||||
if err := r.SeekTo(kmer); err != nil {
|
||||
ch <- result{false}
|
||||
return
|
||||
}
|
||||
|
||||
// Linear scan from the seek position
|
||||
for {
|
||||
v, ok := r.Next()
|
||||
if !ok {
|
||||
ch <- result{false}
|
||||
return
|
||||
}
|
||||
if v == kmer {
|
||||
ch <- result{true}
|
||||
return
|
||||
}
|
||||
if v > kmer {
|
||||
ch <- result{false}
|
||||
return
|
||||
}
|
||||
}
|
||||
}(p)
|
||||
}
|
||||
|
||||
for i := 0; i < ksg.partitions; i++ {
|
||||
res := <-ch
|
||||
if res.found {
|
||||
// Drain remaining goroutines
|
||||
go func() {
|
||||
for j := i + 1; j < ksg.partitions; j++ {
|
||||
<-ch
|
||||
}
|
||||
}()
|
||||
return true
|
||||
}
|
||||
}
|
||||
return false
|
||||
}
|
||||
|
||||
// Iterator returns an iterator over all k-mers in the specified set,
|
||||
// in sorted order within each partition. Since partitions are independent,
|
||||
// to get a globally sorted stream, use iteratorSorted.
|
||||
func (ksg *KmerSetGroup) Iterator(setIndex int) iter.Seq[uint64] {
|
||||
return func(yield func(uint64) bool) {
|
||||
if setIndex < 0 || setIndex >= ksg.n {
|
||||
return
|
||||
}
|
||||
|
||||
// Open all partition readers and merge them
|
||||
readers := make([]*KdiReader, 0, ksg.partitions)
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
r, err := NewKdiReader(ksg.partitionPath(setIndex, p))
|
||||
if err != nil {
|
||||
continue
|
||||
}
|
||||
if r.Count() > 0 {
|
||||
readers = append(readers, r)
|
||||
} else {
|
||||
r.Close()
|
||||
}
|
||||
}
|
||||
|
||||
if len(readers) == 0 {
|
||||
return
|
||||
}
|
||||
|
||||
m := NewKWayMerge(readers)
|
||||
defer m.Close()
|
||||
|
||||
for {
|
||||
kmer, _, ok := m.Next()
|
||||
if !ok {
|
||||
return
|
||||
}
|
||||
if !yield(kmer) {
|
||||
return
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Attribute API (compatible with old API)
|
||||
// ==============================
|
||||
|
||||
// HasAttribute checks if a metadata key exists.
|
||||
func (ksg *KmerSetGroup) HasAttribute(key string) bool {
|
||||
_, ok := ksg.Metadata[key]
|
||||
return ok
|
||||
}
|
||||
|
||||
// GetAttribute returns the value of an attribute.
|
||||
func (ksg *KmerSetGroup) GetAttribute(key string) (interface{}, bool) {
|
||||
switch key {
|
||||
case "id":
|
||||
return ksg.Id(), true
|
||||
case "k":
|
||||
return ksg.K(), true
|
||||
default:
|
||||
value, ok := ksg.Metadata[key]
|
||||
return value, ok
|
||||
}
|
||||
}
|
||||
|
||||
// SetAttribute sets a metadata attribute.
|
||||
func (ksg *KmerSetGroup) SetAttribute(key string, value interface{}) {
|
||||
switch key {
|
||||
case "id":
|
||||
if id, ok := value.(string); ok {
|
||||
ksg.SetId(id)
|
||||
} else {
|
||||
panic(fmt.Sprintf("id must be a string, got %T", value))
|
||||
}
|
||||
case "k":
|
||||
panic("k is immutable")
|
||||
default:
|
||||
ksg.Metadata[key] = value
|
||||
}
|
||||
}
|
||||
|
||||
// DeleteAttribute removes a metadata attribute.
|
||||
func (ksg *KmerSetGroup) DeleteAttribute(key string) {
|
||||
delete(ksg.Metadata, key)
|
||||
}
|
||||
|
||||
// GetIntAttribute returns an attribute as int.
|
||||
func (ksg *KmerSetGroup) GetIntAttribute(key string) (int, bool) {
|
||||
v, ok := ksg.GetAttribute(key)
|
||||
if !ok {
|
||||
return 0, false
|
||||
}
|
||||
switch val := v.(type) {
|
||||
case int:
|
||||
return val, true
|
||||
case int64:
|
||||
return int(val), true
|
||||
case float64:
|
||||
return int(val), true
|
||||
}
|
||||
return 0, false
|
||||
}
|
||||
|
||||
// GetStringAttribute returns an attribute as string.
|
||||
func (ksg *KmerSetGroup) GetStringAttribute(key string) (string, bool) {
|
||||
v, ok := ksg.GetAttribute(key)
|
||||
if !ok {
|
||||
return "", false
|
||||
}
|
||||
if s, ok := v.(string); ok {
|
||||
return s, true
|
||||
}
|
||||
return fmt.Sprintf("%v", v), true
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Jaccard metrics (streaming, disk-based)
|
||||
// ==============================
|
||||
|
||||
// JaccardDistanceMatrix computes a pairwise Jaccard distance matrix
|
||||
// for all sets in the group. Operates partition by partition in streaming.
|
||||
func (ksg *KmerSetGroup) JaccardDistanceMatrix() *obidist.DistMatrix {
|
||||
n := ksg.n
|
||||
labels := make([]string, n)
|
||||
for i := 0; i < n; i++ {
|
||||
if i < len(ksg.setsIDs) && ksg.setsIDs[i] != "" {
|
||||
labels[i] = ksg.setsIDs[i]
|
||||
} else {
|
||||
labels[i] = fmt.Sprintf("set_%d", i)
|
||||
}
|
||||
}
|
||||
|
||||
dm := obidist.NewDistMatrixWithLabels(labels)
|
||||
|
||||
// Accumulate intersection and union counts
|
||||
intersections := make([][]uint64, n)
|
||||
unions := make([][]uint64, n)
|
||||
for i := 0; i < n; i++ {
|
||||
intersections[i] = make([]uint64, n)
|
||||
unions[i] = make([]uint64, n)
|
||||
}
|
||||
|
||||
// Process partition by partition
|
||||
var mu sync.Mutex
|
||||
var wg sync.WaitGroup
|
||||
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
wg.Add(1)
|
||||
go func(part int) {
|
||||
defer wg.Done()
|
||||
|
||||
// Open all set readers for this partition
|
||||
readers := make([]*KdiReader, n)
|
||||
for s := 0; s < n; s++ {
|
||||
r, err := NewKdiReader(ksg.partitionPath(s, part))
|
||||
if err != nil {
|
||||
continue
|
||||
}
|
||||
readers[s] = r
|
||||
}
|
||||
defer func() {
|
||||
for _, r := range readers {
|
||||
if r != nil {
|
||||
r.Close()
|
||||
}
|
||||
}
|
||||
}()
|
||||
|
||||
// Merge all N readers to count intersections and unions
|
||||
activeReaders := make([]*KdiReader, 0, n)
|
||||
activeIndices := make([]int, 0, n)
|
||||
for i, r := range readers {
|
||||
if r != nil && r.Count() > 0 {
|
||||
activeReaders = append(activeReaders, r)
|
||||
activeIndices = append(activeIndices, i)
|
||||
}
|
||||
}
|
||||
if len(activeReaders) == 0 {
|
||||
return
|
||||
}
|
||||
|
||||
merge := NewKWayMerge(activeReaders)
|
||||
// Don't close merge here since readers are managed above
|
||||
// We only want to iterate
|
||||
|
||||
// We need per-set presence tracking, so we use a custom merge
|
||||
// Rebuild with a direct approach
|
||||
merge.Close() // close the merge (which closes readers)
|
||||
|
||||
// Reopen readers for custom merge
|
||||
for s := 0; s < n; s++ {
|
||||
readers[s] = nil
|
||||
r, err := NewKdiReader(ksg.partitionPath(s, part))
|
||||
if err != nil {
|
||||
continue
|
||||
}
|
||||
if r.Count() > 0 {
|
||||
readers[s] = r
|
||||
} else {
|
||||
r.Close()
|
||||
}
|
||||
}
|
||||
|
||||
// Custom k-way merge that tracks which sets contain each kmer
|
||||
type entry struct {
|
||||
val uint64
|
||||
setIdx int
|
||||
}
|
||||
|
||||
// Use a simpler approach: read all values for this partition into memory
|
||||
// for each set, then do a merge
|
||||
setKmers := make([][]uint64, n)
|
||||
for s := 0; s < n; s++ {
|
||||
if readers[s] == nil {
|
||||
continue
|
||||
}
|
||||
kmers := make([]uint64, 0, readers[s].Count())
|
||||
for {
|
||||
v, ok := readers[s].Next()
|
||||
if !ok {
|
||||
break
|
||||
}
|
||||
kmers = append(kmers, v)
|
||||
}
|
||||
setKmers[s] = kmers
|
||||
readers[s].Close()
|
||||
readers[s] = nil
|
||||
}
|
||||
|
||||
// Count pairwise intersections using sorted merge
|
||||
// For each pair (i,j), count kmers present in both
|
||||
localInter := make([][]uint64, n)
|
||||
localUnion := make([][]uint64, n)
|
||||
for i := 0; i < n; i++ {
|
||||
localInter[i] = make([]uint64, n)
|
||||
localUnion[i] = make([]uint64, n)
|
||||
}
|
||||
|
||||
for i := 0; i < n; i++ {
|
||||
localUnion[i][i] = uint64(len(setKmers[i]))
|
||||
for j := i + 1; j < n; j++ {
|
||||
a, b := setKmers[i], setKmers[j]
|
||||
var inter uint64
|
||||
ai, bi := 0, 0
|
||||
for ai < len(a) && bi < len(b) {
|
||||
if a[ai] == b[bi] {
|
||||
inter++
|
||||
ai++
|
||||
bi++
|
||||
} else if a[ai] < b[bi] {
|
||||
ai++
|
||||
} else {
|
||||
bi++
|
||||
}
|
||||
}
|
||||
localInter[i][j] = inter
|
||||
localUnion[i][j] = uint64(len(a)) + uint64(len(b)) - inter
|
||||
}
|
||||
}
|
||||
|
||||
mu.Lock()
|
||||
for i := 0; i < n; i++ {
|
||||
for j := i; j < n; j++ {
|
||||
intersections[i][j] += localInter[i][j]
|
||||
unions[i][j] += localUnion[i][j]
|
||||
}
|
||||
}
|
||||
mu.Unlock()
|
||||
}(p)
|
||||
}
|
||||
wg.Wait()
|
||||
|
||||
// Compute distances from accumulated counts
|
||||
for i := 0; i < n-1; i++ {
|
||||
for j := i + 1; j < n; j++ {
|
||||
u := unions[i][j]
|
||||
if u == 0 {
|
||||
dm.Set(i, j, 1.0)
|
||||
} else {
|
||||
dm.Set(i, j, 1.0-float64(intersections[i][j])/float64(u))
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
return dm
|
||||
}
|
||||
|
||||
// JaccardSimilarityMatrix computes a pairwise Jaccard similarity matrix.
|
||||
func (ksg *KmerSetGroup) JaccardSimilarityMatrix() *obidist.DistMatrix {
|
||||
n := ksg.n
|
||||
labels := make([]string, n)
|
||||
for i := 0; i < n; i++ {
|
||||
if i < len(ksg.setsIDs) && ksg.setsIDs[i] != "" {
|
||||
labels[i] = ksg.setsIDs[i]
|
||||
} else {
|
||||
labels[i] = fmt.Sprintf("set_%d", i)
|
||||
}
|
||||
}
|
||||
|
||||
// Reuse distance computation
|
||||
dm := ksg.JaccardDistanceMatrix()
|
||||
sm := obidist.NewSimilarityMatrixWithLabels(labels)
|
||||
|
||||
for i := 0; i < n-1; i++ {
|
||||
for j := i + 1; j < n; j++ {
|
||||
sm.Set(i, j, 1.0-dm.Get(i, j))
|
||||
}
|
||||
}
|
||||
|
||||
return sm
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Set ID accessors
|
||||
// ==============================
|
||||
|
||||
// SetsIDs returns a copy of the per-set string identifiers.
|
||||
func (ksg *KmerSetGroup) SetsIDs() []string {
|
||||
out := make([]string, len(ksg.setsIDs))
|
||||
copy(out, ksg.setsIDs)
|
||||
return out
|
||||
}
|
||||
|
||||
// SetIDOf returns the string ID of the set at the given index.
|
||||
// Returns "" if index is out of range.
|
||||
func (ksg *KmerSetGroup) SetIDOf(index int) string {
|
||||
if index < 0 || index >= ksg.n {
|
||||
return ""
|
||||
}
|
||||
return ksg.setsIDs[index]
|
||||
}
|
||||
|
||||
// SetSetID sets the string ID of the set at the given index.
|
||||
func (ksg *KmerSetGroup) SetSetID(index int, id string) {
|
||||
if index >= 0 && index < ksg.n {
|
||||
ksg.setsIDs[index] = id
|
||||
}
|
||||
}
|
||||
|
||||
// IndexOfSetID returns the numeric index for a set ID, or -1 if not found.
|
||||
func (ksg *KmerSetGroup) IndexOfSetID(id string) int {
|
||||
for i, sid := range ksg.setsIDs {
|
||||
if sid == id {
|
||||
return i
|
||||
}
|
||||
}
|
||||
return -1
|
||||
}
|
||||
|
||||
// MatchSetIDs resolves glob patterns against set IDs and returns matching
|
||||
// indices sorted in ascending order. Uses path.Match for pattern matching
|
||||
// (supports *, ?, [...] patterns). Returns error if a pattern is malformed.
|
||||
func (ksg *KmerSetGroup) MatchSetIDs(patterns []string) ([]int, error) {
|
||||
seen := make(map[int]bool)
|
||||
for _, pattern := range patterns {
|
||||
for i, sid := range ksg.setsIDs {
|
||||
matched, err := path.Match(pattern, sid)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("obikmer: invalid glob pattern %q: %w", pattern, err)
|
||||
}
|
||||
if matched {
|
||||
seen[i] = true
|
||||
}
|
||||
}
|
||||
}
|
||||
result := make([]int, 0, len(seen))
|
||||
for idx := range seen {
|
||||
result = append(result, idx)
|
||||
}
|
||||
sort.Ints(result)
|
||||
return result, nil
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Per-set metadata accessors
|
||||
// ==============================
|
||||
|
||||
// GetSetMetadata returns the value of a per-set metadata key.
|
||||
func (ksg *KmerSetGroup) GetSetMetadata(setIndex int, key string) (interface{}, bool) {
|
||||
if setIndex < 0 || setIndex >= ksg.n {
|
||||
return nil, false
|
||||
}
|
||||
v, ok := ksg.setsMetadata[setIndex][key]
|
||||
return v, ok
|
||||
}
|
||||
|
||||
// SetSetMetadata sets a per-set metadata attribute.
|
||||
func (ksg *KmerSetGroup) SetSetMetadata(setIndex int, key string, value interface{}) {
|
||||
if setIndex < 0 || setIndex >= ksg.n {
|
||||
return
|
||||
}
|
||||
if ksg.setsMetadata[setIndex] == nil {
|
||||
ksg.setsMetadata[setIndex] = make(map[string]interface{})
|
||||
}
|
||||
ksg.setsMetadata[setIndex][key] = value
|
||||
}
|
||||
|
||||
// DeleteSetMetadata removes a per-set metadata attribute.
|
||||
func (ksg *KmerSetGroup) DeleteSetMetadata(setIndex int, key string) {
|
||||
if setIndex < 0 || setIndex >= ksg.n {
|
||||
return
|
||||
}
|
||||
delete(ksg.setsMetadata[setIndex], key)
|
||||
}
|
||||
|
||||
// AllSetMetadata returns a copy of all metadata for a given set.
|
||||
func (ksg *KmerSetGroup) AllSetMetadata(setIndex int) map[string]interface{} {
|
||||
if setIndex < 0 || setIndex >= ksg.n {
|
||||
return nil
|
||||
}
|
||||
out := make(map[string]interface{}, len(ksg.setsMetadata[setIndex]))
|
||||
for k, v := range ksg.setsMetadata[setIndex] {
|
||||
out[k] = v
|
||||
}
|
||||
return out
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Exported partition path and compatibility
|
||||
// ==============================
|
||||
|
||||
// PartitionPath returns the file path for partition partIndex of set setIndex.
|
||||
func (ksg *KmerSetGroup) PartitionPath(setIndex, partIndex int) string {
|
||||
return ksg.partitionPath(setIndex, partIndex)
|
||||
}
|
||||
|
||||
// SpectrumPath returns the path to the spectrum.bin file for the given set.
|
||||
func (ksg *KmerSetGroup) SpectrumPath(setIndex int) string {
|
||||
return filepath.Join(ksg.path, fmt.Sprintf("set_%d", setIndex), "spectrum.bin")
|
||||
}
|
||||
|
||||
// Spectrum reads the k-mer frequency spectrum for the given set.
|
||||
// Returns nil, nil if no spectrum file exists.
|
||||
func (ksg *KmerSetGroup) Spectrum(setIndex int) (*KmerSpectrum, error) {
|
||||
path := ksg.SpectrumPath(setIndex)
|
||||
if _, err := os.Stat(path); os.IsNotExist(err) {
|
||||
return nil, nil
|
||||
}
|
||||
return ReadSpectrum(path)
|
||||
}
|
||||
|
||||
// IsCompatibleWith returns true if the other group has the same k, m, and partitions.
|
||||
func (ksg *KmerSetGroup) IsCompatibleWith(other *KmerSetGroup) bool {
|
||||
return ksg.k == other.k && ksg.m == other.m && ksg.partitions == other.partitions
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Set management operations
|
||||
// ==============================
|
||||
|
||||
// NewEmptyCompatible creates an empty KmerSetGroup at destDir with the same
|
||||
// k, m, and partitions as this group. The destination must not already exist.
|
||||
func (ksg *KmerSetGroup) NewEmptyCompatible(destDir string) (*KmerSetGroup, error) {
|
||||
if err := os.MkdirAll(destDir, 0755); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: create directory: %w", err)
|
||||
}
|
||||
|
||||
dest := &KmerSetGroup{
|
||||
path: destDir,
|
||||
k: ksg.k,
|
||||
m: ksg.m,
|
||||
partitions: ksg.partitions,
|
||||
n: 0,
|
||||
setsIDs: []string{},
|
||||
counts: []uint64{},
|
||||
setsMetadata: []map[string]interface{}{},
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
|
||||
if err := dest.saveMetadata(); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: write metadata: %w", err)
|
||||
}
|
||||
|
||||
return dest, nil
|
||||
}
|
||||
|
||||
// RemoveSetByID removes the set with the given ID from the group.
|
||||
// It deletes the set directory, renumbers all subsequent sets, and
|
||||
// updates the metadata on disk.
|
||||
func (ksg *KmerSetGroup) RemoveSetByID(id string) error {
|
||||
idx := ksg.IndexOfSetID(id)
|
||||
if idx < 0 {
|
||||
return fmt.Errorf("obikmer: set ID %q not found", id)
|
||||
}
|
||||
|
||||
// Delete the set directory
|
||||
setDir := filepath.Join(ksg.path, fmt.Sprintf("set_%d", idx))
|
||||
if err := os.RemoveAll(setDir); err != nil {
|
||||
return fmt.Errorf("obikmer: remove set directory: %w", err)
|
||||
}
|
||||
|
||||
// Renumber subsequent sets
|
||||
for i := idx + 1; i < ksg.n; i++ {
|
||||
oldDir := filepath.Join(ksg.path, fmt.Sprintf("set_%d", i))
|
||||
newDir := filepath.Join(ksg.path, fmt.Sprintf("set_%d", i-1))
|
||||
if err := os.Rename(oldDir, newDir); err != nil {
|
||||
return fmt.Errorf("obikmer: rename set_%d to set_%d: %w", i, i-1, err)
|
||||
}
|
||||
}
|
||||
|
||||
// Update slices
|
||||
ksg.setsIDs = append(ksg.setsIDs[:idx], ksg.setsIDs[idx+1:]...)
|
||||
ksg.counts = append(ksg.counts[:idx], ksg.counts[idx+1:]...)
|
||||
ksg.setsMetadata = append(ksg.setsMetadata[:idx], ksg.setsMetadata[idx+1:]...)
|
||||
ksg.n--
|
||||
|
||||
return ksg.saveMetadata()
|
||||
}
|
||||
|
||||
// CopySetsByIDTo copies sets identified by their IDs into a KmerSetGroup
|
||||
// at destDir. If destDir does not exist, a new compatible empty group is
|
||||
// created. If it exists, compatibility (k, m, partitions) is checked.
|
||||
// If a set ID already exists in the destination, an error is returned
|
||||
// unless force is true (in which case the existing set is replaced).
|
||||
// Per-set metadata travels with the set.
|
||||
func (ksg *KmerSetGroup) CopySetsByIDTo(ids []string, destDir string, force bool) (*KmerSetGroup, error) {
|
||||
// Resolve source IDs to indices
|
||||
srcIndices := make([]int, len(ids))
|
||||
for i, id := range ids {
|
||||
idx := ksg.IndexOfSetID(id)
|
||||
if idx < 0 {
|
||||
return nil, fmt.Errorf("obikmer: source set ID %q not found", id)
|
||||
}
|
||||
srcIndices[i] = idx
|
||||
}
|
||||
|
||||
// Open or create destination
|
||||
var dest *KmerSetGroup
|
||||
metaPath := filepath.Join(destDir, "metadata.toml")
|
||||
if _, err := os.Stat(metaPath); err == nil {
|
||||
// Destination exists
|
||||
dest, err = OpenKmerSetGroup(destDir)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("obikmer: open destination: %w", err)
|
||||
}
|
||||
if !ksg.IsCompatibleWith(dest) {
|
||||
return nil, fmt.Errorf("obikmer: incompatible groups: source (k=%d, m=%d, P=%d) vs dest (k=%d, m=%d, P=%d)",
|
||||
ksg.k, ksg.m, ksg.partitions, dest.k, dest.m, dest.partitions)
|
||||
}
|
||||
} else {
|
||||
// Create new destination
|
||||
var err error
|
||||
dest, err = ksg.NewEmptyCompatible(destDir)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
}
|
||||
|
||||
// Copy each set
|
||||
for i, srcIdx := range srcIndices {
|
||||
srcID := ids[i]
|
||||
|
||||
// Check for ID conflict in destination
|
||||
existingIdx := dest.IndexOfSetID(srcID)
|
||||
if existingIdx >= 0 {
|
||||
if !force {
|
||||
return nil, fmt.Errorf("obikmer: set ID %q already exists in destination (use force to replace)", srcID)
|
||||
}
|
||||
// Force: remove existing set in destination
|
||||
if err := dest.RemoveSetByID(srcID); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: remove existing set %q in destination: %w", srcID, err)
|
||||
}
|
||||
}
|
||||
|
||||
// Destination set index = current dest size
|
||||
destIdx := dest.n
|
||||
|
||||
// Create destination set directory
|
||||
destSetDir := filepath.Join(destDir, fmt.Sprintf("set_%d", destIdx))
|
||||
if err := os.MkdirAll(destSetDir, 0755); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: create dest set dir: %w", err)
|
||||
}
|
||||
|
||||
// Copy all partition files and their .kdx indices
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
srcPath := ksg.partitionPath(srcIdx, p)
|
||||
destPath := dest.partitionPath(destIdx, p)
|
||||
if err := copyFile(srcPath, destPath); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: copy partition %d of set %q: %w", p, srcID, err)
|
||||
}
|
||||
// Copy .kdx index if it exists
|
||||
srcKdx := KdxPathForKdi(srcPath)
|
||||
if _, err := os.Stat(srcKdx); err == nil {
|
||||
destKdx := KdxPathForKdi(destPath)
|
||||
if err := copyFile(srcKdx, destKdx); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: copy index %d of set %q: %w", p, srcID, err)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// Copy spectrum.bin if it exists
|
||||
srcSpecPath := ksg.SpectrumPath(srcIdx)
|
||||
if _, err := os.Stat(srcSpecPath); err == nil {
|
||||
destSpecPath := filepath.Join(destSetDir, "spectrum.bin")
|
||||
if err := copyFile(srcSpecPath, destSpecPath); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: copy spectrum of set %q: %w", srcID, err)
|
||||
}
|
||||
}
|
||||
|
||||
// Update destination metadata
|
||||
dest.setsIDs = append(dest.setsIDs, srcID)
|
||||
dest.counts = append(dest.counts, ksg.counts[srcIdx])
|
||||
|
||||
// Copy per-set metadata
|
||||
srcMeta := ksg.AllSetMetadata(srcIdx)
|
||||
if srcMeta == nil {
|
||||
srcMeta = make(map[string]interface{})
|
||||
}
|
||||
dest.setsMetadata = append(dest.setsMetadata, srcMeta)
|
||||
dest.n++
|
||||
}
|
||||
|
||||
if err := dest.saveMetadata(); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: save destination metadata: %w", err)
|
||||
}
|
||||
|
||||
return dest, nil
|
||||
}
|
||||
|
||||
// copyFile copies a file from src to dst.
|
||||
func copyFile(src, dst string) error {
|
||||
in, err := os.Open(src)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
defer in.Close()
|
||||
|
||||
out, err := os.Create(dst)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
defer out.Close()
|
||||
|
||||
if _, err := io.Copy(out, in); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
return out.Close()
|
||||
}
|
||||
568
pkg/obikmer/kmer_set_disk_ops.go
Normal file
568
pkg/obikmer/kmer_set_disk_ops.go
Normal file
@@ -0,0 +1,568 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"os"
|
||||
"path/filepath"
|
||||
"runtime"
|
||||
"sync"
|
||||
)
|
||||
|
||||
// Union computes the union of all sets in the group, producing a new
|
||||
// singleton KmerSetGroup on disk. A k-mer is in the result if it
|
||||
// appears in any set.
|
||||
func (ksg *KmerSetGroup) Union(outputDir string) (*KmerSetGroup, error) {
|
||||
return ksg.quorumOp(outputDir, 1, ksg.n)
|
||||
}
|
||||
|
||||
// Intersect computes the intersection of all sets, producing a new
|
||||
// singleton KmerSetGroup on disk. A k-mer is in the result if it
|
||||
// appears in every set.
|
||||
func (ksg *KmerSetGroup) Intersect(outputDir string) (*KmerSetGroup, error) {
|
||||
return ksg.quorumOp(outputDir, ksg.n, ksg.n)
|
||||
}
|
||||
|
||||
// Difference computes set_0 minus the union of all other sets.
|
||||
func (ksg *KmerSetGroup) Difference(outputDir string) (*KmerSetGroup, error) {
|
||||
return ksg.differenceOp(outputDir)
|
||||
}
|
||||
|
||||
// QuorumAtLeast returns k-mers present in at least q sets.
|
||||
func (ksg *KmerSetGroup) QuorumAtLeast(q int, outputDir string) (*KmerSetGroup, error) {
|
||||
return ksg.quorumOp(outputDir, q, ksg.n)
|
||||
}
|
||||
|
||||
// QuorumExactly returns k-mers present in exactly q sets.
|
||||
func (ksg *KmerSetGroup) QuorumExactly(q int, outputDir string) (*KmerSetGroup, error) {
|
||||
return ksg.quorumOp(outputDir, q, q)
|
||||
}
|
||||
|
||||
// QuorumAtMost returns k-mers present in at most q sets.
|
||||
func (ksg *KmerSetGroup) QuorumAtMost(q int, outputDir string) (*KmerSetGroup, error) {
|
||||
return ksg.quorumOp(outputDir, 1, q)
|
||||
}
|
||||
|
||||
// UnionWith merges this group with another, producing a new KmerSetGroup
|
||||
// whose set_i is the union of this.set_i and other.set_i.
|
||||
// Both groups must have the same k, m, P, and N.
|
||||
func (ksg *KmerSetGroup) UnionWith(other *KmerSetGroup, outputDir string) (*KmerSetGroup, error) {
|
||||
if err := ksg.checkCompatible(other); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
return ksg.pairwiseOp(other, outputDir, mergeUnion)
|
||||
}
|
||||
|
||||
// IntersectWith merges this group with another, producing a new KmerSetGroup
|
||||
// whose set_i is the intersection of this.set_i and other.set_i.
|
||||
func (ksg *KmerSetGroup) IntersectWith(other *KmerSetGroup, outputDir string) (*KmerSetGroup, error) {
|
||||
if err := ksg.checkCompatible(other); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
return ksg.pairwiseOp(other, outputDir, mergeIntersect)
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Internal implementation
|
||||
// ==============================
|
||||
|
||||
func (ksg *KmerSetGroup) checkCompatible(other *KmerSetGroup) error {
|
||||
if ksg.k != other.k {
|
||||
return fmt.Errorf("obikmer: incompatible k: %d vs %d", ksg.k, other.k)
|
||||
}
|
||||
if ksg.m != other.m {
|
||||
return fmt.Errorf("obikmer: incompatible m: %d vs %d", ksg.m, other.m)
|
||||
}
|
||||
if ksg.partitions != other.partitions {
|
||||
return fmt.Errorf("obikmer: incompatible partitions: %d vs %d", ksg.partitions, other.partitions)
|
||||
}
|
||||
if ksg.n != other.n {
|
||||
return fmt.Errorf("obikmer: incompatible size: %d vs %d", ksg.n, other.n)
|
||||
}
|
||||
return nil
|
||||
}
|
||||
|
||||
// quorumOp processes all N sets partition by partition.
|
||||
// For each partition, it opens N KdiReaders and does a k-way merge.
|
||||
// A kmer is written to the result if minQ <= count <= maxQ.
|
||||
func (ksg *KmerSetGroup) quorumOp(outputDir string, minQ, maxQ int) (*KmerSetGroup, error) {
|
||||
if minQ < 1 {
|
||||
minQ = 1
|
||||
}
|
||||
if maxQ > ksg.n {
|
||||
maxQ = ksg.n
|
||||
}
|
||||
|
||||
// Create output structure
|
||||
setDir := filepath.Join(outputDir, "set_0")
|
||||
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
counts := make([]uint64, ksg.partitions)
|
||||
|
||||
nWorkers := runtime.NumCPU()
|
||||
if nWorkers > ksg.partitions {
|
||||
nWorkers = ksg.partitions
|
||||
}
|
||||
|
||||
jobs := make(chan int, ksg.partitions)
|
||||
var wg sync.WaitGroup
|
||||
var errMu sync.Mutex
|
||||
var firstErr error
|
||||
|
||||
for w := 0; w < nWorkers; w++ {
|
||||
wg.Add(1)
|
||||
go func() {
|
||||
defer wg.Done()
|
||||
for p := range jobs {
|
||||
c, err := ksg.quorumPartition(p, setDir, minQ, maxQ)
|
||||
if err != nil {
|
||||
errMu.Lock()
|
||||
if firstErr == nil {
|
||||
firstErr = err
|
||||
}
|
||||
errMu.Unlock()
|
||||
return
|
||||
}
|
||||
counts[p] = c
|
||||
}
|
||||
}()
|
||||
}
|
||||
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
jobs <- p
|
||||
}
|
||||
close(jobs)
|
||||
wg.Wait()
|
||||
|
||||
if firstErr != nil {
|
||||
return nil, firstErr
|
||||
}
|
||||
|
||||
var totalCount uint64
|
||||
for _, c := range counts {
|
||||
totalCount += c
|
||||
}
|
||||
|
||||
result := &KmerSetGroup{
|
||||
path: outputDir,
|
||||
k: ksg.k,
|
||||
m: ksg.m,
|
||||
partitions: ksg.partitions,
|
||||
n: 1,
|
||||
setsIDs: []string{""},
|
||||
counts: []uint64{totalCount},
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
|
||||
if err := result.saveMetadata(); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
return result, nil
|
||||
}
|
||||
|
||||
// quorumPartition processes a single partition for quorum filtering.
|
||||
func (ksg *KmerSetGroup) quorumPartition(partIdx int, outSetDir string, minQ, maxQ int) (uint64, error) {
|
||||
// Open readers for all sets
|
||||
readers := make([]*KdiReader, 0, ksg.n)
|
||||
for s := 0; s < ksg.n; s++ {
|
||||
r, err := NewKdiReader(ksg.partitionPath(s, partIdx))
|
||||
if err != nil {
|
||||
// Close already-opened readers
|
||||
for _, rr := range readers {
|
||||
rr.Close()
|
||||
}
|
||||
return 0, err
|
||||
}
|
||||
if r.Count() > 0 {
|
||||
readers = append(readers, r)
|
||||
} else {
|
||||
r.Close()
|
||||
}
|
||||
}
|
||||
|
||||
outPath := filepath.Join(outSetDir, fmt.Sprintf("part_%04d.kdi", partIdx))
|
||||
|
||||
if len(readers) == 0 {
|
||||
// Write empty KDI
|
||||
w, err := NewKdiWriter(outPath)
|
||||
if err != nil {
|
||||
return 0, err
|
||||
}
|
||||
return 0, w.Close()
|
||||
}
|
||||
|
||||
merge := NewKWayMerge(readers)
|
||||
// merge.Close() will close readers
|
||||
|
||||
w, err := NewKdiWriter(outPath)
|
||||
if err != nil {
|
||||
merge.Close()
|
||||
return 0, err
|
||||
}
|
||||
|
||||
for {
|
||||
kmer, count, ok := merge.Next()
|
||||
if !ok {
|
||||
break
|
||||
}
|
||||
if count >= minQ && count <= maxQ {
|
||||
if err := w.Write(kmer); err != nil {
|
||||
merge.Close()
|
||||
w.Close()
|
||||
return 0, err
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
merge.Close()
|
||||
cnt := w.Count()
|
||||
return cnt, w.Close()
|
||||
}
|
||||
|
||||
// differenceOp computes set_0 minus the union of all other sets.
|
||||
func (ksg *KmerSetGroup) differenceOp(outputDir string) (*KmerSetGroup, error) {
|
||||
if ksg.n < 1 {
|
||||
return nil, fmt.Errorf("obikmer: difference requires at least 1 set")
|
||||
}
|
||||
|
||||
setDir := filepath.Join(outputDir, "set_0")
|
||||
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
counts := make([]uint64, ksg.partitions)
|
||||
|
||||
nWorkers := runtime.NumCPU()
|
||||
if nWorkers > ksg.partitions {
|
||||
nWorkers = ksg.partitions
|
||||
}
|
||||
|
||||
jobs := make(chan int, ksg.partitions)
|
||||
var wg sync.WaitGroup
|
||||
var errMu sync.Mutex
|
||||
var firstErr error
|
||||
|
||||
for w := 0; w < nWorkers; w++ {
|
||||
wg.Add(1)
|
||||
go func() {
|
||||
defer wg.Done()
|
||||
for p := range jobs {
|
||||
c, err := ksg.differencePartition(p, setDir)
|
||||
if err != nil {
|
||||
errMu.Lock()
|
||||
if firstErr == nil {
|
||||
firstErr = err
|
||||
}
|
||||
errMu.Unlock()
|
||||
return
|
||||
}
|
||||
counts[p] = c
|
||||
}
|
||||
}()
|
||||
}
|
||||
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
jobs <- p
|
||||
}
|
||||
close(jobs)
|
||||
wg.Wait()
|
||||
|
||||
if firstErr != nil {
|
||||
return nil, firstErr
|
||||
}
|
||||
|
||||
var totalCount uint64
|
||||
for _, c := range counts {
|
||||
totalCount += c
|
||||
}
|
||||
|
||||
result := &KmerSetGroup{
|
||||
path: outputDir,
|
||||
k: ksg.k,
|
||||
m: ksg.m,
|
||||
partitions: ksg.partitions,
|
||||
n: 1,
|
||||
setsIDs: []string{""},
|
||||
counts: []uint64{totalCount},
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
|
||||
if err := result.saveMetadata(); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
return result, nil
|
||||
}
|
||||
|
||||
// differencePartition computes set_0 - union(set_1..set_{n-1}) for one partition.
|
||||
func (ksg *KmerSetGroup) differencePartition(partIdx int, outSetDir string) (uint64, error) {
|
||||
outPath := filepath.Join(outSetDir, fmt.Sprintf("part_%04d.kdi", partIdx))
|
||||
|
||||
// Open set_0 reader
|
||||
r0, err := NewKdiReader(ksg.partitionPath(0, partIdx))
|
||||
if err != nil {
|
||||
return 0, err
|
||||
}
|
||||
|
||||
if r0.Count() == 0 {
|
||||
r0.Close()
|
||||
w, err := NewKdiWriter(outPath)
|
||||
if err != nil {
|
||||
return 0, err
|
||||
}
|
||||
return 0, w.Close()
|
||||
}
|
||||
|
||||
// Open readers for the other sets and merge them
|
||||
var otherReaders []*KdiReader
|
||||
for s := 1; s < ksg.n; s++ {
|
||||
r, err := NewKdiReader(ksg.partitionPath(s, partIdx))
|
||||
if err != nil {
|
||||
r0.Close()
|
||||
for _, rr := range otherReaders {
|
||||
rr.Close()
|
||||
}
|
||||
return 0, err
|
||||
}
|
||||
if r.Count() > 0 {
|
||||
otherReaders = append(otherReaders, r)
|
||||
} else {
|
||||
r.Close()
|
||||
}
|
||||
}
|
||||
|
||||
w, err := NewKdiWriter(outPath)
|
||||
if err != nil {
|
||||
r0.Close()
|
||||
for _, rr := range otherReaders {
|
||||
rr.Close()
|
||||
}
|
||||
return 0, err
|
||||
}
|
||||
|
||||
if len(otherReaders) == 0 {
|
||||
// No other sets — copy set_0
|
||||
for {
|
||||
v, ok := r0.Next()
|
||||
if !ok {
|
||||
break
|
||||
}
|
||||
if err := w.Write(v); err != nil {
|
||||
r0.Close()
|
||||
w.Close()
|
||||
return 0, err
|
||||
}
|
||||
}
|
||||
r0.Close()
|
||||
cnt := w.Count()
|
||||
return cnt, w.Close()
|
||||
}
|
||||
|
||||
// Merge other sets to get the "subtraction" stream
|
||||
otherMerge := NewKWayMerge(otherReaders)
|
||||
|
||||
// Streaming difference: advance both streams
|
||||
v0, ok0 := r0.Next()
|
||||
vo, _, oko := otherMerge.Next()
|
||||
|
||||
for ok0 {
|
||||
if !oko || v0 < vo {
|
||||
// v0 not in others → emit
|
||||
if err := w.Write(v0); err != nil {
|
||||
r0.Close()
|
||||
otherMerge.Close()
|
||||
w.Close()
|
||||
return 0, err
|
||||
}
|
||||
v0, ok0 = r0.Next()
|
||||
} else if v0 == vo {
|
||||
// v0 in others → skip
|
||||
v0, ok0 = r0.Next()
|
||||
vo, _, oko = otherMerge.Next()
|
||||
} else {
|
||||
// vo < v0 → advance others
|
||||
vo, _, oko = otherMerge.Next()
|
||||
}
|
||||
}
|
||||
|
||||
r0.Close()
|
||||
otherMerge.Close()
|
||||
cnt := w.Count()
|
||||
return cnt, w.Close()
|
||||
}
|
||||
|
||||
// mergeMode defines how to combine two values during pairwise operations.
|
||||
type mergeMode int
|
||||
|
||||
const (
|
||||
mergeUnion mergeMode = iota // emit if in either
|
||||
mergeIntersect // emit if in both
|
||||
)
|
||||
|
||||
// pairwiseOp applies a merge operation between corresponding sets of two groups.
|
||||
func (ksg *KmerSetGroup) pairwiseOp(other *KmerSetGroup, outputDir string, mode mergeMode) (*KmerSetGroup, error) {
|
||||
for s := 0; s < ksg.n; s++ {
|
||||
setDir := filepath.Join(outputDir, fmt.Sprintf("set_%d", s))
|
||||
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
}
|
||||
|
||||
counts := make([][]uint64, ksg.n)
|
||||
for s := 0; s < ksg.n; s++ {
|
||||
counts[s] = make([]uint64, ksg.partitions)
|
||||
}
|
||||
|
||||
nWorkers := runtime.NumCPU()
|
||||
if nWorkers > ksg.partitions {
|
||||
nWorkers = ksg.partitions
|
||||
}
|
||||
|
||||
type job struct {
|
||||
setIdx int
|
||||
partIdx int
|
||||
}
|
||||
jobs := make(chan job, ksg.n*ksg.partitions)
|
||||
var wg sync.WaitGroup
|
||||
var errMu sync.Mutex
|
||||
var firstErr error
|
||||
|
||||
for w := 0; w < nWorkers; w++ {
|
||||
wg.Add(1)
|
||||
go func() {
|
||||
defer wg.Done()
|
||||
for j := range jobs {
|
||||
c, err := pairwiseMergePartition(
|
||||
ksg.partitionPath(j.setIdx, j.partIdx),
|
||||
other.partitionPath(j.setIdx, j.partIdx),
|
||||
filepath.Join(outputDir, fmt.Sprintf("set_%d", j.setIdx),
|
||||
fmt.Sprintf("part_%04d.kdi", j.partIdx)),
|
||||
mode,
|
||||
)
|
||||
if err != nil {
|
||||
errMu.Lock()
|
||||
if firstErr == nil {
|
||||
firstErr = err
|
||||
}
|
||||
errMu.Unlock()
|
||||
return
|
||||
}
|
||||
counts[j.setIdx][j.partIdx] = c
|
||||
}
|
||||
}()
|
||||
}
|
||||
|
||||
for s := 0; s < ksg.n; s++ {
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
jobs <- job{s, p}
|
||||
}
|
||||
}
|
||||
close(jobs)
|
||||
wg.Wait()
|
||||
|
||||
if firstErr != nil {
|
||||
return nil, firstErr
|
||||
}
|
||||
|
||||
totalCounts := make([]uint64, ksg.n)
|
||||
setsIDs := make([]string, ksg.n)
|
||||
for s := 0; s < ksg.n; s++ {
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
totalCounts[s] += counts[s][p]
|
||||
}
|
||||
}
|
||||
|
||||
result := &KmerSetGroup{
|
||||
path: outputDir,
|
||||
k: ksg.k,
|
||||
m: ksg.m,
|
||||
partitions: ksg.partitions,
|
||||
n: ksg.n,
|
||||
setsIDs: setsIDs,
|
||||
counts: totalCounts,
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
|
||||
if err := result.saveMetadata(); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
return result, nil
|
||||
}
|
||||
|
||||
// pairwiseMergePartition merges two KDI files (sorted streams) with the given mode.
|
||||
func pairwiseMergePartition(pathA, pathB, outPath string, mode mergeMode) (uint64, error) {
|
||||
rA, err := NewKdiReader(pathA)
|
||||
if err != nil {
|
||||
return 0, err
|
||||
}
|
||||
rB, err := NewKdiReader(pathB)
|
||||
if err != nil {
|
||||
rA.Close()
|
||||
return 0, err
|
||||
}
|
||||
|
||||
w, err := NewKdiWriter(outPath)
|
||||
if err != nil {
|
||||
rA.Close()
|
||||
rB.Close()
|
||||
return 0, err
|
||||
}
|
||||
|
||||
cnt, mergeErr := doPairwiseMerge(rA, rB, w, mode)
|
||||
rA.Close()
|
||||
rB.Close()
|
||||
closeErr := w.Close()
|
||||
if mergeErr != nil {
|
||||
return 0, mergeErr
|
||||
}
|
||||
return cnt, closeErr
|
||||
}
|
||||
|
||||
func doPairwiseMerge(rA, rB *KdiReader, w *KdiWriter, mode mergeMode) (uint64, error) {
|
||||
vA, okA := rA.Next()
|
||||
vB, okB := rB.Next()
|
||||
|
||||
for okA && okB {
|
||||
if vA == vB {
|
||||
if err := w.Write(vA); err != nil {
|
||||
return 0, err
|
||||
}
|
||||
vA, okA = rA.Next()
|
||||
vB, okB = rB.Next()
|
||||
} else if vA < vB {
|
||||
if mode == mergeUnion {
|
||||
if err := w.Write(vA); err != nil {
|
||||
return 0, err
|
||||
}
|
||||
}
|
||||
vA, okA = rA.Next()
|
||||
} else {
|
||||
if mode == mergeUnion {
|
||||
if err := w.Write(vB); err != nil {
|
||||
return 0, err
|
||||
}
|
||||
}
|
||||
vB, okB = rB.Next()
|
||||
}
|
||||
}
|
||||
|
||||
if mode == mergeUnion {
|
||||
for okA {
|
||||
if err := w.Write(vA); err != nil {
|
||||
return 0, err
|
||||
}
|
||||
vA, okA = rA.Next()
|
||||
}
|
||||
for okB {
|
||||
if err := w.Write(vB); err != nil {
|
||||
return 0, err
|
||||
}
|
||||
vB, okB = rB.Next()
|
||||
}
|
||||
}
|
||||
|
||||
return w.Count(), nil
|
||||
}
|
||||
251
pkg/obikmer/kmer_set_disk_ops_test.go
Normal file
251
pkg/obikmer/kmer_set_disk_ops_test.go
Normal file
@@ -0,0 +1,251 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"path/filepath"
|
||||
"testing"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
// buildGroupFromSeqs creates a KmerSetGroup with one set per sequence.
|
||||
func buildGroupFromSeqs(t *testing.T, dir string, k, m int, seqs []string) *KmerSetGroup {
|
||||
t.Helper()
|
||||
n := len(seqs)
|
||||
builder, err := NewKmerSetGroupBuilder(dir, k, m, n, 64)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
for i, s := range seqs {
|
||||
seq := obiseq.NewBioSequence("", []byte(s), "")
|
||||
builder.AddSequence(i, seq)
|
||||
}
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
return ksg
|
||||
}
|
||||
|
||||
func collectKmers(t *testing.T, ksg *KmerSetGroup, setIdx int) []uint64 {
|
||||
t.Helper()
|
||||
var result []uint64
|
||||
for kmer := range ksg.Iterator(setIdx) {
|
||||
result = append(result, kmer)
|
||||
}
|
||||
return result
|
||||
}
|
||||
|
||||
func TestDiskOpsUnion(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
indexDir := filepath.Join(dir, "index")
|
||||
outDir := filepath.Join(dir, "union")
|
||||
|
||||
// Two sequences with some overlap
|
||||
seqs := []string{
|
||||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||
}
|
||||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||
|
||||
result, err := ksg.Union(outDir)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Union should have at least as many k-mers as each individual set
|
||||
unionLen := result.Len(0)
|
||||
if unionLen == 0 {
|
||||
t.Fatal("union is empty")
|
||||
}
|
||||
if unionLen < ksg.Len(0) || unionLen < ksg.Len(1) {
|
||||
t.Fatalf("union (%d) smaller than an input set (%d, %d)", unionLen, ksg.Len(0), ksg.Len(1))
|
||||
}
|
||||
|
||||
// Union should not exceed the sum of both sets
|
||||
if unionLen > ksg.Len(0)+ksg.Len(1) {
|
||||
t.Fatalf("union (%d) larger than sum of sets (%d)", unionLen, ksg.Len(0)+ksg.Len(1))
|
||||
}
|
||||
}
|
||||
|
||||
func TestDiskOpsIntersect(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
indexDir := filepath.Join(dir, "index")
|
||||
outDir := filepath.Join(dir, "intersect")
|
||||
|
||||
// Two sequences with some shared k-mers
|
||||
seqs := []string{
|
||||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||
}
|
||||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||
|
||||
result, err := ksg.Intersect(outDir)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
interLen := result.Len(0)
|
||||
// Intersection should not be bigger than any individual set
|
||||
if interLen > ksg.Len(0) || interLen > ksg.Len(1) {
|
||||
t.Fatalf("intersection (%d) larger than input sets (%d, %d)", interLen, ksg.Len(0), ksg.Len(1))
|
||||
}
|
||||
}
|
||||
|
||||
func TestDiskOpsDifference(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
indexDir := filepath.Join(dir, "index")
|
||||
outDir := filepath.Join(dir, "diff")
|
||||
|
||||
seqs := []string{
|
||||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||
}
|
||||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||
|
||||
result, err := ksg.Difference(outDir)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
diffLen := result.Len(0)
|
||||
// Difference = set_0 - set_1, so should be <= set_0
|
||||
if diffLen > ksg.Len(0) {
|
||||
t.Fatalf("difference (%d) larger than set_0 (%d)", diffLen, ksg.Len(0))
|
||||
}
|
||||
}
|
||||
|
||||
func TestDiskOpsConsistency(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
indexDir := filepath.Join(dir, "index")
|
||||
|
||||
seqs := []string{
|
||||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||
}
|
||||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||
|
||||
unionResult, err := ksg.Union(filepath.Join(dir, "union"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
interResult, err := ksg.Intersect(filepath.Join(dir, "intersect"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
diffResult, err := ksg.Difference(filepath.Join(dir, "diff"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
unionLen := unionResult.Len(0)
|
||||
interLen := interResult.Len(0)
|
||||
diffLen := diffResult.Len(0)
|
||||
|
||||
// |A ∪ B| = |A| + |B| - |A ∩ B|
|
||||
expectedUnion := ksg.Len(0) + ksg.Len(1) - interLen
|
||||
if unionLen != expectedUnion {
|
||||
t.Fatalf("|A∪B|=%d, expected |A|+|B|-|A∩B|=%d+%d-%d=%d",
|
||||
unionLen, ksg.Len(0), ksg.Len(1), interLen, expectedUnion)
|
||||
}
|
||||
|
||||
// |A \ B| = |A| - |A ∩ B|
|
||||
expectedDiff := ksg.Len(0) - interLen
|
||||
if diffLen != expectedDiff {
|
||||
t.Fatalf("|A\\B|=%d, expected |A|-|A∩B|=%d-%d=%d",
|
||||
diffLen, ksg.Len(0), interLen, expectedDiff)
|
||||
}
|
||||
}
|
||||
|
||||
func TestDiskOpsQuorum(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
indexDir := filepath.Join(dir, "index")
|
||||
|
||||
// Three sets
|
||||
seqs := []string{
|
||||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||
"GATCGATCGATCGAAATTTCCCGGG",
|
||||
}
|
||||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||
|
||||
// QuorumAtLeast(1) = Union
|
||||
q1, err := ksg.QuorumAtLeast(1, filepath.Join(dir, "q1"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
union, err := ksg.Union(filepath.Join(dir, "union"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if q1.Len(0) != union.Len(0) {
|
||||
t.Fatalf("QuorumAtLeast(1)=%d != Union=%d", q1.Len(0), union.Len(0))
|
||||
}
|
||||
|
||||
// QuorumAtLeast(3) = Intersect
|
||||
q3, err := ksg.QuorumAtLeast(3, filepath.Join(dir, "q3"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
inter, err := ksg.Intersect(filepath.Join(dir, "inter"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if q3.Len(0) != inter.Len(0) {
|
||||
t.Fatalf("QuorumAtLeast(3)=%d != Intersect=%d", q3.Len(0), inter.Len(0))
|
||||
}
|
||||
|
||||
// QuorumAtLeast(2) should be between Intersect and Union
|
||||
q2, err := ksg.QuorumAtLeast(2, filepath.Join(dir, "q2"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if q2.Len(0) < q3.Len(0) || q2.Len(0) > q1.Len(0) {
|
||||
t.Fatalf("QuorumAtLeast(2)=%d not between intersect=%d and union=%d",
|
||||
q2.Len(0), q3.Len(0), q1.Len(0))
|
||||
}
|
||||
}
|
||||
|
||||
func TestDiskOpsJaccard(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
indexDir := filepath.Join(dir, "index")
|
||||
|
||||
seqs := []string{
|
||||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG", // identical to first
|
||||
"TTTTTTTTTTTTTTTTTTTTTTTTT", // completely different
|
||||
}
|
||||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||
|
||||
dm := ksg.JaccardDistanceMatrix()
|
||||
if dm == nil {
|
||||
t.Fatal("JaccardDistanceMatrix returned nil")
|
||||
}
|
||||
|
||||
// Identical sets should have distance 0
|
||||
d01 := dm.Get(0, 1)
|
||||
if d01 != 0.0 {
|
||||
t.Fatalf("distance(0,1) = %f, expected 0.0 for identical sets", d01)
|
||||
}
|
||||
|
||||
// Completely different sets should have distance 1.0
|
||||
d02 := dm.Get(0, 2)
|
||||
if d02 != 1.0 {
|
||||
t.Fatalf("distance(0,2) = %f, expected 1.0 for disjoint sets", d02)
|
||||
}
|
||||
|
||||
// Similarity matrix
|
||||
sm := ksg.JaccardSimilarityMatrix()
|
||||
if sm == nil {
|
||||
t.Fatal("JaccardSimilarityMatrix returned nil")
|
||||
}
|
||||
|
||||
s01 := sm.Get(0, 1)
|
||||
if s01 != 1.0 {
|
||||
t.Fatalf("similarity(0,1) = %f, expected 1.0 for identical sets", s01)
|
||||
}
|
||||
|
||||
s02 := sm.Get(0, 2)
|
||||
if s02 != 0.0 {
|
||||
t.Fatalf("similarity(0,2) = %f, expected 0.0 for disjoint sets", s02)
|
||||
}
|
||||
}
|
||||
@@ -1,339 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidist"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
// KmerSetGroup represents a vector of KmerSet
|
||||
// Used to manage multiple k-mer sets (for example, by frequency level)
|
||||
type KmerSetGroup struct {
|
||||
id string // Unique identifier of the KmerSetGroup
|
||||
k int // Size of k-mers (immutable)
|
||||
sets []*KmerSet // Vector of KmerSet
|
||||
Metadata map[string]interface{} // Group metadata (not individual sets)
|
||||
}
|
||||
|
||||
// NewKmerSetGroup creates a new group of n KmerSets
|
||||
func NewKmerSetGroup(k int, n int) *KmerSetGroup {
|
||||
if n < 1 {
|
||||
panic("KmerSetGroup size must be >= 1")
|
||||
}
|
||||
|
||||
sets := make([]*KmerSet, n)
|
||||
for i := range sets {
|
||||
sets[i] = NewKmerSet(k)
|
||||
}
|
||||
|
||||
return &KmerSetGroup{
|
||||
k: k,
|
||||
sets: sets,
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
}
|
||||
|
||||
// K returns the size of k-mers (immutable)
|
||||
func (ksg *KmerSetGroup) K() int {
|
||||
return ksg.k
|
||||
}
|
||||
|
||||
// Size returns the number of KmerSet in the group
|
||||
func (ksg *KmerSetGroup) Size() int {
|
||||
return len(ksg.sets)
|
||||
}
|
||||
|
||||
// Get returns the KmerSet at the given index
|
||||
// Returns nil if the index is invalid
|
||||
func (ksg *KmerSetGroup) Get(index int) *KmerSet {
|
||||
if index < 0 || index >= len(ksg.sets) {
|
||||
return nil
|
||||
}
|
||||
return ksg.sets[index]
|
||||
}
|
||||
|
||||
// Set replaces the KmerSet at the given index
|
||||
// Panics if the index is invalid or if k does not match
|
||||
func (ksg *KmerSetGroup) Set(index int, ks *KmerSet) {
|
||||
if index < 0 || index >= len(ksg.sets) {
|
||||
panic(fmt.Sprintf("Index out of bounds: %d (size: %d)", index, len(ksg.sets)))
|
||||
}
|
||||
if ks.k != ksg.k {
|
||||
panic(fmt.Sprintf("KmerSet k mismatch: expected %d, got %d", ksg.k, ks.k))
|
||||
}
|
||||
ksg.sets[index] = ks
|
||||
}
|
||||
|
||||
// Len returns the number of k-mers in a specific KmerSet
|
||||
// Without argument: returns the number of k-mers in the last KmerSet
|
||||
// With argument index: returns the number of k-mers in the KmerSet at this index
|
||||
func (ksg *KmerSetGroup) Len(index ...int) uint64 {
|
||||
if len(index) == 0 {
|
||||
// Without argument: last KmerSet
|
||||
return ksg.sets[len(ksg.sets)-1].Len()
|
||||
}
|
||||
|
||||
// With argument: specific KmerSet
|
||||
idx := index[0]
|
||||
if idx < 0 || idx >= len(ksg.sets) {
|
||||
return 0
|
||||
}
|
||||
return ksg.sets[idx].Len()
|
||||
}
|
||||
|
||||
// MemoryUsage returns the total memory usage in bytes
|
||||
func (ksg *KmerSetGroup) MemoryUsage() uint64 {
|
||||
total := uint64(0)
|
||||
for _, ks := range ksg.sets {
|
||||
total += ks.MemoryUsage()
|
||||
}
|
||||
return total
|
||||
}
|
||||
|
||||
// Clear empties all KmerSet in the group
|
||||
func (ksg *KmerSetGroup) Clear() {
|
||||
for _, ks := range ksg.sets {
|
||||
ks.Clear()
|
||||
}
|
||||
}
|
||||
|
||||
// Copy creates a complete copy of the group (consistent with BioSequence.Copy)
|
||||
func (ksg *KmerSetGroup) Copy() *KmerSetGroup {
|
||||
copiedSets := make([]*KmerSet, len(ksg.sets))
|
||||
for i, ks := range ksg.sets {
|
||||
copiedSets[i] = ks.Copy() // Copy each KmerSet with its metadata
|
||||
}
|
||||
|
||||
// Copy group metadata
|
||||
groupMetadata := make(map[string]interface{}, len(ksg.Metadata))
|
||||
for k, v := range ksg.Metadata {
|
||||
groupMetadata[k] = v
|
||||
}
|
||||
|
||||
return &KmerSetGroup{
|
||||
id: ksg.id,
|
||||
k: ksg.k,
|
||||
sets: copiedSets,
|
||||
Metadata: groupMetadata,
|
||||
}
|
||||
}
|
||||
|
||||
// Id returns the identifier of the KmerSetGroup (consistent with BioSequence.Id)
|
||||
func (ksg *KmerSetGroup) Id() string {
|
||||
return ksg.id
|
||||
}
|
||||
|
||||
// SetId sets the identifier of the KmerSetGroup (consistent with BioSequence.SetId)
|
||||
func (ksg *KmerSetGroup) SetId(id string) {
|
||||
ksg.id = id
|
||||
}
|
||||
|
||||
// AddSequence adds all k-mers from a sequence to a specific KmerSet
|
||||
func (ksg *KmerSetGroup) AddSequence(seq *obiseq.BioSequence, index int) {
|
||||
if index < 0 || index >= len(ksg.sets) {
|
||||
panic(fmt.Sprintf("Index out of bounds: %d (size: %d)", index, len(ksg.sets)))
|
||||
}
|
||||
ksg.sets[index].AddSequence(seq)
|
||||
}
|
||||
|
||||
// AddSequences adds all k-mers from multiple sequences to a specific KmerSet
|
||||
func (ksg *KmerSetGroup) AddSequences(sequences *obiseq.BioSequenceSlice, index int) {
|
||||
if index < 0 || index >= len(ksg.sets) {
|
||||
panic(fmt.Sprintf("Index out of bounds: %d (size: %d)", index, len(ksg.sets)))
|
||||
}
|
||||
ksg.sets[index].AddSequences(sequences)
|
||||
}
|
||||
|
||||
// Union returns the union of all KmerSet in the group
|
||||
// Optimization: starts from the largest set to minimize operations
|
||||
func (ksg *KmerSetGroup) Union() *KmerSet {
|
||||
if len(ksg.sets) == 0 {
|
||||
return NewKmerSet(ksg.k)
|
||||
}
|
||||
|
||||
if len(ksg.sets) == 1 {
|
||||
return ksg.sets[0].Copy()
|
||||
}
|
||||
|
||||
// Find the index of the largest set (the one with the most k-mers)
|
||||
maxIdx := 0
|
||||
maxCard := ksg.sets[0].Len()
|
||||
for i := 1; i < len(ksg.sets); i++ {
|
||||
card := ksg.sets[i].Len()
|
||||
if card > maxCard {
|
||||
maxCard = card
|
||||
maxIdx = i
|
||||
}
|
||||
}
|
||||
|
||||
// Copy the largest set and perform unions in-place
|
||||
result := ksg.sets[maxIdx].bitmap.Clone()
|
||||
for i := 0; i < len(ksg.sets); i++ {
|
||||
if i != maxIdx {
|
||||
result.Or(ksg.sets[i].bitmap)
|
||||
}
|
||||
}
|
||||
|
||||
return NewKmerSetFromBitmap(ksg.k, result)
|
||||
}
|
||||
|
||||
// Intersect returns the intersection of all KmerSet in the group
|
||||
// Optimization: starts from the smallest set to minimize operations
|
||||
func (ksg *KmerSetGroup) Intersect() *KmerSet {
|
||||
if len(ksg.sets) == 0 {
|
||||
return NewKmerSet(ksg.k)
|
||||
}
|
||||
|
||||
if len(ksg.sets) == 1 {
|
||||
return ksg.sets[0].Copy()
|
||||
}
|
||||
|
||||
// Find the index of the smallest set (the one with the fewest k-mers)
|
||||
minIdx := 0
|
||||
minCard := ksg.sets[0].Len()
|
||||
for i := 1; i < len(ksg.sets); i++ {
|
||||
card := ksg.sets[i].Len()
|
||||
if card < minCard {
|
||||
minCard = card
|
||||
minIdx = i
|
||||
}
|
||||
}
|
||||
|
||||
// Copy the smallest set and perform intersections in-place
|
||||
result := ksg.sets[minIdx].bitmap.Clone()
|
||||
for i := 0; i < len(ksg.sets); i++ {
|
||||
if i != minIdx {
|
||||
result.And(ksg.sets[i].bitmap)
|
||||
}
|
||||
}
|
||||
|
||||
return NewKmerSetFromBitmap(ksg.k, result)
|
||||
}
|
||||
|
||||
// Stats returns statistics for each KmerSet in the group
|
||||
type KmerSetGroupStats struct {
|
||||
K int
|
||||
Size int // Number of KmerSet
|
||||
TotalBytes uint64 // Total memory used
|
||||
Sets []KmerSetStats // Stats of each KmerSet
|
||||
}
|
||||
|
||||
type KmerSetStats struct {
|
||||
Index int // Index of the KmerSet in the group
|
||||
Len uint64 // Number of k-mers
|
||||
SizeBytes uint64 // Size in bytes
|
||||
}
|
||||
|
||||
func (ksg *KmerSetGroup) Stats() KmerSetGroupStats {
|
||||
stats := KmerSetGroupStats{
|
||||
K: ksg.k,
|
||||
Size: len(ksg.sets),
|
||||
Sets: make([]KmerSetStats, len(ksg.sets)),
|
||||
}
|
||||
|
||||
for i, ks := range ksg.sets {
|
||||
sizeBytes := ks.MemoryUsage()
|
||||
stats.Sets[i] = KmerSetStats{
|
||||
Index: i,
|
||||
Len: ks.Len(),
|
||||
SizeBytes: sizeBytes,
|
||||
}
|
||||
stats.TotalBytes += sizeBytes
|
||||
}
|
||||
|
||||
return stats
|
||||
}
|
||||
|
||||
func (ksgs KmerSetGroupStats) String() string {
|
||||
result := fmt.Sprintf(`KmerSetGroup Statistics (k=%d, size=%d):
|
||||
Total memory: %.2f MB
|
||||
|
||||
Set breakdown:
|
||||
`, ksgs.K, ksgs.Size, float64(ksgs.TotalBytes)/1024/1024)
|
||||
|
||||
for _, set := range ksgs.Sets {
|
||||
result += fmt.Sprintf(" Set[%d]: %d k-mers (%.2f MB)\n",
|
||||
set.Index,
|
||||
set.Len,
|
||||
float64(set.SizeBytes)/1024/1024)
|
||||
}
|
||||
|
||||
return result
|
||||
}
|
||||
|
||||
// JaccardDistanceMatrix computes a pairwise Jaccard distance matrix for all KmerSets in the group.
|
||||
// Returns a triangular distance matrix where element (i, j) represents the Jaccard distance
|
||||
// between set i and set j.
|
||||
//
|
||||
// The Jaccard distance is: 1 - (|A ∩ B| / |A ∪ B|)
|
||||
//
|
||||
// The matrix labels are set to the IDs of the individual KmerSets if available,
|
||||
// otherwise they are set to "set_0", "set_1", etc.
|
||||
//
|
||||
// Time complexity: O(n² × (|A| + |B|)) where n is the number of sets
|
||||
// Space complexity: O(n²) for the distance matrix
|
||||
func (ksg *KmerSetGroup) JaccardDistanceMatrix() *obidist.DistMatrix {
|
||||
n := len(ksg.sets)
|
||||
|
||||
// Create labels from set IDs
|
||||
labels := make([]string, n)
|
||||
for i, ks := range ksg.sets {
|
||||
if ks.Id() != "" {
|
||||
labels[i] = ks.Id()
|
||||
} else {
|
||||
labels[i] = fmt.Sprintf("set_%d", i)
|
||||
}
|
||||
}
|
||||
|
||||
dm := obidist.NewDistMatrixWithLabels(labels)
|
||||
|
||||
// Compute pairwise distances
|
||||
for i := 0; i < n-1; i++ {
|
||||
for j := i + 1; j < n; j++ {
|
||||
distance := ksg.sets[i].JaccardDistance(ksg.sets[j])
|
||||
dm.Set(i, j, distance)
|
||||
}
|
||||
}
|
||||
|
||||
return dm
|
||||
}
|
||||
|
||||
// JaccardSimilarityMatrix computes a pairwise Jaccard similarity matrix for all KmerSets in the group.
|
||||
// Returns a similarity matrix where element (i, j) represents the Jaccard similarity
|
||||
// between set i and set j.
|
||||
//
|
||||
// The Jaccard similarity is: |A ∩ B| / |A ∪ B|
|
||||
//
|
||||
// The diagonal is 1.0 (similarity of a set to itself).
|
||||
//
|
||||
// The matrix labels are set to the IDs of the individual KmerSets if available,
|
||||
// otherwise they are set to "set_0", "set_1", etc.
|
||||
//
|
||||
// Time complexity: O(n² × (|A| + |B|)) where n is the number of sets
|
||||
// Space complexity: O(n²) for the similarity matrix
|
||||
func (ksg *KmerSetGroup) JaccardSimilarityMatrix() *obidist.DistMatrix {
|
||||
n := len(ksg.sets)
|
||||
|
||||
// Create labels from set IDs
|
||||
labels := make([]string, n)
|
||||
for i, ks := range ksg.sets {
|
||||
if ks.Id() != "" {
|
||||
labels[i] = ks.Id()
|
||||
} else {
|
||||
labels[i] = fmt.Sprintf("set_%d", i)
|
||||
}
|
||||
}
|
||||
|
||||
sm := obidist.NewSimilarityMatrixWithLabels(labels)
|
||||
|
||||
// Compute pairwise similarities
|
||||
for i := 0; i < n-1; i++ {
|
||||
for j := i + 1; j < n; j++ {
|
||||
similarity := ksg.sets[i].JaccardSimilarity(ksg.sets[j])
|
||||
sm.Set(i, j, similarity)
|
||||
}
|
||||
}
|
||||
|
||||
return sm
|
||||
}
|
||||
@@ -1,231 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"math"
|
||||
"testing"
|
||||
)
|
||||
|
||||
func TestKmerSetGroupJaccardDistanceMatrix(t *testing.T) {
|
||||
ksg := NewKmerSetGroup(5, 3)
|
||||
|
||||
// Set 0: {1, 2, 3}
|
||||
ksg.Get(0).AddKmerCode(1)
|
||||
ksg.Get(0).AddKmerCode(2)
|
||||
ksg.Get(0).AddKmerCode(3)
|
||||
ksg.Get(0).SetId("set_A")
|
||||
|
||||
// Set 1: {2, 3, 4}
|
||||
ksg.Get(1).AddKmerCode(2)
|
||||
ksg.Get(1).AddKmerCode(3)
|
||||
ksg.Get(1).AddKmerCode(4)
|
||||
ksg.Get(1).SetId("set_B")
|
||||
|
||||
// Set 2: {5, 6, 7}
|
||||
ksg.Get(2).AddKmerCode(5)
|
||||
ksg.Get(2).AddKmerCode(6)
|
||||
ksg.Get(2).AddKmerCode(7)
|
||||
ksg.Get(2).SetId("set_C")
|
||||
|
||||
dm := ksg.JaccardDistanceMatrix()
|
||||
|
||||
// Check labels
|
||||
if dm.GetLabel(0) != "set_A" {
|
||||
t.Errorf("Expected label 'set_A' at index 0, got '%s'", dm.GetLabel(0))
|
||||
}
|
||||
if dm.GetLabel(1) != "set_B" {
|
||||
t.Errorf("Expected label 'set_B' at index 1, got '%s'", dm.GetLabel(1))
|
||||
}
|
||||
if dm.GetLabel(2) != "set_C" {
|
||||
t.Errorf("Expected label 'set_C' at index 2, got '%s'", dm.GetLabel(2))
|
||||
}
|
||||
|
||||
// Check distances
|
||||
// Distance(0, 1):
|
||||
// Intersection: {2, 3} -> 2 elements
|
||||
// Union: {1, 2, 3, 4} -> 4 elements
|
||||
// Similarity: 2/4 = 0.5
|
||||
// Distance: 1 - 0.5 = 0.5
|
||||
expectedDist01 := 0.5
|
||||
actualDist01 := dm.Get(0, 1)
|
||||
if math.Abs(actualDist01-expectedDist01) > 1e-10 {
|
||||
t.Errorf("Distance(0, 1): expected %f, got %f", expectedDist01, actualDist01)
|
||||
}
|
||||
|
||||
// Distance(0, 2):
|
||||
// Intersection: {} -> 0 elements
|
||||
// Union: {1, 2, 3, 5, 6, 7} -> 6 elements
|
||||
// Similarity: 0/6 = 0
|
||||
// Distance: 1 - 0 = 1.0
|
||||
expectedDist02 := 1.0
|
||||
actualDist02 := dm.Get(0, 2)
|
||||
if math.Abs(actualDist02-expectedDist02) > 1e-10 {
|
||||
t.Errorf("Distance(0, 2): expected %f, got %f", expectedDist02, actualDist02)
|
||||
}
|
||||
|
||||
// Distance(1, 2):
|
||||
// Intersection: {} -> 0 elements
|
||||
// Union: {2, 3, 4, 5, 6, 7} -> 6 elements
|
||||
// Similarity: 0/6 = 0
|
||||
// Distance: 1 - 0 = 1.0
|
||||
expectedDist12 := 1.0
|
||||
actualDist12 := dm.Get(1, 2)
|
||||
if math.Abs(actualDist12-expectedDist12) > 1e-10 {
|
||||
t.Errorf("Distance(1, 2): expected %f, got %f", expectedDist12, actualDist12)
|
||||
}
|
||||
|
||||
// Check symmetry
|
||||
if dm.Get(0, 1) != dm.Get(1, 0) {
|
||||
t.Errorf("Matrix not symmetric: Get(0, 1) = %f, Get(1, 0) = %f",
|
||||
dm.Get(0, 1), dm.Get(1, 0))
|
||||
}
|
||||
|
||||
// Check diagonal
|
||||
if dm.Get(0, 0) != 0.0 {
|
||||
t.Errorf("Diagonal should be 0, got %f", dm.Get(0, 0))
|
||||
}
|
||||
if dm.Get(1, 1) != 0.0 {
|
||||
t.Errorf("Diagonal should be 0, got %f", dm.Get(1, 1))
|
||||
}
|
||||
if dm.Get(2, 2) != 0.0 {
|
||||
t.Errorf("Diagonal should be 0, got %f", dm.Get(2, 2))
|
||||
}
|
||||
}
|
||||
|
||||
func TestKmerSetGroupJaccardSimilarityMatrix(t *testing.T) {
|
||||
ksg := NewKmerSetGroup(5, 3)
|
||||
|
||||
// Set 0: {1, 2, 3}
|
||||
ksg.Get(0).AddKmerCode(1)
|
||||
ksg.Get(0).AddKmerCode(2)
|
||||
ksg.Get(0).AddKmerCode(3)
|
||||
|
||||
// Set 1: {2, 3, 4}
|
||||
ksg.Get(1).AddKmerCode(2)
|
||||
ksg.Get(1).AddKmerCode(3)
|
||||
ksg.Get(1).AddKmerCode(4)
|
||||
|
||||
// Set 2: {1, 2, 3} (same as set 0)
|
||||
ksg.Get(2).AddKmerCode(1)
|
||||
ksg.Get(2).AddKmerCode(2)
|
||||
ksg.Get(2).AddKmerCode(3)
|
||||
|
||||
sm := ksg.JaccardSimilarityMatrix()
|
||||
|
||||
// Check similarities
|
||||
// Similarity(0, 1): 0.5 (as calculated above)
|
||||
expectedSim01 := 0.5
|
||||
actualSim01 := sm.Get(0, 1)
|
||||
if math.Abs(actualSim01-expectedSim01) > 1e-10 {
|
||||
t.Errorf("Similarity(0, 1): expected %f, got %f", expectedSim01, actualSim01)
|
||||
}
|
||||
|
||||
// Similarity(0, 2): 1.0 (identical sets)
|
||||
expectedSim02 := 1.0
|
||||
actualSim02 := sm.Get(0, 2)
|
||||
if math.Abs(actualSim02-expectedSim02) > 1e-10 {
|
||||
t.Errorf("Similarity(0, 2): expected %f, got %f", expectedSim02, actualSim02)
|
||||
}
|
||||
|
||||
// Similarity(1, 2): 0.5
|
||||
// Intersection: {2, 3} -> 2
|
||||
// Union: {1, 2, 3, 4} -> 4
|
||||
// Similarity: 2/4 = 0.5
|
||||
expectedSim12 := 0.5
|
||||
actualSim12 := sm.Get(1, 2)
|
||||
if math.Abs(actualSim12-expectedSim12) > 1e-10 {
|
||||
t.Errorf("Similarity(1, 2): expected %f, got %f", expectedSim12, actualSim12)
|
||||
}
|
||||
|
||||
// Check diagonal (similarity to self = 1.0)
|
||||
if sm.Get(0, 0) != 1.0 {
|
||||
t.Errorf("Diagonal should be 1.0, got %f", sm.Get(0, 0))
|
||||
}
|
||||
if sm.Get(1, 1) != 1.0 {
|
||||
t.Errorf("Diagonal should be 1.0, got %f", sm.Get(1, 1))
|
||||
}
|
||||
if sm.Get(2, 2) != 1.0 {
|
||||
t.Errorf("Diagonal should be 1.0, got %f", sm.Get(2, 2))
|
||||
}
|
||||
}
|
||||
|
||||
func TestKmerSetGroupJaccardMatricesRelation(t *testing.T) {
|
||||
ksg := NewKmerSetGroup(5, 4)
|
||||
|
||||
// Create different sets
|
||||
ksg.Get(0).AddKmerCode(1)
|
||||
ksg.Get(0).AddKmerCode(2)
|
||||
|
||||
ksg.Get(1).AddKmerCode(2)
|
||||
ksg.Get(1).AddKmerCode(3)
|
||||
|
||||
ksg.Get(2).AddKmerCode(1)
|
||||
ksg.Get(2).AddKmerCode(2)
|
||||
ksg.Get(2).AddKmerCode(3)
|
||||
|
||||
ksg.Get(3).AddKmerCode(10)
|
||||
ksg.Get(3).AddKmerCode(20)
|
||||
|
||||
dm := ksg.JaccardDistanceMatrix()
|
||||
sm := ksg.JaccardSimilarityMatrix()
|
||||
|
||||
// For all pairs (including diagonal), distance + similarity should equal 1.0
|
||||
for i := 0; i < 4; i++ {
|
||||
for j := 0; j < 4; j++ {
|
||||
distance := dm.Get(i, j)
|
||||
similarity := sm.Get(i, j)
|
||||
sum := distance + similarity
|
||||
|
||||
if math.Abs(sum-1.0) > 1e-10 {
|
||||
t.Errorf("At (%d, %d): distance %f + similarity %f = %f, expected 1.0",
|
||||
i, j, distance, similarity, sum)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestKmerSetGroupJaccardMatrixLabels(t *testing.T) {
|
||||
ksg := NewKmerSetGroup(5, 3)
|
||||
|
||||
// Don't set IDs - should use default labels
|
||||
ksg.Get(0).AddKmerCode(1)
|
||||
ksg.Get(1).AddKmerCode(2)
|
||||
ksg.Get(2).AddKmerCode(3)
|
||||
|
||||
dm := ksg.JaccardDistanceMatrix()
|
||||
|
||||
// Check default labels
|
||||
if dm.GetLabel(0) != "set_0" {
|
||||
t.Errorf("Expected default label 'set_0', got '%s'", dm.GetLabel(0))
|
||||
}
|
||||
if dm.GetLabel(1) != "set_1" {
|
||||
t.Errorf("Expected default label 'set_1', got '%s'", dm.GetLabel(1))
|
||||
}
|
||||
if dm.GetLabel(2) != "set_2" {
|
||||
t.Errorf("Expected default label 'set_2', got '%s'", dm.GetLabel(2))
|
||||
}
|
||||
}
|
||||
|
||||
func TestKmerSetGroupJaccardMatrixSize(t *testing.T) {
|
||||
ksg := NewKmerSetGroup(5, 5)
|
||||
|
||||
for i := 0; i < 5; i++ {
|
||||
ksg.Get(i).AddKmerCode(uint64(i))
|
||||
}
|
||||
|
||||
dm := ksg.JaccardDistanceMatrix()
|
||||
|
||||
if dm.Size() != 5 {
|
||||
t.Errorf("Expected matrix size 5, got %d", dm.Size())
|
||||
}
|
||||
|
||||
// All sets are disjoint, so all distances should be 1.0
|
||||
for i := 0; i < 5; i++ {
|
||||
for j := i + 1; j < 5; j++ {
|
||||
dist := dm.Get(i, j)
|
||||
if math.Abs(dist-1.0) > 1e-10 {
|
||||
t.Errorf("Expected distance 1.0 for disjoint sets (%d, %d), got %f",
|
||||
i, j, dist)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
@@ -1,235 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"container/heap"
|
||||
|
||||
"github.com/RoaringBitmap/roaring/roaring64"
|
||||
)
|
||||
|
||||
// heapItem represents an element in the min-heap for k-way merge
|
||||
type heapItem struct {
|
||||
value uint64
|
||||
idx int
|
||||
}
|
||||
|
||||
// kmerMinHeap implements heap.Interface for k-way merge algorithm
|
||||
type kmerMinHeap []heapItem
|
||||
|
||||
func (h kmerMinHeap) Len() int { return len(h) }
|
||||
func (h kmerMinHeap) Less(i, j int) bool { return h[i].value < h[j].value }
|
||||
func (h kmerMinHeap) Swap(i, j int) { h[i], h[j] = h[j], h[i] }
|
||||
|
||||
func (h *kmerMinHeap) Push(x interface{}) {
|
||||
*h = append(*h, x.(heapItem))
|
||||
}
|
||||
|
||||
func (h *kmerMinHeap) Pop() interface{} {
|
||||
old := *h
|
||||
n := len(old)
|
||||
x := old[n-1]
|
||||
*h = old[0 : n-1]
|
||||
return x
|
||||
}
|
||||
|
||||
// QuorumAtLeast returns k-mers present in at least q sets
|
||||
//
|
||||
// Algorithm: K-way merge with min-heap counting
|
||||
//
|
||||
// The algorithm processes all k-mers in sorted order using a min-heap:
|
||||
//
|
||||
// 1. Initialize one iterator per non-empty set
|
||||
// 2. Build a min-heap of (value, set_index) pairs, one per iterator
|
||||
// 3. While heap is not empty:
|
||||
// a. Extract the minimum value v from heap
|
||||
// b. Pop ALL heap items with value == v (counting occurrences)
|
||||
// c. If count >= q, add v to result
|
||||
// d. Advance each popped iterator and re-insert into heap if valid
|
||||
//
|
||||
// This ensures each unique k-mer is counted exactly once across all sets.
|
||||
//
|
||||
// Time complexity: O(M log N)
|
||||
// - M = sum of all set cardinalities (total k-mer occurrences)
|
||||
// - N = number of sets
|
||||
// - Each k-mer occurrence is inserted/extracted from heap once: O(M) operations
|
||||
// - Each heap operation costs O(log N)
|
||||
//
|
||||
// Space complexity: O(N)
|
||||
// - Heap contains at most N elements (one per set iterator)
|
||||
// - Output bitmap size depends on quorum result
|
||||
//
|
||||
// Special cases (optimized):
|
||||
// - q <= 0: returns empty set
|
||||
// - q == 1: delegates to Union() (native OR operations)
|
||||
// - q == n: delegates to Intersect() (native AND operations)
|
||||
// - q > n: returns empty set (impossible to satisfy)
|
||||
func (ksg *KmerSetGroup) QuorumAtLeast(q int) *KmerSet {
|
||||
n := len(ksg.sets)
|
||||
|
||||
// Edge cases
|
||||
if q <= 0 || n == 0 {
|
||||
return NewKmerSet(ksg.k)
|
||||
}
|
||||
if q > n {
|
||||
return NewKmerSet(ksg.k)
|
||||
}
|
||||
if q == 1 {
|
||||
return ksg.Union()
|
||||
}
|
||||
if q == n {
|
||||
return ksg.Intersect()
|
||||
}
|
||||
|
||||
// Initialize iterators for all non-empty sets
|
||||
iterators := make([]roaring64.IntIterable64, 0, n)
|
||||
iterIndices := make([]int, 0, n)
|
||||
|
||||
for i, set := range ksg.sets {
|
||||
if set.Len() > 0 {
|
||||
iter := set.bitmap.Iterator()
|
||||
if iter.HasNext() {
|
||||
iterators = append(iterators, iter)
|
||||
iterIndices = append(iterIndices, i)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
if len(iterators) == 0 {
|
||||
return NewKmerSet(ksg.k)
|
||||
}
|
||||
|
||||
// Initialize heap with first value from each iterator
|
||||
h := make(kmerMinHeap, len(iterators))
|
||||
for i, iter := range iterators {
|
||||
h[i] = heapItem{value: iter.Next(), idx: i}
|
||||
}
|
||||
heap.Init(&h)
|
||||
|
||||
// Result bitmap
|
||||
result := roaring64.New()
|
||||
|
||||
// K-way merge with counting
|
||||
for len(h) > 0 {
|
||||
minVal := h[0].value
|
||||
count := 0
|
||||
activeIndices := make([]int, 0, len(h))
|
||||
|
||||
// Pop all elements with same value (count occurrences)
|
||||
for len(h) > 0 && h[0].value == minVal {
|
||||
item := heap.Pop(&h).(heapItem)
|
||||
count++
|
||||
activeIndices = append(activeIndices, item.idx)
|
||||
}
|
||||
|
||||
// Add to result if quorum reached
|
||||
if count >= q {
|
||||
result.Add(minVal)
|
||||
}
|
||||
|
||||
// Advance iterators and re-insert into heap
|
||||
for _, iterIdx := range activeIndices {
|
||||
if iterators[iterIdx].HasNext() {
|
||||
heap.Push(&h, heapItem{
|
||||
value: iterators[iterIdx].Next(),
|
||||
idx: iterIdx,
|
||||
})
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
return NewKmerSetFromBitmap(ksg.k, result)
|
||||
}
|
||||
|
||||
// QuorumAtMost returns k-mers present in at most q sets
|
||||
//
|
||||
// Algorithm: Uses the mathematical identity
|
||||
// AtMost(q) = Union() - AtLeast(q+1)
|
||||
//
|
||||
// Proof:
|
||||
// - Union() contains all k-mers present in at least 1 set
|
||||
// - AtLeast(q+1) contains all k-mers present in q+1 or more sets
|
||||
// - Their difference contains only k-mers present in at most q sets
|
||||
//
|
||||
// Implementation:
|
||||
// 1. Compute U = Union()
|
||||
// 2. Compute A = QuorumAtLeast(q+1)
|
||||
// 3. Return U - A using bitmap AndNot operation
|
||||
//
|
||||
// Time complexity: O(M log N)
|
||||
// - Union(): O(M) with native OR operations
|
||||
// - QuorumAtLeast(q+1): O(M log N)
|
||||
// - AndNot: O(|U|) where |U| <= M
|
||||
// - Total: O(M log N)
|
||||
//
|
||||
// Space complexity: O(N)
|
||||
// - Inherited from QuorumAtLeast heap
|
||||
//
|
||||
// Special cases:
|
||||
// - q <= 0: returns empty set
|
||||
// - q >= n: returns Union() (all k-mers are in at most n sets)
|
||||
func (ksg *KmerSetGroup) QuorumAtMost(q int) *KmerSet {
|
||||
n := len(ksg.sets)
|
||||
|
||||
// Edge cases
|
||||
if q <= 0 {
|
||||
return NewKmerSet(ksg.k)
|
||||
}
|
||||
if q >= n {
|
||||
return ksg.Union()
|
||||
}
|
||||
|
||||
// Compute Union() - AtLeast(q+1)
|
||||
union := ksg.Union()
|
||||
atLeastQ1 := ksg.QuorumAtLeast(q + 1)
|
||||
|
||||
// Difference: elements in union but not in atLeastQ1
|
||||
result := union.bitmap.Clone()
|
||||
result.AndNot(atLeastQ1.bitmap)
|
||||
|
||||
return NewKmerSetFromBitmap(ksg.k, result)
|
||||
}
|
||||
|
||||
// QuorumExactly returns k-mers present in exactly q sets
|
||||
//
|
||||
// Algorithm: Uses the mathematical identity
|
||||
// Exactly(q) = AtLeast(q) - AtLeast(q+1)
|
||||
//
|
||||
// Proof:
|
||||
// - AtLeast(q) contains all k-mers present in q or more sets
|
||||
// - AtLeast(q+1) contains all k-mers present in q+1 or more sets
|
||||
// - Their difference contains only k-mers present in exactly q sets
|
||||
//
|
||||
// Implementation:
|
||||
// 1. Compute A = QuorumAtLeast(q)
|
||||
// 2. Compute B = QuorumAtLeast(q+1)
|
||||
// 3. Return A - B using bitmap AndNot operation
|
||||
//
|
||||
// Time complexity: O(M log N)
|
||||
// - Two calls to QuorumAtLeast: 2 * O(M log N)
|
||||
// - One AndNot operation: O(|A|) where |A| <= M
|
||||
// - Total: O(M log N) since AndNot is dominated by merge operations
|
||||
//
|
||||
// Space complexity: O(N)
|
||||
// - Inherited from QuorumAtLeast heap
|
||||
// - Two temporary bitmaps for intermediate results
|
||||
//
|
||||
// Special cases:
|
||||
// - q <= 0: returns empty set
|
||||
// - q > n: returns empty set (impossible to have k-mer in more than n sets)
|
||||
func (ksg *KmerSetGroup) QuorumExactly(q int) *KmerSet {
|
||||
n := len(ksg.sets)
|
||||
|
||||
// Edge cases
|
||||
if q <= 0 || q > n {
|
||||
return NewKmerSet(ksg.k)
|
||||
}
|
||||
|
||||
// Compute AtLeast(q) - AtLeast(q+1)
|
||||
aq := ksg.QuorumAtLeast(q)
|
||||
aq1 := ksg.QuorumAtLeast(q + 1)
|
||||
|
||||
// Difference: elements in aq but not in aq1
|
||||
result := aq.bitmap.Clone()
|
||||
result.AndNot(aq1.bitmap)
|
||||
|
||||
return NewKmerSetFromBitmap(ksg.k, result)
|
||||
}
|
||||
@@ -1,395 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"testing"
|
||||
)
|
||||
|
||||
// TestQuorumAtLeastEdgeCases tests edge cases for QuorumAtLeast
|
||||
func TestQuorumAtLeastEdgeCases(t *testing.T) {
|
||||
k := 5
|
||||
|
||||
// Test group with all empty sets
|
||||
emptyGroup := NewKmerSetGroup(k, 3)
|
||||
result := emptyGroup.QuorumAtLeast(1)
|
||||
if result.Len() != 0 {
|
||||
t.Errorf("Empty sets: expected 0 k-mers, got %d", result.Len())
|
||||
}
|
||||
|
||||
// Test q <= 0
|
||||
group := NewKmerSetGroup(k, 3)
|
||||
result = group.QuorumAtLeast(0)
|
||||
if result.Len() != 0 {
|
||||
t.Errorf("q=0: expected 0 k-mers, got %d", result.Len())
|
||||
}
|
||||
|
||||
result = group.QuorumAtLeast(-1)
|
||||
if result.Len() != 0 {
|
||||
t.Errorf("q=-1: expected 0 k-mers, got %d", result.Len())
|
||||
}
|
||||
|
||||
// Test q > n
|
||||
group.Get(0).AddKmerCode(1)
|
||||
result = group.QuorumAtLeast(10)
|
||||
if result.Len() != 0 {
|
||||
t.Errorf("q>n: expected 0 k-mers, got %d", result.Len())
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumAtLeastQ1 tests q=1 (should equal Union)
|
||||
func TestQuorumAtLeastQ1(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 3)
|
||||
|
||||
// Add different k-mers to each set
|
||||
group.Get(0).AddKmerCode(1)
|
||||
group.Get(0).AddKmerCode(2)
|
||||
group.Get(1).AddKmerCode(2)
|
||||
group.Get(1).AddKmerCode(3)
|
||||
group.Get(2).AddKmerCode(3)
|
||||
group.Get(2).AddKmerCode(4)
|
||||
|
||||
quorum := group.QuorumAtLeast(1)
|
||||
union := group.Union()
|
||||
|
||||
if quorum.Len() != union.Len() {
|
||||
t.Errorf("QuorumAtLeast(1) length %d != Union length %d", quorum.Len(), union.Len())
|
||||
}
|
||||
|
||||
// Check all elements match
|
||||
for kmer := uint64(1); kmer <= 4; kmer++ {
|
||||
if quorum.Contains(kmer) != union.Contains(kmer) {
|
||||
t.Errorf("Mismatch for k-mer %d", kmer)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumAtLeastQN tests q=n (should equal Intersect)
|
||||
func TestQuorumAtLeastQN(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 3)
|
||||
|
||||
// Add some common k-mers and some unique
|
||||
for i := 0; i < 3; i++ {
|
||||
group.Get(i).AddKmerCode(10) // common to all
|
||||
group.Get(i).AddKmerCode(20) // common to all
|
||||
}
|
||||
group.Get(0).AddKmerCode(1) // unique to set 0
|
||||
group.Get(1).AddKmerCode(2) // unique to set 1
|
||||
|
||||
quorum := group.QuorumAtLeast(3)
|
||||
intersect := group.Intersect()
|
||||
|
||||
if quorum.Len() != intersect.Len() {
|
||||
t.Errorf("QuorumAtLeast(n) length %d != Intersect length %d", quorum.Len(), intersect.Len())
|
||||
}
|
||||
|
||||
if quorum.Len() != 2 {
|
||||
t.Errorf("Expected 2 common k-mers, got %d", quorum.Len())
|
||||
}
|
||||
|
||||
if !quorum.Contains(10) || !quorum.Contains(20) {
|
||||
t.Error("Missing common k-mers")
|
||||
}
|
||||
|
||||
if quorum.Contains(1) || quorum.Contains(2) {
|
||||
t.Error("Unique k-mers should not be in result")
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumAtLeastGeneral tests general quorum values
|
||||
func TestQuorumAtLeastGeneral(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 5)
|
||||
|
||||
// Setup: k-mer i appears in i sets (for i=1..5)
|
||||
// k-mer 1: in set 0
|
||||
// k-mer 2: in sets 0,1
|
||||
// k-mer 3: in sets 0,1,2
|
||||
// k-mer 4: in sets 0,1,2,3
|
||||
// k-mer 5: in sets 0,1,2,3,4 (all)
|
||||
|
||||
for kmer := uint64(1); kmer <= 5; kmer++ {
|
||||
for setIdx := 0; setIdx < int(kmer); setIdx++ {
|
||||
group.Get(setIdx).AddKmerCode(kmer)
|
||||
}
|
||||
}
|
||||
|
||||
tests := []struct {
|
||||
q int
|
||||
expected map[uint64]bool
|
||||
}{
|
||||
{1, map[uint64]bool{1: true, 2: true, 3: true, 4: true, 5: true}},
|
||||
{2, map[uint64]bool{2: true, 3: true, 4: true, 5: true}},
|
||||
{3, map[uint64]bool{3: true, 4: true, 5: true}},
|
||||
{4, map[uint64]bool{4: true, 5: true}},
|
||||
{5, map[uint64]bool{5: true}},
|
||||
}
|
||||
|
||||
for _, tt := range tests {
|
||||
result := group.QuorumAtLeast(tt.q)
|
||||
|
||||
if result.Len() != uint64(len(tt.expected)) {
|
||||
t.Errorf("q=%d: expected %d k-mers, got %d", tt.q, len(tt.expected), result.Len())
|
||||
}
|
||||
|
||||
for kmer := uint64(1); kmer <= 5; kmer++ {
|
||||
shouldContain := tt.expected[kmer]
|
||||
doesContain := result.Contains(kmer)
|
||||
if shouldContain != doesContain {
|
||||
t.Errorf("q=%d, k-mer=%d: expected contains=%v, got %v", tt.q, kmer, shouldContain, doesContain)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumExactlyBasic tests QuorumExactly basic functionality
|
||||
func TestQuorumExactlyBasic(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 5)
|
||||
|
||||
// Setup: k-mer i appears in exactly i sets
|
||||
for kmer := uint64(1); kmer <= 5; kmer++ {
|
||||
for setIdx := 0; setIdx < int(kmer); setIdx++ {
|
||||
group.Get(setIdx).AddKmerCode(kmer)
|
||||
}
|
||||
}
|
||||
|
||||
tests := []struct {
|
||||
q int
|
||||
expected []uint64
|
||||
}{
|
||||
{1, []uint64{1}},
|
||||
{2, []uint64{2}},
|
||||
{3, []uint64{3}},
|
||||
{4, []uint64{4}},
|
||||
{5, []uint64{5}},
|
||||
}
|
||||
|
||||
for _, tt := range tests {
|
||||
result := group.QuorumExactly(tt.q)
|
||||
|
||||
if result.Len() != uint64(len(tt.expected)) {
|
||||
t.Errorf("q=%d: expected %d k-mers, got %d", tt.q, len(tt.expected), result.Len())
|
||||
}
|
||||
|
||||
for _, kmer := range tt.expected {
|
||||
if !result.Contains(kmer) {
|
||||
t.Errorf("q=%d: missing k-mer %d", tt.q, kmer)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumIdentity tests the mathematical identity: Exactly(q) = AtLeast(q) - AtLeast(q+1)
|
||||
func TestQuorumIdentity(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 4)
|
||||
|
||||
// Add random distribution
|
||||
group.Get(0).AddKmerCode(1)
|
||||
group.Get(0).AddKmerCode(2)
|
||||
group.Get(0).AddKmerCode(3)
|
||||
|
||||
group.Get(1).AddKmerCode(2)
|
||||
group.Get(1).AddKmerCode(3)
|
||||
group.Get(1).AddKmerCode(4)
|
||||
|
||||
group.Get(2).AddKmerCode(3)
|
||||
group.Get(2).AddKmerCode(4)
|
||||
|
||||
group.Get(3).AddKmerCode(4)
|
||||
|
||||
for q := 1; q <= 4; q++ {
|
||||
exactly := group.QuorumExactly(q)
|
||||
atLeast := group.QuorumAtLeast(q)
|
||||
atLeastPlus1 := group.QuorumAtLeast(q + 1)
|
||||
|
||||
// Verify: every element in exactly(q) is in atLeast(q)
|
||||
iter := exactly.Iterator()
|
||||
for iter.HasNext() {
|
||||
kmer := iter.Next()
|
||||
if !atLeast.Contains(kmer) {
|
||||
t.Errorf("q=%d: k-mer %d in Exactly but not in AtLeast", q, kmer)
|
||||
}
|
||||
if atLeastPlus1.Contains(kmer) {
|
||||
t.Errorf("q=%d: k-mer %d in Exactly but also in AtLeast(q+1)", q, kmer)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumDisjointSets tests quorum on completely disjoint sets
|
||||
func TestQuorumDisjointSets(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 3)
|
||||
|
||||
// Each set has unique k-mers
|
||||
group.Get(0).AddKmerCode(1)
|
||||
group.Get(1).AddKmerCode(2)
|
||||
group.Get(2).AddKmerCode(3)
|
||||
|
||||
// q=1 should give all
|
||||
result := group.QuorumAtLeast(1)
|
||||
if result.Len() != 3 {
|
||||
t.Errorf("Disjoint sets q=1: expected 3, got %d", result.Len())
|
||||
}
|
||||
|
||||
// q=2 should give none
|
||||
result = group.QuorumAtLeast(2)
|
||||
if result.Len() != 0 {
|
||||
t.Errorf("Disjoint sets q=2: expected 0, got %d", result.Len())
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumIdenticalSets tests quorum on identical sets
|
||||
func TestQuorumIdenticalSets(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 3)
|
||||
|
||||
// All sets have same k-mers
|
||||
for i := 0; i < 3; i++ {
|
||||
group.Get(i).AddKmerCode(10)
|
||||
group.Get(i).AddKmerCode(20)
|
||||
group.Get(i).AddKmerCode(30)
|
||||
}
|
||||
|
||||
// Any q <= n should give all k-mers
|
||||
for q := 1; q <= 3; q++ {
|
||||
result := group.QuorumAtLeast(q)
|
||||
if result.Len() != 3 {
|
||||
t.Errorf("Identical sets q=%d: expected 3, got %d", q, result.Len())
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumLargeNumbers tests with large k-mer values
|
||||
func TestQuorumLargeNumbers(t *testing.T) {
|
||||
k := 21
|
||||
group := NewKmerSetGroup(k, 3)
|
||||
|
||||
// Use large uint64 values (actual k-mer encodings)
|
||||
largeKmers := []uint64{
|
||||
0x1234567890ABCDEF,
|
||||
0xFEDCBA0987654321,
|
||||
0xAAAAAAAAAAAAAAAA,
|
||||
}
|
||||
|
||||
// Add to multiple sets
|
||||
for i := 0; i < 3; i++ {
|
||||
for j := 0; j <= i; j++ {
|
||||
group.Get(j).AddKmerCode(largeKmers[i])
|
||||
}
|
||||
}
|
||||
|
||||
result := group.QuorumAtLeast(2)
|
||||
if result.Len() != 2 {
|
||||
t.Errorf("Large numbers q=2: expected 2, got %d", result.Len())
|
||||
}
|
||||
|
||||
if !result.Contains(largeKmers[1]) || !result.Contains(largeKmers[2]) {
|
||||
t.Error("Large numbers: wrong k-mers in result")
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumAtMostBasic tests QuorumAtMost basic functionality
|
||||
func TestQuorumAtMostBasic(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 5)
|
||||
|
||||
// Setup: k-mer i appears in exactly i sets
|
||||
for kmer := uint64(1); kmer <= 5; kmer++ {
|
||||
for setIdx := 0; setIdx < int(kmer); setIdx++ {
|
||||
group.Get(setIdx).AddKmerCode(kmer)
|
||||
}
|
||||
}
|
||||
|
||||
tests := []struct {
|
||||
q int
|
||||
expected []uint64
|
||||
}{
|
||||
{0, []uint64{}}, // at most 0: none
|
||||
{1, []uint64{1}}, // at most 1: only k-mer 1
|
||||
{2, []uint64{1, 2}}, // at most 2: k-mers 1,2
|
||||
{3, []uint64{1, 2, 3}}, // at most 3: k-mers 1,2,3
|
||||
{4, []uint64{1, 2, 3, 4}}, // at most 4: k-mers 1,2,3,4
|
||||
{5, []uint64{1, 2, 3, 4, 5}}, // at most 5: all k-mers
|
||||
{10, []uint64{1, 2, 3, 4, 5}}, // at most 10: all k-mers
|
||||
}
|
||||
|
||||
for _, tt := range tests {
|
||||
result := group.QuorumAtMost(tt.q)
|
||||
|
||||
if result.Len() != uint64(len(tt.expected)) {
|
||||
t.Errorf("q=%d: expected %d k-mers, got %d", tt.q, len(tt.expected), result.Len())
|
||||
}
|
||||
|
||||
for _, kmer := range tt.expected {
|
||||
if !result.Contains(kmer) {
|
||||
t.Errorf("q=%d: missing k-mer %d", tt.q, kmer)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumComplementIdentity tests that AtLeast and AtMost are complementary
|
||||
func TestQuorumComplementIdentity(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 4)
|
||||
|
||||
// Add random distribution
|
||||
group.Get(0).AddKmerCode(1)
|
||||
group.Get(0).AddKmerCode(2)
|
||||
group.Get(0).AddKmerCode(3)
|
||||
|
||||
group.Get(1).AddKmerCode(2)
|
||||
group.Get(1).AddKmerCode(3)
|
||||
group.Get(1).AddKmerCode(4)
|
||||
|
||||
group.Get(2).AddKmerCode(3)
|
||||
group.Get(2).AddKmerCode(4)
|
||||
|
||||
group.Get(3).AddKmerCode(4)
|
||||
|
||||
union := group.Union()
|
||||
|
||||
for q := 1; q < 4; q++ {
|
||||
atMost := group.QuorumAtMost(q)
|
||||
atLeast := group.QuorumAtLeast(q + 1)
|
||||
|
||||
// Verify: AtMost(q) ∪ AtLeast(q+1) = Union()
|
||||
combined := atMost.Union(atLeast)
|
||||
|
||||
if combined.Len() != union.Len() {
|
||||
t.Errorf("q=%d: AtMost(q) ∪ AtLeast(q+1) has %d k-mers, Union has %d",
|
||||
q, combined.Len(), union.Len())
|
||||
}
|
||||
|
||||
// Verify: AtMost(q) ∩ AtLeast(q+1) = ∅
|
||||
overlap := atMost.Intersect(atLeast)
|
||||
if overlap.Len() != 0 {
|
||||
t.Errorf("q=%d: AtMost(q) and AtLeast(q+1) overlap with %d k-mers",
|
||||
q, overlap.Len())
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// BenchmarkQuorumAtLeast benchmarks quorum operations
|
||||
func BenchmarkQuorumAtLeast(b *testing.B) {
|
||||
k := 21
|
||||
n := 10
|
||||
group := NewKmerSetGroup(k, n)
|
||||
|
||||
// Populate with realistic data
|
||||
for i := 0; i < n; i++ {
|
||||
for j := uint64(0); j < 10000; j++ {
|
||||
if (j % uint64(n)) <= uint64(i) {
|
||||
group.Get(i).AddKmerCode(j)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
b.ResetTimer()
|
||||
for i := 0; i < b.N; i++ {
|
||||
_ = group.QuorumAtLeast(5)
|
||||
}
|
||||
}
|
||||
@@ -1,376 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"encoding/json"
|
||||
"fmt"
|
||||
"os"
|
||||
"path/filepath"
|
||||
"strings"
|
||||
|
||||
"github.com/pelletier/go-toml/v2"
|
||||
"gopkg.in/yaml.v3"
|
||||
)
|
||||
|
||||
// MetadataFormat represents the metadata serialization format
|
||||
type MetadataFormat int
|
||||
|
||||
const (
|
||||
FormatTOML MetadataFormat = iota
|
||||
FormatYAML
|
||||
FormatJSON
|
||||
)
|
||||
|
||||
// String returns the file extension for the format
|
||||
func (f MetadataFormat) String() string {
|
||||
switch f {
|
||||
case FormatTOML:
|
||||
return "toml"
|
||||
case FormatYAML:
|
||||
return "yaml"
|
||||
case FormatJSON:
|
||||
return "json"
|
||||
default:
|
||||
return "toml"
|
||||
}
|
||||
}
|
||||
|
||||
// KmerSetMetadata contient les métadonnées d'un KmerSet ou KmerSetGroup
|
||||
type KmerSetMetadata struct {
|
||||
ID string `toml:"id,omitempty" yaml:"id,omitempty" json:"id,omitempty"` // Identifiant unique
|
||||
K int `toml:"k" yaml:"k" json:"k"` // Taille des k-mers
|
||||
Type string `toml:"type" yaml:"type" json:"type"` // "KmerSet" ou "KmerSetGroup"
|
||||
Size int `toml:"size" yaml:"size" json:"size"` // 1 pour KmerSet, n pour KmerSetGroup
|
||||
Files []string `toml:"files" yaml:"files" json:"files"` // Liste des fichiers .roaring
|
||||
SetsIDs []string `toml:"sets_ids,omitempty" yaml:"sets_ids,omitempty" json:"sets_ids,omitempty"` // IDs des KmerSet individuels
|
||||
UserMetadata map[string]interface{} `toml:"user_metadata,omitempty" yaml:"user_metadata,omitempty" json:"user_metadata,omitempty"` // Métadonnées KmerSet ou KmerSetGroup
|
||||
SetsMetadata []map[string]interface{} `toml:"sets_metadata,omitempty" yaml:"sets_metadata,omitempty" json:"sets_metadata,omitempty"` // Métadonnées des KmerSet individuels dans un KmerSetGroup
|
||||
}
|
||||
|
||||
// SaveKmerSet sauvegarde un KmerSet dans un répertoire
|
||||
// Format: directory/metadata.{toml,yaml,json} + directory/set_0.roaring
|
||||
func (ks *KmerSet) Save(directory string, format MetadataFormat) error {
|
||||
// Créer le répertoire si nécessaire
|
||||
if err := os.MkdirAll(directory, 0755); err != nil {
|
||||
return fmt.Errorf("failed to create directory %s: %w", directory, err)
|
||||
}
|
||||
|
||||
// Métadonnées
|
||||
metadata := KmerSetMetadata{
|
||||
ID: ks.id,
|
||||
K: ks.k,
|
||||
Type: "KmerSet",
|
||||
Size: 1,
|
||||
Files: []string{"set_0.roaring"},
|
||||
UserMetadata: ks.Metadata, // Sauvegarder les métadonnées utilisateur
|
||||
}
|
||||
|
||||
// Sauvegarder les métadonnées
|
||||
if err := saveMetadata(filepath.Join(directory, "metadata."+format.String()), metadata, format); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Sauvegarder le bitmap
|
||||
bitmapPath := filepath.Join(directory, "set_0.roaring")
|
||||
file, err := os.Create(bitmapPath)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to create bitmap file %s: %w", bitmapPath, err)
|
||||
}
|
||||
defer file.Close()
|
||||
|
||||
if _, err := ks.bitmap.WriteTo(file); err != nil {
|
||||
return fmt.Errorf("failed to write bitmap: %w", err)
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
|
||||
// LoadKmerSet charge un KmerSet depuis un répertoire
|
||||
func LoadKmerSet(directory string) (*KmerSet, error) {
|
||||
// Lire les métadonnées (essayer tous les formats)
|
||||
metadata, err := loadMetadata(directory)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
// Vérifier le type
|
||||
if metadata.Type != "KmerSet" {
|
||||
return nil, fmt.Errorf("invalid type: expected KmerSet, got %s", metadata.Type)
|
||||
}
|
||||
|
||||
// Vérifier qu'il n'y a qu'un seul fichier
|
||||
if metadata.Size != 1 || len(metadata.Files) != 1 {
|
||||
return nil, fmt.Errorf("KmerSet must have exactly 1 bitmap file, got %d", len(metadata.Files))
|
||||
}
|
||||
|
||||
// Charger le bitmap
|
||||
bitmapPath := filepath.Join(directory, metadata.Files[0])
|
||||
file, err := os.Open(bitmapPath)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("failed to open bitmap file %s: %w", bitmapPath, err)
|
||||
}
|
||||
defer file.Close()
|
||||
|
||||
ks := NewKmerSet(metadata.K)
|
||||
|
||||
// Charger l'ID
|
||||
ks.id = metadata.ID
|
||||
|
||||
// Charger les métadonnées utilisateur
|
||||
if metadata.UserMetadata != nil {
|
||||
ks.Metadata = metadata.UserMetadata
|
||||
}
|
||||
|
||||
if _, err := ks.bitmap.ReadFrom(file); err != nil {
|
||||
return nil, fmt.Errorf("failed to read bitmap: %w", err)
|
||||
}
|
||||
|
||||
return ks, nil
|
||||
}
|
||||
|
||||
// SaveKmerSetGroup sauvegarde un KmerSetGroup dans un répertoire
|
||||
// Format: directory/metadata.{toml,yaml,json} + directory/set_0.roaring, set_1.roaring, ...
|
||||
func (ksg *KmerSetGroup) Save(directory string, format MetadataFormat) error {
|
||||
// Créer le répertoire si nécessaire
|
||||
if err := os.MkdirAll(directory, 0755); err != nil {
|
||||
return fmt.Errorf("failed to create directory %s: %w", directory, err)
|
||||
}
|
||||
|
||||
// Métadonnées
|
||||
files := make([]string, len(ksg.sets))
|
||||
for i := range ksg.sets {
|
||||
files[i] = fmt.Sprintf("set_%d.roaring", i)
|
||||
}
|
||||
|
||||
// Collecter les IDs et métadonnées de chaque KmerSet individuel
|
||||
setsIDs := make([]string, len(ksg.sets))
|
||||
setsMetadata := make([]map[string]interface{}, len(ksg.sets))
|
||||
for i, ks := range ksg.sets {
|
||||
setsIDs[i] = ks.id
|
||||
setsMetadata[i] = ks.Metadata
|
||||
}
|
||||
|
||||
metadata := KmerSetMetadata{
|
||||
ID: ksg.id,
|
||||
K: ksg.k,
|
||||
Type: "KmerSetGroup",
|
||||
Size: len(ksg.sets),
|
||||
Files: files,
|
||||
SetsIDs: setsIDs, // IDs de chaque set
|
||||
UserMetadata: ksg.Metadata, // Métadonnées du groupe
|
||||
SetsMetadata: setsMetadata, // Métadonnées de chaque set
|
||||
}
|
||||
|
||||
// Sauvegarder les métadonnées
|
||||
if err := saveMetadata(filepath.Join(directory, "metadata."+format.String()), metadata, format); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Sauvegarder chaque bitmap
|
||||
for i, ks := range ksg.sets {
|
||||
bitmapPath := filepath.Join(directory, files[i])
|
||||
file, err := os.Create(bitmapPath)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to create bitmap file %s: %w", bitmapPath, err)
|
||||
}
|
||||
|
||||
if _, err := ks.bitmap.WriteTo(file); err != nil {
|
||||
file.Close()
|
||||
return fmt.Errorf("failed to write bitmap %d: %w", i, err)
|
||||
}
|
||||
file.Close()
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
|
||||
// LoadKmerSetGroup charge un KmerSetGroup depuis un répertoire
|
||||
func LoadKmerSetGroup(directory string) (*KmerSetGroup, error) {
|
||||
// Lire les métadonnées (essayer tous les formats)
|
||||
metadata, err := loadMetadata(directory)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
// Vérifier le type
|
||||
if metadata.Type != "KmerSetGroup" {
|
||||
return nil, fmt.Errorf("invalid type: expected KmerSetGroup, got %s", metadata.Type)
|
||||
}
|
||||
|
||||
// Vérifier la cohérence
|
||||
if metadata.Size != len(metadata.Files) {
|
||||
return nil, fmt.Errorf("size mismatch: size=%d but %d files listed", metadata.Size, len(metadata.Files))
|
||||
}
|
||||
|
||||
// Créer le groupe
|
||||
ksg := NewKmerSetGroup(metadata.K, metadata.Size)
|
||||
|
||||
// Charger l'ID du groupe
|
||||
ksg.id = metadata.ID
|
||||
|
||||
// Charger les métadonnées du groupe
|
||||
if metadata.UserMetadata != nil {
|
||||
ksg.Metadata = metadata.UserMetadata
|
||||
}
|
||||
|
||||
// Charger les IDs de chaque KmerSet
|
||||
if metadata.SetsIDs != nil && len(metadata.SetsIDs) == metadata.Size {
|
||||
for i := range ksg.sets {
|
||||
ksg.sets[i].id = metadata.SetsIDs[i]
|
||||
}
|
||||
}
|
||||
|
||||
// Charger les métadonnées de chaque KmerSet individuel
|
||||
if metadata.SetsMetadata != nil {
|
||||
if len(metadata.SetsMetadata) != metadata.Size {
|
||||
return nil, fmt.Errorf("sets metadata size mismatch: expected %d, got %d", metadata.Size, len(metadata.SetsMetadata))
|
||||
}
|
||||
for i := range ksg.sets {
|
||||
ksg.sets[i].Metadata = metadata.SetsMetadata[i]
|
||||
}
|
||||
}
|
||||
|
||||
// Charger chaque bitmap
|
||||
for i, filename := range metadata.Files {
|
||||
bitmapPath := filepath.Join(directory, filename)
|
||||
file, err := os.Open(bitmapPath)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("failed to open bitmap file %s: %w", bitmapPath, err)
|
||||
}
|
||||
|
||||
if _, err := ksg.sets[i].bitmap.ReadFrom(file); err != nil {
|
||||
file.Close()
|
||||
return nil, fmt.Errorf("failed to read bitmap %d: %w", i, err)
|
||||
}
|
||||
file.Close()
|
||||
}
|
||||
|
||||
return ksg, nil
|
||||
}
|
||||
|
||||
// saveMetadata sauvegarde les métadonnées dans le format spécifié
|
||||
func saveMetadata(path string, metadata KmerSetMetadata, format MetadataFormat) error {
|
||||
file, err := os.Create(path)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to create metadata file %s: %w", path, err)
|
||||
}
|
||||
defer file.Close()
|
||||
|
||||
var encoder interface{ Encode(interface{}) error }
|
||||
|
||||
switch format {
|
||||
case FormatTOML:
|
||||
encoder = toml.NewEncoder(file)
|
||||
case FormatYAML:
|
||||
encoder = yaml.NewEncoder(file)
|
||||
case FormatJSON:
|
||||
jsonEncoder := json.NewEncoder(file)
|
||||
jsonEncoder.SetIndent("", " ")
|
||||
encoder = jsonEncoder
|
||||
default:
|
||||
return fmt.Errorf("unsupported format: %v", format)
|
||||
}
|
||||
|
||||
if err := encoder.Encode(metadata); err != nil {
|
||||
return fmt.Errorf("failed to encode metadata: %w", err)
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
|
||||
// loadMetadata charge les métadonnées depuis un répertoire
|
||||
// Essaie tous les formats (TOML, YAML, JSON) dans l'ordre
|
||||
func loadMetadata(directory string) (*KmerSetMetadata, error) {
|
||||
formats := []MetadataFormat{FormatTOML, FormatYAML, FormatJSON}
|
||||
|
||||
var lastErr error
|
||||
for _, format := range formats {
|
||||
path := filepath.Join(directory, "metadata."+format.String())
|
||||
|
||||
// Vérifier si le fichier existe
|
||||
if _, err := os.Stat(path); os.IsNotExist(err) {
|
||||
continue
|
||||
}
|
||||
|
||||
metadata, err := loadMetadataFromFile(path, format)
|
||||
if err != nil {
|
||||
lastErr = err
|
||||
continue
|
||||
}
|
||||
return metadata, nil
|
||||
}
|
||||
|
||||
if lastErr != nil {
|
||||
return nil, fmt.Errorf("failed to load metadata: %w", lastErr)
|
||||
}
|
||||
return nil, fmt.Errorf("no metadata file found in %s (tried .toml, .yaml, .json)", directory)
|
||||
}
|
||||
|
||||
// loadMetadataFromFile charge les métadonnées depuis un fichier spécifique
|
||||
func loadMetadataFromFile(path string, format MetadataFormat) (*KmerSetMetadata, error) {
|
||||
file, err := os.Open(path)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("failed to open metadata file %s: %w", path, err)
|
||||
}
|
||||
defer file.Close()
|
||||
|
||||
var metadata KmerSetMetadata
|
||||
var decoder interface{ Decode(interface{}) error }
|
||||
|
||||
switch format {
|
||||
case FormatTOML:
|
||||
decoder = toml.NewDecoder(file)
|
||||
case FormatYAML:
|
||||
decoder = yaml.NewDecoder(file)
|
||||
case FormatJSON:
|
||||
decoder = json.NewDecoder(file)
|
||||
default:
|
||||
return nil, fmt.Errorf("unsupported format: %v", format)
|
||||
}
|
||||
|
||||
if err := decoder.Decode(&metadata); err != nil {
|
||||
return nil, fmt.Errorf("failed to decode metadata: %w", err)
|
||||
}
|
||||
|
||||
return &metadata, nil
|
||||
}
|
||||
|
||||
// DetectFormat détecte le format des métadonnées dans un répertoire
|
||||
func DetectFormat(directory string) (MetadataFormat, error) {
|
||||
formats := []MetadataFormat{FormatTOML, FormatYAML, FormatJSON}
|
||||
|
||||
for _, format := range formats {
|
||||
path := filepath.Join(directory, "metadata."+format.String())
|
||||
if _, err := os.Stat(path); err == nil {
|
||||
return format, nil
|
||||
}
|
||||
}
|
||||
|
||||
return FormatTOML, fmt.Errorf("no metadata file found in %s", directory)
|
||||
}
|
||||
|
||||
// IsKmerSetDirectory vérifie si un répertoire contient un KmerSet ou KmerSetGroup
|
||||
func IsKmerSetDirectory(directory string) (bool, string, error) {
|
||||
metadata, err := loadMetadata(directory)
|
||||
if err != nil {
|
||||
return false, "", err
|
||||
}
|
||||
|
||||
return true, metadata.Type, nil
|
||||
}
|
||||
|
||||
// ListBitmapFiles liste tous les fichiers .roaring dans un répertoire
|
||||
func ListBitmapFiles(directory string) ([]string, error) {
|
||||
entries, err := os.ReadDir(directory)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("failed to read directory %s: %w", directory, err)
|
||||
}
|
||||
|
||||
var files []string
|
||||
for _, entry := range entries {
|
||||
if !entry.IsDir() && strings.HasSuffix(entry.Name(), ".roaring") {
|
||||
files = append(files, entry.Name())
|
||||
}
|
||||
}
|
||||
|
||||
return files, nil
|
||||
}
|
||||
@@ -1,272 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"math"
|
||||
"testing"
|
||||
)
|
||||
|
||||
func TestJaccardDistanceIdentical(t *testing.T) {
|
||||
ks1 := NewKmerSet(5)
|
||||
ks1.AddKmerCode(100)
|
||||
ks1.AddKmerCode(200)
|
||||
ks1.AddKmerCode(300)
|
||||
|
||||
ks2 := NewKmerSet(5)
|
||||
ks2.AddKmerCode(100)
|
||||
ks2.AddKmerCode(200)
|
||||
ks2.AddKmerCode(300)
|
||||
|
||||
distance := ks1.JaccardDistance(ks2)
|
||||
similarity := ks1.JaccardSimilarity(ks2)
|
||||
|
||||
if distance != 0.0 {
|
||||
t.Errorf("Expected distance 0.0 for identical sets, got %f", distance)
|
||||
}
|
||||
|
||||
if similarity != 1.0 {
|
||||
t.Errorf("Expected similarity 1.0 for identical sets, got %f", similarity)
|
||||
}
|
||||
}
|
||||
|
||||
func TestJaccardDistanceDisjoint(t *testing.T) {
|
||||
ks1 := NewKmerSet(5)
|
||||
ks1.AddKmerCode(100)
|
||||
ks1.AddKmerCode(200)
|
||||
ks1.AddKmerCode(300)
|
||||
|
||||
ks2 := NewKmerSet(5)
|
||||
ks2.AddKmerCode(400)
|
||||
ks2.AddKmerCode(500)
|
||||
ks2.AddKmerCode(600)
|
||||
|
||||
distance := ks1.JaccardDistance(ks2)
|
||||
similarity := ks1.JaccardSimilarity(ks2)
|
||||
|
||||
if distance != 1.0 {
|
||||
t.Errorf("Expected distance 1.0 for disjoint sets, got %f", distance)
|
||||
}
|
||||
|
||||
if similarity != 0.0 {
|
||||
t.Errorf("Expected similarity 0.0 for disjoint sets, got %f", similarity)
|
||||
}
|
||||
}
|
||||
|
||||
func TestJaccardDistancePartialOverlap(t *testing.T) {
|
||||
// Set 1: {1, 2, 3}
|
||||
ks1 := NewKmerSet(5)
|
||||
ks1.AddKmerCode(1)
|
||||
ks1.AddKmerCode(2)
|
||||
ks1.AddKmerCode(3)
|
||||
|
||||
// Set 2: {2, 3, 4}
|
||||
ks2 := NewKmerSet(5)
|
||||
ks2.AddKmerCode(2)
|
||||
ks2.AddKmerCode(3)
|
||||
ks2.AddKmerCode(4)
|
||||
|
||||
// Intersection: {2, 3} -> cardinality = 2
|
||||
// Union: {1, 2, 3, 4} -> cardinality = 4
|
||||
// Similarity = 2/4 = 0.5
|
||||
// Distance = 1 - 0.5 = 0.5
|
||||
|
||||
distance := ks1.JaccardDistance(ks2)
|
||||
similarity := ks1.JaccardSimilarity(ks2)
|
||||
|
||||
expectedDistance := 0.5
|
||||
expectedSimilarity := 0.5
|
||||
|
||||
if math.Abs(distance-expectedDistance) > 1e-10 {
|
||||
t.Errorf("Expected distance %f, got %f", expectedDistance, distance)
|
||||
}
|
||||
|
||||
if math.Abs(similarity-expectedSimilarity) > 1e-10 {
|
||||
t.Errorf("Expected similarity %f, got %f", expectedSimilarity, similarity)
|
||||
}
|
||||
}
|
||||
|
||||
func TestJaccardDistanceOneSubsetOfOther(t *testing.T) {
|
||||
// Set 1: {1, 2}
|
||||
ks1 := NewKmerSet(5)
|
||||
ks1.AddKmerCode(1)
|
||||
ks1.AddKmerCode(2)
|
||||
|
||||
// Set 2: {1, 2, 3, 4}
|
||||
ks2 := NewKmerSet(5)
|
||||
ks2.AddKmerCode(1)
|
||||
ks2.AddKmerCode(2)
|
||||
ks2.AddKmerCode(3)
|
||||
ks2.AddKmerCode(4)
|
||||
|
||||
// Intersection: {1, 2} -> cardinality = 2
|
||||
// Union: {1, 2, 3, 4} -> cardinality = 4
|
||||
// Similarity = 2/4 = 0.5
|
||||
// Distance = 1 - 0.5 = 0.5
|
||||
|
||||
distance := ks1.JaccardDistance(ks2)
|
||||
similarity := ks1.JaccardSimilarity(ks2)
|
||||
|
||||
expectedDistance := 0.5
|
||||
expectedSimilarity := 0.5
|
||||
|
||||
if math.Abs(distance-expectedDistance) > 1e-10 {
|
||||
t.Errorf("Expected distance %f, got %f", expectedDistance, distance)
|
||||
}
|
||||
|
||||
if math.Abs(similarity-expectedSimilarity) > 1e-10 {
|
||||
t.Errorf("Expected similarity %f, got %f", expectedSimilarity, similarity)
|
||||
}
|
||||
}
|
||||
|
||||
func TestJaccardDistanceEmptySets(t *testing.T) {
|
||||
ks1 := NewKmerSet(5)
|
||||
ks2 := NewKmerSet(5)
|
||||
|
||||
distance := ks1.JaccardDistance(ks2)
|
||||
similarity := ks1.JaccardSimilarity(ks2)
|
||||
|
||||
// By convention, distance = 1.0 for empty sets
|
||||
if distance != 1.0 {
|
||||
t.Errorf("Expected distance 1.0 for empty sets, got %f", distance)
|
||||
}
|
||||
|
||||
if similarity != 0.0 {
|
||||
t.Errorf("Expected similarity 0.0 for empty sets, got %f", similarity)
|
||||
}
|
||||
}
|
||||
|
||||
func TestJaccardDistanceOneEmpty(t *testing.T) {
|
||||
ks1 := NewKmerSet(5)
|
||||
ks1.AddKmerCode(1)
|
||||
ks1.AddKmerCode(2)
|
||||
ks1.AddKmerCode(3)
|
||||
|
||||
ks2 := NewKmerSet(5)
|
||||
|
||||
distance := ks1.JaccardDistance(ks2)
|
||||
similarity := ks1.JaccardSimilarity(ks2)
|
||||
|
||||
// Intersection: {} -> cardinality = 0
|
||||
// Union: {1, 2, 3} -> cardinality = 3
|
||||
// Similarity = 0/3 = 0.0
|
||||
// Distance = 1.0
|
||||
|
||||
if distance != 1.0 {
|
||||
t.Errorf("Expected distance 1.0 when one set is empty, got %f", distance)
|
||||
}
|
||||
|
||||
if similarity != 0.0 {
|
||||
t.Errorf("Expected similarity 0.0 when one set is empty, got %f", similarity)
|
||||
}
|
||||
}
|
||||
|
||||
func TestJaccardDistanceDifferentK(t *testing.T) {
|
||||
ks1 := NewKmerSet(5)
|
||||
ks1.AddKmerCode(1)
|
||||
|
||||
ks2 := NewKmerSet(7)
|
||||
ks2.AddKmerCode(1)
|
||||
|
||||
defer func() {
|
||||
if r := recover(); r == nil {
|
||||
t.Errorf("Expected panic when computing Jaccard distance with different k values")
|
||||
}
|
||||
}()
|
||||
|
||||
_ = ks1.JaccardDistance(ks2)
|
||||
}
|
||||
|
||||
func TestJaccardDistanceSimilarityRelation(t *testing.T) {
|
||||
// Test that distance + similarity = 1.0 for all cases
|
||||
testCases := []struct {
|
||||
name string
|
||||
ks1 *KmerSet
|
||||
ks2 *KmerSet
|
||||
}{
|
||||
{
|
||||
name: "partial overlap",
|
||||
ks1: func() *KmerSet {
|
||||
ks := NewKmerSet(5)
|
||||
ks.AddKmerCode(1)
|
||||
ks.AddKmerCode(2)
|
||||
ks.AddKmerCode(3)
|
||||
return ks
|
||||
}(),
|
||||
ks2: func() *KmerSet {
|
||||
ks := NewKmerSet(5)
|
||||
ks.AddKmerCode(2)
|
||||
ks.AddKmerCode(3)
|
||||
ks.AddKmerCode(4)
|
||||
ks.AddKmerCode(5)
|
||||
return ks
|
||||
}(),
|
||||
},
|
||||
{
|
||||
name: "identical",
|
||||
ks1: func() *KmerSet {
|
||||
ks := NewKmerSet(5)
|
||||
ks.AddKmerCode(10)
|
||||
ks.AddKmerCode(20)
|
||||
return ks
|
||||
}(),
|
||||
ks2: func() *KmerSet {
|
||||
ks := NewKmerSet(5)
|
||||
ks.AddKmerCode(10)
|
||||
ks.AddKmerCode(20)
|
||||
return ks
|
||||
}(),
|
||||
},
|
||||
{
|
||||
name: "disjoint",
|
||||
ks1: func() *KmerSet {
|
||||
ks := NewKmerSet(5)
|
||||
ks.AddKmerCode(1)
|
||||
return ks
|
||||
}(),
|
||||
ks2: func() *KmerSet {
|
||||
ks := NewKmerSet(5)
|
||||
ks.AddKmerCode(100)
|
||||
return ks
|
||||
}(),
|
||||
},
|
||||
}
|
||||
|
||||
for _, tc := range testCases {
|
||||
t.Run(tc.name, func(t *testing.T) {
|
||||
distance := tc.ks1.JaccardDistance(tc.ks2)
|
||||
similarity := tc.ks1.JaccardSimilarity(tc.ks2)
|
||||
|
||||
sum := distance + similarity
|
||||
|
||||
if math.Abs(sum-1.0) > 1e-10 {
|
||||
t.Errorf("Expected distance + similarity = 1.0, got %f + %f = %f",
|
||||
distance, similarity, sum)
|
||||
}
|
||||
})
|
||||
}
|
||||
}
|
||||
|
||||
func TestJaccardDistanceSymmetry(t *testing.T) {
|
||||
ks1 := NewKmerSet(5)
|
||||
ks1.AddKmerCode(1)
|
||||
ks1.AddKmerCode(2)
|
||||
ks1.AddKmerCode(3)
|
||||
|
||||
ks2 := NewKmerSet(5)
|
||||
ks2.AddKmerCode(2)
|
||||
ks2.AddKmerCode(3)
|
||||
ks2.AddKmerCode(4)
|
||||
|
||||
distance1 := ks1.JaccardDistance(ks2)
|
||||
distance2 := ks2.JaccardDistance(ks1)
|
||||
|
||||
similarity1 := ks1.JaccardSimilarity(ks2)
|
||||
similarity2 := ks2.JaccardSimilarity(ks1)
|
||||
|
||||
if math.Abs(distance1-distance2) > 1e-10 {
|
||||
t.Errorf("Jaccard distance not symmetric: %f vs %f", distance1, distance2)
|
||||
}
|
||||
|
||||
if math.Abs(similarity1-similarity2) > 1e-10 {
|
||||
t.Errorf("Jaccard similarity not symmetric: %f vs %f", similarity1, similarity2)
|
||||
}
|
||||
}
|
||||
@@ -5,6 +5,7 @@ import (
|
||||
"sort"
|
||||
"unsafe"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obifp"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obilog"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
@@ -267,6 +268,8 @@ func NewKmerMap[T obifp.FPUint[T]](
|
||||
}
|
||||
|
||||
n := len(sequences)
|
||||
var bar *progressbar.ProgressBar
|
||||
if obidefault.ProgressBar() {
|
||||
pbopt := make([]progressbar.Option, 0, 5)
|
||||
pbopt = append(pbopt,
|
||||
progressbar.OptionSetWriter(os.Stderr),
|
||||
@@ -276,11 +279,12 @@ func NewKmerMap[T obifp.FPUint[T]](
|
||||
progressbar.OptionSetDescription("Indexing kmers"),
|
||||
)
|
||||
|
||||
bar := progressbar.NewOptions(n, pbopt...)
|
||||
bar = progressbar.NewOptions(n, pbopt...)
|
||||
}
|
||||
|
||||
for i, sequence := range sequences {
|
||||
kmap.Push(sequence, maxoccurs)
|
||||
if i%100 == 0 {
|
||||
if bar != nil && i%100 == 0 {
|
||||
bar.Add(100)
|
||||
}
|
||||
}
|
||||
|
||||
47
pkg/obikmer/minimizer_utils.go
Normal file
47
pkg/obikmer/minimizer_utils.go
Normal file
@@ -0,0 +1,47 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"math"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
)
|
||||
|
||||
// DefaultMinimizerSize returns ceil(k / 2.5) as a reasonable default minimizer size.
|
||||
func DefaultMinimizerSize(k int) int {
|
||||
m := int(math.Ceil(float64(k) / 2.5))
|
||||
if m < 1 {
|
||||
m = 1
|
||||
}
|
||||
if m >= k {
|
||||
m = k - 1
|
||||
}
|
||||
return m
|
||||
}
|
||||
|
||||
// MinMinimizerSize returns the minimum m such that 4^m >= nworkers,
|
||||
// i.e. ceil(log(nworkers) / log(4)).
|
||||
func MinMinimizerSize(nworkers int) int {
|
||||
if nworkers <= 1 {
|
||||
return 1
|
||||
}
|
||||
return int(math.Ceil(math.Log(float64(nworkers)) / math.Log(4)))
|
||||
}
|
||||
|
||||
// ValidateMinimizerSize checks and adjusts the minimizer size to satisfy constraints:
|
||||
// - m >= ceil(log(nworkers)/log(4))
|
||||
// - 1 <= m < k
|
||||
func ValidateMinimizerSize(m, k, nworkers int) int {
|
||||
minM := MinMinimizerSize(nworkers)
|
||||
if m < minM {
|
||||
log.Warnf("Minimizer size %d too small for %d workers (4^%d = %d < %d), adjusting to %d",
|
||||
m, nworkers, m, 1<<(2*m), nworkers, minM)
|
||||
m = minM
|
||||
}
|
||||
if m < 1 {
|
||||
m = 1
|
||||
}
|
||||
if m >= k {
|
||||
m = k - 1
|
||||
}
|
||||
return m
|
||||
}
|
||||
67
pkg/obikmer/skm_reader.go
Normal file
67
pkg/obikmer/skm_reader.go
Normal file
@@ -0,0 +1,67 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"bufio"
|
||||
"encoding/binary"
|
||||
"io"
|
||||
"os"
|
||||
)
|
||||
|
||||
// decode2bit maps 2-bit codes back to nucleotide bytes.
|
||||
var decode2bit = [4]byte{'a', 'c', 'g', 't'}
|
||||
|
||||
// SkmReader reads super-kmers from a binary .skm file.
|
||||
type SkmReader struct {
|
||||
r *bufio.Reader
|
||||
file *os.File
|
||||
}
|
||||
|
||||
// NewSkmReader opens a .skm file for reading.
|
||||
func NewSkmReader(path string) (*SkmReader, error) {
|
||||
f, err := os.Open(path)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
return &SkmReader{
|
||||
r: bufio.NewReaderSize(f, 65536),
|
||||
file: f,
|
||||
}, nil
|
||||
}
|
||||
|
||||
// Next reads the next super-kmer from the file.
|
||||
// Returns the SuperKmer and true, or a zero SuperKmer and false at EOF.
|
||||
func (sr *SkmReader) Next() (SuperKmer, bool) {
|
||||
// Read length
|
||||
var lenbuf [2]byte
|
||||
if _, err := io.ReadFull(sr.r, lenbuf[:]); err != nil {
|
||||
return SuperKmer{}, false
|
||||
}
|
||||
seqLen := int(binary.LittleEndian.Uint16(lenbuf[:]))
|
||||
|
||||
// Read packed bytes
|
||||
nBytes := (seqLen + 3) / 4
|
||||
packed := make([]byte, nBytes)
|
||||
if _, err := io.ReadFull(sr.r, packed); err != nil {
|
||||
return SuperKmer{}, false
|
||||
}
|
||||
|
||||
// Decode to nucleotide bytes
|
||||
seq := make([]byte, seqLen)
|
||||
for i := 0; i < seqLen; i++ {
|
||||
byteIdx := i / 4
|
||||
bitPos := uint(6 - (i%4)*2)
|
||||
code := (packed[byteIdx] >> bitPos) & 0x03
|
||||
seq[i] = decode2bit[code]
|
||||
}
|
||||
|
||||
return SuperKmer{
|
||||
Sequence: seq,
|
||||
Start: 0,
|
||||
End: seqLen,
|
||||
}, true
|
||||
}
|
||||
|
||||
// Close closes the underlying file.
|
||||
func (sr *SkmReader) Close() error {
|
||||
return sr.file.Close()
|
||||
}
|
||||
176
pkg/obikmer/skm_test.go
Normal file
176
pkg/obikmer/skm_test.go
Normal file
@@ -0,0 +1,176 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"os"
|
||||
"path/filepath"
|
||||
"testing"
|
||||
)
|
||||
|
||||
func TestSkmRoundTrip(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "test.skm")
|
||||
|
||||
// Create super-kmers from a known sequence
|
||||
seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT")
|
||||
k := 21
|
||||
m := 9
|
||||
superKmers := ExtractSuperKmers(seq, k, m, nil)
|
||||
if len(superKmers) == 0 {
|
||||
t.Fatal("no super-kmers extracted")
|
||||
}
|
||||
|
||||
// Write
|
||||
w, err := NewSkmWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
for _, sk := range superKmers {
|
||||
if err := w.Write(sk); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Read back
|
||||
r, err := NewSkmReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
idx := 0
|
||||
for {
|
||||
sk, ok := r.Next()
|
||||
if !ok {
|
||||
break
|
||||
}
|
||||
if idx >= len(superKmers) {
|
||||
t.Fatal("read more super-kmers than written")
|
||||
}
|
||||
expected := superKmers[idx]
|
||||
if len(sk.Sequence) != len(expected.Sequence) {
|
||||
t.Fatalf("super-kmer %d: length mismatch: got %d, want %d",
|
||||
idx, len(sk.Sequence), len(expected.Sequence))
|
||||
}
|
||||
// Compare nucleotide-by-nucleotide (case insensitive since decode produces lowercase)
|
||||
for j := range sk.Sequence {
|
||||
got := sk.Sequence[j] | 0x20
|
||||
want := expected.Sequence[j] | 0x20
|
||||
if got != want {
|
||||
t.Fatalf("super-kmer %d pos %d: got %c, want %c", idx, j, got, want)
|
||||
}
|
||||
}
|
||||
idx++
|
||||
}
|
||||
if idx != len(superKmers) {
|
||||
t.Fatalf("read %d super-kmers, want %d", idx, len(superKmers))
|
||||
}
|
||||
}
|
||||
|
||||
func TestSkmEmptyFile(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "empty.skm")
|
||||
|
||||
// Write nothing
|
||||
w, err := NewSkmWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Read back
|
||||
r, err := NewSkmReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
_, ok := r.Next()
|
||||
if ok {
|
||||
t.Fatal("expected no super-kmers in empty file")
|
||||
}
|
||||
}
|
||||
|
||||
func TestSkmSingleBase(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "single.skm")
|
||||
|
||||
// Test with sequences of various lengths to check padding
|
||||
sequences := [][]byte{
|
||||
[]byte("A"),
|
||||
[]byte("AC"),
|
||||
[]byte("ACG"),
|
||||
[]byte("ACGT"),
|
||||
[]byte("ACGTA"),
|
||||
}
|
||||
|
||||
w, err := NewSkmWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
for _, seq := range sequences {
|
||||
sk := SuperKmer{Sequence: seq}
|
||||
if err := w.Write(sk); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
r, err := NewSkmReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
for i, expected := range sequences {
|
||||
sk, ok := r.Next()
|
||||
if !ok {
|
||||
t.Fatalf("expected super-kmer %d, got EOF", i)
|
||||
}
|
||||
if len(sk.Sequence) != len(expected) {
|
||||
t.Fatalf("sk %d: length %d, want %d", i, len(sk.Sequence), len(expected))
|
||||
}
|
||||
for j := range sk.Sequence {
|
||||
got := sk.Sequence[j] | 0x20
|
||||
want := expected[j] | 0x20
|
||||
if got != want {
|
||||
t.Fatalf("sk %d pos %d: got %c, want %c", i, j, got, want)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestSkmFileSize(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "size.skm")
|
||||
|
||||
// Write a sequence of known length
|
||||
seq := []byte("ACGTACGTAC") // 10 bases
|
||||
sk := SuperKmer{Sequence: seq}
|
||||
|
||||
w, err := NewSkmWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Write(sk); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Expected: 2 bytes (length) + ceil(10/4)=3 bytes (data) = 5 bytes
|
||||
info, err := os.Stat(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if info.Size() != 5 {
|
||||
t.Fatalf("file size: got %d, want 5", info.Size())
|
||||
}
|
||||
}
|
||||
74
pkg/obikmer/skm_writer.go
Normal file
74
pkg/obikmer/skm_writer.go
Normal file
@@ -0,0 +1,74 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"bufio"
|
||||
"encoding/binary"
|
||||
"os"
|
||||
)
|
||||
|
||||
// SkmWriter writes super-kmers to a binary .skm file.
|
||||
//
|
||||
// Format per super-kmer:
|
||||
//
|
||||
// [len: uint16 LE] length of the super-kmer in bases
|
||||
// [data: ceil(len/4) bytes] sequence encoded 2 bits/base, packed
|
||||
//
|
||||
// Nucleotide encoding: A=00, C=01, G=10, T=11.
|
||||
// The last byte is zero-padded on the low bits if len%4 != 0.
|
||||
type SkmWriter struct {
|
||||
w *bufio.Writer
|
||||
file *os.File
|
||||
}
|
||||
|
||||
// NewSkmWriter creates a new SkmWriter writing to the given file path.
|
||||
func NewSkmWriter(path string) (*SkmWriter, error) {
|
||||
f, err := os.Create(path)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
return &SkmWriter{
|
||||
w: bufio.NewWriterSize(f, 65536),
|
||||
file: f,
|
||||
}, nil
|
||||
}
|
||||
|
||||
// Write encodes a SuperKmer to the .skm file.
|
||||
// The sequence bytes are packed 2 bits per base.
|
||||
func (sw *SkmWriter) Write(sk SuperKmer) error {
|
||||
seq := sk.Sequence
|
||||
seqLen := uint16(len(seq))
|
||||
|
||||
// Write length
|
||||
var lenbuf [2]byte
|
||||
binary.LittleEndian.PutUint16(lenbuf[:], seqLen)
|
||||
if _, err := sw.w.Write(lenbuf[:]); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Encode and write packed sequence (2 bits/base)
|
||||
nBytes := (int(seqLen) + 3) / 4
|
||||
for i := 0; i < nBytes; i++ {
|
||||
var packed byte
|
||||
for j := 0; j < 4; j++ {
|
||||
pos := i*4 + j
|
||||
packed <<= 2
|
||||
if pos < int(seqLen) {
|
||||
packed |= __single_base_code__[seq[pos]&31]
|
||||
}
|
||||
}
|
||||
if err := sw.w.WriteByte(packed); err != nil {
|
||||
return err
|
||||
}
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
|
||||
// Close flushes buffered data and closes the underlying file.
|
||||
func (sw *SkmWriter) Close() error {
|
||||
if err := sw.w.Flush(); err != nil {
|
||||
sw.file.Close()
|
||||
return err
|
||||
}
|
||||
return sw.file.Close()
|
||||
}
|
||||
253
pkg/obikmer/spectrum.go
Normal file
253
pkg/obikmer/spectrum.go
Normal file
@@ -0,0 +1,253 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"bufio"
|
||||
"container/heap"
|
||||
"encoding/csv"
|
||||
"fmt"
|
||||
"os"
|
||||
"sort"
|
||||
"strconv"
|
||||
)
|
||||
|
||||
// KSP file magic bytes: "KSP\x01" (K-mer SPectrum v1)
|
||||
var kspMagic = [4]byte{'K', 'S', 'P', 0x01}
|
||||
|
||||
// SpectrumEntry represents one entry in a k-mer frequency spectrum.
|
||||
type SpectrumEntry struct {
|
||||
Frequency int // how many times a k-mer was observed
|
||||
Count uint64 // how many distinct k-mers have this frequency
|
||||
}
|
||||
|
||||
// KmerSpectrum represents the frequency distribution of k-mers.
|
||||
// Entries are sorted by Frequency in ascending order and only include
|
||||
// non-zero counts.
|
||||
type KmerSpectrum struct {
|
||||
Entries []SpectrumEntry
|
||||
}
|
||||
|
||||
// MaxFrequency returns the highest frequency in the spectrum, or 0 if empty.
|
||||
func (s *KmerSpectrum) MaxFrequency() int {
|
||||
if len(s.Entries) == 0 {
|
||||
return 0
|
||||
}
|
||||
return s.Entries[len(s.Entries)-1].Frequency
|
||||
}
|
||||
|
||||
// ToMap converts a KmerSpectrum back to a map for easy lookup.
|
||||
func (s *KmerSpectrum) ToMap() map[int]uint64 {
|
||||
m := make(map[int]uint64, len(s.Entries))
|
||||
for _, e := range s.Entries {
|
||||
m[e.Frequency] = e.Count
|
||||
}
|
||||
return m
|
||||
}
|
||||
|
||||
// MapToSpectrum converts a map[int]uint64 to a sorted KmerSpectrum.
|
||||
func MapToSpectrum(m map[int]uint64) *KmerSpectrum {
|
||||
entries := make([]SpectrumEntry, 0, len(m))
|
||||
for freq, count := range m {
|
||||
if count > 0 {
|
||||
entries = append(entries, SpectrumEntry{Frequency: freq, Count: count})
|
||||
}
|
||||
}
|
||||
sort.Slice(entries, func(i, j int) bool {
|
||||
return entries[i].Frequency < entries[j].Frequency
|
||||
})
|
||||
return &KmerSpectrum{Entries: entries}
|
||||
}
|
||||
|
||||
// MergeSpectraMaps adds all entries from b into a.
|
||||
func MergeSpectraMaps(a, b map[int]uint64) {
|
||||
for freq, count := range b {
|
||||
a[freq] += count
|
||||
}
|
||||
}
|
||||
|
||||
// WriteSpectrum writes a KmerSpectrum to a binary file.
|
||||
//
|
||||
// Format:
|
||||
//
|
||||
// [magic: 4 bytes "KSP\x01"]
|
||||
// [n_entries: varint]
|
||||
// For each entry (sorted by frequency ascending):
|
||||
// [frequency: varint]
|
||||
// [count: varint]
|
||||
func WriteSpectrum(path string, spectrum *KmerSpectrum) error {
|
||||
f, err := os.Create(path)
|
||||
if err != nil {
|
||||
return fmt.Errorf("create spectrum file: %w", err)
|
||||
}
|
||||
w := bufio.NewWriterSize(f, 65536)
|
||||
|
||||
// Magic
|
||||
if _, err := w.Write(kspMagic[:]); err != nil {
|
||||
f.Close()
|
||||
return err
|
||||
}
|
||||
|
||||
// Number of entries
|
||||
if _, err := EncodeVarint(w, uint64(len(spectrum.Entries))); err != nil {
|
||||
f.Close()
|
||||
return err
|
||||
}
|
||||
|
||||
// Entries
|
||||
for _, e := range spectrum.Entries {
|
||||
if _, err := EncodeVarint(w, uint64(e.Frequency)); err != nil {
|
||||
f.Close()
|
||||
return err
|
||||
}
|
||||
if _, err := EncodeVarint(w, e.Count); err != nil {
|
||||
f.Close()
|
||||
return err
|
||||
}
|
||||
}
|
||||
|
||||
if err := w.Flush(); err != nil {
|
||||
f.Close()
|
||||
return err
|
||||
}
|
||||
return f.Close()
|
||||
}
|
||||
|
||||
// ReadSpectrum reads a KmerSpectrum from a binary file.
|
||||
func ReadSpectrum(path string) (*KmerSpectrum, error) {
|
||||
f, err := os.Open(path)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
defer f.Close()
|
||||
|
||||
r := bufio.NewReaderSize(f, 65536)
|
||||
|
||||
// Check magic
|
||||
var magic [4]byte
|
||||
if _, err := r.Read(magic[:]); err != nil {
|
||||
return nil, fmt.Errorf("read spectrum magic: %w", err)
|
||||
}
|
||||
if magic != kspMagic {
|
||||
return nil, fmt.Errorf("invalid spectrum file magic: %v", magic)
|
||||
}
|
||||
|
||||
// Number of entries
|
||||
nEntries, err := DecodeVarint(r)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("read spectrum entry count: %w", err)
|
||||
}
|
||||
|
||||
entries := make([]SpectrumEntry, nEntries)
|
||||
for i := uint64(0); i < nEntries; i++ {
|
||||
freq, err := DecodeVarint(r)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("read spectrum freq at entry %d: %w", i, err)
|
||||
}
|
||||
count, err := DecodeVarint(r)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("read spectrum count at entry %d: %w", i, err)
|
||||
}
|
||||
entries[i] = SpectrumEntry{
|
||||
Frequency: int(freq),
|
||||
Count: count,
|
||||
}
|
||||
}
|
||||
|
||||
return &KmerSpectrum{Entries: entries}, nil
|
||||
}
|
||||
|
||||
// KmerFreq associates a k-mer (encoded as uint64) with its observed frequency.
|
||||
type KmerFreq struct {
|
||||
Kmer uint64
|
||||
Freq int
|
||||
}
|
||||
|
||||
// kmerFreqHeap is a min-heap of KmerFreq ordered by Freq (lowest first).
|
||||
// Used to maintain a top-N most frequent k-mers set.
|
||||
type kmerFreqHeap []KmerFreq
|
||||
|
||||
func (h kmerFreqHeap) Len() int { return len(h) }
|
||||
func (h kmerFreqHeap) Less(i, j int) bool { return h[i].Freq < h[j].Freq }
|
||||
func (h kmerFreqHeap) Swap(i, j int) { h[i], h[j] = h[j], h[i] }
|
||||
func (h *kmerFreqHeap) Push(x interface{}) { *h = append(*h, x.(KmerFreq)) }
|
||||
func (h *kmerFreqHeap) Pop() interface{} {
|
||||
old := *h
|
||||
n := len(old)
|
||||
x := old[n-1]
|
||||
*h = old[:n-1]
|
||||
return x
|
||||
}
|
||||
|
||||
// TopNKmers maintains a collection of the N most frequent k-mers
|
||||
// using a min-heap. Thread-safe usage requires external synchronization.
|
||||
type TopNKmers struct {
|
||||
n int
|
||||
h kmerFreqHeap
|
||||
}
|
||||
|
||||
// NewTopNKmers creates a new top-N collector.
|
||||
func NewTopNKmers(n int) *TopNKmers {
|
||||
return &TopNKmers{
|
||||
n: n,
|
||||
h: make(kmerFreqHeap, 0, n+1),
|
||||
}
|
||||
}
|
||||
|
||||
// Add considers a k-mer with the given frequency for inclusion in the top-N.
|
||||
func (t *TopNKmers) Add(kmer uint64, freq int) {
|
||||
if t.n <= 0 {
|
||||
return
|
||||
}
|
||||
if len(t.h) < t.n {
|
||||
heap.Push(&t.h, KmerFreq{Kmer: kmer, Freq: freq})
|
||||
} else if freq > t.h[0].Freq {
|
||||
t.h[0] = KmerFreq{Kmer: kmer, Freq: freq}
|
||||
heap.Fix(&t.h, 0)
|
||||
}
|
||||
}
|
||||
|
||||
// Results returns the collected k-mers sorted by frequency descending.
|
||||
func (t *TopNKmers) Results() []KmerFreq {
|
||||
result := make([]KmerFreq, len(t.h))
|
||||
copy(result, t.h)
|
||||
sort.Slice(result, func(i, j int) bool {
|
||||
return result[i].Freq > result[j].Freq
|
||||
})
|
||||
return result
|
||||
}
|
||||
|
||||
// MergeTopN merges another TopNKmers into this one.
|
||||
func (t *TopNKmers) MergeTopN(other *TopNKmers) {
|
||||
if other == nil {
|
||||
return
|
||||
}
|
||||
for _, kf := range other.h {
|
||||
t.Add(kf.Kmer, kf.Freq)
|
||||
}
|
||||
}
|
||||
|
||||
// WriteTopKmersCSV writes the top k-mers to a CSV file.
|
||||
// Columns: sequence, frequency
|
||||
func WriteTopKmersCSV(path string, topKmers []KmerFreq, k int) error {
|
||||
f, err := os.Create(path)
|
||||
if err != nil {
|
||||
return fmt.Errorf("create top-kmers file: %w", err)
|
||||
}
|
||||
defer f.Close()
|
||||
|
||||
w := csv.NewWriter(f)
|
||||
defer w.Flush()
|
||||
|
||||
if err := w.Write([]string{"sequence", "frequency"}); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
buf := make([]byte, k)
|
||||
for _, kf := range topKmers {
|
||||
seq := DecodeKmer(kf.Kmer, k, buf)
|
||||
if err := w.Write([]string{string(seq), strconv.Itoa(kf.Freq)}); err != nil {
|
||||
return err
|
||||
}
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
59
pkg/obikmer/superkmer.go
Normal file
59
pkg/obikmer/superkmer.go
Normal file
@@ -0,0 +1,59 @@
|
||||
package obikmer
|
||||
|
||||
// SuperKmer represents a maximal subsequence where all consecutive k-mers
|
||||
// share the same minimizer.
|
||||
type SuperKmer struct {
|
||||
Minimizer uint64 // The canonical minimizer value (normalized m-mer)
|
||||
Start int // Starting position in the original sequence (0-indexed)
|
||||
End int // Ending position (exclusive, like Go slice notation)
|
||||
Sequence []byte // The actual DNA subsequence [Start:End]
|
||||
}
|
||||
|
||||
// dequeItem represents an element in the monotone deque used for
|
||||
// tracking minimizers in a sliding window.
|
||||
type dequeItem struct {
|
||||
position int // Position of the m-mer in the sequence
|
||||
canonical uint64 // Canonical (normalized) m-mer value
|
||||
}
|
||||
|
||||
// ExtractSuperKmers extracts super k-mers from a DNA sequence.
|
||||
// A super k-mer is a maximal subsequence where all consecutive k-mers
|
||||
// share the same minimizer. The minimizer of a k-mer is the smallest
|
||||
// canonical m-mer among its (k-m+1) constituent m-mers.
|
||||
//
|
||||
// This function uses IterSuperKmers internally and collects results into a slice.
|
||||
//
|
||||
// Parameters:
|
||||
// - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
|
||||
// - k: k-mer size (must be between m+1 and 31)
|
||||
// - m: minimizer size (must be between 1 and k-1)
|
||||
// - buffer: optional pre-allocated buffer for results. If nil, a new slice is created.
|
||||
//
|
||||
// Returns:
|
||||
// - slice of SuperKmer structs representing maximal subsequences
|
||||
// - nil if parameters are invalid or sequence is too short
|
||||
//
|
||||
// Time complexity: O(n) where n is the sequence length
|
||||
// Space complexity: O(k-m+1) for the deque + O(number of super k-mers) for results
|
||||
func ExtractSuperKmers(seq []byte, k int, m int, buffer *[]SuperKmer) []SuperKmer {
|
||||
if m < 1 || m >= k || k < 2 || k > 31 || len(seq) < k {
|
||||
return nil
|
||||
}
|
||||
|
||||
var result []SuperKmer
|
||||
if buffer == nil {
|
||||
estimatedSize := len(seq) / k
|
||||
if estimatedSize < 1 {
|
||||
estimatedSize = 1
|
||||
}
|
||||
result = make([]SuperKmer, 0, estimatedSize)
|
||||
} else {
|
||||
result = (*buffer)[:0]
|
||||
}
|
||||
|
||||
for sk := range IterSuperKmers(seq, k, m) {
|
||||
result = append(result, sk)
|
||||
}
|
||||
|
||||
return result
|
||||
}
|
||||
215
pkg/obikmer/superkmer_iter.go
Normal file
215
pkg/obikmer/superkmer_iter.go
Normal file
@@ -0,0 +1,215 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"iter"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
// IterSuperKmers returns an iterator over super k-mers extracted from a DNA sequence.
|
||||
// It uses the same algorithm as ExtractSuperKmers but yields super k-mers one at a time.
|
||||
//
|
||||
// Parameters:
|
||||
// - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
|
||||
// - k: k-mer size (must be between m+1 and 31)
|
||||
// - m: minimizer size (must be between 1 and k-1)
|
||||
//
|
||||
// Returns:
|
||||
// - An iterator that yields SuperKmer structs
|
||||
//
|
||||
// Example:
|
||||
//
|
||||
// for sk := range IterSuperKmers(sequence, 21, 11) {
|
||||
// fmt.Printf("SuperKmer at %d-%d with minimizer %d\n", sk.Start, sk.End, sk.Minimizer)
|
||||
// }
|
||||
func IterSuperKmers(seq []byte, k int, m int) iter.Seq[SuperKmer] {
|
||||
return func(yield func(SuperKmer) bool) {
|
||||
if m < 1 || m >= k || k < 2 || k > 31 || len(seq) < k {
|
||||
return
|
||||
}
|
||||
|
||||
deque := make([]dequeItem, 0, k-m+1)
|
||||
|
||||
mMask := uint64(1)<<(m*2) - 1
|
||||
rcShift := uint((m - 1) * 2)
|
||||
|
||||
var fwdMmer, rvcMmer uint64
|
||||
for i := 0; i < m-1 && i < len(seq); i++ {
|
||||
code := uint64(__single_base_code__[seq[i]&31])
|
||||
fwdMmer = (fwdMmer << 2) | code
|
||||
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
|
||||
}
|
||||
|
||||
superKmerStart := 0
|
||||
var currentMinimizer uint64
|
||||
firstKmer := true
|
||||
|
||||
for pos := m - 1; pos < len(seq); pos++ {
|
||||
code := uint64(__single_base_code__[seq[pos]&31])
|
||||
fwdMmer = ((fwdMmer << 2) | code) & mMask
|
||||
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
|
||||
|
||||
canonical := fwdMmer
|
||||
if rvcMmer < fwdMmer {
|
||||
canonical = rvcMmer
|
||||
}
|
||||
|
||||
mmerPos := pos - m + 1
|
||||
|
||||
if pos >= k-1 {
|
||||
windowStart := pos - k + 1
|
||||
for len(deque) > 0 && deque[0].position < windowStart {
|
||||
deque = deque[1:]
|
||||
}
|
||||
}
|
||||
|
||||
for len(deque) > 0 && deque[len(deque)-1].canonical >= canonical {
|
||||
deque = deque[:len(deque)-1]
|
||||
}
|
||||
|
||||
deque = append(deque, dequeItem{position: mmerPos, canonical: canonical})
|
||||
|
||||
if pos >= k-1 {
|
||||
newMinimizer := deque[0].canonical
|
||||
kmerStart := pos - k + 1
|
||||
|
||||
if firstKmer {
|
||||
currentMinimizer = newMinimizer
|
||||
firstKmer = false
|
||||
} else if newMinimizer != currentMinimizer {
|
||||
endPos := kmerStart + k - 1
|
||||
superKmer := SuperKmer{
|
||||
Minimizer: currentMinimizer,
|
||||
Start: superKmerStart,
|
||||
End: endPos,
|
||||
Sequence: seq[superKmerStart:endPos],
|
||||
}
|
||||
if !yield(superKmer) {
|
||||
return
|
||||
}
|
||||
|
||||
superKmerStart = kmerStart
|
||||
currentMinimizer = newMinimizer
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
if !firstKmer && len(seq[superKmerStart:]) >= k {
|
||||
superKmer := SuperKmer{
|
||||
Minimizer: currentMinimizer,
|
||||
Start: superKmerStart,
|
||||
End: len(seq),
|
||||
Sequence: seq[superKmerStart:],
|
||||
}
|
||||
yield(superKmer)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// ToBioSequence converts a SuperKmer to a BioSequence with metadata.
|
||||
//
|
||||
// The resulting BioSequence contains:
|
||||
// - ID: "{parentID}_superkmer_{start}_{end}"
|
||||
// - Sequence: the actual DNA subsequence
|
||||
// - Attributes:
|
||||
// - "minimizer_value" (uint64): the canonical minimizer value
|
||||
// - "minimizer_seq" (string): the DNA sequence of the minimizer
|
||||
// - "k" (int): the k-mer size
|
||||
// - "m" (int): the minimizer size
|
||||
// - "start" (int): starting position in original sequence
|
||||
// - "end" (int): ending position in original sequence
|
||||
// - "parent_id" (string): ID of the parent sequence
|
||||
//
|
||||
// Parameters:
|
||||
// - k: k-mer size used for extraction
|
||||
// - m: minimizer size used for extraction
|
||||
// - parentID: ID of the parent sequence
|
||||
// - parentSource: source field from the parent sequence
|
||||
//
|
||||
// Returns:
|
||||
// - *obiseq.BioSequence: A new BioSequence representing this super k-mer
|
||||
func (sk *SuperKmer) ToBioSequence(k int, m int, parentID string, parentSource string) *obiseq.BioSequence {
|
||||
// Create ID for the super-kmer
|
||||
var id string
|
||||
if parentID != "" {
|
||||
id = fmt.Sprintf("%s_superkmer_%d_%d", parentID, sk.Start, sk.End)
|
||||
} else {
|
||||
id = fmt.Sprintf("superkmer_%d_%d", sk.Start, sk.End)
|
||||
}
|
||||
|
||||
// Create the BioSequence
|
||||
seq := obiseq.NewBioSequence(id, sk.Sequence, "")
|
||||
|
||||
// Copy source from parent
|
||||
if parentSource != "" {
|
||||
seq.SetSource(parentSource)
|
||||
}
|
||||
|
||||
// Set attributes
|
||||
seq.SetAttribute("minimizer_value", sk.Minimizer)
|
||||
|
||||
// Decode the minimizer to get its DNA sequence
|
||||
minimizerSeq := DecodeKmer(sk.Minimizer, m, nil)
|
||||
seq.SetAttribute("minimizer_seq", string(minimizerSeq))
|
||||
|
||||
seq.SetAttribute("k", k)
|
||||
seq.SetAttribute("m", m)
|
||||
seq.SetAttribute("start", sk.Start)
|
||||
seq.SetAttribute("end", sk.End)
|
||||
|
||||
if parentID != "" {
|
||||
seq.SetAttribute("parent_id", parentID)
|
||||
}
|
||||
|
||||
return seq
|
||||
}
|
||||
|
||||
// SuperKmerWorker creates a SeqWorker that extracts super k-mers from a BioSequence
|
||||
// and returns them as a slice of BioSequence objects.
|
||||
//
|
||||
// The worker copies the source field from the parent sequence to all extracted super k-mers.
|
||||
//
|
||||
// Parameters:
|
||||
// - k: k-mer size (must be between m+1 and 31)
|
||||
// - m: minimizer size (must be between 1 and k-1)
|
||||
//
|
||||
// Returns:
|
||||
// - SeqWorker: A worker function that can be used in obiiter pipelines
|
||||
//
|
||||
// Example:
|
||||
//
|
||||
// worker := SuperKmerWorker(21, 11)
|
||||
// iterator := iterator.MakeIWorker(worker, false)
|
||||
func SuperKmerWorker(k int, m int) obiseq.SeqWorker {
|
||||
return func(seq *obiseq.BioSequence) (obiseq.BioSequenceSlice, error) {
|
||||
if seq == nil {
|
||||
return obiseq.BioSequenceSlice{}, nil
|
||||
}
|
||||
|
||||
// Validate parameters
|
||||
if m < 1 || m >= k || k < 2 || k > 31 {
|
||||
return obiseq.BioSequenceSlice{}, fmt.Errorf(
|
||||
"invalid parameters: k=%d, m=%d (need 1 <= m < k <= 31)",
|
||||
k, m)
|
||||
}
|
||||
|
||||
sequence := seq.Sequence()
|
||||
if len(sequence) < k {
|
||||
return obiseq.BioSequenceSlice{}, nil
|
||||
}
|
||||
|
||||
parentID := seq.Id()
|
||||
parentSource := seq.Source()
|
||||
|
||||
// Extract super k-mers and convert to BioSequences
|
||||
result := make(obiseq.BioSequenceSlice, 0)
|
||||
|
||||
for sk := range IterSuperKmers(sequence, k, m) {
|
||||
bioSeq := sk.ToBioSequence(k, m, parentID, parentSource)
|
||||
result = append(result, bioSeq)
|
||||
}
|
||||
|
||||
return result, nil
|
||||
}
|
||||
}
|
||||
198
pkg/obikmer/superkmer_iter_test.go
Normal file
198
pkg/obikmer/superkmer_iter_test.go
Normal file
@@ -0,0 +1,198 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"testing"
|
||||
)
|
||||
|
||||
func TestIterSuperKmers(t *testing.T) {
|
||||
seq := []byte("ACGTACGTGGGGAAAA")
|
||||
k := 5
|
||||
m := 3
|
||||
|
||||
count := 0
|
||||
for sk := range IterSuperKmers(seq, k, m) {
|
||||
count++
|
||||
t.Logf("SuperKmer %d: Minimizer=%d, Start=%d, End=%d, Seq=%s",
|
||||
count, sk.Minimizer, sk.Start, sk.End, string(sk.Sequence))
|
||||
|
||||
// Verify sequence boundaries
|
||||
if sk.Start < 0 || sk.End > len(seq) {
|
||||
t.Errorf("Invalid boundaries: Start=%d, End=%d, seqLen=%d",
|
||||
sk.Start, sk.End, len(seq))
|
||||
}
|
||||
|
||||
// Verify sequence content
|
||||
if string(sk.Sequence) != string(seq[sk.Start:sk.End]) {
|
||||
t.Errorf("Sequence mismatch: expected %s, got %s",
|
||||
string(seq[sk.Start:sk.End]), string(sk.Sequence))
|
||||
}
|
||||
}
|
||||
|
||||
if count == 0 {
|
||||
t.Error("No super k-mers extracted")
|
||||
}
|
||||
|
||||
t.Logf("Total super k-mers extracted: %d", count)
|
||||
}
|
||||
|
||||
func TestIterSuperKmersVsSlice(t *testing.T) {
|
||||
seq := []byte("ACGTACGTGGGGAAAAACGTACGT")
|
||||
k := 7
|
||||
m := 4
|
||||
|
||||
// Extract using slice version
|
||||
sliceResult := ExtractSuperKmers(seq, k, m, nil)
|
||||
|
||||
// Extract using iterator version
|
||||
var iterResult []SuperKmer
|
||||
for sk := range IterSuperKmers(seq, k, m) {
|
||||
iterResult = append(iterResult, sk)
|
||||
}
|
||||
|
||||
// Compare counts
|
||||
if len(sliceResult) != len(iterResult) {
|
||||
t.Errorf("Different number of super k-mers: slice=%d, iter=%d",
|
||||
len(sliceResult), len(iterResult))
|
||||
}
|
||||
|
||||
// Compare each super k-mer
|
||||
for i := 0; i < len(sliceResult) && i < len(iterResult); i++ {
|
||||
slice := sliceResult[i]
|
||||
iter := iterResult[i]
|
||||
|
||||
if slice.Minimizer != iter.Minimizer {
|
||||
t.Errorf("SuperKmer %d: different minimizers: slice=%d, iter=%d",
|
||||
i, slice.Minimizer, iter.Minimizer)
|
||||
}
|
||||
|
||||
if slice.Start != iter.Start || slice.End != iter.End {
|
||||
t.Errorf("SuperKmer %d: different boundaries: slice=[%d:%d], iter=[%d:%d]",
|
||||
i, slice.Start, slice.End, iter.Start, iter.End)
|
||||
}
|
||||
|
||||
if string(slice.Sequence) != string(iter.Sequence) {
|
||||
t.Errorf("SuperKmer %d: different sequences: slice=%s, iter=%s",
|
||||
i, string(slice.Sequence), string(iter.Sequence))
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestSuperKmerMinimizerBijection validates the intrinsic property that
|
||||
// a super k-mer sequence has one and only one minimizer (bijection property).
|
||||
// This test ensures that:
|
||||
// 1. All k-mers in a super k-mer share the same minimizer
|
||||
// 2. Two identical super k-mer sequences must have the same minimizer
|
||||
func TestSuperKmerMinimizerBijection(t *testing.T) {
|
||||
testCases := []struct {
|
||||
name string
|
||||
seq []byte
|
||||
k int
|
||||
m int
|
||||
}{
|
||||
{
|
||||
name: "simple sequence",
|
||||
seq: []byte("ACGTACGTACGTACGTACGTACGTACGTACGT"),
|
||||
k: 21,
|
||||
m: 11,
|
||||
},
|
||||
{
|
||||
name: "homopolymer blocks",
|
||||
seq: []byte("AAAACCCCGGGGTTTTAAAACCCCGGGGTTTT"),
|
||||
k: 21,
|
||||
m: 11,
|
||||
},
|
||||
{
|
||||
name: "complex sequence",
|
||||
seq: []byte("ATCGATCGATCGATCGATCGATCGATCGATCG"),
|
||||
k: 15,
|
||||
m: 7,
|
||||
},
|
||||
{
|
||||
name: "longer sequence",
|
||||
seq: []byte("ACGTACGTGGGGAAAAACGTACGTTTTTCCCCACGTACGT"),
|
||||
k: 13,
|
||||
m: 7,
|
||||
},
|
||||
}
|
||||
|
||||
for _, tc := range testCases {
|
||||
t.Run(tc.name, func(t *testing.T) {
|
||||
// Map to track sequence -> minimizer
|
||||
seqToMinimizer := make(map[string]uint64)
|
||||
|
||||
for sk := range IterSuperKmers(tc.seq, tc.k, tc.m) {
|
||||
seqStr := string(sk.Sequence)
|
||||
|
||||
// Check if we've seen this sequence before
|
||||
if prevMinimizer, exists := seqToMinimizer[seqStr]; exists {
|
||||
if prevMinimizer != sk.Minimizer {
|
||||
t.Errorf("BIJECTION VIOLATION: sequence %s has two different minimizers:\n"+
|
||||
" First: %d\n"+
|
||||
" Second: %d\n"+
|
||||
" This violates the super k-mer definition!",
|
||||
seqStr, prevMinimizer, sk.Minimizer)
|
||||
}
|
||||
} else {
|
||||
seqToMinimizer[seqStr] = sk.Minimizer
|
||||
}
|
||||
|
||||
// Verify all k-mers in this super k-mer have the same minimizer
|
||||
if len(sk.Sequence) >= tc.k {
|
||||
for i := 0; i <= len(sk.Sequence)-tc.k; i++ {
|
||||
kmerSeq := sk.Sequence[i : i+tc.k]
|
||||
minimizer := findMinimizer(kmerSeq, tc.k, tc.m)
|
||||
if minimizer != sk.Minimizer {
|
||||
t.Errorf("K-mer at position %d in super k-mer has different minimizer:\n"+
|
||||
" K-mer: %s\n"+
|
||||
" Expected minimizer: %d\n"+
|
||||
" Actual minimizer: %d\n"+
|
||||
" Super k-mer: %s",
|
||||
i, string(kmerSeq), sk.Minimizer, minimizer, seqStr)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
})
|
||||
}
|
||||
}
|
||||
|
||||
// findMinimizer computes the minimizer of a k-mer for testing purposes
|
||||
func findMinimizer(kmer []byte, k int, m int) uint64 {
|
||||
if len(kmer) != k {
|
||||
return 0
|
||||
}
|
||||
|
||||
mMask := uint64(1)<<(m*2) - 1
|
||||
rcShift := uint((m - 1) * 2)
|
||||
|
||||
minMinimizer := uint64(^uint64(0)) // max uint64
|
||||
|
||||
// Scan all m-mers in the k-mer
|
||||
var fwdMmer, rvcMmer uint64
|
||||
for i := 0; i < m-1 && i < len(kmer); i++ {
|
||||
code := uint64(__single_base_code__[kmer[i]&31])
|
||||
fwdMmer = (fwdMmer << 2) | code
|
||||
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
|
||||
}
|
||||
|
||||
for i := m - 1; i < len(kmer); i++ {
|
||||
code := uint64(__single_base_code__[kmer[i]&31])
|
||||
fwdMmer = ((fwdMmer << 2) | code) & mMask
|
||||
rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
|
||||
|
||||
canonical := fwdMmer
|
||||
if rvcMmer < fwdMmer {
|
||||
canonical = rvcMmer
|
||||
}
|
||||
|
||||
if canonical < minMinimizer {
|
||||
minMinimizer = canonical
|
||||
}
|
||||
}
|
||||
|
||||
return minMinimizer
|
||||
}
|
||||
|
||||
// Note: Tests for ToBioSequence and SuperKmerWorker are in a separate
|
||||
// integration test package to avoid circular dependencies between
|
||||
// obikmer and obiseq packages.
|
||||
53
pkg/obikmer/varint.go
Normal file
53
pkg/obikmer/varint.go
Normal file
@@ -0,0 +1,53 @@
|
||||
package obikmer
|
||||
|
||||
import "io"
|
||||
|
||||
// EncodeVarint writes a uint64 value as a variable-length integer to w.
|
||||
// Uses 7 bits per byte with the high bit as a continuation flag
|
||||
// (identical to protobuf unsigned varint encoding).
|
||||
// Returns the number of bytes written.
|
||||
func EncodeVarint(w io.Writer, v uint64) (int, error) {
|
||||
var buf [10]byte // max 10 bytes for uint64 varint
|
||||
n := 0
|
||||
for v >= 0x80 {
|
||||
buf[n] = byte(v) | 0x80
|
||||
v >>= 7
|
||||
n++
|
||||
}
|
||||
buf[n] = byte(v)
|
||||
n++
|
||||
return w.Write(buf[:n])
|
||||
}
|
||||
|
||||
// DecodeVarint reads a variable-length encoded uint64 from r.
|
||||
// Returns the decoded value and any error encountered.
|
||||
func DecodeVarint(r io.Reader) (uint64, error) {
|
||||
var val uint64
|
||||
var shift uint
|
||||
var buf [1]byte
|
||||
|
||||
for {
|
||||
if _, err := io.ReadFull(r, buf[:]); err != nil {
|
||||
return 0, err
|
||||
}
|
||||
b := buf[0]
|
||||
val |= uint64(b&0x7F) << shift
|
||||
if b < 0x80 {
|
||||
return val, nil
|
||||
}
|
||||
shift += 7
|
||||
if shift >= 70 {
|
||||
return 0, io.ErrUnexpectedEOF
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// VarintLen returns the number of bytes needed to encode v as a varint.
|
||||
func VarintLen(v uint64) int {
|
||||
n := 1
|
||||
for v >= 0x80 {
|
||||
v >>= 7
|
||||
n++
|
||||
}
|
||||
return n
|
||||
}
|
||||
82
pkg/obikmer/varint_test.go
Normal file
82
pkg/obikmer/varint_test.go
Normal file
@@ -0,0 +1,82 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"bytes"
|
||||
"testing"
|
||||
)
|
||||
|
||||
func TestVarintRoundTrip(t *testing.T) {
|
||||
values := []uint64{
|
||||
0, 1, 127, 128, 255, 256,
|
||||
16383, 16384,
|
||||
1<<21 - 1, 1 << 21,
|
||||
1<<28 - 1, 1 << 28,
|
||||
1<<35 - 1, 1 << 35,
|
||||
1<<42 - 1, 1 << 42,
|
||||
1<<49 - 1, 1 << 49,
|
||||
1<<56 - 1, 1 << 56,
|
||||
1<<63 - 1, 1 << 63,
|
||||
^uint64(0), // max uint64
|
||||
}
|
||||
|
||||
for _, v := range values {
|
||||
var buf bytes.Buffer
|
||||
n, err := EncodeVarint(&buf, v)
|
||||
if err != nil {
|
||||
t.Fatalf("EncodeVarint(%d): %v", v, err)
|
||||
}
|
||||
if n != VarintLen(v) {
|
||||
t.Fatalf("EncodeVarint(%d): wrote %d bytes, VarintLen says %d", v, n, VarintLen(v))
|
||||
}
|
||||
|
||||
decoded, err := DecodeVarint(&buf)
|
||||
if err != nil {
|
||||
t.Fatalf("DecodeVarint for %d: %v", v, err)
|
||||
}
|
||||
if decoded != v {
|
||||
t.Fatalf("roundtrip failed: encoded %d, decoded %d", v, decoded)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestVarintLen(t *testing.T) {
|
||||
tests := []struct {
|
||||
value uint64
|
||||
expected int
|
||||
}{
|
||||
{0, 1},
|
||||
{127, 1},
|
||||
{128, 2},
|
||||
{16383, 2},
|
||||
{16384, 3},
|
||||
{^uint64(0), 10},
|
||||
}
|
||||
|
||||
for _, tc := range tests {
|
||||
got := VarintLen(tc.value)
|
||||
if got != tc.expected {
|
||||
t.Errorf("VarintLen(%d) = %d, want %d", tc.value, got, tc.expected)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestVarintSequence(t *testing.T) {
|
||||
var buf bytes.Buffer
|
||||
values := []uint64{0, 42, 1000000, ^uint64(0), 1}
|
||||
|
||||
for _, v := range values {
|
||||
if _, err := EncodeVarint(&buf, v); err != nil {
|
||||
t.Fatalf("EncodeVarint(%d): %v", v, err)
|
||||
}
|
||||
}
|
||||
|
||||
for _, expected := range values {
|
||||
got, err := DecodeVarint(&buf)
|
||||
if err != nil {
|
||||
t.Fatalf("DecodeVarint: %v", err)
|
||||
}
|
||||
if got != expected {
|
||||
t.Errorf("got %d, want %d", got, expected)
|
||||
}
|
||||
}
|
||||
}
|
||||
@@ -26,16 +26,11 @@ var __defaut_taxonomy_mutex__ sync.Mutex
|
||||
|
||||
type ArgumentParser func([]string) (*getoptions.GetOpt, []string)
|
||||
|
||||
func GenerateOptionParser(program string,
|
||||
documentation string,
|
||||
optionset ...func(*getoptions.GetOpt)) ArgumentParser {
|
||||
|
||||
options := getoptions.New()
|
||||
options.Self(program, documentation)
|
||||
options.SetMode(getoptions.Bundling)
|
||||
options.SetUnknownMode(getoptions.Fail)
|
||||
options.Bool("help", false, options.Alias("h", "?"))
|
||||
|
||||
// RegisterGlobalOptions registers the global options shared by all obitools
|
||||
// commands onto the given GetOpt instance. It does NOT register --help,
|
||||
// which must be handled by the caller (either as a Bool option or via
|
||||
// HelpCommand for subcommand-based parsers).
|
||||
func RegisterGlobalOptions(options *getoptions.GetOpt) {
|
||||
options.Bool("version", false,
|
||||
options.Description("Prints the version and exits."))
|
||||
|
||||
@@ -46,17 +41,10 @@ func GenerateOptionParser(program string,
|
||||
options.BoolVar(&_Pprof, "pprof", false,
|
||||
options.Description("Enable pprof server. Look at the log for details."))
|
||||
|
||||
// options.IntVar(&_ParallelWorkers, "workers", _ParallelWorkers,
|
||||
// options.Alias("w"),
|
||||
// options.Description("Number of parallele threads computing the result"))
|
||||
|
||||
options.IntVar(obidefault.MaxCPUPtr(), "max-cpu", obidefault.MaxCPU(),
|
||||
options.GetEnv("OBIMAXCPU"),
|
||||
options.Description("Number of parallele threads computing the result"))
|
||||
|
||||
// options.BoolVar(&_Pprof, "force-one-cpu", false,
|
||||
// options.Description("Force to use only one cpu core for parallel processing"))
|
||||
|
||||
options.IntVar(&_PprofMudex, "pprof-mutex", _PprofMudex,
|
||||
options.GetEnv("OBIPPROFMUTEX"),
|
||||
options.Description("Enable profiling of mutex lock."))
|
||||
@@ -77,19 +65,22 @@ func GenerateOptionParser(program string,
|
||||
options.GetEnv("OBIWARNING"),
|
||||
options.Description("Stop printing of the warning message"),
|
||||
)
|
||||
|
||||
for _, o := range optionset {
|
||||
o(options)
|
||||
}
|
||||
|
||||
return func(args []string) (*getoptions.GetOpt, []string) {
|
||||
|
||||
remaining, err := options.Parse(args[1:])
|
||||
|
||||
// ProcessParsedOptions handles the post-parse logic common to all obitools
|
||||
// commands: help, version, debug, pprof, taxonomy, cpu configuration, etc.
|
||||
// It receives the GetOpt instance and the parse error (if any).
|
||||
func ProcessParsedOptions(options *getoptions.GetOpt, parseErr error) {
|
||||
// Note: "help" may not be registered as a Bool (e.g. when using HelpCommand
|
||||
// for subcommand-based parsers). Only check if it won't panic.
|
||||
// We use a recover guard to be safe.
|
||||
func() {
|
||||
defer func() { recover() }()
|
||||
if options.Called("help") {
|
||||
fmt.Fprint(os.Stderr, options.Help())
|
||||
os.Exit(0)
|
||||
}
|
||||
}()
|
||||
|
||||
if options.Called("version") {
|
||||
fmt.Fprintf(os.Stderr, "OBITools %s\n", VersionString())
|
||||
@@ -107,7 +98,6 @@ func GenerateOptionParser(program string,
|
||||
|
||||
if err != nil {
|
||||
log.Fatalf("Cannot load default taxonomy: %v", err)
|
||||
|
||||
}
|
||||
|
||||
taxonomy.SetAsDefault()
|
||||
@@ -146,32 +136,14 @@ func GenerateOptionParser(program string,
|
||||
}
|
||||
|
||||
// Handle user errors
|
||||
if err != nil {
|
||||
fmt.Fprintf(os.Stderr, "ERROR: %s\n\n", err)
|
||||
if parseErr != nil {
|
||||
fmt.Fprintf(os.Stderr, "ERROR: %s\n\n", parseErr)
|
||||
fmt.Fprint(os.Stderr, options.Help(getoptions.HelpSynopsis))
|
||||
os.Exit(1)
|
||||
}
|
||||
|
||||
// // Setup the maximum number of CPU usable by the program
|
||||
// if obidefault.MaxCPU() == 1 {
|
||||
// log.Warn("Limitating the Maximum number of CPU to 1 is not recommanded")
|
||||
// log.Warn("The number of CPU requested has been set to 2")
|
||||
// obidefault.SetMaxCPU(2)
|
||||
// }
|
||||
|
||||
// if options.Called("force-one-cpu") {
|
||||
// log.Warn("Limitating the Maximum number of CPU to 1 is not recommanded")
|
||||
// log.Warn("The number of CPU has been forced to 1")
|
||||
// log.Warn("This can lead to unexpected behavior")
|
||||
// obidefault.SetMaxCPU(1)
|
||||
// }
|
||||
|
||||
runtime.GOMAXPROCS(obidefault.MaxCPU())
|
||||
|
||||
// if options.Called("max-cpu") || options.Called("force-one-cpu") {
|
||||
// log.Printf("CPU number limited to %d", obidefault.MaxCPU())
|
||||
// }
|
||||
|
||||
if options.Called("max-cpu") {
|
||||
log.Printf("CPU number limited to %d", obidefault.MaxCPU())
|
||||
}
|
||||
@@ -182,14 +154,30 @@ func GenerateOptionParser(program string,
|
||||
|
||||
log.Printf("Number of workers set %d", obidefault.ParallelWorkers())
|
||||
|
||||
// if options.Called("workers") {
|
||||
|
||||
// }
|
||||
|
||||
if options.Called("solexa") {
|
||||
obidefault.SetReadQualitiesShift(64)
|
||||
}
|
||||
}
|
||||
|
||||
func GenerateOptionParser(program string,
|
||||
documentation string,
|
||||
optionset ...func(*getoptions.GetOpt)) ArgumentParser {
|
||||
|
||||
options := getoptions.New()
|
||||
options.Self(program, documentation)
|
||||
options.SetMode(getoptions.Bundling)
|
||||
options.SetUnknownMode(getoptions.Fail)
|
||||
options.Bool("help", false, options.Alias("h", "?"))
|
||||
|
||||
RegisterGlobalOptions(options)
|
||||
|
||||
for _, o := range optionset {
|
||||
o(options)
|
||||
}
|
||||
|
||||
return func(args []string) (*getoptions.GetOpt, []string) {
|
||||
remaining, err := options.Parse(args[1:])
|
||||
ProcessParsedOptions(options, err)
|
||||
return options, remaining
|
||||
}
|
||||
}
|
||||
|
||||
43
pkg/obioptions/subcommand.go
Normal file
43
pkg/obioptions/subcommand.go
Normal file
@@ -0,0 +1,43 @@
|
||||
package obioptions
|
||||
|
||||
import (
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// GenerateSubcommandParser creates an option parser that supports subcommands
|
||||
// via go-getoptions' NewCommand/SetCommandFn/Dispatch API.
|
||||
//
|
||||
// The setup function receives the root *GetOpt and should register subcommands
|
||||
// using opt.NewCommand(). Global options (--debug, --max-cpu, etc.) are
|
||||
// registered before setup is called and are inherited by all subcommands.
|
||||
//
|
||||
// Returns the root *GetOpt (needed for Dispatch) and an ArgumentParser
|
||||
// that handles parsing and post-parse processing.
|
||||
func GenerateSubcommandParser(
|
||||
program string,
|
||||
documentation string,
|
||||
setup func(opt *getoptions.GetOpt),
|
||||
) (*getoptions.GetOpt, ArgumentParser) {
|
||||
|
||||
options := getoptions.New()
|
||||
options.Self(program, documentation)
|
||||
options.SetMode(getoptions.Bundling)
|
||||
options.SetUnknownMode(getoptions.Fail)
|
||||
|
||||
// Register global options (inherited by all subcommands)
|
||||
RegisterGlobalOptions(options)
|
||||
|
||||
// Let the caller register subcommands
|
||||
setup(options)
|
||||
|
||||
// Add automatic help subcommand (must be after all commands)
|
||||
options.HelpCommand("help", options.Description("Show help for a command"))
|
||||
|
||||
parser := func(args []string) (*getoptions.GetOpt, []string) {
|
||||
remaining, err := options.Parse(args[1:])
|
||||
ProcessParsedOptions(options, err)
|
||||
return options, remaining
|
||||
}
|
||||
|
||||
return options, parser
|
||||
}
|
||||
@@ -3,7 +3,7 @@ package obioptions
|
||||
// Version is automatically updated by the Makefile from version.txt
|
||||
// The patch number (third digit) is incremented on each push to the repository
|
||||
|
||||
var _Version = "Release 4.4.7"
|
||||
var _Version = "Release 4.4.16"
|
||||
|
||||
// Version returns the version of the obitools package.
|
||||
//
|
||||
|
||||
@@ -13,6 +13,7 @@ import (
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
"github.com/schollz/progressbar/v3"
|
||||
)
|
||||
@@ -69,6 +70,8 @@ func EmpiricalDistCsv(filename string, data [][]Ratio, compressed bool) {
|
||||
}
|
||||
defer destfile.Close()
|
||||
|
||||
var bar *progressbar.ProgressBar
|
||||
if obidefault.ProgressBar() {
|
||||
pbopt := make([]progressbar.Option, 0, 5)
|
||||
pbopt = append(pbopt,
|
||||
progressbar.OptionSetWriter(os.Stderr),
|
||||
@@ -77,8 +80,8 @@ func EmpiricalDistCsv(filename string, data [][]Ratio, compressed bool) {
|
||||
progressbar.OptionSetPredictTime(true),
|
||||
progressbar.OptionSetDescription("[Save CSV stat ratio file]"),
|
||||
)
|
||||
|
||||
bar := progressbar.NewOptions(len(data), pbopt...)
|
||||
bar = progressbar.NewOptions(len(data), pbopt...)
|
||||
}
|
||||
|
||||
fmt.Fprintln(destfile, "Sample,Origin_id,Origin_status,Origin,Mutant,Origin_Weight,Mutant_Weight,Origin_Count,Mutant_Count,Position,Origin_length,A,C,G,T")
|
||||
for code, dist := range data {
|
||||
@@ -101,9 +104,11 @@ func EmpiricalDistCsv(filename string, data [][]Ratio, compressed bool) {
|
||||
ratio.T,
|
||||
)
|
||||
}
|
||||
if bar != nil {
|
||||
bar.Add(1)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// It takes a slice of sequences, a sample name and a statistical threshold and returns a string
|
||||
// containing a GML representation of the graph
|
||||
@@ -181,6 +186,8 @@ func SaveGMLGraphs(dirname string,
|
||||
}
|
||||
}
|
||||
|
||||
var bar *progressbar.ProgressBar
|
||||
if obidefault.ProgressBar() {
|
||||
pbopt := make([]progressbar.Option, 0, 5)
|
||||
pbopt = append(pbopt,
|
||||
progressbar.OptionSetWriter(os.Stderr),
|
||||
@@ -189,8 +196,8 @@ func SaveGMLGraphs(dirname string,
|
||||
progressbar.OptionSetPredictTime(true),
|
||||
progressbar.OptionSetDescription("[Save GML Graph files]"),
|
||||
)
|
||||
|
||||
bar := progressbar.NewOptions(len(samples), pbopt...)
|
||||
bar = progressbar.NewOptions(len(samples), pbopt...)
|
||||
}
|
||||
|
||||
for name, seqs := range samples {
|
||||
|
||||
@@ -204,8 +211,10 @@ func SaveGMLGraphs(dirname string,
|
||||
file.WriteString(Gml(seqs, name, statThreshold))
|
||||
file.Close()
|
||||
|
||||
if bar != nil {
|
||||
bar.Add(1)
|
||||
}
|
||||
}
|
||||
|
||||
}
|
||||
|
||||
@@ -495,6 +504,8 @@ func BuildSeqGraph(samples map[string]*[]*seqPCR,
|
||||
npairs += nseq * (nseq - 1) / 2
|
||||
}
|
||||
|
||||
var bar *progressbar.ProgressBar
|
||||
if obidefault.ProgressBar() {
|
||||
pbopt := make([]progressbar.Option, 0, 5)
|
||||
pbopt = append(pbopt,
|
||||
progressbar.OptionSetWriter(os.Stderr),
|
||||
@@ -503,16 +514,19 @@ func BuildSeqGraph(samples map[string]*[]*seqPCR,
|
||||
progressbar.OptionSetPredictTime(true),
|
||||
progressbar.OptionSetDescription("[One error graph]"),
|
||||
)
|
||||
bar = progressbar.NewOptions(npairs, pbopt...)
|
||||
}
|
||||
|
||||
bar := progressbar.NewOptions(npairs, pbopt...)
|
||||
for _, seqs := range samples {
|
||||
np := buildSamplePairs(seqs, workers)
|
||||
|
||||
if bar != nil {
|
||||
bar.Add(np)
|
||||
}
|
||||
}
|
||||
|
||||
if maxError > 1 {
|
||||
pbopt = make([]progressbar.Option, 0, 5)
|
||||
if obidefault.ProgressBar() {
|
||||
pbopt := make([]progressbar.Option, 0, 5)
|
||||
pbopt = append(pbopt,
|
||||
progressbar.OptionSetWriter(os.Stderr),
|
||||
progressbar.OptionSetWidth(15),
|
||||
@@ -520,12 +534,14 @@ func BuildSeqGraph(samples map[string]*[]*seqPCR,
|
||||
progressbar.OptionSetPredictTime(true),
|
||||
progressbar.OptionSetDescription("[Adds multiple errors]"),
|
||||
)
|
||||
|
||||
bar = progressbar.NewOptions(npairs, pbopt...)
|
||||
}
|
||||
|
||||
for _, seqs := range samples {
|
||||
np := extendSimilarityGraph(seqs, maxError, workers)
|
||||
if bar != nil {
|
||||
bar.Add(np)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
@@ -31,7 +31,6 @@ var __output_in_json__ = false
|
||||
var __output_fastjson_format__ = false
|
||||
var __output_fastobi_format__ = false
|
||||
|
||||
var __no_progress_bar__ = false
|
||||
var __skip_empty__ = false
|
||||
var __skip_on_error__ = false
|
||||
|
||||
@@ -82,7 +81,7 @@ func InputOptionSet(options *getoptions.GetOpt) {
|
||||
}
|
||||
|
||||
func OutputModeOptionSet(options *getoptions.GetOpt, compressed bool) {
|
||||
options.BoolVar(&__no_progress_bar__, "no-progressbar", false,
|
||||
options.BoolVar(obidefault.NoProgressBarPtr(), "no-progressbar", obidefault.NoProgressBar(),
|
||||
options.Description("Disable the progress bar printing"))
|
||||
|
||||
if compressed {
|
||||
@@ -224,13 +223,16 @@ func CLIAnalyzeOnly() int {
|
||||
|
||||
func CLIProgressBar() bool {
|
||||
// If the output is not a terminal, then we do not display the progress bar
|
||||
o, _ := os.Stderr.Stat()
|
||||
onTerminal := (o.Mode() & os.ModeCharDevice) == os.ModeCharDevice
|
||||
oe, _ := os.Stderr.Stat()
|
||||
onTerminal := (oe.Mode() & os.ModeCharDevice) == os.ModeCharDevice
|
||||
if !onTerminal {
|
||||
log.Info("Stderr is redirected, progress bar disabled")
|
||||
}
|
||||
|
||||
return onTerminal && !__no_progress_bar__
|
||||
oo, _ := os.Stdout.Stat()
|
||||
toPipe := (oo.Mode() & os.ModeNamedPipe) == os.ModeNamedPipe
|
||||
|
||||
return onTerminal && !toPipe && obidefault.ProgressBar()
|
||||
}
|
||||
|
||||
func CLIOutPutFileName() string {
|
||||
|
||||
@@ -68,6 +68,8 @@ func ExpandListOfFiles(check_ext bool, filenames ...string) ([]string, error) {
|
||||
strings.HasSuffix(path, "seq.gz") ||
|
||||
strings.HasSuffix(path, "gb") ||
|
||||
strings.HasSuffix(path, "gb.gz") ||
|
||||
strings.HasSuffix(path, "gbff") ||
|
||||
strings.HasSuffix(path, "gbff.gz") ||
|
||||
strings.HasSuffix(path, "dat") ||
|
||||
strings.HasSuffix(path, "dat.gz") ||
|
||||
strings.HasSuffix(path, "ecopcr") ||
|
||||
@@ -204,15 +206,13 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
|
||||
iterator = iterator.PairTo(ip)
|
||||
}
|
||||
} else {
|
||||
iterator = obiiter.NilIBioSequence
|
||||
return obiiter.NilIBioSequence, fmt.Errorf("no sequence files found in the provided paths")
|
||||
}
|
||||
}
|
||||
|
||||
}
|
||||
|
||||
if CLIProgressBar() {
|
||||
iterator = iterator.Speed("Reading sequences")
|
||||
}
|
||||
|
||||
return iterator, nil
|
||||
}
|
||||
|
||||
@@ -12,9 +12,7 @@ import (
|
||||
func CLIWriteSequenceCSV(iterator obiiter.IBioSequence,
|
||||
terminalAction bool, filenames ...string) *obiitercsv.ICSVRecord {
|
||||
|
||||
if obiconvert.CLIProgressBar() {
|
||||
iterator = iterator.Speed("Writing CSV")
|
||||
}
|
||||
|
||||
opts := make([]WithOption, 0, 10)
|
||||
|
||||
|
||||
55
pkg/obitools/obik/cp.go
Normal file
55
pkg/obitools/obik/cp.go
Normal file
@@ -0,0 +1,55 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
func runCp(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
if len(args) < 2 {
|
||||
return fmt.Errorf("usage: obik cp [--set PATTERN]... [--force] <source_index> <dest_index>")
|
||||
}
|
||||
|
||||
srcDir := args[0]
|
||||
destDir := args[1]
|
||||
|
||||
ksg, err := obikmer.OpenKmerSetGroup(srcDir)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open source kmer index: %w", err)
|
||||
}
|
||||
|
||||
// Resolve set patterns
|
||||
patterns := CLISetPatterns()
|
||||
var ids []string
|
||||
if len(patterns) > 0 {
|
||||
indices, err := ksg.MatchSetIDs(patterns)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
if len(indices) == 0 {
|
||||
return fmt.Errorf("no sets match the given patterns")
|
||||
}
|
||||
ids = make([]string, len(indices))
|
||||
for i, idx := range indices {
|
||||
ids[i] = ksg.SetIDOf(idx)
|
||||
}
|
||||
} else {
|
||||
// Copy all sets
|
||||
ids = ksg.SetsIDs()
|
||||
}
|
||||
|
||||
log.Infof("Copying %d set(s) from %s to %s", len(ids), srcDir, destDir)
|
||||
|
||||
dest, err := ksg.CopySetsByIDTo(ids, destDir, CLIForce())
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
log.Infof("Destination now has %d set(s)", dest.Size())
|
||||
return nil
|
||||
}
|
||||
344
pkg/obitools/obik/filter.go
Normal file
344
pkg/obitools/obik/filter.go
Normal file
@@ -0,0 +1,344 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
"os"
|
||||
"path/filepath"
|
||||
"strings"
|
||||
"sync"
|
||||
"sync/atomic"
|
||||
|
||||
"github.com/schollz/progressbar/v3"
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// KmerFilter is a predicate applied to individual k-mers during filtering.
|
||||
// Returns true if the k-mer should be kept.
|
||||
type KmerFilter func(kmer uint64) bool
|
||||
|
||||
// KmerFilterFactory creates a new KmerFilter instance.
|
||||
// Each goroutine should call the factory to get its own filter,
|
||||
// since some filters (e.g. KmerEntropyFilter) are not thread-safe.
|
||||
type KmerFilterFactory func() KmerFilter
|
||||
|
||||
// chainFilterFactories combines multiple KmerFilterFactory into one.
|
||||
// The resulting factory creates a filter that accepts a k-mer only
|
||||
// if all individual filters accept it.
|
||||
func chainFilterFactories(factories []KmerFilterFactory) KmerFilterFactory {
|
||||
switch len(factories) {
|
||||
case 0:
|
||||
return func() KmerFilter { return func(uint64) bool { return true } }
|
||||
case 1:
|
||||
return factories[0]
|
||||
default:
|
||||
return func() KmerFilter {
|
||||
filters := make([]KmerFilter, len(factories))
|
||||
for i, f := range factories {
|
||||
filters[i] = f()
|
||||
}
|
||||
return func(kmer uint64) bool {
|
||||
for _, f := range filters {
|
||||
if !f(kmer) {
|
||||
return false
|
||||
}
|
||||
}
|
||||
return true
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// runFilter implements the "obik filter" subcommand.
|
||||
// It reads an existing kmer index, applies a chain of filters,
|
||||
// and writes a new filtered index.
|
||||
func runFilter(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
if len(args) < 1 {
|
||||
return fmt.Errorf("usage: obik filter [options] <source_index> --out <dest_index>")
|
||||
}
|
||||
|
||||
srcDir := args[0]
|
||||
destDir := CLIOutputDirectory()
|
||||
if destDir == "" || destDir == "-" {
|
||||
return fmt.Errorf("--out option is required and must specify a destination directory")
|
||||
}
|
||||
|
||||
// Open source index
|
||||
src, err := obikmer.OpenKmerSetGroup(srcDir)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open source index: %w", err)
|
||||
}
|
||||
|
||||
k := src.K()
|
||||
|
||||
// Build filter factory chain from CLI options.
|
||||
// Factories are used so each goroutine creates its own filter instance,
|
||||
// since some filters (e.g. KmerEntropyFilter) have mutable state.
|
||||
var factories []KmerFilterFactory
|
||||
var filterDescriptions []string
|
||||
|
||||
// Entropy filter
|
||||
entropyThreshold := CLIIndexEntropyThreshold()
|
||||
entropySize := CLIIndexEntropySize()
|
||||
if entropyThreshold > 0 {
|
||||
factories = append(factories, func() KmerFilter {
|
||||
ef := obikmer.NewKmerEntropyFilter(k, entropySize, entropyThreshold)
|
||||
return ef.Accept
|
||||
})
|
||||
filterDescriptions = append(filterDescriptions,
|
||||
fmt.Sprintf("entropy(threshold=%.4f, level-max=%d)", entropyThreshold, entropySize))
|
||||
}
|
||||
|
||||
// Future filters will be added here, e.g.:
|
||||
// quorumFilter, frequencyFilter, ...
|
||||
|
||||
if len(factories) == 0 {
|
||||
return fmt.Errorf("no filter specified; use --entropy-filter or other filter options")
|
||||
}
|
||||
|
||||
filterFactory := chainFilterFactories(factories)
|
||||
|
||||
// Resolve set selection (default: all sets)
|
||||
patterns := CLISetPatterns()
|
||||
var setIndices []int
|
||||
if len(patterns) > 0 {
|
||||
setIndices, err = src.MatchSetIDs(patterns)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to match set patterns: %w", err)
|
||||
}
|
||||
if len(setIndices) == 0 {
|
||||
return fmt.Errorf("no sets match the given patterns")
|
||||
}
|
||||
} else {
|
||||
setIndices = make([]int, src.Size())
|
||||
for i := range setIndices {
|
||||
setIndices[i] = i
|
||||
}
|
||||
}
|
||||
|
||||
log.Infof("Filtering %d set(s) from %s with: %s",
|
||||
len(setIndices), srcDir, strings.Join(filterDescriptions, " + "))
|
||||
|
||||
// Create destination directory
|
||||
if err := os.MkdirAll(destDir, 0755); err != nil {
|
||||
return fmt.Errorf("failed to create destination: %w", err)
|
||||
}
|
||||
|
||||
P := src.Partitions()
|
||||
|
||||
// Progress bar for partition filtering
|
||||
totalPartitions := len(setIndices) * P
|
||||
var bar *progressbar.ProgressBar
|
||||
if obidefault.ProgressBar() {
|
||||
pbopt := []progressbar.Option{
|
||||
progressbar.OptionSetWriter(os.Stderr),
|
||||
progressbar.OptionSetWidth(15),
|
||||
progressbar.OptionShowCount(),
|
||||
progressbar.OptionShowIts(),
|
||||
progressbar.OptionSetPredictTime(true),
|
||||
progressbar.OptionSetDescription("[Filtering partitions]"),
|
||||
}
|
||||
bar = progressbar.NewOptions(totalPartitions, pbopt...)
|
||||
}
|
||||
|
||||
// Process each selected set
|
||||
newCounts := make([]uint64, len(setIndices))
|
||||
|
||||
for si, srcIdx := range setIndices {
|
||||
setID := src.SetIDOf(srcIdx)
|
||||
if setID == "" {
|
||||
setID = fmt.Sprintf("set_%d", srcIdx)
|
||||
}
|
||||
|
||||
destSetDir := filepath.Join(destDir, fmt.Sprintf("set_%d", si))
|
||||
if err := os.MkdirAll(destSetDir, 0755); err != nil {
|
||||
return fmt.Errorf("failed to create set directory: %w", err)
|
||||
}
|
||||
|
||||
// Process partitions in parallel
|
||||
nWorkers := obidefault.ParallelWorkers()
|
||||
if nWorkers > P {
|
||||
nWorkers = P
|
||||
}
|
||||
|
||||
var totalKept atomic.Uint64
|
||||
var totalProcessed atomic.Uint64
|
||||
|
||||
type job struct {
|
||||
partIdx int
|
||||
}
|
||||
|
||||
jobs := make(chan job, P)
|
||||
var wg sync.WaitGroup
|
||||
var errMu sync.Mutex
|
||||
var firstErr error
|
||||
|
||||
for w := 0; w < nWorkers; w++ {
|
||||
wg.Add(1)
|
||||
go func() {
|
||||
defer wg.Done()
|
||||
// Each goroutine gets its own filter instance
|
||||
workerFilter := filterFactory()
|
||||
for j := range jobs {
|
||||
kept, processed, err := filterPartition(
|
||||
src.PartitionPath(srcIdx, j.partIdx),
|
||||
filepath.Join(destSetDir, fmt.Sprintf("part_%04d.kdi", j.partIdx)),
|
||||
workerFilter,
|
||||
)
|
||||
if err != nil {
|
||||
errMu.Lock()
|
||||
if firstErr == nil {
|
||||
firstErr = err
|
||||
}
|
||||
errMu.Unlock()
|
||||
return
|
||||
}
|
||||
totalKept.Add(kept)
|
||||
totalProcessed.Add(processed)
|
||||
if bar != nil {
|
||||
bar.Add(1)
|
||||
}
|
||||
}
|
||||
}()
|
||||
}
|
||||
|
||||
for p := 0; p < P; p++ {
|
||||
jobs <- job{p}
|
||||
}
|
||||
close(jobs)
|
||||
wg.Wait()
|
||||
|
||||
if firstErr != nil {
|
||||
return fmt.Errorf("failed to filter set %q: %w", setID, firstErr)
|
||||
}
|
||||
|
||||
kept := totalKept.Load()
|
||||
processed := totalProcessed.Load()
|
||||
newCounts[si] = kept
|
||||
log.Infof("Set %q: %d/%d k-mers kept (%.1f%% removed)",
|
||||
setID, kept, processed,
|
||||
100.0*float64(processed-kept)/float64(max(processed, 1)))
|
||||
|
||||
// Copy spectrum.bin if it exists
|
||||
srcSpecPath := src.SpectrumPath(srcIdx)
|
||||
if _, err := os.Stat(srcSpecPath); err == nil {
|
||||
destSpecPath := filepath.Join(destSetDir, "spectrum.bin")
|
||||
if err := copyFileHelper(srcSpecPath, destSpecPath); err != nil {
|
||||
log.Warnf("Could not copy spectrum for set %q: %v", setID, err)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
if bar != nil {
|
||||
fmt.Fprintln(os.Stderr)
|
||||
}
|
||||
|
||||
// Build destination metadata
|
||||
setsIDs := make([]string, len(setIndices))
|
||||
setsMetadata := make([]map[string]interface{}, len(setIndices))
|
||||
for i, srcIdx := range setIndices {
|
||||
setsIDs[i] = src.SetIDOf(srcIdx)
|
||||
setsMetadata[i] = src.AllSetMetadata(srcIdx)
|
||||
if setsMetadata[i] == nil {
|
||||
setsMetadata[i] = make(map[string]interface{})
|
||||
}
|
||||
}
|
||||
|
||||
// Write metadata for the filtered index
|
||||
dest, err := obikmer.NewFilteredKmerSetGroup(
|
||||
destDir, k, src.M(), P,
|
||||
len(setIndices), setsIDs, newCounts, setsMetadata,
|
||||
)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to create filtered metadata: %w", err)
|
||||
}
|
||||
|
||||
// Copy group-level metadata and record applied filters
|
||||
for key, value := range src.Metadata {
|
||||
dest.SetAttribute(key, value)
|
||||
}
|
||||
if entropyThreshold > 0 {
|
||||
dest.SetAttribute("entropy_filter", entropyThreshold)
|
||||
dest.SetAttribute("entropy_filter_size", entropySize)
|
||||
}
|
||||
dest.SetAttribute("filtered_from", srcDir)
|
||||
|
||||
if err := dest.SaveMetadata(); err != nil {
|
||||
return fmt.Errorf("failed to save metadata: %w", err)
|
||||
}
|
||||
|
||||
log.Info("Done.")
|
||||
return nil
|
||||
}
|
||||
|
||||
// filterPartition reads a single .kdi partition, applies the filter predicate,
|
||||
// and writes the accepted k-mers to a new .kdi file.
|
||||
// Returns (kept, processed, error).
|
||||
func filterPartition(srcPath, destPath string, accept KmerFilter) (uint64, uint64, error) {
|
||||
reader, err := obikmer.NewKdiReader(srcPath)
|
||||
if err != nil {
|
||||
// Empty partition — write empty KDI
|
||||
w, err2 := obikmer.NewKdiWriter(destPath)
|
||||
if err2 != nil {
|
||||
return 0, 0, err2
|
||||
}
|
||||
return 0, 0, w.Close()
|
||||
}
|
||||
defer reader.Close()
|
||||
|
||||
w, err := obikmer.NewKdiWriter(destPath)
|
||||
if err != nil {
|
||||
return 0, 0, err
|
||||
}
|
||||
|
||||
var kept, processed uint64
|
||||
for {
|
||||
kmer, ok := reader.Next()
|
||||
if !ok {
|
||||
break
|
||||
}
|
||||
processed++
|
||||
if accept(kmer) {
|
||||
if err := w.Write(kmer); err != nil {
|
||||
w.Close()
|
||||
return 0, 0, err
|
||||
}
|
||||
kept++
|
||||
}
|
||||
}
|
||||
|
||||
return kept, processed, w.Close()
|
||||
}
|
||||
|
||||
// copyFileHelper copies a file (used for spectrum.bin etc.)
|
||||
func copyFileHelper(src, dst string) error {
|
||||
in, err := os.Open(src)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
defer in.Close()
|
||||
|
||||
out, err := os.Create(dst)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
defer out.Close()
|
||||
|
||||
buf := make([]byte, 32*1024)
|
||||
for {
|
||||
n, readErr := in.Read(buf)
|
||||
if n > 0 {
|
||||
if _, writeErr := out.Write(buf[:n]); writeErr != nil {
|
||||
return writeErr
|
||||
}
|
||||
}
|
||||
if readErr != nil {
|
||||
break
|
||||
}
|
||||
}
|
||||
return out.Close()
|
||||
}
|
||||
154
pkg/obitools/obik/index.go
Normal file
154
pkg/obitools/obik/index.go
Normal file
@@ -0,0 +1,154 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
"os"
|
||||
"path/filepath"
|
||||
"sync"
|
||||
"sync/atomic"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
func runIndex(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
outDir := CLIOutputDirectory()
|
||||
if outDir == "" || outDir == "-" {
|
||||
return fmt.Errorf("--out option is required and must specify a directory path")
|
||||
}
|
||||
|
||||
k := CLIKmerSize()
|
||||
if k < 2 || k > 31 {
|
||||
return fmt.Errorf("invalid k-mer size: %d (must be between 2 and 31)", k)
|
||||
}
|
||||
|
||||
m := CLIMinimizerSize()
|
||||
|
||||
minOcc := CLIMinOccurrence()
|
||||
if minOcc < 1 {
|
||||
return fmt.Errorf("invalid min-occurrence: %d (must be >= 1)", minOcc)
|
||||
}
|
||||
|
||||
maxOcc := CLIMaxOccurrence()
|
||||
|
||||
entropyThreshold := CLIIndexEntropyThreshold()
|
||||
entropySize := CLIIndexEntropySize()
|
||||
|
||||
// Build options
|
||||
var opts []obikmer.BuilderOption
|
||||
if minOcc > 1 {
|
||||
opts = append(opts, obikmer.WithMinFrequency(minOcc))
|
||||
}
|
||||
if maxOcc > 0 {
|
||||
opts = append(opts, obikmer.WithMaxFrequency(maxOcc))
|
||||
}
|
||||
if topN := CLISaveFreqKmer(); topN > 0 {
|
||||
opts = append(opts, obikmer.WithSaveFreqKmers(topN))
|
||||
}
|
||||
if entropyThreshold > 0 {
|
||||
opts = append(opts, obikmer.WithEntropyFilter(entropyThreshold, entropySize))
|
||||
}
|
||||
|
||||
// Determine whether to append to existing group or create new
|
||||
var builder *obikmer.KmerSetGroupBuilder
|
||||
var err error
|
||||
metaPath := filepath.Join(outDir, "metadata.toml")
|
||||
if _, statErr := os.Stat(metaPath); statErr == nil {
|
||||
// Existing group: append
|
||||
log.Infof("Appending to existing kmer index at %s", outDir)
|
||||
builder, err = obikmer.AppendKmerSetGroupBuilder(outDir, 1, opts...)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open existing kmer index for appending: %w", err)
|
||||
}
|
||||
} else {
|
||||
// New group
|
||||
if maxOcc > 0 {
|
||||
log.Infof("Creating new kmer index: k=%d, m=%d, occurrence=[%d,%d]", k, m, minOcc, maxOcc)
|
||||
} else {
|
||||
log.Infof("Creating new kmer index: k=%d, m=%d, min-occurrence=%d", k, m, minOcc)
|
||||
}
|
||||
builder, err = obikmer.NewKmerSetGroupBuilder(outDir, k, m, 1, -1, opts...)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to create kmer index builder: %w", err)
|
||||
}
|
||||
}
|
||||
|
||||
// Read and process sequences in parallel
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open sequence files: %w", err)
|
||||
}
|
||||
|
||||
nworkers := obidefault.ParallelWorkers()
|
||||
var seqCount atomic.Int64
|
||||
var wg sync.WaitGroup
|
||||
|
||||
consumer := func(iter obiiter.IBioSequence) {
|
||||
defer wg.Done()
|
||||
for iter.Next() {
|
||||
batch := iter.Get()
|
||||
for _, seq := range batch.Slice() {
|
||||
builder.AddSequence(0, seq)
|
||||
seqCount.Add(1)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
for i := 1; i < nworkers; i++ {
|
||||
wg.Add(1)
|
||||
go consumer(sequences.Split())
|
||||
}
|
||||
wg.Add(1)
|
||||
go consumer(sequences)
|
||||
wg.Wait()
|
||||
|
||||
log.Infof("Processed %d sequences", seqCount.Load())
|
||||
|
||||
// Finalize
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to finalize kmer index: %w", err)
|
||||
}
|
||||
|
||||
// Apply index-id to the new set
|
||||
newSetIdx := builder.StartIndex()
|
||||
if id := CLIIndexId(); id != "" {
|
||||
ksg.SetSetID(newSetIdx, id)
|
||||
}
|
||||
|
||||
// Apply group-level tags (-S)
|
||||
for key, value := range CLISetTag() {
|
||||
ksg.SetAttribute(key, value)
|
||||
}
|
||||
|
||||
// Apply per-set tags (-T) to the new set
|
||||
for key, value := range _setMetaTags {
|
||||
ksg.SetSetMetadata(newSetIdx, key, value)
|
||||
}
|
||||
|
||||
if minOcc > 1 {
|
||||
ksg.SetAttribute("min_occurrence", minOcc)
|
||||
}
|
||||
if maxOcc > 0 {
|
||||
ksg.SetAttribute("max_occurrence", maxOcc)
|
||||
}
|
||||
|
||||
if entropyThreshold > 0 {
|
||||
ksg.SetAttribute("entropy_filter", entropyThreshold)
|
||||
ksg.SetAttribute("entropy_filter_size", entropySize)
|
||||
}
|
||||
|
||||
if err := ksg.SaveMetadata(); err != nil {
|
||||
return fmt.Errorf("failed to save metadata: %w", err)
|
||||
}
|
||||
|
||||
log.Infof("Index contains %d k-mers for set %d in %s", ksg.Len(newSetIdx), newSetIdx, outDir)
|
||||
log.Info("Done.")
|
||||
return nil
|
||||
}
|
||||
419
pkg/obitools/obik/lowmask.go
Normal file
419
pkg/obitools/obik/lowmask.go
Normal file
@@ -0,0 +1,419 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
"math"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// lowMaskWorker creates a worker to mask low-complexity regions in DNA sequences.
|
||||
func lowMaskWorker(kmer_size int, level_max int, threshold float64, mode MaskingMode, maskChar byte, keepShorter bool) obiseq.SeqWorker {
|
||||
|
||||
nLogN := make([]float64, kmer_size+1)
|
||||
for i := 1; i <= kmer_size; i++ {
|
||||
nLogN[i] = float64(i) * math.Log(float64(i))
|
||||
}
|
||||
|
||||
normTables := make([][]int, level_max+1)
|
||||
for ws := 1; ws <= level_max; ws++ {
|
||||
size := 1 << (ws * 2)
|
||||
normTables[ws] = make([]int, size)
|
||||
for code := 0; code < size; code++ {
|
||||
normTables[ws][code] = int(obikmer.NormalizeCircular(uint64(code), ws))
|
||||
}
|
||||
}
|
||||
|
||||
type pair struct {
|
||||
index int
|
||||
value float64
|
||||
}
|
||||
|
||||
slidingMin := func(data []float64, window int) {
|
||||
if len(data) == 0 || window <= 0 {
|
||||
return
|
||||
}
|
||||
if window >= len(data) {
|
||||
minVal := data[0]
|
||||
for i := 1; i < len(data); i++ {
|
||||
if data[i] < minVal {
|
||||
minVal = data[i]
|
||||
}
|
||||
}
|
||||
for i := range data {
|
||||
data[i] = minVal
|
||||
}
|
||||
return
|
||||
}
|
||||
|
||||
deque := make([]pair, 0, window)
|
||||
|
||||
for i, v := range data {
|
||||
for len(deque) > 0 && deque[0].index <= i-window {
|
||||
deque = deque[1:]
|
||||
}
|
||||
|
||||
for len(deque) > 0 && deque[len(deque)-1].value >= v {
|
||||
deque = deque[:len(deque)-1]
|
||||
}
|
||||
|
||||
deque = append(deque, pair{index: i, value: v})
|
||||
|
||||
data[i] = deque[0].value
|
||||
}
|
||||
}
|
||||
|
||||
emaxValues := make([]float64, level_max+1)
|
||||
logNwords := make([]float64, level_max+1)
|
||||
for ws := 1; ws <= level_max; ws++ {
|
||||
nw := kmer_size - ws + 1
|
||||
na := obikmer.CanonicalCircularKmerCount(ws)
|
||||
if nw < na {
|
||||
logNwords[ws] = math.Log(float64(nw))
|
||||
emaxValues[ws] = math.Log(float64(nw))
|
||||
} else {
|
||||
cov := nw / na
|
||||
remains := nw - (na * cov)
|
||||
f1 := float64(cov) / float64(nw)
|
||||
f2 := float64(cov+1) / float64(nw)
|
||||
logNwords[ws] = math.Log(float64(nw))
|
||||
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
|
||||
float64(remains)*f2*math.Log(f2))
|
||||
}
|
||||
}
|
||||
|
||||
maskAmbiguities := func(sequence []byte) []int {
|
||||
maskPositions := make([]int, len(sequence))
|
||||
for i, nuc := range sequence {
|
||||
if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' {
|
||||
end := max(0, i-kmer_size+1)
|
||||
for j := i; j >= end; j-- {
|
||||
maskPositions[j] = -1
|
||||
}
|
||||
}
|
||||
}
|
||||
return maskPositions
|
||||
}
|
||||
|
||||
cleanTable := func(table []int, over int) {
|
||||
for i := 0; i < over; i++ {
|
||||
table[i] = 0
|
||||
}
|
||||
}
|
||||
|
||||
computeEntropies := func(sequence []byte,
|
||||
maskPositions []int,
|
||||
entropies []float64,
|
||||
table []int,
|
||||
words []int,
|
||||
wordSize int,
|
||||
normTable []int) {
|
||||
|
||||
lseq := len(sequence)
|
||||
tableSize := 1 << (wordSize * 2)
|
||||
nwords := kmer_size - wordSize + 1
|
||||
float_nwords := float64(nwords)
|
||||
log_nwords := logNwords[wordSize]
|
||||
entropyMax := emaxValues[wordSize]
|
||||
|
||||
cleanTable(table, tableSize)
|
||||
|
||||
for i := 1; i < lseq; i++ {
|
||||
entropies[i] = 6
|
||||
}
|
||||
end := lseq - wordSize + 1
|
||||
|
||||
mask := (1 << (wordSize * 2)) - 1
|
||||
|
||||
word_index := 0
|
||||
for i := 0; i < wordSize-1; i++ {
|
||||
word_index = (word_index << 2) + int(obikmer.EncodeNucleotide(sequence[i]))
|
||||
}
|
||||
|
||||
for i, j := 0, wordSize-1; i < end; i, j = i+1, j+1 {
|
||||
word_index = ((word_index << 2) & mask) + int(obikmer.EncodeNucleotide(sequence[j]))
|
||||
words[i] = normTable[word_index]
|
||||
}
|
||||
|
||||
s := 0
|
||||
sum_n_logn := 0.0
|
||||
entropy := 1.0
|
||||
cleaned := true
|
||||
|
||||
for i := range end {
|
||||
s++
|
||||
|
||||
switch {
|
||||
case s < nwords:
|
||||
cleaned = false
|
||||
table[words[i]]++
|
||||
|
||||
case i >= (nwords-1) && maskPositions[i-nwords+1] < 0:
|
||||
entropies[i-nwords+1] = 4.0
|
||||
if !cleaned {
|
||||
cleanTable(table, tableSize)
|
||||
}
|
||||
cleaned = true
|
||||
s = 0
|
||||
sum_n_logn = 0.0
|
||||
|
||||
case s == nwords:
|
||||
cleaned = false
|
||||
table[words[i]]++
|
||||
|
||||
sum_n_logn = 0
|
||||
for j := range tableSize {
|
||||
n := float64(table[j])
|
||||
if n > 0 {
|
||||
sum_n_logn += nLogN[int(n)]
|
||||
}
|
||||
}
|
||||
entropy = (log_nwords - sum_n_logn/float_nwords) / entropyMax
|
||||
|
||||
case s > nwords:
|
||||
cleaned = false
|
||||
|
||||
new_word := words[i]
|
||||
old_word := words[i-nwords]
|
||||
|
||||
if old_word != new_word {
|
||||
table[new_word]++
|
||||
table[old_word]--
|
||||
|
||||
n_old := float64(table[old_word])
|
||||
n_new := float64(table[new_word])
|
||||
|
||||
sum_n_logn -= nLogN[int(n_old+1)]
|
||||
if n_old > 0 {
|
||||
sum_n_logn += nLogN[int(n_old)]
|
||||
}
|
||||
if n_new > 0 {
|
||||
sum_n_logn += nLogN[int(n_new)]
|
||||
}
|
||||
if n_new > 1 {
|
||||
sum_n_logn -= nLogN[int(n_new-1)]
|
||||
}
|
||||
}
|
||||
|
||||
entropy = (log_nwords - sum_n_logn/float_nwords) / entropyMax
|
||||
}
|
||||
|
||||
if s >= nwords && maskPositions[i-nwords+1] >= 0 {
|
||||
if entropy < 0 {
|
||||
entropy = 0
|
||||
}
|
||||
entropy = math.Round(entropy*10000) / 10000
|
||||
entropies[i-nwords+1] = entropy
|
||||
}
|
||||
}
|
||||
|
||||
slidingMin(entropies, kmer_size)
|
||||
}
|
||||
|
||||
applyMaskMode := func(sequence *obiseq.BioSequence, maskPositions []bool, mask byte) (obiseq.BioSequenceSlice, error) {
|
||||
seqCopy := sequence.Copy()
|
||||
sequenceBytes := seqCopy.Sequence()
|
||||
|
||||
for i := range sequenceBytes {
|
||||
if maskPositions[i] {
|
||||
sequenceBytes[i] = mask
|
||||
}
|
||||
}
|
||||
|
||||
return obiseq.BioSequenceSlice{seqCopy}, nil
|
||||
}
|
||||
|
||||
selectMasked := func(sequence *obiseq.BioSequence, maskPosition []bool) (obiseq.BioSequenceSlice, error) {
|
||||
rep := obiseq.NewBioSequenceSlice()
|
||||
|
||||
inlow := false
|
||||
fromlow := -1
|
||||
for i, masked := range maskPosition {
|
||||
if masked && !inlow {
|
||||
fromlow = i
|
||||
inlow = true
|
||||
}
|
||||
if inlow && !masked {
|
||||
if fromlow >= 0 {
|
||||
frgLen := i - fromlow
|
||||
if keepShorter || frgLen >= kmer_size {
|
||||
frg, err := sequence.Subsequence(fromlow, i, false)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
rep.Push(frg)
|
||||
}
|
||||
}
|
||||
inlow = false
|
||||
fromlow = -1
|
||||
}
|
||||
}
|
||||
|
||||
if inlow && fromlow >= 0 {
|
||||
frgLen := len(maskPosition) - fromlow
|
||||
if keepShorter || frgLen >= kmer_size {
|
||||
frg, err := sequence.Subsequence(fromlow, len(maskPosition), false)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
rep.Push(frg)
|
||||
}
|
||||
}
|
||||
|
||||
return *rep, nil
|
||||
}
|
||||
|
||||
selectunmasked := func(sequence *obiseq.BioSequence, maskPosition []bool) (obiseq.BioSequenceSlice, error) {
|
||||
rep := obiseq.NewBioSequenceSlice()
|
||||
|
||||
inhigh := false
|
||||
fromhigh := -1
|
||||
for i, masked := range maskPosition {
|
||||
if !masked && !inhigh {
|
||||
fromhigh = i
|
||||
inhigh = true
|
||||
}
|
||||
if inhigh && masked {
|
||||
if fromhigh >= 0 {
|
||||
frgLen := i - fromhigh
|
||||
if keepShorter || frgLen >= kmer_size {
|
||||
frg, err := sequence.Subsequence(fromhigh, i, false)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
rep.Push(frg)
|
||||
}
|
||||
}
|
||||
inhigh = false
|
||||
fromhigh = -1
|
||||
}
|
||||
}
|
||||
|
||||
if inhigh && fromhigh >= 0 {
|
||||
frgLen := len(maskPosition) - fromhigh
|
||||
if keepShorter || frgLen >= kmer_size {
|
||||
frg, err := sequence.Subsequence(fromhigh, len(maskPosition), false)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
rep.Push(frg)
|
||||
}
|
||||
}
|
||||
|
||||
return *rep, nil
|
||||
}
|
||||
|
||||
masking := func(sequence *obiseq.BioSequence) (obiseq.BioSequenceSlice, error) {
|
||||
if sequence.Len() < kmer_size {
|
||||
sequence.SetAttribute("obilowmask_error", "Sequence too short")
|
||||
remove := make([]bool, sequence.Len())
|
||||
for i := range remove {
|
||||
remove[i] = true
|
||||
}
|
||||
switch mode {
|
||||
case MaskMode:
|
||||
return applyMaskMode(sequence, remove, maskChar)
|
||||
case SplitMode:
|
||||
return selectunmasked(sequence, remove)
|
||||
case ExtractMode:
|
||||
return selectMasked(sequence, remove)
|
||||
}
|
||||
return nil, fmt.Errorf("unknown mode %d", mode)
|
||||
}
|
||||
|
||||
bseq := sequence.Sequence()
|
||||
|
||||
maskPositions := maskAmbiguities(bseq)
|
||||
|
||||
maskFlags := make([]int, len(bseq))
|
||||
entropies := make([]float64, len(bseq))
|
||||
for i := range entropies {
|
||||
entropies[i] = 4.0
|
||||
}
|
||||
|
||||
freqs := make([]int, 1<<(2*level_max))
|
||||
words := make([]int, len(bseq))
|
||||
entropies2 := make([]float64, len(bseq))
|
||||
|
||||
computeEntropies(bseq, maskPositions, entropies, freqs, words, level_max, normTables[level_max])
|
||||
|
||||
for i := range bseq {
|
||||
v := level_max
|
||||
maskFlags[i] = v
|
||||
}
|
||||
|
||||
for ws := level_max - 1; ws > 0; ws-- {
|
||||
computeEntropies(bseq, maskPositions, entropies2, freqs, words, ws, normTables[ws])
|
||||
for i, e2 := range entropies2 {
|
||||
if e2 < entropies[i] {
|
||||
entropies[i] = e2
|
||||
maskFlags[i] = ws
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
for i, nuc := range bseq {
|
||||
if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' {
|
||||
entropies[i] = 0
|
||||
}
|
||||
}
|
||||
|
||||
remove := make([]bool, len(entropies))
|
||||
for i, e := range entropies {
|
||||
remove[i] = e <= threshold
|
||||
}
|
||||
|
||||
sequence.SetAttribute("mask", maskFlags)
|
||||
sequence.SetAttribute("Entropies", entropies)
|
||||
|
||||
switch mode {
|
||||
case MaskMode:
|
||||
return applyMaskMode(sequence, remove, maskChar)
|
||||
case SplitMode:
|
||||
return selectunmasked(sequence, remove)
|
||||
case ExtractMode:
|
||||
return selectMasked(sequence, remove)
|
||||
}
|
||||
return nil, fmt.Errorf("unknown mode %d", mode)
|
||||
}
|
||||
|
||||
return masking
|
||||
}
|
||||
|
||||
// runLowmask implements the "obik lowmask" subcommand.
|
||||
// It masks low-complexity regions in DNA sequences using entropy-based detection.
|
||||
func runLowmask(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
kmerSize := CLIKmerSize()
|
||||
levelMax := CLIEntropySize()
|
||||
threshold := CLIEntropyThreshold()
|
||||
mode := CLIMaskingMode()
|
||||
maskChar := CLIMaskingChar()
|
||||
|
||||
log.Printf("Low-complexity masking: kmer-size=%d, entropy-size=%d, threshold=%.4f", kmerSize, levelMax, threshold)
|
||||
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open sequence files: %w", err)
|
||||
}
|
||||
|
||||
worker := lowMaskWorker(kmerSize, levelMax, threshold, mode, maskChar, CLIKeepShorter())
|
||||
|
||||
masked := sequences.MakeIWorker(
|
||||
worker,
|
||||
false,
|
||||
obidefault.ParallelWorkers(),
|
||||
).FilterEmpty()
|
||||
|
||||
obiconvert.CLIWriteBioSequences(masked, true)
|
||||
obiutils.WaitForLastPipe()
|
||||
|
||||
return nil
|
||||
}
|
||||
96
pkg/obitools/obik/ls.go
Normal file
96
pkg/obitools/obik/ls.go
Normal file
@@ -0,0 +1,96 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"encoding/json"
|
||||
"fmt"
|
||||
"strings"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
"gopkg.in/yaml.v3"
|
||||
)
|
||||
|
||||
type setEntry struct {
|
||||
Index int `json:"index" yaml:"index"`
|
||||
ID string `json:"id" yaml:"id"`
|
||||
Count uint64 `json:"count" yaml:"count"`
|
||||
}
|
||||
|
||||
func runLs(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
if len(args) < 1 {
|
||||
return fmt.Errorf("usage: obik ls [options] <index_directory>")
|
||||
}
|
||||
|
||||
ksg, err := obikmer.OpenKmerSetGroup(args[0])
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||
}
|
||||
|
||||
// Determine which sets to show
|
||||
patterns := CLISetPatterns()
|
||||
var indices []int
|
||||
if len(patterns) > 0 {
|
||||
indices, err = ksg.MatchSetIDs(patterns)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
} else {
|
||||
indices = make([]int, ksg.Size())
|
||||
for i := range indices {
|
||||
indices[i] = i
|
||||
}
|
||||
}
|
||||
|
||||
entries := make([]setEntry, len(indices))
|
||||
for i, idx := range indices {
|
||||
entries[i] = setEntry{
|
||||
Index: idx,
|
||||
ID: ksg.SetIDOf(idx),
|
||||
Count: ksg.Len(idx),
|
||||
}
|
||||
}
|
||||
|
||||
format := CLIOutFormat()
|
||||
switch format {
|
||||
case "json":
|
||||
return outputLsJSON(entries)
|
||||
case "yaml":
|
||||
return outputLsYAML(entries)
|
||||
case "csv":
|
||||
return outputLsCSV(entries)
|
||||
default:
|
||||
return outputLsCSV(entries)
|
||||
}
|
||||
}
|
||||
|
||||
func outputLsCSV(entries []setEntry) error {
|
||||
fmt.Println("index,id,count")
|
||||
for _, e := range entries {
|
||||
// Escape commas in ID if needed
|
||||
id := e.ID
|
||||
if strings.ContainsAny(id, ",\"") {
|
||||
id = "\"" + strings.ReplaceAll(id, "\"", "\"\"") + "\""
|
||||
}
|
||||
fmt.Printf("%d,%s,%d\n", e.Index, id, e.Count)
|
||||
}
|
||||
return nil
|
||||
}
|
||||
|
||||
func outputLsJSON(entries []setEntry) error {
|
||||
data, err := json.MarshalIndent(entries, "", " ")
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
fmt.Println(string(data))
|
||||
return nil
|
||||
}
|
||||
|
||||
func outputLsYAML(entries []setEntry) error {
|
||||
data, err := yaml.Marshal(entries)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
fmt.Print(string(data))
|
||||
return nil
|
||||
}
|
||||
221
pkg/obitools/obik/match.go
Normal file
221
pkg/obitools/obik/match.go
Normal file
@@ -0,0 +1,221 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
"sync"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// defaultMatchQueryThreshold is the minimum number of k-mer entries to
|
||||
// accumulate before launching a MatchBatch. Larger values amortize the
|
||||
// cost of opening .kdi files across more query k-mers.
|
||||
const defaultMatchQueryThreshold = 10_000_000
|
||||
|
||||
// preparedBatch pairs a batch with its pre-computed queries.
|
||||
type preparedBatch struct {
|
||||
batch obiiter.BioSequenceBatch
|
||||
seqs []*obiseq.BioSequence
|
||||
queries *obikmer.PreparedQueries
|
||||
}
|
||||
|
||||
// accumulatedWork holds multiple prepared batches whose queries have been
|
||||
// merged into a single PreparedQueries. The flat seqs slice allows
|
||||
// MatchBatch results (indexed by merged SeqIdx) to be mapped back to
|
||||
// the original sequences.
|
||||
type accumulatedWork struct {
|
||||
batches []obiiter.BioSequenceBatch // original batches in order
|
||||
seqs []*obiseq.BioSequence // flat: seqs from all batches concatenated
|
||||
queries *obikmer.PreparedQueries // merged queries with rebased SeqIdx
|
||||
}
|
||||
|
||||
// runMatch implements the "obik match" subcommand.
|
||||
//
|
||||
// Pipeline architecture (no shared mutable state between stages):
|
||||
//
|
||||
// [input batches]
|
||||
// │ Split across nCPU goroutines
|
||||
// ▼
|
||||
// PrepareQueries (CPU, parallel)
|
||||
// │ preparedCh
|
||||
// ▼
|
||||
// Accumulate & MergeQueries (1 goroutine)
|
||||
// │ matchCh — fires when totalKmers >= threshold
|
||||
// ▼
|
||||
// MatchBatch + annotate (1 goroutine, internal parallelism per partition)
|
||||
// │
|
||||
// ▼
|
||||
// [output batches]
|
||||
func runMatch(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
indexDir := CLIIndexDirectory()
|
||||
|
||||
// Open the k-mer index
|
||||
ksg, err := obikmer.OpenKmerSetGroup(indexDir)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||
}
|
||||
|
||||
log.Infof("Opened index: k=%d, m=%d, %d partitions, %d set(s)",
|
||||
ksg.K(), ksg.M(), ksg.Partitions(), ksg.Size())
|
||||
|
||||
// Resolve which sets to match against
|
||||
patterns := CLISetPatterns()
|
||||
var setIndices []int
|
||||
if len(patterns) > 0 {
|
||||
setIndices, err = ksg.MatchSetIDs(patterns)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to match set patterns: %w", err)
|
||||
}
|
||||
if len(setIndices) == 0 {
|
||||
return fmt.Errorf("no sets match the given patterns")
|
||||
}
|
||||
} else {
|
||||
setIndices = make([]int, ksg.Size())
|
||||
for i := range setIndices {
|
||||
setIndices[i] = i
|
||||
}
|
||||
}
|
||||
|
||||
for _, idx := range setIndices {
|
||||
id := ksg.SetIDOf(idx)
|
||||
if id == "" {
|
||||
id = fmt.Sprintf("set_%d", idx)
|
||||
}
|
||||
log.Infof("Matching against set %d (%s): %d k-mers", idx, id, ksg.Len(idx))
|
||||
}
|
||||
|
||||
// Read input sequences
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open sequence files: %w", err)
|
||||
}
|
||||
|
||||
nworkers := obidefault.ParallelWorkers()
|
||||
|
||||
// --- Stage 1: Prepare queries in parallel ---
|
||||
preparedCh := make(chan preparedBatch, nworkers)
|
||||
|
||||
var prepWg sync.WaitGroup
|
||||
preparer := func(iter obiiter.IBioSequence) {
|
||||
defer prepWg.Done()
|
||||
for iter.Next() {
|
||||
batch := iter.Get()
|
||||
slice := batch.Slice()
|
||||
|
||||
seqs := make([]*obiseq.BioSequence, len(slice))
|
||||
for i, s := range slice {
|
||||
seqs[i] = s
|
||||
}
|
||||
|
||||
pq := ksg.PrepareQueries(seqs)
|
||||
|
||||
preparedCh <- preparedBatch{
|
||||
batch: batch,
|
||||
seqs: seqs,
|
||||
queries: pq,
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
for i := 1; i < nworkers; i++ {
|
||||
prepWg.Add(1)
|
||||
go preparer(sequences.Split())
|
||||
}
|
||||
prepWg.Add(1)
|
||||
go preparer(sequences)
|
||||
|
||||
go func() {
|
||||
prepWg.Wait()
|
||||
close(preparedCh)
|
||||
}()
|
||||
|
||||
// --- Stage 2: Accumulate & merge queries ---
|
||||
matchCh := make(chan *accumulatedWork, 2)
|
||||
|
||||
go func() {
|
||||
defer close(matchCh)
|
||||
|
||||
var acc *accumulatedWork
|
||||
|
||||
for pb := range preparedCh {
|
||||
if acc == nil {
|
||||
acc = &accumulatedWork{
|
||||
batches: []obiiter.BioSequenceBatch{pb.batch},
|
||||
seqs: pb.seqs,
|
||||
queries: pb.queries,
|
||||
}
|
||||
} else {
|
||||
// Merge this batch's queries into the accumulator
|
||||
obikmer.MergeQueries(acc.queries, pb.queries)
|
||||
acc.batches = append(acc.batches, pb.batch)
|
||||
acc.seqs = append(acc.seqs, pb.seqs...)
|
||||
}
|
||||
|
||||
// Flush when we exceed the threshold
|
||||
if acc.queries.NKmers >= defaultMatchQueryThreshold {
|
||||
matchCh <- acc
|
||||
acc = nil
|
||||
}
|
||||
}
|
||||
|
||||
// Flush remaining
|
||||
if acc != nil {
|
||||
matchCh <- acc
|
||||
}
|
||||
}()
|
||||
|
||||
// --- Stage 3: Match & annotate ---
|
||||
output := obiiter.MakeIBioSequence()
|
||||
if sequences.IsPaired() {
|
||||
output.MarkAsPaired()
|
||||
}
|
||||
|
||||
output.Add(1)
|
||||
go func() {
|
||||
defer output.Done()
|
||||
|
||||
for work := range matchCh {
|
||||
// Match against each selected set
|
||||
for _, setIdx := range setIndices {
|
||||
result := ksg.MatchBatch(setIdx, work.queries)
|
||||
|
||||
setID := ksg.SetIDOf(setIdx)
|
||||
if setID == "" {
|
||||
setID = fmt.Sprintf("set_%d", setIdx)
|
||||
}
|
||||
attrName := "kmer_matched_" + setID
|
||||
|
||||
for seqIdx, positions := range result {
|
||||
if len(positions) > 0 {
|
||||
work.seqs[seqIdx].SetAttribute(attrName, positions)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// Push annotated batches to output
|
||||
for _, b := range work.batches {
|
||||
output.Push(b)
|
||||
}
|
||||
|
||||
// Help GC
|
||||
work.seqs = nil
|
||||
work.queries = nil
|
||||
}
|
||||
}()
|
||||
|
||||
go output.WaitAndClose()
|
||||
|
||||
obiconvert.CLIWriteBioSequences(output, true)
|
||||
obiutils.WaitForLastPipe()
|
||||
|
||||
return nil
|
||||
}
|
||||
63
pkg/obitools/obik/mv.go
Normal file
63
pkg/obitools/obik/mv.go
Normal file
@@ -0,0 +1,63 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
func runMv(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
if len(args) < 2 {
|
||||
return fmt.Errorf("usage: obik mv [--set PATTERN]... [--force] <source_index> <dest_index>")
|
||||
}
|
||||
|
||||
srcDir := args[0]
|
||||
destDir := args[1]
|
||||
|
||||
ksg, err := obikmer.OpenKmerSetGroup(srcDir)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open source kmer index: %w", err)
|
||||
}
|
||||
|
||||
// Resolve set patterns
|
||||
patterns := CLISetPatterns()
|
||||
var ids []string
|
||||
if len(patterns) > 0 {
|
||||
indices, err := ksg.MatchSetIDs(patterns)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
if len(indices) == 0 {
|
||||
return fmt.Errorf("no sets match the given patterns")
|
||||
}
|
||||
ids = make([]string, len(indices))
|
||||
for i, idx := range indices {
|
||||
ids[i] = ksg.SetIDOf(idx)
|
||||
}
|
||||
} else {
|
||||
// Move all sets
|
||||
ids = ksg.SetsIDs()
|
||||
}
|
||||
|
||||
log.Infof("Moving %d set(s) from %s to %s", len(ids), srcDir, destDir)
|
||||
|
||||
// Copy first
|
||||
dest, err := ksg.CopySetsByIDTo(ids, destDir, CLIForce())
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Remove from source (in reverse order to avoid renumbering issues)
|
||||
for i := len(ids) - 1; i >= 0; i-- {
|
||||
if err := ksg.RemoveSetByID(ids[i]); err != nil {
|
||||
return fmt.Errorf("failed to remove set %q from source after copy: %w", ids[i], err)
|
||||
}
|
||||
}
|
||||
|
||||
log.Infof("Destination now has %d set(s), source has %d set(s)", dest.Size(), ksg.Size())
|
||||
return nil
|
||||
}
|
||||
85
pkg/obitools/obik/obik.go
Normal file
85
pkg/obitools/obik/obik.go
Normal file
@@ -0,0 +1,85 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// OptionSet registers all obik subcommands on the root GetOpt.
|
||||
func OptionSet(opt *getoptions.GetOpt) {
|
||||
// index: build or extend a kmer index from sequence files
|
||||
indexCmd := opt.NewCommand("index", "Build a disk-based kmer index from sequence files")
|
||||
obiconvert.InputOptionSet(indexCmd)
|
||||
obiconvert.OutputModeOptionSet(indexCmd, false)
|
||||
KmerIndexOptionSet(indexCmd)
|
||||
indexCmd.StringMapVar(&_setMetaTags, "tag", 1, 1,
|
||||
indexCmd.Alias("T"),
|
||||
indexCmd.ArgName("KEY=VALUE"),
|
||||
indexCmd.Description("Per-set metadata tag (repeatable)."))
|
||||
indexCmd.SetCommandFn(runIndex)
|
||||
|
||||
// ls: list sets in a kmer index
|
||||
lsCmd := opt.NewCommand("ls", "List sets in a kmer index")
|
||||
OutputFormatOptionSet(lsCmd)
|
||||
SetSelectionOptionSet(lsCmd)
|
||||
lsCmd.SetCommandFn(runLs)
|
||||
|
||||
// summary: detailed statistics
|
||||
summaryCmd := opt.NewCommand("summary", "Show detailed statistics of a kmer index")
|
||||
OutputFormatOptionSet(summaryCmd)
|
||||
summaryCmd.BoolVar(&_jaccard, "jaccard", false,
|
||||
summaryCmd.Description("Compute and display pairwise Jaccard distance matrix."))
|
||||
summaryCmd.SetCommandFn(runSummary)
|
||||
|
||||
// cp: copy sets between indices
|
||||
cpCmd := opt.NewCommand("cp", "Copy sets between kmer indices")
|
||||
SetSelectionOptionSet(cpCmd)
|
||||
ForceOptionSet(cpCmd)
|
||||
cpCmd.SetCommandFn(runCp)
|
||||
|
||||
// mv: move sets between indices
|
||||
mvCmd := opt.NewCommand("mv", "Move sets between kmer indices")
|
||||
SetSelectionOptionSet(mvCmd)
|
||||
ForceOptionSet(mvCmd)
|
||||
mvCmd.SetCommandFn(runMv)
|
||||
|
||||
// rm: remove sets from an index
|
||||
rmCmd := opt.NewCommand("rm", "Remove sets from a kmer index")
|
||||
SetSelectionOptionSet(rmCmd)
|
||||
rmCmd.SetCommandFn(runRm)
|
||||
|
||||
// spectrum: output k-mer frequency spectrum as CSV
|
||||
spectrumCmd := opt.NewCommand("spectrum", "Output k-mer frequency spectrum as CSV")
|
||||
SetSelectionOptionSet(spectrumCmd)
|
||||
obiconvert.OutputModeOptionSet(spectrumCmd, false)
|
||||
spectrumCmd.SetCommandFn(runSpectrum)
|
||||
|
||||
// super: extract super k-mers from sequences
|
||||
superCmd := opt.NewCommand("super", "Extract super k-mers from sequence files")
|
||||
obiconvert.InputOptionSet(superCmd)
|
||||
obiconvert.OutputOptionSet(superCmd)
|
||||
SuperKmerOptionSet(superCmd)
|
||||
superCmd.SetCommandFn(runSuper)
|
||||
|
||||
// lowmask: mask low-complexity regions
|
||||
lowmaskCmd := opt.NewCommand("lowmask", "Mask low-complexity regions in sequences using entropy")
|
||||
obiconvert.InputOptionSet(lowmaskCmd)
|
||||
obiconvert.OutputOptionSet(lowmaskCmd)
|
||||
LowMaskOptionSet(lowmaskCmd)
|
||||
lowmaskCmd.SetCommandFn(runLowmask)
|
||||
|
||||
// match: annotate sequences with k-mer match positions from an index
|
||||
matchCmd := opt.NewCommand("match", "Annotate sequences with k-mer match positions from an index")
|
||||
IndexDirectoryOptionSet(matchCmd)
|
||||
obiconvert.InputOptionSet(matchCmd)
|
||||
obiconvert.OutputOptionSet(matchCmd)
|
||||
SetSelectionOptionSet(matchCmd)
|
||||
matchCmd.SetCommandFn(runMatch)
|
||||
|
||||
// filter: filter an index to remove low-complexity k-mers
|
||||
filterCmd := opt.NewCommand("filter", "Filter a kmer index to remove low-complexity k-mers")
|
||||
obiconvert.OutputModeOptionSet(filterCmd, false)
|
||||
EntropyFilterOptionSet(filterCmd)
|
||||
SetSelectionOptionSet(filterCmd)
|
||||
filterCmd.SetCommandFn(runFilter)
|
||||
}
|
||||
360
pkg/obitools/obik/options.go
Normal file
360
pkg/obitools/obik/options.go
Normal file
@@ -0,0 +1,360 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"strings"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// MaskingMode defines how to handle low-complexity regions
|
||||
type MaskingMode int
|
||||
|
||||
const (
|
||||
MaskMode MaskingMode = iota // Replace low-complexity regions with masked characters
|
||||
SplitMode // Split sequence into high-complexity fragments
|
||||
ExtractMode // Extract low-complexity fragments
|
||||
)
|
||||
|
||||
// Output format flags
|
||||
var _jsonOutput bool
|
||||
var _csvOutput bool
|
||||
var _yamlOutput bool
|
||||
|
||||
// Set selection flags
|
||||
var _setPatterns []string
|
||||
|
||||
// Force flag
|
||||
var _force bool
|
||||
|
||||
// Jaccard flag
|
||||
var _jaccard bool
|
||||
|
||||
// Per-set tags for index subcommand
|
||||
var _setMetaTags = make(map[string]string, 0)
|
||||
|
||||
// ==============================
|
||||
// Shared kmer options (used by index, super, lowmask)
|
||||
// ==============================
|
||||
|
||||
var _kmerSize = 31
|
||||
var _minimizerSize = -1 // -1 means auto: ceil(k / 2.5)
|
||||
|
||||
// KmerSizeOptionSet registers --kmer-size / -k.
|
||||
// Shared by index, super, and lowmask subcommands.
|
||||
func KmerSizeOptionSet(options *getoptions.GetOpt) {
|
||||
options.IntVar(&_kmerSize, "kmer-size", _kmerSize,
|
||||
options.Alias("k"),
|
||||
options.Description("Size of k-mers (must be between 2 and 31)."))
|
||||
}
|
||||
|
||||
// MinimizerOptionSet registers --minimizer-size / -m.
|
||||
// Shared by index and super subcommands.
|
||||
func MinimizerOptionSet(options *getoptions.GetOpt) {
|
||||
options.IntVar(&_minimizerSize, "minimizer-size", _minimizerSize,
|
||||
options.Alias("m"),
|
||||
options.Description("Size of minimizers for parallelization (-1 for auto = ceil(k/2.5))."))
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Lowmask-specific options
|
||||
// ==============================
|
||||
|
||||
var _entropySize = 6
|
||||
var _entropyThreshold = 0.5
|
||||
var _splitMode = false
|
||||
var _extractMode = false
|
||||
var _maskingChar = "."
|
||||
var _keepShorter = false
|
||||
|
||||
// LowMaskOptionSet registers options specific to low-complexity masking.
|
||||
func LowMaskOptionSet(options *getoptions.GetOpt) {
|
||||
KmerSizeOptionSet(options)
|
||||
|
||||
options.IntVar(&_entropySize, "entropy-size", _entropySize,
|
||||
options.Description("Maximum word size considered for entropy estimate."))
|
||||
|
||||
options.Float64Var(&_entropyThreshold, "threshold", _entropyThreshold,
|
||||
options.Description("Entropy threshold below which a kmer is masked (0 to 1)."))
|
||||
|
||||
options.BoolVar(&_splitMode, "extract-high", _splitMode,
|
||||
options.Description("Extract only high-complexity regions."))
|
||||
|
||||
options.BoolVar(&_extractMode, "extract-low", _extractMode,
|
||||
options.Description("Extract only low-complexity regions."))
|
||||
|
||||
options.StringVar(&_maskingChar, "masking-char", _maskingChar,
|
||||
options.Description("Character used to mask low complexity regions."))
|
||||
|
||||
options.BoolVar(&_keepShorter, "keep-shorter", _keepShorter,
|
||||
options.Description("Keep fragments shorter than kmer-size in split/extract mode."))
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Index-specific options
|
||||
// ==============================
|
||||
|
||||
var _indexId = ""
|
||||
var _metadataFormat = "toml"
|
||||
var _setTag = make(map[string]string, 0)
|
||||
var _minOccurrence = 1
|
||||
var _maxOccurrence = 0
|
||||
var _saveFullFilter = false
|
||||
var _saveFreqKmer = 0
|
||||
var _indexEntropyThreshold = 0.0
|
||||
var _indexEntropySize = 6
|
||||
|
||||
// KmerIndexOptionSet defines every option related to kmer index building.
|
||||
func KmerIndexOptionSet(options *getoptions.GetOpt) {
|
||||
KmerSizeOptionSet(options)
|
||||
MinimizerOptionSet(options)
|
||||
|
||||
options.StringVar(&_indexId, "index-id", _indexId,
|
||||
options.Description("Identifier for the kmer index."))
|
||||
|
||||
options.StringVar(&_metadataFormat, "metadata-format", _metadataFormat,
|
||||
options.Description("Format for metadata file (toml, yaml, json)."))
|
||||
|
||||
options.StringMapVar(&_setTag, "set-tag", 1, 1,
|
||||
options.Alias("S"),
|
||||
options.ArgName("KEY=VALUE"),
|
||||
options.Description("Adds a group-level metadata attribute KEY with value VALUE."))
|
||||
|
||||
options.IntVar(&_minOccurrence, "min-occurrence", _minOccurrence,
|
||||
options.Description("Minimum number of occurrences for a k-mer to be kept (default 1 = keep all)."))
|
||||
|
||||
options.IntVar(&_maxOccurrence, "max-occurrence", _maxOccurrence,
|
||||
options.Description("Maximum number of occurrences for a k-mer to be kept (default 0 = no upper bound)."))
|
||||
|
||||
options.BoolVar(&_saveFullFilter, "save-full-filter", _saveFullFilter,
|
||||
options.Description("When using --min-occurrence > 1, save the full frequency filter instead of just the filtered index."))
|
||||
|
||||
options.IntVar(&_saveFreqKmer, "save-freq-kmer", _saveFreqKmer,
|
||||
options.Description("Save the N most frequent k-mers per set to a CSV file (top_kmers.csv)."))
|
||||
|
||||
options.Float64Var(&_indexEntropyThreshold, "entropy-filter", _indexEntropyThreshold,
|
||||
options.Description("Filter low-complexity k-mers with entropy <= threshold (0 = disabled)."))
|
||||
|
||||
options.IntVar(&_indexEntropySize, "entropy-filter-size", _indexEntropySize,
|
||||
options.Description("Maximum word size for entropy filter computation (default 6)."))
|
||||
}
|
||||
|
||||
// EntropyFilterOptionSet registers entropy filter options for commands
|
||||
// that process existing indices (e.g. filter).
|
||||
func EntropyFilterOptionSet(options *getoptions.GetOpt) {
|
||||
options.Float64Var(&_indexEntropyThreshold, "entropy-filter", _indexEntropyThreshold,
|
||||
options.Description("Filter low-complexity k-mers with entropy <= threshold (0 = disabled)."))
|
||||
|
||||
options.IntVar(&_indexEntropySize, "entropy-filter-size", _indexEntropySize,
|
||||
options.Description("Maximum word size for entropy filter computation (default 6)."))
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Super kmer options
|
||||
// ==============================
|
||||
|
||||
// SuperKmerOptionSet registers options specific to super k-mer extraction.
|
||||
func SuperKmerOptionSet(options *getoptions.GetOpt) {
|
||||
KmerSizeOptionSet(options)
|
||||
MinimizerOptionSet(options)
|
||||
}
|
||||
|
||||
// CLIKmerSize returns the k-mer size.
|
||||
func CLIKmerSize() int {
|
||||
return _kmerSize
|
||||
}
|
||||
|
||||
// CLIMinimizerSize returns the effective minimizer size.
|
||||
func CLIMinimizerSize() int {
|
||||
m := _minimizerSize
|
||||
if m < 0 {
|
||||
m = obikmer.DefaultMinimizerSize(_kmerSize)
|
||||
}
|
||||
nworkers := obidefault.ParallelWorkers()
|
||||
m = obikmer.ValidateMinimizerSize(m, _kmerSize, nworkers)
|
||||
return m
|
||||
}
|
||||
|
||||
// CLIIndexId returns the index identifier.
|
||||
func CLIIndexId() string {
|
||||
return _indexId
|
||||
}
|
||||
|
||||
// CLIMetadataFormat returns the metadata format.
|
||||
func CLIMetadataFormat() obikmer.MetadataFormat {
|
||||
switch strings.ToLower(_metadataFormat) {
|
||||
case "toml":
|
||||
return obikmer.FormatTOML
|
||||
case "yaml":
|
||||
return obikmer.FormatYAML
|
||||
case "json":
|
||||
return obikmer.FormatJSON
|
||||
default:
|
||||
log.Warnf("Unknown metadata format %q, defaulting to TOML", _metadataFormat)
|
||||
return obikmer.FormatTOML
|
||||
}
|
||||
}
|
||||
|
||||
// CLISetTag returns the group-level metadata key=value pairs.
|
||||
func CLISetTag() map[string]string {
|
||||
return _setTag
|
||||
}
|
||||
|
||||
// CLIMinOccurrence returns the minimum occurrence threshold.
|
||||
func CLIMinOccurrence() int {
|
||||
return _minOccurrence
|
||||
}
|
||||
|
||||
// CLIMaxOccurrence returns the maximum occurrence threshold (0 = no upper bound).
|
||||
func CLIMaxOccurrence() int {
|
||||
return _maxOccurrence
|
||||
}
|
||||
|
||||
// CLISaveFullFilter returns whether to save the full frequency filter.
|
||||
func CLISaveFullFilter() bool {
|
||||
return _saveFullFilter
|
||||
}
|
||||
|
||||
// CLISaveFreqKmer returns the number of top frequent k-mers to save (0 = disabled).
|
||||
func CLISaveFreqKmer() int {
|
||||
return _saveFreqKmer
|
||||
}
|
||||
|
||||
// CLIOutputDirectory returns the output directory path.
|
||||
func CLIOutputDirectory() string {
|
||||
return obiconvert.CLIOutPutFileName()
|
||||
}
|
||||
|
||||
// SetKmerSize sets the k-mer size (for testing).
|
||||
func SetKmerSize(k int) {
|
||||
_kmerSize = k
|
||||
}
|
||||
|
||||
// SetMinimizerSize sets the minimizer size (for testing).
|
||||
func SetMinimizerSize(m int) {
|
||||
_minimizerSize = m
|
||||
}
|
||||
|
||||
// SetMinOccurrence sets the minimum occurrence (for testing).
|
||||
func SetMinOccurrence(n int) {
|
||||
_minOccurrence = n
|
||||
}
|
||||
|
||||
// CLIMaskingMode returns the masking mode from CLI flags.
|
||||
func CLIMaskingMode() MaskingMode {
|
||||
switch {
|
||||
case _extractMode:
|
||||
return ExtractMode
|
||||
case _splitMode:
|
||||
return SplitMode
|
||||
default:
|
||||
return MaskMode
|
||||
}
|
||||
}
|
||||
|
||||
// CLIMaskingChar returns the masking character, validated.
|
||||
func CLIMaskingChar() byte {
|
||||
mask := strings.TrimSpace(_maskingChar)
|
||||
if len(mask) != 1 {
|
||||
log.Fatalf("--masking-char option accepts a single character, not %s", mask)
|
||||
}
|
||||
return []byte(mask)[0]
|
||||
}
|
||||
|
||||
// CLIEntropySize returns the entropy word size.
|
||||
func CLIEntropySize() int {
|
||||
return _entropySize
|
||||
}
|
||||
|
||||
// CLIEntropyThreshold returns the entropy threshold.
|
||||
func CLIEntropyThreshold() float64 {
|
||||
return _entropyThreshold
|
||||
}
|
||||
|
||||
// CLIKeepShorter returns whether to keep short fragments.
|
||||
func CLIKeepShorter() bool {
|
||||
return _keepShorter
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Match-specific options
|
||||
// ==============================
|
||||
|
||||
var _indexDirectory = ""
|
||||
|
||||
// IndexDirectoryOptionSet registers --index / -i (mandatory directory for match).
|
||||
func IndexDirectoryOptionSet(options *getoptions.GetOpt) {
|
||||
options.StringVar(&_indexDirectory, "index", _indexDirectory,
|
||||
options.Alias("i"),
|
||||
options.Required(),
|
||||
options.ArgName("DIRECTORY"),
|
||||
options.Description("Path to the kmer index directory."))
|
||||
}
|
||||
|
||||
// CLIIndexDirectory returns the --index directory path.
|
||||
func CLIIndexDirectory() string {
|
||||
return _indexDirectory
|
||||
}
|
||||
|
||||
// CLIIndexEntropyThreshold returns the entropy filter threshold for index building (0 = disabled).
|
||||
func CLIIndexEntropyThreshold() float64 {
|
||||
return _indexEntropyThreshold
|
||||
}
|
||||
|
||||
// CLIIndexEntropySize returns the entropy filter word size for index building.
|
||||
func CLIIndexEntropySize() int {
|
||||
return _indexEntropySize
|
||||
}
|
||||
|
||||
// OutputFormatOptionSet registers --json-output, --csv-output, --yaml-output.
|
||||
func OutputFormatOptionSet(options *getoptions.GetOpt) {
|
||||
options.BoolVar(&_jsonOutput, "json-output", false,
|
||||
options.Description("Print results as JSON."))
|
||||
options.BoolVar(&_csvOutput, "csv-output", false,
|
||||
options.Description("Print results as CSV."))
|
||||
options.BoolVar(&_yamlOutput, "yaml-output", false,
|
||||
options.Description("Print results as YAML."))
|
||||
}
|
||||
|
||||
// CLIOutFormat returns the selected output format: "json", "csv", "yaml", or "text".
|
||||
func CLIOutFormat() string {
|
||||
if _jsonOutput {
|
||||
return "json"
|
||||
}
|
||||
if _csvOutput {
|
||||
return "csv"
|
||||
}
|
||||
if _yamlOutput {
|
||||
return "yaml"
|
||||
}
|
||||
return "text"
|
||||
}
|
||||
|
||||
// SetSelectionOptionSet registers --set <glob_pattern> (repeatable).
|
||||
func SetSelectionOptionSet(options *getoptions.GetOpt) {
|
||||
options.StringSliceVar(&_setPatterns, "set", 1, 1,
|
||||
options.Alias("s"),
|
||||
options.ArgName("PATTERN"),
|
||||
options.Description("Set ID or glob pattern (repeatable, supports *, ?, [...])."))
|
||||
}
|
||||
|
||||
// CLISetPatterns returns the --set patterns provided by the user.
|
||||
func CLISetPatterns() []string {
|
||||
return _setPatterns
|
||||
}
|
||||
|
||||
// ForceOptionSet registers --force / -f.
|
||||
func ForceOptionSet(options *getoptions.GetOpt) {
|
||||
options.BoolVar(&_force, "force", false,
|
||||
options.Alias("f"),
|
||||
options.Description("Force operation even if set ID already exists in destination."))
|
||||
}
|
||||
|
||||
// CLIForce returns whether --force was specified.
|
||||
func CLIForce() bool {
|
||||
return _force
|
||||
}
|
||||
56
pkg/obitools/obik/rm.go
Normal file
56
pkg/obitools/obik/rm.go
Normal file
@@ -0,0 +1,56 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
func runRm(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
if len(args) < 1 {
|
||||
return fmt.Errorf("usage: obik rm --set PATTERN [--set PATTERN]... <index_directory>")
|
||||
}
|
||||
|
||||
patterns := CLISetPatterns()
|
||||
if len(patterns) == 0 {
|
||||
return fmt.Errorf("--set is required (specify which sets to remove)")
|
||||
}
|
||||
|
||||
indexDir := args[0]
|
||||
|
||||
ksg, err := obikmer.OpenKmerSetGroup(indexDir)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||
}
|
||||
|
||||
indices, err := ksg.MatchSetIDs(patterns)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
if len(indices) == 0 {
|
||||
return fmt.Errorf("no sets match the given patterns")
|
||||
}
|
||||
|
||||
// Collect IDs before removal (indices shift as we remove)
|
||||
ids := make([]string, len(indices))
|
||||
for i, idx := range indices {
|
||||
ids[i] = ksg.SetIDOf(idx)
|
||||
}
|
||||
|
||||
log.Infof("Removing %d set(s) from %s", len(ids), indexDir)
|
||||
|
||||
// Remove in reverse order to avoid renumbering issues
|
||||
for i := len(ids) - 1; i >= 0; i-- {
|
||||
if err := ksg.RemoveSetByID(ids[i]); err != nil {
|
||||
return fmt.Errorf("failed to remove set %q: %w", ids[i], err)
|
||||
}
|
||||
log.Infof("Removed set %q", ids[i])
|
||||
}
|
||||
|
||||
log.Infof("Index now has %d set(s)", ksg.Size())
|
||||
return nil
|
||||
}
|
||||
121
pkg/obitools/obik/spectrum.go
Normal file
121
pkg/obitools/obik/spectrum.go
Normal file
@@ -0,0 +1,121 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"encoding/csv"
|
||||
"fmt"
|
||||
"os"
|
||||
"strconv"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// runSpectrum implements the "obik spectrum" subcommand.
|
||||
// It outputs k-mer frequency spectra as CSV with one column per set.
|
||||
func runSpectrum(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
if len(args) < 1 {
|
||||
return fmt.Errorf("usage: obik spectrum [options] <index_directory>")
|
||||
}
|
||||
|
||||
ksg, err := obikmer.OpenKmerSetGroup(args[0])
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||
}
|
||||
|
||||
// Determine which sets to include
|
||||
patterns := CLISetPatterns()
|
||||
var indices []int
|
||||
if len(patterns) > 0 {
|
||||
indices, err = ksg.MatchSetIDs(patterns)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to match set patterns: %w", err)
|
||||
}
|
||||
if len(indices) == 0 {
|
||||
return fmt.Errorf("no sets match the given patterns")
|
||||
}
|
||||
} else {
|
||||
// All sets
|
||||
indices = make([]int, ksg.Size())
|
||||
for i := range indices {
|
||||
indices[i] = i
|
||||
}
|
||||
}
|
||||
|
||||
// Read spectra for selected sets
|
||||
spectraMaps := make([]map[int]uint64, len(indices))
|
||||
maxFreq := 0
|
||||
for i, idx := range indices {
|
||||
spectrum, err := ksg.Spectrum(idx)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to read spectrum for set %d: %w", idx, err)
|
||||
}
|
||||
if spectrum == nil {
|
||||
log.Warnf("No spectrum data for set %d (%s)", idx, ksg.SetIDOf(idx))
|
||||
spectraMaps[i] = make(map[int]uint64)
|
||||
continue
|
||||
}
|
||||
spectraMaps[i] = spectrum.ToMap()
|
||||
if mf := spectrum.MaxFrequency(); mf > maxFreq {
|
||||
maxFreq = mf
|
||||
}
|
||||
}
|
||||
|
||||
if maxFreq == 0 {
|
||||
return fmt.Errorf("no spectrum data found in any selected set")
|
||||
}
|
||||
|
||||
// Determine output destination
|
||||
outFile := obiconvert.CLIOutPutFileName()
|
||||
var w *csv.Writer
|
||||
if outFile == "" || outFile == "-" {
|
||||
w = csv.NewWriter(os.Stdout)
|
||||
} else {
|
||||
f, err := os.Create(outFile)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to create output file: %w", err)
|
||||
}
|
||||
defer f.Close()
|
||||
w = csv.NewWriter(f)
|
||||
}
|
||||
defer w.Flush()
|
||||
|
||||
// Build header: frequency, set_id_1, set_id_2, ...
|
||||
header := make([]string, 1+len(indices))
|
||||
header[0] = "frequency"
|
||||
for i, idx := range indices {
|
||||
id := ksg.SetIDOf(idx)
|
||||
if id == "" {
|
||||
id = fmt.Sprintf("set_%d", idx)
|
||||
}
|
||||
header[i+1] = id
|
||||
}
|
||||
if err := w.Write(header); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Write rows for each frequency from 1 to maxFreq
|
||||
record := make([]string, 1+len(indices))
|
||||
for freq := 1; freq <= maxFreq; freq++ {
|
||||
record[0] = strconv.Itoa(freq)
|
||||
hasData := false
|
||||
for i := range indices {
|
||||
count := spectraMaps[i][freq]
|
||||
record[i+1] = strconv.FormatUint(count, 10)
|
||||
if count > 0 {
|
||||
hasData = true
|
||||
}
|
||||
}
|
||||
// Only write rows where at least one set has a non-zero count
|
||||
if hasData {
|
||||
if err := w.Write(record); err != nil {
|
||||
return err
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
148
pkg/obitools/obik/summary.go
Normal file
148
pkg/obitools/obik/summary.go
Normal file
@@ -0,0 +1,148 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"encoding/json"
|
||||
"fmt"
|
||||
"os"
|
||||
"path/filepath"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
"gopkg.in/yaml.v3"
|
||||
)
|
||||
|
||||
type setSummary struct {
|
||||
Index int `json:"index" yaml:"index"`
|
||||
ID string `json:"id" yaml:"id"`
|
||||
Count uint64 `json:"count" yaml:"count"`
|
||||
DiskSize int64 `json:"disk_bytes" yaml:"disk_bytes"`
|
||||
Metadata map[string]interface{} `json:"metadata,omitempty" yaml:"metadata,omitempty"`
|
||||
}
|
||||
|
||||
type groupSummary struct {
|
||||
Path string `json:"path" yaml:"path"`
|
||||
ID string `json:"id,omitempty" yaml:"id,omitempty"`
|
||||
K int `json:"k" yaml:"k"`
|
||||
M int `json:"m" yaml:"m"`
|
||||
Partitions int `json:"partitions" yaml:"partitions"`
|
||||
TotalSets int `json:"total_sets" yaml:"total_sets"`
|
||||
TotalKmers uint64 `json:"total_kmers" yaml:"total_kmers"`
|
||||
TotalDisk int64 `json:"total_disk_bytes" yaml:"total_disk_bytes"`
|
||||
Metadata map[string]interface{} `json:"metadata,omitempty" yaml:"metadata,omitempty"`
|
||||
Sets []setSummary `json:"sets" yaml:"sets"`
|
||||
Jaccard [][]float64 `json:"jaccard,omitempty" yaml:"jaccard,omitempty"`
|
||||
}
|
||||
|
||||
func runSummary(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
if len(args) < 1 {
|
||||
return fmt.Errorf("usage: obik summary [options] <index_directory>")
|
||||
}
|
||||
|
||||
ksg, err := obikmer.OpenKmerSetGroup(args[0])
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||
}
|
||||
|
||||
summary := groupSummary{
|
||||
Path: ksg.Path(),
|
||||
ID: ksg.Id(),
|
||||
K: ksg.K(),
|
||||
M: ksg.M(),
|
||||
Partitions: ksg.Partitions(),
|
||||
TotalSets: ksg.Size(),
|
||||
TotalKmers: ksg.Len(),
|
||||
Metadata: ksg.Metadata,
|
||||
Sets: make([]setSummary, ksg.Size()),
|
||||
}
|
||||
|
||||
var totalDisk int64
|
||||
for i := 0; i < ksg.Size(); i++ {
|
||||
diskSize := computeSetDiskSize(ksg, i)
|
||||
totalDisk += diskSize
|
||||
summary.Sets[i] = setSummary{
|
||||
Index: i,
|
||||
ID: ksg.SetIDOf(i),
|
||||
Count: ksg.Len(i),
|
||||
DiskSize: diskSize,
|
||||
Metadata: ksg.AllSetMetadata(i),
|
||||
}
|
||||
}
|
||||
summary.TotalDisk = totalDisk
|
||||
|
||||
// Jaccard matrix
|
||||
if _jaccard && ksg.Size() > 1 {
|
||||
dm := ksg.JaccardDistanceMatrix()
|
||||
n := ksg.Size()
|
||||
matrix := make([][]float64, n)
|
||||
for i := 0; i < n; i++ {
|
||||
matrix[i] = make([]float64, n)
|
||||
for j := 0; j < n; j++ {
|
||||
if i == j {
|
||||
matrix[i][j] = 0
|
||||
} else {
|
||||
matrix[i][j] = dm.Get(i, j)
|
||||
}
|
||||
}
|
||||
}
|
||||
summary.Jaccard = matrix
|
||||
}
|
||||
|
||||
format := CLIOutFormat()
|
||||
switch format {
|
||||
case "json":
|
||||
return outputSummaryJSON(summary)
|
||||
case "yaml":
|
||||
return outputSummaryYAML(summary)
|
||||
case "csv":
|
||||
return outputSummaryCSV(summary)
|
||||
default:
|
||||
return outputSummaryJSON(summary)
|
||||
}
|
||||
}
|
||||
|
||||
func computeSetDiskSize(ksg *obikmer.KmerSetGroup, setIndex int) int64 {
|
||||
var total int64
|
||||
for p := 0; p < ksg.Partitions(); p++ {
|
||||
path := ksg.PartitionPath(setIndex, p)
|
||||
info, err := os.Stat(path)
|
||||
if err != nil {
|
||||
continue
|
||||
}
|
||||
total += info.Size()
|
||||
}
|
||||
// Also count the set directory entry itself
|
||||
setDir := filepath.Join(ksg.Path(), fmt.Sprintf("set_%d", setIndex))
|
||||
entries, err := os.ReadDir(setDir)
|
||||
if err == nil {
|
||||
// We already counted .kdi files above; this is just for completeness
|
||||
_ = entries
|
||||
}
|
||||
return total
|
||||
}
|
||||
|
||||
func outputSummaryJSON(summary groupSummary) error {
|
||||
data, err := json.MarshalIndent(summary, "", " ")
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
fmt.Println(string(data))
|
||||
return nil
|
||||
}
|
||||
|
||||
func outputSummaryYAML(summary groupSummary) error {
|
||||
data, err := yaml.Marshal(summary)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
fmt.Print(string(data))
|
||||
return nil
|
||||
}
|
||||
|
||||
func outputSummaryCSV(summary groupSummary) error {
|
||||
fmt.Println("index,id,count,disk_bytes")
|
||||
for _, s := range summary.Sets {
|
||||
fmt.Printf("%d,%s,%d,%d\n", s.Index, s.ID, s.Count, s.DiskSize)
|
||||
}
|
||||
return nil
|
||||
}
|
||||
49
pkg/obitools/obik/super.go
Normal file
49
pkg/obitools/obik/super.go
Normal file
@@ -0,0 +1,49 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// runSuper implements the "obik super" subcommand.
|
||||
// It extracts super k-mers from DNA sequences.
|
||||
func runSuper(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
k := CLIKmerSize()
|
||||
m := CLIMinimizerSize()
|
||||
|
||||
if k < 2 || k > 31 {
|
||||
return fmt.Errorf("invalid k-mer size: %d (must be between 2 and 31)", k)
|
||||
}
|
||||
|
||||
if m < 1 || m >= k {
|
||||
return fmt.Errorf("invalid parameters: minimizer size (%d) must be between 1 and k-1 (%d)", m, k-1)
|
||||
}
|
||||
|
||||
log.Printf("Extracting super k-mers with k=%d, m=%d", k, m)
|
||||
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open sequence files: %w", err)
|
||||
}
|
||||
|
||||
worker := obikmer.SuperKmerWorker(k, m)
|
||||
|
||||
superkmers := sequences.MakeIWorker(
|
||||
worker,
|
||||
false,
|
||||
obidefault.ParallelWorkers(),
|
||||
)
|
||||
|
||||
obiconvert.CLIWriteBioSequences(superkmers, true)
|
||||
obiutils.WaitForLastPipe()
|
||||
|
||||
return nil
|
||||
}
|
||||
@@ -42,6 +42,8 @@ func MapOnLandmarkSequences(library obiseq.BioSequenceSlice, landmark_idx []int,
|
||||
|
||||
seqworld := obiutils.Make2DArray[float64](library_size, n_landmark)
|
||||
|
||||
var bar *progressbar.ProgressBar
|
||||
if obidefault.ProgressBar() {
|
||||
pbopt := make([]progressbar.Option, 0, 5)
|
||||
pbopt = append(pbopt,
|
||||
progressbar.OptionSetWriter(os.Stderr),
|
||||
@@ -51,7 +53,8 @@ func MapOnLandmarkSequences(library obiseq.BioSequenceSlice, landmark_idx []int,
|
||||
progressbar.OptionSetDescription("[Sequence mapping]"),
|
||||
)
|
||||
|
||||
bar := progressbar.NewOptions(library_size, pbopt...)
|
||||
bar = progressbar.NewOptions(library_size, pbopt...)
|
||||
}
|
||||
|
||||
waiting := sync.WaitGroup{}
|
||||
waiting.Add(nworkers)
|
||||
@@ -66,8 +69,10 @@ func MapOnLandmarkSequences(library obiseq.BioSequenceSlice, landmark_idx []int,
|
||||
match, lalign := obialign.FastLCSScore(landmark, seq, -1, &buffer)
|
||||
coord[j] = float64(lalign - match)
|
||||
}
|
||||
if bar != nil {
|
||||
bar.Add(1)
|
||||
}
|
||||
}
|
||||
waiting.Done()
|
||||
}
|
||||
|
||||
@@ -170,6 +175,8 @@ func CLISelectLandmarkSequences(iterator obiiter.IBioSequence) obiiter.IBioSeque
|
||||
taxa.Set(i, taxon)
|
||||
}
|
||||
|
||||
var bar2 *progressbar.ProgressBar
|
||||
if obidefault.ProgressBar() {
|
||||
pbopt := make([]progressbar.Option, 0, 5)
|
||||
pbopt = append(pbopt,
|
||||
progressbar.OptionSetWriter(os.Stderr),
|
||||
@@ -179,14 +186,15 @@ func CLISelectLandmarkSequences(iterator obiiter.IBioSequence) obiiter.IBioSeque
|
||||
progressbar.OptionSetDescription("[Sequence Indexing]"),
|
||||
)
|
||||
|
||||
bar := progressbar.NewOptions(len(library), pbopt...)
|
||||
bar2 = progressbar.NewOptions(len(library), pbopt...)
|
||||
}
|
||||
|
||||
for i, seq := range library {
|
||||
idx := obirefidx.GeomIndexSesquence(i, library, taxa, taxo)
|
||||
seq.SetOBITagGeomRefIndex(idx)
|
||||
|
||||
if i%10 == 0 {
|
||||
bar.Add(10)
|
||||
if bar2 != nil && i%10 == 0 {
|
||||
bar2.Add(10)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
@@ -1,332 +0,0 @@
|
||||
```{r}
|
||||
library(tidyverse)
|
||||
```
|
||||
|
||||
```{r}
|
||||
x <- sample(1:4096, 29, replace=TRUE)
|
||||
```
|
||||
|
||||
```{r}
|
||||
emax <- function(lseq,word_size) {
|
||||
nword = lseq - word_size + 1
|
||||
nalpha = 4^word_size
|
||||
|
||||
if (nalpha < nword) {
|
||||
cov = nword %/% nalpha
|
||||
remains = nword %% nalpha
|
||||
f1 = cov/nword
|
||||
f2 = (cov+1)/nword
|
||||
print(c(nalpha - remains,f1,remains,f2))
|
||||
e = -(nalpha - remains) * f1 * log(f1) -
|
||||
remains * f2 * log(f2)
|
||||
} else {
|
||||
e = log(nword)
|
||||
}
|
||||
|
||||
e
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
ec <- function(data,kmer_size) {
|
||||
table <- table(data)
|
||||
s <- sum(table)
|
||||
e <- sum(table * log(table))/s
|
||||
ed <- log(s) - e
|
||||
|
||||
em <- emax(s+kmer_size-1,kmer_size)
|
||||
|
||||
ed/em
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
ef <- function(data,kmer_size) {
|
||||
table <- table(data)
|
||||
s <- sum(table)
|
||||
f <- table / s
|
||||
|
||||
f <- as.numeric(f)
|
||||
f <- f[f > 0]
|
||||
|
||||
em <- emax(s+kmer_size-1,kmer_size)
|
||||
ed <- -sum(f * log(f))
|
||||
|
||||
print(c(ed,em,ed/em))
|
||||
|
||||
ed/em
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
okmer <- function(data,kmer_size) {
|
||||
str_sub(data,1:(nchar(data)-kmer_size+1)) %>%
|
||||
str_sub(1,kmer_size)
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Normalisation circulaire: retourne le plus petit k-mer par rotation circulaire
|
||||
normalize_circular <- function(kmer) {
|
||||
if (nchar(kmer) == 0) return(kmer)
|
||||
|
||||
canonical <- kmer
|
||||
n <- nchar(kmer)
|
||||
|
||||
# Tester toutes les rotations circulaires
|
||||
for (i in 2:n) {
|
||||
rotated <- paste0(str_sub(kmer, i, n), str_sub(kmer, 1, i-1))
|
||||
if (rotated < canonical) {
|
||||
canonical <- rotated
|
||||
}
|
||||
}
|
||||
|
||||
canonical
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Fonction totient d'Euler: compte le nombre d'entiers de 1 à n coprimes avec n
|
||||
euler_totient <- function(n) {
|
||||
if (n <= 0) return(0)
|
||||
|
||||
result <- n
|
||||
p <- 2
|
||||
|
||||
# Traiter tous les facteurs premiers
|
||||
while (p * p <= n) {
|
||||
if (n %% p == 0) {
|
||||
# Retirer toutes les occurrences de p
|
||||
while (n %% p == 0) {
|
||||
n <- n %/% p
|
||||
}
|
||||
# Appliquer la formule: φ(n) = n * (1 - 1/p)
|
||||
result <- result - result %/% p
|
||||
}
|
||||
p <- p + 1
|
||||
}
|
||||
|
||||
# Si n est toujours > 1, alors c'est un facteur premier
|
||||
if (n > 1) {
|
||||
result <- result - result %/% n
|
||||
}
|
||||
|
||||
result
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Retourne tous les diviseurs de n
|
||||
divisors <- function(n) {
|
||||
if (n <= 0) return(integer(0))
|
||||
|
||||
divs <- c()
|
||||
i <- 1
|
||||
while (i * i <= n) {
|
||||
if (n %% i == 0) {
|
||||
divs <- c(divs, i)
|
||||
if (i != n %/% i) {
|
||||
divs <- c(divs, n %/% i)
|
||||
}
|
||||
}
|
||||
i <- i + 1
|
||||
}
|
||||
|
||||
sort(divs)
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Compte le nombre de colliers (necklaces) distincts de longueur n
|
||||
# sur un alphabet de taille a en utilisant la formule de Moreau:
|
||||
# N(n, a) = (1/n) * Σ φ(d) * a^(n/d)
|
||||
# où la somme est sur tous les diviseurs d de n, et φ est la fonction totient d'Euler
|
||||
necklace_count <- function(n, alphabet_size) {
|
||||
if (n <= 0) return(0)
|
||||
|
||||
divs <- divisors(n)
|
||||
sum_val <- 0
|
||||
|
||||
for (d in divs) {
|
||||
# Calculer alphabet_size^(n/d)
|
||||
power <- alphabet_size^(n %/% d)
|
||||
sum_val <- sum_val + euler_totient(d) * power
|
||||
}
|
||||
|
||||
sum_val %/% n
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Nombre de classes d'équivalence pour les k-mers normalisés
|
||||
# Utilise la formule exacte de Moreau pour compter les colliers (necklaces)
|
||||
n_normalized_kmers <- function(kmer_size) {
|
||||
# Valeurs exactes pré-calculées pour k=1 à 6
|
||||
if (kmer_size == 1) return(4)
|
||||
if (kmer_size == 2) return(10)
|
||||
if (kmer_size == 3) return(24)
|
||||
if (kmer_size == 4) return(70)
|
||||
if (kmer_size == 5) return(208)
|
||||
if (kmer_size == 6) return(700)
|
||||
|
||||
# Pour k > 6, utiliser la formule de Moreau (exacte)
|
||||
# Alphabet ADN a 4 bases
|
||||
necklace_count(kmer_size, 4)
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Entropie maximale pour k-mers normalisés
|
||||
enmax <- function(lseq, word_size) {
|
||||
nword = lseq - word_size + 1
|
||||
nalpha = n_normalized_kmers(word_size)
|
||||
|
||||
if (nalpha < nword) {
|
||||
cov = nword %/% nalpha
|
||||
remains = nword %% nalpha
|
||||
f1 = cov/nword
|
||||
f2 = (cov+1)/nword
|
||||
e = -(nalpha - remains) * f1 * log(f1) -
|
||||
remains * f2 * log(f2)
|
||||
} else {
|
||||
e = log(nword)
|
||||
}
|
||||
|
||||
e
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Entropie normalisée avec normalisation circulaire des k-mers
|
||||
ecn <- function(data, kmer_size) {
|
||||
# Normaliser tous les k-mers
|
||||
normalized_data <- sapply(data, normalize_circular)
|
||||
|
||||
# Calculer la table des fréquences
|
||||
table <- table(normalized_data)
|
||||
s <- sum(table)
|
||||
e <- sum(table * log(table))/s
|
||||
ed <- log(s) - e
|
||||
|
||||
# Entropie maximale avec normalisation
|
||||
em <- enmax(s + kmer_size - 1, kmer_size)
|
||||
|
||||
ed/em
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
k<-'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa'
|
||||
ec(okmer(k,1),1)
|
||||
ec(okmer(k,2),2)
|
||||
ec(okmer(k,3),3)
|
||||
ec(okmer(k,4),4)
|
||||
```
|
||||
|
||||
```{r}
|
||||
k<-'atatatatatatatatatatatatatatata'
|
||||
ef(okmer(k,1),1)
|
||||
ef(okmer(k,2),2)
|
||||
ef(okmer(k,3),3)
|
||||
ef(okmer(k,4),4)
|
||||
```
|
||||
|
||||
```{r}
|
||||
k<-'aaaaaaaaaaaaaaaattttttttttttttt'
|
||||
ef(okmer(k,1),1)
|
||||
ef(okmer(k,2),2)
|
||||
ef(okmer(k,3),3)
|
||||
ef(okmer(k,4),4)
|
||||
```
|
||||
|
||||
```{r}
|
||||
k<-'atgatgatgatgatgatgatgatgatgatga'
|
||||
ef(okmer(k,1),1)
|
||||
ef(okmer(k,2),2)
|
||||
ef(okmer(k,3),3)
|
||||
ef(okmer(k,4),4)
|
||||
```
|
||||
|
||||
```{r}
|
||||
k<-'atcgatcgatcgatcgatcgatcgatcgact'
|
||||
ecn(okmer(k,1),1)
|
||||
ecn(okmer(k,2),2)
|
||||
ecn(okmer(k,3),3)
|
||||
ecn(okmer(k,4),4)
|
||||
```
|
||||
|
||||
```{r}
|
||||
k<-paste(sample(rep(c("a","c","g","t"),8),31),collapse="")
|
||||
k <- "actatggcaagtcgtaaccgcgcttatcagg"
|
||||
ecn(okmer(k,1),1)
|
||||
ecn(okmer(k,2),2)
|
||||
ecn(okmer(k,3),3)
|
||||
ecn(okmer(k,4),4)
|
||||
```
|
||||
|
||||
aattaaaaaaacaagataaaataatattttt
|
||||
|
||||
```{r}
|
||||
k<-'aattaaaaaaacaagataaaataatattttt'
|
||||
ecn(okmer(k,1),1)
|
||||
ecn(okmer(k,2),2)
|
||||
ecn(okmer(k,3),3)
|
||||
ecn(okmer(k,4),4)
|
||||
```
|
||||
|
||||
atg tga gat ,,,,
|
||||
|
||||
cat tca atc
|
||||
|
||||
tgatgatgatgatgatgatgatgatgatg
|
||||
|
||||
## Tests de normalisation circulaire
|
||||
|
||||
```{r}
|
||||
# Test de la fonction de normalisation
|
||||
normalize_circular("ca") # devrait donner "ac"
|
||||
normalize_circular("tgca") # devrait donner "atgc"
|
||||
normalize_circular("acgt") # devrait donner "acgt"
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Comparaison ec vs ecn sur une séquence répétitive
|
||||
# Les k-mers "atg", "tga", "gat" sont équivalents par rotation
|
||||
k <- 'atgatgatgatgatgatgatgatgatgatga'
|
||||
cat("Séquence:", k, "\n")
|
||||
cat("ec(k,3) =", ec(okmer(k,3),3), "\n")
|
||||
cat("ecn(k,3) =", ecn(okmer(k,3),3), "\n")
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Comparaison sur séquence aléatoire
|
||||
k <- "actatggcaagtcgtaaccgcgcttatcagg"
|
||||
cat("Séquence:", k, "\n")
|
||||
cat("Sans normalisation:\n")
|
||||
cat(" ec(k,2) =", ec(okmer(k,2),2), "\n")
|
||||
cat(" ec(k,3) =", ec(okmer(k,3),3), "\n")
|
||||
cat(" ec(k,4) =", ec(okmer(k,4),4), "\n")
|
||||
cat("Avec normalisation circulaire:\n")
|
||||
cat(" ecn(k,2) =", ecn(okmer(k,2),2), "\n")
|
||||
cat(" ecn(k,3) =", ecn(okmer(k,3),3), "\n")
|
||||
cat(" ecn(k,4) =", ecn(okmer(k,4),4), "\n")
|
||||
```
|
||||
|
||||
```{r}
|
||||
|
||||
sequence <- "ttcatcactcagcaatcctgaatgatGAGAGCTTTTTTTTTTTATATATATATATATGTATATGTATGAAATACACTtatgctccgtttgtttcgccgtaa"
|
||||
re <- rev(c(0.8108602271901116,0.8108602271901116,0.8041354757148719,0.8041354757148719,0.8041354757148719,0.8041354757148719,0.8041354757148719,0.8041354757148719,0.7800272339058549,0.7800272339058549,0.7751610144606091,0.7751610144606091,0.7751610144606091,0.764858185548322,0.7325526601302021,0.7137620699527615,0.6789199521982864,0.6584536373623372,0.634002687184193,0.6075290415873623,0.5785545803330997,0.5785545803330997,0.5503220289212184,0.5315314387437778,0.4966893209893028,0.46077361820145696,0.42388221293245526,0.4009547969713408,0.3561142883497758,0.3561142883497758,0.3561142883497758,0.3561142883497758,0.3561142883497758,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.35141814451677883,0.35141814451677883,0.35141814451677883,0.35141814451677883,0.35141814451677883,0.390029016052137,0.42781461756157363,0.45192285937059073,0.47238917420654,0.47238917420654,0.47238917420654,0.5092805794755417,0.5451962822633876,0.5800384000178626,0.602395141014297,0.6046146614886381,0.6046146614886381,0.6119084258128231,0.6119084258128231,0.6214217106113492,0.6424704346756562,0.6482381543085467,0.6635191587399633,0.6635191587399633,0.6635191587399633,0.6828444721058894,0.6950205907027562,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.7208976112999935))
|
||||
|
||||
di <- c(0.7208976112999935,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6950205907027562,0.6828444721058894,0.6635191587399633,0.6635191587399633,0.6635191587399633,0.6482381543085467,0.6424704346756562,0.6214217106113492,0.6119084258128231,0.6119084258128231,0.6046146614886382,0.6046146614886382,0.6023951410142971,0.5800384000178627,0.5451962822633876,0.5092805794755418,0.47238917420654003,0.47238917420654003,0.47238917420654003,0.4519228593705908,0.4278146175615737,0.39002901605213713,0.35141814451677894,0.35141814451677894,0.35141814451677894,0.35141814451677894,0.35141814451677883,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3561142883497762,0.3561142883497762,0.3561142883497762,0.3561142883497762,0.3561142883497762,0.40095479697134073,0.42388221293245526,0.46077361820145696,0.4966893209893028,0.5315314387437778,0.5503220289212184,0.5785545803330997,0.5785545803330997,0.6075290415873625,0.6340026871841933,0.6584536373623374,0.6789199521982866,0.7137620699527616,0.7325526601302023,0.7648581855483221,0.7751610144606093,0.7751610144606093,0.7751610144606093,0.7800272339058549,0.7800272339058549,0.8041354757148721,0.8041354757148721,0.8041354757148721,0.8041354757148721,0.8041354757148721,0.8041354757148721,0.8108602271901116,0.8108602271901116)
|
||||
|
||||
ebidir <- tibble(direct=di,reverse=re) %>%
|
||||
mutate(position = 1:length(re),
|
||||
nucleotide = str_sub(sequence,position,position))
|
||||
|
||||
ebidir %>%
|
||||
ggplot(aes(x=position,y=direct)) +
|
||||
geom_line() +
|
||||
scale_x_continuous(breaks = ebidir$position, labels = ebidir$nucleotide) +
|
||||
ylim(0,1)+
|
||||
geom_hline(yintercept=0.5, col = "red", linetype = "dashed")
|
||||
```
|
||||
@@ -1,535 +0,0 @@
|
||||
package obilowmask
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"math"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
log "github.com/sirupsen/logrus"
|
||||
)
|
||||
|
||||
// MaskingMode defines how to handle low-complexity regions
|
||||
type MaskingMode int
|
||||
|
||||
const (
|
||||
Mask MaskingMode = iota // Mask mode: replace low-complexity regions with masked characters
|
||||
Split // Split mode: split sequence into high-complexity fragments
|
||||
Extract
|
||||
)
|
||||
|
||||
// LowMaskWorker creates a worker to mask low-complexity regions in DNA sequences.
|
||||
//
|
||||
// Algorithm principle:
|
||||
// Calculate the normalized entropy of each k-mer at different scales (wordSize = 1 to level_max).
|
||||
// K-mers with entropy below the threshold are masked.
|
||||
//
|
||||
// Parameters:
|
||||
// - kmer_size: size of the sliding window for entropy calculation
|
||||
// - level_max: maximum word size used for entropy calculation (finest scale)
|
||||
// - threshold: normalized entropy threshold below which masking occurs (between 0 and 1)
|
||||
// - mode: Mask (masking) or Split (splitting)
|
||||
// - maskChar: character used for masking (typically 'n' or 'N')
|
||||
//
|
||||
// Returns: a SeqWorker function that can be applied to each sequence
|
||||
func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode MaskingMode, maskChar byte) obiseq.SeqWorker {
|
||||
|
||||
// ========================================================================
|
||||
// FUNCTION 1: emax - Calculate theoretical maximum entropy
|
||||
// ========================================================================
|
||||
// Computes the maximum entropy of a k-mer of length lseq containing words of size word_size.
|
||||
//
|
||||
// Maximum entropy depends on the theoretical optimal word distribution:
|
||||
// - If we have more positions (nw) than possible canonical words (na),
|
||||
// some words will appear multiple times
|
||||
// - We calculate the entropy of a distribution where all words appear
|
||||
// cov or cov+1 times (most uniform distribution possible)
|
||||
//
|
||||
// IMPORTANT: Uses CanonicalCircularKmerCount to get the actual number of canonical words
|
||||
// after circular normalization (e.g., "atg", "tga", "gat" → all "atg").
|
||||
// This is much smaller than 4^word_size (e.g., 10 instead of 16 for word_size=2).
|
||||
emax := func(lseq, word_size int) float64 {
|
||||
nw := lseq - word_size + 1 // Number of words in a k-mer of length lseq
|
||||
na := obikmer.CanonicalCircularKmerCount(word_size) // Number of canonical words after normalization
|
||||
|
||||
// Case 1: Fewer positions than possible words
|
||||
// Maximum entropy is simply log(nw) since we can have at most nw different words
|
||||
if nw < na {
|
||||
return math.Log(float64(nw))
|
||||
}
|
||||
|
||||
// Case 2: More positions than possible words
|
||||
// Some words must appear multiple times
|
||||
cov := nw / na // Average coverage (average number of occurrences per word)
|
||||
remains := nw - (na * cov) // Number of words that will have one additional occurrence
|
||||
|
||||
// Calculate frequencies in the optimal distribution:
|
||||
// - (na - remains) words appear cov times → frequency f1 = cov/nw
|
||||
// - remains words appear (cov+1) times → frequency f2 = (cov+1)/nw
|
||||
f1 := float64(cov) / float64(nw)
|
||||
f2 := float64(cov+1) / float64(nw)
|
||||
|
||||
// Shannon entropy: H = -Σ p(i) * log(p(i))
|
||||
// where p(i) is the probability of observing word i
|
||||
return -(float64(na-remains)*f1*math.Log(f1) +
|
||||
float64(remains)*f2*math.Log(f2))
|
||||
}
|
||||
|
||||
// ========================================================================
|
||||
// FUNCTION 2: maskAmbiguities - Mark positions containing ambiguities
|
||||
// ========================================================================
|
||||
// Identifies positions with ambiguous nucleotides (N, Y, R, etc.) and marks
|
||||
// all k-mers that contain them.
|
||||
//
|
||||
// Returns: a slice where maskPositions[i] = -1 if position i is part of a
|
||||
// k-mer containing an ambiguity, 0 otherwise
|
||||
maskAmbiguities := func(sequence []byte) []int {
|
||||
maskPositions := make([]int, len(sequence))
|
||||
for i, nuc := range sequence {
|
||||
// If nucleotide is not a, c, g or t (lowercase), it's an ambiguity
|
||||
if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' {
|
||||
// Mark all positions of k-mers that contain this nucleotide
|
||||
// A k-mer starting at position (i - kmer_size + 1) will contain position i
|
||||
end := max(0, i-kmer_size+1)
|
||||
for j := i; j >= end; j-- {
|
||||
maskPositions[j] = -1
|
||||
}
|
||||
}
|
||||
}
|
||||
return maskPositions
|
||||
}
|
||||
|
||||
// ========================================================================
|
||||
// FUNCTION 3: cleanTable - Reset a frequency table to zero
|
||||
// ========================================================================
|
||||
cleanTable := func(table []int, over int) {
|
||||
for i := 0; i < over; i++ {
|
||||
table[i] = 0
|
||||
}
|
||||
}
|
||||
|
||||
// ========================================================================
|
||||
// FUNCTION 4: slidingMin - Calculate sliding minimum over a window
|
||||
// ========================================================================
|
||||
// Applies a sliding window of size window over data and replaces each
|
||||
// value with the minimum in the window centered on that position.
|
||||
//
|
||||
// Uses a MinMultiset to efficiently maintain the minimum in the window.
|
||||
slidingMin := func(data []float64, window int) {
|
||||
minimier := obiutils.NewMinMultiset(func(a, b float64) bool { return a < b })
|
||||
ldata := len(data)
|
||||
mem := make([]float64, window) // Circular buffer to store window values
|
||||
|
||||
// Initialize buffer with sentinel value
|
||||
for i := range mem {
|
||||
mem[i] = 10000
|
||||
}
|
||||
|
||||
for i, v := range data {
|
||||
// Get the old value leaving the window
|
||||
m := mem[i%window]
|
||||
mem[i%window] = v
|
||||
|
||||
// Remove old value from multiset if it was valid
|
||||
if m < 10000 {
|
||||
minimier.RemoveOne(m)
|
||||
}
|
||||
|
||||
// Add new value if full window is ahead of us
|
||||
if (ldata - i) >= window {
|
||||
minimier.Add(v)
|
||||
}
|
||||
|
||||
// log.Warnf("taille du minimier %d @ %d", minimier.Len(), i)
|
||||
|
||||
// Retrieve and store current minimum
|
||||
var ok bool
|
||||
if data[i], ok = minimier.Min(); !ok {
|
||||
log.Error("problem with minimum entropy")
|
||||
data[i] = 0.0
|
||||
}
|
||||
|
||||
//xx, _ := minimier.Min()
|
||||
//log.Warnf("Pos: %d n: %d min: %.3f -> %.3f", i, minimier.Len(), v, xx)
|
||||
}
|
||||
}
|
||||
|
||||
// ========================================================================
|
||||
// FUNCTION 5: computeEntropies - Calculate normalized entropy for each position
|
||||
// ========================================================================
|
||||
// This is the central function that calculates the entropy of each k-mer in the sequence
|
||||
// at a given scale (wordSize).
|
||||
//
|
||||
// Algorithm:
|
||||
// 1. Encode the sequence into words (subsequences of size wordSize)
|
||||
// 2. For each k-mer, count the frequencies of words it contains
|
||||
// 3. Calculate normalized entropy = observed_entropy / maximum_entropy
|
||||
// 4. Apply a sliding min filter to smooth results
|
||||
//
|
||||
// IMPORTANT: Line 147 uses NormalizeInt for circular normalization of words!
|
||||
// This means "atg", "tga", and "gat" are considered the same word.
|
||||
computeEntropies := func(sequence []byte,
|
||||
maskPositions []int, // Positions of ambiguities
|
||||
entropies []float64, // Output: normalized entropies for each position
|
||||
table []int, // Frequency table for words (reused between calls)
|
||||
words []int, // Buffer to store encoded words (reused)
|
||||
wordSize int) { // Word size (scale of analysis)
|
||||
|
||||
lseq := len(sequence) // Sequence length
|
||||
tableSize := 1 << (wordSize * 2) // Actual table size (must fit all codes 0 to 4^wordSize-1)
|
||||
nwords := kmer_size - wordSize + 1 // Number of words in a k-mer
|
||||
float_nwords := float64(nwords)
|
||||
log_nwords := math.Log(float_nwords) // log(nwords) used in entropy calculation
|
||||
entropyMax := emax(kmer_size, wordSize) // Theoretical maximum entropy (uses CanonicalKmerCount internally)
|
||||
|
||||
// Reset frequency table (must clear entire table, not just nalpha entries)
|
||||
cleanTable(table, tableSize)
|
||||
|
||||
for i := 1; i < lseq; i++ {
|
||||
entropies[i] = 6
|
||||
}
|
||||
end := lseq - wordSize + 1 // Last position where a word can start
|
||||
|
||||
// ========================================================================
|
||||
// STEP 1: Encode all words in the sequence
|
||||
// ========================================================================
|
||||
// Uses left-shift encoding: each nucleotide is encoded on 2 bits
|
||||
// a=00, c=01, g=10, t=11
|
||||
|
||||
mask := (1 << (wordSize * 2)) - 1 // Mask to keep only last wordSize*2 bits
|
||||
|
||||
// Initialize first word (all nucleotides except the last one)
|
||||
word_index := 0
|
||||
for i := 0; i < wordSize-1; i++ {
|
||||
word_index = (word_index << 2) + int(obikmer.EncodeNucleotide(sequence[i]))
|
||||
}
|
||||
|
||||
// Encode all words with sliding window
|
||||
for i, j := 0, wordSize-1; i < end; i, j = i+1, j+1 {
|
||||
// Shift left by 2 bits, mask, and add new nucleotide
|
||||
word_index = ((word_index << 2) & mask) + int(obikmer.EncodeNucleotide(sequence[j]))
|
||||
|
||||
// *** CIRCULAR NORMALIZATION ***
|
||||
// Convert word to its canonical form (smallest by circular rotation)
|
||||
// This is where "atg", "tga", "gat" all become "atg"
|
||||
// Now using uint64-based NormalizeCircular for better performance
|
||||
words[i] = int(obikmer.NormalizeCircular(uint64(word_index), wordSize))
|
||||
}
|
||||
|
||||
// ========================================================================
|
||||
// STEP 2: Calculate entropy for each k-mer with sliding window
|
||||
// ========================================================================
|
||||
s := 0 // Number of words processed in current k-mer
|
||||
sum_n_logn := 0.0 // Sum of n*log(n) for entropy calculation
|
||||
entropy := 1.0 // Current normalized entropy
|
||||
cleaned := true // Flag indicating if table has been cleaned
|
||||
|
||||
for i := range end {
|
||||
s++
|
||||
|
||||
switch {
|
||||
// CASE 1: Filling phase (fewer than nwords words collected)
|
||||
case s < nwords:
|
||||
cleaned = false
|
||||
table[words[i]]++ // Increment word frequency
|
||||
|
||||
// CASE 2: Position contains an ambiguity
|
||||
case i >= (nwords-1) && maskPositions[i-nwords+1] < 0:
|
||||
entropies[i-nwords+1] = 4.0 // Mark entropy as invalid
|
||||
if !cleaned {
|
||||
cleanTable(table, tableSize) // Reset table
|
||||
}
|
||||
cleaned = true
|
||||
s = 0
|
||||
sum_n_logn = 0.0
|
||||
|
||||
// CASE 3: First complete k-mer (s == nwords)
|
||||
case s == nwords:
|
||||
cleaned = false
|
||||
table[words[i]]++
|
||||
|
||||
// Calculate Shannon entropy: H = -Σ p(i)*log(p(i))
|
||||
// = log(N) - (1/N)*Σ n(i)*log(n(i))
|
||||
// where N = nwords, n(i) = frequency of word i
|
||||
//
|
||||
// NOTE: We iterate over entire table (tableSize = 4^wordSize) to count all frequencies.
|
||||
// Canonical codes are not contiguous (e.g., for k=2: {0,1,2,3,5,6,7,10,11,15})
|
||||
// so we must scan the full table even though only ~10 entries will be non-zero
|
||||
sum_n_logn = 0
|
||||
for j := range tableSize {
|
||||
n := float64(table[j])
|
||||
if n > 0 {
|
||||
sum_n_logn += n * math.Log(n)
|
||||
}
|
||||
}
|
||||
// Normalized entropy = observed entropy / maximum entropy
|
||||
entropy = (log_nwords - sum_n_logn/float_nwords) / entropyMax
|
||||
|
||||
// CASE 4: Sliding window (s > nwords)
|
||||
// Incremental update of entropy by adding a new word
|
||||
// and removing the old one
|
||||
case s > nwords:
|
||||
cleaned = false
|
||||
|
||||
new_word := words[i]
|
||||
old_word := words[i-nwords]
|
||||
|
||||
// Optimization: only recalculate if word changes
|
||||
if old_word != new_word {
|
||||
table[new_word]++
|
||||
table[old_word]--
|
||||
|
||||
n_old := float64(table[old_word])
|
||||
n_new := float64(table[new_word])
|
||||
|
||||
// Incremental update of sum_n_logn
|
||||
// Remove contribution of old word (before decrement)
|
||||
sum_n_logn -= (n_old + 1) * math.Log(n_old+1)
|
||||
// Add contribution of old word (after decrement)
|
||||
if n_old > 0 {
|
||||
sum_n_logn += n_old * math.Log(n_old)
|
||||
}
|
||||
// Add contribution of new word (after increment)
|
||||
if n_new > 0 {
|
||||
sum_n_logn += n_new * math.Log(n_new)
|
||||
}
|
||||
// Remove contribution of new word (before increment)
|
||||
if n_new > 1 {
|
||||
sum_n_logn -= (n_new - 1) * math.Log(n_new-1)
|
||||
}
|
||||
}
|
||||
|
||||
entropy = (log_nwords - sum_n_logn/float_nwords) / entropyMax
|
||||
}
|
||||
|
||||
// Store entropy for position corresponding to start of k-mer
|
||||
if s >= nwords && maskPositions[i-nwords+1] >= 0 {
|
||||
if entropy < 0 {
|
||||
entropy = 0
|
||||
|
||||
}
|
||||
entropy = math.Round(entropy*10000) / 10000
|
||||
entropies[i-nwords+1] = entropy
|
||||
}
|
||||
}
|
||||
|
||||
// ========================================================================
|
||||
// STEP 3: Apply sliding min filter
|
||||
// ========================================================================
|
||||
// Replace each entropy with minimum in window of size kmer_size
|
||||
// This allows robust detection of low-complexity regions
|
||||
slidingMin(entropies, kmer_size)
|
||||
// log.Warnf("%v\n%v", e, entropies)
|
||||
}
|
||||
|
||||
// ========================================================================
|
||||
// FUNCTION 6: applyMaskMode - Apply masking to sequence
|
||||
// ========================================================================
|
||||
applyMaskMode := func(sequence *obiseq.BioSequence, maskPositions []bool, mask byte) (obiseq.BioSequenceSlice, error) {
|
||||
// Create copy to avoid modifying original
|
||||
seqCopy := sequence.Copy()
|
||||
sequenceBytes := seqCopy.Sequence()
|
||||
|
||||
// Mask identified positions
|
||||
for i := range sequenceBytes {
|
||||
if maskPositions[i] {
|
||||
// Operation &^ 32 converts to UPPERCASE (clears bit 5)
|
||||
// sequenceBytes[i] = sequenceBytes[i] &^ 32
|
||||
sequenceBytes[i] = mask
|
||||
}
|
||||
}
|
||||
|
||||
return obiseq.BioSequenceSlice{seqCopy}, nil
|
||||
}
|
||||
|
||||
selectMasked := func(sequence *obiseq.BioSequence, maskPosition []bool) (obiseq.BioSequenceSlice, error) {
|
||||
rep := obiseq.NewBioSequenceSlice()
|
||||
|
||||
inlow := false
|
||||
fromlow := -1
|
||||
for i, masked := range maskPosition {
|
||||
if masked && !inlow {
|
||||
fromlow = i
|
||||
inlow = true
|
||||
}
|
||||
if inlow && !masked {
|
||||
if fromlow >= 0 {
|
||||
frg, err := sequence.Subsequence(fromlow, i, false)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
rep.Push(frg)
|
||||
}
|
||||
inlow = false
|
||||
fromlow = -1
|
||||
}
|
||||
}
|
||||
|
||||
// Handle the case where we end in a masked region
|
||||
if inlow && fromlow >= 0 {
|
||||
frg, err := sequence.Subsequence(fromlow, len(maskPosition), false)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
rep.Push(frg)
|
||||
}
|
||||
|
||||
return *rep, nil
|
||||
}
|
||||
|
||||
selectunmasked := func(sequence *obiseq.BioSequence, maskPosition []bool) (obiseq.BioSequenceSlice, error) {
|
||||
rep := obiseq.NewBioSequenceSlice()
|
||||
|
||||
inhigh := false
|
||||
fromhigh := -1
|
||||
for i, masked := range maskPosition {
|
||||
if !masked && !inhigh {
|
||||
fromhigh = i
|
||||
inhigh = true
|
||||
}
|
||||
if inhigh && masked {
|
||||
if fromhigh >= 0 {
|
||||
frg, err := sequence.Subsequence(fromhigh, i, false)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
rep.Push(frg)
|
||||
}
|
||||
inhigh = false
|
||||
fromhigh = -1
|
||||
}
|
||||
}
|
||||
|
||||
// Handle the case where we end in an unmasked region
|
||||
if inhigh && fromhigh >= 0 {
|
||||
frg, err := sequence.Subsequence(fromhigh, len(maskPosition), false)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
rep.Push(frg)
|
||||
}
|
||||
|
||||
return *rep, nil
|
||||
}
|
||||
|
||||
// ========================================================================
|
||||
// FUNCTION 7: masking - Main masking function
|
||||
// ========================================================================
|
||||
// Calculates entropies at all scales and masks positions
|
||||
// whose minimum entropy is below the threshold.
|
||||
masking := func(sequence *obiseq.BioSequence) (obiseq.BioSequenceSlice, error) {
|
||||
if sequence.Len() < kmer_size {
|
||||
sequence.SetAttribute("obilowmask_error", "Sequence too short")
|
||||
remove := make([]bool, sequence.Len())
|
||||
for i := range remove {
|
||||
remove[i] = true
|
||||
}
|
||||
return applyMaskMode(sequence, remove, maskChar)
|
||||
}
|
||||
|
||||
bseq := sequence.Sequence()
|
||||
|
||||
// Identify ambiguities
|
||||
maskPositions := maskAmbiguities(bseq)
|
||||
|
||||
// Initialize data structures
|
||||
mask := make([]int, len(bseq)) // Stores scale detecting minimum entropy
|
||||
entropies := make([]float64, len(bseq)) // Minimum entropy at each position
|
||||
for i := range entropies {
|
||||
entropies[i] = 4.0 // Very high initial value
|
||||
}
|
||||
|
||||
freqs := make([]int, 1<<(2*level_max)) // Frequency table (max size)
|
||||
words := make([]int, len(bseq)) // Buffer for encoded words
|
||||
|
||||
// ========================================================================
|
||||
// Calculate entropy at maximum scale (level_max)
|
||||
// ========================================================================
|
||||
computeEntropies(bseq, maskPositions, entropies, freqs, words, level_max)
|
||||
|
||||
// Initialize mask with level_max everywhere (except ambiguities)
|
||||
for i := range bseq {
|
||||
v := level_max
|
||||
// if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' {
|
||||
// v = 0
|
||||
// }
|
||||
mask[i] = v
|
||||
}
|
||||
|
||||
// ========================================================================
|
||||
// Calculate entropy at lower scales
|
||||
// ========================================================================
|
||||
entropies2 := make([]float64, len(bseq))
|
||||
|
||||
for ws := level_max - 1; ws > 0; ws-- {
|
||||
// *** WARNING: POTENTIAL BUG ***
|
||||
// The parameter passed is level_max instead of ws!
|
||||
// This means we always recalculate with the same scale
|
||||
// Should be: computeEntropies(bseq, maskPositions, entropies2, freqs, words, ws)
|
||||
computeEntropies(bseq, maskPositions, entropies2, freqs, words, ws)
|
||||
// Keep minimum entropy and corresponding scale
|
||||
for i, e2 := range entropies2 {
|
||||
if e2 < entropies[i] {
|
||||
entropies[i] = e2
|
||||
mask[i] = ws
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// Force entropy to 0 for ambiguous positions
|
||||
for i, nuc := range bseq {
|
||||
if nuc != 'a' && nuc != 'c' && nuc != 'g' && nuc != 't' {
|
||||
entropies[i] = 0
|
||||
}
|
||||
}
|
||||
|
||||
// ========================================================================
|
||||
// Identify positions to mask
|
||||
// ========================================================================
|
||||
remove := make([]bool, len(entropies))
|
||||
for i, e := range entropies {
|
||||
remove[i] = e <= threshold
|
||||
}
|
||||
|
||||
// Save metadata in sequence attributes
|
||||
sequence.SetAttribute("mask", mask)
|
||||
sequence.SetAttribute("Entropies", entropies)
|
||||
|
||||
switch mode {
|
||||
case Mask:
|
||||
return applyMaskMode(sequence, remove, maskChar)
|
||||
case Split:
|
||||
return selectunmasked(sequence, remove)
|
||||
case Extract:
|
||||
return selectMasked(sequence, remove)
|
||||
}
|
||||
return nil, fmt.Errorf("Unknown mode %d", mode)
|
||||
}
|
||||
|
||||
return masking
|
||||
}
|
||||
|
||||
// CLISequenceEntropyMasker creates an iterator that applies entropy masking
|
||||
// to all sequences in an input iterator.
|
||||
//
|
||||
// Uses command-line parameters to configure the worker.
|
||||
func CLISequenceEntropyMasker(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
var newIter obiiter.IBioSequence
|
||||
|
||||
worker := LowMaskWorker(
|
||||
CLIKmerSize(),
|
||||
CLILevelMax(),
|
||||
CLIThreshold(),
|
||||
CLIMaskingMode(),
|
||||
CLIMaskingChar(),
|
||||
)
|
||||
|
||||
// Apply worker in parallel
|
||||
newIter = iterator.MakeIWorker(worker, false, obidefault.ParallelWorkers())
|
||||
|
||||
// Filter resulting empty sequences
|
||||
return newIter.FilterEmpty()
|
||||
}
|
||||
@@ -1,81 +0,0 @@
|
||||
package obilowmask
|
||||
|
||||
import (
|
||||
"strings"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
)
|
||||
|
||||
var __kmer_size__ = 31
|
||||
var __level_max__ = 6
|
||||
var __threshold__ = 0.5
|
||||
var __split_mode__ = false
|
||||
var __low_mode__ = false
|
||||
var __mask__ = "."
|
||||
|
||||
func LowMaskOptionSet(options *getoptions.GetOpt) {
|
||||
|
||||
options.IntVar(&__kmer_size__, "kmer-size", __kmer_size__,
|
||||
options.Description("Size of the kmer considered to estimate entropy."),
|
||||
)
|
||||
|
||||
options.IntVar(&__level_max__, "entropy_size", __level_max__,
|
||||
options.Description("Maximum word size considered for entropy estimate"),
|
||||
)
|
||||
|
||||
options.Float64Var(&__threshold__, "threshold", __threshold__,
|
||||
options.Description("entropy theshold used to mask a kmer"),
|
||||
)
|
||||
|
||||
options.BoolVar(&__split_mode__, "split-mode", __split_mode__,
|
||||
options.Description("in split mode, input sequences are splitted to remove masked regions"),
|
||||
)
|
||||
|
||||
options.BoolVar(&__low_mode__, "low-mode", __low_mode__,
|
||||
options.Description("in split mode, input sequences are splitted to remove masked regions"),
|
||||
)
|
||||
|
||||
options.StringVar(&__mask__, "masking-char", __mask__,
|
||||
options.Description("Character used to mask low complexity region"),
|
||||
)
|
||||
}
|
||||
|
||||
func OptionSet(options *getoptions.GetOpt) {
|
||||
LowMaskOptionSet(options)
|
||||
obiconvert.InputOptionSet(options)
|
||||
obiconvert.OutputOptionSet(options)
|
||||
}
|
||||
|
||||
func CLIKmerSize() int {
|
||||
return __kmer_size__
|
||||
}
|
||||
|
||||
func CLILevelMax() int {
|
||||
return __level_max__
|
||||
}
|
||||
|
||||
func CLIThreshold() float64 {
|
||||
return __threshold__
|
||||
}
|
||||
|
||||
func CLIMaskingMode() MaskingMode {
|
||||
switch {
|
||||
case __low_mode__:
|
||||
return Extract
|
||||
case __split_mode__:
|
||||
return Split
|
||||
default:
|
||||
return Mask
|
||||
}
|
||||
}
|
||||
|
||||
func CLIMaskingChar() byte {
|
||||
mask := strings.TrimSpace(__mask__)
|
||||
if len(mask) != 1 {
|
||||
log.Fatalf("--masking-char option accept a single character, not %s", mask)
|
||||
}
|
||||
return []byte(mask)[0]
|
||||
}
|
||||
@@ -207,6 +207,8 @@ func IndexFamilyDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
|
||||
log.Infof("Done. Found %d clusters", clusters.Len())
|
||||
|
||||
var bar *progressbar.ProgressBar
|
||||
if obidefault.ProgressBar() {
|
||||
pbopt := make([]progressbar.Option, 0, 5)
|
||||
pbopt = append(pbopt,
|
||||
progressbar.OptionSetWriter(os.Stderr),
|
||||
@@ -216,7 +218,8 @@ func IndexFamilyDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
progressbar.OptionSetDescription("Cluster indexing"),
|
||||
)
|
||||
|
||||
bar := progressbar.NewOptions(len(clusters), pbopt...)
|
||||
bar = progressbar.NewOptions(len(clusters), pbopt...)
|
||||
}
|
||||
|
||||
limits := make(chan [2]int)
|
||||
waiting := sync.WaitGroup{}
|
||||
@@ -233,9 +236,11 @@ func IndexFamilyDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
for i := l[0]; i < l[1]; i++ {
|
||||
idx := IndexSequence(i, clusters, &kcluster, taxa, taxonomy)
|
||||
clusters[i].SetOBITagRefIndex(idx)
|
||||
if bar != nil {
|
||||
bar.Add(1)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
waiting.Done()
|
||||
}
|
||||
|
||||
@@ -239,6 +239,8 @@ func IndexReferenceDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
|
||||
log.Info("done")
|
||||
|
||||
var bar *progressbar.ProgressBar
|
||||
if obidefault.ProgressBar() {
|
||||
pbopt := make([]progressbar.Option, 0, 5)
|
||||
pbopt = append(pbopt,
|
||||
progressbar.OptionSetWriter(os.Stderr),
|
||||
@@ -248,7 +250,8 @@ func IndexReferenceDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
progressbar.OptionSetDescription("[Sequence Processing]"),
|
||||
)
|
||||
|
||||
bar := progressbar.NewOptions(len(references), pbopt...)
|
||||
bar = progressbar.NewOptions(len(references), pbopt...)
|
||||
}
|
||||
|
||||
limits := make(chan [2]int)
|
||||
indexed := obiiter.MakeIBioSequence()
|
||||
@@ -267,8 +270,10 @@ func IndexReferenceDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
iref := references[i].Copy()
|
||||
iref.SetOBITagRefIndex(idx)
|
||||
sl = append(sl, iref)
|
||||
if bar != nil {
|
||||
bar.Add(1)
|
||||
}
|
||||
}
|
||||
indexed.Push(obiiter.MakeBioSequenceBatch(source, l[0]/10, sl))
|
||||
}
|
||||
|
||||
|
||||
199
release_notes.sh
Executable file
199
release_notes.sh
Executable file
@@ -0,0 +1,199 @@
|
||||
#!/bin/bash
|
||||
|
||||
# Generate GitHub-compatible release notes for an OBITools4 version.
|
||||
#
|
||||
# Usage:
|
||||
# ./release_notes.sh # latest version
|
||||
# ./release_notes.sh -v 4.4.15 # specific version
|
||||
# ./release_notes.sh -l # list available versions
|
||||
# ./release_notes.sh -r # raw commit list (no LLM)
|
||||
# ./release_notes.sh -c -v 4.4.16 # show LLM context for a version
|
||||
|
||||
GITHUB_REPO="metabarcoding/obitools4"
|
||||
GITHUB_API="https://api.github.com/repos/${GITHUB_REPO}"
|
||||
VERSION=""
|
||||
LIST_VERSIONS=false
|
||||
RAW_MODE=false
|
||||
CONTEXT_MODE=false
|
||||
LLM_MODEL="ollama:qwen3-coder-next:latest"
|
||||
|
||||
# ── Helpers ──────────────────────────────────────────────────────────────
|
||||
|
||||
die() { echo "Error: $*" >&2; exit 1; }
|
||||
|
||||
display_help() {
|
||||
cat <<EOF
|
||||
Usage: $(basename "$0") [OPTIONS]
|
||||
|
||||
Generate GitHub-compatible Markdown release notes for an OBITools4 version.
|
||||
|
||||
Options:
|
||||
-v, --version VERSION Target version (e.g., 4.4.15). Default: latest.
|
||||
-l, --list List all available versions and exit.
|
||||
-r, --raw Output raw commit list without LLM summarization.
|
||||
-c, --context Show the exact context (commits + prompt) sent to the LLM.
|
||||
-m, --model MODEL LLM model for orla (default: $LLM_MODEL).
|
||||
-h, --help Display this help message.
|
||||
|
||||
Examples:
|
||||
$(basename "$0") # release notes for the latest version
|
||||
$(basename "$0") -v 4.4.15 # release notes for a specific version
|
||||
$(basename "$0") -l # list versions
|
||||
$(basename "$0") -r -v 4.4.15 # raw commit log for a version
|
||||
$(basename "$0") -c -v 4.4.16 # show LLM context for a version
|
||||
EOF
|
||||
}
|
||||
|
||||
# Fetch all Release tags from GitHub API (sorted newest first)
|
||||
fetch_versions() {
|
||||
curl -sf "${GITHUB_API}/releases" \
|
||||
| grep '"tag_name":' \
|
||||
| sed -E 's/.*"tag_name": "Release_([0-9.]+)".*/\1/' \
|
||||
| sort -V -r
|
||||
}
|
||||
|
||||
# ── Parse arguments ──────────────────────────────────────────────────────
|
||||
|
||||
while [ "$#" -gt 0 ]; do
|
||||
case "$1" in
|
||||
-v|--version) VERSION="$2"; shift 2 ;;
|
||||
-l|--list) LIST_VERSIONS=true; shift ;;
|
||||
-r|--raw) RAW_MODE=true; shift ;;
|
||||
-c|--context) CONTEXT_MODE=true; shift ;;
|
||||
-m|--model) LLM_MODEL="$2"; shift 2 ;;
|
||||
-h|--help) display_help; exit 0 ;;
|
||||
*) die "Unsupported option: $1" ;;
|
||||
esac
|
||||
done
|
||||
|
||||
# ── List mode ────────────────────────────────────────────────────────────
|
||||
|
||||
if [ "$LIST_VERSIONS" = true ]; then
|
||||
echo "Available OBITools4 versions:" >&2
|
||||
echo "==============================" >&2
|
||||
fetch_versions
|
||||
exit 0
|
||||
fi
|
||||
|
||||
# ── Resolve versions ─────────────────────────────────────────────────────
|
||||
|
||||
all_versions=$(fetch_versions)
|
||||
[ -z "$all_versions" ] && die "Could not fetch versions from GitHub"
|
||||
|
||||
if [ -z "$VERSION" ]; then
|
||||
VERSION=$(echo "$all_versions" | head -1)
|
||||
echo "Using latest version: $VERSION" >&2
|
||||
fi
|
||||
|
||||
tag_name="Release_${VERSION}"
|
||||
|
||||
# Verify the requested version exists
|
||||
if ! echo "$all_versions" | grep -qx "$VERSION"; then
|
||||
die "Version $VERSION not found. Use -l to list available versions."
|
||||
fi
|
||||
|
||||
# Find the previous version (the one right after in the sorted-descending list)
|
||||
previous_version=$(echo "$all_versions" | grep -A1 -x "$VERSION" | tail -1)
|
||||
|
||||
if [ "$previous_version" = "$VERSION" ] || [ -z "$previous_version" ]; then
|
||||
previous_tag=""
|
||||
echo "No previous version found -- will include all commits for $tag_name" >&2
|
||||
else
|
||||
previous_tag="Release_${previous_version}"
|
||||
echo "Generating notes: $previous_tag -> $tag_name" >&2
|
||||
fi
|
||||
|
||||
# ── Fetch commit messages between tags via GitHub compare API ────────────
|
||||
|
||||
if [ -n "$previous_tag" ]; then
|
||||
commits_json=$(curl -sf "${GITHUB_API}/compare/${previous_tag}...${tag_name}")
|
||||
if [ -z "$commits_json" ]; then
|
||||
die "Could not fetch commit comparison from GitHub"
|
||||
fi
|
||||
commit_list=$(echo "$commits_json" \
|
||||
| jq -r '.commits[] | (.sha[:8] + " " + (.commit.message | split("\n")[0]))' 2>/dev/null)
|
||||
else
|
||||
# First release: get commits up to this tag
|
||||
commits_json=$(curl -sf "${GITHUB_API}/commits?sha=${tag_name}&per_page=50")
|
||||
if [ -z "$commits_json" ]; then
|
||||
die "Could not fetch commits from GitHub"
|
||||
fi
|
||||
commit_list=$(echo "$commits_json" \
|
||||
| jq -r '.[] | (.sha[:8] + " " + (.commit.message | split("\n")[0]))' 2>/dev/null)
|
||||
fi
|
||||
|
||||
if [ -z "$commit_list" ]; then
|
||||
die "No commits found between $previous_tag and $tag_name"
|
||||
fi
|
||||
|
||||
# ── LLM prompt (shared by context mode and summarization) ────────────────
|
||||
|
||||
LLM_PROMPT="Summarize the following commits into a GitHub release note for version ${VERSION}. \
|
||||
Ignore commits related to version bumps, .gitignore changes, or any internal housekeeping \
|
||||
that is irrelevant to end users. Describe each user-facing change precisely without exposing \
|
||||
code. Eliminate redundancy. Output strictly valid JSON with no surrounding text, using this \
|
||||
exact schema: {\"title\": \"<short release title>\", \"body\": \"<detailed markdown release notes>\"}"
|
||||
|
||||
# ── Raw mode: just output the commit list ────────────────────────────────
|
||||
|
||||
if [ "$RAW_MODE" = true ]; then
|
||||
echo "# Release ${VERSION}"
|
||||
echo ""
|
||||
echo "## Commits"
|
||||
echo ""
|
||||
echo "$commit_list" | while IFS= read -r line; do
|
||||
echo "- ${line}"
|
||||
done
|
||||
exit 0
|
||||
fi
|
||||
|
||||
# ── Context mode: show what would be sent to the LLM ────────────────────
|
||||
|
||||
if [ "$CONTEXT_MODE" = true ]; then
|
||||
echo "=== LLM Model ==="
|
||||
echo "$LLM_MODEL"
|
||||
echo ""
|
||||
echo "=== Prompt ==="
|
||||
echo "$LLM_PROMPT"
|
||||
echo ""
|
||||
echo "=== Stdin (commit list) ==="
|
||||
echo "$commit_list"
|
||||
exit 0
|
||||
fi
|
||||
|
||||
# ── LLM summarization ───────────────────────────────────────────────────
|
||||
|
||||
if ! command -v orla >/dev/null 2>&1; then
|
||||
die "orla is required for LLM summarization. Use -r for raw output."
|
||||
fi
|
||||
|
||||
if ! command -v jq >/dev/null 2>&1; then
|
||||
die "jq is required for JSON parsing. Use -r for raw output."
|
||||
fi
|
||||
|
||||
echo "Summarizing with LLM ($LLM_MODEL)..." >&2
|
||||
|
||||
raw_output=$(echo "$commit_list" | \
|
||||
ORLA_MAX_TOOL_CALLS=50 orla agent -m "$LLM_MODEL" \
|
||||
"$LLM_PROMPT" \
|
||||
2>/dev/null) || true
|
||||
|
||||
if [ -z "$raw_output" ]; then
|
||||
echo "Warning: LLM returned empty output, falling back to raw mode" >&2
|
||||
exec "$0" -r -v "$VERSION"
|
||||
fi
|
||||
|
||||
# Sanitize: extract JSON object, strip control characters
|
||||
sanitized=$(echo "$raw_output" | sed -n '/^{/,/^}/p' | tr -d '\000-\011\013-\014\016-\037')
|
||||
|
||||
release_title=$(echo "$sanitized" | jq -r '.title // empty' 2>/dev/null)
|
||||
release_body=$(echo "$sanitized" | jq -r '.body // empty' 2>/dev/null)
|
||||
|
||||
if [ -n "$release_title" ] && [ -n "$release_body" ]; then
|
||||
echo "# ${release_title}"
|
||||
echo ""
|
||||
echo "$release_body"
|
||||
else
|
||||
echo "Warning: JSON parsing failed, falling back to raw mode" >&2
|
||||
exec "$0" -r -v "$VERSION"
|
||||
fi
|
||||
@@ -1 +1 @@
|
||||
4.4.7
|
||||
4.4.17
|
||||
|
||||
Reference in New Issue
Block a user