Add modular data structures, parallel pipelines, and system profiling

Establishes foundational infrastructure across multiple crates by introducing unified persistent bit matrix storage with columnar, packed, and implicit variants, alongside De Bruijn graph node encoding and unitig iteration logic. Adds a macro-driven parallel pipeline scheduler featuring NUMA-aware runners, bounded channels, and memory budgets to enforce concurrency limits. Implements streaming nucleotide parsers with pooled page buffers for FASTA, FASTQ, and Genbank formats, complemented by system resource monitoring, progress tracking, and stage profiling utilities. Collectively, these changes provide the core data models, execution frameworks, and I/O pipelines required for downstream k-mer indexing and analysis workloads.
This commit is contained in:
Eric Coissac committed 2026-08-14 14:20:08 +02:00
1 parent cc67023e2c
commit 79346c0c86
69 files changed
+7487 -7060

No files matched your search

-578
View File
@@ -1,578 +0,0 @@
use std::fs::{self, File};
use std::io::{self, BufWriter, Read as _, Write as _};
use std::path::{Path, PathBuf};
use memmap2::Mmap;
use ndarray::{Array1, Array2};
use rayon::prelude::*;
use crate::bitvec::{PersistentBitVec, PersistentBitVecBuilder};
use crate::colgroup::{ColGroup, MatrixGroupOps};
use crate::layer_meta::LayerMeta;
use crate::meta::MatrixMeta;
use crate::tempbitvec::{TempBitVec, TempBitVecBuilder};
use crate::tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
use crate::views::BitSliceView;
fn col_path(dir: &Path, col: usize) -> PathBuf {
dir.join(format!("col_{col:06}.pbiv"))
}
// ── ColumnarBitMatrix ─────────────────────────────────────────────────────────
/// Per-column file layout (original format).
pub struct ColumnarBitMatrix {
cols: Vec<PersistentBitVec>,
n: usize,
}
impl ColumnarBitMatrix {
pub(crate) fn open(dir: &Path) -> io::Result<Self> {
let meta = MatrixMeta::load(dir)?;
let cols = (0..meta.n_cols)
.map(|c| PersistentBitVec::open(&col_path(dir, c)))
.collect::<io::Result<Vec<_>>>()?;
Ok(Self { cols, n: meta.n })
}
pub(crate) fn n(&self) -> usize { self.n }
pub(crate) fn n_cols(&self) -> usize { self.cols.len() }
pub(crate) fn col(&self, c: usize) -> &PersistentBitVec { &self.cols[c] }
pub(crate) fn row(&self, slot: usize) -> Box<[bool]> {
self.cols.iter().map(|c| c.get(slot)).collect()
}
pub(crate) fn fill_row(&self, slot: usize, buf: &mut [u32]) {
for (c, col) in self.cols.iter().enumerate() {
buf[c] = col.get(slot) as u32;
}
}
pub(crate) fn count_ones(&self) -> Array1<u64> {
let counts: Vec<u64> = (0..self.n_cols())
.into_par_iter()
.map(|c| self.col(c).count_ones())
.collect();
Array1::from_vec(counts)
}
pub(crate) fn partial_jaccard_dist_matrix(&self) -> (Array2<u64>, Array2<u64>) {
pairwise2_matrix(self.n_cols(), |i, j| self.col(i).partial_jaccard_dist(self.col(j)))
}
pub(crate) fn partial_hamming_dist_matrix(&self) -> Array2<u64> {
pairwise_matrix(self.n_cols(), |i, j| self.col(i).hamming_dist(self.col(j)))
}
pub(crate) fn append_column(dir: &Path, value_of: impl Fn(usize) -> bool) -> io::Result<()> {
let mut meta = MatrixMeta::load(dir)?;
let mut b = PersistentBitVecBuilder::new(meta.n, &col_path(dir, meta.n_cols))?;
for slot in 0..meta.n {
b.set(slot, value_of(slot));
}
b.close()?;
meta.n_cols += 1;
meta.save(dir)
}
}
// ── PackedBitMatrix ───────────────────────────────────────────────────────────
const PBMX_MAGIC: [u8; 4] = *b"PBMX";
const PBMX_HEADER: usize = 24; // magic(4) + pad(4) + n_rows(8) + n_cols(8)
const PBIV_HEADER: usize = 16; // magic(4) + pad(4) + n(8)
/// Single-file packed layout: all columns concatenated behind a header.
pub struct PackedBitMatrix {
mmap: Mmap,
n_rows: usize,
n_cols: usize,
/// Absolute byte offset to the start of each column's bit data
/// (= file offset of the PBIV blob + PBIV_HEADER).
data_offsets: Vec<usize>,
}
impl PackedBitMatrix {
pub(crate) fn open(path: &Path) -> io::Result<Self> {
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
if mmap.len() < PBMX_HEADER {
return Err(io::Error::new(io::ErrorKind::InvalidData, "PBMX file too short"));
}
if &mmap[0..4] != &PBMX_MAGIC {
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PBMX magic"));
}
let n_rows = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
let n_cols = u64::from_le_bytes(mmap[16..24].try_into().unwrap()) as usize;
let mut data_offsets = Vec::with_capacity(n_cols);
for c in 0..n_cols {
let off_pos = PBMX_HEADER + c * 8;
let col_file_off = u64::from_le_bytes(mmap[off_pos..off_pos+8].try_into().unwrap()) as usize;
data_offsets.push(col_file_off + PBIV_HEADER);
}
Ok(Self { mmap, n_rows, n_cols, data_offsets })
}
#[inline]
pub(crate) fn fill_row(&self, slot: usize, buf: &mut [u32]) {
for (c, &data_off) in self.data_offsets.iter().enumerate() {
buf[c] = ((self.mmap[data_off + (slot >> 3)] >> (slot & 7)) & 1) as u32;
}
}
pub(crate) fn row(&self, slot: usize) -> Box<[bool]> {
(0..self.n_cols).map(|c| {
(self.mmap[self.data_offsets[c] + (slot >> 3)] >> (slot & 7)) & 1 != 0
}).collect()
}
fn col_bytes(&self, c: usize) -> &[u8] {
let start = self.data_offsets[c];
&self.mmap[start..start + self.n_rows.div_ceil(8)]
}
fn col_words(&self, c: usize) -> &[u64] {
let nw = self.n_rows.div_ceil(64);
// SAFETY: data_offsets[c] is always 8-byte aligned.
// PBMX header = 24 + n_cols×8 (multiple of 8); each PBIV blob =
// 16 + nwords×8 (multiple of 8); mmap base is page-aligned.
let ptr = self.mmap[self.data_offsets[c]..].as_ptr() as *const u64;
unsafe { std::slice::from_raw_parts(ptr, nw) }
}
pub(crate) fn col_slice(&self, c: usize) -> BitSliceView<'_> {
BitSliceView::new(self.col_words(c), self.n_rows)
}
pub(crate) fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentBitVecBuilder> {
PersistentBitVecBuilder::from_raw_bytes(self.col_bytes(c), self.n_rows, path)
}
pub(crate) fn count_ones(&self) -> Array1<u64> {
Array1::from_vec(
(0..self.n_cols).into_par_iter()
.map(|c| self.col_slice(c).count_ones())
.collect()
)
}
pub(crate) fn partial_jaccard_dist_matrix(&self) -> (Array2<u64>, Array2<u64>) {
pairwise2_matrix(self.n_cols, |i, j| {
self.col_slice(i).partial_jaccard_dist(self.col_slice(j))
})
}
pub(crate) fn partial_hamming_dist_matrix(&self) -> Array2<u64> {
pairwise_matrix(self.n_cols, |i, j| {
self.col_slice(i).hamming_dist(self.col_slice(j))
})
}
}
/// Reads just the `n_cols` field from an existing packed matrix's header,
/// without mapping the file. Used by `pack_bit_matrix` to tell a genuinely
/// complete pack from a stale one that predates a later column-widening.
fn packed_bit_matrix_n_cols(path: &Path) -> io::Result<usize> {
let mut f = File::open(path)?;
let mut header = [0u8; PBMX_HEADER];
f.read_exact(&mut header)?;
Ok(u64::from_le_bytes(header[16..24].try_into().unwrap()) as usize)
}
/// Build `presence/matrix.pbmx` from existing `col_*.pbiv` files.
pub fn pack_bit_matrix(dir: &Path) -> io::Result<()> {
let packed_path = dir.join("matrix.pbmx");
let meta = match MatrixMeta::load(dir) {
Ok(meta) => meta,
Err(e) => {
// No columnar data pending: either this layer was already
// packed and cleaned up (matrix.pbmx complete, nothing left to
// do), or genuinely nothing was ever written here.
return if packed_path.exists() { Ok(()) } else { Err(e) };
}
};
// A `matrix.pbmx` can already exist here even though columnar data is
// still pending — e.g. copied verbatim from a merge's base source
// before this layer was widened with more genome columns (see
// `obikpartitionner::merge_partition`). Only skip (re-)packing if the
// existing file already reflects the current column count; otherwise
// the columnar files are newer and must be (re-)packed, overwriting the
// stale one — never silently discarded as "leftover cleanup".
if packed_bit_matrix_n_cols(&packed_path).ok() == Some(meta.n_cols) {
for c in 0..meta.n_cols { let _ = fs::remove_file(col_path(dir, c)); }
let _ = fs::remove_file(dir.join("meta.json"));
return Ok(());
}
let n_cols = meta.n_cols;
// Compute offsets from file sizes — no column data loaded into RAM.
let col_sizes: Vec<u64> = (0..n_cols)
.map(|c| fs::metadata(col_path(dir, c)).map(|m| m.len()))
.collect::<io::Result<_>>()?;
let header_size = (PBMX_HEADER + n_cols * 8) as u64;
let mut col_offset = header_size;
let mut offsets = Vec::with_capacity(n_cols);
for &size in &col_sizes {
offsets.push(col_offset);
col_offset += size;
}
// Write to a temp file; rename atomically so a killed process never leaves
// a truncated matrix.pbmx that would be mistaken for a complete file.
let tmp_path = dir.join("matrix.pbmx.tmp");
let mut out = BufWriter::new(File::create(&tmp_path)?);
out.write_all(&PBMX_MAGIC)?;
out.write_all(&[0u8; 4])?;
out.write_all(&(meta.n as u64).to_le_bytes())?;
out.write_all(&(n_cols as u64).to_le_bytes())?;
for &off in &offsets { out.write_all(&off.to_le_bytes())?; }
for c in 0..n_cols {
io::copy(&mut File::open(col_path(dir, c))?, &mut out)?;
}
out.flush()?;
drop(out);
fs::rename(&tmp_path, &packed_path)?;
for c in 0..n_cols { fs::remove_file(col_path(dir, c))?; }
fs::remove_file(dir.join("meta.json"))?;
Ok(())
}
// ── PersistentBitMatrix — public enum ────────────────────────────────────────
/// Bit matrix that transparently handles columnar, packed, and implicit formats.
///
/// - `Columnar`: per-column `.pbiv` files (original format, used during build)
/// - `Packed`: single `matrix.pbmx` file (optimised for query — one `mmap`)
/// - `Implicit`: no file — all values are 1 (mono-genome presence/absence)
pub enum PersistentBitMatrix {
Columnar(ColumnarBitMatrix),
Packed(PackedBitMatrix),
Implicit { n_rows: usize, n_cols: usize },
}
impl PersistentBitMatrix {
/// Open from `layer_dir`, auto-detecting the format.
///
/// Checks (in order):
/// 1. `layer_dir/presence/matrix.pbmx` → Packed
/// 2. `layer_dir/presence/meta.json` → Columnar
/// 3. `layer_dir/layer_meta.json` → Implicit (new index)
/// 4. `layer_dir/unitigs.bin` → Implicit with warning (old index)
pub fn open(layer_dir: &Path) -> io::Result<Self> {
let presence_dir = layer_dir.join("presence");
if presence_dir.join("matrix.pbmx").exists() {
return Ok(Self::Packed(PackedBitMatrix::open(&presence_dir.join("matrix.pbmx"))?));
}
if MatrixMeta::load(&presence_dir).is_ok() {
return Ok(Self::Columnar(ColumnarBitMatrix::open(&presence_dir)?));
}
// No presence matrix → Implicit; requires layer_meta.json
let meta = LayerMeta::load(layer_dir).map_err(|_| io::Error::new(
io::ErrorKind::NotFound,
format!(
"no presence matrix and no layer_meta.json in {} — run 'obikmer upgrade'",
layer_dir.display()
),
))?;
Ok(Self::Implicit { n_rows: meta.n, n_cols: 1 })
}
pub fn n(&self) -> usize {
match self {
Self::Columnar(m) => m.n(),
Self::Packed(m) => m.n_rows,
Self::Implicit { n_rows, .. } => *n_rows,
}
}
pub fn n_cols(&self) -> usize {
match self {
Self::Columnar(m) => m.n_cols(),
Self::Packed(m) => m.n_cols,
Self::Implicit { n_cols, .. } => *n_cols,
}
}
pub fn col(&self, c: usize) -> &PersistentBitVec {
match self {
Self::Columnar(m) => m.col(c),
_ => panic!("col() only available on Columnar PersistentBitMatrix"),
}
}
pub fn col_view(&self, c: usize) -> BitSliceView<'_> {
match self {
Self::Columnar(m) => m.col(c).view(),
Self::Packed(m) => m.col_slice(c),
Self::Implicit { .. } => panic!("col_view() not available on Implicit PersistentBitMatrix"),
}
}
/// Column-major point lookup: value at column `c`, slot `slot`, as 0/1.
///
/// Unlike [`col_view`](Self::col_view), this never panics on `Implicit`
/// (every column reads as present, per the mono-genome fast path) — safe
/// to call for any `c < self.n_cols()`.
pub fn get(&self, c: usize, slot: usize) -> u32 {
match self {
Self::Columnar(m) => m.col(c).get(slot) as u32,
Self::Packed(m) => m.col_slice(c).get(slot) as u32,
Self::Implicit { .. } => 1,
}
}
pub fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentBitVecBuilder> {
match self {
Self::Columnar(m) => PersistentBitVecBuilder::build_from(m.col(c), path),
Self::Packed(m) => m.col_persist(c, path),
Self::Implicit { n_rows, .. } => {
PersistentBitVecBuilder::new_ones(*n_rows, path)
}
}
}
pub fn row(&self, slot: usize) -> Box<[bool]> {
match self {
Self::Columnar(m) => m.row(slot),
Self::Packed(m) => m.row(slot),
Self::Implicit { n_cols, .. } => vec![true; *n_cols].into_boxed_slice(),
}
}
/// Fill `buf[i]` with `col_i[slot]` as 0/1 u32, without allocating.
pub fn fill_row(&self, slot: usize, buf: &mut [u32]) {
match self {
Self::Columnar(m) => m.fill_row(slot, buf),
Self::Packed(m) => m.fill_row(slot, buf),
Self::Implicit { n_cols, .. } => buf[..*n_cols].fill(1),
}
}
pub fn count_ones(&self) -> Array1<u64> {
match self {
Self::Columnar(m) => m.count_ones(),
Self::Packed(m) => m.count_ones(),
Self::Implicit { n_rows, n_cols } => Array1::from_elem(*n_cols, *n_rows as u64),
}
}
pub fn partial_jaccard_dist_matrix(&self) -> (Array2<u64>, Array2<u64>) {
match self {
Self::Columnar(m) => m.partial_jaccard_dist_matrix(),
Self::Packed(m) => m.partial_jaccard_dist_matrix(),
Self::Implicit { n_rows, n_cols } => {
let v = *n_rows as u64;
let n = *n_cols;
let mut inter = Array2::zeros((n, n));
let mut union = Array2::zeros((n, n));
for i in 0..n { for j in 0..n {
inter[[i, j]] = v; union[[i, j]] = v;
}}
(inter, union)
}
}
}
pub fn partial_hamming_dist_matrix(&self) -> Array2<u64> {
match self {
Self::Columnar(m) => m.partial_hamming_dist_matrix(),
Self::Packed(m) => m.partial_hamming_dist_matrix(),
Self::Implicit { n_cols, .. } => Array2::zeros((*n_cols, *n_cols)),
}
}
/// Append a new column to an on-disk Columnar matrix.
pub fn append_column(dir: &Path, value_of: impl Fn(usize) -> bool) -> io::Result<()> {
ColumnarBitMatrix::append_column(dir, value_of)
}
}
// ── Trait impls ───────────────────────────────────────────────────────────────
use crate::traits::{BitPartials, ColumnWeights};
impl ColumnWeights for PersistentBitMatrix {
fn col_weights(&self) -> Array1<u64> { self.count_ones() }
}
impl BitPartials for PersistentBitMatrix {
fn partial_jaccard(&self) -> (Array2<u64>, Array2<u64>) {
self.partial_jaccard_dist_matrix()
}
fn partial_hamming(&self) -> Array2<u64> {
self.partial_hamming_dist_matrix()
}
}
// ── Builder (unchanged — always builds Columnar) ──────────────────────────────
pub struct PersistentBitMatrixBuilder {
dir: PathBuf,
n: usize,
n_cols: usize,
}
impl PersistentBitMatrixBuilder {
pub fn new(n: usize, dir: &Path) -> io::Result<Self> {
fs::create_dir_all(dir)?;
Ok(Self { dir: dir.to_path_buf(), n, n_cols: 0 })
}
pub fn n(&self) -> usize { self.n }
pub fn n_cols(&self) -> usize { self.n_cols }
pub fn add_col(&mut self) -> io::Result<PersistentBitVecBuilder> {
let path = col_path(&self.dir, self.n_cols);
self.n_cols += 1;
PersistentBitVecBuilder::new(self.n, &path)
}
pub fn add_col_ones(&mut self) -> io::Result<PersistentBitVecBuilder> {
let path = col_path(&self.dir, self.n_cols);
self.n_cols += 1;
PersistentBitVecBuilder::new_ones(self.n, &path)
}
pub fn add_col_from(&mut self, src: &TempBitVec) -> io::Result<()> {
src.make_persistent(&col_path(&self.dir, self.n_cols))?;
self.n_cols += 1;
Ok(())
}
pub fn add_col_from_int(&mut self, src: &TempCompactIntVec) -> io::Result<()> {
let path = col_path(&self.dir, self.n_cols);
self.n_cols += 1;
let mut b = PersistentBitVecBuilder::new(self.n, &path)?;
b.or_where(src.view(), |v| v > 0);
b.close()
}
pub fn close(self) -> io::Result<()> {
MatrixMeta { n: self.n, n_cols: self.n_cols }.save(&self.dir)
}
}
// ── MatrixGroupOps ────────────────────────────────────────────────────────────
impl MatrixGroupOps for PersistentBitMatrix {
fn partial_group_presence_count(&self, g: &ColGroup, _threshold: u32) -> io::Result<TempCompactIntVec> {
// Bit matrices store 0/1 — threshold is structurally always 1.
let n = self.n();
if g.indices.len() < 255 {
let mut builder = TempCompactIntVecBuilder::new(n)?;
for &c in &g.indices {
builder.inc_present_fast(self.col_view(c));
}
builder.freeze()
} else {
let mut result = TempCompactIntVecBuilder::new(n)?;
for chunk in g.indices.chunks(254) {
let mut chunk_b = TempCompactIntVecBuilder::new(n)?;
for &c in chunk {
chunk_b.inc_present_fast(self.col_view(c));
}
let frozen = chunk_b.freeze()?;
result.add(frozen.view());
}
result.freeze()
}
}
fn partial_group_sum(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
// For bit matrices, sum = count of 1-bits — identical to presence_count.
self.partial_group_presence_count(g, 1)
}
fn partial_group_any(&self, g: &ColGroup, _threshold: u32) -> io::Result<TempBitVec> {
let n = self.n();
let mut result = TempBitVecBuilder::new(n)?;
for &c in &g.indices {
result.or(self.col_view(c));
}
result.freeze()
}
fn partial_group_min(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
// min of 0/1 values = AND: 1 only if ALL columns are 1
let n = self.n();
let mut result = TempCompactIntVecBuilder::new(n)?;
if let Some((&first, rest)) = g.indices.split_first() {
result.inc_present_fast(self.col_view(first));
for &c in rest { result.mask_with(self.col_view(c)); }
}
result.freeze()
}
fn partial_group_max(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
// max of 0/1 values = OR: 1 if any column is 1
let any = self.partial_group_any(g, 1)?;
let n = any.len();
let mut result = TempCompactIntVecBuilder::new(n)?;
result.inc_present(any.view());
result.freeze()
}
}
// ── Shared matrix helpers (also used by intmatrix.rs) ─────────────────────────
fn upper_pairs(n: usize) -> Vec<(usize, usize)> {
(0..n).flat_map(|i| (i + 1..n).map(move |j| (i, j))).collect()
}
fn fill_symmetric<T>(n: usize, vals: impl Iterator<Item = (usize, usize, T, T)>) -> Array2<T>
where T: Clone + Default {
let mut m = Array2::from_elem((n, n), T::default());
for (i, j, vij, vji) in vals { m[[i, j]] = vij; m[[j, i]] = vji; }
m
}
/// Compute a symmetric `n×n` matrix in parallel by evaluating `f(i,j)` for
/// all upper-triangle pairs, plus `f(i,i)` for the diagonal. `T: Copy` avoids
/// the `.clone()` needed for the lower-triangle mirror.
///
/// The diagonal is *not* generally `T::default()`: for a self-comparison,
/// `f(i,i)` is often the column's own weight (e.g. intersection-with-self —
/// see `pairwise2_matrix`), not zero. Distance finalisations that need a
/// zero diagonal (self-distance) already overwrite it explicitly.
pub(crate) fn pairwise_matrix<T>(n: usize, f: impl Fn(usize, usize) -> T + Sync) -> Array2<T>
where T: Copy + Default + Send {
let results: Vec<(usize, usize, T)> = upper_pairs(n)
.into_par_iter().map(|(i, j)| (i, j, f(i, j))).collect();
let mut m = fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)));
for i in 0..n { m[[i, i]] = f(i, i); }
m
}
/// Same as `pairwise_matrix` but `f` returns two values that fill two
/// symmetric matrices simultaneously (e.g. intersection + union for Jaccard).
/// The diagonal is `f(i,i)` (e.g. a genome's kmer count intersected with
/// itself), not `T::default()` — see `pairwise_matrix` for why that matters.
pub(crate) fn pairwise2_matrix<T>(n: usize, f: impl Fn(usize, usize) -> (T, T) + Sync) -> (Array2<T>, Array2<T>)
where T: Copy + Default + Send {
let results: Vec<(usize, usize, T, T)> = upper_pairs(n)
.into_par_iter()
.map(|(i, j)| { let (a, b) = f(i, j); (i, j, a, b) })
.collect();
let mut m0 = Array2::from_elem((n, n), T::default());
let mut m1 = Array2::from_elem((n, n), T::default());
for (i, j, a, b) in results {
m0[[i, j]] = a; m0[[j, i]] = a;
m1[[i, j]] = b; m1[[j, i]] = b;
}
for i in 0..n {
let (a, b) = f(i, i);
m0[[i, i]] = a;
m1[[i, i]] = b;
}
(m0, m1)
}
@@ -0,0 +1,58 @@
use std::fs;
use std::io;
use std::path::{Path, PathBuf};
use crate::bitvec::PersistentBitVecBuilder;
use crate::meta::MatrixMeta;
use crate::tempbitvec::TempBitVec;
use crate::tempintvec::TempCompactIntVec;
use super::col_path;
// ── Builder (unchanged — always builds Columnar) ──────────────────────────────
pub struct PersistentBitMatrixBuilder {
dir: PathBuf,
n: usize,
n_cols: usize,
}
impl PersistentBitMatrixBuilder {
pub fn new(n: usize, dir: &Path) -> io::Result<Self> {
fs::create_dir_all(dir)?;
Ok(Self { dir: dir.to_path_buf(), n, n_cols: 0 })
}
pub fn n(&self) -> usize { self.n }
pub fn n_cols(&self) -> usize { self.n_cols }
pub fn add_col(&mut self) -> io::Result<PersistentBitVecBuilder> {
let path = col_path(&self.dir, self.n_cols);
self.n_cols += 1;
PersistentBitVecBuilder::new(self.n, &path)
}
pub fn add_col_ones(&mut self) -> io::Result<PersistentBitVecBuilder> {
let path = col_path(&self.dir, self.n_cols);
self.n_cols += 1;
PersistentBitVecBuilder::new_ones(self.n, &path)
}
pub fn add_col_from(&mut self, src: &TempBitVec) -> io::Result<()> {
src.make_persistent(&col_path(&self.dir, self.n_cols))?;
self.n_cols += 1;
Ok(())
}
pub fn add_col_from_int(&mut self, src: &TempCompactIntVec) -> io::Result<()> {
let path = col_path(&self.dir, self.n_cols);
self.n_cols += 1;
let mut b = PersistentBitVecBuilder::new(self.n, &path)?;
b.or_where(src.view(), |v| v > 0);
b.close()
}
pub fn close(self) -> io::Result<()> {
MatrixMeta { n: self.n, n_cols: self.n_cols }.save(&self.dir)
}
}
@@ -0,0 +1,70 @@
use std::io;
use std::path::Path;
use ndarray::{Array1, Array2};
use rayon::prelude::*;
use crate::bitvec::{PersistentBitVec, PersistentBitVecBuilder};
use crate::meta::MatrixMeta;
use super::col_path;
use super::pairwise::{pairwise_matrix, pairwise2_matrix};
// ── ColumnarBitMatrix ─────────────────────────────────────────────────────────
/// Per-column file layout (original format).
pub struct ColumnarBitMatrix {
cols: Vec<PersistentBitVec>,
n: usize,
}
impl ColumnarBitMatrix {
pub(crate) fn open(dir: &Path) -> io::Result<Self> {
let meta = MatrixMeta::load(dir)?;
let cols = (0..meta.n_cols)
.map(|c| PersistentBitVec::open(&col_path(dir, c)))
.collect::<io::Result<Vec<_>>>()?;
Ok(Self { cols, n: meta.n })
}
pub(crate) fn n(&self) -> usize { self.n }
pub(crate) fn n_cols(&self) -> usize { self.cols.len() }
pub(crate) fn col(&self, c: usize) -> &PersistentBitVec { &self.cols[c] }
pub(crate) fn row(&self, slot: usize) -> Box<[bool]> {
self.cols.iter().map(|c| c.get(slot)).collect()
}
pub(crate) fn fill_row(&self, slot: usize, buf: &mut [u32]) {
for (c, col) in self.cols.iter().enumerate() {
buf[c] = col.get(slot) as u32;
}
}
pub(crate) fn count_ones(&self) -> Array1<u64> {
let counts: Vec<u64> = (0..self.n_cols())
.into_par_iter()
.map(|c| self.col(c).count_ones())
.collect();
Array1::from_vec(counts)
}
pub(crate) fn partial_jaccard_dist_matrix(&self) -> (Array2<u64>, Array2<u64>) {
pairwise2_matrix(self.n_cols(), |i, j| self.col(i).partial_jaccard_dist(self.col(j)))
}
pub(crate) fn partial_hamming_dist_matrix(&self) -> Array2<u64> {
pairwise_matrix(self.n_cols(), |i, j| self.col(i).hamming_dist(self.col(j)))
}
pub(crate) fn append_column(dir: &Path, value_of: impl Fn(usize) -> bool) -> io::Result<()> {
let mut meta = MatrixMeta::load(dir)?;
let mut b = PersistentBitVecBuilder::new(meta.n, &col_path(dir, meta.n_cols))?;
for slot in 0..meta.n {
b.set(slot, value_of(slot));
}
b.close()?;
meta.n_cols += 1;
meta.save(dir)
}
}
@@ -0,0 +1,68 @@
use std::io;
use crate::colgroup::{ColGroup, MatrixGroupOps};
use crate::tempbitvec::{TempBitVec, TempBitVecBuilder};
use crate::tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
use super::persistent::PersistentBitMatrix;
// ── MatrixGroupOps ────────────────────────────────────────────────────────────
impl MatrixGroupOps for PersistentBitMatrix {
fn partial_group_presence_count(&self, g: &ColGroup, _threshold: u32) -> io::Result<TempCompactIntVec> {
// Bit matrices store 0/1 — threshold is structurally always 1.
let n = self.n();
if g.indices.len() < 255 {
let mut builder = TempCompactIntVecBuilder::new(n)?;
for &c in &g.indices {
builder.inc_present_fast(self.col_view(c));
}
builder.freeze()
} else {
let mut result = TempCompactIntVecBuilder::new(n)?;
for chunk in g.indices.chunks(254) {
let mut chunk_b = TempCompactIntVecBuilder::new(n)?;
for &c in chunk {
chunk_b.inc_present_fast(self.col_view(c));
}
let frozen = chunk_b.freeze()?;
result.add(frozen.view());
}
result.freeze()
}
}
fn partial_group_sum(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
// For bit matrices, sum = count of 1-bits — identical to presence_count.
self.partial_group_presence_count(g, 1)
}
fn partial_group_any(&self, g: &ColGroup, _threshold: u32) -> io::Result<TempBitVec> {
let n = self.n();
let mut result = TempBitVecBuilder::new(n)?;
for &c in &g.indices {
result.or(self.col_view(c));
}
result.freeze()
}
fn partial_group_min(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
// min of 0/1 values = AND: 1 only if ALL columns are 1
let n = self.n();
let mut result = TempCompactIntVecBuilder::new(n)?;
if let Some((&first, rest)) = g.indices.split_first() {
result.inc_present_fast(self.col_view(first));
for &c in rest { result.mask_with(self.col_view(c)); }
}
result.freeze()
}
fn partial_group_max(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
// max of 0/1 values = OR: 1 if any column is 1
let any = self.partial_group_any(g, 1)?;
let n = any.len();
let mut result = TempCompactIntVecBuilder::new(n)?;
result.inc_present(any.view());
result.freeze()
}
}
+29
View File
@@ -0,0 +1,29 @@
//! Bit matrices (presence/absence), in three on-disk formats transparently
//! handled by [`PersistentBitMatrix`]: per-column `Columnar`, single-file
//! mmap'd `Packed`, and implicit (mono-genome, no file at all).
//!
//! Submodules: [`columnar`] (build-time per-column format), [`packed`]
//! (query-optimised single-mmap format + [`pack_bit_matrix`]),
//! [`persistent`] (the format-dispatching [`PersistentBitMatrix`] enum),
//! [`builder`] ([`PersistentBitMatrixBuilder`], always builds Columnar),
//! [`group_ops`] (`MatrixGroupOps` impl), [`pairwise`] (shared symmetric
//! pairwise-matrix helpers, also used by `intmatrix.rs`).
use std::path::{Path, PathBuf};
mod builder;
mod columnar;
mod group_ops;
mod packed;
mod pairwise;
mod persistent;
pub use builder::PersistentBitMatrixBuilder;
pub use packed::pack_bit_matrix;
pub use persistent::PersistentBitMatrix;
pub(crate) use pairwise::{pairwise_matrix, pairwise2_matrix};
fn col_path(dir: &Path, col: usize) -> PathBuf {
dir.join(format!("col_{col:06}.pbiv"))
}
+181
View File
@@ -0,0 +1,181 @@
use std::fs::{self, File};
use std::io::{self, BufWriter, Read as _, Write as _};
use std::path::Path;
use memmap2::Mmap;
use ndarray::{Array1, Array2};
use rayon::prelude::*;
use crate::bitvec::PersistentBitVecBuilder;
use crate::meta::MatrixMeta;
use crate::views::BitSliceView;
use super::col_path;
use super::pairwise::{pairwise_matrix, pairwise2_matrix};
// ── PackedBitMatrix ───────────────────────────────────────────────────────────
const PBMX_MAGIC: [u8; 4] = *b"PBMX";
const PBMX_HEADER: usize = 24; // magic(4) + pad(4) + n_rows(8) + n_cols(8)
const PBIV_HEADER: usize = 16; // magic(4) + pad(4) + n(8)
/// Single-file packed layout: all columns concatenated behind a header.
pub struct PackedBitMatrix {
mmap: Mmap,
pub(super) n_rows: usize,
pub(super) n_cols: usize,
/// Absolute byte offset to the start of each column's bit data
/// (= file offset of the PBIV blob + PBIV_HEADER).
data_offsets: Vec<usize>,
}
impl PackedBitMatrix {
pub(crate) fn open(path: &Path) -> io::Result<Self> {
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
if mmap.len() < PBMX_HEADER {
return Err(io::Error::new(io::ErrorKind::InvalidData, "PBMX file too short"));
}
if &mmap[0..4] != &PBMX_MAGIC {
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PBMX magic"));
}
let n_rows = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
let n_cols = u64::from_le_bytes(mmap[16..24].try_into().unwrap()) as usize;
let mut data_offsets = Vec::with_capacity(n_cols);
for c in 0..n_cols {
let off_pos = PBMX_HEADER + c * 8;
let col_file_off = u64::from_le_bytes(mmap[off_pos..off_pos+8].try_into().unwrap()) as usize;
data_offsets.push(col_file_off + PBIV_HEADER);
}
Ok(Self { mmap, n_rows, n_cols, data_offsets })
}
#[inline]
pub(crate) fn fill_row(&self, slot: usize, buf: &mut [u32]) {
for (c, &data_off) in self.data_offsets.iter().enumerate() {
buf[c] = ((self.mmap[data_off + (slot >> 3)] >> (slot & 7)) & 1) as u32;
}
}
pub(crate) fn row(&self, slot: usize) -> Box<[bool]> {
(0..self.n_cols).map(|c| {
(self.mmap[self.data_offsets[c] + (slot >> 3)] >> (slot & 7)) & 1 != 0
}).collect()
}
fn col_bytes(&self, c: usize) -> &[u8] {
let start = self.data_offsets[c];
&self.mmap[start..start + self.n_rows.div_ceil(8)]
}
fn col_words(&self, c: usize) -> &[u64] {
let nw = self.n_rows.div_ceil(64);
// SAFETY: data_offsets[c] is always 8-byte aligned.
// PBMX header = 24 + n_cols×8 (multiple of 8); each PBIV blob =
// 16 + nwords×8 (multiple of 8); mmap base is page-aligned.
let ptr = self.mmap[self.data_offsets[c]..].as_ptr() as *const u64;
unsafe { std::slice::from_raw_parts(ptr, nw) }
}
pub(crate) fn col_slice(&self, c: usize) -> BitSliceView<'_> {
BitSliceView::new(self.col_words(c), self.n_rows)
}
pub(crate) fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentBitVecBuilder> {
PersistentBitVecBuilder::from_raw_bytes(self.col_bytes(c), self.n_rows, path)
}
pub(crate) fn count_ones(&self) -> Array1<u64> {
Array1::from_vec(
(0..self.n_cols).into_par_iter()
.map(|c| self.col_slice(c).count_ones())
.collect()
)
}
pub(crate) fn partial_jaccard_dist_matrix(&self) -> (Array2<u64>, Array2<u64>) {
pairwise2_matrix(self.n_cols, |i, j| {
self.col_slice(i).partial_jaccard_dist(self.col_slice(j))
})
}
pub(crate) fn partial_hamming_dist_matrix(&self) -> Array2<u64> {
pairwise_matrix(self.n_cols, |i, j| {
self.col_slice(i).hamming_dist(self.col_slice(j))
})
}
}
/// Reads just the `n_cols` field from an existing packed matrix's header,
/// without mapping the file. Used by `pack_bit_matrix` to tell a genuinely
/// complete pack from a stale one that predates a later column-widening.
fn packed_bit_matrix_n_cols(path: &Path) -> io::Result<usize> {
let mut f = File::open(path)?;
let mut header = [0u8; PBMX_HEADER];
f.read_exact(&mut header)?;
Ok(u64::from_le_bytes(header[16..24].try_into().unwrap()) as usize)
}
/// Build `presence/matrix.pbmx` from existing `col_*.pbiv` files.
pub fn pack_bit_matrix(dir: &Path) -> io::Result<()> {
let packed_path = dir.join("matrix.pbmx");
let meta = match MatrixMeta::load(dir) {
Ok(meta) => meta,
Err(e) => {
// No columnar data pending: either this layer was already
// packed and cleaned up (matrix.pbmx complete, nothing left to
// do), or genuinely nothing was ever written here.
return if packed_path.exists() { Ok(()) } else { Err(e) };
}
};
// A `matrix.pbmx` can already exist here even though columnar data is
// still pending — e.g. copied verbatim from a merge's base source
// before this layer was widened with more genome columns (see
// `obikpartitionner::merge_partition`). Only skip (re-)packing if the
// existing file already reflects the current column count; otherwise
// the columnar files are newer and must be (re-)packed, overwriting the
// stale one — never silently discarded as "leftover cleanup".
if packed_bit_matrix_n_cols(&packed_path).ok() == Some(meta.n_cols) {
for c in 0..meta.n_cols { let _ = fs::remove_file(col_path(dir, c)); }
let _ = fs::remove_file(dir.join("meta.json"));
return Ok(());
}
let n_cols = meta.n_cols;
// Compute offsets from file sizes — no column data loaded into RAM.
let col_sizes: Vec<u64> = (0..n_cols)
.map(|c| fs::metadata(col_path(dir, c)).map(|m| m.len()))
.collect::<io::Result<_>>()?;
let header_size = (PBMX_HEADER + n_cols * 8) as u64;
let mut col_offset = header_size;
let mut offsets = Vec::with_capacity(n_cols);
for &size in &col_sizes {
offsets.push(col_offset);
col_offset += size;
}
// Write to a temp file; rename atomically so a killed process never leaves
// a truncated matrix.pbmx that would be mistaken for a complete file.
let tmp_path = dir.join("matrix.pbmx.tmp");
let mut out = BufWriter::new(File::create(&tmp_path)?);
out.write_all(&PBMX_MAGIC)?;
out.write_all(&[0u8; 4])?;
out.write_all(&(meta.n as u64).to_le_bytes())?;
out.write_all(&(n_cols as u64).to_le_bytes())?;
for &off in &offsets { out.write_all(&off.to_le_bytes())?; }
for c in 0..n_cols {
io::copy(&mut File::open(col_path(dir, c))?, &mut out)?;
}
out.flush()?;
drop(out);
fs::rename(&tmp_path, &packed_path)?;
for c in 0..n_cols { fs::remove_file(col_path(dir, c))?; }
fs::remove_file(dir.join("meta.json"))?;
Ok(())
}
@@ -0,0 +1,56 @@
use ndarray::Array2;
use rayon::prelude::*;
// ── Shared matrix helpers (also used by intmatrix.rs) ─────────────────────────
fn upper_pairs(n: usize) -> Vec<(usize, usize)> {
(0..n).flat_map(|i| (i + 1..n).map(move |j| (i, j))).collect()
}
fn fill_symmetric<T>(n: usize, vals: impl Iterator<Item = (usize, usize, T, T)>) -> Array2<T>
where T: Clone + Default {
let mut m = Array2::from_elem((n, n), T::default());
for (i, j, vij, vji) in vals { m[[i, j]] = vij; m[[j, i]] = vji; }
m
}
/// Compute a symmetric `n×n` matrix in parallel by evaluating `f(i,j)` for
/// all upper-triangle pairs, plus `f(i,i)` for the diagonal. `T: Copy` avoids
/// the `.clone()` needed for the lower-triangle mirror.
///
/// The diagonal is *not* generally `T::default()`: for a self-comparison,
/// `f(i,i)` is often the column's own weight (e.g. intersection-with-self —
/// see `pairwise2_matrix`), not zero. Distance finalisations that need a
/// zero diagonal (self-distance) already overwrite it explicitly.
pub(crate) fn pairwise_matrix<T>(n: usize, f: impl Fn(usize, usize) -> T + Sync) -> Array2<T>
where T: Copy + Default + Send {
let results: Vec<(usize, usize, T)> = upper_pairs(n)
.into_par_iter().map(|(i, j)| (i, j, f(i, j))).collect();
let mut m = fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)));
for i in 0..n { m[[i, i]] = f(i, i); }
m
}
/// Same as `pairwise_matrix` but `f` returns two values that fill two
/// symmetric matrices simultaneously (e.g. intersection + union for Jaccard).
/// The diagonal is `f(i,i)` (e.g. a genome's kmer count intersected with
/// itself), not `T::default()` — see `pairwise_matrix` for why that matters.
pub(crate) fn pairwise2_matrix<T>(n: usize, f: impl Fn(usize, usize) -> (T, T) + Sync) -> (Array2<T>, Array2<T>)
where T: Copy + Default + Send {
let results: Vec<(usize, usize, T, T)> = upper_pairs(n)
.into_par_iter()
.map(|(i, j)| { let (a, b) = f(i, j); (i, j, a, b) })
.collect();
let mut m0 = Array2::from_elem((n, n), T::default());
let mut m1 = Array2::from_elem((n, n), T::default());
for (i, j, a, b) in results {
m0[[i, j]] = a; m0[[j, i]] = a;
m1[[i, j]] = b; m1[[j, i]] = b;
}
for i in 0..n {
let (a, b) = f(i, i);
m0[[i, i]] = a;
m1[[i, i]] = b;
}
(m0, m1)
}
@@ -0,0 +1,181 @@
use std::io;
use std::path::Path;
use ndarray::{Array1, Array2};
use crate::bitvec::{PersistentBitVec, PersistentBitVecBuilder};
use crate::layer_meta::LayerMeta;
use crate::meta::MatrixMeta;
use crate::traits::{BitPartials, ColumnWeights};
use crate::views::BitSliceView;
use super::columnar::ColumnarBitMatrix;
use super::packed::PackedBitMatrix;
// ── PersistentBitMatrix — public enum ────────────────────────────────────────
/// Bit matrix that transparently handles columnar, packed, and implicit formats.
///
/// - `Columnar`: per-column `.pbiv` files (original format, used during build)
/// - `Packed`: single `matrix.pbmx` file (optimised for query — one `mmap`)
/// - `Implicit`: no file — all values are 1 (mono-genome presence/absence)
pub enum PersistentBitMatrix {
Columnar(ColumnarBitMatrix),
Packed(PackedBitMatrix),
Implicit { n_rows: usize, n_cols: usize },
}
impl PersistentBitMatrix {
/// Open from `layer_dir`, auto-detecting the format.
///
/// Checks (in order):
/// 1. `layer_dir/presence/matrix.pbmx` → Packed
/// 2. `layer_dir/presence/meta.json` → Columnar
/// 3. `layer_dir/layer_meta.json` → Implicit (new index)
/// 4. `layer_dir/unitigs.bin` → Implicit with warning (old index)
pub fn open(layer_dir: &Path) -> io::Result<Self> {
let presence_dir = layer_dir.join("presence");
if presence_dir.join("matrix.pbmx").exists() {
return Ok(Self::Packed(PackedBitMatrix::open(&presence_dir.join("matrix.pbmx"))?));
}
if MatrixMeta::load(&presence_dir).is_ok() {
return Ok(Self::Columnar(ColumnarBitMatrix::open(&presence_dir)?));
}
// No presence matrix → Implicit; requires layer_meta.json
let meta = LayerMeta::load(layer_dir).map_err(|_| io::Error::new(
io::ErrorKind::NotFound,
format!(
"no presence matrix and no layer_meta.json in {} — run 'obikmer upgrade'",
layer_dir.display()
),
))?;
Ok(Self::Implicit { n_rows: meta.n, n_cols: 1 })
}
pub fn n(&self) -> usize {
match self {
Self::Columnar(m) => m.n(),
Self::Packed(m) => m.n_rows,
Self::Implicit { n_rows, .. } => *n_rows,
}
}
pub fn n_cols(&self) -> usize {
match self {
Self::Columnar(m) => m.n_cols(),
Self::Packed(m) => m.n_cols,
Self::Implicit { n_cols, .. } => *n_cols,
}
}
pub fn col(&self, c: usize) -> &PersistentBitVec {
match self {
Self::Columnar(m) => m.col(c),
_ => panic!("col() only available on Columnar PersistentBitMatrix"),
}
}
pub fn col_view(&self, c: usize) -> BitSliceView<'_> {
match self {
Self::Columnar(m) => m.col(c).view(),
Self::Packed(m) => m.col_slice(c),
Self::Implicit { .. } => panic!("col_view() not available on Implicit PersistentBitMatrix"),
}
}
/// Column-major point lookup: value at column `c`, slot `slot`, as 0/1.
///
/// Unlike [`col_view`](Self::col_view), this never panics on `Implicit`
/// (every column reads as present, per the mono-genome fast path) — safe
/// to call for any `c < self.n_cols()`.
pub fn get(&self, c: usize, slot: usize) -> u32 {
match self {
Self::Columnar(m) => m.col(c).get(slot) as u32,
Self::Packed(m) => m.col_slice(c).get(slot) as u32,
Self::Implicit { .. } => 1,
}
}
pub fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentBitVecBuilder> {
match self {
Self::Columnar(m) => PersistentBitVecBuilder::build_from(m.col(c), path),
Self::Packed(m) => m.col_persist(c, path),
Self::Implicit { n_rows, .. } => {
PersistentBitVecBuilder::new_ones(*n_rows, path)
}
}
}
pub fn row(&self, slot: usize) -> Box<[bool]> {
match self {
Self::Columnar(m) => m.row(slot),
Self::Packed(m) => m.row(slot),
Self::Implicit { n_cols, .. } => vec![true; *n_cols].into_boxed_slice(),
}
}
/// Fill `buf[i]` with `col_i[slot]` as 0/1 u32, without allocating.
pub fn fill_row(&self, slot: usize, buf: &mut [u32]) {
match self {
Self::Columnar(m) => m.fill_row(slot, buf),
Self::Packed(m) => m.fill_row(slot, buf),
Self::Implicit { n_cols, .. } => buf[..*n_cols].fill(1),
}
}
pub fn count_ones(&self) -> Array1<u64> {
match self {
Self::Columnar(m) => m.count_ones(),
Self::Packed(m) => m.count_ones(),
Self::Implicit { n_rows, n_cols } => Array1::from_elem(*n_cols, *n_rows as u64),
}
}
pub fn partial_jaccard_dist_matrix(&self) -> (Array2<u64>, Array2<u64>) {
match self {
Self::Columnar(m) => m.partial_jaccard_dist_matrix(),
Self::Packed(m) => m.partial_jaccard_dist_matrix(),
Self::Implicit { n_rows, n_cols } => {
let v = *n_rows as u64;
let n = *n_cols;
let mut inter = Array2::zeros((n, n));
let mut union = Array2::zeros((n, n));
for i in 0..n { for j in 0..n {
inter[[i, j]] = v; union[[i, j]] = v;
}}
(inter, union)
}
}
}
pub fn partial_hamming_dist_matrix(&self) -> Array2<u64> {
match self {
Self::Columnar(m) => m.partial_hamming_dist_matrix(),
Self::Packed(m) => m.partial_hamming_dist_matrix(),
Self::Implicit { n_cols, .. } => Array2::zeros((*n_cols, *n_cols)),
}
}
/// Append a new column to an on-disk Columnar matrix.
pub fn append_column(dir: &Path, value_of: impl Fn(usize) -> bool) -> io::Result<()> {
ColumnarBitMatrix::append_column(dir, value_of)
}
}
// ── Trait impls ───────────────────────────────────────────────────────────────
impl ColumnWeights for PersistentBitMatrix {
fn col_weights(&self) -> Array1<u64> { self.count_ones() }
}
impl BitPartials for PersistentBitMatrix {
fn partial_jaccard(&self) -> (Array2<u64>, Array2<u64>) {
self.partial_jaccard_dist_matrix()
}
fn partial_hamming(&self) -> Array2<u64> {
self.partial_hamming_dist_matrix()
}
}
@@ -1,250 +1,24 @@
//use ahash::RandomState;
use crossbeam_channel;
use hashbrown::HashMap;
use obikseq::k;
use obikseq::{CanonicalKmer, Sequence, Unitig};
use obikseq::{CanonicalKmer, Unitig};
#[cfg(not(any(test, feature = "test-utils")))]
use rayon::iter::{IntoParallelRefIterator, ParallelIterator};
use std::cell::RefCell;
use std::fmt;
use std::sync::atomic::{AtomicU8, Ordering};
use xxhash_rust::xxh3::Xxh3Builder;
use super::node::{IS_VISITED_MASK, Node};
use super::unitig_iter::UnitigNucIter;
use super::walk::WalkState;
// ── Types ─────────────────────────────────────────────────────────────────────
type FastHashMap<K, V> = HashMap<K, V, Xxh3Builder>;
// ── Node ──────────────────────────────────────────────────────────────────────
//
// bit layout (LSB first):
// bit 0 : can_extend_right — exactly one right canonical neighbour exists
// bit 1 : can_extend_left — exactly one left canonical neighbour exists
// bit 2 : visited
// bits 3–4 : right_nuc — index 0–3 (A/C/G/T) of that neighbour; valid iff bit 0 = 1
// bits 5–6 : left_nuc — index 0–3 (A/C/G/T) of that neighbour; valid iff bit 1 = 1
// bit 7 : marked as start node (1)
//
// "can_extend" = false covers both 0 neighbours and ≥2 neighbours; the only
// information needed for traversal is "exactly one".
#[repr(transparent)]
#[derive(Debug, Clone, Copy, Default)]
pub struct Node(u8);
const CAN_EXTEND_RIGHT_MASK: u8 = 0b0000_0001; // bit 0: can_extend_right — exactly one right canonical neighbour exists
const CAN_EXTEND_LEFT_MASK: u8 = 0b0000_0010; // bit 1: can_extend_left — exactly one left canonical neighbour exists
const IS_VISITED_MASK: u8 = 0b0000_0100; // bit 2: visited
const RIGHT_NUC_MASK: u8 = 0b0001_1000; // bits 3–4: right_nuc — index 0–3 (A/C/G/T) of that neighbour; valid iff bit 0 = 1
const LEFT_NUC_MASK: u8 = 0b0110_0000; // bits 5–6: left_nuc — index 0–3 (A/C/G/T) of that neighbour; valid iff bit 1 = 1
const IS_START_MASK: u8 = 0b1000_0000; // bit 7: marked as start node
impl Node {
/// Returns `true` if the node can be extended to the right.
///
/// A single right neighbour exists.
#[inline]
pub fn can_extend_right(self) -> bool {
self.0 & CAN_EXTEND_RIGHT_MASK != 0
}
/// Returns `true` if the node can be extended to the left.
///
/// A single left neighbour exists.
#[inline]
pub fn can_extend_left(self) -> bool {
self.0 & CAN_EXTEND_LEFT_MASK != 0
}
/// Returns `true` if the node has been visited.
#[inline]
pub fn is_visited(self) -> bool {
self.0 & IS_VISITED_MASK != 0
}
/// Returns `true` if the node is a start node.
#[inline]
pub fn is_start(self) -> bool {
self.0 & IS_START_MASK != 0
}
#[inline]
pub fn set_start(&mut self) {
self.0 |= IS_START_MASK;
}
pub fn unset_start(&mut self) {
self.0 &= !IS_START_MASK;
}
/// Index of the unique right neighbour (0=A, 1=C, 2=G, 3=T).
/// Only meaningful when `can_extend_right()` is true.
#[inline]
pub fn right_nuc(self) -> u8 {
debug_assert!(
self.can_extend_right(),
"from: right_nuc -> The node cannot be extended to the right"
);
(self.0 >> 3) & 0b11
}
/// Index of the unique left neighbour (0=A, 1=C, 2=G, 3=T).
/// Only meaningful when `can_extend_left()` is true.
#[inline]
pub fn left_nuc(self) -> u8 {
debug_assert!(
self.can_extend_left(),
"from: left_nuc -> The node cannot be extended to the left"
);
(self.0 >> 5) & 0b11
}
/// Marks the node as visited.
#[inline]
pub fn set_visited(&mut self) {
debug_assert!(
!self.is_visited(),
"from: is_visited -> The node has already been visited"
);
self.0 |= IS_VISITED_MASK;
}
/// `nuc` = Some(i) → exactly one neighbour (bit 0 set, bits 3–4 = nucleotide index).
/// `nuc` = None → 0 or ≥2 neighbours; `count` encoded in bits 3–4 as count.sat_sub(1).
pub fn set_right(&mut self, count: u8, nuc: Option<u8>) {
self.0 &= !(CAN_EXTEND_RIGHT_MASK | RIGHT_NUC_MASK);
if count == 1 {
self.0 |= CAN_EXTEND_RIGHT_MASK;
if let Some(n) = nuc {
self.0 |= (n & 0b11) << 3;
return;
}
unreachable!("nuc must be Some when count is 1");
}
self.0 |= (count.saturating_sub(1).min(3)) << 3;
}
/// `nuc` = Some(i) → exactly one neighbour (bit 0 set, bits 3–4 = nucleotide index).
/// `nuc` = None → 0 or ≥2 neighbours; `count` encoded in bits 3–4 as count.sat_sub(1).
pub fn set_left(&mut self, count: u8, nuc: Option<u8>) {
self.0 &= !(CAN_EXTEND_LEFT_MASK | LEFT_NUC_MASK);
if count == 1 {
self.0 |= CAN_EXTEND_LEFT_MASK;
if let Some(n) = nuc {
self.0 |= (n & 0b11) << 5;
return;
}
unreachable!("nuc must be Some when count is 1");
}
self.0 |= (count.saturating_sub(1).min(3)) << 5;
}
}
impl fmt::Display for Node {
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
const NUC: [char; 4] = ['A', 'C', 'G', 'T'];
let r = if self.can_extend_right() {
format!("→{}", NUC[self.right_nuc() as usize])
} else if (self.0 >> 3) & 0b11 == 0 {
"→0".to_string()
} else {
"→≥2".to_string()
};
let l = if self.can_extend_left() {
format!("←{}", NUC[self.left_nuc() as usize])
} else if (self.0 >> 5) & 0b11 == 0 {
"←0".to_string()
} else {
"←≥2".to_string()
};
let v = if self.is_visited() { "V" } else { "." };
write!(f, "Node({r} {l} {v})")
}
}
pub struct WalkState {
kmer: CanonicalKmer,
node: Node,
direct: bool,
}
impl WalkState {
pub fn new(kmer: CanonicalKmer, node: Node, direct: bool) -> Self {
debug_assert!(!node.is_visited(), "Cannot walk over a visited node");
Self { kmer, node, direct }
}
pub fn leavable(&self, graph: &GraphDeBruijn) -> bool {
self.walk(graph).is_some()
}
pub fn reachable(&self, graph: &GraphDeBruijn) -> bool {
WalkState {
kmer: self.kmer,
node: self.node,
direct: !self.direct,
}
.leavable(graph)
}
pub fn walk(&self, graph: &GraphDeBruijn) -> Option<(WalkState, u8)> {
if self.direct {
if !self.node.can_extend_right() {
return None;
}
let nuc = self.node.right_nuc();
let next = self.kmer.into_kmer().push_right(nuc);
let cnext = next.canonical();
let dnext = next.raw() == cnext.raw();
let next_node = Node(graph.nodes.get(&cnext).unwrap().load(Ordering::Relaxed));
if next_node.is_visited() {
return None;
}
let reachable = if dnext {
next_node.can_extend_left()
} else {
next_node.can_extend_right()
};
reachable.then_some((
WalkState {
kmer: cnext,
node: next_node,
direct: dnext,
},
nuc,
))
} else {
if !self.node.can_extend_left() {
return None;
}
let nuc = self.node.left_nuc();
let next = self.kmer.into_kmer().push_left(nuc);
let cnext = next.canonical();
let dnext = next.raw() != cnext.raw();
let next_node = Node(graph.nodes.get(&cnext).unwrap().load(Ordering::Relaxed));
if next_node.is_visited() {
return None;
}
let reachable = if dnext {
next_node.can_extend_right()
} else {
next_node.can_extend_left()
};
reachable.then_some((
WalkState {
kmer: cnext,
node: next_node,
direct: dnext,
},
3 - nuc,
))
}
}
}
pub(super) type FastHashMap<K, V> = HashMap<K, V, Xxh3Builder>;
// ── GraphDeBruijn ─────────────────────────────────────────────────────────────
pub struct GraphDeBruijn {
nodes: FastHashMap<CanonicalKmer, AtomicU8>,
pub(super) nodes: FastHashMap<CanonicalKmer, AtomicU8>,
}
impl GraphDeBruijn {
@@ -346,7 +120,7 @@ impl GraphDeBruijn {
Some(WalkState::new(kmer, node, true))
}
fn unitig_nucleotides(&self, kmer: CanonicalKmer, k: usize) -> Option<UnitigNucIter<'_>> {
pub(super) fn unitig_nucleotides(&self, kmer: CanonicalKmer, k: usize) -> Option<UnitigNucIter<'_>> {
let old = self
.nodes
.get(&kmer)?
@@ -362,13 +136,7 @@ impl GraphDeBruijn {
.fetch_or(IS_VISITED_MASK, Ordering::AcqRel);
(ext_old & IS_VISITED_MASK == 0).then_some((next_state, nuc))
});
Some(UnitigNucIter {
graph: self,
start: kmer,
pos: 0,
k,
next_step,
})
Some(UnitigNucIter::new(self, kmer, k, next_step))
}
pub fn for_each_unitig(&self, f: impl Fn(UnitigNucIter<'_>) + Sync) {
@@ -467,12 +235,7 @@ impl GraphDeBruijn {
}
fn is_start(&self, query: CanonicalKmer, node: Node) -> bool {
!WalkState {
kmer: query,
node,
direct: true,
}
.reachable(self)
!WalkState::new(query, node, true).reachable(self)
}
pub fn try_for_each_unitig<E, F>(&self, f: F) -> Result<(), E>
@@ -514,44 +277,6 @@ impl GraphDeBruijn {
}
}
// ── UnitigNucIter ─────────────────────────────────────────────────────────────
pub struct UnitigNucIter<'a> {
graph: &'a GraphDeBruijn,
start: CanonicalKmer,
pos: usize,
k: usize,
next_step: Option<(WalkState, u8)>,
}
impl Iterator for UnitigNucIter<'_> {
type Item = u8;
fn next(&mut self) -> Option<u8> {
if self.pos < self.k {
let nuc = self.start.nucleotide(self.pos);
self.pos += 1;
Some(nuc)
} else if let Some((state, nuc)) = self.next_step.take() {
self.next_step = state.walk(self.graph).and_then(|(next_state, next_nuc)| {
let old = self
.graph
.nodes
.get(&next_state.kmer)?
.fetch_or(IS_VISITED_MASK, Ordering::AcqRel);
(old & IS_VISITED_MASK == 0).then_some((next_state, next_nuc))
});
Some(nuc)
} else {
None
}
}
fn size_hint(&self) -> (usize, Option<usize>) {
(self.k - self.pos.min(self.k), None)
}
}
/// Returns the count of neighbors and the index of the first
/// neighbor if exactly one of the four canonical neighbours exists in
/// the graph, where `i` is its index (0=A, 1=C, 2=G, 3=T).
@@ -580,8 +305,3 @@ fn count_neighbors(
(0, None)
}
}
// ── tests ─────────────────────────────────────────────────────────────────────
#[cfg(test)]
#[path = "tests/debruijn.rs"]
mod tests;
+20
View File
@@ -0,0 +1,20 @@
//! De Bruijn graph over canonical k-mers, built for unitig extraction.
//!
//! Submodules: [`node`] (packed per-kmer neighbour/visited/start flags),
//! [`walk`] (single-step traversal), [`graph`] ([`GraphDeBruijn`] itself),
//! [`unitig_iter`] (nucleotide-by-nucleotide unitig walk iterator).
mod graph;
mod node;
mod unitig_iter;
mod walk;
pub use graph::GraphDeBruijn;
// Only used by `tests/debruijn.rs` (`use super::*`) below.
#[cfg(test)]
use obikseq::{CanonicalKmer, Sequence};
#[cfg(test)]
#[path = "../tests/debruijn.rs"]
mod tests;
+148
View File
@@ -0,0 +1,148 @@
use std::fmt;
// ── Node ──────────────────────────────────────────────────────────────────────
//
// bit layout (LSB first):
// bit 0 : can_extend_right — exactly one right canonical neighbour exists
// bit 1 : can_extend_left — exactly one left canonical neighbour exists
// bit 2 : visited
// bits 3–4 : right_nuc — index 0–3 (A/C/G/T) of that neighbour; valid iff bit 0 = 1
// bits 5–6 : left_nuc — index 0–3 (A/C/G/T) of that neighbour; valid iff bit 1 = 1
// bit 7 : marked as start node (1)
//
// "can_extend" = false covers both 0 neighbours and ≥2 neighbours; the only
// information needed for traversal is "exactly one".
#[repr(transparent)]
#[derive(Debug, Clone, Copy, Default)]
pub struct Node(pub(super) u8);
const CAN_EXTEND_RIGHT_MASK: u8 = 0b0000_0001; // bit 0: can_extend_right — exactly one right canonical neighbour exists
const CAN_EXTEND_LEFT_MASK: u8 = 0b0000_0010; // bit 1: can_extend_left — exactly one left canonical neighbour exists
pub(super) const IS_VISITED_MASK: u8 = 0b0000_0100; // bit 2: visited
const RIGHT_NUC_MASK: u8 = 0b0001_1000; // bits 3–4: right_nuc — index 0–3 (A/C/G/T) of that neighbour; valid iff bit 0 = 1
const LEFT_NUC_MASK: u8 = 0b0110_0000; // bits 5–6: left_nuc — index 0–3 (A/C/G/T) of that neighbour; valid iff bit 1 = 1
const IS_START_MASK: u8 = 0b1000_0000; // bit 7: marked as start node
impl Node {
/// Returns `true` if the node can be extended to the right.
///
/// A single right neighbour exists.
#[inline]
pub fn can_extend_right(self) -> bool {
self.0 & CAN_EXTEND_RIGHT_MASK != 0
}
/// Returns `true` if the node can be extended to the left.
///
/// A single left neighbour exists.
#[inline]
pub fn can_extend_left(self) -> bool {
self.0 & CAN_EXTEND_LEFT_MASK != 0
}
/// Returns `true` if the node has been visited.
#[inline]
pub fn is_visited(self) -> bool {
self.0 & IS_VISITED_MASK != 0
}
/// Returns `true` if the node is a start node.
#[inline]
pub fn is_start(self) -> bool {
self.0 & IS_START_MASK != 0
}
#[inline]
pub fn set_start(&mut self) {
self.0 |= IS_START_MASK;
}
pub fn unset_start(&mut self) {
self.0 &= !IS_START_MASK;
}
/// Index of the unique right neighbour (0=A, 1=C, 2=G, 3=T).
/// Only meaningful when `can_extend_right()` is true.
#[inline]
pub fn right_nuc(self) -> u8 {
debug_assert!(
self.can_extend_right(),
"from: right_nuc -> The node cannot be extended to the right"
);
(self.0 >> 3) & 0b11
}
/// Index of the unique left neighbour (0=A, 1=C, 2=G, 3=T).
/// Only meaningful when `can_extend_left()` is true.
#[inline]
pub fn left_nuc(self) -> u8 {
debug_assert!(
self.can_extend_left(),
"from: left_nuc -> The node cannot be extended to the left"
);
(self.0 >> 5) & 0b11
}
/// Marks the node as visited.
#[inline]
pub fn set_visited(&mut self) {
debug_assert!(
!self.is_visited(),
"from: is_visited -> The node has already been visited"
);
self.0 |= IS_VISITED_MASK;
}
/// `nuc` = Some(i) → exactly one neighbour (bit 0 set, bits 3–4 = nucleotide index).
/// `nuc` = None → 0 or ≥2 neighbours; `count` encoded in bits 3–4 as count.sat_sub(1).
pub fn set_right(&mut self, count: u8, nuc: Option<u8>) {
self.0 &= !(CAN_EXTEND_RIGHT_MASK | RIGHT_NUC_MASK);
if count == 1 {
self.0 |= CAN_EXTEND_RIGHT_MASK;
if let Some(n) = nuc {
self.0 |= (n & 0b11) << 3;
return;
}
unreachable!("nuc must be Some when count is 1");
}
self.0 |= (count.saturating_sub(1).min(3)) << 3;
}
/// `nuc` = Some(i) → exactly one neighbour (bit 0 set, bits 3–4 = nucleotide index).
/// `nuc` = None → 0 or ≥2 neighbours; `count` encoded in bits 3–4 as count.sat_sub(1).
pub fn set_left(&mut self, count: u8, nuc: Option<u8>) {
self.0 &= !(CAN_EXTEND_LEFT_MASK | LEFT_NUC_MASK);
if count == 1 {
self.0 |= CAN_EXTEND_LEFT_MASK;
if let Some(n) = nuc {
self.0 |= (n & 0b11) << 5;
return;
}
unreachable!("nuc must be Some when count is 1");
}
self.0 |= (count.saturating_sub(1).min(3)) << 5;
}
}
impl fmt::Display for Node {
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
const NUC: [char; 4] = ['A', 'C', 'G', 'T'];
let r = if self.can_extend_right() {
format!("→{}", NUC[self.right_nuc() as usize])
} else if (self.0 >> 3) & 0b11 == 0 {
"→0".to_string()
} else {
"→≥2".to_string()
};
let l = if self.can_extend_left() {
format!("←{}", NUC[self.left_nuc() as usize])
} else if (self.0 >> 5) & 0b11 == 0 {
"←0".to_string()
} else {
"←≥2".to_string()
};
let v = if self.is_visited() { "V" } else { "." };
write!(f, "Node({r} {l} {v})")
}
}
@@ -0,0 +1,61 @@
use obikseq::CanonicalKmer;
use std::sync::atomic::Ordering;
use super::graph::GraphDeBruijn;
use super::node::IS_VISITED_MASK;
use super::walk::WalkState;
// ── UnitigNucIter ─────────────────────────────────────────────────────────────
pub struct UnitigNucIter<'a> {
graph: &'a GraphDeBruijn,
start: CanonicalKmer,
pos: usize,
k: usize,
next_step: Option<(WalkState, u8)>,
}
impl<'a> UnitigNucIter<'a> {
pub(super) fn new(
graph: &'a GraphDeBruijn,
start: CanonicalKmer,
k: usize,
next_step: Option<(WalkState, u8)>,
) -> Self {
Self {
graph,
start,
pos: 0,
k,
next_step,
}
}
}
impl Iterator for UnitigNucIter<'_> {
type Item = u8;
fn next(&mut self) -> Option<u8> {
if self.pos < self.k {
let nuc = self.start.nucleotide(self.pos);
self.pos += 1;
Some(nuc)
} else if let Some((state, nuc)) = self.next_step.take() {
self.next_step = state.walk(self.graph).and_then(|(next_state, next_nuc)| {
let old = self
.graph
.nodes
.get(&next_state.kmer)?
.fetch_or(IS_VISITED_MASK, Ordering::AcqRel);
(old & IS_VISITED_MASK == 0).then_some((next_state, next_nuc))
});
Some(nuc)
} else {
None
}
}
fn size_hint(&self) -> (usize, Option<usize>) {
(self.k - self.pos.min(self.k), None)
}
}
+85
View File
@@ -0,0 +1,85 @@
use obikseq::{CanonicalKmer, Sequence};
use std::sync::atomic::Ordering;
use super::graph::GraphDeBruijn;
use super::node::Node;
pub struct WalkState {
pub(super) kmer: CanonicalKmer,
pub(super) node: Node,
pub(super) direct: bool,
}
impl WalkState {
pub fn new(kmer: CanonicalKmer, node: Node, direct: bool) -> Self {
debug_assert!(!node.is_visited(), "Cannot walk over a visited node");
Self { kmer, node, direct }
}
pub fn leavable(&self, graph: &GraphDeBruijn) -> bool {
self.walk(graph).is_some()
}
pub fn reachable(&self, graph: &GraphDeBruijn) -> bool {
WalkState {
kmer: self.kmer,
node: self.node,
direct: !self.direct,
}
.leavable(graph)
}
pub fn walk(&self, graph: &GraphDeBruijn) -> Option<(WalkState, u8)> {
if self.direct {
if !self.node.can_extend_right() {
return None;
}
let nuc = self.node.right_nuc();
let next = self.kmer.into_kmer().push_right(nuc);
let cnext = next.canonical();
let dnext = next.raw() == cnext.raw();
let next_node = Node(graph.nodes.get(&cnext).unwrap().load(Ordering::Relaxed));
if next_node.is_visited() {
return None;
}
let reachable = if dnext {
next_node.can_extend_left()
} else {
next_node.can_extend_right()
};
reachable.then_some((
WalkState {
kmer: cnext,
node: next_node,
direct: dnext,
},
nuc,
))
} else {
if !self.node.can_extend_left() {
return None;
}
let nuc = self.node.left_nuc();
let next = self.kmer.into_kmer().push_left(nuc);
let cnext = next.canonical();
let dnext = next.raw() != cnext.raw();
let next_node = Node(graph.nodes.get(&cnext).unwrap().load(Ordering::Relaxed));
if next_node.is_visited() {
return None;
}
let reachable = if dnext {
next_node.can_extend_right()
} else {
next_node.can_extend_left()
};
reachable.then_some((
WalkState {
kmer: cnext,
node: next_node,
direct: dnext,
},
3 - nuc,
))
}
}
}
+17
View File
@@ -0,0 +1,17 @@
//! NUMA-aware partition runner via hwlocality.
//!
//! Detects NUMA topology using hwloc (cross-platform: Linux, macOS, etc.) and
//! builds one Rayon ThreadPool per NUMA node with threads pinned to that node's
//! CPUs. Linux first-touch policy then places graph allocations in local DRAM
//! automatically — no explicit memory binding needed.
//!
//! UMA systems (single socket, Apple Silicon, etc.) are the degenerate case:
//! one synthetic node containing all cores, no pool, no pinning.
//!
//! Submodules: [`topology`] (NUMA detection, per-node pools, thread pinning),
//! [`runner`] ([`PartitionRunner`], the adaptive worker-activation scheduler).
mod runner;
mod topology;
pub use runner::PartitionRunner;
@@ -1,137 +1,11 @@
// NUMA-aware partition runner via hwlocality.
//
// Detects NUMA topology using hwloc (cross-platform: Linux, macOS, etc.) and
// builds one Rayon ThreadPool per NUMA node with threads pinned to that node's
// CPUs. Linux first-touch policy then places graph allocations in local DRAM
// automatically — no explicit memory binding needed.
//
// UMA systems (single socket, Apple Silicon, etc.) are the degenerate case:
// one synthetic node containing all cores, no pool, no pinning.
use std::sync::Arc;
use std::time::{Duration, Instant};
use crossbeam_channel::unbounded;
#[cfg(feature = "numa")]
use hwlocality::Topology;
#[cfg(feature = "numa")]
use hwlocality::cpu::binding::CpuBindingFlags;
#[cfg(feature = "numa")]
use hwlocality::cpu::cpuset::CpuSet;
#[cfg(feature = "numa")]
use hwlocality::object::types::ObjectType;
use obisys::{CpuSample, IoSample};
use tracing::debug;
// ── Public interface ──────────────────────────────────────────────────────────
pub struct NumaSetup {
/// One entry per NUMA node. `None` on UMA systems (no pool, no pinning).
pub pools: Vec<Option<Arc<rayon::ThreadPool>>>,
/// CPU indices for each NUMA node, in node order.
pub cpus_per_node: Vec<Vec<usize>>,
}
impl NumaSetup {
/// Maximum worker slots per node (one per physical core in the node).
pub fn workers_per_node(&self) -> usize {
self.cpus_per_node
.first()
.map(|c| c.len().max(1))
.unwrap_or(1)
}
}
/// Detect NUMA topology and build per-node Rayon pools.
/// Always succeeds: falls back to a single synthetic UMA node on failure.
#[cfg(feature = "numa")]
pub fn build() -> NumaSetup {
if let Ok(topology) = Topology::new() {
let nodes: Vec<Vec<usize>> = topology
.objects_with_type(ObjectType::NUMANode)
.filter_map(|obj| obj.cpuset())
.map(|cpuset| {
cpuset
.iter_set()
.map(|idx| usize::from(idx))
.collect::<Vec<_>>()
})
.filter(|v| !v.is_empty())
.collect();
if nodes.len() > 1 {
if let Some(pools) = nodes
.iter()
.map(|cpus| build_pool(cpus).map(|p| Some(Arc::new(p))))
.collect::<Option<Vec<_>>>()
{
debug!(
"NUMA topology: {} node(s), {} core(s)/node",
nodes.len(),
nodes.first().map_or(0, |v| v.len()),
);
return NumaSetup {
pools,
cpus_per_node: nodes,
};
}
}
}
// UMA fallback: single synthetic node, all cores, no pool, no pinning.
let n_cores = obisys::effective_parallelism();
debug!("UMA: single synthetic node, {} core(s)", n_cores);
NumaSetup {
pools: vec![None],
cpus_per_node: vec![(0..n_cores).collect()],
}
}
#[cfg(not(feature = "numa"))]
pub fn build() -> NumaSetup {
let n_cores = obisys::effective_parallelism();
debug!("UMA: single synthetic node, {} core(s)", n_cores);
NumaSetup {
pools: vec![None],
cpus_per_node: vec![(0..n_cores).collect()],
}
}
/// Bind the calling thread to `cpu_indices` using hwloc.
/// Silently returns on any error so the thread still runs, just unbound.
#[cfg(feature = "numa")]
pub fn pin_current_thread(cpu_indices: &[usize]) {
let Ok(topology) = Topology::new() else {
return;
};
let mut cpuset = CpuSet::new();
for &idx in cpu_indices {
cpuset.set(idx);
}
let _ = topology.bind_cpu(&cpuset, CpuBindingFlags::THREAD);
}
#[cfg(not(feature = "numa"))]
pub fn pin_current_thread(_cpu_indices: &[usize]) {}
// ── Internal helpers ──────────────────────────────────────────────────────────
#[cfg(feature = "numa")]
fn build_pool(cpus: &[usize]) -> Option<rayon::ThreadPool> {
let cpus = cpus.to_vec();
rayon::ThreadPoolBuilder::new()
.num_threads(cpus.len())
.spawn_handler(move |thread| {
let cpus = cpus.clone();
std::thread::Builder::new().spawn(move || {
pin_current_thread(&cpus);
thread.run();
})?;
Ok(())
})
.build()
.ok()
}
use super::topology::{build, pin_current_thread};
// ── PartitionRunner ─────────────────────────────────────────────────────────
+121
View File
@@ -0,0 +1,121 @@
use std::sync::Arc;
#[cfg(feature = "numa")]
use hwlocality::Topology;
#[cfg(feature = "numa")]
use hwlocality::cpu::binding::CpuBindingFlags;
#[cfg(feature = "numa")]
use hwlocality::cpu::cpuset::CpuSet;
#[cfg(feature = "numa")]
use hwlocality::object::types::ObjectType;
use tracing::debug;
// ── Public interface ──────────────────────────────────────────────────────────
pub struct NumaSetup {
/// One entry per NUMA node. `None` on UMA systems (no pool, no pinning).
pub pools: Vec<Option<Arc<rayon::ThreadPool>>>,
/// CPU indices for each NUMA node, in node order.
pub cpus_per_node: Vec<Vec<usize>>,
}
impl NumaSetup {
/// Maximum worker slots per node (one per physical core in the node).
pub fn workers_per_node(&self) -> usize {
self.cpus_per_node
.first()
.map(|c| c.len().max(1))
.unwrap_or(1)
}
}
/// Detect NUMA topology and build per-node Rayon pools.
/// Always succeeds: falls back to a single synthetic UMA node on failure.
#[cfg(feature = "numa")]
pub fn build() -> NumaSetup {
if let Ok(topology) = Topology::new() {
let nodes: Vec<Vec<usize>> = topology
.objects_with_type(ObjectType::NUMANode)
.filter_map(|obj| obj.cpuset())
.map(|cpuset| {
cpuset
.iter_set()
.map(|idx| usize::from(idx))
.collect::<Vec<_>>()
})
.filter(|v| !v.is_empty())
.collect();
if nodes.len() > 1 {
if let Some(pools) = nodes
.iter()
.map(|cpus| build_pool(cpus).map(|p| Some(Arc::new(p))))
.collect::<Option<Vec<_>>>()
{
debug!(
"NUMA topology: {} node(s), {} core(s)/node",
nodes.len(),
nodes.first().map_or(0, |v| v.len()),
);
return NumaSetup {
pools,
cpus_per_node: nodes,
};
}
}
}
// UMA fallback: single synthetic node, all cores, no pool, no pinning.
let n_cores = obisys::effective_parallelism();
debug!("UMA: single synthetic node, {} core(s)", n_cores);
NumaSetup {
pools: vec![None],
cpus_per_node: vec![(0..n_cores).collect()],
}
}
#[cfg(not(feature = "numa"))]
pub fn build() -> NumaSetup {
let n_cores = obisys::effective_parallelism();
debug!("UMA: single synthetic node, {} core(s)", n_cores);
NumaSetup {
pools: vec![None],
cpus_per_node: vec![(0..n_cores).collect()],
}
}
/// Bind the calling thread to `cpu_indices` using hwloc.
/// Silently returns on any error so the thread still runs, just unbound.
#[cfg(feature = "numa")]
pub fn pin_current_thread(cpu_indices: &[usize]) {
let Ok(topology) = Topology::new() else {
return;
};
let mut cpuset = CpuSet::new();
for &idx in cpu_indices {
cpuset.set(idx);
}
let _ = topology.bind_cpu(&cpuset, CpuBindingFlags::THREAD);
}
#[cfg(not(feature = "numa"))]
pub fn pin_current_thread(_cpu_indices: &[usize]) {}
// ── Internal helpers ──────────────────────────────────────────────────────────
#[cfg(feature = "numa")]
fn build_pool(cpus: &[usize]) -> Option<rayon::ThreadPool> {
let cpus = cpus.to_vec();
rayon::ThreadPoolBuilder::new()
.num_threads(cpus.len())
.spawn_handler(move |thread| {
let cpus = cpus.clone();
std::thread::Builder::new().spawn(move || {
pin_current_thread(&cpus);
thread.run();
})?;
Ok(())
})
.build()
.ok()
}
File diff suppressed because it is too large. Load diff
+185
View File
@@ -0,0 +1,185 @@
use rayon::prelude::*;
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix, SiblingAnnex};
use obikpartitionner::KmerPartition;
use obikseq::CanonicalKmer;
use obilayeredmap::MphfLayer;
use obilayeredmap::meta::PartitionMeta;
use obiskio::UnitigFileReader;
use obisys::progress_bar;
use crate::error::{OKIError, OKIResult};
use crate::index::KmerIndex;
use super::cache::{Mat, PartitionCache};
use super::helpers::{central_base, is_minorant, partition_of};
use super::{olm_to_ok, ANNEX_FILE_NAME, INDEX_SUBDIR};
/// IUPAC ambiguity code for a per-genome family presence mask (bit `b` set
/// iff the genome carries the member whose own central base is `b`):
/// single bit -> the plain base; 2 or 3 bits -> the matching IUPAC
/// ambiguity code (preserves partial information instead of collapsing to
/// `N`, the same convention used for diploid heterozygous VCF/FASTA sites);
/// all 4 bits -> `N`; no bits (genome carries none of the family's observed
/// members) -> `-` (no data at this locus for this genome).
fn iupac_code(mask: u8) -> u8 {
match mask & 0b1111 {
0b0000 => b'-',
0b0001 => b'A',
0b0010 => b'C',
0b0100 => b'G',
0b1000 => b'T',
0b0101 => b'R', // A/G
0b1010 => b'Y', // C/T
0b0110 => b'S', // C/G
0b1001 => b'W', // A/T
0b1100 => b'K', // G/T
0b0011 => b'M', // A/C
0b1110 => b'B', // C/G/T
0b1101 => b'D', // A/G/T
0b1011 => b'H', // A/C/T
0b0111 => b'V', // A/C/G
0b1111 => b'N',
_ => unreachable!("masked to 4 bits"),
}
}
/// A SNP-only pseudo-alignment: one row (byte sequence, IUPAC-coded) per
/// genome, one column per variable family (`family_size() >= 2` — monomorphic
/// families carry no signal and are skipped, unlike `raw_snp_distance`'s
/// tally which does count them as `shared`). Column order is the same,
/// deterministic sweep order as the annex build (partition, then layer, then
/// slot) — arbitrary but stable and identical across genomes, which is all a
/// pseudo-alignment needs (there is no natural genomic coordinate to sort by
/// once flanks are dropped). See `docmd/theory/evolutionary_distances.md`,
/// "Multi-genome framing: family as pseudo-alignment column".
pub struct SnpAlignment {
/// `sequences[g]` = genome `g`'s IUPAC-coded row, same length for every
/// genome (`sequences.len()` columns).
pub sequences: Vec<Vec<u8>>,
}
impl KmerIndex {
/// Build the SNP-only pseudo-alignment from an already-built sibling
/// annex (run [`build_sibling_annex`](Self::build_sibling_annex) first).
pub fn snp_pseudo_alignment(&self) -> OKIResult<SnpAlignment> {
let n_parts = self.n_partitions();
let n_genomes = self.meta.genomes.len();
let with_counts = self.meta.config.with_counts;
let k = self.kmer_size();
let n_bits = n_parts.trailing_zeros() as usize;
let partition = KmerPartition::open_with_config(
&self.root_path,
self.kmer_size(),
self.minimizer_size(),
n_bits,
)
.map_err(OKIError::Partition)?;
let cache = PartitionCache::build(&partition, n_parts, with_counts)?;
let mut layer_dirs = Vec::new();
for part in 0..n_parts {
let index_dir = self.partition().part_dir(part).join(INDEX_SUBDIR);
if !index_dir.exists() {
continue;
}
let meta = PartitionMeta::load(&index_dir).map_err(olm_to_ok)?;
for l in 0..meta.n_layers {
let layer_dir = index_dir.join(format!("layer_{l}"));
let annex_path = layer_dir.join(ANNEX_FILE_NAME);
if !annex_path.exists() {
return Err(OKIError::InvalidInput(format!(
"no sibling annex at {} — run build_sibling_annex first",
annex_path.display()
)));
}
layer_dirs.push(layer_dir);
}
}
let pb = progress_bar("snp_pseudo_alignment", layer_dirs.len() as u64, "layers");
// `Vec<Vec<u8>>` per layer, one entry (column) per variable family;
// `par_iter().map(...).collect()` on this indexed source preserves
// input order, so concatenating the results below in order gives a
// single deterministic column order across the whole index.
let partials: Vec<Vec<Vec<u8>>> = layer_dirs
.par_iter()
.map(|layer_dir| -> OKIResult<Vec<Vec<u8>>> {
let index_dir = layer_dir.parent().expect("layer_dir has a parent index dir");
let meta = PartitionMeta::load(index_dir).map_err(olm_to_ok)?;
let annex = SiblingAnnex::open(&layer_dir.join(ANNEX_FILE_NAME))?;
let mphf = MphfLayer::open(layer_dir, &meta.mode).map_err(olm_to_ok)?;
let mut slot_kmer: Vec<Option<CanonicalKmer>> = vec![None; annex.len()];
let reader = UnitigFileReader::open_sequential(&layer_dir.join("unitigs.bin"))
.map_err(OKIError::Partition)?;
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) {
slot_kmer[slot] = Some(kmer);
}
}
let use_counts = with_counts && layer_dir.join("counts").exists();
let mat = if use_counts {
Mat::Count(PersistentCompactIntMatrix::open(layer_dir)?)
} else {
Mat::Presence(PersistentBitMatrix::open(layer_dir)?)
};
let n_cols = mat.n_cols().min(n_genomes);
let mut columns: Vec<Vec<u8>> = Vec::new();
let mut genome_mask: Vec<u8> = Vec::with_capacity(n_genomes);
for slot in 0..annex.len() {
let Some(mask) = annex.get(slot) else { continue };
let Some(kmer) = slot_kmer[slot] else { continue };
if !is_minorant(kmer, mask, k) {
continue; // family tallied once, at its minorant
}
if mask.family_size() < 2 {
continue; // monomorphic family — no signal, skip
}
genome_mask.clear();
genome_mask.resize(n_genomes, 0);
for other in kmer.central_canonical_neighbors() {
let base = central_base(other, k);
if !mask.has(base) {
continue;
}
let presence: Option<Vec<bool>> = if other == kmer {
Some((0..n_cols).map(|g| mat.carries(g, slot)).collect())
} else {
let dest = partition_of(other, n_parts);
cache.find_presence(dest, other, n_genomes)
};
let Some(presence) = presence else { continue };
for (g, &present) in presence.iter().enumerate() {
if present {
genome_mask[g] |= 1 << base;
}
}
}
columns.push(genome_mask.iter().map(|&m| iupac_code(m)).collect());
}
pb.inc(1);
Ok(columns)
})
.collect::<OKIResult<Vec<_>>>()?;
pb.finish_and_clear();
let mut sequences: Vec<Vec<u8>> = vec![Vec::new(); n_genomes];
for layer_columns in partials {
for column in layer_columns {
for (g, &code) in column.iter().enumerate() {
sequences[g].push(code);
}
}
}
Ok(SnpAlignment { sequences })
}
}
+255
View File
@@ -0,0 +1,255 @@
use std::path::Path;
use std::sync::atomic::{AtomicU8, Ordering};
use std::sync::Arc;
use rayon::prelude::*;
use obicompactvec::{FamilyMask, SiblingAnnexBuilder};
use obikpartitionner::KmerPartition;
use obipipeline::ThrottleGuard;
use obikseq::CanonicalKmer;
use obilayeredmap::MphfLayer;
use obilayeredmap::meta::PartitionMeta;
use obiskio::UnitigFileReader;
use obisys::progress_bar;
use crate::error::{OKIError, OKIResult};
use crate::index::KmerIndex;
use super::cache::PartitionCache;
use super::helpers::{central_base, partition_of};
use super::{olm_to_ok, ANNEX_FILE_NAME, INDEX_SUBDIR};
// ── obipipeline data types ─────────────────────────────────────────────────
/// A batch of this layer's distinct k-mers (local MPHF slot + k-mer), the
/// pipeline's source item — batched, not one k-mer per item, so that
/// pipeline messages and their synchronisation cost stay amortised over
/// thousands of lookups (see `build_layer_sibling_annex`'s comment on
/// `BATCH_SIZE`). Carries the throttle permit for the whole batch, moved
/// (not cloned) into the corresponding `VariantBatch` — a 1-to-1 transform,
/// unlike the fan-out `Flat` stage this replaced, needs no `Arc` sharing.
struct SourceBatch {
items: Vec<(usize, CanonicalKmer)>,
_permit: ThrottleGuard,
}
/// One batch's worth of central-substitution variants (up to 3 per source
/// k-mer), each already routed to its destination partition and carrying
/// its own central base (0=A/1=C/2=G/3=T) — the mask bit it will set on a
/// hit. `(dest_partition, variant, source_slot, base)` per entry.
struct VariantBatch {
items: Vec<(usize, CanonicalKmer, usize, u8)>,
_permit: ThrottleGuard,
}
enum SibData {
Batch(SourceBatch),
Variants(VariantBatch),
}
impl KmerIndex {
/// Build the sibling-count/minorant annex for every layer of every
/// partition of this (already built) index, writing one annex file per
/// layer alongside its existing index files. Safe to call again later
/// (e.g. after a fresh `merge`) — each run simply overwrites the annex
/// files of the index it is called on.
///
/// Construction only — no statistics gathered here on purpose: this is
/// meant to run routinely (it is the artefact the SNP-family distances
/// will consume), while the sibling-count distribution
/// ([`sibling_annex_stats`](Self::sibling_annex_stats)) is a separate,
/// occasional diagnostic pass over the result, not run every time.
///
/// Cross-partition/cross-layer lookups are required (a k-mer's siblings
/// can live in any partition), but the layer loop itself — and thus the
/// annex file this produces — stays local to one layer at a time.
pub fn build_sibling_annex(&self) -> OKIResult<()> {
let n_parts = self.n_partitions();
let n_bits = n_parts.trailing_zeros() as usize;
let partition = KmerPartition::open_with_config(
&self.root_path,
self.kmer_size(),
self.minimizer_size(),
n_bits,
)
.map_err(OKIError::Partition)?;
tracing::info!("opening {n_parts} partition(s) for the sibling-annex sweep");
let cache = Arc::new(PartitionCache::build(&partition, n_parts, self.meta.config.with_counts)?);
let pb = progress_bar("sibling_annex", n_parts as u64, "partitions");
let mut total_slots: u64 = 0;
for part in 0..n_parts {
let index_dir = self.partition().part_dir(part).join(INDEX_SUBDIR);
if !index_dir.exists() {
pb.inc(1);
continue;
}
let meta = PartitionMeta::load(&index_dir).map_err(olm_to_ok)?;
let mut part_slots: u64 = 0;
for l in 0..meta.n_layers {
let layer_dir = index_dir.join(format!("layer_{l}"));
part_slots += self.build_layer_sibling_annex(&layer_dir, n_parts, &cache)?;
}
total_slots += part_slots;
pb.inc(1);
pb.set_message(format!("partition {part}: {part_slots} kmers ({total_slots} total)"));
}
pb.finish_and_clear();
tracing::info!("sibling annex built — {total_slots} kmers across {n_parts} partitions");
Ok(())
}
/// Returns the number of distinct k-mers (annex slots) processed, for
/// progress reporting.
fn build_layer_sibling_annex(
&self,
layer_dir: &Path,
n_parts: usize,
cache: &Arc<PartitionCache>,
) -> OKIResult<u64> {
let index_dir = layer_dir.parent().expect("layer_dir has a parent index dir");
let meta = PartitionMeta::load(index_dir).map_err(olm_to_ok)?;
let mphf = MphfLayer::open(layer_dir, &meta.mode).map_err(olm_to_ok)?;
let n_slots = mphf.n();
// ── Enumerate this layer's distinct k-mers, one per slot ────────────
let mut slot_kmer: Vec<Option<CanonicalKmer>> = vec![None; n_slots];
let reader = UnitigFileReader::open_sequential(&layer_dir.join("unitigs.bin"))
.map_err(OKIError::Partition)?;
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) {
slot_kmer[slot] = Some(kmer);
}
}
let k = self.kmer_size();
// ── Reconciliation state, initialised with each slot's own base —
// that member is trivially present, no lookup needed. Built before
// the pipeline runs, from the same enumeration, since `sources`
// below is consumed as a throttled iterator, not collected.
// `AtomicU8`, not `FamilyMask`, because the gather phase below
// parallelises across destination partitions (independent
// `query_partition_with` calls, safe to run concurrently) and their
// `Found` hits can land on arbitrary, possibly-shared slots — a
// lock-free `fetch_or` avoids needing any synchronisation beyond
// that. ─────────────────────────────────────────────────────────
let mask: Vec<AtomicU8> = (0..n_slots).map(|_| AtomicU8::new(0)).collect();
for (slot, kmer) in slot_kmer.iter().enumerate().filter_map(|(s, k)| k.map(|k| (s, k))) {
mask[slot].fetch_or(1 << central_base(kmer, k), Ordering::Relaxed);
}
// ── obipipeline: a *batch* transform, not a per-k-mer `Flat` one —
// the actual cross-partition lookup reuses
// `KmerPartition::query_partition_with` (the same batching mechanism
// `obikmer query` already uses: open a partition's files once,
// answer a whole batch of queries against it) instead of one lookup
// per pipeline item. A per-item lookup (tried first) reopened/
// re-mmap'd every target partition's files on every single variant
// — fine at toy scale, but ~90% system time against a real index,
// observed in practice. A *later* attempt still pushed one pipeline
// message per generated variant (a `Flat` stage, `SourceItem` =>
// `VariantQuery`, one k-mer in => up to 3 variants out as separate
// messages) — cheaper than reopening files, but sampling a real run
// showed most wall-clock time going into per-message channel
// send/notify syscalls instead of the lookup itself: the pipeline's
// whole point is amortising synchronisation over a batch, and a
// single k-mer's ≤3 variants is far too fine a granularity for
// that. Batching `BATCH_SIZE` source k-mers into one pipeline item
// — a plain 1-to-1 (`|`, not `||`) transform, batch in, batch of
// variants out, one message either way — keeps the per-message
// synchronisation cost amortised over thousands of lookups instead
// of one to three. ──────────────────────────────────────────────
const BATCH_SIZE: usize = 4096;
let n_workers = obisys::effective_parallelism();
let capacity = 256;
// Throttling limits how many *batches* are in flight at once — the
// permit is acquired per batch (not per k-mer) in the source
// thread, and released once its `VariantBatch` has been read out of
// the pipeline by the accumulation loop below. See
// `obipipeline::throttle`'s docs for why this is required, not
// optional, once a `Flat`-style stage sits in the pipeline.
let sources: Vec<(usize, CanonicalKmer)> = slot_kmer
.iter()
.enumerate()
.filter_map(|(slot, maybe_kmer)| maybe_kmer.map(|kmer| (slot, kmer)))
.collect();
let batches: Vec<Vec<(usize, CanonicalKmer)>> = sources
.chunks(BATCH_SIZE)
.map(|chunk| chunk.to_vec())
.collect();
let throttled = obipipeline::throttle(batches.into_iter(), n_workers).map(|t| SourceBatch {
items: t.item,
_permit: t.guard,
});
let pipe = obipipeline::make_pipe! {
SibData : SourceBatch => VariantBatch,
| {
move |batch: SourceBatch| -> VariantBatch {
let mut items = Vec::with_capacity(batch.items.len() * 3);
for (slot, kmer) in batch.items {
for variant in kmer.central_canonical_neighbors() {
if variant == kmer {
continue;
}
items.push((
partition_of(variant, n_parts),
variant,
slot,
central_base(variant, k),
));
}
}
VariantBatch { items, _permit: batch._permit }
}
} : Batch => Variants,
};
// ── Group generated variants by destination partition. `cache`
// holds every partition already mmap'd (no more `open()` cost), but
// `mmap` pages are still loaded on demand and can be evicted — a
// lookup is not free just because the file isn't reopened. Grouping
// keeps one partition's pages hot while its whole batch is resolved,
// instead of faulting pages in and out as lookups jump between
// partitions in whatever order the pipeline happens to produce
// them. Each batch's throttle permit drops here, once accumulated.
let mut outgoing: Vec<Vec<(CanonicalKmer, usize, u8)>> = (0..n_parts).map(|_| Vec::new()).collect();
for vb in pipe.apply(throttled, n_workers, capacity) {
for (dest_partition, variant, source_slot, base) in vb.items {
outgoing[dest_partition].push((variant, source_slot, base));
}
}
// ── Resolve each partition's batch against the cache in one
// contiguous pass; parallelised across partitions (independent,
// read-only) so this keeps using multiple cores without giving up
// the per-partition locality above. ─────────────────────────────
outgoing.par_iter().enumerate().filter(|(_, q)| !q.is_empty()).for_each(|(dest, queries)| {
for &(variant, source_slot, base) in queries {
if cache.find(dest, variant) {
mask[source_slot].fetch_or(1 << base, Ordering::Relaxed);
}
}
});
// ── Write the layer's annex file ─────────────────────────────────────
let annex_path = layer_dir.join(ANNEX_FILE_NAME);
let mut builder = SiblingAnnexBuilder::new(n_slots, &annex_path)?;
for (slot, m) in mask.iter().enumerate() {
if slot_kmer[slot].is_none() {
continue; // unused MPHF slot, if any — leave at the sentinel
}
builder.set(slot, FamilyMask::from_bits(m.load(Ordering::Relaxed)));
}
builder.close()?;
Ok(n_slots as u64)
}
}
+121
View File
@@ -0,0 +1,121 @@
use rayon::prelude::*;
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix};
use obikpartitionner::KmerPartition;
use obikseq::CanonicalKmer;
use obilayeredmap::MphfLayer;
use obilayeredmap::meta::PartitionMeta;
use obisys::progress_bar;
use crate::error::OKIResult;
use super::{olm_to_ok, INDEX_SUBDIR};
/// Every partition's already-open MPHF layers, built **once** for the whole
/// `build_sibling_annex` run and shared (read-only) across every lookup, in
/// every source layer, for the rest of the run — not reopened/re-mmap'd per
/// query, nor per source layer.
///
/// Confirmed necessary by sampling a real run: routing lookups through
/// `KmerPartition::query_partition_with` (the same batching `obikmer query`
/// uses) still reopens+re-mmaps every target partition's files on every
/// call, and it is called once per destination partition **per source
/// layer** — for an index with many layers this repeats the same
/// `MphfLayer::open`/`Evidence::open`/`PersistentBitMatrix::open` work over
/// and over. Parallelising those calls (see the gather step below) spread
/// the redundant work across more cores but did not reduce it: sampling
/// showed Rayon workers spending their time inside repeated `open()`
/// syscalls, not computation. This cache amortises that cost to once per
/// partition for the entire run, regardless of how many source layers or
/// lookups follow.
/// A cached layer's opened presence/count matrix, alongside its `MphfLayer`.
pub(super) enum Mat {
Count(PersistentCompactIntMatrix),
Presence(PersistentBitMatrix),
}
impl Mat {
pub(super) fn n_cols(&self) -> usize {
match self {
Mat::Count(m) => m.n_cols(),
Mat::Presence(m) => m.n_cols(),
}
}
pub(super) fn carries(&self, g: usize, slot: usize) -> bool {
match self {
Mat::Count(m) => m.col_view(g).get(slot) != 0,
Mat::Presence(m) => m.get(g, slot) != 0,
}
}
}
pub(super) struct PartitionCache {
/// `layers[partition][layer]` = that partition's opened MPHF layers,
/// paired 1:1 with `mats[partition][layer]`; empty if the partition
/// directory doesn't exist. Used by both
/// [`crate::index::KmerIndex::build_sibling_annex`] (`layers` only) and
/// [`crate::index::KmerIndex::sibling_annex_stats`] (both).
layers: Vec<Vec<MphfLayer>>,
mats: Vec<Vec<Mat>>,
}
impl PartitionCache {
pub(super) fn build(partition: &KmerPartition, n_parts: usize, with_counts: bool) -> OKIResult<Self> {
let pb = progress_bar("open_partitions", n_parts as u64, "partitions");
let built: Vec<(Vec<MphfLayer>, Vec<Mat>)> = (0..n_parts)
.into_par_iter()
.map(|part| -> OKIResult<(Vec<MphfLayer>, Vec<Mat>)> {
let index_dir = partition.part_dir(part).join(INDEX_SUBDIR);
if !index_dir.exists() {
pb.inc(1);
return Ok((Vec::new(), Vec::new()));
}
let meta = PartitionMeta::load(&index_dir).map_err(olm_to_ok)?;
let mut layers = Vec::with_capacity(meta.n_layers);
let mut mats = Vec::with_capacity(meta.n_layers);
for l in 0..meta.n_layers {
let layer_dir = index_dir.join(format!("layer_{l}"));
let Ok(mphf) = MphfLayer::open(&layer_dir, &meta.mode) else { continue };
let use_counts = with_counts && layer_dir.join("counts").exists();
let mat = if use_counts {
PersistentCompactIntMatrix::open(&layer_dir).ok().map(Mat::Count)
} else {
PersistentBitMatrix::open(&layer_dir).ok().map(Mat::Presence)
};
let Some(mat) = mat else { continue };
layers.push(mphf);
mats.push(mat);
}
pb.inc(1);
Ok((layers, mats))
})
.collect::<OKIResult<Vec<_>>>()?;
pb.finish_and_clear();
let (layers, mats) = built.into_iter().unzip();
Ok(Self { layers, mats })
}
/// Existence-only lookup of `variant` in partition `dest_partition`:
/// tries each of the partition's already-open layers in turn, stopping
/// at the first hit.
pub(super) fn find(&self, dest_partition: usize, variant: CanonicalKmer) -> bool {
self.layers
.get(dest_partition)
.is_some_and(|layers| layers.iter().any(|mphf| mphf.find(variant).is_some()))
}
/// Per-genome presence vector for `variant` in partition `dest_partition`
/// (`true` iff that genome carries it), `None` on a miss. Same shape as
/// `find`, but also reads the cached matrix instead of just the MPHF.
pub(super) fn find_presence(&self, dest_partition: usize, variant: CanonicalKmer, n_genomes: usize) -> Option<Vec<bool>> {
let layers = self.layers.get(dest_partition)?;
let mats = self.mats.get(dest_partition)?;
for (mphf, mat) in layers.iter().zip(mats.iter()) {
if let Some(slot) = mphf.find(variant) {
let n_cols = mat.n_cols().min(n_genomes);
return Some((0..n_cols).map(|g| mat.carries(g, slot)).collect());
}
}
None
}
}
+204
View File
@@ -0,0 +1,204 @@
use ndarray::Array2;
use rayon::prelude::*;
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix, SiblingAnnex};
use obikpartitionner::KmerPartition;
use obikseq::CanonicalKmer;
use obilayeredmap::MphfLayer;
use obilayeredmap::meta::PartitionMeta;
use obiskio::UnitigFileReader;
use obisys::progress_bar;
use crate::error::{OKIError, OKIResult};
use crate::index::KmerIndex;
use super::cache::{Mat, PartitionCache};
use super::distance::RawSnpDistanceOutput;
use super::helpers::{central_base, is_minorant, partition_of};
use super::{olm_to_ok, ANNEX_FILE_NAME, INDEX_SUBDIR};
/// See [`KmerIndex::cardinality_tally`].
pub struct CardinalityTally {
/// `counts[a][b] == counts[b][a]` = number of family sites, pooled over
/// included genome pairs, where one genome's family cardinality
/// (popcount of its presence mask, `0..=4`) is `a` and the other's is
/// `b`. Diagonal is real data here (both genomes at the same
/// cardinality), unlike [`super::distance::BasePairTally::counts`].
pub counts: [[u64; 5]; 5],
}
impl KmerIndex {
/// Cardinality co-occurrence, pooled only over genome pairs whose
/// overall SNP ratio in `raw` is at or below `ratio_ceiling` — same
/// saturation/no-data exclusion discipline as
/// [`base_pair_tally`](Self::base_pair_tally). Unlike
/// `scan_family_pairs` (which resolves each genome to a single form and
/// silently drops any genome carrying more than one member of the
/// family), this needs the *full* per-genome presence mask — a family
/// member count of 2, 3 or 4 is exactly the signal being tallied, not
/// noise to discard — so it re-implements the traversal rather than
/// reusing that helper.
///
/// Restricted to variable families (`family_size() >= 2`), matching
/// `snp_pseudo_alignment`'s own scope — briefly removed, then
/// reinstated: without it, the diagonal is dominated by genome-wide
/// invariant background (family_size()<2 loci vastly outnumber the
/// ones that ever vary anywhere), which is inconsistent with the
/// `+ASC`-corrected alignment this matrix is ultimately used with —
/// `+ASC` exists specifically because the likelihood only ever sees
/// variable sites, so a rate model calibrated mostly from invariant
/// background sites doesn't describe the population it's applied to.
/// Verified empirically: removing the filter measurably worsened a
/// real IQ-TREE run (log-likelihood dropped, `NNI search needs
/// unusual large number of steps to converge` warnings appeared) — see
/// `docmd/theory/evolutionary_distances.md` for the full account.
/// [`base_pair_tally`](Self::base_pair_tally)'s own diagonal (`same`)
/// gets the matching restriction via `scan_family_pairs`'s new
/// `variable` flag, rather than a `family_size()` check of its own (it
/// doesn't have direct access to the family's mask).
pub fn cardinality_tally(&self, raw: &RawSnpDistanceOutput, ratio_ceiling: f64) -> OKIResult<CardinalityTally> {
let n_parts = self.n_partitions();
let n_genomes = self.meta.genomes.len();
let with_counts = self.meta.config.with_counts;
let k = self.kmer_size();
let n_bits = n_parts.trailing_zeros() as usize;
let included = Array2::from_shape_fn((n_genomes, n_genomes), |(i, j)| {
if i == j {
return false;
}
let snp = raw.snp[[i, j]];
let total = snp + raw.shared[[i, j]];
total > 0 && (snp as f64 / total as f64) <= ratio_ceiling
});
let partition = KmerPartition::open_with_config(
&self.root_path,
self.kmer_size(),
self.minimizer_size(),
n_bits,
)
.map_err(OKIError::Partition)?;
let cache = PartitionCache::build(&partition, n_parts, with_counts)?;
let mut layer_dirs = Vec::new();
for part in 0..n_parts {
let index_dir = self.partition().part_dir(part).join(INDEX_SUBDIR);
if !index_dir.exists() {
continue;
}
let meta = PartitionMeta::load(&index_dir).map_err(olm_to_ok)?;
for l in 0..meta.n_layers {
let layer_dir = index_dir.join(format!("layer_{l}"));
let annex_path = layer_dir.join(ANNEX_FILE_NAME);
if !annex_path.exists() {
return Err(OKIError::InvalidInput(format!(
"no sibling annex at {} — run build_sibling_annex first",
annex_path.display()
)));
}
layer_dirs.push(layer_dir);
}
}
let pb = progress_bar("cardinality_tally", layer_dirs.len() as u64, "layers");
let partials: Vec<[[u64; 5]; 5]> = layer_dirs
.par_iter()
.map(|layer_dir| -> OKIResult<[[u64; 5]; 5]> {
let index_dir = layer_dir.parent().expect("layer_dir has a parent index dir");
let meta = PartitionMeta::load(index_dir).map_err(olm_to_ok)?;
let annex = SiblingAnnex::open(&layer_dir.join(ANNEX_FILE_NAME))?;
let mphf = MphfLayer::open(layer_dir, &meta.mode).map_err(olm_to_ok)?;
let mut slot_kmer: Vec<Option<CanonicalKmer>> = vec![None; annex.len()];
let reader = UnitigFileReader::open_sequential(&layer_dir.join("unitigs.bin"))
.map_err(OKIError::Partition)?;
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) {
slot_kmer[slot] = Some(kmer);
}
}
let use_counts = with_counts && layer_dir.join("counts").exists();
let mat = if use_counts {
Mat::Count(PersistentCompactIntMatrix::open(layer_dir)?)
} else {
Mat::Presence(PersistentBitMatrix::open(layer_dir)?)
};
let n_cols = mat.n_cols().min(n_genomes);
let mut counts = [[0u64; 5]; 5];
let mut genome_mask: Vec<u8> = Vec::with_capacity(n_genomes);
for slot in 0..annex.len() {
let Some(mask) = annex.get(slot) else { continue };
let Some(kmer) = slot_kmer[slot] else { continue };
if !is_minorant(kmer, mask, k) {
continue; // family tallied once, at its minorant
}
if mask.family_size() < 2 {
// Fully invariant family (never varies anywhere in
// the index) — genome-wide background, not
// SNP-adjacent signal; would otherwise swamp the
// diagonal (`c=1/c=1` etc.), which needs to reflect
// the same variable-families-only population the
// `+ASC`-corrected alignment/likelihood actually
// models. See `base_pair_tally`'s `variable` gate
// on its own `same` diagonal for the matching fix.
continue;
}
genome_mask.clear();
genome_mask.resize(n_genomes, 0);
for other in kmer.central_canonical_neighbors() {
let base = central_base(other, k);
if !mask.has(base) {
continue;
}
let presence: Option<Vec<bool>> = if other == kmer {
Some((0..n_cols).map(|g| mat.carries(g, slot)).collect())
} else {
let dest = partition_of(other, n_parts);
cache.find_presence(dest, other, n_genomes)
};
let Some(presence) = presence else { continue };
for (g, &present) in presence.iter().enumerate() {
if present {
genome_mask[g] |= 1 << base;
}
}
}
for i in 0..n_genomes {
let card_i = genome_mask[i].count_ones() as usize;
for j in (i + 1)..n_genomes {
if !included[[i, j]] {
continue;
}
let card_j = genome_mask[j].count_ones() as usize;
counts[card_i][card_j] += 1;
if card_i != card_j {
counts[card_j][card_i] += 1;
}
}
}
}
pb.inc(1);
Ok(counts)
})
.collect::<OKIResult<Vec<_>>>()?;
pb.finish_and_clear();
let mut total = [[0u64; 5]; 5];
for partial in partials {
for a in 0..5 {
for b in 0..5 {
total[a][b] += partial[a][b];
}
}
}
Ok(CardinalityTally { counts: total })
}
}
+305
View File
@@ -0,0 +1,305 @@
use ndarray::Array2;
use rayon::prelude::*;
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix, SiblingAnnex};
use obikpartitionner::KmerPartition;
use obikseq::CanonicalKmer;
use obilayeredmap::MphfLayer;
use obilayeredmap::meta::PartitionMeta;
use obiskio::UnitigFileReader;
use obisys::progress_bar;
use crate::error::{OKIError, OKIResult};
use crate::index::KmerIndex;
use super::cache::{Mat, PartitionCache};
use super::helpers::{central_base, is_minorant, partition_of};
use super::{olm_to_ok, ANNEX_FILE_NAME, INDEX_SUBDIR};
/// Raw p-distance restricted to loci that are single-copy in **both**
/// genomes of a pair — the "stringent / paralogy-aware" locus eligibility
/// rule (`docmd/theory/evolutionary_distances.md`, "Locus eligibility"),
/// without the JC/K2P/LogDet finalisation math: `snp[i,j]` + `shared[i,j]`
/// is the number of eligible loci, `snp[i,j] / (snp[i,j] + shared[i,j])` is
/// `p_hat`. A quick, self-contained way to sanity-check the estimator
/// against a real index before the full `SnpTally` design is built.
///
/// A locus (family, tallied once at its minorant) is eligible for pair
/// `(i, j)` iff genome `i` carries exactly one of the family's observed
/// forms **and** genome `j` carries exactly one (possibly a different one)
/// — presence-only: a genome carrying the same form twice (a same-allele
/// duplicate) is indistinguishable from carrying it once when only a
/// presence matrix is available, so such cases are not excluded here even
/// when a count index exists. See "Locus eligibility", stringent rule, for
/// why this matters and how a count index would close the gap — left as a
/// follow-up, not applied here.
pub struct RawSnpDistanceOutput {
/// n×n count of eligible loci where the two genomes' single forms differ.
pub snp: Array2<u64>,
/// n×n count of eligible loci where the two genomes' single forms agree.
pub shared: Array2<u64>,
}
impl KmerIndex {
/// Shared traversal behind [`raw_snp_distance`](Self::raw_snp_distance)
/// and [`base_pair_tally`](Self::base_pair_tally): for every family
/// (tallied once, at its minorant) of every layer of the already-built
/// sibling annex, resolves each genome's single observed form (`None`
/// if absent or ambiguous/multi-copy), then calls `on_pair(acc, i, j,
/// bi, bj, variable)` for every genome pair `(i, j)` where both are
/// unambiguous and single-copy (`bi == bj` means shared at that locus,
/// `bi != bj` means a SNP). `variable` is the family's own
/// `family_size() >= 2` (true if more than one member is observed
/// *anywhere* in the family, i.e. it isn't fully invariant across the
/// whole index) — `raw_snp_distance` ignores it (a fully-invariant
/// family is still legitimately "shared"), but callers whose diagonal
/// should only reflect genuine SNP-adjacent agreement, not the
/// genome-wide invariant background, need it (see
/// [`base_pair_tally`](Self::base_pair_tally)'s `same` field). Layers
/// are processed in parallel (rayon); each gets its own accumulator
/// from `zero()`, combined pairwise via `combine`.
fn scan_family_pairs<Acc, F, C>(
&self,
label: &str,
zero: impl Fn() -> Acc + Sync,
on_pair: F,
combine: C,
) -> OKIResult<Acc>
where
Acc: Send,
F: Fn(&mut Acc, usize, usize, u8, u8, bool) + Sync,
C: Fn(Acc, Acc) -> Acc,
{
let n_parts = self.n_partitions();
let n_genomes = self.meta.genomes.len();
let with_counts = self.meta.config.with_counts;
let k = self.kmer_size();
let n_bits = n_parts.trailing_zeros() as usize;
let partition = KmerPartition::open_with_config(
&self.root_path,
self.kmer_size(),
self.minimizer_size(),
n_bits,
)
.map_err(OKIError::Partition)?;
let cache = PartitionCache::build(&partition, n_parts, with_counts)?;
let mut layer_dirs = Vec::new();
for part in 0..n_parts {
let index_dir = self.partition().part_dir(part).join(INDEX_SUBDIR);
if !index_dir.exists() {
continue;
}
let meta = PartitionMeta::load(&index_dir).map_err(olm_to_ok)?;
for l in 0..meta.n_layers {
let layer_dir = index_dir.join(format!("layer_{l}"));
let annex_path = layer_dir.join(ANNEX_FILE_NAME);
if !annex_path.exists() {
return Err(OKIError::InvalidInput(format!(
"no sibling annex at {} — run build_sibling_annex first",
annex_path.display()
)));
}
layer_dirs.push(layer_dir);
}
}
let pb = progress_bar(label, layer_dirs.len() as u64, "layers");
let partials: Vec<Acc> = layer_dirs
.par_iter()
.map(|layer_dir| -> OKIResult<Acc> {
let mut acc = zero();
let index_dir = layer_dir.parent().expect("layer_dir has a parent index dir");
let meta = PartitionMeta::load(index_dir).map_err(olm_to_ok)?;
let annex = SiblingAnnex::open(&layer_dir.join(ANNEX_FILE_NAME))?;
let mphf = MphfLayer::open(layer_dir, &meta.mode).map_err(olm_to_ok)?;
let mut slot_kmer: Vec<Option<CanonicalKmer>> = vec![None; annex.len()];
let reader = UnitigFileReader::open_sequential(&layer_dir.join("unitigs.bin"))
.map_err(OKIError::Partition)?;
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) {
slot_kmer[slot] = Some(kmer);
}
}
let use_counts = with_counts && layer_dir.join("counts").exists();
let mat = if use_counts {
Mat::Count(PersistentCompactIntMatrix::open(layer_dir)?)
} else {
Mat::Presence(PersistentBitMatrix::open(layer_dir)?)
};
let n_cols = mat.n_cols().min(n_genomes);
// Per family: which single form (if exactly one) each genome
// carries — `None` once a second form is seen (ambiguous,
// not single-copy, ineligible for either side of a pair).
let mut single_form: Vec<Option<u8>> = Vec::with_capacity(n_cols);
let mut ambiguous: Vec<bool> = Vec::with_capacity(n_cols);
for slot in 0..annex.len() {
let Some(mask) = annex.get(slot) else { continue };
let Some(kmer) = slot_kmer[slot] else { continue };
if !is_minorant(kmer, mask, k) {
continue; // family tallied once, at its minorant
}
let variable = mask.family_size() >= 2;
single_form.clear();
single_form.resize(n_cols, None);
ambiguous.clear();
ambiguous.resize(n_cols, false);
for other in kmer.central_canonical_neighbors() {
let base = central_base(other, k);
if !mask.has(base) {
continue;
}
let presence: Option<Vec<bool>> = if other == kmer {
Some((0..n_cols).map(|g| mat.carries(g, slot)).collect())
} else {
let dest = partition_of(other, n_parts);
cache.find_presence(dest, other, n_genomes)
};
let Some(presence) = presence else { continue };
for (g, &present) in presence.iter().enumerate() {
if !present {
continue;
}
if single_form[g].is_some() {
ambiguous[g] = true;
} else {
single_form[g] = Some(base);
}
}
}
for i in 0..n_cols {
if ambiguous[i] {
continue;
}
let Some(bi) = single_form[i] else { continue };
for j in (i + 1)..n_cols {
if ambiguous[j] {
continue;
}
let Some(bj) = single_form[j] else { continue };
on_pair(&mut acc, i, j, bi, bj, variable);
}
}
}
pb.inc(1);
Ok(acc)
})
.collect::<OKIResult<Vec<_>>>()?;
pb.finish_and_clear();
let mut total = zero();
for partial in partials {
total = combine(total, partial);
}
Ok(total)
}
/// Compute [`RawSnpDistanceOutput`] from an already-built sibling annex
/// (run [`build_sibling_annex`](Self::build_sibling_annex) first).
pub fn raw_snp_distance(&self) -> OKIResult<RawSnpDistanceOutput> {
let n_genomes = self.meta.genomes.len();
let (snp, shared) = self.scan_family_pairs(
"raw_snp_distance",
|| (Array2::<u64>::zeros((n_genomes, n_genomes)), Array2::<u64>::zeros((n_genomes, n_genomes))),
|(snp, shared), i, j, bi, bj, _variable| {
if bi == bj {
shared[[i, j]] += 1;
shared[[j, i]] += 1;
} else {
snp[[i, j]] += 1;
snp[[j, i]] += 1;
}
},
|(mut snp, mut shared), (s, sh)| {
snp += &s;
shared += &sh;
(snp, shared)
},
)?;
Ok(RawSnpDistanceOutput { snp, shared })
}
/// Symmetric 6-category base-pair substitution tally (AC, AG, AT, CG,
/// CT, GT — indexed `0=A,1=C,2=G,3=T`), pooled only over genome pairs
/// whose overall SNP ratio in `raw` is at or below `ratio_ceiling` —
/// same saturation-exclusion discipline as
/// [`cardinality_tally`](Self::cardinality_tally), for the same reason:
/// a saturated pair's observed base-pair mix trends toward neutral base
/// composition, not the true point-mutation spectrum.
///
/// A second full pass over the annex, sharing
/// [`raw_snp_distance`](Self::raw_snp_distance)'s traversal (guided by
/// it, not a blind re-scan) — needed because `raw_snp_distance` only
/// keeps aggregate SNP/shared counts per genome pair, not which bases
/// were actually involved at each locus, and the ratio-ceiling filter
/// can only be evaluated once the aggregate counts are known.
pub fn base_pair_tally(&self, raw: &RawSnpDistanceOutput, ratio_ceiling: f64) -> OKIResult<BasePairTally> {
let n_genomes = self.meta.genomes.len();
let included = Array2::from_shape_fn((n_genomes, n_genomes), |(i, j)| {
if i == j {
return false;
}
let snp = raw.snp[[i, j]];
let total = snp + raw.shared[[i, j]];
total > 0 && (snp as f64 / total as f64) <= ratio_ceiling
});
let (counts, same) = self.scan_family_pairs(
"base_pair_tally",
|| ([[0u64; 4]; 4], [0u64; 4]),
|(counts, same), i, j, bi, bj, variable| {
if !included[[i, j]] {
return;
}
if bi != bj {
counts[bi as usize][bj as usize] += 1;
counts[bj as usize][bi as usize] += 1;
} else if variable {
// Only count "stayed the same" from families that vary
// *somewhere* in the index — a fully invariant family
// (never varies anywhere) isn't a SNP-adjacent
// agreement, it's genome-wide background, and would
// otherwise swamp the diagonal (see
// `docmd/theory/evolutionary_distances.md`, the
// ascertainment-bias regression this was reverting).
same[bi as usize] += 1;
}
},
|(mut counts, mut same), (partial_counts, partial_same)| {
for a in 0..4 {
same[a] += partial_same[a];
for b in 0..4 {
counts[a][b] += partial_counts[a][b];
}
}
(counts, same)
},
)?;
Ok(BasePairTally { counts, same })
}
}
/// See [`KmerIndex::base_pair_tally`].
pub struct BasePairTally {
/// `counts[a][b] == counts[b][a]` = number of eligible loci, pooled
/// over included genome pairs, where the two genomes' single forms are
/// `a` and `b` (0=A, 1=C, 2=G, 3=T). Diagonal always `0` — an `a == b`
/// locus is counted in `same`, not here.
pub counts: [[u64; 4]; 4],
/// `same[a]` = number of eligible loci, pooled over included genome
/// pairs, where both genomes' single forms are `a` — the diagonal
/// `counts` omits, needed to build a proper row-stochastic composition
/// probability matrix (the "stay the same base" entries), not just the
/// substitution-cost off-diagonal.
pub same: [u64; 4],
}
+49
View File
@@ -0,0 +1,49 @@
use obikseq::CanonicalKmer;
use obiskbuilder::rolling_stat::RollingStat;
use obicompactvec::FamilyMask;
/// Central-position base of a canonical k-mer, in the fixed 0=A/1=C/2=G/3=T
/// encoding — the mask's bit index. `k` must be odd (project invariant).
#[inline]
pub(super) fn central_base(kmer: CanonicalKmer, k: usize) -> u8 {
kmer.nucleotide((k - 1) / 2)
}
/// Is `kmer` the minorant of its family, given the family's presence mask?
/// Regenerates the family's 4 canonical forms from `kmer` itself (cheap, no
/// lookup — see the design doc's "Definitions" section for why this is
/// always safe: the set of 4 forms is invariant regardless of which member
/// you start from), and compares the raw encodings of whichever are marked
/// present in `mask`.
pub(super) fn is_minorant(kmer: CanonicalKmer, mask: FamilyMask, k: usize) -> bool {
kmer.central_canonical_neighbors().into_iter().all(|other| {
other == kmer || !mask.has(central_base(other, k)) || kmer.raw() <= other.raw()
})
}
/// Minimiser of a single, isolated canonical k-mer (not part of a streamed
/// sequence). `RollingStat` computes minimisers incrementally along a
/// sequence; this feeds one k-mer's bases through a fresh instance to get
/// the same selection for a single, disconnected k-mer. Not the leanest
/// possible primitive (an O(1)-amortised dedicated scan, as originally
/// sketched in the design doc's Step 0, would avoid the ASCII round-trip and
/// `RollingStat` allocation) but correct and reuses already-tested logic;
/// left as a follow-up optimisation.
fn lone_kmer_minimizer(kmer: CanonicalKmer) -> obikseq::Minimizer {
let ascii = kmer.to_ascii();
let mut rs = RollingStat::new(0);
for b in ascii {
rs.push(b);
}
rs.canonical_minimizer()
.expect("RollingStat must be ready after k bases of a valid k-mer")
}
/// Destination partition for a (possibly synthetic) canonical k-mer, using
/// the same routing rule as the rest of the index (`minimiser.seq_hash() &
/// mask`, `n_partitions` is a power of two).
pub(super) fn partition_of(kmer: CanonicalKmer, n_partitions: usize) -> usize {
let mask = (n_partitions as u64) - 1;
(lone_kmer_minimizer(kmer).seq_hash() & mask) as usize
}
+73
View File
@@ -0,0 +1,73 @@
//! Family presence-mask annex construction.
//!
//! See `docmd/theory/evolutionary_distances.md`, "Definitions: family, and
//! the canonical form of a family" and "Step 2b", for the full design
//! discussion this implements.
//!
//! For each distinct k-mer of each layer of the (already built/merged)
//! index, computes a 4-bit presence mask for its "family" (the up to 4
//! k-mers sharing its flanks, differing only at the central base —
//! well-defined for odd k): bit `b` set iff the family member whose own
//! canonical central base is `b` (0=A, 1=C, 2=G, 3=T) is observed anywhere
//! in the current multi-genome index — a property of the whole index, not
//! of any one genome. Sibling count and minorant are *derived* from the
//! mask by callers, not stored (see `FamilyMask` and
//! [`sibling_annex_stats`](crate::index::KmerIndex::sibling_annex_stats)
//! below).
//!
//! Per layer, an `obipipeline` batch transform (throttled — see
//! `obipipeline::throttle`) generates a whole batch's central variants at
//! once (`BATCH_SIZE` source k-mers in, that batch's variants out as one
//! pipeline message), interleaved across many in-flight batches by the
//! scheduler's shared worker pool rather than processed on a single
//! thread. The actual cross-partition lookup reuses a `PartitionCache` of
//! every partition's already-open MPHF layers, built once for the whole
//! `build_sibling_annex` run, rather than reopening files per lookup or
//! per source layer. Two earlier, coarser-grained designs were tried and
//! measured (not guessed) to be worse, in order: (1) reopening/re-mmap'ing
//! every target partition's files on every single lookup — fine at toy
//! scale, ~90% system time against a real index; (2) a `Flat` pipeline
//! stage pushing one message per generated *variant* (up to 3 per source
//! k-mer) — cheaper than reopening files, but sampling a real run showed
//! most wall-clock time going into per-message channel send/notify
//! syscalls rather than the lookup itself, because a single k-mer's ≤3
//! variants is far too fine a granularity to amortise a pipeline's
//! synchronisation cost over. See `docmd/theory/evolutionary_distances.md`,
//! Step 2b, "Mechanism".
//!
//! Submodules, in the order data flows through them: [`cache`] (shared
//! whole-run partition cache), [`helpers`] (small pure functions used
//! throughout), [`build`] (annex construction), [`stats`] (family-size
//! diagnostics), [`distance`] (raw SNP distance + base-pair tally),
//! [`cardinality`] (cardinality co-occurrence), [`alignment`] (SNP-only
//! pseudo-alignment).
mod alignment;
mod build;
mod cache;
mod cardinality;
mod distance;
mod helpers;
mod stats;
#[cfg(test)]
mod tests;
pub use alignment::SnpAlignment;
pub use cardinality::CardinalityTally;
pub use distance::{BasePairTally, RawSnpDistanceOutput};
pub use stats::SiblingAnnexStats;
use obilayeredmap::OLMError;
use crate::error::OKIError;
pub(super) const INDEX_SUBDIR: &str = "index";
pub(super) const ANNEX_FILE_NAME: &str = "siblings.psib";
pub(super) fn olm_to_ok(e: OLMError) -> OKIError {
match e {
OLMError::Io(e) => OKIError::Io(e),
other => OKIError::InvalidInput(format!("layered-map error: {other}")),
}
}
+192
View File
@@ -0,0 +1,192 @@
use rayon::prelude::*;
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix, SiblingAnnex};
use obikpartitionner::KmerPartition;
use obikseq::CanonicalKmer;
use obilayeredmap::MphfLayer;
use obilayeredmap::meta::PartitionMeta;
use obiskio::UnitigFileReader;
use obisys::progress_bar;
use crate::error::{OKIError, OKIResult};
use crate::index::KmerIndex;
use super::cache::{Mat, PartitionCache};
use super::helpers::{central_base, is_minorant, partition_of};
use super::{olm_to_ok, ANNEX_FILE_NAME, INDEX_SUBDIR};
/// Distribution of family sizes (1-4), read back from an already-built
/// annex (see [`KmerIndex::build_sibling_annex`]) plus the index's
/// presence/count data — a separate, occasional diagnostic pass, not fused
/// into construction.
///
/// Every count here is **per family, not per slot**: a family with `F`
/// members occupies `F` annex slots (one per observed member), all sharing
/// the same mask. Counting every slot would count each family up to 4
/// times over; only the minorant's slot is tallied (minorant is derived on
/// the fly — see `is_minorant` — not stored, but cheap: no lookup, pure
/// bit arithmetic on already-in-hand data).
#[derive(Debug, Clone, Default)]
pub struct SiblingAnnexStats {
/// `counts[s]` = number of *families* of size `s + 1` (index 0 = size 1,
/// i.e. 0 siblings, ... index 3 = size 4, i.e. 3 siblings).
pub counts: [u64; 4],
/// `per_genome[g][s]` = number of families of size `s + 1` for which
/// genome `g` (index into `KmerIndex::meta().genomes`) carries at least
/// one member.
pub per_genome: Vec<[u64; 4]>,
}
impl KmerIndex {
/// Tally the family-size distribution of an already-built annex
/// (globally, and per genome), counting each family once (at its
/// minorant slot). Errors if [`build_sibling_annex`] has not been run on
/// this index first.
///
/// [`build_sibling_annex`]: Self::build_sibling_annex
pub fn sibling_annex_stats(&self) -> OKIResult<SiblingAnnexStats> {
let n_parts = self.n_partitions();
let n_genomes = self.meta.genomes.len();
let with_counts = self.meta.config.with_counts;
let k = self.kmer_size();
let n_bits = n_parts.trailing_zeros() as usize;
// Same whole-run cache as `build_sibling_annex` — see its docs for
// why re-opening per lookup (or per call to a batching helper) is
// not good enough on a real index.
let partition = KmerPartition::open_with_config(
&self.root_path,
self.kmer_size(),
self.minimizer_size(),
n_bits,
)
.map_err(OKIError::Partition)?;
let cache = PartitionCache::build(&partition, n_parts, with_counts)?;
// Gather the (partition, layer) pairs to process — cheap metadata
// reads only, checking every annex file exists up front so a
// missing one is reported before any real work starts.
let mut layer_dirs = Vec::new();
for part in 0..n_parts {
let index_dir = self.partition().part_dir(part).join(INDEX_SUBDIR);
if !index_dir.exists() {
continue;
}
let meta = PartitionMeta::load(&index_dir).map_err(olm_to_ok)?;
for l in 0..meta.n_layers {
let layer_dir = index_dir.join(format!("layer_{l}"));
let annex_path = layer_dir.join(ANNEX_FILE_NAME);
if !annex_path.exists() {
return Err(OKIError::InvalidInput(format!(
"no sibling annex at {} — run build_sibling_annex first",
annex_path.display()
)));
}
layer_dirs.push(layer_dir);
}
}
// One layer's worth of work, parallelised across layers with Rayon
// — independent, read-only, each producing its own partial tally
// merged at the end.
let pb = progress_bar("sibling_annex_stats", layer_dirs.len() as u64, "layers");
let partials: Vec<SiblingAnnexStats> = layer_dirs
.par_iter()
.map(|layer_dir| -> OKIResult<SiblingAnnexStats> {
let mut stats = SiblingAnnexStats {
per_genome: vec![[0u64; 4]; n_genomes],
..Default::default()
};
let index_dir = layer_dir.parent().expect("layer_dir has a parent index dir");
let meta = PartitionMeta::load(index_dir).map_err(olm_to_ok)?;
let annex = SiblingAnnex::open(&layer_dir.join(ANNEX_FILE_NAME))?;
// Need each slot's own k-mer to derive minorant — same
// enumeration as construction.
let mphf = MphfLayer::open(layer_dir, &meta.mode).map_err(olm_to_ok)?;
let mut slot_kmer: Vec<Option<CanonicalKmer>> = vec![None; annex.len()];
let reader = UnitigFileReader::open_sequential(&layer_dir.join("unitigs.bin"))
.map_err(OKIError::Partition)?;
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) {
slot_kmer[slot] = Some(kmer);
}
}
let use_counts = with_counts && layer_dir.join("counts").exists();
let mat = if use_counts {
Mat::Count(PersistentCompactIntMatrix::open(layer_dir)?)
} else {
Mat::Presence(PersistentBitMatrix::open(layer_dir)?)
};
let n_cols = mat.n_cols().min(n_genomes);
for slot in 0..annex.len() {
let Some(mask) = annex.get(slot) else { continue };
let Some(kmer) = slot_kmer[slot] else { continue };
if !is_minorant(kmer, mask, k) {
continue; // this family is tallied at its minorant's slot only
}
let s = mask.siblings() as usize;
stats.counts[s] += 1;
// "Genome g represents this family" means g carries
// *any* of its members, not just the minorant's own —
// start from the minorant's own presence (already
// open, no lookup) and OR in every other present
// member's presence vector, resolved against the
// whole-run cache (no I/O) — exactly `mask.siblings()`
// of them, the mask tells us precisely which to fetch.
let mut carries = vec![false; n_cols];
for g in 0..n_cols {
carries[g] = mat.carries(g, slot);
}
for other in kmer.central_canonical_neighbors() {
if other == kmer {
continue;
}
let base = central_base(other, k);
if !mask.has(base) {
continue;
}
let dest = partition_of(other, n_parts);
if let Some(other_presence) = cache.find_presence(dest, other, n_genomes) {
for (g, &present) in other_presence.iter().enumerate() {
if present {
carries[g] = true;
}
}
}
}
for (g, &carried) in carries.iter().enumerate() {
if carried {
stats.per_genome[g][s] += 1;
}
}
}
pb.inc(1);
Ok(stats)
})
.collect::<OKIResult<Vec<_>>>()?;
pb.finish_and_clear();
let mut stats = SiblingAnnexStats {
per_genome: vec![[0u64; 4]; n_genomes],
..Default::default()
};
for part in partials {
for s in 0..4 {
stats.counts[s] += part.counts[s];
}
for g in 0..n_genomes {
for s in 0..4 {
stats.per_genome[g][s] += part.per_genome[g][s];
}
}
}
Ok(stats)
}
}
+186
View File
@@ -0,0 +1,186 @@
use std::io::Write;
use std::path::Path;
use obicompactvec::{FamilyMask, SiblingAnnex};
use obikseq::{CanonicalKmer, Kmer, Sequence};
use obilayeredmap::MphfLayer;
use obilayeredmap::meta::PartitionMeta;
use obisys::Reporter;
use tempfile::tempdir;
use crate::index::KmerIndex;
use crate::meta::{GenomeInfo, IndexConfig};
use crate::merge::MergeMode;
use super::helpers::is_minorant;
use super::{ANNEX_FILE_NAME, INDEX_SUBDIR};
// k must be >= 11 (project constraint, "k ∈ [11,31]"); k=11, level_max=1,
// theta=0.0 mirror `obiskbuilder`'s own tests (smaller k/level_max
// combinations trip an unrelated pre-existing bug in `obikentropy`'s
// sliding-window ring buffer — not this feature's concern).
const K: usize = 11;
const M: usize = 5;
/// Build a single-genome index from one in-memory FASTA sequence, driving
/// the same primitives `obikmer`'s `scatter` step uses (minus the
/// multi-file `obipipeline` wrapper — a single sequence needs none of
/// that): normalise -> build superkmers -> route -> write.
/// `cargo test` doesn't install a `tracing` subscriber the way `obikmer`'s
/// CLI does, so `debug!`/etc. are silent no-ops by default — including the
/// `PartitionRunner` instrumentation that would matter most for
/// re-diagnosing a hang here. `try_init` is idempotent across concurrently
/// running tests (later calls just find a subscriber already installed).
fn init_tracing() {
let _ = tracing_subscriber::fmt()
.with_env_filter(
tracing_subscriber::EnvFilter::try_from_default_env()
.unwrap_or_else(|_| tracing_subscriber::EnvFilter::new("info")),
)
.with_writer(std::io::stderr)
.try_init();
}
fn build_single_genome_index(dir: &Path, label: &str, seq: &[u8]) -> KmerIndex {
init_tracing();
let fasta_path = dir.join(format!("{label}.fasta"));
let mut f = std::fs::File::create(&fasta_path).unwrap();
writeln!(f, ">{label}").unwrap();
f.write_all(seq).unwrap();
writeln!(f).unwrap();
drop(f);
let index_path = dir.join(format!("{label}.idx"));
let config = IndexConfig {
kmer_size: K,
minimizer_size: M,
n_bits: 0, // 1 partition — keeps the test deterministic and simple
with_counts: false,
evidence: obilayeredmap::IndexMode::Exact,
block_bits: 0,
};
let mut idx = KmerIndex::create(&index_path, config, Some(GenomeInfo::new(label)), false)
.expect("create");
let mut rep = Reporter::new();
let stream = obiread::open_nuc_stream(fasta_path.to_str().unwrap(), K).expect("open fasta");
for page in stream {
let batch = obiskbuilder::build_superkmers_page(page, K, /* level_max */ 1, /* theta */ 0.0);
idx.partition_mut().write_batch(batch).expect("write_batch");
}
idx.partition_mut().close().expect("close partition writers");
idx.mark_scattered().expect("mark_scattered");
idx.dereplicate_and_count(false, &mut rep).expect("dereplicate_and_count");
idx.build_layers(1, None, false, &mut rep).expect("build_layers");
idx
}
fn canonical(ascii: &[u8]) -> CanonicalKmer {
Kmer::from_ascii(ascii).unwrap().canonical()
}
/// Read back the annex entry for a given canonical k-mer from the merged
/// index's (single) partition/layer, asserting it was found at all.
fn annex_info_for(idx: &KmerIndex, kmer: CanonicalKmer) -> FamilyMask {
let index_dir = idx.partition().part_dir(0).join(INDEX_SUBDIR);
let meta = PartitionMeta::load(&index_dir).unwrap();
for l in 0..meta.n_layers {
let layer_dir = index_dir.join(format!("layer_{l}"));
let mphf = MphfLayer::open(&layer_dir, &meta.mode).unwrap();
if let Some(slot) = mphf.find(kmer) {
let annex = SiblingAnnex::open(&layer_dir.join(ANNEX_FILE_NAME)).unwrap();
return annex.get(slot).expect("slot must have a computed annex entry");
}
}
panic!("kmer not found in any layer of partition 0");
}
fn merge_two(dir: &Path, g1: &KmerIndex, g2: &KmerIndex) -> KmerIndex {
let mut rep = Reporter::new();
KmerIndex::merge(
&dir.join("merged.idx"),
&[g1, g2],
MergeMode::Presence,
false,
false,
1.0,
&mut rep,
)
.expect("merge")
}
#[test]
fn sibling_annex_one_sibling_each() {
// k=11, centre = index 5 (0-based). Two genomes, each exactly one
// k-mer, sharing every base except the centre:
// g1 = "AACCGCTTAAG" (centre 'C', base index 1)
// g2 = "AACCGGTTAAG" (centre 'G', base index 2)
// Hand-verified: both stay forward-oriented under canonicalisation
// (each is lexicographically smaller than its own reverse
// complement, since both start with "AA"), and raw(g1) < raw(g2)
// (only differing base: C=0b01 < G=0b10 at the centre) — so g1 is
// the minorant, g2 is not. The mask is a family-wide value: both
// slots must read back the *same* mask (bits 1 and 2 set).
let dir = tempdir().unwrap();
let g1 = build_single_genome_index(dir.path(), "g1", b"AACCGCTTAAG");
let g2 = build_single_genome_index(dir.path(), "g2", b"AACCGGTTAAG");
let merged = merge_two(dir.path(), &g1, &g2);
merged.build_sibling_annex().expect("build_sibling_annex");
let g1_kmer = canonical(b"AACCGCTTAAG");
let g2_kmer = canonical(b"AACCGGTTAAG");
let expected_mask = FamilyMask::EMPTY.with(1).with(2);
let a = annex_info_for(&merged, g1_kmer);
assert_eq!(a, expected_mask, "AACCGCTTAAG");
assert_eq!(a.siblings(), 1);
assert!(is_minorant(g1_kmer, a, K), "g1 should be the minorant");
let b = annex_info_for(&merged, g2_kmer);
assert_eq!(b, expected_mask, "AACCGGTTAAG");
assert_eq!(b.siblings(), 1);
assert!(!is_minorant(g2_kmer, b, K), "g2 should not be the minorant");
}
#[test]
fn sibling_annex_zero_siblings_when_identical_and_no_variant_exists() {
// Same k-mer in both genomes, no other genome around to carry a
// variant -> 0 siblings, trivially its own minorant.
let dir = tempdir().unwrap();
let g1 = build_single_genome_index(dir.path(), "g1", b"GATTACAGATC");
let g2 = build_single_genome_index(dir.path(), "g2", b"GATTACAGATC");
let merged = merge_two(dir.path(), &g1, &g2);
merged.build_sibling_annex().expect("build_sibling_annex");
let kmer = canonical(b"GATTACAGATC");
let mask = annex_info_for(&merged, kmer);
assert_eq!(mask.siblings(), 0, "GATTACAGATC");
assert_eq!(mask.family_size(), 1);
assert!(is_minorant(kmer, mask, K));
}
#[test]
fn sibling_annex_stats_counts_each_family_once_and_per_genome() {
// Reuses the one-sibling-each fixture: a single family of size 2
// (g1's centre-C form + g2's centre-G form), each genome carrying
// exactly one of the two members. Stats must report exactly one
// family of size 2 (`counts[1] == 1`, since index 1 = size 2), not
// two (which naively summing both slots would give), and both
// genomes represented at size 2, neither at any other size.
let dir = tempdir().unwrap();
let g1 = build_single_genome_index(dir.path(), "g1", b"AACCGCTTAAG");
let g2 = build_single_genome_index(dir.path(), "g2", b"AACCGGTTAAG");
let merged = merge_two(dir.path(), &g1, &g2);
merged.build_sibling_annex().expect("build_sibling_annex");
let stats = merged.sibling_annex_stats().expect("sibling_annex_stats");
assert_eq!(stats.counts, [0, 1, 0, 0], "one family of size 2, counted once");
assert_eq!(stats.per_genome.len(), 2);
for g in 0..2 {
assert_eq!(
stats.per_genome[g], [0, 1, 0, 0],
"genome {g} should represent exactly one size-2 family"
);
}
}
@@ -1,5 +1,14 @@
//! Merging a source partition's new layer into a destination partition:
//! de Bruijn graph union (pass 1) then column fill (pass 2).
//!
//! Submodules: [`src_layer`] (`SrcLayerData`, the opened-source-matrix
//! lookup used by pass 2 here and by `rebuild_layer`). The `merge_partition`
//! orchestration itself stays in this file — its ~400-line body is one
//! tightly threaded pipeline (shared `Arc`/`Mutex` state across pass 1,
//! builder setup, and pass 2), not a set of independently callable steps.
use std::fs;
use std::path::{Path, PathBuf};
use std::path::PathBuf;
use std::sync::{Arc, Mutex};
use tracing::debug;
@@ -10,7 +19,6 @@ use obipipeline::{
};
use obicompactvec::{
MatrixGroupOps,
PersistentBitMatrix, PersistentBitMatrixBuilder, PersistentBitVecBuilder,
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, PersistentCompactIntVecBuilder,
};
@@ -23,6 +31,10 @@ use crate::common::{ColBuilder, col_path_bit, col_path_int, load_meta, olm_to_sk
use crate::graph_pipeline::{build_graph, materialize_layer};
use crate::partition::KmerPartition;
mod src_layer;
pub(crate) use src_layer::SrcLayerData;
// ── MergeMode ─────────────────────────────────────────────────────────────────
#[derive(Debug, Clone, Copy, PartialEq, Eq)]
@@ -31,91 +43,6 @@ pub enum MergeMode {
Count,
}
// ── SrcLayerData — opened source matrix for pass-2 lookup ─────────────────────
pub(crate) enum SrcLayerData {
Presence(MphfOnly, PersistentBitMatrix),
Count(MphfOnly, PersistentCompactIntMatrix),
}
impl SrcLayerData {
pub(crate) fn open(layer_dir: &Path, merge_mode: MergeMode) -> SKResult<Self> {
let counts_dir = layer_dir.join("counts");
match merge_mode {
MergeMode::Presence => {
if counts_dir.exists() && !layer_dir.join("presence").exists() {
let mphf = MphfOnly::open(layer_dir).map_err(|e| olm_to_sk(e, "merge"))?;
let mat = PersistentCompactIntMatrix::open(layer_dir).map_err(SKError::Io)?;
Ok(SrcLayerData::Count(mphf, mat))
} else {
// presence dir exists, or neither exists → Implicit handled by open()
let mphf = MphfOnly::open(layer_dir).map_err(|e| olm_to_sk(e, "merge"))?;
let mat = PersistentBitMatrix::open(layer_dir).map_err(SKError::Io)?;
Ok(SrcLayerData::Presence(mphf, mat))
}
}
MergeMode::Count => {
let mphf = MphfOnly::open(layer_dir).map_err(|e| olm_to_sk(e, "merge"))?;
if counts_dir.exists() {
let mat = PersistentCompactIntMatrix::open(layer_dir).map_err(SKError::Io)?;
Ok(SrcLayerData::Count(mphf, mat))
} else {
// No counts → treat as implicit presence (all 1s)
let mat = PersistentBitMatrix::open(layer_dir).map_err(SKError::Io)?;
Ok(SrcLayerData::Presence(mphf, mat))
}
}
}
}
/// Return one value per source genome for `kmer`.
/// The caller guarantees `kmer` is in the source MPHF domain.
#[inline]
pub(crate) fn lookup(&self, kmer: CanonicalKmer, n_genomes: usize) -> Vec<u32> {
let mut buf = vec![0u32; n_genomes];
match self {
SrcLayerData::Presence(mphf, mat) => mat.fill_row(mphf.index(kmer), &mut buf),
SrcLayerData::Count(mphf, mat) => mat.fill_row(mphf.index(kmer), &mut buf),
}
buf
}
pub(crate) fn n_slots(&self) -> usize {
match self {
SrcLayerData::Presence(_, mat) => mat.n(),
SrcLayerData::Count(_, mat) => mat.n(),
}
}
/// MPHF lookup: returns the slot index for `kmer` (kmer must be in the domain).
#[inline]
pub(crate) fn slot(&self, kmer: CanonicalKmer) -> usize {
match self {
SrcLayerData::Presence(mphf, _) => mphf.index(kmer),
SrcLayerData::Count(mphf, _) => mphf.index(kmer),
}
}
/// Row lookup by slot index, bypassing the MPHF.
#[inline]
pub(crate) fn fill_row_by_slot(&self, slot: usize, n_genomes: usize) -> Vec<u32> {
let mut buf = vec![0u32; n_genomes];
match self {
SrcLayerData::Presence(_, mat) => mat.fill_row(slot, &mut buf),
SrcLayerData::Count(_, mat) => mat.fill_row(slot, &mut buf),
}
buf
}
/// Call `f` with a reference to the underlying matrix as `&dyn MatrixGroupOps`.
pub(crate) fn with_matrix<R>(&self, f: impl FnOnce(&dyn MatrixGroupOps) -> R) -> R {
match self {
SrcLayerData::Presence(_, mat) => f(mat),
SrcLayerData::Count(_, mat) => f(mat),
}
}
}
// ── helpers ───────────────────────────────────────────────────────────────────
const INDEX_SUBDIR: &str = "index";
@@ -0,0 +1,95 @@
use std::path::Path;
use obicompactvec::{MatrixGroupOps, PersistentBitMatrix, PersistentCompactIntMatrix};
use obikseq::CanonicalKmer;
use obilayeredmap::MphfOnly;
use obiskio::{SKError, SKResult};
use crate::common::olm_to_sk;
use super::MergeMode;
// ── SrcLayerData — opened source matrix for pass-2 lookup ─────────────────────
pub(crate) enum SrcLayerData {
Presence(MphfOnly, PersistentBitMatrix),
Count(MphfOnly, PersistentCompactIntMatrix),
}
impl SrcLayerData {
pub(crate) fn open(layer_dir: &Path, merge_mode: MergeMode) -> SKResult<Self> {
let counts_dir = layer_dir.join("counts");
match merge_mode {
MergeMode::Presence => {
if counts_dir.exists() && !layer_dir.join("presence").exists() {
let mphf = MphfOnly::open(layer_dir).map_err(|e| olm_to_sk(e, "merge"))?;
let mat = PersistentCompactIntMatrix::open(layer_dir).map_err(SKError::Io)?;
Ok(SrcLayerData::Count(mphf, mat))
} else {
// presence dir exists, or neither exists → Implicit handled by open()
let mphf = MphfOnly::open(layer_dir).map_err(|e| olm_to_sk(e, "merge"))?;
let mat = PersistentBitMatrix::open(layer_dir).map_err(SKError::Io)?;
Ok(SrcLayerData::Presence(mphf, mat))
}
}
MergeMode::Count => {
let mphf = MphfOnly::open(layer_dir).map_err(|e| olm_to_sk(e, "merge"))?;
if counts_dir.exists() {
let mat = PersistentCompactIntMatrix::open(layer_dir).map_err(SKError::Io)?;
Ok(SrcLayerData::Count(mphf, mat))
} else {
// No counts → treat as implicit presence (all 1s)
let mat = PersistentBitMatrix::open(layer_dir).map_err(SKError::Io)?;
Ok(SrcLayerData::Presence(mphf, mat))
}
}
}
}
/// Return one value per source genome for `kmer`.
/// The caller guarantees `kmer` is in the source MPHF domain.
#[inline]
pub(crate) fn lookup(&self, kmer: CanonicalKmer, n_genomes: usize) -> Vec<u32> {
let mut buf = vec![0u32; n_genomes];
match self {
SrcLayerData::Presence(mphf, mat) => mat.fill_row(mphf.index(kmer), &mut buf),
SrcLayerData::Count(mphf, mat) => mat.fill_row(mphf.index(kmer), &mut buf),
}
buf
}
pub(crate) fn n_slots(&self) -> usize {
match self {
SrcLayerData::Presence(_, mat) => mat.n(),
SrcLayerData::Count(_, mat) => mat.n(),
}
}
/// MPHF lookup: returns the slot index for `kmer` (kmer must be in the domain).
#[inline]
pub(crate) fn slot(&self, kmer: CanonicalKmer) -> usize {
match self {
SrcLayerData::Presence(mphf, _) => mphf.index(kmer),
SrcLayerData::Count(mphf, _) => mphf.index(kmer),
}
}
/// Row lookup by slot index, bypassing the MPHF.
#[inline]
pub(crate) fn fill_row_by_slot(&self, slot: usize, n_genomes: usize) -> Vec<u32> {
let mut buf = vec![0u32; n_genomes];
match self {
SrcLayerData::Presence(_, mat) => mat.fill_row(slot, &mut buf),
SrcLayerData::Count(_, mat) => mat.fill_row(slot, &mut buf),
}
buf
}
/// Call `f` with a reference to the underlying matrix as `&dyn MatrixGroupOps`.
pub(crate) fn with_matrix<R>(&self, f: impl FnOnce(&dyn MatrixGroupOps) -> R) -> R {
match self {
SrcLayerData::Presence(_, mat) => f(mat),
SrcLayerData::Count(_, mat) => f(mat),
}
}
}
-662
View File
@@ -1,662 +0,0 @@
use std::collections::{BTreeMap, HashMap};
use std::fs;
use std::io;
use std::path::{Path, PathBuf};
use std::time::Instant;
use tracing::debug;
use obisys::progress_bar;
use cacheline_ef::{CachelineEf, CachelineEfVec};
use epserde::ser::Serialize as EpSerialize;
use memmap2::Mmap;
use obicompactvec::PersistentCompactIntVecBuilder;
use obikseq::RoutableSuperKmer;
use obikseq::Sequence;
use obikseq::superkmer::SuperKmer;
use obiskio::{SKFileMeta, SKFileReader, SKFileWriter, SKResult};
use ptr_hash::{PtrHash, PtrHashParams, bucket_fn::CubicEps, hash::Xx64};
use rayon::prelude::*;
use remove_dir_all::remove_dir_all;
use sysinfo::System;
use niffler::Level;
use niffler::send::compression::Format;
use crate::kmer_sort::{chunk_size_from_ram, sort_unique_kmers};
type Mphf = PtrHash<u64, CubicEps, CachelineEfVec<Vec<CachelineEf>>, Xx64, Vec<u8>>;
pub struct KmerSpectrum {
pub f0: u64,
pub f1: u64,
pub counts: BTreeMap<u32, u64>,
}
const SK_EXT: &str = "skmer.zst";
pub const PARTITIONS_SUBDIR: &str = "partitions";
pub struct KmerPartition {
root_path: PathBuf,
n_partitions: usize,
partitions_mask: u64,
kmer_size: usize,
minimizer_size: usize,
writers: Vec<Option<SKFileWriter>>,
level: Level,
closed: bool,
}
impl KmerPartition {
pub fn create<P: AsRef<Path>>(
path: P,
n_bits: usize,
kmer_size: usize,
minimizer_size: usize,
force: bool,
) -> SKResult<Self> {
Self::create_with(path, n_bits, kmer_size, minimizer_size, Level::One, force)
}
pub fn create_with<P: AsRef<Path>>(
path: P,
n_bits: usize,
kmer_size: usize,
minimizer_size: usize,
level: Level,
force: bool,
) -> SKResult<Self> {
let root_path = path.as_ref().to_owned();
if root_path.exists() {
if force {
remove_dir_all(&root_path)?;
} else {
return Err(io::Error::new(
io::ErrorKind::AlreadyExists,
format!(
"{}: partition directory already exists",
root_path.display()
),
)
.into());
}
}
fs::create_dir_all(root_path.join(PARTITIONS_SUBDIR))?;
let n_partitions = 1usize << n_bits;
let writers = (0..n_partitions).map(|_| None).collect();
let partition = Self {
root_path,
n_partitions,
partitions_mask: (1u64 << n_bits) - 1,
kmer_size,
minimizer_size,
writers,
level,
closed: false,
};
Ok(partition)
}
pub fn open_with_config<P: AsRef<Path>>(
path: P,
kmer_size: usize,
minimizer_size: usize,
n_bits: usize,
) -> SKResult<Self> {
let root_path = path.as_ref().to_owned();
if !root_path.exists() {
return Err(io::Error::new(
io::ErrorKind::NotFound,
format!("{}: partition directory not found", root_path.display()),
)
.into());
}
let n_partitions = 1usize << n_bits;
let writers = (0..n_partitions).map(|_| None).collect();
Ok(Self {
root_path,
n_partitions,
partitions_mask: (1u64 << n_bits) - 1,
kmer_size,
minimizer_size,
writers,
level: Level::One,
closed: true,
})
}
/// Route and write one super-kmer to its partition file.
pub fn write(&mut self, rsk: RoutableSuperKmer) -> SKResult<()> {
self.check_not_closed()?;
let partition = (rsk.minimizer().seq_hash() & self.partitions_mask) as usize;
let sk = rsk.into_superkmer();
self.ensure_writer(partition)?.write(&sk)
}
/// Route and write a batch of super-kmers.
pub fn write_batch(&mut self, rsks: Vec<RoutableSuperKmer>) -> SKResult<()> {
self.check_not_closed()?;
for rsk in rsks {
let partition = (rsk.minimizer().seq_hash() & self.partitions_mask) as usize;
let sk = rsk.into_superkmer();
self.ensure_writer(partition)?.write(&sk)?;
}
Ok(())
}
pub fn flush(&mut self) -> SKResult<()> {
self.check_not_closed()?;
for writer in self.writers.iter_mut().flatten() {
writer.flush()?;
}
Ok(())
}
pub fn close(&mut self) -> SKResult<()> {
if self.closed {
return Ok(());
}
self.closed = true;
for writer in self.writers.iter_mut().flatten() {
writer.close()?;
}
Ok(())
}
pub fn is_open(&self) -> bool {
!self.closed
}
pub fn path(&self) -> &Path {
&self.root_path
}
/// Path of partition `i` directory.
pub fn part_dir(&self, i: usize) -> PathBuf {
self.root_path.join(PARTITIONS_SUBDIR).join(format!("part_{i:05}"))
}
pub fn kmer_size(&self) -> usize {
self.kmer_size
}
pub fn minimizer_size(&self) -> usize {
self.minimizer_size
}
pub fn n_partitions(&self) -> usize {
self.n_partitions
}
/// Deduplicate all `raw.{ext}` files in parallel, replacing each with a
/// `dereplicated.{ext}` file where identical canonical sequences are merged
/// and their counts summed.
///
/// Each partition file is processed in two phases to bound memory use:
///
/// 1. **Split** — the raw file is scattered into `2^temp_bits` temporary
/// files routed by `hash(canonical_seq) & temp_mask`. Because duplicates
/// always share the same hash, they always land in the same temp file.
/// 2. **Merge** — each temp file is loaded fully into a `HashMap`, counts
/// are accumulated in `u64` (no 24-bit overflow risk), and the result is
/// appended to `dereplicated.{ext}`.
///
/// If a merged count exceeds the 24-bit header limit, the sequence is
/// emitted as multiple records whose counts sum to the true total.
///
/// `temp_bits` controls the split fan-out (`2^temp_bits` temp files per
/// partition). Higher values reduce per-temp-file memory at the cost of
/// more temporary file descriptors — all managed by the global fd pool.
pub fn dereplicate(&self) -> SKResult<()> {
let level = self.level;
let sys = System::new_all();
// available_memory() can return 0 on macOS when the compressor page count exceeds
// free+inactive+purgeable pages (sysinfo saturating_sub). Fall back to half of total.
let available = match sys.available_memory() {
0 => sys.total_memory() / 2,
n => n,
};
let n_threads = rayon::current_num_threads().max(1) as u64;
let available_per_thread = available / n_threads;
let pb = progress_bar("dereplication", self.n_partitions as u64, "partitions");
let results: Vec<SKResult<()>> = (0..self.n_partitions)
.into_par_iter()
.map(|i| {
let dir = self.part_dir(i);
if !dir.exists() {
pb.inc(1);
return Ok(());
}
let raw_path = dir.join(format!("raw.{SK_EXT}"));
let t = Instant::now();
let n_buckets = optimal_buckets(&raw_path, available_per_thread);
let result = dereplicate_partition(&dir, level, n_buckets);
pb.set_message(format!("last {:.0}ms", t.elapsed().as_millis()));
pb.inc(1);
result
})
.collect();
pb.finish_and_clear();
for r in results {
r?;
}
Ok(())
}
/// For each partition that has a `dereplicated.{ext}` file:
/// 1. Enumerates all unique canonical kmers (two passes over the file).
/// 2. Builds a provisional MPHF (FMPHGO) over those kmers.
/// 3. Writes a flat binary count file (`counts1.bin`, one `u32` per slot,
/// memory-mapped) accumulating kmer abundances from the superkmer counts.
/// 4. Persists the MPHF to `mphf1.bin` for downstream use.
///
/// Returns the aggregated `KmerSpectrum`. Per-partition spectrum files are
/// deleted after aggregation unless `keep_partial` is true.
///
/// Partitions are processed in parallel via Rayon (one task per thread).
/// Peak memory per partition is ~80 MB, so n_threads partitions run simultaneously.
pub fn count_kmer(&self, keep_partial: bool) -> SKResult<KmerSpectrum> {
let sys = System::new_all();
let available = match sys.available_memory() {
0 => sys.total_memory() / 2,
n => n,
};
let n_threads = rayon::current_num_threads().max(1) as u64;
let chunk_kmers = chunk_size_from_ram(available / n_threads);
let pb = progress_bar("counting", self.n_partitions as u64, "partitions");
let results: Vec<SKResult<()>> = (0..self.n_partitions)
.into_par_iter()
.map(|i| {
let dir = self.part_dir(i);
let dedup_path = dir.join(format!("dereplicated.{SK_EXT}"));
if !dedup_path.exists() {
pb.inc(1);
return Ok(());
}
let t = Instant::now();
let result = count_partition(&dir, &dedup_path, chunk_kmers);
pb.set_message(format!("last {:.0}ms", t.elapsed().as_millis()));
pb.inc(1);
result
})
.collect();
pb.finish_and_clear();
for r in results {
r?;
}
// Aggregate per-partition spectra.
let mut counts: BTreeMap<u32, u64> = BTreeMap::new();
let mut f0: u64 = 0;
let mut f1: u64 = 0;
for i in 0..self.n_partitions {
let path = self.part_dir(i).join("kmer_spectrum_raw.json");
if !path.exists() {
continue;
}
let v: serde_json::Value =
serde_json::from_str(&fs::read_to_string(&path)?).map_err(io::Error::other)?;
f0 += v["f0"].as_u64().unwrap_or(0);
f1 += v["f1"].as_u64().unwrap_or(0);
if let Some(obj) = v["spectrum"].as_object() {
for (c_str, freq) in obj {
if let (Ok(c), Some(f)) = (c_str.parse::<u32>(), freq.as_u64()) {
*counts.entry(c).or_insert(0) += f;
}
}
}
if !keep_partial {
let _ = fs::remove_file(&path);
}
}
Ok(KmerSpectrum { f0, f1, counts })
}
// ── private ───────────────────────────────────────────────────────────────
fn check_not_closed(&self) -> SKResult<()> {
if self.closed {
Err(io::Error::new(io::ErrorKind::BrokenPipe, "write to closed KmerPartition").into())
} else {
Ok(())
}
}
fn ensure_writer(&mut self, partition: usize) -> SKResult<&mut SKFileWriter> {
if self.writers[partition].is_none() {
let dir = self.root_path.join(PARTITIONS_SUBDIR).join(format!("part_{:05}", partition));
fs::create_dir_all(&dir)?;
let file_path = dir.join(format!("raw.{SK_EXT}"));
let writer = SKFileWriter::create_with(file_path, Format::Zstd, self.level)?;
self.writers[partition] = Some(writer);
}
Ok(self.writers[partition].as_mut().unwrap())
}
}
// ── free helpers ─────────────────────────────────────────────────────────────
/// Estimate the number of in-memory buckets needed to deduplicate the partition
/// file at `raw_path` given `available_bytes` of free RAM.
///
/// Memory per HashMap entry:
/// key Box (1 + avg_seq_bytes) + SuperKmer header (4 B) + avg seq bytes + u64 count (8 B),
/// multiplied by 1.5 for hashbrown load-factor overhead.
///
/// Returns 1 if the partition fits comfortably in memory (no split needed).
/// Always returns a power of two.
/// Remove a SuperKmer file and its sidecar (if present).
fn remove_skmer_file(path: &Path) -> SKResult<()> {
fs::remove_file(path)?;
let sidecar = SKFileMeta::sidecar_path(path);
match fs::remove_file(&sidecar) {
Ok(()) => {}
Err(e) if e.kind() == io::ErrorKind::NotFound => {}
Err(e) => return Err(e.into()),
}
Ok(())
}
fn optimal_buckets(raw_path: &Path, available_bytes: u64) -> usize {
// Use 60 % of available RAM to leave headroom for the rest of the process.
let budget = (available_bytes as f64 * 0.60) as u64;
let meta = match SKFileMeta::read(raw_path) {
Ok(Some(m)) if m.instances > 0 => m,
_ => return 1,
};
let avg_seq_bytes = ((meta.length_sum + meta.instances - 1) / meta.instances + 3) / 4;
// SuperKmer: header (4 B) + Box<[u8]> ptr+len (16 B) + heap seq bytes; value: u64 (8 B); ×1.5 for hashbrown overhead.
let bytes_per_entry = ((4 + 16 + avg_seq_bytes + 8) as f64 * 1.5) as u64;
let estimated = meta.instances * bytes_per_entry;
if estimated <= budget {
debug!("Dereplication: estimated={estimated} budget={budget} n_temp=1");
return 1;
}
// Round up to the next power of two.
let n = (estimated + budget - 1) / budget;
debug!("Dereplication: estimated={estimated} budget={budget} n_temp={n}");
n.next_power_of_two() as usize
}
/// Maximum value that fits in the 24-bit COUNT field of a SuperKmer header.
const MAX_SK_COUNT: u64 = (1 << 24) - 1;
/// Deduplicate one partition directory in place (two-phase split + merge).
fn dereplicate_partition(dir: &Path, level: Level, n_temp: usize) -> SKResult<()> {
let raw_path = dir.join(format!("raw.{SK_EXT}"));
if !raw_path.exists() {
return Ok(());
}
let out_path = dir.join(format!("dereplicated.{SK_EXT}"));
let mut writer = SKFileWriter::create_with(&out_path, Format::Zstd, level)?;
if n_temp == 1 {
// ── Direct path: partition fits in memory, no split needed ────────────
let map = load_bucket(&raw_path)?;
remove_skmer_file(&raw_path)?;
flush_map(map, &mut writer)?;
} else {
// ── Phase 1: split raw file into temp buckets ─────────────────────────
let temp_mask = (n_temp as u64) - 1;
let temp_paths: Vec<PathBuf> = (0..n_temp)
.map(|j| dir.join(format!("temp_{j:04}.{SK_EXT}")))
.collect();
{
let mut writers: Vec<SKFileWriter> = temp_paths
.iter()
.map(|p| SKFileWriter::create_with(p, Format::Zstd, level))
.collect::<SKResult<_>>()?;
let mut reader = SKFileReader::open(&raw_path)?;
while let Some(sk) = reader.read()? {
let bucket = (sk.seq_hash() & temp_mask) as usize;
writers[bucket].write(&sk)?;
}
for w in &mut writers {
w.close()?;
}
}
remove_skmer_file(&raw_path)?;
// ── Phase 2: merge each temp bucket into the output ───────────────────
for temp_path in &temp_paths {
let map = load_bucket(temp_path)?;
remove_skmer_file(temp_path)?;
flush_map(map, &mut writer)?;
}
}
writer.close()?;
Ok(())
}
/// Read a SuperKmer file into a deduplication map (already canonical).
fn load_bucket(path: &Path) -> SKResult<HashMap<SuperKmer, u64>> {
let capacity = SKFileMeta::read(path)
.ok()
.flatten()
.map(|m| m.instances as usize)
.unwrap_or(0);
let mut map: HashMap<SuperKmer, u64> = HashMap::with_capacity(capacity);
let mut reader = SKFileReader::open(path)?;
while let Some(sk) = reader.read()? {
let count = sk.count() as u64;
*map.entry(sk).or_insert(0) += count;
}
Ok(map)
}
/// Write all entries of a deduplication map to `writer`, splitting oversized counts.
fn flush_map(map: HashMap<SuperKmer, u64>, writer: &mut SKFileWriter) -> SKResult<()> {
for (mut sk, mut total) in map {
while total > MAX_SK_COUNT {
sk.set_count(MAX_SK_COUNT as u32);
writer.write(&sk)?;
total -= MAX_SK_COUNT;
}
sk.set_count(total as u32);
writer.write(&sk)?;
}
Ok(())
}
fn build_mphf(unique_path: &Path, f0: usize) -> io::Result<Mphf> {
let file = fs::File::open(unique_path)?;
let mmap = unsafe { Mmap::map(&file)? };
let kmers: &[u64] = unsafe {
std::slice::from_raw_parts(mmap.as_ptr() as *const u64, f0)
};
// Sequential constructor: the outer par_iter over partitions already saturates
// the Rayon pool. new_from_par_iter would get no additional threads and adds
// coordination overhead. try_new accesses the same mmap'd pages at zero extra cost.
Mphf::try_new(kmers, PtrHashParams::<CubicEps>::default())
.ok_or_else(|| io::Error::other("ptr_hash construction failed"))
}
fn count_partition(dir: &Path, dedup_path: &Path, chunk_kmers: usize) -> SKResult<()> {
let unique_path = dir.join("sorted_unique.bin");
let f0 = sort_unique_kmers(dedup_path, dir, &unique_path, chunk_kmers)?;
if f0 == 0 {
return Ok(());
}
debug!("{}: f0={f0} unique kmers sorted", dir.display());
let mphf = build_mphf(&unique_path, f0)?;
fs::remove_file(&unique_path)?;
let counts_path = dir.join("counts1.bin");
let mut builder = PersistentCompactIntVecBuilder::new(f0, &counts_path)?;
{
let mut reader = SKFileReader::open(dedup_path)?;
while let Some(sk) = reader.read()? {
let sk_count = sk.count();
for kmer in sk.iter_canonical_kmers() {
let slot = mphf.index(&kmer.raw());
builder.set(slot, builder.get(slot).saturating_add(sk_count));
}
}
}
let mut spectrum: BTreeMap<u32, u64> = BTreeMap::new();
for slot in 0..f0 {
let c = builder.get(slot);
if c > 0 {
*spectrum.entry(c).or_insert(0) += 1;
}
}
let f1: u64 = spectrum.iter().map(|(&c, &f)| c as u64 * f).sum();
builder.close()?;
let spectrum_map: BTreeMap<String, u64> = spectrum
.iter()
.map(|(&c, &f)| (format!("{c:010}"), f))
.collect();
serde_json::to_writer_pretty(
fs::File::create(dir.join("kmer_spectrum_raw.json"))?,
&serde_json::json!({ "f0": f0 as u64, "f1": f1, "spectrum": &spectrum_map }),
)
.map_err(io::Error::other)?;
EpSerialize::store(&mphf, &dir.join("mphf1.bin"))
.map_err(|e| io::Error::other(e.to_string()))?;
Ok(())
}
impl Drop for KmerPartition {
fn drop(&mut self) {
let _ = self.close();
}
}
// ── integration tests ─────────────────────────────────────────────────────────
#[cfg(test)]
mod tests {
use super::*;
use std::collections::HashMap;
use obikrope::Rope;
use obikseq::SuperKmer;
use obiskbuilder::build_superkmers;
const K: usize = 11;
const M: usize = 5;
fn setup() {
obikseq::params::set_k(K);
obikseq::params::set_m(M);
}
/// Direct canonical k-mer counts from ASCII sequences — ground truth.
fn direct_counts(seqs: &[&[u8]]) -> (u64, u64) {
let mut counts: HashMap<Vec<u8>, u64> = HashMap::new();
for seq in seqs {
for i in 0..seq.len().saturating_sub(K - 1) {
let km = SuperKmer::from_ascii(&seq[i..i + K]).to_ascii();
*counts.entry(km).or_insert(0) += 1;
}
}
let f0 = counts.len() as u64;
let f1: u64 = counts.values().sum();
(f0, f1)
}
/// Run the full pipeline on a list of sequences and return (f0, f1) from
/// the `kmer_spectrum_raw.json` produced by `count_partition`.
fn pipeline_counts(seqs: &[&[u8]]) -> (u64, u64) {
setup();
let mut rope_data: Vec<u8> = Vec::new();
for seq in seqs {
rope_data.extend_from_slice(seq);
rope_data.push(0x00);
}
let mut rope = Rope::new(None);
rope.push(rope_data);
let superkmers: Vec<_> = build_superkmers(rope, K, 1, 0.0);
let dir = tempfile::tempdir().unwrap();
let mut kp = KmerPartition::create(dir.path(), 0, K, M, true).unwrap();
kp.write_batch(superkmers).unwrap();
kp.close().unwrap();
kp.dereplicate().unwrap();
let part_dir = dir.path().join(PARTITIONS_SUBDIR).join("part_00000");
let dedup_path = part_dir.join("dereplicated.skmer.zst");
if !dedup_path.exists() {
return (0, 0);
}
count_partition(&part_dir, &dedup_path, 1 << 20).unwrap();
let spec: serde_json::Value = serde_json::from_reader(
fs::File::open(part_dir.join("kmer_spectrum_raw.json")).unwrap(),
).unwrap();
let f0 = spec["f0"].as_u64().unwrap_or(0);
let f1 = spec["f1"].as_u64().unwrap_or(0);
(f0, f1)
}
#[test]
fn single_sequence_f0_f1_match() {
let seqs: &[&[u8]] = &[b"ACGTACGTACGTACGTACGT"];
let (ef0, ef1) = direct_counts(seqs);
let (gf0, gf1) = pipeline_counts(seqs);
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
}
#[test]
fn two_sequences_f0_f1_match() {
let seqs: &[&[u8]] = &[
b"ACGTACGTACGTACGTACGT",
b"TGCATGCATGCATGCATGCA",
];
let (ef0, ef1) = direct_counts(seqs);
let (gf0, gf1) = pipeline_counts(seqs);
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
}
#[test]
fn repeated_sequence_f1_doubles() {
let seq = b"ACGTACGTACGTACGTACGT";
let seqs: &[&[u8]] = &[seq, seq];
let (ef0, ef1) = direct_counts(seqs);
let (gf0, gf1) = pipeline_counts(seqs);
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
}
#[test]
fn many_sequences_f0_f1_match() {
// 20 distinct sequences of length 40 — forces multiple super-kmers and
// multiple minimizer boundaries per sequence.
let bases = b"ACGT";
let seqs: Vec<Vec<u8>> = (0..20u32)
.map(|i| (0..40).map(|j| bases[((i * 7 + j * 3) % 4) as usize]).collect())
.collect();
let seq_refs: Vec<&[u8]> = seqs.iter().map(|v| v.as_slice()).collect();
let (ef0, ef1) = direct_counts(&seq_refs);
let (gf0, gf1) = pipeline_counts(&seq_refs);
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
}
}
@@ -0,0 +1,80 @@
use std::collections::BTreeMap;
use std::fs;
use std::io;
use std::path::Path;
use cacheline_ef::{CachelineEf, CachelineEfVec};
use epserde::ser::Serialize as EpSerialize;
use memmap2::Mmap;
use obicompactvec::PersistentCompactIntVecBuilder;
use obiskio::{SKFileReader, SKResult};
use ptr_hash::{PtrHash, PtrHashParams, bucket_fn::CubicEps, hash::Xx64};
use tracing::debug;
use crate::kmer_sort::sort_unique_kmers;
pub(super) type Mphf = PtrHash<u64, CubicEps, CachelineEfVec<Vec<CachelineEf>>, Xx64, Vec<u8>>;
fn build_mphf(unique_path: &Path, f0: usize) -> io::Result<Mphf> {
let file = fs::File::open(unique_path)?;
let mmap = unsafe { Mmap::map(&file)? };
let kmers: &[u64] = unsafe {
std::slice::from_raw_parts(mmap.as_ptr() as *const u64, f0)
};
// Sequential constructor: the outer par_iter over partitions already saturates
// the Rayon pool. new_from_par_iter would get no additional threads and adds
// coordination overhead. try_new accesses the same mmap'd pages at zero extra cost.
Mphf::try_new(kmers, PtrHashParams::<CubicEps>::default())
.ok_or_else(|| io::Error::other("ptr_hash construction failed"))
}
pub(super) fn count_partition(dir: &Path, dedup_path: &Path, chunk_kmers: usize) -> SKResult<()> {
let unique_path = dir.join("sorted_unique.bin");
let f0 = sort_unique_kmers(dedup_path, dir, &unique_path, chunk_kmers)?;
if f0 == 0 {
return Ok(());
}
debug!("{}: f0={f0} unique kmers sorted", dir.display());
let mphf = build_mphf(&unique_path, f0)?;
fs::remove_file(&unique_path)?;
let counts_path = dir.join("counts1.bin");
let mut builder = PersistentCompactIntVecBuilder::new(f0, &counts_path)?;
{
let mut reader = SKFileReader::open(dedup_path)?;
while let Some(sk) = reader.read()? {
let sk_count = sk.count();
for kmer in sk.iter_canonical_kmers() {
let slot = mphf.index(&kmer.raw());
builder.set(slot, builder.get(slot).saturating_add(sk_count));
}
}
}
let mut spectrum: BTreeMap<u32, u64> = BTreeMap::new();
for slot in 0..f0 {
let c = builder.get(slot);
if c > 0 {
*spectrum.entry(c).or_insert(0) += 1;
}
}
let f1: u64 = spectrum.iter().map(|(&c, &f)| c as u64 * f).sum();
builder.close()?;
let spectrum_map: BTreeMap<String, u64> = spectrum
.iter()
.map(|(&c, &f)| (format!("{c:010}"), f))
.collect();
serde_json::to_writer_pretty(
fs::File::create(dir.join("kmer_spectrum_raw.json"))?,
&serde_json::json!({ "f0": f0 as u64, "f1": f1, "spectrum": &spectrum_map }),
)
.map_err(io::Error::other)?;
EpSerialize::store(&mphf, &dir.join("mphf1.bin"))
.map_err(|e| io::Error::other(e.to_string()))?;
Ok(())
}
@@ -0,0 +1,144 @@
use std::collections::HashMap;
use std::fs;
use std::io;
use std::path::{Path, PathBuf};
use tracing::debug;
use niffler::Level;
use niffler::send::compression::Format;
use obikseq::Sequence;
use obikseq::superkmer::SuperKmer;
use obiskio::{SKFileMeta, SKFileReader, SKFileWriter, SKResult};
use super::SK_EXT;
/// Estimate the number of in-memory buckets needed to deduplicate the partition
/// file at `raw_path` given `available_bytes` of free RAM.
///
/// Memory per HashMap entry:
/// key Box (1 + avg_seq_bytes) + SuperKmer header (4 B) + avg seq bytes + u64 count (8 B),
/// multiplied by 1.5 for hashbrown load-factor overhead.
///
/// Returns 1 if the partition fits comfortably in memory (no split needed).
/// Always returns a power of two.
pub(super) fn optimal_buckets(raw_path: &Path, available_bytes: u64) -> usize {
// Use 60 % of available RAM to leave headroom for the rest of the process.
let budget = (available_bytes as f64 * 0.60) as u64;
let meta = match SKFileMeta::read(raw_path) {
Ok(Some(m)) if m.instances > 0 => m,
_ => return 1,
};
let avg_seq_bytes = ((meta.length_sum + meta.instances - 1) / meta.instances + 3) / 4;
// SuperKmer: header (4 B) + Box<[u8]> ptr+len (16 B) + heap seq bytes; value: u64 (8 B); ×1.5 for hashbrown overhead.
let bytes_per_entry = ((4 + 16 + avg_seq_bytes + 8) as f64 * 1.5) as u64;
let estimated = meta.instances * bytes_per_entry;
if estimated <= budget {
debug!("Dereplication: estimated={estimated} budget={budget} n_temp=1");
return 1;
}
// Round up to the next power of two.
let n = (estimated + budget - 1) / budget;
debug!("Dereplication: estimated={estimated} budget={budget} n_temp={n}");
n.next_power_of_two() as usize
}
/// Remove a SuperKmer file and its sidecar (if present).
fn remove_skmer_file(path: &Path) -> SKResult<()> {
fs::remove_file(path)?;
let sidecar = SKFileMeta::sidecar_path(path);
match fs::remove_file(&sidecar) {
Ok(()) => {}
Err(e) if e.kind() == io::ErrorKind::NotFound => {}
Err(e) => return Err(e.into()),
}
Ok(())
}
/// Maximum value that fits in the 24-bit COUNT field of a SuperKmer header.
const MAX_SK_COUNT: u64 = (1 << 24) - 1;
/// Deduplicate one partition directory in place (two-phase split + merge).
pub(super) fn dereplicate_partition(dir: &Path, level: Level, n_temp: usize) -> SKResult<()> {
let raw_path = dir.join(format!("raw.{SK_EXT}"));
if !raw_path.exists() {
return Ok(());
}
let out_path = dir.join(format!("dereplicated.{SK_EXT}"));
let mut writer = SKFileWriter::create_with(&out_path, Format::Zstd, level)?;
if n_temp == 1 {
// ── Direct path: partition fits in memory, no split needed ────────────
let map = load_bucket(&raw_path)?;
remove_skmer_file(&raw_path)?;
flush_map(map, &mut writer)?;
} else {
// ── Phase 1: split raw file into temp buckets ─────────────────────────
let temp_mask = (n_temp as u64) - 1;
let temp_paths: Vec<PathBuf> = (0..n_temp)
.map(|j| dir.join(format!("temp_{j:04}.{SK_EXT}")))
.collect();
{
let mut writers: Vec<SKFileWriter> = temp_paths
.iter()
.map(|p| SKFileWriter::create_with(p, Format::Zstd, level))
.collect::<SKResult<_>>()?;
let mut reader = SKFileReader::open(&raw_path)?;
while let Some(sk) = reader.read()? {
let bucket = (sk.seq_hash() & temp_mask) as usize;
writers[bucket].write(&sk)?;
}
for w in &mut writers {
w.close()?;
}
}
remove_skmer_file(&raw_path)?;
// ── Phase 2: merge each temp bucket into the output ───────────────────
for temp_path in &temp_paths {
let map = load_bucket(temp_path)?;
remove_skmer_file(temp_path)?;
flush_map(map, &mut writer)?;
}
}
writer.close()?;
Ok(())
}
/// Read a SuperKmer file into a deduplication map (already canonical).
fn load_bucket(path: &Path) -> SKResult<HashMap<SuperKmer, u64>> {
let capacity = SKFileMeta::read(path)
.ok()
.flatten()
.map(|m| m.instances as usize)
.unwrap_or(0);
let mut map: HashMap<SuperKmer, u64> = HashMap::with_capacity(capacity);
let mut reader = SKFileReader::open(path)?;
while let Some(sk) = reader.read()? {
let count = sk.count() as u64;
*map.entry(sk).or_insert(0) += count;
}
Ok(map)
}
/// Write all entries of a deduplication map to `writer`, splitting oversized counts.
fn flush_map(map: HashMap<SuperKmer, u64>, writer: &mut SKFileWriter) -> SKResult<()> {
for (mut sk, mut total) in map {
while total > MAX_SK_COUNT {
sk.set_count(MAX_SK_COUNT as u32);
writer.write(&sk)?;
total -= MAX_SK_COUNT;
}
sk.set_count(total as u32);
writer.write(&sk)?;
}
Ok(())
}
@@ -0,0 +1,341 @@
use std::collections::BTreeMap;
use std::fs;
use std::io;
use std::path::{Path, PathBuf};
use std::time::Instant;
use obisys::progress_bar;
use obikseq::RoutableSuperKmer;
use obiskio::SKResult;
use rayon::prelude::*;
use remove_dir_all::remove_dir_all;
use sysinfo::System;
use niffler::Level;
use niffler::send::compression::Format;
use obiskio::SKFileWriter;
use crate::kmer_sort::chunk_size_from_ram;
use super::count::count_partition;
use super::dereplicate::{dereplicate_partition, optimal_buckets};
use super::{PARTITIONS_SUBDIR, SK_EXT};
pub struct KmerSpectrum {
pub f0: u64,
pub f1: u64,
pub counts: BTreeMap<u32, u64>,
}
pub struct KmerPartition {
root_path: PathBuf,
n_partitions: usize,
partitions_mask: u64,
kmer_size: usize,
minimizer_size: usize,
writers: Vec<Option<SKFileWriter>>,
level: Level,
closed: bool,
}
impl KmerPartition {
pub fn create<P: AsRef<Path>>(
path: P,
n_bits: usize,
kmer_size: usize,
minimizer_size: usize,
force: bool,
) -> SKResult<Self> {
Self::create_with(path, n_bits, kmer_size, minimizer_size, Level::One, force)
}
pub fn create_with<P: AsRef<Path>>(
path: P,
n_bits: usize,
kmer_size: usize,
minimizer_size: usize,
level: Level,
force: bool,
) -> SKResult<Self> {
let root_path = path.as_ref().to_owned();
if root_path.exists() {
if force {
remove_dir_all(&root_path)?;
} else {
return Err(io::Error::new(
io::ErrorKind::AlreadyExists,
format!(
"{}: partition directory already exists",
root_path.display()
),
)
.into());
}
}
fs::create_dir_all(root_path.join(PARTITIONS_SUBDIR))?;
let n_partitions = 1usize << n_bits;
let writers = (0..n_partitions).map(|_| None).collect();
let partition = Self {
root_path,
n_partitions,
partitions_mask: (1u64 << n_bits) - 1,
kmer_size,
minimizer_size,
writers,
level,
closed: false,
};
Ok(partition)
}
pub fn open_with_config<P: AsRef<Path>>(
path: P,
kmer_size: usize,
minimizer_size: usize,
n_bits: usize,
) -> SKResult<Self> {
let root_path = path.as_ref().to_owned();
if !root_path.exists() {
return Err(io::Error::new(
io::ErrorKind::NotFound,
format!("{}: partition directory not found", root_path.display()),
)
.into());
}
let n_partitions = 1usize << n_bits;
let writers = (0..n_partitions).map(|_| None).collect();
Ok(Self {
root_path,
n_partitions,
partitions_mask: (1u64 << n_bits) - 1,
kmer_size,
minimizer_size,
writers,
level: Level::One,
closed: true,
})
}
/// Route and write one super-kmer to its partition file.
pub fn write(&mut self, rsk: RoutableSuperKmer) -> SKResult<()> {
self.check_not_closed()?;
let partition = (rsk.minimizer().seq_hash() & self.partitions_mask) as usize;
let sk = rsk.into_superkmer();
self.ensure_writer(partition)?.write(&sk)
}
/// Route and write a batch of super-kmers.
pub fn write_batch(&mut self, rsks: Vec<RoutableSuperKmer>) -> SKResult<()> {
self.check_not_closed()?;
for rsk in rsks {
let partition = (rsk.minimizer().seq_hash() & self.partitions_mask) as usize;
let sk = rsk.into_superkmer();
self.ensure_writer(partition)?.write(&sk)?;
}
Ok(())
}
pub fn flush(&mut self) -> SKResult<()> {
self.check_not_closed()?;
for writer in self.writers.iter_mut().flatten() {
writer.flush()?;
}
Ok(())
}
pub fn close(&mut self) -> SKResult<()> {
if self.closed {
return Ok(());
}
self.closed = true;
for writer in self.writers.iter_mut().flatten() {
writer.close()?;
}
Ok(())
}
pub fn is_open(&self) -> bool {
!self.closed
}
pub fn path(&self) -> &Path {
&self.root_path
}
/// Path of partition `i` directory.
pub fn part_dir(&self, i: usize) -> PathBuf {
self.root_path.join(PARTITIONS_SUBDIR).join(format!("part_{i:05}"))
}
pub fn kmer_size(&self) -> usize {
self.kmer_size
}
pub fn minimizer_size(&self) -> usize {
self.minimizer_size
}
pub fn n_partitions(&self) -> usize {
self.n_partitions
}
/// Deduplicate all `raw.{ext}` files in parallel, replacing each with a
/// `dereplicated.{ext}` file where identical canonical sequences are merged
/// and their counts summed.
///
/// Each partition file is processed in two phases to bound memory use:
///
/// 1. **Split** — the raw file is scattered into `2^temp_bits` temporary
/// files routed by `hash(canonical_seq) & temp_mask`. Because duplicates
/// always share the same hash, they always land in the same temp file.
/// 2. **Merge** — each temp file is loaded fully into a `HashMap`, counts
/// are accumulated in `u64` (no 24-bit overflow risk), and the result is
/// appended to `dereplicated.{ext}`.
///
/// If a merged count exceeds the 24-bit header limit, the sequence is
/// emitted as multiple records whose counts sum to the true total.
///
/// `temp_bits` controls the split fan-out (`2^temp_bits` temp files per
/// partition). Higher values reduce per-temp-file memory at the cost of
/// more temporary file descriptors — all managed by the global fd pool.
pub fn dereplicate(&self) -> SKResult<()> {
let level = self.level;
let sys = System::new_all();
// available_memory() can return 0 on macOS when the compressor page count exceeds
// free+inactive+purgeable pages (sysinfo saturating_sub). Fall back to half of total.
let available = match sys.available_memory() {
0 => sys.total_memory() / 2,
n => n,
};
let n_threads = rayon::current_num_threads().max(1) as u64;
let available_per_thread = available / n_threads;
let pb = progress_bar("dereplication", self.n_partitions as u64, "partitions");
let results: Vec<SKResult<()>> = (0..self.n_partitions)
.into_par_iter()
.map(|i| {
let dir = self.part_dir(i);
if !dir.exists() {
pb.inc(1);
return Ok(());
}
let raw_path = dir.join(format!("raw.{SK_EXT}"));
let t = Instant::now();
let n_buckets = optimal_buckets(&raw_path, available_per_thread);
let result = dereplicate_partition(&dir, level, n_buckets);
pb.set_message(format!("last {:.0}ms", t.elapsed().as_millis()));
pb.inc(1);
result
})
.collect();
pb.finish_and_clear();
for r in results {
r?;
}
Ok(())
}
/// For each partition that has a `dereplicated.{ext}` file:
/// 1. Enumerates all unique canonical kmers (two passes over the file).
/// 2. Builds a provisional MPHF (FMPHGO) over those kmers.
/// 3. Writes a flat binary count file (`counts1.bin`, one `u32` per slot,
/// memory-mapped) accumulating kmer abundances from the superkmer counts.
/// 4. Persists the MPHF to `mphf1.bin` for downstream use.
///
/// Returns the aggregated `KmerSpectrum`. Per-partition spectrum files are
/// deleted after aggregation unless `keep_partial` is true.
///
/// Partitions are processed in parallel via Rayon (one task per thread).
/// Peak memory per partition is ~80 MB, so n_threads partitions run simultaneously.
pub fn count_kmer(&self, keep_partial: bool) -> SKResult<KmerSpectrum> {
let sys = System::new_all();
let available = match sys.available_memory() {
0 => sys.total_memory() / 2,
n => n,
};
let n_threads = rayon::current_num_threads().max(1) as u64;
let chunk_kmers = chunk_size_from_ram(available / n_threads);
let pb = progress_bar("counting", self.n_partitions as u64, "partitions");
let results: Vec<SKResult<()>> = (0..self.n_partitions)
.into_par_iter()
.map(|i| {
let dir = self.part_dir(i);
let dedup_path = dir.join(format!("dereplicated.{SK_EXT}"));
if !dedup_path.exists() {
pb.inc(1);
return Ok(());
}
let t = Instant::now();
let result = count_partition(&dir, &dedup_path, chunk_kmers);
pb.set_message(format!("last {:.0}ms", t.elapsed().as_millis()));
pb.inc(1);
result
})
.collect();
pb.finish_and_clear();
for r in results {
r?;
}
// Aggregate per-partition spectra.
let mut counts: BTreeMap<u32, u64> = BTreeMap::new();
let mut f0: u64 = 0;
let mut f1: u64 = 0;
for i in 0..self.n_partitions {
let path = self.part_dir(i).join("kmer_spectrum_raw.json");
if !path.exists() {
continue;
}
let v: serde_json::Value =
serde_json::from_str(&fs::read_to_string(&path)?).map_err(io::Error::other)?;
f0 += v["f0"].as_u64().unwrap_or(0);
f1 += v["f1"].as_u64().unwrap_or(0);
if let Some(obj) = v["spectrum"].as_object() {
for (c_str, freq) in obj {
if let (Ok(c), Some(f)) = (c_str.parse::<u32>(), freq.as_u64()) {
*counts.entry(c).or_insert(0) += f;
}
}
}
if !keep_partial {
let _ = fs::remove_file(&path);
}
}
Ok(KmerSpectrum { f0, f1, counts })
}
// ── private ───────────────────────────────────────────────────────────────
fn check_not_closed(&self) -> SKResult<()> {
if self.closed {
Err(io::Error::new(io::ErrorKind::BrokenPipe, "write to closed KmerPartition").into())
} else {
Ok(())
}
}
fn ensure_writer(&mut self, partition: usize) -> SKResult<&mut SKFileWriter> {
if self.writers[partition].is_none() {
let dir = self.root_path.join(PARTITIONS_SUBDIR).join(format!("part_{:05}", partition));
fs::create_dir_all(&dir)?;
let file_path = dir.join(format!("raw.{SK_EXT}"));
let writer = SKFileWriter::create_with(file_path, Format::Zstd, self.level)?;
self.writers[partition] = Some(writer);
}
Ok(self.writers[partition].as_mut().unwrap())
}
}
impl Drop for KmerPartition {
fn drop(&mut self) {
let _ = self.close();
}
}
+19
View File
@@ -0,0 +1,19 @@
//! K-mer partitioning: routing super-kmers into per-partition files,
//! deduplicating them, and counting unique canonical k-mers.
//!
//! Submodules: [`kmer_partition`] (`KmerPartition`, `KmerSpectrum` and the
//! routing/lifecycle API), [`dereplicate`] (two-phase split+merge
//! deduplication), [`count`] (unique-kmer enumeration, MPHF, abundance
//! counting).
mod count;
mod dereplicate;
mod kmer_partition;
#[cfg(test)]
mod tests;
pub use kmer_partition::{KmerPartition, KmerSpectrum};
const SK_EXT: &str = "skmer.zst";
pub const PARTITIONS_SUBDIR: &str = "partitions";
+113
View File
@@ -0,0 +1,113 @@
use std::collections::HashMap;
use std::fs;
use obikrope::Rope;
use obikseq::SuperKmer;
use obiskbuilder::build_superkmers;
use super::count::count_partition;
use super::{KmerPartition, PARTITIONS_SUBDIR};
const K: usize = 11;
const M: usize = 5;
fn setup() {
obikseq::params::set_k(K);
obikseq::params::set_m(M);
}
/// Direct canonical k-mer counts from ASCII sequences — ground truth.
fn direct_counts(seqs: &[&[u8]]) -> (u64, u64) {
let mut counts: HashMap<Vec<u8>, u64> = HashMap::new();
for seq in seqs {
for i in 0..seq.len().saturating_sub(K - 1) {
let km = SuperKmer::from_ascii(&seq[i..i + K]).to_ascii();
*counts.entry(km).or_insert(0) += 1;
}
}
let f0 = counts.len() as u64;
let f1: u64 = counts.values().sum();
(f0, f1)
}
/// Run the full pipeline on a list of sequences and return (f0, f1) from
/// the `kmer_spectrum_raw.json` produced by `count_partition`.
fn pipeline_counts(seqs: &[&[u8]]) -> (u64, u64) {
setup();
let mut rope_data: Vec<u8> = Vec::new();
for seq in seqs {
rope_data.extend_from_slice(seq);
rope_data.push(0x00);
}
let mut rope = Rope::new(None);
rope.push(rope_data);
let superkmers: Vec<_> = build_superkmers(rope, K, 1, 0.0);
let dir = tempfile::tempdir().unwrap();
let mut kp = KmerPartition::create(dir.path(), 0, K, M, true).unwrap();
kp.write_batch(superkmers).unwrap();
kp.close().unwrap();
kp.dereplicate().unwrap();
let part_dir = dir.path().join(PARTITIONS_SUBDIR).join("part_00000");
let dedup_path = part_dir.join("dereplicated.skmer.zst");
if !dedup_path.exists() {
return (0, 0);
}
count_partition(&part_dir, &dedup_path, 1 << 20).unwrap();
let spec: serde_json::Value = serde_json::from_reader(
fs::File::open(part_dir.join("kmer_spectrum_raw.json")).unwrap(),
).unwrap();
let f0 = spec["f0"].as_u64().unwrap_or(0);
let f1 = spec["f1"].as_u64().unwrap_or(0);
(f0, f1)
}
#[test]
fn single_sequence_f0_f1_match() {
let seqs: &[&[u8]] = &[b"ACGTACGTACGTACGTACGT"];
let (ef0, ef1) = direct_counts(seqs);
let (gf0, gf1) = pipeline_counts(seqs);
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
}
#[test]
fn two_sequences_f0_f1_match() {
let seqs: &[&[u8]] = &[
b"ACGTACGTACGTACGTACGT",
b"TGCATGCATGCATGCATGCA",
];
let (ef0, ef1) = direct_counts(seqs);
let (gf0, gf1) = pipeline_counts(seqs);
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
}
#[test]
fn repeated_sequence_f1_doubles() {
let seq = b"ACGTACGTACGTACGTACGT";
let seqs: &[&[u8]] = &[seq, seq];
let (ef0, ef1) = direct_counts(seqs);
let (gf0, gf1) = pipeline_counts(seqs);
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
}
#[test]
fn many_sequences_f0_f1_match() {
// 20 distinct sequences of length 40 — forces multiple super-kmers and
// multiple minimizer boundaries per sequence.
let bases = b"ACGT";
let seqs: Vec<Vec<u8>> = (0..20u32)
.map(|i| (0..40).map(|j| bases[((i * 7 + j * 3) % 4) as usize]).collect())
.collect();
let seq_refs: Vec<&[u8]> = seqs.iter().map(|v| v.as_slice()).collect();
let (ef0, ef1) = direct_counts(&seq_refs);
let (gf0, gf1) = pipeline_counts(&seq_refs);
assert_eq!(gf0, ef0, "f0 wrong: expected {ef0}, got {gf0}");
assert_eq!(gf1, ef1, "f1 wrong: expected {ef1}, got {gf1}");
}
-828
View File
@@ -1,828 +0,0 @@
//! Cursors for sequential and random access over a [`Rope`].
//!
//! # Design
//!
//! A cursor borrows a `&'a Rope` and keeps a small block cache so that
//! consecutive accesses within the same block cost O(1). The first access to a
//! new block costs O(log n) (binary search in [`Rope::lookup`]); subsequent
//! accesses within that block are free.
//!
//! All mutable state (current position, cache) is stored in [`Cell`] fields,
//! so every cursor method takes `&self` rather than `&mut self`. This means:
//!
//! - Two cursors can coexist on the same rope without lifetime conflicts.
//! - The `iter()` method returns a lightweight wrapper that holds `&Cursor`,
//! allowing `cursor.tell()` or `cursor.seek()` to be called **inside a `for`
//! loop** over the same cursor.
//!
//! # Cursors
//!
//! | Type | Direction | First `read_next` | `seek(Relative, +n)` |
//! |------|-----------|-------------------|----------------------|
//! | [`ForwardCursor`] | start → end | index 0 | advances (+n) |
//! | [`BackwardCursor`] | end → start | index `len-1` | retreats (+n) |
//!
//! # Example
//!
//! ```
//! use obikrope::{Rope, RopeCursor};
//!
//! let mut rope = Rope::new(None);
//! rope.push(b"ACGT".to_vec());
//!
//! let cursor = rope.fw_cursor();
//! for byte in cursor.iter() {
//! // cursor.tell() is valid here — iter() holds &cursor, not &mut cursor
//! let _ = cursor.tell();
//! }
//! ```
use std::cell::Cell;
use crate::{Rope, RopeError};
/// Controls how the `pos` argument of [`RopeCursor::seek`] is interpreted.
#[derive(Clone, Copy)]
pub enum SeekMode {
/// `pos` is an absolute byte index from the start of the rope.
Absolute,
/// `pos` is relative to the current position.
/// Positive = forward for [`ForwardCursor`], backward for [`BackwardCursor`].
Relative,
/// `pos` is counted back from the end: target = `len - pos`.
RelativeToEnd,
/// `pos` is a rope index relative to the start of the rope.
Rope,
}
// ── shared state ──────────────────────────────────────────────────────────────
/// Per-cursor cache of the last accessed block, the current position, and the
/// base offset that defines the cursor's local coordinate system.
///
/// All fields are [`Cell`]-wrapped so they can be mutated through a shared
/// reference, enabling `&self` methods on cursors.
#[derive(Clone)]
pub struct CursorState<'a> {
block_idx: Cell<usize>,
block_start: Cell<usize>,
block_end: Cell<usize>,
block: Cell<&'a [Cell<u8>]>,
initialized: Cell<bool>,
current: Cell<Option<usize>>,
/// Absolute rope index that maps to local position 0.
/// All user-facing coordinates are relative to this value.
offset: Cell<usize>,
}
impl<'a> CursorState<'a> {
fn new() -> Self {
Self::with_offset(0)
}
fn with_offset(offset: usize) -> Self {
Self {
block_idx: Cell::new(0),
block_start: Cell::new(0),
block_end: Cell::new(0),
block: Cell::new(&[]),
initialized: Cell::new(false),
current: Cell::new(None),
offset: Cell::new(offset),
}
}
fn get(&self, rope: &'a Rope, i: usize) -> Option<u8> {
if !self.initialized.get() || i < self.block_start.get() || i >= self.block_end.get() {
let (bi, bs, be) = rope.lookup(i)?;
self.block_idx.set(bi);
self.block_start.set(bs);
self.block_end.set(be);
self.block.set(rope.get_block(bi)?);
self.initialized.set(true);
}
Some(self.block.get()[i - self.block_start.get()].get())
}
fn set(&self, rope: &'a Rope, i: usize, value: u8) -> Result<(), RopeError> {
if !self.initialized.get() || i < self.block_start.get() || i >= self.block_end.get() {
let (bi, bs, be) = rope.lookup(i).ok_or(RopeError::OutOfBounds(format!(
"index out of bounds: i={} > {}",
i,
rope.len()
)))?;
self.block_idx.set(bi);
self.block_start.set(bs);
self.block_end.set(be);
self.block
.set(rope.get_block(bi).ok_or(RopeError::BlockNotFound(format!(
"Cannot find block for index {}",
i
)))?);
self.initialized.set(true);
}
self.block.get()[i - self.block_start.get()].set(value);
Ok(())
}
}
// ── trait ─────────────────────────────────────────────────────────────────────
/// Common interface for all rope cursors.
///
/// # Required methods
///
/// Implementors must provide [`rope`](RopeCursor::rope),
/// [`state`](RopeCursor::state), [`read_next`](RopeCursor::read_next) and
/// [`seek`](RopeCursor::seek). Everything else has a default implementation.
///
/// The direction of `read_next` and the sign convention for
/// [`SeekMode::Relative`] differ between [`ForwardCursor`] and
/// [`BackwardCursor`]; all other methods are identical.
pub trait RopeCursor<'a> {
/// The rope this cursor is bound to.
fn rope(&self) -> &'a Rope;
/// Internal cache state — implementation detail exposed for default methods.
fn state(&self) -> &CursorState<'a>;
/// Read the next byte in cursor direction and advance the position.
/// Returns `Err` at the exhausted end.
fn read_next(&self) -> Result<u8, RopeError>;
/// Move the cursor to a new position.
///
/// `pos` is interpreted according to `mode`:
/// - [`Absolute`](SeekMode::Absolute): local coordinate (`pos + offset` in the rope).
/// - [`Rope`](SeekMode::Rope): raw rope index, ignores the offset. Pass a value
/// from [`rope_tell`](RopeCursor::rope_tell) to restore a saved position.
/// - [`Relative`](SeekMode::Relative): delta from the current position.
/// For [`ForwardCursor`], positive advances toward the end;
/// for [`BackwardCursor`], positive retreats toward the start.
/// - [`RelativeToEnd`](SeekMode::RelativeToEnd): `rope.len() - pos`.
///
/// Returns the new position as a **rope index** (same value as
/// [`rope_tell`](RopeCursor::rope_tell) would return immediately after).
fn seek(&self, pos: isize, mode: SeekMode) -> Result<usize, RopeError>;
// ── default methods ───────────────────────────────────────────────────────
/// Read the byte at **local** index `i` (relative to the cursor's offset)
/// without moving the position.
fn get(&self, i: usize) -> Option<u8> {
self.state().get(self.rope(), i + self.state().offset.get())
}
/// Write `value` at **local** index `i` without moving the position.
fn set(&self, i: usize, value: u8) -> Result<(), RopeError> {
self.state()
.set(self.rope(), i + self.state().offset.get(), value)
}
/// Current position relative to the cursor's offset, or `None` if the
/// cursor has not moved yet.
fn tell(&self) -> Option<usize> {
let abs = self.state().current.get()?;
Some(abs.saturating_sub(self.state().offset.get()))
}
/// Current position as an absolute rope index.
///
/// Unlike [`tell`](RopeCursor::tell), this method **always** returns a
/// value: if the cursor has not moved yet, it returns the cursor's offset
/// (the rope index of local position 0).
///
/// Use the returned value with [`SeekMode::Rope`] to restore a position,
/// or as a truncation point after a write pass.
fn rope_tell(&self) -> usize {
self.state()
.current
.get()
.unwrap_or(self.state().offset.get())
}
/// Number of bytes visible through this cursor (`rope.len() - offset`).
fn len(&self) -> usize {
self.rope().len().saturating_sub(self.state().offset.get())
}
/// Reset the cursor to its initial state (positioned before the first
/// byte of its local view). Equivalent to `seek(0, Absolute)` on a
/// fresh cursor, but works even when `current` is `None`.
fn reset(&self) {
self.state().current.set(None);
}
/// Read the byte at the current position without advancing.
fn peek(&self) -> Option<u8> {
self.state().get(self.rope(), self.state().current.get()?)
}
/// Write `value` at the current position without advancing.
fn poke(&self, value: u8) -> Result<(), RopeError> {
let pos = self.state().current.get().ok_or(RopeError::CurrentNotSet)?;
self.state().set(self.rope(), pos, value)
}
/// Move backward by `go_back_of` steps (toward lower indices for
/// [`ForwardCursor`], toward higher indices for [`BackwardCursor`]).
fn rewind(&self, go_back_of: usize) -> Result<(), RopeError> {
self.seek(-(go_back_of as isize), SeekMode::Relative)?;
Ok(())
}
/// Move forward by `ahead` steps (opposite of [`rewind`](RopeCursor::rewind)).
fn forward(&self, ahead: usize) -> Result<(), RopeError> {
self.seek(ahead as isize, SeekMode::Relative)?;
Ok(())
}
}
// ── ForwardCursor ─────────────────────────────────────────────────────────────
/// A cursor that reads from the start toward the end of the rope.
///
/// - `read_next`: first call reads index 0, then 1, 2, …
/// - `seek(Relative, +n)`: advances by n.
/// - `rewind(n)`: steps back by n.
///
/// Extra methods not in the trait: [`read_ahead`](ForwardCursor::read_ahead),
/// [`write`](ForwardCursor::write), [`iter`](ForwardCursor::iter).
#[derive(Clone)]
pub struct ForwardCursor<'a> {
rope: &'a Rope,
state: CursorState<'a>,
}
impl<'a> ForwardCursor<'a> {
/// Create a new forward cursor positioned before the first byte.
pub fn new(rope: &'a Rope) -> Self {
Self {
rope,
state: CursorState::new(),
}
}
/// Read the byte at `current + ahead` without moving the position.
pub fn read_ahead(&self, ahead: usize) -> Result<u8, RopeError> {
let pos = self.state.current.get().ok_or(RopeError::CurrentNotSet)?;
self.state
.get(self.rope, pos + ahead)
.ok_or(RopeError::OutOfBounds(format!(
"index out of bounds: i={} + {} > {}",
pos,
ahead,
self.rope.len()
)))
}
/// Write `value` at the current position and advance by one.
///
/// If the cursor has not moved yet, writes at the first byte of its local
/// view (absolute index = offset).
pub fn write(&self, value: u8) -> Result<(), RopeError> {
let pos = self.state.current.get().unwrap_or(self.state.offset.get());
self.state.set(self.rope, pos, value)?;
self.state.current.set(Some(pos + 1));
Ok(())
}
/// Return a shared-borrow iterator that yields bytes forward.
///
/// Because the iterator holds `&self` rather than `&mut self`, methods
/// such as [`tell`](RopeCursor::tell) and [`seek`](RopeCursor::seek) can
/// be called on the cursor inside the loop body.
pub fn iter(&self) -> ForwardIter<'a, '_> {
ForwardIter { cursor: self }
}
/// Create a new [`ForwardCursor`] whose local position 0 starts at the
/// current absolute position of `self`.
///
/// The new cursor shares the same underlying [`Rope`] (with the same
/// [`Cell`]-based interior mutability) but has an independent position and
/// an `offset` equal to `self.absolute_tell()`. If `self` has not moved
/// yet, the new cursor starts at the same offset as `self`.
pub fn cursor(&self) -> ForwardCursor<'a> {
let new_offset = self.rope_tell();
ForwardCursor {
rope: self.rope,
state: CursorState::with_offset(new_offset),
}
}
}
impl<'a> RopeCursor<'a> for ForwardCursor<'a> {
fn rope(&self) -> &'a Rope {
self.rope
}
fn state(&self) -> &CursorState<'a> {
&self.state
}
fn read_next(&self) -> Result<u8, RopeError> {
let next_pos = match self.state.current.get() {
Some(i) => i + 1,
None => self.state.offset.get(),
};
let value = self
.state
.get(self.rope, next_pos)
.ok_or(RopeError::OutOfBounds(format!(
"index out of bounds: i={} > {}",
next_pos,
self.rope.len()
)))?;
self.state.current.set(Some(next_pos));
Ok(value)
}
fn seek(&self, pos: isize, mode: SeekMode) -> Result<usize, RopeError> {
let offset = self.state.offset.get() as isize;
let abs_pos = match mode {
SeekMode::Absolute => pos + offset,
SeekMode::Relative => {
self.state.current.get().ok_or(RopeError::CurrentNotSet)? as isize + pos
}
SeekMode::RelativeToEnd => self.rope.len() as isize - pos,
SeekMode::Rope => pos,
};
if abs_pos < 0 {
return Err(RopeError::OutOfBounds(format!(
"index out of bounds: i={} < 0",
abs_pos
)));
}
self.state.current.set(Some(abs_pos as usize));
Ok(abs_pos as usize)
}
}
impl Iterator for ForwardCursor<'_> {
type Item = u8;
fn next(&mut self) -> Option<Self::Item> {
self.read_next().ok()
}
}
/// Shared-borrow iterator returned by [`ForwardCursor::iter`].
pub struct ForwardIter<'a, 'b> {
cursor: &'b ForwardCursor<'a>,
}
impl Iterator for ForwardIter<'_, '_> {
type Item = u8;
fn next(&mut self) -> Option<u8> {
self.cursor.read_next().ok()
}
}
// ── BackwardCursor ────────────────────────────────────────────────────────────
/// A cursor that reads from the end toward the start of the rope.
///
/// - `read_next`: first call reads index `len-1`, then `len-2`, …
/// - `seek(Relative, +n)`: retreats by n (subtracts n from the index).
/// - `rewind(n)`: advances toward the end by n.
///
/// Extra methods not in the trait: [`read_behind`](BackwardCursor::read_behind),
/// [`iter`](BackwardCursor::iter).
#[derive(Clone)]
pub struct BackwardCursor<'a> {
rope: &'a Rope,
state: CursorState<'a>,
}
impl<'a> BackwardCursor<'a> {
/// Create a new backward cursor positioned past the last byte.
pub fn new(rope: &'a Rope) -> Self {
Self {
rope,
state: CursorState::new(),
}
}
/// Read the byte at `current + behind` (toward higher indices) without moving.
pub fn read_behind(&self, behind: usize) -> Result<u8, RopeError> {
let pos = self.state.current.get().ok_or(RopeError::CurrentNotSet)?;
let target = pos
.checked_add(behind)
.filter(|&t| t < self.rope.len())
.ok_or(RopeError::OutOfBounds(format!(
"index out of bounds: i={} + {} > {}",
pos,
behind,
self.rope.len()
)))?;
self.state
.get(self.rope, target)
.ok_or(RopeError::OutOfBounds(format!(
"index out of bounds: i={} + {} > {}",
pos,
behind,
self.rope.len()
)))
}
/// Return a shared-borrow iterator that yields bytes backward.
///
/// Because the iterator holds `&self` rather than `&mut self`, methods
/// such as [`tell`](RopeCursor::tell) and [`seek`](RopeCursor::seek) can
/// be called on the cursor inside the loop body.
pub fn iter(&self) -> BackwardIter<'a, '_> {
BackwardIter { cursor: self }
}
/// Create a new [`BackwardCursor`] that stops at the current absolute
/// position of `self` (used as the lower bound / offset of the new cursor).
///
/// The new cursor scans from `rope.len() - 1` down to the current absolute
/// position of `self`. If `self` has not moved yet, the new cursor has the
/// same offset as `self` (no restriction).
pub fn cursor(&self) -> BackwardCursor<'a> {
let new_offset = self.rope_tell();
BackwardCursor {
rope: self.rope,
state: CursorState::with_offset(new_offset),
}
}
}
impl<'a> RopeCursor<'a> for BackwardCursor<'a> {
fn rope(&self) -> &'a Rope {
self.rope
}
fn state(&self) -> &CursorState<'a> {
&self.state
}
fn read_next(&self) -> Result<u8, RopeError> {
let offset = self.state.offset.get();
let next_pos = match self.state.current.get() {
None => self
.rope
.len()
.checked_sub(1)
.ok_or(RopeError::OutOfBounds(
"BackwardCursor: rope is empty".to_string(),
))?,
Some(i) if i <= offset => {
return Err(RopeError::OutOfBounds(
"BackwardCursor: already at beginning".to_string(),
));
}
Some(i) => i - 1,
};
let value = self
.state
.get(self.rope, next_pos)
.ok_or(RopeError::OutOfBounds(format!(
"BackwardCursor: index out of bounds at i={}",
next_pos
)))?;
self.state.current.set(Some(next_pos));
Ok(value)
}
fn seek(&self, pos: isize, mode: SeekMode) -> Result<usize, RopeError> {
let offset = self.state.offset.get() as isize;
let abs_pos = match mode {
SeekMode::Absolute => pos + offset,
SeekMode::Relative => {
self.state.current.get().ok_or(RopeError::CurrentNotSet)? as isize - pos
}
SeekMode::RelativeToEnd => self.rope.len() as isize - pos,
SeekMode::Rope => pos,
};
if abs_pos < 0 {
return Err(RopeError::OutOfBounds(format!(
"index out of bounds: i={} < 0",
abs_pos
)));
}
self.state.current.set(Some(abs_pos as usize));
Ok(abs_pos as usize)
}
}
impl Iterator for BackwardCursor<'_> {
type Item = u8;
fn next(&mut self) -> Option<Self::Item> {
self.read_next().ok()
}
}
/// Shared-borrow iterator returned by [`BackwardCursor::iter`].
pub struct BackwardIter<'a, 'b> {
cursor: &'b BackwardCursor<'a>,
}
impl Iterator for BackwardIter<'_, '_> {
type Item = u8;
fn next(&mut self) -> Option<u8> {
self.cursor.read_next().ok()
}
}
// ── tests ─────────────────────────────────────────────────────────────────────
#[cfg(test)]
mod tests {
use super::*;
use crate::Rope;
fn rope(data: &[u8]) -> Rope {
let mut r = Rope::new(None);
r.push(data.to_vec());
r
}
fn rope2(a: &[u8], b: &[u8]) -> Rope {
let mut r = Rope::new(None);
r.push(a.to_vec());
r.push(b.to_vec());
r
}
// ── ForwardCursor ─────────────────────────────────────────────────────────
#[test]
fn forward_reads_all_bytes() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
let out: Vec<u8> = c.collect();
assert_eq!(out, b"ACGT");
}
#[test]
fn forward_tell_tracks_position() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
assert_eq!(c.tell(), None);
c.read_next().unwrap();
assert_eq!(c.tell(), Some(0));
c.read_next().unwrap();
assert_eq!(c.tell(), Some(1));
}
#[test]
fn forward_iter_with_tell_inside_loop() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
let mut positions = Vec::new();
for _ in c.iter() {
positions.push(c.tell());
}
assert_eq!(positions, vec![Some(0), Some(1), Some(2), Some(3)]);
}
#[test]
fn forward_read_ahead() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
c.read_next().unwrap(); // at 0 = 'A'
assert_eq!(c.read_ahead(1).unwrap(), b'C');
assert_eq!(c.read_ahead(2).unwrap(), b'G');
assert_eq!(c.tell(), Some(0)); // position unchanged
}
#[test]
fn forward_write_and_read_back() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
c.write(b'X').unwrap();
c.write(b'Y').unwrap();
let c2 = r.fw_cursor();
assert_eq!(c2.read_next().unwrap(), b'X');
assert_eq!(c2.read_next().unwrap(), b'Y');
assert_eq!(c2.read_next().unwrap(), b'G');
}
#[test]
fn forward_rewind_and_reread() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
c.read_next().unwrap(); // A → current = Some(0)
c.read_next().unwrap(); // C → current = Some(1)
c.read_next().unwrap(); // G → current = Some(2)
c.rewind(1).unwrap(); // current = Some(1) → next read = index 2
assert_eq!(c.read_next().unwrap(), b'G');
}
#[test]
fn forward_seek_absolute() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
c.seek(2, SeekMode::Absolute).unwrap();
assert_eq!(c.read_next().unwrap(), b'T');
}
#[test]
fn forward_seek_relative_to_end() {
let r = rope(b"ACGT");
// seek(1, RelativeToEnd): current = len-1 = 3; peek() reads index 3 = T.
let c = r.fw_cursor();
c.seek(1, SeekMode::RelativeToEnd).unwrap();
assert_eq!(c.peek().unwrap(), b'T');
// seek(2, RelativeToEnd): current = len-2 = 2; read_next reads index 3 = T.
let c2 = r.fw_cursor();
c2.seek(2, SeekMode::RelativeToEnd).unwrap();
assert_eq!(c2.read_next().unwrap(), b'T');
}
#[test]
fn forward_get_random_access() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
assert_eq!(c.get(0), Some(b'A'));
assert_eq!(c.get(3), Some(b'T'));
assert_eq!(c.get(4), None);
}
#[test]
fn forward_crosses_block_boundary() {
let r = rope2(b"AC", b"GT");
let c = r.fw_cursor();
let out: Vec<u8> = c.collect();
assert_eq!(out, b"ACGT");
}
// ── BackwardCursor ────────────────────────────────────────────────────────
#[test]
fn backward_reads_all_bytes_in_reverse() {
let r = rope(b"ACGT");
let c = r.bw_cursor();
let out: Vec<u8> = c.collect();
assert_eq!(out, b"TGCA");
}
#[test]
fn backward_tell_tracks_position() {
let r = rope(b"ACGT");
let c = r.bw_cursor();
assert_eq!(c.tell(), None);
c.read_next().unwrap(); // reads index 3
assert_eq!(c.tell(), Some(3));
c.read_next().unwrap(); // reads index 2
assert_eq!(c.tell(), Some(2));
}
#[test]
fn backward_iter_with_tell_and_seek_inside_loop() {
let r = rope(b"ACGT");
let c = r.bw_cursor();
let mut restart: usize = 0;
for byte in c.iter() {
if byte == b'G' {
restart = c.tell().unwrap();
}
if byte == b'A' {
// seek back to G and break
c.seek(restart as isize, SeekMode::Absolute).ok();
break;
}
}
assert_eq!(c.tell(), Some(restart));
}
#[test]
fn backward_rewind_moves_toward_end() {
let r = rope(b"ACGT");
let c = r.bw_cursor();
c.read_next().unwrap(); // index 3 = T
c.read_next().unwrap(); // index 2 = G
c.rewind(1).unwrap(); // back to index 3
assert_eq!(c.tell(), Some(3));
assert_eq!(c.read_next().unwrap(), b'G'); // reads index 2
}
#[test]
fn backward_crosses_block_boundary() {
let r = rope2(b"AC", b"GT");
let c = r.bw_cursor();
let out: Vec<u8> = c.collect();
assert_eq!(out, b"TGCA");
}
#[test]
fn backward_empty_rope_returns_error() {
let r = Rope::new(None);
let c = r.bw_cursor();
assert!(c.read_next().is_err());
}
#[test]
fn forward_empty_rope_returns_error() {
let r = Rope::new(None);
let c = r.fw_cursor();
assert!(c.read_next().is_err());
}
// ── offset / sub-cursor ───────────────────────────────────────────────────
#[test]
fn forward_cursor_reads_from_offset() {
// cursor() at current=Some(2) → new cursor reads from index 2
let r = rope(b"ABCDE");
let c = r.fw_cursor();
c.read_next().unwrap(); // A → current=Some(0)
c.read_next().unwrap(); // B → current=Some(1)
c.read_next().unwrap(); // C → current=Some(2)
let sub = c.cursor(); // offset=2 (absolute_tell=2)
assert_eq!(sub.read_next().unwrap(), b'C'); // reads index 2
assert_eq!(sub.tell(), Some(0)); // relative: 2-2=0
assert_eq!(sub.rope_tell(), 2);
assert_eq!(sub.read_next().unwrap(), b'D');
assert_eq!(sub.tell(), Some(1)); // relative: 3-2=1
}
#[test]
fn forward_cursor_get_uses_relative_index() {
let r = rope(b"ABCDE");
let c = r.fw_cursor();
c.read_next().unwrap(); // A → current=Some(0), absolute_tell=0
let _sub = c.cursor(); // offset=0 — created to show cursor() compiles; not used further
// From sub2 with offset=2: get(0)=C, get(2)=E
let c2 = r.fw_cursor();
c2.read_next().unwrap(); // at 0
c2.read_next().unwrap(); // at 1
c2.read_next().unwrap(); // at 2, absolute=2
let sub2 = c2.cursor(); // offset=2
assert_eq!(sub2.get(0), Some(b'C')); // local 0 = absolute 2
assert_eq!(sub2.get(2), Some(b'E')); // local 2 = absolute 4
assert_eq!(sub2.get(3), None); // local 3 = absolute 5, OOB
}
#[test]
fn forward_cursor_len_reflects_offset() {
let r = rope(b"ABCDE"); // len=5
let c = r.fw_cursor();
c.read_next().unwrap();
c.read_next().unwrap();
c.read_next().unwrap(); // absolute_tell=2
let sub = c.cursor(); // offset=2
assert_eq!(sub.len(), 3); // 5 - 2
}
#[test]
fn forward_reset_goes_back_to_start() {
let r = rope(b"ABCDE");
let c = r.fw_cursor();
c.read_next().unwrap(); // A
c.read_next().unwrap(); // B
c.reset();
assert_eq!(c.tell(), None);
assert_eq!(c.read_next().unwrap(), b'A'); // starts over
}
#[test]
fn forward_sub_cursor_write_and_reset() {
// Write two bytes, discard them via reset(), write again.
let r = rope(b"XXXXX");
let c = r.fw_cursor();
c.write(b'A').unwrap(); // absolute 0 → current=Some(1)
c.write(b'B').unwrap(); // absolute 1 → current=Some(2)
let seg = c.cursor(); // absolute_tell=2, offset=2
seg.write(b'C').unwrap(); // absolute 2 → current=Some(3), tell=3-2=1
seg.write(b'D').unwrap(); // absolute 3 → current=Some(4), tell=4-2=2
assert_eq!(seg.tell(), Some(2)); // 2 bytes written into this segment
seg.reset();
assert_eq!(seg.tell(), None);
seg.write(b'E').unwrap(); // absolute 2 again
let all: Vec<u8> = r.fw_cursor().collect();
assert_eq!(&all[..3], b"ABE");
}
#[test]
fn backward_cursor_stops_at_offset() {
// BackwardCursor.cursor() creates a cursor with offset = absolute_tell.
// offset = local position 0 (inclusive lower bound).
// The cursor reads rope.len()-1 downto offset, then stops.
let r = rope(b"ABCDE"); // 0=A 1=B 2=C 3=D 4=E
let bw = r.bw_cursor();
bw.read_next().unwrap(); // E=4, current=Some(4)
bw.read_next().unwrap(); // D=3, current=Some(3), absolute_tell=3
// sub: offset=3, reads from 4 down to 3 (inclusive), then stops.
let sub = bw.cursor();
assert_eq!(sub.read_next().unwrap(), b'E'); // index 4, tell=4-3=1
assert_eq!(sub.read_next().unwrap(), b'D'); // index 3, tell=3-3=0 (local 0)
assert!(sub.read_next().is_err()); // would go to 2 < offset=3
}
#[test]
fn forward_absolute_tell_unchanged_by_offset() {
let r = rope(b"ABCDE");
let c = r.fw_cursor();
c.read_next().unwrap(); // absolute=0
let sub = c.cursor(); // offset=0
sub.read_next().unwrap(); // reads index 0, absolute_tell=0
sub.read_next().unwrap(); // reads index 1, absolute_tell=1
assert_eq!(sub.tell(), Some(1));
assert_eq!(sub.rope_tell(), 1);
// sub2 with offset=1
let sub2 = sub.cursor(); // offset=1
sub2.read_next().unwrap(); // reads index 1, absolute=1
assert_eq!(sub2.tell(), Some(0)); // relative: 1-1=0
assert_eq!(sub2.rope_tell(), 1);
}
}
+149
View File
@@ -0,0 +1,149 @@
use crate::{Rope, RopeError};
use super::state::CursorState;
use super::traits::{RopeCursor, SeekMode};
/// A cursor that reads from the end toward the start of the rope.
///
/// - `read_next`: first call reads index `len-1`, then `len-2`, …
/// - `seek(Relative, +n)`: retreats by n (subtracts n from the index).
/// - `rewind(n)`: advances toward the end by n.
///
/// Extra methods not in the trait: [`read_behind`](BackwardCursor::read_behind),
/// [`iter`](BackwardCursor::iter).
#[derive(Clone)]
pub struct BackwardCursor<'a> {
rope: &'a Rope,
state: CursorState<'a>,
}
impl<'a> BackwardCursor<'a> {
/// Create a new backward cursor positioned past the last byte.
pub fn new(rope: &'a Rope) -> Self {
Self {
rope,
state: CursorState::new(),
}
}
/// Read the byte at `current + behind` (toward higher indices) without moving.
pub fn read_behind(&self, behind: usize) -> Result<u8, RopeError> {
let pos = self.state.current.get().ok_or(RopeError::CurrentNotSet)?;
let target = pos
.checked_add(behind)
.filter(|&t| t < self.rope.len())
.ok_or(RopeError::OutOfBounds(format!(
"index out of bounds: i={} + {} > {}",
pos,
behind,
self.rope.len()
)))?;
self.state
.get(self.rope, target)
.ok_or(RopeError::OutOfBounds(format!(
"index out of bounds: i={} + {} > {}",
pos,
behind,
self.rope.len()
)))
}
/// Return a shared-borrow iterator that yields bytes backward.
///
/// Because the iterator holds `&self` rather than `&mut self`, methods
/// such as [`tell`](RopeCursor::tell) and [`seek`](RopeCursor::seek) can
/// be called on the cursor inside the loop body.
pub fn iter(&self) -> BackwardIter<'a, '_> {
BackwardIter { cursor: self }
}
/// Create a new [`BackwardCursor`] that stops at the current absolute
/// position of `self` (used as the lower bound / offset of the new cursor).
///
/// The new cursor scans from `rope.len() - 1` down to the current absolute
/// position of `self`. If `self` has not moved yet, the new cursor has the
/// same offset as `self` (no restriction).
pub fn cursor(&self) -> BackwardCursor<'a> {
let new_offset = self.rope_tell();
BackwardCursor {
rope: self.rope,
state: CursorState::with_offset(new_offset),
}
}
}
impl<'a> RopeCursor<'a> for BackwardCursor<'a> {
fn rope(&self) -> &'a Rope {
self.rope
}
fn state(&self) -> &CursorState<'a> {
&self.state
}
fn read_next(&self) -> Result<u8, RopeError> {
let offset = self.state.offset.get();
let next_pos = match self.state.current.get() {
None => self
.rope
.len()
.checked_sub(1)
.ok_or(RopeError::OutOfBounds(
"BackwardCursor: rope is empty".to_string(),
))?,
Some(i) if i <= offset => {
return Err(RopeError::OutOfBounds(
"BackwardCursor: already at beginning".to_string(),
));
}
Some(i) => i - 1,
};
let value = self
.state
.get(self.rope, next_pos)
.ok_or(RopeError::OutOfBounds(format!(
"BackwardCursor: index out of bounds at i={}",
next_pos
)))?;
self.state.current.set(Some(next_pos));
Ok(value)
}
fn seek(&self, pos: isize, mode: SeekMode) -> Result<usize, RopeError> {
let offset = self.state.offset.get() as isize;
let abs_pos = match mode {
SeekMode::Absolute => pos + offset,
SeekMode::Relative => {
self.state.current.get().ok_or(RopeError::CurrentNotSet)? as isize - pos
}
SeekMode::RelativeToEnd => self.rope.len() as isize - pos,
SeekMode::Rope => pos,
};
if abs_pos < 0 {
return Err(RopeError::OutOfBounds(format!(
"index out of bounds: i={} < 0",
abs_pos
)));
}
self.state.current.set(Some(abs_pos as usize));
Ok(abs_pos as usize)
}
}
impl Iterator for BackwardCursor<'_> {
type Item = u8;
fn next(&mut self) -> Option<Self::Item> {
self.read_next().ok()
}
}
/// Shared-borrow iterator returned by [`BackwardCursor::iter`].
pub struct BackwardIter<'a, 'b> {
cursor: &'b BackwardCursor<'a>,
}
impl Iterator for BackwardIter<'_, '_> {
type Item = u8;
fn next(&mut self) -> Option<u8> {
self.cursor.read_next().ok()
}
}
+142
View File
@@ -0,0 +1,142 @@
use crate::{Rope, RopeError};
use super::state::CursorState;
use super::traits::{RopeCursor, SeekMode};
/// A cursor that reads from the start toward the end of the rope.
///
/// - `read_next`: first call reads index 0, then 1, 2, …
/// - `seek(Relative, +n)`: advances by n.
/// - `rewind(n)`: steps back by n.
///
/// Extra methods not in the trait: [`read_ahead`](ForwardCursor::read_ahead),
/// [`write`](ForwardCursor::write), [`iter`](ForwardCursor::iter).
#[derive(Clone)]
pub struct ForwardCursor<'a> {
rope: &'a Rope,
state: CursorState<'a>,
}
impl<'a> ForwardCursor<'a> {
/// Create a new forward cursor positioned before the first byte.
pub fn new(rope: &'a Rope) -> Self {
Self {
rope,
state: CursorState::new(),
}
}
/// Read the byte at `current + ahead` without moving the position.
pub fn read_ahead(&self, ahead: usize) -> Result<u8, RopeError> {
let pos = self.state.current.get().ok_or(RopeError::CurrentNotSet)?;
self.state
.get(self.rope, pos + ahead)
.ok_or(RopeError::OutOfBounds(format!(
"index out of bounds: i={} + {} > {}",
pos,
ahead,
self.rope.len()
)))
}
/// Write `value` at the current position and advance by one.
///
/// If the cursor has not moved yet, writes at the first byte of its local
/// view (absolute index = offset).
pub fn write(&self, value: u8) -> Result<(), RopeError> {
let pos = self.state.current.get().unwrap_or(self.state.offset.get());
self.state.set(self.rope, pos, value)?;
self.state.current.set(Some(pos + 1));
Ok(())
}
/// Return a shared-borrow iterator that yields bytes forward.
///
/// Because the iterator holds `&self` rather than `&mut self`, methods
/// such as [`tell`](RopeCursor::tell) and [`seek`](RopeCursor::seek) can
/// be called on the cursor inside the loop body.
pub fn iter(&self) -> ForwardIter<'a, '_> {
ForwardIter { cursor: self }
}
/// Create a new [`ForwardCursor`] whose local position 0 starts at the
/// current absolute position of `self`.
///
/// The new cursor shares the same underlying [`Rope`] (with the same
/// [`Cell`](std::cell::Cell)-based interior mutability) but has an
/// independent position and an `offset` equal to `self.absolute_tell()`.
/// If `self` has not moved yet, the new cursor starts at the same offset
/// as `self`.
pub fn cursor(&self) -> ForwardCursor<'a> {
let new_offset = self.rope_tell();
ForwardCursor {
rope: self.rope,
state: CursorState::with_offset(new_offset),
}
}
}
impl<'a> RopeCursor<'a> for ForwardCursor<'a> {
fn rope(&self) -> &'a Rope {
self.rope
}
fn state(&self) -> &CursorState<'a> {
&self.state
}
fn read_next(&self) -> Result<u8, RopeError> {
let next_pos = match self.state.current.get() {
Some(i) => i + 1,
None => self.state.offset.get(),
};
let value = self
.state
.get(self.rope, next_pos)
.ok_or(RopeError::OutOfBounds(format!(
"index out of bounds: i={} > {}",
next_pos,
self.rope.len()
)))?;
self.state.current.set(Some(next_pos));
Ok(value)
}
fn seek(&self, pos: isize, mode: SeekMode) -> Result<usize, RopeError> {
let offset = self.state.offset.get() as isize;
let abs_pos = match mode {
SeekMode::Absolute => pos + offset,
SeekMode::Relative => {
self.state.current.get().ok_or(RopeError::CurrentNotSet)? as isize + pos
}
SeekMode::RelativeToEnd => self.rope.len() as isize - pos,
SeekMode::Rope => pos,
};
if abs_pos < 0 {
return Err(RopeError::OutOfBounds(format!(
"index out of bounds: i={} < 0",
abs_pos
)));
}
self.state.current.set(Some(abs_pos as usize));
Ok(abs_pos as usize)
}
}
impl Iterator for ForwardCursor<'_> {
type Item = u8;
fn next(&mut self) -> Option<Self::Item> {
self.read_next().ok()
}
}
/// Shared-borrow iterator returned by [`ForwardCursor::iter`].
pub struct ForwardIter<'a, 'b> {
cursor: &'b ForwardCursor<'a>,
}
impl Iterator for ForwardIter<'_, '_> {
type Item = u8;
fn next(&mut self) -> Option<u8> {
self.cursor.read_next().ok()
}
}
+53
View File
@@ -0,0 +1,53 @@
//! Cursors for sequential and random access over a [`Rope`].
//!
//! # Design
//!
//! A cursor borrows a `&'a Rope` and keeps a small block cache so that
//! consecutive accesses within the same block cost O(1). The first access to a
//! new block costs O(log n) (binary search in [`Rope::lookup`]); subsequent
//! accesses within that block are free.
//!
//! All mutable state (current position, cache) is stored in [`Cell`](std::cell::Cell)
//! fields, so every cursor method takes `&self` rather than `&mut self`. This means:
//!
//! - Two cursors can coexist on the same rope without lifetime conflicts.
//! - The `iter()` method returns a lightweight wrapper that holds `&Cursor`,
//! allowing `cursor.tell()` or `cursor.seek()` to be called **inside a `for`
//! loop** over the same cursor.
//!
//! # Cursors
//!
//! | Type | Direction | First `read_next` | `seek(Relative, +n)` |
//! |------|-----------|-------------------|----------------------|
//! | [`ForwardCursor`] | start → end | index 0 | advances (+n) |
//! | [`BackwardCursor`] | end → start | index `len-1` | retreats (+n) |
//!
//! # Example
//!
//! ```
//! use obikrope::{Rope, RopeCursor};
//!
//! let mut rope = Rope::new(None);
//! rope.push(b"ACGT".to_vec());
//!
//! let cursor = rope.fw_cursor();
//! for byte in cursor.iter() {
//! // cursor.tell() is valid here — iter() holds &cursor, not &mut cursor
//! let _ = cursor.tell();
//! }
//! ```
//!
//! Submodules: [`state`] (shared block-cache state), [`traits`] (`SeekMode`,
//! `RopeCursor`), [`forward`]/[`backward`] (the two cursor implementations).
mod backward;
mod forward;
mod state;
mod traits;
#[cfg(test)]
mod tests;
pub use backward::BackwardCursor;
pub use forward::ForwardCursor;
pub use traits::{RopeCursor, SeekMode};
+72
View File
@@ -0,0 +1,72 @@
use std::cell::Cell;
use crate::{Rope, RopeError};
/// Per-cursor cache of the last accessed block, the current position, and the
/// base offset that defines the cursor's local coordinate system.
///
/// All fields are [`Cell`]-wrapped so they can be mutated through a shared
/// reference, enabling `&self` methods on cursors.
#[derive(Clone)]
pub struct CursorState<'a> {
block_idx: Cell<usize>,
block_start: Cell<usize>,
block_end: Cell<usize>,
block: Cell<&'a [Cell<u8>]>,
initialized: Cell<bool>,
pub(super) current: Cell<Option<usize>>,
/// Absolute rope index that maps to local position 0.
/// All user-facing coordinates are relative to this value.
pub(super) offset: Cell<usize>,
}
impl<'a> CursorState<'a> {
pub(super) fn new() -> Self {
Self::with_offset(0)
}
pub(super) fn with_offset(offset: usize) -> Self {
Self {
block_idx: Cell::new(0),
block_start: Cell::new(0),
block_end: Cell::new(0),
block: Cell::new(&[]),
initialized: Cell::new(false),
current: Cell::new(None),
offset: Cell::new(offset),
}
}
pub(super) fn get(&self, rope: &'a Rope, i: usize) -> Option<u8> {
if !self.initialized.get() || i < self.block_start.get() || i >= self.block_end.get() {
let (bi, bs, be) = rope.lookup(i)?;
self.block_idx.set(bi);
self.block_start.set(bs);
self.block_end.set(be);
self.block.set(rope.get_block(bi)?);
self.initialized.set(true);
}
Some(self.block.get()[i - self.block_start.get()].get())
}
pub(super) fn set(&self, rope: &'a Rope, i: usize, value: u8) -> Result<(), RopeError> {
if !self.initialized.get() || i < self.block_start.get() || i >= self.block_end.get() {
let (bi, bs, be) = rope.lookup(i).ok_or(RopeError::OutOfBounds(format!(
"index out of bounds: i={} > {}",
i,
rope.len()
)))?;
self.block_idx.set(bi);
self.block_start.set(bs);
self.block_end.set(be);
self.block
.set(rope.get_block(bi).ok_or(RopeError::BlockNotFound(format!(
"Cannot find block for index {}",
i
)))?);
self.initialized.set(true);
}
self.block.get()[i - self.block_start.get()].set(value);
Ok(())
}
}
+298
View File
@@ -0,0 +1,298 @@
use super::*;
use crate::Rope;
fn rope(data: &[u8]) -> Rope {
let mut r = Rope::new(None);
r.push(data.to_vec());
r
}
fn rope2(a: &[u8], b: &[u8]) -> Rope {
let mut r = Rope::new(None);
r.push(a.to_vec());
r.push(b.to_vec());
r
}
// ── ForwardCursor ─────────────────────────────────────────────────────────
#[test]
fn forward_reads_all_bytes() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
let out: Vec<u8> = c.collect();
assert_eq!(out, b"ACGT");
}
#[test]
fn forward_tell_tracks_position() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
assert_eq!(c.tell(), None);
c.read_next().unwrap();
assert_eq!(c.tell(), Some(0));
c.read_next().unwrap();
assert_eq!(c.tell(), Some(1));
}
#[test]
fn forward_iter_with_tell_inside_loop() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
let mut positions = Vec::new();
for _ in c.iter() {
positions.push(c.tell());
}
assert_eq!(positions, vec![Some(0), Some(1), Some(2), Some(3)]);
}
#[test]
fn forward_read_ahead() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
c.read_next().unwrap(); // at 0 = 'A'
assert_eq!(c.read_ahead(1).unwrap(), b'C');
assert_eq!(c.read_ahead(2).unwrap(), b'G');
assert_eq!(c.tell(), Some(0)); // position unchanged
}
#[test]
fn forward_write_and_read_back() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
c.write(b'X').unwrap();
c.write(b'Y').unwrap();
let c2 = r.fw_cursor();
assert_eq!(c2.read_next().unwrap(), b'X');
assert_eq!(c2.read_next().unwrap(), b'Y');
assert_eq!(c2.read_next().unwrap(), b'G');
}
#[test]
fn forward_rewind_and_reread() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
c.read_next().unwrap(); // A → current = Some(0)
c.read_next().unwrap(); // C → current = Some(1)
c.read_next().unwrap(); // G → current = Some(2)
c.rewind(1).unwrap(); // current = Some(1) → next read = index 2
assert_eq!(c.read_next().unwrap(), b'G');
}
#[test]
fn forward_seek_absolute() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
c.seek(2, SeekMode::Absolute).unwrap();
assert_eq!(c.read_next().unwrap(), b'T');
}
#[test]
fn forward_seek_relative_to_end() {
let r = rope(b"ACGT");
// seek(1, RelativeToEnd): current = len-1 = 3; peek() reads index 3 = T.
let c = r.fw_cursor();
c.seek(1, SeekMode::RelativeToEnd).unwrap();
assert_eq!(c.peek().unwrap(), b'T');
// seek(2, RelativeToEnd): current = len-2 = 2; read_next reads index 3 = T.
let c2 = r.fw_cursor();
c2.seek(2, SeekMode::RelativeToEnd).unwrap();
assert_eq!(c2.read_next().unwrap(), b'T');
}
#[test]
fn forward_get_random_access() {
let r = rope(b"ACGT");
let c = r.fw_cursor();
assert_eq!(c.get(0), Some(b'A'));
assert_eq!(c.get(3), Some(b'T'));
assert_eq!(c.get(4), None);
}
#[test]
fn forward_crosses_block_boundary() {
let r = rope2(b"AC", b"GT");
let c = r.fw_cursor();
let out: Vec<u8> = c.collect();
assert_eq!(out, b"ACGT");
}
// ── BackwardCursor ────────────────────────────────────────────────────────
#[test]
fn backward_reads_all_bytes_in_reverse() {
let r = rope(b"ACGT");
let c = r.bw_cursor();
let out: Vec<u8> = c.collect();
assert_eq!(out, b"TGCA");
}
#[test]
fn backward_tell_tracks_position() {
let r = rope(b"ACGT");
let c = r.bw_cursor();
assert_eq!(c.tell(), None);
c.read_next().unwrap(); // reads index 3
assert_eq!(c.tell(), Some(3));
c.read_next().unwrap(); // reads index 2
assert_eq!(c.tell(), Some(2));
}
#[test]
fn backward_iter_with_tell_and_seek_inside_loop() {
let r = rope(b"ACGT");
let c = r.bw_cursor();
let mut restart: usize = 0;
for byte in c.iter() {
if byte == b'G' {
restart = c.tell().unwrap();
}
if byte == b'A' {
// seek back to G and break
c.seek(restart as isize, SeekMode::Absolute).ok();
break;
}
}
assert_eq!(c.tell(), Some(restart));
}
#[test]
fn backward_rewind_moves_toward_end() {
let r = rope(b"ACGT");
let c = r.bw_cursor();
c.read_next().unwrap(); // index 3 = T
c.read_next().unwrap(); // index 2 = G
c.rewind(1).unwrap(); // back to index 3
assert_eq!(c.tell(), Some(3));
assert_eq!(c.read_next().unwrap(), b'G'); // reads index 2
}
#[test]
fn backward_crosses_block_boundary() {
let r = rope2(b"AC", b"GT");
let c = r.bw_cursor();
let out: Vec<u8> = c.collect();
assert_eq!(out, b"TGCA");
}
#[test]
fn backward_empty_rope_returns_error() {
let r = Rope::new(None);
let c = r.bw_cursor();
assert!(c.read_next().is_err());
}
#[test]
fn forward_empty_rope_returns_error() {
let r = Rope::new(None);
let c = r.fw_cursor();
assert!(c.read_next().is_err());
}
// ── offset / sub-cursor ───────────────────────────────────────────────────
#[test]
fn forward_cursor_reads_from_offset() {
// cursor() at current=Some(2) → new cursor reads from index 2
let r = rope(b"ABCDE");
let c = r.fw_cursor();
c.read_next().unwrap(); // A → current=Some(0)
c.read_next().unwrap(); // B → current=Some(1)
c.read_next().unwrap(); // C → current=Some(2)
let sub = c.cursor(); // offset=2 (absolute_tell=2)
assert_eq!(sub.read_next().unwrap(), b'C'); // reads index 2
assert_eq!(sub.tell(), Some(0)); // relative: 2-2=0
assert_eq!(sub.rope_tell(), 2);
assert_eq!(sub.read_next().unwrap(), b'D');
assert_eq!(sub.tell(), Some(1)); // relative: 3-2=1
}
#[test]
fn forward_cursor_get_uses_relative_index() {
let r = rope(b"ABCDE");
let c = r.fw_cursor();
c.read_next().unwrap(); // A → current=Some(0), absolute_tell=0
let _sub = c.cursor(); // offset=0 — created to show cursor() compiles; not used further
// From sub2 with offset=2: get(0)=C, get(2)=E
let c2 = r.fw_cursor();
c2.read_next().unwrap(); // at 0
c2.read_next().unwrap(); // at 1
c2.read_next().unwrap(); // at 2, absolute=2
let sub2 = c2.cursor(); // offset=2
assert_eq!(sub2.get(0), Some(b'C')); // local 0 = absolute 2
assert_eq!(sub2.get(2), Some(b'E')); // local 2 = absolute 4
assert_eq!(sub2.get(3), None); // local 3 = absolute 5, OOB
}
#[test]
fn forward_cursor_len_reflects_offset() {
let r = rope(b"ABCDE"); // len=5
let c = r.fw_cursor();
c.read_next().unwrap();
c.read_next().unwrap();
c.read_next().unwrap(); // absolute_tell=2
let sub = c.cursor(); // offset=2
assert_eq!(sub.len(), 3); // 5 - 2
}
#[test]
fn forward_reset_goes_back_to_start() {
let r = rope(b"ABCDE");
let c = r.fw_cursor();
c.read_next().unwrap(); // A
c.read_next().unwrap(); // B
c.reset();
assert_eq!(c.tell(), None);
assert_eq!(c.read_next().unwrap(), b'A'); // starts over
}
#[test]
fn forward_sub_cursor_write_and_reset() {
// Write two bytes, discard them via reset(), write again.
let r = rope(b"XXXXX");
let c = r.fw_cursor();
c.write(b'A').unwrap(); // absolute 0 → current=Some(1)
c.write(b'B').unwrap(); // absolute 1 → current=Some(2)
let seg = c.cursor(); // absolute_tell=2, offset=2
seg.write(b'C').unwrap(); // absolute 2 → current=Some(3), tell=3-2=1
seg.write(b'D').unwrap(); // absolute 3 → current=Some(4), tell=4-2=2
assert_eq!(seg.tell(), Some(2)); // 2 bytes written into this segment
seg.reset();
assert_eq!(seg.tell(), None);
seg.write(b'E').unwrap(); // absolute 2 again
let all: Vec<u8> = r.fw_cursor().collect();
assert_eq!(&all[..3], b"ABE");
}
#[test]
fn backward_cursor_stops_at_offset() {
// BackwardCursor.cursor() creates a cursor with offset = absolute_tell.
// offset = local position 0 (inclusive lower bound).
// The cursor reads rope.len()-1 downto offset, then stops.
let r = rope(b"ABCDE"); // 0=A 1=B 2=C 3=D 4=E
let bw = r.bw_cursor();
bw.read_next().unwrap(); // E=4, current=Some(4)
bw.read_next().unwrap(); // D=3, current=Some(3), absolute_tell=3
// sub: offset=3, reads from 4 down to 3 (inclusive), then stops.
let sub = bw.cursor();
assert_eq!(sub.read_next().unwrap(), b'E'); // index 4, tell=4-3=1
assert_eq!(sub.read_next().unwrap(), b'D'); // index 3, tell=3-3=0 (local 0)
assert!(sub.read_next().is_err()); // would go to 2 < offset=3
}
#[test]
fn forward_absolute_tell_unchanged_by_offset() {
let r = rope(b"ABCDE");
let c = r.fw_cursor();
c.read_next().unwrap(); // absolute=0
let sub = c.cursor(); // offset=0
sub.read_next().unwrap(); // reads index 0, absolute_tell=0
sub.read_next().unwrap(); // reads index 1, absolute_tell=1
assert_eq!(sub.tell(), Some(1));
assert_eq!(sub.rope_tell(), 1);
// sub2 with offset=1
let sub2 = sub.cursor(); // offset=1
sub2.read_next().unwrap(); // reads index 1, absolute=1
assert_eq!(sub2.tell(), Some(0)); // relative: 1-1=0
assert_eq!(sub2.rope_tell(), 1);
}
+127
View File
@@ -0,0 +1,127 @@
use crate::{Rope, RopeError};
use super::state::CursorState;
/// Controls how the `pos` argument of [`RopeCursor::seek`] is interpreted.
#[derive(Clone, Copy)]
pub enum SeekMode {
/// `pos` is an absolute byte index from the start of the rope.
Absolute,
/// `pos` is relative to the current position.
/// Positive = forward for [`ForwardCursor`](super::ForwardCursor), backward for [`BackwardCursor`](super::BackwardCursor).
Relative,
/// `pos` is counted back from the end: target = `len - pos`.
RelativeToEnd,
/// `pos` is a rope index relative to the start of the rope.
Rope,
}
/// Common interface for all rope cursors.
///
/// # Required methods
///
/// Implementors must provide [`rope`](RopeCursor::rope),
/// [`state`](RopeCursor::state), [`read_next`](RopeCursor::read_next) and
/// [`seek`](RopeCursor::seek). Everything else has a default implementation.
///
/// The direction of `read_next` and the sign convention for
/// [`SeekMode::Relative`] differ between [`ForwardCursor`](super::ForwardCursor)
/// and [`BackwardCursor`](super::BackwardCursor); all other methods are identical.
pub trait RopeCursor<'a> {
/// The rope this cursor is bound to.
fn rope(&self) -> &'a Rope;
/// Internal cache state — implementation detail exposed for default methods.
fn state(&self) -> &CursorState<'a>;
/// Read the next byte in cursor direction and advance the position.
/// Returns `Err` at the exhausted end.
fn read_next(&self) -> Result<u8, RopeError>;
/// Move the cursor to a new position.
///
/// `pos` is interpreted according to `mode`:
/// - [`Absolute`](SeekMode::Absolute): local coordinate (`pos + offset` in the rope).
/// - [`Rope`](SeekMode::Rope): raw rope index, ignores the offset. Pass a value
/// from [`rope_tell`](RopeCursor::rope_tell) to restore a saved position.
/// - [`Relative`](SeekMode::Relative): delta from the current position.
/// For [`ForwardCursor`](super::ForwardCursor), positive advances toward the end;
/// for [`BackwardCursor`](super::BackwardCursor), positive retreats toward the start.
/// - [`RelativeToEnd`](SeekMode::RelativeToEnd): `rope.len() - pos`.
///
/// Returns the new position as a **rope index** (same value as
/// [`rope_tell`](RopeCursor::rope_tell) would return immediately after).
fn seek(&self, pos: isize, mode: SeekMode) -> Result<usize, RopeError>;
// ── default methods ───────────────────────────────────────────────────────
/// Read the byte at **local** index `i` (relative to the cursor's offset)
/// without moving the position.
fn get(&self, i: usize) -> Option<u8> {
self.state().get(self.rope(), i + self.state().offset.get())
}
/// Write `value` at **local** index `i` without moving the position.
fn set(&self, i: usize, value: u8) -> Result<(), RopeError> {
self.state()
.set(self.rope(), i + self.state().offset.get(), value)
}
/// Current position relative to the cursor's offset, or `None` if the
/// cursor has not moved yet.
fn tell(&self) -> Option<usize> {
let abs = self.state().current.get()?;
Some(abs.saturating_sub(self.state().offset.get()))
}
/// Current position as an absolute rope index.
///
/// Unlike [`tell`](RopeCursor::tell), this method **always** returns a
/// value: if the cursor has not moved yet, it returns the cursor's offset
/// (the rope index of local position 0).
///
/// Use the returned value with [`SeekMode::Rope`] to restore a position,
/// or as a truncation point after a write pass.
fn rope_tell(&self) -> usize {
self.state()
.current
.get()
.unwrap_or(self.state().offset.get())
}
/// Number of bytes visible through this cursor (`rope.len() - offset`).
fn len(&self) -> usize {
self.rope().len().saturating_sub(self.state().offset.get())
}
/// Reset the cursor to its initial state (positioned before the first
/// byte of its local view). Equivalent to `seek(0, Absolute)` on a
/// fresh cursor, but works even when `current` is `None`.
fn reset(&self) {
self.state().current.set(None);
}
/// Read the byte at the current position without advancing.
fn peek(&self) -> Option<u8> {
self.state().get(self.rope(), self.state().current.get()?)
}
/// Write `value` at the current position without advancing.
fn poke(&self, value: u8) -> Result<(), RopeError> {
let pos = self.state().current.get().ok_or(RopeError::CurrentNotSet)?;
self.state().set(self.rope(), pos, value)
}
/// Move backward by `go_back_of` steps (toward lower indices for
/// [`ForwardCursor`](super::ForwardCursor), toward higher indices for
/// [`BackwardCursor`](super::BackwardCursor)).
fn rewind(&self, go_back_of: usize) -> Result<(), RopeError> {
self.seek(-(go_back_of as isize), SeekMode::Relative)?;
Ok(())
}
/// Move forward by `ahead` steps (opposite of [`rewind`](RopeCursor::rewind)).
fn forward(&self, ahead: usize) -> Result<(), RopeError> {
self.seek(ahead as isize, SeekMode::Relative)?;
Ok(())
}
}
-878
View File
@@ -1,878 +0,0 @@
use crossbeam_channel::{Receiver, Select, Sender, bounded};
use std::error::Error;
use std::fmt;
use std::marker::PhantomData;
use std::sync::Arc;
use std::thread;
/// Error type for pipeline operations.
#[derive(Debug)]
pub enum PipelineError {
/// A stage received a `PipelineData` variant it did not expect.
TypeMismatch,
/// The step kind is not compatible with the data type.
StepKindMismatch(&'static str),
/// The source has no more data to produce.
EndOfStream,
/// An error occurred inside a stage (e.g., I/O, parsing, custom logic).
StepError(Box<dyn Error + Send + Sync>),
}
impl fmt::Display for PipelineError {
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
match self {
PipelineError::TypeMismatch => write!(f, "data type mismatch in pipeline stage"),
PipelineError::StepKindMismatch(s) => write!(f, "step kind mismatch: {}", s),
PipelineError::EndOfStream => write!(f, "end of input stream"),
PipelineError::StepError(e) => write!(f, "stage error: {}", e),
}
}
}
impl Error for PipelineError {
fn source(&self) -> Option<&(dyn Error + 'static)> {
match self {
PipelineError::StepError(e) => Some(e.as_ref()),
_ => None,
}
}
}
// ── Function types ────────────────────────────────────────────────────────────
/// Fonction source : appelée répétitivement, retourne le prochain item ou EndOfStream.
/// `FnMut` car elle maintient un état interne (position dans l'itérateur).
pub type SourceFn<D> = Box<dyn FnMut() -> Result<D, PipelineError> + Send>;
/// Fonction sink : consomme un item final, peut échouer (erreur d'I/O, etc.).
pub type SinkFn<D> = Box<dyn Fn(D) -> Result<(), PipelineError> + Send>;
/// Fonction de transformation partagée entre workers via Arc.
pub type SharedFn<D> = Arc<dyn Fn(D) -> Result<D, PipelineError> + Send + Sync>;
/// Fonction de transformation 1→N (flat map) partagée entre workers via Arc.
///
/// La fonction reçoit l'item d'entrée, un canal `push` pour envoyer chaque item
/// produit, et un canal `delta` pour signaler au scheduler combien d'items
/// supplémentaires sont entrés dans le pipeline (N-1 si N items produits).
/// Elle doit appeler `delta.send(N - 1)` **après** avoir poussé tous les items.
pub type SharedFlatFn<D> =
Arc<dyn Fn(D, &Sender<Result<D, PipelineError>>, &Sender<isize>) + Send + Sync>;
// ── Stage enum ────────────────────────────────────────────────────────────────
/// Une étape du pipeline : transform classique (1→1) ou flat transform (1→N).
pub enum Stage<D> {
Transform(SharedFn<D>),
Flat(SharedFlatFn<D>),
}
impl<D> Clone for Stage<D> {
fn clone(&self) -> Self {
match self {
Stage::Transform(f) => Stage::Transform(Arc::clone(f)),
Stage::Flat(f) => Stage::Flat(Arc::clone(f)),
}
}
}
// ── Worker task ───────────────────────────────────────────────────────────────
enum WorkerTask<D> {
Transform(D, usize),
Flat(D, usize),
}
// ── Thread runners ────────────────────────────────────────────────────────────
fn source_runner<DATA>(
mut source: SourceFn<DATA>,
capacity: usize,
) -> (
Receiver<Result<DATA, PipelineError>>,
thread::JoinHandle<()>,
)
where
DATA: Send + Sync + 'static,
{
let (tx, rx) = bounded(capacity);
let handle = thread::spawn(move || {
loop {
match source() {
Ok(data) => {
if tx.send(Ok(data)).is_err() {
break;
}
}
Err(PipelineError::EndOfStream) => break,
Err(e) => {
eprintln!("Source error: {:?}", e);
let _ = tx.send(Err(e));
break;
}
}
}
});
(rx, handle)
}
/// Lance un thread worker du pool.
///
/// Gère deux types de tâches :
/// - `Transform` : applique `f(data)` et envoie le résultat dans `result_tx`.
/// - `Flat` : appelle `f(data, &push_tx, &delta_tx)` ; la fonction elle-même
/// pousse ses items dans `push_tx` et envoie `N-1` dans `delta_tx`.
fn transform_runner<DATA>(
task_rx: Receiver<WorkerTask<DATA>>,
stages: Vec<Stage<DATA>>,
stage_txs: Vec<Sender<Result<DATA, PipelineError>>>,
flat_delta_tx: Sender<isize>,
) -> thread::JoinHandle<()>
where
DATA: Send + Sync + 'static,
{
thread::spawn(move || {
while let Ok(task) = task_rx.recv() {
match task {
WorkerTask::Transform(data, idx) => {
if let Stage::Transform(f) = &stages[idx] {
let _ = stage_txs[idx].send(f(data));
}
}
WorkerTask::Flat(data, idx) => {
if let Stage::Flat(f) = &stages[idx] {
f(data, &stage_txs[idx], &flat_delta_tx);
}
}
}
}
})
}
/// Lance le thread sink.
fn sink_runner<DATA>(
sink: SinkFn<DATA>,
capacity: usize,
) -> (
Sender<DATA>,
Receiver<PipelineError>,
thread::JoinHandle<()>,
)
where
DATA: Send + Sync + 'static,
{
let (data_tx, data_rx) = bounded(capacity);
let (err_tx, err_rx) = bounded(capacity);
let handle = thread::spawn(move || {
for data in data_rx {
if let Err(e) = sink(data) {
let _ = err_tx.send(e);
break;
}
}
});
(data_tx, err_rx, handle)
}
// ── Pipeline ──────────────────────────────────────────────────────────────────
pub struct Pipeline<DATA> {
source: SourceFn<DATA>,
stages: Vec<Stage<DATA>>,
sink: SinkFn<DATA>,
}
impl<DATA> Pipeline<DATA> {
pub fn new(
source: SourceFn<DATA>,
stages: Vec<Stage<DATA>>,
sink: SinkFn<DATA>,
) -> Self {
Self { source, stages, sink }
}
}
// ── WorkerPool ────────────────────────────────────────────────────────────────
pub struct WorkerPool<DATA> {
pipeline: Pipeline<DATA>,
handles: Vec<std::thread::JoinHandle<()>>,
n_workers: usize,
capacity: usize,
}
impl<DATA> WorkerPool<DATA>
where
DATA: Send + Sync + 'static,
{
pub fn new(pipeline: Pipeline<DATA>, n_workers: usize, capacity: usize) -> Self {
Self {
pipeline,
handles: Vec::new(),
n_workers,
capacity,
}
}
pub fn run(mut self) {
let n = self.pipeline.stages.len();
// ── Canaux inter-stages ────────────────────────────────────────────
// stage_txs[i] / stage_rxs[i] : sortie du stage i
let mut stage_txs: Vec<Sender<Result<DATA, PipelineError>>> = Vec::new();
let mut stage_rxs: Vec<Receiver<Result<DATA, PipelineError>>> = Vec::new();
for _ in 0..n {
let (tx, rx) = bounded(self.capacity);
stage_txs.push(tx);
stage_rxs.push(rx);
}
// ── Source thread ──────────────────────────────────────────────────
let (source_rx, src_handle) = source_runner(self.pipeline.source, self.capacity);
self.handles.push(src_handle);
let stages = self.pipeline.stages;
// ── Canal delta pour les flat stages ───────────────────────────────
// Chaque flat worker envoie `N-1` ici après avoir poussé N items.
// Le scheduler ajuste `in_flight` en conséquence.
let (flat_delta_tx, flat_delta_rx) = bounded::<isize>(self.capacity);
// ── Worker pool ────────────────────────────────────────────────────
let (worker_tx, worker_rx): (Sender<WorkerTask<DATA>>, Receiver<WorkerTask<DATA>>) =
bounded(self.capacity);
for _ in 0..self.n_workers {
self.handles.push(transform_runner(
worker_rx.clone(),
stages.iter().map(Stage::clone).collect(),
stage_txs.clone(),
flat_delta_tx.clone(),
));
}
// Le scheduler ne tient plus flat_delta_tx : les workers le détiennent.
// On le drop ici pour que le canal se ferme quand les workers terminent.
drop(flat_delta_tx);
// ── Sink thread ────────────────────────────────────────────────────
let (sink_tx, sink_err_rx, sink_handle) = sink_runner(self.pipeline.sink, self.capacity);
self.handles.push(sink_handle);
// ── Boucle principale ──────────────────────────────────────────────
//
// `in_flight` (isize) = nb d'items qui doivent encore atteindre le sink.
// Peut temporairement être négatif si un flat worker a poussé ses items
// avant que le scheduler ait reçu le delta correspondant.
//
// `flat_workers_active` = nb de flat workers en cours d'exécution.
// Empêche la terminaison prématurée quand in_flight vaut 0 mais qu'un
// flat worker n'a pas encore envoyé son delta.
//
// Priorités du Select biaisé (index le plus bas = priorité la plus haute) :
// 0 → sink_err_rx (arrêt immédiat sur erreur sink)
// 1 → flat_delta_rx (mettre à jour in_flight avant de dispatcher)
// 2..=n+1 → stage_rxs[n-1..0] (vider le pipeline en priorité)
// n+2 → source_rx (dernier recours : nouvelles données)
//
// Quand k = 0 : erreur du sink
// Quand k = 1 : delta d'un flat worker
// Quand 2 ≤ k ≤ n+1 : résultat du stage n+1-k
// Quand k = n+2 : item source
//
// Terminaison : source tarie ET in_flight == 0 ET aucun flat worker actif.
{
let mut source_done = false;
let mut in_flight: isize = 0;
let mut flat_workers_active: usize = 0;
loop {
if source_done && in_flight == 0 && flat_workers_active == 0 {
break;
}
let mut sel = Select::new_biased();
sel.recv(&sink_err_rx); // index 0
sel.recv(&flat_delta_rx); // index 1
for rx in stage_rxs.iter().rev() {
sel.recv(rx); // indices 2..=n+1
}
let src_idx = if !source_done {
Some(sel.recv(&source_rx)) // index n+2
} else {
None
};
let oper = sel.select();
let k = oper.index();
if k == 0 {
// ── Erreur du sink ────────────────────────────────────
match oper.recv(&sink_err_rx) {
Ok(e) => { eprintln!("Sink error: {:?}", e); break; }
Err(_) => break,
}
} else if k == 1 {
// ── Delta d'un flat worker ────────────────────────────
// delta = N - 1 (N items poussés, 1 item consommé)
match oper.recv(&flat_delta_rx) {
Ok(delta) => {
in_flight += delta;
flat_workers_active -= 1;
}
Err(_) => {}
}
} else if src_idx == Some(k) {
// ── Nouvel item depuis la source ──────────────────────
match oper.recv(&source_rx) {
Ok(Ok(data)) => {
if n == 0 {
let _ = sink_tx.send(data);
} else {
in_flight += 1;
dispatch(
data, 0,
&stages, &worker_tx,
&mut flat_workers_active,
);
}
}
Ok(Err(e)) => eprintln!("Source error: {:?}", e),
Err(_) => source_done = true,
}
} else {
// ── Résultat d'un stage intermédiaire ─────────────────
// k ∈ [2, n+1] → stage = n+1 - k
let stage = n + 1 - k;
match oper.recv(&stage_rxs[stage]) {
Ok(Ok(data)) => {
if stage == n - 1 {
in_flight -= 1;
let _ = sink_tx.send(data);
} else {
dispatch(
data, stage + 1,
&stages, &worker_tx,
&mut flat_workers_active,
);
}
}
Ok(Err(e)) => eprintln!("Stage {} error: {:?}", stage, e),
Err(_) => break,
}
}
}
}
drop(worker_tx);
drop(sink_tx);
for h in self.handles {
let _ = h.join();
}
}
}
// ── Pipe ──────────────────────────────────────────────────────────────────────
/// Typed, composable iterator transformer.
///
/// A `Pipe<D, In, Out>` is a pure description of pipeline stages — no threads,
/// no channels, no scheduler. Call `.apply(iter, n_workers, capacity)` to start
/// execution and get back a `PipeIter<Out>`.
///
/// Compose two pipes with `.then()`: the resulting `Pipe` holds the concatenated
/// stage list, so a single scheduler is created when `.apply()` is eventually called.
pub struct Pipe<D, In, Out> {
stages: Vec<Stage<D>>,
wrap: Arc<dyn Fn(In) -> D + Send + Sync>,
unwrap: Arc<dyn Fn(D) -> Out + Send + Sync>,
_phantom: PhantomData<(In, Out)>,
}
impl<D, In, Out> Pipe<D, In, Out> {
/// Build a `Pipe` from stages and wrap/unwrap converters.
/// Prefer the `make_pipe!` macro.
pub fn new(
stages: Vec<Stage<D>>,
wrap: Arc<dyn Fn(In) -> D + Send + Sync>,
unwrap: Arc<dyn Fn(D) -> Out + Send + Sync>,
) -> Self {
Self { stages, wrap, unwrap, _phantom: PhantomData }
}
/// Concatenate stages from two pipes into one.
///
/// Requires `Out` of `self` == `In` of `other`. The single scheduler
/// created at `.apply()` time sees the full combined stage list.
pub fn then<Next>(self, other: Pipe<D, Out, Next>) -> Pipe<D, In, Next> {
Pipe {
stages: self.stages.into_iter().chain(other.stages).collect(),
wrap: self.wrap,
unwrap: other.unwrap,
_phantom: PhantomData,
}
}
}
impl<D, In, Out> Pipe<D, In, Out>
where
D: Send + Sync + 'static,
In: Send + 'static,
Out: Send + 'static,
{
/// Run the pipeline in a background thread; returns an iterator over the output.
pub fn apply(
self,
input: impl Iterator<Item = In> + Send + 'static,
n_workers: usize,
capacity: usize,
) -> PipeIter<Out> {
let wrap = Arc::clone(&self.wrap);
let unwrap = Arc::clone(&self.unwrap);
let mut iter = input;
let source: SourceFn<D> = Box::new(move || match iter.next() {
Some(x) => Ok(wrap(x)),
None => Err(PipelineError::EndOfStream),
});
let (out_tx, out_rx) = bounded::<Out>(capacity);
let sink: SinkFn<D> = Box::new(move |data: D| {
out_tx.send(unwrap(data)).map_err(|_| {
PipelineError::StepError(Box::new(std::io::Error::new(
std::io::ErrorKind::BrokenPipe,
"output channel closed",
)))
})
});
let pipeline = Pipeline::new(source, self.stages, sink);
let handle = thread::spawn(move || {
WorkerPool::new(pipeline, n_workers, capacity).run();
});
PipeIter { rx: out_rx, handle: Some(handle) }
}
}
// ── PipeIter ──────────────────────────────────────────────────────────────────
/// Iterator over the output of `Pipe::apply()`.
pub struct PipeIter<Out> {
rx: Receiver<Out>,
handle: Option<thread::JoinHandle<()>>,
}
impl<Out> Iterator for PipeIter<Out> {
type Item = Out;
fn next(&mut self) -> Option<Out> {
self.rx.recv().ok()
}
}
impl<Out> Drop for PipeIter<Out> {
fn drop(&mut self) {
// Drain buffered items so the scheduler can unblock if the channel is full.
while self.rx.try_recv().is_ok() {}
if let Some(h) = self.handle.take() {
let _ = h.join();
}
}
}
/// Envoie `data` au stage `stage_idx`.
/// Pour un `Transform`, empile une `WorkerTask::Transform`.
/// Pour un `Flat`, incrémente `flat_workers_active` et empile une `WorkerTask::Flat`.
#[inline]
fn dispatch<DATA>(
data: DATA,
stage_idx: usize,
stages: &[Stage<DATA>],
worker_tx: &Sender<WorkerTask<DATA>>,
flat_workers_active: &mut usize,
) {
match &stages[stage_idx] {
Stage::Transform(_) => {
let _ = worker_tx.send(WorkerTask::Transform(data, stage_idx));
}
Stage::Flat(_) => {
*flat_workers_active += 1;
let _ = worker_tx.send(WorkerTask::Flat(data, stage_idx));
}
}
}
// ── Macros ────────────────────────────────────────────────────────────────────
/// Creates a `SourceFn` from an iterator of plain values.
#[macro_export]
macro_rules! make_source {
($enum:ident, $iterator:expr, $output:ident) => {{
let mut iter = $iterator.into_iter();
Box::new(
move || -> ::std::result::Result<$enum, $crate::PipelineError> {
match iter.next() {
Some(x) => Ok($enum::$output(x)),
None => Err($crate::PipelineError::EndOfStream),
}
},
)
as Box<dyn FnMut() -> ::std::result::Result<$enum, $crate::PipelineError> + Send>
}};
}
/// Creates a `SourceFn` from an iterator of `Result<T, E>`.
#[macro_export]
macro_rules! make_source_fallible {
($enum:ident, $iterator:expr, $output:ident) => {{
let mut iter = $iterator.into_iter();
Box::new(
move || -> ::std::result::Result<$enum, $crate::PipelineError> {
match iter.next() {
Some(Ok(x)) => Ok($enum::$output(x)),
Some(Err(e)) => Err($crate::PipelineError::StepError(Box::new(e))),
None => Err($crate::PipelineError::EndOfStream),
}
},
)
as Box<dyn FnMut() -> ::std::result::Result<$enum, $crate::PipelineError> + Send>
}};
}
/// Creates a `Stage::Transform` from a pure (non-fallible) function `Fn(T) -> U`.
#[macro_export]
macro_rules! make_transform {
($enum:ident, $func:tt, $input:ident, $output:ident) => {{
let __f = $func;
$crate::Stage::Transform(
::std::sync::Arc::from(Box::new(
move |data: $enum| -> ::std::result::Result<$enum, $crate::PipelineError> {
match data {
$enum::$input(x) => Ok($enum::$output(__f(x))),
_ => Err($crate::PipelineError::TypeMismatch),
}
},
)
as Box<
dyn Fn($enum) -> ::std::result::Result<$enum, $crate::PipelineError>
+ Send
+ Sync,
>)
)
}};
}
/// Creates a `Stage::Transform` from a fallible function `Fn(T) -> Result<U, E>`.
#[macro_export]
macro_rules! make_transform_fallible {
($enum:ident, $func:tt, $input:ident, $output:ident) => {{
let __f = $func;
$crate::Stage::Transform(
::std::sync::Arc::from(Box::new(
move |data: $enum| -> ::std::result::Result<$enum, $crate::PipelineError> {
match data {
$enum::$input(inner) => {
let result = __f(inner)
.map_err(|e| $crate::PipelineError::StepError(Box::new(e)))?;
Ok($enum::$output(result))
}
_ => Err($crate::PipelineError::TypeMismatch),
}
},
)
as Box<
dyn Fn($enum) -> ::std::result::Result<$enum, $crate::PipelineError>
+ Send
+ Sync,
>)
)
}};
}
/// Creates a `Stage::Flat` from a function `Fn(T) -> impl IntoIterator<Item = U>`.
///
/// Pour chaque item produit par l'itérateur, il est poussé individuellement dans
/// le canal de sortie, permettant au scheduler de dispatcher les items en parallèle
/// dès qu'un worker est disponible.
#[macro_export]
macro_rules! make_flat_transform {
($enum:ident, $func:tt, $input:ident, $output:ident) => {{
let __f = $func;
$crate::Stage::Flat(
::std::sync::Arc::new(
move |data: $enum,
push: &$crate::PipelineSender<
::std::result::Result<$enum, $crate::PipelineError>,
>,
delta: &$crate::PipelineSender<isize>| {
match data {
$enum::$input(inner) => {
let mut count: isize = 0;
for item in __f(inner) {
push.send(Ok($enum::$output(item))).ok();
count += 1;
}
delta.send(count - 1).ok();
}
_ => {
push.send(Err($crate::PipelineError::TypeMismatch)).ok();
delta.send(0).ok();
}
}
},
) as $crate::SharedFlatFn<$enum>
)
}};
}
/// Creates a `Stage::Flat` from a fallible function
/// `Fn(T) -> Result<impl IntoIterator<Item = U>, E>`.
///
/// Si la fonction retourne `Err`, une erreur est poussée dans le canal et aucun
/// item normal n'est produit.
#[macro_export]
macro_rules! make_flat_transform_fallible {
($enum:ident, $func:tt, $input:ident, $output:ident) => {{
let __f = $func;
$crate::Stage::Flat(
::std::sync::Arc::new(
move |data: $enum,
push: &$crate::PipelineSender<
::std::result::Result<$enum, $crate::PipelineError>,
>,
delta: &$crate::PipelineSender<isize>| {
match data {
$enum::$input(inner) => match __f(inner) {
Ok(iter) => {
let mut count: isize = 0;
for item in iter {
push.send(Ok($enum::$output(item))).ok();
count += 1;
}
delta.send(count - 1).ok();
}
Err(e) => {
push.send(Err($crate::PipelineError::StepError(Box::new(e))))
.ok();
delta.send(0).ok();
}
},
_ => {
push.send(Err($crate::PipelineError::TypeMismatch)).ok();
delta.send(0).ok();
}
}
},
) as $crate::SharedFlatFn<$enum>
)
}};
}
/// Creates a `SinkFn` from a function that consumes a concrete value and returns `()`.
#[macro_export]
macro_rules! make_sink {
($enum:ident, $func:tt, $input:ident) => {{
let __f = $func;
Box::new(
move |data: $enum| -> ::std::result::Result<(), $crate::PipelineError> {
match data {
$enum::$input(x) => {
__f(x);
Ok(())
}
_ => Err($crate::PipelineError::TypeMismatch),
}
},
)
as Box<dyn Fn($enum) -> ::std::result::Result<(), $crate::PipelineError> + Send>
}};
}
/// Creates a `SinkFn` from a fallible function that returns `Result<(), E>`.
#[macro_export]
macro_rules! make_sink_fallible {
($enum:ident, $func:tt, $input:ident) => {{
let __f = $func;
Box::new(
move |data: $enum| -> ::std::result::Result<(), $crate::PipelineError> {
match data {
$enum::$input(inner) => {
__f(inner).map_err(|e| $crate::PipelineError::StepError(Box::new(e)))
}
_ => Err($crate::PipelineError::TypeMismatch),
}
},
)
as Box<dyn Fn($enum) -> ::std::result::Result<(), $crate::PipelineError> + Send>
}};
}
/// Construit un `Pipeline` à partir d'une source, d'une liste de stages et d'un sink.
///
/// Syntaxe :
/// ```ignore
/// make_pipeline! {
/// MyData,
/// source my_iter => Variant, // source non-fallible
/// source? my_iter => Variant, // source fallible (Result<T, E>)
/// | func: In => Out, // transform 1→1 non-fallible
/// |? func: In => Out, // transform 1→1 fallible
/// || func: In => Out, // flat transform 1→N non-fallible
/// ||? func: In => Out, // flat transform 1→N fallible
/// sink my_func @ Variant, // sink non-fallible
/// sink? my_func @ Variant, // sink fallible
/// }
/// ```
#[macro_export]
macro_rules! make_pipeline {
// ── Points d'entrée ──────────────────────────────────────────────────
($enum:ident, source $src:expr => $src_out:ident, $($rest:tt)*) => {
$crate::make_pipeline!(@build $enum,
{ $crate::make_source!($enum, $src, $src_out) },
[],
$($rest)*)
};
($enum:ident, source? $src:expr => $src_out:ident, $($rest:tt)*) => {
$crate::make_pipeline!(@build $enum,
{ $crate::make_source_fallible!($enum, $src, $src_out) },
[],
$($rest)*)
};
// ── Accumulation des stages ──────────────────────────────────────────
// transform 1→1 non-fallible
(@build $enum:ident, $source:tt, [$($acc:tt)*],
| $tf:tt : $t_in:ident => $t_out:ident, $($rest:tt)*) => {
$crate::make_pipeline!(@build $enum, $source,
[$($acc)* $crate::make_transform!($enum, $tf, $t_in, $t_out),],
$($rest)*)
};
// transform 1→1 fallible
(@build $enum:ident, $source:tt, [$($acc:tt)*],
|? $tf:tt : $t_in:ident => $t_out:ident, $($rest:tt)*) => {
$crate::make_pipeline!(@build $enum, $source,
[$($acc)* $crate::make_transform_fallible!($enum, $tf, $t_in, $t_out),],
$($rest)*)
};
// flat transform 1→N non-fallible
(@build $enum:ident, $source:tt, [$($acc:tt)*],
|| $tf:tt : $t_in:ident => $t_out:ident, $($rest:tt)*) => {
$crate::make_pipeline!(@build $enum, $source,
[$($acc)* $crate::make_flat_transform!($enum, $tf, $t_in, $t_out),],
$($rest)*)
};
// flat transform 1→N fallible
(@build $enum:ident, $source:tt, [$($acc:tt)*],
||? $tf:tt : $t_in:ident => $t_out:ident, $($rest:tt)*) => {
$crate::make_pipeline!(@build $enum, $source,
[$($acc)* $crate::make_flat_transform_fallible!($enum, $tf, $t_in, $t_out),],
$($rest)*)
};
// ── Terminaison : sink ───────────────────────────────────────────────
(@build $enum:ident, $source:tt, [$($acc:tt)*],
sink $sink_fn:tt @ $sink_in:ident $(,)?) => {
$crate::Pipeline::new(
$source,
vec![$($acc)*],
$crate::make_sink!($enum, $sink_fn, $sink_in),
)
};
(@build $enum:ident, $source:tt, [$($acc:tt)*],
sink? $sink_fn:tt @ $sink_in:ident $(,)?) => {
$crate::Pipeline::new(
$source,
vec![$($acc)*],
$crate::make_sink_fallible!($enum, $sink_fn, $sink_in),
)
};
}
/// Builds a typed `Pipe<D, In, Out>` — sourceless and sinkless.
///
/// Syntax:
/// ```ignore
/// make_pipe! {
/// MyData : InType => OutType,
/// | func : InVariant => OutVariant, // transform 1→1
/// |? func : InVariant => OutVariant, // transform 1→1 fallible
/// || func : InVariant => OutVariant, // flat transform 1→N
/// ||? func : InVariant => OutVariant, // flat transform 1→N fallible
/// }
/// ```
#[macro_export]
macro_rules! make_pipe {
// ── Entry: first stage | ─────────────────────────────────────────────
($enum:ident : $in_ty:ty => $out_ty:ty,
| $tf:tt : $fi:ident => $fo:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$crate::make_transform!($enum, $tf, $fi, $fo),], $fo, $($rest)*)
};
// ── Entry: first stage |? ────────────────────────────────────────────
($enum:ident : $in_ty:ty => $out_ty:ty,
|? $tf:tt : $fi:ident => $fo:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$crate::make_transform_fallible!($enum, $tf, $fi, $fo),], $fo, $($rest)*)
};
// ── Entry: first stage || ────────────────────────────────────────────
($enum:ident : $in_ty:ty => $out_ty:ty,
|| $tf:tt : $fi:ident => $fo:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$crate::make_flat_transform!($enum, $tf, $fi, $fo),], $fo, $($rest)*)
};
// ── Entry: first stage ||? ───────────────────────────────────────────
($enum:ident : $in_ty:ty => $out_ty:ty,
||? $tf:tt : $fi:ident => $fo:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$crate::make_flat_transform_fallible!($enum, $tf, $fi, $fo),], $fo, $($rest)*)
};
// ── Accumulation: | ──────────────────────────────────────────────────
(@build $enum:ident : $in_ty:ty => $out_ty:ty, $fi:ident,
[$($acc:tt)*], $lo:ident,
| $tf:tt : $ti:ident => $to:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$($acc)* $crate::make_transform!($enum, $tf, $ti, $to),], $to, $($rest)*)
};
// ── Accumulation: |? ─────────────────────────────────────────────────
(@build $enum:ident : $in_ty:ty => $out_ty:ty, $fi:ident,
[$($acc:tt)*], $lo:ident,
|? $tf:tt : $ti:ident => $to:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$($acc)* $crate::make_transform_fallible!($enum, $tf, $ti, $to),], $to, $($rest)*)
};
// ── Accumulation: || ─────────────────────────────────────────────────
(@build $enum:ident : $in_ty:ty => $out_ty:ty, $fi:ident,
[$($acc:tt)*], $lo:ident,
|| $tf:tt : $ti:ident => $to:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$($acc)* $crate::make_flat_transform!($enum, $tf, $ti, $to),], $to, $($rest)*)
};
// ── Accumulation: ||? ────────────────────────────────────────────────
(@build $enum:ident : $in_ty:ty => $out_ty:ty, $fi:ident,
[$($acc:tt)*], $lo:ident,
||? $tf:tt : $ti:ident => $to:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$($acc)* $crate::make_flat_transform_fallible!($enum, $tf, $ti, $to),], $to, $($rest)*)
};
// ── Termination ───────────────────────────────────────────────────────
(@build $enum:ident : $in_ty:ty => $out_ty:ty, $fi:ident,
[$($acc:tt)*], $lo:ident $(,)?) => {
$crate::Pipe::new(
vec![$($acc)*],
::std::sync::Arc::new(|x: $in_ty| $enum::$fi(x)),
::std::sync::Arc::new(|d: $enum| -> $out_ty {
if let $enum::$lo(x) = d { x }
else { ::std::unreachable!("unexpected pipeline data variant in make_pipe!") }
}),
)
};
}
+35
View File
@@ -0,0 +1,35 @@
use std::error::Error;
use std::fmt;
/// Error type for pipeline operations.
#[derive(Debug)]
pub enum PipelineError {
/// A stage received a `PipelineData` variant it did not expect.
TypeMismatch,
/// The step kind is not compatible with the data type.
StepKindMismatch(&'static str),
/// The source has no more data to produce.
EndOfStream,
/// An error occurred inside a stage (e.g., I/O, parsing, custom logic).
StepError(Box<dyn Error + Send + Sync>),
}
impl fmt::Display for PipelineError {
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
match self {
PipelineError::TypeMismatch => write!(f, "data type mismatch in pipeline stage"),
PipelineError::StepKindMismatch(s) => write!(f, "step kind mismatch: {}", s),
PipelineError::EndOfStream => write!(f, "end of input stream"),
PipelineError::StepError(e) => write!(f, "stage error: {}", e),
}
}
}
impl Error for PipelineError {
fn source(&self) -> Option<&(dyn Error + 'static)> {
match self {
PipelineError::StepError(e) => Some(e.as_ref()),
_ => None,
}
}
}
+373
View File
@@ -0,0 +1,373 @@
// ── Macros ────────────────────────────────────────────────────────────────────
/// Creates a `SourceFn` from an iterator of plain values.
#[macro_export]
macro_rules! make_source {
($enum:ident, $iterator:expr, $output:ident) => {{
let mut iter = $iterator.into_iter();
Box::new(
move || -> ::std::result::Result<$enum, $crate::PipelineError> {
match iter.next() {
Some(x) => Ok($enum::$output(x)),
None => Err($crate::PipelineError::EndOfStream),
}
},
)
as Box<dyn FnMut() -> ::std::result::Result<$enum, $crate::PipelineError> + Send>
}};
}
/// Creates a `SourceFn` from an iterator of `Result<T, E>`.
#[macro_export]
macro_rules! make_source_fallible {
($enum:ident, $iterator:expr, $output:ident) => {{
let mut iter = $iterator.into_iter();
Box::new(
move || -> ::std::result::Result<$enum, $crate::PipelineError> {
match iter.next() {
Some(Ok(x)) => Ok($enum::$output(x)),
Some(Err(e)) => Err($crate::PipelineError::StepError(Box::new(e))),
None => Err($crate::PipelineError::EndOfStream),
}
},
)
as Box<dyn FnMut() -> ::std::result::Result<$enum, $crate::PipelineError> + Send>
}};
}
/// Creates a `Stage::Transform` from a pure (non-fallible) function `Fn(T) -> U`.
#[macro_export]
macro_rules! make_transform {
($enum:ident, $func:tt, $input:ident, $output:ident) => {{
let __f = $func;
$crate::Stage::Transform(
::std::sync::Arc::from(Box::new(
move |data: $enum| -> ::std::result::Result<$enum, $crate::PipelineError> {
match data {
$enum::$input(x) => Ok($enum::$output(__f(x))),
_ => Err($crate::PipelineError::TypeMismatch),
}
},
)
as Box<
dyn Fn($enum) -> ::std::result::Result<$enum, $crate::PipelineError>
+ Send
+ Sync,
>)
)
}};
}
/// Creates a `Stage::Transform` from a fallible function `Fn(T) -> Result<U, E>`.
#[macro_export]
macro_rules! make_transform_fallible {
($enum:ident, $func:tt, $input:ident, $output:ident) => {{
let __f = $func;
$crate::Stage::Transform(
::std::sync::Arc::from(Box::new(
move |data: $enum| -> ::std::result::Result<$enum, $crate::PipelineError> {
match data {
$enum::$input(inner) => {
let result = __f(inner)
.map_err(|e| $crate::PipelineError::StepError(Box::new(e)))?;
Ok($enum::$output(result))
}
_ => Err($crate::PipelineError::TypeMismatch),
}
},
)
as Box<
dyn Fn($enum) -> ::std::result::Result<$enum, $crate::PipelineError>
+ Send
+ Sync,
>)
)
}};
}
/// Creates a `Stage::Flat` from a function `Fn(T) -> impl IntoIterator<Item = U>`.
///
/// Pour chaque item produit par l'itérateur, il est poussé individuellement dans
/// le canal de sortie, permettant au scheduler de dispatcher les items en parallèle
/// dès qu'un worker est disponible.
#[macro_export]
macro_rules! make_flat_transform {
($enum:ident, $func:tt, $input:ident, $output:ident) => {{
let __f = $func;
$crate::Stage::Flat(
::std::sync::Arc::new(
move |data: $enum,
push: &$crate::PipelineSender<
::std::result::Result<$enum, $crate::PipelineError>,
>,
delta: &$crate::PipelineSender<isize>| {
match data {
$enum::$input(inner) => {
let mut count: isize = 0;
for item in __f(inner) {
push.send(Ok($enum::$output(item))).ok();
count += 1;
}
delta.send(count - 1).ok();
}
_ => {
push.send(Err($crate::PipelineError::TypeMismatch)).ok();
delta.send(0).ok();
}
}
},
) as $crate::SharedFlatFn<$enum>
)
}};
}
/// Creates a `Stage::Flat` from a fallible function
/// `Fn(T) -> Result<impl IntoIterator<Item = U>, E>`.
///
/// Si la fonction retourne `Err`, une erreur est poussée dans le canal et aucun
/// item normal n'est produit.
#[macro_export]
macro_rules! make_flat_transform_fallible {
($enum:ident, $func:tt, $input:ident, $output:ident) => {{
let __f = $func;
$crate::Stage::Flat(
::std::sync::Arc::new(
move |data: $enum,
push: &$crate::PipelineSender<
::std::result::Result<$enum, $crate::PipelineError>,
>,
delta: &$crate::PipelineSender<isize>| {
match data {
$enum::$input(inner) => match __f(inner) {
Ok(iter) => {
let mut count: isize = 0;
for item in iter {
push.send(Ok($enum::$output(item))).ok();
count += 1;
}
delta.send(count - 1).ok();
}
Err(e) => {
push.send(Err($crate::PipelineError::StepError(Box::new(e))))
.ok();
delta.send(0).ok();
}
},
_ => {
push.send(Err($crate::PipelineError::TypeMismatch)).ok();
delta.send(0).ok();
}
}
},
) as $crate::SharedFlatFn<$enum>
)
}};
}
/// Creates a `SinkFn` from a function that consumes a concrete value and returns `()`.
#[macro_export]
macro_rules! make_sink {
($enum:ident, $func:tt, $input:ident) => {{
let __f = $func;
Box::new(
move |data: $enum| -> ::std::result::Result<(), $crate::PipelineError> {
match data {
$enum::$input(x) => {
__f(x);
Ok(())
}
_ => Err($crate::PipelineError::TypeMismatch),
}
},
)
as Box<dyn Fn($enum) -> ::std::result::Result<(), $crate::PipelineError> + Send>
}};
}
/// Creates a `SinkFn` from a fallible function that returns `Result<(), E>`.
#[macro_export]
macro_rules! make_sink_fallible {
($enum:ident, $func:tt, $input:ident) => {{
let __f = $func;
Box::new(
move |data: $enum| -> ::std::result::Result<(), $crate::PipelineError> {
match data {
$enum::$input(inner) => {
__f(inner).map_err(|e| $crate::PipelineError::StepError(Box::new(e)))
}
_ => Err($crate::PipelineError::TypeMismatch),
}
},
)
as Box<dyn Fn($enum) -> ::std::result::Result<(), $crate::PipelineError> + Send>
}};
}
/// Construit un `Pipeline` à partir d'une source, d'une liste de stages et d'un sink.
///
/// Syntaxe :
/// ```ignore
/// make_pipeline! {
/// MyData,
/// source my_iter => Variant, // source non-fallible
/// source? my_iter => Variant, // source fallible (Result<T, E>)
/// | func: In => Out, // transform 1→1 non-fallible
/// |? func: In => Out, // transform 1→1 fallible
/// || func: In => Out, // flat transform 1→N non-fallible
/// ||? func: In => Out, // flat transform 1→N fallible
/// sink my_func @ Variant, // sink non-fallible
/// sink? my_func @ Variant, // sink fallible
/// }
/// ```
#[macro_export]
macro_rules! make_pipeline {
// ── Points d'entrée ──────────────────────────────────────────────────
($enum:ident, source $src:expr => $src_out:ident, $($rest:tt)*) => {
$crate::make_pipeline!(@build $enum,
{ $crate::make_source!($enum, $src, $src_out) },
[],
$($rest)*)
};
($enum:ident, source? $src:expr => $src_out:ident, $($rest:tt)*) => {
$crate::make_pipeline!(@build $enum,
{ $crate::make_source_fallible!($enum, $src, $src_out) },
[],
$($rest)*)
};
// ── Accumulation des stages ──────────────────────────────────────────
// transform 1→1 non-fallible
(@build $enum:ident, $source:tt, [$($acc:tt)*],
| $tf:tt : $t_in:ident => $t_out:ident, $($rest:tt)*) => {
$crate::make_pipeline!(@build $enum, $source,
[$($acc)* $crate::make_transform!($enum, $tf, $t_in, $t_out),],
$($rest)*)
};
// transform 1→1 fallible
(@build $enum:ident, $source:tt, [$($acc:tt)*],
|? $tf:tt : $t_in:ident => $t_out:ident, $($rest:tt)*) => {
$crate::make_pipeline!(@build $enum, $source,
[$($acc)* $crate::make_transform_fallible!($enum, $tf, $t_in, $t_out),],
$($rest)*)
};
// flat transform 1→N non-fallible
(@build $enum:ident, $source:tt, [$($acc:tt)*],
|| $tf:tt : $t_in:ident => $t_out:ident, $($rest:tt)*) => {
$crate::make_pipeline!(@build $enum, $source,
[$($acc)* $crate::make_flat_transform!($enum, $tf, $t_in, $t_out),],
$($rest)*)
};
// flat transform 1→N fallible
(@build $enum:ident, $source:tt, [$($acc:tt)*],
||? $tf:tt : $t_in:ident => $t_out:ident, $($rest:tt)*) => {
$crate::make_pipeline!(@build $enum, $source,
[$($acc)* $crate::make_flat_transform_fallible!($enum, $tf, $t_in, $t_out),],
$($rest)*)
};
// ── Terminaison : sink ───────────────────────────────────────────────
(@build $enum:ident, $source:tt, [$($acc:tt)*],
sink $sink_fn:tt @ $sink_in:ident $(,)?) => {
$crate::Pipeline::new(
$source,
vec![$($acc)*],
$crate::make_sink!($enum, $sink_fn, $sink_in),
)
};
(@build $enum:ident, $source:tt, [$($acc:tt)*],
sink? $sink_fn:tt @ $sink_in:ident $(,)?) => {
$crate::Pipeline::new(
$source,
vec![$($acc)*],
$crate::make_sink_fallible!($enum, $sink_fn, $sink_in),
)
};
}
/// Builds a typed `Pipe<D, In, Out>` — sourceless and sinkless.
///
/// Syntax:
/// ```ignore
/// make_pipe! {
/// MyData : InType => OutType,
/// | func : InVariant => OutVariant, // transform 1→1
/// |? func : InVariant => OutVariant, // transform 1→1 fallible
/// || func : InVariant => OutVariant, // flat transform 1→N
/// ||? func : InVariant => OutVariant, // flat transform 1→N fallible
/// }
/// ```
#[macro_export]
macro_rules! make_pipe {
// ── Entry: first stage | ─────────────────────────────────────────────
($enum:ident : $in_ty:ty => $out_ty:ty,
| $tf:tt : $fi:ident => $fo:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$crate::make_transform!($enum, $tf, $fi, $fo),], $fo, $($rest)*)
};
// ── Entry: first stage |? ────────────────────────────────────────────
($enum:ident : $in_ty:ty => $out_ty:ty,
|? $tf:tt : $fi:ident => $fo:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$crate::make_transform_fallible!($enum, $tf, $fi, $fo),], $fo, $($rest)*)
};
// ── Entry: first stage || ────────────────────────────────────────────
($enum:ident : $in_ty:ty => $out_ty:ty,
|| $tf:tt : $fi:ident => $fo:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$crate::make_flat_transform!($enum, $tf, $fi, $fo),], $fo, $($rest)*)
};
// ── Entry: first stage ||? ───────────────────────────────────────────
($enum:ident : $in_ty:ty => $out_ty:ty,
||? $tf:tt : $fi:ident => $fo:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$crate::make_flat_transform_fallible!($enum, $tf, $fi, $fo),], $fo, $($rest)*)
};
// ── Accumulation: | ──────────────────────────────────────────────────
(@build $enum:ident : $in_ty:ty => $out_ty:ty, $fi:ident,
[$($acc:tt)*], $lo:ident,
| $tf:tt : $ti:ident => $to:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$($acc)* $crate::make_transform!($enum, $tf, $ti, $to),], $to, $($rest)*)
};
// ── Accumulation: |? ─────────────────────────────────────────────────
(@build $enum:ident : $in_ty:ty => $out_ty:ty, $fi:ident,
[$($acc:tt)*], $lo:ident,
|? $tf:tt : $ti:ident => $to:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$($acc)* $crate::make_transform_fallible!($enum, $tf, $ti, $to),], $to, $($rest)*)
};
// ── Accumulation: || ─────────────────────────────────────────────────
(@build $enum:ident : $in_ty:ty => $out_ty:ty, $fi:ident,
[$($acc:tt)*], $lo:ident,
|| $tf:tt : $ti:ident => $to:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$($acc)* $crate::make_flat_transform!($enum, $tf, $ti, $to),], $to, $($rest)*)
};
// ── Accumulation: ||? ────────────────────────────────────────────────
(@build $enum:ident : $in_ty:ty => $out_ty:ty, $fi:ident,
[$($acc:tt)*], $lo:ident,
||? $tf:tt : $ti:ident => $to:ident, $($rest:tt)*) => {
$crate::make_pipe!(@build $enum : $in_ty => $out_ty, $fi,
[$($acc)* $crate::make_flat_transform_fallible!($enum, $tf, $ti, $to),], $to, $($rest)*)
};
// ── Termination ───────────────────────────────────────────────────────
(@build $enum:ident : $in_ty:ty => $out_ty:ty, $fi:ident,
[$($acc:tt)*], $lo:ident $(,)?) => {
$crate::Pipe::new(
vec![$($acc)*],
::std::sync::Arc::new(|x: $in_ty| $enum::$fi(x)),
::std::sync::Arc::new(|d: $enum| -> $out_ty {
if let $enum::$lo(x) = d { x }
else { ::std::unreachable!("unexpected pipeline data variant in make_pipe!") }
}),
)
};
}
+19
View File
@@ -0,0 +1,19 @@
//! Scheduler: a channel/thread-based pipeline runtime with typed, composable
//! stages (`Pipe`), plus the macro-based `PipelineData`-enum runtime it grew
//! out of (`Pipeline`/`WorkerPool`).
//!
//! Submodules: [`error`] (`PipelineError`), [`types`] (function types, `Stage`),
//! [`runner`] (thread bodies), [`pool`] (`Pipeline`/`WorkerPool` scheduler
//! loop), [`pipe`] (`Pipe`/`PipeIter`), [`macros`] (`make_pipe!` and friends).
mod error;
mod macros;
mod pipe;
mod pool;
mod runner;
mod types;
pub use error::PipelineError;
pub use pipe::{Pipe, PipeIter};
pub use pool::{Pipeline, WorkerPool};
pub use types::{SharedFlatFn, SharedFn, SinkFn, SourceFn, Stage};
+117
View File
@@ -0,0 +1,117 @@
use crossbeam_channel::{Receiver, bounded};
use std::marker::PhantomData;
use std::sync::Arc;
use std::thread;
use super::error::PipelineError;
use super::pool::{Pipeline, WorkerPool};
use super::types::{SinkFn, SourceFn, Stage};
// ── Pipe ──────────────────────────────────────────────────────────────────────
/// Typed, composable iterator transformer.
///
/// A `Pipe<D, In, Out>` is a pure description of pipeline stages — no threads,
/// no channels, no scheduler. Call `.apply(iter, n_workers, capacity)` to start
/// execution and get back a `PipeIter<Out>`.
///
/// Compose two pipes with `.then()`: the resulting `Pipe` holds the concatenated
/// stage list, so a single scheduler is created when `.apply()` is eventually called.
pub struct Pipe<D, In, Out> {
stages: Vec<Stage<D>>,
wrap: Arc<dyn Fn(In) -> D + Send + Sync>,
unwrap: Arc<dyn Fn(D) -> Out + Send + Sync>,
_phantom: PhantomData<(In, Out)>,
}
impl<D, In, Out> Pipe<D, In, Out> {
/// Build a `Pipe` from stages and wrap/unwrap converters.
/// Prefer the `make_pipe!` macro.
pub fn new(
stages: Vec<Stage<D>>,
wrap: Arc<dyn Fn(In) -> D + Send + Sync>,
unwrap: Arc<dyn Fn(D) -> Out + Send + Sync>,
) -> Self {
Self { stages, wrap, unwrap, _phantom: PhantomData }
}
/// Concatenate stages from two pipes into one.
///
/// Requires `Out` of `self` == `In` of `other`. The single scheduler
/// created at `.apply()` time sees the full combined stage list.
pub fn then<Next>(self, other: Pipe<D, Out, Next>) -> Pipe<D, In, Next> {
Pipe {
stages: self.stages.into_iter().chain(other.stages).collect(),
wrap: self.wrap,
unwrap: other.unwrap,
_phantom: PhantomData,
}
}
}
impl<D, In, Out> Pipe<D, In, Out>
where
D: Send + Sync + 'static,
In: Send + 'static,
Out: Send + 'static,
{
/// Run the pipeline in a background thread; returns an iterator over the output.
pub fn apply(
self,
input: impl Iterator<Item = In> + Send + 'static,
n_workers: usize,
capacity: usize,
) -> PipeIter<Out> {
let wrap = Arc::clone(&self.wrap);
let unwrap = Arc::clone(&self.unwrap);
let mut iter = input;
let source: SourceFn<D> = Box::new(move || match iter.next() {
Some(x) => Ok(wrap(x)),
None => Err(PipelineError::EndOfStream),
});
let (out_tx, out_rx) = bounded::<Out>(capacity);
let sink: SinkFn<D> = Box::new(move |data: D| {
out_tx.send(unwrap(data)).map_err(|_| {
PipelineError::StepError(Box::new(std::io::Error::new(
std::io::ErrorKind::BrokenPipe,
"output channel closed",
)))
})
});
let pipeline = Pipeline::new(source, self.stages, sink);
let handle = thread::spawn(move || {
WorkerPool::new(pipeline, n_workers, capacity).run();
});
PipeIter { rx: out_rx, handle: Some(handle) }
}
}
// ── PipeIter ──────────────────────────────────────────────────────────────────
/// Iterator over the output of `Pipe::apply()`.
pub struct PipeIter<Out> {
rx: Receiver<Out>,
handle: Option<thread::JoinHandle<()>>,
}
impl<Out> Iterator for PipeIter<Out> {
type Item = Out;
fn next(&mut self) -> Option<Out> {
self.rx.recv().ok()
}
}
impl<Out> Drop for PipeIter<Out> {
fn drop(&mut self) {
// Drain buffered items so the scheduler can unblock if the channel is full.
while self.rx.try_recv().is_ok() {}
if let Some(h) = self.handle.take() {
let _ = h.join();
}
}
}
+203
View File
@@ -0,0 +1,203 @@
use crossbeam_channel::{Receiver, Select, Sender, bounded};
use super::error::PipelineError;
use super::runner::{dispatch, sink_runner, source_runner, transform_runner};
use super::types::{SinkFn, SourceFn, Stage, WorkerTask};
// ── Pipeline ──────────────────────────────────────────────────────────────────
pub struct Pipeline<DATA> {
source: SourceFn<DATA>,
stages: Vec<Stage<DATA>>,
sink: SinkFn<DATA>,
}
impl<DATA> Pipeline<DATA> {
pub fn new(
source: SourceFn<DATA>,
stages: Vec<Stage<DATA>>,
sink: SinkFn<DATA>,
) -> Self {
Self { source, stages, sink }
}
}
// ── WorkerPool ────────────────────────────────────────────────────────────────
pub struct WorkerPool<DATA> {
pipeline: Pipeline<DATA>,
handles: Vec<std::thread::JoinHandle<()>>,
n_workers: usize,
capacity: usize,
}
impl<DATA> WorkerPool<DATA>
where
DATA: Send + Sync + 'static,
{
pub fn new(pipeline: Pipeline<DATA>, n_workers: usize, capacity: usize) -> Self {
Self {
pipeline,
handles: Vec::new(),
n_workers,
capacity,
}
}
pub fn run(mut self) {
let n = self.pipeline.stages.len();
// ── Canaux inter-stages ────────────────────────────────────────────
// stage_txs[i] / stage_rxs[i] : sortie du stage i
let mut stage_txs: Vec<Sender<Result<DATA, PipelineError>>> = Vec::new();
let mut stage_rxs: Vec<Receiver<Result<DATA, PipelineError>>> = Vec::new();
for _ in 0..n {
let (tx, rx) = bounded(self.capacity);
stage_txs.push(tx);
stage_rxs.push(rx);
}
// ── Source thread ──────────────────────────────────────────────────
let (source_rx, src_handle) = source_runner(self.pipeline.source, self.capacity);
self.handles.push(src_handle);
let stages = self.pipeline.stages;
// ── Canal delta pour les flat stages ───────────────────────────────
// Chaque flat worker envoie `N-1` ici après avoir poussé N items.
// Le scheduler ajuste `in_flight` en conséquence.
let (flat_delta_tx, flat_delta_rx) = bounded::<isize>(self.capacity);
// ── Worker pool ────────────────────────────────────────────────────
let (worker_tx, worker_rx): (Sender<WorkerTask<DATA>>, Receiver<WorkerTask<DATA>>) =
bounded(self.capacity);
for _ in 0..self.n_workers {
self.handles.push(transform_runner(
worker_rx.clone(),
stages.iter().map(Stage::clone).collect(),
stage_txs.clone(),
flat_delta_tx.clone(),
));
}
// Le scheduler ne tient plus flat_delta_tx : les workers le détiennent.
// On le drop ici pour que le canal se ferme quand les workers terminent.
drop(flat_delta_tx);
// ── Sink thread ────────────────────────────────────────────────────
let (sink_tx, sink_err_rx, sink_handle) = sink_runner(self.pipeline.sink, self.capacity);
self.handles.push(sink_handle);
// ── Boucle principale ──────────────────────────────────────────────
//
// `in_flight` (isize) = nb d'items qui doivent encore atteindre le sink.
// Peut temporairement être négatif si un flat worker a poussé ses items
// avant que le scheduler ait reçu le delta correspondant.
//
// `flat_workers_active` = nb de flat workers en cours d'exécution.
// Empêche la terminaison prématurée quand in_flight vaut 0 mais qu'un
// flat worker n'a pas encore envoyé son delta.
//
// Priorités du Select biaisé (index le plus bas = priorité la plus haute) :
// 0 → sink_err_rx (arrêt immédiat sur erreur sink)
// 1 → flat_delta_rx (mettre à jour in_flight avant de dispatcher)
// 2..=n+1 → stage_rxs[n-1..0] (vider le pipeline en priorité)
// n+2 → source_rx (dernier recours : nouvelles données)
//
// Quand k = 0 : erreur du sink
// Quand k = 1 : delta d'un flat worker
// Quand 2 ≤ k ≤ n+1 : résultat du stage n+1-k
// Quand k = n+2 : item source
//
// Terminaison : source tarie ET in_flight == 0 ET aucun flat worker actif.
{
let mut source_done = false;
let mut in_flight: isize = 0;
let mut flat_workers_active: usize = 0;
loop {
if source_done && in_flight == 0 && flat_workers_active == 0 {
break;
}
let mut sel = Select::new_biased();
sel.recv(&sink_err_rx); // index 0
sel.recv(&flat_delta_rx); // index 1
for rx in stage_rxs.iter().rev() {
sel.recv(rx); // indices 2..=n+1
}
let src_idx = if !source_done {
Some(sel.recv(&source_rx)) // index n+2
} else {
None
};
let oper = sel.select();
let k = oper.index();
if k == 0 {
// ── Erreur du sink ────────────────────────────────────
match oper.recv(&sink_err_rx) {
Ok(e) => { eprintln!("Sink error: {:?}", e); break; }
Err(_) => break,
}
} else if k == 1 {
// ── Delta d'un flat worker ────────────────────────────
// delta = N - 1 (N items poussés, 1 item consommé)
match oper.recv(&flat_delta_rx) {
Ok(delta) => {
in_flight += delta;
flat_workers_active -= 1;
}
Err(_) => {}
}
} else if src_idx == Some(k) {
// ── Nouvel item depuis la source ──────────────────────
match oper.recv(&source_rx) {
Ok(Ok(data)) => {
if n == 0 {
let _ = sink_tx.send(data);
} else {
in_flight += 1;
dispatch(
data, 0,
&stages, &worker_tx,
&mut flat_workers_active,
);
}
}
Ok(Err(e)) => eprintln!("Source error: {:?}", e),
Err(_) => source_done = true,
}
} else {
// ── Résultat d'un stage intermédiaire ─────────────────
// k ∈ [2, n+1] → stage = n+1 - k
let stage = n + 1 - k;
match oper.recv(&stage_rxs[stage]) {
Ok(Ok(data)) => {
if stage == n - 1 {
in_flight -= 1;
let _ = sink_tx.send(data);
} else {
dispatch(
data, stage + 1,
&stages, &worker_tx,
&mut flat_workers_active,
);
}
}
Ok(Err(e)) => eprintln!("Stage {} error: {:?}", stage, e),
Err(_) => break,
}
}
}
}
drop(worker_tx);
drop(sink_tx);
for h in self.handles {
let _ = h.join();
}
}
}
+118
View File
@@ -0,0 +1,118 @@
use crossbeam_channel::{Receiver, Sender, bounded};
use std::thread;
use super::error::PipelineError;
use super::types::{SinkFn, SourceFn, Stage, WorkerTask};
// ── Thread runners ────────────────────────────────────────────────────────────
pub(super) fn source_runner<DATA>(
mut source: SourceFn<DATA>,
capacity: usize,
) -> (
Receiver<Result<DATA, PipelineError>>,
thread::JoinHandle<()>,
)
where
DATA: Send + Sync + 'static,
{
let (tx, rx) = bounded(capacity);
let handle = thread::spawn(move || {
loop {
match source() {
Ok(data) => {
if tx.send(Ok(data)).is_err() {
break;
}
}
Err(PipelineError::EndOfStream) => break,
Err(e) => {
eprintln!("Source error: {:?}", e);
let _ = tx.send(Err(e));
break;
}
}
}
});
(rx, handle)
}
/// Lance un thread worker du pool.
///
/// Gère deux types de tâches :
/// - `Transform` : applique `f(data)` et envoie le résultat dans `result_tx`.
/// - `Flat` : appelle `f(data, &push_tx, &delta_tx)` ; la fonction elle-même
/// pousse ses items dans `push_tx` et envoie `N-1` dans `delta_tx`.
pub(super) fn transform_runner<DATA>(
task_rx: Receiver<WorkerTask<DATA>>,
stages: Vec<Stage<DATA>>,
stage_txs: Vec<Sender<Result<DATA, PipelineError>>>,
flat_delta_tx: Sender<isize>,
) -> thread::JoinHandle<()>
where
DATA: Send + Sync + 'static,
{
thread::spawn(move || {
while let Ok(task) = task_rx.recv() {
match task {
WorkerTask::Transform(data, idx) => {
if let Stage::Transform(f) = &stages[idx] {
let _ = stage_txs[idx].send(f(data));
}
}
WorkerTask::Flat(data, idx) => {
if let Stage::Flat(f) = &stages[idx] {
f(data, &stage_txs[idx], &flat_delta_tx);
}
}
}
}
})
}
/// Lance le thread sink.
pub(super) fn sink_runner<DATA>(
sink: SinkFn<DATA>,
capacity: usize,
) -> (
Sender<DATA>,
Receiver<PipelineError>,
thread::JoinHandle<()>,
)
where
DATA: Send + Sync + 'static,
{
let (data_tx, data_rx) = bounded(capacity);
let (err_tx, err_rx) = bounded(capacity);
let handle = thread::spawn(move || {
for data in data_rx {
if let Err(e) = sink(data) {
let _ = err_tx.send(e);
break;
}
}
});
(data_tx, err_rx, handle)
}
/// Envoie `data` au stage `stage_idx`.
/// Pour un `Transform`, empile une `WorkerTask::Transform`.
/// Pour un `Flat`, incrémente `flat_workers_active` et empile une `WorkerTask::Flat`.
#[inline]
pub(super) fn dispatch<DATA>(
data: DATA,
stage_idx: usize,
stages: &[Stage<DATA>],
worker_tx: &Sender<WorkerTask<DATA>>,
flat_workers_active: &mut usize,
) {
match &stages[stage_idx] {
Stage::Transform(_) => {
let _ = worker_tx.send(WorkerTask::Transform(data, stage_idx));
}
Stage::Flat(_) => {
*flat_workers_active += 1;
let _ = worker_tx.send(WorkerTask::Flat(data, stage_idx));
}
}
}
+49
View File
@@ -0,0 +1,49 @@
use crossbeam_channel::Sender;
use std::sync::Arc;
use super::error::PipelineError;
// ── Function types ────────────────────────────────────────────────────────────
/// Fonction source : appelée répétitivement, retourne le prochain item ou EndOfStream.
/// `FnMut` car elle maintient un état interne (position dans l'itérateur).
pub type SourceFn<D> = Box<dyn FnMut() -> Result<D, PipelineError> + Send>;
/// Fonction sink : consomme un item final, peut échouer (erreur d'I/O, etc.).
pub type SinkFn<D> = Box<dyn Fn(D) -> Result<(), PipelineError> + Send>;
/// Fonction de transformation partagée entre workers via Arc.
pub type SharedFn<D> = Arc<dyn Fn(D) -> Result<D, PipelineError> + Send + Sync>;
/// Fonction de transformation 1→N (flat map) partagée entre workers via Arc.
///
/// La fonction reçoit l'item d'entrée, un canal `push` pour envoyer chaque item
/// produit, et un canal `delta` pour signaler au scheduler combien d'items
/// supplémentaires sont entrés dans le pipeline (N-1 si N items produits).
/// Elle doit appeler `delta.send(N - 1)` **après** avoir poussé tous les items.
pub type SharedFlatFn<D> =
Arc<dyn Fn(D, &Sender<Result<D, PipelineError>>, &Sender<isize>) + Send + Sync>;
// ── Stage enum ────────────────────────────────────────────────────────────────
/// Une étape du pipeline : transform classique (1→1) ou flat transform (1→N).
pub enum Stage<D> {
Transform(SharedFn<D>),
Flat(SharedFlatFn<D>),
}
impl<D> Clone for Stage<D> {
fn clone(&self) -> Self {
match self {
Stage::Transform(f) => Stage::Transform(Arc::clone(f)),
Stage::Flat(f) => Stage::Flat(Arc::clone(f)),
}
}
}
// ── Worker task ───────────────────────────────────────────────────────────────
pub(super) enum WorkerTask<D> {
Transform(D, usize),
Flat(D, usize),
}
-733
View File
@@ -1,733 +0,0 @@
use std::io::{self, Read};
use std::mem::ManuallyDrop;
use std::sync::{Arc, Mutex};
use crate::mimetype::MimeTypeGuesser;
use crate::xopen::open_raw;
pub const MAX_K: usize = 31;
const PAGE_SIZE: usize = 65536;
// overlap (MAX_K - 1) + page data (PAGE_SIZE) + 1 byte for the end-of-page terminating 0
const BUF_SIZE: usize = MAX_K + PAGE_SIZE;
// ─── OverlapState ─────────────────────────────────────────────────────────────
pub(crate) struct OverlapState {
data: [u8; MAX_K],
len: usize,
k: usize,
}
impl OverlapState {
pub(crate) fn new(k: usize) -> Self {
assert!(k > 0 && k <= MAX_K);
Self {
data: [0u8; MAX_K],
len: 0,
k,
}
}
}
// ─── NucParser trait ──────────────────────────────────────────────────────────
// Transforms a raw page into a compacted nucleotide stream in-place.
//
// Buffer layout on each call:
// buf[0..overlap_len()] — overlap bytes copied by write_overlap()
// buf[overlap_len()..overlap_len()+n] — raw bytes just read from the source
//
// Returns the number of output bytes in buf[0..returned].
pub(crate) trait NucParser {
// required: format-specific
fn new(k: usize) -> Self
where
Self: Sized;
fn overlap_state(&self) -> &OverlapState;
fn overlap_state_mut(&mut self) -> &mut OverlapState;
fn is_in_seq(&self) -> bool;
fn parse_inplace(&mut self, buf: &mut [u8], n: usize) -> usize;
// provided: format-independent overlap management
fn overlap_len(&self) -> usize {
self.overlap_state().len
}
fn write_overlap(&self, buf: &mut [u8]) {
let ol = &self.overlap_state();
buf[..ol.len].copy_from_slice(&ol.data[..ol.len]);
}
// Called at end of parse_inplace: saves overlap state and returns adjusted j.
// seq_start is the j-position where the last sequence started in this call's output.
fn save_overlap(&mut self, buf: &mut [u8], j: usize, seq_start: usize) -> usize {
if !self.is_in_seq() {
self.overlap_state_mut().len = 0;
return j;
}
let seq_len = j - seq_start;
let k = self.overlap_state().k;
if seq_len >= k {
// Sequence long enough: save last k-1 nucleotides, terminate with 0.
let ol = k - 1;
self.overlap_state_mut().data[..ol].copy_from_slice(&buf[j - ol..j]);
self.overlap_state_mut().len = ol;
// SAFETY: j <= total - 1 < BUF_SIZE = buf.len()
// (total = overlap_len + n <= (MAX_K-1) + PAGE_SIZE = BUF_SIZE - 1)
unsafe {
*buf.get_unchecked_mut(j) = 0;
}
j + 1
} else if seq_len > 0 {
// Short sequence (< k): save whole fragment, strip from output.
self.overlap_state_mut().data[..seq_len].copy_from_slice(&buf[seq_start..j]);
self.overlap_state_mut().len = seq_len;
seq_start
} else {
self.overlap_state_mut().len = 0;
j
}
}
}
// ─── FASTA parser ─────────────────────────────────────────────────────────────
#[derive(Clone, Copy)]
enum FastaState {
OutSeq,
InTitle,
InSeq,
InAmbiguous,
}
pub(crate) struct FastaParser {
state: FastaState,
overlap: OverlapState,
}
impl NucParser for FastaParser {
fn new(k: usize) -> Self {
Self {
state: FastaState::OutSeq,
overlap: OverlapState::new(k),
}
}
#[inline]
fn overlap_state(&self) -> &OverlapState {
&self.overlap
}
#[inline]
fn overlap_state_mut(&mut self) -> &mut OverlapState {
&mut self.overlap
}
#[inline]
fn is_in_seq(&self) -> bool {
matches!(self.state, FastaState::InSeq)
}
fn parse_inplace(&mut self, buf: &mut [u8], n: usize) -> usize {
let total = self.overlap.len + n;
let mut i = 0; // read index
let mut j = 0; // write index (invariant: j <= i always)
// j-position where the current sequence started in this call's output;
// meaningful only when state is InSeq.
let mut seq_start: usize = 0;
while i < total {
// SAFETY: i < total <= BUF_SIZE = buf.len()
let byte = unsafe { *buf.get_unchecked(i) };
match self.state {
FastaState::OutSeq => {
if byte == b'>' {
self.state = FastaState::InTitle;
}
i += 1;
}
FastaState::InTitle => {
if byte == b'\n' || byte == b'\r' {
self.state = FastaState::InSeq;
seq_start = j;
}
i += 1;
}
FastaState::InSeq => {
if byte == b'\n' || byte == b'\r' {
i += 1;
continue;
}
let nuc = byte & 0xDF; // to uppercase
if nuc == b'A' || nuc == b'C' || nuc == b'G' || nuc == b'T' {
// SAFETY: j <= i < total <= BUF_SIZE = buf.len()
unsafe {
*buf.get_unchecked_mut(j) = nuc;
}
j += 1;
i += 1;
} else if byte == b'>' {
if j > seq_start {
unsafe {
*buf.get_unchecked_mut(j) = 0;
}
j += 1;
}
self.state = FastaState::InTitle;
i += 1;
} else {
// first ambiguous base: end current sequence if non-empty
if j > seq_start {
unsafe {
*buf.get_unchecked_mut(j) = 0;
}
j += 1;
}
self.state = FastaState::InAmbiguous;
i += 1;
}
}
FastaState::InAmbiguous => {
if byte == b'\n' || byte == b'\r' {
i += 1;
continue;
}
if byte == b'>' {
self.state = FastaState::InTitle;
i += 1;
continue;
}
let nuc = byte & 0xDF;
if nuc == b'A' || nuc == b'C' || nuc == b'G' || nuc == b'T' {
seq_start = j;
// SAFETY: j <= i < total <= BUF_SIZE = buf.len()
unsafe {
*buf.get_unchecked_mut(j) = nuc;
}
j += 1;
self.state = FastaState::InSeq;
}
i += 1;
}
}
}
self.save_overlap(buf, j, seq_start)
}
}
// ─── FASTQ parser ─────────────────────────────────────────────────────────────
#[derive(Clone, Copy)]
enum FastqState {
OutSeq,
InTitle,
InSeq,
InAmbiguous,
InQualTitle,
InQual,
}
pub(crate) struct FastqParser {
state: FastqState,
overlap: OverlapState,
}
impl NucParser for FastqParser {
fn new(k: usize) -> Self {
Self {
state: FastqState::OutSeq,
overlap: OverlapState::new(k),
}
}
#[inline]
fn overlap_state(&self) -> &OverlapState {
&self.overlap
}
#[inline]
fn overlap_state_mut(&mut self) -> &mut OverlapState {
&mut self.overlap
}
#[inline]
fn is_in_seq(&self) -> bool {
matches!(self.state, FastqState::InSeq)
}
fn parse_inplace(&mut self, buf: &mut [u8], n: usize) -> usize {
let total = self.overlap.len + n;
let mut i = 0;
let mut j = 0;
let mut seq_start: usize = 0;
while i < total {
// SAFETY: i < total <= BUF_SIZE = buf.len()
let byte = unsafe { *buf.get_unchecked(i) };
match self.state {
FastqState::OutSeq => {
if byte == b'@' {
self.state = FastqState::InTitle;
}
i += 1;
}
FastqState::InTitle => {
if byte == b'\n' || byte == b'\r' {
self.state = FastqState::InSeq;
seq_start = j;
}
i += 1;
}
FastqState::InSeq => {
if byte == b'\n' || byte == b'\r' {
if j > seq_start {
unsafe {
*buf.get_unchecked_mut(j) = 0;
}
j += 1;
}
self.state = FastqState::InQualTitle;
i += 1;
continue;
}
let nuc = byte & 0xDF;
if nuc == b'A' || nuc == b'C' || nuc == b'G' || nuc == b'T' {
// SAFETY: j <= i < total <= BUF_SIZE = buf.len()
unsafe {
*buf.get_unchecked_mut(j) = nuc;
}
j += 1;
} else {
if j > seq_start {
unsafe {
*buf.get_unchecked_mut(j) = 0;
}
j += 1;
}
self.state = FastqState::InAmbiguous;
}
i += 1;
}
FastqState::InAmbiguous => {
if byte == b'\n' || byte == b'\r' {
self.state = FastqState::InQualTitle;
i += 1;
continue;
}
let nuc = byte & 0xDF;
if nuc == b'A' || nuc == b'C' || nuc == b'G' || nuc == b'T' {
seq_start = j;
// SAFETY: j <= i < total <= BUF_SIZE = buf.len()
unsafe {
*buf.get_unchecked_mut(j) = nuc;
}
j += 1;
self.state = FastqState::InSeq;
}
i += 1;
}
FastqState::InQualTitle => {
if byte == b'\n' || byte == b'\r' {
self.state = FastqState::InQual;
}
i += 1;
}
FastqState::InQual => {
if byte == b'\n' || byte == b'\r' {
self.state = FastqState::OutSeq;
}
i += 1;
}
}
}
self.save_overlap(buf, j, seq_start)
}
}
// ─── GenBank parser ───────────────────────────────────────────────────────────
const ORIGIN_TAIL: &[u8] = b"RIGIN";
#[derive(Clone, Copy)]
enum GenbankState {
OutSeq,
MatchOrigin,
SkipOriginLine,
InSeq,
InSlash,
InAmbiguous,
}
pub(crate) struct GenbankParser {
state: GenbankState,
overlap: OverlapState,
keyword_pos: usize,
at_line_start: bool,
}
impl NucParser for GenbankParser {
fn new(k: usize) -> Self {
Self {
state: GenbankState::OutSeq,
overlap: OverlapState::new(k),
keyword_pos: 0,
at_line_start: true,
}
}
#[inline]
fn overlap_state(&self) -> &OverlapState {
&self.overlap
}
#[inline]
fn overlap_state_mut(&mut self) -> &mut OverlapState {
&mut self.overlap
}
#[inline]
fn is_in_seq(&self) -> bool {
matches!(self.state, GenbankState::InSeq)
}
fn parse_inplace(&mut self, buf: &mut [u8], n: usize) -> usize {
let total = self.overlap.len + n;
let mut i = 0;
let mut j = 0;
let mut seq_start: usize = 0;
while i < total {
// SAFETY: i < total <= BUF_SIZE = buf.len()
let byte = unsafe { *buf.get_unchecked(i) };
match self.state {
GenbankState::OutSeq => {
if byte == b'\n' || byte == b'\r' {
self.at_line_start = true;
} else if self.at_line_start && byte == b'O' {
self.state = GenbankState::MatchOrigin;
self.keyword_pos = 1;
self.at_line_start = false;
} else {
self.at_line_start = false;
}
i += 1;
}
GenbankState::MatchOrigin => {
if byte == b'\n' || byte == b'\r' {
self.state = GenbankState::OutSeq;
self.at_line_start = true;
} else if byte == ORIGIN_TAIL[self.keyword_pos - 1] {
self.keyword_pos += 1;
if self.keyword_pos == 6 {
self.state = GenbankState::SkipOriginLine;
}
} else {
self.state = GenbankState::OutSeq;
self.at_line_start = false;
}
i += 1;
}
GenbankState::SkipOriginLine => {
if byte == b'\n' || byte == b'\r' {
self.state = GenbankState::InSeq;
seq_start = j;
}
i += 1;
}
GenbankState::InSeq => {
if byte == b'\n' || byte == b'\r' {
self.at_line_start = true;
i += 1;
continue;
}
if self.at_line_start && byte == b'/' {
self.state = GenbankState::InSlash;
self.at_line_start = false;
i += 1;
continue;
}
self.at_line_start = false;
let nuc = byte & 0xDF;
if nuc == b'A' || nuc == b'C' || nuc == b'G' || nuc == b'T' {
// SAFETY: j <= i < total <= BUF_SIZE = buf.len()
unsafe {
*buf.get_unchecked_mut(j) = nuc;
}
j += 1;
} else if byte.is_ascii_digit() || byte == b' ' {
// position numbers and spacing between groups: skip
} else {
// ambiguous base: end current sequence if non-empty
if j > seq_start {
unsafe {
*buf.get_unchecked_mut(j) = 0;
}
j += 1;
}
self.state = GenbankState::InAmbiguous;
}
i += 1;
}
GenbankState::InSlash => {
if byte == b'/' {
// confirmed "//": end of sequence record
if j > seq_start {
unsafe {
*buf.get_unchecked_mut(j) = 0;
}
j += 1;
}
self.state = GenbankState::OutSeq;
self.at_line_start = false;
} else if byte == b'\n' || byte == b'\r' {
// single '/' line: back to sequence
self.state = GenbankState::InSeq;
self.at_line_start = true;
} else {
// false positive: single '/' mid-line, resume sequence
self.state = GenbankState::InSeq;
self.at_line_start = false;
}
i += 1;
}
GenbankState::InAmbiguous => {
if byte == b'\n' || byte == b'\r' {
self.at_line_start = true;
i += 1;
continue;
}
if self.at_line_start && byte == b'/' {
self.state = GenbankState::InSlash;
self.at_line_start = false;
i += 1;
continue;
}
self.at_line_start = false;
let nuc = byte & 0xDF;
if nuc == b'A' || nuc == b'C' || nuc == b'G' || nuc == b'T' {
seq_start = j;
// SAFETY: j <= i < total <= BUF_SIZE = buf.len()
unsafe {
*buf.get_unchecked_mut(j) = nuc;
}
j += 1;
self.state = GenbankState::InSeq;
}
// digits, spaces, other ambiguous codes: skip
i += 1;
}
}
}
self.save_overlap(buf, j, seq_start)
}
}
// ─── NucPage ──────────────────────────────────────────────────────────────────
/// Owned page of compacted nucleotides: uppercase A/C/G/T bytes separated by `0`
/// at sequence boundaries. Automatically returns its buffer to the pool on drop.
pub struct NucPage {
data: ManuallyDrop<Vec<u8>>,
len: usize,
pool: Arc<Mutex<Vec<Vec<u8>>>>,
}
impl std::ops::Deref for NucPage {
type Target = [u8];
fn deref(&self) -> &[u8] {
&self.data[..self.len]
}
}
impl Drop for NucPage {
fn drop(&mut self) {
// SAFETY: data is never accessed after this point
let buf = unsafe { ManuallyDrop::take(&mut self.data) };
self.pool.lock().unwrap().push(buf);
}
}
// ─── NucPageCursor ────────────────────────────────────────────────────────────
/// A forward cursor over the normalised bytes of a [`NucPage`].
///
/// Provides the `next_byte` / `rewind` interface consumed by
/// [`obiskbuilder::SuperKmerStreamIter`].
pub struct NucPageCursor<'a> {
data: &'a [u8],
pos: usize,
}
impl NucPageCursor<'_> {
/// Returns the next byte in the page, or `None` at end.
#[inline]
pub fn next_byte(&mut self) -> Option<u8> {
if self.pos < self.data.len() {
let b = self.data[self.pos];
self.pos += 1;
Some(b)
} else {
None
}
}
/// Steps the cursor back by `n` bytes.
///
/// The caller guarantees that the last `n` bytes were all `ACGT`
/// (no `0x00` separators), so they are still in the page buffer.
#[inline]
pub fn rewind(&mut self, n: usize) {
self.pos -= n;
}
/// Total number of bytes in the underlying page.
#[inline]
pub fn len(&self) -> usize {
self.data.len()
}
/// Returns `true` if the page contains no bytes.
#[inline]
pub fn is_empty(&self) -> bool {
self.data.is_empty()
}
}
impl NucPage {
/// Creates a forward cursor positioned at the start of this page.
pub fn cursor(&self) -> NucPageCursor<'_> {
NucPageCursor { data: self, pos: 0 }
}
}
// ─── NucStream ────────────────────────────────────────────────────────────────
pub(crate) struct NucStream<R: Read, P: NucParser> {
reader: R,
parser: P,
pool: Arc<Mutex<Vec<Vec<u8>>>>,
eof: bool,
}
impl<R: Read, P: NucParser> NucStream<R, P> {
pub(crate) fn new(reader: R, k: usize) -> Self {
Self {
reader,
parser: P::new(k),
pool: Arc::new(Mutex::new(Vec::new())),
eof: false,
}
}
pub(crate) fn read_page(&mut self) -> Option<NucPage> {
loop {
if self.eof {
return None;
}
// take a buffer from the pool, or allocate fresh if all are in-flight
let mut buf = self
.pool
.lock()
.unwrap()
.pop()
.unwrap_or_else(|| vec![0u8; BUF_SIZE]);
let ol = self.parser.overlap_len();
self.parser.write_overlap(&mut buf[..ol]);
let n = self.reader.read(&mut buf[ol..ol + PAGE_SIZE]).unwrap_or(0);
if n == 0 {
self.eof = true;
if ol == 0 {
self.pool.lock().unwrap().push(buf);
return None;
}
}
let out_len = self.parser.parse_inplace(&mut buf, n);
if out_len > 0 {
return Some(NucPage {
data: ManuallyDrop::new(buf),
len: out_len,
pool: Arc::clone(&self.pool),
});
}
// empty page (all headers/ambiguous): return buf to pool and loop
self.pool.lock().unwrap().push(buf);
}
}
}
impl<R: Read, P: NucParser> Iterator for NucStream<R, P> {
type Item = NucPage;
fn next(&mut self) -> Option<NucPage> {
self.read_page()
}
}
// ─── FastaNucStream ───────────────────────────────────────────────────────────
pub(crate) type FastaNucStream<R> = NucStream<R, FastaParser>;
pub(crate) type FastqNucStream<R> = NucStream<R, FastqParser>;
pub(crate) type GenbankNucStream<R> = NucStream<R, GenbankParser>;
// ─── AnyNucStream ─────────────────────────────────────────────────────────────
pub(crate) enum AnyNucStream<R: Read> {
Fasta(FastaNucStream<R>),
Fastq(FastqNucStream<R>),
Genbank(GenbankNucStream<R>),
}
impl<R: Read> Iterator for AnyNucStream<R> {
type Item = NucPage;
fn next(&mut self) -> Option<NucPage> {
match self {
AnyNucStream::Fasta(s) => s.next(),
AnyNucStream::Fastq(s) => s.next(),
AnyNucStream::Genbank(s) => s.next(),
}
}
}
fn dispatch<R: Read>(
mut guesser: MimeTypeGuesser<R>,
k: usize,
) -> Option<AnyNucStream<MimeTypeGuesser<R>>> {
match guesser.mime_type() {
Some("text/fasta") => Some(AnyNucStream::Fasta(NucStream::new(guesser, k))),
Some("text/fastq") => Some(AnyNucStream::Fastq(NucStream::new(guesser, k))),
Some("text/gbff") => Some(AnyNucStream::Genbank(NucStream::new(guesser, k))),
_ => None,
}
}
/// Wraps an already-open reader in a nucleotide stream, detecting its format.
/// Returns `None` if the format is not recognised.
pub(crate) fn nuc_stream<R: Read>(reader: R, k: usize) -> Option<AnyNucStream<MimeTypeGuesser<R>>> {
dispatch(MimeTypeGuesser::new(reader), k)
}
/// Opens a nucleotide stream from any source (file path, URL, or `-` for stdin),
/// with transparent decompression and automatic format detection.
///
/// # Errors
/// Returns an `io::Error` if the source cannot be opened, decompression fails,
/// or the format is not recognised.
pub fn open_nuc_stream(
source: &str,
k: usize,
) -> io::Result<Box<dyn Iterator<Item = NucPage> + Send>> {
let reader = open_raw(source)?;
nuc_stream(reader, k)
.map(|s| Box::new(s) as Box<dyn Iterator<Item = NucPage> + Send>)
.ok_or_else(|| io::Error::new(io::ErrorKind::InvalidData, "unknown sequence format"))
}
#[cfg(test)]
#[path = "tests/nucstream.rs"]
mod tests;
+128
View File
@@ -0,0 +1,128 @@
use super::overlap::{NucParser, OverlapState};
// ─── FASTA parser ─────────────────────────────────────────────────────────────
#[derive(Clone, Copy)]
enum FastaState {
OutSeq,
InTitle,
InSeq,
InAmbiguous,
}
pub(crate) struct FastaParser {
state: FastaState,
overlap: OverlapState,
}
impl NucParser for FastaParser {
fn new(k: usize) -> Self {
Self {
state: FastaState::OutSeq,
overlap: OverlapState::new(k),
}
}
#[inline]
fn overlap_state(&self) -> &OverlapState {
&self.overlap
}
#[inline]
fn overlap_state_mut(&mut self) -> &mut OverlapState {
&mut self.overlap
}
#[inline]
fn is_in_seq(&self) -> bool {
matches!(self.state, FastaState::InSeq)
}
fn parse_inplace(&mut self, buf: &mut [u8], n: usize) -> usize {
let total = self.overlap.len + n;
let mut i = 0; // read index
let mut j = 0; // write index (invariant: j <= i always)
// j-position where the current sequence started in this call's output;
// meaningful only when state is InSeq.
let mut seq_start: usize = 0;
while i < total {
// SAFETY: i < total <= BUF_SIZE = buf.len()
let byte = unsafe { *buf.get_unchecked(i) };
match self.state {
FastaState::OutSeq => {
if byte == b'>' {
self.state = FastaState::InTitle;
}
i += 1;
}
FastaState::InTitle => {
if byte == b'\n' || byte == b'\r' {
self.state = FastaState::InSeq;
seq_start = j;
}
i += 1;
}
FastaState::InSeq => {
if byte == b'\n' || byte == b'\r' {
i += 1;
continue;
}
let nuc = byte & 0xDF; // to uppercase
if nuc == b'A' || nuc == b'C' || nuc == b'G' || nuc == b'T' {
// SAFETY: j <= i < total <= BUF_SIZE = buf.len()
unsafe {
*buf.get_unchecked_mut(j) = nuc;
}
j += 1;
i += 1;
} else if byte == b'>' {
if j > seq_start {
unsafe {
*buf.get_unchecked_mut(j) = 0;
}
j += 1;
}
self.state = FastaState::InTitle;
i += 1;
} else {
// first ambiguous base: end current sequence if non-empty
if j > seq_start {
unsafe {
*buf.get_unchecked_mut(j) = 0;
}
j += 1;
}
self.state = FastaState::InAmbiguous;
i += 1;
}
}
FastaState::InAmbiguous => {
if byte == b'\n' || byte == b'\r' {
i += 1;
continue;
}
if byte == b'>' {
self.state = FastaState::InTitle;
i += 1;
continue;
}
let nuc = byte & 0xDF;
if nuc == b'A' || nuc == b'C' || nuc == b'G' || nuc == b'T' {
seq_start = j;
// SAFETY: j <= i < total <= BUF_SIZE = buf.len()
unsafe {
*buf.get_unchecked_mut(j) = nuc;
}
j += 1;
self.state = FastaState::InSeq;
}
i += 1;
}
}
}
self.save_overlap(buf, j, seq_start)
}
}
+132
View File
@@ -0,0 +1,132 @@
use super::overlap::{NucParser, OverlapState};
// ─── FASTQ parser ─────────────────────────────────────────────────────────────
#[derive(Clone, Copy)]
enum FastqState {
OutSeq,
InTitle,
InSeq,
InAmbiguous,
InQualTitle,
InQual,
}
pub(crate) struct FastqParser {
state: FastqState,
overlap: OverlapState,
}
impl NucParser for FastqParser {
fn new(k: usize) -> Self {
Self {
state: FastqState::OutSeq,
overlap: OverlapState::new(k),
}
}
#[inline]
fn overlap_state(&self) -> &OverlapState {
&self.overlap
}
#[inline]
fn overlap_state_mut(&mut self) -> &mut OverlapState {
&mut self.overlap
}
#[inline]
fn is_in_seq(&self) -> bool {
matches!(self.state, FastqState::InSeq)
}
fn parse_inplace(&mut self, buf: &mut [u8], n: usize) -> usize {
let total = self.overlap.len + n;
let mut i = 0;
let mut j = 0;
let mut seq_start: usize = 0;
while i < total {
// SAFETY: i < total <= BUF_SIZE = buf.len()
let byte = unsafe { *buf.get_unchecked(i) };
match self.state {
FastqState::OutSeq => {
if byte == b'@' {
self.state = FastqState::InTitle;
}
i += 1;
}
FastqState::InTitle => {
if byte == b'\n' || byte == b'\r' {
self.state = FastqState::InSeq;
seq_start = j;
}
i += 1;
}
FastqState::InSeq => {
if byte == b'\n' || byte == b'\r' {
if j > seq_start {
unsafe {
*buf.get_unchecked_mut(j) = 0;
}
j += 1;
}
self.state = FastqState::InQualTitle;
i += 1;
continue;
}
let nuc = byte & 0xDF;
if nuc == b'A' || nuc == b'C' || nuc == b'G' || nuc == b'T' {
// SAFETY: j <= i < total <= BUF_SIZE = buf.len()
unsafe {
*buf.get_unchecked_mut(j) = nuc;
}
j += 1;
} else {
if j > seq_start {
unsafe {
*buf.get_unchecked_mut(j) = 0;
}
j += 1;
}
self.state = FastqState::InAmbiguous;
}
i += 1;
}
FastqState::InAmbiguous => {
if byte == b'\n' || byte == b'\r' {
self.state = FastqState::InQualTitle;
i += 1;
continue;
}
let nuc = byte & 0xDF;
if nuc == b'A' || nuc == b'C' || nuc == b'G' || nuc == b'T' {
seq_start = j;
// SAFETY: j <= i < total <= BUF_SIZE = buf.len()
unsafe {
*buf.get_unchecked_mut(j) = nuc;
}
j += 1;
self.state = FastqState::InSeq;
}
i += 1;
}
FastqState::InQualTitle => {
if byte == b'\n' || byte == b'\r' {
self.state = FastqState::InQual;
}
i += 1;
}
FastqState::InQual => {
if byte == b'\n' || byte == b'\r' {
self.state = FastqState::OutSeq;
}
i += 1;
}
}
}
self.save_overlap(buf, j, seq_start)
}
}
+181
View File
@@ -0,0 +1,181 @@
use super::overlap::{NucParser, OverlapState};
// ─── GenBank parser ───────────────────────────────────────────────────────────
const ORIGIN_TAIL: &[u8] = b"RIGIN";
#[derive(Clone, Copy)]
enum GenbankState {
OutSeq,
MatchOrigin,
SkipOriginLine,
InSeq,
InSlash,
InAmbiguous,
}
pub(crate) struct GenbankParser {
state: GenbankState,
overlap: OverlapState,
keyword_pos: usize,
at_line_start: bool,
}
impl NucParser for GenbankParser {
fn new(k: usize) -> Self {
Self {
state: GenbankState::OutSeq,
overlap: OverlapState::new(k),
keyword_pos: 0,
at_line_start: true,
}
}
#[inline]
fn overlap_state(&self) -> &OverlapState {
&self.overlap
}
#[inline]
fn overlap_state_mut(&mut self) -> &mut OverlapState {
&mut self.overlap
}
#[inline]
fn is_in_seq(&self) -> bool {
matches!(self.state, GenbankState::InSeq)
}
fn parse_inplace(&mut self, buf: &mut [u8], n: usize) -> usize {
let total = self.overlap.len + n;
let mut i = 0;
let mut j = 0;
let mut seq_start: usize = 0;
while i < total {
// SAFETY: i < total <= BUF_SIZE = buf.len()
let byte = unsafe { *buf.get_unchecked(i) };
match self.state {
GenbankState::OutSeq => {
if byte == b'\n' || byte == b'\r' {
self.at_line_start = true;
} else if self.at_line_start && byte == b'O' {
self.state = GenbankState::MatchOrigin;
self.keyword_pos = 1;
self.at_line_start = false;
} else {
self.at_line_start = false;
}
i += 1;
}
GenbankState::MatchOrigin => {
if byte == b'\n' || byte == b'\r' {
self.state = GenbankState::OutSeq;
self.at_line_start = true;
} else if byte == ORIGIN_TAIL[self.keyword_pos - 1] {
self.keyword_pos += 1;
if self.keyword_pos == 6 {
self.state = GenbankState::SkipOriginLine;
}
} else {
self.state = GenbankState::OutSeq;
self.at_line_start = false;
}
i += 1;
}
GenbankState::SkipOriginLine => {
if byte == b'\n' || byte == b'\r' {
self.state = GenbankState::InSeq;
seq_start = j;
}
i += 1;
}
GenbankState::InSeq => {
if byte == b'\n' || byte == b'\r' {
self.at_line_start = true;
i += 1;
continue;
}
if self.at_line_start && byte == b'/' {
self.state = GenbankState::InSlash;
self.at_line_start = false;
i += 1;
continue;
}
self.at_line_start = false;
let nuc = byte & 0xDF;
if nuc == b'A' || nuc == b'C' || nuc == b'G' || nuc == b'T' {
// SAFETY: j <= i < total <= BUF_SIZE = buf.len()
unsafe {
*buf.get_unchecked_mut(j) = nuc;
}
j += 1;
} else if byte.is_ascii_digit() || byte == b' ' {
// position numbers and spacing between groups: skip
} else {
// ambiguous base: end current sequence if non-empty
if j > seq_start {
unsafe {
*buf.get_unchecked_mut(j) = 0;
}
j += 1;
}
self.state = GenbankState::InAmbiguous;
}
i += 1;
}
GenbankState::InSlash => {
if byte == b'/' {
// confirmed "//": end of sequence record
if j > seq_start {
unsafe {
*buf.get_unchecked_mut(j) = 0;
}
j += 1;
}
self.state = GenbankState::OutSeq;
self.at_line_start = false;
} else if byte == b'\n' || byte == b'\r' {
// single '/' line: back to sequence
self.state = GenbankState::InSeq;
self.at_line_start = true;
} else {
// false positive: single '/' mid-line, resume sequence
self.state = GenbankState::InSeq;
self.at_line_start = false;
}
i += 1;
}
GenbankState::InAmbiguous => {
if byte == b'\n' || byte == b'\r' {
self.at_line_start = true;
i += 1;
continue;
}
if self.at_line_start && byte == b'/' {
self.state = GenbankState::InSlash;
self.at_line_start = false;
i += 1;
continue;
}
self.at_line_start = false;
let nuc = byte & 0xDF;
if nuc == b'A' || nuc == b'C' || nuc == b'G' || nuc == b'T' {
seq_start = j;
// SAFETY: j <= i < total <= BUF_SIZE = buf.len()
unsafe {
*buf.get_unchecked_mut(j) = nuc;
}
j += 1;
self.state = GenbankState::InSeq;
}
// digits, spaces, other ambiguous codes: skip
i += 1;
}
}
}
self.save_overlap(buf, j, seq_start)
}
}
+40
View File
@@ -0,0 +1,40 @@
//! Streaming, in-place normalisation of raw sequence bytes into compacted
//! nucleotide pages: uppercase A/C/G/T separated by `0` at sequence
//! boundaries, ready for k-mer extraction without re-scanning for case or
//! ambiguity codes.
//!
//! Submodules: [`overlap`] (format-independent k-1 overlap bookkeeping
//! shared by every parser), [`fasta`]/[`fastq`]/[`genbank`] (one
//! format-specific in-place state machine each), [`page`] (the pooled
//! output buffer, [`NucPage`]), [`stream`] (format dispatch and the public
//! [`open_nuc_stream`] entry point).
mod fasta;
mod fastq;
mod genbank;
mod overlap;
mod page;
mod stream;
pub use page::{NucPage, NucPageCursor};
pub use stream::open_nuc_stream;
// Only used by `tests.rs` (`use super::*`) below — the crate itself always
// reaches these through their defining submodule directly.
#[cfg(test)]
pub(crate) use fasta::FastaParser;
#[cfg(test)]
pub(crate) use fastq::FastqParser;
#[cfg(test)]
pub(crate) use genbank::GenbankParser;
#[cfg(test)]
pub(crate) use stream::NucStream;
pub(crate) const MAX_K: usize = 31;
pub(crate) const PAGE_SIZE: usize = 65536;
// overlap (MAX_K - 1) + page data (PAGE_SIZE) + 1 byte for the end-of-page terminating 0
pub(crate) const BUF_SIZE: usize = MAX_K + PAGE_SIZE;
#[cfg(test)]
#[path = "../tests/nucstream.rs"]
mod tests;
+81
View File
@@ -0,0 +1,81 @@
use super::MAX_K;
// ─── OverlapState ─────────────────────────────────────────────────────────────
pub(crate) struct OverlapState {
data: [u8; MAX_K],
pub(super) len: usize,
k: usize,
}
impl OverlapState {
pub(crate) fn new(k: usize) -> Self {
assert!(k > 0 && k <= MAX_K);
Self {
data: [0u8; MAX_K],
len: 0,
k,
}
}
}
// ─── NucParser trait ──────────────────────────────────────────────────────────
// Transforms a raw page into a compacted nucleotide stream in-place.
//
// Buffer layout on each call:
// buf[0..overlap_len()] — overlap bytes copied by write_overlap()
// buf[overlap_len()..overlap_len()+n] — raw bytes just read from the source
//
// Returns the number of output bytes in buf[0..returned].
pub(crate) trait NucParser {
// required: format-specific
fn new(k: usize) -> Self
where
Self: Sized;
fn overlap_state(&self) -> &OverlapState;
fn overlap_state_mut(&mut self) -> &mut OverlapState;
fn is_in_seq(&self) -> bool;
fn parse_inplace(&mut self, buf: &mut [u8], n: usize) -> usize;
// provided: format-independent overlap management
fn overlap_len(&self) -> usize {
self.overlap_state().len
}
fn write_overlap(&self, buf: &mut [u8]) {
let ol = &self.overlap_state();
buf[..ol.len].copy_from_slice(&ol.data[..ol.len]);
}
// Called at end of parse_inplace: saves overlap state and returns adjusted j.
// seq_start is the j-position where the last sequence started in this call's output.
fn save_overlap(&mut self, buf: &mut [u8], j: usize, seq_start: usize) -> usize {
if !self.is_in_seq() {
self.overlap_state_mut().len = 0;
return j;
}
let seq_len = j - seq_start;
let k = self.overlap_state().k;
if seq_len >= k {
// Sequence long enough: save last k-1 nucleotides, terminate with 0.
let ol = k - 1;
self.overlap_state_mut().data[..ol].copy_from_slice(&buf[j - ol..j]);
self.overlap_state_mut().len = ol;
// SAFETY: j <= total - 1 < BUF_SIZE = buf.len()
// (total = overlap_len + n <= (MAX_K-1) + PAGE_SIZE = BUF_SIZE - 1)
unsafe {
*buf.get_unchecked_mut(j) = 0;
}
j + 1
} else if seq_len > 0 {
// Short sequence (< k): save whole fragment, strip from output.
self.overlap_state_mut().data[..seq_len].copy_from_slice(&buf[seq_start..j]);
self.overlap_state_mut().len = seq_len;
seq_start
} else {
self.overlap_state_mut().len = 0;
j
}
}
}
+80
View File
@@ -0,0 +1,80 @@
use std::mem::ManuallyDrop;
use std::sync::{Arc, Mutex};
// ─── NucPage ──────────────────────────────────────────────────────────────────
/// Owned page of compacted nucleotides: uppercase A/C/G/T bytes separated by `0`
/// at sequence boundaries. Automatically returns its buffer to the pool on drop.
pub struct NucPage {
pub(super) data: ManuallyDrop<Vec<u8>>,
pub(super) len: usize,
pub(super) pool: Arc<Mutex<Vec<Vec<u8>>>>,
}
impl std::ops::Deref for NucPage {
type Target = [u8];
fn deref(&self) -> &[u8] {
&self.data[..self.len]
}
}
impl Drop for NucPage {
fn drop(&mut self) {
// SAFETY: data is never accessed after this point
let buf = unsafe { ManuallyDrop::take(&mut self.data) };
self.pool.lock().unwrap().push(buf);
}
}
// ─── NucPageCursor ────────────────────────────────────────────────────────────
/// A forward cursor over the normalised bytes of a [`NucPage`].
///
/// Provides the `next_byte` / `rewind` interface consumed by
/// [`obiskbuilder::SuperKmerStreamIter`].
pub struct NucPageCursor<'a> {
data: &'a [u8],
pos: usize,
}
impl NucPageCursor<'_> {
/// Returns the next byte in the page, or `None` at end.
#[inline]
pub fn next_byte(&mut self) -> Option<u8> {
if self.pos < self.data.len() {
let b = self.data[self.pos];
self.pos += 1;
Some(b)
} else {
None
}
}
/// Steps the cursor back by `n` bytes.
///
/// The caller guarantees that the last `n` bytes were all `ACGT`
/// (no `0x00` separators), so they are still in the page buffer.
#[inline]
pub fn rewind(&mut self, n: usize) {
self.pos -= n;
}
/// Total number of bytes in the underlying page.
#[inline]
pub fn len(&self) -> usize {
self.data.len()
}
/// Returns `true` if the page contains no bytes.
#[inline]
pub fn is_empty(&self) -> bool {
self.data.is_empty()
}
}
impl NucPage {
/// Creates a forward cursor positioned at the start of this page.
pub fn cursor(&self) -> NucPageCursor<'_> {
NucPageCursor { data: self, pos: 0 }
}
}
+135
View File
@@ -0,0 +1,135 @@
use std::io::{self, Read};
use std::mem::ManuallyDrop;
use std::sync::{Arc, Mutex};
use crate::mimetype::MimeTypeGuesser;
use crate::xopen::open_raw;
use super::fasta::FastaParser;
use super::fastq::FastqParser;
use super::genbank::GenbankParser;
use super::overlap::NucParser;
use super::page::NucPage;
use super::{BUF_SIZE, PAGE_SIZE};
// ─── NucStream ────────────────────────────────────────────────────────────────
pub(crate) struct NucStream<R: Read, P: NucParser> {
reader: R,
parser: P,
pool: Arc<Mutex<Vec<Vec<u8>>>>,
eof: bool,
}
impl<R: Read, P: NucParser> NucStream<R, P> {
pub(crate) fn new(reader: R, k: usize) -> Self {
Self {
reader,
parser: P::new(k),
pool: Arc::new(Mutex::new(Vec::new())),
eof: false,
}
}
pub(crate) fn read_page(&mut self) -> Option<NucPage> {
loop {
if self.eof {
return None;
}
// take a buffer from the pool, or allocate fresh if all are in-flight
let mut buf = self
.pool
.lock()
.unwrap()
.pop()
.unwrap_or_else(|| vec![0u8; BUF_SIZE]);
let ol = self.parser.overlap_len();
self.parser.write_overlap(&mut buf[..ol]);
let n = self.reader.read(&mut buf[ol..ol + PAGE_SIZE]).unwrap_or(0);
if n == 0 {
self.eof = true;
if ol == 0 {
self.pool.lock().unwrap().push(buf);
return None;
}
}
let out_len = self.parser.parse_inplace(&mut buf, n);
if out_len > 0 {
return Some(NucPage {
data: ManuallyDrop::new(buf),
len: out_len,
pool: Arc::clone(&self.pool),
});
}
// empty page (all headers/ambiguous): return buf to pool and loop
self.pool.lock().unwrap().push(buf);
}
}
}
impl<R: Read, P: NucParser> Iterator for NucStream<R, P> {
type Item = NucPage;
fn next(&mut self) -> Option<NucPage> {
self.read_page()
}
}
// ─── FastaNucStream ───────────────────────────────────────────────────────────
pub(crate) type FastaNucStream<R> = NucStream<R, FastaParser>;
pub(crate) type FastqNucStream<R> = NucStream<R, FastqParser>;
pub(crate) type GenbankNucStream<R> = NucStream<R, GenbankParser>;
// ─── AnyNucStream ─────────────────────────────────────────────────────────────
pub(crate) enum AnyNucStream<R: Read> {
Fasta(FastaNucStream<R>),
Fastq(FastqNucStream<R>),
Genbank(GenbankNucStream<R>),
}
impl<R: Read> Iterator for AnyNucStream<R> {
type Item = NucPage;
fn next(&mut self) -> Option<NucPage> {
match self {
AnyNucStream::Fasta(s) => s.next(),
AnyNucStream::Fastq(s) => s.next(),
AnyNucStream::Genbank(s) => s.next(),
}
}
}
fn dispatch<R: Read>(
mut guesser: MimeTypeGuesser<R>,
k: usize,
) -> Option<AnyNucStream<MimeTypeGuesser<R>>> {
match guesser.mime_type() {
Some("text/fasta") => Some(AnyNucStream::Fasta(NucStream::new(guesser, k))),
Some("text/fastq") => Some(AnyNucStream::Fastq(NucStream::new(guesser, k))),
Some("text/gbff") => Some(AnyNucStream::Genbank(NucStream::new(guesser, k))),
_ => None,
}
}
/// Wraps an already-open reader in a nucleotide stream, detecting its format.
/// Returns `None` if the format is not recognised.
pub(crate) fn nuc_stream<R: Read>(reader: R, k: usize) -> Option<AnyNucStream<MimeTypeGuesser<R>>> {
dispatch(MimeTypeGuesser::new(reader), k)
}
/// Opens a nucleotide stream from any source (file path, URL, or `-` for stdin),
/// with transparent decompression and automatic format detection.
///
/// # Errors
/// Returns an `io::Error` if the source cannot be opened, decompression fails,
/// or the format is not recognised.
pub fn open_nuc_stream(
source: &str,
k: usize,
) -> io::Result<Box<dyn Iterator<Item = NucPage> + Send>> {
let reader = open_raw(source)?;
nuc_stream(reader, k)
.map(|s| Box::new(s) as Box<dyn Iterator<Item = NucPage> + Send>)
.ok_or_else(|| io::Error::new(io::ErrorKind::InvalidData, "unknown sequence format"))
}
-550
View File
@@ -1,550 +0,0 @@
use std::fs::File;
use std::io::{BufWriter, Write as _};
use std::path::{Path, PathBuf};
use std::sync::Arc;
use memmap2::Mmap;
use obikseq::{CanonicalKmer, Kmer, Unitig};
pub use obikseq::MAX_KMERS_PER_CHUNK;
use crate::error::{SKError, SKResult};
// ── Block index parameters ────────────────────────────────────────────────────
//
// BLOCK_SIZE = 1 << block_bits chunks share one offset entry in the index.
// block_bits=0 → one entry per chunk (exact offsets, no scan).
// block_bits=6 → one entry per 64 chunks (default; O(64) scan per lookup).
//
// block_bits is stored in the index file so the reader derives all parameters
// at runtime — no compile-time constant constrains the format.
const MAGIC: [u8; 4] = *b"UIX3";
/// Default block granularity used by [`UnitigFileWriter::create`].
pub const DEFAULT_BLOCK_BITS: u8 = 0;
fn idx_path(path: &Path) -> PathBuf {
crate::append_path_suffix(path, ".idx")
}
// ── Writer ────────────────────────────────────────────────────────────────────
/// Writes a sequence of [`Unitig`] to an uncompressed binary file and builds
/// a block-sampled offset index at close time.
///
/// One offset is stored every `1 << block_bits` chunks; random access to chunk
/// `i` costs at most `(1 << block_bits) − 1` sequential chunk scans after the
/// block lookup.
///
/// Unitigs with more than [`MAX_KMERS_PER_CHUNK`] k-mers are transparently split
/// into overlapping chunks (k−1 nucleotide overlap) so no k-mer is lost.
pub struct UnitigFileWriter {
file: BufWriter<File>,
block_offsets: Vec<u32>,
chunk_count: usize,
next_offset: u32,
n_kmers: usize,
k: usize,
block_bits: u8,
mask: usize, // (1 << block_bits) - 1
}
impl UnitigFileWriter {
/// Create a writer with the default block size (`DEFAULT_BLOCK_BITS = 6`).
pub fn create(path: &Path) -> SKResult<Self> {
Self::create_with_block_bits(path, DEFAULT_BLOCK_BITS)
}
/// Create a writer with a custom block size.
///
/// `block_bits` must be in 0..=31. `block_bits=0` stores one offset per
/// chunk (exact, no scan); larger values trade index size for scan length.
pub fn create_with_block_bits(path: &Path, block_bits: u8) -> SKResult<Self> {
assert!(block_bits <= 31, "block_bits must be ≤ 31");
let file = File::create(path).map_err(SKError::Io)?;
Ok(Self {
file: BufWriter::new(file),
block_offsets: Vec::new(),
chunk_count: 0,
next_offset: 0,
n_kmers: 0,
k: obikseq::params::k(),
block_bits,
mask: (1usize << block_bits) - 1,
})
}
/// Write a unitig, splitting into overlapping chunks if it exceeds
/// [`MAX_KMERS_PER_CHUNK`].
pub fn write(&mut self, unitig: &Unitig) -> SKResult<()> {
let seql = unitig.seql();
let k = self.k;
if seql < k {
return Ok(());
}
let n_kmers = seql - k + 1;
if n_kmers <= MAX_KMERS_PER_CHUNK {
return self.write_chunk(unitig);
}
let chunk_nucl = MAX_KMERS_PER_CHUNK + k - 1;
let stride = MAX_KMERS_PER_CHUNK;
let mut start = 0;
while start < seql {
let end = (start + chunk_nucl).min(seql);
self.write_chunk(&unitig.sub(start, end))?;
if end == seql { break; }
start += stride;
}
Ok(())
}
fn write_chunk(&mut self, unitig: &Unitig) -> SKResult<()> {
let seql = unitig.seql();
let byte_len = (seql + 3) / 4;
debug_assert!(seql - self.k <= u8::MAX as usize, "chunk exceeds MAX_KMERS_PER_CHUNK");
if self.chunk_count & self.mask == 0 {
self.block_offsets.push(self.next_offset);
}
self.n_kmers += seql - self.k + 1;
self.chunk_count += 1;
unitig.write_to_binary(&mut self.file).map_err(SKError::Io)?;
self.next_offset += 1 + byte_len as u32;
Ok(())
}
/// Flush and close the binary sequence file.
///
/// The companion `.idx` file is **not** written here; call
/// [`build_unitig_idx`] separately when exact evidence is needed.
pub fn close(mut self) -> SKResult<()> {
self.file.flush().map_err(SKError::Io)?;
drop(self.file);
Ok(())
}
pub fn len(&self) -> usize { self.chunk_count }
pub fn is_empty(&self) -> bool { self.chunk_count == 0 }
pub fn block_bits(&self) -> u8 { self.block_bits }
}
fn write_idx(
path: &Path,
n_unitigs: u32,
n_kmers: u64,
block_bits: u8,
block_offsets: &[u32],
) -> SKResult<()> {
let mut w = BufWriter::new(File::create(path).map_err(SKError::Io)?);
w.write_all(&MAGIC).map_err(SKError::Io)?;
w.write_all(&(block_bits as u32).to_le_bytes()).map_err(SKError::Io)?;
w.write_all(&n_unitigs.to_le_bytes()).map_err(SKError::Io)?;
w.write_all(&n_kmers.to_le_bytes()).map_err(SKError::Io)?;
for &off in block_offsets {
w.write_all(&off.to_le_bytes()).map_err(SKError::Io)?;
}
w.flush().map_err(SKError::Io)
}
/// Scan an existing `unitigs.bin` file and write its companion `.idx`.
///
/// Called by the exact-evidence construction route after the sequence file is
/// closed. `block_bits` controls index granularity (1 << block_bits chunks per
/// offset entry); use [`DEFAULT_BLOCK_BITS`] for the default.
pub fn build_unitig_idx(unitigs_path: &Path, block_bits: u8) -> SKResult<()> {
assert!(block_bits <= 31, "block_bits must be ≤ 31");
let file = File::open(unitigs_path).map_err(SKError::Io)?;
let mmap = unsafe { Mmap::map(&file).map_err(SKError::Io)? };
let k = obikseq::params::k();
let block_size = 1usize << block_bits;
let mask = block_size - 1;
let mut block_offsets: Vec<u32> = Vec::new();
let mut offset = 0usize;
let mut chunk_count = 0usize;
let mut n_kmers = 0usize;
while offset < mmap.len() {
if chunk_count & mask == 0 {
block_offsets.push(offset as u32);
}
let seql_minus_k = mmap[offset] as usize;
let byte_len = (seql_minus_k + k + 3) / 4;
n_kmers += seql_minus_k + 1;
offset += 1 + byte_len;
chunk_count += 1;
}
block_offsets.push(offset as u32); // sentinel
write_idx(
&idx_path(unitigs_path),
chunk_count as u32,
n_kmers as u64,
block_bits,
&block_offsets,
)
}
// ── Reader ────────────────────────────────────────────────────────────────────
/// Memory-mapped view of a unitig file, with optional direct-access index.
///
/// Three constructors select the operating mode:
/// - [`open`](Self::open) — smart default: direct access if `.idx` exists, sequential otherwise.
/// - [`open_sequential`](Self::open_sequential) — always sequential, ignores `.idx`.
/// - [`open_direct_access`](Self::open_direct_access) — requires `.idx`, errors if absent.
///
/// All positional methods (`chunk_start`, `verify_canonical_kmer`, …) work in
/// both modes. Without `.idx` they fall back to an O(i) sequential scan —
/// correct but slower.
pub struct UnitigFileReader {
mmap: Mmap,
block_offsets: Vec<u32>,
n_unitigs: usize,
n_kmers: usize,
k: usize,
block_bits: u8,
mask: usize, // (1 << block_bits) - 1
}
impl UnitigFileReader {
/// Smart default: opens with direct access if `.idx` is present, sequential otherwise.
pub fn open(path: &Path) -> SKResult<Self> {
if idx_path(path).exists() {
Self::open_direct_access(path)
} else {
Self::open_sequential(path)
}
}
/// Always sequential — never reads `.idx` even if present.
///
/// Scans the binary file once to count chunks and k-mers.
/// Positional access (`chunk_start`, `verify_canonical_kmer`) falls back to
/// O(i) sequential scan.
pub fn open_sequential(path: &Path) -> SKResult<Self> {
let file = File::open(path).map_err(SKError::Io)?;
let mmap = unsafe { Mmap::map(&file).map_err(SKError::Io)? };
let k = obikseq::params::k();
let mut offset = 0usize;
let mut n_unitigs = 0usize;
let mut n_kmers = 0usize;
while offset < mmap.len() {
let seql_minus_k = mmap[offset] as usize;
n_kmers += seql_minus_k + 1;
offset += 1 + (seql_minus_k + k + 3) / 4;
n_unitigs += 1;
}
Ok(Self {
mmap,
block_offsets: Vec::new(),
n_unitigs,
n_kmers,
k,
block_bits: DEFAULT_BLOCK_BITS,
mask: (1usize << DEFAULT_BLOCK_BITS) - 1,
})
}
/// Requires `.idx` — errors if the companion index file is absent.
///
/// Enables O(1 << block_bits) positional access to any chunk.
/// Use only when direct access is architecturally required (query-time
/// verification on an exact-evidence layer).
pub fn open_direct_access(path: &Path) -> SKResult<Self> {
let file = File::open(path).map_err(SKError::Io)?;
let mmap = unsafe { Mmap::map(&file).map_err(SKError::Io)? };
let (n_unitigs, n_kmers, block_bits, block_offsets) = read_idx(&idx_path(path))?;
let k = obikseq::params::k();
Ok(Self {
mmap,
block_offsets,
n_unitigs,
n_kmers,
k,
block_bits,
mask: (1usize << block_bits) - 1,
})
}
pub fn len(&self) -> usize { self.n_unitigs }
pub fn is_empty(&self) -> bool { self.n_unitigs == 0 }
pub fn n_kmers(&self) -> usize { self.n_kmers }
pub fn block_bits(&self) -> u8 { self.block_bits }
pub fn has_direct_access(&self) -> bool { !self.block_offsets.is_empty() }
/// Byte offset of record `i` in the mmap.
///
/// Fast path (O(1 << block_bits)) when `.idx` is loaded; degraded O(i)
/// sequential scan otherwise.
#[inline]
fn chunk_start(&self, i: usize) -> usize {
if !self.block_offsets.is_empty() {
if self.block_bits == 0 {
return self.block_offsets[i] as usize;
}
let block = i >> self.block_bits;
let rem = i & self.mask;
let mut offset = self.block_offsets[block] as usize;
for _ in 0..rem {
let seql_minus_k = self.mmap[offset] as usize;
offset += 1 + (seql_minus_k + self.k + 3) / 4;
}
offset
} else {
let mut offset = 0usize;
for _ in 0..i {
let seql_minus_k = self.mmap[offset] as usize;
offset += 1 + (seql_minus_k + self.k + 3) / 4;
}
offset
}
}
/// Nucleotide length of chunk `i`.
#[inline]
pub fn seql(&self, i: usize) -> usize {
self.mmap[self.chunk_start(i)] as usize + self.k
}
/// Reconstruct chunk `i` as a [`Unitig`].
pub fn unitig(&self, i: usize) -> Unitig {
let offset = self.chunk_start(i);
let seql = self.mmap[offset] as usize + self.k;
let byte_len = (seql + 3) / 4;
let bytes = self.mmap[offset + 1..offset + 1 + byte_len].to_vec().into_boxed_slice();
Unitig::new((seql % 4) as u8, bytes)
}
/// Raw left-aligned u64 of the k-mer at position `j` within chunk `i`.
#[inline]
pub fn raw_kmer(&self, i: usize, j: usize) -> u64 {
let offset = self.chunk_start(i);
extract_kmer_raw(&self.mmap[offset + 1..], j, self.k)
}
/// `true` iff the k-mer at position `j` of chunk `i` matches `query`.
///
/// Works in both modes; O(i) scan when `.idx` is absent.
#[inline]
pub fn verify_canonical_kmer(&self, i: usize, j: usize, query: CanonicalKmer) -> bool {
canonical_raw(self.raw_kmer(i, j), self.k) == query.raw()
}
// ── Sequential iterators (O(n) running-offset cursor) ─────────────────────
fn iter_chunks_sequential(&self) -> impl Iterator<Item = (usize, Unitig)> + '_ {
let k = self.k;
let mmap = &*self.mmap;
let n = self.n_unitigs;
let mut offset = 0usize;
(0..n).map(move |chunk_id| {
let seql = mmap[offset] as usize + k;
let byte_len = (seql + 3) / 4;
let bytes = mmap[offset + 1..offset + 1 + byte_len].to_vec().into_boxed_slice();
offset += 1 + byte_len;
(chunk_id, Unitig::new((seql % 4) as u8, bytes))
})
}
/// Iterate all unitigs sequentially. Works without `.idx` (sequential open).
pub fn iter_unitigs(&self) -> impl Iterator<Item = (usize, Unitig)> + '_ {
self.iter_chunks_sequential()
}
pub fn iter_kmers(&self) -> impl Iterator<Item = Kmer> + '_ {
self.iter_chunks_sequential()
.flat_map(|(_, u)| u.into_kmers())
}
pub fn iter_indexed_canonical_kmers(
&self,
) -> impl Iterator<Item = (CanonicalKmer, usize, usize)> + '_ {
self.iter_chunks_sequential()
.flat_map(|(chunk_id, u)| {
u.into_canonical_kmers()
.enumerate()
.map(move |(rank, kmer)| (kmer, chunk_id, rank))
})
}
}
fn read_idx(path: &Path) -> SKResult<(usize, usize, u8, Vec<u32>)> {
let data = std::fs::read(path).map_err(SKError::Io)?;
let mut pos = 0;
let magic_bytes = data.get(pos..pos + 4)
.ok_or(SKError::Truncated { context: "unitig index: magic" })?;
if magic_bytes != &MAGIC {
return Err(SKError::BadMagic {
expected: "UIX3",
got: magic_bytes.try_into().unwrap(),
});
}
pos += 4;
let bb_bytes = data.get(pos..pos + 4)
.ok_or(SKError::Truncated { context: "unitig index: block_bits" })?;
let block_bits_u32 = u32::from_le_bytes(bb_bytes.try_into().unwrap());
if block_bits_u32 > 31 {
return Err(SKError::InvalidData {
context: "unitig index",
detail: format!("block_bits out of range: {block_bits_u32}"),
});
}
let block_bits = block_bits_u32 as u8;
pos += 4;
let n_bytes = data.get(pos..pos + 4)
.ok_or(SKError::Truncated { context: "unitig index: n_unitigs" })?;
let n_unitigs = u32::from_le_bytes(n_bytes.try_into().unwrap()) as usize;
pos += 4;
let nk_bytes = data.get(pos..pos + 8)
.ok_or(SKError::Truncated { context: "unitig index: n_kmers" })?;
let n_kmers = u64::from_le_bytes(nk_bytes.try_into().unwrap()) as usize;
pos += 8;
let block_size = 1usize << block_bits;
let n_blocks = (n_unitigs + block_size - 1) >> block_bits;
let n_offsets = n_blocks + 1;
let mut block_offsets = Vec::with_capacity(n_offsets);
for _ in 0..n_offsets {
let off_bytes = data.get(pos..pos + 4)
.ok_or(SKError::Truncated { context: "unitig index: block_offsets" })?;
block_offsets.push(u32::from_le_bytes(off_bytes.try_into().unwrap()));
pos += 4;
}
Ok((n_unitigs, n_kmers, block_bits, block_offsets))
}
// ── Kmer utilities ────────────────────────────────────────────────────────────
#[inline]
fn revcomp_raw(raw: u64, k: usize) -> u64 {
let x = !raw;
let x = x.swap_bytes();
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
x << (64 - 2 * k)
}
#[inline]
fn canonical_raw(raw: u64, k: usize) -> u64 {
raw.min(revcomp_raw(raw, k))
}
#[inline]
fn extract_kmer_raw(bytes: &[u8], j: usize, k: usize) -> u64 {
let bit_start = j * 2;
let byte_start = bit_start / 8;
let bit_offset = bit_start % 8;
let bytes_needed = (bit_offset + 2 * k + 7) / 8;
let mut acc = 0u128;
for idx in 0..bytes_needed {
acc = (acc << 8) | bytes.get(byte_start + idx).copied().unwrap_or(0) as u128;
}
let shift = bytes_needed * 8 - bit_offset - 2 * k;
let mask = !0u64 >> (64 - 2 * k);
let raw = (acc >> shift) as u64 & mask;
raw << (64 - 2 * k)
}
// ── CanonicalKmerRawIter ──────────────────────────────────────────────────────
// ── CanonicalKmerIter ─────────────────────────────────────────────────────────
/// Sequential iterator over [`CanonicalKmer`] from a `unitigs.bin` file.
///
/// Holds an `Arc<Mmap>` so that `Clone` is O(1): both copies share the same
/// memory-mapped pages. Cloning resets the cursor to position 0 — this lets
/// ptr_hash's `new_from_par_iter` (which requires a `Clone`-able parallel
/// iterator via `par_bridge()`) make multiple passes without ever creating
/// a `.idx` file.
pub struct CanonicalKmerIter {
mmap: Arc<Mmap>,
k: usize,
chunk_pos: usize, // byte offset of the current chunk header
data_pos: usize, // byte offset of the current chunk's sequence bytes
n_kmers: usize, // kmers in current chunk
kmer_idx: usize, // next kmer index to yield within the current chunk
}
impl CanonicalKmerIter {
pub fn new(path: &Path) -> SKResult<Self> {
let file = File::open(path).map_err(SKError::Io)?;
let mmap = Arc::new(unsafe { Mmap::map(&file).map_err(SKError::Io)? });
let k = obikseq::params::k();
let mut s = Self { mmap, k, chunk_pos: 0, data_pos: 0, n_kmers: 0, kmer_idx: 0 };
s.load_chunk();
Ok(s)
}
#[inline]
fn load_chunk(&mut self) {
if self.chunk_pos < self.mmap.len() {
let seql_minus_k = self.mmap[self.chunk_pos] as usize;
self.n_kmers = seql_minus_k + 1;
self.data_pos = self.chunk_pos + 1;
self.kmer_idx = 0;
}
}
}
impl Clone for CanonicalKmerIter {
fn clone(&self) -> Self {
let mut c = Self {
mmap: Arc::clone(&self.mmap),
k: self.k,
chunk_pos: 0,
data_pos: 0,
n_kmers: 0,
kmer_idx: 0,
};
c.load_chunk();
c
}
}
impl Iterator for CanonicalKmerIter {
type Item = CanonicalKmer;
#[inline]
fn next(&mut self) -> Option<CanonicalKmer> {
loop {
if self.chunk_pos >= self.mmap.len() {
return None;
}
if self.kmer_idx < self.n_kmers {
let raw = extract_kmer_raw(&self.mmap[self.data_pos..], self.kmer_idx, self.k);
let canon = canonical_raw(raw, self.k);
self.kmer_idx += 1;
return Some(CanonicalKmer::from_raw_unchecked(canon));
}
let seql_minus_k = self.mmap[self.chunk_pos] as usize;
let byte_len = (seql_minus_k + self.k + 3) / 4;
self.chunk_pos += 1 + byte_len;
self.load_chunk();
}
}
}
#[cfg(test)]
#[path = "tests/unitig_index.rs"]
mod tests;
+86
View File
@@ -0,0 +1,86 @@
use std::path::Path;
use std::sync::Arc;
use memmap2::Mmap;
use obikseq::CanonicalKmer;
use crate::error::{SKError, SKResult};
use super::kmer_raw::{canonical_raw, extract_kmer_raw};
// ── CanonicalKmerIter ─────────────────────────────────────────────────────────
/// Sequential iterator over [`CanonicalKmer`] from a `unitigs.bin` file.
///
/// Holds an `Arc<Mmap>` so that `Clone` is O(1): both copies share the same
/// memory-mapped pages. Cloning resets the cursor to position 0 — this lets
/// ptr_hash's `new_from_par_iter` (which requires a `Clone`-able parallel
/// iterator via `par_bridge()`) make multiple passes without ever creating
/// a `.idx` file.
pub struct CanonicalKmerIter {
mmap: Arc<Mmap>,
k: usize,
chunk_pos: usize, // byte offset of the current chunk header
data_pos: usize, // byte offset of the current chunk's sequence bytes
n_kmers: usize, // kmers in current chunk
kmer_idx: usize, // next kmer index to yield within the current chunk
}
impl CanonicalKmerIter {
pub fn new(path: &Path) -> SKResult<Self> {
let file = std::fs::File::open(path).map_err(SKError::Io)?;
let mmap = Arc::new(unsafe { Mmap::map(&file).map_err(SKError::Io)? });
let k = obikseq::params::k();
let mut s = Self { mmap, k, chunk_pos: 0, data_pos: 0, n_kmers: 0, kmer_idx: 0 };
s.load_chunk();
Ok(s)
}
#[inline]
fn load_chunk(&mut self) {
if self.chunk_pos < self.mmap.len() {
let seql_minus_k = self.mmap[self.chunk_pos] as usize;
self.n_kmers = seql_minus_k + 1;
self.data_pos = self.chunk_pos + 1;
self.kmer_idx = 0;
}
}
}
impl Clone for CanonicalKmerIter {
fn clone(&self) -> Self {
let mut c = Self {
mmap: Arc::clone(&self.mmap),
k: self.k,
chunk_pos: 0,
data_pos: 0,
n_kmers: 0,
kmer_idx: 0,
};
c.load_chunk();
c
}
}
impl Iterator for CanonicalKmerIter {
type Item = CanonicalKmer;
#[inline]
fn next(&mut self) -> Option<CanonicalKmer> {
loop {
if self.chunk_pos >= self.mmap.len() {
return None;
}
if self.kmer_idx < self.n_kmers {
let raw = extract_kmer_raw(&self.mmap[self.data_pos..], self.kmer_idx, self.k);
let canon = canonical_raw(raw, self.k);
self.kmer_idx += 1;
return Some(CanonicalKmer::from_raw_unchecked(canon));
}
let seql_minus_k = self.mmap[self.chunk_pos] as usize;
let byte_len = (seql_minus_k + self.k + 3) / 4;
self.chunk_pos += 1 + byte_len;
self.load_chunk();
}
}
}
+33
View File
@@ -0,0 +1,33 @@
// ── Kmer utilities ────────────────────────────────────────────────────────────
#[inline]
pub(super) fn revcomp_raw(raw: u64, k: usize) -> u64 {
let x = !raw;
let x = x.swap_bytes();
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
x << (64 - 2 * k)
}
#[inline]
pub(super) fn canonical_raw(raw: u64, k: usize) -> u64 {
raw.min(revcomp_raw(raw, k))
}
#[inline]
pub(super) fn extract_kmer_raw(bytes: &[u8], j: usize, k: usize) -> u64 {
let bit_start = j * 2;
let byte_start = bit_start / 8;
let bit_offset = bit_start % 8;
let bytes_needed = (bit_offset + 2 * k + 7) / 8;
let mut acc = 0u128;
for idx in 0..bytes_needed {
acc = (acc << 8) | bytes.get(byte_start + idx).copied().unwrap_or(0) as u128;
}
let shift = bytes_needed * 8 - bit_offset - 2 * k;
let mask = !0u64 >> (64 - 2 * k);
let raw = (acc >> shift) as u64 & mask;
raw << (64 - 2 * k)
}
+48
View File
@@ -0,0 +1,48 @@
//! Binary unitig storage: an append-only sequence file (`unitigs.bin`) plus
//! an optional block-sampled `.idx` for O(1 << block_bits) random access.
//!
//! Submodules: [`writer`] ([`UnitigFileWriter`], chunk splitting, `.idx`
//! construction), [`reader`] ([`UnitigFileReader`], sequential or
//! direct-access), [`kmer_raw`] (packed 2-bit k-mer extraction/canonicalisation,
//! shared by both the reader and [`CanonicalKmerIter`]), [`kmer_iter`]
//! (cheaply-cloneable sequential k-mer iterator for `ptr_hash`).
use std::path::{Path, PathBuf};
mod kmer_iter;
mod kmer_raw;
mod reader;
mod writer;
pub use kmer_iter::CanonicalKmerIter;
pub use obikseq::MAX_KMERS_PER_CHUNK;
pub use reader::UnitigFileReader;
pub use writer::{UnitigFileWriter, build_unitig_idx};
// Only used by `tests/unitig_index.rs` (`use super::*`) below.
#[cfg(test)]
use obikseq::CanonicalKmer;
#[cfg(test)]
use kmer_raw::{canonical_raw, extract_kmer_raw, revcomp_raw};
// ── Block index parameters ────────────────────────────────────────────────────
//
// BLOCK_SIZE = 1 << block_bits chunks share one offset entry in the index.
// block_bits=0 → one entry per chunk (exact offsets, no scan).
// block_bits=6 → one entry per 64 chunks (default; O(64) scan per lookup).
//
// block_bits is stored in the index file so the reader derives all parameters
// at runtime — no compile-time constant constrains the format.
const MAGIC: [u8; 4] = *b"UIX3";
/// Default block granularity used by [`UnitigFileWriter::create`].
pub const DEFAULT_BLOCK_BITS: u8 = 0;
fn idx_path(path: &Path) -> PathBuf {
crate::append_path_suffix(path, ".idx")
}
#[cfg(test)]
#[path = "../tests/unitig_index.rs"]
mod tests;
+246
View File
@@ -0,0 +1,246 @@
use std::fs::File;
use std::path::Path;
use memmap2::Mmap;
use obikseq::{CanonicalKmer, Kmer, Unitig};
use crate::error::{SKError, SKResult};
use super::kmer_raw::{canonical_raw, extract_kmer_raw};
use super::{DEFAULT_BLOCK_BITS, MAGIC, idx_path};
// ── Reader ────────────────────────────────────────────────────────────────────
/// Memory-mapped view of a unitig file, with optional direct-access index.
///
/// Three constructors select the operating mode:
/// - [`open`](Self::open) — smart default: direct access if `.idx` exists, sequential otherwise.
/// - [`open_sequential`](Self::open_sequential) — always sequential, ignores `.idx`.
/// - [`open_direct_access`](Self::open_direct_access) — requires `.idx`, errors if absent.
///
/// All positional methods (`chunk_start`, `verify_canonical_kmer`, …) work in
/// both modes. Without `.idx` they fall back to an O(i) sequential scan —
/// correct but slower.
pub struct UnitigFileReader {
mmap: Mmap,
block_offsets: Vec<u32>,
n_unitigs: usize,
n_kmers: usize,
k: usize,
block_bits: u8,
mask: usize, // (1 << block_bits) - 1
}
impl UnitigFileReader {
/// Smart default: opens with direct access if `.idx` is present, sequential otherwise.
pub fn open(path: &Path) -> SKResult<Self> {
if idx_path(path).exists() {
Self::open_direct_access(path)
} else {
Self::open_sequential(path)
}
}
/// Always sequential — never reads `.idx` even if present.
///
/// Scans the binary file once to count chunks and k-mers.
/// Positional access (`chunk_start`, `verify_canonical_kmer`) falls back to
/// O(i) sequential scan.
pub fn open_sequential(path: &Path) -> SKResult<Self> {
let file = File::open(path).map_err(SKError::Io)?;
let mmap = unsafe { Mmap::map(&file).map_err(SKError::Io)? };
let k = obikseq::params::k();
let mut offset = 0usize;
let mut n_unitigs = 0usize;
let mut n_kmers = 0usize;
while offset < mmap.len() {
let seql_minus_k = mmap[offset] as usize;
n_kmers += seql_minus_k + 1;
offset += 1 + (seql_minus_k + k + 3) / 4;
n_unitigs += 1;
}
Ok(Self {
mmap,
block_offsets: Vec::new(),
n_unitigs,
n_kmers,
k,
block_bits: DEFAULT_BLOCK_BITS,
mask: (1usize << DEFAULT_BLOCK_BITS) - 1,
})
}
/// Requires `.idx` — errors if the companion index file is absent.
///
/// Enables O(1 << block_bits) positional access to any chunk.
/// Use only when direct access is architecturally required (query-time
/// verification on an exact-evidence layer).
pub fn open_direct_access(path: &Path) -> SKResult<Self> {
let file = File::open(path).map_err(SKError::Io)?;
let mmap = unsafe { Mmap::map(&file).map_err(SKError::Io)? };
let (n_unitigs, n_kmers, block_bits, block_offsets) = read_idx(&idx_path(path))?;
let k = obikseq::params::k();
Ok(Self {
mmap,
block_offsets,
n_unitigs,
n_kmers,
k,
block_bits,
mask: (1usize << block_bits) - 1,
})
}
pub fn len(&self) -> usize { self.n_unitigs }
pub fn is_empty(&self) -> bool { self.n_unitigs == 0 }
pub fn n_kmers(&self) -> usize { self.n_kmers }
pub fn block_bits(&self) -> u8 { self.block_bits }
pub fn has_direct_access(&self) -> bool { !self.block_offsets.is_empty() }
/// Byte offset of record `i` in the mmap.
///
/// Fast path (O(1 << block_bits)) when `.idx` is loaded; degraded O(i)
/// sequential scan otherwise.
#[inline]
fn chunk_start(&self, i: usize) -> usize {
if !self.block_offsets.is_empty() {
if self.block_bits == 0 {
return self.block_offsets[i] as usize;
}
let block = i >> self.block_bits;
let rem = i & self.mask;
let mut offset = self.block_offsets[block] as usize;
for _ in 0..rem {
let seql_minus_k = self.mmap[offset] as usize;
offset += 1 + (seql_minus_k + self.k + 3) / 4;
}
offset
} else {
let mut offset = 0usize;
for _ in 0..i {
let seql_minus_k = self.mmap[offset] as usize;
offset += 1 + (seql_minus_k + self.k + 3) / 4;
}
offset
}
}
/// Nucleotide length of chunk `i`.
#[inline]
pub fn seql(&self, i: usize) -> usize {
self.mmap[self.chunk_start(i)] as usize + self.k
}
/// Reconstruct chunk `i` as a [`Unitig`].
pub fn unitig(&self, i: usize) -> Unitig {
let offset = self.chunk_start(i);
let seql = self.mmap[offset] as usize + self.k;
let byte_len = (seql + 3) / 4;
let bytes = self.mmap[offset + 1..offset + 1 + byte_len].to_vec().into_boxed_slice();
Unitig::new((seql % 4) as u8, bytes)
}
/// Raw left-aligned u64 of the k-mer at position `j` within chunk `i`.
#[inline]
pub fn raw_kmer(&self, i: usize, j: usize) -> u64 {
let offset = self.chunk_start(i);
extract_kmer_raw(&self.mmap[offset + 1..], j, self.k)
}
/// `true` iff the k-mer at position `j` of chunk `i` matches `query`.
///
/// Works in both modes; O(i) scan when `.idx` is absent.
#[inline]
pub fn verify_canonical_kmer(&self, i: usize, j: usize, query: CanonicalKmer) -> bool {
canonical_raw(self.raw_kmer(i, j), self.k) == query.raw()
}
// ── Sequential iterators (O(n) running-offset cursor) ─────────────────────
pub(crate) fn iter_chunks_sequential(&self) -> impl Iterator<Item = (usize, Unitig)> + '_ {
let k = self.k;
let mmap = &*self.mmap;
let n = self.n_unitigs;
let mut offset = 0usize;
(0..n).map(move |chunk_id| {
let seql = mmap[offset] as usize + k;
let byte_len = (seql + 3) / 4;
let bytes = mmap[offset + 1..offset + 1 + byte_len].to_vec().into_boxed_slice();
offset += 1 + byte_len;
(chunk_id, Unitig::new((seql % 4) as u8, bytes))
})
}
/// Iterate all unitigs sequentially. Works without `.idx` (sequential open).
pub fn iter_unitigs(&self) -> impl Iterator<Item = (usize, Unitig)> + '_ {
self.iter_chunks_sequential()
}
pub fn iter_kmers(&self) -> impl Iterator<Item = Kmer> + '_ {
self.iter_chunks_sequential()
.flat_map(|(_, u)| u.into_kmers())
}
pub fn iter_indexed_canonical_kmers(
&self,
) -> impl Iterator<Item = (CanonicalKmer, usize, usize)> + '_ {
self.iter_chunks_sequential()
.flat_map(|(chunk_id, u)| {
u.into_canonical_kmers()
.enumerate()
.map(move |(rank, kmer)| (kmer, chunk_id, rank))
})
}
}
fn read_idx(path: &Path) -> SKResult<(usize, usize, u8, Vec<u32>)> {
let data = std::fs::read(path).map_err(SKError::Io)?;
let mut pos = 0;
let magic_bytes = data.get(pos..pos + 4)
.ok_or(SKError::Truncated { context: "unitig index: magic" })?;
if magic_bytes != &MAGIC {
return Err(SKError::BadMagic {
expected: "UIX3",
got: magic_bytes.try_into().unwrap(),
});
}
pos += 4;
let bb_bytes = data.get(pos..pos + 4)
.ok_or(SKError::Truncated { context: "unitig index: block_bits" })?;
let block_bits_u32 = u32::from_le_bytes(bb_bytes.try_into().unwrap());
if block_bits_u32 > 31 {
return Err(SKError::InvalidData {
context: "unitig index",
detail: format!("block_bits out of range: {block_bits_u32}"),
});
}
let block_bits = block_bits_u32 as u8;
pos += 4;
let n_bytes = data.get(pos..pos + 4)
.ok_or(SKError::Truncated { context: "unitig index: n_unitigs" })?;
let n_unitigs = u32::from_le_bytes(n_bytes.try_into().unwrap()) as usize;
pos += 4;
let nk_bytes = data.get(pos..pos + 8)
.ok_or(SKError::Truncated { context: "unitig index: n_kmers" })?;
let n_kmers = u64::from_le_bytes(nk_bytes.try_into().unwrap()) as usize;
pos += 8;
let block_size = 1usize << block_bits;
let n_blocks = (n_unitigs + block_size - 1) >> block_bits;
let n_offsets = n_blocks + 1;
let mut block_offsets = Vec::with_capacity(n_offsets);
for _ in 0..n_offsets {
let off_bytes = data.get(pos..pos + 4)
.ok_or(SKError::Truncated { context: "unitig index: block_offsets" })?;
block_offsets.push(u32::from_le_bytes(off_bytes.try_into().unwrap()));
pos += 4;
}
Ok((n_unitigs, n_kmers, block_bits, block_offsets))
}
+178
View File
@@ -0,0 +1,178 @@
use std::fs::File;
use std::io::{BufWriter, Write as _};
use std::path::Path;
use memmap2::Mmap;
use obikseq::{MAX_KMERS_PER_CHUNK, Unitig};
use crate::error::{SKError, SKResult};
use super::{DEFAULT_BLOCK_BITS, MAGIC, idx_path};
// ── Writer ────────────────────────────────────────────────────────────────────
/// Writes a sequence of [`Unitig`] to an uncompressed binary file and builds
/// a block-sampled offset index at close time.
///
/// One offset is stored every `1 << block_bits` chunks; random access to chunk
/// `i` costs at most `(1 << block_bits) − 1` sequential chunk scans after the
/// block lookup.
///
/// Unitigs with more than [`MAX_KMERS_PER_CHUNK`] k-mers are transparently split
/// into overlapping chunks (k−1 nucleotide overlap) so no k-mer is lost.
pub struct UnitigFileWriter {
file: BufWriter<File>,
block_offsets: Vec<u32>,
chunk_count: usize,
next_offset: u32,
n_kmers: usize,
k: usize,
block_bits: u8,
mask: usize, // (1 << block_bits) - 1
}
impl UnitigFileWriter {
/// Create a writer with the default block size (`DEFAULT_BLOCK_BITS = 6`).
pub fn create(path: &Path) -> SKResult<Self> {
Self::create_with_block_bits(path, DEFAULT_BLOCK_BITS)
}
/// Create a writer with a custom block size.
///
/// `block_bits` must be in 0..=31. `block_bits=0` stores one offset per
/// chunk (exact, no scan); larger values trade index size for scan length.
pub fn create_with_block_bits(path: &Path, block_bits: u8) -> SKResult<Self> {
assert!(block_bits <= 31, "block_bits must be ≤ 31");
let file = File::create(path).map_err(SKError::Io)?;
Ok(Self {
file: BufWriter::new(file),
block_offsets: Vec::new(),
chunk_count: 0,
next_offset: 0,
n_kmers: 0,
k: obikseq::params::k(),
block_bits,
mask: (1usize << block_bits) - 1,
})
}
/// Write a unitig, splitting into overlapping chunks if it exceeds
/// [`MAX_KMERS_PER_CHUNK`].
pub fn write(&mut self, unitig: &Unitig) -> SKResult<()> {
let seql = unitig.seql();
let k = self.k;
if seql < k {
return Ok(());
}
let n_kmers = seql - k + 1;
if n_kmers <= MAX_KMERS_PER_CHUNK {
return self.write_chunk(unitig);
}
let chunk_nucl = MAX_KMERS_PER_CHUNK + k - 1;
let stride = MAX_KMERS_PER_CHUNK;
let mut start = 0;
while start < seql {
let end = (start + chunk_nucl).min(seql);
self.write_chunk(&unitig.sub(start, end))?;
if end == seql { break; }
start += stride;
}
Ok(())
}
fn write_chunk(&mut self, unitig: &Unitig) -> SKResult<()> {
let seql = unitig.seql();
let byte_len = (seql + 3) / 4;
debug_assert!(seql - self.k <= u8::MAX as usize, "chunk exceeds MAX_KMERS_PER_CHUNK");
if self.chunk_count & self.mask == 0 {
self.block_offsets.push(self.next_offset);
}
self.n_kmers += seql - self.k + 1;
self.chunk_count += 1;
unitig.write_to_binary(&mut self.file).map_err(SKError::Io)?;
self.next_offset += 1 + byte_len as u32;
Ok(())
}
/// Flush and close the binary sequence file.
///
/// The companion `.idx` file is **not** written here; call
/// [`build_unitig_idx`] separately when exact evidence is needed.
pub fn close(mut self) -> SKResult<()> {
self.file.flush().map_err(SKError::Io)?;
drop(self.file);
Ok(())
}
pub fn len(&self) -> usize { self.chunk_count }
pub fn is_empty(&self) -> bool { self.chunk_count == 0 }
pub fn block_bits(&self) -> u8 { self.block_bits }
}
fn write_idx(
path: &Path,
n_unitigs: u32,
n_kmers: u64,
block_bits: u8,
block_offsets: &[u32],
) -> SKResult<()> {
let mut w = BufWriter::new(File::create(path).map_err(SKError::Io)?);
w.write_all(&MAGIC).map_err(SKError::Io)?;
w.write_all(&(block_bits as u32).to_le_bytes()).map_err(SKError::Io)?;
w.write_all(&n_unitigs.to_le_bytes()).map_err(SKError::Io)?;
w.write_all(&n_kmers.to_le_bytes()).map_err(SKError::Io)?;
for &off in block_offsets {
w.write_all(&off.to_le_bytes()).map_err(SKError::Io)?;
}
w.flush().map_err(SKError::Io)
}
/// Scan an existing `unitigs.bin` file and write its companion `.idx`.
///
/// Called by the exact-evidence construction route after the sequence file is
/// closed. `block_bits` controls index granularity (1 << block_bits chunks per
/// offset entry); use [`DEFAULT_BLOCK_BITS`] for the default.
pub fn build_unitig_idx(unitigs_path: &Path, block_bits: u8) -> SKResult<()> {
assert!(block_bits <= 31, "block_bits must be ≤ 31");
let file = File::open(unitigs_path).map_err(SKError::Io)?;
let mmap = unsafe { Mmap::map(&file).map_err(SKError::Io)? };
let k = obikseq::params::k();
let block_size = 1usize << block_bits;
let mask = block_size - 1;
let mut block_offsets: Vec<u32> = Vec::new();
let mut offset = 0usize;
let mut chunk_count = 0usize;
let mut n_kmers = 0usize;
while offset < mmap.len() {
if chunk_count & mask == 0 {
block_offsets.push(offset as u32);
}
let seql_minus_k = mmap[offset] as usize;
let byte_len = (seql_minus_k + k + 3) / 4;
n_kmers += seql_minus_k + 1;
offset += 1 + byte_len;
chunk_count += 1;
}
block_offsets.push(offset as u32); // sentinel
write_idx(
&idx_path(unitigs_path),
chunk_count as u32,
n_kmers as u64,
block_bits,
&block_offsets,
)
}
+65
View File
@@ -0,0 +1,65 @@
use std::sync::{Condvar, Mutex};
struct BudgetInner {
remaining: u64,
active: usize,
peak_active: usize,
}
/// Counting semaphore that limits total concurrent estimated memory usage.
///
/// Each worker acquires a cost (bytes) before starting and releases it on
/// completion. Non-deadlock guarantee: when no worker is active the next
/// acquire always succeeds regardless of cost vs. remaining budget.
pub struct MemoryBudget {
total: u64,
inner: Mutex<BudgetInner>,
condvar: Condvar,
}
impl MemoryBudget {
pub fn new(total: u64) -> Self {
Self {
total,
inner: Mutex::new(BudgetInner {
remaining: total,
active: 0,
peak_active: 0,
}),
condvar: Condvar::new(),
}
}
pub fn acquire(&self, cost: u64) {
let mut g = self.inner.lock().unwrap();
loop {
if g.active == 0 || g.remaining >= cost {
g.remaining = g.remaining.saturating_sub(cost);
g.active += 1;
g.peak_active = g.peak_active.max(g.active);
return;
}
g = self.condvar.wait(g).unwrap();
}
}
pub fn release(&self, cost: u64) {
let mut g = self.inner.lock().unwrap();
g.remaining = (g.remaining + cost).min(self.total);
g.active -= 1;
self.condvar.notify_all();
}
pub fn total(&self) -> u64 {
self.total
}
pub fn active(&self) -> usize {
self.inner.lock().unwrap().active
}
pub fn remaining(&self) -> u64 {
self.inner.lock().unwrap().remaining
}
pub fn peak_active(&self) -> usize {
self.inner.lock().unwrap().peak_active
}
}
+14 -867
View File
@@ -1,867 +1,14 @@
use std::fmt;
use std::sync::atomic::{AtomicU64, Ordering};
use std::sync::{Condvar, Mutex};
use std::time::{Duration, Instant};
use indicatif::{ProgressBar, ProgressStyle};
use tracing::{debug, info, warn};
const BRAILLE: &[&str] = &["⠋", "⠙", "⠹", "⠸", "⠼", "⠴", "⠦", "⠧", "⠇", "⠏"];
// ── DirLock ──────────────────────────────────────────────────────────────────
/// Exclusive advisory lock on an index directory, held for the duration of
/// any command that writes into an already-existing index (building the
/// sibling annex, merging into a destination, filtering/selecting in place,
/// ...). Two such commands racing on the same directory can otherwise
/// corrupt each other's writes with no error from either side.
///
/// Only the directory actually being *written to* needs a lock — a command
/// like `merge` that reads several source indexes to build one destination
/// only needs to lock the destination.
///
/// Uses the OS's advisory file lock (`flock` on Unix, `LockFileEx` on
/// Windows) via `fs4`, not a hand-rolled PID file: the OS releases it
/// automatically on process exit, including a crash — no stale-lock cleanup
/// logic needed.
pub struct DirLock {
_file: std::fs::File,
}
impl DirLock {
/// Block until the exclusive lock on `dir` is acquired (creating `dir`
/// and the lock file within it if needed). Logs once if the wait is
/// non-trivial, so a blocked command doesn't look silently hung.
pub fn acquire(dir: &std::path::Path) -> std::io::Result<Self> {
use fs4::fs_std::FileExt;
std::fs::create_dir_all(dir)?;
let lock_path = dir.join(".obikmer.lock");
let file = std::fs::OpenOptions::new()
.create(true)
.truncate(false)
.write(true)
.open(&lock_path)?;
if file.try_lock_exclusive().is_err() {
info!(dir = %dir.display(), "waiting for another obikmer process to release this index");
file.lock_exclusive()?;
}
Ok(Self { _file: file })
}
}
// ── TracedBar ──────────────────────────────────────────────────────────────────
/// Wrapper around `ProgressBar` that emits `tracing` events when stderr is not
/// a TTY (e.g. HPC job logs): every 10% for bounded bars, every ~10 s for
/// spinners (throttled on `set_message`).
pub struct TracedBar {
pb: ProgressBar,
label: String,
unit: String,
total: u64, // 0 for spinners
start: Instant, // creation time, for spinner throttling
last_pct: AtomicU64, // last emitted 10%-bucket (1..=10), 0 = none yet
last_log_ms: AtomicU64, // ms since `start` at last spinner log
}
impl TracedBar {
pub fn inc(&self, delta: u64) {
self.pb.inc(delta);
if self.pb.is_hidden() && self.total > 0 {
let pos = self.pb.position();
let pct10 = (pos * 10) / self.total; // 0..=10
let last = self.last_pct.load(Ordering::Relaxed);
if pct10 > last
&& self
.last_pct
.compare_exchange(last, pct10, Ordering::Relaxed, Ordering::Relaxed)
.is_ok()
{
info!(
stage = %self.label,
progress = format_args!("{}%", pct10 * 10),
"{}/{} {}",
pos, self.total, self.unit
);
}
}
}
pub fn set_message(&self, msg: impl Into<String>) {
let msg = msg.into();
if self.pb.is_hidden() {
if self.total > 0 {
debug!(stage = %self.label, "{msg}");
} else {
// spinner: throttle to ~10 s
let now_ms = self.start.elapsed().as_millis() as u64;
let last = self.last_log_ms.load(Ordering::Relaxed);
if now_ms >= last + 10_000
&& self
.last_log_ms
.compare_exchange(last, now_ms, Ordering::Relaxed, Ordering::Relaxed)
.is_ok()
{
info!(stage = %self.label, "{msg}");
}
}
}
self.pb.set_message(msg);
}
pub fn finish_and_clear(&self) {
self.pb.finish_and_clear();
}
}
/// Spinner with the standard project look: `⠋ label — msg 0s`.
/// Caller updates the message with `pb.set_message(...)`.
pub fn spinner(label: &str) -> TracedBar {
let pb = ProgressBar::new_spinner();
pb.set_style(
ProgressStyle::with_template(&format!("{{spinner}} {label} — {{msg}} {{elapsed}}"))
.unwrap()
.tick_strings(BRAILLE),
);
pb.enable_steady_tick(Duration::from_millis(100));
TracedBar {
pb,
label: label.to_string(),
unit: String::new(),
total: 0,
start: Instant::now(),
last_pct: AtomicU64::new(0),
last_log_ms: AtomicU64::new(0),
}
}
/// Progress bar with the standard project look:
/// `⠋ label — [████░░░░] pos/len unit elapsed`.
pub fn progress_bar(label: &str, n: u64, unit: &str) -> TracedBar {
let pb = ProgressBar::new(n);
pb.set_style(
ProgressStyle::with_template(&format!(
"{{spinner}} {label} — {{bar:40.cyan/blue}} {{pos}}/{{len}} {unit} {{elapsed}}"
))
.unwrap()
.tick_strings(BRAILLE),
);
pb.enable_steady_tick(Duration::from_millis(100));
TracedBar {
pb,
label: label.to_string(),
unit: unit.to_string(),
total: n,
start: Instant::now(),
last_pct: AtomicU64::new(0),
last_log_ms: AtomicU64::new(0),
}
}
use libc::{RUSAGE_SELF, getrusage, rusage, timeval};
use sysinfo::System;
// ── Memory query ──────────────────────────────────────────────────────────────
/// Returns the number of bytes available for allocation in the current process context.
///
/// On Linux, cgroup memory limits (SLURM, containers) are checked first: the
/// process may be constrained to far less than the host's available RAM.
/// Returns `min(cgroup_available, host_available)` when a finite limit is found.
///
/// On macOS, `available_memory()` can return 0 when the memory compressor
/// inflates the page count; in that case we fall back to half of total memory.
/// Returns the process peak RSS (high-water mark since process start).
/// Monotonically increasing — use delta before/after a phase to measure its RAM cost.
pub fn peak_rss_bytes() -> u64 {
rss_to_bytes(&get_rusage())
}
pub fn available_memory_bytes() -> u64 {
let sys = System::new_all();
let host_avail = match sys.available_memory() {
0 => sys.total_memory() / 2,
n => n,
};
#[cfg(target_os = "linux")]
if let Some(cg) = cgroup_v2_available().or_else(cgroup_v1_available) {
return cg.min(host_avail);
}
host_avail
}
/// cgroup v2 (unified hierarchy): reads memory.max and memory.current for the
/// current process's cgroup. Returns None if unlimited or on any parse error.
#[cfg(target_os = "linux")]
fn cgroup_v2_available() -> Option<u64> {
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
let rel = cgroup
.lines()
.find(|l| l.starts_with("0::"))?
.strip_prefix("0::")?
.trim();
let base = format!("/sys/fs/cgroup{rel}");
// "max" means no limit → parse::<u64>() fails → None
let limit: u64 = std::fs::read_to_string(format!("{base}/memory.max"))
.ok()?
.trim()
.parse()
.ok()?;
let used: u64 = std::fs::read_to_string(format!("{base}/memory.current"))
.ok()?
.trim()
.parse()
.ok()?;
Some(limit.saturating_sub(used))
}
/// cgroup v1 (memory subsystem): reads memory.limit_in_bytes and
/// memory.usage_in_bytes. Returns None if unlimited or on any parse error.
#[cfg(target_os = "linux")]
fn cgroup_v1_available() -> Option<u64> {
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
let path = cgroup
.lines()
.find(|l| l.contains(":memory:"))?
.split(':')
.nth(2)?;
let base = format!("/sys/fs/cgroup/memory{path}");
let limit: u64 = std::fs::read_to_string(format!("{base}/memory.limit_in_bytes"))
.ok()?
.trim()
.parse()
.ok()?;
// Kernel uses 2^63 (rounded to page) as "no limit" sentinel
if limit > (1u64 << 62) {
return None;
}
let used: u64 = std::fs::read_to_string(format!("{base}/memory.usage_in_bytes"))
.ok()?
.trim()
.parse()
.ok()?;
Some(limit.saturating_sub(used))
}
// ── CPU parallelism query ────────────────────────────────────────────────────
/// Returns the number of cores this process can actually use concurrently.
///
/// `std::thread::available_parallelism()` reads CPU affinity
/// (`sched_getaffinity`), not the container's CPU quota — a Docker/cgroup
/// container commonly reports the *host's* full core count this way while
/// actually being throttled (via `cpu.max`/`cpu.cfs_quota_us`) to a fraction
/// of a core. Sizing a thread/worker pool off the unthrottled count causes
/// severe oversubscription: dozens of threads contending for a sliver of
/// real CPU time, which can look indistinguishable from a hang for minutes
/// or hours (observed in CI). On Linux, this reads the cgroup CPU quota
/// first and returns `min(cgroup_quota, host_parallelism)` when a finite
/// quota is found; falls back to `available_parallelism()` otherwise (same
/// convention as [`available_memory_bytes`]).
pub fn effective_parallelism() -> usize {
let host = std::thread::available_parallelism().map(|n| n.get()).unwrap_or(1);
#[cfg(target_os = "linux")]
{
if let Some(quota) = cgroup_v2_cpu_quota() {
let effective = quota.clamp(1, host);
tracing::debug!(host, quota, effective, source = "cgroup v2", "effective_parallelism");
return effective;
}
if let Some(quota) = cgroup_v1_cpu_quota() {
let effective = quota.clamp(1, host);
tracing::debug!(host, quota, effective, source = "cgroup v1", "effective_parallelism");
return effective;
}
}
tracing::debug!(host, effective = host, source = "available_parallelism (no cgroup quota found)", "effective_parallelism");
host
}
/// cgroup v2 (unified hierarchy): reads `cpu.max` ("<quota> <period>", or
/// "max <period>" when unlimited) for the current process's cgroup, rounded
/// up to whole cores. Returns `None` if unlimited or on any parse error.
#[cfg(target_os = "linux")]
fn cgroup_v2_cpu_quota() -> Option<usize> {
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
let rel = cgroup
.lines()
.find(|l| l.starts_with("0::"))?
.strip_prefix("0::")?
.trim();
let base = format!("/sys/fs/cgroup{rel}");
let raw = std::fs::read_to_string(format!("{base}/cpu.max")).ok()?;
let mut parts = raw.split_whitespace();
let quota_str = parts.next()?;
let period: f64 = parts.next()?.parse().ok()?;
if quota_str == "max" {
return None; // unlimited
}
let quota: f64 = quota_str.parse().ok()?;
Some((quota / period).ceil().max(1.0) as usize)
}
/// cgroup v1 (cpu subsystem): reads `cpu.cfs_quota_us`/`cpu.cfs_period_us`,
/// rounded up to whole cores. Returns `None` if unlimited (quota <= 0) or on
/// any parse error.
#[cfg(target_os = "linux")]
fn cgroup_v1_cpu_quota() -> Option<usize> {
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
let path = cgroup
.lines()
.find(|l| l.contains(":cpu:") || l.contains(":cpu,cpuacct:"))?
.split(':')
.nth(2)?;
let base = format!("/sys/fs/cgroup/cpu{path}");
let quota: i64 = std::fs::read_to_string(format!("{base}/cpu.cfs_quota_us"))
.ok()?
.trim()
.parse()
.ok()?;
if quota <= 0 {
return None; // unlimited
}
let period: i64 = std::fs::read_to_string(format!("{base}/cpu.cfs_period_us"))
.ok()?
.trim()
.parse()
.ok()?;
if period <= 0 {
return None;
}
Some(((quota as f64) / (period as f64)).ceil().max(1.0) as usize)
}
// ── raw helpers ───────────────────────────────────────────────────────────────
fn get_rusage() -> rusage {
let mut ru = unsafe { std::mem::zeroed::<rusage>() };
unsafe { getrusage(RUSAGE_SELF, &mut ru) };
ru
}
fn tv_to_secs(tv: timeval) -> f64 {
tv.tv_sec as f64 + tv.tv_usec as f64 * 1e-6
}
#[cfg(target_os = "macos")]
fn rss_to_bytes(ru: &rusage) -> u64 {
ru.ru_maxrss as u64
}
#[cfg(not(target_os = "macos"))]
fn rss_to_bytes(ru: &rusage) -> u64 {
ru.ru_maxrss as u64 * 1024
}
// Monotonically increasing counters — negative delta would be a kernel bug.
fn delta(end: i64, start: i64) -> u64 {
(end - start).max(0) as u64
}
// ── CpuSample ─────────────────────────────────────────────────────────────────
/// Snapshot of process-wide CPU time + wall clock at a point in time.
/// Use [`cpu_efficiency`](Self::cpu_efficiency) to measure the fraction of
/// available cores used since the snapshot was taken.
pub struct CpuSample {
wall: Instant,
user_secs: f64,
sys_secs: f64,
previous: f64,
}
impl CpuSample {
pub fn now() -> Self {
let ru = get_rusage();
Self {
wall: Instant::now(),
user_secs: tv_to_secs(ru.ru_utime),
sys_secs: tv_to_secs(ru.ru_stime),
previous: 0.0,
}
}
/// (user_delta + sys_delta) / (wall_delta × n_cores) since this snapshot.
/// Returns 0.0 if less than 100 ms have elapsed (too noisy).
pub fn cpu_efficiency(&self, n_cores: usize) -> f64 {
let ru = get_rusage();
let wall = self.wall.elapsed().as_secs_f64();
if wall < 0.1 {
return 0.0;
}
let cpu =
(tv_to_secs(ru.ru_utime) - self.user_secs) + (tv_to_secs(ru.ru_stime) - self.sys_secs);
cpu / (wall * n_cores as f64)
}
pub fn do_i_activate(&mut self, threshold: f64) -> bool {
let delta_wall = self.wall.elapsed().as_secs_f64();
if delta_wall < 0.1 {
// Window too short to be meaningful — leave state untouched so it
// keeps accumulating until a real sample can be taken.
return false;
}
let n = CpuSample::now();
let delta_ru = (n.user_secs - self.user_secs) + (n.sys_secs - self.sys_secs);
let efficiency = delta_ru / delta_wall;
let activate = 0f64.max(efficiency - self.previous) >= threshold;
debug!(
"Do I activate : {} -> {} = {} Activate: {}",
self.previous,
efficiency,
0f64.max(efficiency - self.previous),
activate
);
self.previous = efficiency;
self.user_secs = n.user_secs;
self.sys_secs = n.sys_secs;
self.wall = n.wall;
activate
}
}
// ── IoSample ──────────────────────────────────────────────────────────────────
/// Snapshot of process-wide block I/O (bytes read + written) + wall clock.
///
/// Same activation protocol as [`CpuSample`], but the growth check in
/// [`do_i_activate`](Self::do_i_activate) is *relative* rather than absolute:
/// raw I/O throughput has no portable scale across storage devices, unlike a
/// core count.
pub struct IoSample {
wall: Instant,
bytes: u64,
previous_rate: f64,
}
impl IoSample {
pub fn now() -> Self {
Self {
wall: Instant::now(),
bytes: Self::read_bytes(),
previous_rate: 0.0,
}
}
/// Bytes actually submitted to the block layer (read + write), summed
/// process-wide. Returns 0 if unavailable — degrades gracefully to a
/// signal that never triggers activation (CPU-only heuristic).
#[cfg(target_os = "linux")]
fn read_bytes() -> u64 {
let Ok(io) = std::fs::read_to_string("/proc/self/io") else {
return 0;
};
io.lines()
.filter_map(|l| {
l.strip_prefix("read_bytes: ")
.or_else(|| l.strip_prefix("write_bytes: "))
})
.filter_map(|v| v.trim().parse::<u64>().ok())
.sum()
}
#[cfg(target_os = "macos")]
fn read_bytes() -> u64 {
use libc::{RUSAGE_INFO_V4, getpid, proc_pid_rusage, rusage_info_v4};
let mut info: rusage_info_v4 = unsafe { std::mem::zeroed() };
let ret =
unsafe { proc_pid_rusage(getpid(), RUSAGE_INFO_V4, &mut info as *mut _ as *mut _) };
if ret != 0 {
return 0;
}
info.ri_diskio_bytesread + info.ri_diskio_byteswritten
}
#[cfg(not(any(target_os = "linux", target_os = "macos")))]
fn read_bytes() -> u64 {
0
}
/// Same protocol as [`CpuSample::do_i_activate`] (0.1 s minimum window,
/// state untouched on early return), but growth is measured relative to
/// the previous rate. `threshold` is a fraction, e.g. `0.2` for a 20 %
/// increase in throughput since the last real sample.
pub fn do_i_activate(&mut self, threshold: f64) -> bool {
let elapsed = self.wall.elapsed().as_secs_f64();
if elapsed < 0.1 {
return false;
}
let n = Self::read_bytes();
let rate = n.saturating_sub(self.bytes) as f64 / elapsed;
let activate = if self.previous_rate == 0.0 {
rate > 0.0 // bootstrap: any measured throughput is signal enough
} else {
(rate - self.previous_rate) / self.previous_rate >= threshold
};
debug!(
"Do I activate (I/O) : {} -> {} Activate: {}",
self.previous_rate, rate, activate
);
self.previous_rate = rate;
self.bytes = n;
self.wall = Instant::now();
activate
}
}
// ── public API ────────────────────────────────────────────────────────────────
/// Snapshot taken at the start of a pipeline stage.
#[must_use = "call .stop() to record the stage"]
pub struct Stage {
label: String,
wall: Instant,
ru: rusage,
}
impl Stage {
pub fn start(label: impl Into<String>) -> Self {
let label = label.into();
info!(stage = %label, "started");
Self {
label,
wall: Instant::now(),
ru: get_rusage(),
}
}
pub fn stop(self) -> StageStats {
let wall_secs = self.wall.elapsed().as_secs_f64();
let end = get_rusage();
let stats = StageStats {
label: self.label,
wall_secs,
user_secs: tv_to_secs(end.ru_utime) - tv_to_secs(self.ru.ru_utime),
sys_secs: tv_to_secs(end.ru_stime) - tv_to_secs(self.ru.ru_stime),
max_rss_bytes: rss_to_bytes(&end),
minor_faults: delta(end.ru_minflt as i64, self.ru.ru_minflt as i64),
major_faults: delta(end.ru_majflt as i64, self.ru.ru_majflt as i64),
vol_ctx: delta(end.ru_nvcsw as i64, self.ru.ru_nvcsw as i64),
invol_ctx: delta(end.ru_nivcsw as i64, self.ru.ru_nivcsw as i64),
in_blocks: delta(end.ru_inblock as i64, self.ru.ru_inblock as i64),
out_blocks: delta(end.ru_oublock as i64, self.ru.ru_oublock as i64),
swaps: delta(end.ru_nswap as i64, self.ru.ru_nswap as i64),
};
info!(
stage = %stats.label,
wall_secs = format_args!("{:.3}", stats.wall_secs),
rss = %fmt_bytes(stats.max_rss_bytes),
swaps = stats.swaps,
"done"
);
if stats.swaps > 0 {
warn!(
stage = %stats.label,
swaps = stats.swaps,
"working set exceeds available RAM"
);
}
stats
}
}
/// Per-stage efficiency metrics collected from `getrusage(RUSAGE_SELF)` deltas.
pub struct StageStats {
pub label: String,
pub wall_secs: f64,
pub user_secs: f64,
pub sys_secs: f64,
/// Peak RSS at end of stage (bytes). ru_maxrss is a process-lifetime maximum,
/// so this reflects the high-water mark up to and including this stage.
pub max_rss_bytes: u64,
pub minor_faults: u64,
pub major_faults: u64,
pub vol_ctx: u64, // voluntary context switches
pub invol_ctx: u64, // involuntary context switches
pub in_blocks: u64, // filesystem block reads (after page cache)
pub out_blocks: u64, // filesystem block writes
pub swaps: u64,
}
impl StageStats {
/// (user + sys) / wall — effective thread count utilisation.
pub fn parallelism(&self) -> f64 {
if self.wall_secs > 1e-9 {
(self.user_secs + self.sys_secs) / self.wall_secs
} else {
0.0
}
}
/// parallelism / n_cores — fraction of available CPU power used (0..1+).
pub fn efficiency(&self, n_cores: usize) -> f64 {
self.parallelism() / n_cores as f64
}
}
/// Accumulates stage stats and prints a human-readable summary table.
#[derive(Default)]
pub struct Reporter {
stages: Vec<StageStats>,
}
impl Reporter {
pub fn new() -> Self {
Self::default()
}
pub fn push(&mut self, stats: StageStats) {
self.stages.push(stats);
}
pub fn stages(&self) -> &[StageStats] {
&self.stages
}
/// Print the summary to stderr.
pub fn print(&self) {
eprint!("{self}");
}
}
// ── diagnosis ─────────────────────────────────────────────────────────────────
struct Diagnosis {
tag: &'static str,
detail: Option<String>,
}
// Thresholds are intentionally conservative to avoid false positives.
fn diagnose(s: &StageStats, n_cores: usize) -> Diagnosis {
let eff = s.efficiency(n_cores);
let cpu_pct = eff * 100.0;
let io_ops = s.in_blocks + s.out_blocks;
// swaps > 0 is the only reliable cross-platform indicator of true RAM exhaustion.
// ru_majflt is intentionally excluded: on macOS it counts all file-backed mmap
// page-ins (even from page cache), making it useless as a memory-pressure signal
// for mmap-heavy code. On Linux it is more meaningful, but swaps covers the
// severe case on both platforms.
if s.swaps > 0 {
return Diagnosis {
tag: "swapping",
detail: Some(format!(
"swapped {} time(s) — working set exceeds available RAM",
s.swaps,
)),
};
}
if eff < 0.3 && io_ops > 100 {
return Diagnosis {
tag: "disk I/O",
detail: Some(format!(
"{} block reads + {} writes — CPU at {:.0}%, stage is I/O-bound",
s.in_blocks, s.out_blocks, cpu_pct,
)),
};
}
if eff < 0.3 && s.vol_ctx > 200 {
return Diagnosis {
tag: "contention",
detail: Some(format!(
"{} voluntary context switches — CPU at {:.0}%, possible lock contention or I/O wait",
s.vol_ctx, cpu_pct,
)),
};
}
Diagnosis {
tag: "—",
detail: None,
}
}
// ── display helpers ───────────────────────────────────────────────────────────
fn fmt_secs(s: f64) -> String {
if s >= 100.0 {
format!("{:.0}s", s)
} else if s >= 10.0 {
format!("{:.1}s", s)
} else if s >= 1.0 {
format!("{:.2}s", s)
} else {
format!("{:.0}ms", s * 1000.0)
}
}
fn fmt_bytes(b: u64) -> String {
if b >= 1 << 30 {
format!("{:.1} GB", b as f64 / (1u64 << 30) as f64)
} else if b >= 1 << 20 {
format!("{:.0} MB", b as f64 / (1u64 << 20) as f64)
} else {
format!("{:.0} KB", b as f64 / 1024.0)
}
}
fn fmt_efficiency(par: f64, n_cores: usize) -> String {
format!(
"{:.1}×/{} ({:.0}%)",
par,
n_cores,
par / n_cores as f64 * 100.0
)
}
// ── Display ───────────────────────────────────────────────────────────────────
// ── MemoryBudget ──────────────────────────────────────────────────────────────
struct BudgetInner {
remaining: u64,
active: usize,
peak_active: usize,
}
/// Counting semaphore that limits total concurrent estimated memory usage.
///
/// Each worker acquires a cost (bytes) before starting and releases it on
/// completion. Non-deadlock guarantee: when no worker is active the next
/// acquire always succeeds regardless of cost vs. remaining budget.
pub struct MemoryBudget {
total: u64,
inner: Mutex<BudgetInner>,
condvar: Condvar,
}
impl MemoryBudget {
pub fn new(total: u64) -> Self {
Self {
total,
inner: Mutex::new(BudgetInner {
remaining: total,
active: 0,
peak_active: 0,
}),
condvar: Condvar::new(),
}
}
pub fn acquire(&self, cost: u64) {
let mut g = self.inner.lock().unwrap();
loop {
if g.active == 0 || g.remaining >= cost {
g.remaining = g.remaining.saturating_sub(cost);
g.active += 1;
g.peak_active = g.peak_active.max(g.active);
return;
}
g = self.condvar.wait(g).unwrap();
}
}
pub fn release(&self, cost: u64) {
let mut g = self.inner.lock().unwrap();
g.remaining = (g.remaining + cost).min(self.total);
g.active -= 1;
self.condvar.notify_all();
}
pub fn total(&self) -> u64 {
self.total
}
pub fn active(&self) -> usize {
self.inner.lock().unwrap().active
}
pub fn remaining(&self) -> u64 {
self.inner.lock().unwrap().remaining
}
pub fn peak_active(&self) -> usize {
self.inner.lock().unwrap().peak_active
}
}
// ── Display ───────────────────────────────────────────────────────────────────
impl fmt::Display for Reporter {
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
if self.stages.is_empty() {
return Ok(());
}
let n_cores = effective_parallelism();
// column widths
let nw = self
.stages
.iter()
.map(|s| s.label.len())
.max()
.unwrap_or(5)
.max(5);
// efficiency col: worst-case width for this run's n_cores value
let ew = format!("{:.1}×/{} (100%)", 99.9f64, n_cores).len();
let sep_w = nw + 2 + 7 + 2 + ew + 2 + 8 + 2 + 12;
let sep = "─".repeat(sep_w);
// header
writeln!(
f,
"{:<nw$} {:>7} {:>ew$} {:>8} status",
"stage", "wall", "efficiency", "peak RSS"
)?;
writeln!(f, "{sep}")?;
// compute all diagnoses up front (needed for both table and footnotes)
let diagnoses: Vec<Diagnosis> = self.stages.iter().map(|s| diagnose(s, n_cores)).collect();
// per-stage rows
for (s, d) in self.stages.iter().zip(diagnoses.iter()) {
writeln!(
f,
"{:<nw$} {:>7} {:>ew$} {:>8} {}",
s.label,
fmt_secs(s.wall_secs),
fmt_efficiency(s.parallelism(), n_cores),
fmt_bytes(s.max_rss_bytes),
d.tag,
)?;
}
// totals
let tw = self.stages.iter().map(|s| s.wall_secs).sum::<f64>();
let tu = self.stages.iter().map(|s| s.user_secs).sum::<f64>();
let ts = self.stages.iter().map(|s| s.sys_secs).sum::<f64>();
let trss = self
.stages
.iter()
.map(|s| s.max_rss_bytes)
.max()
.unwrap_or(0);
let tpar = if tw > 1e-9 { (tu + ts) / tw } else { 0.0 };
writeln!(f, "{sep}")?;
writeln!(
f,
"{:<nw$} {:>7} {:>ew$} {:>8}",
"TOTAL",
fmt_secs(tw),
fmt_efficiency(tpar, n_cores),
fmt_bytes(trss),
)?;
// bottleneck footnotes (only if at least one anomaly detected)
let bottlenecks: Vec<(&str, &str)> = self
.stages
.iter()
.zip(diagnoses.iter())
.filter_map(|(s, d)| d.detail.as_deref().map(|det| (s.label.as_str(), det)))
.collect();
if !bottlenecks.is_empty() {
writeln!(f, "\nBottlenecks:")?;
for (label, detail) in &bottlenecks {
writeln!(f, " {label} — {detail}")?;
}
}
Ok(())
}
}
//! Cross-cutting system utilities: directory locking, progress/logging,
//! resource (CPU/memory) introspection, and per-stage profiling.
mod budget;
mod lock;
mod progress;
mod resources;
mod stage;
pub use budget::MemoryBudget;
pub use lock::DirLock;
pub use progress::{TracedBar, progress_bar, spinner};
pub use resources::{CpuSample, IoSample, available_memory_bytes, effective_parallelism, peak_rss_bytes};
pub use stage::{Reporter, Stage, StageStats};
+42
View File
@@ -0,0 +1,42 @@
use tracing::info;
/// Exclusive advisory lock on an index directory, held for the duration of
/// any command that writes into an already-existing index (building the
/// sibling annex, merging into a destination, filtering/selecting in place,
/// ...). Two such commands racing on the same directory can otherwise
/// corrupt each other's writes with no error from either side.
///
/// Only the directory actually being *written to* needs a lock — a command
/// like `merge` that reads several source indexes to build one destination
/// only needs to lock the destination.
///
/// Uses the OS's advisory file lock (`flock` on Unix, `LockFileEx` on
/// Windows) via `fs4`, not a hand-rolled PID file: the OS releases it
/// automatically on process exit, including a crash — no stale-lock cleanup
/// logic needed.
pub struct DirLock {
_file: std::fs::File,
}
impl DirLock {
/// Block until the exclusive lock on `dir` is acquired (creating `dir`
/// and the lock file within it if needed). Logs once if the wait is
/// non-trivial, so a blocked command doesn't look silently hung.
pub fn acquire(dir: &std::path::Path) -> std::io::Result<Self> {
use fs4::fs_std::FileExt;
std::fs::create_dir_all(dir)?;
let lock_path = dir.join(".obikmer.lock");
let file = std::fs::OpenOptions::new()
.create(true)
.truncate(false)
.write(true)
.open(&lock_path)?;
if file.try_lock_exclusive().is_err() {
info!(dir = %dir.display(), "waiting for another obikmer process to release this index");
file.lock_exclusive()?;
}
Ok(Self { _file: file })
}
}
+114
View File
@@ -0,0 +1,114 @@
use std::sync::atomic::{AtomicU64, Ordering};
use std::time::{Duration, Instant};
use indicatif::{ProgressBar, ProgressStyle};
use tracing::{debug, info};
const BRAILLE: &[&str] = &["⠋", "⠙", "⠹", "⠸", "⠼", "⠴", "⠦", "⠧", "⠇", "⠏"];
/// Wrapper around `ProgressBar` that emits `tracing` events when stderr is not
/// a TTY (e.g. HPC job logs): every 10% for bounded bars, every ~10 s for
/// spinners (throttled on `set_message`).
pub struct TracedBar {
pb: ProgressBar,
label: String,
unit: String,
total: u64, // 0 for spinners
start: Instant, // creation time, for spinner throttling
last_pct: AtomicU64, // last emitted 10%-bucket (1..=10), 0 = none yet
last_log_ms: AtomicU64, // ms since `start` at last spinner log
}
impl TracedBar {
pub fn inc(&self, delta: u64) {
self.pb.inc(delta);
if self.pb.is_hidden() && self.total > 0 {
let pos = self.pb.position();
let pct10 = (pos * 10) / self.total; // 0..=10
let last = self.last_pct.load(Ordering::Relaxed);
if pct10 > last
&& self
.last_pct
.compare_exchange(last, pct10, Ordering::Relaxed, Ordering::Relaxed)
.is_ok()
{
info!(
stage = %self.label,
progress = format_args!("{}%", pct10 * 10),
"{}/{} {}",
pos, self.total, self.unit
);
}
}
}
pub fn set_message(&self, msg: impl Into<String>) {
let msg = msg.into();
if self.pb.is_hidden() {
if self.total > 0 {
debug!(stage = %self.label, "{msg}");
} else {
// spinner: throttle to ~10 s
let now_ms = self.start.elapsed().as_millis() as u64;
let last = self.last_log_ms.load(Ordering::Relaxed);
if now_ms >= last + 10_000
&& self
.last_log_ms
.compare_exchange(last, now_ms, Ordering::Relaxed, Ordering::Relaxed)
.is_ok()
{
info!(stage = %self.label, "{msg}");
}
}
}
self.pb.set_message(msg);
}
pub fn finish_and_clear(&self) {
self.pb.finish_and_clear();
}
}
/// Spinner with the standard project look: `⠋ label — msg 0s`.
/// Caller updates the message with `pb.set_message(...)`.
pub fn spinner(label: &str) -> TracedBar {
let pb = ProgressBar::new_spinner();
pb.set_style(
ProgressStyle::with_template(&format!("{{spinner}} {label} — {{msg}} {{elapsed}}"))
.unwrap()
.tick_strings(BRAILLE),
);
pb.enable_steady_tick(Duration::from_millis(100));
TracedBar {
pb,
label: label.to_string(),
unit: String::new(),
total: 0,
start: Instant::now(),
last_pct: AtomicU64::new(0),
last_log_ms: AtomicU64::new(0),
}
}
/// Progress bar with the standard project look:
/// `⠋ label — [████░░░░] pos/len unit elapsed`.
pub fn progress_bar(label: &str, n: u64, unit: &str) -> TracedBar {
let pb = ProgressBar::new(n);
pb.set_style(
ProgressStyle::with_template(&format!(
"{{spinner}} {label} — {{bar:40.cyan/blue}} {{pos}}/{{len}} {unit} {{elapsed}}"
))
.unwrap()
.tick_strings(BRAILLE),
);
pb.enable_steady_tick(Duration::from_millis(100));
TracedBar {
pb,
label: label.to_string(),
unit: unit.to_string(),
total: n,
start: Instant::now(),
last_pct: AtomicU64::new(0),
last_log_ms: AtomicU64::new(0),
}
}
+355
View File
@@ -0,0 +1,355 @@
use std::time::Instant;
use libc::{RUSAGE_SELF, getrusage, rusage, timeval};
use sysinfo::System;
use tracing::debug;
// ── Memory query ──────────────────────────────────────────────────────────────
/// Returns the number of bytes available for allocation in the current process context.
///
/// On Linux, cgroup memory limits (SLURM, containers) are checked first: the
/// process may be constrained to far less than the host's available RAM.
/// Returns `min(cgroup_available, host_available)` when a finite limit is found.
///
/// On macOS, `available_memory()` can return 0 when the memory compressor
/// inflates the page count; in that case we fall back to half of total memory.
/// Returns the process peak RSS (high-water mark since process start).
/// Monotonically increasing — use delta before/after a phase to measure its RAM cost.
pub fn peak_rss_bytes() -> u64 {
rss_to_bytes(&get_rusage())
}
pub fn available_memory_bytes() -> u64 {
let sys = System::new_all();
let host_avail = match sys.available_memory() {
0 => sys.total_memory() / 2,
n => n,
};
#[cfg(target_os = "linux")]
if let Some(cg) = cgroup_v2_available().or_else(cgroup_v1_available) {
return cg.min(host_avail);
}
host_avail
}
/// cgroup v2 (unified hierarchy): reads memory.max and memory.current for the
/// current process's cgroup. Returns None if unlimited or on any parse error.
#[cfg(target_os = "linux")]
fn cgroup_v2_available() -> Option<u64> {
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
let rel = cgroup
.lines()
.find(|l| l.starts_with("0::"))?
.strip_prefix("0::")?
.trim();
let base = format!("/sys/fs/cgroup{rel}");
// "max" means no limit → parse::<u64>() fails → None
let limit: u64 = std::fs::read_to_string(format!("{base}/memory.max"))
.ok()?
.trim()
.parse()
.ok()?;
let used: u64 = std::fs::read_to_string(format!("{base}/memory.current"))
.ok()?
.trim()
.parse()
.ok()?;
Some(limit.saturating_sub(used))
}
/// cgroup v1 (memory subsystem): reads memory.limit_in_bytes and
/// memory.usage_in_bytes. Returns None if unlimited or on any parse error.
#[cfg(target_os = "linux")]
fn cgroup_v1_available() -> Option<u64> {
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
let path = cgroup
.lines()
.find(|l| l.contains(":memory:"))?
.split(':')
.nth(2)?;
let base = format!("/sys/fs/cgroup/memory{path}");
let limit: u64 = std::fs::read_to_string(format!("{base}/memory.limit_in_bytes"))
.ok()?
.trim()
.parse()
.ok()?;
// Kernel uses 2^63 (rounded to page) as "no limit" sentinel
if limit > (1u64 << 62) {
return None;
}
let used: u64 = std::fs::read_to_string(format!("{base}/memory.usage_in_bytes"))
.ok()?
.trim()
.parse()
.ok()?;
Some(limit.saturating_sub(used))
}
// ── CPU parallelism query ────────────────────────────────────────────────────
/// Returns the number of cores this process can actually use concurrently.
///
/// `std::thread::available_parallelism()` reads CPU affinity
/// (`sched_getaffinity`), not the container's CPU quota — a Docker/cgroup
/// container commonly reports the *host's* full core count this way while
/// actually being throttled (via `cpu.max`/`cpu.cfs_quota_us`) to a fraction
/// of a core. Sizing a thread/worker pool off the unthrottled count causes
/// severe oversubscription: dozens of threads contending for a sliver of
/// real CPU time, which can look indistinguishable from a hang for minutes
/// or hours (observed in CI). On Linux, this reads the cgroup CPU quota
/// first and returns `min(cgroup_quota, host_parallelism)` when a finite
/// quota is found; falls back to `available_parallelism()` otherwise (same
/// convention as [`available_memory_bytes`]).
pub fn effective_parallelism() -> usize {
let host = std::thread::available_parallelism().map(|n| n.get()).unwrap_or(1);
#[cfg(target_os = "linux")]
{
if let Some(quota) = cgroup_v2_cpu_quota() {
let effective = quota.clamp(1, host);
tracing::debug!(host, quota, effective, source = "cgroup v2", "effective_parallelism");
return effective;
}
if let Some(quota) = cgroup_v1_cpu_quota() {
let effective = quota.clamp(1, host);
tracing::debug!(host, quota, effective, source = "cgroup v1", "effective_parallelism");
return effective;
}
}
tracing::debug!(host, effective = host, source = "available_parallelism (no cgroup quota found)", "effective_parallelism");
host
}
/// cgroup v2 (unified hierarchy): reads `cpu.max` ("<quota> <period>", or
/// "max <period>" when unlimited) for the current process's cgroup, rounded
/// up to whole cores. Returns `None` if unlimited or on any parse error.
#[cfg(target_os = "linux")]
fn cgroup_v2_cpu_quota() -> Option<usize> {
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
let rel = cgroup
.lines()
.find(|l| l.starts_with("0::"))?
.strip_prefix("0::")?
.trim();
let base = format!("/sys/fs/cgroup{rel}");
let raw = std::fs::read_to_string(format!("{base}/cpu.max")).ok()?;
let mut parts = raw.split_whitespace();
let quota_str = parts.next()?;
let period: f64 = parts.next()?.parse().ok()?;
if quota_str == "max" {
return None; // unlimited
}
let quota: f64 = quota_str.parse().ok()?;
Some((quota / period).ceil().max(1.0) as usize)
}
/// cgroup v1 (cpu subsystem): reads `cpu.cfs_quota_us`/`cpu.cfs_period_us`,
/// rounded up to whole cores. Returns `None` if unlimited (quota <= 0) or on
/// any parse error.
#[cfg(target_os = "linux")]
fn cgroup_v1_cpu_quota() -> Option<usize> {
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
let path = cgroup
.lines()
.find(|l| l.contains(":cpu:") || l.contains(":cpu,cpuacct:"))?
.split(':')
.nth(2)?;
let base = format!("/sys/fs/cgroup/cpu{path}");
let quota: i64 = std::fs::read_to_string(format!("{base}/cpu.cfs_quota_us"))
.ok()?
.trim()
.parse()
.ok()?;
if quota <= 0 {
return None; // unlimited
}
let period: i64 = std::fs::read_to_string(format!("{base}/cpu.cfs_period_us"))
.ok()?
.trim()
.parse()
.ok()?;
if period <= 0 {
return None;
}
Some(((quota as f64) / (period as f64)).ceil().max(1.0) as usize)
}
// ── raw helpers ───────────────────────────────────────────────────────────────
pub(crate) fn get_rusage() -> rusage {
let mut ru = unsafe { std::mem::zeroed::<rusage>() };
unsafe { getrusage(RUSAGE_SELF, &mut ru) };
ru
}
pub(crate) fn tv_to_secs(tv: timeval) -> f64 {
tv.tv_sec as f64 + tv.tv_usec as f64 * 1e-6
}
#[cfg(target_os = "macos")]
pub(crate) fn rss_to_bytes(ru: &rusage) -> u64 {
ru.ru_maxrss as u64
}
#[cfg(not(target_os = "macos"))]
pub(crate) fn rss_to_bytes(ru: &rusage) -> u64 {
ru.ru_maxrss as u64 * 1024
}
// Monotonically increasing counters — negative delta would be a kernel bug.
pub(crate) fn delta(end: i64, start: i64) -> u64 {
(end - start).max(0) as u64
}
// ── CpuSample ─────────────────────────────────────────────────────────────────
/// Snapshot of process-wide CPU time + wall clock at a point in time.
/// Use [`cpu_efficiency`](Self::cpu_efficiency) to measure the fraction of
/// available cores used since the snapshot was taken.
pub struct CpuSample {
wall: Instant,
user_secs: f64,
sys_secs: f64,
previous: f64,
}
impl CpuSample {
pub fn now() -> Self {
let ru = get_rusage();
Self {
wall: Instant::now(),
user_secs: tv_to_secs(ru.ru_utime),
sys_secs: tv_to_secs(ru.ru_stime),
previous: 0.0,
}
}
/// (user_delta + sys_delta) / (wall_delta × n_cores) since this snapshot.
/// Returns 0.0 if less than 100 ms have elapsed (too noisy).
pub fn cpu_efficiency(&self, n_cores: usize) -> f64 {
let ru = get_rusage();
let wall = self.wall.elapsed().as_secs_f64();
if wall < 0.1 {
return 0.0;
}
let cpu =
(tv_to_secs(ru.ru_utime) - self.user_secs) + (tv_to_secs(ru.ru_stime) - self.sys_secs);
cpu / (wall * n_cores as f64)
}
pub fn do_i_activate(&mut self, threshold: f64) -> bool {
let delta_wall = self.wall.elapsed().as_secs_f64();
if delta_wall < 0.1 {
// Window too short to be meaningful — leave state untouched so it
// keeps accumulating until a real sample can be taken.
return false;
}
let n = CpuSample::now();
let delta_ru = (n.user_secs - self.user_secs) + (n.sys_secs - self.sys_secs);
let efficiency = delta_ru / delta_wall;
let activate = 0f64.max(efficiency - self.previous) >= threshold;
debug!(
"Do I activate : {} -> {} = {} Activate: {}",
self.previous,
efficiency,
0f64.max(efficiency - self.previous),
activate
);
self.previous = efficiency;
self.user_secs = n.user_secs;
self.sys_secs = n.sys_secs;
self.wall = n.wall;
activate
}
}
// ── IoSample ──────────────────────────────────────────────────────────────────
/// Snapshot of process-wide block I/O (bytes read + written) + wall clock.
///
/// Same activation protocol as [`CpuSample`], but the growth check in
/// [`do_i_activate`](Self::do_i_activate) is *relative* rather than absolute:
/// raw I/O throughput has no portable scale across storage devices, unlike a
/// core count.
pub struct IoSample {
wall: Instant,
bytes: u64,
previous_rate: f64,
}
impl IoSample {
pub fn now() -> Self {
Self {
wall: Instant::now(),
bytes: Self::read_bytes(),
previous_rate: 0.0,
}
}
/// Bytes actually submitted to the block layer (read + write), summed
/// process-wide. Returns 0 if unavailable — degrades gracefully to a
/// signal that never triggers activation (CPU-only heuristic).
#[cfg(target_os = "linux")]
fn read_bytes() -> u64 {
let Ok(io) = std::fs::read_to_string("/proc/self/io") else {
return 0;
};
io.lines()
.filter_map(|l| {
l.strip_prefix("read_bytes: ")
.or_else(|| l.strip_prefix("write_bytes: "))
})
.filter_map(|v| v.trim().parse::<u64>().ok())
.sum()
}
#[cfg(target_os = "macos")]
fn read_bytes() -> u64 {
use libc::{RUSAGE_INFO_V4, getpid, proc_pid_rusage, rusage_info_v4};
let mut info: rusage_info_v4 = unsafe { std::mem::zeroed() };
let ret =
unsafe { proc_pid_rusage(getpid(), RUSAGE_INFO_V4, &mut info as *mut _ as *mut _) };
if ret != 0 {
return 0;
}
info.ri_diskio_bytesread + info.ri_diskio_byteswritten
}
#[cfg(not(any(target_os = "linux", target_os = "macos")))]
fn read_bytes() -> u64 {
0
}
/// Same protocol as [`CpuSample::do_i_activate`] (0.1 s minimum window,
/// state untouched on early return), but growth is measured relative to
/// the previous rate. `threshold` is a fraction, e.g. `0.2` for a 20 %
/// increase in throughput since the last real sample.
pub fn do_i_activate(&mut self, threshold: f64) -> bool {
let elapsed = self.wall.elapsed().as_secs_f64();
if elapsed < 0.1 {
return false;
}
let n = Self::read_bytes();
let rate = n.saturating_sub(self.bytes) as f64 / elapsed;
let activate = if self.previous_rate == 0.0 {
rate > 0.0 // bootstrap: any measured throughput is signal enough
} else {
(rate - self.previous_rate) / self.previous_rate >= threshold
};
debug!(
"Do I activate (I/O) : {} -> {} Activate: {}",
self.previous_rate, rate, activate
);
self.previous_rate = rate;
self.bytes = n;
self.wall = Instant::now();
activate
}
}
+292
View File
@@ -0,0 +1,292 @@
use std::fmt;
use std::time::Instant;
use libc::rusage;
use tracing::{info, warn};
use crate::resources::{delta, effective_parallelism, get_rusage, rss_to_bytes, tv_to_secs};
// ── public API ────────────────────────────────────────────────────────────────
/// Snapshot taken at the start of a pipeline stage.
#[must_use = "call .stop() to record the stage"]
pub struct Stage {
label: String,
wall: Instant,
ru: rusage,
}
impl Stage {
pub fn start(label: impl Into<String>) -> Self {
let label = label.into();
info!(stage = %label, "started");
Self {
label,
wall: Instant::now(),
ru: get_rusage(),
}
}
pub fn stop(self) -> StageStats {
let wall_secs = self.wall.elapsed().as_secs_f64();
let end = get_rusage();
let stats = StageStats {
label: self.label,
wall_secs,
user_secs: tv_to_secs(end.ru_utime) - tv_to_secs(self.ru.ru_utime),
sys_secs: tv_to_secs(end.ru_stime) - tv_to_secs(self.ru.ru_stime),
max_rss_bytes: rss_to_bytes(&end),
minor_faults: delta(end.ru_minflt as i64, self.ru.ru_minflt as i64),
major_faults: delta(end.ru_majflt as i64, self.ru.ru_majflt as i64),
vol_ctx: delta(end.ru_nvcsw as i64, self.ru.ru_nvcsw as i64),
invol_ctx: delta(end.ru_nivcsw as i64, self.ru.ru_nivcsw as i64),
in_blocks: delta(end.ru_inblock as i64, self.ru.ru_inblock as i64),
out_blocks: delta(end.ru_oublock as i64, self.ru.ru_oublock as i64),
swaps: delta(end.ru_nswap as i64, self.ru.ru_nswap as i64),
};
info!(
stage = %stats.label,
wall_secs = format_args!("{:.3}", stats.wall_secs),
rss = %fmt_bytes(stats.max_rss_bytes),
swaps = stats.swaps,
"done"
);
if stats.swaps > 0 {
warn!(
stage = %stats.label,
swaps = stats.swaps,
"working set exceeds available RAM"
);
}
stats
}
}
/// Per-stage efficiency metrics collected from `getrusage(RUSAGE_SELF)` deltas.
pub struct StageStats {
pub label: String,
pub wall_secs: f64,
pub user_secs: f64,
pub sys_secs: f64,
/// Peak RSS at end of stage (bytes). ru_maxrss is a process-lifetime maximum,
/// so this reflects the high-water mark up to and including this stage.
pub max_rss_bytes: u64,
pub minor_faults: u64,
pub major_faults: u64,
pub vol_ctx: u64, // voluntary context switches
pub invol_ctx: u64, // involuntary context switches
pub in_blocks: u64, // filesystem block reads (after page cache)
pub out_blocks: u64, // filesystem block writes
pub swaps: u64,
}
impl StageStats {
/// (user + sys) / wall — effective thread count utilisation.
pub fn parallelism(&self) -> f64 {
if self.wall_secs > 1e-9 {
(self.user_secs + self.sys_secs) / self.wall_secs
} else {
0.0
}
}
/// parallelism / n_cores — fraction of available CPU power used (0..1+).
pub fn efficiency(&self, n_cores: usize) -> f64 {
self.parallelism() / n_cores as f64
}
}
/// Accumulates stage stats and prints a human-readable summary table.
#[derive(Default)]
pub struct Reporter {
stages: Vec<StageStats>,
}
impl Reporter {
pub fn new() -> Self {
Self::default()
}
pub fn push(&mut self, stats: StageStats) {
self.stages.push(stats);
}
pub fn stages(&self) -> &[StageStats] {
&self.stages
}
/// Print the summary to stderr.
pub fn print(&self) {
eprint!("{self}");
}
}
// ── diagnosis ─────────────────────────────────────────────────────────────────
struct Diagnosis {
tag: &'static str,
detail: Option<String>,
}
// Thresholds are intentionally conservative to avoid false positives.
fn diagnose(s: &StageStats, n_cores: usize) -> Diagnosis {
let eff = s.efficiency(n_cores);
let cpu_pct = eff * 100.0;
let io_ops = s.in_blocks + s.out_blocks;
// swaps > 0 is the only reliable cross-platform indicator of true RAM exhaustion.
// ru_majflt is intentionally excluded: on macOS it counts all file-backed mmap
// page-ins (even from page cache), making it useless as a memory-pressure signal
// for mmap-heavy code. On Linux it is more meaningful, but swaps covers the
// severe case on both platforms.
if s.swaps > 0 {
return Diagnosis {
tag: "swapping",
detail: Some(format!(
"swapped {} time(s) — working set exceeds available RAM",
s.swaps,
)),
};
}
if eff < 0.3 && io_ops > 100 {
return Diagnosis {
tag: "disk I/O",
detail: Some(format!(
"{} block reads + {} writes — CPU at {:.0}%, stage is I/O-bound",
s.in_blocks, s.out_blocks, cpu_pct,
)),
};
}
if eff < 0.3 && s.vol_ctx > 200 {
return Diagnosis {
tag: "contention",
detail: Some(format!(
"{} voluntary context switches — CPU at {:.0}%, possible lock contention or I/O wait",
s.vol_ctx, cpu_pct,
)),
};
}
Diagnosis {
tag: "—",
detail: None,
}
}
// ── display helpers ───────────────────────────────────────────────────────────
fn fmt_secs(s: f64) -> String {
if s >= 100.0 {
format!("{:.0}s", s)
} else if s >= 10.0 {
format!("{:.1}s", s)
} else if s >= 1.0 {
format!("{:.2}s", s)
} else {
format!("{:.0}ms", s * 1000.0)
}
}
fn fmt_bytes(b: u64) -> String {
if b >= 1 << 30 {
format!("{:.1} GB", b as f64 / (1u64 << 30) as f64)
} else if b >= 1 << 20 {
format!("{:.0} MB", b as f64 / (1u64 << 20) as f64)
} else {
format!("{:.0} KB", b as f64 / 1024.0)
}
}
fn fmt_efficiency(par: f64, n_cores: usize) -> String {
format!(
"{:.1}×/{} ({:.0}%)",
par,
n_cores,
par / n_cores as f64 * 100.0
)
}
// ── Display ───────────────────────────────────────────────────────────────────
impl fmt::Display for Reporter {
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
if self.stages.is_empty() {
return Ok(());
}
let n_cores = effective_parallelism();
// column widths
let nw = self
.stages
.iter()
.map(|s| s.label.len())
.max()
.unwrap_or(5)
.max(5);
// efficiency col: worst-case width for this run's n_cores value
let ew = format!("{:.1}×/{} (100%)", 99.9f64, n_cores).len();
let sep_w = nw + 2 + 7 + 2 + ew + 2 + 8 + 2 + 12;
let sep = "─".repeat(sep_w);
// header
writeln!(
f,
"{:<nw$} {:>7} {:>ew$} {:>8} status",
"stage", "wall", "efficiency", "peak RSS"
)?;
writeln!(f, "{sep}")?;
// compute all diagnoses up front (needed for both table and footnotes)
let diagnoses: Vec<Diagnosis> = self.stages.iter().map(|s| diagnose(s, n_cores)).collect();
// per-stage rows
for (s, d) in self.stages.iter().zip(diagnoses.iter()) {
writeln!(
f,
"{:<nw$} {:>7} {:>ew$} {:>8} {}",
s.label,
fmt_secs(s.wall_secs),
fmt_efficiency(s.parallelism(), n_cores),
fmt_bytes(s.max_rss_bytes),
d.tag,
)?;
}
// totals
let tw = self.stages.iter().map(|s| s.wall_secs).sum::<f64>();
let tu = self.stages.iter().map(|s| s.user_secs).sum::<f64>();
let ts = self.stages.iter().map(|s| s.sys_secs).sum::<f64>();
let trss = self
.stages
.iter()
.map(|s| s.max_rss_bytes)
.max()
.unwrap_or(0);
let tpar = if tw > 1e-9 { (tu + ts) / tw } else { 0.0 };
writeln!(f, "{sep}")?;
writeln!(
f,
"{:<nw$} {:>7} {:>ew$} {:>8}",
"TOTAL",
fmt_secs(tw),
fmt_efficiency(tpar, n_cores),
fmt_bytes(trss),
)?;
// bottleneck footnotes (only if at least one anomaly detected)
let bottlenecks: Vec<(&str, &str)> = self
.stages
.iter()
.zip(diagnoses.iter())
.filter_map(|(s, d)| d.detail.as_deref().map(|det| (s.label.as_str(), det)))
.collect();
if !bottlenecks.is_empty() {
writeln!(f, "\nBottlenecks:")?;
for (label, detail) in &bottlenecks {
writeln!(f, " {label} — {detail}")?;
}
}
Ok(())
}
}