mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-08-08 06:20:36 +00:00
555 lines
28 KiB
HTML
555 lines
28 KiB
HTML
<!DOCTYPE html>
|
||
<html lang="" xml:lang="">
|
||
<head>
|
||
|
||
<meta charset="utf-8" />
|
||
<meta http-equiv="X-UA-Compatible" content="IE=edge" />
|
||
<title>The GO OBITools</title>
|
||
<meta name="description" content="Description of the principles used into the GO implementation of OBITools." />
|
||
<meta name="generator" content="bookdown 0.29 and GitBook 2.6.7" />
|
||
|
||
<meta property="og:title" content="The GO OBITools" />
|
||
<meta property="og:type" content="book" />
|
||
|
||
<meta property="og:description" content="Description of the principles used into the GO implementation of OBITools." />
|
||
<meta name="github-repo" content="seankross/bookdown-start" />
|
||
|
||
<meta name="twitter:card" content="summary" />
|
||
<meta name="twitter:title" content="The GO OBITools" />
|
||
|
||
<meta name="twitter:description" content="Description of the principles used into the GO implementation of OBITools." />
|
||
|
||
|
||
<meta name="author" content="SEric Coissac" />
|
||
|
||
|
||
<meta name="date" content="2022-08-25" />
|
||
|
||
<meta name="viewport" content="width=device-width, initial-scale=1" />
|
||
<meta name="apple-mobile-web-app-capable" content="yes" />
|
||
<meta name="apple-mobile-web-app-status-bar-style" content="black" />
|
||
|
||
|
||
|
||
<link rel="next" href="the-obitools-commands.html"/>
|
||
<script src="book_assets/jquery-3.6.0/jquery-3.6.0.min.js"></script>
|
||
<script src="https://cdn.jsdelivr.net/npm/fuse.js@6.4.6/dist/fuse.min.js"></script>
|
||
<link href="book_assets/gitbook-2.6.7/css/style.css" rel="stylesheet" />
|
||
<link href="book_assets/gitbook-2.6.7/css/plugin-table.css" rel="stylesheet" />
|
||
<link href="book_assets/gitbook-2.6.7/css/plugin-bookdown.css" rel="stylesheet" />
|
||
<link href="book_assets/gitbook-2.6.7/css/plugin-highlight.css" rel="stylesheet" />
|
||
<link href="book_assets/gitbook-2.6.7/css/plugin-search.css" rel="stylesheet" />
|
||
<link href="book_assets/gitbook-2.6.7/css/plugin-fontsettings.css" rel="stylesheet" />
|
||
<link href="book_assets/gitbook-2.6.7/css/plugin-clipboard.css" rel="stylesheet" />
|
||
|
||
|
||
|
||
|
||
|
||
|
||
|
||
|
||
<link href="book_assets/anchor-sections-1.1.0/anchor-sections.css" rel="stylesheet" />
|
||
<link href="book_assets/anchor-sections-1.1.0/anchor-sections-hash.css" rel="stylesheet" />
|
||
<script src="book_assets/anchor-sections-1.1.0/anchor-sections.js"></script>
|
||
|
||
|
||
<style type="text/css">
|
||
pre > code.sourceCode { white-space: pre; position: relative; }
|
||
pre > code.sourceCode > span { display: inline-block; line-height: 1.25; }
|
||
pre > code.sourceCode > span:empty { height: 1.2em; }
|
||
.sourceCode { overflow: visible; }
|
||
code.sourceCode > span { color: inherit; text-decoration: inherit; }
|
||
pre.sourceCode { margin: 0; }
|
||
@media screen {
|
||
div.sourceCode { overflow: auto; }
|
||
}
|
||
@media print {
|
||
pre > code.sourceCode { white-space: pre-wrap; }
|
||
pre > code.sourceCode > span { text-indent: -5em; padding-left: 5em; }
|
||
}
|
||
pre.numberSource code
|
||
{ counter-reset: source-line 0; }
|
||
pre.numberSource code > span
|
||
{ position: relative; left: -4em; counter-increment: source-line; }
|
||
pre.numberSource code > span > a:first-child::before
|
||
{ content: counter(source-line);
|
||
position: relative; left: -1em; text-align: right; vertical-align: baseline;
|
||
border: none; display: inline-block;
|
||
-webkit-touch-callout: none; -webkit-user-select: none;
|
||
-khtml-user-select: none; -moz-user-select: none;
|
||
-ms-user-select: none; user-select: none;
|
||
padding: 0 4px; width: 4em;
|
||
color: #aaaaaa;
|
||
}
|
||
pre.numberSource { margin-left: 3em; border-left: 1px solid #aaaaaa; padding-left: 4px; }
|
||
div.sourceCode
|
||
{ }
|
||
@media screen {
|
||
pre > code.sourceCode > span > a:first-child::before { text-decoration: underline; }
|
||
}
|
||
code span.al { color: #ff0000; font-weight: bold; } /* Alert */
|
||
code span.an { color: #60a0b0; font-weight: bold; font-style: italic; } /* Annotation */
|
||
code span.at { color: #7d9029; } /* Attribute */
|
||
code span.bn { color: #40a070; } /* BaseN */
|
||
code span.bu { } /* BuiltIn */
|
||
code span.cf { color: #007020; font-weight: bold; } /* ControlFlow */
|
||
code span.ch { color: #4070a0; } /* Char */
|
||
code span.cn { color: #880000; } /* Constant */
|
||
code span.co { color: #60a0b0; font-style: italic; } /* Comment */
|
||
code span.cv { color: #60a0b0; font-weight: bold; font-style: italic; } /* CommentVar */
|
||
code span.do { color: #ba2121; font-style: italic; } /* Documentation */
|
||
code span.dt { color: #902000; } /* DataType */
|
||
code span.dv { color: #40a070; } /* DecVal */
|
||
code span.er { color: #ff0000; font-weight: bold; } /* Error */
|
||
code span.ex { } /* Extension */
|
||
code span.fl { color: #40a070; } /* Float */
|
||
code span.fu { color: #06287e; } /* Function */
|
||
code span.im { } /* Import */
|
||
code span.in { color: #60a0b0; font-weight: bold; font-style: italic; } /* Information */
|
||
code span.kw { color: #007020; font-weight: bold; } /* Keyword */
|
||
code span.op { color: #666666; } /* Operator */
|
||
code span.ot { color: #007020; } /* Other */
|
||
code span.pp { color: #bc7a00; } /* Preprocessor */
|
||
code span.sc { color: #4070a0; } /* SpecialChar */
|
||
code span.ss { color: #bb6688; } /* SpecialString */
|
||
code span.st { color: #4070a0; } /* String */
|
||
code span.va { color: #19177c; } /* Variable */
|
||
code span.vs { color: #4070a0; } /* VerbatimString */
|
||
code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warning */
|
||
</style>
|
||
|
||
|
||
</head>
|
||
|
||
<body>
|
||
|
||
|
||
|
||
<div class="book without-animation with-summary font-size-2 font-family-1" data-basepath=".">
|
||
|
||
<div class="book-summary">
|
||
<nav role="navigation">
|
||
|
||
<ul class="summary">
|
||
<li class="chapter" data-level="1" data-path="the-obitools.html"><a href="the-obitools.html"><i class="fa fa-check"></i><b>1</b> The OBITools</a>
|
||
<ul>
|
||
<li class="chapter" data-level="1.1" data-path="the-obitools.html"><a href="the-obitools.html#aims-of-obitools"><i class="fa fa-check"></i><b>1.1</b> Aims of <em>OBITools</em></a></li>
|
||
<li class="chapter" data-level="1.2" data-path="the-obitools.html"><a href="the-obitools.html#file-formats-usable-with-obitools"><i class="fa fa-check"></i><b>1.2</b> File formats usable with <em>OBITools</em></a>
|
||
<ul>
|
||
<li class="chapter" data-level="1.2.1" data-path="the-obitools.html"><a href="the-obitools.html#the-sequence-files"><i class="fa fa-check"></i><b>1.2.1</b> The sequence files</a></li>
|
||
<li class="chapter" data-level="1.2.2" data-path="the-obitools.html"><a href="the-obitools.html#the-iupac-code"><i class="fa fa-check"></i><b>1.2.2</b> The IUPAC Code</a></li>
|
||
<li class="chapter" data-level="1.2.3" data-path="the-obitools.html"><a href="the-obitools.html#classical-fasta"><i class="fa fa-check"></i><b>1.2.3</b> The <em>fasta</em> format</a></li>
|
||
<li class="chapter" data-level="1.2.4" data-path="the-obitools.html"><a href="the-obitools.html#classical-fastq"><i class="fa fa-check"></i><b>1.2.4</b> The <em>fastq</em> sequence format</a></li>
|
||
</ul></li>
|
||
<li class="chapter" data-level="1.3" data-path="the-obitools.html"><a href="the-obitools.html#file-extension"><i class="fa fa-check"></i><b>1.3</b> File extension</a></li>
|
||
<li class="chapter" data-level="1.4" data-path="the-obitools.html"><a href="the-obitools.html#see-also"><i class="fa fa-check"></i><b>1.4</b> See also</a></li>
|
||
<li class="chapter" data-level="1.5" data-path="the-obitools.html"><a href="the-obitools.html#references"><i class="fa fa-check"></i><b>1.5</b> References</a></li>
|
||
</ul></li>
|
||
<li class="chapter" data-level="2" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html"><i class="fa fa-check"></i><b>2</b> The <em>OBITools</em> commands</a>
|
||
<ul>
|
||
<li class="chapter" data-level="2.1" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#specifying-the-input-files-to-obitools-commands"><i class="fa fa-check"></i><b>2.1</b> Specifying the input files to <em>OBITools</em> commands</a></li>
|
||
<li class="chapter" data-level="2.2" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#options-common-to-most-of-the-obitools-commands"><i class="fa fa-check"></i><b>2.2</b> Options common to most of the <em>OBITools</em> commands</a>
|
||
<ul>
|
||
<li class="chapter" data-level="2.2.1" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#specifying-input-format"><i class="fa fa-check"></i><b>2.2.1</b> Specifying input format</a></li>
|
||
<li class="chapter" data-level="2.2.2" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#specifying-output-format"><i class="fa fa-check"></i><b>2.2.2</b> Specifying output format</a></li>
|
||
<li class="chapter" data-level="2.2.3" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#format-of-the-annotations-in-fasta-and-fastq-files"><i class="fa fa-check"></i><b>2.2.3</b> Format of the annotations in Fasta and Fastq files</a></li>
|
||
</ul></li>
|
||
<li class="chapter" data-level="2.3" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#metabarcode-design-and-quality-assessment"><i class="fa fa-check"></i><b>2.3</b> Metabarcode design and quality assessment</a></li>
|
||
<li class="chapter" data-level="2.4" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#file-format-conversions"><i class="fa fa-check"></i><b>2.4</b> File format conversions</a></li>
|
||
<li class="chapter" data-level="2.5" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#sequence-annotations"><i class="fa fa-check"></i><b>2.5</b> Sequence annotations</a></li>
|
||
<li class="chapter" data-level="2.6" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#computations-on-sequences"><i class="fa fa-check"></i><b>2.6</b> Computations on sequences</a>
|
||
<ul>
|
||
<li class="chapter" data-level="2.6.1" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#obipairing"><i class="fa fa-check"></i><b>2.6.1</b> <code>obipairing</code></a></li>
|
||
</ul></li>
|
||
<li class="chapter" data-level="2.7" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#sequence-sampling-and-filtering"><i class="fa fa-check"></i><b>2.7</b> Sequence sampling and filtering</a>
|
||
<ul>
|
||
<li class="chapter" data-level="2.7.1" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#utilities"><i class="fa fa-check"></i><b>2.7.1</b> Utilities</a></li>
|
||
</ul></li>
|
||
</ul></li>
|
||
<li class="chapter" data-level="3" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html"><i class="fa fa-check"></i><b>3</b> Reference documentation for the GO <em>OBITools</em> library</a>
|
||
<ul>
|
||
<li class="chapter" data-level="3.1" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html#biosequence"><i class="fa fa-check"></i><b>3.1</b> BioSequence</a>
|
||
<ul>
|
||
<li class="chapter" data-level="3.1.1" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html#creating-new-instances"><i class="fa fa-check"></i><b>3.1.1</b> Creating new instances</a></li>
|
||
<li class="chapter" data-level="3.1.2" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html#end-of-life-of-a-biosequence-instance"><i class="fa fa-check"></i><b>3.1.2</b> End of life of a <code>BioSequence</code> instance</a></li>
|
||
<li class="chapter" data-level="3.1.3" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html#accessing-to-the-elements-of-a-sequence"><i class="fa fa-check"></i><b>3.1.3</b> Accessing to the elements of a sequence</a></li>
|
||
</ul></li>
|
||
</ul></li>
|
||
<li class="chapter" data-level="4" data-path="annexes.html"><a href="annexes.html"><i class="fa fa-check"></i><b>4</b> Annexes</a>
|
||
<ul>
|
||
<li class="chapter" data-level="4.0.1" data-path="annexes.html"><a href="annexes.html#sequence-attributes"><i class="fa fa-check"></i><b>4.0.1</b> Sequence attributes</a></li>
|
||
</ul></li>
|
||
</ul>
|
||
|
||
</nav>
|
||
</div>
|
||
|
||
<div class="book-body">
|
||
<div class="body-inner">
|
||
<div class="book-header" role="navigation">
|
||
<h1>
|
||
<i class="fa fa-circle-o-notch fa-spin"></i><a href="./">The GO <em>OBITools</em></a>
|
||
</h1>
|
||
</div>
|
||
|
||
<div class="page-wrapper" tabindex="-1" role="main">
|
||
<div class="page-inner">
|
||
|
||
<section class="normal" id="section-">
|
||
<div id="header">
|
||
<h1 class="title">The GO <em>OBITools</em></h1>
|
||
<p class="author"><em>SEric Coissac</em></p>
|
||
<p class="date"><em>2022-08-25</em></p>
|
||
</div>
|
||
<div id="the-obitools" class="section level1 hasAnchor" number="1">
|
||
<h1><span class="header-section-number">1</span> The OBITools<a href="the-obitools.html#the-obitools" class="anchor-section" aria-label="Anchor link to header"></a></h1>
|
||
<div id="aims-of-obitools" class="section level2 hasAnchor" number="1.1">
|
||
<h2><span class="header-section-number">1.1</span> Aims of <em>OBITools</em><a href="the-obitools.html#aims-of-obitools" class="anchor-section" aria-label="Anchor link to header"></a></h2>
|
||
</div>
|
||
<div id="file-formats-usable-with-obitools" class="section level2 hasAnchor" number="1.2">
|
||
<h2><span class="header-section-number">1.2</span> File formats usable with <em>OBITools</em><a href="the-obitools.html#file-formats-usable-with-obitools" class="anchor-section" aria-label="Anchor link to header"></a></h2>
|
||
<div id="the-sequence-files" class="section level3 hasAnchor" number="1.2.1">
|
||
<h3><span class="header-section-number">1.2.1</span> The sequence files<a href="the-obitools.html#the-sequence-files" class="anchor-section" aria-label="Anchor link to header"></a></h3>
|
||
<p>Sequences can be stored following various format. OBITools knows some of
|
||
them. The central formats for sequence files manipulated by OBITools
|
||
scripts are the <code>fasta</code> and fastq format. OBITools extends the both
|
||
these formats by specifying a syntax to include in the definition line
|
||
data qualifying the sequence. All file formats use the <code>IUPAC</code> code for
|
||
encoding nucleotides.</p>
|
||
</div>
|
||
<div id="the-iupac-code" class="section level3 hasAnchor" number="1.2.2">
|
||
<h3><span class="header-section-number">1.2.2</span> The IUPAC Code<a href="the-obitools.html#the-iupac-code" class="anchor-section" aria-label="Anchor link to header"></a></h3>
|
||
<p>The International Union of Pure and Applied Chemistry (IUPAC_) defined
|
||
the standard code for representing protein or DNA sequences.</p>
|
||
<div id="DNA-IUPAC" class="section level4 hasAnchor" number="1.2.2.1">
|
||
<h4><span class="header-section-number">1.2.2.1</span> Nucleic IUPAC Code<a href="the-obitools.html#DNA-IUPAC" class="anchor-section" aria-label="Anchor link to header"></a></h4>
|
||
<table>
|
||
<thead>
|
||
<tr class="header">
|
||
<th><strong>Code</strong></th>
|
||
<th><strong>Nucleotide</strong></th>
|
||
</tr>
|
||
</thead>
|
||
<tbody>
|
||
<tr class="odd">
|
||
<td>A</td>
|
||
<td>Adenine</td>
|
||
</tr>
|
||
<tr class="even">
|
||
<td>C</td>
|
||
<td>Cytosine</td>
|
||
</tr>
|
||
<tr class="odd">
|
||
<td>G</td>
|
||
<td>Guanine</td>
|
||
</tr>
|
||
<tr class="even">
|
||
<td>T</td>
|
||
<td>Thymine</td>
|
||
</tr>
|
||
<tr class="odd">
|
||
<td>U</td>
|
||
<td>Uracil</td>
|
||
</tr>
|
||
<tr class="even">
|
||
<td>R</td>
|
||
<td>Purine (A or G)</td>
|
||
</tr>
|
||
<tr class="odd">
|
||
<td>Y</td>
|
||
<td>Pyrimidine (C, T, or U)</td>
|
||
</tr>
|
||
<tr class="even">
|
||
<td>M</td>
|
||
<td>C or A</td>
|
||
</tr>
|
||
<tr class="odd">
|
||
<td>K</td>
|
||
<td>T, U, or G</td>
|
||
</tr>
|
||
<tr class="even">
|
||
<td>W</td>
|
||
<td>T, U, or A</td>
|
||
</tr>
|
||
<tr class="odd">
|
||
<td>S</td>
|
||
<td>C or G</td>
|
||
</tr>
|
||
<tr class="even">
|
||
<td>B</td>
|
||
<td>C, T, U, or G (not A)</td>
|
||
</tr>
|
||
<tr class="odd">
|
||
<td>D</td>
|
||
<td>A, T, U, or G (not C)</td>
|
||
</tr>
|
||
<tr class="even">
|
||
<td>H</td>
|
||
<td>A, T, U, or C (not G)</td>
|
||
</tr>
|
||
<tr class="odd">
|
||
<td>V</td>
|
||
<td>A, C, or G (not T, not U)</td>
|
||
</tr>
|
||
<tr class="even">
|
||
<td>N</td>
|
||
<td>Any base (A, C, G, T, or U)</td>
|
||
</tr>
|
||
</tbody>
|
||
</table>
|
||
</div>
|
||
</div>
|
||
<div id="classical-fasta" class="section level3 hasAnchor" number="1.2.3">
|
||
<h3><span class="header-section-number">1.2.3</span> The <em>fasta</em> format<a href="the-obitools.html#classical-fasta" class="anchor-section" aria-label="Anchor link to header"></a></h3>
|
||
<p>The <strong>fasta format</strong> is certainly the most widely used sequence file
|
||
format. This is certainly due to its great simplicity. It was originally
|
||
created for the Lipman and Pearson <a href="http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation">FASTA
|
||
program</a>.
|
||
OBITools use in more of the classical :ref:<code>fasta</code> format an
|
||
:ref:<code>extended version</code> of this format where structured data are
|
||
included in the title line.</p>
|
||
<p>In <em>fasta</em> format a sequence is represented by a title line beginning
|
||
with a <strong><code>></code></strong> character and the sequences by itself following the
|
||
:doc:<code>iupac</code> code. The sequence is usually split other severals lines of
|
||
the same length (expect for the last one)</p>
|
||
<pre><code>>my_sequence this is my pretty sequence
|
||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||
AACGACGTTGCAGTACGTTGCAGT</code></pre>
|
||
<p>This is no special format for the title line excepting that this line
|
||
should be unique. Usually the first word following the <strong>></strong> character
|
||
is considered as the sequence identifier. The end of the title line
|
||
corresponding to a description of the sequence. Several sequences can be
|
||
concatenated in a same file. The description of the next sequence is
|
||
just pasted at the end of the record of the previous one</p>
|
||
<pre><code>>sequence_A this is my first pretty sequence
|
||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||
AACGACGTTGCAGTACGTTGCAGT
|
||
>sequence_B this is my second pretty sequence
|
||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||
AACGACGTTGCAGTACGTTGCAGT
|
||
>sequence_C this is my third pretty sequence
|
||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||
AACGACGTTGCAGTACGTTGCAGT</code></pre>
|
||
</div>
|
||
<div id="classical-fastq" class="section level3 hasAnchor" number="1.2.4">
|
||
<h3><span class="header-section-number">1.2.4</span> The <em>fastq</em> sequence format<a href="the-obitools.html#classical-fastq" class="anchor-section" aria-label="Anchor link to header"></a></h3>
|
||
<p>.. note::</p>
|
||
<pre><code>This article uses material from the Wikipedia article
|
||
`FASTQ format `
|
||
which is released under the
|
||
`Creative Commons Attribution-Share-Alike License 3.0 `</code></pre>
|
||
<p><strong>fastq format</strong> is a text-based format for storing both a biological
|
||
sequence (usually nucleotide sequence) and its corresponding quality
|
||
scores. Both the sequence letter and quality score are encoded with a
|
||
single ASCII character for brevity. It was originally developed at the
|
||
<code>Wellcome Trust Sanger Institute</code> to bundle a <a href="the-obitools.html#classical-fasta">fasta</a>
|
||
sequence and its quality data, but has recently become the <em>de facto</em>
|
||
standard for storing the output of high throughput sequencing
|
||
instruments such as the Illumina Genome Analyzer Illumina. [1]_</p>
|
||
<div id="format" class="section level4 hasAnchor" number="1.2.4.1">
|
||
<h4><span class="header-section-number">1.2.4.1</span> Format<a href="the-obitools.html#format" class="anchor-section" aria-label="Anchor link to header"></a></h4>
|
||
<p>A fastq file normally uses four lines per sequence.</p>
|
||
<ul>
|
||
<li>Line 1 begins with a ‘@’ character and is followed by a sequence
|
||
identifier and an <em>optional</em> description (like a :ref:<code>fasta</code> title
|
||
line).</li>
|
||
<li>Line 2 is the raw sequence letters.</li>
|
||
<li>Line 3 begins with a ‘+’ character and is <em>optionally</em> followed by
|
||
the same sequence identifier (and any description) again.</li>
|
||
<li>Line 4 encodes the quality values for the sequence in Line 2, and
|
||
must contain the same number of symbols as letters in the sequence.</li>
|
||
</ul>
|
||
<p>A fastq file containing a single sequence might look like this:</p>
|
||
<pre><code>@SEQ_ID
|
||
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
|
||
+
|
||
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65</code></pre>
|
||
<p>The character ‘!’ represents the lowest quality while ‘~’ is the
|
||
highest. Here are the quality value characters in left-to-right
|
||
increasing order of quality (<code>ASCII</code>):</p>
|
||
<pre><code>!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~</code></pre>
|
||
<p>The original Sanger FASTQ files also allowed the sequence and quality
|
||
strings to be wrapped (split over multiple lines), but this is generally
|
||
discouraged as it can make parsing complicated due to the unfortunate
|
||
choice of “@” and “+” as markers (these characters can also occur in
|
||
the quality string).</p>
|
||
</div>
|
||
<div id="variations" class="section level4 hasAnchor" number="1.2.4.2">
|
||
<h4><span class="header-section-number">1.2.4.2</span> Variations<a href="the-obitools.html#variations" class="anchor-section" aria-label="Anchor link to header"></a></h4>
|
||
<div id="quality" class="section level5 hasAnchor" number="1.2.4.2.1">
|
||
<h5><span class="header-section-number">1.2.4.2.1</span> Quality<a href="the-obitools.html#quality" class="anchor-section" aria-label="Anchor link to header"></a></h5>
|
||
<p>A quality value <em>Q</em> is an integer mapping of <em>p</em> (i.e., the probability
|
||
that the corresponding base call is incorrect). Two different equations
|
||
have been in use. The first is the standard Sanger variant to assess
|
||
reliability of a base call, otherwise known as Phred quality score:</p>
|
||
<p><span class="math display">\[
|
||
Q_\text{sanger} = -10 \, \log_{10} p
|
||
\]</span></p>
|
||
<p>The Solexa pipeline (i.e., the software delivered with the Illumina
|
||
Genome Analyzer) earlier used a different mapping, encoding the odds
|
||
<span class="math inline">\(\mathbf{p}/(1-\mathbf{p})\)</span> instead of the probability <span class="math inline">\(\mathbf{p}\)</span>:</p>
|
||
<p><span class="math display">\[
|
||
Q_\text{solexa-prior to v.1.3} = -10 \, \log_{10} \frac{p}{1-p}
|
||
\]</span></p>
|
||
<p>Although both mappings are asymptotically identical at higher quality
|
||
values, they differ at lower quality levels (i.e., approximately
|
||
<span class="math inline">\(\mathbf{p} > 0.05\)</span>, or equivalently, <span class="math inline">\(\mathbf{Q} < 13\)</span>).</p>
|
||
<p>|Relationship between <em>Q</em> and <em>p</em> using the Sanger (red) and Solexa
|
||
(black) equations (described above). The vertical dotted line indicates
|
||
<span class="math inline">\(\mathbf{p}= 0.05\)</span>, or equivalently, <span class="math inline">\(Q = 13\)</span>.|</p>
|
||
</div>
|
||
</div>
|
||
<div id="encoding" class="section level4 hasAnchor" number="1.2.4.3">
|
||
<h4><span class="header-section-number">1.2.4.3</span> Encoding<a href="the-obitools.html#encoding" class="anchor-section" aria-label="Anchor link to header"></a></h4>
|
||
<ul>
|
||
<li>Sanger format can encode a Phred quality score from 0 to 93 using
|
||
ASCII 33 to 126 (although in raw read data the Phred quality score
|
||
rarely exceeds 60, higher scores are possible in assemblies or read
|
||
maps).</li>
|
||
<li>Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality
|
||
score from -5 to 62 using ASCII 59 to 126 (although in raw read data
|
||
Solexa scores from -5 to 40 only are expected)</li>
|
||
<li>Starting with Illumina 1.3 and before Illumina 1.8, the format
|
||
encoded a Phred quality score from 0 to 62 using ASCII 64 to 126
|
||
(although in raw read data Phred scores from 0 to 40 only are
|
||
expected).</li>
|
||
<li>Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0
|
||
to 2 have a slightly different meaning. The values 0 and 1 are no
|
||
longer used and the value 2, encoded by ASCII 66 “B”.</li>
|
||
</ul>
|
||
<p>Sequencing Control Software, Version 2.6, Catalog # SY-960-2601, Part
|
||
# 15009921 Rev. A, November
|
||
2009] <a href="%5Bhttp://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\%5D(http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf)%7B.uri%7D" class="uri">[http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\\](http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf){.uri}</a>
|
||
(page 30) states the following: <em>If a read ends with a segment of mostly
|
||
low quality (Q15 or below), then all of the quality values in the
|
||
segment are replaced with a value of 2 (encoded as the letter B in
|
||
Illumina’s text-based encoding of quality scores)… This Q2 indicator
|
||
does not predict a specific error rate, but rather indicates that a
|
||
specific final portion of the read should not be used in further
|
||
analyses.</em> Also, the quality score encoded as “B” letter may occur
|
||
internally within reads at least as late as pipeline version 1.6, as
|
||
shown in the following example:</p>
|
||
<pre><code>@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
|
||
TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
|
||
+HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
|
||
efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB</code></pre>
|
||
<p>An alternative interpretation of this ASCII encoding has been proposed.
|
||
Also, in Illumina runs using PhiX controls, the character ‘B’ was
|
||
observed to represent an “unknown quality score”. The error rate of ‘B’
|
||
reads was roughly 3 phred scores lower the mean observed score of a
|
||
given run.</p>
|
||
<ul>
|
||
<li>Starting in Illumina 1.8, the quality scores have basically returned
|
||
to the use of the Sanger format (Phred+33).</li>
|
||
</ul>
|
||
</div>
|
||
</div>
|
||
</div>
|
||
<div id="file-extension" class="section level2 hasAnchor" number="1.3">
|
||
<h2><span class="header-section-number">1.3</span> File extension<a href="the-obitools.html#file-extension" class="anchor-section" aria-label="Anchor link to header"></a></h2>
|
||
<p>There is no standard file extension for a FASTQ file, but .fq and
|
||
.fastq, are commonly used.</p>
|
||
</div>
|
||
<div id="see-also" class="section level2 hasAnchor" number="1.4">
|
||
<h2><span class="header-section-number">1.4</span> See also<a href="the-obitools.html#see-also" class="anchor-section" aria-label="Anchor link to header"></a></h2>
|
||
<ul>
|
||
<li>:ref:<code>fasta</code></li>
|
||
</ul>
|
||
</div>
|
||
<div id="references" class="section level2 hasAnchor" number="1.5">
|
||
<h2><span class="header-section-number">1.5</span> References<a href="the-obitools.html#references" class="anchor-section" aria-label="Anchor link to header"></a></h2>
|
||
<p>.. [1] Cock et al (2009) The Sanger FASTQ file format for sequences with
|
||
quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids
|
||
Research,</p>
|
||
<p>.. [2] Illumina Quality Scores, Tobias Mann, Bioinformatics, San Diego,
|
||
Illumina <code>1</code>__</p>
|
||
<p>.. |Relationship between <em>Q</em> and <em>p</em> using the Sanger (red) and Solexa
|
||
(black) equations (described above). The vertical dotted line indicates
|
||
<em>p</em> = 0.05, or equivalently, <em>Q</em> Å 13.| image:: Probability metrics.png</p>
|
||
<p>See <a href="http://en.wikipedia.org/wiki/FASTQ_format" class="uri">http://en.wikipedia.org/wiki/FASTQ_format</a></p>
|
||
|
||
</div>
|
||
</div>
|
||
</section>
|
||
|
||
</div>
|
||
</div>
|
||
</div>
|
||
|
||
<a href="the-obitools-commands.html" class="navigation navigation-next navigation-unique" aria-label="Next page"><i class="fa fa-angle-right"></i></a>
|
||
</div>
|
||
</div>
|
||
<script src="book_assets/gitbook-2.6.7/js/app.min.js"></script>
|
||
<script src="book_assets/gitbook-2.6.7/js/clipboard.min.js"></script>
|
||
<script src="book_assets/gitbook-2.6.7/js/plugin-search.js"></script>
|
||
<script src="book_assets/gitbook-2.6.7/js/plugin-sharing.js"></script>
|
||
<script src="book_assets/gitbook-2.6.7/js/plugin-fontsettings.js"></script>
|
||
<script src="book_assets/gitbook-2.6.7/js/plugin-bookdown.js"></script>
|
||
<script src="book_assets/gitbook-2.6.7/js/jquery.highlight.js"></script>
|
||
<script src="book_assets/gitbook-2.6.7/js/plugin-clipboard.js"></script>
|
||
<script>
|
||
gitbook.require(["gitbook"], function(gitbook) {
|
||
gitbook.start({
|
||
"sharing": {
|
||
"github": false,
|
||
"facebook": true,
|
||
"twitter": true,
|
||
"linkedin": false,
|
||
"weibo": false,
|
||
"instapaper": false,
|
||
"vk": false,
|
||
"whatsapp": false,
|
||
"all": ["facebook", "twitter", "linkedin", "weibo", "instapaper"]
|
||
},
|
||
"fontsettings": {
|
||
"theme": "white",
|
||
"family": "sans",
|
||
"size": 2
|
||
},
|
||
"edit": {
|
||
"link": null,
|
||
"text": null
|
||
},
|
||
"history": {
|
||
"link": null,
|
||
"text": null
|
||
},
|
||
"view": {
|
||
"link": null,
|
||
"text": null
|
||
},
|
||
"download": ["_main.pdf"],
|
||
"search": {
|
||
"engine": "fuse",
|
||
"options": null
|
||
},
|
||
"toc": {
|
||
"collapse": "subsection"
|
||
}
|
||
});
|
||
});
|
||
</script>
|
||
|
||
<!-- dynamically load mathjax for compatibility with self-contained -->
|
||
<script>
|
||
(function () {
|
||
var script = document.createElement("script");
|
||
script.type = "text/javascript";
|
||
var src = "true";
|
||
if (src === "" || src === "true") src = "https://cdnjs.cloudflare.com/ajax/libs/mathjax/2.7.9/latest.js?config=TeX-MML-AM_CHTML";
|
||
if (location.protocol !== "file:")
|
||
if (/^https?:/.test(src))
|
||
src = src.replace(/^https?:/, '');
|
||
script.src = src;
|
||
document.getElementsByTagName("head")[0].appendChild(script);
|
||
})();
|
||
</script>
|
||
</body>
|
||
|
||
</html>
|