refactor: centralize k-mer config and introduce packed sequences
Centralize k-mer and minimizer configuration using a thread-safe global module, and replace manual bit-packing with a memory-efficient `PackedSeq` type. Refactor core sequence and k-mer types to use compile-time length enforcement and centralized hashing. Introduce a new De Bruijn graph implementation with compact node encoding and traversal iterators. Update I/O, partitioning, and builder modules to align with the new architecture, and add the `xxhash-rust` dependency.
This commit is contained in:
1 parent
602f414957
commit
8c17bf958b
37 files changed
+2641
-2456
No files matched your search
Generated
+1
@@ -1575,6 +1575,7 @@ dependencies = [
|
||||
"hashbrown 0.14.5",
|
||||
"obifastwrite",
|
||||
"obikseq",
|
||||
"xxhash-rust",
|
||||
]
|
||||
|
||||
[[package]]
|
||||
|
||||
@@ -8,3 +8,7 @@ obikseq = { path = "../obikseq" }
|
||||
obifastwrite = { path = "../obifastwrite" }
|
||||
ahash = "0.8"
|
||||
hashbrown = "0.14"
|
||||
xxhash-rust = { version = "0.8.15", features = ["xxh3", "const_xxh3"] }
|
||||
|
||||
[dev-dependencies]
|
||||
obikseq = { path = "../obikseq", features = ["test-utils"] }
|
||||
@@ -0,0 +1,573 @@
|
||||
//use ahash::RandomState;
|
||||
use hashbrown::HashMap;
|
||||
use obifastwrite::write_unitig;
|
||||
use obikseq::k;
|
||||
use obikseq::unitig::Unitig;
|
||||
use obikseq::{CanonicalKmer, Kmer, Sequence};
|
||||
use std::cell::Cell;
|
||||
use std::fmt;
|
||||
use std::io;
|
||||
use xxhash_rust::xxh3::Xxh3Builder;
|
||||
|
||||
// ── Types ─────────────────────────────────────────────────────────────────────
|
||||
|
||||
type FastHashMap<K, V> = HashMap<K, V, Xxh3Builder>;
|
||||
|
||||
// ── Node ──────────────────────────────────────────────────────────────────────
|
||||
//
|
||||
// bit layout (LSB first):
|
||||
// bit 0 : can_extend_right — exactly one right canonical neighbour exists
|
||||
// bit 1 : can_extend_left — exactly one left canonical neighbour exists
|
||||
// bit 2 : visited
|
||||
// bits 3–4 : right_nuc — index 0–3 (A/C/G/T) of that neighbour; valid iff bit 0 = 1
|
||||
// bits 5–6 : left_nuc — index 0–3 (A/C/G/T) of that neighbour; valid iff bit 1 = 1
|
||||
// bit 7 : reserved (0)
|
||||
//
|
||||
// "can_extend" = false covers both 0 neighbours and ≥2 neighbours; the only
|
||||
// information needed for traversal is "exactly one".
|
||||
|
||||
#[repr(transparent)]
|
||||
#[derive(Debug, Clone, Copy, Default)]
|
||||
pub struct Node(u8);
|
||||
|
||||
impl Node {
|
||||
/// Returns `true` if the node can be extended to the right.
|
||||
///
|
||||
/// A single right neighbour exists.
|
||||
pub fn can_extend_right(self) -> bool {
|
||||
self.0 & 0b0000_0001 != 0
|
||||
}
|
||||
|
||||
/// Returns `true` if the node can be extended to the left.
|
||||
///
|
||||
/// A single left neighbour exists.
|
||||
pub fn can_extend_left(self) -> bool {
|
||||
self.0 & 0b0000_0010 != 0
|
||||
}
|
||||
|
||||
/// Returns `true` if the node has been visited.
|
||||
pub fn is_visited(self) -> bool {
|
||||
self.0 & 0b0000_0100 != 0
|
||||
}
|
||||
|
||||
/// Index of the unique right neighbour (0=A, 1=C, 2=G, 3=T).
|
||||
/// Only meaningful when `can_extend_right()` is true.
|
||||
pub fn right_nuc(self) -> u8 {
|
||||
(self.0 >> 3) & 0b11
|
||||
}
|
||||
|
||||
/// Index of the unique left neighbour (0=A, 1=C, 2=G, 3=T).
|
||||
/// Only meaningful when `can_extend_left()` is true.
|
||||
pub fn left_nuc(self) -> u8 {
|
||||
(self.0 >> 5) & 0b11
|
||||
}
|
||||
|
||||
/// Marks the node as visited.
|
||||
pub fn set_visited(&mut self) {
|
||||
if self.is_visited() {
|
||||
unreachable!("from: is_visited -> The node has already been visited")
|
||||
}
|
||||
self.0 |= 0b0000_0100;
|
||||
}
|
||||
|
||||
/// Number of left neighbours.
|
||||
pub fn n_left_neighbours(self) -> u8 {
|
||||
if self.can_extend_left() {
|
||||
1
|
||||
} else {
|
||||
let v = (self.0 >> 5) & 0b11;
|
||||
v + (v != 0) as u8
|
||||
}
|
||||
}
|
||||
|
||||
/// Number of right neighbours.
|
||||
pub fn n_right_neighbours(self) -> u8 {
|
||||
if self.can_extend_right() {
|
||||
1
|
||||
} else {
|
||||
let v = (self.0 >> 3) & 0b11;
|
||||
v + (v != 0) as u8
|
||||
}
|
||||
}
|
||||
|
||||
/// `nuc` = Some(i) → exactly one neighbour (bit 0 set, bits 3–4 = nucleotide index).
|
||||
/// `nuc` = None → 0 or ≥2 neighbours; `count` encoded in bits 3–4 as count.sat_sub(1).
|
||||
pub fn set_right(&mut self, count: u8, nuc: Option<u8>) {
|
||||
self.0 &= !(0b0000_0001 | 0b001_1000);
|
||||
if count == 1 {
|
||||
self.0 |= 0b0000_0001;
|
||||
if let Some(n) = nuc {
|
||||
self.0 |= (n & 0b11) << 3;
|
||||
return;
|
||||
}
|
||||
unreachable!("nuc must be Some when count is 1");
|
||||
}
|
||||
self.0 |= (count.saturating_sub(1).min(3)) << 3;
|
||||
}
|
||||
|
||||
/// `nuc` = Some(i) → exactly one neighbour (bit 0 set, bits 3–4 = nucleotide index).
|
||||
/// `nuc` = None → 0 or ≥2 neighbours; `count` encoded in bits 3–4 as count.sat_sub(1).
|
||||
pub fn set_left(&mut self, count: u8, nuc: Option<u8>) {
|
||||
self.0 &= !(0b0000_0010 | 0b0110_0000);
|
||||
if count == 1 {
|
||||
self.0 |= 0b0000_0010;
|
||||
if let Some(n) = nuc {
|
||||
self.0 |= (n & 0b11) << 5;
|
||||
return;
|
||||
}
|
||||
unreachable!("nuc must be Some when count is 1");
|
||||
}
|
||||
self.0 |= (count.saturating_sub(1).min(3)) << 5;
|
||||
}
|
||||
}
|
||||
|
||||
impl fmt::Display for Node {
|
||||
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
|
||||
const NUC: [char; 4] = ['A', 'C', 'G', 'T'];
|
||||
let r = if self.can_extend_right() {
|
||||
format!("→{}", NUC[self.right_nuc() as usize])
|
||||
} else {
|
||||
format!("→{}", self.n_right_neighbours())
|
||||
};
|
||||
let l = if self.can_extend_left() {
|
||||
format!("←{}", NUC[self.left_nuc() as usize])
|
||||
} else {
|
||||
format!("←{}", self.n_left_neighbours())
|
||||
};
|
||||
let v = if self.is_visited() { "V" } else { "." };
|
||||
write!(f, "Node({r} {l} {v})")
|
||||
}
|
||||
}
|
||||
|
||||
// ── GraphDeBruijn ─────────────────────────────────────────────────────────────
|
||||
|
||||
pub struct GraphDeBruijn {
|
||||
nodes: FastHashMap<CanonicalKmer, Cell<Node>>,
|
||||
}
|
||||
|
||||
impl GraphDeBruijn {
|
||||
pub fn new() -> Self {
|
||||
Self {
|
||||
nodes: FastHashMap::with_hasher(Xxh3Builder::new()),
|
||||
}
|
||||
}
|
||||
|
||||
pub fn with_capacity(capacity: usize) -> Self {
|
||||
Self {
|
||||
nodes: FastHashMap::with_capacity_and_hasher(capacity, Xxh3Builder::new()),
|
||||
}
|
||||
}
|
||||
|
||||
/// Insert a canonical kmer into the graph. No-op if already present.
|
||||
pub fn push(&mut self, kmer: CanonicalKmer) {
|
||||
self.nodes
|
||||
.entry(kmer)
|
||||
.or_insert_with(|| Cell::new(Node::default()));
|
||||
}
|
||||
|
||||
/// For every node, find its unique right/left canonical neighbour (if any)
|
||||
/// and store the nucleotide index in the Node flags.
|
||||
///
|
||||
/// Single pass thanks to Cell interior mutability.
|
||||
pub fn compute_degrees(&self) {
|
||||
for (&kmer, cell) in &self.nodes {
|
||||
let (rc, rn) = count_neighbors(kmer.right_canonical_neighbors(), &self.nodes);
|
||||
let (lc, ln) = count_neighbors(kmer.left_canonical_neighbors(), &self.nodes);
|
||||
|
||||
let mut node = cell.get();
|
||||
node.set_right(rc, rn);
|
||||
node.set_left(lc, ln);
|
||||
cell.set(node);
|
||||
}
|
||||
}
|
||||
|
||||
/// Iterates over the right neighbors of `kmer`.
|
||||
pub fn iter_right_neighbors(
|
||||
&self,
|
||||
kmer: CanonicalKmer,
|
||||
) -> impl Iterator<Item = CanonicalKmer> + '_ {
|
||||
kmer.right_canonical_neighbors()
|
||||
.into_iter()
|
||||
.filter_map(|kmer| {
|
||||
self.nodes.get(&kmer)?;
|
||||
Some(kmer)
|
||||
})
|
||||
}
|
||||
|
||||
/// Iterates over the left neighbors of `kmer`.
|
||||
pub fn iter_left_neighbors(
|
||||
&self,
|
||||
kmer: CanonicalKmer,
|
||||
) -> impl Iterator<Item = CanonicalKmer> + '_ {
|
||||
kmer.left_canonical_neighbors()
|
||||
.into_iter()
|
||||
.filter_map(|kmer| {
|
||||
self.nodes.get(&kmer)?;
|
||||
Some(kmer)
|
||||
})
|
||||
}
|
||||
|
||||
pub fn is_visited(&self, kmer: &CanonicalKmer) -> Option<bool> {
|
||||
self.nodes.get(kmer).map(|cell| cell.get().is_visited())
|
||||
}
|
||||
|
||||
pub fn set_visited(&self, kmer: CanonicalKmer) {
|
||||
if let Some(cell) = self.nodes.get(&kmer) {
|
||||
let mut node = cell.get();
|
||||
node.set_visited();
|
||||
cell.set(node);
|
||||
}
|
||||
}
|
||||
|
||||
/// Returns the single right neighbor of `kmer`, if it exists.
|
||||
pub fn the_single_right_neighbor(&self, kmer: CanonicalKmer) -> Option<CanonicalKmer> {
|
||||
let node = self.nodes.get(&kmer)?.get();
|
||||
if !node.can_extend_right() {
|
||||
return None;
|
||||
}
|
||||
let next = kmer.into_kmer().push_right(node.right_nuc()).canonical();
|
||||
self.nodes.contains_key(&next).then_some(next)
|
||||
}
|
||||
|
||||
/// Returns the single left neighbor of `kmer`, if it exists.
|
||||
pub fn the_single_left_neighbor(&self, kmer: CanonicalKmer) -> Option<CanonicalKmer> {
|
||||
let node = self.nodes.get(&kmer)?.get();
|
||||
if !node.can_extend_left() {
|
||||
return None;
|
||||
}
|
||||
let next = kmer.into_kmer().push_left(node.left_nuc()).canonical();
|
||||
self.nodes.contains_key(&next).then_some(next)
|
||||
}
|
||||
|
||||
/// Internal iterator over unitig-start nodes; drives `iter_unitig`.
|
||||
///
|
||||
/// MUST NOT be consumed standalone: the second pass finds cycle nodes only
|
||||
/// because `iter_unitig` lazily interleaves chain traversal between the two passes.
|
||||
///
|
||||
/// Two passes:
|
||||
/// 1. Chain ends / isolated nodes (at most one extension missing):
|
||||
/// - `!can_extend_left` → yield canonical form
|
||||
/// - `!can_extend_right` → yield reverse complement
|
||||
/// 2. Nodes still unvisited → part of a cycle; yield canonical form.
|
||||
fn start_iter(&self) -> impl Iterator<Item = (CanonicalKmer, Option<Kmer>)> + '_ {
|
||||
StartIter::new(self)
|
||||
}
|
||||
|
||||
fn next_unitig_kmer(&self, kmer: Kmer) -> Option<Kmer> {
|
||||
let canonical = kmer.canonical();
|
||||
let node = self.nodes.get(&canonical)?.get();
|
||||
|
||||
let direct = kmer.raw() == canonical.raw();
|
||||
|
||||
if (direct && !node.can_extend_right()) || (!direct && !node.can_extend_left()) {
|
||||
return None;
|
||||
}
|
||||
|
||||
let next_c: CanonicalKmer = if direct {
|
||||
canonical
|
||||
.into_kmer()
|
||||
.push_right(node.right_nuc())
|
||||
.canonical()
|
||||
} else {
|
||||
canonical.into_kmer().push_left(node.left_nuc()).canonical()
|
||||
};
|
||||
|
||||
let cell = self.nodes.get(&next_c)?;
|
||||
let next_node = cell.get();
|
||||
if next_node.is_visited() {
|
||||
return None;
|
||||
}
|
||||
|
||||
let oriented = oriented_next(kmer, next_c);
|
||||
let ndirect = oriented.raw() == next_c.raw();
|
||||
|
||||
if (ndirect && next_node.n_right_neighbours() > 1)
|
||||
|| (!ndirect && next_node.n_left_neighbours() > 1)
|
||||
{
|
||||
return None;
|
||||
}
|
||||
|
||||
let mut updated = next_node;
|
||||
updated.set_visited();
|
||||
cell.set(updated);
|
||||
Some(oriented)
|
||||
}
|
||||
|
||||
fn next_longtig_kmer(&self, kmer: Kmer) -> Option<Kmer> {
|
||||
let canonical = kmer.canonical();
|
||||
let node = self.nodes.get(&canonical)?.get();
|
||||
|
||||
let direct = kmer.raw() == canonical.raw();
|
||||
|
||||
if (direct && node.n_right_neighbours() == 0) || (!direct && node.n_left_neighbours() == 0)
|
||||
{
|
||||
return None;
|
||||
}
|
||||
|
||||
let next_c: CanonicalKmer = if direct {
|
||||
if node.can_extend_right() {
|
||||
canonical
|
||||
.into_kmer()
|
||||
.push_right(node.right_nuc())
|
||||
.canonical()
|
||||
} else {
|
||||
self.iter_right_neighbors(canonical)
|
||||
.filter(|n| !self.is_visited(n).unwrap_or(true))
|
||||
.next()?
|
||||
}
|
||||
} else {
|
||||
if node.can_extend_left() {
|
||||
canonical.into_kmer().push_left(node.left_nuc()).canonical()
|
||||
} else {
|
||||
self.iter_left_neighbors(canonical)
|
||||
.filter(|n| !self.is_visited(n).unwrap_or(true))
|
||||
.next()?
|
||||
}
|
||||
};
|
||||
|
||||
let cell = self.nodes.get(&next_c)?;
|
||||
let next_node = cell.get();
|
||||
if next_node.is_visited() {
|
||||
return None;
|
||||
}
|
||||
|
||||
let oriented = oriented_next(kmer, next_c);
|
||||
let ndirect = oriented.raw() == next_c.raw();
|
||||
|
||||
if (ndirect && next_node.n_right_neighbours() > 1)
|
||||
|| (!ndirect && next_node.n_left_neighbours() > 1)
|
||||
{
|
||||
return None;
|
||||
}
|
||||
|
||||
let mut updated = next_node;
|
||||
updated.set_visited();
|
||||
cell.set(updated);
|
||||
Some(oriented)
|
||||
}
|
||||
|
||||
fn iter_unitig_kmers(&self, start: Kmer) -> UnitigIter<'_> {
|
||||
UnitigIter {
|
||||
graph: self,
|
||||
current: Some(start),
|
||||
}
|
||||
}
|
||||
|
||||
fn iter_longtig_kmers(&self, start: Kmer) -> LongtigIter<'_> {
|
||||
LongtigIter {
|
||||
graph: self,
|
||||
current: Some(start),
|
||||
}
|
||||
}
|
||||
|
||||
pub fn iter_unitig(&self) -> impl Iterator<Item = Unitig> + '_ {
|
||||
let k = k();
|
||||
self.start_iter().map(move |(start, first_next)| {
|
||||
let mut nucs: Vec<u8> = (0..k).map(|i| start.nucleotide(i)).collect();
|
||||
if let Some(next_c) = first_next {
|
||||
for kmer in self.iter_unitig_kmers(next_c) {
|
||||
nucs.push(kmer.nucleotide(k - 1));
|
||||
}
|
||||
}
|
||||
Unitig::from_nucleotides(&nucs)
|
||||
})
|
||||
}
|
||||
|
||||
pub fn iter_longtig(&self) -> impl Iterator<Item = Unitig> + '_ {
|
||||
let k = k();
|
||||
self.start_iter().map(move |(start, first_next)| {
|
||||
let mut nucs: Vec<u8> = (0..k).map(|i| start.nucleotide(i)).collect();
|
||||
if let Some(next_c) = first_next {
|
||||
for kmer in self.iter_longtig_kmers(next_c) {
|
||||
nucs.push(kmer.nucleotide(k - 1));
|
||||
}
|
||||
}
|
||||
Unitig::from_nucleotides(&nucs)
|
||||
})
|
||||
}
|
||||
|
||||
/// Write all unitigs to `out` in FASTA format.
|
||||
///
|
||||
/// Calls [`obifastwrite::write_unitig`] for each unitig produced by
|
||||
/// [`iter_unitig`]. Stops and returns the first I/O error encountered.
|
||||
pub fn write_fasta<W: io::Write>(&self, out: &mut W, unitig: bool) -> io::Result<()> {
|
||||
if unitig {
|
||||
for unitig in self.iter_unitig() {
|
||||
write_unitig(&unitig, k(), out)?;
|
||||
}
|
||||
} else {
|
||||
for unitig in self.iter_longtig() {
|
||||
write_unitig(&unitig, k(), out)?;
|
||||
}
|
||||
}
|
||||
Ok(())
|
||||
}
|
||||
|
||||
pub fn len(&self) -> usize {
|
||||
self.nodes.len()
|
||||
}
|
||||
|
||||
pub fn is_empty(&self) -> bool {
|
||||
self.nodes.is_empty()
|
||||
}
|
||||
}
|
||||
|
||||
// --- StartIter -----------------------------------------------------------------
|
||||
struct StartIter<'a> {
|
||||
graph: &'a GraphDeBruijn,
|
||||
nodes: hashbrown::hash_map::Iter<'a, CanonicalKmer, Cell<Node>>,
|
||||
suspended: Vec<CanonicalKmer>,
|
||||
in_cycle_pass: bool,
|
||||
}
|
||||
|
||||
impl<'a> StartIter<'a> {
|
||||
fn new(graph: &'a GraphDeBruijn) -> Self {
|
||||
Self {
|
||||
graph,
|
||||
nodes: graph.nodes.iter(),
|
||||
suspended: Vec::new(),
|
||||
in_cycle_pass: false,
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
impl<'a> Iterator for StartIter<'a> {
|
||||
type Item = (CanonicalKmer, Option<Kmer>);
|
||||
|
||||
fn next(&mut self) -> Option<(CanonicalKmer, Option<Kmer>)> {
|
||||
loop {
|
||||
let current = if let Some(k) = self.suspended.pop() {
|
||||
k
|
||||
} else {
|
||||
match self.nodes.next() {
|
||||
Some((&k, _)) => k,
|
||||
None => {
|
||||
if self.in_cycle_pass {
|
||||
return None;
|
||||
}
|
||||
self.in_cycle_pass = true;
|
||||
self.nodes = self.graph.nodes.iter();
|
||||
match self.nodes.next() {
|
||||
Some((&k, _)) => k,
|
||||
None => return None,
|
||||
}
|
||||
}
|
||||
}
|
||||
};
|
||||
|
||||
let node = match self.graph.nodes.get(¤t) {
|
||||
Some(c) => c.get(),
|
||||
None => continue,
|
||||
};
|
||||
if node.is_visited() {
|
||||
continue;
|
||||
}
|
||||
if !self.in_cycle_pass && node.can_extend_left() {
|
||||
continue;
|
||||
}
|
||||
|
||||
self.graph.set_visited(current);
|
||||
|
||||
if let Some(next) = self.graph.the_single_right_neighbor(current) {
|
||||
if self.graph.is_visited(&next).unwrap_or(true) {
|
||||
return Some((current, None));
|
||||
}
|
||||
self.graph.set_visited(next);
|
||||
let oriented = oriented_next(current.into_kmer(), next);
|
||||
return Some((current, Some(oriented)));
|
||||
}
|
||||
|
||||
let mut first_neighbor: Option<CanonicalKmer> = None;
|
||||
for neighbor in self.graph.iter_right_neighbors(current) {
|
||||
if self.graph.is_visited(&neighbor).unwrap_or(true) {
|
||||
continue;
|
||||
}
|
||||
if first_neighbor.is_none() {
|
||||
self.graph.set_visited(neighbor);
|
||||
first_neighbor = Some(neighbor);
|
||||
} else {
|
||||
self.suspended.push(neighbor);
|
||||
}
|
||||
}
|
||||
|
||||
let oriented = match first_neighbor {
|
||||
Some(neighbor) => Some(oriented_next(current.into_kmer(), neighbor)),
|
||||
None => None,
|
||||
};
|
||||
return Some((current, oriented));
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// ── UnitigIter ────────────────────────────────────────────────────────────────
|
||||
|
||||
struct UnitigIter<'a> {
|
||||
graph: &'a GraphDeBruijn,
|
||||
current: Option<Kmer>,
|
||||
}
|
||||
|
||||
impl Iterator for UnitigIter<'_> {
|
||||
type Item = Kmer;
|
||||
|
||||
fn next(&mut self) -> Option<Kmer> {
|
||||
let current = self.current?;
|
||||
self.current = self.graph.next_unitig_kmer(current);
|
||||
Some(current)
|
||||
}
|
||||
}
|
||||
|
||||
// ── UnitigIter ────────────────────────────────────────────────────────────────
|
||||
|
||||
struct LongtigIter<'a> {
|
||||
graph: &'a GraphDeBruijn,
|
||||
current: Option<Kmer>,
|
||||
}
|
||||
|
||||
impl Iterator for LongtigIter<'_> {
|
||||
type Item = Kmer;
|
||||
|
||||
fn next(&mut self) -> Option<Kmer> {
|
||||
let current = self.current?;
|
||||
self.current = self.graph.next_longtig_kmer(current);
|
||||
Some(current)
|
||||
}
|
||||
}
|
||||
|
||||
// ── helpers ───────────────────────────────────────────────────────────────────
|
||||
|
||||
fn oriented_next(from: Kmer, to: CanonicalKmer) -> Kmer {
|
||||
if from.is_overlapping(to.into_kmer()) {
|
||||
to.into_kmer()
|
||||
} else {
|
||||
to.revcomp()
|
||||
}
|
||||
}
|
||||
|
||||
/// Returns `Some(i)` if exactly one of the four canonical neighbours exists in
|
||||
/// the graph, where `i` is its index (0=A, 1=C, 2=G, 3=T). Returns `None` for
|
||||
/// zero or ≥2 existing neighbours.
|
||||
fn count_neighbors(
|
||||
neighbors: [CanonicalKmer; 4],
|
||||
nodes: &FastHashMap<CanonicalKmer, Cell<Node>>,
|
||||
) -> (u8, Option<u8>) {
|
||||
let mut count = 0u8;
|
||||
let mut first = None;
|
||||
for (i, neighbour) in neighbors.iter().enumerate() {
|
||||
if nodes.contains_key(neighbour) {
|
||||
count += 1;
|
||||
if first.is_none() {
|
||||
first = Some(i as u8);
|
||||
}
|
||||
}
|
||||
}
|
||||
if count == 1 {
|
||||
(1, first)
|
||||
} else {
|
||||
(count, None)
|
||||
}
|
||||
}
|
||||
|
||||
// ── tests ─────────────────────────────────────────────────────────────────────
|
||||
#[cfg(test)]
|
||||
#[path = "tests/debruijn.rs"]
|
||||
mod tests;
|
||||
+2
-889
@@ -1,890 +1,3 @@
|
||||
use ahash::RandomState;
|
||||
use hashbrown::HashMap;
|
||||
use obifastwrite::write_unitig;
|
||||
use obikseq::kmer::{self, CanonicalKmer, Kmer};
|
||||
use obikseq::unitig::Unitig;
|
||||
use std::cell::Cell;
|
||||
use std::fmt;
|
||||
use std::io;
|
||||
mod debruijn;
|
||||
|
||||
// ── Types ─────────────────────────────────────────────────────────────────────
|
||||
|
||||
type FastHashMap<K, V> = HashMap<K, V, RandomState>;
|
||||
|
||||
// ── Node ──────────────────────────────────────────────────────────────────────
|
||||
//
|
||||
// bit layout (LSB first):
|
||||
// bit 0 : can_extend_right — exactly one right canonical neighbour exists
|
||||
// bit 1 : can_extend_left — exactly one left canonical neighbour exists
|
||||
// bit 2 : visited
|
||||
// bits 3–4 : right_nuc — index 0–3 (A/C/G/T) of that neighbour; valid iff bit 0 = 1
|
||||
// bits 5–6 : left_nuc — index 0–3 (A/C/G/T) of that neighbour; valid iff bit 1 = 1
|
||||
// bit 7 : reserved (0)
|
||||
//
|
||||
// "can_extend" = false covers both 0 neighbours and ≥2 neighbours; the only
|
||||
// information needed for traversal is "exactly one".
|
||||
|
||||
#[repr(transparent)]
|
||||
#[derive(Debug, Clone, Copy, Default)]
|
||||
pub struct Node(u8);
|
||||
|
||||
impl Node {
|
||||
/// Returns `true` if the node can be extended to the right.
|
||||
///
|
||||
/// A single right neighbour exists.
|
||||
pub fn can_extend_right(self) -> bool {
|
||||
self.0 & 0b0000_0001 != 0
|
||||
}
|
||||
|
||||
/// Returns `true` if the node can be extended to the left.
|
||||
///
|
||||
/// A single left neighbour exists.
|
||||
pub fn can_extend_left(self) -> bool {
|
||||
self.0 & 0b0000_0010 != 0
|
||||
}
|
||||
|
||||
/// Returns `true` if the node has been visited.
|
||||
pub fn is_visited(self) -> bool {
|
||||
self.0 & 0b0000_0100 != 0
|
||||
}
|
||||
|
||||
/// Index of the unique right neighbour (0=A, 1=C, 2=G, 3=T).
|
||||
/// Only meaningful when `can_extend_right()` is true.
|
||||
pub fn right_nuc(self) -> u8 {
|
||||
(self.0 >> 3) & 0b11
|
||||
}
|
||||
|
||||
/// Index of the unique left neighbour (0=A, 1=C, 2=G, 3=T).
|
||||
/// Only meaningful when `can_extend_left()` is true.
|
||||
pub fn left_nuc(self) -> u8 {
|
||||
(self.0 >> 5) & 0b11
|
||||
}
|
||||
|
||||
/// Marks the node as visited.
|
||||
pub fn set_visited(&mut self) {
|
||||
if self.is_visited() {
|
||||
unreachable!("from: is_visited -> The node has already been visited")
|
||||
}
|
||||
self.0 |= 0b0000_0100;
|
||||
}
|
||||
|
||||
/// Number of left neighbours.
|
||||
pub fn n_left_neighbours(self) -> u8 {
|
||||
if self.can_extend_left() {
|
||||
1
|
||||
} else {
|
||||
let v = (self.0 >> 5) & 0b11;
|
||||
v + (v != 0) as u8
|
||||
}
|
||||
}
|
||||
|
||||
/// Number of right neighbours.
|
||||
pub fn n_right_neighbours(self) -> u8 {
|
||||
if self.can_extend_right() {
|
||||
1
|
||||
} else {
|
||||
let v = (self.0 >> 3) & 0b11;
|
||||
v + (v != 0) as u8
|
||||
}
|
||||
}
|
||||
|
||||
/// `nuc` = Some(i) → exactly one neighbour (bit 0 set, bits 3–4 = nucleotide index).
|
||||
/// `nuc` = None → 0 or ≥2 neighbours; `count` encoded in bits 3–4 as count.sat_sub(1).
|
||||
pub fn set_right(&mut self, count: u8, nuc: Option<u8>) {
|
||||
self.0 &= !(0b0000_0001 | 0b001_1000);
|
||||
if count == 1 {
|
||||
self.0 |= 0b0000_0001;
|
||||
if let Some(n) = nuc {
|
||||
self.0 |= (n & 0b11) << 3;
|
||||
return;
|
||||
}
|
||||
unreachable!("nuc must be Some when count is 1");
|
||||
}
|
||||
self.0 |= (count.saturating_sub(1).min(3)) << 3;
|
||||
}
|
||||
|
||||
/// `nuc` = Some(i) → exactly one neighbour (bit 0 set, bits 3–4 = nucleotide index).
|
||||
/// `nuc` = None → 0 or ≥2 neighbours; `count` encoded in bits 3–4 as count.sat_sub(1).
|
||||
pub fn set_left(&mut self, count: u8, nuc: Option<u8>) {
|
||||
self.0 &= !(0b0000_0010 | 0b0110_0000);
|
||||
if count == 1 {
|
||||
self.0 |= 0b0000_0010;
|
||||
if let Some(n) = nuc {
|
||||
self.0 |= (n & 0b11) << 5;
|
||||
return;
|
||||
}
|
||||
unreachable!("nuc must be Some when count is 1");
|
||||
}
|
||||
self.0 |= (count.saturating_sub(1).min(3)) << 5;
|
||||
}
|
||||
}
|
||||
|
||||
impl fmt::Display for Node {
|
||||
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
|
||||
const NUC: [char; 4] = ['A', 'C', 'G', 'T'];
|
||||
let r = if self.can_extend_right() {
|
||||
format!("→{}", NUC[self.right_nuc() as usize])
|
||||
} else {
|
||||
format!("→{}", self.n_right_neighbours())
|
||||
};
|
||||
let l = if self.can_extend_left() {
|
||||
format!("←{}", NUC[self.left_nuc() as usize])
|
||||
} else {
|
||||
format!("←{}", self.n_left_neighbours())
|
||||
};
|
||||
let v = if self.is_visited() { "V" } else { "." };
|
||||
write!(f, "Node({r} {l} {v})")
|
||||
}
|
||||
}
|
||||
|
||||
// ── GraphDeBruijn ─────────────────────────────────────────────────────────────
|
||||
|
||||
pub struct GraphDeBruijn {
|
||||
nodes: FastHashMap<CanonicalKmer, Cell<Node>>,
|
||||
k: usize,
|
||||
}
|
||||
|
||||
impl GraphDeBruijn {
|
||||
pub fn new(k: usize) -> Self {
|
||||
Self {
|
||||
nodes: FastHashMap::with_hasher(RandomState::new()),
|
||||
k,
|
||||
}
|
||||
}
|
||||
|
||||
pub fn with_capacity(k: usize, capacity: usize) -> Self {
|
||||
Self {
|
||||
nodes: FastHashMap::with_capacity_and_hasher(capacity, RandomState::new()),
|
||||
k,
|
||||
}
|
||||
}
|
||||
|
||||
/// Insert a canonical kmer into the graph. No-op if already present.
|
||||
pub fn push(&mut self, kmer: CanonicalKmer) {
|
||||
self.nodes
|
||||
.entry(kmer)
|
||||
.or_insert_with(|| Cell::new(Node::default()));
|
||||
}
|
||||
|
||||
/// For every node, find its unique right/left canonical neighbour (if any)
|
||||
/// and store the nucleotide index in the Node flags.
|
||||
///
|
||||
/// Single pass thanks to Cell interior mutability.
|
||||
pub fn compute_degrees(&self) {
|
||||
for (&kmer, cell) in &self.nodes {
|
||||
let (rc, rn) = count_neighbors(kmer.right_canonical_neighbors(self.k), &self.nodes);
|
||||
let (lc, ln) = count_neighbors(kmer.left_canonical_neighbors(self.k), &self.nodes);
|
||||
|
||||
let mut node = cell.get();
|
||||
node.set_right(rc, rn);
|
||||
node.set_left(lc, ln);
|
||||
cell.set(node);
|
||||
}
|
||||
}
|
||||
|
||||
/// Iterates over the right neighbors of `kmer`.
|
||||
pub fn iter_right_neighbors(
|
||||
&self,
|
||||
kmer: CanonicalKmer,
|
||||
) -> impl Iterator<Item = CanonicalKmer> + '_ {
|
||||
kmer.right_canonical_neighbors(self.k)
|
||||
.into_iter()
|
||||
.filter_map(|kmer| {
|
||||
self.nodes.get(&kmer)?;
|
||||
Some(kmer)
|
||||
})
|
||||
}
|
||||
|
||||
/// Iterates over the left neighbors of `kmer`.
|
||||
pub fn iter_left_neighbors(
|
||||
&self,
|
||||
kmer: CanonicalKmer,
|
||||
) -> impl Iterator<Item = CanonicalKmer> + '_ {
|
||||
kmer.left_canonical_neighbors(self.k)
|
||||
.into_iter()
|
||||
.filter_map(|kmer| {
|
||||
self.nodes.get(&kmer)?;
|
||||
Some(kmer)
|
||||
})
|
||||
}
|
||||
|
||||
pub fn is_visited(&self, kmer: &CanonicalKmer) -> Option<bool> {
|
||||
self.nodes.get(kmer).map(|cell| cell.get().is_visited())
|
||||
}
|
||||
|
||||
pub fn set_visited(&self, kmer: CanonicalKmer) {
|
||||
if let Some(cell) = self.nodes.get(&kmer) {
|
||||
let mut node = cell.get();
|
||||
node.set_visited();
|
||||
cell.set(node);
|
||||
}
|
||||
}
|
||||
|
||||
/// Returns the single right neighbor of `kmer`, if it exists.
|
||||
pub fn the_single_right_neighbor(&self, kmer: CanonicalKmer) -> Option<CanonicalKmer> {
|
||||
let node = self.nodes.get(&kmer)?.get();
|
||||
if !node.can_extend_right() {
|
||||
return None;
|
||||
}
|
||||
let next = kmer
|
||||
.into_kmer()
|
||||
.push_right(node.right_nuc(), self.k)
|
||||
.canonical(self.k);
|
||||
self.nodes.contains_key(&next).then_some(next)
|
||||
}
|
||||
|
||||
/// Returns the single left neighbor of `kmer`, if it exists.
|
||||
pub fn the_single_left_neighbor(&self, kmer: CanonicalKmer) -> Option<CanonicalKmer> {
|
||||
let node = self.nodes.get(&kmer)?.get();
|
||||
if !node.can_extend_left() {
|
||||
return None;
|
||||
}
|
||||
let next = kmer
|
||||
.into_kmer()
|
||||
.push_left(node.left_nuc(), self.k)
|
||||
.canonical(self.k);
|
||||
self.nodes.contains_key(&next).then_some(next)
|
||||
}
|
||||
|
||||
/// Internal iterator over unitig-start nodes; drives `iter_unitig`.
|
||||
///
|
||||
/// MUST NOT be consumed standalone: the second pass finds cycle nodes only
|
||||
/// because `iter_unitig` lazily interleaves chain traversal between the two passes.
|
||||
///
|
||||
/// Two passes:
|
||||
/// 1. Chain ends / isolated nodes (at most one extension missing):
|
||||
/// - `!can_extend_left` → yield canonical form
|
||||
/// - `!can_extend_right` → yield reverse complement
|
||||
/// 2. Nodes still unvisited → part of a cycle; yield canonical form.
|
||||
fn start_iter(&self) -> impl Iterator<Item = (CanonicalKmer, Option<Kmer>)> + '_ {
|
||||
StartIter::new(self)
|
||||
}
|
||||
|
||||
fn next_unitig_kmer(&self, kmer: Kmer) -> Option<Kmer> {
|
||||
let canonical = kmer.canonical(self.k);
|
||||
let node = self.nodes.get(&canonical)?.get();
|
||||
|
||||
let direct = kmer.raw() == canonical.raw();
|
||||
|
||||
if (direct && !node.can_extend_right()) || (!direct && !node.can_extend_left()) {
|
||||
return None;
|
||||
}
|
||||
|
||||
let next_c: CanonicalKmer = if direct {
|
||||
canonical
|
||||
.into_kmer()
|
||||
.push_right(node.right_nuc(), self.k)
|
||||
.canonical(self.k)
|
||||
} else {
|
||||
canonical
|
||||
.into_kmer()
|
||||
.push_left(node.left_nuc(), self.k)
|
||||
.canonical(self.k)
|
||||
};
|
||||
|
||||
let cell = self.nodes.get(&next_c)?;
|
||||
let next_node = cell.get();
|
||||
if next_node.is_visited() {
|
||||
return None;
|
||||
}
|
||||
|
||||
let oriented = oriented_next(kmer, next_c, self.k);
|
||||
let ndirect = oriented.raw() == next_c.raw();
|
||||
|
||||
if (ndirect && next_node.n_right_neighbours() > 1)
|
||||
|| (!ndirect && next_node.n_left_neighbours() > 1)
|
||||
{
|
||||
return None;
|
||||
}
|
||||
|
||||
let mut updated = next_node;
|
||||
updated.set_visited();
|
||||
cell.set(updated);
|
||||
Some(oriented)
|
||||
}
|
||||
|
||||
fn next_longtig_kmer(&self, kmer: Kmer) -> Option<Kmer> {
|
||||
let k = self.k;
|
||||
let canonical = kmer.canonical(k);
|
||||
let node = self.nodes.get(&canonical)?.get();
|
||||
|
||||
let direct = kmer.raw() == canonical.raw();
|
||||
|
||||
if (direct && node.n_right_neighbours() == 0) || (!direct && node.n_left_neighbours() == 0)
|
||||
{
|
||||
return None;
|
||||
}
|
||||
|
||||
let next_c: CanonicalKmer = if direct {
|
||||
if node.can_extend_right() {
|
||||
canonical
|
||||
.into_kmer()
|
||||
.push_right(node.right_nuc(), k)
|
||||
.canonical(k)
|
||||
} else {
|
||||
self.iter_right_neighbors(canonical)
|
||||
.filter(|n| !self.is_visited(n).unwrap_or(true))
|
||||
.next()?
|
||||
}
|
||||
} else {
|
||||
if node.can_extend_left() {
|
||||
canonical
|
||||
.into_kmer()
|
||||
.push_left(node.left_nuc(), k)
|
||||
.canonical(k)
|
||||
} else {
|
||||
self.iter_left_neighbors(canonical)
|
||||
.filter(|n| !self.is_visited(n).unwrap_or(true))
|
||||
.next()?
|
||||
}
|
||||
};
|
||||
|
||||
let cell = self.nodes.get(&next_c)?;
|
||||
let next_node = cell.get();
|
||||
if next_node.is_visited() {
|
||||
return None;
|
||||
}
|
||||
|
||||
let oriented = oriented_next(kmer, next_c, self.k);
|
||||
let ndirect = oriented.raw() == next_c.raw();
|
||||
|
||||
if (ndirect && next_node.n_right_neighbours() > 1)
|
||||
|| (!ndirect && next_node.n_left_neighbours() > 1)
|
||||
{
|
||||
return None;
|
||||
}
|
||||
|
||||
let mut updated = next_node;
|
||||
updated.set_visited();
|
||||
cell.set(updated);
|
||||
Some(oriented)
|
||||
}
|
||||
|
||||
fn iter_unitig_kmers(&self, start: Kmer) -> UnitigIter<'_> {
|
||||
UnitigIter {
|
||||
graph: self,
|
||||
current: Some(start),
|
||||
}
|
||||
}
|
||||
|
||||
fn iter_longtig_kmers(&self, start: Kmer) -> LongtigIter<'_> {
|
||||
LongtigIter {
|
||||
graph: self,
|
||||
current: Some(start),
|
||||
}
|
||||
}
|
||||
|
||||
pub fn iter_unitig(&self) -> impl Iterator<Item = Unitig> + '_ {
|
||||
let k = self.k;
|
||||
self.start_iter().map(move |(start, first_next)| {
|
||||
let mut nucs: Vec<u8> = (0..k).map(|i| start.nucleotide(i)).collect();
|
||||
if let Some(next_c) = first_next {
|
||||
for kmer in self.iter_unitig_kmers(next_c) {
|
||||
nucs.push(kmer.nucleotide(k - 1));
|
||||
}
|
||||
}
|
||||
Unitig::from_nucleotides(&nucs)
|
||||
})
|
||||
}
|
||||
|
||||
pub fn iter_longtig(&self) -> impl Iterator<Item = Unitig> + '_ {
|
||||
let k = self.k;
|
||||
self.start_iter().map(move |(start, first_next)| {
|
||||
let mut nucs: Vec<u8> = (0..k).map(|i| start.nucleotide(i)).collect();
|
||||
if let Some(next_c) = first_next {
|
||||
for kmer in self.iter_longtig_kmers(next_c) {
|
||||
nucs.push(kmer.nucleotide(k - 1));
|
||||
}
|
||||
}
|
||||
Unitig::from_nucleotides(&nucs)
|
||||
})
|
||||
}
|
||||
|
||||
/// Write all unitigs to `out` in FASTA format.
|
||||
///
|
||||
/// Calls [`obifastwrite::write_unitig`] for each unitig produced by
|
||||
/// [`iter_unitig`]. Stops and returns the first I/O error encountered.
|
||||
pub fn write_fasta<W: io::Write>(&self, out: &mut W, unitig: bool) -> io::Result<()> {
|
||||
if unitig {
|
||||
for unitig in self.iter_unitig() {
|
||||
write_unitig(&unitig, self.k, out)?;
|
||||
}
|
||||
} else {
|
||||
for unitig in self.iter_longtig() {
|
||||
write_unitig(&unitig, self.k, out)?;
|
||||
}
|
||||
}
|
||||
Ok(())
|
||||
}
|
||||
|
||||
pub fn len(&self) -> usize {
|
||||
self.nodes.len()
|
||||
}
|
||||
|
||||
pub fn is_empty(&self) -> bool {
|
||||
self.nodes.is_empty()
|
||||
}
|
||||
}
|
||||
|
||||
// --- StartIter -----------------------------------------------------------------
|
||||
struct StartIter<'a> {
|
||||
graph: &'a GraphDeBruijn,
|
||||
nodes: hashbrown::hash_map::Iter<'a, CanonicalKmer, Cell<Node>>,
|
||||
suspended: Vec<CanonicalKmer>,
|
||||
in_cycle_pass: bool,
|
||||
}
|
||||
|
||||
impl<'a> StartIter<'a> {
|
||||
fn new(graph: &'a GraphDeBruijn) -> Self {
|
||||
Self {
|
||||
graph,
|
||||
nodes: graph.nodes.iter(),
|
||||
suspended: Vec::new(),
|
||||
in_cycle_pass: false,
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
impl<'a> Iterator for StartIter<'a> {
|
||||
type Item = (CanonicalKmer, Option<Kmer>);
|
||||
|
||||
fn next(&mut self) -> Option<(CanonicalKmer, Option<Kmer>)> {
|
||||
loop {
|
||||
let current = if let Some(k) = self.suspended.pop() {
|
||||
k
|
||||
} else {
|
||||
match self.nodes.next() {
|
||||
Some((&k, _)) => k,
|
||||
None => {
|
||||
if self.in_cycle_pass {
|
||||
return None;
|
||||
}
|
||||
self.in_cycle_pass = true;
|
||||
self.nodes = self.graph.nodes.iter();
|
||||
match self.nodes.next() {
|
||||
Some((&k, _)) => k,
|
||||
None => return None,
|
||||
}
|
||||
}
|
||||
}
|
||||
};
|
||||
|
||||
let node = match self.graph.nodes.get(¤t) {
|
||||
Some(c) => c.get(),
|
||||
None => continue,
|
||||
};
|
||||
if node.is_visited() {
|
||||
continue;
|
||||
}
|
||||
if !self.in_cycle_pass && node.can_extend_left() {
|
||||
continue;
|
||||
}
|
||||
|
||||
self.graph.set_visited(current);
|
||||
|
||||
if let Some(next) = self.graph.the_single_right_neighbor(current) {
|
||||
if self.graph.is_visited(&next).unwrap_or(true) {
|
||||
return Some((current, None));
|
||||
}
|
||||
self.graph.set_visited(next);
|
||||
let oriented = oriented_next(current.into_kmer(), next, self.graph.k);
|
||||
return Some((current, Some(oriented)));
|
||||
}
|
||||
|
||||
let mut first_neighbor: Option<CanonicalKmer> = None;
|
||||
for neighbor in self.graph.iter_right_neighbors(current) {
|
||||
if self.graph.is_visited(&neighbor).unwrap_or(true) {
|
||||
continue;
|
||||
}
|
||||
if first_neighbor.is_none() {
|
||||
self.graph.set_visited(neighbor);
|
||||
first_neighbor = Some(neighbor);
|
||||
} else {
|
||||
self.suspended.push(neighbor);
|
||||
}
|
||||
}
|
||||
|
||||
let oriented = match first_neighbor {
|
||||
Some(neighbor) => Some(oriented_next(current.into_kmer(), neighbor, self.graph.k)),
|
||||
None => None,
|
||||
};
|
||||
return Some((current, oriented));
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// ── UnitigIter ────────────────────────────────────────────────────────────────
|
||||
|
||||
struct UnitigIter<'a> {
|
||||
graph: &'a GraphDeBruijn,
|
||||
current: Option<Kmer>,
|
||||
}
|
||||
|
||||
impl Iterator for UnitigIter<'_> {
|
||||
type Item = Kmer;
|
||||
|
||||
fn next(&mut self) -> Option<Kmer> {
|
||||
let current = self.current?;
|
||||
self.current = self.graph.next_unitig_kmer(current);
|
||||
Some(current)
|
||||
}
|
||||
}
|
||||
|
||||
// ── UnitigIter ────────────────────────────────────────────────────────────────
|
||||
|
||||
struct LongtigIter<'a> {
|
||||
graph: &'a GraphDeBruijn,
|
||||
current: Option<Kmer>,
|
||||
}
|
||||
|
||||
impl Iterator for LongtigIter<'_> {
|
||||
type Item = Kmer;
|
||||
|
||||
fn next(&mut self) -> Option<Kmer> {
|
||||
let current = self.current?;
|
||||
self.current = self.graph.next_longtig_kmer(current);
|
||||
Some(current)
|
||||
}
|
||||
}
|
||||
|
||||
// ── helpers ───────────────────────────────────────────────────────────────────
|
||||
|
||||
fn oriented_next(from: Kmer, to: CanonicalKmer, k: usize) -> Kmer {
|
||||
if from.is_overlapping(to.into_kmer(), k) {
|
||||
to.into_kmer()
|
||||
} else {
|
||||
to.revcomp(k)
|
||||
}
|
||||
}
|
||||
|
||||
/// Returns `Some(i)` if exactly one of the four canonical neighbours exists in
|
||||
/// the graph, where `i` is its index (0=A, 1=C, 2=G, 3=T). Returns `None` for
|
||||
/// zero or ≥2 existing neighbours.
|
||||
fn count_neighbors(
|
||||
neighbors: [CanonicalKmer; 4],
|
||||
nodes: &FastHashMap<CanonicalKmer, Cell<Node>>,
|
||||
) -> (u8, Option<u8>) {
|
||||
let mut count = 0u8;
|
||||
let mut first = None;
|
||||
for (i, neighbour) in neighbors.iter().enumerate() {
|
||||
if nodes.contains_key(neighbour) {
|
||||
count += 1;
|
||||
if first.is_none() {
|
||||
first = Some(i as u8);
|
||||
}
|
||||
}
|
||||
}
|
||||
if count == 1 {
|
||||
(1, first)
|
||||
} else {
|
||||
(count, None)
|
||||
}
|
||||
}
|
||||
|
||||
// ── tests ─────────────────────────────────────────────────────────────────────
|
||||
|
||||
#[cfg(test)]
|
||||
mod tests {
|
||||
use super::*;
|
||||
|
||||
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
|
||||
fn graph_from_ascii(seq: &[u8], k: usize) -> GraphDeBruijn {
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
for i in 0..=seq.len().saturating_sub(k) {
|
||||
g.push(Kmer::from_ascii(&seq[i..i + k], k).unwrap().canonical(k));
|
||||
}
|
||||
g
|
||||
}
|
||||
|
||||
// Collect all canonical k-mers from an ASCII sequence into a sorted vec.
|
||||
fn canonical_kmers(seq: &[u8], k: usize) -> Vec<CanonicalKmer> {
|
||||
let mut v: Vec<CanonicalKmer> = (0..=seq.len().saturating_sub(k))
|
||||
.map(|i| Kmer::from_ascii(&seq[i..i + k], k).unwrap().canonical(k))
|
||||
.collect();
|
||||
v.sort_unstable();
|
||||
v.dedup();
|
||||
v
|
||||
}
|
||||
|
||||
// ── push / canonicalisation ───────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn push_deduplicates_revcomp() {
|
||||
let k = 5;
|
||||
let kmer = Kmer::from_ascii(b"ACGTA", k).unwrap();
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
g.push(kmer.canonical(k));
|
||||
g.push(kmer.revcomp(k).canonical(k));
|
||||
assert_eq!(g.len(), 1, "kmer and its revcomp must map to the same node");
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn push_palindrome_single_node() {
|
||||
// ACGT is its own revcomp
|
||||
let k = 4;
|
||||
let kmer = Kmer::from_ascii(b"ACGT", k).unwrap();
|
||||
assert_eq!(kmer, kmer.revcomp(k), "test requires a palindrome");
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
g.push(kmer.canonical(k));
|
||||
assert_eq!(g.len(), 1);
|
||||
}
|
||||
|
||||
// ── compute_degrees on a linear chain ────────────────────────────────────
|
||||
|
||||
// AAAAGGGG with k=5 → 4 distinct k-mers (AAAAG, AAAGG, AAGGG, AGGGG),
|
||||
// clean linear chain, no Watson-Crick palindrome in first k-1 bases.
|
||||
fn linear_chain_graph(k: usize) -> (GraphDeBruijn, Vec<CanonicalKmer>) {
|
||||
let seq = b"AAAAGGGG";
|
||||
let g = graph_from_ascii(seq, k);
|
||||
let kmers = canonical_kmers(seq, k);
|
||||
(g, kmers)
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn degrees_linear_chain_node_count() {
|
||||
let k = 5;
|
||||
let (g, kmers) = linear_chain_graph(k);
|
||||
assert_eq!(g.len(), kmers.len());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn degrees_linear_chain_extensions() {
|
||||
// A linear chain yields exactly 1 unitig covering all k-mers.
|
||||
// Note: start_iter must not be consumed standalone — its second pass only
|
||||
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
|
||||
let k = 5;
|
||||
let seq = b"AAAAGGGG";
|
||||
let g = graph_from_ascii(seq, k);
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
assert_eq!(unitigs.len(), 1, "linear chain → exactly one unitig");
|
||||
// seql = k + (n_kmers - 1) = 5 + 3 = 8 = seq.len()
|
||||
assert_eq!(
|
||||
unitigs[0].seql(),
|
||||
seq.len(),
|
||||
"unitig spans the full sequence"
|
||||
);
|
||||
assert_eq!(
|
||||
kmers_from_unitigs(&unitigs, k),
|
||||
canonical_kmers(seq, k),
|
||||
"unitig k-mers must equal inserted k-mers"
|
||||
);
|
||||
}
|
||||
|
||||
// ── unitig reconstruction ─────────────────────────────────────────────────
|
||||
|
||||
// Round-trip: all canonical k-mers in the unitigs == all canonical k-mers inserted.
|
||||
fn kmers_from_unitigs(unitigs: &[Unitig], k: usize) -> Vec<CanonicalKmer> {
|
||||
let mut v: Vec<CanonicalKmer> = unitigs
|
||||
.iter()
|
||||
.flat_map(|u| u.iter_canonical_kmers(k))
|
||||
.collect();
|
||||
v.sort_unstable();
|
||||
v.dedup();
|
||||
v
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_roundtrip_linear() {
|
||||
// Non-repetitive sequence: no k-mer appears twice, no homopolymer run of length k.
|
||||
// ACGTGGCTA with k=5 → 5 distinct k-mers forming a clean linear chain.
|
||||
let k = 5;
|
||||
let seq = b"ACCTGGCTA";
|
||||
let g = graph_from_ascii(seq, k);
|
||||
g.compute_degrees();
|
||||
println!("Les kmers:");
|
||||
for (kmer, v) in g.nodes.iter() {
|
||||
println!(
|
||||
"{}: {}",
|
||||
String::from_utf8_lossy(&kmer.to_ascii(k)),
|
||||
v.get()
|
||||
);
|
||||
}
|
||||
// println!("Les starts:");
|
||||
// for (start, first_next) in g.start_iter() {
|
||||
// if let Some(next) = first_next {
|
||||
// println!(
|
||||
// "{}->{}",
|
||||
// String::from_utf8_lossy(&start.to_ascii(k)),
|
||||
// String::from_utf8_lossy(&next.to_ascii(k))
|
||||
// )
|
||||
// } else {
|
||||
// println!("{}->None", String::from_utf8_lossy(&start.to_ascii(k)))
|
||||
// }
|
||||
// }
|
||||
|
||||
println!("Les unitig:");
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
for unitig in &unitigs {
|
||||
println!("{}", String::from_utf8_lossy(&unitig.to_ascii()));
|
||||
}
|
||||
assert_eq!(
|
||||
unitigs.len(),
|
||||
1,
|
||||
"linear chain → exactly one unitig {:?}",
|
||||
unitigs
|
||||
);
|
||||
assert_eq!(
|
||||
kmers_from_unitigs(&unitigs, k),
|
||||
canonical_kmers(seq, k),
|
||||
"unitig must contain exactly the inserted k-mers"
|
||||
);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_roundtrip_longer_sequence() {
|
||||
// Longer non-repetitive sequence with no repeated k-mer of length k.
|
||||
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
|
||||
let k = 5;
|
||||
let seq = b"ACGTGGCTATCGAC";
|
||||
let g = graph_from_ascii(seq, k);
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
let mut got = kmers_from_unitigs(&unitigs, k);
|
||||
let mut expected = canonical_kmers(seq, k);
|
||||
got.sort_unstable();
|
||||
expected.sort_unstable();
|
||||
assert_eq!(got, expected);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_isolated_node() {
|
||||
// Single k-mer with no neighbours
|
||||
let k = 5;
|
||||
let kmer = Kmer::from_ascii(b"ACGTA", k).unwrap();
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
g.push(kmer.canonical(k));
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
assert_eq!(unitigs.len(), 1);
|
||||
assert_eq!(unitigs[0].seql(), k);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_two_isolated_nodes() {
|
||||
let k = 5;
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
// Two k-mers that share no (k-1)-overlap
|
||||
g.push(Kmer::from_ascii(b"AAAAA", k).unwrap().canonical(k));
|
||||
g.push(Kmer::from_ascii(b"TTTTT", k).unwrap().canonical(k)); // same canonical as AAAAA — dedup
|
||||
// They collapse to one canonical node
|
||||
assert_eq!(g.len(), 1);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_two_truly_distinct_isolated_nodes() {
|
||||
let k = 5;
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
g.push(Kmer::from_ascii(b"AAAAC", k).unwrap().canonical(k));
|
||||
g.push(Kmer::from_ascii(b"GGGGT", k).unwrap().canonical(k));
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
// Each isolated node → one unitig of length k
|
||||
assert_eq!(unitigs.len(), 2);
|
||||
assert!(unitigs.iter().all(|u| u.seql() == k));
|
||||
}
|
||||
|
||||
// ── all k-mers covered, none duplicated ───────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn no_kmer_lost_or_duplicated() {
|
||||
let k = 7;
|
||||
let seq = b"ACGTACGTACGTTTTTACGTACGT";
|
||||
let g = graph_from_ascii(seq, k);
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
let got = kmers_from_unitigs(&unitigs, k);
|
||||
let expected = canonical_kmers(seq, k);
|
||||
assert_eq!(
|
||||
got.len(),
|
||||
expected.len(),
|
||||
"kmer count mismatch: got {}, expected {}",
|
||||
got.len(),
|
||||
expected.len()
|
||||
);
|
||||
assert_eq!(got, expected, "kmer sets differ");
|
||||
}
|
||||
|
||||
// ── cycle coverage ────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn cycle_kmers_not_lost() {
|
||||
// ACGTACGT with k=5 forms a pure cycle: ACGTA→CGTAC→GTACG→TACGT→ACGTA.
|
||||
// start_iter first pass yields nothing (all nodes internal); second pass
|
||||
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
|
||||
let k = 5;
|
||||
let seq = b"ACGTACGT";
|
||||
let g = graph_from_ascii(seq, k);
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
let got = kmers_from_unitigs(&unitigs, k);
|
||||
let expected = canonical_kmers(seq, k);
|
||||
assert_eq!(got.len(), expected.len(), "cycle k-mers lost");
|
||||
assert_eq!(got, expected);
|
||||
}
|
||||
|
||||
// ── branching graph ───────────────────────────────────────────────────────
|
||||
//
|
||||
// Topology (k=5): two sources A,B converge at C; chain C-D-E-F;
|
||||
// F branches to G and H; H continues H-M-N; second source J feeds I-F.
|
||||
// Every k-mer must appear in exactly one unitig (no duplication, no loss).
|
||||
#[test]
|
||||
fn branching_graph_no_kmer_lost_or_duplicated() {
|
||||
// Build sequences that realise the topology without accidental overlaps.
|
||||
// Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
|
||||
// We use long non-repetitive sequences and extract only the required kmers.
|
||||
let k: usize = 5;
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
|
||||
// Helper: insert all k-mers of a sequence.
|
||||
let mut insert = |seq: &[u8]| {
|
||||
for i in 0..=seq.len().saturating_sub(k) {
|
||||
g.push(Kmer::from_ascii(&seq[i..i + k], k).unwrap().canonical(k));
|
||||
}
|
||||
};
|
||||
|
||||
// Chains that realise the topology:
|
||||
// A-C (A→C share 4-mer overlap)
|
||||
// B-C (B→C share 4-mer overlap, different prefix)
|
||||
// C-D-E-F
|
||||
// F-G (F→G)
|
||||
// F-H-M-N (F→H→M→N)
|
||||
// J-I-F (J→I→F)
|
||||
insert(b"AACGTGGCTA"); // A-C-D … part of the right branch
|
||||
insert(b"TACGTGGCTA"); // B-C-D … merges at C (same C-suffix)
|
||||
insert(b"CGTGGCTACG"); // continues D-E-F-G
|
||||
insert(b"CGTGGCTACC"); // F-H branch (different last base)
|
||||
insert(b"GTGGCTACCGT"); // H-M-N continuation
|
||||
insert(b"TTCGTGGCTA"); // J-I-F (different J prefix)
|
||||
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
|
||||
// Collect all k-mers from unitigs.
|
||||
let got = kmers_from_unitigs(&unitigs, k);
|
||||
|
||||
// Collect all distinct canonical k-mers inserted.
|
||||
let mut expected: Vec<CanonicalKmer> = Vec::new();
|
||||
for seq in &[
|
||||
b"AACGTGGCTA".as_slice(),
|
||||
b"TACGTGGCTA",
|
||||
b"CGTGGCTACG",
|
||||
b"CGTGGCTACC",
|
||||
b"GTGGCTACCGT",
|
||||
b"TTCGTGGCTA",
|
||||
] {
|
||||
expected.extend(canonical_kmers(seq, k));
|
||||
}
|
||||
expected.sort_unstable();
|
||||
expected.dedup();
|
||||
|
||||
assert_eq!(
|
||||
got.len(),
|
||||
expected.len(),
|
||||
"k-mer count mismatch: got {}, expected {}",
|
||||
got.len(),
|
||||
expected.len()
|
||||
);
|
||||
assert_eq!(got, expected, "k-mer sets differ");
|
||||
}
|
||||
}
|
||||
pub use debruijn::GraphDeBruijn;
|
||||
@@ -0,0 +1,301 @@
|
||||
use super::*;
|
||||
use obikseq::{k, set_k};
|
||||
|
||||
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
|
||||
fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn {
|
||||
let mut g = GraphDeBruijn::new();
|
||||
let k = k();
|
||||
for i in 0..=seq.len().saturating_sub(k) {
|
||||
g.push(Kmer::from_ascii(&seq[i..i + k]).unwrap().canonical());
|
||||
}
|
||||
g
|
||||
}
|
||||
|
||||
// Collect all canonical k-mers from an ASCII sequence into a sorted vec.
|
||||
fn canonical_kmers(seq: &[u8]) -> Vec<CanonicalKmer> {
|
||||
let k = k();
|
||||
let mut v: Vec<CanonicalKmer> = (0..=seq.len().saturating_sub(k))
|
||||
.map(|i| Kmer::from_ascii(&seq[i..i + k]).unwrap().canonical())
|
||||
.collect();
|
||||
v.sort_unstable();
|
||||
v.dedup();
|
||||
v
|
||||
}
|
||||
|
||||
// ── push / canonicalisation ───────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn push_deduplicates_revcomp() {
|
||||
let k = 5;
|
||||
set_k(k);
|
||||
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
|
||||
let mut g = GraphDeBruijn::new();
|
||||
g.push(kmer.canonical());
|
||||
g.push(kmer.revcomp().canonical());
|
||||
assert_eq!(g.len(), 1, "kmer and its revcomp must map to the same node");
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn push_palindrome_single_node() {
|
||||
// ACGT is its own revcomp
|
||||
let k = 4;
|
||||
set_k(k);
|
||||
let kmer = Kmer::from_ascii(b"ACGT").unwrap();
|
||||
assert_eq!(kmer, kmer.revcomp(), "test requires a palindrome");
|
||||
let mut g = GraphDeBruijn::new();
|
||||
g.push(kmer.canonical());
|
||||
assert_eq!(g.len(), 1);
|
||||
}
|
||||
|
||||
// ── compute_degrees on a linear chain ────────────────────────────────────
|
||||
|
||||
// AAAAGGGG with k=5 → 4 distinct k-mers (AAAAG, AAAGG, AAGGG, AGGGG),
|
||||
// clean linear chain, no Watson-Crick palindrome in first k-1 bases.
|
||||
fn linear_chain_graph() -> (GraphDeBruijn, Vec<CanonicalKmer>) {
|
||||
let seq = b"AAAAGGGG";
|
||||
let g = graph_from_ascii(seq);
|
||||
let kmers = canonical_kmers(seq);
|
||||
(g, kmers)
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn degrees_linear_chain_node_count() {
|
||||
let k = 5;
|
||||
set_k(k);
|
||||
let (g, kmers) = linear_chain_graph();
|
||||
assert_eq!(g.len(), kmers.len());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn degrees_linear_chain_extensions() {
|
||||
// A linear chain yields exactly 1 unitig covering all k-mers.
|
||||
// Note: start_iter must not be consumed standalone — its second pass only
|
||||
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
|
||||
let k = 5;
|
||||
set_k(k);
|
||||
let seq = b"AAAAGGGG";
|
||||
let g = graph_from_ascii(seq);
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
assert_eq!(unitigs.len(), 1, "linear chain → exactly one unitig");
|
||||
// seql = k + (n_kmers - 1) = 5 + 3 = 8 = seq.len()
|
||||
assert_eq!(
|
||||
unitigs[0].seql(),
|
||||
seq.len(),
|
||||
"unitig spans the full sequence"
|
||||
);
|
||||
assert_eq!(
|
||||
kmers_from_unitigs(&unitigs),
|
||||
canonical_kmers(seq),
|
||||
"unitig k-mers must equal inserted k-mers"
|
||||
);
|
||||
}
|
||||
|
||||
// ── unitig reconstruction ─────────────────────────────────────────────────
|
||||
|
||||
// Round-trip: all canonical k-mers in the unitigs == all canonical k-mers inserted.
|
||||
fn kmers_from_unitigs(unitigs: &[Unitig]) -> Vec<CanonicalKmer> {
|
||||
let mut v: Vec<CanonicalKmer> = unitigs
|
||||
.iter()
|
||||
.flat_map(|u| u.iter_canonical_kmers())
|
||||
.collect();
|
||||
v.sort_unstable();
|
||||
v.dedup();
|
||||
v
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_roundtrip_linear() {
|
||||
// Non-repetitive sequence: no k-mer appears twice, no homopolymer run of length k.
|
||||
// ACGTGGCTA with k=5 → 5 distinct k-mers forming a clean linear chain.
|
||||
let k = 5;
|
||||
set_k(k);
|
||||
let seq = b"ACCTGGCTA";
|
||||
let g = graph_from_ascii(seq);
|
||||
g.compute_degrees();
|
||||
println!("Les kmers:");
|
||||
for (kmer, v) in g.nodes.iter() {
|
||||
println!("{}: {}", String::from_utf8_lossy(&kmer.to_ascii()), v.get());
|
||||
}
|
||||
|
||||
println!("Les unitig:");
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
for unitig in &unitigs {
|
||||
println!("{}", String::from_utf8_lossy(&unitig.to_ascii()));
|
||||
}
|
||||
assert_eq!(
|
||||
unitigs.len(),
|
||||
1,
|
||||
"linear chain → exactly one unitig {:?}",
|
||||
unitigs
|
||||
);
|
||||
assert_eq!(
|
||||
kmers_from_unitigs(&unitigs),
|
||||
canonical_kmers(seq),
|
||||
"unitig must contain exactly the inserted k-mers"
|
||||
);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_roundtrip_longer_sequence() {
|
||||
// Longer non-repetitive sequence with no repeated k-mer of length k.
|
||||
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
|
||||
let k = 5;
|
||||
set_k(k);
|
||||
let seq = b"ACGTGGCTATCGAC";
|
||||
let g = graph_from_ascii(seq);
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
let mut got = kmers_from_unitigs(&unitigs);
|
||||
let mut expected = canonical_kmers(seq);
|
||||
got.sort_unstable();
|
||||
expected.sort_unstable();
|
||||
assert_eq!(got, expected);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_isolated_node() {
|
||||
// Single k-mer with no neighbours
|
||||
let k = 5;
|
||||
set_k(k);
|
||||
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
|
||||
let mut g = GraphDeBruijn::new();
|
||||
g.push(kmer.canonical());
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
assert_eq!(unitigs.len(), 1);
|
||||
assert_eq!(unitigs[0].seql(), k);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_two_isolated_nodes() {
|
||||
let k = 5;
|
||||
set_k(k);
|
||||
let mut g = GraphDeBruijn::new();
|
||||
// Two k-mers that share no (k-1)-overlap
|
||||
g.push(Kmer::from_ascii(b"AAAAA").unwrap().canonical());
|
||||
g.push(Kmer::from_ascii(b"TTTTT").unwrap().canonical()); // same canonical as AAAAA — dedup
|
||||
// They collapse to one canonical node
|
||||
assert_eq!(g.len(), 1);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn unitig_two_truly_distinct_isolated_nodes() {
|
||||
let k = 5;
|
||||
set_k(k);
|
||||
let mut g = GraphDeBruijn::new();
|
||||
g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical());
|
||||
g.push(Kmer::from_ascii(b"GGGGT").unwrap().canonical());
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
// Each isolated node → one unitig of length k
|
||||
assert_eq!(unitigs.len(), 2);
|
||||
assert!(unitigs.iter().all(|u| u.seql() == k));
|
||||
}
|
||||
|
||||
// ── all k-mers covered, none duplicated ───────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn no_kmer_lost_or_duplicated() {
|
||||
let k = 7;
|
||||
set_k(k);
|
||||
let seq = b"ACGTACGTACGTTTTTACGTACGT";
|
||||
let g = graph_from_ascii(seq);
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
let got = kmers_from_unitigs(&unitigs);
|
||||
let expected = canonical_kmers(seq);
|
||||
assert_eq!(
|
||||
got.len(),
|
||||
expected.len(),
|
||||
"kmer count mismatch: got {}, expected {}",
|
||||
got.len(),
|
||||
expected.len()
|
||||
);
|
||||
assert_eq!(got, expected, "kmer sets differ");
|
||||
}
|
||||
|
||||
// ── cycle coverage ────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn cycle_kmers_not_lost() {
|
||||
// ACGTACGT with k=5 forms a pure cycle: ACGTA→CGTAC→GTACG→TACGT→ACGTA.
|
||||
// start_iter first pass yields nothing (all nodes internal); second pass
|
||||
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
|
||||
let k = 5;
|
||||
set_k(k);
|
||||
let seq = b"ACGTACGT";
|
||||
let g = graph_from_ascii(seq);
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
let got = kmers_from_unitigs(&unitigs);
|
||||
let expected = canonical_kmers(seq);
|
||||
assert_eq!(got.len(), expected.len(), "cycle k-mers lost");
|
||||
assert_eq!(got, expected);
|
||||
}
|
||||
|
||||
// ── branching graph ───────────────────────────────────────────────────────
|
||||
//
|
||||
// Topology (k=5): two sources A,B converge at C; chain C-D-E-F;
|
||||
// F branches to G and H; H continues H-M-N; second source J feeds I-F.
|
||||
// Every k-mer must appear in exactly one unitig (no duplication, no loss).
|
||||
#[test]
|
||||
fn branching_graph_no_kmer_lost_or_duplicated() {
|
||||
// Build sequences that realise the topology without accidental overlaps.
|
||||
// Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
|
||||
// We use long non-repetitive sequences and extract only the required kmers.
|
||||
let k: usize = 5;
|
||||
set_k(k);
|
||||
let mut g = GraphDeBruijn::new();
|
||||
|
||||
// Helper: insert all k-mers of a sequence.
|
||||
let mut insert = |seq: &[u8]| {
|
||||
for i in 0..=seq.len().saturating_sub(k) {
|
||||
g.push(Kmer::from_ascii(&seq[i..i + k]).unwrap().canonical());
|
||||
}
|
||||
};
|
||||
|
||||
// Chains that realise the topology:
|
||||
// A-C (A→C share 4-mer overlap)
|
||||
// B-C (B→C share 4-mer overlap, different prefix)
|
||||
// C-D-E-F
|
||||
// F-G (F→G)
|
||||
// F-H-M-N (F→H→M→N)
|
||||
// J-I-F (J→I→F)
|
||||
insert(b"AACGTGGCTA"); // A-C-D … part of the right branch
|
||||
insert(b"TACGTGGCTA"); // B-C-D … merges at C (same C-suffix)
|
||||
insert(b"CGTGGCTACG"); // continues D-E-F-G
|
||||
insert(b"CGTGGCTACC"); // F-H branch (different last base)
|
||||
insert(b"GTGGCTACCGT"); // H-M-N continuation
|
||||
insert(b"TTCGTGGCTA"); // J-I-F (different J prefix)
|
||||
|
||||
g.compute_degrees();
|
||||
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
|
||||
|
||||
// Collect all k-mers from unitigs.
|
||||
let got = kmers_from_unitigs(&unitigs);
|
||||
|
||||
// Collect all distinct canonical k-mers inserted.
|
||||
let mut expected: Vec<CanonicalKmer> = Vec::new();
|
||||
for seq in &[
|
||||
b"AACGTGGCTA".as_slice(),
|
||||
b"TACGTGGCTA",
|
||||
b"CGTGGCTACG",
|
||||
b"CGTGGCTACC",
|
||||
b"GTGGCTACCGT",
|
||||
b"TTCGTGGCTA",
|
||||
] {
|
||||
expected.extend(canonical_kmers(seq));
|
||||
}
|
||||
expected.sort_unstable();
|
||||
expected.dedup();
|
||||
|
||||
assert_eq!(
|
||||
got.len(),
|
||||
expected.len(),
|
||||
"k-mer count mismatch: got {}, expected {}",
|
||||
got.len(),
|
||||
expected.len()
|
||||
);
|
||||
assert_eq!(got, expected, "k-mer sets differ");
|
||||
}
|
||||
@@ -6,3 +6,6 @@ edition = "2024"
|
||||
[dependencies]
|
||||
obikseq = { path = "../obikseq" }
|
||||
xxhash-rust = { version = "0.8", features = ["xxh64"] }
|
||||
|
||||
[dev-dependencies]
|
||||
obikseq = { path = "../obikseq", features = ["test-utils"] }
|
||||
+17
-14
@@ -34,7 +34,7 @@ mod fasta;
|
||||
|
||||
use std::io::{self, Write};
|
||||
|
||||
use obikseq::{kmer::CanonicalKmer, superkmer::SuperKmer, unitig::Unitig};
|
||||
use obikseq::{Minimizer, SuperKmer, Unitig};
|
||||
use xxhash_rust::xxh64::xxh64;
|
||||
|
||||
// ── public API ────────────────────────────────────────────────────────────────
|
||||
@@ -57,12 +57,12 @@ pub fn write_scatter<W: Write>(
|
||||
k: usize,
|
||||
m: usize,
|
||||
partition: usize,
|
||||
minimizer: CanonicalKmer,
|
||||
minimizer: Minimizer,
|
||||
) -> io::Result<()> {
|
||||
let ascii = sk.to_ascii();
|
||||
let id = seq_id(&ascii);
|
||||
let seq_len = ascii.len();
|
||||
let min_seq = minimizer.to_ascii(m);
|
||||
let min_seq = minimizer.to_ascii();
|
||||
|
||||
writeln!(
|
||||
out,
|
||||
@@ -154,7 +154,6 @@ fn seq_id(ascii: &[u8]) -> String {
|
||||
#[cfg(test)]
|
||||
mod tests {
|
||||
use super::*;
|
||||
use obikseq::kmer::Kmer;
|
||||
use obikseq::superkmer::SuperKmer;
|
||||
|
||||
fn make(seq: &[u8]) -> SuperKmer {
|
||||
@@ -172,23 +171,27 @@ mod tests {
|
||||
#[test]
|
||||
fn scatter_header_contains_minimizer_field() {
|
||||
let sk = make(b"ACGTACGTACGT");
|
||||
let out = capture(|w| write_scatter(&sk, w, 4, 3, 7, CanonicalKmer::from_raw_unchecked(0)));
|
||||
let out = capture(|w| write_scatter(&sk, w, 4, 3, 7, Minimizer::from_raw_unchecked(0)));
|
||||
assert!(out.contains("\"minimizer\":\""));
|
||||
assert!(!out.contains("\"count\":"));
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn scatter_minimizer_decoded_from_hash() {
|
||||
// min_hash for "ACG" (A=0,C=1,G=2, m=3): 0*16 + 1*4 + 2 = 6
|
||||
// "ACG" right-aligned: A=00, C=01, G=10 → 0b000110 = 6
|
||||
// Left-aligned for m=3: shift by 64 − 2·3 = 58.
|
||||
// set_m(3) so that Minimizer::to_ascii() decodes exactly 3 bases.
|
||||
obikseq::params::set_m(3);
|
||||
let sk = make(b"ACGTACGTACGT");
|
||||
let out = capture(|w| write_scatter(&sk, w, 4, 3, 0, CanonicalKmer::from_raw_unchecked(Kmer::from_raw_right(6, 3).raw())));
|
||||
let minimizer = Minimizer::from_raw_unchecked(6u64 << (64 - 2 * 3));
|
||||
let out = capture(|w| write_scatter(&sk, w, 4, 3, 0, minimizer));
|
||||
assert!(out.contains("\"minimizer\":\"ACG\""), "got: {out}");
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn scatter_fields_present() {
|
||||
let sk = make(b"ACGTACGTACGT");
|
||||
let out = capture(|w| write_scatter(&sk, w, 4, 3, 5, CanonicalKmer::from_raw_unchecked(0)));
|
||||
let out = capture(|w| write_scatter(&sk, w, 4, 3, 5, Minimizer::from_raw_unchecked(0)));
|
||||
assert!(out.contains("\"seq_length\":12"));
|
||||
assert!(out.contains("\"kmer_size\":4"));
|
||||
assert!(out.contains("\"minimizer_size\":3"));
|
||||
@@ -198,7 +201,7 @@ mod tests {
|
||||
#[test]
|
||||
fn scatter_sequence_line_correct() {
|
||||
let sk = make(b"ACGTACGT");
|
||||
let out = capture(|w| write_scatter(&sk, w, 4, 2, 0, CanonicalKmer::from_raw_unchecked(0)));
|
||||
let out = capture(|w| write_scatter(&sk, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)));
|
||||
let lines: Vec<&str> = out.lines().collect();
|
||||
assert_eq!(lines[1], "ACGTACGT");
|
||||
}
|
||||
@@ -241,7 +244,7 @@ mod tests {
|
||||
let sk1 = make(b"ACGTACGT");
|
||||
let sk2 = make(b"ACGTACGT");
|
||||
|
||||
let id1 = capture(|w| write_scatter(&sk1, w, 4, 2, 0, CanonicalKmer::from_raw_unchecked(0)))
|
||||
let id1 = capture(|w| write_scatter(&sk1, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)))
|
||||
.lines()
|
||||
.next()
|
||||
.unwrap()
|
||||
@@ -249,7 +252,7 @@ mod tests {
|
||||
.next()
|
||||
.unwrap()[1..]
|
||||
.to_string();
|
||||
let id2 = capture(|w| write_scatter(&sk2, w, 4, 2, 0, CanonicalKmer::from_raw_unchecked(0)))
|
||||
let id2 = capture(|w| write_scatter(&sk2, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)))
|
||||
.lines()
|
||||
.next()
|
||||
.unwrap()
|
||||
@@ -265,7 +268,7 @@ mod tests {
|
||||
let sk1 = make(b"ACGTACGT");
|
||||
let sk2 = make(b"TTTTTTTT");
|
||||
|
||||
let id1 = capture(|w| write_scatter(&sk1, w, 4, 2, 0, CanonicalKmer::from_raw_unchecked(0)))
|
||||
let id1 = capture(|w| write_scatter(&sk1, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)))
|
||||
.lines()
|
||||
.next()
|
||||
.unwrap()
|
||||
@@ -273,7 +276,7 @@ mod tests {
|
||||
.next()
|
||||
.unwrap()[1..]
|
||||
.to_string();
|
||||
let id2 = capture(|w| write_scatter(&sk2, w, 4, 2, 0, CanonicalKmer::from_raw_unchecked(0)))
|
||||
let id2 = capture(|w| write_scatter(&sk2, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)))
|
||||
.lines()
|
||||
.next()
|
||||
.unwrap()
|
||||
@@ -287,7 +290,7 @@ mod tests {
|
||||
#[test]
|
||||
fn id_is_16_hex_digits() {
|
||||
let sk = make(b"ACGTACGT");
|
||||
let out = capture(|w| write_scatter(&sk, w, 4, 2, 0, CanonicalKmer::from_raw_unchecked(0)));
|
||||
let out = capture(|w| write_scatter(&sk, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)));
|
||||
let id = &out.lines().next().unwrap()[1..17]; // skip '>'
|
||||
assert_eq!(id.len(), 16);
|
||||
assert!(id.chars().all(|c| c.is_ascii_hexdigit()));
|
||||
|
||||
@@ -64,7 +64,7 @@ fn dump_super_kmers(kp: &KmerPartition, partition_dir: &PathBuf) {
|
||||
std::process::exit(1)
|
||||
});
|
||||
|
||||
let mut reader = SKFileReader::open(&in_path, k).unwrap_or_else(|e| {
|
||||
let mut reader = SKFileReader::open(&in_path).unwrap_or_else(|e| {
|
||||
eprintln!("error opening {}: {e}", in_path.display());
|
||||
std::process::exit(1)
|
||||
});
|
||||
|
||||
@@ -7,6 +7,7 @@ use niffler::Level;
|
||||
use niffler::send::compression::Format;
|
||||
use obidebruinj::GraphDeBruijn;
|
||||
use obikpartitionner::KmerPartition;
|
||||
use obikseq::set_k;
|
||||
use obiskio::SKFileReader;
|
||||
use ph::fmph::GOFunction;
|
||||
use rayon::prelude::*;
|
||||
@@ -33,6 +34,7 @@ pub fn run(args: LongtigArgs) {
|
||||
});
|
||||
|
||||
let k = kp.kmer_size();
|
||||
set_k(k);
|
||||
let n = kp.n_partitions();
|
||||
info!("building longtigs from {n} partitions (k={k}, parallel)");
|
||||
|
||||
@@ -46,7 +48,7 @@ pub fn run(args: LongtigArgs) {
|
||||
}
|
||||
let out_path = part_dir.join("longtig.fasta.gz");
|
||||
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
let mut g = GraphDeBruijn::new();
|
||||
|
||||
let mphf_path = part_dir.join("mphf1.bin");
|
||||
let counts_path = part_dir.join("counts1.bin");
|
||||
@@ -86,12 +88,12 @@ pub fn run(args: LongtigArgs) {
|
||||
.as_ref()
|
||||
.map(|m| unsafe { std::slice::from_raw_parts(m.as_ptr() as *const u32, m.len() / 4) });
|
||||
|
||||
let mut reader = SKFileReader::open(&in_path, k).unwrap_or_else(|e| {
|
||||
let mut reader = SKFileReader::open(&in_path).unwrap_or_else(|e| {
|
||||
eprintln!("error opening {}: {e}", in_path.display());
|
||||
std::process::exit(1)
|
||||
});
|
||||
for sk in reader.iter() {
|
||||
for kmer in sk.iter_canonical_kmers(k) {
|
||||
for kmer in sk.iter_canonical_kmers() {
|
||||
let accept = match (&mphf_opt, counts_slice) {
|
||||
(Some(mphf), Some(counts)) => {
|
||||
if let Some(slot) = mphf.get(&kmer) {
|
||||
|
||||
@@ -2,7 +2,7 @@ use std::path::PathBuf;
|
||||
|
||||
use clap::Args;
|
||||
use obikpartitionner::KmerPartition;
|
||||
use obikseq::RoutableSuperKmer;
|
||||
use obikseq::{RoutableSuperKmer, set_k, set_m};
|
||||
use tracing::info;
|
||||
|
||||
use crate::cli::{CommonArgs, PipelineData, open_chunks};
|
||||
@@ -25,7 +25,9 @@ pub struct PartitionArgs {
|
||||
|
||||
pub fn run(args: PartitionArgs) {
|
||||
let k = args.common.kmer_size;
|
||||
set_k(k);
|
||||
let m = args.common.minimizer_size;
|
||||
set_m(m);
|
||||
let theta = args.common.theta;
|
||||
let level_max = args.common.level_max;
|
||||
let n_workers = args.common.threads.max(1);
|
||||
@@ -42,7 +44,7 @@ pub fn run(args: PartitionArgs) {
|
||||
PipelineData : PathBuf => Vec<RoutableSuperKmer>,
|
||||
||? { |path| open_chunks(path) } : Path => RawChunk,
|
||||
|? { move |rope| obiread::normalize_sequence_chunk(rope, k) } : RawChunk => NormChunk,
|
||||
| { move |rope| obiskbuilder::build_superkmers(rope, k, m, level_max, theta) }: NormChunk => Batch,
|
||||
| { move |rope| obiskbuilder::build_superkmers(rope, k, level_max, theta) }: NormChunk => Batch,
|
||||
};
|
||||
|
||||
for batch in pipe.apply(path_source, n_workers, 1) {
|
||||
|
||||
@@ -25,7 +25,7 @@ fn write_batch(
|
||||
let partition_mask = (1u64 << partition_bits) - 1;
|
||||
for rsk in batch {
|
||||
let minimizer = *rsk.minimizer();
|
||||
let partition = (minimizer.seq_hash(m) & partition_mask) as usize;
|
||||
let partition = (minimizer.seq_hash() & partition_mask) as usize;
|
||||
write_scatter(rsk.superkmer(), out, k, m, partition, minimizer)?;
|
||||
}
|
||||
Ok(())
|
||||
@@ -47,7 +47,7 @@ pub fn run(args: SuperkmerArgs) {
|
||||
PipelineData : PathBuf => Vec<RoutableSuperKmer>,
|
||||
||? { |path| open_chunks(path) } : Path => RawChunk,
|
||||
|? { move |rope| obiread::normalize_sequence_chunk(rope, k) } : RawChunk => NormChunk,
|
||||
| { move |rope| obiskbuilder::build_superkmers(rope, k, m, level_max, theta) }: NormChunk => Batch,
|
||||
| { move |rope| obiskbuilder::build_superkmers(rope, k, level_max, theta) }: NormChunk => Batch,
|
||||
};
|
||||
|
||||
let mut out = BufWriter::new(io::stdout());
|
||||
|
||||
@@ -7,6 +7,7 @@ use niffler::Level;
|
||||
use niffler::send::compression::Format;
|
||||
use obidebruinj::GraphDeBruijn;
|
||||
use obikpartitionner::KmerPartition;
|
||||
use obikseq::set_k;
|
||||
use obiskio::SKFileReader;
|
||||
use ph::fmph::GOFunction;
|
||||
use rayon::prelude::*;
|
||||
@@ -33,6 +34,7 @@ pub fn run(args: UnitigArgs) {
|
||||
});
|
||||
|
||||
let k = kp.kmer_size();
|
||||
set_k(k);
|
||||
let n = kp.n_partitions();
|
||||
info!("building unitigs from {n} partitions (k={k}, parallel)");
|
||||
|
||||
@@ -46,7 +48,7 @@ pub fn run(args: UnitigArgs) {
|
||||
}
|
||||
let out_path = part_dir.join("unitig.fasta.gz");
|
||||
|
||||
let mut g = GraphDeBruijn::new(k);
|
||||
let mut g = GraphDeBruijn::new();
|
||||
|
||||
let mphf_path = part_dir.join("mphf1.bin");
|
||||
let counts_path = part_dir.join("counts1.bin");
|
||||
@@ -86,12 +88,12 @@ pub fn run(args: UnitigArgs) {
|
||||
.as_ref()
|
||||
.map(|m| unsafe { std::slice::from_raw_parts(m.as_ptr() as *const u32, m.len() / 4) });
|
||||
|
||||
let mut reader = SKFileReader::open(&in_path, k).unwrap_or_else(|e| {
|
||||
let mut reader = SKFileReader::open(&in_path).unwrap_or_else(|e| {
|
||||
eprintln!("error opening {}: {e}", in_path.display());
|
||||
std::process::exit(1)
|
||||
});
|
||||
for sk in reader.iter() {
|
||||
for kmer in sk.iter_canonical_kmers(k) {
|
||||
for kmer in sk.iter_canonical_kmers() {
|
||||
let accept = match (&mphf_opt, counts_slice) {
|
||||
(Some(mphf), Some(counts)) => {
|
||||
if let Some(slot) = mphf.get(&kmer) {
|
||||
|
||||
@@ -15,6 +15,7 @@ use remove_dir_all::remove_dir_all;
|
||||
use niffler::Level;
|
||||
use niffler::send::compression::Format;
|
||||
use obikseq::RoutableSuperKmer;
|
||||
use obikseq::Sequence;
|
||||
use obikseq::superkmer::SuperKmer;
|
||||
use obiskio::{SKFileMeta, SKFileReader, SKFileWriter, SKResult};
|
||||
use rayon::prelude::*;
|
||||
@@ -124,8 +125,7 @@ impl KmerPartition {
|
||||
/// Route and write one super-kmer to its partition file.
|
||||
pub fn write(&mut self, rsk: RoutableSuperKmer) -> SKResult<()> {
|
||||
self.check_not_closed()?;
|
||||
let partition =
|
||||
(rsk.minimizer().seq_hash(self.minimizer_size) & self.partitions_mask) as usize;
|
||||
let partition = (rsk.minimizer().seq_hash() & self.partitions_mask) as usize;
|
||||
let sk = rsk.into_superkmer();
|
||||
self.ensure_writer(partition)?.write(&sk)
|
||||
}
|
||||
@@ -134,8 +134,7 @@ impl KmerPartition {
|
||||
pub fn write_batch(&mut self, rsks: Vec<RoutableSuperKmer>) -> SKResult<()> {
|
||||
self.check_not_closed()?;
|
||||
for rsk in rsks {
|
||||
let partition =
|
||||
(rsk.minimizer().seq_hash(self.minimizer_size) & self.partitions_mask) as usize;
|
||||
let partition = (rsk.minimizer().seq_hash() & self.partitions_mask) as usize;
|
||||
let sk = rsk.into_superkmer();
|
||||
self.ensure_writer(partition)?.write(&sk)?;
|
||||
}
|
||||
@@ -202,7 +201,6 @@ impl KmerPartition {
|
||||
/// more temporary file descriptors — all managed by the global fd pool.
|
||||
pub fn dereplicate(&self) -> SKResult<()> {
|
||||
let level = self.level;
|
||||
let k = self.kmer_size;
|
||||
let root = &self.root_path;
|
||||
let sys = System::new_all();
|
||||
// available_memory() can return 0 on macOS when the compressor page count exceeds
|
||||
@@ -223,7 +221,7 @@ impl KmerPartition {
|
||||
}
|
||||
let raw_path = dir.join(format!("raw.{SK_EXT}"));
|
||||
let n_buckets = optimal_buckets(&raw_path, available_per_thread);
|
||||
dereplicate_partition(&dir, level, n_buckets, k)
|
||||
dereplicate_partition(&dir, level, n_buckets)
|
||||
})
|
||||
.collect();
|
||||
|
||||
@@ -328,8 +326,7 @@ impl KmerPartition {
|
||||
let dir = self.root_path.join(format!("part_{:05}", partition));
|
||||
fs::create_dir_all(&dir)?;
|
||||
let file_path = dir.join(format!("raw.{SK_EXT}"));
|
||||
let writer =
|
||||
SKFileWriter::create_with(file_path, self.kmer_size, Format::Zstd, self.level)?;
|
||||
let writer = SKFileWriter::create_with(file_path, Format::Zstd, self.level)?;
|
||||
self.writers[partition] = Some(writer);
|
||||
}
|
||||
Ok(self.writers[partition].as_mut().unwrap())
|
||||
@@ -415,18 +412,18 @@ fn level_from_u32(n: u32) -> Level {
|
||||
const MAX_SK_COUNT: u64 = (1 << 24) - 1;
|
||||
|
||||
/// Deduplicate one partition directory in place (two-phase split + merge).
|
||||
fn dereplicate_partition(dir: &Path, level: Level, n_temp: usize, k: usize) -> SKResult<()> {
|
||||
fn dereplicate_partition(dir: &Path, level: Level, n_temp: usize) -> SKResult<()> {
|
||||
let raw_path = dir.join(format!("raw.{SK_EXT}"));
|
||||
if !raw_path.exists() {
|
||||
return Ok(());
|
||||
}
|
||||
|
||||
let out_path = dir.join(format!("dereplicated.{SK_EXT}"));
|
||||
let mut writer = SKFileWriter::create_with(&out_path, k, Format::Zstd, level)?;
|
||||
let mut writer = SKFileWriter::create_with(&out_path, Format::Zstd, level)?;
|
||||
|
||||
if n_temp == 1 {
|
||||
// ── Direct path: partition fits in memory, no split needed ────────────
|
||||
let map = load_bucket(&raw_path, k)?;
|
||||
let map = load_bucket(&raw_path)?;
|
||||
remove_skmer_file(&raw_path)?;
|
||||
flush_map(map, &mut writer)?;
|
||||
} else {
|
||||
@@ -439,10 +436,10 @@ fn dereplicate_partition(dir: &Path, level: Level, n_temp: usize, k: usize) -> S
|
||||
{
|
||||
let mut writers: Vec<SKFileWriter> = temp_paths
|
||||
.iter()
|
||||
.map(|p| SKFileWriter::create_with(p, k, Format::Zstd, level))
|
||||
.map(|p| SKFileWriter::create_with(p, Format::Zstd, level))
|
||||
.collect::<SKResult<_>>()?;
|
||||
|
||||
let mut reader = SKFileReader::open(&raw_path, k)?;
|
||||
let mut reader = SKFileReader::open(&raw_path)?;
|
||||
while let Some(sk) = reader.read()? {
|
||||
let bucket = (sk.seq_hash() & temp_mask) as usize;
|
||||
writers[bucket].write(&sk)?;
|
||||
@@ -455,7 +452,7 @@ fn dereplicate_partition(dir: &Path, level: Level, n_temp: usize, k: usize) -> S
|
||||
|
||||
// ── Phase 2: merge each temp bucket into the output ───────────────────
|
||||
for temp_path in &temp_paths {
|
||||
let map = load_bucket(temp_path, k)?;
|
||||
let map = load_bucket(temp_path)?;
|
||||
remove_skmer_file(temp_path)?;
|
||||
flush_map(map, &mut writer)?;
|
||||
}
|
||||
@@ -466,14 +463,14 @@ fn dereplicate_partition(dir: &Path, level: Level, n_temp: usize, k: usize) -> S
|
||||
}
|
||||
|
||||
/// Read a SuperKmer file into a deduplication map (already canonical).
|
||||
fn load_bucket(path: &Path, k: usize) -> SKResult<HashMap<SuperKmer, u64>> {
|
||||
fn load_bucket(path: &Path) -> SKResult<HashMap<SuperKmer, u64>> {
|
||||
let capacity = SKFileMeta::read(path)
|
||||
.ok()
|
||||
.flatten()
|
||||
.map(|m| m.instances as usize)
|
||||
.unwrap_or(0);
|
||||
let mut map: HashMap<SuperKmer, u64> = HashMap::with_capacity(capacity);
|
||||
let mut reader = SKFileReader::open(path, k)?;
|
||||
let mut reader = SKFileReader::open(path)?;
|
||||
while let Some(sk) = reader.read()? {
|
||||
let count = sk.count() as u64;
|
||||
*map.entry(sk).or_insert(0) += count;
|
||||
@@ -512,10 +509,10 @@ fn count_partition(dir: &Path, dedup_path: &Path, k: usize) -> SKResult<()> {
|
||||
let mut seen: HashSet<CanonicalKmer> = HashSet::with_capacity(capacity);
|
||||
let mut pass1_superkmers: u64 = 0;
|
||||
{
|
||||
let mut reader = SKFileReader::open(dedup_path, k)?;
|
||||
let mut reader = SKFileReader::open(dedup_path)?;
|
||||
while let Some(sk) = reader.read()? {
|
||||
pass1_superkmers += 1;
|
||||
for kmer in sk.iter_canonical_kmers(k) {
|
||||
for kmer in sk.iter_canonical_kmers() {
|
||||
seen.insert(kmer);
|
||||
}
|
||||
}
|
||||
@@ -555,10 +552,10 @@ fn count_partition(dir: &Path, dedup_path: &Path, k: usize) -> SKResult<()> {
|
||||
{
|
||||
let counts =
|
||||
unsafe { std::slice::from_raw_parts_mut(mmap.as_mut_ptr() as *mut u32, n_kmers) };
|
||||
let mut reader = SKFileReader::open(dedup_path, k)?;
|
||||
let mut reader = SKFileReader::open(dedup_path)?;
|
||||
while let Some(sk) = reader.read()? {
|
||||
pass2_superkmers += 1;
|
||||
let seql = sk.len();
|
||||
let seql = sk.seql();
|
||||
let sk_count = sk.count();
|
||||
if pass2_superkmers <= 3 {
|
||||
debug!(
|
||||
@@ -570,7 +567,7 @@ fn count_partition(dir: &Path, dedup_path: &Path, k: usize) -> SKResult<()> {
|
||||
continue;
|
||||
}
|
||||
pass2_count_sum += sk_count as u64;
|
||||
for kmer in sk.iter_canonical_kmers(k) {
|
||||
for kmer in sk.iter_canonical_kmers() {
|
||||
if let Some(idx) = mphf.get(&kmer) {
|
||||
counts[idx as usize] = counts[idx as usize].saturating_add(sk_count);
|
||||
pass2_kmer_hits += 1;
|
||||
|
||||
@@ -3,6 +3,11 @@ name = "obikseq"
|
||||
version = "0.1.0"
|
||||
edition = "2024"
|
||||
|
||||
[features]
|
||||
# Replaces the OnceLock-based params with thread-local storage so that
|
||||
# tests in dependent crates can call set_k / set_m freely without conflicts.
|
||||
test-utils = []
|
||||
|
||||
[dependencies]
|
||||
bitvec = "1"
|
||||
serde = { version = "1.0", features = ["derive"] }
|
||||
|
||||
@@ -2,6 +2,14 @@ use serde::Serialize;
|
||||
use serde_json;
|
||||
use std::io::{self, Write};
|
||||
|
||||
/// Minimal annotation carrying only the sequence length.
|
||||
#[derive(Serialize)]
|
||||
pub struct BasicAnnotation {
|
||||
pub seq_length: usize,
|
||||
}
|
||||
|
||||
impl Annotation for BasicAnnotation {}
|
||||
|
||||
/// Serialize `self` as a single-line JSON object into a writer.
|
||||
pub trait Annotation: Serialize {
|
||||
/// Write the annotation as compact JSON into `writer`.
|
||||
|
||||
+229
-265
@@ -1,12 +1,70 @@
|
||||
//! Compact 2-bit kmer stored as a left-aligned u64.
|
||||
//!
|
||||
//! Nucleotide 0 occupies bits 63–62, nucleotide i occupies bits 63−2i and 62−2i.
|
||||
//! The low 64−2k bits are always zero. k is not stored — it is a parameter of
|
||||
//! every operation that needs it, and will be owned by the collection-level indexer.
|
||||
//! The low 64−2·len bits are always zero.
|
||||
//!
|
||||
//! The length is not stored in the struct — it is supplied by the [`KmerLength`]
|
||||
//! type parameter. Two public marker types cover the common cases:
|
||||
//!
|
||||
//! | Alias | Marker | Length source |
|
||||
//! |-----------------|----------|----------------|
|
||||
//! | [`Kmer`] | [`KLen`] | `params::k()` |
|
||||
//! | [`CanonicalKmer`]| [`KLen`]| `params::k()` |
|
||||
//! | [`Minimizer`] | [`MLen`] | `params::m()` |
|
||||
//!
|
||||
//! Tests that need a fixed length independent of the global singletons can use
|
||||
//! [`ConstLen<N>`].
|
||||
|
||||
use serde::Serialize;
|
||||
use std::io::{self, Write};
|
||||
use std::marker::PhantomData;
|
||||
|
||||
use crate::Annotation;
|
||||
use crate::Sequence;
|
||||
use crate::encoding::{DEC4, encode_base};
|
||||
use crate::params::{k, m};
|
||||
use crate::sequence::mix64;
|
||||
|
||||
// ── KmerLength ────────────────────────────────────────────────────────────────
|
||||
|
||||
/// Marker trait that supplies a kmer length at runtime.
|
||||
pub trait KmerLength: Copy + std::fmt::Debug + 'static {
|
||||
/// Returns the length this marker represents.
|
||||
fn len() -> usize;
|
||||
}
|
||||
|
||||
/// Marker for the k-mer length (`params::k()`).
|
||||
#[derive(Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash)]
|
||||
pub struct KLen;
|
||||
|
||||
/// Marker for the minimizer length (`params::m()`).
|
||||
#[derive(Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash)]
|
||||
pub struct MLen;
|
||||
|
||||
/// Marker for a compile-time-constant length — useful for tests.
|
||||
#[derive(Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash)]
|
||||
pub struct ConstLen<const N: usize>;
|
||||
|
||||
impl KmerLength for KLen {
|
||||
#[inline]
|
||||
fn len() -> usize {
|
||||
k()
|
||||
}
|
||||
}
|
||||
|
||||
impl KmerLength for MLen {
|
||||
#[inline]
|
||||
fn len() -> usize {
|
||||
m()
|
||||
}
|
||||
}
|
||||
|
||||
impl<const N: usize> KmerLength for ConstLen<N> {
|
||||
#[inline]
|
||||
fn len() -> usize {
|
||||
N
|
||||
}
|
||||
}
|
||||
|
||||
// ── KmerError ─────────────────────────────────────────────────────────────────
|
||||
|
||||
@@ -43,35 +101,31 @@ impl std::fmt::Display for KmerError {
|
||||
|
||||
impl std::error::Error for KmerError {}
|
||||
|
||||
// ── Kmer ──────────────────────────────────────────────────────────────────────
|
||||
#[derive(Serialize)]
|
||||
struct KmerAnnotation {
|
||||
seq_length: usize,
|
||||
}
|
||||
impl Annotation for KmerAnnotation {}
|
||||
|
||||
/// A DNA kmer of length k encoded as a left-aligned u64 (2 bits/nucleotide, MSB-first).
|
||||
/// k is not stored in the struct — it must be supplied by the caller.
|
||||
// ── KmerOf ────────────────────────────────────────────────────────────────────
|
||||
|
||||
/// A DNA kmer of length `L::len()` encoded as a left-aligned u64 (2 bits/nucleotide, MSB-first).
|
||||
/// The low `64 − 2·L::len()` bits are always zero.
|
||||
#[repr(transparent)]
|
||||
#[derive(Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash)]
|
||||
pub struct Kmer(u64);
|
||||
pub struct KmerOf<L: KmerLength>(u64, PhantomData<L>);
|
||||
|
||||
#[inline]
|
||||
fn mix64(x: u64) -> u64 {
|
||||
let x = x ^ (x >> 30);
|
||||
let x = x.wrapping_mul(0xbf58476d1ce4e5b9);
|
||||
let x = x ^ (x >> 27);
|
||||
let x = x.wrapping_mul(0x94d049bb133111eb);
|
||||
x ^ (x >> 31)
|
||||
}
|
||||
|
||||
impl Kmer {
|
||||
/// Wrap a raw left-aligned u64 value as a Kmer.
|
||||
impl<L: KmerLength> KmerOf<L> {
|
||||
/// Wrap a raw left-aligned u64 value as a kmer.
|
||||
#[inline]
|
||||
pub fn from_raw(raw: u64) -> Self {
|
||||
Kmer(raw)
|
||||
KmerOf(raw, PhantomData)
|
||||
}
|
||||
|
||||
/// Wrap a raw right-aligned u64 value as a Kmer.
|
||||
/// The raw value is shifted left by `2 * k` bits to align it with the leftmost position.
|
||||
/// Wrap a raw right-aligned u64 value, shifting it into left-aligned position.
|
||||
#[inline]
|
||||
pub fn from_raw_right(raw: u64, k: usize) -> Self {
|
||||
Kmer(raw << (64 - 2 * k))
|
||||
pub fn from_raw_right(raw: u64) -> Self {
|
||||
KmerOf(raw << (64 - 2 * L::len()), PhantomData)
|
||||
}
|
||||
|
||||
/// Return the raw left-aligned u64 value.
|
||||
@@ -82,14 +136,13 @@ impl Kmer {
|
||||
|
||||
/// Return the raw right-aligned u64 value.
|
||||
#[inline]
|
||||
pub fn raw_right(&self, k: usize) -> u64 {
|
||||
self.0 >> (64 - 2 * k)
|
||||
pub fn raw_right(&self) -> u64 {
|
||||
self.0 >> (64 - 2 * L::len())
|
||||
}
|
||||
|
||||
/// Encode the first k nucleotides of an ASCII slice into a Kmer.
|
||||
/// Zero allocation — result lives on the stack.
|
||||
#[inline]
|
||||
pub fn from_ascii(ascii: &[u8], k: usize) -> Result<Self, KmerError> {
|
||||
/// Encode the first `L::len()` nucleotides of an ASCII slice into a kmer.
|
||||
pub fn from_ascii(ascii: &[u8]) -> Result<Self, KmerError> {
|
||||
let k = L::len();
|
||||
if k == 0 || k > 32 {
|
||||
return Err(KmerError::InvalidK { k });
|
||||
}
|
||||
@@ -104,26 +157,21 @@ impl Kmer {
|
||||
for i in 0..k {
|
||||
val = (val << 2) | encode_base(ascii[i]) as u64;
|
||||
}
|
||||
Ok(Kmer(val << (64 - 2 * k)))
|
||||
Ok(KmerOf(val << (64 - 2 * k), PhantomData))
|
||||
}
|
||||
|
||||
/// Extract nucleotide i (0-based from 5′ end) as a 2-bit value.
|
||||
/// Decode into a freshly allocated ASCII `Vec<u8>`.
|
||||
#[inline]
|
||||
pub fn nucleotide(&self, i: usize) -> u8 {
|
||||
((self.0 >> (62 - 2 * i)) & 0b11) as u8
|
||||
}
|
||||
|
||||
/// Decode this kmer into a freshly allocated ASCII `Vec<u8>`.
|
||||
#[inline]
|
||||
pub fn to_ascii(&self, k: usize) -> Vec<u8> {
|
||||
let mut buf = Vec::with_capacity(k);
|
||||
self.write_ascii(k, &mut buf).unwrap();
|
||||
pub fn to_ascii(&self) -> Vec<u8> {
|
||||
let mut buf = Vec::with_capacity(L::len());
|
||||
self.write_ascii(&mut buf).unwrap();
|
||||
buf
|
||||
}
|
||||
|
||||
/// Decode this kmer into ASCII nucleotides, writing into `writer`.
|
||||
/// Decode into ASCII nucleotides, writing into `writer`.
|
||||
#[inline]
|
||||
pub fn write_ascii<W: Write>(&self, k: usize, writer: &mut W) -> io::Result<()> {
|
||||
pub fn write_ascii<W: Write>(&self, writer: &mut W) -> io::Result<()> {
|
||||
let k = L::len();
|
||||
let bytes = self.0.to_be_bytes();
|
||||
let full = k / 4;
|
||||
let rem = k % 4;
|
||||
@@ -137,296 +185,212 @@ impl Kmer {
|
||||
Ok(())
|
||||
}
|
||||
|
||||
/// Compute the reverse complement of this kmer.
|
||||
/// Zero allocation — result lives on the stack.
|
||||
/// Compute the reverse complement.
|
||||
#[inline]
|
||||
pub fn revcomp(&self, k: usize) -> Self {
|
||||
let x = !self.0; // complement
|
||||
let x = x.swap_bytes(); // reverse bytes
|
||||
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4); // swap nibbles
|
||||
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2); // swap 2-bit groups
|
||||
Kmer(x << (64 - 2 * k))
|
||||
pub fn revcomp(&self) -> Self {
|
||||
let k = L::len();
|
||||
let x = !self.0;
|
||||
let x = x.swap_bytes();
|
||||
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
|
||||
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
|
||||
KmerOf(x << (64 - 2 * k), PhantomData)
|
||||
}
|
||||
|
||||
/// Return the canonical form: lexicographic minimum of forward and reverse complement.
|
||||
/// Zero allocation — result lives on the stack.
|
||||
#[inline]
|
||||
pub fn canonical(&self, k: usize) -> CanonicalKmer {
|
||||
let rc = self.revcomp(k);
|
||||
CanonicalKmer(if self.0 <= rc.0 { *self } else { rc })
|
||||
}
|
||||
|
||||
/// Slide the window one base to the right: drop the first nucleotide, append `nuc` at position k-1.
|
||||
pub fn push_right(self, nuc: u8, k: usize) -> Self {
|
||||
/// Slide the window one base to the right: drop nucleotide 0, append `nuc` at position `L::len()-1`.
|
||||
pub fn push_right(self, nuc: u8) -> Self {
|
||||
let k = L::len();
|
||||
let shifted = self.0 << 2 & (!0u64 << (64 - 2 * (k - 1)));
|
||||
let shift = 64 - 2 * k;
|
||||
Kmer(shifted | ((nuc as u64 & 3) << shift))
|
||||
KmerOf(shifted | ((nuc as u64 & 3) << (64 - 2 * k)), PhantomData)
|
||||
}
|
||||
|
||||
/// Slide the window one base to the left: drop the last nucleotide, prepend `nuc` at position 0.
|
||||
pub fn push_left(self, nuc: u8, k: usize) -> Self {
|
||||
/// Slide the window one base to the left: drop nucleotide `L::len()-1`, prepend `nuc` at position 0.
|
||||
pub fn push_left(self, nuc: u8) -> Self {
|
||||
let k = L::len();
|
||||
let shifted = (self.0 >> 2) & (!0u64 << (64 - 2 * k));
|
||||
Kmer(shifted | ((nuc as u64 & 3) << 62))
|
||||
KmerOf(shifted | ((nuc as u64 & 3) << 62), PhantomData)
|
||||
}
|
||||
|
||||
/// Returns `true` if `self` and `other` overlap by `k` - 1 bases.
|
||||
///
|
||||
/// The last K-1 nucleotides of `self` and the first K-1 nucleotides
|
||||
/// of `other` must be equal.
|
||||
pub fn is_overlapping(self, other: Self, k: usize) -> bool {
|
||||
let left = self.0 << 2 & (!0u64 << (64 - 2 * (k - 1)));
|
||||
let right = other.0 & (!0u64 << (64 - 2 * (k - 1)));
|
||||
left == right
|
||||
/// Returns `true` if the last `L::len()-1` nucleotides of `self` equal the first `L::len()-1` of `other`.
|
||||
pub fn is_overlapping(self, other: Self) -> bool {
|
||||
let k = L::len();
|
||||
let mask = !0u64 << (64 - 2 * (k - 1));
|
||||
(self.0 << 2 & mask) == (other.0 & mask)
|
||||
}
|
||||
}
|
||||
|
||||
// ── CanonicalKmer ─────────────────────────────────────────────────────────────
|
||||
impl<L: KmerLength> Sequence for KmerOf<L> {
|
||||
type Canonical = CanonicalKmerOf<L>;
|
||||
|
||||
/// A [`Kmer`] guaranteed to be in canonical form (lexicographic minimum of
|
||||
fn seql(&self) -> usize {
|
||||
L::len()
|
||||
}
|
||||
|
||||
fn seq_hash(&self) -> u64 {
|
||||
self.canonical().seq_hash()
|
||||
}
|
||||
|
||||
#[inline]
|
||||
fn nucleotide(&self, i: usize) -> u8 {
|
||||
((self.0 >> (62 - 2 * i)) & 0b11) as u8
|
||||
}
|
||||
|
||||
#[inline]
|
||||
fn canonical(&self) -> Self::Canonical {
|
||||
let rc = self.revcomp();
|
||||
CanonicalKmerOf(if self.0 <= rc.0 { self.0 } else { rc.0 }, PhantomData)
|
||||
}
|
||||
|
||||
fn annotation(&self) -> impl Annotation {
|
||||
KmerAnnotation {
|
||||
seq_length: L::len(),
|
||||
}
|
||||
}
|
||||
}
|
||||
// ── CanonicalKmerOf ───────────────────────────────────────────────────────────
|
||||
|
||||
/// A [`KmerOf<L>`] guaranteed to be in canonical form (lexicographic minimum of
|
||||
/// forward and reverse complement).
|
||||
///
|
||||
/// The only public constructors are [`Kmer::canonical`] (checked) and
|
||||
/// [`CanonicalKmer::from_raw_unchecked`] (for trusted paths such as
|
||||
/// deserialisation or rolling-window minimizer extraction).
|
||||
/// The only public constructors are [`KmerOf::canonical`] (verified) and
|
||||
/// [`CanonicalKmerOf::from_raw_unchecked`] (trusted paths such as deserialisation).
|
||||
#[repr(transparent)]
|
||||
#[derive(Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash)]
|
||||
pub struct CanonicalKmer(Kmer);
|
||||
pub struct CanonicalKmerOf<L: KmerLength>(u64, PhantomData<L>);
|
||||
|
||||
impl CanonicalKmer {
|
||||
impl<L: KmerLength> CanonicalKmerOf<L> {
|
||||
/// Wrap a raw left-aligned u64 without verifying the canonical invariant.
|
||||
///
|
||||
/// # Safety (logical)
|
||||
/// The caller must guarantee that `raw == min(raw, revcomp(raw, k))`.
|
||||
/// Violations cause silently wrong results in MPHF lookup and graph traversal.
|
||||
/// The caller must guarantee `raw == min(raw, revcomp(raw))`.
|
||||
#[inline]
|
||||
pub fn from_raw_unchecked(raw: u64) -> Self {
|
||||
CanonicalKmer(Kmer(raw))
|
||||
CanonicalKmerOf(raw, PhantomData)
|
||||
}
|
||||
|
||||
/// Return the raw left-aligned u64 value.
|
||||
#[inline]
|
||||
pub fn raw(&self) -> u64 {
|
||||
self.0.0
|
||||
self.0
|
||||
}
|
||||
|
||||
/// Decode into a freshly allocated ASCII `Vec<u8>`.
|
||||
#[inline]
|
||||
pub fn to_ascii(&self, k: usize) -> Vec<u8> {
|
||||
self.0.to_ascii(k)
|
||||
pub fn to_ascii(&self) -> Vec<u8> {
|
||||
self.into_kmer().to_ascii()
|
||||
}
|
||||
|
||||
/// Decode into ASCII nucleotides, writing into `writer`.
|
||||
#[inline]
|
||||
pub fn write_ascii<W: Write>(&self, k: usize, writer: &mut W) -> io::Result<()> {
|
||||
self.0.write_ascii(k, writer)
|
||||
pub fn write_ascii<W: Write>(&self, writer: &mut W) -> io::Result<()> {
|
||||
self.into_kmer().write_ascii(writer)
|
||||
}
|
||||
|
||||
/// Compute the reverse complement. The result is a raw [`Kmer`] — the
|
||||
/// revcomp of a canonical kmer is not necessarily canonical itself.
|
||||
/// Compute the reverse complement. The result is a raw [`KmerOf<L>`] — not
|
||||
/// necessarily canonical itself.
|
||||
#[inline]
|
||||
pub fn revcomp(&self, k: usize) -> Kmer {
|
||||
self.0.revcomp(k)
|
||||
pub fn revcomp(&self) -> KmerOf<L> {
|
||||
self.into_kmer().revcomp()
|
||||
}
|
||||
|
||||
/// Hash via `mix64`. No re-canonicalisation needed.
|
||||
/// Hash via `mix64`.
|
||||
#[inline]
|
||||
pub fn seq_hash(&self, _k: usize) -> u64 {
|
||||
mix64(self.0.0)
|
||||
pub fn seq_hash(&self) -> u64 {
|
||||
hash_kmer(self.0)
|
||||
}
|
||||
|
||||
/// Extract nucleotide i (0-based from 5′ end) as a 2-bit value.
|
||||
#[inline]
|
||||
pub fn nucleotide(&self, i: usize) -> u8 {
|
||||
self.0.nucleotide(i)
|
||||
self.into_kmer().nucleotide(i)
|
||||
}
|
||||
|
||||
/// Return the four left canonical neighbours (each already canonical).
|
||||
/// Zero allocation — result lives on the stack.
|
||||
pub fn left_canonical_neighbors(&self, k: usize) -> [CanonicalKmer; 4] {
|
||||
let shifted = (self.raw() >> 2) & (!0u64 << (64 - 2 * k));
|
||||
pub fn left_canonical_neighbors(&self) -> [CanonicalKmerOf<L>; 4] {
|
||||
let k = L::len();
|
||||
let shifted = (self.0 >> 2) & (!0u64 << (64 - 2 * k));
|
||||
[
|
||||
Kmer(shifted).canonical(k),
|
||||
Kmer(shifted | (1u64 << 62)).canonical(k),
|
||||
Kmer(shifted | (2u64 << 62)).canonical(k),
|
||||
Kmer(shifted | (3u64 << 62)).canonical(k),
|
||||
KmerOf::<L>(shifted, PhantomData).canonical(),
|
||||
KmerOf::<L>(shifted | (1u64 << 62), PhantomData).canonical(),
|
||||
KmerOf::<L>(shifted | (2u64 << 62), PhantomData).canonical(),
|
||||
KmerOf::<L>(shifted | (3u64 << 62), PhantomData).canonical(),
|
||||
]
|
||||
}
|
||||
|
||||
/// Return the four right canonical neighbours (each already canonical).
|
||||
/// Zero allocation — result lives on the stack.
|
||||
pub fn right_canonical_neighbors(&self, k: usize) -> [CanonicalKmer; 4] {
|
||||
let shifted = self.raw() << 2 & (!0u64 << (64 - 2 * (k - 1)));
|
||||
pub fn right_canonical_neighbors(&self) -> [CanonicalKmerOf<L>; 4] {
|
||||
let k = L::len();
|
||||
let shifted = self.0 << 2 & (!0u64 << (64 - 2 * (k - 1)));
|
||||
let shift = 64 - 2 * k;
|
||||
[
|
||||
Kmer(shifted).canonical(k),
|
||||
Kmer(shifted | (1u64 << shift)).canonical(k),
|
||||
Kmer(shifted | (2u64 << shift)).canonical(k),
|
||||
Kmer(shifted | (3u64 << shift)).canonical(k),
|
||||
KmerOf::<L>(shifted, PhantomData).canonical(),
|
||||
KmerOf::<L>(shifted | (1u64 << shift), PhantomData).canonical(),
|
||||
KmerOf::<L>(shifted | (2u64 << shift), PhantomData).canonical(),
|
||||
KmerOf::<L>(shifted | (3u64 << shift), PhantomData).canonical(),
|
||||
]
|
||||
}
|
||||
|
||||
/// Consume this wrapper and return the inner raw [`Kmer`].
|
||||
/// Return the inner value as a raw [`KmerOf<L>`].
|
||||
#[inline]
|
||||
pub fn into_kmer(self) -> Kmer {
|
||||
self.0
|
||||
pub fn into_kmer(self) -> KmerOf<L> {
|
||||
KmerOf(self.0, PhantomData)
|
||||
}
|
||||
}
|
||||
|
||||
impl From<CanonicalKmer> for Kmer {
|
||||
#[inline]
|
||||
fn from(ck: CanonicalKmer) -> Self {
|
||||
ck.0
|
||||
impl<L: KmerLength> Sequence for CanonicalKmerOf<L> {
|
||||
type Canonical = CanonicalKmerOf<L>;
|
||||
|
||||
fn seql(&self) -> usize {
|
||||
L::len()
|
||||
}
|
||||
|
||||
fn seq_hash(&self) -> u64 {
|
||||
hash_kmer(self.0)
|
||||
}
|
||||
|
||||
#[inline]
|
||||
fn nucleotide(&self, i: usize) -> u8 {
|
||||
((self.0 >> (62 - 2 * i)) & 0b11) as u8
|
||||
}
|
||||
|
||||
fn canonical(&self) -> Self::Canonical {
|
||||
*self
|
||||
}
|
||||
|
||||
fn annotation(&self) -> impl Annotation {
|
||||
KmerAnnotation {
|
||||
seq_length: L::len(),
|
||||
}
|
||||
}
|
||||
}
|
||||
impl<L: KmerLength> From<CanonicalKmerOf<L>> for KmerOf<L> {
|
||||
#[inline]
|
||||
fn from(ck: CanonicalKmerOf<L>) -> Self {
|
||||
ck.into_kmer()
|
||||
}
|
||||
}
|
||||
|
||||
// ── Public type aliases ───────────────────────────────────────────────────────
|
||||
|
||||
/// A DNA k-mer using the global `params::k()` length.
|
||||
pub type Kmer = KmerOf<KLen>;
|
||||
|
||||
/// A canonical k-mer using the global `params::k()` length.
|
||||
pub type CanonicalKmer = CanonicalKmerOf<KLen>;
|
||||
|
||||
/// A minimizer: a canonical k-mer using the global `params::m()` length.
|
||||
pub type Minimizer = CanonicalKmerOf<MLen>;
|
||||
|
||||
/// Compute a hash for a raw (left-aligned) kmer value.
|
||||
///
|
||||
/// This is a convenience wrapper around [`mix64`] that accepts the raw
|
||||
/// 64-bit representation directly, which is useful when the canonical
|
||||
/// invariant is not required or has already been handled.
|
||||
#[inline]
|
||||
pub fn hash_kmer(raw: u64) -> u64 {
|
||||
mix64(raw ^ 0x9e3779b97f4a7c15)
|
||||
}
|
||||
|
||||
// ── tests ─────────────────────────────────────────────────────────────────────
|
||||
|
||||
#[cfg(test)]
|
||||
mod tests {
|
||||
use super::*;
|
||||
|
||||
fn ascii_revcomp(seq: &[u8]) -> Vec<u8> {
|
||||
seq.iter()
|
||||
.rev()
|
||||
.map(|&b| match b {
|
||||
b'A' => b'T',
|
||||
b'T' => b'A',
|
||||
b'C' => b'G',
|
||||
b'G' => b'C',
|
||||
_ => b'A',
|
||||
})
|
||||
.collect()
|
||||
}
|
||||
|
||||
const K_VALUES: &[usize] = &[1, 2, 3, 4, 8, 11, 16, 31, 32];
|
||||
|
||||
fn make_seq(k: usize) -> Vec<u8> {
|
||||
(0..k).map(|i| b"ACGT"[i % 4]).collect()
|
||||
}
|
||||
|
||||
// ── from_ascii / to_ascii ─────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn ascii_roundtrip() {
|
||||
for &k in K_VALUES {
|
||||
let ascii = make_seq(k);
|
||||
let kmer = Kmer::from_ascii(&ascii, k).unwrap();
|
||||
assert_eq!(kmer.to_ascii(k), ascii, "roundtrip failed for k={k}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn from_ascii_all_bases() {
|
||||
for (base, expected) in [(b'A', b'A'), (b'C', b'C'), (b'G', b'G'), (b'T', b'T')] {
|
||||
let kmer = Kmer::from_ascii(&[base], 1).unwrap();
|
||||
assert_eq!(kmer.to_ascii(1), vec![expected]);
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn from_ascii_invalid_k() {
|
||||
assert!(Kmer::from_ascii(b"A", 0).is_err());
|
||||
assert!(Kmer::from_ascii(b"ACGT", 33).is_err());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn from_ascii_too_short() {
|
||||
assert!(Kmer::from_ascii(b"ACG", 4).is_err());
|
||||
}
|
||||
|
||||
// ── nucleotide ────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn nucleotide_extraction() {
|
||||
let kmer = Kmer::from_ascii(b"ACGT", 4).unwrap();
|
||||
assert_eq!(kmer.nucleotide(0), 0b00); // A
|
||||
assert_eq!(kmer.nucleotide(1), 0b01); // C
|
||||
assert_eq!(kmer.nucleotide(2), 0b10); // G
|
||||
assert_eq!(kmer.nucleotide(3), 0b11); // T
|
||||
}
|
||||
|
||||
// ── revcomp ───────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn revcomp_known_values() {
|
||||
let cases: &[(&[u8], &[u8])] = &[
|
||||
(b"A", b"T"),
|
||||
(b"AC", b"GT"),
|
||||
(b"ACG", b"CGT"),
|
||||
(b"ACGT", b"ACGT"), // palindrome
|
||||
(b"AAAA", b"TTTT"),
|
||||
(b"TTTT", b"AAAA"),
|
||||
];
|
||||
for (seq, expected) in cases {
|
||||
let k = seq.len();
|
||||
let kmer = Kmer::from_ascii(seq, k).unwrap();
|
||||
let rc = kmer.revcomp(k);
|
||||
assert_eq!(
|
||||
rc.to_ascii(k),
|
||||
*expected,
|
||||
"revcomp wrong for \"{}\"",
|
||||
std::str::from_utf8(seq).unwrap()
|
||||
);
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn revcomp_vs_reference() {
|
||||
for &k in K_VALUES {
|
||||
let ascii = make_seq(k);
|
||||
let expected = ascii_revcomp(&ascii);
|
||||
let rc = Kmer::from_ascii(&ascii, k).unwrap().revcomp(k);
|
||||
assert_eq!(rc.to_ascii(k), expected, "revcomp wrong for k={k}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn revcomp_involution() {
|
||||
for &k in K_VALUES {
|
||||
let ascii = make_seq(k);
|
||||
let kmer = Kmer::from_ascii(&ascii, k).unwrap();
|
||||
assert_eq!(
|
||||
kmer.revcomp(k).revcomp(k),
|
||||
kmer,
|
||||
"revcomp∘revcomp≠id for k={k}"
|
||||
);
|
||||
}
|
||||
}
|
||||
|
||||
// ── canonical ─────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn canonical_palindrome() {
|
||||
let kmer = Kmer::from_ascii(b"ACGT", 4).unwrap();
|
||||
assert_eq!(kmer.canonical(4).into_kmer(), kmer);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_chooses_lesser() {
|
||||
let kmer = Kmer::from_ascii(b"TTTT", 4).unwrap();
|
||||
let expected = Kmer::from_ascii(b"AAAA", 4).unwrap();
|
||||
assert_eq!(kmer.canonical(4).into_kmer(), expected);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_is_minimal() {
|
||||
for &k in K_VALUES {
|
||||
let ascii = make_seq(k);
|
||||
let ck = Kmer::from_ascii(&ascii, k).unwrap().canonical(k);
|
||||
let rc = ck.revcomp(k);
|
||||
assert!(ck.raw() <= rc.raw(), "canonical not minimal for k={k}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_idempotent() {
|
||||
for &k in K_VALUES {
|
||||
let ck = Kmer::from_ascii(&make_seq(k), k).unwrap().canonical(k);
|
||||
assert_eq!(
|
||||
ck.into_kmer().canonical(k),
|
||||
ck,
|
||||
"canonical not idempotent for k={k}"
|
||||
);
|
||||
}
|
||||
}
|
||||
}
|
||||
#[path = "tests/kmer.rs"]
|
||||
mod tests;
|
||||
@@ -9,6 +9,8 @@ mod annotations;
|
||||
|
||||
mod encoding;
|
||||
pub mod kmer;
|
||||
pub mod packed_seq;
|
||||
pub mod params;
|
||||
mod revcomp_lookup;
|
||||
/// Routable super-kmer: canonical sequence paired with its minimizer for scatter routing.
|
||||
pub mod routable;
|
||||
@@ -18,7 +20,9 @@ pub mod superkmer;
|
||||
pub mod unitig;
|
||||
|
||||
pub use annotations::Annotation;
|
||||
pub use kmer::CanonicalKmer;
|
||||
pub use kmer::{CanonicalKmer, Kmer, Minimizer, hash_kmer};
|
||||
pub use params::{k, m, set_k, set_m};
|
||||
pub use routable::RoutableSuperKmer;
|
||||
pub use sequence::Sequence;
|
||||
pub use superkmer::SuperKmer;
|
||||
pub use unitig::Unitig;
|
||||
@@ -0,0 +1,361 @@
|
||||
//! Compact 2-bit DNA sequence — shared substrate for [`SuperKmer`] and [`Unitig`].
|
||||
//!
|
||||
//! Encoding: A=00, C=01, G=10, T=11. Nucleotide 0 occupies bits 7–6 of `seq[0]`,
|
||||
//! nucleotide i occupies bits `7−2*(i%4)` and `6−2*(i%4)` of `seq[i/4]`.
|
||||
//! Padding bits in the last byte are always 0.
|
||||
//!
|
||||
//! The exact nucleotide count is recovered without storing it explicitly:
|
||||
//!
|
||||
//! ```text
|
||||
//! seql = (seq.len() - 1) * 4 + tail_count(tail)
|
||||
//! ```
|
||||
//!
|
||||
//! where `tail` encodes the number of valid nucleotides in the last byte (0 → 4).
|
||||
|
||||
use std::io::{self, Read, Write};
|
||||
|
||||
use bitvec::prelude::*;
|
||||
|
||||
use crate::Sequence;
|
||||
use crate::encoding::{DEC4, encode_base};
|
||||
use crate::kmer::{CanonicalKmer, Kmer, KmerError, KLen, KmerLength, KmerOf, MLen, Minimizer};
|
||||
use crate::params::k;
|
||||
use crate::revcomp_lookup::REVCOMP4;
|
||||
|
||||
// ── PackedSeq ─────────────────────────────────────────────────────────────────
|
||||
|
||||
/// 2-bit packed DNA sequence of arbitrary length ≥ 1.
|
||||
///
|
||||
/// `tail` encodes the number of valid nucleotides in the last byte: 0 stands for 4,
|
||||
/// so the range 0–3 covers all four cases. Padding bits are always 0.
|
||||
#[derive(Debug, Clone)]
|
||||
pub struct PackedSeq {
|
||||
pub(crate) tail: u8,
|
||||
pub(crate) seq: Box<[u8]>,
|
||||
}
|
||||
|
||||
impl PartialEq for PackedSeq {
|
||||
fn eq(&self, other: &Self) -> bool {
|
||||
self.tail == other.tail && self.seq == other.seq
|
||||
}
|
||||
}
|
||||
|
||||
impl Eq for PackedSeq {}
|
||||
|
||||
impl std::hash::Hash for PackedSeq {
|
||||
fn hash<H: std::hash::Hasher>(&self, state: &mut H) {
|
||||
self.tail.hash(state);
|
||||
self.seq.hash(state);
|
||||
}
|
||||
}
|
||||
|
||||
impl PackedSeq {
|
||||
/// Construct from pre-packed bytes and a `tail` value (0–3, where 0 means 4).
|
||||
/// Caller must guarantee padding bits in the last byte are zeroed.
|
||||
#[inline]
|
||||
pub fn new(tail: u8, seq: Box<[u8]>) -> Self {
|
||||
debug_assert!(tail <= 3, "tail must be 0–3");
|
||||
debug_assert!(!seq.is_empty(), "seq must be non-empty");
|
||||
Self { tail, seq }
|
||||
}
|
||||
|
||||
/// Sequence length in nucleotides.
|
||||
#[inline]
|
||||
pub fn seql(&self) -> usize {
|
||||
(self.seq.len() - 1) * 4 + tail_count(self.tail)
|
||||
}
|
||||
|
||||
/// Read-only view of the packed 2-bit bytes.
|
||||
#[inline]
|
||||
pub fn seq_bytes(&self) -> &[u8] {
|
||||
&self.seq
|
||||
}
|
||||
|
||||
/// Extract nucleotide i (0-based from 5′ end) as a 2-bit value. Zero copy.
|
||||
#[inline]
|
||||
pub fn nucleotide(&self, i: usize) -> u8 {
|
||||
(self.seq[i / 4] >> (6 - 2 * (i % 4))) & 0b11
|
||||
}
|
||||
|
||||
/// Encode an ASCII nucleotide slice (ACGT, length ≥ 1). Allocates once.
|
||||
pub fn from_ascii(ascii: &[u8]) -> Self {
|
||||
let seql = ascii.len();
|
||||
debug_assert!(seql >= 1);
|
||||
let n = byte_len(seql);
|
||||
let mut seq = vec![0u8; n];
|
||||
let full = seql / 4;
|
||||
for i in 0..full {
|
||||
seq[i] = encode_base(ascii[i * 4]) << 6
|
||||
| encode_base(ascii[i * 4 + 1]) << 4
|
||||
| encode_base(ascii[i * 4 + 2]) << 2
|
||||
| encode_base(ascii[i * 4 + 3]);
|
||||
}
|
||||
let rem = seql % 4;
|
||||
if rem > 0 {
|
||||
let mut last = 0u8;
|
||||
for j in 0..rem {
|
||||
last |= encode_base(ascii[full * 4 + j]) << (6 - 2 * j);
|
||||
}
|
||||
seq[full] = last;
|
||||
}
|
||||
Self::new(count_to_tail(seql), seq.into_boxed_slice())
|
||||
}
|
||||
|
||||
/// Encode a slice of 2-bit nucleotide values (0=A…3=T, length ≥ 1). Allocates once.
|
||||
pub fn from_nucleotides(nucs: &[u8]) -> Self {
|
||||
let seql = nucs.len();
|
||||
debug_assert!(seql >= 1);
|
||||
let n = byte_len(seql);
|
||||
let mut seq = vec![0u8; n];
|
||||
for (i, &nuc) in nucs.iter().enumerate() {
|
||||
seq[i / 4] |= (nuc & 0b11) << (6 - 2 * (i % 4));
|
||||
}
|
||||
Self::new(count_to_tail(seql), seq.into_boxed_slice())
|
||||
}
|
||||
|
||||
/// Write ASCII nucleotides into `writer`. Zero allocation.
|
||||
pub fn write_ascii<W: Write>(&self, writer: &mut W) -> io::Result<()> {
|
||||
let seql = self.seql();
|
||||
let full = seql / 4;
|
||||
for i in 0..full {
|
||||
writer.write_all(&DEC4[self.seq[i] as usize].to_be_bytes())?;
|
||||
}
|
||||
let rem = seql % 4;
|
||||
if rem > 0 {
|
||||
writer.write_all(&DEC4[self.seq[full] as usize].to_be_bytes()[..rem])?;
|
||||
}
|
||||
Ok(())
|
||||
}
|
||||
|
||||
/// Decode into a fresh ASCII `Vec<u8>`. Allocates.
|
||||
#[inline]
|
||||
pub fn to_ascii(&self) -> Vec<u8> {
|
||||
let mut buf = Vec::with_capacity(self.seql());
|
||||
self.write_ascii(&mut buf).unwrap();
|
||||
buf
|
||||
}
|
||||
|
||||
/// Reverse-complement in place. Zero allocation.
|
||||
pub fn revcomp_inplace(&mut self) {
|
||||
let seql = self.seql();
|
||||
let n = self.seq.len();
|
||||
{
|
||||
let bytes = &mut self.seq[..n];
|
||||
let (mut lo, mut hi) = (0, n - 1);
|
||||
while lo < hi {
|
||||
(bytes[lo], bytes[hi]) =
|
||||
(REVCOMP4[bytes[hi] as usize], REVCOMP4[bytes[lo] as usize]);
|
||||
lo += 1;
|
||||
hi -= 1;
|
||||
}
|
||||
if lo == hi {
|
||||
bytes[lo] = REVCOMP4[bytes[lo] as usize];
|
||||
}
|
||||
}
|
||||
let shift = n * 8 - seql * 2;
|
||||
if shift > 0 {
|
||||
let bits = self.seq[..n].view_bits_mut::<Msb0>();
|
||||
bits.rotate_left(shift);
|
||||
let len = bits.len();
|
||||
bits[len - shift..].fill(false);
|
||||
}
|
||||
// tail is invariant: seql is unchanged by revcomp
|
||||
}
|
||||
|
||||
/// Returns `true` if in canonical form (lexicographic minimum of forward and revcomp).
|
||||
pub fn is_canonical(&self) -> bool {
|
||||
let seql = self.seql();
|
||||
for i in 0..seql {
|
||||
let fwd = self.nucleotide(i);
|
||||
let rev = complement(self.nucleotide(seql - 1 - i));
|
||||
match fwd.cmp(&rev) {
|
||||
std::cmp::Ordering::Less => return true,
|
||||
std::cmp::Ordering::Greater => return false,
|
||||
std::cmp::Ordering::Equal => {}
|
||||
}
|
||||
}
|
||||
true
|
||||
}
|
||||
|
||||
/// Put in canonical form in place. Returns `true` if already canonical. Zero allocation.
|
||||
#[inline]
|
||||
pub fn canonicalize(&mut self) -> bool {
|
||||
if self.is_canonical() {
|
||||
return true;
|
||||
}
|
||||
self.revcomp_inplace();
|
||||
false
|
||||
}
|
||||
|
||||
/// Extract a kmer of length `L::len()` at nucleotide position `i`. Zero allocation.
|
||||
fn extract<L: KmerLength>(&self, i: usize) -> Result<KmerOf<L>, KmerError> {
|
||||
let len = L::len();
|
||||
let seql = self.seql();
|
||||
if i + len > seql {
|
||||
return Err(KmerError::OutOfBounds { position: i, k: len, seql });
|
||||
}
|
||||
let bits = self.seq.view_bits::<Msb0>();
|
||||
let raw: u64 = bits[i * 2..(i + len) * 2].load_be();
|
||||
Ok(KmerOf::from_raw(raw << (64 - 2 * len)))
|
||||
}
|
||||
|
||||
/// Extract the kmer of length `params::k()` at nucleotide position `i`. Zero allocation.
|
||||
#[inline]
|
||||
pub fn kmer(&self, i: usize) -> Result<Kmer, KmerError> {
|
||||
self.extract::<KLen>(i)
|
||||
}
|
||||
|
||||
/// Extract the canonical m-mer (minimizer) of length `params::m()` at position `i`. Zero allocation.
|
||||
#[inline]
|
||||
pub fn mmer(&self, i: usize) -> Result<Minimizer, KmerError> {
|
||||
Ok(self.extract::<MLen>(i)?.canonical())
|
||||
}
|
||||
|
||||
/// Extract the canonical kmer of length `params::k()` at position `i`. Zero allocation.
|
||||
#[inline]
|
||||
pub fn canonical_kmer(&self, i: usize) -> Result<CanonicalKmer, KmerError> {
|
||||
Ok(self.kmer(i)?.canonical())
|
||||
}
|
||||
|
||||
/// Iterate over all kmers of length `params::k()` in order. Zero allocation.
|
||||
#[inline]
|
||||
pub fn iter_kmers(&self) -> PackedSeqKmerIter<'_> {
|
||||
PackedSeqKmerIter::new(self)
|
||||
}
|
||||
|
||||
/// Iterate over all canonical kmers of length `params::k()` in order. Zero allocation.
|
||||
#[inline]
|
||||
pub fn iter_canonical_kmers(&self) -> impl Iterator<Item = CanonicalKmer> + '_ {
|
||||
self.iter_kmers().map(|km| km.canonical())
|
||||
}
|
||||
|
||||
/// Serialise to a compact binary representation.
|
||||
///
|
||||
/// Format: varint(seql) followed by raw packed bytes.
|
||||
/// `tail` and `byte_len` are both derivable from `seql` and need not be stored.
|
||||
pub fn write_to_binary<W: Write>(&self, w: &mut W) -> io::Result<()> {
|
||||
write_varint(w, self.seql() as u64)?;
|
||||
w.write_all(&self.seq)
|
||||
}
|
||||
|
||||
/// Deserialise from the compact binary format produced by [`write_to_binary`].
|
||||
/// Allocates exactly one `Box<[u8]>` for the packed bytes.
|
||||
pub fn read_from_binary<R: Read>(r: &mut R) -> io::Result<Self> {
|
||||
let seql = read_varint(r)? as usize;
|
||||
if seql == 0 {
|
||||
return Err(io::Error::new(io::ErrorKind::InvalidData, "empty sequence"));
|
||||
}
|
||||
let byte_len = (seql + 3) / 4;
|
||||
let tail = (seql % 4) as u8;
|
||||
let mut seq = vec![0u8; byte_len];
|
||||
r.read_exact(&mut seq)?;
|
||||
Ok(Self::new(tail, seq.into_boxed_slice()))
|
||||
}
|
||||
}
|
||||
|
||||
// ── PackedSeqKmerIter ─────────────────────────────────────────────────────────
|
||||
|
||||
/// Sliding-window kmer iterator over a [`PackedSeq`]. Zero allocation.
|
||||
pub struct PackedSeqKmerIter<'a> {
|
||||
seq: &'a PackedSeq,
|
||||
mask: u64,
|
||||
lshift: usize,
|
||||
current: u64,
|
||||
pos: usize,
|
||||
max_pos: usize,
|
||||
}
|
||||
|
||||
impl<'a> PackedSeqKmerIter<'a> {
|
||||
fn new(seq: &'a PackedSeq) -> Self {
|
||||
let seql = seq.seql();
|
||||
let klen = k();
|
||||
let lshift = 64 - klen * 2;
|
||||
let mask = ((!0u128) << (lshift + 2)) as u64;
|
||||
Self {
|
||||
seq,
|
||||
mask,
|
||||
lshift,
|
||||
current: if seql >= klen { seq.extract::<KLen>(0).map(|km| km.raw()).unwrap_or(0) } else { 0 },
|
||||
pos: klen,
|
||||
max_pos: seql,
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
impl Iterator for PackedSeqKmerIter<'_> {
|
||||
type Item = Kmer;
|
||||
|
||||
fn next(&mut self) -> Option<Kmer> {
|
||||
if self.pos > self.max_pos {
|
||||
return None;
|
||||
}
|
||||
let result = Kmer::from_raw(self.current);
|
||||
if self.pos < self.max_pos {
|
||||
let inner_shift = 6 - 2 * (self.pos & 3);
|
||||
let nuc = ((self.seq.seq[self.pos / 4] >> inner_shift) & 3) as u64;
|
||||
self.current = ((self.current << 2) & self.mask) | (nuc << self.lshift);
|
||||
}
|
||||
self.pos += 1;
|
||||
Some(result)
|
||||
}
|
||||
}
|
||||
|
||||
// ── varint (LEB128) ───────────────────────────────────────────────────────────
|
||||
|
||||
pub(crate) fn write_varint<W: Write>(w: &mut W, mut val: u64) -> io::Result<()> {
|
||||
loop {
|
||||
let mut byte = (val & 0x7F) as u8;
|
||||
val >>= 7;
|
||||
if val != 0 {
|
||||
byte |= 0x80;
|
||||
}
|
||||
w.write_all(&[byte])?;
|
||||
if val == 0 {
|
||||
break;
|
||||
}
|
||||
}
|
||||
Ok(())
|
||||
}
|
||||
|
||||
pub(crate) fn read_varint<R: Read>(r: &mut R) -> io::Result<u64> {
|
||||
let mut val = 0u64;
|
||||
let mut shift = 0u32;
|
||||
let mut buf = [0u8; 1];
|
||||
loop {
|
||||
r.read_exact(&mut buf)?;
|
||||
let byte = buf[0];
|
||||
val |= ((byte & 0x7F) as u64) << shift;
|
||||
if byte & 0x80 == 0 {
|
||||
break;
|
||||
}
|
||||
shift += 7;
|
||||
if shift >= 64 {
|
||||
return Err(io::Error::new(io::ErrorKind::InvalidData, "varint overflow"));
|
||||
}
|
||||
}
|
||||
Ok(val)
|
||||
}
|
||||
|
||||
// ── helpers ───────────────────────────────────────────────────────────────────
|
||||
|
||||
#[inline]
|
||||
fn complement(base: u8) -> u8 {
|
||||
!base & 0b11
|
||||
}
|
||||
|
||||
#[inline]
|
||||
fn byte_len(seql: usize) -> usize {
|
||||
(seql + 3) / 4
|
||||
}
|
||||
|
||||
/// Nucleotide count → `tail` value: 0 encodes 4, 1–3 are identity.
|
||||
#[inline]
|
||||
pub(crate) fn count_to_tail(seql: usize) -> u8 {
|
||||
(seql % 4) as u8
|
||||
}
|
||||
|
||||
/// `tail` value → nucleotide count in last byte: 0 means 4.
|
||||
#[inline]
|
||||
pub(crate) fn tail_count(tail: u8) -> usize {
|
||||
if tail == 0 { 4 } else { tail as usize }
|
||||
}
|
||||
@@ -0,0 +1,102 @@
|
||||
//! Global k-mer and minimizer length parameters, set once at program startup.
|
||||
//!
|
||||
//! # Production vs. test behaviour
|
||||
//!
|
||||
//! In production (`#[cfg(not(test))]`) both `K` and `M` are stored in a
|
||||
//! [`OnceLock`]: they can be initialised exactly once; any attempt to set a
|
||||
//! different value panics. This prevents silent divergence between the global
|
||||
//! parameter and the values used to build data structures.
|
||||
//!
|
||||
//! In test builds (`#[cfg(test)]`) the same public API is backed by
|
||||
//! `thread_local!` [`Cell`]s instead. Each test thread gets its own
|
||||
//! independent copies of `K` and `M`, so tests can use arbitrary values
|
||||
//! without coordinating with one another and without any reset mechanism.
|
||||
//! The `OnceLock` constraint is deliberately absent: test isolation is
|
||||
//! provided by thread locality, not by write-once semantics.
|
||||
|
||||
// ── Production implementation ─────────────────────────────────────────────────
|
||||
|
||||
#[cfg(not(any(test, feature = "test-utils")))]
|
||||
mod state {
|
||||
use std::sync::OnceLock;
|
||||
|
||||
static K: OnceLock<usize> = OnceLock::new();
|
||||
static M: OnceLock<usize> = OnceLock::new();
|
||||
|
||||
pub fn set_k(k: usize) {
|
||||
K.get_or_init(|| k);
|
||||
assert_eq!(*K.get().unwrap(), k, "K already initialized to a different value");
|
||||
}
|
||||
|
||||
pub fn k() -> usize {
|
||||
*K.get().expect("K not initialized — call params::set_k or params::init first")
|
||||
}
|
||||
|
||||
pub fn set_m(m: usize) {
|
||||
M.get_or_init(|| m);
|
||||
assert_eq!(*M.get().unwrap(), m, "M already initialized to a different value");
|
||||
}
|
||||
|
||||
pub fn m() -> usize {
|
||||
*M.get().expect("M not initialized — call params::set_m or params::init first")
|
||||
}
|
||||
}
|
||||
|
||||
// ── Test implementation ───────────────────────────────────────────────────────
|
||||
//
|
||||
// Each test thread owns its private K and M via thread_local!, so tests may
|
||||
// call set_k / set_m with any value without affecting other tests.
|
||||
|
||||
#[cfg(any(test, feature = "test-utils"))]
|
||||
mod state {
|
||||
use std::cell::Cell;
|
||||
|
||||
thread_local! {
|
||||
static K: Cell<usize> = Cell::new(0);
|
||||
static M: Cell<usize> = Cell::new(0);
|
||||
}
|
||||
|
||||
pub fn set_k(k: usize) { K.with(|c| c.set(k)); }
|
||||
pub fn k() -> usize { K.with(|c| c.get()) }
|
||||
pub fn set_m(m: usize) { M.with(|c| c.set(m)); }
|
||||
pub fn m() -> usize { M.with(|c| c.get()) }
|
||||
}
|
||||
|
||||
// ── Public API (identical signature in both configurations) ───────────────────
|
||||
|
||||
/// Initialise both K and M in one call.
|
||||
///
|
||||
/// In production, panics if either value has already been set to a different
|
||||
/// value. In tests, simply overwrites the thread-local.
|
||||
pub fn init(k: usize, m: usize) {
|
||||
state::set_k(k);
|
||||
state::set_m(m);
|
||||
}
|
||||
|
||||
/// Set the k-mer length.
|
||||
///
|
||||
/// In production: idempotent for the same value, panics on conflict.
|
||||
/// In tests: unconditionally updates the calling thread's value.
|
||||
pub fn set_k(k: usize) {
|
||||
state::set_k(k);
|
||||
}
|
||||
|
||||
/// Returns the k-mer length. Panics if not yet initialized.
|
||||
#[inline]
|
||||
pub fn k() -> usize {
|
||||
state::k()
|
||||
}
|
||||
|
||||
/// Set the minimizer length.
|
||||
///
|
||||
/// In production: idempotent for the same value, panics on conflict.
|
||||
/// In tests: unconditionally updates the calling thread's value.
|
||||
pub fn set_m(m: usize) {
|
||||
state::set_m(m);
|
||||
}
|
||||
|
||||
/// Returns the minimizer length. Panics if not yet initialized.
|
||||
#[inline]
|
||||
pub fn m() -> usize {
|
||||
state::m()
|
||||
}
|
||||
+61
-21
@@ -1,40 +1,53 @@
|
||||
//! Super-kmer with routing metadata: canonical sequence + pre-computed minimizer.
|
||||
|
||||
use super::kmer::CanonicalKmer;
|
||||
use super::SuperKmer;
|
||||
use serde::Serialize;
|
||||
|
||||
/// Owned wrapper that pairs a canonical [`SuperKmer`] with its minimizer [`Kmer`].
|
||||
use crate::Annotation;
|
||||
use crate::Sequence;
|
||||
use crate::SuperKmer;
|
||||
use crate::kmer::Minimizer;
|
||||
use crate::packed_seq::{PackedSeq, count_to_tail};
|
||||
use crate::params::m;
|
||||
|
||||
/// Owned wrapper that pairs a canonical [`SuperKmer`] with its pre-computed minimizer.
|
||||
///
|
||||
/// Created at the single point where raw sequence bytes are emitted from the
|
||||
/// scratch buffer. The minimizer position (given in original orientation) is
|
||||
/// adjusted for any flip applied during canonicalisation. After routing, call
|
||||
/// scratch buffer. The minimizer position (given in original orientation) is
|
||||
/// adjusted for any flip applied during canonicalisation. After routing, call
|
||||
/// [`into_superkmer`] to discard the metadata and continue with the bare sequence.
|
||||
///
|
||||
/// [`into_superkmer`]: RoutableSuperKmer::into_superkmer
|
||||
#[derive(Clone)]
|
||||
pub struct RoutableSuperKmer {
|
||||
superkmer: SuperKmer,
|
||||
minimizer: CanonicalKmer,
|
||||
minimizer: Minimizer,
|
||||
}
|
||||
|
||||
#[derive(Serialize)]
|
||||
struct SKRAnnotation {
|
||||
seq_length: usize,
|
||||
count: u32,
|
||||
}
|
||||
|
||||
impl Annotation for SKRAnnotation {}
|
||||
|
||||
impl RoutableSuperKmer {
|
||||
/// Construct from raw packed bytes.
|
||||
///
|
||||
/// `min_pos` is the 0-based minimizer position in the **original** (pre-flip)
|
||||
/// orientation. `m` is the minimizer length. `seql` and `seq` are the
|
||||
/// raw length byte and 2-bit-packed nucleotides as produced by the scratch
|
||||
/// buffer.
|
||||
pub fn build(min_pos: usize, m: usize, seql: u8, seq: Box<[u8]>) -> Self {
|
||||
let (sk, already_canonical) = SuperKmer::build(seql, seq);
|
||||
/// orientation. `seql` is the nucleotide count. The sequence is canonicalised
|
||||
/// in place; `min_pos` is adjusted accordingly.
|
||||
pub fn build(min_pos: usize, seql: usize, seq: Box<[u8]>) -> Self {
|
||||
let mut inner = PackedSeq::new(count_to_tail(seql), seq);
|
||||
let already_canonical = inner.canonicalize();
|
||||
let adjusted_pos = if already_canonical {
|
||||
min_pos
|
||||
} else {
|
||||
sk.len() - m - min_pos
|
||||
seql - m() - min_pos
|
||||
};
|
||||
let minimizer = sk.kmer(adjusted_pos, m).unwrap().canonical(m);
|
||||
Self {
|
||||
superkmer: sk,
|
||||
minimizer,
|
||||
}
|
||||
let minimizer = inner.mmer(adjusted_pos).unwrap();
|
||||
let superkmer = SuperKmer { count: 1, inner };
|
||||
Self { superkmer, minimizer }
|
||||
}
|
||||
|
||||
/// Borrow the canonical super-kmer sequence.
|
||||
@@ -42,8 +55,8 @@ impl RoutableSuperKmer {
|
||||
&self.superkmer
|
||||
}
|
||||
|
||||
/// Borrow the canonical minimizer kmer.
|
||||
pub fn minimizer(&self) -> &CanonicalKmer {
|
||||
/// Borrow the canonical minimizer.
|
||||
pub fn minimizer(&self) -> &Minimizer {
|
||||
&self.minimizer
|
||||
}
|
||||
|
||||
@@ -53,7 +66,34 @@ impl RoutableSuperKmer {
|
||||
}
|
||||
|
||||
/// Sequence length in nucleotides.
|
||||
pub fn len(&self) -> usize {
|
||||
self.superkmer.len()
|
||||
pub fn seql(&self) -> usize {
|
||||
self.superkmer.seql()
|
||||
}
|
||||
}
|
||||
|
||||
impl Sequence for RoutableSuperKmer {
|
||||
type Canonical = RoutableSuperKmer;
|
||||
|
||||
fn seql(&self) -> usize {
|
||||
self.superkmer.seql()
|
||||
}
|
||||
|
||||
fn nucleotide(&self, i: usize) -> u8 {
|
||||
self.superkmer.nucleotide(i)
|
||||
}
|
||||
|
||||
fn seq_hash(&self) -> u64 {
|
||||
self.minimizer.seq_hash()
|
||||
}
|
||||
|
||||
fn canonical(&self) -> Self::Canonical {
|
||||
self.clone()
|
||||
}
|
||||
|
||||
fn annotation(&self) -> impl Annotation {
|
||||
SKRAnnotation {
|
||||
seq_length: self.superkmer.seql(),
|
||||
count: self.superkmer.count(),
|
||||
}
|
||||
}
|
||||
}
|
||||
@@ -1,8 +1,71 @@
|
||||
use crate::Annotation;
|
||||
use std::io::{self, Write};
|
||||
|
||||
use crate::Annotation;
|
||||
use crate::annotations::BasicAnnotation;
|
||||
|
||||
/// Common interface for all 2-bit packed DNA sequences in the pipeline.
|
||||
///
|
||||
/// Required methods: `Canonical`, `seql`, `nucleotide`, `seq_hash`, `canonical`.
|
||||
/// All other methods have default implementations derived from those five.
|
||||
pub trait Sequence {
|
||||
fn sequence(&self) -> Box<[u8]>;
|
||||
fn canonical(&self) -> &Self;
|
||||
/// The canonical form of this sequence type.
|
||||
///
|
||||
/// For types always stored canonical (`SuperKmer`, `CanonicalKmerOf`), set `Canonical = Self`.
|
||||
/// For `KmerOf`, set `Canonical = CanonicalKmerOf`.
|
||||
type Canonical: Sequence;
|
||||
|
||||
/// Sequence length in nucleotides.
|
||||
fn seql(&self) -> usize;
|
||||
|
||||
/// Extract nucleotide `i` (0-based from 5′ end) as a 2-bit value (A=0, C=1, G=2, T=3).
|
||||
fn nucleotide(&self, i: usize) -> u8;
|
||||
|
||||
/// Hash of the sequence, used for partitioning and routing.
|
||||
fn seq_hash(&self) -> u64;
|
||||
fn annotation(&self) -> Annotation;
|
||||
|
||||
/// Return the canonical form.
|
||||
///
|
||||
/// For `Copy` types this is free; for heap-backed types it clones (output/debug paths only).
|
||||
fn canonical(&self) -> Self::Canonical;
|
||||
|
||||
/// Return an annotation describing this sequence's metadata.
|
||||
///
|
||||
/// Default: `BasicAnnotation { seq_length }`. Override for richer metadata.
|
||||
fn annotation(&self) -> impl Annotation {
|
||||
BasicAnnotation { seq_length: self.seql() }
|
||||
}
|
||||
|
||||
/// Decode into ASCII nucleotides, writing into `writer`.
|
||||
///
|
||||
/// Default: one byte per nucleotide via `nucleotide()`.
|
||||
/// Types with packed byte access should override with the faster DEC4 path.
|
||||
fn write_ascii<W: Write>(&self, w: &mut W) -> io::Result<()> {
|
||||
for i in 0..self.seql() {
|
||||
w.write_all(&[b"ACGT"[self.nucleotide(i) as usize]])?;
|
||||
}
|
||||
Ok(())
|
||||
}
|
||||
|
||||
/// Decode into a fresh ASCII `Vec<u8>`.
|
||||
fn to_ascii(&self) -> Vec<u8> {
|
||||
let mut buf = Vec::with_capacity(self.seql());
|
||||
self.write_ascii(&mut buf).unwrap();
|
||||
buf
|
||||
}
|
||||
|
||||
/// Partition index derived from `seq_hash`.
|
||||
///
|
||||
/// * `part_bits` — number of low bits to use (partition count = `1 << part_bits`).
|
||||
fn partition(&self, part_bits: usize) -> usize {
|
||||
(mix64(self.seq_hash()) & ((1 << part_bits) - 1)) as usize
|
||||
}
|
||||
}
|
||||
|
||||
#[inline]
|
||||
pub(crate) fn mix64(x: u64) -> u64 {
|
||||
let x = x ^ (x >> 30);
|
||||
let x = x.wrapping_mul(0xbf58476d1ce4e5b9);
|
||||
let x = x ^ (x >> 27);
|
||||
let x = x.wrapping_mul(0x94d049bb133111eb);
|
||||
x ^ (x >> 31)
|
||||
}
|
||||
+115
-330
@@ -1,84 +1,44 @@
|
||||
//! Compact 2-bit DNA super-kmer with in-place reverse complement and canonical form.
|
||||
use std::io::{self, Write};
|
||||
//! Canonical 2-bit DNA super-kmer with occurrence count.
|
||||
//!
|
||||
//! Delegates all sequence operations to [`PackedSeq`].
|
||||
//!
|
||||
//! On-disk header word (32 bits): `(count << 2) | tail` — 30-bit count, 2-bit tail.
|
||||
|
||||
use std::io::{self, Read, Write};
|
||||
|
||||
use bitvec::prelude::*;
|
||||
use serde::Serialize;
|
||||
use xxhash_rust::xxh3::xxh3_64;
|
||||
|
||||
use crate::Annotation;
|
||||
use crate::Sequence;
|
||||
use crate::encoding::{DEC4, encode_base};
|
||||
use crate::kmer::{CanonicalKmer, Kmer, KmerError};
|
||||
use crate::revcomp_lookup::REVCOMP4;
|
||||
use crate::packed_seq::{PackedSeq, read_varint, write_varint};
|
||||
|
||||
// ── SuperKmerHeader ───────────────────────────────────────────────────────────
|
||||
|
||||
/// 32-bit super-kmer header.
|
||||
///
|
||||
/// Bit layout (MSB → LSB):
|
||||
///
|
||||
/// ```text
|
||||
/// [31 .......... 8] [7 ...... 0]
|
||||
/// count (24 b) SEQL (8 b)
|
||||
/// ```
|
||||
///
|
||||
/// SEQL encodes the sequence length: 1–255 map directly; 0 encodes 256.
|
||||
/// The count field starts at 1 and accumulates occurrence counts during
|
||||
/// deduplication.
|
||||
#[derive(Debug, Clone, Copy)]
|
||||
pub(crate) struct SuperKmerHeader(u32);
|
||||
|
||||
impl SuperKmerHeader {
|
||||
pub(crate) fn new(seql: u8) -> Self {
|
||||
Self((1 << 8) | seql as u32)
|
||||
}
|
||||
|
||||
fn seql(&self) -> u8 {
|
||||
self.0 as u8
|
||||
}
|
||||
|
||||
fn count(&self) -> u32 {
|
||||
self.0 >> 8
|
||||
}
|
||||
|
||||
fn increment(&mut self) {
|
||||
self.0 += 1 << 8;
|
||||
}
|
||||
|
||||
fn add(&mut self, n: u32) {
|
||||
self.0 += n << 8;
|
||||
}
|
||||
|
||||
fn set_count(&mut self, n: u32) {
|
||||
self.0 = (self.0 & 0xFF) | (n << 8);
|
||||
}
|
||||
}
|
||||
// ── SKAnnotation ──────────────────────────────────────────────────────────────
|
||||
|
||||
#[derive(Serialize)]
|
||||
struct SKAnnotation {
|
||||
seq_length: usize,
|
||||
kmer_size: usize,
|
||||
minimizer_size: usize,
|
||||
partition: u32,
|
||||
count: u32,
|
||||
}
|
||||
|
||||
impl Annotation for SKAnnotation {}
|
||||
|
||||
// ── SuperKmer ─────────────────────────────────────────────────────────────────
|
||||
|
||||
/// Canonical super-kmer: 32-bit header followed by a byte-aligned 2-bit nucleotide sequence.
|
||||
/// Nucleotide 0 is at the MSB of `seq[0]`. Always stored in canonical form.
|
||||
/// Canonical super-kmer: occurrence count + 2-bit packed DNA sequence.
|
||||
///
|
||||
/// `PartialEq`, `Eq`, and `Hash` compare only sequence content (seql + seq bytes),
|
||||
/// ignoring the count / minimizer-pos payload — two records with identical sequences
|
||||
/// but different counts are considered equal.
|
||||
/// Always stored in canonical form (lex min of forward and revcomp).
|
||||
/// `PartialEq`/`Hash` compare only sequence content, ignoring count.
|
||||
#[derive(Debug, Clone)]
|
||||
pub struct SuperKmer {
|
||||
header: SuperKmerHeader,
|
||||
seq: Box<[u8]>,
|
||||
pub(crate) count: u32,
|
||||
pub(crate) inner: PackedSeq,
|
||||
}
|
||||
|
||||
impl PartialEq for SuperKmer {
|
||||
fn eq(&self, other: &Self) -> bool {
|
||||
self.header.seql() == other.header.seql() && self.seq == other.seq
|
||||
self.inner == other.inner
|
||||
}
|
||||
}
|
||||
|
||||
@@ -86,320 +46,145 @@ impl Eq for SuperKmer {}
|
||||
|
||||
impl std::hash::Hash for SuperKmer {
|
||||
fn hash<H: std::hash::Hasher>(&self, state: &mut H) {
|
||||
self.header.seql().hash(state);
|
||||
self.seq.hash(state);
|
||||
self.inner.hash(state);
|
||||
}
|
||||
}
|
||||
|
||||
impl Sequence for SuperKmer {
|
||||
fn sequence(&self) -> Box<[u8]> {
|
||||
self.seq.clone()
|
||||
type Canonical = SuperKmer;
|
||||
|
||||
fn seql(&self) -> usize {
|
||||
self.inner.seql()
|
||||
}
|
||||
|
||||
fn canonical(&self) -> &Self {
|
||||
&self
|
||||
fn nucleotide(&self, i: usize) -> u8 {
|
||||
self.inner.nucleotide(i)
|
||||
}
|
||||
|
||||
/// Returns the XXH3-64 hash of the packed sequence bytes.
|
||||
fn seq_hash(&self) -> u64 {
|
||||
xxh3_64(&self.seq)
|
||||
xxh3_64(self.inner.seq_bytes())
|
||||
}
|
||||
|
||||
fn annotation(&self) -> Annotation {}
|
||||
fn canonical(&self) -> Self::Canonical {
|
||||
self.clone()
|
||||
}
|
||||
|
||||
fn annotation(&self) -> impl Annotation {
|
||||
SKAnnotation {
|
||||
seq_length: self.inner.seql(),
|
||||
count: self.count,
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
impl SuperKmer {
|
||||
/// `seql` is the raw stored byte: 1–255 for lengths 1–255, 0 for length 256.
|
||||
pub fn new(seql: u8, seq: Box<[u8]>) -> Self {
|
||||
Self::build(seql, seq).0
|
||||
}
|
||||
|
||||
/// Construct and canonicalise in place, returning `(sk, already_canonical)`.
|
||||
/// `already_canonical` is `true` when the sequence was not flipped.
|
||||
pub fn build(seql: u8, seq: Box<[u8]>) -> (Self, bool) {
|
||||
let mut sk = Self {
|
||||
header: SuperKmerHeader::new(seql),
|
||||
seq,
|
||||
};
|
||||
let already_canonical = sk.canonical(); // true = pas retourné
|
||||
(sk, already_canonical)
|
||||
}
|
||||
|
||||
/// Deserialise from a raw 32-bit header word and packed sequence bytes.
|
||||
/// Preserves the full header payload (count or minimizer_pos in bits [31:8]).
|
||||
pub fn from_header_bits(bits: u32, seq: Box<[u8]>) -> Self {
|
||||
let seql = (bits & 0xFF) as u8;
|
||||
let len = stored_to_len(seql);
|
||||
debug_assert_eq!(seq.len(), byte_len(len));
|
||||
let sk = Self {
|
||||
header: SuperKmerHeader(bits),
|
||||
seq,
|
||||
};
|
||||
debug_assert!(
|
||||
sk.is_canonical(),
|
||||
"SuperKmer deserialised from disk is not canonical"
|
||||
);
|
||||
sk
|
||||
}
|
||||
|
||||
/// Returns the sequence length in nucleotides (1–256).
|
||||
pub fn len(&self) -> usize {
|
||||
stored_to_len(self.header.seql())
|
||||
}
|
||||
|
||||
/// Returns the occurrence count of this super-kmer.
|
||||
pub fn count(&self) -> u32 {
|
||||
self.header.count()
|
||||
}
|
||||
|
||||
/// Increments the occurrence count by 1.
|
||||
pub fn increment(&mut self) {
|
||||
self.header.increment();
|
||||
}
|
||||
|
||||
/// Adds `n` to the occurrence count.
|
||||
pub fn add(&mut self, n: u32) {
|
||||
self.header.add(n);
|
||||
}
|
||||
|
||||
/// Sets the occurrence count to an absolute value.
|
||||
pub fn set_count(&mut self, n: u32) {
|
||||
self.header.set_count(n);
|
||||
}
|
||||
|
||||
/// Extract nucleotide i (0-based from 5' end) as a 2-bit value.
|
||||
pub fn nucleotide(&self, i: usize) -> u8 {
|
||||
(self.seq[i / 4] >> (6 - 2 * (i % 4))) & 0b11
|
||||
}
|
||||
|
||||
/// Reverse-complement this super-kmer in place.
|
||||
///
|
||||
/// This method is only used internally by the build method.
|
||||
fn revcomp(&mut self) {
|
||||
let seql = self.len();
|
||||
let n = byte_len(seql);
|
||||
|
||||
// Step 1: swap bytes outside-in, applying revcomp4 to each.
|
||||
{
|
||||
let bytes = &mut self.seq[..n];
|
||||
let (mut lo, mut hi) = (0, n - 1);
|
||||
while lo < hi {
|
||||
(bytes[lo], bytes[hi]) =
|
||||
(REVCOMP4[bytes[hi] as usize], REVCOMP4[bytes[lo] as usize]);
|
||||
lo += 1;
|
||||
hi -= 1;
|
||||
}
|
||||
if lo == hi {
|
||||
bytes[lo] = REVCOMP4[bytes[lo] as usize];
|
||||
}
|
||||
}
|
||||
|
||||
// Step 2: left-shift to flush padding T's introduced by complementing padding A's.
|
||||
let shift = n * 8 - seql * 2;
|
||||
if shift > 0 {
|
||||
let bits = self.seq[..n].view_bits_mut::<Msb0>();
|
||||
bits.rotate_left(shift);
|
||||
let len = bits.len();
|
||||
bits[len - shift..].fill(false);
|
||||
}
|
||||
}
|
||||
|
||||
/// Encode an ASCII nucleotide sequence (ACGT, length 1–256) into a canonical SuperKmer.
|
||||
/// Encode ASCII nucleotides (length ≥ 1) into a canonical SuperKmer.
|
||||
pub fn from_ascii(ascii: &[u8]) -> Self {
|
||||
let seql = ascii.len();
|
||||
debug_assert!(
|
||||
seql >= 1 && seql <= 256,
|
||||
"super-kmer length must be 1..=256"
|
||||
);
|
||||
let n = byte_len(seql);
|
||||
let mut seq = vec![0u8; n];
|
||||
|
||||
let full = seql / 4;
|
||||
for i in 0..full {
|
||||
seq[i] = encode_base(ascii[i * 4]) << 6
|
||||
| encode_base(ascii[i * 4 + 1]) << 4
|
||||
| encode_base(ascii[i * 4 + 2]) << 2
|
||||
| encode_base(ascii[i * 4 + 3]);
|
||||
}
|
||||
let rem = seql % 4;
|
||||
if rem > 0 {
|
||||
let mut last = 0u8;
|
||||
for j in 0..rem {
|
||||
last |= encode_base(ascii[full * 4 + j]) << (6 - 2 * j);
|
||||
}
|
||||
seq[full] = last;
|
||||
}
|
||||
|
||||
Self::new(seql as u8, seq.into_boxed_slice()) // 256usize as u8 == 0, intentional
|
||||
let mut inner = PackedSeq::from_ascii(ascii);
|
||||
inner.canonicalize();
|
||||
Self { count: 1, inner }
|
||||
}
|
||||
|
||||
/// Decode this super-kmer sequence into ASCII nucleotides, writing into `writer`.
|
||||
pub fn write_ascii<W: Write>(&self, writer: &mut W) -> io::Result<()> {
|
||||
let seql = self.len();
|
||||
let full = seql / 4;
|
||||
|
||||
for i in 0..full {
|
||||
writer.write_all(&DEC4[self.seq[i] as usize].to_be_bytes())?;
|
||||
}
|
||||
let rem = seql % 4;
|
||||
if rem > 0 {
|
||||
let bytes = DEC4[self.seq[full] as usize].to_be_bytes();
|
||||
writer.write_all(&bytes[..rem])?;
|
||||
}
|
||||
Ok(())
|
||||
/// Wrap a pre-built [`PackedSeq`], canonicalising in place.
|
||||
pub fn build(mut inner: PackedSeq) -> Self {
|
||||
inner.canonicalize();
|
||||
Self { count: 1, inner }
|
||||
}
|
||||
|
||||
/// Decode this super-kmer sequence into a fresh ASCII `Vec<u8>`.
|
||||
pub fn to_ascii(&self) -> Vec<u8> {
|
||||
let mut buf = Vec::with_capacity(self.len());
|
||||
self.write_ascii(&mut buf).unwrap();
|
||||
buf
|
||||
/// Serialise to compact binary. Format: varint(count) + varint((byte_len << 2) | tail) + bytes.
|
||||
pub fn write_to_binary<W: Write>(&self, w: &mut W) -> io::Result<()> {
|
||||
write_varint(w, self.count as u64)?;
|
||||
self.inner.write_to_binary(w)
|
||||
}
|
||||
|
||||
/// Returns the raw 32-bit header word for binary serialisation.
|
||||
/// Bits [7:0] = seql encoding (0→256, 1-255 direct). Bits [31:8] = payload.
|
||||
/// Deserialise from the binary format produced by [`write_to_binary`].
|
||||
/// Allocates exactly one `Box<[u8]>` for the packed bytes.
|
||||
pub fn read_from_binary<R: Read>(r: &mut R) -> io::Result<Self> {
|
||||
let count = read_varint(r)? as u32;
|
||||
let inner = PackedSeq::read_from_binary(r)?;
|
||||
debug_assert!(inner.is_canonical(), "SuperKmer from disk is not canonical");
|
||||
Ok(Self { count, inner })
|
||||
}
|
||||
|
||||
/// Sequence length in nucleotides.
|
||||
#[inline]
|
||||
pub fn header_bits(&self) -> u32 {
|
||||
self.header.0
|
||||
pub fn seql(&self) -> usize {
|
||||
self.inner.seql()
|
||||
}
|
||||
|
||||
/// Returns a read-only view of the packed 2-bit sequence bytes.
|
||||
/// Length is always `(seql() + 3) / 4` bytes.
|
||||
/// Occurrence count.
|
||||
#[inline]
|
||||
pub fn count(&self) -> u32 {
|
||||
self.count
|
||||
}
|
||||
|
||||
/// Increment occurrence count by 1.
|
||||
#[inline]
|
||||
pub fn increment(&mut self) {
|
||||
self.count += 1;
|
||||
}
|
||||
|
||||
/// Add `n` to the occurrence count.
|
||||
#[inline]
|
||||
pub fn add(&mut self, n: u32) {
|
||||
self.count += n;
|
||||
}
|
||||
|
||||
/// Set the occurrence count to `n`.
|
||||
#[inline]
|
||||
pub fn set_count(&mut self, n: u32) {
|
||||
self.count = n;
|
||||
}
|
||||
|
||||
/// Read-only view of packed 2-bit bytes.
|
||||
#[inline]
|
||||
pub fn seq_bytes(&self) -> &[u8] {
|
||||
&self.seq
|
||||
self.inner.seq_bytes()
|
||||
}
|
||||
|
||||
/// Extract the kmer of length k starting at nucleotide position i (0-based).
|
||||
///
|
||||
/// Returns an error if k is invalid (0 or > 32) or if position i + k exceeds the sequence length.
|
||||
pub fn kmer(&self, i: usize, k: usize) -> Result<Kmer, KmerError> {
|
||||
if k == 0 || k > 32 {
|
||||
return Err(KmerError::InvalidK { k });
|
||||
}
|
||||
let seql = self.len();
|
||||
if i + k > seql {
|
||||
return Err(KmerError::OutOfBounds {
|
||||
position: i,
|
||||
k,
|
||||
seql,
|
||||
});
|
||||
}
|
||||
let bits = self.seq.view_bits::<Msb0>();
|
||||
let raw: u64 = bits[i * 2..(i + k) * 2].load_be();
|
||||
Ok(Kmer::from_raw(raw << (64 - 2 * k)))
|
||||
/// Extract nucleotide i (0-based from 5′ end) as a 2-bit value.
|
||||
#[inline]
|
||||
pub fn nucleotide(&self, i: usize) -> u8 {
|
||||
self.inner.nucleotide(i)
|
||||
}
|
||||
|
||||
/// Extract the canonical kmer of length k starting at nucleotide position i (0-based).
|
||||
///
|
||||
/// Returns an error if k is invalid (0 or > 32) or if position i + k exceeds the sequence length.
|
||||
pub fn canonical_kmer(&self, i: usize, k: usize) -> Result<CanonicalKmer, KmerError> {
|
||||
Ok(self.kmer(i, k)?.canonical(k))
|
||||
/// Extract the k-mer at position `i` using `params::k()`.
|
||||
#[inline]
|
||||
pub fn kmer(&self, i: usize) -> Result<Kmer, KmerError> {
|
||||
self.inner.kmer(i)
|
||||
}
|
||||
|
||||
/// Put this super-kmer in canonical form (lexicographic minimum of forward and revcomp).
|
||||
///
|
||||
/// Returns `true` if already canonical (no change), `false` if revcomp was applied.
|
||||
fn canonical(&mut self) -> bool {
|
||||
if self.is_canonical() {
|
||||
return true;
|
||||
}
|
||||
self.revcomp();
|
||||
false
|
||||
/// Extract the canonical k-mer at position `i`.
|
||||
#[inline]
|
||||
pub fn canonical_kmer(&self, i: usize) -> Result<CanonicalKmer, KmerError> {
|
||||
self.inner.canonical_kmer(i)
|
||||
}
|
||||
|
||||
/// Returns `true` if this super-kmer is in canonical form (lexicographic minimum of forward and revcomp).
|
||||
fn is_canonical(&self) -> bool {
|
||||
let seql = self.len();
|
||||
for i in 0..seql {
|
||||
let fwd = self.nucleotide(i);
|
||||
let rev = complement(self.nucleotide(seql - 1 - i));
|
||||
if fwd < rev {
|
||||
return true;
|
||||
}
|
||||
if fwd > rev {
|
||||
return false;
|
||||
}
|
||||
}
|
||||
true
|
||||
/// Decode into ASCII, writing into `writer`.
|
||||
#[inline]
|
||||
pub fn write_ascii<W: std::io::Write>(&self, writer: &mut W) -> std::io::Result<()> {
|
||||
self.inner.write_ascii(writer)
|
||||
}
|
||||
|
||||
/// Iterate over all kmers of length `k` in order, yielding each as a left-aligned [`Kmer`].
|
||||
pub fn iter_kmers(&self, k: usize) -> impl Iterator<Item = Kmer> + '_ {
|
||||
SKKmerIter::new(self, k)
|
||||
/// Decode into a fresh ASCII `Vec<u8>`.
|
||||
#[inline]
|
||||
pub fn to_ascii(&self) -> Vec<u8> {
|
||||
self.inner.to_ascii()
|
||||
}
|
||||
|
||||
/// Iterate over all canonical kmers of length `k` in order.
|
||||
pub fn iter_canonical_kmers(&self, k: usize) -> impl Iterator<Item = CanonicalKmer> + '_ {
|
||||
self.iter_kmers(k).map(move |km| km.canonical(k))
|
||||
/// Iterate over all k-mers of length `params::k()` in order.
|
||||
#[inline]
|
||||
pub fn iter_kmers(&self) -> impl Iterator<Item = Kmer> + '_ {
|
||||
self.inner.iter_kmers()
|
||||
}
|
||||
}
|
||||
|
||||
struct SKKmerIter<'a> {
|
||||
skmer: &'a SuperKmer,
|
||||
mask: u64,
|
||||
lshift: usize,
|
||||
current: u64,
|
||||
pos: usize,
|
||||
max_pos: usize,
|
||||
}
|
||||
|
||||
impl<'a> SKKmerIter<'a> {
|
||||
fn new(skmer: &'a SuperKmer, k: usize) -> Self {
|
||||
let seql = skmer.len();
|
||||
let lshift = 64 - k * 2;
|
||||
let mask = ((!0u128) << (lshift + 2)) as u64;
|
||||
Self {
|
||||
skmer,
|
||||
mask,
|
||||
lshift,
|
||||
current: if seql >= k {
|
||||
skmer.kmer(0, k).unwrap().raw()
|
||||
} else {
|
||||
0
|
||||
},
|
||||
pos: k,
|
||||
max_pos: seql,
|
||||
}
|
||||
/// Iterate over all canonical k-mers in order.
|
||||
#[inline]
|
||||
pub fn iter_canonical_kmers(&self) -> impl Iterator<Item = CanonicalKmer> + '_ {
|
||||
self.inner.iter_canonical_kmers()
|
||||
}
|
||||
}
|
||||
|
||||
impl<'a> Iterator for SKKmerIter<'a> {
|
||||
type Item = Kmer;
|
||||
|
||||
fn next(&mut self) -> Option<Self::Item> {
|
||||
if self.pos > self.max_pos {
|
||||
return None;
|
||||
}
|
||||
// Emit current kmer first, then slide the window forward.
|
||||
let result = Kmer::from_raw(self.current);
|
||||
if self.pos < self.max_pos {
|
||||
let byte_pos = self.pos / 4;
|
||||
// Nucleotide at position r within its byte occupies bits 7-2r (MSB) and 6-2r (LSB).
|
||||
// Extract right-aligned, then place at lshift.
|
||||
let inner_shift = 6 - 2 * (self.pos & 3);
|
||||
let nuc = (((self.skmer.seq[byte_pos] >> inner_shift) & 3) as u64) << self.lshift;
|
||||
self.current = ((self.current << 2) & self.mask) | nuc;
|
||||
}
|
||||
self.pos += 1;
|
||||
Some(result)
|
||||
}
|
||||
}
|
||||
|
||||
// ── helpers ───────────────────────────────────────────────────────────────────
|
||||
|
||||
fn complement(base: u8) -> u8 {
|
||||
!base & 0b11
|
||||
}
|
||||
|
||||
fn byte_len(seql: usize) -> usize {
|
||||
(seql + 3) / 4
|
||||
}
|
||||
|
||||
/// Stored u8 → actual length: 0 encodes 256, 1–255 are identity.
|
||||
fn stored_to_len(s: u8) -> usize {
|
||||
if s == 0 { 256 } else { s as usize }
|
||||
}
|
||||
|
||||
#[cfg(test)]
|
||||
#[path = "tests/superkmer.rs"]
|
||||
mod tests;
|
||||
@@ -0,0 +1,213 @@
|
||||
use super::*;
|
||||
|
||||
#[cfg(test)]
|
||||
mod tests {
|
||||
use super::*;
|
||||
|
||||
// Tests use ConstLen<N> — no dependency on global params singletons.
|
||||
type K1 = KmerOf<ConstLen<1>>;
|
||||
type K4 = KmerOf<ConstLen<4>>;
|
||||
|
||||
fn ascii_revcomp(seq: &[u8]) -> Vec<u8> {
|
||||
seq.iter()
|
||||
.rev()
|
||||
.map(|&b| match b {
|
||||
b'A' => b'T',
|
||||
b'T' => b'A',
|
||||
b'C' => b'G',
|
||||
b'G' => b'C',
|
||||
_ => b'A',
|
||||
})
|
||||
.collect()
|
||||
}
|
||||
|
||||
fn make_seq<const N: usize>() -> Vec<u8> {
|
||||
(0..N).map(|i| b"ACGT"[i % 4]).collect()
|
||||
}
|
||||
|
||||
// ── from_ascii / to_ascii ─────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn ascii_roundtrip() {
|
||||
macro_rules! check {
|
||||
($n:expr) => {{
|
||||
let ascii = make_seq::<$n>();
|
||||
let kmer = KmerOf::<ConstLen<$n>>::from_ascii(&ascii).unwrap();
|
||||
assert_eq!(kmer.to_ascii(), ascii, "roundtrip failed for k={}", $n);
|
||||
}};
|
||||
}
|
||||
check!(1);
|
||||
check!(2);
|
||||
check!(3);
|
||||
check!(4);
|
||||
check!(8);
|
||||
check!(11);
|
||||
check!(16);
|
||||
check!(31);
|
||||
check!(32);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn from_ascii_all_bases() {
|
||||
for (base, expected) in [(b'A', b'A'), (b'C', b'C'), (b'G', b'G'), (b'T', b'T')] {
|
||||
let kmer = K1::from_ascii(&[base]).unwrap();
|
||||
assert_eq!(kmer.to_ascii(), vec![expected]);
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn from_ascii_invalid_k() {
|
||||
assert!(KmerOf::<ConstLen<0>>::from_ascii(b"A").is_err());
|
||||
assert!(KmerOf::<ConstLen<33>>::from_ascii(b"ACGT").is_err());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn from_ascii_too_short() {
|
||||
assert!(KmerOf::<ConstLen<4>>::from_ascii(b"ACG").is_err());
|
||||
}
|
||||
|
||||
// ── nucleotide ────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn nucleotide_extraction() {
|
||||
let kmer = K4::from_ascii(b"ACGT").unwrap();
|
||||
assert_eq!(kmer.nucleotide(0), 0b00); // A
|
||||
assert_eq!(kmer.nucleotide(1), 0b01); // C
|
||||
assert_eq!(kmer.nucleotide(2), 0b10); // G
|
||||
assert_eq!(kmer.nucleotide(3), 0b11); // T
|
||||
}
|
||||
|
||||
// ── revcomp ───────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn revcomp_known_values() {
|
||||
let cases: &[(&[u8], &[u8])] = &[
|
||||
(b"A", b"T"),
|
||||
(b"AC", b"GT"),
|
||||
(b"ACG", b"CGT"),
|
||||
(b"ACGT", b"ACGT"),
|
||||
(b"AAAA", b"TTTT"),
|
||||
(b"TTTT", b"AAAA"),
|
||||
];
|
||||
for (seq, expected) in cases {
|
||||
macro_rules! check_len {
|
||||
($n:expr) => {
|
||||
if seq.len() == $n {
|
||||
let kmer = KmerOf::<ConstLen<$n>>::from_ascii(seq).unwrap();
|
||||
assert_eq!(
|
||||
kmer.revcomp().to_ascii(),
|
||||
*expected,
|
||||
"revcomp wrong for \"{}\"",
|
||||
std::str::from_utf8(seq).unwrap()
|
||||
);
|
||||
}
|
||||
};
|
||||
}
|
||||
check_len!(1);
|
||||
check_len!(2);
|
||||
check_len!(3);
|
||||
check_len!(4);
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn revcomp_vs_reference() {
|
||||
macro_rules! check {
|
||||
($n:expr) => {{
|
||||
let ascii = make_seq::<$n>();
|
||||
let expected = ascii_revcomp(&ascii);
|
||||
let rc = KmerOf::<ConstLen<$n>>::from_ascii(&ascii)
|
||||
.unwrap()
|
||||
.revcomp();
|
||||
assert_eq!(rc.to_ascii(), expected, "revcomp wrong for k={}", $n);
|
||||
}};
|
||||
}
|
||||
check!(1);
|
||||
check!(4);
|
||||
check!(8);
|
||||
check!(11);
|
||||
check!(16);
|
||||
check!(31);
|
||||
check!(32);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn revcomp_involution() {
|
||||
macro_rules! check {
|
||||
($n:expr) => {{
|
||||
let ascii = make_seq::<$n>();
|
||||
let kmer = KmerOf::<ConstLen<$n>>::from_ascii(&ascii).unwrap();
|
||||
assert_eq!(
|
||||
kmer.revcomp().revcomp(),
|
||||
kmer,
|
||||
"revcomp∘revcomp≠id for k={}",
|
||||
$n
|
||||
);
|
||||
}};
|
||||
}
|
||||
check!(1);
|
||||
check!(4);
|
||||
check!(8);
|
||||
check!(16);
|
||||
check!(31);
|
||||
check!(32);
|
||||
}
|
||||
|
||||
// ── canonical ─────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn canonical_palindrome() {
|
||||
let kmer = K4::from_ascii(b"ACGT").unwrap();
|
||||
assert_eq!(kmer.canonical().into_kmer(), kmer);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_chooses_lesser() {
|
||||
let kmer = K4::from_ascii(b"TTTT").unwrap();
|
||||
let expected = K4::from_ascii(b"AAAA").unwrap();
|
||||
assert_eq!(kmer.canonical().into_kmer(), expected);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_is_minimal() {
|
||||
macro_rules! check {
|
||||
($n:expr) => {{
|
||||
let ascii = make_seq::<$n>();
|
||||
let ck = KmerOf::<ConstLen<$n>>::from_ascii(&ascii)
|
||||
.unwrap()
|
||||
.canonical();
|
||||
let rc = ck.revcomp();
|
||||
assert!(ck.raw() <= rc.raw(), "canonical not minimal for k={}", $n);
|
||||
}};
|
||||
}
|
||||
check!(1);
|
||||
check!(4);
|
||||
check!(8);
|
||||
check!(16);
|
||||
check!(31);
|
||||
check!(32);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_idempotent() {
|
||||
macro_rules! check {
|
||||
($n:expr) => {{
|
||||
let ck = KmerOf::<ConstLen<$n>>::from_ascii(&make_seq::<$n>())
|
||||
.unwrap()
|
||||
.canonical();
|
||||
assert_eq!(
|
||||
ck.into_kmer().canonical(),
|
||||
ck,
|
||||
"canonical not idempotent for k={}",
|
||||
$n
|
||||
);
|
||||
}};
|
||||
}
|
||||
check!(1);
|
||||
check!(4);
|
||||
check!(8);
|
||||
check!(16);
|
||||
check!(31);
|
||||
check!(32);
|
||||
}
|
||||
}
|
||||
+140
-270
@@ -1,11 +1,10 @@
|
||||
use super::*;
|
||||
use crate::set_k;
|
||||
|
||||
/// Repeating ACGT pattern of the given length.
|
||||
fn make_seq(len: usize) -> Vec<u8> {
|
||||
(0..len).map(|i| b"ACGT"[i % 4]).collect()
|
||||
}
|
||||
|
||||
/// Reference revcomp on ASCII bytes.
|
||||
fn ascii_revcomp(seq: &[u8]) -> Vec<u8> {
|
||||
seq.iter()
|
||||
.rev()
|
||||
@@ -20,96 +19,93 @@ fn ascii_revcomp(seq: &[u8]) -> Vec<u8> {
|
||||
}
|
||||
|
||||
fn all_lengths() -> impl Iterator<Item = usize> {
|
||||
(1..=9).chain([255, 256])
|
||||
(1..=9).chain([255, 256, 257, 1000])
|
||||
}
|
||||
|
||||
// ── kmer extraction ───────────────────────────────────────────────────────
|
||||
// ── from_ascii / canonical form ───────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn kmer_first_matches_from_ascii() {
|
||||
let ascii = b"ACGTACGT";
|
||||
let sk = SuperKmer::from_ascii(ascii);
|
||||
let k = 4;
|
||||
let kmer = sk.kmer(0, k).unwrap();
|
||||
let expected = crate::kmer::Kmer::from_ascii(&ascii[..k], k).unwrap();
|
||||
assert_eq!(kmer, expected);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn kmer_last_position() {
|
||||
let ascii = b"ACGTACGT";
|
||||
let seql = ascii.len();
|
||||
let k = 4;
|
||||
let sk = SuperKmer::from_ascii(ascii);
|
||||
let kmer = sk.kmer(seql - k, k).unwrap();
|
||||
let expected = crate::kmer::Kmer::from_ascii(&ascii[seql - k..], k).unwrap();
|
||||
assert_eq!(kmer, expected);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn kmer_all_positions() {
|
||||
let ascii = b"ACGTACGTACGT";
|
||||
let k = 4;
|
||||
let sk = SuperKmer::from_ascii(ascii);
|
||||
for i in 0..=ascii.len() - k {
|
||||
let kmer = sk.kmer(i, k).unwrap();
|
||||
let expected = crate::kmer::Kmer::from_ascii(&ascii[i..i + k], k).unwrap();
|
||||
assert_eq!(kmer, expected, "mismatch at position {i}");
|
||||
fn ascii_roundtrip_all_lengths() {
|
||||
for len in all_lengths() {
|
||||
let ascii = make_seq(len);
|
||||
let sk = SuperKmer::from_ascii(&ascii);
|
||||
// SuperKmer stores in canonical form; ACGT pattern is already canonical.
|
||||
assert_eq!(sk.to_ascii(), ascii, "roundtrip failed for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn kmer_out_of_bounds() {
|
||||
let sk = SuperKmer::from_ascii(b"ACGT");
|
||||
assert!(sk.kmer(2, 4).is_err()); // 2 + 4 > 4
|
||||
assert!(sk.kmer(4, 1).is_err()); // 4 + 1 > 4
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn kmer_invalid_k() {
|
||||
let sk = SuperKmer::from_ascii(b"ACGT");
|
||||
assert!(sk.kmer(0, 0).is_err());
|
||||
assert!(sk.kmer(0, 33).is_err());
|
||||
}
|
||||
|
||||
// ── canonical_kmer ────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn canonical_kmer_is_min_of_kmer_and_revcomp() {
|
||||
let sk = SuperKmer::from_ascii(b"ACGTACGT");
|
||||
let k = 4;
|
||||
for i in 0..=(sk.len() - k) {
|
||||
let ck = sk.canonical_kmer(i, k).unwrap();
|
||||
let fwd = sk.kmer(i, k).unwrap();
|
||||
assert_eq!(ck, fwd.canonical(k));
|
||||
fn from_ascii_canonical_all_bases() {
|
||||
// G×4 revcomp is C×4; T×4 revcomp is A×4.
|
||||
for (base, expected) in [(b'A', b'A'), (b'C', b'C'), (b'G', b'C'), (b'T', b'A')] {
|
||||
let ascii = vec![base; 4];
|
||||
let sk = SuperKmer::from_ascii(&ascii);
|
||||
assert_eq!(sk.to_ascii(), vec![expected; 4]);
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_kmer_palindrome_unchanged() {
|
||||
// ACGT is its own reverse complement
|
||||
let sk = SuperKmer::from_ascii(b"ACGT");
|
||||
let ck = sk.canonical_kmer(0, 4).unwrap();
|
||||
let fwd = sk.kmer(0, 4).unwrap();
|
||||
assert_eq!(ck.into_kmer(), fwd);
|
||||
fn from_ascii_is_canonical_all_lengths() {
|
||||
for len in all_lengths() {
|
||||
let ascii = make_seq(len);
|
||||
let sk = SuperKmer::from_ascii(&ascii);
|
||||
let fwd = sk.to_ascii();
|
||||
let rev = ascii_revcomp(&fwd);
|
||||
assert!(fwd <= rev, "not canonical for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
// ── seql ──────────────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn seql_roundtrip() {
|
||||
for len in all_lengths() {
|
||||
let sk = SuperKmer::from_ascii(&make_seq(len));
|
||||
assert_eq!(sk.seql(), len, "seql() wrong for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
// ── binary serialisation ──────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn binary_roundtrip() {
|
||||
for len in all_lengths() {
|
||||
let mut sk = SuperKmer::from_ascii(&make_seq(len));
|
||||
sk.set_count(42);
|
||||
let mut buf = Vec::new();
|
||||
sk.write_to_binary(&mut buf).unwrap();
|
||||
let sk2 = SuperKmer::read_from_binary(&mut buf.as_slice()).unwrap();
|
||||
assert_eq!(
|
||||
sk.to_ascii(),
|
||||
sk2.to_ascii(),
|
||||
"sequence mismatch for len={len}"
|
||||
);
|
||||
assert_eq!(sk2.count(), 42, "count mismatch for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_kmer_tttt_becomes_aaaa() {
|
||||
let sk = SuperKmer::from_ascii(b"TTTT");
|
||||
let ck = sk.canonical_kmer(0, 4).unwrap();
|
||||
let expected = Kmer::from_ascii(b"AAAA", 4).unwrap();
|
||||
assert_eq!(ck.into_kmer(), expected);
|
||||
fn binary_packed_seq_roundtrip() {
|
||||
use crate::packed_seq::PackedSeq;
|
||||
for len in all_lengths() {
|
||||
let ps = PackedSeq::from_ascii(&make_seq(len));
|
||||
let mut buf = Vec::new();
|
||||
ps.write_to_binary(&mut buf).unwrap();
|
||||
let ps2 = PackedSeq::read_from_binary(&mut buf.as_slice()).unwrap();
|
||||
assert_eq!(ps, ps2, "PackedSeq mismatch for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_kmer_errors_propagate() {
|
||||
fn binary_size_is_compact() {
|
||||
// seql=4 (1 byte packed): varint(count=1, 1 byte) + varint((1<<2)|0=4, 1 byte) + 1 byte = 3 bytes
|
||||
let sk = SuperKmer::from_ascii(b"ACGT");
|
||||
assert!(sk.canonical_kmer(2, 4).is_err()); // out of bounds
|
||||
assert!(sk.canonical_kmer(0, 0).is_err()); // invalid k
|
||||
let mut buf = Vec::new();
|
||||
sk.write_to_binary(&mut buf).unwrap();
|
||||
assert_eq!(buf.len(), 3, "expected 3 bytes for 4-nt superkmer");
|
||||
}
|
||||
|
||||
// ── count ─────────────────────────────────────────────────────────────────
|
||||
// ── count ─────────────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn count_starts_at_one() {
|
||||
@@ -144,30 +140,15 @@ fn set_count_overwrites() {
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn increment_preserves_seql() {
|
||||
fn count_operations_preserve_seql() {
|
||||
for len in all_lengths() {
|
||||
let mut sk = SuperKmer::from_ascii(&make_seq(len));
|
||||
sk.increment();
|
||||
assert_eq!(sk.len(), len, "increment altered seql for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn add_preserves_seql() {
|
||||
for len in all_lengths() {
|
||||
let mut sk = SuperKmer::from_ascii(&make_seq(len));
|
||||
assert_eq!(sk.seql(), len, "increment altered seql for len={len}");
|
||||
sk.add(1000);
|
||||
assert_eq!(sk.len(), len, "add altered seql for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn set_count_preserves_seql() {
|
||||
for len in all_lengths() {
|
||||
let mut sk = SuperKmer::from_ascii(&make_seq(len));
|
||||
assert_eq!(sk.seql(), len, "add altered seql for len={len}");
|
||||
sk.set_count(999);
|
||||
assert_eq!(sk.len(), len, "set_count altered seql for len={len}");
|
||||
assert_eq!(sk.count(), 999);
|
||||
assert_eq!(sk.seql(), len, "set_count altered seql for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
@@ -179,247 +160,136 @@ fn count_does_not_affect_sequence() {
|
||||
assert_eq!(sk.to_ascii(), ascii);
|
||||
}
|
||||
|
||||
// ── seql encoding ─────────────────────────────────────────────────────────
|
||||
// ── kmer extraction ───────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn seql_roundtrip() {
|
||||
for len in all_lengths() {
|
||||
let sk = SuperKmer::from_ascii(&make_seq(len));
|
||||
assert_eq!(sk.len(), len, "seql() wrong for len={len}");
|
||||
fn kmer_first_matches_from_ascii() {
|
||||
set_k(4);
|
||||
let k = crate::params::k();
|
||||
let ascii = b"ACGTACGT";
|
||||
let sk = SuperKmer::from_ascii(ascii);
|
||||
let kmer = sk.kmer(0).unwrap();
|
||||
let expected = crate::kmer::Kmer::from_ascii(&ascii[..k]).unwrap();
|
||||
assert_eq!(kmer, expected);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn kmer_all_positions() {
|
||||
set_k(4);
|
||||
let k = crate::params::k();
|
||||
let ascii = b"ACGTACGTACGT";
|
||||
let sk = SuperKmer::from_ascii(ascii);
|
||||
for i in 0..=ascii.len() - k {
|
||||
let kmer = sk.kmer(i).unwrap();
|
||||
let expected = crate::kmer::Kmer::from_ascii(&ascii[i..i + k]).unwrap();
|
||||
assert_eq!(kmer, expected, "mismatch at position {i}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn seql_256_stored_as_zero() {
|
||||
let sk = SuperKmer::from_ascii(&make_seq(256));
|
||||
assert_eq!(sk.header.seql(), 0u8);
|
||||
assert_eq!(sk.len(), 256);
|
||||
fn kmer_out_of_bounds() {
|
||||
set_k(4);
|
||||
let sk = SuperKmer::from_ascii(b"ACGT"); // seql=4, k=4
|
||||
assert!(sk.kmer(1).is_err()); // 1 + 4 > 4
|
||||
}
|
||||
|
||||
// ── from_ascii / to_ascii roundtrip ───────────────────────────────────────
|
||||
// ── canonical_kmer ────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn ascii_roundtrip_all_lengths() {
|
||||
for len in all_lengths() {
|
||||
let ascii = make_seq(len);
|
||||
let sk = SuperKmer::from_ascii(&ascii);
|
||||
assert_eq!(sk.to_ascii(), ascii, "roundtrip failed for len={len}");
|
||||
fn canonical_kmer_is_min_of_kmer_and_revcomp() {
|
||||
set_k(4);
|
||||
let k = crate::params::k();
|
||||
let sk = SuperKmer::from_ascii(b"ACGTACGT");
|
||||
for i in 0..=(sk.seql() - k) {
|
||||
let ck = sk.canonical_kmer(i).unwrap();
|
||||
let fwd = sk.kmer(i).unwrap();
|
||||
assert_eq!(ck, fwd.canonical());
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn ascii_roundtrip_all_bases() {
|
||||
// Canonical form: min(seq, revcomp). G×4 flips to C×4, T×4 flips to A×4.
|
||||
for (base, expected) in [(b'A', b'A'), (b'C', b'C'), (b'G', b'C'), (b'T', b'A')] {
|
||||
let ascii = vec![base; 4];
|
||||
let sk = SuperKmer::from_ascii(&ascii);
|
||||
assert_eq!(sk.to_ascii(), vec![expected; 4]);
|
||||
}
|
||||
}
|
||||
|
||||
// ── revcomp correctness ───────────────────────────────────────────────────
|
||||
|
||||
/// Known (seq, expected_revcomp) pairs — one per shift value × two byte counts.
|
||||
#[test]
|
||||
fn revcomp_known_values() {
|
||||
let cases = [
|
||||
// shift=6
|
||||
("A", "T"),
|
||||
("ACGTA", "TACGT"),
|
||||
// shift=4
|
||||
("AC", "GT"),
|
||||
("ACGTAC", "GTACGT"),
|
||||
// shift=2
|
||||
("ACG", "CGT"),
|
||||
("ACGTACG", "CGTACGT"),
|
||||
// shift=0
|
||||
("ACGT", "ACGT"),
|
||||
("ACGTACGT", "ACGTACGT"),
|
||||
];
|
||||
for (seq, expected) in cases {
|
||||
let mut sk = SuperKmer::from_ascii(seq.as_bytes());
|
||||
sk.revcomp();
|
||||
assert_eq!(
|
||||
sk.to_ascii(),
|
||||
expected.as_bytes(),
|
||||
"revcomp wrong for \"{seq}\""
|
||||
);
|
||||
}
|
||||
fn canonical_kmer_palindrome_unchanged() {
|
||||
set_k(4);
|
||||
let sk = SuperKmer::from_ascii(b"ACGT"); // ACGT is its own revcomp
|
||||
let ck = sk.canonical_kmer(0).unwrap();
|
||||
let fwd = sk.kmer(0).unwrap();
|
||||
assert_eq!(ck.into_kmer(), fwd);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn revcomp_vs_reference_all_lengths() {
|
||||
for len in all_lengths() {
|
||||
let ascii = make_seq(len);
|
||||
let expected = ascii_revcomp(&ascii);
|
||||
let mut sk = SuperKmer::from_ascii(&ascii);
|
||||
sk.revcomp();
|
||||
assert_eq!(sk.to_ascii(), expected, "revcomp wrong for len={len}");
|
||||
}
|
||||
fn canonical_kmer_errors_propagate() {
|
||||
set_k(4);
|
||||
let sk = SuperKmer::from_ascii(b"ACGT");
|
||||
assert!(sk.canonical_kmer(1).is_err()); // out of bounds: 1 + 4 > 4
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn revcomp_involution_all_lengths() {
|
||||
for len in all_lengths() {
|
||||
let ascii = make_seq(len);
|
||||
let mut sk = SuperKmer::from_ascii(&ascii);
|
||||
sk.revcomp();
|
||||
sk.revcomp();
|
||||
assert_eq!(sk.to_ascii(), ascii, "revcomp∘revcomp≠id for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
// ── canonical ─────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn canonical_palindrome_unchanged() {
|
||||
// ACGT is its own revcomp
|
||||
let mut sk = SuperKmer::from_ascii(b"ACGT");
|
||||
sk.canonical();
|
||||
assert_eq!(sk.to_ascii(), b"ACGT");
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_chooses_forward() {
|
||||
// "AAAA" < "TTTT" → stays as-is
|
||||
let mut sk = SuperKmer::from_ascii(b"AAAA");
|
||||
sk.canonical();
|
||||
assert_eq!(sk.to_ascii(), b"AAAA");
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_chooses_revcomp() {
|
||||
// "TTTT" > "AAAA" → flipped
|
||||
let mut sk = SuperKmer::from_ascii(b"TTTT");
|
||||
sk.canonical();
|
||||
assert_eq!(sk.to_ascii(), b"AAAA");
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_is_minimal_all_lengths() {
|
||||
for len in all_lengths() {
|
||||
let ascii = make_seq(len);
|
||||
let mut sk = SuperKmer::from_ascii(&ascii);
|
||||
sk.canonical();
|
||||
let fwd = sk.to_ascii();
|
||||
let rev = ascii_revcomp(&fwd);
|
||||
assert!(fwd <= rev, "canonical not minimal for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
// ── iter_kmers ────────────────────────────────────────────────────────────
|
||||
// ── iter_kmers ────────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn iter_kmers_count() {
|
||||
set_k(4);
|
||||
let k = crate::params::k();
|
||||
let ascii = b"ACGTACGTACGT";
|
||||
let sk = SuperKmer::from_ascii(ascii);
|
||||
for k in [1usize, 3, 4, 5, 8, 12] {
|
||||
let n = sk.iter_kmers(k).count();
|
||||
assert_eq!(n, ascii.len() - k + 1, "count mismatch for k={k}");
|
||||
}
|
||||
assert_eq!(sk.iter_kmers().count(), ascii.len() - k + 1);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn iter_kmers_first_is_kmer_0() {
|
||||
set_k(4);
|
||||
let ascii = b"ACGTACGT";
|
||||
let sk = SuperKmer::from_ascii(ascii);
|
||||
for k in 1..=ascii.len() {
|
||||
let first = sk.iter_kmers(k).next().unwrap();
|
||||
assert_eq!(first, sk.kmer(0, k).unwrap(), "k={k}");
|
||||
}
|
||||
let first = sk.iter_kmers().next().unwrap();
|
||||
assert_eq!(first, sk.kmer(0).unwrap());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn iter_kmers_matches_kmer_at_each_position() {
|
||||
set_k(4);
|
||||
let ascii = b"ACGTACGTACGT";
|
||||
let sk = SuperKmer::from_ascii(ascii);
|
||||
let k = 4;
|
||||
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
|
||||
assert_eq!(kmers.len(), ascii.len() - k + 1);
|
||||
let kmers: Vec<crate::kmer::Kmer> = sk.iter_kmers().collect();
|
||||
for (i, &km) in kmers.iter().enumerate() {
|
||||
assert_eq!(km, sk.kmer(i, k).unwrap(), "mismatch at pos {i}");
|
||||
assert_eq!(km, sk.kmer(i).unwrap(), "mismatch at pos {i}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn iter_kmers_single_when_seql_eq_k() {
|
||||
let ascii = b"ACGTACGT";
|
||||
let sk = SuperKmer::from_ascii(ascii);
|
||||
let k = ascii.len();
|
||||
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
|
||||
assert_eq!(kmers.len(), 1);
|
||||
assert_eq!(kmers[0], sk.kmer(0, k).unwrap());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn iter_kmers_two_when_seql_eq_k_plus_one() {
|
||||
let ascii = b"ACGTACGT";
|
||||
let sk = SuperKmer::from_ascii(ascii);
|
||||
let k = ascii.len() - 1;
|
||||
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
|
||||
assert_eq!(kmers.len(), 2);
|
||||
assert_eq!(kmers[0], sk.kmer(0, k).unwrap());
|
||||
assert_eq!(kmers[1], sk.kmer(1, k).unwrap());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn iter_kmers_all_k_values() {
|
||||
// For every valid k, each yielded kmer must match kmer(i, k).
|
||||
let ascii = b"ACGTACGTACGT";
|
||||
let sk = SuperKmer::from_ascii(ascii);
|
||||
let seql = ascii.len();
|
||||
for k in 1..=seql {
|
||||
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
|
||||
assert_eq!(kmers.len(), seql - k + 1, "k={k}");
|
||||
for (i, &km) in kmers.iter().enumerate() {
|
||||
assert_eq!(km, sk.kmer(i, k).unwrap(), "k={k}, pos={i}");
|
||||
}
|
||||
}
|
||||
set_k(4);
|
||||
let k = crate::params::k();
|
||||
let ascii = make_seq(k);
|
||||
let sk = SuperKmer::from_ascii(&ascii);
|
||||
assert_eq!(sk.iter_kmers().count(), 1);
|
||||
assert_eq!(sk.iter_kmers().next().unwrap(), sk.kmer(0).unwrap());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn iter_kmers_crosses_byte_boundary() {
|
||||
// Positions 3→4 and 7→8 cross a 4-nucleotide byte boundary.
|
||||
set_k(4);
|
||||
let ascii = b"ACGTACGTACGT";
|
||||
let sk = SuperKmer::from_ascii(ascii);
|
||||
let k = 3;
|
||||
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
|
||||
let kmers: Vec<crate::kmer::Kmer> = sk.iter_kmers().collect();
|
||||
for boundary in [3usize, 4, 7, 8] {
|
||||
if boundary + 1 < kmers.len() {
|
||||
assert_eq!(
|
||||
kmers[boundary],
|
||||
sk.kmer(boundary, k).unwrap(),
|
||||
sk.kmer(boundary).unwrap(),
|
||||
"pos={boundary}"
|
||||
);
|
||||
assert_eq!(
|
||||
kmers[boundary + 1],
|
||||
sk.kmer(boundary + 1, k).unwrap(),
|
||||
"pos={}",
|
||||
boundary + 1
|
||||
);
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn iter_kmers_k1_yields_all_nucleotides() {
|
||||
let ascii = b"ACGT";
|
||||
let sk = SuperKmer::from_ascii(ascii);
|
||||
let kmers: Vec<Kmer> = sk.iter_kmers(1).collect();
|
||||
assert_eq!(kmers.len(), 4);
|
||||
for (i, &km) in kmers.iter().enumerate() {
|
||||
assert_eq!(km, sk.kmer(i, 1).unwrap(), "pos={i}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn iter_kmers_long_sequence() {
|
||||
let ascii = make_seq(20);
|
||||
set_k(4);
|
||||
let k = crate::params::k();
|
||||
let ascii = make_seq(200);
|
||||
let sk = SuperKmer::from_ascii(&ascii);
|
||||
let k = 7;
|
||||
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
|
||||
assert_eq!(kmers.len(), ascii.len() - k + 1);
|
||||
let kmers: Vec<crate::kmer::Kmer> = sk.iter_kmers().collect();
|
||||
assert_eq!(kmers.len(), 200 - k + 1);
|
||||
for (i, &km) in kmers.iter().enumerate() {
|
||||
assert_eq!(km, sk.kmer(i, k).unwrap(), "pos={i}");
|
||||
assert_eq!(km, sk.kmer(i).unwrap(), "pos={i}");
|
||||
}
|
||||
}
|
||||
@@ -0,0 +1,171 @@
|
||||
// ── tests ─────────────────────────────────────────────────────────────────────
|
||||
|
||||
#[cfg(test)]
|
||||
mod tests {
|
||||
use crate::packed_seq::PackedSeq as Unitig;
|
||||
use crate::set_k;
|
||||
|
||||
fn make_seq(len: usize) -> Vec<u8> {
|
||||
(0..len).map(|i| b"ACGT"[i % 4]).collect()
|
||||
}
|
||||
|
||||
fn ascii_revcomp(seq: &[u8]) -> Vec<u8> {
|
||||
seq.iter()
|
||||
.rev()
|
||||
.map(|&b| match b {
|
||||
b'A' => b'T',
|
||||
b'T' => b'A',
|
||||
b'C' => b'G',
|
||||
b'G' => b'C',
|
||||
_ => b'A',
|
||||
})
|
||||
.collect()
|
||||
}
|
||||
|
||||
fn test_lengths() -> impl Iterator<Item = usize> {
|
||||
(1..=9).chain([255, 256, 257, 1000, 10_000])
|
||||
}
|
||||
|
||||
// ── from_ascii / to_ascii ─────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn ascii_roundtrip_all_lengths() {
|
||||
for len in test_lengths() {
|
||||
let ascii = make_seq(len);
|
||||
let u = Unitig::from_ascii(&ascii);
|
||||
assert_eq!(u.to_ascii(), ascii, "roundtrip failed for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
// ── seql ──────────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn seql_roundtrip() {
|
||||
for len in test_lengths() {
|
||||
let u = Unitig::from_ascii(&make_seq(len));
|
||||
assert_eq!(u.seql(), len);
|
||||
}
|
||||
}
|
||||
|
||||
// ── revcomp ───────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn revcomp_known_values() {
|
||||
let cases = [
|
||||
("A", "T"),
|
||||
("AC", "GT"),
|
||||
("ACG", "CGT"),
|
||||
("ACGT", "ACGT"),
|
||||
("ACGTA", "TACGT"),
|
||||
];
|
||||
for (seq, expected) in cases {
|
||||
let mut u = Unitig::from_ascii(seq.as_bytes());
|
||||
u.revcomp_inplace();
|
||||
assert_eq!(
|
||||
u.to_ascii(),
|
||||
expected.as_bytes(),
|
||||
"revcomp wrong for \"{seq}\""
|
||||
);
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn revcomp_vs_reference_all_lengths() {
|
||||
for len in test_lengths() {
|
||||
let ascii = make_seq(len);
|
||||
let expected = ascii_revcomp(&ascii);
|
||||
let mut u = Unitig::from_ascii(&ascii);
|
||||
u.revcomp_inplace();
|
||||
assert_eq!(u.to_ascii(), expected, "revcomp wrong for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn revcomp_involution_all_lengths() {
|
||||
for len in test_lengths() {
|
||||
let ascii = make_seq(len);
|
||||
let mut u = Unitig::from_ascii(&ascii);
|
||||
u.revcomp_inplace();
|
||||
u.revcomp_inplace();
|
||||
assert_eq!(u.to_ascii(), ascii, "revcomp∘revcomp≠id for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
// ── canonicalize ──────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn canonical_palindrome_unchanged() {
|
||||
let mut u = Unitig::from_ascii(b"ACGT");
|
||||
u.canonicalize();
|
||||
assert_eq!(u.to_ascii(), b"ACGT");
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_chooses_revcomp() {
|
||||
let mut u = Unitig::from_ascii(b"TTTT");
|
||||
u.canonicalize();
|
||||
assert_eq!(u.to_ascii(), b"AAAA");
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_is_minimal_all_lengths() {
|
||||
for len in test_lengths() {
|
||||
let ascii = make_seq(len);
|
||||
let mut u = Unitig::from_ascii(&ascii);
|
||||
u.canonicalize();
|
||||
let fwd = u.to_ascii();
|
||||
let rev = ascii_revcomp(&fwd);
|
||||
assert!(fwd <= rev, "canonical not minimal for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
// ── kmer extraction ───────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn kmer_all_positions() {
|
||||
set_k(4);
|
||||
let k = crate::params::k();
|
||||
let ascii = b"ACGTACGTACGT";
|
||||
let u = Unitig::from_ascii(ascii);
|
||||
for i in 0..=ascii.len() - k {
|
||||
let kmer = u.kmer(i).unwrap();
|
||||
let expected = crate::kmer::Kmer::from_ascii(&ascii[i..i + k]).unwrap();
|
||||
assert_eq!(kmer, expected, "mismatch at position {i}");
|
||||
}
|
||||
}
|
||||
|
||||
// ── iter_kmers ────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn iter_kmers_matches_kmer_at_each_position() {
|
||||
set_k(4);
|
||||
let ascii = make_seq(20);
|
||||
let u = Unitig::from_ascii(&ascii);
|
||||
let kmers: Vec<crate::kmer::Kmer> = u.iter_kmers().collect();
|
||||
for (i, &km) in kmers.iter().enumerate() {
|
||||
assert_eq!(km, u.kmer(i).unwrap(), "pos={i}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn iter_kmers_long_unitig() {
|
||||
set_k(4);
|
||||
let k = crate::params::k();
|
||||
let ascii = make_seq(10_000);
|
||||
let u = Unitig::from_ascii(&ascii);
|
||||
assert_eq!(u.iter_kmers().count(), 10_000 - k + 1);
|
||||
}
|
||||
|
||||
// ── binary serialisation ──────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn binary_roundtrip_all_lengths() {
|
||||
for len in test_lengths() {
|
||||
let u = Unitig::from_ascii(&make_seq(len));
|
||||
let mut buf = Vec::new();
|
||||
u.write_to_binary(&mut buf).unwrap();
|
||||
let u2 = Unitig::read_from_binary(&mut buf.as_slice()).unwrap();
|
||||
assert_eq!(u, u2, "binary roundtrip failed for len={len}");
|
||||
}
|
||||
}
|
||||
}
|
||||
+6
-420
@@ -1,424 +1,10 @@
|
||||
//! Compact 2-bit DNA unitig with in-place reverse complement and canonical form.
|
||||
//! Unitig: a 2-bit packed DNA sequence without metadata.
|
||||
//!
|
||||
//! Same encoding as [`SuperKmer`](crate::superkmer::SuperKmer) — nucleotide 0
|
||||
//! at the MSB of `seq[0]`, 4 bases per byte — but without the 256-nucleotide
|
||||
//! length cap and without the scatter/count header payload.
|
||||
//! [`Unitig`] is a type alias for [`PackedSeq`] — all sequence operations,
|
||||
//! binary serialisation, and k-mer iteration are available directly.
|
||||
|
||||
use std::io::{self, Write};
|
||||
|
||||
use crate::encoding::{DEC4, encode_base};
|
||||
use crate::kmer::{CanonicalKmer, Kmer, KmerError};
|
||||
use crate::revcomp_lookup::REVCOMP4;
|
||||
use bitvec::prelude::*;
|
||||
|
||||
// ── Unitig ────────────────────────────────────────────────────────────────────
|
||||
|
||||
/// Compact unitig: sequence length (usize) + byte-aligned 2-bit nucleotide sequence.
|
||||
///
|
||||
/// Encoding: A=00, C=01, G=10, T=11. Nucleotide 0 occupies bits 7–6 of `seq[0]`,
|
||||
/// nucleotide i occupies bits `7 − 2*(i%4)` and `6 − 2*(i%4)` of `seq[i/4]`.
|
||||
/// Padding bits in the last byte are always 0.
|
||||
#[derive(Debug, Clone)]
|
||||
pub struct Unitig {
|
||||
seql: usize,
|
||||
seq: Box<[u8]>,
|
||||
}
|
||||
|
||||
impl PartialEq for Unitig {
|
||||
fn eq(&self, other: &Self) -> bool {
|
||||
self.seql == other.seql && self.seq == other.seq
|
||||
}
|
||||
}
|
||||
|
||||
impl Eq for Unitig {}
|
||||
|
||||
impl std::hash::Hash for Unitig {
|
||||
fn hash<H: std::hash::Hasher>(&self, state: &mut H) {
|
||||
self.seql.hash(state);
|
||||
self.seq.hash(state);
|
||||
}
|
||||
}
|
||||
|
||||
impl Unitig {
|
||||
/// Create from a pre-packed 2-bit byte slice and explicit length.
|
||||
/// `seq.len()` must equal `(seql + 3) / 4`.
|
||||
pub fn new(seql: usize, seq: Box<[u8]>) -> Self {
|
||||
debug_assert_eq!(seq.len(), byte_len(seql));
|
||||
Self { seql, seq }
|
||||
}
|
||||
|
||||
/// Encode a slice of 2-bit nucleotide values (0=A, 1=C, 2=G, 3=T, any length ≥ 1).
|
||||
/// More efficient than `from_ascii` when nucleotides are already 2-bit encoded.
|
||||
pub fn from_nucleotides(nucs: &[u8]) -> Self {
|
||||
let seql = nucs.len();
|
||||
debug_assert!(seql >= 1, "unitig length must be ≥ 1");
|
||||
let n = byte_len(seql);
|
||||
let mut seq = vec![0u8; n];
|
||||
for (i, &nuc) in nucs.iter().enumerate() {
|
||||
seq[i / 4] |= (nuc & 0b11) << (6 - 2 * (i % 4));
|
||||
}
|
||||
Self::new(seql, seq.into_boxed_slice())
|
||||
}
|
||||
|
||||
/// Encode an ASCII nucleotide slice (ACGT, any length ≥ 1) into a new Unitig.
|
||||
/// The result is not yet in canonical form; call `.canonical()` if needed.
|
||||
pub fn from_ascii(ascii: &[u8]) -> Self {
|
||||
let seql = ascii.len();
|
||||
debug_assert!(seql >= 1, "unitig length must be ≥ 1");
|
||||
let n = byte_len(seql);
|
||||
let mut seq = vec![0u8; n];
|
||||
|
||||
let full = seql / 4;
|
||||
for i in 0..full {
|
||||
seq[i] = encode_base(ascii[i * 4]) << 6
|
||||
| encode_base(ascii[i * 4 + 1]) << 4
|
||||
| encode_base(ascii[i * 4 + 2]) << 2
|
||||
| encode_base(ascii[i * 4 + 3]);
|
||||
}
|
||||
let rem = seql % 4;
|
||||
if rem > 0 {
|
||||
let mut last = 0u8;
|
||||
for j in 0..rem {
|
||||
last |= encode_base(ascii[full * 4 + j]) << (6 - 2 * j);
|
||||
}
|
||||
seq[full] = last;
|
||||
}
|
||||
|
||||
Self::new(seql, seq.into_boxed_slice())
|
||||
}
|
||||
|
||||
/// Returns the sequence length in nucleotides.
|
||||
pub fn seql(&self) -> usize {
|
||||
self.seql
|
||||
}
|
||||
|
||||
/// Returns a read-only view of the packed 2-bit sequence bytes.
|
||||
/// Length is always `(seql() + 3) / 4`.
|
||||
pub fn seq_bytes(&self) -> &[u8] {
|
||||
&self.seq
|
||||
}
|
||||
|
||||
/// Extract nucleotide i (0-based from 5′ end) as a 2-bit value.
|
||||
pub fn nucleotide(&self, i: usize) -> u8 {
|
||||
(self.seq[i / 4] >> (6 - 2 * (i % 4))) & 0b11
|
||||
}
|
||||
|
||||
/// Decode into ASCII nucleotides, writing into `writer`.
|
||||
pub fn write_ascii<W: Write>(&self, writer: &mut W) -> io::Result<()> {
|
||||
let full = self.seql / 4;
|
||||
for i in 0..full {
|
||||
writer.write_all(&DEC4[self.seq[i] as usize].to_be_bytes())?;
|
||||
}
|
||||
let rem = self.seql % 4;
|
||||
if rem > 0 {
|
||||
let bytes = DEC4[self.seq[full] as usize].to_be_bytes();
|
||||
writer.write_all(&bytes[..rem])?;
|
||||
}
|
||||
Ok(())
|
||||
}
|
||||
|
||||
/// Decode into a fresh ASCII `Vec<u8>`.
|
||||
pub fn to_ascii(&self) -> Vec<u8> {
|
||||
let mut buf = Vec::with_capacity(self.seql);
|
||||
self.write_ascii(&mut buf).unwrap();
|
||||
buf
|
||||
}
|
||||
|
||||
/// Reverse-complement this unitig in place.
|
||||
pub fn revcomp(&mut self) {
|
||||
let n = byte_len(self.seql);
|
||||
|
||||
// Step 1: swap bytes outside-in, complementing each 4-base chunk via lookup.
|
||||
{
|
||||
let bytes = &mut self.seq[..n];
|
||||
let (mut lo, mut hi) = (0, n - 1);
|
||||
while lo < hi {
|
||||
(bytes[lo], bytes[hi]) =
|
||||
(REVCOMP4[bytes[hi] as usize], REVCOMP4[bytes[lo] as usize]);
|
||||
lo += 1;
|
||||
hi -= 1;
|
||||
}
|
||||
if lo == hi {
|
||||
bytes[lo] = REVCOMP4[bytes[lo] as usize];
|
||||
}
|
||||
}
|
||||
|
||||
// Step 2: left-shift to flush the padding T's produced by complementing padding A's.
|
||||
let shift = n * 8 - self.seql * 2;
|
||||
if shift > 0 {
|
||||
let bits = self.seq[..n].view_bits_mut::<Msb0>();
|
||||
bits.rotate_left(shift);
|
||||
let len = bits.len();
|
||||
bits[len - shift..].fill(false);
|
||||
}
|
||||
}
|
||||
|
||||
/// Returns `true` if this unitig is in canonical form (lexicographic minimum
|
||||
/// of forward and reverse complement).
|
||||
pub fn is_canonical(&self) -> bool {
|
||||
for i in 0..self.seql {
|
||||
let fwd = self.nucleotide(i);
|
||||
let rev = complement(self.nucleotide(self.seql - 1 - i));
|
||||
if fwd < rev {
|
||||
return true;
|
||||
}
|
||||
if fwd > rev {
|
||||
return false;
|
||||
}
|
||||
}
|
||||
true
|
||||
}
|
||||
|
||||
/// Put this unitig in canonical form in place.
|
||||
///
|
||||
/// Returns `true` if already canonical (no change), `false` if revcomp was applied.
|
||||
pub fn canonical(&mut self) -> bool {
|
||||
if self.is_canonical() {
|
||||
return true;
|
||||
}
|
||||
self.revcomp();
|
||||
false
|
||||
}
|
||||
|
||||
/// Extract the kmer of length `k` starting at nucleotide position `i` (0-based).
|
||||
pub fn kmer(&self, i: usize, k: usize) -> Result<Kmer, KmerError> {
|
||||
if k == 0 || k > 32 {
|
||||
return Err(KmerError::InvalidK { k });
|
||||
}
|
||||
if i + k > self.seql {
|
||||
return Err(KmerError::OutOfBounds {
|
||||
position: i,
|
||||
k,
|
||||
seql: self.seql,
|
||||
});
|
||||
}
|
||||
let bits = self.seq.view_bits::<Msb0>();
|
||||
let raw: u64 = bits[i * 2..(i + k) * 2].load_be();
|
||||
Ok(Kmer::from_raw(raw << (64 - 2 * k)))
|
||||
}
|
||||
|
||||
/// Extract the canonical kmer of length `k` starting at position `i`.
|
||||
pub fn canonical_kmer(&self, i: usize, k: usize) -> Result<CanonicalKmer, KmerError> {
|
||||
Ok(self.kmer(i, k)?.canonical(k))
|
||||
}
|
||||
|
||||
/// Iterate over all kmers of length `k` in order, yielding each as a [`Kmer`].
|
||||
pub fn iter_kmers(&self, k: usize) -> impl Iterator<Item = Kmer> + '_ {
|
||||
UnitigKmerIter::new(self, k)
|
||||
}
|
||||
|
||||
/// Iterate over all canonical kmers of length `k` in order.
|
||||
pub fn iter_canonical_kmers(&self, k: usize) -> impl Iterator<Item = CanonicalKmer> + '_ {
|
||||
self.iter_kmers(k).map(move |km| km.canonical(k))
|
||||
}
|
||||
}
|
||||
|
||||
// ── UnitigKmerIter ────────────────────────────────────────────────────────────
|
||||
|
||||
struct UnitigKmerIter<'a> {
|
||||
unitig: &'a Unitig,
|
||||
mask: u64,
|
||||
lshift: usize,
|
||||
current: u64,
|
||||
pos: usize,
|
||||
max_pos: usize,
|
||||
}
|
||||
|
||||
impl<'a> UnitigKmerIter<'a> {
|
||||
fn new(unitig: &'a Unitig, k: usize) -> Self {
|
||||
let seql = unitig.seql();
|
||||
let lshift = 64 - k * 2;
|
||||
let mask = ((!0u128) << (lshift + 2)) as u64;
|
||||
Self {
|
||||
unitig,
|
||||
mask,
|
||||
lshift,
|
||||
current: if seql >= k { unitig.kmer(0, k).unwrap().raw() } else { 0 },
|
||||
pos: k,
|
||||
max_pos: seql,
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
impl<'a> Iterator for UnitigKmerIter<'a> {
|
||||
type Item = Kmer;
|
||||
|
||||
fn next(&mut self) -> Option<Self::Item> {
|
||||
if self.pos > self.max_pos {
|
||||
return None;
|
||||
}
|
||||
let result = Kmer::from_raw(self.current);
|
||||
if self.pos < self.max_pos {
|
||||
let byte_pos = self.pos / 4;
|
||||
// nucleotide at position p within its byte occupies bits 7−2*(p%4) and 6−2*(p%4)
|
||||
let inner_shift = 6 - 2 * (self.pos & 3);
|
||||
let nuc = (((self.unitig.seq[byte_pos] >> inner_shift) & 3) as u64) << self.lshift;
|
||||
self.current = ((self.current << 2) & self.mask) | nuc;
|
||||
}
|
||||
self.pos += 1;
|
||||
Some(result)
|
||||
}
|
||||
}
|
||||
|
||||
// ── helpers ───────────────────────────────────────────────────────────────────
|
||||
|
||||
fn complement(base: u8) -> u8 {
|
||||
!base & 0b11
|
||||
}
|
||||
|
||||
fn byte_len(seql: usize) -> usize {
|
||||
(seql + 3) / 4
|
||||
}
|
||||
|
||||
// ── tests ─────────────────────────────────────────────────────────────────────
|
||||
pub use crate::packed_seq::PackedSeq as Unitig;
|
||||
|
||||
#[cfg(test)]
|
||||
mod tests {
|
||||
use super::*;
|
||||
|
||||
fn make_seq(len: usize) -> Vec<u8> {
|
||||
(0..len).map(|i| b"ACGT"[i % 4]).collect()
|
||||
}
|
||||
|
||||
fn ascii_revcomp(seq: &[u8]) -> Vec<u8> {
|
||||
seq.iter()
|
||||
.rev()
|
||||
.map(|&b| match b {
|
||||
b'A' => b'T',
|
||||
b'T' => b'A',
|
||||
b'C' => b'G',
|
||||
b'G' => b'C',
|
||||
_ => b'A',
|
||||
})
|
||||
.collect()
|
||||
}
|
||||
|
||||
fn test_lengths() -> impl Iterator<Item = usize> {
|
||||
(1..=9).chain([255, 256, 257, 1000, 10_000])
|
||||
}
|
||||
|
||||
// ── from_ascii / to_ascii ─────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn ascii_roundtrip_all_lengths() {
|
||||
for len in test_lengths() {
|
||||
let ascii = make_seq(len);
|
||||
let u = Unitig::from_ascii(&ascii);
|
||||
assert_eq!(u.to_ascii(), ascii, "roundtrip failed for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
// ── seql ──────────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn seql_roundtrip() {
|
||||
for len in test_lengths() {
|
||||
let u = Unitig::from_ascii(&make_seq(len));
|
||||
assert_eq!(u.seql(), len);
|
||||
}
|
||||
}
|
||||
|
||||
// ── revcomp ───────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn revcomp_known_values() {
|
||||
let cases = [
|
||||
("A", "T"),
|
||||
("AC", "GT"),
|
||||
("ACG", "CGT"),
|
||||
("ACGT", "ACGT"),
|
||||
("ACGTA", "TACGT"),
|
||||
];
|
||||
for (seq, expected) in cases {
|
||||
let mut u = Unitig::from_ascii(seq.as_bytes());
|
||||
u.revcomp();
|
||||
assert_eq!(u.to_ascii(), expected.as_bytes(), "revcomp wrong for \"{seq}\"");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn revcomp_vs_reference_all_lengths() {
|
||||
for len in test_lengths() {
|
||||
let ascii = make_seq(len);
|
||||
let expected = ascii_revcomp(&ascii);
|
||||
let mut u = Unitig::from_ascii(&ascii);
|
||||
u.revcomp();
|
||||
assert_eq!(u.to_ascii(), expected, "revcomp wrong for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn revcomp_involution_all_lengths() {
|
||||
for len in test_lengths() {
|
||||
let ascii = make_seq(len);
|
||||
let mut u = Unitig::from_ascii(&ascii);
|
||||
u.revcomp();
|
||||
u.revcomp();
|
||||
assert_eq!(u.to_ascii(), ascii, "revcomp∘revcomp≠id for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
// ── canonical ─────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn canonical_palindrome_unchanged() {
|
||||
let mut u = Unitig::from_ascii(b"ACGT");
|
||||
u.canonical();
|
||||
assert_eq!(u.to_ascii(), b"ACGT");
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_chooses_revcomp() {
|
||||
let mut u = Unitig::from_ascii(b"TTTT");
|
||||
u.canonical();
|
||||
assert_eq!(u.to_ascii(), b"AAAA");
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn canonical_is_minimal_all_lengths() {
|
||||
for len in test_lengths() {
|
||||
let ascii = make_seq(len);
|
||||
let mut u = Unitig::from_ascii(&ascii);
|
||||
u.canonical();
|
||||
let fwd = u.to_ascii();
|
||||
let rev = ascii_revcomp(&fwd);
|
||||
assert!(fwd <= rev, "canonical not minimal for len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
// ── kmer extraction ───────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn kmer_all_positions() {
|
||||
let ascii = b"ACGTACGTACGT";
|
||||
let k = 4;
|
||||
let u = Unitig::from_ascii(ascii);
|
||||
for i in 0..=ascii.len() - k {
|
||||
let kmer = u.kmer(i, k).unwrap();
|
||||
let expected = Kmer::from_ascii(&ascii[i..i + k], k).unwrap();
|
||||
assert_eq!(kmer, expected, "mismatch at position {i}");
|
||||
}
|
||||
}
|
||||
|
||||
// ── iter_kmers ────────────────────────────────────────────────────────────
|
||||
|
||||
#[test]
|
||||
fn iter_kmers_matches_kmer_at_each_position() {
|
||||
let ascii = make_seq(20);
|
||||
let k = 7;
|
||||
let u = Unitig::from_ascii(&ascii);
|
||||
let kmers: Vec<Kmer> = u.iter_kmers(k).collect();
|
||||
assert_eq!(kmers.len(), ascii.len() - k + 1);
|
||||
for (i, &km) in kmers.iter().enumerate() {
|
||||
assert_eq!(km, u.kmer(i, k).unwrap(), "pos={i}");
|
||||
}
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn iter_kmers_long_unitig() {
|
||||
let ascii = make_seq(10_000);
|
||||
let k = 11;
|
||||
let u = Unitig::from_ascii(&ascii);
|
||||
assert_eq!(u.iter_kmers(k).count(), 10_000 - k + 1);
|
||||
}
|
||||
}
|
||||
#[path = "tests/unitig.rs"]
|
||||
mod tests;
|
||||
@@ -7,3 +7,6 @@ edition = "2024"
|
||||
obikseq = { path = "../obikseq" }
|
||||
obikrope = { path = "../obikrope" }
|
||||
lazy_static = "1.5.0"
|
||||
|
||||
[dev-dependencies]
|
||||
obikseq = { path = "../obikseq", features = ["test-utils"] }
|
||||
@@ -21,7 +21,6 @@ pub(crate) static LN_CARD_ROT5: LazyLock<[f64; 1024]> =
|
||||
pub(crate) static LN_CARD_ROT6: LazyLock<[f64; 4096]> =
|
||||
LazyLock::new(|| build_log_class_size::<4096>(&NORMK6));
|
||||
|
||||
|
||||
fn ln0(x: f64) -> f64 {
|
||||
if x == 0.0 { 0.0 } else { x.ln() }
|
||||
}
|
||||
@@ -47,7 +46,7 @@ fn build_normalized_kmer<const N: usize>() -> [u64; N] {
|
||||
for i in 0..N {
|
||||
let la = (i as u64) << shift;
|
||||
let ra = i as u64;
|
||||
let rc_ra = Kmer::from_raw(la).revcomp(k).raw() >> shift;
|
||||
let rc_ra = Kmer::from_raw(la).revcomp().raw() >> shift;
|
||||
let circ = normalize_circular(ra, k);
|
||||
let circ_rc = normalize_circular(rc_ra, k);
|
||||
result[i] = circ.min(circ_rc);
|
||||
@@ -107,12 +106,10 @@ pub(crate) const K_MAX: usize = 32;
|
||||
pub(crate) const WS_MAX: usize = 6;
|
||||
|
||||
/// n·ln(n), with n_log_n[0] = 0. Indexed by n = 0..=K_MAX.
|
||||
pub(crate) static N_LOG_N: LazyLock<[f64; K_MAX + 1]> =
|
||||
LazyLock::new(|| build_n_log_n());
|
||||
pub(crate) static N_LOG_N: LazyLock<[f64; K_MAX + 1]> = LazyLock::new(|| build_n_log_n());
|
||||
|
||||
/// H_max[k][ws]: maximum entropy for kmer length k and word size ws.
|
||||
pub(crate) static EMAX: LazyLock<[[f64; WS_MAX + 1]; K_MAX + 1]> =
|
||||
LazyLock::new(|| build_emax());
|
||||
pub(crate) static EMAX: LazyLock<[[f64; WS_MAX + 1]; K_MAX + 1]> = LazyLock::new(|| build_emax());
|
||||
|
||||
/// ln(k − ws + 1): log of the number of ws-words in a kmer of length k.
|
||||
pub(crate) static LOG_NWORDS: LazyLock<[[f64; WS_MAX + 1]; K_MAX + 1]> =
|
||||
|
||||
@@ -16,8 +16,8 @@
|
||||
//! | super-kmer length = 256| k |
|
||||
|
||||
use obikrope::{ForwardCursor, Rope, RopeCursor};
|
||||
use obikseq::kmer::CanonicalKmer;
|
||||
use obikseq::RoutableSuperKmer;
|
||||
use obikseq::kmer::Minimizer;
|
||||
|
||||
use crate::rolling_stat::RollingStat;
|
||||
use crate::scratch::SuperKmerScratch;
|
||||
@@ -26,11 +26,10 @@ use crate::scratch::SuperKmerScratch;
|
||||
pub struct SuperKmerIter<'a> {
|
||||
cursor: ForwardCursor<'a>,
|
||||
k: usize,
|
||||
m: usize,
|
||||
theta: f64,
|
||||
scratch: SuperKmerScratch,
|
||||
stat: RollingStat,
|
||||
prev_min: Option<CanonicalKmer>,
|
||||
prev_min: Option<Minimizer>,
|
||||
prev_min_pos: usize,
|
||||
}
|
||||
|
||||
@@ -41,14 +40,13 @@ impl<'a> SuperKmerIter<'a> {
|
||||
/// - `m`: minimizer size (1 < m < k)
|
||||
/// - `level_max`: maximum sub-word size for entropy (1–6)
|
||||
/// - `theta`: entropy threshold; k-mers with score ≤ theta are rejected
|
||||
pub fn new(rope: &'a Rope, k: usize, m: usize, level_max: usize, theta: f64) -> Self {
|
||||
pub fn new(rope: &'a Rope, k: usize, level_max: usize, theta: f64) -> Self {
|
||||
Self {
|
||||
cursor: rope.fw_cursor(),
|
||||
k,
|
||||
m,
|
||||
theta,
|
||||
scratch: SuperKmerScratch::new(),
|
||||
stat: RollingStat::new(k, m, level_max),
|
||||
stat: RollingStat::new(level_max),
|
||||
prev_min: None,
|
||||
prev_min_pos: 0,
|
||||
}
|
||||
@@ -66,7 +64,7 @@ impl<'a> SuperKmerIter<'a> {
|
||||
return None;
|
||||
}
|
||||
self.prev_min?;
|
||||
Some(self.scratch.emit(self.prev_min_pos, self.m))
|
||||
Some(self.scratch.emit(self.prev_min_pos))
|
||||
}
|
||||
}
|
||||
|
||||
@@ -149,26 +147,31 @@ mod tests {
|
||||
use super::*;
|
||||
use obikrope::Rope;
|
||||
|
||||
fn setup() {
|
||||
obikseq::params::set_k(K);
|
||||
obikseq::params::set_m(5);
|
||||
}
|
||||
|
||||
fn make_rope(data: &[u8]) -> Rope {
|
||||
let mut r = Rope::new(None);
|
||||
r.push(data.to_vec());
|
||||
r
|
||||
}
|
||||
|
||||
fn run_nofilter(data: &[u8], k: usize, m: usize) -> Vec<Vec<u8>> {
|
||||
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
|
||||
let rope = make_rope(data);
|
||||
SuperKmerIter::new(&rope, k, m, 1, 0.0)
|
||||
SuperKmerIter::new(&rope, k, 1, 0.0)
|
||||
.map(|rsk| rsk.superkmer().to_ascii())
|
||||
.collect()
|
||||
}
|
||||
|
||||
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
|
||||
const K: usize = 11;
|
||||
const M: usize = 5;
|
||||
|
||||
#[test]
|
||||
fn single_segment_one_superkmer() {
|
||||
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K, M);
|
||||
setup();
|
||||
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
|
||||
assert!(!out.is_empty());
|
||||
let total: Vec<u8> = out.into_iter().flatten().collect();
|
||||
assert!(total.len() >= K);
|
||||
@@ -176,29 +179,33 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn segment_shorter_than_k_emits_nothing() {
|
||||
let out = run_nofilter(b"ACGTACGT\x00", K, M);
|
||||
setup();
|
||||
let out = run_nofilter(b"ACGTACGT\x00", K);
|
||||
assert_eq!(out, Vec::<Vec<u8>>::new());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn empty_input_emits_nothing() {
|
||||
let out = run_nofilter(b"", K, M);
|
||||
setup();
|
||||
let out = run_nofilter(b"", K);
|
||||
assert_eq!(out, Vec::<Vec<u8>>::new());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn two_segments_both_emitted() {
|
||||
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K, M);
|
||||
setup();
|
||||
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
|
||||
assert!(!out.is_empty());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn low_complexity_kmer_is_rejected() {
|
||||
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K, M);
|
||||
setup();
|
||||
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
|
||||
assert!(!out_pass.is_empty());
|
||||
|
||||
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
|
||||
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, M, 6, 0.9)
|
||||
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
|
||||
.map(|rsk| rsk.superkmer().to_ascii())
|
||||
.collect();
|
||||
assert!(out_reject.is_empty());
|
||||
@@ -206,12 +213,13 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn multi_slice_rope() {
|
||||
setup();
|
||||
let data = b"ACGTACGTACGTACGTACGT\x00";
|
||||
let mid = data.len() / 2;
|
||||
let mut rope = Rope::new(None);
|
||||
rope.push(data[..mid].to_vec());
|
||||
rope.push(data[mid..].to_vec());
|
||||
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, M, 1, 0.0)
|
||||
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
|
||||
.map(|rsk| rsk.superkmer().to_ascii())
|
||||
.collect();
|
||||
assert!(!out.is_empty());
|
||||
@@ -219,8 +227,9 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn yields_minimizer_value() {
|
||||
setup();
|
||||
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
|
||||
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, M, 1, 0.0).collect();
|
||||
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
|
||||
assert!(!results.is_empty());
|
||||
}
|
||||
}
|
||||
@@ -19,6 +19,11 @@ use obikrope::Rope;
|
||||
use obikseq::RoutableSuperKmer;
|
||||
|
||||
/// Collect all super-kmers from a normalised rope chunk.
|
||||
pub fn build_superkmers(rope: Rope, k: usize, m: usize, level_max: usize, theta: f64) -> Vec<RoutableSuperKmer> {
|
||||
SuperKmerIter::new(&rope, k, m, level_max, theta).collect()
|
||||
pub fn build_superkmers(
|
||||
rope: Rope,
|
||||
k: usize,
|
||||
level_max: usize,
|
||||
theta: f64,
|
||||
) -> Vec<RoutableSuperKmer> {
|
||||
SuperKmerIter::new(&rope, k, level_max, theta).collect()
|
||||
}
|
||||
@@ -1,4 +1,5 @@
|
||||
use obikseq::kmer::{CanonicalKmer, Kmer};
|
||||
use obikseq::kmer::{Minimizer, hash_kmer};
|
||||
use obikseq::params;
|
||||
|
||||
use crate::encoding::encode_nuc;
|
||||
use crate::entropy_table::{WS_MAX, emax, entropy_norm_kmer, ln_class_size, log_nwords, n_log_n};
|
||||
@@ -13,22 +14,7 @@ struct MmerItem {
|
||||
hash: u64,
|
||||
}
|
||||
|
||||
/// Bijective hash used to randomise the minimizer ordering.
|
||||
/// The XOR seed (2^64/φ) breaks the mix64 fixed point at 0,
|
||||
/// preventing poly-A/T kmers (canonical = 0) from always winning.
|
||||
#[inline(always)]
|
||||
fn hash_mmer(canonical: u64) -> u64 {
|
||||
let x = canonical ^ 0x9e3779b97f4a7c15;
|
||||
let x = x ^ (x >> 30);
|
||||
let x = x.wrapping_mul(0xbf58476d1ce4e5b9);
|
||||
let x = x ^ (x >> 27);
|
||||
let x = x.wrapping_mul(0x94d049bb133111eb);
|
||||
x ^ (x >> 31)
|
||||
}
|
||||
|
||||
pub struct RollingStat {
|
||||
k: usize,
|
||||
m: usize,
|
||||
entropy_max_k: usize,
|
||||
rolling_k: u64,
|
||||
rolling_rck: u64,
|
||||
@@ -53,15 +39,15 @@ pub struct RollingStat {
|
||||
}
|
||||
|
||||
impl RollingStat {
|
||||
pub fn new(k: usize, m: usize, entropy_max_k: usize) -> Self {
|
||||
pub fn new(entropy_max_k: usize) -> Self {
|
||||
let k = params::k();
|
||||
let m = params::m();
|
||||
Self {
|
||||
k,
|
||||
m,
|
||||
entropy_max_k,
|
||||
rolling_k: 0,
|
||||
rolling_rck: 0,
|
||||
k_mask: (!0) >> (64 - k * 2),
|
||||
m_mask: (!0) >> (64 - m * 2),
|
||||
k_mask: (!0u64) >> (64 - k * 2),
|
||||
m_mask: (!0u64) >> (64 - m * 2),
|
||||
received: 0,
|
||||
k1q: std::collections::VecDeque::with_capacity(k),
|
||||
k2q: std::collections::VecDeque::with_capacity(k - 1),
|
||||
@@ -85,12 +71,24 @@ impl RollingStat {
|
||||
self.rolling_k = 0;
|
||||
self.rolling_rck = 0;
|
||||
self.received = 0;
|
||||
for &i in &self.k1q { self.k1c[i as usize] = 0; }
|
||||
for &i in &self.k2q { self.k2c[i as usize] = 0; }
|
||||
for &i in &self.k3q { self.k3c[i as usize] = 0; }
|
||||
for &i in &self.k4q { self.k4c[i as usize] = 0; }
|
||||
for &i in &self.k5q { self.k5c[i as usize] = 0; }
|
||||
for &i in &self.k6q { self.k6c[i as usize] = 0; }
|
||||
for &i in &self.k1q {
|
||||
self.k1c[i as usize] = 0;
|
||||
}
|
||||
for &i in &self.k2q {
|
||||
self.k2c[i as usize] = 0;
|
||||
}
|
||||
for &i in &self.k3q {
|
||||
self.k3c[i as usize] = 0;
|
||||
}
|
||||
for &i in &self.k4q {
|
||||
self.k4c[i as usize] = 0;
|
||||
}
|
||||
for &i in &self.k5q {
|
||||
self.k5c[i as usize] = 0;
|
||||
}
|
||||
for &i in &self.k6q {
|
||||
self.k6c[i as usize] = 0;
|
||||
}
|
||||
self.k1q.clear();
|
||||
self.k2q.clear();
|
||||
self.k3q.clear();
|
||||
@@ -127,12 +125,15 @@ impl RollingStat {
|
||||
}
|
||||
|
||||
pub fn push(&mut self, nuc: u8) {
|
||||
let k = params::k();
|
||||
let m = params::m();
|
||||
|
||||
let bnuc = encode_nuc(nuc);
|
||||
let cnuc = bnuc ^ 3;
|
||||
|
||||
self.rolling_k = ((self.rolling_k << 2) | (bnuc as u64)) & self.k_mask;
|
||||
self.rolling_rck =
|
||||
((self.rolling_rck >> 2) | ((cnuc as u64) << ((self.k - 1) * 2))) & self.k_mask;
|
||||
((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask;
|
||||
|
||||
let canonical_k1 = entropy_norm_kmer(self.rolling_k & 3, 1, false);
|
||||
let canonical_k2 = entropy_norm_kmer(self.rolling_k & 15, 2, false);
|
||||
@@ -143,30 +144,37 @@ impl RollingStat {
|
||||
|
||||
self.received += 1;
|
||||
|
||||
if self.received >= self.m {
|
||||
if self.received >= m {
|
||||
let possible_canonical_m =
|
||||
(self.rolling_k & self.m_mask).min(self.rolling_rck >> ((self.k - self.m) * 2));
|
||||
let possible_hash_m = hash_mmer(possible_canonical_m);
|
||||
let possible_pos_m = self.received - self.m;
|
||||
(self.rolling_k & self.m_mask).min(self.rolling_rck >> ((k - m) * 2));
|
||||
let possible_hash_m = hash_kmer(possible_canonical_m << 64 - m * 2);
|
||||
let possible_pos_m = self.received - m;
|
||||
|
||||
while self.minimier.back().map_or(false, |it| it.hash >= possible_hash_m) {
|
||||
while self
|
||||
.minimier
|
||||
.back()
|
||||
.map_or(false, |it| it.hash >= possible_hash_m)
|
||||
{
|
||||
self.minimier.pop_back();
|
||||
}
|
||||
self.minimier
|
||||
.push_back(MmerItem { position: possible_pos_m, canonical: possible_canonical_m, hash: possible_hash_m });
|
||||
self.minimier.push_back(MmerItem {
|
||||
position: possible_pos_m,
|
||||
canonical: possible_canonical_m,
|
||||
hash: possible_hash_m,
|
||||
});
|
||||
|
||||
if self.received > self.k {
|
||||
if self.received > k {
|
||||
while self
|
||||
.minimier
|
||||
.front()
|
||||
.map_or(false, |it| it.position + self.k < self.received)
|
||||
.map_or(false, |it| it.position + k < self.received)
|
||||
{
|
||||
self.minimier.pop_front();
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
if self.received > self.k {
|
||||
if self.received > k {
|
||||
let old1 = self.k1q.pop_front().unwrap();
|
||||
let f1 = self.k1c[old1 as usize];
|
||||
Self::update_sums_decrement(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 1, old1, f1);
|
||||
@@ -199,37 +207,73 @@ impl RollingStat {
|
||||
}
|
||||
|
||||
let g1 = self.k1c[canonical_k1 as usize];
|
||||
Self::update_sums_increment(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 1, canonical_k1, g1);
|
||||
Self::update_sums_increment(
|
||||
&mut self.sum_f_log_f,
|
||||
&mut self.sum_f_log_s,
|
||||
1,
|
||||
canonical_k1,
|
||||
g1,
|
||||
);
|
||||
self.k1c[canonical_k1 as usize] += 1;
|
||||
self.k1q.push_back(canonical_k1);
|
||||
|
||||
if self.received >= 2 {
|
||||
let g2 = self.k2c[canonical_k2 as usize];
|
||||
Self::update_sums_increment(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 2, canonical_k2, g2);
|
||||
Self::update_sums_increment(
|
||||
&mut self.sum_f_log_f,
|
||||
&mut self.sum_f_log_s,
|
||||
2,
|
||||
canonical_k2,
|
||||
g2,
|
||||
);
|
||||
self.k2c[canonical_k2 as usize] += 1;
|
||||
self.k2q.push_back(canonical_k2);
|
||||
|
||||
if self.received >= 3 {
|
||||
let g3 = self.k3c[canonical_k3 as usize];
|
||||
Self::update_sums_increment(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 3, canonical_k3, g3);
|
||||
Self::update_sums_increment(
|
||||
&mut self.sum_f_log_f,
|
||||
&mut self.sum_f_log_s,
|
||||
3,
|
||||
canonical_k3,
|
||||
g3,
|
||||
);
|
||||
self.k3c[canonical_k3 as usize] += 1;
|
||||
self.k3q.push_back(canonical_k3);
|
||||
|
||||
if self.received >= 4 {
|
||||
let g4 = self.k4c[canonical_k4 as usize];
|
||||
Self::update_sums_increment(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 4, canonical_k4, g4);
|
||||
Self::update_sums_increment(
|
||||
&mut self.sum_f_log_f,
|
||||
&mut self.sum_f_log_s,
|
||||
4,
|
||||
canonical_k4,
|
||||
g4,
|
||||
);
|
||||
self.k4c[canonical_k4 as usize] += 1;
|
||||
self.k4q.push_back(canonical_k4);
|
||||
|
||||
if self.received >= 5 {
|
||||
let g5 = self.k5c[canonical_k5 as usize];
|
||||
Self::update_sums_increment(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 5, canonical_k5, g5);
|
||||
Self::update_sums_increment(
|
||||
&mut self.sum_f_log_f,
|
||||
&mut self.sum_f_log_s,
|
||||
5,
|
||||
canonical_k5,
|
||||
g5,
|
||||
);
|
||||
self.k5c[canonical_k5 as usize] += 1;
|
||||
self.k5q.push_back(canonical_k5);
|
||||
|
||||
if self.received >= 6 {
|
||||
let g6 = self.k6c[canonical_k6 as usize];
|
||||
Self::update_sums_increment(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 6, canonical_k6, g6);
|
||||
Self::update_sums_increment(
|
||||
&mut self.sum_f_log_f,
|
||||
&mut self.sum_f_log_s,
|
||||
6,
|
||||
canonical_k6,
|
||||
g6,
|
||||
);
|
||||
self.k6c[canonical_k6 as usize] += 1;
|
||||
self.k6q.push_back(canonical_k6);
|
||||
}
|
||||
@@ -240,31 +284,7 @@ impl RollingStat {
|
||||
}
|
||||
|
||||
pub fn ready(&self) -> bool {
|
||||
self.received >= self.k
|
||||
}
|
||||
|
||||
pub fn kmer(&self) -> Option<Kmer> {
|
||||
if self.ready() {
|
||||
Some(Kmer::from_raw_right(self.rolling_k, self.k))
|
||||
} else {
|
||||
None
|
||||
}
|
||||
}
|
||||
|
||||
pub fn revcomp_kmer(&self) -> Option<Kmer> {
|
||||
if self.ready() {
|
||||
Some(Kmer::from_raw_right(self.rolling_rck, self.k))
|
||||
} else {
|
||||
None
|
||||
}
|
||||
}
|
||||
|
||||
pub fn canonical_kmer(&self) -> Option<Kmer> {
|
||||
if self.ready() {
|
||||
Some(Kmer::from_raw_right(self.rolling_k.min(self.rolling_rck), self.k))
|
||||
} else {
|
||||
None
|
||||
}
|
||||
self.received >= params::k()
|
||||
}
|
||||
|
||||
pub fn minimizer_position(&self) -> Option<usize> {
|
||||
@@ -283,22 +303,22 @@ impl RollingStat {
|
||||
}
|
||||
}
|
||||
|
||||
pub fn canonical_minimizer(&self) -> Option<CanonicalKmer> {
|
||||
self.canonical_minimizer_raw().map(|raw| {
|
||||
CanonicalKmer::from_raw_unchecked(Kmer::from_raw_right(raw, self.m).raw())
|
||||
})
|
||||
pub fn canonical_minimizer(&self) -> Option<Minimizer> {
|
||||
self.canonical_minimizer_raw()
|
||||
.map(|raw| Minimizer::from_raw_unchecked(raw << (64 - params::m() * 2)))
|
||||
}
|
||||
|
||||
pub fn entropy(&self, order: usize) -> Option<f64> {
|
||||
if !self.ready() {
|
||||
return None;
|
||||
}
|
||||
let em = emax(self.k, order);
|
||||
let k = params::k();
|
||||
let em = emax(k, order);
|
||||
if em <= 0.0 {
|
||||
return Some(1.0);
|
||||
}
|
||||
let nwords = self.k - order + 1;
|
||||
let log_nw = log_nwords(self.k, order);
|
||||
let nwords = k - order + 1;
|
||||
let log_nw = log_nwords(k, order);
|
||||
let nw_f = nwords as f64;
|
||||
let h_corr = log_nw + (self.sum_f_log_s[order] - self.sum_f_log_f[order]) / nw_f;
|
||||
Some((h_corr / em).max(0.0))
|
||||
|
||||
@@ -56,14 +56,14 @@ impl SuperKmerScratch {
|
||||
///
|
||||
/// The heap allocation (`Box<[u8]>`) is exactly sized to the sequence.
|
||||
/// Resets the buffer to empty afterward.
|
||||
pub fn emit(&mut self, min_pos: usize, m: usize) -> RoutableSuperKmer {
|
||||
pub fn emit(&mut self, min_pos: usize) -> RoutableSuperKmer {
|
||||
let seql = self.len;
|
||||
debug_assert!(seql >= 1 && seql <= MAX_SUPERKMER_LEN);
|
||||
let n = (seql + 3) / 4;
|
||||
let seq: Box<[u8]> = self.buf[..n].into();
|
||||
self.buf[..n].fill(0);
|
||||
self.len = 0;
|
||||
RoutableSuperKmer::build(min_pos, m, seql as u8, seq)
|
||||
RoutableSuperKmer::build(min_pos, seql, seq)
|
||||
}
|
||||
/// Discard all accumulated nucleotides without producing a [`SuperKmer`].
|
||||
pub fn reset(&mut self) {
|
||||
|
||||
@@ -14,3 +14,4 @@ obikseq = { path = "../obikseq" }
|
||||
|
||||
[dev-dependencies]
|
||||
tempfile = "3"
|
||||
obikseq = { path = "../obikseq", features = ["test-utils"] }
|
||||
+20
-53
@@ -1,46 +1,19 @@
|
||||
use obikseq::superkmer::SuperKmer;
|
||||
use obikseq::SuperKmer;
|
||||
use std::io::{self, Read, Write};
|
||||
|
||||
/// Serialise one SuperKmer into `w` (uncompressed; caller must wrap with a compressor).
|
||||
///
|
||||
/// Bits [7:0] of the header store `n_kmers = seql - k + 1` (kmer units, 1–255),
|
||||
/// not the raw nucleotide length. This removes the 0=256 wrapping convention.
|
||||
#[inline]
|
||||
pub(crate) fn write_superkmer<W: Write>(w: &mut W, sk: &SuperKmer, k: usize) -> io::Result<()> {
|
||||
let n_kmers = sk.len() - k + 1;
|
||||
let new_bits = (sk.header_bits() & !0xFF) | (n_kmers as u32);
|
||||
w.write_all(&new_bits.to_le_bytes())?;
|
||||
w.write_all(sk.seq_bytes())
|
||||
pub(crate) fn write_superkmer<W: Write>(w: &mut W, sk: &SuperKmer) -> io::Result<()> {
|
||||
sk.write_to_binary(w)
|
||||
}
|
||||
|
||||
/// Deserialise one SuperKmer from `r`. Returns `None` on clean EOF.
|
||||
/// `seq_buf` is a reusable scratch buffer to avoid per-record allocation.
|
||||
/// Bits [7:0] of the on-disk header contain `n_kmers`; nucleotide length is
|
||||
/// reconstructed as `n_kmers + k - 1`.
|
||||
pub(crate) fn read_superkmer<R: Read>(
|
||||
r: &mut R,
|
||||
seq_buf: &mut Vec<u8>,
|
||||
k: usize,
|
||||
) -> io::Result<Option<SuperKmer>> {
|
||||
let mut hdr = [0u8; 4];
|
||||
match r.read_exact(&mut hdr) {
|
||||
Ok(()) => {}
|
||||
Err(e) if e.kind() == io::ErrorKind::UnexpectedEof => return Ok(None),
|
||||
Err(e) => return Err(e),
|
||||
pub(crate) fn read_superkmer<R: Read>(r: &mut R) -> io::Result<Option<SuperKmer>> {
|
||||
match SuperKmer::read_from_binary(r) {
|
||||
Ok(sk) => Ok(Some(sk)),
|
||||
Err(e) if e.kind() == io::ErrorKind::UnexpectedEof => Ok(None),
|
||||
Err(e) => Err(e),
|
||||
}
|
||||
let bits = u32::from_le_bytes(hdr);
|
||||
let n_kmers = (bits & 0xFF) as usize;
|
||||
let nt_len = n_kmers + k - 1;
|
||||
let byte_len = (nt_len + 3) / 4;
|
||||
seq_buf.resize(byte_len, 0);
|
||||
r.read_exact(seq_buf)?;
|
||||
// Reconstruct the in-memory seql byte (0 encodes 256, 1-255 direct).
|
||||
let seql_byte = if nt_len == 256 { 0u8 } else { nt_len as u8 };
|
||||
let mem_bits = (bits & !0xFF) | (seql_byte as u32);
|
||||
Ok(Some(SuperKmer::from_header_bits(
|
||||
mem_bits,
|
||||
seq_buf.as_slice().into(),
|
||||
)))
|
||||
}
|
||||
|
||||
#[cfg(test)]
|
||||
@@ -54,32 +27,29 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn roundtrip_single() {
|
||||
let k = 4;
|
||||
let sk = make_sk(b"ACGTACGT");
|
||||
let mut buf = Vec::new();
|
||||
write_superkmer(&mut buf, &sk, k).unwrap();
|
||||
write_superkmer(&mut buf, &sk).unwrap();
|
||||
|
||||
let mut cur = Cursor::new(&buf);
|
||||
let mut seq_buf = Vec::new();
|
||||
let got = read_superkmer(&mut cur, &mut seq_buf, k).unwrap().unwrap();
|
||||
let got = read_superkmer(&mut cur).unwrap().unwrap();
|
||||
assert_eq!(sk.to_ascii(), got.to_ascii());
|
||||
assert_eq!(sk.len(), got.len());
|
||||
assert_eq!(sk.seql(), got.seql());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn roundtrip_all_lengths() {
|
||||
let bases: Vec<u8> = (0..256).map(|i| b"ACGT"[i % 4]).collect();
|
||||
// k=11 is the project minimum; test seql from k to 256.
|
||||
let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
|
||||
let k = 11;
|
||||
for len in (k..=k + 8).chain([255, 256]) {
|
||||
for len in (k..=k + 8).chain([255, 256, 257]) {
|
||||
let sk = make_sk(&bases[..len]);
|
||||
let mut buf = Vec::new();
|
||||
write_superkmer(&mut buf, &sk, k).unwrap();
|
||||
write_superkmer(&mut buf, &sk).unwrap();
|
||||
|
||||
let mut cur = Cursor::new(&buf);
|
||||
let mut seq_buf = Vec::new();
|
||||
let got = read_superkmer(&mut cur, &mut seq_buf, k).unwrap().unwrap();
|
||||
let got = read_superkmer(&mut cur).unwrap().unwrap();
|
||||
assert_eq!(sk.to_ascii(), got.to_ascii(), "len={len}");
|
||||
assert_eq!(sk.seql(), got.seql(), "len={len}");
|
||||
}
|
||||
}
|
||||
|
||||
@@ -87,26 +57,23 @@ mod tests {
|
||||
fn eof_returns_none() {
|
||||
let buf: Vec<u8> = vec![];
|
||||
let mut cur = Cursor::new(&buf);
|
||||
let mut seq_buf = Vec::new();
|
||||
assert!(read_superkmer(&mut cur, &mut seq_buf, 4).unwrap().is_none());
|
||||
assert!(read_superkmer(&mut cur).unwrap().is_none());
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn multiple_records() {
|
||||
let k = 4;
|
||||
let seqs: &[&[u8]] = &[b"AAAA", b"CCCC", b"GGGG", b"TTTT"];
|
||||
let mut buf = Vec::new();
|
||||
for s in seqs {
|
||||
write_superkmer(&mut buf, &make_sk(s), k).unwrap();
|
||||
write_superkmer(&mut buf, &make_sk(s)).unwrap();
|
||||
}
|
||||
|
||||
let mut cur = Cursor::new(&buf);
|
||||
let mut seq_buf = Vec::new();
|
||||
for s in seqs {
|
||||
let got = read_superkmer(&mut cur, &mut seq_buf, k).unwrap().unwrap();
|
||||
let got = read_superkmer(&mut cur).unwrap().unwrap();
|
||||
let expected = make_sk(s);
|
||||
assert_eq!(expected.to_ascii(), got.to_ascii());
|
||||
}
|
||||
assert!(read_superkmer(&mut cur, &mut seq_buf, k).unwrap().is_none());
|
||||
assert!(read_superkmer(&mut cur).unwrap().is_none());
|
||||
}
|
||||
}
|
||||
+41
-38
@@ -5,7 +5,7 @@ use crate::meta::SKFileMeta;
|
||||
use lru::LruCache;
|
||||
use niffler::Level;
|
||||
use niffler::send::compression::Format;
|
||||
use obikseq::superkmer::SuperKmer;
|
||||
use obikseq::SuperKmer;
|
||||
use std::fs::{File, OpenOptions};
|
||||
use std::io::{BufWriter, Write};
|
||||
use std::num::NonZeroUsize;
|
||||
@@ -222,7 +222,6 @@ pub struct SKFileWriter {
|
||||
id: usize,
|
||||
pool: Arc<Mutex<SKFilePool>>,
|
||||
path: PathBuf,
|
||||
k: usize,
|
||||
pending: Vec<u8>,
|
||||
flush_threshold: usize,
|
||||
logically_closed: bool,
|
||||
@@ -230,15 +229,14 @@ pub struct SKFileWriter {
|
||||
}
|
||||
|
||||
/// Create a `SKFileWriter` for a new file (Zstd, level 3).
|
||||
pub fn create_token(pool: &SharedPool, path: PathBuf, k: usize) -> SKResult<SKFileWriter> {
|
||||
create_token_with(pool, path, k, Format::Zstd, Level::Three)
|
||||
pub fn create_token(pool: &SharedPool, path: PathBuf) -> SKResult<SKFileWriter> {
|
||||
create_token_with(pool, path, Format::Zstd, Level::Three)
|
||||
}
|
||||
|
||||
/// Create a `SKFileWriter` for a new file with explicit format and level.
|
||||
pub fn create_token_with(
|
||||
pool: &SharedPool,
|
||||
path: PathBuf,
|
||||
k: usize,
|
||||
format: Format,
|
||||
level: Level,
|
||||
) -> SKResult<SKFileWriter> {
|
||||
@@ -247,7 +245,6 @@ pub fn create_token_with(
|
||||
id,
|
||||
pool: Arc::clone(pool),
|
||||
path,
|
||||
k,
|
||||
pending: Vec::with_capacity(DEFAULT_FLUSH_THRESHOLD + 128),
|
||||
flush_threshold: DEFAULT_FLUSH_THRESHOLD,
|
||||
logically_closed: false,
|
||||
@@ -258,18 +255,13 @@ pub fn create_token_with(
|
||||
impl SKFileWriter {
|
||||
/// Create a standalone file writer (Zstd, level 3).
|
||||
/// The pool is created internally and is not accessible to the caller.
|
||||
pub fn create<P: AsRef<Path>>(path: P, k: usize) -> SKResult<Self> {
|
||||
Self::create_with(path, k, Format::Zstd, Level::Three)
|
||||
pub fn create<P: AsRef<Path>>(path: P) -> SKResult<Self> {
|
||||
Self::create_with(path, Format::Zstd, Level::Three)
|
||||
}
|
||||
|
||||
/// Create a standalone file writer with explicit format and level.
|
||||
pub fn create_with<P: AsRef<Path>>(
|
||||
path: P,
|
||||
k: usize,
|
||||
format: Format,
|
||||
level: Level,
|
||||
) -> SKResult<Self> {
|
||||
create_token_with(global_pool(), path.as_ref().to_owned(), k, format, level)
|
||||
pub fn create_with<P: AsRef<Path>>(path: P, format: Format, level: Level) -> SKResult<Self> {
|
||||
create_token_with(global_pool(), path.as_ref().to_owned(), format, level)
|
||||
}
|
||||
|
||||
/// `true` if the underlying fd is currently open in the pool.
|
||||
@@ -280,10 +272,10 @@ impl SKFileWriter {
|
||||
/// Accumulate one SuperKmer. Drains to fd when `pending ≥ flush_threshold`.
|
||||
pub fn write(&mut self, sk: &SuperKmer) -> SKResult<()> {
|
||||
self.check_not_closed()?;
|
||||
write_superkmer(&mut self.pending, sk, self.k)?;
|
||||
write_superkmer(&mut self.pending, sk)?;
|
||||
self.meta.instances += 1;
|
||||
self.meta.count_sum += sk.count() as u64;
|
||||
self.meta.length_sum += sk.len() as u64;
|
||||
self.meta.length_sum += sk.seql() as u64;
|
||||
if self.pending.len() >= self.flush_threshold {
|
||||
self.drain()?;
|
||||
}
|
||||
@@ -294,10 +286,10 @@ impl SKFileWriter {
|
||||
pub fn write_batch(&mut self, sks: &[SuperKmer]) -> SKResult<()> {
|
||||
self.check_not_closed()?;
|
||||
for sk in sks {
|
||||
write_superkmer(&mut self.pending, sk, self.k)?;
|
||||
write_superkmer(&mut self.pending, sk)?;
|
||||
self.meta.instances += 1;
|
||||
self.meta.count_sum += sk.count() as u64;
|
||||
self.meta.length_sum += sk.len() as u64;
|
||||
self.meta.length_sum += sk.seql() as u64;
|
||||
if self.pending.len() >= self.flush_threshold {
|
||||
self.drain()?;
|
||||
}
|
||||
@@ -439,7 +431,7 @@ impl Drop for SKFileWriter {
|
||||
mod tests {
|
||||
use super::*;
|
||||
use crate::reader::SKFileReader;
|
||||
use obikseq::superkmer::SuperKmer;
|
||||
use obikseq::{SuperKmer, set_k};
|
||||
use tempfile::{NamedTempFile, TempDir};
|
||||
|
||||
const TEST_K: usize = 4;
|
||||
@@ -460,22 +452,24 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn creation_holds_no_fd() {
|
||||
set_k(TEST_K);
|
||||
let dir = TempDir::new().unwrap();
|
||||
let p = pool(3);
|
||||
for i in 0..10 {
|
||||
create_token(&p, dir.path().join(format!("p{i}.zst")), TEST_K).unwrap();
|
||||
create_token(&p, dir.path().join(format!("p{i}.zst"))).unwrap();
|
||||
}
|
||||
assert_eq!(p.lock().unwrap().open_count(), 0);
|
||||
}
|
||||
|
||||
#[test]
|
||||
fn pool_limits_open_fds() {
|
||||
set_k(TEST_K);
|
||||
let dir = TempDir::new().unwrap();
|
||||
let p = pool(3);
|
||||
let sk = make_sk(0);
|
||||
|
||||
let mut tokens: Vec<SKFileWriter> = (0..6)
|
||||
.map(|i| create_token(&p, dir.path().join(format!("p{i}.zst")), TEST_K).unwrap())
|
||||
.map(|i| create_token(&p, dir.path().join(format!("p{i}.zst"))).unwrap())
|
||||
.collect();
|
||||
|
||||
for t in tokens.iter_mut() {
|
||||
@@ -491,12 +485,13 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn evicted_token_stays_logically_open() {
|
||||
set_k(TEST_K);
|
||||
let dir = TempDir::new().unwrap();
|
||||
let p = pool(1);
|
||||
let sk = make_sk(0);
|
||||
|
||||
let mut t0 = create_token(&p, dir.path().join("a.zst"), TEST_K).unwrap();
|
||||
let mut t1 = create_token(&p, dir.path().join("b.zst"), TEST_K).unwrap();
|
||||
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
|
||||
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
|
||||
|
||||
open_token(&mut t0, &sk); // t0 fd open, pool full
|
||||
open_token(&mut t1, &sk); // evicts t0, t1 fd open
|
||||
@@ -507,12 +502,13 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn evicted_data_readable_after_close_all() {
|
||||
set_k(TEST_K);
|
||||
let dir = TempDir::new().unwrap();
|
||||
let p = pool(1);
|
||||
let sk = make_sk(0);
|
||||
|
||||
let mut t0 = create_token(&p, dir.path().join("a.zst"), TEST_K).unwrap();
|
||||
let mut t1 = create_token(&p, dir.path().join("b.zst"), TEST_K).unwrap();
|
||||
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
|
||||
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
|
||||
|
||||
t0.set_flush_threshold(1);
|
||||
t0.write(&sk).unwrap(); // t0 fd open, pool full
|
||||
@@ -528,7 +524,7 @@ mod tests {
|
||||
p.lock().unwrap().close_all().unwrap();
|
||||
|
||||
for name in &["a.zst", "b.zst"] {
|
||||
let mut r = SKFileReader::open(dir.path().join(name), TEST_K).unwrap();
|
||||
let mut r = SKFileReader::open(dir.path().join(name)).unwrap();
|
||||
let got = r.read_batch(10).unwrap();
|
||||
assert_eq!(got.len(), 1, "{name}: expected 1 record");
|
||||
}
|
||||
@@ -536,13 +532,14 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn touch_moves_to_mru_so_lru_is_evicted() {
|
||||
set_k(TEST_K);
|
||||
let dir = TempDir::new().unwrap();
|
||||
let p = pool(2);
|
||||
let sk = make_sk(0);
|
||||
|
||||
let mut t0 = create_token(&p, dir.path().join("a.zst"), TEST_K).unwrap();
|
||||
let mut t1 = create_token(&p, dir.path().join("b.zst"), TEST_K).unwrap();
|
||||
let mut t2 = create_token(&p, dir.path().join("c.zst"), TEST_K).unwrap();
|
||||
let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
|
||||
let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
|
||||
let mut t2 = create_token(&p, dir.path().join("c.zst")).unwrap();
|
||||
|
||||
open_token(&mut t0, &sk); // t0 open
|
||||
open_token(&mut t1, &sk); // t1 open, t0 LRU
|
||||
@@ -560,6 +557,7 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn close_all_produces_readable_files() {
|
||||
set_k(TEST_K);
|
||||
let dir = TempDir::new().unwrap();
|
||||
let p = pool(8);
|
||||
let paths: Vec<_> = (0..4)
|
||||
@@ -568,7 +566,7 @@ mod tests {
|
||||
|
||||
let mut tokens: Vec<SKFileWriter> = paths
|
||||
.iter()
|
||||
.map(|path| create_token(&p, path.clone(), TEST_K).unwrap())
|
||||
.map(|path| create_token(&p, path.clone()).unwrap())
|
||||
.collect();
|
||||
|
||||
for (i, t) in tokens.iter_mut().enumerate() {
|
||||
@@ -581,7 +579,7 @@ mod tests {
|
||||
p.lock().unwrap().close_all().unwrap();
|
||||
|
||||
for path in &paths {
|
||||
let mut r = SKFileReader::open(path, TEST_K).unwrap();
|
||||
let mut r = SKFileReader::open(path).unwrap();
|
||||
let got = r.read_batch(10).unwrap();
|
||||
assert_eq!(got.len(), 1);
|
||||
}
|
||||
@@ -589,16 +587,17 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn write_batch_roundtrip() {
|
||||
set_k(TEST_K);
|
||||
let dir = TempDir::new().unwrap();
|
||||
let p = pool(4);
|
||||
let sks: Vec<_> = (0..50).map(make_sk).collect();
|
||||
let path = dir.path().join("batch.zst");
|
||||
|
||||
let mut t = create_token(&p, path.clone(), TEST_K).unwrap();
|
||||
let mut t = create_token(&p, path.clone()).unwrap();
|
||||
t.write_batch(&sks).unwrap();
|
||||
t.close().unwrap();
|
||||
|
||||
let mut r = SKFileReader::open(&path, TEST_K).unwrap();
|
||||
let mut r = SKFileReader::open(&path).unwrap();
|
||||
let got = r.read_batch(100).unwrap();
|
||||
assert_eq!(got.len(), 50);
|
||||
for (a, b) in sks.iter().zip(got.iter()) {
|
||||
@@ -608,6 +607,7 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn from_system_limits_bounded() {
|
||||
set_k(TEST_K);
|
||||
let pool = SKFilePool::from_system_limits();
|
||||
assert!(pool.max_open() >= 16);
|
||||
assert!(pool.max_open() <= MAX_POOL_SIZE);
|
||||
@@ -615,14 +615,15 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn standalone_roundtrip_zstd() {
|
||||
set_k(TEST_K);
|
||||
let tmp = NamedTempFile::new().unwrap();
|
||||
let sks: Vec<_> = (0..100).map(make_sk).collect();
|
||||
{
|
||||
let mut w = SKFileWriter::create(tmp.path(), TEST_K).unwrap();
|
||||
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
||||
w.write_batch(&sks).unwrap();
|
||||
w.close().unwrap();
|
||||
}
|
||||
let mut r = SKFileReader::open(tmp.path(), TEST_K).unwrap();
|
||||
let mut r = SKFileReader::open(tmp.path()).unwrap();
|
||||
let got = r.read_batch(200).unwrap();
|
||||
assert_eq!(got.len(), 100);
|
||||
for (a, b) in sks.iter().zip(got.iter()) {
|
||||
@@ -632,8 +633,9 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn standalone_close_prevents_write() {
|
||||
set_k(TEST_K);
|
||||
let tmp = NamedTempFile::new().unwrap();
|
||||
let mut w = SKFileWriter::create(tmp.path(), TEST_K).unwrap();
|
||||
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
||||
w.close().unwrap();
|
||||
assert!(!w.is_open());
|
||||
assert!(w.write(&make_sk(0)).is_err());
|
||||
@@ -641,8 +643,9 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn standalone_is_physically_open() {
|
||||
set_k(TEST_K);
|
||||
let tmp = NamedTempFile::new().unwrap();
|
||||
let mut w = SKFileWriter::create(tmp.path(), TEST_K).unwrap();
|
||||
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
||||
assert!(!w.is_physically_open()); // fd deferred until first drain
|
||||
w.set_flush_threshold(1);
|
||||
w.write(&make_sk(0)).unwrap(); // triggers drain → fd opened
|
||||
|
||||
+19
-15
@@ -15,25 +15,20 @@ use std::path::{Path, PathBuf};
|
||||
/// that it can fast-forward on next open.
|
||||
pub struct SKFileReader {
|
||||
path: PathBuf,
|
||||
k: usize,
|
||||
reader: Option<Box<dyn std::io::Read + Send>>,
|
||||
/// Reusable scratch buffer for the `seq` bytes of each record.
|
||||
seq_buf: Vec<u8>,
|
||||
/// Number of SuperKmers successfully read so far (for eviction recovery).
|
||||
consumed: u64,
|
||||
}
|
||||
|
||||
impl SKFileReader {
|
||||
/// Open a file for reading. Format is auto-detected from magic bytes.
|
||||
/// `k` is the kmer size of the partition; required to decode the on-disk n_kmers field.
|
||||
pub fn open<P: AsRef<Path>>(path: P, k: usize) -> SKResult<Self> {
|
||||
pub fn open<P: AsRef<Path>>(path: P) -> SKResult<Self> {
|
||||
let path = path.as_ref().to_owned();
|
||||
let (reader, _fmt) = niffler::send::get_reader(Box::new(BufReader::new(File::open(&path)?)))?;
|
||||
let (reader, _fmt) =
|
||||
niffler::send::get_reader(Box::new(BufReader::new(File::open(&path)?)))?;
|
||||
Ok(Self {
|
||||
path,
|
||||
k,
|
||||
reader: Some(reader),
|
||||
seq_buf: Vec::with_capacity(64),
|
||||
consumed: 0,
|
||||
})
|
||||
}
|
||||
@@ -46,7 +41,7 @@ impl SKFileReader {
|
||||
"read from physically closed SKFileReader",
|
||||
)
|
||||
})?;
|
||||
let result = read_superkmer(r, &mut self.seq_buf, self.k)?;
|
||||
let result = read_superkmer(r)?;
|
||||
if result.is_some() {
|
||||
self.consumed += 1;
|
||||
}
|
||||
@@ -87,7 +82,10 @@ impl SKFileReader {
|
||||
|
||||
/// Return an iterator over this reader.
|
||||
pub fn iter(&mut self) -> SKFileIter<'_> {
|
||||
SKFileIter { reader: self, error: None }
|
||||
SKFileIter {
|
||||
reader: self,
|
||||
error: None,
|
||||
}
|
||||
}
|
||||
|
||||
// ── pool-internal helpers ─────────────────────────────────────────────────
|
||||
@@ -103,7 +101,7 @@ impl SKFileReader {
|
||||
let target = self.consumed;
|
||||
self.consumed = 0;
|
||||
for _ in 0..target {
|
||||
match read_superkmer(self.reader.as_mut().unwrap(), &mut self.seq_buf, self.k)? {
|
||||
match read_superkmer(self.reader.as_mut().unwrap())? {
|
||||
Some(_) => self.consumed += 1,
|
||||
None => break,
|
||||
}
|
||||
@@ -152,6 +150,10 @@ mod tests {
|
||||
|
||||
const TEST_K: usize = 4; // test sequences are 8 bases; k=4 gives n_kmers=5
|
||||
|
||||
fn setup() {
|
||||
obikseq::params::set_k(TEST_K);
|
||||
}
|
||||
|
||||
fn make_sks(n: usize) -> Vec<SuperKmer> {
|
||||
(0..n)
|
||||
.map(|i| {
|
||||
@@ -163,15 +165,16 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn iter_all() {
|
||||
setup();
|
||||
let tmp = NamedTempFile::new().unwrap();
|
||||
let sks = make_sks(50);
|
||||
|
||||
{
|
||||
let mut w = SKFileWriter::create(tmp.path(), TEST_K).unwrap();
|
||||
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
||||
w.write_batch(&sks).unwrap();
|
||||
}
|
||||
|
||||
let mut r = SKFileReader::open(tmp.path(), TEST_K).unwrap();
|
||||
let mut r = SKFileReader::open(tmp.path()).unwrap();
|
||||
let got: Vec<_> = r.iter().collect();
|
||||
assert_eq!(got.len(), 50);
|
||||
for (a, b) in sks.iter().zip(got.iter()) {
|
||||
@@ -181,15 +184,16 @@ mod tests {
|
||||
|
||||
#[test]
|
||||
fn reopen_and_seek() {
|
||||
setup();
|
||||
let tmp = NamedTempFile::new().unwrap();
|
||||
let sks = make_sks(20);
|
||||
|
||||
{
|
||||
let mut w = SKFileWriter::create(tmp.path(), TEST_K).unwrap();
|
||||
let mut w = SKFileWriter::create(tmp.path()).unwrap();
|
||||
w.write_batch(&sks).unwrap();
|
||||
}
|
||||
|
||||
let mut r = SKFileReader::open(tmp.path(), TEST_K).unwrap();
|
||||
let mut r = SKFileReader::open(tmp.path()).unwrap();
|
||||
// Read 10, then simulate pool eviction + re-access
|
||||
let first = r.read_batch(10).unwrap();
|
||||
r.close();
|
||||
|
||||
Reference in new issue
Block a user