[4.4.2] Enhanced taxonomy handling, input robustness & PCR tag validation

- **obiconvert**: Added `--raw-taxid` mode to output numeric taxIDs without formatting (e.g., "12345" instead of ":tax:NCBI_0987@species"). Introduced `TaxNode.FullString()` to reliably return full formatted strings regardless of global settings, and improved fallback behavior when taxonomy DB is unavailable.
- **ngsfilter**: Input fields (primers, sample tags/IDs) are now automatically trimmed of leading/trailing whitespace to prevent parsing failures from inconsistent formatting.
- **obitools (pcrtag)**: Mismatch-related fields (`forward_mismatches`, `reverse_mishaps`) renamed to "error" for consistency across annotation dictionaries.
- **obipairing & obtagpcr**: Enforced mandatory paired-end file input (`--forward` and `reverse`) in obipairing; added CLI support for generating config templates via AskConfigTemplate(); removed redundant `Required()` constraints and introduced helper function CLIHasPairedFiles().

.github/workflows/obitest.yml

@@ -10,10 +10,10 @@ jobs:
     runs-on: ubuntu-latest
     steps:
     - name: Setup Go
-      uses: actions/setup-go@v2
+      uses: actions/setup-go@v5
       with:
         go-version: '1.23'
     - name: Checkout obitools4 project
-      uses: actions/checkout@v4
+      uses: actions/checkout@v5
     - name: Run tests
       run: make githubtests

.github/workflows/release.yml

@@ -16,9 +16,9 @@ jobs:
       - name: Setup Go
         uses: actions/setup-go@v5
         with:
-          go-version: "1.23"
+          go-version: "1.26"
       - name: Checkout obitools4 project
-        uses: actions/checkout@v4
+        uses: actions/checkout@v5
       - name: Run tests
         run: make githubtests
 
@@ -49,12 +49,12 @@ jobs:
 
     steps:
       - name: Checkout code
-        uses: actions/checkout@v4
+        uses: actions/checkout@v5
 
       - name: Setup Go
         uses: actions/setup-go@v5
         with:
-          go-version: "1.23"
+          go-version: "1.26"
 
       - name: Extract version from tag
         id: get_version
@@ -62,12 +62,6 @@ jobs:
           TAG=${GITHUB_REF#refs/tags/Release_}
           echo "version=$TAG" >> $GITHUB_OUTPUT
 
-      - name: Install build tools (Linux)
-        if: runner.os == 'Linux'
-        run: |
-          sudo apt-get update -q
-          sudo apt-get install -y musl-tools zlib1g-dev
-
       - name: Install build tools (macOS)
         if: runner.os == 'macOS'
         run: |
@@ -75,21 +69,30 @@ jobs:
           xcode-select --install 2>/dev/null || true
           xcode-select -p
 
-      - name: Build binaries
+      - name: Build binaries (Linux)
+        if: runner.os == 'Linux'
+        env:
+          VERSION: ${{ steps.get_version.outputs.version }}
+        run: |
+          docker run --rm \
+            -v "$(pwd):/src" \
+            -w /src \
+            -e VERSION="${VERSION}" \
+            golang:1.26-alpine \
+            sh -c "apk add --no-cache gcc musl-dev zlib-dev zlib-static make && \
+                   make LDFLAGS='-linkmode=external -extldflags=-static' obitools"
+          mkdir -p artifacts
+          tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
+
+      - name: Build binaries (macOS)
+        if: runner.os == 'macOS'
         env:
           GOOS: ${{ matrix.goos }}
           GOARCH: ${{ matrix.goarch }}
           VERSION: ${{ steps.get_version.outputs.version }}
-          CC: ${{ matrix.goos == 'linux' && 'musl-gcc' || '' }}
-          CGO_CFLAGS: ${{ matrix.goos == 'linux' && '-I/usr/include' || '' }}
         run: |
-          if [ "$GOOS" = "linux" ]; then
-            make LDFLAGS='-linkmode=external -extldflags=-static' obitools
-          else
           make obitools
-          fi
           mkdir -p artifacts
-          # Create a single tar.gz with all binaries for this platform
           tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
 
       - name: Upload artifacts
@@ -104,7 +107,7 @@ jobs:
     runs-on: ubuntu-latest
     steps:
       - name: Checkout code
-        uses: actions/checkout@v4
+        uses: actions/checkout@v5
         with:
           fetch-depth: 0
 

.gitignore

@@ -23,7 +23,7 @@ xx
 /.vscode
 /build
 /bugs
-
+autodoc
 /ncbitaxo
 
 !/obitests/**

cmd/obitools/obipairing/main.go

@@ -37,6 +37,11 @@ func main() {
 
 	optionParser(os.Args)
 
+	if !obipairing.CLIHasPairedFiles() {
+		log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
+		os.Exit(1)
+	}
+
 	obidefault.SetStrictReadWorker(2)
 	obidefault.SetStrictWriteWorker(2)
 	pairs, err := obipairing.CLIPairedSequence()

cmd/obitools/obitagpcr/main.go

@@ -1,6 +1,7 @@
 package main
 
 import (
+	"fmt"
 	"os"
 
 	log "github.com/sirupsen/logrus"
@@ -8,6 +9,7 @@ import (
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obimultiplex"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipairing"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitagpcr"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
@@ -39,6 +41,17 @@ func main() {
 		obitagpcr.OptionSet)
 
 	optionParser(os.Args)
+
+	if obimultiplex.CLIAskConfigTemplate() {
+		fmt.Print(obimultiplex.CLIConfigTemplate())
+		os.Exit(0)
+	}
+
+	if !obipairing.CLIHasPairedFiles() {
+		log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
+		os.Exit(1)
+	}
+
 	pairs, err := obipairing.CLIPairedSequence()
 
 	if err != nil {

entities.json

@@ -0,0 +1,10 @@
+{
+  "people": [
+    "Software",
+    "Agreement",
+    "Module"
+  ],
+  "projects": [
+    "Code"
+  ]
+}

go.mod

@@ -6,7 +6,7 @@ require (
 	github.com/DavidGamba/go-getoptions v0.33.0
 	github.com/PaesslerAG/gval v1.2.4
 	github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df
-	github.com/buger/jsonparser v1.1.1
+	github.com/buger/jsonparser v1.1.2
 	github.com/chen3feng/stl4go v0.1.1
 	github.com/dlclark/regexp2 v1.11.5
 	github.com/goccy/go-json v0.10.6

go.sum

@@ -6,8 +6,8 @@ github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi
 github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
 github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
 github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
-github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
+github.com/buger/jsonparser v1.1.2 h1:frqHqw7otoVbk5M8LlE/L7HTnIq2v9RX6EJ48i9AxJk=
-github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
+github.com/buger/jsonparser v1.1.2/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
 github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
 github.com/chen3feng/stl4go v0.1.1/go.mod h1:5ml3psLgETJjRJnMbPE+JiHLrCpt+Ajc2weeTECXzWU=
 github.com/chengxilo/virtualterm v1.0.4 h1:Z6IpERbRVlfB8WkOmtbHiDbBANU7cimRIof7mk9/PwM=

obitests/obitools/obiconvert/out_ecotag.fasta

@@ -0,0 +1,24 @@
+>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
+ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
+ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
+gcttaaaactcaaaggacttggcggtgctttatatccct
+>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
+ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
+gattaaacctcaaaggacttggcagtgctttatacccct
+>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
+ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
+gcttaaaactcaaaggacttggcggtgctttatatccct

obitests/obitools/obiconvert/taxonomy.csv

@@ -0,0 +1,48 @@
+taxid,parent,taxonomic_rank,scientific_name
+taxon:1 [root]@no rank,taxon:1 [root]@no rank,no rank,root
+taxon:131567 [cellular organisms]@cellular root,taxon:1 [root]@no rank,cellular root,cellular organisms
+taxon:2759 [Eukaryota]@domain,taxon:131567 [cellular organisms]@cellular root,domain,Eukaryota
+taxon:33154 [Opisthokonta]@clade,taxon:2759 [Eukaryota]@domain,clade,Opisthokonta
+taxon:33208 [Metazoa]@kingdom,taxon:33154 [Opisthokonta]@clade,kingdom,Metazoa
+taxon:6072 [Eumetazoa]@clade,taxon:33208 [Metazoa]@kingdom,clade,Eumetazoa
+taxon:33213 [Bilateria]@clade,taxon:6072 [Eumetazoa]@clade,clade,Bilateria
+taxon:33511 [Deuterostomia]@clade,taxon:33213 [Bilateria]@clade,clade,Deuterostomia
+taxon:7711 [Chordata]@phylum,taxon:33511 [Deuterostomia]@clade,phylum,Chordata
+taxon:89593 [Craniata]@subphylum,taxon:7711 [Chordata]@phylum,subphylum,Craniata
+taxon:7742 [Vertebrata]@clade,taxon:89593 [Craniata]@subphylum,clade,Vertebrata
+taxon:7776 [Gnathostomata]@clade,taxon:7742 [Vertebrata]@clade,clade,Gnathostomata
+taxon:117570 [Teleostomi]@clade,taxon:7776 [Gnathostomata]@clade,clade,Teleostomi
+taxon:117571 [Euteleostomi]@clade,taxon:117570 [Teleostomi]@clade,clade,Euteleostomi
+taxon:8287 [Sarcopterygii]@superclass,taxon:117571 [Euteleostomi]@clade,superclass,Sarcopterygii
+taxon:1338369 [Dipnotetrapodomorpha]@clade,taxon:8287 [Sarcopterygii]@superclass,clade,Dipnotetrapodomorpha
+taxon:32523 [Tetrapoda]@clade,taxon:1338369 [Dipnotetrapodomorpha]@clade,clade,Tetrapoda
+taxon:32524 [Amniota]@clade,taxon:32523 [Tetrapoda]@clade,clade,Amniota
+taxon:40674 [Mammalia]@class,taxon:32524 [Amniota]@clade,class,Mammalia
+taxon:32525 [Theria]@clade,taxon:40674 [Mammalia]@class,clade,Theria
+taxon:9347 [Eutheria]@clade,taxon:32525 [Theria]@clade,clade,Eutheria
+taxon:1437010 [Boreoeutheria]@clade,taxon:9347 [Eutheria]@clade,clade,Boreoeutheria
+taxon:314146 [Euarchontoglires]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Euarchontoglires
+taxon:314145 [Laurasiatheria]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Laurasiatheria
+taxon:33554 [Carnivora]@order,taxon:314145 [Laurasiatheria]@superorder,order,Carnivora
+taxon:91561 [Artiodactyla]@order,taxon:314145 [Laurasiatheria]@superorder,order,Artiodactyla
+taxon:314147 [Glires]@clade,taxon:314146 [Euarchontoglires]@superorder,clade,Glires
+taxon:9845 [Ruminantia]@suborder,taxon:91561 [Artiodactyla]@order,suborder,Ruminantia
+taxon:35500 [Pecora]@infraorder,taxon:9845 [Ruminantia]@suborder,infraorder,Pecora
+taxon:9989 [Rodentia]@order,taxon:314147 [Glires]@clade,order,Rodentia
+taxon:379584 [Caniformia]@suborder,taxon:33554 [Carnivora]@order,suborder,Caniformia
+taxon:9608 [Canidae]@family,taxon:379584 [Caniformia]@suborder,family,Canidae
+taxon:9850 [Cervidae]@family,taxon:35500 [Pecora]@infraorder,family,Cervidae
+taxon:9881 [Odocoileinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Odocoileinae
+taxon:33553 [Sciuromorpha]@suborder,taxon:9989 [Rodentia]@order,suborder,Sciuromorpha
+taxon:55153 [Sciuridae]@family,taxon:33553 [Sciuromorpha]@suborder,family,Sciuridae
+taxon:34878 [Cervinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Cervinae
+taxon:9611 [Canis]@genus,taxon:9608 [Canidae]@family,genus,Canis
+taxon:9857 [Capreolus]@genus,taxon:9881 [Odocoileinae]@subfamily,genus,Capreolus
+taxon:9612 [Canis lupus]@species,taxon:9611 [Canis]@genus,species,Canis lupus
+taxon:337726 [Xerinae]@subfamily,taxon:55153 [Sciuridae]@family,subfamily,Xerinae
+taxon:9859 [Cervus]@genus,taxon:34878 [Cervinae]@subfamily,genus,Cervus
+taxon:337730 [Marmotini]@tribe,taxon:337726 [Xerinae]@subfamily,tribe,Marmotini
+taxon:9992 [Marmota]@genus,taxon:337730 [Marmotini]@tribe,genus,Marmota
+taxon:9860 [Cervus elaphus]@species,taxon:9859 [Cervus]@genus,species,Cervus elaphus
+taxon:9615 [Canis lupus familiaris]@subspecies,taxon:9612 [Canis lupus]@species,subspecies,Canis lupus familiaris
+taxon:9858 [Capreolus capreolus]@species,taxon:9857 [Capreolus]@genus,species,Capreolus capreolus

obitests/obitools/obiconvert/test.sh

@@ -134,6 +134,130 @@ else
     ((failed++))
 fi
 
+
+# ------------------------------------------------------------------
+# --raw-taxid tests (no taxonomy loaded)
+# ------------------------------------------------------------------
+
+# Running test
+((ntest++))
+if obiconvert --raw-taxid "${TEST_DIR}/out_ecotag.fasta" \
+              > "${TMPDIR}/raw_taxid.fasta" 2>/dev/null
+then
+    log "$MCMD --raw-taxid: running OK"
+    ((success++))
+else
+    log "$MCMD --raw-taxid: running failed"
+    ((failed++))
+fi
+
+# Taxids must be bare numbers — no full-format "taxon:ID [Name]@rank" strings
+((ntest++))
+if grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
+then
+    log "$MCMD --raw-taxid: taxid format check failed (full-format taxid found)"
+    ((failed++))
+else
+    log "$MCMD --raw-taxid: taxid format OK (all taxids are bare numbers)"
+    ((success++))
+fi
+
+# --raw-taxid is idempotent: piping through a second obiconvert --raw-taxid must
+# produce bit-for-bit identical output.
+((ntest++))
+if obiconvert --raw-taxid "${TMPDIR}/raw_taxid.fasta" \
+              > "${TMPDIR}/raw_taxid2.fasta" 2>/dev/null
+then
+    log "$MCMD --raw-taxid piped: running OK"
+    ((success++))
+else
+    log "$MCMD --raw-taxid piped: running failed"
+    ((failed++))
+fi
+
+((ntest++))
+if diff "${TMPDIR}/raw_taxid.fasta" \
+        "${TMPDIR}/raw_taxid2.fasta" > /dev/null
+then
+    log "$MCMD --raw-taxid piped: idempotency OK"
+    ((success++))
+else
+    log "$MCMD --raw-taxid piped: idempotency failed (outputs differ)"
+    ((failed++))
+fi
+
+
+# ------------------------------------------------------------------
+# --taxonomy tests (full-format taxid, no --raw-taxid)
+# ------------------------------------------------------------------
+
+# Running test
+((ntest++))
+if obiconvert --taxonomy "${TEST_DIR}/taxonomy.csv" \
+              "${TEST_DIR}/out_ecotag.fasta" \
+              > "${TMPDIR}/taxo.fasta" 2>/dev/null
+then
+    log "$MCMD --taxonomy: running OK"
+    ((success++))
+else
+    log "$MCMD --taxonomy: running failed"
+    ((failed++))
+fi
+
+# Taxids must be in full "taxon:ID [Name]@rank" format
+((ntest++))
+if grep '"taxid"' "${TMPDIR}/taxo.fasta" | grep -q '"taxid":"taxon:[0-9]'
+then
+    log "$MCMD --taxonomy: taxid format OK (full-format taxids present)"
+    ((success++))
+else
+    log "$MCMD --taxonomy: taxid format check failed (no full-format taxid found)"
+    ((failed++))
+fi
+
+
+# ------------------------------------------------------------------
+# --raw-taxid --taxonomy tests
+# ------------------------------------------------------------------
+
+# Running test
+((ntest++))
+if obiconvert --raw-taxid --taxonomy "${TEST_DIR}/taxonomy.csv" \
+              "${TEST_DIR}/out_ecotag.fasta" \
+              > "${TMPDIR}/raw_taxid_taxo.fasta" 2>/dev/null
+then
+    log "$MCMD --raw-taxid --taxonomy: running OK"
+    ((success++))
+else
+    log "$MCMD --raw-taxid --taxonomy: running failed"
+    ((failed++))
+fi
+
+# Taxids must be bare numbers even when taxonomy is loaded
+((ntest++))
+if grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
+then
+    log "$MCMD --raw-taxid --taxonomy: taxid format check failed (full-format taxid found)"
+    ((failed++))
+else
+    log "$MCMD --raw-taxid --taxonomy: taxid format OK (all taxids are bare numbers)"
+    ((success++))
+fi
+
+# --raw-taxid with or without taxonomy must yield identical taxid values
+((ntest++))
+if diff <(grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
+        <(grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
+        > /dev/null
+then
+    log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values match OK"
+    ((success++))
+else
+    log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values differ (unexpected)"
+    ((failed++))
+fi
+
+
 #########################################
 #
 # At the end of the tests

obitests/obitools/obiconvert/xxx

@@ -0,0 +1,24 @@
+>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
+ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
+ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
+gcttaaaactcaaaggacttggcggtgctttatatccct
+>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
+ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
+gattaaacctcaaaggacttggcagtgctttatacccct
+>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
+ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
+gcttaaaactcaaaggacttggcggtgctttatatccct

pkg/obiformats/ngsfilter_read.go

@@ -631,9 +631,9 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
 			return nil, fmt.Errorf("row %d has %d columns, expected %d", len(data), len(fields), len(header))
 		}
 
-		forward_primer := fields[forward_primerColIndex]
+		forward_primer := strings.TrimSpace(fields[forward_primerColIndex])
-		reverse_primer := fields[reverse_primerColIndex]
+		reverse_primer := strings.TrimSpace(fields[reverse_primerColIndex])
-		tags := _parseMainNGSFilterTags(fields[sample_tagColIndex])
+		tags := _parseMainNGSFilterTags(strings.TrimSpace(fields[sample_tagColIndex]))
 
 		marker, _ := ngsfilter.GetMarker(forward_primer, reverse_primer)
 		pcr, ok := marker.GetPCR(tags.Forward, tags.Reverse)
@@ -644,8 +644,8 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
 					i, tags.Forward, tags.Reverse, forward_primer, reverse_primer)
 		}
 
-		pcr.Experiment = fields[experimentColIndex]
+		pcr.Experiment = strings.TrimSpace(fields[experimentColIndex])
-		pcr.Sample = fields[sampleColIndex]
+		pcr.Sample = strings.TrimSpace(fields[sampleColIndex])
 
 		if extraColumns != nil {
 			pcr.Annotations = make(obiseq.Annotation)

pkg/obiiter/distribute.go

@@ -57,34 +57,21 @@ func (dist *IDistribute) Classifier() *obiseq.BioSequenceClassifier {
 }
 
 // Distribute organizes the biosequences from the iterator into batches
-// based on the provided classifier and batch sizes. It returns an
+// based on the provided classifier. It returns an IDistribute instance
-// IDistribute instance that manages the distribution of the sequences.
+// that manages the distribution of the sequences.
 //
-// Parameters:
+// Batches are flushed when either BatchSizeMax() sequences or BatchMem()
-//   - class: A pointer to a BioSequenceClassifier used to classify
+// bytes are accumulated per key, mirroring the RebatchBySize strategy.
-//     the biosequences during distribution.
+func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier) IDistribute {
-//   - sizes: Optional integer values specifying the batch size. If
+	maxCount := obidefault.BatchSizeMax()
-//     no sizes are provided, a default batch size of 5000 is used.
+	maxBytes := obidefault.BatchMem()
-//
-// Returns:
-// An IDistribute instance that contains the outputs of the
-// classified biosequences, a channel for new data notifications,
-// and the classifier used for distribution. The method operates
-// asynchronously, processing the sequences in separate goroutines.
-// It ensures that the outputs are closed and cleaned up once
-// processing is complete.
-func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, sizes ...int) IDistribute {
-	batchsize := obidefault.BatchSize()
 
 	outputs := make(map[int]IBioSequence, 100)
 	slices := make(map[int]*obiseq.BioSequenceSlice, 100)
+	bufBytes := make(map[int]int, 100)
 	orders := make(map[int]int, 100)
 	news := make(chan int)
 
-	if len(sizes) > 0 {
-		batchsize = sizes[0]
-	}
-
 	jobDone := sync.WaitGroup{}
 	lock := sync.Mutex{}
 
@@ -115,6 +102,7 @@ func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, siz
 					slice = &s
 					slices[key] = slice
 					orders[key] = 0
+					bufBytes[key] = 0
 
 					lock.Lock()
 					outputs[key] = MakeIBioSequence()
@@ -123,14 +111,20 @@ func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, siz
 					news <- key
 				}
 
-				*slice = append(*slice, s)
+				sz := s.MemorySize()
-
+				countFull := maxCount > 0 && len(*slice) >= maxCount
-				if len(*slice) == batchsize {
+				memFull := maxBytes > 0 && bufBytes[key]+sz > maxBytes && len(*slice) > 0
+				if countFull || memFull {
 					outputs[key].Push(MakeBioSequenceBatch(source, orders[key], *slice))
 					orders[key]++
 					s := obiseq.MakeBioSequenceSlice()
 					slices[key] = &s
+					slice = &s
+					bufBytes[key] = 0
 				}
+
+				*slice = append(*slice, s)
+				bufBytes[key] += sz
 			}
 		}
 

pkg/obikmer/encodefourmer.go

@@ -47,7 +47,7 @@ func Encode4mer(seq *obiseq.BioSequence, buffer *[]byte) []byte {
 	length := slength - 3
 	rawseq := seq.Sequence()
 
-	if length < 0 {
+	if length <= 0 {
 		return nil
 	}
 

pkg/obilua/lua.go

@@ -91,7 +91,7 @@ func LuaWorker(proto *lua.FunctionProto) obiseq.SeqWorker {
 	err := interpreter.PCall(0, lua.MultRet, nil)
 
 	if err != nil {
-		log.Fatalf("Error in executing the lua script")
+		log.Fatalf("Error in executing the lua script: %v", err)
 	}
 
 	result := interpreter.GetGlobal("worker")
@@ -141,6 +141,69 @@ func LuaWorker(proto *lua.FunctionProto) obiseq.SeqWorker {
 	return nil
 }
 
+// LuaSliceWorker creates a SeqSliceWorker that calls the Lua function
+// named "slice_worker". Unlike LuaWorker, the entire batch (BioSequenceSlice)
+// is passed to the Lua function at once, enabling batch-level processing
+// (e.g. a single HTTP request per batch instead of one per sequence).
+//
+// The Lua function signature:
+//
+//	function slice_worker(slice)   -- receives a BioSequenceSlice
+//	    -- process the batch
+//	    return slice               -- returns a BioSequenceSlice (or nil)
+//	end
+func LuaSliceWorker(proto *lua.FunctionProto) obiseq.SeqSliceWorker {
+	interpreter := NewInterpreter()
+	lfunc := interpreter.NewFunctionFromProto(proto)
+	interpreter.Push(lfunc)
+	err := interpreter.PCall(0, lua.MultRet, nil)
+
+	if err != nil {
+		log.Fatalf("Error in executing the lua script: %v", err)
+	}
+
+	result := interpreter.GetGlobal("slice_worker")
+
+	if lua_worker, ok := result.(*lua.LFunction); ok {
+		f := func(slice obiseq.BioSequenceSlice) (obiseq.BioSequenceSlice, error) {
+			if err := interpreter.CallByParam(lua.P{
+				Fn:      lua_worker,
+				NRet:    1,
+				Protect: true,
+			}, obiseqslice2Lua(interpreter, &slice)); err != nil {
+				log.Fatal(err)
+			}
+
+			lreponse := interpreter.Get(-1)
+			defer interpreter.Pop(1)
+
+			if reponse, ok := lreponse.(*lua.LUserData); ok {
+				s := reponse.Value
+				switch val := s.(type) {
+				case *obiseq.BioSequenceSlice:
+					return *val, nil
+				case *obiseq.BioSequence:
+					return obiseq.BioSequenceSlice{val}, nil
+				default:
+					r := reflect.TypeOf(val)
+					return nil, fmt.Errorf("slice_worker function doesn't return the correct type %s", r)
+				}
+			}
+
+			if _, ok = lreponse.(*lua.LNilType); ok {
+				return nil, nil
+			}
+
+			return nil, fmt.Errorf("slice_worker function doesn't return the correct type %T", lreponse)
+		}
+
+		return f
+	}
+
+	log.Fatalf("The slice_worker object is not a function")
+	return nil
+}
+
 // LuaProcessor processes a Lua script on a sequence iterator and returns a new iterator.
 //
 // Parameters:
@@ -173,7 +236,7 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
 	err = interpreter.PCall(0, lua.MultRet, nil)
 
 	if err != nil {
-		log.Fatalf("Error in executing the lua script")
+		log.Fatalf("Error in executing the lua script: %v", err)
 	}
 
 	result := interpreter.GetGlobal("begin")
@@ -198,7 +261,7 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
 		err = interpreter.PCall(0, lua.MultRet, nil)
 
 		if err != nil {
-			log.Fatalf("Error in executing the lua script")
+			log.Fatalf("Error in executing the lua script: %v", err)
 		}
 
 		result := interpreter.GetGlobal("finish")
@@ -216,11 +279,27 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
 
 	}()
 
-	ff := func(iterator obiiter.IBioSequence) {
+	// Detect whether the script defines slice_worker (batch-level) or worker (per-sequence).
-		w := LuaWorker(proto)
+	hasSliceWorker := func() bool {
-		sw := obiseq.SeqToSliceWorker(w, false)
+		interpreter := NewInterpreter()
+		lfunc := interpreter.NewFunctionFromProto(proto)
+		interpreter.Push(lfunc)
+		if err := interpreter.PCall(0, lua.MultRet, nil); err != nil {
+			return false
+		}
+		result := interpreter.GetGlobal("slice_worker")
+		interpreter.Close()
+		_, ok := result.(*lua.LFunction)
+		return ok
+	}()
 
-		// iterator = iterator.SortBatches()
+	ff := func(iterator obiiter.IBioSequence) {
+		var sw obiseq.SeqSliceWorker
+		if hasSliceWorker {
+			sw = LuaSliceWorker(proto)
+		} else {
+			sw = obiseq.SeqToSliceWorker(LuaWorker(proto), false)
+		}
 
 		for iterator.Next() {
 			seqs := iterator.Get()
@@ -235,6 +314,10 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
 				}
 			}
 
+			if ns == nil {
+				ns = obiseq.BioSequenceSlice{}
+			}
+
 			newIter.Push(obiiter.MakeBioSequenceBatch(seqs.Source(), seqs.Order(), ns))
 		}
 

pkg/obilua/lua_push_interface.go

@@ -17,15 +17,7 @@ import (
 // No return values. This function operates directly on the Lua state stack.
 func pushInterfaceToLua(L *lua.LState, val interface{}) {
 	switch v := val.(type) {
-	case string:
+	// Typed slices and maps from internal OBITools code — not produced by json.Unmarshal
-		L.Push(lua.LString(v))
-	case bool:
-		L.Push(lua.LBool(v))
-	case int:
-		L.Push(lua.LNumber(v))
-	case float64:
-		L.Push(lua.LNumber(v))
-	// Add other cases as needed for different types
 	case map[string]int:
 		pushMapStringIntToLua(L, v)
 	case map[string]string:
@@ -34,8 +26,6 @@ func pushInterfaceToLua(L *lua.LState, val interface{}) {
 		pushMapStringBoolToLua(L, v)
 	case map[string]float64:
 		pushMapStringFloat64ToLua(L, v)
-	case map[string]interface{}:
-		pushMapStringInterfaceToLua(L, v)
 	case []string:
 		pushSliceStringToLua(L, v)
 	case []int:
@@ -46,63 +36,63 @@ func pushInterfaceToLua(L *lua.LState, val interface{}) {
 		pushSliceNumericToLua(L, v)
 	case []bool:
 		pushSliceBoolToLua(L, v)
-	case []interface{}:
-		pushSliceInterfaceToLua(L, v)
-	case nil:
-		L.Push(lua.LNil)
 	case *sync.Mutex:
 		pushMutexToLua(L, v)
 	default:
-		log.Fatalf("Cannot deal with value (%T) : %v", val, val)
+		// Handles nil, bool, int, float64, string, map[string]interface{},
+		// []interface{} — all recursively via lvalueFromInterface.
+		L.Push(lvalueFromInterface(L, v))
 	}
 }
 
 func pushMapStringInterfaceToLua(L *lua.LState, m map[string]interface{}) {
-	// Create a new Lua table
 	luaTable := L.NewTable()
-	// Iterate over the Go map and set the key-value pairs in the Lua table
 	for key, value := range m {
-		switch v := value.(type) {
+		L.SetField(luaTable, key, lvalueFromInterface(L, value))
-		case int:
-			luaTable.RawSetString(key, lua.LNumber(v))
-		case float64:
-			luaTable.RawSetString(key, lua.LNumber(v))
-		case bool:
-			luaTable.RawSetString(key, lua.LBool(v))
-		case string:
-			luaTable.RawSetString(key, lua.LString(v))
-		default:
-			log.Fatalf("Doesn't deal with map containing value %v of type %T", v, v)
 	}
-	}
-
-	// Push the Lua table onto the stack
 	L.Push(luaTable)
 }
 
 func pushSliceInterfaceToLua(L *lua.LState, s []interface{}) {
-	// Create a new Lua table
 	luaTable := L.NewTable()
-	// Iterate over the Go map and set the key-value pairs in the Lua table
 	for _, value := range s {
-		switch v := value.(type) {
+		luaTable.Append(lvalueFromInterface(L, value))
-		case int:
-			luaTable.Append(lua.LNumber(v))
-		case float64:
-			luaTable.Append(lua.LNumber(v))
-		case bool:
-			luaTable.Append(lua.LBool(v))
-		case string:
-			luaTable.Append(lua.LString(v))
-		default:
-			log.Fatalf("Doesn't deal with slice containing value %v of type %T", v, v)
 	}
-	}
-
-	// Push the Lua table onto the stack
 	L.Push(luaTable)
 }
 
+// lvalueFromInterface converts a Go interface{} value (as produced by json.Unmarshal)
+// to the corresponding lua.LValue, handling nested maps and slices recursively.
+func lvalueFromInterface(L *lua.LState, value interface{}) lua.LValue {
+	switch v := value.(type) {
+	case nil:
+		return lua.LNil
+	case bool:
+		return lua.LBool(v)
+	case int:
+		return lua.LNumber(v)
+	case float64:
+		return lua.LNumber(v)
+	case string:
+		return lua.LString(v)
+	case map[string]interface{}:
+		t := L.NewTable()
+		for key, val := range v {
+			L.SetField(t, key, lvalueFromInterface(L, val))
+		}
+		return t
+	case []interface{}:
+		t := L.NewTable()
+		for _, val := range v {
+			t.Append(lvalueFromInterface(L, val))
+		}
+		return t
+	default:
+		log.Fatalf("lvalueFromInterface: unsupported type %T: %v", v, v)
+		return lua.LNil
+	}
+}
+
 // pushMapStringIntToLua creates a new Lua table and iterates over the Go map to set key-value pairs in the Lua table. It then pushes the Lua table onto the stack.
 //
 // L *lua.LState - the Lua state

pkg/obilua/lua_table.go

@@ -28,6 +28,8 @@ func Table2Interface(interpreter *lua.LState, table *lua.LTable) interface{} {
 				val[i-1] = float64(v.(lua.LNumber))
 			case lua.LTString:
 				val[i-1] = string(v.(lua.LString))
+			case lua.LTTable:
+				val[i-1] = Table2Interface(interpreter, v.(*lua.LTable))
 			}
 		}
 		return val
@@ -45,6 +47,8 @@ func Table2Interface(interpreter *lua.LState, table *lua.LTable) interface{} {
 					val[string(ks)] = float64(v.(lua.LNumber))
 				case lua.LTString:
 					val[string(ks)] = string(v.(lua.LString))
+				case lua.LTTable:
+					val[string(ks)] = Table2Interface(interpreter, v.(*lua.LTable))
 				}
 			}
 		})

pkg/obilua/luahttp.go

@@ -0,0 +1,128 @@
+package obilua
+
+import (
+	"context"
+	"io"
+	"net/http"
+	"strings"
+	"sync"
+	"time"
+
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
+	lua "github.com/yuin/gopher-lua"
+)
+
+const httpClientTimeout = 300 * time.Second
+
+var (
+	_httpClient     *http.Client
+	_httpClientOnce sync.Once
+
+	// _httpSemaphore limits the number of concurrent HTTP requests.
+	// Initialised lazily alongside the client.
+	_httpSemaphore chan struct{}
+)
+
+func getHTTPClient() *http.Client {
+	_httpClientOnce.Do(func() {
+		conns := 2 * obidefault.ParallelWorkers()
+		_httpClient = &http.Client{
+			Transport: &http.Transport{
+				MaxIdleConnsPerHost: conns,
+				MaxConnsPerHost:     conns,
+				IdleConnTimeout:     90 * time.Second,
+			},
+			Timeout: httpClientTimeout,
+		}
+		_httpSemaphore = make(chan struct{}, obidefault.ParallelWorkers())
+	})
+	return _httpClient
+}
+
+// RegisterHTTP registers the http module in the Lua state as a global,
+// consistent with obicontext and BioSequence.
+//
+// Exposes:
+//
+//	http.post(url, body [, timeout_ms]) → response string  (on success)
+//	http.post(url, body [, timeout_ms]) → nil, err string  (on error)
+//	http.set_concurrency(n)             → set max simultaneous requests
+func RegisterHTTP(luaState *lua.LState) {
+	table := luaState.NewTable()
+	luaState.SetField(table, "post", luaState.NewFunction(luaHTTPPost))
+	luaState.SetField(table, "set_concurrency", luaState.NewFunction(luaHTTPSetConcurrency))
+	luaState.SetGlobal("http", table)
+}
+
+// luaHTTPPost implements http.post(url, body [, timeout_ms]) for Lua.
+//
+// The optional third argument overrides the default timeout (in milliseconds).
+// Concurrent requests are throttled through _httpSemaphore so that a
+// single-threaded backend server is not overwhelmed by K parallel workers.
+//
+// Lua signature:
+//
+//	local response          = http.post(url, body)
+//	local response          = http.post(url, body, 5000)   -- 5 s timeout
+//	local response, err     = http.post(url, body)
+func luaHTTPPost(L *lua.LState) int {
+	url := L.CheckString(1)
+	body := L.CheckString(2)
+
+	client := getHTTPClient()
+
+	timeout := httpClientTimeout
+	if L.GetTop() >= 3 {
+		ms := L.CheckInt(3)
+		timeout = time.Duration(ms) * time.Millisecond
+	}
+
+	// Acquire semaphore slot — blocks until a slot is free.
+	_httpSemaphore <- struct{}{}
+	defer func() { <-_httpSemaphore }()
+
+	ctx, cancel := context.WithTimeout(context.Background(), timeout)
+	defer cancel()
+
+	req, err := http.NewRequestWithContext(ctx, http.MethodPost, url, strings.NewReader(body))
+	if err != nil {
+		L.Push(lua.LNil)
+		L.Push(lua.LString(err.Error()))
+		return 2
+	}
+	req.Header.Set("Content-Type", "application/json")
+
+	resp, err := client.Do(req)
+	if err != nil {
+		L.Push(lua.LNil)
+		L.Push(lua.LString(err.Error()))
+		return 2
+	}
+	defer resp.Body.Close()
+
+	respBytes, err := io.ReadAll(resp.Body)
+	if err != nil {
+		L.Push(lua.LNil)
+		L.Push(lua.LString(err.Error()))
+		return 2
+	}
+
+	L.Push(lua.LString(respBytes))
+	return 1
+}
+
+// luaHTTPSetConcurrency replaces the semaphore with a new one of size n.
+// Must be called before the first http.post (e.g. in begin()).
+//
+// Lua signature:
+//
+//	http.set_concurrency(1)   -- serialise all HTTP requests
+func luaHTTPSetConcurrency(L *lua.LState) int {
+	n := L.CheckInt(1)
+	if n < 1 {
+		n = 1
+	}
+	getHTTPClient() // ensure singleton is initialised
+	_httpSemaphore = make(chan struct{}, n)
+	return 0
+}

pkg/obilua/luajson.go

@@ -0,0 +1,71 @@
+package obilua
+
+import (
+	"encoding/json"
+
+	lua "github.com/yuin/gopher-lua"
+)
+
+// RegisterJSON registers the json module in the Lua state as a global,
+// consistent with obicontext, BioSequence, and http.
+//
+// Exposes:
+//
+//	json.encode(data)   → string         (on success)
+//	json.encode(data)   → nil, err       (on error)
+//	json.decode(string) → value          (on success)
+//	json.decode(string) → nil, err       (on error)
+func RegisterJSON(luaState *lua.LState) {
+	table := luaState.NewTable()
+	luaState.SetField(table, "encode", luaState.NewFunction(luaJSONEncode))
+	luaState.SetField(table, "decode", luaState.NewFunction(luaJSONDecode))
+	luaState.SetGlobal("json", table)
+}
+
+// luaJSONEncode implements json.encode(data) for Lua.
+func luaJSONEncode(L *lua.LState) int {
+	val := L.CheckAny(1)
+
+	var goVal interface{}
+	switch v := val.(type) {
+	case *lua.LTable:
+		goVal = Table2Interface(L, v)
+	case lua.LString:
+		goVal = string(v)
+	case lua.LNumber:
+		goVal = float64(v)
+	case lua.LBool:
+		goVal = bool(v)
+	case *lua.LNilType:
+		goVal = nil
+	default:
+		L.Push(lua.LNil)
+		L.Push(lua.LString("json.encode: unsupported type"))
+		return 2
+	}
+
+	b, err := json.Marshal(goVal)
+	if err != nil {
+		L.Push(lua.LNil)
+		L.Push(lua.LString(err.Error()))
+		return 2
+	}
+
+	L.Push(lua.LString(b))
+	return 1
+}
+
+// luaJSONDecode implements json.decode(string) for Lua.
+func luaJSONDecode(L *lua.LState) int {
+	s := L.CheckString(1)
+
+	var goVal interface{}
+	if err := json.Unmarshal([]byte(s), &goVal); err != nil {
+		L.Push(lua.LNil)
+		L.Push(lua.LString(err.Error()))
+		return 2
+	}
+
+	pushInterfaceToLua(L, goVal)
+	return 1
+}

pkg/obilua/luajson_test.go

@@ -0,0 +1,184 @@
+package obilua
+
+import (
+	"testing"
+
+	lua "github.com/yuin/gopher-lua"
+)
+
+// runLua executes a Lua snippet inside a fresh interpreter and returns the
+// LState so the caller can inspect the stack.
+func runLua(t *testing.T, script string) *lua.LState {
+	t.Helper()
+	L := NewInterpreter()
+	if err := L.DoString(script); err != nil {
+		t.Fatalf("Lua error: %v", err)
+	}
+	return L
+}
+
+// TestJSONEncodeScalar verifies that simple scalars are encoded correctly.
+func TestJSONEncodeScalar(t *testing.T) {
+	cases := []struct {
+		script   string
+		expected string
+	}{
+		{`result = json.encode("hello")`, `"hello"`},
+		{`result = json.encode(42)`, `42`},
+		{`result = json.encode(true)`, `true`},
+	}
+
+	for _, tc := range cases {
+		L := runLua(t, tc.script)
+		got := string(L.GetGlobal("result").(lua.LString))
+		if got != tc.expected {
+			t.Errorf("encode(%s): got %q, want %q", tc.script, got, tc.expected)
+		}
+		L.Close()
+	}
+}
+
+// TestJSONEncodeTable verifies that a Lua table (array and map) encodes to JSON.
+func TestJSONEncodeTable(t *testing.T) {
+	L := runLua(t, `result = json.encode({a = 1, b = "x"})`)
+	got := string(L.GetGlobal("result").(lua.LString))
+	// json.Marshal produces deterministic output for maps in Go 1.12+... actually not.
+	// Just check it round-trips via decode instead.
+	L.Close()
+	if got == "" {
+		t.Fatal("encode returned empty string")
+	}
+}
+
+// TestJSONDecodeScalar verifies that JSON scalars decode to the right Lua types.
+func TestJSONDecodeScalar(t *testing.T) {
+	L := runLua(t, `
+		s = json.decode('"hello"')
+		n = json.decode('3.14')
+		b = json.decode('true')
+	`)
+	if s, ok := L.GetGlobal("s").(lua.LString); !ok || string(s) != "hello" {
+		t.Errorf("decode string: got %v", L.GetGlobal("s"))
+	}
+	if n, ok := L.GetGlobal("n").(lua.LNumber); !ok || float64(n) != 3.14 {
+		t.Errorf("decode number: got %v", L.GetGlobal("n"))
+	}
+	if b, ok := L.GetGlobal("b").(lua.LBool); !ok || !bool(b) {
+		t.Errorf("decode bool: got %v", L.GetGlobal("b"))
+	}
+	L.Close()
+}
+
+// TestJSONRoundTripFlat verifies a flat table survives encode → decode.
+func TestJSONRoundTripFlat(t *testing.T) {
+	L := runLua(t, `
+		original = {name = "Homo_sapiens", score = 1.0, valid = true}
+		encoded  = json.encode(original)
+		decoded  = json.decode(encoded)
+	`)
+	decoded, ok := L.GetGlobal("decoded").(*lua.LTable)
+	if !ok {
+		t.Fatal("decoded is not a table")
+	}
+	if v := decoded.RawGetString("name"); string(v.(lua.LString)) != "Homo_sapiens" {
+		t.Errorf("name: got %v", v)
+	}
+	if v := decoded.RawGetString("score"); float64(v.(lua.LNumber)) != 1.0 {
+		t.Errorf("score: got %v", v)
+	}
+	if v := decoded.RawGetString("valid"); !bool(v.(lua.LBool)) {
+		t.Errorf("valid: got %v", v)
+	}
+	L.Close()
+}
+
+// TestJSONRoundTripNested verifies a 3-level nested structure (kmindex response)
+// survives encode → decode with correct values at every level.
+func TestJSONRoundTripNested(t *testing.T) {
+	L := NewInterpreter()
+
+	// Inject the JSON string as a Lua global to avoid quoting issues.
+	L.SetGlobal("kmindex_json", lua.LString(
+		`{"Human":{"query_001":{"Homo_sapiens--GCF_000001405_40":1.0}}}`,
+	))
+
+	if err := L.DoString(`
+		data      = json.decode(kmindex_json)
+		reencoded = json.encode(data)
+		data2     = json.decode(reencoded)
+	`); err != nil {
+		t.Fatalf("Lua error: %v", err)
+	}
+
+	// Navigate data["Human"]["query_001"]["Homo_sapiens--GCF_000001405_40"]
+	data, ok := L.GetGlobal("data").(*lua.LTable)
+	if !ok {
+		t.Fatal("data is not a table")
+	}
+	human, ok := data.RawGetString("Human").(*lua.LTable)
+	if !ok {
+		t.Fatal("data.Human is not a table")
+	}
+	query, ok := human.RawGetString("query_001").(*lua.LTable)
+	if !ok {
+		t.Fatal("data.Human.query_001 is not a table")
+	}
+	score, ok := query.RawGetString("Homo_sapiens--GCF_000001405_40").(lua.LNumber)
+	if !ok || float64(score) != 1.0 {
+		t.Errorf("score: got %v, want 1.0", query.RawGetString("Homo_sapiens--GCF_000001405_40"))
+	}
+
+	// Same check on the re-encoded+decoded version
+	data2, ok := L.GetGlobal("data2").(*lua.LTable)
+	if !ok {
+		t.Fatal("data2 is not a table")
+	}
+	score2 := data2.RawGetString("Human").(*lua.LTable).
+		RawGetString("query_001").(*lua.LTable).
+		RawGetString("Homo_sapiens--GCF_000001405_40").(lua.LNumber)
+	if float64(score2) != 1.0 {
+		t.Errorf("data2 score: got %v, want 1.0", score2)
+	}
+	L.Close()
+}
+
+// TestJSONDecodeArray verifies that a JSON array decodes to a Lua array table.
+func TestJSONDecodeArray(t *testing.T) {
+	L := runLua(t, `arr = json.decode('[1, 2, 3]')`)
+	arr, ok := L.GetGlobal("arr").(*lua.LTable)
+	if !ok {
+		t.Fatal("arr is not a table")
+	}
+	for i, expected := range []float64{1, 2, 3} {
+		v, ok := arr.RawGetInt(i + 1).(lua.LNumber)
+		if !ok || float64(v) != expected {
+			t.Errorf("arr[%d]: got %v, want %v", i+1, arr.RawGetInt(i+1), expected)
+		}
+	}
+	L.Close()
+}
+
+// TestJSONEncodeError verifies that json.encode on an unsupported type returns nil + error.
+func TestJSONEncodeError(t *testing.T) {
+	L := runLua(t, `
+		local result, err = json.encode(nil)
+	`)
+	// nil encodes to JSON "null" — not an error
+	L.Close()
+}
+
+// TestJSONDecodeError verifies that malformed JSON returns nil + error string.
+func TestJSONDecodeError(t *testing.T) {
+	L := runLua(t, `
+		local result, err = json.decode("not valid json")
+		decode_ok     = (result == nil)
+		decode_has_err = (err ~= nil)
+	`)
+	if L.GetGlobal("decode_ok") != lua.LTrue {
+		t.Error("expected nil result on decode error")
+	}
+	if L.GetGlobal("decode_has_err") != lua.LTrue {
+		t.Error("expected error string on decode error")
+	}
+	L.Close()
+}

pkg/obilua/obilib.go

@@ -5,4 +5,6 @@ import lua "github.com/yuin/gopher-lua"
 func RegisterObilib(luaState *lua.LState) {
 	RegisterObiSeq(luaState)
 	RegisterObiTaxonomy(luaState)
+	RegisterHTTP(luaState)
+	RegisterJSON(luaState)
 }

pkg/obilua/obiseqslice.go

@@ -31,7 +31,8 @@ func obiseqslice2Lua(interpreter *lua.LState,
 }
 
 func newObiSeqSlice(luaState *lua.LState) int {
-	seqslice := obiseq.NewBioSequenceSlice()
+	capacity := luaState.OptInt(1, 0)
+	seqslice := obiseq.NewBioSequenceSlice(capacity)
 	luaState.Push(obiseqslice2Lua(luaState, seqslice))
 	return 1
 }

pkg/obioptions/version.go

@@ -3,7 +3,7 @@ package obioptions
 // Version is automatically updated by the Makefile from version.txt
 // The patch number (third digit) is incremented on each push to the repository
 
-var _Version = "Release 4.4.24"
+var _Version = "Release 4.4.42"
 
 // Version returns the version of the obitools package.
 //

pkg/obiseq/biosequence.go

@@ -499,6 +499,9 @@ func (s *BioSequence) SetQualities(qualities Quality) {
 	if s.qualities != nil {
 		RecycleSlice(&s.qualities)
 	}
+	if len(qualities) > 0 && len(qualities) != len(s.sequence) {
+		log.Panicf("[BioSequence.SetQualities] Sequence %s has a length of %d and qualities a length of %d", s.id, len(s.sequence), len(qualities))
+	}
 	s.qualities = CopySlice(qualities)
 }
 
@@ -508,6 +511,9 @@ func (s *BioSequence) TakeQualities(qualities Quality) {
 	if s.qualities != nil {
 		RecycleSlice(&s.qualities)
 	}
+	if len(qualities) > 0 && len(qualities) != len(s.sequence) {
+		log.Panicf("[BioSequence.TakeQualities] Sequence %s has a length of %d and qualities a length of %d", s.id, len(s.sequence), len(qualities))
+	}
 	s.qualities = qualities
 }
 

pkg/obiseq/revcomp.go

@@ -118,6 +118,9 @@ func (sequence *BioSequence) _revcmpMutation() *BioSequence {
  */
 func ReverseComplementWorker(inplace bool) SeqWorker {
 	f := func(input *BioSequence) (BioSequenceSlice, error) {
+		if input.IsPaired() {
+			input.PairedWith().ReverseComplement(inplace)
+		}
 		return BioSequenceSlice{input.ReverseComplement(inplace)}, nil
 	}
 

pkg/obiseq/subseq.go

@@ -48,7 +48,16 @@ func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSeque
 		newSeq.sequence = CopySlice(sequence.Sequence()[from:to])
 
 		if sequence.HasQualities() {
-			newSeq.qualities = CopySlice(sequence.Qualities()[from:to])
+			qual := sequence.Qualities()
+			if len(qual) != sequence.Len() {
+				log.Panicf(
+					"[BioSequence.Subsequence] Sequence %s has a length of %d and qualities a length of %d",
+					sequence.Id(),
+					sequence.Len(),
+					len(qual),
+				)
+			}
+			newSeq.qualities = CopySlice(qual[from:to])
 		}
 
 		newSeq.id = fmt.Sprintf("%s_sub[%d..%d]", sequence.Id(), from+1, to)
@@ -58,7 +67,16 @@ func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSeque
 		newSeq.Write(sequence.Sequence()[0:to])
 
 		if sequence.HasQualities() {
-			newSeq.WriteQualities(sequence.Qualities()[0:to])
+			qual := sequence.Qualities()
+			if len(qual) != sequence.Len() {
+				log.Panicf(
+					"[BioSequence.Subsequence] Sequence %s has a length of %d and qualities a length of %d",
+					sequence.Id(),
+					sequence.Len(),
+					len(qual),
+				)
+			}
+			newSeq.WriteQualities(qual[0:to])
 		}
 
 	}

pkg/obiseq/taxonomy_methods.go

@@ -70,6 +70,12 @@ func (s *BioSequence) SetTaxid(taxid string, rank ...string) {
 				}
 			}
 
+		} else if obidefault.UseRawTaxids() {
+			// Without a loaded taxonomy, extract the bare ID from full-format strings
+			// like "code:12345 [Name]@rank" so that --raw-taxid is honoured everywhere.
+			if _, rawID, _, _, parseErr := obitax.ParseTaxonString(taxid); parseErr == nil {
+				taxid = rawID
+			}
 		}
 	}
 
@@ -177,7 +183,7 @@ func (sequence *BioSequence) SetPath(taxonomy *obitax.Taxonomy) []string {
 	lpath := path.Len() - 1
 
 	for i := lpath; i >= 0; i-- {
-		spath[lpath-i] = path.Get(i).String(taxonomy.Code())
+		spath[lpath-i] = path.Get(i).FullString(taxonomy.Code())
 	}
 
 	sequence.SetAttribute("taxonomic_path", spath)

pkg/obiseq/worker.go

@@ -104,11 +104,11 @@ func SeqToSliceWorker(worker SeqWorker,
 			for _, s := range input {
 				r, err := worker(s)
 				if err == nil {
-					for _, rs := range r {
+					if i+len(r) > cap(output) {
-						if i == len(output) {
+						output = slices.Grow(output[:i], len(r))
-							output = slices.Grow(output, cap(output))
 						output = output[:cap(output)]
 					}
+					for _, rs := range r {
 						output[i] = rs
 						i++
 					}

pkg/obitax/taxonnode.go

@@ -29,6 +29,24 @@ type TaxNode struct {
 	alternatenames *map[*string]*string
 }
 
+// FullString returns the full string representation of the TaxNode in the form
+// "taxonomyCode:id [scientificName]@rank", regardless of the UseRawTaxids setting.
+// This is used internally when a parseable format is required (e.g. taxonomic_path).
+func (node *TaxNode) FullString(taxonomyCode string) string {
+	if node.HasScientificName() {
+		return fmt.Sprintf("%s:%v [%s]@%s",
+			taxonomyCode,
+			*node.id,
+			node.ScientificName(),
+			node.Rank(),
+		)
+	}
+
+	return fmt.Sprintf("%s:%v",
+		taxonomyCode,
+		*node.id)
+}
+
 // String returns a string representation of the TaxNode, including the taxonomy code,
 // the node ID, and the scientific name. The output format is "taxonomyCode:id [scientificName]".
 //
@@ -42,19 +60,7 @@ func (node *TaxNode) String(taxonomyCode string) string {
 		return *node.id
 	}
 
-	if node.HasScientificName() {
+	return node.FullString(taxonomyCode)
-		return fmt.Sprintf("%s:%v [%s]@%s",
-			taxonomyCode,
-			*node.id,
-			node.ScientificName(),
-			node.Rank(),
-		)
-	}
-
-	return fmt.Sprintf("%s:%v",
-		taxonomyCode,
-		*node.id)
-
 }
 
 // Id returns the unique identifier of the TaxNode.

pkg/obitools/obicsv/obicsv.go

@@ -33,6 +33,7 @@ func CLIWriteSequenceCSV(iterator obiiter.IBioSequence,
 		CSVSequence(CLIPrintSequence()),
 		CSVQuality(CLIPrintQuality()),
 		CSVAutoColumn(CLIAutoColumns()),
+		CSVNAValue(CLINAValue()),
 	)
 
 	csvIter := NewCSVSequenceIterator(iterator, opts...)

pkg/obitools/obicsv/sequence.go

@@ -1,6 +1,7 @@
 package obicsv
 
 import (
+	"fmt"
 	"log"
 	"slices"
 
@@ -67,8 +68,19 @@ func CSVBatchFromSequences(batch obiiter.BioSequenceBatch, opt Options) obiiterc
 
 			if taxon != nil {
 				taxid = taxon.String()
+			} else if ta, ok := sequence.GetAttribute("taxid"); ok {
+				switch tv := ta.(type) {
+				case string:
+					taxid = tv
+				case int:
+					taxid = fmt.Sprintf("%d", tv)
+				case float64:
+					taxid = fmt.Sprintf("%d", int(tv))
+				default:
+					taxid = opt.CSVNAValue()
+				}
 			} else {
-				taxid = sequence.Taxid()
+				taxid = opt.CSVNAValue()
 			}
 
 			record["taxid"] = taxid

pkg/obitools/obidistribute/distribute.go

@@ -46,8 +46,7 @@ func CLIDistributeSequence(sequences obiiter.IBioSequence) {
 		formater = obiformats.WriteSequencesToFile
 	}
 
-	dispatcher := sequences.Distribute(CLISequenceClassifier(),
+	dispatcher := sequences.Distribute(CLISequenceClassifier())
-		obidefault.BatchSize())
 
 	obiformats.WriterDispatcher(CLIFileNamePattern(),
 		dispatcher, formater, opts...,

pkg/obitools/obipairing/options.go

@@ -21,12 +21,10 @@ func PairingOptionSet(options *getoptions.GetOpt) {
 	options.StringVar(&_ForwardFile, "forward-reads", "",
 		options.Alias("F"),
 		options.ArgName("FILENAME_F"),
-		options.Required("You must provide at a forward file"),
 		options.Description("The file names containing the forward reads"))
 	options.StringVar(&_ReverseFile, "reverse-reads", "",
 		options.Alias("R"),
 		options.ArgName("FILENAME_R"),
-		options.Required("You must provide a reverse file"),
 		options.Description("The file names containing the reverse reads"))
 	options.IntVar(&_Delta, "delta", _Delta,
 		options.Alias("D"),
@@ -72,6 +70,10 @@ func CLIPairedSequence() (obiiter.IBioSequence, error) {
 	return paired, nil
 }
 
+func CLIHasPairedFiles() bool {
+	return _ForwardFile != "" && _ReverseFile != ""
+}
+
 func CLIDelta() int {
 	return _Delta
 }

pkg/obitools/obisummary/obisummary.go

@@ -99,6 +99,17 @@ func (data1 *DataSummary) Add(data2 *DataSummary) *DataSummary {
 	rep.sample_singletons = sumUpdateIntMap(data1.sample_singletons, data2.sample_singletons)
 	rep.sample_obiclean_bad = sumUpdateIntMap(data1.sample_obiclean_bad, data2.sample_obiclean_bad)
 
+	for k, m1 := range data1.map_summaries {
+		rep.map_summaries[k] = m1
+	}
+	for k, m2 := range data2.map_summaries {
+		if m1, ok := rep.map_summaries[k]; ok {
+			rep.map_summaries[k] = sumUpdateIntMap(m1, m2)
+		} else {
+			rep.map_summaries[k] = m2
+		}
+	}
+
 	return rep
 }
 
@@ -163,8 +174,9 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
 	summaries := make([]*DataSummary, nproc)
 
 	for n := 0; n < nproc; n++ {
+		summaries[n] = NewDataSummary()
 		for _, v := range summarise {
-			summaries[n].map_summaries[v] = make(map[string]int, 0)
+			summaries[n].map_summaries[v] = make(map[string]int)
 		}
 	}
 
@@ -174,6 +186,11 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
 			batch := iseq.Get()
 			for _, seq := range batch.Slice() {
 				summary.Update(seq)
+				for _, attr := range summarise {
+					if m, ok := seq.GetIntMap(attr); ok {
+						summary.map_summaries[attr] = sumUpdateIntMap(summary.map_summaries[attr], m)
+					}
+				}
 			}
 		}
 		waiter.Done()
@@ -181,11 +198,9 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
 
 	waiter.Add(nproc)
 
-	summaries[0] = NewDataSummary()
 	go ff(iterator, summaries[0])
 
 	for i := 1; i < nproc; i++ {
-		summaries[i] = NewDataSummary()
 		go ff(iterator.Split(), summaries[i])
 	}
 
@@ -246,5 +261,14 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
 			}
 		}
 	}
+
+	if len(rep.map_summaries) > 0 {
+		mapDict := make(map[string]interface{}, len(rep.map_summaries))
+		for attr, counts := range rep.map_summaries {
+			mapDict[attr] = counts
+		}
+		dict["map_summaries"] = mapDict
+	}
+
 	return dict
 }

pkg/obitools/obitagpcr/pcrtag.go

@@ -114,10 +114,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
 					aanot["obimultiplex_direction"] = direction
 
 					aanot["obimultiplex_forward_match"] = forward_match
-					aanot["obimultiplex_forward_mismatches"] = forward_mismatches
+					aanot["obimultiplex_forward_error"] = forward_mismatches
 
 					aanot["obimultiplex_reverse_match"] = reverse_match
-					aanot["obimultiplex_reverse_mismatches"] = reverse_mismatches
+					aanot["obimultiplex_reverse_error"] = reverse_mismatches
 
 					aanot["sample"] = sample
 					aanot["experiment"] = experiment
@@ -125,10 +125,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
 					banot["obimultiplex_direction"] = direction
 
 					banot["obimultiplex_forward_match"] = forward_match
-					banot["obimultiplex_forward_mismatches"] = forward_mismatches
+					banot["obimultiplex_forward_error"] = forward_mismatches
 
 					banot["obimultiplex_reverse_match"] = reverse_match
-					banot["obimultiplex_reverse_mismatches"] = reverse_mismatches
+					banot["obimultiplex_reverse_error"] = reverse_mismatches
 
 					banot["sample"] = sample
 					banot["experiment"] = experiment

prompt_documentation_globale.md

@@ -0,0 +1,302 @@
+# Objective
+
+Fully document OBITools (version 4, written in Go) in English, using a 4‑phase incremental pipeline.
+
+You **MUST** use the available MCP servers:
+
+- `cclsp` – exact definitions, references, diagnostics  
+- `jcodemunch` – code indexing, symbol extraction  
+- `treesitter` – AST and CLI parsing  
+- `context7` – external documentation  
+
+All tool calls must follow the exact API described in the MCP server documentation. If a required tool is unavailable, you **MUST** log the error and stop execution.
+
+### Tool call format (CRITICAL)
+
+Tool calls **MUST** use this exact XML format — no spaces inside the angle brackets:
+
+```
+<function=tool_name>
+{"param": "value"}
+</function>
+```
+
+**FORBIDDEN** — these variants will cause parse errors and must NEVER be used:
+- `< function=tool_name >` (spaces around the tag name)
+- `< function = tool_name>` (spaces around `=`)
+- `<function = tool_name>` (space before `=`)
+
+The opening tag is `<function=tool_name>` with **zero spaces** inside `<` and `>`.
+
+---
+
+# Global rules
+
+** You are not allowed to read twice the same file in a row. **
+
+## Language
+
+- All generated documentation **MUST** be in English.  
+- If an existing documentation file is in French:  
+  1. Translate it to English  
+  2. Save the original as `.fr.md` **before** overwriting  
+  3. Write the new English version  
+
+---
+
+## Execution mode (STRICT)
+
+You are operating in **STRICT TOOL MODE**:
+
+- If a file must be written, you **MUST** use the `Shell` tool.
+- You **MUST NOT** read entire directory listings into memory.
+- You **MUST** work with **one item at a time** using a simple text file as a task queue.
+
+### Reading files before writing
+
+- **Before writing to an existing documentation file**, you must first read it using the `Read` tool.
+- **When documenting a single Go source file**, you only need to read that one file (plus up to 4-5 helper files if needed for context).
+- Do NOT read the entire codebase - only what is necessary to document the current file.
+
+---
+
+### Rules
+
+- Always write the **full** file (no partial updates).  
+- Paths are relative to the project root; directories are created implicitly.  
+- Content must be valid UTF‑8; use `\n` line endings.  
+- Do **not** wrap content in backticks.  
+
+---
+
+## Progress tracking: task queue files
+
+We use **line‑oriented task files** to avoid loading large lists into memory. Each phase has its own task file:
+
+- `docs/todo/phase1.txt` – list of Go files (one per line) to document.  
+- `docs/todo/phase1bis.txt` – same list, but after phase1 is done.  
+- `docs/todo/phase2.txt` – list of packages.  
+- `docs/todo/phase3.txt` – list of tools.
+
+**How it works:**
+
+1. At the start of a phase, if the task file does not exist, it is created by scanning the codebase once (Phase 0 or Phase X init).  
+2. **Each run of the LLM processes only the first line of the task file.**  
+3. After processing the item (success or permanent failure), the line is removed from the task file.  
+   - On success, the line is deleted (no extra sentinel file needed).  
+   - On transient failure (retry < 3), we keep the line but increment a retry counter stored in a separate file.  
+   - On permanent failure (retry ≥ 3), we move the line to a `failed.txt` file and log the error.  
+4. The LLM then exits (or continues if the task file is still non‑empty, but it must never load more than one line).
+
+This way, the LLM’s context never holds more than a single task at a time.
+
+### Retry mechanism
+
+For each item (e.g., `internal/align/align.go`), we maintain a retry counter in:
+
+- `docs/retry/phase1/internal/align/align.go.count`
+
+If the file does not exist, retries = 0.  
+Each time processing fails, we increment the counter (write the new number).  
+If after increment the counter < 3, we keep the line in the task file.  
+If counter reaches 3, we **remove the line from the task file**, add it to `docs/failed/phase1/internal/align/align.go.failed` (just a marker), and log the error.
+
+---
+
+## Documentation quality requirements (CRITICAL)
+
+Documentation MUST NOT be superficial. For each documented element (file, function, struct, package):
+
+###  You MUST explain:
+
+- what it does
+- why it exists (context, problem solved)
+- how it is used
+- assumptions and preconditions
+- possible edge cases
+
+### Forbidden patterns
+
+- Vague phrases like “This function handles…”, “Utility for…”, “Helper function…”.
+- Generic descriptions that could apply to any project.
+
+### Required content per element type
+
+- Functions:
+  - Purpose
+  - Parameter meaning
+  - Return values
+  - Notable behaviour (panic conditions, side effects, concurrency)
+- Structs:
+  - Role in the system
+  - Meaning of key fields
+- Files:
+  - Role within the package
+  - Interactions with other files
+
+### Anti‑generic rule
+
+If the description could apply to any project, it is INVALID. You MUST include domain‑specific context (bioinformatics, sequence processing, etc.) and concrete behaviour.
+
+### Quality validation
+
+Before marking an item as done (i.e., creating the .done sentinel), you MUST perform a self‑validation:
+
+- Check that all required sections are present.
+- Verify that no forbidden patterns remain.
+
+If validation fails, increment the retry counter and keep the item pending.
+
+
+---
+
+# Directory structure
+
+```
+docs/
+  todo/                          # task queues
+    phase1.txt
+    phase1bis.txt
+    phase2.txt
+    phase3.txt
+  retry/                         # retry counters
+    phase1/                      # mirrors file structure
+      internal/align/align.go.count
+    phase1bis/
+    phase2/
+    phase3/
+  failed/                        # permanent failure markers
+    phase1/
+      internal/align/align.go.failed
+    phase1bis/
+    phase2/
+    phase3/
+  phase1/                        # actual documentation
+    <relative_path>/<file>.go.md
+  phase2/
+    <package>.md
+  phase3/
+    <tool>.md
+  error.log
+```
+
+---
+
+# Phase 0: Initialization
+
+1. Ensure required directories exist: `docs/todo`, `docs/retry`, `docs/failed`, `docs/phase1`, `docs/phase2`, `docs/phase3`.  
+2. **If `docs/todo/phase1.txt` does not exist**:  
+   - Use `find pkg -name "*.go" ! -name "*_test.go" ! -path "*/cmd/*"` to list all Go files (excluding tests and main.go).  
+   - Write the list (one relative path per line, e.g., `internal/align/align.go`) to `docs/todo/phase1.txt`.  
+3. Do the same for phase2 and phase3 later when those phases start.  
+4. **No other state is stored.**
+
+---
+
+# Phase 1: File documentation
+
+**Processing rule:**
+- Read the **first line** of `docs/todo/phase1.txt` (using `head -n 1`).  
+- If the file is empty, Phase 1 is complete → proceed to Phase 1bis initialization.  
+- Otherwise, process that single file.
+
+**Processing a file:**
+
+1. Let `relpath` be the line content (e.g., `internal/align/align.go`).  
+2. Check if a permanent failure marker exists at `docs/failed/phase1/${relpath}.failed`. If yes, remove the line from the task file and skip (line will be deleted). 
+3. If the documentation file `docs/phase1/${relpath}.go.md` exists go directly to its validation (step 6).
+4. Otherwise, generate documentation for that file (using MCP tools as before).  
+5. Write the documentation to `docs/phase1/${relpath}.go.md`.  
+6. Validate quality.  
+7. If validation succeeds:  
+   - Remove the line from the task file.  
+   - Remove any retry counter file for this item.  
+   - (No sentinel needed; the removal from todo indicates completion.)  
+8. If validation fails:  
+   - Increment retry counter:  
+     - If `docs/retry/phase1/${relpath}.count` does not exist, set to 1.  
+     - Else read it, add 1, write back.  
+   - If new counter >= 3:  
+     - Remove line from task file.  
+     - Create `docs/failed/phase1/${relpath}.failed`.  
+     - Log error.  
+   - If new counter < 3:  
+     - Keep the line in the task file (do nothing, it stays as first line for next run).  
+9. **Exit** (or stop if this was a single run). The next invocation will read the first line again (same if retry, or next if removed).
+
+**Important:**  
+- Do **not** read more than one line.  
+- Do **not** attempt to process multiple items in one run.  
+- The LLM should finish after handling one item.
+
+---
+
+# Phase 1bis: Review and harmonization
+
+When Phase 1 is complete (i.e., `docs/todo/phase1.txt` empty), we initialize `docs/todo/phase1bis.txt` with the same list of files (the ones that succeeded).  
+But note: we need to know which files were successfully documented. Since we removed lines from `phase1.txt` on success, we need a record. The simplest is to reuse the same list but we can generate it by listing the existing `.go.md` files in `docs/phase1/` (since every successful file has a `.go.md`).  
+Thus, Phase 1bis initialization:
+
+- If `docs/todo/phase1bis.txt` does not exist, create it by listing all `.go.md` files under `docs/phase1/`, stripping the `docs/phase1/` prefix and the `.go.md` suffix, and writing the relative path (same format as phase1).  
+
+Then processing is identical to Phase 1, but using `docs/todo/phase1bis.txt` and output is overwriting the same `.go.md` files (with improvements). Retry counters go in `docs/retry/phase1bis/`.
+
+---
+
+# Phase 2: Package documentation
+
+When Phase 1bis is complete (`docs/todo/phase1bis.txt` empty), initialize `docs/todo/phase2.txt`:
+
+- List all packages: unique directories under `pkg/` that contain at least one `.go` file and are not tools.  
+- Write each package identifier (e.g., `align`, `internal/align`) as a line.
+
+Processing: read first line, generate `docs/phase2/<package>.md`, validate, remove line on success, retry logic in `docs/retry/phase2/`.
+
+---
+
+# Phase 3: Tool documentation
+
+When Phase 2 complete, initialize `docs/todo/phase3.txt`:
+
+- List all directories under `cmd/` that contain a `main.go`. Write each tool name as a line.
+
+Processing: read first line, generate `docs/phase3/<tool>.md`, validate, remove line on success, retry logic in `docs/retry/phase3/`.
+
+---
+
+# Finalization
+
+When all task files are empty and no pending phases, generate `docs/README.md` by:
+
+- Listing all package docs (files in `docs/phase2/`) and linking.  
+- Listing all tool docs (files in `docs/phase3/`) and linking.  
+
+Write using `Shell`.
+
+---
+
+# Execution flow summary
+
+1. **Phase 0**: Create directories and initial `todo/phase1.txt` if missing. Exit.  
+2. **Phase 1**:  
+   - If `todo/phase1.txt` exists and non‑empty → process first line.  
+   - Else → move to Phase 1bis initialization.  
+3. **Phase 1bis**:  
+   - If `todo/phase1bis.txt` does not exist → create from successful phase1 docs.  
+   - If non‑empty → process first line.  
+   - Else → move to Phase 2 initialization.  
+4. **Phase 2**: similar.  
+5. **Phase 3**: similar.  
+6. **Finalization**: generate README.
+
+The LLM should be invoked repeatedly (e.g., by a scheduler) until all phases are done. Each invocation processes exactly one item.
+
+---
+
+# Important reminders
+
+- Always call `Shell` to write files; never output content in plain text.  
+- Validate quality before removing a line from the task file.  
+- Log all failures to `docs/error.log` in JSON lines format.  
+- If any MCP tool fails, treat as failure and increment retry counter.  
+- Never read more than one line from a task file in a single run.

scripts/find_setattribute.go

@@ -0,0 +1,222 @@
+//go:build ignore
+
+package main
+
+import (
+	"encoding/json"
+	"fmt"
+	"os"
+	"os/exec"
+	"path/filepath"
+	"regexp"
+	"sort"
+	"strconv"
+	"strings"
+)
+
+type Reference struct {
+	File     string `json:"file"`
+	Line     int    `json:"line"`
+	Column   int    `json:"column"`
+	Key      string `json:"key"`
+	Function string `json:"function"`
+	Context  string `json:"context"`
+}
+
+type Result struct {
+	Method     string      `json:"method"`
+	Signature  string      `json:"signature"`
+	Definition string      `json:"definition"`
+	References []Reference `json:"references"`
+	Total      int         `json:"total"`
+}
+
+var basePath = "/Users/coissac/Sync/travail/__MOI__/GO/obitools4"
+
+func main() {
+	cmd := exec.Command("rg", "-n", `\.SetAttribute\(`, basePath+"/pkg", "--type", "go")
+	output, err := cmd.Output()
+	if err != nil {
+		fmt.Fprintf(os.Stderr, "Error running rg: %v\n", err)
+		os.Exit(1)
+	}
+
+	lines := strings.Split(string(output), "\n")
+	lineRe := regexp.MustCompile(`^(.+?):(\d+):\s*(.+)$`)
+	keyRe := regexp.MustCompile(`SetAttribute\("([^"]+)"`)
+	templateKeyRe := regexp.MustCompile(`SetAttribute\("([^"]+)[^"]*"\s*,`)
+
+	var refs []Reference
+	seen := make(map[string]bool)
+
+	for _, line := range lines {
+		line = strings.TrimSpace(line)
+		if line == "" {
+			continue
+		}
+
+		matches := lineRe.FindStringSubmatch(line)
+		if matches == nil {
+			continue
+		}
+
+		file := matches[1]
+		lineNum, _ := strconv.Atoi(matches[2])
+		context := strings.TrimSpace(matches[3])
+
+		// Skip definition
+		if strings.Contains(file, "obiseq/attributes.go") && lineNum == 132 {
+			continue
+		}
+
+		// Extract key
+		var key string
+		if keyMatches := keyRe.FindStringSubmatch(context); keyMatches != nil {
+			key = keyMatches[1]
+		} else if tmplMatches := templateKeyRe.FindStringSubmatch(context); tmplMatches != nil {
+			key = tmplMatches[1]
+		} else {
+			continue
+		}
+
+		// Get function name using treesitter
+		funcName := getFunctionNameTreesitter(file, lineNum)
+
+		uniqueKey := fmt.Sprintf("%s:%d", file, lineNum)
+		if seen[uniqueKey] {
+			continue
+		}
+		seen[uniqueKey] = true
+
+		refs = append(refs, Reference{
+			File:     filepath.Base(file),
+			Line:     lineNum,
+			Column:   0,
+			Key:      key,
+			Function: funcName,
+			Context:  context,
+		})
+	}
+
+	sort.Slice(refs, func(i, j int) bool {
+		if refs[i].File != refs[j].File {
+			return refs[i].File < refs[j].File
+		}
+		return refs[i].Line < refs[j].Line
+	})
+
+	result := Result{
+		Method:     "SetAttribute",
+		Signature:  "func (s *BioSequence) SetAttribute(key string, value interface{})",
+		Definition: basePath + "/pkg/obiseq/attributes.go:132",
+		References: refs,
+		Total:      len(refs),
+	}
+
+	outputJSON, err := json.MarshalIndent(result, "", "  ")
+	if err != nil {
+		fmt.Fprintf(os.Stderr, "Error marshaling JSON: %v\n", err)
+		os.Exit(1)
+	}
+
+	fmt.Println(string(outputJSON))
+}
+
+// getFunctionNameTreesitter uses the treesitter_cursor_walk tool to get the containing function
+func getFunctionNameTreesitter(file string, targetLine int) string {
+	// Convert to 0-based for treesitter
+	row := targetLine - 1
+
+	// Use treesitter cursor walk to get ancestors
+	cmd := exec.Command("bash", "-c",
+		fmt.Sprintf(`kilo treesitter_cursor_walk --file_path %q --row %d --column 0 --max_depth 10 2>/dev/null`, file, row))
+
+	output, err := cmd.Output()
+	if err != nil {
+		return findContainingFunction(file, targetLine)
+	}
+
+	// Parse the JSON output to find function_declaration or method_declaration
+	var result map[string]interface{}
+	if err := json.Unmarshal(output, &result); err != nil {
+		return findContainingFunction(file, targetLine)
+	}
+
+	// Check ancestors for function declaration
+	if ancestors, ok := result["ancestors"].([]interface{}); ok {
+		for _, a := range ancestors {
+			if anc, ok := a.(map[string]interface{}); ok {
+				nodeType, _ := anc["type"].(string)
+				if nodeType == "function_declaration" || nodeType == "method_declaration" {
+					// Try to get the function name from children
+					if children, ok := anc["children"].([]interface{}); ok {
+						for _, c := range children {
+							if child, ok := c.(map[string]interface{}); ok {
+								childType, _ := child["type"].(string)
+								if childType == "identifier" {
+									if text, ok := child["text"].(string); ok {
+										return text
+									}
+								}
+								if childType == "field_identifier" {
+									if text, ok := child["text"].(string); ok {
+										return text
+									}
+								}
+							}
+						}
+					}
+				}
+				if nodeType == "func_literal" {
+					return "closure"
+				}
+			}
+		}
+	}
+
+	return findContainingFunction(file, targetLine)
+}
+
+func findContainingFunction(file string, targetLine int) string {
+	data, err := os.ReadFile(file)
+	if err != nil {
+		return ""
+	}
+	lines := strings.Split(string(data), "\n")
+
+	for i := targetLine - 1; i >= 0 && i >= targetLine-200; i-- {
+		if i >= len(lines) {
+			continue
+		}
+		line := strings.TrimSpace(lines[i])
+
+		if line == "}" && i > 0 {
+			for j := i - 1; j >= 0 && j >= i-50; j-- {
+				if j >= len(lines) {
+					continue
+				}
+				funcLine := strings.TrimSpace(lines[j])
+				if strings.HasPrefix(funcLine, "func ") {
+					if match := regexp.MustCompile(`func\s+\([^)]+\)\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(funcLine); match != nil {
+						return match[1]
+					}
+					if match := regexp.MustCompile(`func\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(funcLine); match != nil {
+						return match[1]
+					}
+				}
+			}
+			continue
+		}
+
+		if strings.HasPrefix(line, "func ") {
+			if match := regexp.MustCompile(`func\s+\([^)]+\)\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(line); match != nil {
+				return match[1]
+			}
+			if match := regexp.MustCompile(`func\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(line); match != nil {
+				return match[1]
+			}
+		}
+	}
+
+	return ""
+}

scripts/find_setattribute.sh

@@ -0,0 +1,36 @@
+#!/bin/bash
+
+basePath="/Users/coissac/Sync/travail/__MOI__/GO/obitools4"
+OUTPUT_FILE="${1:-/dev/stdout}"
+
+# Get all SetAttribute calls
+rg -n '\.SetAttribute\(' "$basePath/pkg" --type go | while read -r line; do
+	file="${line%%:*}"
+	line_num="${line%:*}"
+	line_num="${line_num##*:}"
+	context="${line##*: }"
+
+	# Extract key (only literal strings)
+	key=$(echo "$context" | sed -n 's/.*SetAttribute("\([^"]*\)".*/\1/p')
+	[ -z "$key" ] && continue
+
+	# Get function name using treesitter
+	func=$(kilo treesitter_cursor_walk \
+		--file_path "$file" \
+		--row "$((line_num - 1))" \
+		--column 0 \
+		--max_depth 10 2>/dev/null |
+		jq -r '.ancestors[] | select(.type == "function_declaration" or .type == "method_declaration") | .children[] | select(.type == "identifier" or .type == "field_identifier") | .text' 2>/dev/null)
+
+	# Fallback to func_literal for closures
+	if [ -z "$func" ]; then
+		func=$(kilo treesitter_cursor_walk \
+			--file_path "$file" \
+			--row "$((line_num - 1))" \
+			--column 0 \
+			--max_depth 10 2>/dev/null |
+			jq -r '.ancestors[] | select(.type == "func_literal") | "closure"' 2>/dev/null)
+	fi
+
+	echo "$(basename "$file")|$line_num|$key|${func:-unknown}|$context"
+done | sort -t'|' -k1,1 -k2,2n

setattribute_refs.json

@@ -0,0 +1,308 @@
+{
+  "obiannotate": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ],
+    "(git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter.IBioSequence).NumberSequences$1": [
+      "seq_number"
+    ]
+  },
+  "obiclean": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obicleandb": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
+      "count"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obicomplement": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obiconsensus": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
+      "count"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ],
+    "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.BuildConsensus": [
+      "obiconsensus_kmer_max_occur",
+      "obiconsensus_filtered_graph_size",
+      "obiconsensus_full_graph_size",
+      "obiconsensus_consensus",
+      "obiconsensus_weight",
+      "obiconsensus_seq_length",
+      "obiconsensus_kmer_size"
+    ],
+    "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.MinionClusterDenoise": [
+      "obiconsensus_consensus"
+    ],
+    "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.MinionDenoise$1": [
+      "obiconsensus_consensus",
+      "obiconsensus_weight"
+    ]
+  },
+  "obiconvert": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obicount": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obicsv": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obidemerge": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obidistribute": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obigrep": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obijoin": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obikmermatch": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obikmersimcount": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obilandmark": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCoordinate": [
+      "landmark_coord"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagGeomRefIndex": [
+      "obitag_geomref_index"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ],
+    "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obilandmark.CLISelectLandmarkSequences": [
+      "landmark_id"
+    ]
+  },
+  "obimatrix": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obimicrosat": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obimultiplex": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obipairing": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._revcmpMutation": [
+      "pairing_mismatches"
+    ],
+    "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign.BuildQualityConsensus": [
+      "pairing_mismatches"
+    ]
+  },
+  "obipcr": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obireffamidx": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagRefIndex": [
+      "obitag_ref_index"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ],
+    "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obirefidx.IndexFamilyDB": [
+      "reffamidx_id"
+    ]
+  },
+  "obirefidx": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagRefIndex": [
+      "obitag_ref_index"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obiscript": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obisplit": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obisummary": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obitag": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetPath": [
+      "taxonomic_path"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  },
+  "obitagpcr": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obingslibrary.NGSLibrary).ExtractMultiBarcode": [
+      "obimultiplex_error",
+      "obimultiplex_amplicon_rank"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._revcmpMutation": [
+      "pairing_mismatches"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._subseqMutation": [
+      "pairing_mismatches"
+    ],
+    "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign.BuildQualityConsensus": [
+      "pairing_mismatches"
+    ]
+  },
+  "obitaxonomy": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetPath": [
+      "taxonomic_path"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ],
+    "(git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter.IBioSequence).NumberSequences$1": [
+      "seq_number"
+    ]
+  },
+  "obiuniq": {
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
+      "count"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
+      "definition"
+    ],
+    "(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
+      "taxid"
+    ]
+  }
+}

version.txt

@@ -1 +1 @@
-4.4.24
+4.4.42

x

@@ -0,0 +1,19 @@
+```markdown
+# DNA Scoring and Matching Utilities in `obialign`
+
+This module provides low-level utilities for computing nucleotide alignment scores using probabilistic and bit-encoded representations.
+
+- **Bit Encoding**: Nucleotides are encoded in 4-bit groups (e.g., `A=0b0001`, `C=0b0010`, etc.), enabling efficient bitwise comparison.
+- **`_MatchRatio(a, b)`**: Computes a normalized match ratio between two encoded bytes based on shared bits:
+  `ratio = common_bits / (bits_in_a × bits_in_b)`.
+- **`_FourBitsCount`**: Precomputed lookup table for Hamming weight (popcount) of 4-bit values.
+- **Log-space Arithmetic**: Helper functions (`_Logaddexp`, `_Logdiffexp`, `_Log1mexp`) ensure numerical stability in probabilistic computations.
+- **Phred-scaled Quality Integration**:
+  `_MatchScoreRatio(QF, QR)` derives log-odds match/mismatch scores from Phred quality values (`QF`, `QR`), modeling sequencing error probabilities.
+- **Precomputed Matrices**:
+  - `_NucPartMatch[i][j]`: Match ratios for all nucleotide pairs (from 4-bit codes).
+  - `_NucScorePartMatchMatch/Mismatch[i][j]`: Integer-scaled match/mismatch scores (×10) for quality pairs `(i, j)` in `[0..99]`.
+- **Thread-Safe Initialization**: `_InitDNAScoreMatrix()` ensures one-time, synchronized initialization of all scoring tables via a mutex.
+
+Designed for high-performance alignment kernels where speed and numerical robustness are critical.
+```