mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-06-24 17:51:00 +00:00
Compare commits
91 Commits
| Author | SHA1 | Date | |
|---|---|---|---|
| 578445f38a | |||
| 2edb33ad08 | |||
| b108d4978e | |||
| e9210e28a3 | |||
| 13a93fce11 | |||
| 14064c919e | |||
| 1dfd68aa6d | |||
| 930fe5f1ba | |||
| dcdaf9e372 | |||
| af7ae3d60c | |||
| cecf90fa40 | |||
| a186bd1c92 | |||
| 46d60c1a44 | |||
| 6c4a6c697c | |||
| 60b3753673 | |||
| 14e2840a2d | |||
| 42910c7db9 | |||
| 8b4cf677c6 | |||
| 02765f154f | |||
| 449544bd63 | |||
| 434d2e5930 | |||
| 7cb02ded69 | |||
| 6d469bd711 | |||
| 3d8e4a3a4e | |||
| 07d04a6967 | |||
| 03f251c365 | |||
| 5714fa6cd3 | |||
| f101625771 | |||
| 4359b52eaf | |||
| da0c8b6f28 | |||
| 841e5c9e2a | |||
| e298daeef9 | |||
| d9e6f67a6e | |||
| f036c7fa96 | |||
| e33665e716 | |||
| c955a614ca | |||
| f19065261e | |||
| 3e349e92e1 | |||
| a4ce24a418 | |||
| 960ad1531d | |||
| 137f49d1d1 | |||
| 083a92e13d | |||
| 67683435e8 | |||
| f32b29db4f | |||
| 10f49fe64b | |||
| d257917748 | |||
| fec078c04c | |||
| a92393dd51 | |||
| 7e76698490 | |||
| 64b0b32f61 | |||
| c8e6a218cb | |||
| 8c7017a99d | |||
| c7816973a6 | |||
| 670edc1958 | |||
| f92f285417 | |||
| a786b58ed3 | |||
| a2b26712b2 | |||
| 1599abc9ad | |||
| af213ab446 | |||
| a60184c115 | |||
| 585b024bf0 | |||
| afc9ffda85 | |||
| fdd972bbd2 | |||
| 76f595e1fe | |||
| 1e1e5443e3 | |||
| 15d1f1fd80 | |||
| 8df2cbe22f | |||
| 58d685926b | |||
| e9f24426df | |||
| 2f7be10b5d | |||
| 43125f9f5e | |||
| c23368e929 | |||
| 6cb5a81685 | |||
| 94b0887069 | |||
| c188580aac | |||
| 1e1f575d1c | |||
| 40769bf827 | |||
| 74e6fcaf83 | |||
| 30ec8b1b63 | |||
| cdc72c5346 | |||
| 82a9972be7 | |||
| ff6e515b2a | |||
| cd0c525f50 | |||
| abe935aa18 | |||
| 8dd32dc1bf | |||
| 6ee8750635 | |||
| 8c318c480e | |||
| 09fbc217d3 | |||
| 3d2e205722 | |||
| 623116ab13 | |||
| 1e4509cb63 |
@@ -10,10 +10,10 @@ jobs:
|
|||||||
runs-on: ubuntu-latest
|
runs-on: ubuntu-latest
|
||||||
steps:
|
steps:
|
||||||
- name: Setup Go
|
- name: Setup Go
|
||||||
uses: actions/setup-go@v2
|
uses: actions/setup-go@v5
|
||||||
with:
|
with:
|
||||||
go-version: '1.23'
|
go-version: '1.23'
|
||||||
- name: Checkout obitools4 project
|
- name: Checkout obitools4 project
|
||||||
uses: actions/checkout@v4
|
uses: actions/checkout@v5
|
||||||
- name: Run tests
|
- name: Run tests
|
||||||
run: make githubtests
|
run: make githubtests
|
||||||
|
|||||||
@@ -16,9 +16,9 @@ jobs:
|
|||||||
- name: Setup Go
|
- name: Setup Go
|
||||||
uses: actions/setup-go@v5
|
uses: actions/setup-go@v5
|
||||||
with:
|
with:
|
||||||
go-version: "1.23"
|
go-version: "1.26"
|
||||||
- name: Checkout obitools4 project
|
- name: Checkout obitools4 project
|
||||||
uses: actions/checkout@v4
|
uses: actions/checkout@v5
|
||||||
- name: Run tests
|
- name: Run tests
|
||||||
run: make githubtests
|
run: make githubtests
|
||||||
|
|
||||||
@@ -49,12 +49,12 @@ jobs:
|
|||||||
|
|
||||||
steps:
|
steps:
|
||||||
- name: Checkout code
|
- name: Checkout code
|
||||||
uses: actions/checkout@v4
|
uses: actions/checkout@v5
|
||||||
|
|
||||||
- name: Setup Go
|
- name: Setup Go
|
||||||
uses: actions/setup-go@v5
|
uses: actions/setup-go@v5
|
||||||
with:
|
with:
|
||||||
go-version: "1.23"
|
go-version: "1.26"
|
||||||
|
|
||||||
- name: Extract version from tag
|
- name: Extract version from tag
|
||||||
id: get_version
|
id: get_version
|
||||||
@@ -69,7 +69,23 @@ jobs:
|
|||||||
xcode-select --install 2>/dev/null || true
|
xcode-select --install 2>/dev/null || true
|
||||||
xcode-select -p
|
xcode-select -p
|
||||||
|
|
||||||
- name: Build binaries
|
- name: Build binaries (Linux)
|
||||||
|
if: runner.os == 'Linux'
|
||||||
|
env:
|
||||||
|
VERSION: ${{ steps.get_version.outputs.version }}
|
||||||
|
run: |
|
||||||
|
docker run --rm \
|
||||||
|
-v "$(pwd):/src" \
|
||||||
|
-w /src \
|
||||||
|
-e VERSION="${VERSION}" \
|
||||||
|
golang:1.26-alpine \
|
||||||
|
sh -c "apk add --no-cache gcc musl-dev zlib-dev zlib-static make && \
|
||||||
|
make LDFLAGS='-linkmode=external -extldflags=-static' obitools"
|
||||||
|
mkdir -p artifacts
|
||||||
|
tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
|
||||||
|
|
||||||
|
- name: Build binaries (macOS)
|
||||||
|
if: runner.os == 'macOS'
|
||||||
env:
|
env:
|
||||||
GOOS: ${{ matrix.goos }}
|
GOOS: ${{ matrix.goos }}
|
||||||
GOARCH: ${{ matrix.goarch }}
|
GOARCH: ${{ matrix.goarch }}
|
||||||
@@ -77,7 +93,6 @@ jobs:
|
|||||||
run: |
|
run: |
|
||||||
make obitools
|
make obitools
|
||||||
mkdir -p artifacts
|
mkdir -p artifacts
|
||||||
# Create a single tar.gz with all binaries for this platform
|
|
||||||
tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
|
tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
|
||||||
|
|
||||||
- name: Upload artifacts
|
- name: Upload artifacts
|
||||||
@@ -92,7 +107,7 @@ jobs:
|
|||||||
runs-on: ubuntu-latest
|
runs-on: ubuntu-latest
|
||||||
steps:
|
steps:
|
||||||
- name: Checkout code
|
- name: Checkout code
|
||||||
uses: actions/checkout@v4
|
uses: actions/checkout@v5
|
||||||
with:
|
with:
|
||||||
fetch-depth: 0
|
fetch-depth: 0
|
||||||
|
|
||||||
|
|||||||
+1
-1
@@ -23,7 +23,7 @@ xx
|
|||||||
/.vscode
|
/.vscode
|
||||||
/build
|
/build
|
||||||
/bugs
|
/bugs
|
||||||
|
autodoc
|
||||||
/ncbitaxo
|
/ncbitaxo
|
||||||
|
|
||||||
!/obitests/**
|
!/obitests/**
|
||||||
|
|||||||
@@ -2,9 +2,17 @@
|
|||||||
#export GOBIN=$(GOPATH)/bin
|
#export GOBIN=$(GOPATH)/bin
|
||||||
#export PATH=$(GOBIN):$(shell echo $${PATH})
|
#export PATH=$(GOBIN):$(shell echo $${PATH})
|
||||||
|
|
||||||
|
.DEFAULT_GOAL := all
|
||||||
|
|
||||||
|
GREEN := \033[0;32m
|
||||||
|
YELLOW := \033[0;33m
|
||||||
|
BLUE := \033[0;34m
|
||||||
|
NC := \033[0m
|
||||||
|
|
||||||
GOFLAGS=
|
GOFLAGS=
|
||||||
|
LDFLAGS=
|
||||||
GOCMD=go
|
GOCMD=go
|
||||||
GOBUILD=$(GOCMD) build $(GOFLAGS)
|
GOBUILD=$(GOCMD) build $(GOFLAGS) $(if $(LDFLAGS),-ldflags="$(LDFLAGS)")
|
||||||
GOGENERATE=$(GOCMD) generate
|
GOGENERATE=$(GOCMD) generate
|
||||||
GOCLEAN=$(GOCMD) clean
|
GOCLEAN=$(GOCMD) clean
|
||||||
GOTEST=$(GOCMD) test
|
GOTEST=$(GOCMD) test
|
||||||
@@ -43,7 +51,7 @@ $(OBITOOLS_PREFIX)$(notdir $(1)): $(BUILD_DIR) $(1) pkg/obioptions/version.go
|
|||||||
@echo -n - Building obitool $(notdir $(1))...
|
@echo -n - Building obitool $(notdir $(1))...
|
||||||
@$(GOBUILD) -o $(BUILD_DIR)/$(OBITOOLS_PREFIX)$(notdir $(1)) ./$(1) \
|
@$(GOBUILD) -o $(BUILD_DIR)/$(OBITOOLS_PREFIX)$(notdir $(1)) ./$(1) \
|
||||||
2> $(OBITOOLS_PREFIX)$(notdir $(1)).log \
|
2> $(OBITOOLS_PREFIX)$(notdir $(1)).log \
|
||||||
|| cat $(OBITOOLS_PREFIX)$(notdir $(1)).log
|
|| { cat $(OBITOOLS_PREFIX)$(notdir $(1)).log; rm -f $(OBITOOLS_PREFIX)$(notdir $(1)).log; exit 1; }
|
||||||
@rm -f $(OBITOOLS_PREFIX)$(notdir $(1)).log
|
@rm -f $(OBITOOLS_PREFIX)$(notdir $(1)).log
|
||||||
@echo Done.
|
@echo Done.
|
||||||
endef
|
endef
|
||||||
@@ -60,6 +68,28 @@ endif
|
|||||||
|
|
||||||
OUTPUT:=$(shell mktemp)
|
OUTPUT:=$(shell mktemp)
|
||||||
|
|
||||||
|
help:
|
||||||
|
@printf "$(GREEN)OBITools4 Makefile$(NC)\n\n"
|
||||||
|
@printf "$(BLUE)Main targets:$(NC)\n"
|
||||||
|
@printf " %-20s %s\n" "all" "Build all obitools (default)"
|
||||||
|
@printf " %-20s %s\n" "obitools" "Build all obitools binaries to build/"
|
||||||
|
@printf " %-20s %s\n" "test" "Run Go unit tests"
|
||||||
|
@printf " %-20s %s\n" "obitests" "Run integration tests (obitests/)"
|
||||||
|
@printf " %-20s %s\n" "bump-version" "Increment patch version (or set with VERSION=x.y.z)"
|
||||||
|
@printf " %-20s %s\n" "update-deps" "Update all Go dependencies"
|
||||||
|
@printf "\n$(BLUE)Jujutsu workflow:$(NC)\n"
|
||||||
|
@printf " %-20s %s\n" "jjnew" "Document current commit and start a new one"
|
||||||
|
@printf " %-20s %s\n" "jjpush" "Release: describe, bump, generate notes, push PR, tag (VERSION=x.y.z optional)"
|
||||||
|
@printf " %-20s %s\n" "jjfetch" "Fetch latest commits from origin"
|
||||||
|
@printf "\n$(BLUE)Required tools:$(NC)\n"
|
||||||
|
@printf " %-20s " "go"; command -v go >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(go version)" || printf "$(YELLOW)✗ not found$(NC)\n"
|
||||||
|
@printf " %-20s " "git"; command -v git >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(git --version)" || printf "$(YELLOW)✗ not found$(NC)\n"
|
||||||
|
@printf " %-20s " "jj"; command -v jj >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(jj --version)" || printf "$(YELLOW)✗ not found$(NC)\n"
|
||||||
|
@printf " %-20s " "gh"; command -v gh >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(gh --version | head -1)" || printf "$(YELLOW)✗ not found$(NC) (brew install gh)\n"
|
||||||
|
@printf "\n$(BLUE)Optional tools (release notes generation):$(NC)\n"
|
||||||
|
@printf " %-20s " "aichat"; command -v aichat >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(aichat --version)" || printf "$(YELLOW)✗ not found$(NC) (https://github.com/sigoden/aichat)\n"
|
||||||
|
@printf " %-20s " "jq"; command -v jq >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(jq --version)" || printf "$(YELLOW)✗ not found$(NC) (brew install jq)\n"
|
||||||
|
|
||||||
all: install-githook obitools
|
all: install-githook obitools
|
||||||
|
|
||||||
obitools: $(patsubst %,$(OBITOOLS_PREFIX)%,$(OBITOOLS))
|
obitools: $(patsubst %,$(OBITOOLS_PREFIX)%,$(OBITOOLS))
|
||||||
@@ -106,8 +136,12 @@ pkg/obioptions/version.go: version.txt .FORCE
|
|||||||
@rm -f $(OUTPUT)
|
@rm -f $(OUTPUT)
|
||||||
|
|
||||||
bump-version:
|
bump-version:
|
||||||
@echo "Incrementing version..."
|
|
||||||
@current=$$(cat version.txt); \
|
@current=$$(cat version.txt); \
|
||||||
|
if [ -n "$(VERSION)" ]; then \
|
||||||
|
new_version="$(VERSION)"; \
|
||||||
|
echo "Setting version to $$new_version (was $$current)"; \
|
||||||
|
else \
|
||||||
|
echo "Incrementing version..."; \
|
||||||
echo " Current version: $$current"; \
|
echo " Current version: $$current"; \
|
||||||
major=$$(echo $$current | cut -d. -f1); \
|
major=$$(echo $$current | cut -d. -f1); \
|
||||||
minor=$$(echo $$current | cut -d. -f2); \
|
minor=$$(echo $$current | cut -d. -f2); \
|
||||||
@@ -115,6 +149,7 @@ bump-version:
|
|||||||
new_patch=$$((patch + 1)); \
|
new_patch=$$((patch + 1)); \
|
||||||
new_version="$$major.$$minor.$$new_patch"; \
|
new_version="$$major.$$minor.$$new_patch"; \
|
||||||
echo " New version: $$new_version"; \
|
echo " New version: $$new_version"; \
|
||||||
|
fi; \
|
||||||
echo "$$new_version" > version.txt
|
echo "$$new_version" > version.txt
|
||||||
@echo "✓ Version updated in version.txt"
|
@echo "✓ Version updated in version.txt"
|
||||||
@$(MAKE) pkg/obioptions/version.go
|
@$(MAKE) pkg/obioptions/version.go
|
||||||
@@ -130,6 +165,7 @@ jjnew:
|
|||||||
jjpush:
|
jjpush:
|
||||||
@$(MAKE) jjpush-describe
|
@$(MAKE) jjpush-describe
|
||||||
@$(MAKE) jjpush-bump
|
@$(MAKE) jjpush-bump
|
||||||
|
@$(MAKE) jjpush-notes
|
||||||
@$(MAKE) jjpush-push
|
@$(MAKE) jjpush-push
|
||||||
@$(MAKE) jjpush-tag
|
@$(MAKE) jjpush-tag
|
||||||
@echo "$(GREEN)✓ Release complete$(NC)"
|
@echo "$(GREEN)✓ Release complete$(NC)"
|
||||||
@@ -142,44 +178,62 @@ jjpush-bump:
|
|||||||
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
|
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
|
||||||
@jj new
|
@jj new
|
||||||
@$(MAKE) bump-version
|
@$(MAKE) bump-version
|
||||||
@echo "$(BLUE)→ Documenting version bump commit...$(NC)"
|
|
||||||
@jj auto-describe
|
|
||||||
|
|
||||||
jjpush-push:
|
jjpush-notes:
|
||||||
@echo "$(BLUE)→ Pushing commits...$(NC)"
|
|
||||||
@jj git push --change @
|
|
||||||
|
|
||||||
jjpush-tag:
|
|
||||||
@version=$$(cat version.txt); \
|
@version=$$(cat version.txt); \
|
||||||
tag_name="Release_$$version"; \
|
echo "$(BLUE)→ Generating release notes for version $$version...$(NC)"; \
|
||||||
echo "$(BLUE)→ Generating release notes for $$tag_name...$(NC)"; \
|
release_title="Release $$version"; \
|
||||||
release_message="Release $$version"; \
|
release_body=""; \
|
||||||
if command -v orla >/dev/null 2>&1 && command -v jq >/dev/null 2>&1; then \
|
if command -v aichat >/dev/null 2>&1; then \
|
||||||
previous_tag=$$(git describe --tags --abbrev=0 --match 'Release_*' HEAD^ 2>/dev/null); \
|
previous_tag=$$(git describe --tags --abbrev=0 --match 'Release_*' 2>/dev/null); \
|
||||||
if [ -z "$$previous_tag" ]; then \
|
if [ -z "$$previous_tag" ]; then \
|
||||||
echo "$(YELLOW)⚠ No previous Release tag found, skipping release notes$(NC)"; \
|
echo "$(YELLOW)⚠ No previous Release tag found, skipping release notes$(NC)"; \
|
||||||
else \
|
else \
|
||||||
raw_output=$$(git log --format="%h %B" "$$previous_tag..HEAD" | \
|
raw_output=$$(git log --format="%h %B" "$$previous_tag..HEAD" | \
|
||||||
ORLA_MAX_TOOL_CALLS=50 orla agent -m ollama:qwen3-coder-next:latest \
|
aichat \
|
||||||
"Summarize the following commits into a GitHub release note for version $$version. Ignore commits related to version bumps, .gitignore changes, or any internal housekeeping that is irrelevant to end users. Describe each user-facing change precisely without exposing code. Eliminate redundancy. Output strictly valid JSON with no surrounding text, using this exact schema: {\"title\": \"<short release title>\", \"body\": \"<detailed markdown release notes>\"}" 2>/dev/null) || true; \
|
"Summarize the following commits into a GitHub release note for version $$version. Ignore commits related to version bumps, .gitignore changes, or any internal housekeeping that is irrelevant to end users. Describe each user-facing change precisely without exposing code. Eliminate redundancy. Output strictly valid JSON with no surrounding text, using this exact schema: {\"title\": \"<short release title>\", \"body\": \"<detailed markdown release notes>\"}" 2>/dev/null) || true; \
|
||||||
if [ -n "$$raw_output" ]; then \
|
if [ -n "$$raw_output" ]; then \
|
||||||
sanitized=$$(echo "$$raw_output" | sed -n '/^{/,/^}/p' | tr -d '\000-\011\013-\014\016-\037'); \
|
notes=$$(printf '%s\n' "$$raw_output" | python3 tools/json2md.py 2>/dev/null); \
|
||||||
release_title=$$(echo "$$sanitized" | jq -r '.title // empty' 2>/dev/null) ; \
|
if [ -n "$$notes" ]; then \
|
||||||
release_body=$$(echo "$$sanitized" | jq -r '.body // empty' 2>/dev/null) ; \
|
release_title=$$(echo "$$notes" | head -1); \
|
||||||
if [ -n "$$release_title" ] && [ -n "$$release_body" ]; then \
|
release_body=$$(echo "$$notes" | tail -n +3); \
|
||||||
release_message="$$release_title"$$'\n\n'"$$release_body"; \
|
|
||||||
else \
|
else \
|
||||||
echo "$(YELLOW)⚠ JSON parsing failed, using default release message$(NC)"; \
|
echo "$(YELLOW)⚠ JSON parsing failed, using default release message$(NC)"; \
|
||||||
fi; \
|
fi; \
|
||||||
fi; \
|
fi; \
|
||||||
fi; \
|
fi; \
|
||||||
fi; \
|
fi; \
|
||||||
|
printf '%s' "$$release_title" > /tmp/obitools4-release-title.txt; \
|
||||||
|
printf '%s' "$$release_body" > /tmp/obitools4-release-body.txt; \
|
||||||
|
echo "$(BLUE)→ Setting release notes as commit description...$(NC)"; \
|
||||||
|
jj desc -m "$$release_title"$$'\n\n'"$$release_body"
|
||||||
|
|
||||||
|
jjpush-push:
|
||||||
|
@echo "$(BLUE)→ Pushing commits...$(NC)"
|
||||||
|
@jj git push --change @
|
||||||
|
@echo "$(BLUE)→ Creating/updating PR...$(NC)"
|
||||||
|
@release_title=$$(cat /tmp/obitools4-release-title.txt 2>/dev/null || echo "Release $$(cat version.txt)"); \
|
||||||
|
release_body=$$(cat /tmp/obitools4-release-body.txt 2>/dev/null || echo ""); \
|
||||||
|
branch=$$(jj log -r @ --no-graph -T 'bookmarks.map(|b| b.name()).join("\n")' 2>/dev/null | head -1); \
|
||||||
|
if [ -n "$$branch" ] && command -v gh >/dev/null 2>&1; then \
|
||||||
|
gh pr create --title "$$release_title" --body "$$release_body" --base master --head "$$branch" 2>/dev/null \
|
||||||
|
|| gh pr edit "$$branch" --title "$$release_title" --body "$$release_body" 2>/dev/null \
|
||||||
|
|| echo "$(YELLOW)⚠ Could not create/update PR$(NC)"; \
|
||||||
|
fi
|
||||||
|
|
||||||
|
jjpush-tag:
|
||||||
|
@version=$$(cat version.txt); \
|
||||||
|
tag_name="Release_$$version"; \
|
||||||
|
release_title=$$(cat /tmp/obitools4-release-title.txt 2>/dev/null || echo "Release $$version"); \
|
||||||
|
release_body=$$(cat /tmp/obitools4-release-body.txt 2>/dev/null || echo ""); \
|
||||||
install_section=$$'\n## Installation\n\n### Pre-built binaries\n\nDownload the appropriate archive for your system from the\n[release assets](https://github.com/metabarcoding/obitools4/releases/tag/Release_'"$$version"')\nand extract it:\n\n#### Linux (AMD64)\n```bash\ntar -xzf obitools4_'"$$version"'_linux_amd64.tar.gz\n```\n\n#### Linux (ARM64)\n```bash\ntar -xzf obitools4_'"$$version"'_linux_arm64.tar.gz\n```\n\n#### macOS (Intel)\n```bash\ntar -xzf obitools4_'"$$version"'_darwin_amd64.tar.gz\n```\n\n#### macOS (Apple Silicon)\n```bash\ntar -xzf obitools4_'"$$version"'_darwin_arm64.tar.gz\n```\n\nAll OBITools4 binaries are included in each archive.\n\n### From source\n\nYou can also compile and install OBITools4 directly from source using the\ninstallation script:\n\n```bash\ncurl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --version '"$$version"'\n```\n\nBy default binaries are installed in `/usr/local/bin`. Use `--install-dir` to\nchange the destination and `--obitools-prefix` to add a prefix to command names:\n\n```bash\ncurl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | \\\n bash -s -- --version '"$$version"' --install-dir ~/local --obitools-prefix k\n```\n'; \
|
install_section=$$'\n## Installation\n\n### Pre-built binaries\n\nDownload the appropriate archive for your system from the\n[release assets](https://github.com/metabarcoding/obitools4/releases/tag/Release_'"$$version"')\nand extract it:\n\n#### Linux (AMD64)\n```bash\ntar -xzf obitools4_'"$$version"'_linux_amd64.tar.gz\n```\n\n#### Linux (ARM64)\n```bash\ntar -xzf obitools4_'"$$version"'_linux_arm64.tar.gz\n```\n\n#### macOS (Intel)\n```bash\ntar -xzf obitools4_'"$$version"'_darwin_amd64.tar.gz\n```\n\n#### macOS (Apple Silicon)\n```bash\ntar -xzf obitools4_'"$$version"'_darwin_arm64.tar.gz\n```\n\nAll OBITools4 binaries are included in each archive.\n\n### From source\n\nYou can also compile and install OBITools4 directly from source using the\ninstallation script:\n\n```bash\ncurl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --version '"$$version"'\n```\n\nBy default binaries are installed in `/usr/local/bin`. Use `--install-dir` to\nchange the destination and `--obitools-prefix` to add a prefix to command names:\n\n```bash\ncurl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | \\\n bash -s -- --version '"$$version"' --install-dir ~/local --obitools-prefix k\n```\n'; \
|
||||||
release_message="$$release_message$$install_section"; \
|
release_message="$$release_title"$$'\n\n'"$$release_body$$install_section"; \
|
||||||
echo "$(BLUE)→ Creating tag $$tag_name...$(NC)"; \
|
echo "$(BLUE)→ Creating tag $$tag_name...$(NC)"; \
|
||||||
git tag -a "$$tag_name" -m "$$release_message" 2>/dev/null || echo "$(YELLOW)⚠ Tag $$tag_name already exists$(NC)"; \
|
commit_hash=$$(jj log -r @ --no-graph -T 'commit_id' 2>/dev/null); \
|
||||||
|
git tag -a "$$tag_name" $${commit_hash:+"$$commit_hash"} -m "$$release_message" 2>/dev/null || echo "$(YELLOW)⚠ Tag $$tag_name already exists$(NC)"; \
|
||||||
echo "$(BLUE)→ Pushing tag $$tag_name...$(NC)"; \
|
echo "$(BLUE)→ Pushing tag $$tag_name...$(NC)"; \
|
||||||
git push origin "$$tag_name" 2>/dev/null || echo "$(YELLOW)⚠ Tag push failed or already pushed$(NC)"
|
git push origin "$$tag_name" 2>/dev/null || echo "$(YELLOW)⚠ Tag push failed or already pushed$(NC)"; \
|
||||||
|
rm -f /tmp/obitools4-release-title.txt /tmp/obitools4-release-body.txt
|
||||||
|
|
||||||
jjfetch:
|
jjfetch:
|
||||||
@echo "$(YELLOW)→ Pulling latest commits...$(NC)"
|
@echo "$(YELLOW)→ Pulling latest commits...$(NC)"
|
||||||
@@ -187,5 +241,5 @@ jjfetch:
|
|||||||
@jj new master@origin
|
@jj new master@origin
|
||||||
@echo "$(GREEN)✓ Latest commits pulled$(NC)"
|
@echo "$(GREEN)✓ Latest commits pulled$(NC)"
|
||||||
|
|
||||||
.PHONY: all obitools update-deps obitests githubtests jjnew jjpush jjpush-describe jjpush-bump jjpush-push jjpush-tag jjfetch bump-version .FORCE
|
.PHONY: all obitools update-deps obitests githubtests help jjnew jjpush jjpush-describe jjpush-bump jjpush-notes jjpush-push jjpush-tag jjfetch bump-version .FORCE
|
||||||
.FORCE:
|
.FORCE:
|
||||||
|
|||||||
@@ -34,6 +34,10 @@ The installation script offers several options:
|
|||||||
> want to have several versions of obitools at the
|
> want to have several versions of obitools at the
|
||||||
> same time on your system (as example `-p g` will produce
|
> same time on your system (as example `-p g` will produce
|
||||||
> `gobigrep` command instead of `obigrep`).
|
> `gobigrep` command instead of `obigrep`).
|
||||||
|
>
|
||||||
|
> -j, --jobs Number of parallel jobs used for compilation
|
||||||
|
> (default: 1). Increase this value to speed up
|
||||||
|
> compilation on multi-core systems (e.g., `-j 4`).
|
||||||
|
|
||||||
### Examples
|
### Examples
|
||||||
|
|
||||||
|
|||||||
@@ -37,6 +37,11 @@ func main() {
|
|||||||
|
|
||||||
optionParser(os.Args)
|
optionParser(os.Args)
|
||||||
|
|
||||||
|
if !obipairing.CLIHasPairedFiles() {
|
||||||
|
log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
|
||||||
|
os.Exit(1)
|
||||||
|
}
|
||||||
|
|
||||||
obidefault.SetStrictReadWorker(2)
|
obidefault.SetStrictReadWorker(2)
|
||||||
obidefault.SetStrictWriteWorker(2)
|
obidefault.SetStrictWriteWorker(2)
|
||||||
pairs, err := obipairing.CLIPairedSequence()
|
pairs, err := obipairing.CLIPairedSequence()
|
||||||
|
|||||||
@@ -1,6 +1,7 @@
|
|||||||
package main
|
package main
|
||||||
|
|
||||||
import (
|
import (
|
||||||
|
"fmt"
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
@@ -8,6 +9,7 @@ import (
|
|||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obimultiplex"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipairing"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipairing"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitagpcr"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitagpcr"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
@@ -39,6 +41,17 @@ func main() {
|
|||||||
obitagpcr.OptionSet)
|
obitagpcr.OptionSet)
|
||||||
|
|
||||||
optionParser(os.Args)
|
optionParser(os.Args)
|
||||||
|
|
||||||
|
if obimultiplex.CLIAskConfigTemplate() {
|
||||||
|
fmt.Print(obimultiplex.CLIConfigTemplate())
|
||||||
|
os.Exit(0)
|
||||||
|
}
|
||||||
|
|
||||||
|
if !obipairing.CLIHasPairedFiles() {
|
||||||
|
log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
|
||||||
|
os.Exit(1)
|
||||||
|
}
|
||||||
|
|
||||||
pairs, err := obipairing.CLIPairedSequence()
|
pairs, err := obipairing.CLIPairedSequence()
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
|
|||||||
@@ -0,0 +1,10 @@
|
|||||||
|
{
|
||||||
|
"people": [
|
||||||
|
"Software",
|
||||||
|
"Agreement",
|
||||||
|
"Module"
|
||||||
|
],
|
||||||
|
"projects": [
|
||||||
|
"Code"
|
||||||
|
]
|
||||||
|
}
|
||||||
@@ -1,35 +1,33 @@
|
|||||||
module git.metabarcoding.org/obitools/obitools4/obitools4
|
module git.metabarcoding.org/obitools/obitools4/obitools4
|
||||||
|
|
||||||
go 1.23.4
|
go 1.26.1
|
||||||
|
|
||||||
toolchain go1.24.2
|
|
||||||
|
|
||||||
require (
|
require (
|
||||||
github.com/DavidGamba/go-getoptions v0.28.0
|
github.com/DavidGamba/go-getoptions v0.33.0
|
||||||
github.com/PaesslerAG/gval v1.2.2
|
github.com/PaesslerAG/gval v1.2.4
|
||||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df
|
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df
|
||||||
github.com/buger/jsonparser v1.1.1
|
github.com/buger/jsonparser v1.1.2
|
||||||
github.com/chen3feng/stl4go v0.1.1
|
github.com/chen3feng/stl4go v0.1.1
|
||||||
github.com/dlclark/regexp2 v1.11.4
|
github.com/dlclark/regexp2 v1.11.5
|
||||||
github.com/goccy/go-json v0.10.3
|
github.com/goccy/go-json v0.10.6
|
||||||
github.com/klauspost/pgzip v1.2.6
|
github.com/klauspost/pgzip v1.2.6
|
||||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58
|
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58
|
||||||
github.com/pelletier/go-toml/v2 v2.2.4
|
github.com/pelletier/go-toml/v2 v2.2.4
|
||||||
github.com/rrethy/ahocorasick v1.0.0
|
github.com/rrethy/ahocorasick v1.0.0
|
||||||
github.com/schollz/progressbar/v3 v3.13.1
|
github.com/schollz/progressbar/v3 v3.19.0
|
||||||
github.com/sirupsen/logrus v1.9.3
|
github.com/sirupsen/logrus v1.9.4
|
||||||
github.com/stretchr/testify v1.8.4
|
github.com/stretchr/testify v1.10.0
|
||||||
github.com/tevino/abool/v2 v2.1.0
|
github.com/tevino/abool/v2 v2.1.0
|
||||||
github.com/yuin/gopher-lua v1.1.1
|
github.com/yuin/gopher-lua v1.1.1
|
||||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa
|
golang.org/x/exp v0.0.0-20260312153236-7ab1446f8b90
|
||||||
gonum.org/v1/gonum v0.14.0
|
gonum.org/v1/gonum v0.17.0
|
||||||
gopkg.in/yaml.v3 v3.0.1
|
gopkg.in/yaml.v3 v3.0.1
|
||||||
scientificgo.org/special v0.0.0
|
scientificgo.org/special v0.0.0
|
||||||
)
|
)
|
||||||
|
|
||||||
require (
|
require (
|
||||||
github.com/davecgh/go-spew v1.1.1 // indirect
|
github.com/davecgh/go-spew v1.1.1 // indirect
|
||||||
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 // indirect
|
github.com/goombaio/orderedmap v0.0.0-20180925151256-3da0e2f905f9 // indirect
|
||||||
github.com/kr/pretty v0.3.1 // indirect
|
github.com/kr/pretty v0.3.1 // indirect
|
||||||
github.com/kr/text v0.2.0 // indirect
|
github.com/kr/text v0.2.0 // indirect
|
||||||
github.com/pmezard/go-difflib v1.0.0 // indirect
|
github.com/pmezard/go-difflib v1.0.0 // indirect
|
||||||
@@ -38,16 +36,15 @@ require (
|
|||||||
|
|
||||||
require (
|
require (
|
||||||
github.com/dsnet/compress v0.0.1
|
github.com/dsnet/compress v0.0.1
|
||||||
github.com/gabriel-vasile/mimetype v1.4.3
|
github.com/gabriel-vasile/mimetype v1.4.13
|
||||||
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77
|
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77
|
||||||
github.com/klauspost/compress v1.17.2
|
github.com/klauspost/compress v1.18.4
|
||||||
github.com/mattn/go-runewidth v0.0.15 // indirect
|
github.com/mattn/go-runewidth v0.0.21 // indirect
|
||||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db // indirect
|
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db // indirect
|
||||||
github.com/rivo/uniseg v0.4.4 // indirect
|
github.com/rivo/uniseg v0.4.7 // indirect
|
||||||
github.com/shopspring/decimal v1.3.1 // indirect
|
github.com/shopspring/decimal v1.4.0 // indirect
|
||||||
github.com/ulikunitz/xz v0.5.11
|
github.com/ulikunitz/xz v0.5.15
|
||||||
golang.org/x/net v0.35.0 // indirect
|
golang.org/x/sys v0.42.0 // indirect
|
||||||
golang.org/x/sys v0.30.0 // indirect
|
golang.org/x/term v0.41.0 // indirect
|
||||||
golang.org/x/term v0.29.0 // indirect
|
|
||||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c
|
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c
|
||||||
)
|
)
|
||||||
|
|||||||
@@ -1,36 +1,41 @@
|
|||||||
github.com/DavidGamba/go-getoptions v0.28.0 h1:18wgEvfZdrlfIhVDGEBO3Dl0fkOyXqXLa0tLMCKxM1c=
|
github.com/DavidGamba/go-getoptions v0.33.0 h1:8xCPH87Yy5avYenygyHVlqqm8RpymH0YFe4a7IWlarE=
|
||||||
github.com/DavidGamba/go-getoptions v0.28.0/go.mod h1:zE97E3PR9P3BI/HKyNYgdMlYxodcuiC6W68KIgeYT84=
|
github.com/DavidGamba/go-getoptions v0.33.0/go.mod h1:zE97E3PR9P3BI/HKyNYgdMlYxodcuiC6W68KIgeYT84=
|
||||||
github.com/PaesslerAG/gval v1.2.2 h1:Y7iBzhgE09IGTt5QgGQ2IdaYYYOU134YGHBThD+wm9E=
|
github.com/PaesslerAG/gval v1.2.4 h1:rhX7MpjJlcxYwL2eTTYIOBUyEKZ+A96T9vQySWkVUiU=
|
||||||
github.com/PaesslerAG/gval v1.2.2/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
|
github.com/PaesslerAG/gval v1.2.4/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
|
||||||
github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
|
github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
|
||||||
github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
|
github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
|
||||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
|
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
|
||||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
|
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
|
||||||
github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
|
github.com/buger/jsonparser v1.1.2 h1:frqHqw7otoVbk5M8LlE/L7HTnIq2v9RX6EJ48i9AxJk=
|
||||||
github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
|
github.com/buger/jsonparser v1.1.2/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
|
||||||
github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
|
github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
|
||||||
github.com/chen3feng/stl4go v0.1.1/go.mod h1:5ml3psLgETJjRJnMbPE+JiHLrCpt+Ajc2weeTECXzWU=
|
github.com/chen3feng/stl4go v0.1.1/go.mod h1:5ml3psLgETJjRJnMbPE+JiHLrCpt+Ajc2weeTECXzWU=
|
||||||
|
github.com/chengxilo/virtualterm v1.0.4 h1:Z6IpERbRVlfB8WkOmtbHiDbBANU7cimRIof7mk9/PwM=
|
||||||
|
github.com/chengxilo/virtualterm v1.0.4/go.mod h1:DyxxBZz/x1iqJjFxTFcr6/x+jSpqN0iwWCOK1q10rlY=
|
||||||
|
github.com/clipperhouse/uax29/v2 v2.2.0 h1:ChwIKnQN3kcZteTXMgb1wztSgaU+ZemkgWdohwgs8tY=
|
||||||
|
github.com/clipperhouse/uax29/v2 v2.2.0/go.mod h1:EFJ2TJMRUaplDxHKj1qAEhCtQPW2tJSwu5BF98AuoVM=
|
||||||
github.com/creack/pty v1.1.9/go.mod h1:oKZEueFk5CKHvIhNR5MUki03XCEU+Q6VDXinZuGJ33E=
|
github.com/creack/pty v1.1.9/go.mod h1:oKZEueFk5CKHvIhNR5MUki03XCEU+Q6VDXinZuGJ33E=
|
||||||
github.com/davecgh/go-spew v1.1.0/go.mod h1:J7Y8YcW2NihsgmVo/mv3lAwl/skON4iLHjSsI+c5H38=
|
|
||||||
github.com/davecgh/go-spew v1.1.1 h1:vj9j/u1bqnvCEfJOwUhtlOARqs3+rkHYY13jYWTU97c=
|
github.com/davecgh/go-spew v1.1.1 h1:vj9j/u1bqnvCEfJOwUhtlOARqs3+rkHYY13jYWTU97c=
|
||||||
github.com/davecgh/go-spew v1.1.1/go.mod h1:J7Y8YcW2NihsgmVo/mv3lAwl/skON4iLHjSsI+c5H38=
|
github.com/davecgh/go-spew v1.1.1/go.mod h1:J7Y8YcW2NihsgmVo/mv3lAwl/skON4iLHjSsI+c5H38=
|
||||||
github.com/dlclark/regexp2 v1.11.4 h1:rPYF9/LECdNymJufQKmri9gV604RvvABwgOA8un7yAo=
|
github.com/dlclark/regexp2 v1.11.5 h1:Q/sSnsKerHeCkc/jSTNq1oCm7KiVgUMZRDUoRu0JQZQ=
|
||||||
github.com/dlclark/regexp2 v1.11.4/go.mod h1:DHkYz0B9wPfa6wondMfaivmHpzrQ3v9q8cnmRbL6yW8=
|
github.com/dlclark/regexp2 v1.11.5/go.mod h1:DHkYz0B9wPfa6wondMfaivmHpzrQ3v9q8cnmRbL6yW8=
|
||||||
github.com/dsnet/compress v0.0.1 h1:PlZu0n3Tuv04TzpfPbrnI0HW/YwodEXDS+oPKahKF0Q=
|
github.com/dsnet/compress v0.0.1 h1:PlZu0n3Tuv04TzpfPbrnI0HW/YwodEXDS+oPKahKF0Q=
|
||||||
github.com/dsnet/compress v0.0.1/go.mod h1:Aw8dCMJ7RioblQeTqt88akK31OvO8Dhf5JflhBbQEHo=
|
github.com/dsnet/compress v0.0.1/go.mod h1:Aw8dCMJ7RioblQeTqt88akK31OvO8Dhf5JflhBbQEHo=
|
||||||
github.com/dsnet/golib v0.0.0-20171103203638-1ea166775780/go.mod h1:Lj+Z9rebOhdfkVLjJ8T6VcRQv3SXugXy999NBtR9aFY=
|
github.com/dsnet/golib v0.0.0-20171103203638-1ea166775780/go.mod h1:Lj+Z9rebOhdfkVLjJ8T6VcRQv3SXugXy999NBtR9aFY=
|
||||||
github.com/gabriel-vasile/mimetype v1.4.3 h1:in2uUcidCuFcDKtdcBxlR0rJ1+fsokWf+uqxgUFjbI0=
|
github.com/gabriel-vasile/mimetype v1.4.13 h1:46nXokslUBsAJE/wMsp5gtO500a4F3Nkz9Ufpk2AcUM=
|
||||||
github.com/gabriel-vasile/mimetype v1.4.3/go.mod h1:d8uq/6HKRL6CGdk+aubisF/M5GcPfT7nKyLpA0lbSSk=
|
github.com/gabriel-vasile/mimetype v1.4.13/go.mod h1:d+9Oxyo1wTzWdyVUPMmXFvp4F9tea18J8ufA774AB3s=
|
||||||
github.com/goccy/go-json v0.10.3 h1:KZ5WoDbxAIgm2HNbYckL0se1fHD6rz5j4ywS6ebzDqA=
|
github.com/goccy/go-json v0.10.6 h1:p8HrPJzOakx/mn/bQtjgNjdTcN+/S6FcG2CTtQOrHVU=
|
||||||
github.com/goccy/go-json v0.10.3/go.mod h1:oq7eo15ShAhp70Anwd5lgX2pLfOS3QCiwU/PULtXL6M=
|
github.com/goccy/go-json v0.10.6/go.mod h1:oq7eo15ShAhp70Anwd5lgX2pLfOS3QCiwU/PULtXL6M=
|
||||||
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 h1:SajEQ6tktpF9SRIuzbiPOX9AEZZ53Bvw0k9Mzrts8Lg=
|
github.com/google/go-cmp v0.6.0 h1:ofyhxvXcZhMsU5ulbFiLKl/XBFqE1GSq7atu8tAmTRI=
|
||||||
|
github.com/google/go-cmp v0.6.0/go.mod h1:17dUlkBOakJ0+DkrSSNjCkIjxS6bF9zb3elmeNGIjoY=
|
||||||
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419/go.mod h1:YKu81H3RSd1cFh0d7NhvUoTtUC9IY/vBX0WUQb1/o4Y=
|
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419/go.mod h1:YKu81H3RSd1cFh0d7NhvUoTtUC9IY/vBX0WUQb1/o4Y=
|
||||||
|
github.com/goombaio/orderedmap v0.0.0-20180925151256-3da0e2f905f9 h1:vFjPvFavIiDY71bQ9HIxPQBANvNl1SmFC4fgg5xRkho=
|
||||||
|
github.com/goombaio/orderedmap v0.0.0-20180925151256-3da0e2f905f9/go.mod h1:YKu81H3RSd1cFh0d7NhvUoTtUC9IY/vBX0WUQb1/o4Y=
|
||||||
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77 h1:4dvq1tGHn1Y9KSRY0OZ24Khki4+4U+ZrA//YYsdUlJU=
|
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77 h1:4dvq1tGHn1Y9KSRY0OZ24Khki4+4U+ZrA//YYsdUlJU=
|
||||||
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77/go.mod h1:HPelMYpOyy0XvglpBbmZ3krZpwaHmszj/vQNlnETPTM=
|
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77/go.mod h1:HPelMYpOyy0XvglpBbmZ3krZpwaHmszj/vQNlnETPTM=
|
||||||
github.com/k0kubun/go-ansi v0.0.0-20180517002512-3bf9e2903213/go.mod h1:vNUNkEQ1e29fT/6vq2aBdFsgNPmy8qMdSay1npru+Sw=
|
|
||||||
github.com/klauspost/compress v1.4.1/go.mod h1:RyIbtBH6LamlWaDj8nUwkbUhJ87Yi3uG0guNDohfE1A=
|
github.com/klauspost/compress v1.4.1/go.mod h1:RyIbtBH6LamlWaDj8nUwkbUhJ87Yi3uG0guNDohfE1A=
|
||||||
github.com/klauspost/compress v1.17.2 h1:RlWWUY/Dr4fL8qk9YG7DTZ7PDgME2V4csBXA8L/ixi4=
|
github.com/klauspost/compress v1.18.4 h1:RPhnKRAQ4Fh8zU2FY/6ZFDwTVTxgJ/EMydqSTzE9a2c=
|
||||||
github.com/klauspost/compress v1.17.2/go.mod h1:ntbaceVETuRiXiv4DpjP66DpAtAGkEQskQzEyD//IeE=
|
github.com/klauspost/compress v1.18.4/go.mod h1:R0h/fSBs8DE4ENlcrlib3PsXS61voFxhIs2DeRhCvJ4=
|
||||||
github.com/klauspost/cpuid v1.2.0/go.mod h1:Pj4uuM528wm8OyEC2QMXAi2YiTZ96dNQPGgoMS4s3ek=
|
github.com/klauspost/cpuid v1.2.0/go.mod h1:Pj4uuM528wm8OyEC2QMXAi2YiTZ96dNQPGgoMS4s3ek=
|
||||||
github.com/klauspost/pgzip v1.2.6 h1:8RXeL5crjEUFnR2/Sn6GJNWtSQ3Dk8pq4CL3jvdDyjU=
|
github.com/klauspost/pgzip v1.2.6 h1:8RXeL5crjEUFnR2/Sn6GJNWtSQ3Dk8pq4CL3jvdDyjU=
|
||||||
github.com/klauspost/pgzip v1.2.6/go.mod h1:Ch1tH69qFZu15pkjo5kYi6mth2Zzwzt50oCQKQE9RUs=
|
github.com/klauspost/pgzip v1.2.6/go.mod h1:Ch1tH69qFZu15pkjo5kYi6mth2Zzwzt50oCQKQE9RUs=
|
||||||
@@ -41,10 +46,8 @@ github.com/kr/pty v1.1.1/go.mod h1:pFQYn66WHrOpPYNljwOMqo10TkYh1fy3cYio2l3bCsQ=
|
|||||||
github.com/kr/text v0.1.0/go.mod h1:4Jbv+DJW3UT/LiOwJeYQe1efqtUx/iVham/4vfdArNI=
|
github.com/kr/text v0.1.0/go.mod h1:4Jbv+DJW3UT/LiOwJeYQe1efqtUx/iVham/4vfdArNI=
|
||||||
github.com/kr/text v0.2.0 h1:5Nx0Ya0ZqY2ygV366QzturHI13Jq95ApcVaJBhpS+AY=
|
github.com/kr/text v0.2.0 h1:5Nx0Ya0ZqY2ygV366QzturHI13Jq95ApcVaJBhpS+AY=
|
||||||
github.com/kr/text v0.2.0/go.mod h1:eLer722TekiGuMkidMxC/pM04lWEeraHUUmBw8l2grE=
|
github.com/kr/text v0.2.0/go.mod h1:eLer722TekiGuMkidMxC/pM04lWEeraHUUmBw8l2grE=
|
||||||
github.com/mattn/go-isatty v0.0.17/go.mod h1:kYGgaQfpe5nmfYZH+SKPsOc2e4SrIfOl2e/yFXSvRLM=
|
github.com/mattn/go-runewidth v0.0.21 h1:jJKAZiQH+2mIinzCJIaIG9Be1+0NR+5sz/lYEEjdM8w=
|
||||||
github.com/mattn/go-runewidth v0.0.14/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
|
github.com/mattn/go-runewidth v0.0.21/go.mod h1:XBkDxAl56ILZc9knddidhrOlY5R/pDhgLpndooCuJAs=
|
||||||
github.com/mattn/go-runewidth v0.0.15 h1:UNAjwbU9l54TA3KzvqLGxwWjHmMgBUVhBiTjelZgg3U=
|
|
||||||
github.com/mattn/go-runewidth v0.0.15/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
|
|
||||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2EmQ4l5rM/4FEfDWcRD+abF5XlKShorW5LRoQ=
|
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2EmQ4l5rM/4FEfDWcRD+abF5XlKShorW5LRoQ=
|
||||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
|
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
|
||||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
|
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
|
||||||
@@ -54,50 +57,40 @@ github.com/pelletier/go-toml/v2 v2.2.4/go.mod h1:2gIqNv+qfxSVS7cM2xJQKtLSTLUE9V8
|
|||||||
github.com/pkg/diff v0.0.0-20210226163009-20ebb0f2a09e/go.mod h1:pJLUxLENpZxwdsKMEsNbx1VGcRFpLqf3715MtcvvzbA=
|
github.com/pkg/diff v0.0.0-20210226163009-20ebb0f2a09e/go.mod h1:pJLUxLENpZxwdsKMEsNbx1VGcRFpLqf3715MtcvvzbA=
|
||||||
github.com/pmezard/go-difflib v1.0.0 h1:4DBwDE0NGyQoBHbLQYPwSUPoCMWR5BEzIk/f1lZbAQM=
|
github.com/pmezard/go-difflib v1.0.0 h1:4DBwDE0NGyQoBHbLQYPwSUPoCMWR5BEzIk/f1lZbAQM=
|
||||||
github.com/pmezard/go-difflib v1.0.0/go.mod h1:iKH77koFhYxTK1pcRnkKkqfTogsbg7gZNVY4sRDYZ/4=
|
github.com/pmezard/go-difflib v1.0.0/go.mod h1:iKH77koFhYxTK1pcRnkKkqfTogsbg7gZNVY4sRDYZ/4=
|
||||||
github.com/rivo/uniseg v0.2.0/go.mod h1:J6wj4VEh+S6ZtnVlnTBMWIodfgj8LQOQFoIToxlJtxc=
|
github.com/rivo/uniseg v0.4.7 h1:WUdvkW8uEhrYfLC4ZzdpI2ztxP1I582+49Oc5Mq64VQ=
|
||||||
github.com/rivo/uniseg v0.4.4 h1:8TfxU8dW6PdqD27gjM8MVNuicgxIjxpm4K7x4jp8sis=
|
github.com/rivo/uniseg v0.4.7/go.mod h1:FN3SvrM+Zdj16jyLfmOkMNblXMcoc8DfTHruCPUcx88=
|
||||||
github.com/rivo/uniseg v0.4.4/go.mod h1:FN3SvrM+Zdj16jyLfmOkMNblXMcoc8DfTHruCPUcx88=
|
|
||||||
github.com/rogpeppe/go-internal v1.9.0/go.mod h1:WtVeX8xhTBvf0smdhujwtBcq4Qrzq/fJaraNFVN+nFs=
|
github.com/rogpeppe/go-internal v1.9.0/go.mod h1:WtVeX8xhTBvf0smdhujwtBcq4Qrzq/fJaraNFVN+nFs=
|
||||||
github.com/rogpeppe/go-internal v1.12.0 h1:exVL4IDcn6na9z1rAb56Vxr+CgyK3nn3O+epU5NdKM8=
|
github.com/rogpeppe/go-internal v1.12.0 h1:exVL4IDcn6na9z1rAb56Vxr+CgyK3nn3O+epU5NdKM8=
|
||||||
github.com/rogpeppe/go-internal v1.12.0/go.mod h1:E+RYuTGaKKdloAfM02xzb0FW3Paa99yedzYV+kq4uf4=
|
github.com/rogpeppe/go-internal v1.12.0/go.mod h1:E+RYuTGaKKdloAfM02xzb0FW3Paa99yedzYV+kq4uf4=
|
||||||
github.com/rrethy/ahocorasick v1.0.0 h1:YKkCB+E5PXc0xmLfMrWbfNht8vG9Re97IHSWZk/Lk8E=
|
github.com/rrethy/ahocorasick v1.0.0 h1:YKkCB+E5PXc0xmLfMrWbfNht8vG9Re97IHSWZk/Lk8E=
|
||||||
github.com/rrethy/ahocorasick v1.0.0/go.mod h1:nq8oScE7Vy1rOppoQxpQiiDmPHuKCuk9rXrNcxUV3R0=
|
github.com/rrethy/ahocorasick v1.0.0/go.mod h1:nq8oScE7Vy1rOppoQxpQiiDmPHuKCuk9rXrNcxUV3R0=
|
||||||
github.com/schollz/progressbar/v3 v3.13.1 h1:o8rySDYiQ59Mwzy2FELeHY5ZARXZTVJC7iHD6PEFUiE=
|
github.com/schollz/progressbar/v3 v3.19.0 h1:Ea18xuIRQXLAUidVDox3AbwfUhD0/1IvohyTutOIFoc=
|
||||||
github.com/schollz/progressbar/v3 v3.13.1/go.mod h1:xvrbki8kfT1fzWzBT/UZd9L6GA+jdL7HAgq2RFnO6fQ=
|
github.com/schollz/progressbar/v3 v3.19.0/go.mod h1:IsO3lpbaGuzh8zIMzgY3+J8l4C8GjO0Y9S69eFvNsec=
|
||||||
github.com/shopspring/decimal v1.3.1 h1:2Usl1nmF/WZucqkFZhnfFYxxxu8LG21F6nPQBE5gKV8=
|
|
||||||
github.com/shopspring/decimal v1.3.1/go.mod h1:DKyhrW/HYNuLGql+MJL6WCR6knT2jwCFRcu2hWCYk4o=
|
github.com/shopspring/decimal v1.3.1/go.mod h1:DKyhrW/HYNuLGql+MJL6WCR6knT2jwCFRcu2hWCYk4o=
|
||||||
github.com/sirupsen/logrus v1.9.3 h1:dueUQJ1C2q9oE3F7wvmSGAaVtTmUizReu6fjN8uqzbQ=
|
github.com/shopspring/decimal v1.4.0 h1:bxl37RwXBklmTi0C79JfXCEBD1cqqHt0bbgBAGFp81k=
|
||||||
github.com/sirupsen/logrus v1.9.3/go.mod h1:naHLuLoDiP4jHNo9R0sCBMtWGeIprob74mVsIT4qYEQ=
|
github.com/shopspring/decimal v1.4.0/go.mod h1:gawqmDU56v4yIKSwfBSFip1HdCCXN8/+DMd9qYNcwME=
|
||||||
github.com/stretchr/objx v0.1.0/go.mod h1:HFkY916IF+rwdDfMAkV7OtwuqBVzrE8GR6GFx+wExME=
|
github.com/sirupsen/logrus v1.9.4 h1:TsZE7l11zFCLZnZ+teH4Umoq5BhEIfIzfRDZ1Uzql2w=
|
||||||
github.com/stretchr/testify v1.3.0/go.mod h1:M5WIy9Dh21IEIfnGCwXGc5bZfKNJtfHm1UVUgZn+9EI=
|
github.com/sirupsen/logrus v1.9.4/go.mod h1:ftWc9WdOfJ0a92nsE2jF5u5ZwH8Bv2zdeOC42RjbV2g=
|
||||||
github.com/stretchr/testify v1.7.0/go.mod h1:6Fq8oRcR53rry900zMqJjRRixrwX3KX962/h/Wwjteg=
|
github.com/stretchr/testify v1.10.0 h1:Xv5erBjTwe/5IxqUQTdXv5kgmIvbHo3QQyRwhJsOfJA=
|
||||||
github.com/stretchr/testify v1.8.4 h1:CcVxjf3Q8PM0mHUKJCdn+eZZtm5yQwehR5yeSVQQcUk=
|
github.com/stretchr/testify v1.10.0/go.mod h1:r2ic/lqez/lEtzL7wO/rwa5dbSLXVDPFyf8C91i36aY=
|
||||||
github.com/stretchr/testify v1.8.4/go.mod h1:sz/lmYIOXD/1dqDmKjjqLyZ2RngseejIcXlSw2iwfAo=
|
|
||||||
github.com/tevino/abool/v2 v2.1.0 h1:7w+Vf9f/5gmKT4m4qkayb33/92M+Um45F2BkHOR+L/c=
|
github.com/tevino/abool/v2 v2.1.0 h1:7w+Vf9f/5gmKT4m4qkayb33/92M+Um45F2BkHOR+L/c=
|
||||||
github.com/tevino/abool/v2 v2.1.0/go.mod h1:+Lmlqk6bHDWHqN1cbxqhwEAwMPXgc8I1SDEamtseuXY=
|
github.com/tevino/abool/v2 v2.1.0/go.mod h1:+Lmlqk6bHDWHqN1cbxqhwEAwMPXgc8I1SDEamtseuXY=
|
||||||
github.com/ulikunitz/xz v0.5.6/go.mod h1:2bypXElzHzzJZwzH67Y6wb67pO62Rzfn7BSiF4ABRW8=
|
github.com/ulikunitz/xz v0.5.6/go.mod h1:2bypXElzHzzJZwzH67Y6wb67pO62Rzfn7BSiF4ABRW8=
|
||||||
github.com/ulikunitz/xz v0.5.11 h1:kpFauv27b6ynzBNT/Xy+1k+fK4WswhN/6PN5WhFAGw8=
|
github.com/ulikunitz/xz v0.5.15 h1:9DNdB5s+SgV3bQ2ApL10xRc35ck0DuIX/isZvIk+ubY=
|
||||||
github.com/ulikunitz/xz v0.5.11/go.mod h1:nbz6k7qbPmH4IRqmfOplQw/tblSgqTqBwxkY0oWt/14=
|
github.com/ulikunitz/xz v0.5.15/go.mod h1:nbz6k7qbPmH4IRqmfOplQw/tblSgqTqBwxkY0oWt/14=
|
||||||
github.com/yuin/gopher-lua v1.1.1 h1:kYKnWBjvbNP4XLT3+bPEwAXJx262OhaHDWDVOPjL46M=
|
github.com/yuin/gopher-lua v1.1.1 h1:kYKnWBjvbNP4XLT3+bPEwAXJx262OhaHDWDVOPjL46M=
|
||||||
github.com/yuin/gopher-lua v1.1.1/go.mod h1:GBR0iDaNXjAgGg9zfCvksxSRnQx76gclCIb7kdAd1Pw=
|
github.com/yuin/gopher-lua v1.1.1/go.mod h1:GBR0iDaNXjAgGg9zfCvksxSRnQx76gclCIb7kdAd1Pw=
|
||||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa h1:FRnLl4eNAQl8hwxVVC17teOw8kdjVDVAiFMtgUdTSRQ=
|
golang.org/x/exp v0.0.0-20260312153236-7ab1446f8b90 h1:jiDhWWeC7jfWqR9c/uplMOqJ0sbNlNWv0UkzE0vX1MA=
|
||||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa/go.mod h1:zk2irFbV9DP96SEBUUAy67IdHUaZuSnrz1n472HUCLE=
|
golang.org/x/exp v0.0.0-20260312153236-7ab1446f8b90/go.mod h1:xE1HEv6b+1SCZ5/uscMRjUBKtIxworgEcEi+/n9NQDQ=
|
||||||
golang.org/x/net v0.35.0 h1:T5GQRQb2y08kTAByq9L4/bz8cipCdA8FbRTXewonqY8=
|
golang.org/x/sys v0.42.0 h1:omrd2nAlyT5ESRdCLYdm3+fMfNFE/+Rf4bDIQImRJeo=
|
||||||
golang.org/x/net v0.35.0/go.mod h1:EglIi67kWsHKlRzzVMUD93VMSWGFOMSZgxFjparz1Qk=
|
golang.org/x/sys v0.42.0/go.mod h1:4GL1E5IUh+htKOUEOaiffhrAeqysfVGipDYzABqnCmw=
|
||||||
golang.org/x/sys v0.0.0-20220715151400-c0bba94af5f8/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
golang.org/x/term v0.41.0 h1:QCgPso/Q3RTJx2Th4bDLqML4W6iJiaXFq2/ftQF13YU=
|
||||||
golang.org/x/sys v0.0.0-20220811171246-fbc7d0a398ab/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
golang.org/x/term v0.41.0/go.mod h1:3pfBgksrReYfZ5lvYM0kSO0LIkAl4Yl2bXOkKP7Ec2A=
|
||||||
golang.org/x/sys v0.6.0/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
gonum.org/v1/gonum v0.17.0 h1:VbpOemQlsSMrYmn7T2OUvQ4dqxQXU+ouZFQsZOx50z4=
|
||||||
golang.org/x/sys v0.30.0 h1:QjkSwP/36a20jFYWkSue1YwXzLmsV5Gfq7Eiy72C1uc=
|
gonum.org/v1/gonum v0.17.0/go.mod h1:El3tOrEuMpv2UdMrbNlKEh9vd86bmQ6vqIcDwxEOc1E=
|
||||||
golang.org/x/sys v0.30.0/go.mod h1:/VUhepiaJMQUp4+oa/7Zr1D23ma6VTLIYjOOTFZPUcA=
|
|
||||||
golang.org/x/term v0.6.0/go.mod h1:m6U89DPEgQRMq3DNkDClhWw02AUbt2daBVO4cn4Hv9U=
|
|
||||||
golang.org/x/term v0.29.0 h1:L6pJp37ocefwRRtYPKSWOWzOtWSxVajvz2ldH/xi3iU=
|
|
||||||
golang.org/x/term v0.29.0/go.mod h1:6bl4lRlvVuDgSf3179VpIxBF0o10JUpXWOnI7nErv7s=
|
|
||||||
gonum.org/v1/gonum v0.14.0 h1:2NiG67LD1tEH0D7kM+ps2V+fXmsAnpUeec7n8tcr4S0=
|
|
||||||
gonum.org/v1/gonum v0.14.0/go.mod h1:AoWeoz0becf9QMWtE8iWXNXc27fK4fNeHNf/oMejGfU=
|
|
||||||
gopkg.in/check.v1 v0.0.0-20161208181325-20d25e280405/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0=
|
gopkg.in/check.v1 v0.0.0-20161208181325-20d25e280405/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0=
|
||||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c h1:Hei/4ADfdWqJk1ZMxUNpqntNwaWcugrBjAiHlqqRiVk=
|
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c h1:Hei/4ADfdWqJk1ZMxUNpqntNwaWcugrBjAiHlqqRiVk=
|
||||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c/go.mod h1:JHkPIbrfpd72SG/EVd6muEfDQjcINNoR0C8j2r3qZ4Q=
|
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c/go.mod h1:JHkPIbrfpd72SG/EVd6muEfDQjcINNoR0C8j2r3qZ4Q=
|
||||||
gopkg.in/yaml.v3 v3.0.0-20200313102051-9f266ea9e77c/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
|
|
||||||
gopkg.in/yaml.v3 v3.0.1 h1:fxVm/GzAzEWqLHuvctI91KS9hhNmmWOoWu0XTYJS7CA=
|
gopkg.in/yaml.v3 v3.0.1 h1:fxVm/GzAzEWqLHuvctI91KS9hhNmmWOoWu0XTYJS7CA=
|
||||||
gopkg.in/yaml.v3 v3.0.1/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
|
gopkg.in/yaml.v3 v3.0.1/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
|
||||||
scientificgo.org/special v0.0.0 h1:P6WJkECo6tgtvZAEfNXl+KEB9ReAatjKAeX8U07mjSc=
|
scientificgo.org/special v0.0.0 h1:P6WJkECo6tgtvZAEfNXl+KEB9ReAatjKAeX8U07mjSc=
|
||||||
|
|||||||
@@ -52,6 +52,8 @@ golang.org/x/image v0.6.0/go.mod h1:MXLdDR43H7cDJq5GEGXEVeeNhPgi+YYEQ2pC1byI1x0=
|
|||||||
golang.org/x/mod v0.13.0 h1:I/DsJXRlw/8l/0c24sM9yb0T4z9liZTduXvdAWYiysY=
|
golang.org/x/mod v0.13.0 h1:I/DsJXRlw/8l/0c24sM9yb0T4z9liZTduXvdAWYiysY=
|
||||||
golang.org/x/mod v0.13.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
golang.org/x/mod v0.13.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
||||||
golang.org/x/mod v0.14.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
golang.org/x/mod v0.14.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
||||||
|
golang.org/x/net v0.38.0/go.mod h1:ivrbrMbzFq5J41QOQh0siUuly180yBYtLp+CKbEaFx8=
|
||||||
|
golang.org/x/net v0.52.0/go.mod h1:R1MAz7uMZxVMualyPXb+VaqGSa3LIaUqk0eEt3w36Sw=
|
||||||
golang.org/x/sync v0.0.0-20220722155255-886fb9371eb4 h1:uVc8UZUe6tr40fFVnUP5Oj+veunVezqYl9z7DYw9xzw=
|
golang.org/x/sync v0.0.0-20220722155255-886fb9371eb4 h1:uVc8UZUe6tr40fFVnUP5Oj+veunVezqYl9z7DYw9xzw=
|
||||||
golang.org/x/text v0.13.0 h1:ablQoSUd0tRdKxZewP80B+BaqeKJuVhuRxj/dkrun3k=
|
golang.org/x/text v0.13.0 h1:ablQoSUd0tRdKxZewP80B+BaqeKJuVhuRxj/dkrun3k=
|
||||||
golang.org/x/text v0.13.0/go.mod h1:TvPlkZtksWOMsz7fbANvkp4WM8x/WCo/om8BMLbz+aE=
|
golang.org/x/text v0.13.0/go.mod h1:TvPlkZtksWOMsz7fbANvkp4WM8x/WCo/om8BMLbz+aE=
|
||||||
|
|||||||
+41
-14
@@ -7,6 +7,7 @@ INSTALL_DIR="/usr/local"
|
|||||||
OBITOOLS_PREFIX=""
|
OBITOOLS_PREFIX=""
|
||||||
VERSION=""
|
VERSION=""
|
||||||
LIST_VERSIONS=false
|
LIST_VERSIONS=false
|
||||||
|
JOBS=1
|
||||||
|
|
||||||
# Help message
|
# Help message
|
||||||
function display_help {
|
function display_help {
|
||||||
@@ -21,6 +22,7 @@ function display_help {
|
|||||||
echo " gobigrep command instead of obigrep)."
|
echo " gobigrep command instead of obigrep)."
|
||||||
echo " -v, --version Install a specific version (e.g., 4.4.8)."
|
echo " -v, --version Install a specific version (e.g., 4.4.8)."
|
||||||
echo " If not specified, installs the latest version."
|
echo " If not specified, installs the latest version."
|
||||||
|
echo " -j, --jobs Number of parallel jobs for compilation (default: 1)."
|
||||||
echo " -l, --list List all available versions and exit."
|
echo " -l, --list List all available versions and exit."
|
||||||
echo " -h, --help Display this help message."
|
echo " -h, --help Display this help message."
|
||||||
echo ""
|
echo ""
|
||||||
@@ -65,6 +67,10 @@ while [ "$#" -gt 0 ]; do
|
|||||||
VERSION="$2"
|
VERSION="$2"
|
||||||
shift 2
|
shift 2
|
||||||
;;
|
;;
|
||||||
|
-j|--jobs)
|
||||||
|
JOBS="$2"
|
||||||
|
shift 2
|
||||||
|
;;
|
||||||
-l|--list)
|
-l|--list)
|
||||||
LIST_VERSIONS=true
|
LIST_VERSIONS=true
|
||||||
shift
|
shift
|
||||||
@@ -122,9 +128,15 @@ mkdir -p "${WORK_DIR}/cache" \
|
|||||||
exit 1)
|
exit 1)
|
||||||
|
|
||||||
# Create installation directory
|
# Create installation directory
|
||||||
mkdir -p "${INSTALL_DIR}/bin" 2> /dev/null \
|
if ! mkdir -p "${INSTALL_DIR}/bin" 2>/dev/null; then
|
||||||
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
if [ ! -w "$(dirname "${INSTALL_DIR}")" ] && [ ! -w "${INSTALL_DIR}" ]; then
|
||||||
sudo mkdir -p "${INSTALL_DIR}/bin")
|
echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
||||||
|
sudo mkdir -p "${INSTALL_DIR}/bin"
|
||||||
|
else
|
||||||
|
echo "Error: Could not create ${INSTALL_DIR}/bin (check path or disk space)" 1>&2
|
||||||
|
exit 1
|
||||||
|
fi
|
||||||
|
fi
|
||||||
|
|
||||||
if [[ ! -d "${INSTALL_DIR}/bin" ]]; then
|
if [[ ! -d "${INSTALL_DIR}/bin" ]]; then
|
||||||
echo "Could not create ${INSTALL_DIR}/bin directory for installing obitools" 1>&2
|
echo "Could not create ${INSTALL_DIR}/bin directory for installing obitools" 1>&2
|
||||||
@@ -171,22 +183,24 @@ GOURL=$(curl -s "${URL}${GOFILE}" \
|
|||||||
|
|
||||||
echo "Installing Go from: $GOURL" 1>&2
|
echo "Installing Go from: $GOURL" 1>&2
|
||||||
|
|
||||||
curl -s "$GOURL" | tar zxf -
|
curl --progress-bar "$GOURL" | tar zxf -
|
||||||
|
|
||||||
PATH="$(pwd)/go/bin:$PATH"
|
export GOROOT="$(pwd)/go"
|
||||||
|
PATH="${GOROOT}/bin:$PATH"
|
||||||
export PATH
|
export PATH
|
||||||
GOPATH="$(pwd)/go"
|
export GOPATH="$(pwd)/gopath"
|
||||||
export GOPATH
|
|
||||||
export GOCACHE="$(pwd)/cache"
|
export GOCACHE="$(pwd)/cache"
|
||||||
|
export GOTOOLCHAIN=local
|
||||||
|
|
||||||
|
echo "GOROOT=$GOROOT" 1>&2
|
||||||
echo "GOCACHE=$GOCACHE" 1>&2
|
echo "GOCACHE=$GOCACHE" 1>&2
|
||||||
mkdir -p "$GOCACHE"
|
mkdir -p "$GOPATH" "$GOCACHE"
|
||||||
|
|
||||||
# Download OBITools4 source
|
# Download OBITools4 source
|
||||||
echo "Downloading OBITools4 v${VERSION}..." 1>&2
|
echo "Downloading OBITools4 v${VERSION}..." 1>&2
|
||||||
echo "Source URL: $OBIURL4" 1>&2
|
echo "Source URL: $OBIURL4" 1>&2
|
||||||
|
|
||||||
if ! curl -sL "$OBIURL4" > obitools4.zip; then
|
if ! curl --progress-bar -L "$OBIURL4" > obitools4.zip; then
|
||||||
echo "Error: Could not download OBITools4 version ${VERSION}" 1>&2
|
echo "Error: Could not download OBITools4 version ${VERSION}" 1>&2
|
||||||
echo "Please check that this version exists with: $0 --list" 1>&2
|
echo "Please check that this version exists with: $0 --list" 1>&2
|
||||||
exit 1
|
exit 1
|
||||||
@@ -208,16 +222,29 @@ mkdir -p vendor
|
|||||||
|
|
||||||
# Build with or without prefix
|
# Build with or without prefix
|
||||||
if [[ -z "$OBITOOLS_PREFIX" ]] ; then
|
if [[ -z "$OBITOOLS_PREFIX" ]] ; then
|
||||||
make GOFLAGS="-buildvcs=false"
|
make -j"${JOBS}" obitools GOFLAGS="-buildvcs=false"
|
||||||
else
|
else
|
||||||
make GOFLAGS="-buildvcs=false" OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
|
make -j"${JOBS}" obitools GOFLAGS="-buildvcs=false" OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
|
||||||
fi
|
fi
|
||||||
|
|
||||||
# Install binaries
|
# Install binaries
|
||||||
echo "Installing binaries to ${INSTALL_DIR}/bin..." 1>&2
|
echo "Installing binaries to ${INSTALL_DIR}/bin..." 1>&2
|
||||||
(cp build/* "${INSTALL_DIR}/bin" 2> /dev/null) \
|
if ! cp build/* "${INSTALL_DIR}/bin" 2>/dev/null; then
|
||||||
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
if [ ! -w "${INSTALL_DIR}/bin" ]; then
|
||||||
sudo cp build/* "${INSTALL_DIR}/bin")
|
echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
||||||
|
sudo cp build/* "${INSTALL_DIR}/bin"
|
||||||
|
else
|
||||||
|
echo "Error: Could not copy binaries to ${INSTALL_DIR}/bin" 1>&2
|
||||||
|
echo " Source files: $(ls build/ 2>/dev/null || echo 'none found')" 1>&2
|
||||||
|
echo "" 1>&2
|
||||||
|
echo "The build directory has been preserved for manual recovery:" 1>&2
|
||||||
|
echo " $(pwd)/build/" 1>&2
|
||||||
|
echo "You can install manually with:" 1>&2
|
||||||
|
echo " cp $(pwd)/build/* ${INSTALL_DIR}/bin/" 1>&2
|
||||||
|
popd > /dev/null || true
|
||||||
|
exit 1
|
||||||
|
fi
|
||||||
|
fi
|
||||||
|
|
||||||
popd > /dev/null || exit
|
popd > /dev/null || exit
|
||||||
|
|
||||||
|
|||||||
Binary file not shown.
Vendored
BIN
Binary file not shown.
Vendored
BIN
Binary file not shown.
@@ -0,0 +1,24 @@
|
|||||||
|
>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
|
||||||
|
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
|
||||||
|
gcctgaaactcaaaggacttggcggtgctttacatccct
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
|
||||||
|
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
|
||||||
|
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
|
||||||
|
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
|
||||||
|
gcttaaaactcaaaggacttggcggtgctttatatccct
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
|
||||||
|
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
|
||||||
|
gattaaacctcaaaggacttggcagtgctttatacccct
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
|
||||||
|
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
|
||||||
|
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
|
||||||
|
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
|
||||||
|
gcttaaaactcaaaggacttggcggtgctttatatccct
|
||||||
@@ -0,0 +1,48 @@
|
|||||||
|
taxid,parent,taxonomic_rank,scientific_name
|
||||||
|
taxon:1 [root]@no rank,taxon:1 [root]@no rank,no rank,root
|
||||||
|
taxon:131567 [cellular organisms]@cellular root,taxon:1 [root]@no rank,cellular root,cellular organisms
|
||||||
|
taxon:2759 [Eukaryota]@domain,taxon:131567 [cellular organisms]@cellular root,domain,Eukaryota
|
||||||
|
taxon:33154 [Opisthokonta]@clade,taxon:2759 [Eukaryota]@domain,clade,Opisthokonta
|
||||||
|
taxon:33208 [Metazoa]@kingdom,taxon:33154 [Opisthokonta]@clade,kingdom,Metazoa
|
||||||
|
taxon:6072 [Eumetazoa]@clade,taxon:33208 [Metazoa]@kingdom,clade,Eumetazoa
|
||||||
|
taxon:33213 [Bilateria]@clade,taxon:6072 [Eumetazoa]@clade,clade,Bilateria
|
||||||
|
taxon:33511 [Deuterostomia]@clade,taxon:33213 [Bilateria]@clade,clade,Deuterostomia
|
||||||
|
taxon:7711 [Chordata]@phylum,taxon:33511 [Deuterostomia]@clade,phylum,Chordata
|
||||||
|
taxon:89593 [Craniata]@subphylum,taxon:7711 [Chordata]@phylum,subphylum,Craniata
|
||||||
|
taxon:7742 [Vertebrata]@clade,taxon:89593 [Craniata]@subphylum,clade,Vertebrata
|
||||||
|
taxon:7776 [Gnathostomata]@clade,taxon:7742 [Vertebrata]@clade,clade,Gnathostomata
|
||||||
|
taxon:117570 [Teleostomi]@clade,taxon:7776 [Gnathostomata]@clade,clade,Teleostomi
|
||||||
|
taxon:117571 [Euteleostomi]@clade,taxon:117570 [Teleostomi]@clade,clade,Euteleostomi
|
||||||
|
taxon:8287 [Sarcopterygii]@superclass,taxon:117571 [Euteleostomi]@clade,superclass,Sarcopterygii
|
||||||
|
taxon:1338369 [Dipnotetrapodomorpha]@clade,taxon:8287 [Sarcopterygii]@superclass,clade,Dipnotetrapodomorpha
|
||||||
|
taxon:32523 [Tetrapoda]@clade,taxon:1338369 [Dipnotetrapodomorpha]@clade,clade,Tetrapoda
|
||||||
|
taxon:32524 [Amniota]@clade,taxon:32523 [Tetrapoda]@clade,clade,Amniota
|
||||||
|
taxon:40674 [Mammalia]@class,taxon:32524 [Amniota]@clade,class,Mammalia
|
||||||
|
taxon:32525 [Theria]@clade,taxon:40674 [Mammalia]@class,clade,Theria
|
||||||
|
taxon:9347 [Eutheria]@clade,taxon:32525 [Theria]@clade,clade,Eutheria
|
||||||
|
taxon:1437010 [Boreoeutheria]@clade,taxon:9347 [Eutheria]@clade,clade,Boreoeutheria
|
||||||
|
taxon:314146 [Euarchontoglires]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Euarchontoglires
|
||||||
|
taxon:314145 [Laurasiatheria]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Laurasiatheria
|
||||||
|
taxon:33554 [Carnivora]@order,taxon:314145 [Laurasiatheria]@superorder,order,Carnivora
|
||||||
|
taxon:91561 [Artiodactyla]@order,taxon:314145 [Laurasiatheria]@superorder,order,Artiodactyla
|
||||||
|
taxon:314147 [Glires]@clade,taxon:314146 [Euarchontoglires]@superorder,clade,Glires
|
||||||
|
taxon:9845 [Ruminantia]@suborder,taxon:91561 [Artiodactyla]@order,suborder,Ruminantia
|
||||||
|
taxon:35500 [Pecora]@infraorder,taxon:9845 [Ruminantia]@suborder,infraorder,Pecora
|
||||||
|
taxon:9989 [Rodentia]@order,taxon:314147 [Glires]@clade,order,Rodentia
|
||||||
|
taxon:379584 [Caniformia]@suborder,taxon:33554 [Carnivora]@order,suborder,Caniformia
|
||||||
|
taxon:9608 [Canidae]@family,taxon:379584 [Caniformia]@suborder,family,Canidae
|
||||||
|
taxon:9850 [Cervidae]@family,taxon:35500 [Pecora]@infraorder,family,Cervidae
|
||||||
|
taxon:9881 [Odocoileinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Odocoileinae
|
||||||
|
taxon:33553 [Sciuromorpha]@suborder,taxon:9989 [Rodentia]@order,suborder,Sciuromorpha
|
||||||
|
taxon:55153 [Sciuridae]@family,taxon:33553 [Sciuromorpha]@suborder,family,Sciuridae
|
||||||
|
taxon:34878 [Cervinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Cervinae
|
||||||
|
taxon:9611 [Canis]@genus,taxon:9608 [Canidae]@family,genus,Canis
|
||||||
|
taxon:9857 [Capreolus]@genus,taxon:9881 [Odocoileinae]@subfamily,genus,Capreolus
|
||||||
|
taxon:9612 [Canis lupus]@species,taxon:9611 [Canis]@genus,species,Canis lupus
|
||||||
|
taxon:337726 [Xerinae]@subfamily,taxon:55153 [Sciuridae]@family,subfamily,Xerinae
|
||||||
|
taxon:9859 [Cervus]@genus,taxon:34878 [Cervinae]@subfamily,genus,Cervus
|
||||||
|
taxon:337730 [Marmotini]@tribe,taxon:337726 [Xerinae]@subfamily,tribe,Marmotini
|
||||||
|
taxon:9992 [Marmota]@genus,taxon:337730 [Marmotini]@tribe,genus,Marmota
|
||||||
|
taxon:9860 [Cervus elaphus]@species,taxon:9859 [Cervus]@genus,species,Cervus elaphus
|
||||||
|
taxon:9615 [Canis lupus familiaris]@subspecies,taxon:9612 [Canis lupus]@species,subspecies,Canis lupus familiaris
|
||||||
|
taxon:9858 [Capreolus capreolus]@species,taxon:9857 [Capreolus]@genus,species,Capreolus capreolus
|
||||||
|
@@ -134,6 +134,130 @@ else
|
|||||||
((failed++))
|
((failed++))
|
||||||
fi
|
fi
|
||||||
|
|
||||||
|
|
||||||
|
# ------------------------------------------------------------------
|
||||||
|
# --raw-taxid tests (no taxonomy loaded)
|
||||||
|
# ------------------------------------------------------------------
|
||||||
|
|
||||||
|
# Running test
|
||||||
|
((ntest++))
|
||||||
|
if obiconvert --raw-taxid "${TEST_DIR}/out_ecotag.fasta" \
|
||||||
|
> "${TMPDIR}/raw_taxid.fasta" 2>/dev/null
|
||||||
|
then
|
||||||
|
log "$MCMD --raw-taxid: running OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD --raw-taxid: running failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Taxids must be bare numbers — no full-format "taxon:ID [Name]@rank" strings
|
||||||
|
((ntest++))
|
||||||
|
if grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
|
||||||
|
then
|
||||||
|
log "$MCMD --raw-taxid: taxid format check failed (full-format taxid found)"
|
||||||
|
((failed++))
|
||||||
|
else
|
||||||
|
log "$MCMD --raw-taxid: taxid format OK (all taxids are bare numbers)"
|
||||||
|
((success++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# --raw-taxid is idempotent: piping through a second obiconvert --raw-taxid must
|
||||||
|
# produce bit-for-bit identical output.
|
||||||
|
((ntest++))
|
||||||
|
if obiconvert --raw-taxid "${TMPDIR}/raw_taxid.fasta" \
|
||||||
|
> "${TMPDIR}/raw_taxid2.fasta" 2>/dev/null
|
||||||
|
then
|
||||||
|
log "$MCMD --raw-taxid piped: running OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD --raw-taxid piped: running failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
((ntest++))
|
||||||
|
if diff "${TMPDIR}/raw_taxid.fasta" \
|
||||||
|
"${TMPDIR}/raw_taxid2.fasta" > /dev/null
|
||||||
|
then
|
||||||
|
log "$MCMD --raw-taxid piped: idempotency OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD --raw-taxid piped: idempotency failed (outputs differ)"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
|
||||||
|
# ------------------------------------------------------------------
|
||||||
|
# --taxonomy tests (full-format taxid, no --raw-taxid)
|
||||||
|
# ------------------------------------------------------------------
|
||||||
|
|
||||||
|
# Running test
|
||||||
|
((ntest++))
|
||||||
|
if obiconvert --taxonomy "${TEST_DIR}/taxonomy.csv" \
|
||||||
|
"${TEST_DIR}/out_ecotag.fasta" \
|
||||||
|
> "${TMPDIR}/taxo.fasta" 2>/dev/null
|
||||||
|
then
|
||||||
|
log "$MCMD --taxonomy: running OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD --taxonomy: running failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Taxids must be in full "taxon:ID [Name]@rank" format
|
||||||
|
((ntest++))
|
||||||
|
if grep '"taxid"' "${TMPDIR}/taxo.fasta" | grep -q '"taxid":"taxon:[0-9]'
|
||||||
|
then
|
||||||
|
log "$MCMD --taxonomy: taxid format OK (full-format taxids present)"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD --taxonomy: taxid format check failed (no full-format taxid found)"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
|
||||||
|
# ------------------------------------------------------------------
|
||||||
|
# --raw-taxid --taxonomy tests
|
||||||
|
# ------------------------------------------------------------------
|
||||||
|
|
||||||
|
# Running test
|
||||||
|
((ntest++))
|
||||||
|
if obiconvert --raw-taxid --taxonomy "${TEST_DIR}/taxonomy.csv" \
|
||||||
|
"${TEST_DIR}/out_ecotag.fasta" \
|
||||||
|
> "${TMPDIR}/raw_taxid_taxo.fasta" 2>/dev/null
|
||||||
|
then
|
||||||
|
log "$MCMD --raw-taxid --taxonomy: running OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD --raw-taxid --taxonomy: running failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Taxids must be bare numbers even when taxonomy is loaded
|
||||||
|
((ntest++))
|
||||||
|
if grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
|
||||||
|
then
|
||||||
|
log "$MCMD --raw-taxid --taxonomy: taxid format check failed (full-format taxid found)"
|
||||||
|
((failed++))
|
||||||
|
else
|
||||||
|
log "$MCMD --raw-taxid --taxonomy: taxid format OK (all taxids are bare numbers)"
|
||||||
|
((success++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# --raw-taxid with or without taxonomy must yield identical taxid values
|
||||||
|
((ntest++))
|
||||||
|
if diff <(grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
|
||||||
|
<(grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
|
||||||
|
> /dev/null
|
||||||
|
then
|
||||||
|
log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values match OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values differ (unexpected)"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
#########################################
|
||||||
#
|
#
|
||||||
# At the end of the tests
|
# At the end of the tests
|
||||||
|
|||||||
@@ -0,0 +1,24 @@
|
|||||||
|
>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
|
||||||
|
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
|
||||||
|
gcctgaaactcaaaggacttggcggtgctttacatccct
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
|
||||||
|
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
|
||||||
|
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
|
||||||
|
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
|
||||||
|
gcttaaaactcaaaggacttggcggtgctttatatccct
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
|
||||||
|
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
|
||||||
|
gattaaacctcaaaggacttggcagtgctttatacccct
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
|
||||||
|
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
|
||||||
|
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
|
||||||
|
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
|
||||||
|
gcttaaaactcaaaggacttggcggtgctttatatccct
|
||||||
+46
-1
@@ -1,6 +1,12 @@
|
|||||||
package obidefault
|
package obidefault
|
||||||
|
|
||||||
var _BatchSize = 2000
|
// _BatchSize is the minimum number of sequences per batch (floor).
|
||||||
|
// Used as the minSeqs argument to RebatchBySize.
|
||||||
|
var _BatchSize = 1
|
||||||
|
|
||||||
|
// _BatchSizeMax is the maximum number of sequences per batch (ceiling).
|
||||||
|
// A batch is flushed when this count is reached regardless of memory usage.
|
||||||
|
var _BatchSizeMax = 2000
|
||||||
|
|
||||||
// SetBatchSize sets the size of the sequence batches.
|
// SetBatchSize sets the size of the sequence batches.
|
||||||
//
|
//
|
||||||
@@ -24,3 +30,42 @@ func BatchSize() int {
|
|||||||
func BatchSizePtr() *int {
|
func BatchSizePtr() *int {
|
||||||
return &_BatchSize
|
return &_BatchSize
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// BatchSizeMax returns the maximum number of sequences per batch.
|
||||||
|
func BatchSizeMax() int {
|
||||||
|
return _BatchSizeMax
|
||||||
|
}
|
||||||
|
|
||||||
|
func BatchSizeMaxPtr() *int {
|
||||||
|
return &_BatchSizeMax
|
||||||
|
}
|
||||||
|
|
||||||
|
// _BatchMem holds the maximum cumulative memory (in bytes) per batch when
|
||||||
|
// memory-based batching is requested. A value of 0 disables memory-based
|
||||||
|
// batching and falls back to count-based batching.
|
||||||
|
var _BatchMem = 128 * 1024 * 1024 // 128 MB default; set to 0 to disable
|
||||||
|
var _BatchMemStr = ""
|
||||||
|
|
||||||
|
// SetBatchMem sets the memory budget per batch in bytes.
|
||||||
|
func SetBatchMem(n int) {
|
||||||
|
_BatchMem = n
|
||||||
|
}
|
||||||
|
|
||||||
|
// BatchMem returns the current memory budget per batch in bytes.
|
||||||
|
// A value of 0 means memory-based batching is disabled.
|
||||||
|
func BatchMem() int {
|
||||||
|
return _BatchMem
|
||||||
|
}
|
||||||
|
|
||||||
|
func BatchMemPtr() *int {
|
||||||
|
return &_BatchMem
|
||||||
|
}
|
||||||
|
|
||||||
|
// BatchMemStr returns the raw --batch-mem string value as provided on the CLI.
|
||||||
|
func BatchMemStr() string {
|
||||||
|
return _BatchMemStr
|
||||||
|
}
|
||||||
|
|
||||||
|
func BatchMemStrPtr() *string {
|
||||||
|
return &_BatchMemStr
|
||||||
|
}
|
||||||
|
|||||||
+152
-2
@@ -161,6 +161,149 @@ func EmblChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (obise
|
|||||||
return parser
|
return parser
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// extractEmblSeq scans the sequence section of an EMBL record directly on the
|
||||||
|
// rope. EMBL sequence lines start with 5 spaces followed by bases in groups of
|
||||||
|
// 10, separated by spaces, with a position number at the end. The section ends
|
||||||
|
// with "//".
|
||||||
|
func (s *ropeScanner) extractEmblSeq(dest []byte, UtoT bool) []byte {
|
||||||
|
// We use ReadLine and scan each line for bases (skip digits, spaces, newlines).
|
||||||
|
for {
|
||||||
|
line := s.ReadLine()
|
||||||
|
if line == nil {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
if len(line) >= 2 && line[0] == '/' && line[1] == '/' {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
// Lines start with 5 spaces; bases follow separated by single spaces.
|
||||||
|
// Digits at the end are the position counter — skip them.
|
||||||
|
// Simplest: take every byte that is a letter.
|
||||||
|
for _, b := range line {
|
||||||
|
if b >= 'A' && b <= 'Z' {
|
||||||
|
b += 'a' - 'A'
|
||||||
|
}
|
||||||
|
if UtoT && b == 'u' {
|
||||||
|
b = 't'
|
||||||
|
}
|
||||||
|
if b >= 'a' && b <= 'z' {
|
||||||
|
dest = append(dest, b)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return dest
|
||||||
|
}
|
||||||
|
|
||||||
|
// EmblChunkParserRope parses an EMBL chunk directly from a rope without Pack().
|
||||||
|
func EmblChunkParserRope(source string, rope *PieceOfChunk, withFeatureTable, UtoT bool) (obiseq.BioSequenceSlice, error) {
|
||||||
|
scanner := newRopeScanner(rope)
|
||||||
|
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
|
||||||
|
|
||||||
|
var id string
|
||||||
|
var scientificName string
|
||||||
|
defBytes := make([]byte, 0, 256)
|
||||||
|
featBytes := make([]byte, 0, 1024)
|
||||||
|
var taxid int
|
||||||
|
inSeq := false
|
||||||
|
|
||||||
|
for {
|
||||||
|
line := scanner.ReadLine()
|
||||||
|
if line == nil {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
|
||||||
|
if inSeq {
|
||||||
|
// Should not happen — extractEmblSeq consumed up to "//"
|
||||||
|
inSeq = false
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
switch {
|
||||||
|
case bytes.HasPrefix(line, []byte("ID ")):
|
||||||
|
id = string(bytes.SplitN(line[5:], []byte(";"), 2)[0])
|
||||||
|
case bytes.HasPrefix(line, []byte("OS ")):
|
||||||
|
scientificName = string(bytes.TrimSpace(line[5:]))
|
||||||
|
case bytes.HasPrefix(line, []byte("DE ")):
|
||||||
|
if len(defBytes) > 0 {
|
||||||
|
defBytes = append(defBytes, ' ')
|
||||||
|
}
|
||||||
|
defBytes = append(defBytes, bytes.TrimSpace(line[5:])...)
|
||||||
|
case withFeatureTable && bytes.HasPrefix(line, []byte("FH ")):
|
||||||
|
featBytes = append(featBytes, line...)
|
||||||
|
case withFeatureTable && bytes.Equal(line, []byte("FH")):
|
||||||
|
featBytes = append(featBytes, '\n')
|
||||||
|
featBytes = append(featBytes, line...)
|
||||||
|
case bytes.HasPrefix(line, []byte("FT ")):
|
||||||
|
if withFeatureTable {
|
||||||
|
featBytes = append(featBytes, '\n')
|
||||||
|
featBytes = append(featBytes, line...)
|
||||||
|
}
|
||||||
|
if bytes.HasPrefix(line, []byte(`FT /db_xref="taxon:`)) {
|
||||||
|
rest := line[37:]
|
||||||
|
end := bytes.IndexByte(rest, '"')
|
||||||
|
if end > 0 {
|
||||||
|
taxid, _ = strconv.Atoi(string(rest[:end]))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
case bytes.HasPrefix(line, []byte(" ")):
|
||||||
|
// First sequence line: extract all bases via extractEmblSeq,
|
||||||
|
// which also consumes this line's remaining content.
|
||||||
|
// But ReadLine already consumed this line — we need to process it
|
||||||
|
// plus subsequent lines. Process this line inline then call helper.
|
||||||
|
seqDest := make([]byte, 0, 4096)
|
||||||
|
for _, b := range line {
|
||||||
|
if b >= 'A' && b <= 'Z' {
|
||||||
|
b += 'a' - 'A'
|
||||||
|
}
|
||||||
|
if UtoT && b == 'u' {
|
||||||
|
b = 't'
|
||||||
|
}
|
||||||
|
if b >= 'a' && b <= 'z' {
|
||||||
|
seqDest = append(seqDest, b)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
seqDest = scanner.extractEmblSeq(seqDest, UtoT)
|
||||||
|
|
||||||
|
seq := obiseq.NewBioSequenceOwning(id, seqDest, string(defBytes))
|
||||||
|
seq.SetSource(source)
|
||||||
|
if withFeatureTable {
|
||||||
|
seq.SetFeatures(featBytes)
|
||||||
|
}
|
||||||
|
annot := seq.Annotations()
|
||||||
|
annot["scientific_name"] = scientificName
|
||||||
|
annot["taxid"] = taxid
|
||||||
|
sequences = append(sequences, seq)
|
||||||
|
|
||||||
|
// Reset state
|
||||||
|
id = ""
|
||||||
|
scientificName = ""
|
||||||
|
defBytes = defBytes[:0]
|
||||||
|
featBytes = featBytes[:0]
|
||||||
|
taxid = 1
|
||||||
|
|
||||||
|
case bytes.Equal(line, []byte("//")):
|
||||||
|
// record ended without SQ/sequence section (e.g. WGS entries)
|
||||||
|
if id != "" {
|
||||||
|
seq := obiseq.NewBioSequenceOwning(id, []byte{}, string(defBytes))
|
||||||
|
seq.SetSource(source)
|
||||||
|
if withFeatureTable {
|
||||||
|
seq.SetFeatures(featBytes)
|
||||||
|
}
|
||||||
|
annot := seq.Annotations()
|
||||||
|
annot["scientific_name"] = scientificName
|
||||||
|
annot["taxid"] = taxid
|
||||||
|
sequences = append(sequences, seq)
|
||||||
|
}
|
||||||
|
id = ""
|
||||||
|
scientificName = ""
|
||||||
|
defBytes = defBytes[:0]
|
||||||
|
featBytes = featBytes[:0]
|
||||||
|
taxid = 1
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return sequences, nil
|
||||||
|
}
|
||||||
|
|
||||||
func _ParseEmblFile(
|
func _ParseEmblFile(
|
||||||
input ChannelFileChunk,
|
input ChannelFileChunk,
|
||||||
out obiiter.IBioSequence,
|
out obiiter.IBioSequence,
|
||||||
@@ -171,7 +314,14 @@ func _ParseEmblFile(
|
|||||||
|
|
||||||
for chunks := range input {
|
for chunks := range input {
|
||||||
order := chunks.Order
|
order := chunks.Order
|
||||||
sequences, err := parser(chunks.Source, chunks.Raw)
|
var sequences obiseq.BioSequenceSlice
|
||||||
|
var err error
|
||||||
|
|
||||||
|
if chunks.Rope != nil {
|
||||||
|
sequences, err = EmblChunkParserRope(chunks.Source, chunks.Rope, withFeatureTable, UtoT)
|
||||||
|
} else {
|
||||||
|
sequences, err = parser(chunks.Source, chunks.Raw)
|
||||||
|
}
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("%s : Cannot parse the embl file : %v", chunks.Source, err)
|
log.Fatalf("%s : Cannot parse the embl file : %v", chunks.Source, err)
|
||||||
@@ -196,7 +346,7 @@ func ReadEMBL(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, er
|
|||||||
1024*1024*128,
|
1024*1024*128,
|
||||||
EndOfLastFlatFileEntry,
|
EndOfLastFlatFileEntry,
|
||||||
"\nID ",
|
"\nID ",
|
||||||
true,
|
false,
|
||||||
)
|
)
|
||||||
|
|
||||||
newIter := obiiter.MakeIBioSequence()
|
newIter := obiiter.MakeIBioSequence()
|
||||||
|
|||||||
@@ -209,28 +209,121 @@ func FastaChunkParser(UtoT bool) func(string, io.Reader) (obiseq.BioSequenceSlic
|
|||||||
return parser
|
return parser
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// extractFastaSeq scans sequence bytes from the rope directly into dest,
|
||||||
|
// appending valid nucleotide characters and skipping whitespace.
|
||||||
|
// Stops when '>' is found at the start of a line (next record) or at EOF.
|
||||||
|
// Returns (dest with appended bases, hasMore).
|
||||||
|
// hasMore=true means scanner is now positioned at '>' of the next record.
|
||||||
|
func (s *ropeScanner) extractFastaSeq(dest []byte, UtoT bool) ([]byte, bool) {
|
||||||
|
lineStart := true
|
||||||
|
|
||||||
|
for s.current != nil {
|
||||||
|
data := s.current.data[s.pos:]
|
||||||
|
for i, b := range data {
|
||||||
|
if lineStart && b == '>' {
|
||||||
|
s.pos += i
|
||||||
|
if s.pos >= len(s.current.data) {
|
||||||
|
s.current = s.current.Next()
|
||||||
|
s.pos = 0
|
||||||
|
}
|
||||||
|
return dest, true
|
||||||
|
}
|
||||||
|
if b == '\n' || b == '\r' {
|
||||||
|
lineStart = true
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
lineStart = false
|
||||||
|
if b == ' ' || b == '\t' {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
if b >= 'A' && b <= 'Z' {
|
||||||
|
b += 'a' - 'A'
|
||||||
|
}
|
||||||
|
if UtoT && b == 'u' {
|
||||||
|
b = 't'
|
||||||
|
}
|
||||||
|
dest = append(dest, b)
|
||||||
|
}
|
||||||
|
s.current = s.current.Next()
|
||||||
|
s.pos = 0
|
||||||
|
}
|
||||||
|
return dest, false
|
||||||
|
}
|
||||||
|
|
||||||
|
// FastaChunkParserRope parses a FASTA chunk directly from the rope without Pack().
|
||||||
|
func FastaChunkParserRope(source string, rope *PieceOfChunk, UtoT bool) (obiseq.BioSequenceSlice, error) {
|
||||||
|
scanner := newRopeScanner(rope)
|
||||||
|
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
|
||||||
|
|
||||||
|
for {
|
||||||
|
bline := scanner.ReadLine()
|
||||||
|
if bline == nil {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
if len(bline) == 0 || bline[0] != '>' {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
// Parse header: ">id definition"
|
||||||
|
header := bline[1:]
|
||||||
|
var id string
|
||||||
|
var definition string
|
||||||
|
sp := bytes.IndexByte(header, ' ')
|
||||||
|
if sp < 0 {
|
||||||
|
sp = bytes.IndexByte(header, '\t')
|
||||||
|
}
|
||||||
|
if sp < 0 {
|
||||||
|
id = string(header)
|
||||||
|
} else {
|
||||||
|
id = string(header[:sp])
|
||||||
|
definition = string(bytes.TrimSpace(header[sp+1:]))
|
||||||
|
}
|
||||||
|
|
||||||
|
seqDest := make([]byte, 0, 4096)
|
||||||
|
var hasMore bool
|
||||||
|
seqDest, hasMore = scanner.extractFastaSeq(seqDest, UtoT)
|
||||||
|
|
||||||
|
if len(seqDest) == 0 {
|
||||||
|
log.Fatalf("%s [%s]: sequence is empty", source, id)
|
||||||
|
}
|
||||||
|
|
||||||
|
seq := obiseq.NewBioSequenceOwning(id, seqDest, definition)
|
||||||
|
seq.SetSource(source)
|
||||||
|
sequences = append(sequences, seq)
|
||||||
|
|
||||||
|
if !hasMore {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return sequences, nil
|
||||||
|
}
|
||||||
|
|
||||||
func _ParseFastaFile(
|
func _ParseFastaFile(
|
||||||
input ChannelFileChunk,
|
input ChannelFileChunk,
|
||||||
out obiiter.IBioSequence,
|
out obiiter.IBioSequence,
|
||||||
UtoT bool,
|
UtoT bool,
|
||||||
) {
|
) {
|
||||||
|
|
||||||
parser := FastaChunkParser(UtoT)
|
parser := FastaChunkParser(UtoT)
|
||||||
|
|
||||||
for chunks := range input {
|
for chunks := range input {
|
||||||
sequences, err := parser(chunks.Source, chunks.Raw)
|
var sequences obiseq.BioSequenceSlice
|
||||||
// obilog.Warnf("Chunck(%d:%d) -%d- ", chunks.Order, l, sequences.Len())
|
var err error
|
||||||
|
|
||||||
|
if chunks.Rope != nil {
|
||||||
|
sequences, err = FastaChunkParserRope(chunks.Source, chunks.Rope, UtoT)
|
||||||
|
} else {
|
||||||
|
sequences, err = parser(chunks.Source, chunks.Raw)
|
||||||
|
}
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("File %s : Cannot parse the fasta file : %v", chunks.Source, err)
|
log.Fatalf("File %s : Cannot parse the fasta file : %v", chunks.Source, err)
|
||||||
}
|
}
|
||||||
|
|
||||||
out.Push(obiiter.MakeBioSequenceBatch(chunks.Source, chunks.Order, sequences))
|
out.Push(obiiter.MakeBioSequenceBatch(chunks.Source, chunks.Order, sequences))
|
||||||
|
|
||||||
}
|
}
|
||||||
|
|
||||||
out.Done()
|
out.Done()
|
||||||
|
|
||||||
}
|
}
|
||||||
|
|
||||||
func ReadFasta(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
|
func ReadFasta(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
|
||||||
@@ -245,7 +338,7 @@ func ReadFasta(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
|
|||||||
1024*1024,
|
1024*1024,
|
||||||
EndOfLastFastaEntry,
|
EndOfLastFastaEntry,
|
||||||
"\n>",
|
"\n>",
|
||||||
true,
|
false,
|
||||||
)
|
)
|
||||||
|
|
||||||
for i := 0; i < nworker; i++ {
|
for i := 0; i < nworker; i++ {
|
||||||
|
|||||||
@@ -303,6 +303,80 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
|
|||||||
return parser
|
return parser
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// FastqChunkParserRope parses a FASTQ chunk directly from a rope without Pack().
|
||||||
|
func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte, with_quality, UtoT bool) (obiseq.BioSequenceSlice, error) {
|
||||||
|
scanner := newRopeScanner(rope)
|
||||||
|
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
|
||||||
|
|
||||||
|
for {
|
||||||
|
// Line 1: @id [definition]
|
||||||
|
hline := scanner.ReadLine()
|
||||||
|
if hline == nil {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
if len(hline) == 0 || hline[0] != '@' {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
header := hline[1:]
|
||||||
|
var id string
|
||||||
|
var definition string
|
||||||
|
sp := bytes.IndexByte(header, ' ')
|
||||||
|
if sp < 0 {
|
||||||
|
sp = bytes.IndexByte(header, '\t')
|
||||||
|
}
|
||||||
|
if sp < 0 {
|
||||||
|
id = string(header)
|
||||||
|
} else {
|
||||||
|
id = string(header[:sp])
|
||||||
|
definition = string(bytes.TrimSpace(header[sp+1:]))
|
||||||
|
}
|
||||||
|
|
||||||
|
// Line 2: sequence
|
||||||
|
sline := scanner.ReadLine()
|
||||||
|
if sline == nil {
|
||||||
|
log.Fatalf("@%s[%s]: unexpected EOF after header", id, source)
|
||||||
|
}
|
||||||
|
seqDest := make([]byte, len(sline))
|
||||||
|
w := 0
|
||||||
|
for _, b := range sline {
|
||||||
|
if b >= 'A' && b <= 'Z' {
|
||||||
|
b += 'a' - 'A'
|
||||||
|
}
|
||||||
|
if UtoT && b == 'u' {
|
||||||
|
b = 't'
|
||||||
|
}
|
||||||
|
seqDest[w] = b
|
||||||
|
w++
|
||||||
|
}
|
||||||
|
seqDest = seqDest[:w]
|
||||||
|
if len(seqDest) == 0 {
|
||||||
|
log.Fatalf("@%s[%s]: sequence is empty", id, source)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Line 3: + (skip)
|
||||||
|
scanner.ReadLine()
|
||||||
|
|
||||||
|
// Line 4: quality
|
||||||
|
qline := scanner.ReadLine()
|
||||||
|
|
||||||
|
seq := obiseq.NewBioSequenceOwning(id, seqDest, definition)
|
||||||
|
seq.SetSource(source)
|
||||||
|
|
||||||
|
if with_quality && qline != nil {
|
||||||
|
qDest := make([]byte, len(qline))
|
||||||
|
copy(qDest, qline)
|
||||||
|
for i := range qDest {
|
||||||
|
qDest[i] -= quality_shift
|
||||||
|
}
|
||||||
|
seq.TakeQualities(qDest)
|
||||||
|
}
|
||||||
|
|
||||||
|
sequences = append(sequences, seq)
|
||||||
|
}
|
||||||
|
|
||||||
|
return sequences, nil
|
||||||
|
}
|
||||||
|
|
||||||
func _ParseFastqFile(
|
func _ParseFastqFile(
|
||||||
input ChannelFileChunk,
|
input ChannelFileChunk,
|
||||||
out obiiter.IBioSequence,
|
out obiiter.IBioSequence,
|
||||||
@@ -313,7 +387,14 @@ func _ParseFastqFile(
|
|||||||
parser := FastqChunkParser(quality_shift, with_quality, UtoT)
|
parser := FastqChunkParser(quality_shift, with_quality, UtoT)
|
||||||
|
|
||||||
for chunks := range input {
|
for chunks := range input {
|
||||||
sequences, err := parser(chunks.Source, chunks.Raw)
|
var sequences obiseq.BioSequenceSlice
|
||||||
|
var err error
|
||||||
|
|
||||||
|
if chunks.Rope != nil {
|
||||||
|
sequences, err = FastqChunkParserRope(chunks.Source, chunks.Rope, quality_shift, with_quality, UtoT)
|
||||||
|
} else {
|
||||||
|
sequences, err = parser(chunks.Source, chunks.Raw)
|
||||||
|
}
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("File %s : Cannot parse the fastq file : %v", chunks.Source, err)
|
log.Fatalf("File %s : Cannot parse the fastq file : %v", chunks.Source, err)
|
||||||
@@ -339,7 +420,7 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
|
|||||||
1024*1024,
|
1024*1024,
|
||||||
EndOfLastFastqEntry,
|
EndOfLastFastqEntry,
|
||||||
"\n@",
|
"\n@",
|
||||||
true,
|
false,
|
||||||
)
|
)
|
||||||
|
|
||||||
for i := 0; i < nworker; i++ {
|
for i := 0; i < nworker; i++ {
|
||||||
|
|||||||
@@ -296,7 +296,7 @@ func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
|
|||||||
|
|
||||||
case strings.HasSuffix(skey, "_taxid"):
|
case strings.HasSuffix(skey, "_taxid"):
|
||||||
if dataType == jsonparser.Number || dataType == jsonparser.String {
|
if dataType == jsonparser.Number || dataType == jsonparser.String {
|
||||||
rank, _ := obiutils.SplitInTwo(skey, '_')
|
rank := skey[:len(skey)-len("_taxid")]
|
||||||
|
|
||||||
taxid := string(value)
|
taxid := string(value)
|
||||||
sequence.SetTaxid(taxid, rank)
|
sequence.SetTaxid(taxid, rank)
|
||||||
|
|||||||
@@ -146,6 +146,65 @@ func __match__key__(text []byte) []int {
|
|||||||
return []int{} // Not a key
|
return []int{} // Not a key
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func __match__array__(text []byte) []int {
|
||||||
|
|
||||||
|
state := 0
|
||||||
|
level := 0
|
||||||
|
start := 0
|
||||||
|
instring := byte(0)
|
||||||
|
|
||||||
|
for i, r := range text {
|
||||||
|
if state == 2 {
|
||||||
|
if r == ';' {
|
||||||
|
return []int{start, i + 1}
|
||||||
|
}
|
||||||
|
if r != ' ' && r != '\t' {
|
||||||
|
return []int{}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if state == 0 {
|
||||||
|
if r == '[' {
|
||||||
|
level++
|
||||||
|
state++
|
||||||
|
start = i
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
if r != ' ' && r != '\t' {
|
||||||
|
return []int{}
|
||||||
|
}
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
// state == 1: inside the array
|
||||||
|
if instring != 0 {
|
||||||
|
if r == instring {
|
||||||
|
instring = 0
|
||||||
|
}
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
if r == '"' || r == '\'' {
|
||||||
|
instring = r
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
if r == '[' || r == '{' {
|
||||||
|
level++
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
if r == ']' || r == '}' {
|
||||||
|
level--
|
||||||
|
if level == 0 {
|
||||||
|
state++
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return []int{}
|
||||||
|
}
|
||||||
|
|
||||||
func __match__general__(text []byte) []int {
|
func __match__general__(text []byte) []int {
|
||||||
|
|
||||||
for i, r := range text {
|
for i, r := range text {
|
||||||
@@ -242,6 +301,21 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
|
|||||||
stop = m[1] + 1
|
stop = m[1] + 1
|
||||||
} else {
|
} else {
|
||||||
|
|
||||||
|
// array value
|
||||||
|
m = __match__array__(part)
|
||||||
|
if len(m) > 0 {
|
||||||
|
bvalue = bytes.TrimSpace(part[m[0]:(m[1] - 1)])
|
||||||
|
j := bytes.ReplaceAll(bvalue, []byte("'"), []byte(`"`))
|
||||||
|
j = __obi_header_map_int_key__.ReplaceAll(j, []byte(`$1"$2":`))
|
||||||
|
arr, err := _parse_json_array_interface(j)
|
||||||
|
if err != nil {
|
||||||
|
value = string(bvalue)
|
||||||
|
} else {
|
||||||
|
value = arr
|
||||||
|
}
|
||||||
|
stop = m[1] + 1
|
||||||
|
} else {
|
||||||
|
|
||||||
// Generic value
|
// Generic value
|
||||||
|
|
||||||
// m = __obi_header_value_general_pattern__.FindIndex(part)
|
// m = __obi_header_value_general_pattern__.FindIndex(part)
|
||||||
@@ -264,6 +338,7 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
|
|||||||
// no value
|
// no value
|
||||||
break
|
break
|
||||||
} // End of No value
|
} // End of No value
|
||||||
|
} // End of not array
|
||||||
} // End of not dict
|
} // End of not dict
|
||||||
} // End of not string
|
} // End of not string
|
||||||
} // End of not numeric
|
} // End of not numeric
|
||||||
@@ -327,9 +402,8 @@ func WriteFastSeqOBIHeade(buffer *bytes.Buffer, sequence *obiseq.BioSequence) {
|
|||||||
buffer.WriteString(fmt.Sprintf("%s=", key))
|
buffer.WriteString(fmt.Sprintf("%s=", key))
|
||||||
buffer.Write(tv)
|
buffer.Write(tv)
|
||||||
buffer.WriteString("; ")
|
buffer.WriteString("; ")
|
||||||
case map[string]int,
|
default:
|
||||||
map[string]string,
|
if obiutils.IsAMap(value) || obiutils.IsASlice(value) || obiutils.IsAnArray(value) {
|
||||||
map[string]interface{}:
|
|
||||||
tv, err := obiutils.JsonMarshal(t)
|
tv, err := obiutils.JsonMarshal(t)
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("Cannot convert %v value", value)
|
log.Fatalf("Cannot convert %v value", value)
|
||||||
@@ -338,11 +412,12 @@ func WriteFastSeqOBIHeade(buffer *bytes.Buffer, sequence *obiseq.BioSequence) {
|
|||||||
buffer.WriteString(fmt.Sprintf("%s=", key))
|
buffer.WriteString(fmt.Sprintf("%s=", key))
|
||||||
buffer.Write(tv)
|
buffer.Write(tv)
|
||||||
buffer.WriteString("; ")
|
buffer.WriteString("; ")
|
||||||
default:
|
} else {
|
||||||
buffer.WriteString(fmt.Sprintf("%s=%v; ", key, value))
|
buffer.WriteString(fmt.Sprintf("%s=%v; ", key, value))
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
}
|
||||||
|
|
||||||
if sequence.HasDefinition() {
|
if sequence.HasDefinition() {
|
||||||
buffer.WriteByte(' ')
|
buffer.WriteByte(' ')
|
||||||
|
|||||||
@@ -90,6 +90,9 @@ func FormatFastaBatch(batch obiiter.BioSequenceBatch, formater FormatHeader, ski
|
|||||||
log.Debugf("FormatFastaBatch: #%d : %d seqs", batch.Order(), batch.Len())
|
log.Debugf("FormatFastaBatch: #%d : %d seqs", batch.Order(), batch.Len())
|
||||||
|
|
||||||
for _, seq := range batch.Slice() {
|
for _, seq := range batch.Slice() {
|
||||||
|
if len(seq.Id()) == 0 {
|
||||||
|
log.Fatalf("Sequence identifier is empty")
|
||||||
|
}
|
||||||
if seq.Len() > 0 {
|
if seq.Len() > 0 {
|
||||||
// Write header directly into bs — no intermediate string
|
// Write header directly into bs — no intermediate string
|
||||||
bs.WriteByte('>')
|
bs.WriteByte('>')
|
||||||
|
|||||||
@@ -64,6 +64,9 @@ func FormatFastqBatch(batch obiiter.BioSequenceBatch,
|
|||||||
first := true
|
first := true
|
||||||
|
|
||||||
for _, seq := range batch.Slice() {
|
for _, seq := range batch.Slice() {
|
||||||
|
if len(seq.Id()) == 0 {
|
||||||
|
log.Fatalf("Sequence identifier is empty")
|
||||||
|
}
|
||||||
if seq.Len() > 0 {
|
if seq.Len() > 0 {
|
||||||
_formatFastq(&bs, seq, formater)
|
_formatFastq(&bs, seq, formater)
|
||||||
|
|
||||||
|
|||||||
@@ -29,70 +29,11 @@ const (
|
|||||||
|
|
||||||
var _seqlenght_rx = regexp.MustCompile(" +([0-9]+) bp")
|
var _seqlenght_rx = regexp.MustCompile(" +([0-9]+) bp")
|
||||||
|
|
||||||
// gbRopeScanner reads lines from a PieceOfChunk rope without heap allocation.
|
|
||||||
// The carry buffer (stack) handles lines that span two rope nodes.
|
|
||||||
type gbRopeScanner struct {
|
|
||||||
current *PieceOfChunk
|
|
||||||
pos int
|
|
||||||
carry [256]byte // max GenBank line = 80 chars; 256 gives ample margin
|
|
||||||
carryN int
|
|
||||||
}
|
|
||||||
|
|
||||||
func newGbRopeScanner(rope *PieceOfChunk) *gbRopeScanner {
|
|
||||||
return &gbRopeScanner{current: rope}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ReadLine returns the next line without the trailing \n (or \r\n).
|
|
||||||
// Returns nil at end of rope. The returned slice aliases carry[] or the node
|
|
||||||
// data and is valid only until the next ReadLine call.
|
|
||||||
func (s *gbRopeScanner) ReadLine() []byte {
|
|
||||||
for {
|
|
||||||
if s.current == nil {
|
|
||||||
if s.carryN > 0 {
|
|
||||||
n := s.carryN
|
|
||||||
s.carryN = 0
|
|
||||||
return s.carry[:n]
|
|
||||||
}
|
|
||||||
return nil
|
|
||||||
}
|
|
||||||
|
|
||||||
data := s.current.data[s.pos:]
|
|
||||||
idx := bytes.IndexByte(data, '\n')
|
|
||||||
|
|
||||||
if idx >= 0 {
|
|
||||||
var line []byte
|
|
||||||
if s.carryN == 0 {
|
|
||||||
line = data[:idx]
|
|
||||||
} else {
|
|
||||||
n := copy(s.carry[s.carryN:], data[:idx])
|
|
||||||
s.carryN += n
|
|
||||||
line = s.carry[:s.carryN]
|
|
||||||
s.carryN = 0
|
|
||||||
}
|
|
||||||
s.pos += idx + 1
|
|
||||||
if s.pos >= len(s.current.data) {
|
|
||||||
s.current = s.current.Next()
|
|
||||||
s.pos = 0
|
|
||||||
}
|
|
||||||
if len(line) > 0 && line[len(line)-1] == '\r' {
|
|
||||||
line = line[:len(line)-1]
|
|
||||||
}
|
|
||||||
return line
|
|
||||||
}
|
|
||||||
|
|
||||||
// No \n in this node: accumulate into carry and advance
|
|
||||||
n := copy(s.carry[s.carryN:], data)
|
|
||||||
s.carryN += n
|
|
||||||
s.current = s.current.Next()
|
|
||||||
s.pos = 0
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// extractSequence scans the ORIGIN section byte-by-byte directly on the rope,
|
// extractSequence scans the ORIGIN section byte-by-byte directly on the rope,
|
||||||
// appending compacted bases to dest. Returns the extended slice.
|
// appending compacted bases to dest. Returns the extended slice.
|
||||||
// Stops and returns when "//" is found at the start of a line.
|
// Stops and returns when "//" is found at the start of a line.
|
||||||
// The scanner is left positioned after the "//" line.
|
// The scanner is left positioned after the "//" line.
|
||||||
func (s *gbRopeScanner) extractSequence(dest []byte, UtoT bool) []byte {
|
func (s *ropeScanner) extractSequence(dest []byte, UtoT bool) []byte {
|
||||||
lineStart := true
|
lineStart := true
|
||||||
skipDigits := true
|
skipDigits := true
|
||||||
|
|
||||||
@@ -139,24 +80,6 @@ func (s *gbRopeScanner) extractSequence(dest []byte, UtoT bool) []byte {
|
|||||||
return dest
|
return dest
|
||||||
}
|
}
|
||||||
|
|
||||||
// skipToNewline advances the scanner past the next '\n'.
|
|
||||||
func (s *gbRopeScanner) skipToNewline() {
|
|
||||||
for s.current != nil {
|
|
||||||
data := s.current.data[s.pos:]
|
|
||||||
idx := bytes.IndexByte(data, '\n')
|
|
||||||
if idx >= 0 {
|
|
||||||
s.pos += idx + 1
|
|
||||||
if s.pos >= len(s.current.data) {
|
|
||||||
s.current = s.current.Next()
|
|
||||||
s.pos = 0
|
|
||||||
}
|
|
||||||
return
|
|
||||||
}
|
|
||||||
s.current = s.current.Next()
|
|
||||||
s.pos = 0
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// parseLseqFromLocus extracts the declared sequence length from a LOCUS line.
|
// parseLseqFromLocus extracts the declared sequence length from a LOCUS line.
|
||||||
// Format: "LOCUS <id> <length> bp ..."
|
// Format: "LOCUS <id> <length> bp ..."
|
||||||
// Returns -1 if not found or parse error.
|
// Returns -1 if not found or parse error.
|
||||||
@@ -205,7 +128,7 @@ func GenbankChunkParserRope(source string, rope *PieceOfChunk,
|
|||||||
withFeatureTable, UtoT bool) (obiseq.BioSequenceSlice, error) {
|
withFeatureTable, UtoT bool) (obiseq.BioSequenceSlice, error) {
|
||||||
|
|
||||||
state := inHeader
|
state := inHeader
|
||||||
scanner := newGbRopeScanner(rope)
|
scanner := newRopeScanner(rope)
|
||||||
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
|
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
|
||||||
|
|
||||||
id := ""
|
id := ""
|
||||||
|
|||||||
@@ -631,9 +631,9 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
|
|||||||
return nil, fmt.Errorf("row %d has %d columns, expected %d", len(data), len(fields), len(header))
|
return nil, fmt.Errorf("row %d has %d columns, expected %d", len(data), len(fields), len(header))
|
||||||
}
|
}
|
||||||
|
|
||||||
forward_primer := fields[forward_primerColIndex]
|
forward_primer := strings.TrimSpace(fields[forward_primerColIndex])
|
||||||
reverse_primer := fields[reverse_primerColIndex]
|
reverse_primer := strings.TrimSpace(fields[reverse_primerColIndex])
|
||||||
tags := _parseMainNGSFilterTags(fields[sample_tagColIndex])
|
tags := _parseMainNGSFilterTags(strings.TrimSpace(fields[sample_tagColIndex]))
|
||||||
|
|
||||||
marker, _ := ngsfilter.GetMarker(forward_primer, reverse_primer)
|
marker, _ := ngsfilter.GetMarker(forward_primer, reverse_primer)
|
||||||
pcr, ok := marker.GetPCR(tags.Forward, tags.Reverse)
|
pcr, ok := marker.GetPCR(tags.Forward, tags.Reverse)
|
||||||
@@ -644,8 +644,8 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
|
|||||||
i, tags.Forward, tags.Reverse, forward_primer, reverse_primer)
|
i, tags.Forward, tags.Reverse, forward_primer, reverse_primer)
|
||||||
}
|
}
|
||||||
|
|
||||||
pcr.Experiment = fields[experimentColIndex]
|
pcr.Experiment = strings.TrimSpace(fields[experimentColIndex])
|
||||||
pcr.Sample = fields[sampleColIndex]
|
pcr.Sample = strings.TrimSpace(fields[sampleColIndex])
|
||||||
|
|
||||||
if extraColumns != nil {
|
if extraColumns != nil {
|
||||||
pcr.Annotations = make(obiseq.Annotation)
|
pcr.Annotations = make(obiseq.Annotation)
|
||||||
|
|||||||
@@ -0,0 +1,77 @@
|
|||||||
|
package obiformats
|
||||||
|
|
||||||
|
import "bytes"
|
||||||
|
|
||||||
|
// ropeScanner reads lines from a PieceOfChunk rope.
|
||||||
|
// The carry buffer handles lines that span two rope nodes; it grows as needed.
|
||||||
|
type ropeScanner struct {
|
||||||
|
current *PieceOfChunk
|
||||||
|
pos int
|
||||||
|
carry []byte
|
||||||
|
}
|
||||||
|
|
||||||
|
func newRopeScanner(rope *PieceOfChunk) *ropeScanner {
|
||||||
|
return &ropeScanner{current: rope}
|
||||||
|
}
|
||||||
|
|
||||||
|
// ReadLine returns the next line without the trailing \n (or \r\n).
|
||||||
|
// Returns nil at end of rope. The returned slice aliases carry[] or the node
|
||||||
|
// data and is valid only until the next ReadLine call.
|
||||||
|
func (s *ropeScanner) ReadLine() []byte {
|
||||||
|
for {
|
||||||
|
if s.current == nil {
|
||||||
|
if len(s.carry) > 0 {
|
||||||
|
line := s.carry
|
||||||
|
s.carry = s.carry[:0]
|
||||||
|
return line
|
||||||
|
}
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
data := s.current.data[s.pos:]
|
||||||
|
idx := bytes.IndexByte(data, '\n')
|
||||||
|
|
||||||
|
if idx >= 0 {
|
||||||
|
var line []byte
|
||||||
|
if len(s.carry) == 0 {
|
||||||
|
line = data[:idx]
|
||||||
|
} else {
|
||||||
|
s.carry = append(s.carry, data[:idx]...)
|
||||||
|
line = s.carry
|
||||||
|
s.carry = s.carry[:0]
|
||||||
|
}
|
||||||
|
s.pos += idx + 1
|
||||||
|
if s.pos >= len(s.current.data) {
|
||||||
|
s.current = s.current.Next()
|
||||||
|
s.pos = 0
|
||||||
|
}
|
||||||
|
if len(line) > 0 && line[len(line)-1] == '\r' {
|
||||||
|
line = line[:len(line)-1]
|
||||||
|
}
|
||||||
|
return line
|
||||||
|
}
|
||||||
|
|
||||||
|
// No \n in this node: accumulate into carry and advance
|
||||||
|
s.carry = append(s.carry, data...)
|
||||||
|
s.current = s.current.Next()
|
||||||
|
s.pos = 0
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// skipToNewline advances the scanner past the next '\n'.
|
||||||
|
func (s *ropeScanner) skipToNewline() {
|
||||||
|
for s.current != nil {
|
||||||
|
data := s.current.data[s.pos:]
|
||||||
|
idx := bytes.IndexByte(data, '\n')
|
||||||
|
if idx >= 0 {
|
||||||
|
s.pos += idx + 1
|
||||||
|
if s.pos >= len(s.current.data) {
|
||||||
|
s.current = s.current.Next()
|
||||||
|
s.pos = 0
|
||||||
|
}
|
||||||
|
return
|
||||||
|
}
|
||||||
|
s.current = s.current.Next()
|
||||||
|
s.pos = 0
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -444,6 +444,67 @@ func (iterator IBioSequence) Rebatch(size int) IBioSequence {
|
|||||||
return newIter
|
return newIter
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// RebatchBySize reorganises the stream into batches bounded by two independent
|
||||||
|
// upper limits: maxCount (max number of sequences) and maxBytes (max cumulative
|
||||||
|
// estimated memory). A batch is flushed as soon as either limit would be
|
||||||
|
// exceeded. A single sequence larger than maxBytes is always emitted alone.
|
||||||
|
// Passing 0 for a limit disables that constraint; if both are 0 it falls back
|
||||||
|
// to Rebatch(obidefault.BatchSizeMax()).
|
||||||
|
func (iterator IBioSequence) RebatchBySize(maxBytes int, maxCount int) IBioSequence {
|
||||||
|
if maxBytes <= 0 && maxCount <= 0 {
|
||||||
|
return iterator.Rebatch(obidefault.BatchSizeMax())
|
||||||
|
}
|
||||||
|
|
||||||
|
newIter := MakeIBioSequence()
|
||||||
|
|
||||||
|
newIter.Add(1)
|
||||||
|
|
||||||
|
go func() {
|
||||||
|
newIter.WaitAndClose()
|
||||||
|
}()
|
||||||
|
|
||||||
|
go func() {
|
||||||
|
order := 0
|
||||||
|
iterator = iterator.SortBatches()
|
||||||
|
buffer := obiseq.MakeBioSequenceSlice()
|
||||||
|
bufBytes := 0
|
||||||
|
source := ""
|
||||||
|
|
||||||
|
flush := func() {
|
||||||
|
if len(buffer) > 0 {
|
||||||
|
newIter.Push(MakeBioSequenceBatch(source, order, buffer))
|
||||||
|
order++
|
||||||
|
buffer = obiseq.MakeBioSequenceSlice()
|
||||||
|
bufBytes = 0
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
for iterator.Next() {
|
||||||
|
seqs := iterator.Get()
|
||||||
|
source = seqs.Source()
|
||||||
|
for _, s := range seqs.Slice() {
|
||||||
|
sz := s.MemorySize()
|
||||||
|
countFull := maxCount > 0 && len(buffer) >= maxCount
|
||||||
|
memFull := maxBytes > 0 && bufBytes+sz > maxBytes && len(buffer) > 0
|
||||||
|
if countFull || memFull {
|
||||||
|
flush()
|
||||||
|
}
|
||||||
|
buffer = append(buffer, s)
|
||||||
|
bufBytes += sz
|
||||||
|
}
|
||||||
|
}
|
||||||
|
flush()
|
||||||
|
|
||||||
|
newIter.Done()
|
||||||
|
}()
|
||||||
|
|
||||||
|
if iterator.IsPaired() {
|
||||||
|
newIter.MarkAsPaired()
|
||||||
|
}
|
||||||
|
|
||||||
|
return newIter
|
||||||
|
}
|
||||||
|
|
||||||
func (iterator IBioSequence) FilterEmpty() IBioSequence {
|
func (iterator IBioSequence) FilterEmpty() IBioSequence {
|
||||||
|
|
||||||
newIter := MakeIBioSequence()
|
newIter := MakeIBioSequence()
|
||||||
@@ -638,7 +699,7 @@ func (iterator IBioSequence) FilterOn(predicate obiseq.SequencePredicate,
|
|||||||
trueIter.MarkAsPaired()
|
trueIter.MarkAsPaired()
|
||||||
}
|
}
|
||||||
|
|
||||||
return trueIter.Rebatch(size)
|
return trueIter.RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||||
}
|
}
|
||||||
|
|
||||||
func (iterator IBioSequence) FilterAnd(predicate obiseq.SequencePredicate,
|
func (iterator IBioSequence) FilterAnd(predicate obiseq.SequencePredicate,
|
||||||
@@ -694,7 +755,7 @@ func (iterator IBioSequence) FilterAnd(predicate obiseq.SequencePredicate,
|
|||||||
trueIter.MarkAsPaired()
|
trueIter.MarkAsPaired()
|
||||||
}
|
}
|
||||||
|
|
||||||
return trueIter.Rebatch(size)
|
return trueIter.RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||||
}
|
}
|
||||||
|
|
||||||
// Load all sequences availables from an IBioSequenceBatch iterator into
|
// Load all sequences availables from an IBioSequenceBatch iterator into
|
||||||
|
|||||||
+18
-24
@@ -57,34 +57,21 @@ func (dist *IDistribute) Classifier() *obiseq.BioSequenceClassifier {
|
|||||||
}
|
}
|
||||||
|
|
||||||
// Distribute organizes the biosequences from the iterator into batches
|
// Distribute organizes the biosequences from the iterator into batches
|
||||||
// based on the provided classifier and batch sizes. It returns an
|
// based on the provided classifier. It returns an IDistribute instance
|
||||||
// IDistribute instance that manages the distribution of the sequences.
|
// that manages the distribution of the sequences.
|
||||||
//
|
//
|
||||||
// Parameters:
|
// Batches are flushed when either BatchSizeMax() sequences or BatchMem()
|
||||||
// - class: A pointer to a BioSequenceClassifier used to classify
|
// bytes are accumulated per key, mirroring the RebatchBySize strategy.
|
||||||
// the biosequences during distribution.
|
func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier) IDistribute {
|
||||||
// - sizes: Optional integer values specifying the batch size. If
|
maxCount := obidefault.BatchSizeMax()
|
||||||
// no sizes are provided, a default batch size of 5000 is used.
|
maxBytes := obidefault.BatchMem()
|
||||||
//
|
|
||||||
// Returns:
|
|
||||||
// An IDistribute instance that contains the outputs of the
|
|
||||||
// classified biosequences, a channel for new data notifications,
|
|
||||||
// and the classifier used for distribution. The method operates
|
|
||||||
// asynchronously, processing the sequences in separate goroutines.
|
|
||||||
// It ensures that the outputs are closed and cleaned up once
|
|
||||||
// processing is complete.
|
|
||||||
func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, sizes ...int) IDistribute {
|
|
||||||
batchsize := obidefault.BatchSize()
|
|
||||||
|
|
||||||
outputs := make(map[int]IBioSequence, 100)
|
outputs := make(map[int]IBioSequence, 100)
|
||||||
slices := make(map[int]*obiseq.BioSequenceSlice, 100)
|
slices := make(map[int]*obiseq.BioSequenceSlice, 100)
|
||||||
|
bufBytes := make(map[int]int, 100)
|
||||||
orders := make(map[int]int, 100)
|
orders := make(map[int]int, 100)
|
||||||
news := make(chan int)
|
news := make(chan int)
|
||||||
|
|
||||||
if len(sizes) > 0 {
|
|
||||||
batchsize = sizes[0]
|
|
||||||
}
|
|
||||||
|
|
||||||
jobDone := sync.WaitGroup{}
|
jobDone := sync.WaitGroup{}
|
||||||
lock := sync.Mutex{}
|
lock := sync.Mutex{}
|
||||||
|
|
||||||
@@ -115,6 +102,7 @@ func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, siz
|
|||||||
slice = &s
|
slice = &s
|
||||||
slices[key] = slice
|
slices[key] = slice
|
||||||
orders[key] = 0
|
orders[key] = 0
|
||||||
|
bufBytes[key] = 0
|
||||||
|
|
||||||
lock.Lock()
|
lock.Lock()
|
||||||
outputs[key] = MakeIBioSequence()
|
outputs[key] = MakeIBioSequence()
|
||||||
@@ -123,14 +111,20 @@ func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, siz
|
|||||||
news <- key
|
news <- key
|
||||||
}
|
}
|
||||||
|
|
||||||
*slice = append(*slice, s)
|
sz := s.MemorySize()
|
||||||
|
countFull := maxCount > 0 && len(*slice) >= maxCount
|
||||||
if len(*slice) == batchsize {
|
memFull := maxBytes > 0 && bufBytes[key]+sz > maxBytes && len(*slice) > 0
|
||||||
|
if countFull || memFull {
|
||||||
outputs[key].Push(MakeBioSequenceBatch(source, orders[key], *slice))
|
outputs[key].Push(MakeBioSequenceBatch(source, orders[key], *slice))
|
||||||
orders[key]++
|
orders[key]++
|
||||||
s := obiseq.MakeBioSequenceSlice()
|
s := obiseq.MakeBioSequenceSlice()
|
||||||
slices[key] = &s
|
slices[key] = &s
|
||||||
|
slice = &s
|
||||||
|
bufBytes[key] = 0
|
||||||
}
|
}
|
||||||
|
|
||||||
|
*slice = append(*slice, s)
|
||||||
|
bufBytes[key] += sz
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -3,6 +3,7 @@ package obiiter
|
|||||||
import (
|
import (
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
@@ -70,7 +71,7 @@ func IFragments(minsize, length, overlap, size, nworkers int) Pipeable {
|
|||||||
}
|
}
|
||||||
go f(iterator)
|
go f(iterator)
|
||||||
|
|
||||||
return newiter.SortBatches().Rebatch(size)
|
return newiter.SortBatches().RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||||
}
|
}
|
||||||
|
|
||||||
return ifrg
|
return ifrg
|
||||||
|
|||||||
@@ -47,7 +47,7 @@ func Encode4mer(seq *obiseq.BioSequence, buffer *[]byte) []byte {
|
|||||||
length := slength - 3
|
length := slength - 3
|
||||||
rawseq := seq.Sequence()
|
rawseq := seq.Sequence()
|
||||||
|
|
||||||
if length < 0 {
|
if length <= 0 {
|
||||||
return nil
|
return nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
+75
-40
@@ -4,22 +4,21 @@ import "math"
|
|||||||
|
|
||||||
// KmerEntropy computes the entropy of a single encoded k-mer.
|
// KmerEntropy computes the entropy of a single encoded k-mer.
|
||||||
//
|
//
|
||||||
// The algorithm mirrors the lowmask entropy calculation: it decodes the k-mer
|
// The algorithm mirrors the Rust obiskbuilder entropy: it decodes the k-mer
|
||||||
// to a DNA sequence, extracts all sub-words of each size from 1 to levelMax,
|
// to a DNA sequence, extracts all sub-words of each size from 1 to levelMax,
|
||||||
// normalizes them by circular canonical form, counts their frequencies, and
|
// normalizes them by circular canonical form, counts their frequencies, and
|
||||||
// computes Shannon entropy normalized by the maximum possible entropy.
|
// computes Shannon entropy corrected for class sizes, normalized by the
|
||||||
|
// maximum possible entropy over 4^ws raw bins.
|
||||||
// The returned value is the minimum entropy across all word sizes.
|
// The returned value is the minimum entropy across all word sizes.
|
||||||
//
|
//
|
||||||
|
// Correction for small sequences: the raw entropy H = log(N) - Σ f·log(f)/N
|
||||||
|
// under-estimates the true complexity when many raw words collapse to the same
|
||||||
|
// canonical form. Adding Σ f·log(class_size)/N recovers the entropy of the
|
||||||
|
// underlying uncollapsed distribution (assuming uniform mixing within each
|
||||||
|
// equivalence class).
|
||||||
|
//
|
||||||
// A value close to 0 indicates very low complexity (e.g. "AAAA..."),
|
// A value close to 0 indicates very low complexity (e.g. "AAAA..."),
|
||||||
// while a value close to 1 indicates high complexity.
|
// while a value close to 1 indicates high complexity.
|
||||||
//
|
|
||||||
// Parameters:
|
|
||||||
// - kmer: the encoded k-mer (2 bits per base)
|
|
||||||
// - k: the k-mer size
|
|
||||||
// - levelMax: maximum sub-word size for entropy (typically 6)
|
|
||||||
//
|
|
||||||
// Returns:
|
|
||||||
// - minimum normalized entropy across all word sizes 1..levelMax
|
|
||||||
func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
||||||
if k < 1 || levelMax < 1 {
|
if k < 1 || levelMax < 1 {
|
||||||
return 1.0
|
return 1.0
|
||||||
@@ -35,7 +34,7 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
|||||||
var seqBuf [32]byte
|
var seqBuf [32]byte
|
||||||
seq := DecodeKmer(kmer, k, seqBuf[:])
|
seq := DecodeKmer(kmer, k, seqBuf[:])
|
||||||
|
|
||||||
// Pre-compute nLogN lookup (same as lowmask)
|
// Pre-compute nLogN lookup
|
||||||
nLogN := make([]float64, k+1)
|
nLogN := make([]float64, k+1)
|
||||||
for i := 1; i <= k; i++ {
|
for i := 1; i <= k; i++ {
|
||||||
nLogN[i] = float64(i) * math.Log(float64(i))
|
nLogN[i] = float64(i) * math.Log(float64(i))
|
||||||
@@ -51,6 +50,23 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// Build ln(class_size) tables: for each canonical form, how many raw
|
||||||
|
// words map to it under circular normalization.
|
||||||
|
classLogSizeTables := make([][]float64, levelMax+1)
|
||||||
|
for ws := 1; ws <= levelMax; ws++ {
|
||||||
|
tableSize := 1 << (ws * 2)
|
||||||
|
classSize := make([]int, tableSize)
|
||||||
|
for code := 0; code < tableSize; code++ {
|
||||||
|
classSize[normTables[ws][code]]++
|
||||||
|
}
|
||||||
|
classLogSizeTables[ws] = make([]float64, tableSize)
|
||||||
|
for j := 0; j < tableSize; j++ {
|
||||||
|
if classSize[j] > 0 {
|
||||||
|
classLogSizeTables[ws][j] = math.Log(float64(classSize[j]))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
minEntropy := math.MaxFloat64
|
minEntropy := math.MaxFloat64
|
||||||
|
|
||||||
for ws := 1; ws <= levelMax; ws++ {
|
for ws := 1; ws <= levelMax; ws++ {
|
||||||
@@ -75,23 +91,13 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
|||||||
table[normWord]++
|
table[normWord]++
|
||||||
}
|
}
|
||||||
|
|
||||||
// Compute Shannon entropy
|
// Compute emax over 4^ws raw bins (uncollapsed distribution).
|
||||||
floatNwords := float64(nwords)
|
floatNwords := float64(nwords)
|
||||||
logNwords := math.Log(floatNwords)
|
logNwords := math.Log(floatNwords)
|
||||||
|
na := tableSize // 4^ws
|
||||||
var sumNLogN float64
|
|
||||||
for j := 0; j < tableSize; j++ {
|
|
||||||
n := table[j]
|
|
||||||
if n > 0 {
|
|
||||||
sumNLogN += nLogN[n]
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Compute emax (maximum possible entropy for this word size)
|
|
||||||
na := CanonicalCircularKmerCount(ws)
|
|
||||||
var emax float64
|
var emax float64
|
||||||
if nwords < na {
|
if nwords < na {
|
||||||
emax = math.Log(float64(nwords))
|
emax = logNwords
|
||||||
} else {
|
} else {
|
||||||
cov := nwords / na
|
cov := nwords / na
|
||||||
remains := nwords - (na * cov)
|
remains := nwords - (na * cov)
|
||||||
@@ -105,7 +111,19 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
|||||||
continue
|
continue
|
||||||
}
|
}
|
||||||
|
|
||||||
entropy := (logNwords - sumNLogN/floatNwords) / emax
|
// Accumulate Σ f·log(f) and Σ f·log(class_size) over canonical forms.
|
||||||
|
classLogSize := classLogSizeTables[ws]
|
||||||
|
var sumNLogN, sumClassLogN float64
|
||||||
|
for j := 0; j < tableSize; j++ {
|
||||||
|
n := table[j]
|
||||||
|
if n > 0 {
|
||||||
|
sumNLogN += nLogN[n]
|
||||||
|
sumClassLogN += float64(n) * classLogSize[j]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Corrected entropy: H_raw ≈ log(N) + (Σf·log(s) - Σf·log(f)) / N
|
||||||
|
entropy := (logNwords + sumClassLogN/floatNwords - sumNLogN/floatNwords) / emax
|
||||||
if entropy < 0 {
|
if entropy < 0 {
|
||||||
entropy = 0
|
entropy = 0
|
||||||
}
|
}
|
||||||
@@ -134,6 +152,7 @@ type KmerEntropyFilter struct {
|
|||||||
threshold float64
|
threshold float64
|
||||||
nLogN []float64
|
nLogN []float64
|
||||||
normTables [][]int
|
normTables [][]int
|
||||||
|
classLogSizeTables [][]float64
|
||||||
emaxValues []float64
|
emaxValues []float64
|
||||||
logNwords []float64
|
logNwords []float64
|
||||||
// Pre-allocated frequency tables reused across Entropy() calls.
|
// Pre-allocated frequency tables reused across Entropy() calls.
|
||||||
@@ -142,11 +161,6 @@ type KmerEntropyFilter struct {
|
|||||||
}
|
}
|
||||||
|
|
||||||
// NewKmerEntropyFilter creates an entropy filter with pre-computed tables.
|
// NewKmerEntropyFilter creates an entropy filter with pre-computed tables.
|
||||||
//
|
|
||||||
// Parameters:
|
|
||||||
// - k: the k-mer size
|
|
||||||
// - levelMax: maximum sub-word size for entropy (typically 6)
|
|
||||||
// - threshold: entropy threshold (k-mers with entropy <= threshold are rejected)
|
|
||||||
func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter {
|
func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter {
|
||||||
if levelMax >= k {
|
if levelMax >= k {
|
||||||
levelMax = k - 1
|
levelMax = k - 1
|
||||||
@@ -169,20 +183,38 @@ func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ln(class_size) for each canonical form under circular normalization.
|
||||||
|
classLogSizeTables := make([][]float64, levelMax+1)
|
||||||
|
for ws := 1; ws <= levelMax; ws++ {
|
||||||
|
tableSize := 1 << (ws * 2)
|
||||||
|
classSize := make([]int, tableSize)
|
||||||
|
for code := 0; code < tableSize; code++ {
|
||||||
|
classSize[normTables[ws][code]]++
|
||||||
|
}
|
||||||
|
classLogSizeTables[ws] = make([]float64, tableSize)
|
||||||
|
for j := 0; j < tableSize; j++ {
|
||||||
|
if classSize[j] > 0 {
|
||||||
|
classLogSizeTables[ws][j] = math.Log(float64(classSize[j]))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Pre-compute emax and logNwords per word size.
|
||||||
|
// emax uses 4^ws raw bins to match the corrected entropy.
|
||||||
emaxValues := make([]float64, levelMax+1)
|
emaxValues := make([]float64, levelMax+1)
|
||||||
logNwords := make([]float64, levelMax+1)
|
logNwords := make([]float64, levelMax+1)
|
||||||
for ws := 1; ws <= levelMax; ws++ {
|
for ws := 1; ws <= levelMax; ws++ {
|
||||||
nw := k - ws + 1
|
nw := k - ws + 1
|
||||||
na := CanonicalCircularKmerCount(ws)
|
na := 1 << (ws * 2) // 4^ws raw bins
|
||||||
|
floatNw := float64(nw)
|
||||||
|
logNwords[ws] = math.Log(floatNw)
|
||||||
if nw < na {
|
if nw < na {
|
||||||
logNwords[ws] = math.Log(float64(nw))
|
emaxValues[ws] = logNwords[ws]
|
||||||
emaxValues[ws] = math.Log(float64(nw))
|
|
||||||
} else {
|
} else {
|
||||||
cov := nw / na
|
cov := nw / na
|
||||||
remains := nw - (na * cov)
|
remains := nw - (na * cov)
|
||||||
f1 := float64(cov) / float64(nw)
|
f1 := float64(cov) / floatNw
|
||||||
f2 := float64(cov+1) / float64(nw)
|
f2 := float64(cov+1) / floatNw
|
||||||
logNwords[ws] = math.Log(float64(nw))
|
|
||||||
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
|
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
|
||||||
float64(remains)*f2*math.Log(f2))
|
float64(remains)*f2*math.Log(f2))
|
||||||
}
|
}
|
||||||
@@ -200,6 +232,7 @@ func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter
|
|||||||
threshold: threshold,
|
threshold: threshold,
|
||||||
nLogN: nLogN,
|
nLogN: nLogN,
|
||||||
normTables: normTables,
|
normTables: normTables,
|
||||||
|
classLogSizeTables: classLogSizeTables,
|
||||||
emaxValues: emaxValues,
|
emaxValues: emaxValues,
|
||||||
logNwords: logNwords,
|
logNwords: logNwords,
|
||||||
freqTables: freqTables,
|
freqTables: freqTables,
|
||||||
@@ -236,7 +269,7 @@ func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
|
|||||||
// Count circular-canonical sub-word frequencies
|
// Count circular-canonical sub-word frequencies
|
||||||
tableSize := 1 << (ws * 2)
|
tableSize := 1 << (ws * 2)
|
||||||
table := ef.freqTables[ws]
|
table := ef.freqTables[ws]
|
||||||
clear(table) // reset to zero
|
clear(table)
|
||||||
mask := (1 << (ws * 2)) - 1
|
mask := (1 << (ws * 2)) - 1
|
||||||
normTable := ef.normTables[ws]
|
normTable := ef.normTables[ws]
|
||||||
|
|
||||||
@@ -251,19 +284,21 @@ func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
|
|||||||
table[normWord]++
|
table[normWord]++
|
||||||
}
|
}
|
||||||
|
|
||||||
// Compute Shannon entropy
|
|
||||||
floatNwords := float64(nwords)
|
floatNwords := float64(nwords)
|
||||||
logNwords := ef.logNwords[ws]
|
logNwords := ef.logNwords[ws]
|
||||||
|
classLogSize := ef.classLogSizeTables[ws]
|
||||||
|
|
||||||
var sumNLogN float64
|
var sumNLogN, sumClassLogN float64
|
||||||
for j := 0; j < tableSize; j++ {
|
for j := 0; j < tableSize; j++ {
|
||||||
n := table[j]
|
n := table[j]
|
||||||
if n > 0 {
|
if n > 0 {
|
||||||
sumNLogN += ef.nLogN[n]
|
sumNLogN += ef.nLogN[n]
|
||||||
|
sumClassLogN += float64(n) * classLogSize[j]
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
entropy := (logNwords - sumNLogN/floatNwords) / emax
|
// Corrected entropy: H_raw ≈ log(N) + (Σf·log(s) - Σf·log(f)) / N
|
||||||
|
entropy := (logNwords + sumClassLogN/floatNwords - sumNLogN/floatNwords) / emax
|
||||||
if entropy < 0 {
|
if entropy < 0 {
|
||||||
entropy = 0
|
entropy = 0
|
||||||
}
|
}
|
||||||
|
|||||||
+90
-7
@@ -91,7 +91,7 @@ func LuaWorker(proto *lua.FunctionProto) obiseq.SeqWorker {
|
|||||||
err := interpreter.PCall(0, lua.MultRet, nil)
|
err := interpreter.PCall(0, lua.MultRet, nil)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("Error in executing the lua script")
|
log.Fatalf("Error in executing the lua script: %v", err)
|
||||||
}
|
}
|
||||||
|
|
||||||
result := interpreter.GetGlobal("worker")
|
result := interpreter.GetGlobal("worker")
|
||||||
@@ -141,6 +141,69 @@ func LuaWorker(proto *lua.FunctionProto) obiseq.SeqWorker {
|
|||||||
return nil
|
return nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// LuaSliceWorker creates a SeqSliceWorker that calls the Lua function
|
||||||
|
// named "slice_worker". Unlike LuaWorker, the entire batch (BioSequenceSlice)
|
||||||
|
// is passed to the Lua function at once, enabling batch-level processing
|
||||||
|
// (e.g. a single HTTP request per batch instead of one per sequence).
|
||||||
|
//
|
||||||
|
// The Lua function signature:
|
||||||
|
//
|
||||||
|
// function slice_worker(slice) -- receives a BioSequenceSlice
|
||||||
|
// -- process the batch
|
||||||
|
// return slice -- returns a BioSequenceSlice (or nil)
|
||||||
|
// end
|
||||||
|
func LuaSliceWorker(proto *lua.FunctionProto) obiseq.SeqSliceWorker {
|
||||||
|
interpreter := NewInterpreter()
|
||||||
|
lfunc := interpreter.NewFunctionFromProto(proto)
|
||||||
|
interpreter.Push(lfunc)
|
||||||
|
err := interpreter.PCall(0, lua.MultRet, nil)
|
||||||
|
|
||||||
|
if err != nil {
|
||||||
|
log.Fatalf("Error in executing the lua script: %v", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
result := interpreter.GetGlobal("slice_worker")
|
||||||
|
|
||||||
|
if lua_worker, ok := result.(*lua.LFunction); ok {
|
||||||
|
f := func(slice obiseq.BioSequenceSlice) (obiseq.BioSequenceSlice, error) {
|
||||||
|
if err := interpreter.CallByParam(lua.P{
|
||||||
|
Fn: lua_worker,
|
||||||
|
NRet: 1,
|
||||||
|
Protect: true,
|
||||||
|
}, obiseqslice2Lua(interpreter, &slice)); err != nil {
|
||||||
|
log.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
lreponse := interpreter.Get(-1)
|
||||||
|
defer interpreter.Pop(1)
|
||||||
|
|
||||||
|
if reponse, ok := lreponse.(*lua.LUserData); ok {
|
||||||
|
s := reponse.Value
|
||||||
|
switch val := s.(type) {
|
||||||
|
case *obiseq.BioSequenceSlice:
|
||||||
|
return *val, nil
|
||||||
|
case *obiseq.BioSequence:
|
||||||
|
return obiseq.BioSequenceSlice{val}, nil
|
||||||
|
default:
|
||||||
|
r := reflect.TypeOf(val)
|
||||||
|
return nil, fmt.Errorf("slice_worker function doesn't return the correct type %s", r)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if _, ok = lreponse.(*lua.LNilType); ok {
|
||||||
|
return nil, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
return nil, fmt.Errorf("slice_worker function doesn't return the correct type %T", lreponse)
|
||||||
|
}
|
||||||
|
|
||||||
|
return f
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Fatalf("The slice_worker object is not a function")
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
// LuaProcessor processes a Lua script on a sequence iterator and returns a new iterator.
|
// LuaProcessor processes a Lua script on a sequence iterator and returns a new iterator.
|
||||||
//
|
//
|
||||||
// Parameters:
|
// Parameters:
|
||||||
@@ -173,7 +236,7 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
|
|||||||
err = interpreter.PCall(0, lua.MultRet, nil)
|
err = interpreter.PCall(0, lua.MultRet, nil)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("Error in executing the lua script")
|
log.Fatalf("Error in executing the lua script: %v", err)
|
||||||
}
|
}
|
||||||
|
|
||||||
result := interpreter.GetGlobal("begin")
|
result := interpreter.GetGlobal("begin")
|
||||||
@@ -198,7 +261,7 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
|
|||||||
err = interpreter.PCall(0, lua.MultRet, nil)
|
err = interpreter.PCall(0, lua.MultRet, nil)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("Error in executing the lua script")
|
log.Fatalf("Error in executing the lua script: %v", err)
|
||||||
}
|
}
|
||||||
|
|
||||||
result := interpreter.GetGlobal("finish")
|
result := interpreter.GetGlobal("finish")
|
||||||
@@ -216,11 +279,27 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
|
|||||||
|
|
||||||
}()
|
}()
|
||||||
|
|
||||||
ff := func(iterator obiiter.IBioSequence) {
|
// Detect whether the script defines slice_worker (batch-level) or worker (per-sequence).
|
||||||
w := LuaWorker(proto)
|
hasSliceWorker := func() bool {
|
||||||
sw := obiseq.SeqToSliceWorker(w, false)
|
interpreter := NewInterpreter()
|
||||||
|
lfunc := interpreter.NewFunctionFromProto(proto)
|
||||||
|
interpreter.Push(lfunc)
|
||||||
|
if err := interpreter.PCall(0, lua.MultRet, nil); err != nil {
|
||||||
|
return false
|
||||||
|
}
|
||||||
|
result := interpreter.GetGlobal("slice_worker")
|
||||||
|
interpreter.Close()
|
||||||
|
_, ok := result.(*lua.LFunction)
|
||||||
|
return ok
|
||||||
|
}()
|
||||||
|
|
||||||
// iterator = iterator.SortBatches()
|
ff := func(iterator obiiter.IBioSequence) {
|
||||||
|
var sw obiseq.SeqSliceWorker
|
||||||
|
if hasSliceWorker {
|
||||||
|
sw = LuaSliceWorker(proto)
|
||||||
|
} else {
|
||||||
|
sw = obiseq.SeqToSliceWorker(LuaWorker(proto), false)
|
||||||
|
}
|
||||||
|
|
||||||
for iterator.Next() {
|
for iterator.Next() {
|
||||||
seqs := iterator.Get()
|
seqs := iterator.Get()
|
||||||
@@ -235,6 +314,10 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
if ns == nil {
|
||||||
|
ns = obiseq.BioSequenceSlice{}
|
||||||
|
}
|
||||||
|
|
||||||
newIter.Push(obiiter.MakeBioSequenceBatch(seqs.Source(), seqs.Order(), ns))
|
newIter.Push(obiiter.MakeBioSequenceBatch(seqs.Source(), seqs.Order(), ns))
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -17,15 +17,7 @@ import (
|
|||||||
// No return values. This function operates directly on the Lua state stack.
|
// No return values. This function operates directly on the Lua state stack.
|
||||||
func pushInterfaceToLua(L *lua.LState, val interface{}) {
|
func pushInterfaceToLua(L *lua.LState, val interface{}) {
|
||||||
switch v := val.(type) {
|
switch v := val.(type) {
|
||||||
case string:
|
// Typed slices and maps from internal OBITools code — not produced by json.Unmarshal
|
||||||
L.Push(lua.LString(v))
|
|
||||||
case bool:
|
|
||||||
L.Push(lua.LBool(v))
|
|
||||||
case int:
|
|
||||||
L.Push(lua.LNumber(v))
|
|
||||||
case float64:
|
|
||||||
L.Push(lua.LNumber(v))
|
|
||||||
// Add other cases as needed for different types
|
|
||||||
case map[string]int:
|
case map[string]int:
|
||||||
pushMapStringIntToLua(L, v)
|
pushMapStringIntToLua(L, v)
|
||||||
case map[string]string:
|
case map[string]string:
|
||||||
@@ -34,8 +26,6 @@ func pushInterfaceToLua(L *lua.LState, val interface{}) {
|
|||||||
pushMapStringBoolToLua(L, v)
|
pushMapStringBoolToLua(L, v)
|
||||||
case map[string]float64:
|
case map[string]float64:
|
||||||
pushMapStringFloat64ToLua(L, v)
|
pushMapStringFloat64ToLua(L, v)
|
||||||
case map[string]interface{}:
|
|
||||||
pushMapStringInterfaceToLua(L, v)
|
|
||||||
case []string:
|
case []string:
|
||||||
pushSliceStringToLua(L, v)
|
pushSliceStringToLua(L, v)
|
||||||
case []int:
|
case []int:
|
||||||
@@ -46,61 +36,61 @@ func pushInterfaceToLua(L *lua.LState, val interface{}) {
|
|||||||
pushSliceNumericToLua(L, v)
|
pushSliceNumericToLua(L, v)
|
||||||
case []bool:
|
case []bool:
|
||||||
pushSliceBoolToLua(L, v)
|
pushSliceBoolToLua(L, v)
|
||||||
case []interface{}:
|
|
||||||
pushSliceInterfaceToLua(L, v)
|
|
||||||
case nil:
|
|
||||||
L.Push(lua.LNil)
|
|
||||||
case *sync.Mutex:
|
case *sync.Mutex:
|
||||||
pushMutexToLua(L, v)
|
pushMutexToLua(L, v)
|
||||||
default:
|
default:
|
||||||
log.Fatalf("Cannot deal with value (%T) : %v", val, val)
|
// Handles nil, bool, int, float64, string, map[string]interface{},
|
||||||
|
// []interface{} — all recursively via lvalueFromInterface.
|
||||||
|
L.Push(lvalueFromInterface(L, v))
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
func pushMapStringInterfaceToLua(L *lua.LState, m map[string]interface{}) {
|
func pushMapStringInterfaceToLua(L *lua.LState, m map[string]interface{}) {
|
||||||
// Create a new Lua table
|
|
||||||
luaTable := L.NewTable()
|
luaTable := L.NewTable()
|
||||||
// Iterate over the Go map and set the key-value pairs in the Lua table
|
|
||||||
for key, value := range m {
|
for key, value := range m {
|
||||||
switch v := value.(type) {
|
L.SetField(luaTable, key, lvalueFromInterface(L, value))
|
||||||
case int:
|
|
||||||
luaTable.RawSetString(key, lua.LNumber(v))
|
|
||||||
case float64:
|
|
||||||
luaTable.RawSetString(key, lua.LNumber(v))
|
|
||||||
case bool:
|
|
||||||
luaTable.RawSetString(key, lua.LBool(v))
|
|
||||||
case string:
|
|
||||||
luaTable.RawSetString(key, lua.LString(v))
|
|
||||||
default:
|
|
||||||
log.Fatalf("Doesn't deal with map containing value %v of type %T", v, v)
|
|
||||||
}
|
}
|
||||||
}
|
|
||||||
|
|
||||||
// Push the Lua table onto the stack
|
|
||||||
L.Push(luaTable)
|
L.Push(luaTable)
|
||||||
}
|
}
|
||||||
|
|
||||||
func pushSliceInterfaceToLua(L *lua.LState, s []interface{}) {
|
func pushSliceInterfaceToLua(L *lua.LState, s []interface{}) {
|
||||||
// Create a new Lua table
|
|
||||||
luaTable := L.NewTable()
|
luaTable := L.NewTable()
|
||||||
// Iterate over the Go map and set the key-value pairs in the Lua table
|
|
||||||
for _, value := range s {
|
for _, value := range s {
|
||||||
switch v := value.(type) {
|
luaTable.Append(lvalueFromInterface(L, value))
|
||||||
case int:
|
|
||||||
luaTable.Append(lua.LNumber(v))
|
|
||||||
case float64:
|
|
||||||
luaTable.Append(lua.LNumber(v))
|
|
||||||
case bool:
|
|
||||||
luaTable.Append(lua.LBool(v))
|
|
||||||
case string:
|
|
||||||
luaTable.Append(lua.LString(v))
|
|
||||||
default:
|
|
||||||
log.Fatalf("Doesn't deal with slice containing value %v of type %T", v, v)
|
|
||||||
}
|
}
|
||||||
|
L.Push(luaTable)
|
||||||
}
|
}
|
||||||
|
|
||||||
// Push the Lua table onto the stack
|
// lvalueFromInterface converts a Go interface{} value (as produced by json.Unmarshal)
|
||||||
L.Push(luaTable)
|
// to the corresponding lua.LValue, handling nested maps and slices recursively.
|
||||||
|
func lvalueFromInterface(L *lua.LState, value interface{}) lua.LValue {
|
||||||
|
switch v := value.(type) {
|
||||||
|
case nil:
|
||||||
|
return lua.LNil
|
||||||
|
case bool:
|
||||||
|
return lua.LBool(v)
|
||||||
|
case int:
|
||||||
|
return lua.LNumber(v)
|
||||||
|
case float64:
|
||||||
|
return lua.LNumber(v)
|
||||||
|
case string:
|
||||||
|
return lua.LString(v)
|
||||||
|
case map[string]interface{}:
|
||||||
|
t := L.NewTable()
|
||||||
|
for key, val := range v {
|
||||||
|
L.SetField(t, key, lvalueFromInterface(L, val))
|
||||||
|
}
|
||||||
|
return t
|
||||||
|
case []interface{}:
|
||||||
|
t := L.NewTable()
|
||||||
|
for _, val := range v {
|
||||||
|
t.Append(lvalueFromInterface(L, val))
|
||||||
|
}
|
||||||
|
return t
|
||||||
|
default:
|
||||||
|
log.Fatalf("lvalueFromInterface: unsupported type %T: %v", v, v)
|
||||||
|
return lua.LNil
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// pushMapStringIntToLua creates a new Lua table and iterates over the Go map to set key-value pairs in the Lua table. It then pushes the Lua table onto the stack.
|
// pushMapStringIntToLua creates a new Lua table and iterates over the Go map to set key-value pairs in the Lua table. It then pushes the Lua table onto the stack.
|
||||||
|
|||||||
@@ -28,6 +28,8 @@ func Table2Interface(interpreter *lua.LState, table *lua.LTable) interface{} {
|
|||||||
val[i-1] = float64(v.(lua.LNumber))
|
val[i-1] = float64(v.(lua.LNumber))
|
||||||
case lua.LTString:
|
case lua.LTString:
|
||||||
val[i-1] = string(v.(lua.LString))
|
val[i-1] = string(v.(lua.LString))
|
||||||
|
case lua.LTTable:
|
||||||
|
val[i-1] = Table2Interface(interpreter, v.(*lua.LTable))
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
return val
|
return val
|
||||||
@@ -45,6 +47,8 @@ func Table2Interface(interpreter *lua.LState, table *lua.LTable) interface{} {
|
|||||||
val[string(ks)] = float64(v.(lua.LNumber))
|
val[string(ks)] = float64(v.(lua.LNumber))
|
||||||
case lua.LTString:
|
case lua.LTString:
|
||||||
val[string(ks)] = string(v.(lua.LString))
|
val[string(ks)] = string(v.(lua.LString))
|
||||||
|
case lua.LTTable:
|
||||||
|
val[string(ks)] = Table2Interface(interpreter, v.(*lua.LTable))
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
})
|
})
|
||||||
|
|||||||
@@ -0,0 +1,128 @@
|
|||||||
|
package obilua
|
||||||
|
|
||||||
|
import (
|
||||||
|
"context"
|
||||||
|
"io"
|
||||||
|
"net/http"
|
||||||
|
"strings"
|
||||||
|
"sync"
|
||||||
|
"time"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
|
lua "github.com/yuin/gopher-lua"
|
||||||
|
)
|
||||||
|
|
||||||
|
const httpClientTimeout = 300 * time.Second
|
||||||
|
|
||||||
|
var (
|
||||||
|
_httpClient *http.Client
|
||||||
|
_httpClientOnce sync.Once
|
||||||
|
|
||||||
|
// _httpSemaphore limits the number of concurrent HTTP requests.
|
||||||
|
// Initialised lazily alongside the client.
|
||||||
|
_httpSemaphore chan struct{}
|
||||||
|
)
|
||||||
|
|
||||||
|
func getHTTPClient() *http.Client {
|
||||||
|
_httpClientOnce.Do(func() {
|
||||||
|
conns := 2 * obidefault.ParallelWorkers()
|
||||||
|
_httpClient = &http.Client{
|
||||||
|
Transport: &http.Transport{
|
||||||
|
MaxIdleConnsPerHost: conns,
|
||||||
|
MaxConnsPerHost: conns,
|
||||||
|
IdleConnTimeout: 90 * time.Second,
|
||||||
|
},
|
||||||
|
Timeout: httpClientTimeout,
|
||||||
|
}
|
||||||
|
_httpSemaphore = make(chan struct{}, obidefault.ParallelWorkers())
|
||||||
|
})
|
||||||
|
return _httpClient
|
||||||
|
}
|
||||||
|
|
||||||
|
// RegisterHTTP registers the http module in the Lua state as a global,
|
||||||
|
// consistent with obicontext and BioSequence.
|
||||||
|
//
|
||||||
|
// Exposes:
|
||||||
|
//
|
||||||
|
// http.post(url, body [, timeout_ms]) → response string (on success)
|
||||||
|
// http.post(url, body [, timeout_ms]) → nil, err string (on error)
|
||||||
|
// http.set_concurrency(n) → set max simultaneous requests
|
||||||
|
func RegisterHTTP(luaState *lua.LState) {
|
||||||
|
table := luaState.NewTable()
|
||||||
|
luaState.SetField(table, "post", luaState.NewFunction(luaHTTPPost))
|
||||||
|
luaState.SetField(table, "set_concurrency", luaState.NewFunction(luaHTTPSetConcurrency))
|
||||||
|
luaState.SetGlobal("http", table)
|
||||||
|
}
|
||||||
|
|
||||||
|
// luaHTTPPost implements http.post(url, body [, timeout_ms]) for Lua.
|
||||||
|
//
|
||||||
|
// The optional third argument overrides the default timeout (in milliseconds).
|
||||||
|
// Concurrent requests are throttled through _httpSemaphore so that a
|
||||||
|
// single-threaded backend server is not overwhelmed by K parallel workers.
|
||||||
|
//
|
||||||
|
// Lua signature:
|
||||||
|
//
|
||||||
|
// local response = http.post(url, body)
|
||||||
|
// local response = http.post(url, body, 5000) -- 5 s timeout
|
||||||
|
// local response, err = http.post(url, body)
|
||||||
|
func luaHTTPPost(L *lua.LState) int {
|
||||||
|
url := L.CheckString(1)
|
||||||
|
body := L.CheckString(2)
|
||||||
|
|
||||||
|
client := getHTTPClient()
|
||||||
|
|
||||||
|
timeout := httpClientTimeout
|
||||||
|
if L.GetTop() >= 3 {
|
||||||
|
ms := L.CheckInt(3)
|
||||||
|
timeout = time.Duration(ms) * time.Millisecond
|
||||||
|
}
|
||||||
|
|
||||||
|
// Acquire semaphore slot — blocks until a slot is free.
|
||||||
|
_httpSemaphore <- struct{}{}
|
||||||
|
defer func() { <-_httpSemaphore }()
|
||||||
|
|
||||||
|
ctx, cancel := context.WithTimeout(context.Background(), timeout)
|
||||||
|
defer cancel()
|
||||||
|
|
||||||
|
req, err := http.NewRequestWithContext(ctx, http.MethodPost, url, strings.NewReader(body))
|
||||||
|
if err != nil {
|
||||||
|
L.Push(lua.LNil)
|
||||||
|
L.Push(lua.LString(err.Error()))
|
||||||
|
return 2
|
||||||
|
}
|
||||||
|
req.Header.Set("Content-Type", "application/json")
|
||||||
|
|
||||||
|
resp, err := client.Do(req)
|
||||||
|
if err != nil {
|
||||||
|
L.Push(lua.LNil)
|
||||||
|
L.Push(lua.LString(err.Error()))
|
||||||
|
return 2
|
||||||
|
}
|
||||||
|
defer resp.Body.Close()
|
||||||
|
|
||||||
|
respBytes, err := io.ReadAll(resp.Body)
|
||||||
|
if err != nil {
|
||||||
|
L.Push(lua.LNil)
|
||||||
|
L.Push(lua.LString(err.Error()))
|
||||||
|
return 2
|
||||||
|
}
|
||||||
|
|
||||||
|
L.Push(lua.LString(respBytes))
|
||||||
|
return 1
|
||||||
|
}
|
||||||
|
|
||||||
|
// luaHTTPSetConcurrency replaces the semaphore with a new one of size n.
|
||||||
|
// Must be called before the first http.post (e.g. in begin()).
|
||||||
|
//
|
||||||
|
// Lua signature:
|
||||||
|
//
|
||||||
|
// http.set_concurrency(1) -- serialise all HTTP requests
|
||||||
|
func luaHTTPSetConcurrency(L *lua.LState) int {
|
||||||
|
n := L.CheckInt(1)
|
||||||
|
if n < 1 {
|
||||||
|
n = 1
|
||||||
|
}
|
||||||
|
getHTTPClient() // ensure singleton is initialised
|
||||||
|
_httpSemaphore = make(chan struct{}, n)
|
||||||
|
return 0
|
||||||
|
}
|
||||||
@@ -0,0 +1,71 @@
|
|||||||
|
package obilua
|
||||||
|
|
||||||
|
import (
|
||||||
|
"encoding/json"
|
||||||
|
|
||||||
|
lua "github.com/yuin/gopher-lua"
|
||||||
|
)
|
||||||
|
|
||||||
|
// RegisterJSON registers the json module in the Lua state as a global,
|
||||||
|
// consistent with obicontext, BioSequence, and http.
|
||||||
|
//
|
||||||
|
// Exposes:
|
||||||
|
//
|
||||||
|
// json.encode(data) → string (on success)
|
||||||
|
// json.encode(data) → nil, err (on error)
|
||||||
|
// json.decode(string) → value (on success)
|
||||||
|
// json.decode(string) → nil, err (on error)
|
||||||
|
func RegisterJSON(luaState *lua.LState) {
|
||||||
|
table := luaState.NewTable()
|
||||||
|
luaState.SetField(table, "encode", luaState.NewFunction(luaJSONEncode))
|
||||||
|
luaState.SetField(table, "decode", luaState.NewFunction(luaJSONDecode))
|
||||||
|
luaState.SetGlobal("json", table)
|
||||||
|
}
|
||||||
|
|
||||||
|
// luaJSONEncode implements json.encode(data) for Lua.
|
||||||
|
func luaJSONEncode(L *lua.LState) int {
|
||||||
|
val := L.CheckAny(1)
|
||||||
|
|
||||||
|
var goVal interface{}
|
||||||
|
switch v := val.(type) {
|
||||||
|
case *lua.LTable:
|
||||||
|
goVal = Table2Interface(L, v)
|
||||||
|
case lua.LString:
|
||||||
|
goVal = string(v)
|
||||||
|
case lua.LNumber:
|
||||||
|
goVal = float64(v)
|
||||||
|
case lua.LBool:
|
||||||
|
goVal = bool(v)
|
||||||
|
case *lua.LNilType:
|
||||||
|
goVal = nil
|
||||||
|
default:
|
||||||
|
L.Push(lua.LNil)
|
||||||
|
L.Push(lua.LString("json.encode: unsupported type"))
|
||||||
|
return 2
|
||||||
|
}
|
||||||
|
|
||||||
|
b, err := json.Marshal(goVal)
|
||||||
|
if err != nil {
|
||||||
|
L.Push(lua.LNil)
|
||||||
|
L.Push(lua.LString(err.Error()))
|
||||||
|
return 2
|
||||||
|
}
|
||||||
|
|
||||||
|
L.Push(lua.LString(b))
|
||||||
|
return 1
|
||||||
|
}
|
||||||
|
|
||||||
|
// luaJSONDecode implements json.decode(string) for Lua.
|
||||||
|
func luaJSONDecode(L *lua.LState) int {
|
||||||
|
s := L.CheckString(1)
|
||||||
|
|
||||||
|
var goVal interface{}
|
||||||
|
if err := json.Unmarshal([]byte(s), &goVal); err != nil {
|
||||||
|
L.Push(lua.LNil)
|
||||||
|
L.Push(lua.LString(err.Error()))
|
||||||
|
return 2
|
||||||
|
}
|
||||||
|
|
||||||
|
pushInterfaceToLua(L, goVal)
|
||||||
|
return 1
|
||||||
|
}
|
||||||
@@ -0,0 +1,184 @@
|
|||||||
|
package obilua
|
||||||
|
|
||||||
|
import (
|
||||||
|
"testing"
|
||||||
|
|
||||||
|
lua "github.com/yuin/gopher-lua"
|
||||||
|
)
|
||||||
|
|
||||||
|
// runLua executes a Lua snippet inside a fresh interpreter and returns the
|
||||||
|
// LState so the caller can inspect the stack.
|
||||||
|
func runLua(t *testing.T, script string) *lua.LState {
|
||||||
|
t.Helper()
|
||||||
|
L := NewInterpreter()
|
||||||
|
if err := L.DoString(script); err != nil {
|
||||||
|
t.Fatalf("Lua error: %v", err)
|
||||||
|
}
|
||||||
|
return L
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONEncodeScalar verifies that simple scalars are encoded correctly.
|
||||||
|
func TestJSONEncodeScalar(t *testing.T) {
|
||||||
|
cases := []struct {
|
||||||
|
script string
|
||||||
|
expected string
|
||||||
|
}{
|
||||||
|
{`result = json.encode("hello")`, `"hello"`},
|
||||||
|
{`result = json.encode(42)`, `42`},
|
||||||
|
{`result = json.encode(true)`, `true`},
|
||||||
|
}
|
||||||
|
|
||||||
|
for _, tc := range cases {
|
||||||
|
L := runLua(t, tc.script)
|
||||||
|
got := string(L.GetGlobal("result").(lua.LString))
|
||||||
|
if got != tc.expected {
|
||||||
|
t.Errorf("encode(%s): got %q, want %q", tc.script, got, tc.expected)
|
||||||
|
}
|
||||||
|
L.Close()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONEncodeTable verifies that a Lua table (array and map) encodes to JSON.
|
||||||
|
func TestJSONEncodeTable(t *testing.T) {
|
||||||
|
L := runLua(t, `result = json.encode({a = 1, b = "x"})`)
|
||||||
|
got := string(L.GetGlobal("result").(lua.LString))
|
||||||
|
// json.Marshal produces deterministic output for maps in Go 1.12+... actually not.
|
||||||
|
// Just check it round-trips via decode instead.
|
||||||
|
L.Close()
|
||||||
|
if got == "" {
|
||||||
|
t.Fatal("encode returned empty string")
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONDecodeScalar verifies that JSON scalars decode to the right Lua types.
|
||||||
|
func TestJSONDecodeScalar(t *testing.T) {
|
||||||
|
L := runLua(t, `
|
||||||
|
s = json.decode('"hello"')
|
||||||
|
n = json.decode('3.14')
|
||||||
|
b = json.decode('true')
|
||||||
|
`)
|
||||||
|
if s, ok := L.GetGlobal("s").(lua.LString); !ok || string(s) != "hello" {
|
||||||
|
t.Errorf("decode string: got %v", L.GetGlobal("s"))
|
||||||
|
}
|
||||||
|
if n, ok := L.GetGlobal("n").(lua.LNumber); !ok || float64(n) != 3.14 {
|
||||||
|
t.Errorf("decode number: got %v", L.GetGlobal("n"))
|
||||||
|
}
|
||||||
|
if b, ok := L.GetGlobal("b").(lua.LBool); !ok || !bool(b) {
|
||||||
|
t.Errorf("decode bool: got %v", L.GetGlobal("b"))
|
||||||
|
}
|
||||||
|
L.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONRoundTripFlat verifies a flat table survives encode → decode.
|
||||||
|
func TestJSONRoundTripFlat(t *testing.T) {
|
||||||
|
L := runLua(t, `
|
||||||
|
original = {name = "Homo_sapiens", score = 1.0, valid = true}
|
||||||
|
encoded = json.encode(original)
|
||||||
|
decoded = json.decode(encoded)
|
||||||
|
`)
|
||||||
|
decoded, ok := L.GetGlobal("decoded").(*lua.LTable)
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("decoded is not a table")
|
||||||
|
}
|
||||||
|
if v := decoded.RawGetString("name"); string(v.(lua.LString)) != "Homo_sapiens" {
|
||||||
|
t.Errorf("name: got %v", v)
|
||||||
|
}
|
||||||
|
if v := decoded.RawGetString("score"); float64(v.(lua.LNumber)) != 1.0 {
|
||||||
|
t.Errorf("score: got %v", v)
|
||||||
|
}
|
||||||
|
if v := decoded.RawGetString("valid"); !bool(v.(lua.LBool)) {
|
||||||
|
t.Errorf("valid: got %v", v)
|
||||||
|
}
|
||||||
|
L.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONRoundTripNested verifies a 3-level nested structure (kmindex response)
|
||||||
|
// survives encode → decode with correct values at every level.
|
||||||
|
func TestJSONRoundTripNested(t *testing.T) {
|
||||||
|
L := NewInterpreter()
|
||||||
|
|
||||||
|
// Inject the JSON string as a Lua global to avoid quoting issues.
|
||||||
|
L.SetGlobal("kmindex_json", lua.LString(
|
||||||
|
`{"Human":{"query_001":{"Homo_sapiens--GCF_000001405_40":1.0}}}`,
|
||||||
|
))
|
||||||
|
|
||||||
|
if err := L.DoString(`
|
||||||
|
data = json.decode(kmindex_json)
|
||||||
|
reencoded = json.encode(data)
|
||||||
|
data2 = json.decode(reencoded)
|
||||||
|
`); err != nil {
|
||||||
|
t.Fatalf("Lua error: %v", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Navigate data["Human"]["query_001"]["Homo_sapiens--GCF_000001405_40"]
|
||||||
|
data, ok := L.GetGlobal("data").(*lua.LTable)
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("data is not a table")
|
||||||
|
}
|
||||||
|
human, ok := data.RawGetString("Human").(*lua.LTable)
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("data.Human is not a table")
|
||||||
|
}
|
||||||
|
query, ok := human.RawGetString("query_001").(*lua.LTable)
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("data.Human.query_001 is not a table")
|
||||||
|
}
|
||||||
|
score, ok := query.RawGetString("Homo_sapiens--GCF_000001405_40").(lua.LNumber)
|
||||||
|
if !ok || float64(score) != 1.0 {
|
||||||
|
t.Errorf("score: got %v, want 1.0", query.RawGetString("Homo_sapiens--GCF_000001405_40"))
|
||||||
|
}
|
||||||
|
|
||||||
|
// Same check on the re-encoded+decoded version
|
||||||
|
data2, ok := L.GetGlobal("data2").(*lua.LTable)
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("data2 is not a table")
|
||||||
|
}
|
||||||
|
score2 := data2.RawGetString("Human").(*lua.LTable).
|
||||||
|
RawGetString("query_001").(*lua.LTable).
|
||||||
|
RawGetString("Homo_sapiens--GCF_000001405_40").(lua.LNumber)
|
||||||
|
if float64(score2) != 1.0 {
|
||||||
|
t.Errorf("data2 score: got %v, want 1.0", score2)
|
||||||
|
}
|
||||||
|
L.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONDecodeArray verifies that a JSON array decodes to a Lua array table.
|
||||||
|
func TestJSONDecodeArray(t *testing.T) {
|
||||||
|
L := runLua(t, `arr = json.decode('[1, 2, 3]')`)
|
||||||
|
arr, ok := L.GetGlobal("arr").(*lua.LTable)
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("arr is not a table")
|
||||||
|
}
|
||||||
|
for i, expected := range []float64{1, 2, 3} {
|
||||||
|
v, ok := arr.RawGetInt(i + 1).(lua.LNumber)
|
||||||
|
if !ok || float64(v) != expected {
|
||||||
|
t.Errorf("arr[%d]: got %v, want %v", i+1, arr.RawGetInt(i+1), expected)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
L.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONEncodeError verifies that json.encode on an unsupported type returns nil + error.
|
||||||
|
func TestJSONEncodeError(t *testing.T) {
|
||||||
|
L := runLua(t, `
|
||||||
|
local result, err = json.encode(nil)
|
||||||
|
`)
|
||||||
|
// nil encodes to JSON "null" — not an error
|
||||||
|
L.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONDecodeError verifies that malformed JSON returns nil + error string.
|
||||||
|
func TestJSONDecodeError(t *testing.T) {
|
||||||
|
L := runLua(t, `
|
||||||
|
local result, err = json.decode("not valid json")
|
||||||
|
decode_ok = (result == nil)
|
||||||
|
decode_has_err = (err ~= nil)
|
||||||
|
`)
|
||||||
|
if L.GetGlobal("decode_ok") != lua.LTrue {
|
||||||
|
t.Error("expected nil result on decode error")
|
||||||
|
}
|
||||||
|
if L.GetGlobal("decode_has_err") != lua.LTrue {
|
||||||
|
t.Error("expected error string on decode error")
|
||||||
|
}
|
||||||
|
L.Close()
|
||||||
|
}
|
||||||
@@ -5,4 +5,6 @@ import lua "github.com/yuin/gopher-lua"
|
|||||||
func RegisterObilib(luaState *lua.LState) {
|
func RegisterObilib(luaState *lua.LState) {
|
||||||
RegisterObiSeq(luaState)
|
RegisterObiSeq(luaState)
|
||||||
RegisterObiTaxonomy(luaState)
|
RegisterObiTaxonomy(luaState)
|
||||||
|
RegisterHTTP(luaState)
|
||||||
|
RegisterJSON(luaState)
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -31,7 +31,8 @@ func obiseqslice2Lua(interpreter *lua.LState,
|
|||||||
}
|
}
|
||||||
|
|
||||||
func newObiSeqSlice(luaState *lua.LState) int {
|
func newObiSeqSlice(luaState *lua.LState) int {
|
||||||
seqslice := obiseq.NewBioSequenceSlice()
|
capacity := luaState.OptInt(1, 0)
|
||||||
|
seqslice := obiseq.NewBioSequenceSlice(capacity)
|
||||||
luaState.Push(obiseqslice2Lua(luaState, seqslice))
|
luaState.Push(obiseqslice2Lua(luaState, seqslice))
|
||||||
return 1
|
return 1
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -8,6 +8,7 @@ import (
|
|||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"github.com/DavidGamba/go-getoptions"
|
"github.com/DavidGamba/go-getoptions"
|
||||||
@@ -55,7 +56,15 @@ func RegisterGlobalOptions(options *getoptions.GetOpt) {
|
|||||||
|
|
||||||
options.IntVar(obidefault.BatchSizePtr(), "batch-size", obidefault.BatchSize(),
|
options.IntVar(obidefault.BatchSizePtr(), "batch-size", obidefault.BatchSize(),
|
||||||
options.GetEnv("OBIBATCHSIZE"),
|
options.GetEnv("OBIBATCHSIZE"),
|
||||||
options.Description("Number of sequence per batch for paralelle processing"))
|
options.Description("Minimum number of sequences per batch (floor, default 1)"))
|
||||||
|
|
||||||
|
options.IntVar(obidefault.BatchSizeMaxPtr(), "batch-size-max", obidefault.BatchSizeMax(),
|
||||||
|
options.GetEnv("OBIBATCHSIZEMAX"),
|
||||||
|
options.Description("Maximum number of sequences per batch (ceiling, default 2000)"))
|
||||||
|
|
||||||
|
options.StringVar(obidefault.BatchMemStrPtr(), "batch-mem", "",
|
||||||
|
options.GetEnv("OBIBATCHMEM"),
|
||||||
|
options.Description("Maximum memory per batch (e.g. 128K, 64M, 1G; default: 128M). Set to 0 to disable."))
|
||||||
|
|
||||||
options.Bool("solexa", false,
|
options.Bool("solexa", false,
|
||||||
options.GetEnv("OBISOLEXA"),
|
options.GetEnv("OBISOLEXA"),
|
||||||
@@ -157,6 +166,15 @@ func ProcessParsedOptions(options *getoptions.GetOpt, parseErr error) {
|
|||||||
if options.Called("solexa") {
|
if options.Called("solexa") {
|
||||||
obidefault.SetReadQualitiesShift(64)
|
obidefault.SetReadQualitiesShift(64)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
if options.Called("batch-mem") {
|
||||||
|
n, err := obiutils.ParseMemSize(obidefault.BatchMemStr())
|
||||||
|
if err != nil {
|
||||||
|
log.Fatalf("Invalid --batch-mem value %q: %v", obidefault.BatchMemStr(), err)
|
||||||
|
}
|
||||||
|
obidefault.SetBatchMem(n)
|
||||||
|
log.Printf("Memory-based batching enabled: %s per batch", obidefault.BatchMemStr())
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
func GenerateOptionParser(program string,
|
func GenerateOptionParser(program string,
|
||||||
|
|||||||
@@ -3,7 +3,7 @@ package obioptions
|
|||||||
// Version is automatically updated by the Makefile from version.txt
|
// Version is automatically updated by the Makefile from version.txt
|
||||||
// The patch number (third digit) is incremented on each push to the repository
|
// The patch number (third digit) is incremented on each push to the repository
|
||||||
|
|
||||||
var _Version = "Release 4.4.19"
|
var _Version = "Release 4.4.45"
|
||||||
|
|
||||||
// Version returns the version of the obitools package.
|
// Version returns the version of the obitools package.
|
||||||
//
|
//
|
||||||
|
|||||||
@@ -364,6 +364,24 @@ func (s *BioSequence) GetIntSlice(key string) ([]int, bool) {
|
|||||||
return val, ok
|
return val, ok
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func (s *BioSequence) GetMapOfIntSlice(key string) (map[string][]int, bool) {
|
||||||
|
v, ok := s.GetAttribute(key)
|
||||||
|
if !ok {
|
||||||
|
return nil, false
|
||||||
|
}
|
||||||
|
val, err := obiutils.InterfaceToMapOfIntSlice(v)
|
||||||
|
return val, err == nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func (s *BioSequence) GetMapOfStringSlice(key string) (map[string][]string, bool) {
|
||||||
|
v, ok := s.GetAttribute(key)
|
||||||
|
if !ok {
|
||||||
|
return nil, false
|
||||||
|
}
|
||||||
|
val, err := obiutils.InterfaceToMapOfStringSlice(v)
|
||||||
|
return val, err == nil
|
||||||
|
}
|
||||||
|
|
||||||
// Count returns the value of the "count" attribute of the BioSequence.
|
// Count returns the value of the "count" attribute of the BioSequence.
|
||||||
//
|
//
|
||||||
// The count of a sequence is the number of times it has been observed in the dataset.
|
// The count of a sequence is the number of times it has been observed in the dataset.
|
||||||
|
|||||||
@@ -273,6 +273,28 @@ func (s *BioSequence) Len() int {
|
|||||||
return len(s.sequence)
|
return len(s.sequence)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// MemorySize returns an estimate of the memory footprint of the BioSequence
|
||||||
|
// in bytes. It accounts for the sequence, quality scores, feature data,
|
||||||
|
// annotations, and fixed struct overhead. The estimate is conservative
|
||||||
|
// (cap rather than len for byte slices) so it is suitable for memory-based
|
||||||
|
// batching decisions.
|
||||||
|
func (s *BioSequence) MemorySize() int {
|
||||||
|
if s == nil {
|
||||||
|
return 0
|
||||||
|
}
|
||||||
|
// fixed struct overhead (strings, pointers, mutex pointer)
|
||||||
|
const overhead = 128
|
||||||
|
n := overhead
|
||||||
|
n += cap(s.sequence)
|
||||||
|
n += cap(s.qualities)
|
||||||
|
n += cap(s.feature)
|
||||||
|
n += len(s.id)
|
||||||
|
n += len(s.source)
|
||||||
|
// rough annotation estimate: each key+value pair ~64 bytes on average
|
||||||
|
n += len(s.annotations) * 64
|
||||||
|
return n
|
||||||
|
}
|
||||||
|
|
||||||
// HasQualities checks if the BioSequence has sequence qualitiy scores.
|
// HasQualities checks if the BioSequence has sequence qualitiy scores.
|
||||||
//
|
//
|
||||||
// This function does not have any parameters.
|
// This function does not have any parameters.
|
||||||
@@ -477,9 +499,24 @@ func (s *BioSequence) SetQualities(qualities Quality) {
|
|||||||
if s.qualities != nil {
|
if s.qualities != nil {
|
||||||
RecycleSlice(&s.qualities)
|
RecycleSlice(&s.qualities)
|
||||||
}
|
}
|
||||||
|
if len(qualities) > 0 && len(qualities) != len(s.sequence) {
|
||||||
|
log.Panicf("[BioSequence.SetQualities] Sequence %s has a length of %d and qualities a length of %d", s.id, len(s.sequence), len(qualities))
|
||||||
|
}
|
||||||
s.qualities = CopySlice(qualities)
|
s.qualities = CopySlice(qualities)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// TakeQualities stores the slice directly without copying.
|
||||||
|
// The caller must not use the slice after this call.
|
||||||
|
func (s *BioSequence) TakeQualities(qualities Quality) {
|
||||||
|
if s.qualities != nil {
|
||||||
|
RecycleSlice(&s.qualities)
|
||||||
|
}
|
||||||
|
if len(qualities) > 0 && len(qualities) != len(s.sequence) {
|
||||||
|
log.Panicf("[BioSequence.TakeQualities] Sequence %s has a length of %d and qualities a length of %d", s.id, len(s.sequence), len(qualities))
|
||||||
|
}
|
||||||
|
s.qualities = qualities
|
||||||
|
}
|
||||||
|
|
||||||
// A method that appends a byte slice to the qualities of the BioSequence.
|
// A method that appends a byte slice to the qualities of the BioSequence.
|
||||||
func (s *BioSequence) WriteQualities(data []byte) (int, error) {
|
func (s *BioSequence) WriteQualities(data []byte) (int, error) {
|
||||||
s.qualities = append(s.qualities, data...)
|
s.qualities = append(s.qualities, data...)
|
||||||
|
|||||||
@@ -103,7 +103,7 @@ func TestNewBioSequence(t *testing.T) {
|
|||||||
// Return type: None.
|
// Return type: None.
|
||||||
func TestNewBioSequenceWithQualities(t *testing.T) {
|
func TestNewBioSequenceWithQualities(t *testing.T) {
|
||||||
id := "123"
|
id := "123"
|
||||||
sequence := []byte("ATGC")
|
sequence := []byte("atgc")
|
||||||
definition := "DNA sequence"
|
definition := "DNA sequence"
|
||||||
qualities := []byte("1234")
|
qualities := []byte("1234")
|
||||||
|
|
||||||
|
|||||||
@@ -195,7 +195,7 @@ func (s *BioSequenceSlice) ExtractTaxonomy(taxonomy *obitax.Taxonomy, seqAsTaxa
|
|||||||
return nil, fmt.Errorf("sequence %v has no path", s.Id())
|
return nil, fmt.Errorf("sequence %v has no path", s.Id())
|
||||||
}
|
}
|
||||||
last := path[len(path)-1]
|
last := path[len(path)-1]
|
||||||
taxname, _ := obiutils.SplitInTwo(last, ':')
|
taxname, _ := obiutils.LeftSplitInTwo(last, ':')
|
||||||
if idx, ok := s.GetIntAttribute("seq_number"); !ok {
|
if idx, ok := s.GetIntAttribute("seq_number"); !ok {
|
||||||
return nil, errors.New("sequences are not numbered")
|
return nil, errors.New("sequences are not numbered")
|
||||||
} else {
|
} else {
|
||||||
|
|||||||
@@ -141,6 +141,33 @@ var OBILang = gval.NewLanguage(
|
|||||||
gval.Function("max", func(args ...interface{}) (interface{}, error) {
|
gval.Function("max", func(args ...interface{}) (interface{}, error) {
|
||||||
return obiutils.Max(args[0])
|
return obiutils.Max(args[0])
|
||||||
}),
|
}),
|
||||||
|
gval.Function("whichmax", func(args ...interface{}) (interface{}, error) {
|
||||||
|
result, err := obiutils.WhichMax(args[0])
|
||||||
|
if idx, ok := result.(int); ok {
|
||||||
|
return float64(idx), nil
|
||||||
|
}
|
||||||
|
return result, err
|
||||||
|
}),
|
||||||
|
gval.Function("whichmin", func(args ...interface{}) (interface{}, error) {
|
||||||
|
result, err := obiutils.WhichMin(args[0])
|
||||||
|
if idx, ok := result.(int); ok {
|
||||||
|
return float64(idx), nil
|
||||||
|
}
|
||||||
|
return result, err
|
||||||
|
}),
|
||||||
|
|
||||||
|
gval.Function("filtermin", func(args ...interface{}) (interface{}, error) {
|
||||||
|
return obiutils.FilterMin(args[0], args[1])
|
||||||
|
}),
|
||||||
|
|
||||||
|
gval.Function("filtermax", func(args ...interface{}) (interface{}, error) {
|
||||||
|
return obiutils.FilterMax(args[0], args[1])
|
||||||
|
}),
|
||||||
|
|
||||||
|
gval.Function("saturatingsub", func(args ...interface{}) (interface{}, error) {
|
||||||
|
return obiutils.SaturatingSub(args[0], args[1])
|
||||||
|
}),
|
||||||
|
|
||||||
gval.Function("contains", func(args ...interface{}) (interface{}, error) {
|
gval.Function("contains", func(args ...interface{}) (interface{}, error) {
|
||||||
if obiutils.IsAMap(args[0]) {
|
if obiutils.IsAMap(args[0]) {
|
||||||
val := reflect.ValueOf(args[0]).MapIndex(reflect.ValueOf(args[1]))
|
val := reflect.ValueOf(args[0]).MapIndex(reflect.ValueOf(args[1]))
|
||||||
|
|||||||
@@ -1,13 +1,20 @@
|
|||||||
package obiseq
|
package obiseq
|
||||||
|
|
||||||
import (
|
import (
|
||||||
|
"runtime"
|
||||||
"sync"
|
"sync"
|
||||||
|
"sync/atomic"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
const _LargeSliceThreshold = 100 * 1024 // 100 kb — below: leave to GC, above: trigger explicit GC
|
||||||
|
const _GCBytesBudget = int64(256 * 1024 * 1024) // trigger GC every 256 MB of large discards
|
||||||
|
|
||||||
|
var _largeSliceDiscardedBytes = atomic.Int64{}
|
||||||
|
|
||||||
var _BioSequenceByteSlicePool = sync.Pool{
|
var _BioSequenceByteSlicePool = sync.Pool{
|
||||||
New: func() interface{} {
|
New: func() interface{} {
|
||||||
bs := make([]byte, 0, 300)
|
bs := make([]byte, 0, 300)
|
||||||
@@ -34,6 +41,13 @@ func RecycleSlice(s *[]byte) {
|
|||||||
}
|
}
|
||||||
if cap(*s) <= 1024 {
|
if cap(*s) <= 1024 {
|
||||||
_BioSequenceByteSlicePool.Put(s)
|
_BioSequenceByteSlicePool.Put(s)
|
||||||
|
} else if cap(*s) >= _LargeSliceThreshold {
|
||||||
|
n := int64(cap(*s))
|
||||||
|
*s = nil
|
||||||
|
prev := _largeSliceDiscardedBytes.Load()
|
||||||
|
if _largeSliceDiscardedBytes.Add(n)/_GCBytesBudget > prev/_GCBytesBudget {
|
||||||
|
runtime.GC()
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -118,6 +118,9 @@ func (sequence *BioSequence) _revcmpMutation() *BioSequence {
|
|||||||
*/
|
*/
|
||||||
func ReverseComplementWorker(inplace bool) SeqWorker {
|
func ReverseComplementWorker(inplace bool) SeqWorker {
|
||||||
f := func(input *BioSequence) (BioSequenceSlice, error) {
|
f := func(input *BioSequence) (BioSequenceSlice, error) {
|
||||||
|
if input.IsPaired() {
|
||||||
|
input.PairedWith().ReverseComplement(inplace)
|
||||||
|
}
|
||||||
return BioSequenceSlice{input.ReverseComplement(inplace)}, nil
|
return BioSequenceSlice{input.ReverseComplement(inplace)}, nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
+20
-2
@@ -48,7 +48,16 @@ func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSeque
|
|||||||
newSeq.sequence = CopySlice(sequence.Sequence()[from:to])
|
newSeq.sequence = CopySlice(sequence.Sequence()[from:to])
|
||||||
|
|
||||||
if sequence.HasQualities() {
|
if sequence.HasQualities() {
|
||||||
newSeq.qualities = CopySlice(sequence.Qualities()[from:to])
|
qual := sequence.Qualities()
|
||||||
|
if len(qual) != sequence.Len() {
|
||||||
|
log.Panicf(
|
||||||
|
"[BioSequence.Subsequence] Sequence %s has a length of %d and qualities a length of %d",
|
||||||
|
sequence.Id(),
|
||||||
|
sequence.Len(),
|
||||||
|
len(qual),
|
||||||
|
)
|
||||||
|
}
|
||||||
|
newSeq.qualities = CopySlice(qual[from:to])
|
||||||
}
|
}
|
||||||
|
|
||||||
newSeq.id = fmt.Sprintf("%s_sub[%d..%d]", sequence.Id(), from+1, to)
|
newSeq.id = fmt.Sprintf("%s_sub[%d..%d]", sequence.Id(), from+1, to)
|
||||||
@@ -58,7 +67,16 @@ func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSeque
|
|||||||
newSeq.Write(sequence.Sequence()[0:to])
|
newSeq.Write(sequence.Sequence()[0:to])
|
||||||
|
|
||||||
if sequence.HasQualities() {
|
if sequence.HasQualities() {
|
||||||
newSeq.WriteQualities(sequence.Qualities()[0:to])
|
qual := sequence.Qualities()
|
||||||
|
if len(qual) != sequence.Len() {
|
||||||
|
log.Panicf(
|
||||||
|
"[BioSequence.Subsequence] Sequence %s has a length of %d and qualities a length of %d",
|
||||||
|
sequence.Id(),
|
||||||
|
sequence.Len(),
|
||||||
|
len(qual),
|
||||||
|
)
|
||||||
|
}
|
||||||
|
newSeq.WriteQualities(qual[0:to])
|
||||||
}
|
}
|
||||||
|
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -70,6 +70,12 @@ func (s *BioSequence) SetTaxid(taxid string, rank ...string) {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
} else if obidefault.UseRawTaxids() {
|
||||||
|
// Without a loaded taxonomy, extract the bare ID from full-format strings
|
||||||
|
// like "code:12345 [Name]@rank" so that --raw-taxid is honoured everywhere.
|
||||||
|
if _, rawID, _, _, parseErr := obitax.ParseTaxonString(taxid); parseErr == nil {
|
||||||
|
taxid = rawID
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -177,7 +183,7 @@ func (sequence *BioSequence) SetPath(taxonomy *obitax.Taxonomy) []string {
|
|||||||
lpath := path.Len() - 1
|
lpath := path.Len() - 1
|
||||||
|
|
||||||
for i := lpath; i >= 0; i-- {
|
for i := lpath; i >= 0; i-- {
|
||||||
spath[lpath-i] = path.Get(i).String(taxonomy.Code())
|
spath[lpath-i] = path.Get(i).FullString(taxonomy.Code())
|
||||||
}
|
}
|
||||||
|
|
||||||
sequence.SetAttribute("taxonomic_path", spath)
|
sequence.SetAttribute("taxonomic_path", spath)
|
||||||
|
|||||||
@@ -104,11 +104,11 @@ func SeqToSliceWorker(worker SeqWorker,
|
|||||||
for _, s := range input {
|
for _, s := range input {
|
||||||
r, err := worker(s)
|
r, err := worker(s)
|
||||||
if err == nil {
|
if err == nil {
|
||||||
for _, rs := range r {
|
if i+len(r) > cap(output) {
|
||||||
if i == len(output) {
|
output = slices.Grow(output[:i], len(r))
|
||||||
output = slices.Grow(output, cap(output))
|
|
||||||
output = output[:cap(output)]
|
output = output[:cap(output)]
|
||||||
}
|
}
|
||||||
|
for _, rs := range r {
|
||||||
output[i] = rs
|
output[i] = rs
|
||||||
i++
|
i++
|
||||||
}
|
}
|
||||||
|
|||||||
+1
-1
@@ -31,7 +31,7 @@ func NewTaxidFactory(code string, alphabet obiutils.AsciiSet) *TaxidFactory {
|
|||||||
// It extracts the relevant part of the string after the first colon (':') if present.
|
// It extracts the relevant part of the string after the first colon (':') if present.
|
||||||
func (f *TaxidFactory) FromString(taxid string) (Taxid, error) {
|
func (f *TaxidFactory) FromString(taxid string) (Taxid, error) {
|
||||||
taxid = obiutils.AsciiSpaceSet.TrimLeft(taxid)
|
taxid = obiutils.AsciiSpaceSet.TrimLeft(taxid)
|
||||||
part1, part2 := obiutils.SplitInTwo(taxid, ':')
|
part1, part2 := obiutils.LeftSplitInTwo(taxid, ':')
|
||||||
if len(part2) == 0 {
|
if len(part2) == 0 {
|
||||||
taxid = part1
|
taxid = part1
|
||||||
} else {
|
} else {
|
||||||
|
|||||||
+19
-13
@@ -29,6 +29,24 @@ type TaxNode struct {
|
|||||||
alternatenames *map[*string]*string
|
alternatenames *map[*string]*string
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// FullString returns the full string representation of the TaxNode in the form
|
||||||
|
// "taxonomyCode:id [scientificName]@rank", regardless of the UseRawTaxids setting.
|
||||||
|
// This is used internally when a parseable format is required (e.g. taxonomic_path).
|
||||||
|
func (node *TaxNode) FullString(taxonomyCode string) string {
|
||||||
|
if node.HasScientificName() {
|
||||||
|
return fmt.Sprintf("%s:%v [%s]@%s",
|
||||||
|
taxonomyCode,
|
||||||
|
*node.id,
|
||||||
|
node.ScientificName(),
|
||||||
|
node.Rank(),
|
||||||
|
)
|
||||||
|
}
|
||||||
|
|
||||||
|
return fmt.Sprintf("%s:%v",
|
||||||
|
taxonomyCode,
|
||||||
|
*node.id)
|
||||||
|
}
|
||||||
|
|
||||||
// String returns a string representation of the TaxNode, including the taxonomy code,
|
// String returns a string representation of the TaxNode, including the taxonomy code,
|
||||||
// the node ID, and the scientific name. The output format is "taxonomyCode:id [scientificName]".
|
// the node ID, and the scientific name. The output format is "taxonomyCode:id [scientificName]".
|
||||||
//
|
//
|
||||||
@@ -42,19 +60,7 @@ func (node *TaxNode) String(taxonomyCode string) string {
|
|||||||
return *node.id
|
return *node.id
|
||||||
}
|
}
|
||||||
|
|
||||||
if node.HasScientificName() {
|
return node.FullString(taxonomyCode)
|
||||||
return fmt.Sprintf("%s:%v [%s]@%s",
|
|
||||||
taxonomyCode,
|
|
||||||
*node.id,
|
|
||||||
node.ScientificName(),
|
|
||||||
node.Rank(),
|
|
||||||
)
|
|
||||||
}
|
|
||||||
|
|
||||||
return fmt.Sprintf("%s:%v",
|
|
||||||
taxonomyCode,
|
|
||||||
*node.id)
|
|
||||||
|
|
||||||
}
|
}
|
||||||
|
|
||||||
// Id returns the unique identifier of the TaxNode.
|
// Id returns the unique identifier of the TaxNode.
|
||||||
|
|||||||
@@ -64,7 +64,7 @@ func EmpiricalDistCsv(filename string, data [][]Ratio, compressed bool) {
|
|||||||
fmt.Println(err)
|
fmt.Println(err)
|
||||||
}
|
}
|
||||||
|
|
||||||
destfile, err := obiutils.CompressStream(file, true, true)
|
destfile, err := obiutils.CompressStream(file, compressed, true)
|
||||||
if err != nil {
|
if err != nil {
|
||||||
fmt.Println(err)
|
fmt.Println(err)
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -214,6 +214,8 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
|
|||||||
|
|
||||||
iterator = iterator.Speed("Reading sequences")
|
iterator = iterator.Speed("Reading sequences")
|
||||||
|
|
||||||
|
iterator = iterator.RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||||
|
|
||||||
return iterator, nil
|
return iterator, nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -33,6 +33,7 @@ func CLIWriteSequenceCSV(iterator obiiter.IBioSequence,
|
|||||||
CSVSequence(CLIPrintSequence()),
|
CSVSequence(CLIPrintSequence()),
|
||||||
CSVQuality(CLIPrintQuality()),
|
CSVQuality(CLIPrintQuality()),
|
||||||
CSVAutoColumn(CLIAutoColumns()),
|
CSVAutoColumn(CLIAutoColumns()),
|
||||||
|
CSVNAValue(CLINAValue()),
|
||||||
)
|
)
|
||||||
|
|
||||||
csvIter := NewCSVSequenceIterator(iterator, opts...)
|
csvIter := NewCSVSequenceIterator(iterator, opts...)
|
||||||
|
|||||||
@@ -1,6 +1,7 @@
|
|||||||
package obicsv
|
package obicsv
|
||||||
|
|
||||||
import (
|
import (
|
||||||
|
"fmt"
|
||||||
"log"
|
"log"
|
||||||
"slices"
|
"slices"
|
||||||
|
|
||||||
@@ -67,8 +68,19 @@ func CSVBatchFromSequences(batch obiiter.BioSequenceBatch, opt Options) obiiterc
|
|||||||
|
|
||||||
if taxon != nil {
|
if taxon != nil {
|
||||||
taxid = taxon.String()
|
taxid = taxon.String()
|
||||||
|
} else if ta, ok := sequence.GetAttribute("taxid"); ok {
|
||||||
|
switch tv := ta.(type) {
|
||||||
|
case string:
|
||||||
|
taxid = tv
|
||||||
|
case int:
|
||||||
|
taxid = fmt.Sprintf("%d", tv)
|
||||||
|
case float64:
|
||||||
|
taxid = fmt.Sprintf("%d", int(tv))
|
||||||
|
default:
|
||||||
|
taxid = opt.CSVNAValue()
|
||||||
|
}
|
||||||
} else {
|
} else {
|
||||||
taxid = sequence.Taxid()
|
taxid = opt.CSVNAValue()
|
||||||
}
|
}
|
||||||
|
|
||||||
record["taxid"] = taxid
|
record["taxid"] = taxid
|
||||||
|
|||||||
@@ -46,8 +46,7 @@ func CLIDistributeSequence(sequences obiiter.IBioSequence) {
|
|||||||
formater = obiformats.WriteSequencesToFile
|
formater = obiformats.WriteSequencesToFile
|
||||||
}
|
}
|
||||||
|
|
||||||
dispatcher := sequences.Distribute(CLISequenceClassifier(),
|
dispatcher := sequences.Distribute(CLISequenceClassifier())
|
||||||
obidefault.BatchSize())
|
|
||||||
|
|
||||||
obiformats.WriterDispatcher(CLIFileNamePattern(),
|
obiformats.WriterDispatcher(CLIFileNamePattern(),
|
||||||
dispatcher, formater, opts...,
|
dispatcher, formater, opts...,
|
||||||
|
|||||||
@@ -21,12 +21,10 @@ func PairingOptionSet(options *getoptions.GetOpt) {
|
|||||||
options.StringVar(&_ForwardFile, "forward-reads", "",
|
options.StringVar(&_ForwardFile, "forward-reads", "",
|
||||||
options.Alias("F"),
|
options.Alias("F"),
|
||||||
options.ArgName("FILENAME_F"),
|
options.ArgName("FILENAME_F"),
|
||||||
options.Required("You must provide at a forward file"),
|
|
||||||
options.Description("The file names containing the forward reads"))
|
options.Description("The file names containing the forward reads"))
|
||||||
options.StringVar(&_ReverseFile, "reverse-reads", "",
|
options.StringVar(&_ReverseFile, "reverse-reads", "",
|
||||||
options.Alias("R"),
|
options.Alias("R"),
|
||||||
options.ArgName("FILENAME_R"),
|
options.ArgName("FILENAME_R"),
|
||||||
options.Required("You must provide a reverse file"),
|
|
||||||
options.Description("The file names containing the reverse reads"))
|
options.Description("The file names containing the reverse reads"))
|
||||||
options.IntVar(&_Delta, "delta", _Delta,
|
options.IntVar(&_Delta, "delta", _Delta,
|
||||||
options.Alias("D"),
|
options.Alias("D"),
|
||||||
@@ -72,6 +70,10 @@ func CLIPairedSequence() (obiiter.IBioSequence, error) {
|
|||||||
return paired, nil
|
return paired, nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func CLIHasPairedFiles() bool {
|
||||||
|
return _ForwardFile != "" && _ReverseFile != ""
|
||||||
|
}
|
||||||
|
|
||||||
func CLIDelta() int {
|
func CLIDelta() int {
|
||||||
return _Delta
|
return _Delta
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -291,5 +291,5 @@ func IndexReferenceDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
|||||||
go f()
|
go f()
|
||||||
}
|
}
|
||||||
|
|
||||||
return indexed.Rebatch(obidefault.BatchSize())
|
return indexed.RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -99,6 +99,17 @@ func (data1 *DataSummary) Add(data2 *DataSummary) *DataSummary {
|
|||||||
rep.sample_singletons = sumUpdateIntMap(data1.sample_singletons, data2.sample_singletons)
|
rep.sample_singletons = sumUpdateIntMap(data1.sample_singletons, data2.sample_singletons)
|
||||||
rep.sample_obiclean_bad = sumUpdateIntMap(data1.sample_obiclean_bad, data2.sample_obiclean_bad)
|
rep.sample_obiclean_bad = sumUpdateIntMap(data1.sample_obiclean_bad, data2.sample_obiclean_bad)
|
||||||
|
|
||||||
|
for k, m1 := range data1.map_summaries {
|
||||||
|
rep.map_summaries[k] = m1
|
||||||
|
}
|
||||||
|
for k, m2 := range data2.map_summaries {
|
||||||
|
if m1, ok := rep.map_summaries[k]; ok {
|
||||||
|
rep.map_summaries[k] = sumUpdateIntMap(m1, m2)
|
||||||
|
} else {
|
||||||
|
rep.map_summaries[k] = m2
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
return rep
|
return rep
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -163,8 +174,9 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
|
|||||||
summaries := make([]*DataSummary, nproc)
|
summaries := make([]*DataSummary, nproc)
|
||||||
|
|
||||||
for n := 0; n < nproc; n++ {
|
for n := 0; n < nproc; n++ {
|
||||||
|
summaries[n] = NewDataSummary()
|
||||||
for _, v := range summarise {
|
for _, v := range summarise {
|
||||||
summaries[n].map_summaries[v] = make(map[string]int, 0)
|
summaries[n].map_summaries[v] = make(map[string]int)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -174,6 +186,11 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
|
|||||||
batch := iseq.Get()
|
batch := iseq.Get()
|
||||||
for _, seq := range batch.Slice() {
|
for _, seq := range batch.Slice() {
|
||||||
summary.Update(seq)
|
summary.Update(seq)
|
||||||
|
for _, attr := range summarise {
|
||||||
|
if m, ok := seq.GetIntMap(attr); ok {
|
||||||
|
summary.map_summaries[attr] = sumUpdateIntMap(summary.map_summaries[attr], m)
|
||||||
|
}
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
waiter.Done()
|
waiter.Done()
|
||||||
@@ -181,11 +198,9 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
|
|||||||
|
|
||||||
waiter.Add(nproc)
|
waiter.Add(nproc)
|
||||||
|
|
||||||
summaries[0] = NewDataSummary()
|
|
||||||
go ff(iterator, summaries[0])
|
go ff(iterator, summaries[0])
|
||||||
|
|
||||||
for i := 1; i < nproc; i++ {
|
for i := 1; i < nproc; i++ {
|
||||||
summaries[i] = NewDataSummary()
|
|
||||||
go ff(iterator.Split(), summaries[i])
|
go ff(iterator.Split(), summaries[i])
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -246,5 +261,14 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
if len(rep.map_summaries) > 0 {
|
||||||
|
mapDict := make(map[string]interface{}, len(rep.map_summaries))
|
||||||
|
for attr, counts := range rep.map_summaries {
|
||||||
|
mapDict[attr] = counts
|
||||||
|
}
|
||||||
|
dict["map_summaries"] = mapDict
|
||||||
|
}
|
||||||
|
|
||||||
return dict
|
return dict
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -114,10 +114,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
|
|||||||
aanot["obimultiplex_direction"] = direction
|
aanot["obimultiplex_direction"] = direction
|
||||||
|
|
||||||
aanot["obimultiplex_forward_match"] = forward_match
|
aanot["obimultiplex_forward_match"] = forward_match
|
||||||
aanot["obimultiplex_forward_mismatches"] = forward_mismatches
|
aanot["obimultiplex_forward_error"] = forward_mismatches
|
||||||
|
|
||||||
aanot["obimultiplex_reverse_match"] = reverse_match
|
aanot["obimultiplex_reverse_match"] = reverse_match
|
||||||
aanot["obimultiplex_reverse_mismatches"] = reverse_mismatches
|
aanot["obimultiplex_reverse_error"] = reverse_mismatches
|
||||||
|
|
||||||
aanot["sample"] = sample
|
aanot["sample"] = sample
|
||||||
aanot["experiment"] = experiment
|
aanot["experiment"] = experiment
|
||||||
@@ -125,10 +125,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
|
|||||||
banot["obimultiplex_direction"] = direction
|
banot["obimultiplex_direction"] = direction
|
||||||
|
|
||||||
banot["obimultiplex_forward_match"] = forward_match
|
banot["obimultiplex_forward_match"] = forward_match
|
||||||
banot["obimultiplex_forward_mismatches"] = forward_mismatches
|
banot["obimultiplex_forward_error"] = forward_mismatches
|
||||||
|
|
||||||
banot["obimultiplex_reverse_match"] = reverse_match
|
banot["obimultiplex_reverse_match"] = reverse_match
|
||||||
banot["obimultiplex_reverse_mismatches"] = reverse_mismatches
|
banot["obimultiplex_reverse_error"] = reverse_mismatches
|
||||||
|
|
||||||
banot["sample"] = sample
|
banot["sample"] = sample
|
||||||
banot["experiment"] = experiment
|
banot["experiment"] = experiment
|
||||||
|
|||||||
@@ -276,6 +276,44 @@ func InterfaceToStringMap(i interface{}) (val map[string]string, err error) {
|
|||||||
return
|
return
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func InterfaceToMapOfIntSlice(i interface{}) (val map[string][]int, err error) {
|
||||||
|
err = nil
|
||||||
|
switch m := i.(type) {
|
||||||
|
case map[string][]int:
|
||||||
|
val = m
|
||||||
|
case map[string]interface{}:
|
||||||
|
val = make(map[string][]int, len(m))
|
||||||
|
for k, v := range m {
|
||||||
|
val[k], err = InterfaceToIntSlice(v)
|
||||||
|
if err != nil {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
}
|
||||||
|
default:
|
||||||
|
err = &NotAMapInt{"value attribute cannot be casted to a map[string][]int"}
|
||||||
|
}
|
||||||
|
return
|
||||||
|
}
|
||||||
|
|
||||||
|
func InterfaceToMapOfStringSlice(i interface{}) (val map[string][]string, err error) {
|
||||||
|
err = nil
|
||||||
|
switch m := i.(type) {
|
||||||
|
case map[string][]string:
|
||||||
|
val = m
|
||||||
|
case map[string]interface{}:
|
||||||
|
val = make(map[string][]string, len(m))
|
||||||
|
for k, v := range m {
|
||||||
|
val[k], err = InterfaceToStringSlice(v)
|
||||||
|
if err != nil {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
}
|
||||||
|
default:
|
||||||
|
err = &NotAMapInt{"value attribute cannot be casted to a map[string][]string"}
|
||||||
|
}
|
||||||
|
return
|
||||||
|
}
|
||||||
|
|
||||||
func InterfaceToStringSlice(i interface{}) (val []string, err error) {
|
func InterfaceToStringSlice(i interface{}) (val []string, err error) {
|
||||||
err = nil
|
err = nil
|
||||||
|
|
||||||
|
|||||||
@@ -0,0 +1,85 @@
|
|||||||
|
package obiutils
|
||||||
|
|
||||||
|
import (
|
||||||
|
"fmt"
|
||||||
|
"strconv"
|
||||||
|
"strings"
|
||||||
|
"unicode"
|
||||||
|
)
|
||||||
|
|
||||||
|
// ParseMemSize parses a human-readable memory size string and returns the
|
||||||
|
// equivalent number of bytes. The value is a number optionally followed by a
|
||||||
|
// unit suffix (case-insensitive):
|
||||||
|
//
|
||||||
|
// B or (no suffix) — bytes
|
||||||
|
// K or KB — kibibytes (1 024)
|
||||||
|
// M or MB — mebibytes (1 048 576)
|
||||||
|
// G or GB — gibibytes (1 073 741 824)
|
||||||
|
// T or TB — tebibytes (1 099 511 627 776)
|
||||||
|
//
|
||||||
|
// Examples: "512", "128K", "128k", "64M", "1G", "2GB"
|
||||||
|
func ParseMemSize(s string) (int, error) {
|
||||||
|
s = strings.TrimSpace(s)
|
||||||
|
if s == "" {
|
||||||
|
return 0, fmt.Errorf("empty memory size string")
|
||||||
|
}
|
||||||
|
|
||||||
|
// split numeric prefix from unit suffix
|
||||||
|
i := 0
|
||||||
|
for i < len(s) && (unicode.IsDigit(rune(s[i])) || s[i] == '.') {
|
||||||
|
i++
|
||||||
|
}
|
||||||
|
numStr := s[:i]
|
||||||
|
unit := strings.ToUpper(strings.TrimSpace(s[i:]))
|
||||||
|
// strip trailing 'B' from two-letter units (KB→K, MB→M …)
|
||||||
|
if len(unit) == 2 && unit[1] == 'B' {
|
||||||
|
unit = unit[:1]
|
||||||
|
}
|
||||||
|
|
||||||
|
val, err := strconv.ParseFloat(numStr, 64)
|
||||||
|
if err != nil {
|
||||||
|
return 0, fmt.Errorf("invalid memory size %q: %w", s, err)
|
||||||
|
}
|
||||||
|
|
||||||
|
var multiplier float64
|
||||||
|
switch unit {
|
||||||
|
case "", "B":
|
||||||
|
multiplier = 1
|
||||||
|
case "K":
|
||||||
|
multiplier = 1024
|
||||||
|
case "M":
|
||||||
|
multiplier = 1024 * 1024
|
||||||
|
case "G":
|
||||||
|
multiplier = 1024 * 1024 * 1024
|
||||||
|
case "T":
|
||||||
|
multiplier = 1024 * 1024 * 1024 * 1024
|
||||||
|
default:
|
||||||
|
return 0, fmt.Errorf("unknown memory unit %q in %q", unit, s)
|
||||||
|
}
|
||||||
|
|
||||||
|
return int(val * multiplier), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// FormatMemSize formats a byte count as a human-readable string with the
|
||||||
|
// largest unit that produces a value ≥ 1 (e.g. 1536 → "1.5K").
|
||||||
|
func FormatMemSize(n int) string {
|
||||||
|
units := []struct {
|
||||||
|
suffix string
|
||||||
|
size int
|
||||||
|
}{
|
||||||
|
{"T", 1024 * 1024 * 1024 * 1024},
|
||||||
|
{"G", 1024 * 1024 * 1024},
|
||||||
|
{"M", 1024 * 1024},
|
||||||
|
{"K", 1024},
|
||||||
|
}
|
||||||
|
for _, u := range units {
|
||||||
|
if n >= u.size {
|
||||||
|
v := float64(n) / float64(u.size)
|
||||||
|
if v == float64(int(v)) {
|
||||||
|
return fmt.Sprintf("%d%s", int(v), u.suffix)
|
||||||
|
}
|
||||||
|
return fmt.Sprintf("%.1f%s", v, u.suffix)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return fmt.Sprintf("%dB", n)
|
||||||
|
}
|
||||||
+365
-4
@@ -34,6 +34,26 @@ func MinMaxSlice[T constraints.Ordered](vec []T) (min, max T) {
|
|||||||
return
|
return
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func FilterMinSlice[T constraints.Ordered](vec []T, minimum T) []T {
|
||||||
|
result := make([]T, 0, len(vec))
|
||||||
|
for _, v := range vec {
|
||||||
|
if v >= minimum {
|
||||||
|
result = append(result, v)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
|
func FilterMaxSlice[T constraints.Ordered](vec []T, maximum T) []T {
|
||||||
|
result := make([]T, 0, len(vec))
|
||||||
|
for _, v := range vec {
|
||||||
|
if v <= maximum {
|
||||||
|
result = append(result, v)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
func MaxMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
|
func MaxMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
|
||||||
var maxKey K
|
var maxKey K
|
||||||
var maxValue T
|
var maxValue T
|
||||||
@@ -73,6 +93,46 @@ func MinMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
|
|||||||
return minKey, minValue, nil
|
return minKey, minValue, nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func FilterMinMap[K comparable, T constraints.Ordered](values map[K]T, minimum T) map[K]T {
|
||||||
|
result := make(map[K]T)
|
||||||
|
for k, v := range values {
|
||||||
|
if v >= minimum {
|
||||||
|
result[k] = v
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
|
func FilterMaxMap[K comparable, T constraints.Ordered](values map[K]T, maximum T) map[K]T {
|
||||||
|
result := make(map[K]T)
|
||||||
|
for k, v := range values {
|
||||||
|
if v <= maximum {
|
||||||
|
result[k] = v
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
|
func SaturatingSubSlice[T Numeric](vec []T, sub T) []T {
|
||||||
|
result := make([]T, len(vec))
|
||||||
|
for i, v := range vec {
|
||||||
|
if v > sub {
|
||||||
|
result[i] = v - sub
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
|
func SaturatingSubMap[K comparable, T Numeric](values map[K]T, sub T) map[K]T {
|
||||||
|
result := make(map[K]T)
|
||||||
|
for k, v := range values {
|
||||||
|
if v > sub {
|
||||||
|
result[k] = v - sub
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
// Min returns the smallest element in a slice/array or map,
|
// Min returns the smallest element in a slice/array or map,
|
||||||
// or the value itself if data is a single comparable value.
|
// or the value itself if data is a single comparable value.
|
||||||
// Returns an error if the container is empty or the type is unsupported.
|
// Returns an error if the container is empty or the type is unsupported.
|
||||||
@@ -135,11 +195,121 @@ func Max(data interface{}) (interface{}, error) {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func FilterMin(data interface{}, minimum interface{}) (interface{}, error) {
|
||||||
|
v := reflect.ValueOf(data)
|
||||||
|
switch v.Kind() {
|
||||||
|
case reflect.Slice, reflect.Array:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty slice or array")
|
||||||
|
}
|
||||||
|
return filterMinFromIterable(v, minimum)
|
||||||
|
case reflect.Map:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty map")
|
||||||
|
}
|
||||||
|
return filterMinFromMap(v, minimum)
|
||||||
|
default:
|
||||||
|
if !isOrderedKind(v.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||||
|
}
|
||||||
|
return data, nil
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func FilterMax(data interface{}, maximum interface{}) (interface{}, error) {
|
||||||
|
v := reflect.ValueOf(data)
|
||||||
|
switch v.Kind() {
|
||||||
|
case reflect.Slice, reflect.Array:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty slice or array")
|
||||||
|
}
|
||||||
|
return filterMaxFromIterable(v, maximum)
|
||||||
|
case reflect.Map:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty map")
|
||||||
|
}
|
||||||
|
return filterMaxFromMap(v, maximum)
|
||||||
|
default:
|
||||||
|
if !isOrderedKind(v.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||||
|
}
|
||||||
|
return data, nil
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func SaturatingSub(data interface{}, sub interface{}) (interface{}, error) {
|
||||||
|
v := reflect.ValueOf(data)
|
||||||
|
switch v.Kind() {
|
||||||
|
case reflect.Slice, reflect.Array:
|
||||||
|
return saturatingSubFromIterable(v, sub)
|
||||||
|
case reflect.Map:
|
||||||
|
return saturatingSubFromMap(v, sub)
|
||||||
|
default:
|
||||||
|
if !isNumericKind(v.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||||
|
}
|
||||||
|
r, err := saturatingSubValues(v, reflect.ValueOf(sub))
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
return r.Interface(), nil
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func saturatingSubFromIterable(v reflect.Value, sub interface{}) (interface{}, error) {
|
||||||
|
subVal := reflect.ValueOf(sub)
|
||||||
|
result := reflect.MakeSlice(v.Type(), v.Len(), v.Len())
|
||||||
|
for i := 0; i < v.Len(); i++ {
|
||||||
|
r, err := saturatingSubValues(v.Index(i), subVal)
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
result.Index(i).Set(r)
|
||||||
|
}
|
||||||
|
return result.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func saturatingSubFromMap(v reflect.Value, sub interface{}) (interface{}, error) {
|
||||||
|
subVal := reflect.ValueOf(sub)
|
||||||
|
result := reflect.MakeMap(v.Type())
|
||||||
|
for _, key := range v.MapKeys() {
|
||||||
|
r, err := saturatingSubValues(v.MapIndex(key), subVal)
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
if !r.IsZero() {
|
||||||
|
result.SetMapIndex(key, r)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func saturatingSubValues(a, b reflect.Value) (reflect.Value, error) {
|
||||||
|
result := reflect.New(a.Type()).Elem()
|
||||||
|
switch a.Kind() {
|
||||||
|
case reflect.Int, reflect.Int8, reflect.Int16, reflect.Int32, reflect.Int64:
|
||||||
|
if av, bv := a.Int(), b.Int(); av > bv {
|
||||||
|
result.SetInt(av - bv)
|
||||||
|
}
|
||||||
|
case reflect.Uint, reflect.Uint8, reflect.Uint16, reflect.Uint32, reflect.Uint64:
|
||||||
|
if av, bv := a.Uint(), b.Uint(); av > bv {
|
||||||
|
result.SetUint(av - bv)
|
||||||
|
}
|
||||||
|
case reflect.Float32, reflect.Float64:
|
||||||
|
if av, bv := a.Float(), b.Float(); av > bv {
|
||||||
|
result.SetFloat(av - bv)
|
||||||
|
}
|
||||||
|
default:
|
||||||
|
return reflect.Value{}, fmt.Errorf("unsupported type for saturating subtraction: %s", a.Kind())
|
||||||
|
}
|
||||||
|
return result, nil
|
||||||
|
}
|
||||||
|
|
||||||
// maxFromIterable scans a slice/array to find the maximum.
|
// maxFromIterable scans a slice/array to find the maximum.
|
||||||
func maxFromIterable(v reflect.Value) (interface{}, error) {
|
func maxFromIterable(v reflect.Value) (interface{}, error) {
|
||||||
var best reflect.Value
|
var best reflect.Value
|
||||||
for i := 0; i < v.Len(); i++ {
|
for i := 0; i < v.Len(); i++ {
|
||||||
elem := v.Index(i)
|
elem := unwrapInterface(v.Index(i))
|
||||||
if !isOrderedKind(elem.Kind()) {
|
if !isOrderedKind(elem.Kind()) {
|
||||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
}
|
}
|
||||||
@@ -154,7 +324,7 @@ func maxFromIterable(v reflect.Value) (interface{}, error) {
|
|||||||
func minFromIterable(v reflect.Value) (interface{}, error) {
|
func minFromIterable(v reflect.Value) (interface{}, error) {
|
||||||
var minVal reflect.Value
|
var minVal reflect.Value
|
||||||
for i := 0; i < v.Len(); i++ {
|
for i := 0; i < v.Len(); i++ {
|
||||||
elem := v.Index(i)
|
elem := unwrapInterface(v.Index(i))
|
||||||
if !isOrderedKind(elem.Kind()) {
|
if !isOrderedKind(elem.Kind()) {
|
||||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
}
|
}
|
||||||
@@ -165,12 +335,182 @@ func minFromIterable(v reflect.Value) (interface{}, error) {
|
|||||||
return minVal.Interface(), nil
|
return minVal.Interface(), nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func filterMinFromIterable(v reflect.Value, minimum interface{}) (interface{}, error) {
|
||||||
|
minVal := reflect.ValueOf(minimum)
|
||||||
|
result := reflect.MakeSlice(v.Type(), 0, v.Len())
|
||||||
|
for i := 0; i < v.Len(); i++ {
|
||||||
|
elem := unwrapInterface(v.Index(i))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if !less(elem, minVal) { // elem >= minimum
|
||||||
|
result = reflect.Append(result, elem)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func filterMaxFromIterable(v reflect.Value, maximum interface{}) (interface{}, error) {
|
||||||
|
maxVal := reflect.ValueOf(maximum)
|
||||||
|
result := reflect.MakeSlice(v.Type(), 0, v.Len())
|
||||||
|
for i := 0; i < v.Len(); i++ {
|
||||||
|
elem := unwrapInterface(v.Index(i))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if !greater(elem, maxVal) { // elem <= maximum
|
||||||
|
result = reflect.Append(result, elem)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// whichMaxFromIterable returns the index of the maximum element in a slice/array.
|
||||||
|
func whichMaxFromIterable(v reflect.Value) (int, error) {
|
||||||
|
var best reflect.Value
|
||||||
|
bestIdx := 0
|
||||||
|
for i := 0; i < v.Len(); i++ {
|
||||||
|
elem := unwrapInterface(v.Index(i))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if i == 0 || greater(elem, best) {
|
||||||
|
best = elem
|
||||||
|
bestIdx = i
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return bestIdx, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// whichMinFromIterable returns the index of the minimum element in a slice/array.
|
||||||
|
func whichMinFromIterable(v reflect.Value) (int, error) {
|
||||||
|
var minVal reflect.Value
|
||||||
|
minIdx := 0
|
||||||
|
for i := 0; i < v.Len(); i++ {
|
||||||
|
elem := unwrapInterface(v.Index(i))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if i == 0 || less(elem, minVal) {
|
||||||
|
minVal = elem
|
||||||
|
minIdx = i
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return minIdx, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// whichMaxFromMap returns the key associated with the maximum value in a map.
|
||||||
|
func whichMaxFromMap(v reflect.Value) (interface{}, error) {
|
||||||
|
var best reflect.Value
|
||||||
|
var bestKey reflect.Value
|
||||||
|
first := true
|
||||||
|
for _, key := range v.MapKeys() {
|
||||||
|
elem := unwrapInterface(v.MapIndex(key))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if first || greater(elem, best) {
|
||||||
|
best = elem
|
||||||
|
bestKey = key
|
||||||
|
first = false
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return bestKey.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// whichMinFromMap returns the key associated with the minimum value in a map.
|
||||||
|
func whichMinFromMap(v reflect.Value) (interface{}, error) {
|
||||||
|
var minVal reflect.Value
|
||||||
|
var minKey reflect.Value
|
||||||
|
first := true
|
||||||
|
for _, key := range v.MapKeys() {
|
||||||
|
elem := unwrapInterface(v.MapIndex(key))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if first || less(elem, minVal) {
|
||||||
|
minVal = elem
|
||||||
|
minKey = key
|
||||||
|
first = false
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return minKey.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// WhichMax returns the key (for a map) or index (for a slice/array) of the maximum value.
|
||||||
|
func WhichMax(data interface{}) (interface{}, error) {
|
||||||
|
v := reflect.ValueOf(data)
|
||||||
|
switch v.Kind() {
|
||||||
|
case reflect.Slice, reflect.Array:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty slice or array")
|
||||||
|
}
|
||||||
|
return whichMaxFromIterable(v)
|
||||||
|
case reflect.Map:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty map")
|
||||||
|
}
|
||||||
|
return whichMaxFromMap(v)
|
||||||
|
default:
|
||||||
|
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// WhichMin returns the key (for a map) or index (for a slice/array) of the minimum value.
|
||||||
|
func WhichMin(data interface{}) (interface{}, error) {
|
||||||
|
v := reflect.ValueOf(data)
|
||||||
|
switch v.Kind() {
|
||||||
|
case reflect.Slice, reflect.Array:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty slice or array")
|
||||||
|
}
|
||||||
|
return whichMinFromIterable(v)
|
||||||
|
case reflect.Map:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty map")
|
||||||
|
}
|
||||||
|
return whichMinFromMap(v)
|
||||||
|
default:
|
||||||
|
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func filterMinFromMap(v reflect.Value, minimum interface{}) (interface{}, error) {
|
||||||
|
minVal := reflect.ValueOf(minimum)
|
||||||
|
result := reflect.MakeMap(v.Type())
|
||||||
|
for _, key := range v.MapKeys() {
|
||||||
|
elem := unwrapInterface(v.MapIndex(key))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if !less(elem, minVal) { // elem >= minimum
|
||||||
|
result.SetMapIndex(key, elem)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func filterMaxFromMap(v reflect.Value, maximum interface{}) (interface{}, error) {
|
||||||
|
maxVal := reflect.ValueOf(maximum)
|
||||||
|
result := reflect.MakeMap(v.Type())
|
||||||
|
for _, key := range v.MapKeys() {
|
||||||
|
elem := unwrapInterface(v.MapIndex(key))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if !greater(elem, maxVal) { // elem <= maximum
|
||||||
|
result.SetMapIndex(key, elem)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
// maxFromMap scans map values to find the maximum.
|
// maxFromMap scans map values to find the maximum.
|
||||||
func maxFromMap(v reflect.Value) (interface{}, error) {
|
func maxFromMap(v reflect.Value) (interface{}, error) {
|
||||||
var best reflect.Value
|
var best reflect.Value
|
||||||
first := true
|
first := true
|
||||||
for _, key := range v.MapKeys() {
|
for _, key := range v.MapKeys() {
|
||||||
elem := v.MapIndex(key)
|
elem := unwrapInterface(v.MapIndex(key))
|
||||||
if !isOrderedKind(elem.Kind()) {
|
if !isOrderedKind(elem.Kind()) {
|
||||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
}
|
}
|
||||||
@@ -187,7 +527,7 @@ func minFromMap(v reflect.Value) (interface{}, error) {
|
|||||||
var minVal reflect.Value
|
var minVal reflect.Value
|
||||||
first := true
|
first := true
|
||||||
for _, key := range v.MapKeys() {
|
for _, key := range v.MapKeys() {
|
||||||
elem := v.MapIndex(key)
|
elem := unwrapInterface(v.MapIndex(key))
|
||||||
if !isOrderedKind(elem.Kind()) {
|
if !isOrderedKind(elem.Kind()) {
|
||||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
}
|
}
|
||||||
@@ -199,6 +539,27 @@ func minFromMap(v reflect.Value) (interface{}, error) {
|
|||||||
return minVal.Interface(), nil
|
return minVal.Interface(), nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func isNumericKind(k reflect.Kind) bool {
|
||||||
|
switch k {
|
||||||
|
case reflect.Int, reflect.Int8, reflect.Int16, reflect.Int32, reflect.Int64,
|
||||||
|
reflect.Uint, reflect.Uint8, reflect.Uint16, reflect.Uint32, reflect.Uint64,
|
||||||
|
reflect.Float32, reflect.Float64:
|
||||||
|
return true
|
||||||
|
default:
|
||||||
|
return false
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// unwrapInterface returns v.Elem() when v holds an interface value, otherwise v unchanged.
|
||||||
|
// This is necessary when iterating map[string]interface{} or []interface{} via reflection:
|
||||||
|
// the element Kind is reflect.Interface, not the underlying concrete type.
|
||||||
|
func unwrapInterface(v reflect.Value) reflect.Value {
|
||||||
|
if v.Kind() == reflect.Interface {
|
||||||
|
return v.Elem()
|
||||||
|
}
|
||||||
|
return v
|
||||||
|
}
|
||||||
|
|
||||||
// isOrderedKind reports whether k supports comparison ordering.
|
// isOrderedKind reports whether k supports comparison ordering.
|
||||||
func isOrderedKind(k reflect.Kind) bool {
|
func isOrderedKind(k reflect.Kind) bool {
|
||||||
switch k {
|
switch k {
|
||||||
|
|||||||
+15
-1
@@ -144,7 +144,7 @@ func (r *AsciiSet) TrimLeft(s string) string {
|
|||||||
return s[i:]
|
return s[i:]
|
||||||
}
|
}
|
||||||
|
|
||||||
func SplitInTwo(s string, sep byte) (string, string) {
|
func LeftSplitInTwo(s string, sep byte) (string, string) {
|
||||||
i := 0
|
i := 0
|
||||||
for ; i < len(s); i++ {
|
for ; i < len(s); i++ {
|
||||||
c := s[i]
|
c := s[i]
|
||||||
@@ -157,3 +157,17 @@ func SplitInTwo(s string, sep byte) (string, string) {
|
|||||||
}
|
}
|
||||||
return s[:i], s[i+1:]
|
return s[:i], s[i+1:]
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func RightSplitInTwo(s string, sep byte) (string, string) {
|
||||||
|
i := len(s) - 1
|
||||||
|
for ; i >= 0; i-- {
|
||||||
|
c := s[i]
|
||||||
|
if c == sep {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if i == len(s) {
|
||||||
|
return s, ""
|
||||||
|
}
|
||||||
|
return s[:i], s[i+1:]
|
||||||
|
}
|
||||||
|
|||||||
@@ -0,0 +1,302 @@
|
|||||||
|
# Objective
|
||||||
|
|
||||||
|
Fully document OBITools (version 4, written in Go) in English, using a 4‑phase incremental pipeline.
|
||||||
|
|
||||||
|
You **MUST** use the available MCP servers:
|
||||||
|
|
||||||
|
- `cclsp` – exact definitions, references, diagnostics
|
||||||
|
- `jcodemunch` – code indexing, symbol extraction
|
||||||
|
- `treesitter` – AST and CLI parsing
|
||||||
|
- `context7` – external documentation
|
||||||
|
|
||||||
|
All tool calls must follow the exact API described in the MCP server documentation. If a required tool is unavailable, you **MUST** log the error and stop execution.
|
||||||
|
|
||||||
|
### Tool call format (CRITICAL)
|
||||||
|
|
||||||
|
Tool calls **MUST** use this exact XML format — no spaces inside the angle brackets:
|
||||||
|
|
||||||
|
```
|
||||||
|
<function=tool_name>
|
||||||
|
{"param": "value"}
|
||||||
|
</function>
|
||||||
|
```
|
||||||
|
|
||||||
|
**FORBIDDEN** — these variants will cause parse errors and must NEVER be used:
|
||||||
|
- `< function=tool_name >` (spaces around the tag name)
|
||||||
|
- `< function = tool_name>` (spaces around `=`)
|
||||||
|
- `<function = tool_name>` (space before `=`)
|
||||||
|
|
||||||
|
The opening tag is `<function=tool_name>` with **zero spaces** inside `<` and `>`.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Global rules
|
||||||
|
|
||||||
|
** You are not allowed to read twice the same file in a row. **
|
||||||
|
|
||||||
|
## Language
|
||||||
|
|
||||||
|
- All generated documentation **MUST** be in English.
|
||||||
|
- If an existing documentation file is in French:
|
||||||
|
1. Translate it to English
|
||||||
|
2. Save the original as `.fr.md` **before** overwriting
|
||||||
|
3. Write the new English version
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Execution mode (STRICT)
|
||||||
|
|
||||||
|
You are operating in **STRICT TOOL MODE**:
|
||||||
|
|
||||||
|
- If a file must be written, you **MUST** use the `Shell` tool.
|
||||||
|
- You **MUST NOT** read entire directory listings into memory.
|
||||||
|
- You **MUST** work with **one item at a time** using a simple text file as a task queue.
|
||||||
|
|
||||||
|
### Reading files before writing
|
||||||
|
|
||||||
|
- **Before writing to an existing documentation file**, you must first read it using the `Read` tool.
|
||||||
|
- **When documenting a single Go source file**, you only need to read that one file (plus up to 4-5 helper files if needed for context).
|
||||||
|
- Do NOT read the entire codebase - only what is necessary to document the current file.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
### Rules
|
||||||
|
|
||||||
|
- Always write the **full** file (no partial updates).
|
||||||
|
- Paths are relative to the project root; directories are created implicitly.
|
||||||
|
- Content must be valid UTF‑8; use `\n` line endings.
|
||||||
|
- Do **not** wrap content in backticks.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Progress tracking: task queue files
|
||||||
|
|
||||||
|
We use **line‑oriented task files** to avoid loading large lists into memory. Each phase has its own task file:
|
||||||
|
|
||||||
|
- `docs/todo/phase1.txt` – list of Go files (one per line) to document.
|
||||||
|
- `docs/todo/phase1bis.txt` – same list, but after phase1 is done.
|
||||||
|
- `docs/todo/phase2.txt` – list of packages.
|
||||||
|
- `docs/todo/phase3.txt` – list of tools.
|
||||||
|
|
||||||
|
**How it works:**
|
||||||
|
|
||||||
|
1. At the start of a phase, if the task file does not exist, it is created by scanning the codebase once (Phase 0 or Phase X init).
|
||||||
|
2. **Each run of the LLM processes only the first line of the task file.**
|
||||||
|
3. After processing the item (success or permanent failure), the line is removed from the task file.
|
||||||
|
- On success, the line is deleted (no extra sentinel file needed).
|
||||||
|
- On transient failure (retry < 3), we keep the line but increment a retry counter stored in a separate file.
|
||||||
|
- On permanent failure (retry ≥ 3), we move the line to a `failed.txt` file and log the error.
|
||||||
|
4. The LLM then exits (or continues if the task file is still non‑empty, but it must never load more than one line).
|
||||||
|
|
||||||
|
This way, the LLM’s context never holds more than a single task at a time.
|
||||||
|
|
||||||
|
### Retry mechanism
|
||||||
|
|
||||||
|
For each item (e.g., `internal/align/align.go`), we maintain a retry counter in:
|
||||||
|
|
||||||
|
- `docs/retry/phase1/internal/align/align.go.count`
|
||||||
|
|
||||||
|
If the file does not exist, retries = 0.
|
||||||
|
Each time processing fails, we increment the counter (write the new number).
|
||||||
|
If after increment the counter < 3, we keep the line in the task file.
|
||||||
|
If counter reaches 3, we **remove the line from the task file**, add it to `docs/failed/phase1/internal/align/align.go.failed` (just a marker), and log the error.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Documentation quality requirements (CRITICAL)
|
||||||
|
|
||||||
|
Documentation MUST NOT be superficial. For each documented element (file, function, struct, package):
|
||||||
|
|
||||||
|
### You MUST explain:
|
||||||
|
|
||||||
|
- what it does
|
||||||
|
- why it exists (context, problem solved)
|
||||||
|
- how it is used
|
||||||
|
- assumptions and preconditions
|
||||||
|
- possible edge cases
|
||||||
|
|
||||||
|
### Forbidden patterns
|
||||||
|
|
||||||
|
- Vague phrases like “This function handles…”, “Utility for…”, “Helper function…”.
|
||||||
|
- Generic descriptions that could apply to any project.
|
||||||
|
|
||||||
|
### Required content per element type
|
||||||
|
|
||||||
|
- Functions:
|
||||||
|
- Purpose
|
||||||
|
- Parameter meaning
|
||||||
|
- Return values
|
||||||
|
- Notable behaviour (panic conditions, side effects, concurrency)
|
||||||
|
- Structs:
|
||||||
|
- Role in the system
|
||||||
|
- Meaning of key fields
|
||||||
|
- Files:
|
||||||
|
- Role within the package
|
||||||
|
- Interactions with other files
|
||||||
|
|
||||||
|
### Anti‑generic rule
|
||||||
|
|
||||||
|
If the description could apply to any project, it is INVALID. You MUST include domain‑specific context (bioinformatics, sequence processing, etc.) and concrete behaviour.
|
||||||
|
|
||||||
|
### Quality validation
|
||||||
|
|
||||||
|
Before marking an item as done (i.e., creating the .done sentinel), you MUST perform a self‑validation:
|
||||||
|
|
||||||
|
- Check that all required sections are present.
|
||||||
|
- Verify that no forbidden patterns remain.
|
||||||
|
|
||||||
|
If validation fails, increment the retry counter and keep the item pending.
|
||||||
|
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Directory structure
|
||||||
|
|
||||||
|
```
|
||||||
|
docs/
|
||||||
|
todo/ # task queues
|
||||||
|
phase1.txt
|
||||||
|
phase1bis.txt
|
||||||
|
phase2.txt
|
||||||
|
phase3.txt
|
||||||
|
retry/ # retry counters
|
||||||
|
phase1/ # mirrors file structure
|
||||||
|
internal/align/align.go.count
|
||||||
|
phase1bis/
|
||||||
|
phase2/
|
||||||
|
phase3/
|
||||||
|
failed/ # permanent failure markers
|
||||||
|
phase1/
|
||||||
|
internal/align/align.go.failed
|
||||||
|
phase1bis/
|
||||||
|
phase2/
|
||||||
|
phase3/
|
||||||
|
phase1/ # actual documentation
|
||||||
|
<relative_path>/<file>.go.md
|
||||||
|
phase2/
|
||||||
|
<package>.md
|
||||||
|
phase3/
|
||||||
|
<tool>.md
|
||||||
|
error.log
|
||||||
|
```
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Phase 0: Initialization
|
||||||
|
|
||||||
|
1. Ensure required directories exist: `docs/todo`, `docs/retry`, `docs/failed`, `docs/phase1`, `docs/phase2`, `docs/phase3`.
|
||||||
|
2. **If `docs/todo/phase1.txt` does not exist**:
|
||||||
|
- Use `find pkg -name "*.go" ! -name "*_test.go" ! -path "*/cmd/*"` to list all Go files (excluding tests and main.go).
|
||||||
|
- Write the list (one relative path per line, e.g., `internal/align/align.go`) to `docs/todo/phase1.txt`.
|
||||||
|
3. Do the same for phase2 and phase3 later when those phases start.
|
||||||
|
4. **No other state is stored.**
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Phase 1: File documentation
|
||||||
|
|
||||||
|
**Processing rule:**
|
||||||
|
- Read the **first line** of `docs/todo/phase1.txt` (using `head -n 1`).
|
||||||
|
- If the file is empty, Phase 1 is complete → proceed to Phase 1bis initialization.
|
||||||
|
- Otherwise, process that single file.
|
||||||
|
|
||||||
|
**Processing a file:**
|
||||||
|
|
||||||
|
1. Let `relpath` be the line content (e.g., `internal/align/align.go`).
|
||||||
|
2. Check if a permanent failure marker exists at `docs/failed/phase1/${relpath}.failed`. If yes, remove the line from the task file and skip (line will be deleted).
|
||||||
|
3. If the documentation file `docs/phase1/${relpath}.go.md` exists go directly to its validation (step 6).
|
||||||
|
4. Otherwise, generate documentation for that file (using MCP tools as before).
|
||||||
|
5. Write the documentation to `docs/phase1/${relpath}.go.md`.
|
||||||
|
6. Validate quality.
|
||||||
|
7. If validation succeeds:
|
||||||
|
- Remove the line from the task file.
|
||||||
|
- Remove any retry counter file for this item.
|
||||||
|
- (No sentinel needed; the removal from todo indicates completion.)
|
||||||
|
8. If validation fails:
|
||||||
|
- Increment retry counter:
|
||||||
|
- If `docs/retry/phase1/${relpath}.count` does not exist, set to 1.
|
||||||
|
- Else read it, add 1, write back.
|
||||||
|
- If new counter >= 3:
|
||||||
|
- Remove line from task file.
|
||||||
|
- Create `docs/failed/phase1/${relpath}.failed`.
|
||||||
|
- Log error.
|
||||||
|
- If new counter < 3:
|
||||||
|
- Keep the line in the task file (do nothing, it stays as first line for next run).
|
||||||
|
9. **Exit** (or stop if this was a single run). The next invocation will read the first line again (same if retry, or next if removed).
|
||||||
|
|
||||||
|
**Important:**
|
||||||
|
- Do **not** read more than one line.
|
||||||
|
- Do **not** attempt to process multiple items in one run.
|
||||||
|
- The LLM should finish after handling one item.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Phase 1bis: Review and harmonization
|
||||||
|
|
||||||
|
When Phase 1 is complete (i.e., `docs/todo/phase1.txt` empty), we initialize `docs/todo/phase1bis.txt` with the same list of files (the ones that succeeded).
|
||||||
|
But note: we need to know which files were successfully documented. Since we removed lines from `phase1.txt` on success, we need a record. The simplest is to reuse the same list but we can generate it by listing the existing `.go.md` files in `docs/phase1/` (since every successful file has a `.go.md`).
|
||||||
|
Thus, Phase 1bis initialization:
|
||||||
|
|
||||||
|
- If `docs/todo/phase1bis.txt` does not exist, create it by listing all `.go.md` files under `docs/phase1/`, stripping the `docs/phase1/` prefix and the `.go.md` suffix, and writing the relative path (same format as phase1).
|
||||||
|
|
||||||
|
Then processing is identical to Phase 1, but using `docs/todo/phase1bis.txt` and output is overwriting the same `.go.md` files (with improvements). Retry counters go in `docs/retry/phase1bis/`.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Phase 2: Package documentation
|
||||||
|
|
||||||
|
When Phase 1bis is complete (`docs/todo/phase1bis.txt` empty), initialize `docs/todo/phase2.txt`:
|
||||||
|
|
||||||
|
- List all packages: unique directories under `pkg/` that contain at least one `.go` file and are not tools.
|
||||||
|
- Write each package identifier (e.g., `align`, `internal/align`) as a line.
|
||||||
|
|
||||||
|
Processing: read first line, generate `docs/phase2/<package>.md`, validate, remove line on success, retry logic in `docs/retry/phase2/`.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Phase 3: Tool documentation
|
||||||
|
|
||||||
|
When Phase 2 complete, initialize `docs/todo/phase3.txt`:
|
||||||
|
|
||||||
|
- List all directories under `cmd/` that contain a `main.go`. Write each tool name as a line.
|
||||||
|
|
||||||
|
Processing: read first line, generate `docs/phase3/<tool>.md`, validate, remove line on success, retry logic in `docs/retry/phase3/`.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Finalization
|
||||||
|
|
||||||
|
When all task files are empty and no pending phases, generate `docs/README.md` by:
|
||||||
|
|
||||||
|
- Listing all package docs (files in `docs/phase2/`) and linking.
|
||||||
|
- Listing all tool docs (files in `docs/phase3/`) and linking.
|
||||||
|
|
||||||
|
Write using `Shell`.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Execution flow summary
|
||||||
|
|
||||||
|
1. **Phase 0**: Create directories and initial `todo/phase1.txt` if missing. Exit.
|
||||||
|
2. **Phase 1**:
|
||||||
|
- If `todo/phase1.txt` exists and non‑empty → process first line.
|
||||||
|
- Else → move to Phase 1bis initialization.
|
||||||
|
3. **Phase 1bis**:
|
||||||
|
- If `todo/phase1bis.txt` does not exist → create from successful phase1 docs.
|
||||||
|
- If non‑empty → process first line.
|
||||||
|
- Else → move to Phase 2 initialization.
|
||||||
|
4. **Phase 2**: similar.
|
||||||
|
5. **Phase 3**: similar.
|
||||||
|
6. **Finalization**: generate README.
|
||||||
|
|
||||||
|
The LLM should be invoked repeatedly (e.g., by a scheduler) until all phases are done. Each invocation processes exactly one item.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Important reminders
|
||||||
|
|
||||||
|
- Always call `Shell` to write files; never output content in plain text.
|
||||||
|
- Validate quality before removing a line from the task file.
|
||||||
|
- Log all failures to `docs/error.log` in JSON lines format.
|
||||||
|
- If any MCP tool fails, treat as failure and increment retry counter.
|
||||||
|
- Never read more than one line from a task file in a single run.
|
||||||
@@ -0,0 +1,222 @@
|
|||||||
|
//go:build ignore
|
||||||
|
|
||||||
|
package main
|
||||||
|
|
||||||
|
import (
|
||||||
|
"encoding/json"
|
||||||
|
"fmt"
|
||||||
|
"os"
|
||||||
|
"os/exec"
|
||||||
|
"path/filepath"
|
||||||
|
"regexp"
|
||||||
|
"sort"
|
||||||
|
"strconv"
|
||||||
|
"strings"
|
||||||
|
)
|
||||||
|
|
||||||
|
type Reference struct {
|
||||||
|
File string `json:"file"`
|
||||||
|
Line int `json:"line"`
|
||||||
|
Column int `json:"column"`
|
||||||
|
Key string `json:"key"`
|
||||||
|
Function string `json:"function"`
|
||||||
|
Context string `json:"context"`
|
||||||
|
}
|
||||||
|
|
||||||
|
type Result struct {
|
||||||
|
Method string `json:"method"`
|
||||||
|
Signature string `json:"signature"`
|
||||||
|
Definition string `json:"definition"`
|
||||||
|
References []Reference `json:"references"`
|
||||||
|
Total int `json:"total"`
|
||||||
|
}
|
||||||
|
|
||||||
|
var basePath = "/Users/coissac/Sync/travail/__MOI__/GO/obitools4"
|
||||||
|
|
||||||
|
func main() {
|
||||||
|
cmd := exec.Command("rg", "-n", `\.SetAttribute\(`, basePath+"/pkg", "--type", "go")
|
||||||
|
output, err := cmd.Output()
|
||||||
|
if err != nil {
|
||||||
|
fmt.Fprintf(os.Stderr, "Error running rg: %v\n", err)
|
||||||
|
os.Exit(1)
|
||||||
|
}
|
||||||
|
|
||||||
|
lines := strings.Split(string(output), "\n")
|
||||||
|
lineRe := regexp.MustCompile(`^(.+?):(\d+):\s*(.+)$`)
|
||||||
|
keyRe := regexp.MustCompile(`SetAttribute\("([^"]+)"`)
|
||||||
|
templateKeyRe := regexp.MustCompile(`SetAttribute\("([^"]+)[^"]*"\s*,`)
|
||||||
|
|
||||||
|
var refs []Reference
|
||||||
|
seen := make(map[string]bool)
|
||||||
|
|
||||||
|
for _, line := range lines {
|
||||||
|
line = strings.TrimSpace(line)
|
||||||
|
if line == "" {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
matches := lineRe.FindStringSubmatch(line)
|
||||||
|
if matches == nil {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
file := matches[1]
|
||||||
|
lineNum, _ := strconv.Atoi(matches[2])
|
||||||
|
context := strings.TrimSpace(matches[3])
|
||||||
|
|
||||||
|
// Skip definition
|
||||||
|
if strings.Contains(file, "obiseq/attributes.go") && lineNum == 132 {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
// Extract key
|
||||||
|
var key string
|
||||||
|
if keyMatches := keyRe.FindStringSubmatch(context); keyMatches != nil {
|
||||||
|
key = keyMatches[1]
|
||||||
|
} else if tmplMatches := templateKeyRe.FindStringSubmatch(context); tmplMatches != nil {
|
||||||
|
key = tmplMatches[1]
|
||||||
|
} else {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
// Get function name using treesitter
|
||||||
|
funcName := getFunctionNameTreesitter(file, lineNum)
|
||||||
|
|
||||||
|
uniqueKey := fmt.Sprintf("%s:%d", file, lineNum)
|
||||||
|
if seen[uniqueKey] {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
seen[uniqueKey] = true
|
||||||
|
|
||||||
|
refs = append(refs, Reference{
|
||||||
|
File: filepath.Base(file),
|
||||||
|
Line: lineNum,
|
||||||
|
Column: 0,
|
||||||
|
Key: key,
|
||||||
|
Function: funcName,
|
||||||
|
Context: context,
|
||||||
|
})
|
||||||
|
}
|
||||||
|
|
||||||
|
sort.Slice(refs, func(i, j int) bool {
|
||||||
|
if refs[i].File != refs[j].File {
|
||||||
|
return refs[i].File < refs[j].File
|
||||||
|
}
|
||||||
|
return refs[i].Line < refs[j].Line
|
||||||
|
})
|
||||||
|
|
||||||
|
result := Result{
|
||||||
|
Method: "SetAttribute",
|
||||||
|
Signature: "func (s *BioSequence) SetAttribute(key string, value interface{})",
|
||||||
|
Definition: basePath + "/pkg/obiseq/attributes.go:132",
|
||||||
|
References: refs,
|
||||||
|
Total: len(refs),
|
||||||
|
}
|
||||||
|
|
||||||
|
outputJSON, err := json.MarshalIndent(result, "", " ")
|
||||||
|
if err != nil {
|
||||||
|
fmt.Fprintf(os.Stderr, "Error marshaling JSON: %v\n", err)
|
||||||
|
os.Exit(1)
|
||||||
|
}
|
||||||
|
|
||||||
|
fmt.Println(string(outputJSON))
|
||||||
|
}
|
||||||
|
|
||||||
|
// getFunctionNameTreesitter uses the treesitter_cursor_walk tool to get the containing function
|
||||||
|
func getFunctionNameTreesitter(file string, targetLine int) string {
|
||||||
|
// Convert to 0-based for treesitter
|
||||||
|
row := targetLine - 1
|
||||||
|
|
||||||
|
// Use treesitter cursor walk to get ancestors
|
||||||
|
cmd := exec.Command("bash", "-c",
|
||||||
|
fmt.Sprintf(`kilo treesitter_cursor_walk --file_path %q --row %d --column 0 --max_depth 10 2>/dev/null`, file, row))
|
||||||
|
|
||||||
|
output, err := cmd.Output()
|
||||||
|
if err != nil {
|
||||||
|
return findContainingFunction(file, targetLine)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Parse the JSON output to find function_declaration or method_declaration
|
||||||
|
var result map[string]interface{}
|
||||||
|
if err := json.Unmarshal(output, &result); err != nil {
|
||||||
|
return findContainingFunction(file, targetLine)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Check ancestors for function declaration
|
||||||
|
if ancestors, ok := result["ancestors"].([]interface{}); ok {
|
||||||
|
for _, a := range ancestors {
|
||||||
|
if anc, ok := a.(map[string]interface{}); ok {
|
||||||
|
nodeType, _ := anc["type"].(string)
|
||||||
|
if nodeType == "function_declaration" || nodeType == "method_declaration" {
|
||||||
|
// Try to get the function name from children
|
||||||
|
if children, ok := anc["children"].([]interface{}); ok {
|
||||||
|
for _, c := range children {
|
||||||
|
if child, ok := c.(map[string]interface{}); ok {
|
||||||
|
childType, _ := child["type"].(string)
|
||||||
|
if childType == "identifier" {
|
||||||
|
if text, ok := child["text"].(string); ok {
|
||||||
|
return text
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if childType == "field_identifier" {
|
||||||
|
if text, ok := child["text"].(string); ok {
|
||||||
|
return text
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if nodeType == "func_literal" {
|
||||||
|
return "closure"
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return findContainingFunction(file, targetLine)
|
||||||
|
}
|
||||||
|
|
||||||
|
func findContainingFunction(file string, targetLine int) string {
|
||||||
|
data, err := os.ReadFile(file)
|
||||||
|
if err != nil {
|
||||||
|
return ""
|
||||||
|
}
|
||||||
|
lines := strings.Split(string(data), "\n")
|
||||||
|
|
||||||
|
for i := targetLine - 1; i >= 0 && i >= targetLine-200; i-- {
|
||||||
|
if i >= len(lines) {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
line := strings.TrimSpace(lines[i])
|
||||||
|
|
||||||
|
if line == "}" && i > 0 {
|
||||||
|
for j := i - 1; j >= 0 && j >= i-50; j-- {
|
||||||
|
if j >= len(lines) {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
funcLine := strings.TrimSpace(lines[j])
|
||||||
|
if strings.HasPrefix(funcLine, "func ") {
|
||||||
|
if match := regexp.MustCompile(`func\s+\([^)]+\)\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(funcLine); match != nil {
|
||||||
|
return match[1]
|
||||||
|
}
|
||||||
|
if match := regexp.MustCompile(`func\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(funcLine); match != nil {
|
||||||
|
return match[1]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
if strings.HasPrefix(line, "func ") {
|
||||||
|
if match := regexp.MustCompile(`func\s+\([^)]+\)\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(line); match != nil {
|
||||||
|
return match[1]
|
||||||
|
}
|
||||||
|
if match := regexp.MustCompile(`func\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(line); match != nil {
|
||||||
|
return match[1]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return ""
|
||||||
|
}
|
||||||
Executable
+36
@@ -0,0 +1,36 @@
|
|||||||
|
#!/bin/bash
|
||||||
|
|
||||||
|
basePath="/Users/coissac/Sync/travail/__MOI__/GO/obitools4"
|
||||||
|
OUTPUT_FILE="${1:-/dev/stdout}"
|
||||||
|
|
||||||
|
# Get all SetAttribute calls
|
||||||
|
rg -n '\.SetAttribute\(' "$basePath/pkg" --type go | while read -r line; do
|
||||||
|
file="${line%%:*}"
|
||||||
|
line_num="${line%:*}"
|
||||||
|
line_num="${line_num##*:}"
|
||||||
|
context="${line##*: }"
|
||||||
|
|
||||||
|
# Extract key (only literal strings)
|
||||||
|
key=$(echo "$context" | sed -n 's/.*SetAttribute("\([^"]*\)".*/\1/p')
|
||||||
|
[ -z "$key" ] && continue
|
||||||
|
|
||||||
|
# Get function name using treesitter
|
||||||
|
func=$(kilo treesitter_cursor_walk \
|
||||||
|
--file_path "$file" \
|
||||||
|
--row "$((line_num - 1))" \
|
||||||
|
--column 0 \
|
||||||
|
--max_depth 10 2>/dev/null |
|
||||||
|
jq -r '.ancestors[] | select(.type == "function_declaration" or .type == "method_declaration") | .children[] | select(.type == "identifier" or .type == "field_identifier") | .text' 2>/dev/null)
|
||||||
|
|
||||||
|
# Fallback to func_literal for closures
|
||||||
|
if [ -z "$func" ]; then
|
||||||
|
func=$(kilo treesitter_cursor_walk \
|
||||||
|
--file_path "$file" \
|
||||||
|
--row "$((line_num - 1))" \
|
||||||
|
--column 0 \
|
||||||
|
--max_depth 10 2>/dev/null |
|
||||||
|
jq -r '.ancestors[] | select(.type == "func_literal") | "closure"' 2>/dev/null)
|
||||||
|
fi
|
||||||
|
|
||||||
|
echo "$(basename "$file")|$line_num|$key|${func:-unknown}|$context"
|
||||||
|
done | sort -t'|' -k1,1 -k2,2n
|
||||||
@@ -0,0 +1,308 @@
|
|||||||
|
{
|
||||||
|
"obiannotate": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
],
|
||||||
|
"(git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter.IBioSequence).NumberSequences$1": [
|
||||||
|
"seq_number"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obiclean": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obicleandb": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
|
||||||
|
"count"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obicomplement": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obiconsensus": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
|
||||||
|
"count"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
],
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.BuildConsensus": [
|
||||||
|
"obiconsensus_kmer_max_occur",
|
||||||
|
"obiconsensus_filtered_graph_size",
|
||||||
|
"obiconsensus_full_graph_size",
|
||||||
|
"obiconsensus_consensus",
|
||||||
|
"obiconsensus_weight",
|
||||||
|
"obiconsensus_seq_length",
|
||||||
|
"obiconsensus_kmer_size"
|
||||||
|
],
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.MinionClusterDenoise": [
|
||||||
|
"obiconsensus_consensus"
|
||||||
|
],
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.MinionDenoise$1": [
|
||||||
|
"obiconsensus_consensus",
|
||||||
|
"obiconsensus_weight"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obiconvert": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obicount": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obicsv": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obidemerge": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obidistribute": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obigrep": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obijoin": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obikmermatch": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obikmersimcount": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obilandmark": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCoordinate": [
|
||||||
|
"landmark_coord"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagGeomRefIndex": [
|
||||||
|
"obitag_geomref_index"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
],
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obilandmark.CLISelectLandmarkSequences": [
|
||||||
|
"landmark_id"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obimatrix": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obimicrosat": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obimultiplex": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obipairing": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._revcmpMutation": [
|
||||||
|
"pairing_mismatches"
|
||||||
|
],
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign.BuildQualityConsensus": [
|
||||||
|
"pairing_mismatches"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obipcr": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obireffamidx": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagRefIndex": [
|
||||||
|
"obitag_ref_index"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
],
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obirefidx.IndexFamilyDB": [
|
||||||
|
"reffamidx_id"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obirefidx": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagRefIndex": [
|
||||||
|
"obitag_ref_index"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obiscript": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obisplit": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obisummary": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obitag": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetPath": [
|
||||||
|
"taxonomic_path"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obitagpcr": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obingslibrary.NGSLibrary).ExtractMultiBarcode": [
|
||||||
|
"obimultiplex_error",
|
||||||
|
"obimultiplex_amplicon_rank"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._revcmpMutation": [
|
||||||
|
"pairing_mismatches"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._subseqMutation": [
|
||||||
|
"pairing_mismatches"
|
||||||
|
],
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign.BuildQualityConsensus": [
|
||||||
|
"pairing_mismatches"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obitaxonomy": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetPath": [
|
||||||
|
"taxonomic_path"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
],
|
||||||
|
"(git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter.IBioSequence).NumberSequences$1": [
|
||||||
|
"seq_number"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obiuniq": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
|
||||||
|
"count"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
}
|
||||||
|
}
|
||||||
Executable
+36
@@ -0,0 +1,36 @@
|
|||||||
|
#!/usr/bin/env python3
|
||||||
|
"""
|
||||||
|
Read potentially malformed JSON from stdin (aichat output), extract title and
|
||||||
|
body, and print them as plain text: title on first line, blank line, then body.
|
||||||
|
Exits with 1 on failure (no output).
|
||||||
|
"""
|
||||||
|
|
||||||
|
import sys
|
||||||
|
import json
|
||||||
|
import re
|
||||||
|
|
||||||
|
text = sys.stdin.read()
|
||||||
|
|
||||||
|
m = re.search(r'\{.*\}', text, re.DOTALL)
|
||||||
|
if not m:
|
||||||
|
sys.exit(1)
|
||||||
|
|
||||||
|
s = m.group()
|
||||||
|
obj = None
|
||||||
|
|
||||||
|
try:
|
||||||
|
obj = json.loads(s)
|
||||||
|
except Exception:
|
||||||
|
s2 = re.sub(r'(?<!\\)\n', r'\\n', s)
|
||||||
|
try:
|
||||||
|
obj = json.loads(s2)
|
||||||
|
except Exception:
|
||||||
|
sys.exit(1)
|
||||||
|
|
||||||
|
title = obj.get('title', '').strip()
|
||||||
|
body = obj.get('body', '').strip()
|
||||||
|
|
||||||
|
if not title or not body:
|
||||||
|
sys.exit(1)
|
||||||
|
|
||||||
|
print(f"{title}\n\n{body}")
|
||||||
+1
-1
@@ -1 +1 @@
|
|||||||
4.4.19
|
4.4.45
|
||||||
|
|||||||
@@ -0,0 +1,19 @@
|
|||||||
|
```markdown
|
||||||
|
# DNA Scoring and Matching Utilities in `obialign`
|
||||||
|
|
||||||
|
This module provides low-level utilities for computing nucleotide alignment scores using probabilistic and bit-encoded representations.
|
||||||
|
|
||||||
|
- **Bit Encoding**: Nucleotides are encoded in 4-bit groups (e.g., `A=0b0001`, `C=0b0010`, etc.), enabling efficient bitwise comparison.
|
||||||
|
- **`_MatchRatio(a, b)`**: Computes a normalized match ratio between two encoded bytes based on shared bits:
|
||||||
|
`ratio = common_bits / (bits_in_a × bits_in_b)`.
|
||||||
|
- **`_FourBitsCount`**: Precomputed lookup table for Hamming weight (popcount) of 4-bit values.
|
||||||
|
- **Log-space Arithmetic**: Helper functions (`_Logaddexp`, `_Logdiffexp`, `_Log1mexp`) ensure numerical stability in probabilistic computations.
|
||||||
|
- **Phred-scaled Quality Integration**:
|
||||||
|
`_MatchScoreRatio(QF, QR)` derives log-odds match/mismatch scores from Phred quality values (`QF`, `QR`), modeling sequencing error probabilities.
|
||||||
|
- **Precomputed Matrices**:
|
||||||
|
- `_NucPartMatch[i][j]`: Match ratios for all nucleotide pairs (from 4-bit codes).
|
||||||
|
- `_NucScorePartMatchMatch/Mismatch[i][j]`: Integer-scaled match/mismatch scores (×10) for quality pairs `(i, j)` in `[0..99]`.
|
||||||
|
- **Thread-Safe Initialization**: `_InitDNAScoreMatrix()` ensures one-time, synchronized initialization of all scoring tables via a mutex.
|
||||||
|
|
||||||
|
Designed for high-performance alignment kernels where speed and numerical robustness are critical.
|
||||||
|
```
|
||||||
Reference in New Issue
Block a user