refactor: centralize k-mer config and introduce packed sequences

Centralize k-mer and minimizer configuration using a thread-safe global module, and replace manual bit-packing with a memory-efficient `PackedSeq` type. Refactor core sequence and k-mer types to use compile-time length enforcement and centralized hashing. Introduce a new De Bruijn graph implementation with compact node encoding and traversal iterators. Update I/O, partitioning, and builder modules to align with the new architecture, and add the `xxhash-rust` dependency.
This commit is contained in:
Eric Coissac
2026-05-05 18:08:19 +02:00
parent 602f414957
commit 8c17bf958b
37 changed files with 2641 additions and 2456 deletions
+3
View File
@@ -2,6 +2,9 @@
Tu es ma base de connaissance et mon bloc-notes intelligent sur le projet **obikmer**. Tu ne proposes pas, tu ne codes pas spontanément — tu réponds à mes questions et tu structures mes idées au fur et à mesure que je les exprime. Tu es ma base de connaissance et mon bloc-notes intelligent sur le projet **obikmer**. Tu ne proposes pas, tu ne codes pas spontanément — tu réponds à mes questions et tu structures mes idées au fur et à mesure que je les exprime.
**Règle absolue : une question appelle une réponse, pas une action.**
Ne modifier aucun fichier à moins d'une demande explicite de modification. En particulier : observer un bug ou une incohérence dans le code montré ne constitue pas un mandat pour le corriger. Le code montré peut refléter une intention en cours — modifier sans mandat risque d'introduire un vrai bug là où tu croyais corriger.
Tu maintiens en **anglais**, dense et sans remplissage, les documents suivants : Tu maintiens en **anglais**, dense et sans remplissage, les documents suivants :
- `docmd/index.md` — document de discussion de base, enrichi progressivement au fil de nos échanges ; il reflète l'état courant de la réflexion sur le projet - `docmd/index.md` — document de discussion de base, enrichi progressivement au fil de nos échanges ; il reflète l'état courant de la réflexion sur le projet
- les autres fichiers Markdown dans `docmd/` selon leur thème respectif - les autres fichiers Markdown dans `docmd/` selon leur thème respectif
+1
View File
@@ -1575,6 +1575,7 @@ dependencies = [
"hashbrown 0.14.5", "hashbrown 0.14.5",
"obifastwrite", "obifastwrite",
"obikseq", "obikseq",
"xxhash-rust",
] ]
[[package]] [[package]]
+4
View File
@@ -8,3 +8,7 @@ obikseq = { path = "../obikseq" }
obifastwrite = { path = "../obifastwrite" } obifastwrite = { path = "../obifastwrite" }
ahash = "0.8" ahash = "0.8"
hashbrown = "0.14" hashbrown = "0.14"
xxhash-rust = { version = "0.8.15", features = ["xxh3", "const_xxh3"] }
[dev-dependencies]
obikseq = { path = "../obikseq", features = ["test-utils"] }
+573
View File
@@ -0,0 +1,573 @@
//use ahash::RandomState;
use hashbrown::HashMap;
use obifastwrite::write_unitig;
use obikseq::k;
use obikseq::unitig::Unitig;
use obikseq::{CanonicalKmer, Kmer, Sequence};
use std::cell::Cell;
use std::fmt;
use std::io;
use xxhash_rust::xxh3::Xxh3Builder;
// ── Types ─────────────────────────────────────────────────────────────────────
type FastHashMap<K, V> = HashMap<K, V, Xxh3Builder>;
// ── Node ──────────────────────────────────────────────────────────────────────
//
// bit layout (LSB first):
// bit 0 : can_extend_right — exactly one right canonical neighbour exists
// bit 1 : can_extend_left — exactly one left canonical neighbour exists
// bit 2 : visited
// bits 34 : right_nuc — index 03 (A/C/G/T) of that neighbour; valid iff bit 0 = 1
// bits 56 : left_nuc — index 03 (A/C/G/T) of that neighbour; valid iff bit 1 = 1
// bit 7 : reserved (0)
//
// "can_extend" = false covers both 0 neighbours and ≥2 neighbours; the only
// information needed for traversal is "exactly one".
#[repr(transparent)]
#[derive(Debug, Clone, Copy, Default)]
pub struct Node(u8);
impl Node {
/// Returns `true` if the node can be extended to the right.
///
/// A single right neighbour exists.
pub fn can_extend_right(self) -> bool {
self.0 & 0b0000_0001 != 0
}
/// Returns `true` if the node can be extended to the left.
///
/// A single left neighbour exists.
pub fn can_extend_left(self) -> bool {
self.0 & 0b0000_0010 != 0
}
/// Returns `true` if the node has been visited.
pub fn is_visited(self) -> bool {
self.0 & 0b0000_0100 != 0
}
/// Index of the unique right neighbour (0=A, 1=C, 2=G, 3=T).
/// Only meaningful when `can_extend_right()` is true.
pub fn right_nuc(self) -> u8 {
(self.0 >> 3) & 0b11
}
/// Index of the unique left neighbour (0=A, 1=C, 2=G, 3=T).
/// Only meaningful when `can_extend_left()` is true.
pub fn left_nuc(self) -> u8 {
(self.0 >> 5) & 0b11
}
/// Marks the node as visited.
pub fn set_visited(&mut self) {
if self.is_visited() {
unreachable!("from: is_visited -> The node has already been visited")
}
self.0 |= 0b0000_0100;
}
/// Number of left neighbours.
pub fn n_left_neighbours(self) -> u8 {
if self.can_extend_left() {
1
} else {
let v = (self.0 >> 5) & 0b11;
v + (v != 0) as u8
}
}
/// Number of right neighbours.
pub fn n_right_neighbours(self) -> u8 {
if self.can_extend_right() {
1
} else {
let v = (self.0 >> 3) & 0b11;
v + (v != 0) as u8
}
}
/// `nuc` = Some(i) → exactly one neighbour (bit 0 set, bits 34 = nucleotide index).
/// `nuc` = None → 0 or ≥2 neighbours; `count` encoded in bits 34 as count.sat_sub(1).
pub fn set_right(&mut self, count: u8, nuc: Option<u8>) {
self.0 &= !(0b0000_0001 | 0b001_1000);
if count == 1 {
self.0 |= 0b0000_0001;
if let Some(n) = nuc {
self.0 |= (n & 0b11) << 3;
return;
}
unreachable!("nuc must be Some when count is 1");
}
self.0 |= (count.saturating_sub(1).min(3)) << 3;
}
/// `nuc` = Some(i) → exactly one neighbour (bit 0 set, bits 34 = nucleotide index).
/// `nuc` = None → 0 or ≥2 neighbours; `count` encoded in bits 34 as count.sat_sub(1).
pub fn set_left(&mut self, count: u8, nuc: Option<u8>) {
self.0 &= !(0b0000_0010 | 0b0110_0000);
if count == 1 {
self.0 |= 0b0000_0010;
if let Some(n) = nuc {
self.0 |= (n & 0b11) << 5;
return;
}
unreachable!("nuc must be Some when count is 1");
}
self.0 |= (count.saturating_sub(1).min(3)) << 5;
}
}
impl fmt::Display for Node {
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
const NUC: [char; 4] = ['A', 'C', 'G', 'T'];
let r = if self.can_extend_right() {
format!("{}", NUC[self.right_nuc() as usize])
} else {
format!("{}", self.n_right_neighbours())
};
let l = if self.can_extend_left() {
format!("{}", NUC[self.left_nuc() as usize])
} else {
format!("{}", self.n_left_neighbours())
};
let v = if self.is_visited() { "V" } else { "." };
write!(f, "Node({r} {l} {v})")
}
}
// ── GraphDeBruijn ─────────────────────────────────────────────────────────────
pub struct GraphDeBruijn {
nodes: FastHashMap<CanonicalKmer, Cell<Node>>,
}
impl GraphDeBruijn {
pub fn new() -> Self {
Self {
nodes: FastHashMap::with_hasher(Xxh3Builder::new()),
}
}
pub fn with_capacity(capacity: usize) -> Self {
Self {
nodes: FastHashMap::with_capacity_and_hasher(capacity, Xxh3Builder::new()),
}
}
/// Insert a canonical kmer into the graph. No-op if already present.
pub fn push(&mut self, kmer: CanonicalKmer) {
self.nodes
.entry(kmer)
.or_insert_with(|| Cell::new(Node::default()));
}
/// For every node, find its unique right/left canonical neighbour (if any)
/// and store the nucleotide index in the Node flags.
///
/// Single pass thanks to Cell interior mutability.
pub fn compute_degrees(&self) {
for (&kmer, cell) in &self.nodes {
let (rc, rn) = count_neighbors(kmer.right_canonical_neighbors(), &self.nodes);
let (lc, ln) = count_neighbors(kmer.left_canonical_neighbors(), &self.nodes);
let mut node = cell.get();
node.set_right(rc, rn);
node.set_left(lc, ln);
cell.set(node);
}
}
/// Iterates over the right neighbors of `kmer`.
pub fn iter_right_neighbors(
&self,
kmer: CanonicalKmer,
) -> impl Iterator<Item = CanonicalKmer> + '_ {
kmer.right_canonical_neighbors()
.into_iter()
.filter_map(|kmer| {
self.nodes.get(&kmer)?;
Some(kmer)
})
}
/// Iterates over the left neighbors of `kmer`.
pub fn iter_left_neighbors(
&self,
kmer: CanonicalKmer,
) -> impl Iterator<Item = CanonicalKmer> + '_ {
kmer.left_canonical_neighbors()
.into_iter()
.filter_map(|kmer| {
self.nodes.get(&kmer)?;
Some(kmer)
})
}
pub fn is_visited(&self, kmer: &CanonicalKmer) -> Option<bool> {
self.nodes.get(kmer).map(|cell| cell.get().is_visited())
}
pub fn set_visited(&self, kmer: CanonicalKmer) {
if let Some(cell) = self.nodes.get(&kmer) {
let mut node = cell.get();
node.set_visited();
cell.set(node);
}
}
/// Returns the single right neighbor of `kmer`, if it exists.
pub fn the_single_right_neighbor(&self, kmer: CanonicalKmer) -> Option<CanonicalKmer> {
let node = self.nodes.get(&kmer)?.get();
if !node.can_extend_right() {
return None;
}
let next = kmer.into_kmer().push_right(node.right_nuc()).canonical();
self.nodes.contains_key(&next).then_some(next)
}
/// Returns the single left neighbor of `kmer`, if it exists.
pub fn the_single_left_neighbor(&self, kmer: CanonicalKmer) -> Option<CanonicalKmer> {
let node = self.nodes.get(&kmer)?.get();
if !node.can_extend_left() {
return None;
}
let next = kmer.into_kmer().push_left(node.left_nuc()).canonical();
self.nodes.contains_key(&next).then_some(next)
}
/// Internal iterator over unitig-start nodes; drives `iter_unitig`.
///
/// MUST NOT be consumed standalone: the second pass finds cycle nodes only
/// because `iter_unitig` lazily interleaves chain traversal between the two passes.
///
/// Two passes:
/// 1. Chain ends / isolated nodes (at most one extension missing):
/// - `!can_extend_left` → yield canonical form
/// - `!can_extend_right` → yield reverse complement
/// 2. Nodes still unvisited → part of a cycle; yield canonical form.
fn start_iter(&self) -> impl Iterator<Item = (CanonicalKmer, Option<Kmer>)> + '_ {
StartIter::new(self)
}
fn next_unitig_kmer(&self, kmer: Kmer) -> Option<Kmer> {
let canonical = kmer.canonical();
let node = self.nodes.get(&canonical)?.get();
let direct = kmer.raw() == canonical.raw();
if (direct && !node.can_extend_right()) || (!direct && !node.can_extend_left()) {
return None;
}
let next_c: CanonicalKmer = if direct {
canonical
.into_kmer()
.push_right(node.right_nuc())
.canonical()
} else {
canonical.into_kmer().push_left(node.left_nuc()).canonical()
};
let cell = self.nodes.get(&next_c)?;
let next_node = cell.get();
if next_node.is_visited() {
return None;
}
let oriented = oriented_next(kmer, next_c);
let ndirect = oriented.raw() == next_c.raw();
if (ndirect && next_node.n_right_neighbours() > 1)
|| (!ndirect && next_node.n_left_neighbours() > 1)
{
return None;
}
let mut updated = next_node;
updated.set_visited();
cell.set(updated);
Some(oriented)
}
fn next_longtig_kmer(&self, kmer: Kmer) -> Option<Kmer> {
let canonical = kmer.canonical();
let node = self.nodes.get(&canonical)?.get();
let direct = kmer.raw() == canonical.raw();
if (direct && node.n_right_neighbours() == 0) || (!direct && node.n_left_neighbours() == 0)
{
return None;
}
let next_c: CanonicalKmer = if direct {
if node.can_extend_right() {
canonical
.into_kmer()
.push_right(node.right_nuc())
.canonical()
} else {
self.iter_right_neighbors(canonical)
.filter(|n| !self.is_visited(n).unwrap_or(true))
.next()?
}
} else {
if node.can_extend_left() {
canonical.into_kmer().push_left(node.left_nuc()).canonical()
} else {
self.iter_left_neighbors(canonical)
.filter(|n| !self.is_visited(n).unwrap_or(true))
.next()?
}
};
let cell = self.nodes.get(&next_c)?;
let next_node = cell.get();
if next_node.is_visited() {
return None;
}
let oriented = oriented_next(kmer, next_c);
let ndirect = oriented.raw() == next_c.raw();
if (ndirect && next_node.n_right_neighbours() > 1)
|| (!ndirect && next_node.n_left_neighbours() > 1)
{
return None;
}
let mut updated = next_node;
updated.set_visited();
cell.set(updated);
Some(oriented)
}
fn iter_unitig_kmers(&self, start: Kmer) -> UnitigIter<'_> {
UnitigIter {
graph: self,
current: Some(start),
}
}
fn iter_longtig_kmers(&self, start: Kmer) -> LongtigIter<'_> {
LongtigIter {
graph: self,
current: Some(start),
}
}
pub fn iter_unitig(&self) -> impl Iterator<Item = Unitig> + '_ {
let k = k();
self.start_iter().map(move |(start, first_next)| {
let mut nucs: Vec<u8> = (0..k).map(|i| start.nucleotide(i)).collect();
if let Some(next_c) = first_next {
for kmer in self.iter_unitig_kmers(next_c) {
nucs.push(kmer.nucleotide(k - 1));
}
}
Unitig::from_nucleotides(&nucs)
})
}
pub fn iter_longtig(&self) -> impl Iterator<Item = Unitig> + '_ {
let k = k();
self.start_iter().map(move |(start, first_next)| {
let mut nucs: Vec<u8> = (0..k).map(|i| start.nucleotide(i)).collect();
if let Some(next_c) = first_next {
for kmer in self.iter_longtig_kmers(next_c) {
nucs.push(kmer.nucleotide(k - 1));
}
}
Unitig::from_nucleotides(&nucs)
})
}
/// Write all unitigs to `out` in FASTA format.
///
/// Calls [`obifastwrite::write_unitig`] for each unitig produced by
/// [`iter_unitig`]. Stops and returns the first I/O error encountered.
pub fn write_fasta<W: io::Write>(&self, out: &mut W, unitig: bool) -> io::Result<()> {
if unitig {
for unitig in self.iter_unitig() {
write_unitig(&unitig, k(), out)?;
}
} else {
for unitig in self.iter_longtig() {
write_unitig(&unitig, k(), out)?;
}
}
Ok(())
}
pub fn len(&self) -> usize {
self.nodes.len()
}
pub fn is_empty(&self) -> bool {
self.nodes.is_empty()
}
}
// --- StartIter -----------------------------------------------------------------
struct StartIter<'a> {
graph: &'a GraphDeBruijn,
nodes: hashbrown::hash_map::Iter<'a, CanonicalKmer, Cell<Node>>,
suspended: Vec<CanonicalKmer>,
in_cycle_pass: bool,
}
impl<'a> StartIter<'a> {
fn new(graph: &'a GraphDeBruijn) -> Self {
Self {
graph,
nodes: graph.nodes.iter(),
suspended: Vec::new(),
in_cycle_pass: false,
}
}
}
impl<'a> Iterator for StartIter<'a> {
type Item = (CanonicalKmer, Option<Kmer>);
fn next(&mut self) -> Option<(CanonicalKmer, Option<Kmer>)> {
loop {
let current = if let Some(k) = self.suspended.pop() {
k
} else {
match self.nodes.next() {
Some((&k, _)) => k,
None => {
if self.in_cycle_pass {
return None;
}
self.in_cycle_pass = true;
self.nodes = self.graph.nodes.iter();
match self.nodes.next() {
Some((&k, _)) => k,
None => return None,
}
}
}
};
let node = match self.graph.nodes.get(&current) {
Some(c) => c.get(),
None => continue,
};
if node.is_visited() {
continue;
}
if !self.in_cycle_pass && node.can_extend_left() {
continue;
}
self.graph.set_visited(current);
if let Some(next) = self.graph.the_single_right_neighbor(current) {
if self.graph.is_visited(&next).unwrap_or(true) {
return Some((current, None));
}
self.graph.set_visited(next);
let oriented = oriented_next(current.into_kmer(), next);
return Some((current, Some(oriented)));
}
let mut first_neighbor: Option<CanonicalKmer> = None;
for neighbor in self.graph.iter_right_neighbors(current) {
if self.graph.is_visited(&neighbor).unwrap_or(true) {
continue;
}
if first_neighbor.is_none() {
self.graph.set_visited(neighbor);
first_neighbor = Some(neighbor);
} else {
self.suspended.push(neighbor);
}
}
let oriented = match first_neighbor {
Some(neighbor) => Some(oriented_next(current.into_kmer(), neighbor)),
None => None,
};
return Some((current, oriented));
}
}
}
// ── UnitigIter ────────────────────────────────────────────────────────────────
struct UnitigIter<'a> {
graph: &'a GraphDeBruijn,
current: Option<Kmer>,
}
impl Iterator for UnitigIter<'_> {
type Item = Kmer;
fn next(&mut self) -> Option<Kmer> {
let current = self.current?;
self.current = self.graph.next_unitig_kmer(current);
Some(current)
}
}
// ── UnitigIter ────────────────────────────────────────────────────────────────
struct LongtigIter<'a> {
graph: &'a GraphDeBruijn,
current: Option<Kmer>,
}
impl Iterator for LongtigIter<'_> {
type Item = Kmer;
fn next(&mut self) -> Option<Kmer> {
let current = self.current?;
self.current = self.graph.next_longtig_kmer(current);
Some(current)
}
}
// ── helpers ───────────────────────────────────────────────────────────────────
fn oriented_next(from: Kmer, to: CanonicalKmer) -> Kmer {
if from.is_overlapping(to.into_kmer()) {
to.into_kmer()
} else {
to.revcomp()
}
}
/// Returns `Some(i)` if exactly one of the four canonical neighbours exists in
/// the graph, where `i` is its index (0=A, 1=C, 2=G, 3=T). Returns `None` for
/// zero or ≥2 existing neighbours.
fn count_neighbors(
neighbors: [CanonicalKmer; 4],
nodes: &FastHashMap<CanonicalKmer, Cell<Node>>,
) -> (u8, Option<u8>) {
let mut count = 0u8;
let mut first = None;
for (i, neighbour) in neighbors.iter().enumerate() {
if nodes.contains_key(neighbour) {
count += 1;
if first.is_none() {
first = Some(i as u8);
}
}
}
if count == 1 {
(1, first)
} else {
(count, None)
}
}
// ── tests ─────────────────────────────────────────────────────────────────────
#[cfg(test)]
#[path = "tests/debruijn.rs"]
mod tests;
+2 -889
View File
@@ -1,890 +1,3 @@
use ahash::RandomState; mod debruijn;
use hashbrown::HashMap;
use obifastwrite::write_unitig;
use obikseq::kmer::{self, CanonicalKmer, Kmer};
use obikseq::unitig::Unitig;
use std::cell::Cell;
use std::fmt;
use std::io;
// ── Types ───────────────────────────────────────────────────────────────────── pub use debruijn::GraphDeBruijn;
type FastHashMap<K, V> = HashMap<K, V, RandomState>;
// ── Node ──────────────────────────────────────────────────────────────────────
//
// bit layout (LSB first):
// bit 0 : can_extend_right — exactly one right canonical neighbour exists
// bit 1 : can_extend_left — exactly one left canonical neighbour exists
// bit 2 : visited
// bits 34 : right_nuc — index 03 (A/C/G/T) of that neighbour; valid iff bit 0 = 1
// bits 56 : left_nuc — index 03 (A/C/G/T) of that neighbour; valid iff bit 1 = 1
// bit 7 : reserved (0)
//
// "can_extend" = false covers both 0 neighbours and ≥2 neighbours; the only
// information needed for traversal is "exactly one".
#[repr(transparent)]
#[derive(Debug, Clone, Copy, Default)]
pub struct Node(u8);
impl Node {
/// Returns `true` if the node can be extended to the right.
///
/// A single right neighbour exists.
pub fn can_extend_right(self) -> bool {
self.0 & 0b0000_0001 != 0
}
/// Returns `true` if the node can be extended to the left.
///
/// A single left neighbour exists.
pub fn can_extend_left(self) -> bool {
self.0 & 0b0000_0010 != 0
}
/// Returns `true` if the node has been visited.
pub fn is_visited(self) -> bool {
self.0 & 0b0000_0100 != 0
}
/// Index of the unique right neighbour (0=A, 1=C, 2=G, 3=T).
/// Only meaningful when `can_extend_right()` is true.
pub fn right_nuc(self) -> u8 {
(self.0 >> 3) & 0b11
}
/// Index of the unique left neighbour (0=A, 1=C, 2=G, 3=T).
/// Only meaningful when `can_extend_left()` is true.
pub fn left_nuc(self) -> u8 {
(self.0 >> 5) & 0b11
}
/// Marks the node as visited.
pub fn set_visited(&mut self) {
if self.is_visited() {
unreachable!("from: is_visited -> The node has already been visited")
}
self.0 |= 0b0000_0100;
}
/// Number of left neighbours.
pub fn n_left_neighbours(self) -> u8 {
if self.can_extend_left() {
1
} else {
let v = (self.0 >> 5) & 0b11;
v + (v != 0) as u8
}
}
/// Number of right neighbours.
pub fn n_right_neighbours(self) -> u8 {
if self.can_extend_right() {
1
} else {
let v = (self.0 >> 3) & 0b11;
v + (v != 0) as u8
}
}
/// `nuc` = Some(i) → exactly one neighbour (bit 0 set, bits 34 = nucleotide index).
/// `nuc` = None → 0 or ≥2 neighbours; `count` encoded in bits 34 as count.sat_sub(1).
pub fn set_right(&mut self, count: u8, nuc: Option<u8>) {
self.0 &= !(0b0000_0001 | 0b001_1000);
if count == 1 {
self.0 |= 0b0000_0001;
if let Some(n) = nuc {
self.0 |= (n & 0b11) << 3;
return;
}
unreachable!("nuc must be Some when count is 1");
}
self.0 |= (count.saturating_sub(1).min(3)) << 3;
}
/// `nuc` = Some(i) → exactly one neighbour (bit 0 set, bits 34 = nucleotide index).
/// `nuc` = None → 0 or ≥2 neighbours; `count` encoded in bits 34 as count.sat_sub(1).
pub fn set_left(&mut self, count: u8, nuc: Option<u8>) {
self.0 &= !(0b0000_0010 | 0b0110_0000);
if count == 1 {
self.0 |= 0b0000_0010;
if let Some(n) = nuc {
self.0 |= (n & 0b11) << 5;
return;
}
unreachable!("nuc must be Some when count is 1");
}
self.0 |= (count.saturating_sub(1).min(3)) << 5;
}
}
impl fmt::Display for Node {
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
const NUC: [char; 4] = ['A', 'C', 'G', 'T'];
let r = if self.can_extend_right() {
format!("{}", NUC[self.right_nuc() as usize])
} else {
format!("{}", self.n_right_neighbours())
};
let l = if self.can_extend_left() {
format!("{}", NUC[self.left_nuc() as usize])
} else {
format!("{}", self.n_left_neighbours())
};
let v = if self.is_visited() { "V" } else { "." };
write!(f, "Node({r} {l} {v})")
}
}
// ── GraphDeBruijn ─────────────────────────────────────────────────────────────
pub struct GraphDeBruijn {
nodes: FastHashMap<CanonicalKmer, Cell<Node>>,
k: usize,
}
impl GraphDeBruijn {
pub fn new(k: usize) -> Self {
Self {
nodes: FastHashMap::with_hasher(RandomState::new()),
k,
}
}
pub fn with_capacity(k: usize, capacity: usize) -> Self {
Self {
nodes: FastHashMap::with_capacity_and_hasher(capacity, RandomState::new()),
k,
}
}
/// Insert a canonical kmer into the graph. No-op if already present.
pub fn push(&mut self, kmer: CanonicalKmer) {
self.nodes
.entry(kmer)
.or_insert_with(|| Cell::new(Node::default()));
}
/// For every node, find its unique right/left canonical neighbour (if any)
/// and store the nucleotide index in the Node flags.
///
/// Single pass thanks to Cell interior mutability.
pub fn compute_degrees(&self) {
for (&kmer, cell) in &self.nodes {
let (rc, rn) = count_neighbors(kmer.right_canonical_neighbors(self.k), &self.nodes);
let (lc, ln) = count_neighbors(kmer.left_canonical_neighbors(self.k), &self.nodes);
let mut node = cell.get();
node.set_right(rc, rn);
node.set_left(lc, ln);
cell.set(node);
}
}
/// Iterates over the right neighbors of `kmer`.
pub fn iter_right_neighbors(
&self,
kmer: CanonicalKmer,
) -> impl Iterator<Item = CanonicalKmer> + '_ {
kmer.right_canonical_neighbors(self.k)
.into_iter()
.filter_map(|kmer| {
self.nodes.get(&kmer)?;
Some(kmer)
})
}
/// Iterates over the left neighbors of `kmer`.
pub fn iter_left_neighbors(
&self,
kmer: CanonicalKmer,
) -> impl Iterator<Item = CanonicalKmer> + '_ {
kmer.left_canonical_neighbors(self.k)
.into_iter()
.filter_map(|kmer| {
self.nodes.get(&kmer)?;
Some(kmer)
})
}
pub fn is_visited(&self, kmer: &CanonicalKmer) -> Option<bool> {
self.nodes.get(kmer).map(|cell| cell.get().is_visited())
}
pub fn set_visited(&self, kmer: CanonicalKmer) {
if let Some(cell) = self.nodes.get(&kmer) {
let mut node = cell.get();
node.set_visited();
cell.set(node);
}
}
/// Returns the single right neighbor of `kmer`, if it exists.
pub fn the_single_right_neighbor(&self, kmer: CanonicalKmer) -> Option<CanonicalKmer> {
let node = self.nodes.get(&kmer)?.get();
if !node.can_extend_right() {
return None;
}
let next = kmer
.into_kmer()
.push_right(node.right_nuc(), self.k)
.canonical(self.k);
self.nodes.contains_key(&next).then_some(next)
}
/// Returns the single left neighbor of `kmer`, if it exists.
pub fn the_single_left_neighbor(&self, kmer: CanonicalKmer) -> Option<CanonicalKmer> {
let node = self.nodes.get(&kmer)?.get();
if !node.can_extend_left() {
return None;
}
let next = kmer
.into_kmer()
.push_left(node.left_nuc(), self.k)
.canonical(self.k);
self.nodes.contains_key(&next).then_some(next)
}
/// Internal iterator over unitig-start nodes; drives `iter_unitig`.
///
/// MUST NOT be consumed standalone: the second pass finds cycle nodes only
/// because `iter_unitig` lazily interleaves chain traversal between the two passes.
///
/// Two passes:
/// 1. Chain ends / isolated nodes (at most one extension missing):
/// - `!can_extend_left` → yield canonical form
/// - `!can_extend_right` → yield reverse complement
/// 2. Nodes still unvisited → part of a cycle; yield canonical form.
fn start_iter(&self) -> impl Iterator<Item = (CanonicalKmer, Option<Kmer>)> + '_ {
StartIter::new(self)
}
fn next_unitig_kmer(&self, kmer: Kmer) -> Option<Kmer> {
let canonical = kmer.canonical(self.k);
let node = self.nodes.get(&canonical)?.get();
let direct = kmer.raw() == canonical.raw();
if (direct && !node.can_extend_right()) || (!direct && !node.can_extend_left()) {
return None;
}
let next_c: CanonicalKmer = if direct {
canonical
.into_kmer()
.push_right(node.right_nuc(), self.k)
.canonical(self.k)
} else {
canonical
.into_kmer()
.push_left(node.left_nuc(), self.k)
.canonical(self.k)
};
let cell = self.nodes.get(&next_c)?;
let next_node = cell.get();
if next_node.is_visited() {
return None;
}
let oriented = oriented_next(kmer, next_c, self.k);
let ndirect = oriented.raw() == next_c.raw();
if (ndirect && next_node.n_right_neighbours() > 1)
|| (!ndirect && next_node.n_left_neighbours() > 1)
{
return None;
}
let mut updated = next_node;
updated.set_visited();
cell.set(updated);
Some(oriented)
}
fn next_longtig_kmer(&self, kmer: Kmer) -> Option<Kmer> {
let k = self.k;
let canonical = kmer.canonical(k);
let node = self.nodes.get(&canonical)?.get();
let direct = kmer.raw() == canonical.raw();
if (direct && node.n_right_neighbours() == 0) || (!direct && node.n_left_neighbours() == 0)
{
return None;
}
let next_c: CanonicalKmer = if direct {
if node.can_extend_right() {
canonical
.into_kmer()
.push_right(node.right_nuc(), k)
.canonical(k)
} else {
self.iter_right_neighbors(canonical)
.filter(|n| !self.is_visited(n).unwrap_or(true))
.next()?
}
} else {
if node.can_extend_left() {
canonical
.into_kmer()
.push_left(node.left_nuc(), k)
.canonical(k)
} else {
self.iter_left_neighbors(canonical)
.filter(|n| !self.is_visited(n).unwrap_or(true))
.next()?
}
};
let cell = self.nodes.get(&next_c)?;
let next_node = cell.get();
if next_node.is_visited() {
return None;
}
let oriented = oriented_next(kmer, next_c, self.k);
let ndirect = oriented.raw() == next_c.raw();
if (ndirect && next_node.n_right_neighbours() > 1)
|| (!ndirect && next_node.n_left_neighbours() > 1)
{
return None;
}
let mut updated = next_node;
updated.set_visited();
cell.set(updated);
Some(oriented)
}
fn iter_unitig_kmers(&self, start: Kmer) -> UnitigIter<'_> {
UnitigIter {
graph: self,
current: Some(start),
}
}
fn iter_longtig_kmers(&self, start: Kmer) -> LongtigIter<'_> {
LongtigIter {
graph: self,
current: Some(start),
}
}
pub fn iter_unitig(&self) -> impl Iterator<Item = Unitig> + '_ {
let k = self.k;
self.start_iter().map(move |(start, first_next)| {
let mut nucs: Vec<u8> = (0..k).map(|i| start.nucleotide(i)).collect();
if let Some(next_c) = first_next {
for kmer in self.iter_unitig_kmers(next_c) {
nucs.push(kmer.nucleotide(k - 1));
}
}
Unitig::from_nucleotides(&nucs)
})
}
pub fn iter_longtig(&self) -> impl Iterator<Item = Unitig> + '_ {
let k = self.k;
self.start_iter().map(move |(start, first_next)| {
let mut nucs: Vec<u8> = (0..k).map(|i| start.nucleotide(i)).collect();
if let Some(next_c) = first_next {
for kmer in self.iter_longtig_kmers(next_c) {
nucs.push(kmer.nucleotide(k - 1));
}
}
Unitig::from_nucleotides(&nucs)
})
}
/// Write all unitigs to `out` in FASTA format.
///
/// Calls [`obifastwrite::write_unitig`] for each unitig produced by
/// [`iter_unitig`]. Stops and returns the first I/O error encountered.
pub fn write_fasta<W: io::Write>(&self, out: &mut W, unitig: bool) -> io::Result<()> {
if unitig {
for unitig in self.iter_unitig() {
write_unitig(&unitig, self.k, out)?;
}
} else {
for unitig in self.iter_longtig() {
write_unitig(&unitig, self.k, out)?;
}
}
Ok(())
}
pub fn len(&self) -> usize {
self.nodes.len()
}
pub fn is_empty(&self) -> bool {
self.nodes.is_empty()
}
}
// --- StartIter -----------------------------------------------------------------
struct StartIter<'a> {
graph: &'a GraphDeBruijn,
nodes: hashbrown::hash_map::Iter<'a, CanonicalKmer, Cell<Node>>,
suspended: Vec<CanonicalKmer>,
in_cycle_pass: bool,
}
impl<'a> StartIter<'a> {
fn new(graph: &'a GraphDeBruijn) -> Self {
Self {
graph,
nodes: graph.nodes.iter(),
suspended: Vec::new(),
in_cycle_pass: false,
}
}
}
impl<'a> Iterator for StartIter<'a> {
type Item = (CanonicalKmer, Option<Kmer>);
fn next(&mut self) -> Option<(CanonicalKmer, Option<Kmer>)> {
loop {
let current = if let Some(k) = self.suspended.pop() {
k
} else {
match self.nodes.next() {
Some((&k, _)) => k,
None => {
if self.in_cycle_pass {
return None;
}
self.in_cycle_pass = true;
self.nodes = self.graph.nodes.iter();
match self.nodes.next() {
Some((&k, _)) => k,
None => return None,
}
}
}
};
let node = match self.graph.nodes.get(&current) {
Some(c) => c.get(),
None => continue,
};
if node.is_visited() {
continue;
}
if !self.in_cycle_pass && node.can_extend_left() {
continue;
}
self.graph.set_visited(current);
if let Some(next) = self.graph.the_single_right_neighbor(current) {
if self.graph.is_visited(&next).unwrap_or(true) {
return Some((current, None));
}
self.graph.set_visited(next);
let oriented = oriented_next(current.into_kmer(), next, self.graph.k);
return Some((current, Some(oriented)));
}
let mut first_neighbor: Option<CanonicalKmer> = None;
for neighbor in self.graph.iter_right_neighbors(current) {
if self.graph.is_visited(&neighbor).unwrap_or(true) {
continue;
}
if first_neighbor.is_none() {
self.graph.set_visited(neighbor);
first_neighbor = Some(neighbor);
} else {
self.suspended.push(neighbor);
}
}
let oriented = match first_neighbor {
Some(neighbor) => Some(oriented_next(current.into_kmer(), neighbor, self.graph.k)),
None => None,
};
return Some((current, oriented));
}
}
}
// ── UnitigIter ────────────────────────────────────────────────────────────────
struct UnitigIter<'a> {
graph: &'a GraphDeBruijn,
current: Option<Kmer>,
}
impl Iterator for UnitigIter<'_> {
type Item = Kmer;
fn next(&mut self) -> Option<Kmer> {
let current = self.current?;
self.current = self.graph.next_unitig_kmer(current);
Some(current)
}
}
// ── UnitigIter ────────────────────────────────────────────────────────────────
struct LongtigIter<'a> {
graph: &'a GraphDeBruijn,
current: Option<Kmer>,
}
impl Iterator for LongtigIter<'_> {
type Item = Kmer;
fn next(&mut self) -> Option<Kmer> {
let current = self.current?;
self.current = self.graph.next_longtig_kmer(current);
Some(current)
}
}
// ── helpers ───────────────────────────────────────────────────────────────────
fn oriented_next(from: Kmer, to: CanonicalKmer, k: usize) -> Kmer {
if from.is_overlapping(to.into_kmer(), k) {
to.into_kmer()
} else {
to.revcomp(k)
}
}
/// Returns `Some(i)` if exactly one of the four canonical neighbours exists in
/// the graph, where `i` is its index (0=A, 1=C, 2=G, 3=T). Returns `None` for
/// zero or ≥2 existing neighbours.
fn count_neighbors(
neighbors: [CanonicalKmer; 4],
nodes: &FastHashMap<CanonicalKmer, Cell<Node>>,
) -> (u8, Option<u8>) {
let mut count = 0u8;
let mut first = None;
for (i, neighbour) in neighbors.iter().enumerate() {
if nodes.contains_key(neighbour) {
count += 1;
if first.is_none() {
first = Some(i as u8);
}
}
}
if count == 1 {
(1, first)
} else {
(count, None)
}
}
// ── tests ─────────────────────────────────────────────────────────────────────
#[cfg(test)]
mod tests {
use super::*;
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
fn graph_from_ascii(seq: &[u8], k: usize) -> GraphDeBruijn {
let mut g = GraphDeBruijn::new(k);
for i in 0..=seq.len().saturating_sub(k) {
g.push(Kmer::from_ascii(&seq[i..i + k], k).unwrap().canonical(k));
}
g
}
// Collect all canonical k-mers from an ASCII sequence into a sorted vec.
fn canonical_kmers(seq: &[u8], k: usize) -> Vec<CanonicalKmer> {
let mut v: Vec<CanonicalKmer> = (0..=seq.len().saturating_sub(k))
.map(|i| Kmer::from_ascii(&seq[i..i + k], k).unwrap().canonical(k))
.collect();
v.sort_unstable();
v.dedup();
v
}
// ── push / canonicalisation ───────────────────────────────────────────────
#[test]
fn push_deduplicates_revcomp() {
let k = 5;
let kmer = Kmer::from_ascii(b"ACGTA", k).unwrap();
let mut g = GraphDeBruijn::new(k);
g.push(kmer.canonical(k));
g.push(kmer.revcomp(k).canonical(k));
assert_eq!(g.len(), 1, "kmer and its revcomp must map to the same node");
}
#[test]
fn push_palindrome_single_node() {
// ACGT is its own revcomp
let k = 4;
let kmer = Kmer::from_ascii(b"ACGT", k).unwrap();
assert_eq!(kmer, kmer.revcomp(k), "test requires a palindrome");
let mut g = GraphDeBruijn::new(k);
g.push(kmer.canonical(k));
assert_eq!(g.len(), 1);
}
// ── compute_degrees on a linear chain ────────────────────────────────────
// AAAAGGGG with k=5 → 4 distinct k-mers (AAAAG, AAAGG, AAGGG, AGGGG),
// clean linear chain, no Watson-Crick palindrome in first k-1 bases.
fn linear_chain_graph(k: usize) -> (GraphDeBruijn, Vec<CanonicalKmer>) {
let seq = b"AAAAGGGG";
let g = graph_from_ascii(seq, k);
let kmers = canonical_kmers(seq, k);
(g, kmers)
}
#[test]
fn degrees_linear_chain_node_count() {
let k = 5;
let (g, kmers) = linear_chain_graph(k);
assert_eq!(g.len(), kmers.len());
}
#[test]
fn degrees_linear_chain_extensions() {
// A linear chain yields exactly 1 unitig covering all k-mers.
// Note: start_iter must not be consumed standalone — its second pass only
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
let k = 5;
let seq = b"AAAAGGGG";
let g = graph_from_ascii(seq, k);
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
assert_eq!(unitigs.len(), 1, "linear chain → exactly one unitig");
// seql = k + (n_kmers - 1) = 5 + 3 = 8 = seq.len()
assert_eq!(
unitigs[0].seql(),
seq.len(),
"unitig spans the full sequence"
);
assert_eq!(
kmers_from_unitigs(&unitigs, k),
canonical_kmers(seq, k),
"unitig k-mers must equal inserted k-mers"
);
}
// ── unitig reconstruction ─────────────────────────────────────────────────
// Round-trip: all canonical k-mers in the unitigs == all canonical k-mers inserted.
fn kmers_from_unitigs(unitigs: &[Unitig], k: usize) -> Vec<CanonicalKmer> {
let mut v: Vec<CanonicalKmer> = unitigs
.iter()
.flat_map(|u| u.iter_canonical_kmers(k))
.collect();
v.sort_unstable();
v.dedup();
v
}
#[test]
fn unitig_roundtrip_linear() {
// Non-repetitive sequence: no k-mer appears twice, no homopolymer run of length k.
// ACGTGGCTA with k=5 → 5 distinct k-mers forming a clean linear chain.
let k = 5;
let seq = b"ACCTGGCTA";
let g = graph_from_ascii(seq, k);
g.compute_degrees();
println!("Les kmers:");
for (kmer, v) in g.nodes.iter() {
println!(
"{}: {}",
String::from_utf8_lossy(&kmer.to_ascii(k)),
v.get()
);
}
// println!("Les starts:");
// for (start, first_next) in g.start_iter() {
// if let Some(next) = first_next {
// println!(
// "{}->{}",
// String::from_utf8_lossy(&start.to_ascii(k)),
// String::from_utf8_lossy(&next.to_ascii(k))
// )
// } else {
// println!("{}->None", String::from_utf8_lossy(&start.to_ascii(k)))
// }
// }
println!("Les unitig:");
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
for unitig in &unitigs {
println!("{}", String::from_utf8_lossy(&unitig.to_ascii()));
}
assert_eq!(
unitigs.len(),
1,
"linear chain → exactly one unitig {:?}",
unitigs
);
assert_eq!(
kmers_from_unitigs(&unitigs, k),
canonical_kmers(seq, k),
"unitig must contain exactly the inserted k-mers"
);
}
#[test]
fn unitig_roundtrip_longer_sequence() {
// Longer non-repetitive sequence with no repeated k-mer of length k.
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
let k = 5;
let seq = b"ACGTGGCTATCGAC";
let g = graph_from_ascii(seq, k);
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
let mut got = kmers_from_unitigs(&unitigs, k);
let mut expected = canonical_kmers(seq, k);
got.sort_unstable();
expected.sort_unstable();
assert_eq!(got, expected);
}
#[test]
fn unitig_isolated_node() {
// Single k-mer with no neighbours
let k = 5;
let kmer = Kmer::from_ascii(b"ACGTA", k).unwrap();
let mut g = GraphDeBruijn::new(k);
g.push(kmer.canonical(k));
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
assert_eq!(unitigs.len(), 1);
assert_eq!(unitigs[0].seql(), k);
}
#[test]
fn unitig_two_isolated_nodes() {
let k = 5;
let mut g = GraphDeBruijn::new(k);
// Two k-mers that share no (k-1)-overlap
g.push(Kmer::from_ascii(b"AAAAA", k).unwrap().canonical(k));
g.push(Kmer::from_ascii(b"TTTTT", k).unwrap().canonical(k)); // same canonical as AAAAA — dedup
// They collapse to one canonical node
assert_eq!(g.len(), 1);
}
#[test]
fn unitig_two_truly_distinct_isolated_nodes() {
let k = 5;
let mut g = GraphDeBruijn::new(k);
g.push(Kmer::from_ascii(b"AAAAC", k).unwrap().canonical(k));
g.push(Kmer::from_ascii(b"GGGGT", k).unwrap().canonical(k));
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
// Each isolated node → one unitig of length k
assert_eq!(unitigs.len(), 2);
assert!(unitigs.iter().all(|u| u.seql() == k));
}
// ── all k-mers covered, none duplicated ───────────────────────────────────
#[test]
fn no_kmer_lost_or_duplicated() {
let k = 7;
let seq = b"ACGTACGTACGTTTTTACGTACGT";
let g = graph_from_ascii(seq, k);
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
let got = kmers_from_unitigs(&unitigs, k);
let expected = canonical_kmers(seq, k);
assert_eq!(
got.len(),
expected.len(),
"kmer count mismatch: got {}, expected {}",
got.len(),
expected.len()
);
assert_eq!(got, expected, "kmer sets differ");
}
// ── cycle coverage ────────────────────────────────────────────────────────
#[test]
fn cycle_kmers_not_lost() {
// ACGTACGT with k=5 forms a pure cycle: ACGTA→CGTAC→GTACG→TACGT→ACGTA.
// start_iter first pass yields nothing (all nodes internal); second pass
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
let k = 5;
let seq = b"ACGTACGT";
let g = graph_from_ascii(seq, k);
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
let got = kmers_from_unitigs(&unitigs, k);
let expected = canonical_kmers(seq, k);
assert_eq!(got.len(), expected.len(), "cycle k-mers lost");
assert_eq!(got, expected);
}
// ── branching graph ───────────────────────────────────────────────────────
//
// Topology (k=5): two sources A,B converge at C; chain C-D-E-F;
// F branches to G and H; H continues H-M-N; second source J feeds I-F.
// Every k-mer must appear in exactly one unitig (no duplication, no loss).
#[test]
fn branching_graph_no_kmer_lost_or_duplicated() {
// Build sequences that realise the topology without accidental overlaps.
// Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
// We use long non-repetitive sequences and extract only the required kmers.
let k: usize = 5;
let mut g = GraphDeBruijn::new(k);
// Helper: insert all k-mers of a sequence.
let mut insert = |seq: &[u8]| {
for i in 0..=seq.len().saturating_sub(k) {
g.push(Kmer::from_ascii(&seq[i..i + k], k).unwrap().canonical(k));
}
};
// Chains that realise the topology:
// A-C (A→C share 4-mer overlap)
// B-C (B→C share 4-mer overlap, different prefix)
// C-D-E-F
// F-G (F→G)
// F-H-M-N (F→H→M→N)
// J-I-F (J→I→F)
insert(b"AACGTGGCTA"); // A-C-D … part of the right branch
insert(b"TACGTGGCTA"); // B-C-D … merges at C (same C-suffix)
insert(b"CGTGGCTACG"); // continues D-E-F-G
insert(b"CGTGGCTACC"); // F-H branch (different last base)
insert(b"GTGGCTACCGT"); // H-M-N continuation
insert(b"TTCGTGGCTA"); // J-I-F (different J prefix)
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
// Collect all k-mers from unitigs.
let got = kmers_from_unitigs(&unitigs, k);
// Collect all distinct canonical k-mers inserted.
let mut expected: Vec<CanonicalKmer> = Vec::new();
for seq in &[
b"AACGTGGCTA".as_slice(),
b"TACGTGGCTA",
b"CGTGGCTACG",
b"CGTGGCTACC",
b"GTGGCTACCGT",
b"TTCGTGGCTA",
] {
expected.extend(canonical_kmers(seq, k));
}
expected.sort_unstable();
expected.dedup();
assert_eq!(
got.len(),
expected.len(),
"k-mer count mismatch: got {}, expected {}",
got.len(),
expected.len()
);
assert_eq!(got, expected, "k-mer sets differ");
}
}
+301
View File
@@ -0,0 +1,301 @@
use super::*;
use obikseq::{k, set_k};
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn {
let mut g = GraphDeBruijn::new();
let k = k();
for i in 0..=seq.len().saturating_sub(k) {
g.push(Kmer::from_ascii(&seq[i..i + k]).unwrap().canonical());
}
g
}
// Collect all canonical k-mers from an ASCII sequence into a sorted vec.
fn canonical_kmers(seq: &[u8]) -> Vec<CanonicalKmer> {
let k = k();
let mut v: Vec<CanonicalKmer> = (0..=seq.len().saturating_sub(k))
.map(|i| Kmer::from_ascii(&seq[i..i + k]).unwrap().canonical())
.collect();
v.sort_unstable();
v.dedup();
v
}
// ── push / canonicalisation ───────────────────────────────────────────────
#[test]
fn push_deduplicates_revcomp() {
let k = 5;
set_k(k);
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
let mut g = GraphDeBruijn::new();
g.push(kmer.canonical());
g.push(kmer.revcomp().canonical());
assert_eq!(g.len(), 1, "kmer and its revcomp must map to the same node");
}
#[test]
fn push_palindrome_single_node() {
// ACGT is its own revcomp
let k = 4;
set_k(k);
let kmer = Kmer::from_ascii(b"ACGT").unwrap();
assert_eq!(kmer, kmer.revcomp(), "test requires a palindrome");
let mut g = GraphDeBruijn::new();
g.push(kmer.canonical());
assert_eq!(g.len(), 1);
}
// ── compute_degrees on a linear chain ────────────────────────────────────
// AAAAGGGG with k=5 → 4 distinct k-mers (AAAAG, AAAGG, AAGGG, AGGGG),
// clean linear chain, no Watson-Crick palindrome in first k-1 bases.
fn linear_chain_graph() -> (GraphDeBruijn, Vec<CanonicalKmer>) {
let seq = b"AAAAGGGG";
let g = graph_from_ascii(seq);
let kmers = canonical_kmers(seq);
(g, kmers)
}
#[test]
fn degrees_linear_chain_node_count() {
let k = 5;
set_k(k);
let (g, kmers) = linear_chain_graph();
assert_eq!(g.len(), kmers.len());
}
#[test]
fn degrees_linear_chain_extensions() {
// A linear chain yields exactly 1 unitig covering all k-mers.
// Note: start_iter must not be consumed standalone — its second pass only
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
let k = 5;
set_k(k);
let seq = b"AAAAGGGG";
let g = graph_from_ascii(seq);
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
assert_eq!(unitigs.len(), 1, "linear chain → exactly one unitig");
// seql = k + (n_kmers - 1) = 5 + 3 = 8 = seq.len()
assert_eq!(
unitigs[0].seql(),
seq.len(),
"unitig spans the full sequence"
);
assert_eq!(
kmers_from_unitigs(&unitigs),
canonical_kmers(seq),
"unitig k-mers must equal inserted k-mers"
);
}
// ── unitig reconstruction ─────────────────────────────────────────────────
// Round-trip: all canonical k-mers in the unitigs == all canonical k-mers inserted.
fn kmers_from_unitigs(unitigs: &[Unitig]) -> Vec<CanonicalKmer> {
let mut v: Vec<CanonicalKmer> = unitigs
.iter()
.flat_map(|u| u.iter_canonical_kmers())
.collect();
v.sort_unstable();
v.dedup();
v
}
#[test]
fn unitig_roundtrip_linear() {
// Non-repetitive sequence: no k-mer appears twice, no homopolymer run of length k.
// ACGTGGCTA with k=5 → 5 distinct k-mers forming a clean linear chain.
let k = 5;
set_k(k);
let seq = b"ACCTGGCTA";
let g = graph_from_ascii(seq);
g.compute_degrees();
println!("Les kmers:");
for (kmer, v) in g.nodes.iter() {
println!("{}: {}", String::from_utf8_lossy(&kmer.to_ascii()), v.get());
}
println!("Les unitig:");
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
for unitig in &unitigs {
println!("{}", String::from_utf8_lossy(&unitig.to_ascii()));
}
assert_eq!(
unitigs.len(),
1,
"linear chain → exactly one unitig {:?}",
unitigs
);
assert_eq!(
kmers_from_unitigs(&unitigs),
canonical_kmers(seq),
"unitig must contain exactly the inserted k-mers"
);
}
#[test]
fn unitig_roundtrip_longer_sequence() {
// Longer non-repetitive sequence with no repeated k-mer of length k.
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
let k = 5;
set_k(k);
let seq = b"ACGTGGCTATCGAC";
let g = graph_from_ascii(seq);
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
let mut got = kmers_from_unitigs(&unitigs);
let mut expected = canonical_kmers(seq);
got.sort_unstable();
expected.sort_unstable();
assert_eq!(got, expected);
}
#[test]
fn unitig_isolated_node() {
// Single k-mer with no neighbours
let k = 5;
set_k(k);
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
let mut g = GraphDeBruijn::new();
g.push(kmer.canonical());
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
assert_eq!(unitigs.len(), 1);
assert_eq!(unitigs[0].seql(), k);
}
#[test]
fn unitig_two_isolated_nodes() {
let k = 5;
set_k(k);
let mut g = GraphDeBruijn::new();
// Two k-mers that share no (k-1)-overlap
g.push(Kmer::from_ascii(b"AAAAA").unwrap().canonical());
g.push(Kmer::from_ascii(b"TTTTT").unwrap().canonical()); // same canonical as AAAAA — dedup
// They collapse to one canonical node
assert_eq!(g.len(), 1);
}
#[test]
fn unitig_two_truly_distinct_isolated_nodes() {
let k = 5;
set_k(k);
let mut g = GraphDeBruijn::new();
g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical());
g.push(Kmer::from_ascii(b"GGGGT").unwrap().canonical());
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
// Each isolated node → one unitig of length k
assert_eq!(unitigs.len(), 2);
assert!(unitigs.iter().all(|u| u.seql() == k));
}
// ── all k-mers covered, none duplicated ───────────────────────────────────
#[test]
fn no_kmer_lost_or_duplicated() {
let k = 7;
set_k(k);
let seq = b"ACGTACGTACGTTTTTACGTACGT";
let g = graph_from_ascii(seq);
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
let got = kmers_from_unitigs(&unitigs);
let expected = canonical_kmers(seq);
assert_eq!(
got.len(),
expected.len(),
"kmer count mismatch: got {}, expected {}",
got.len(),
expected.len()
);
assert_eq!(got, expected, "kmer sets differ");
}
// ── cycle coverage ────────────────────────────────────────────────────────
#[test]
fn cycle_kmers_not_lost() {
// ACGTACGT with k=5 forms a pure cycle: ACGTA→CGTAC→GTACG→TACGT→ACGTA.
// start_iter first pass yields nothing (all nodes internal); second pass
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
let k = 5;
set_k(k);
let seq = b"ACGTACGT";
let g = graph_from_ascii(seq);
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
let got = kmers_from_unitigs(&unitigs);
let expected = canonical_kmers(seq);
assert_eq!(got.len(), expected.len(), "cycle k-mers lost");
assert_eq!(got, expected);
}
// ── branching graph ───────────────────────────────────────────────────────
//
// Topology (k=5): two sources A,B converge at C; chain C-D-E-F;
// F branches to G and H; H continues H-M-N; second source J feeds I-F.
// Every k-mer must appear in exactly one unitig (no duplication, no loss).
#[test]
fn branching_graph_no_kmer_lost_or_duplicated() {
// Build sequences that realise the topology without accidental overlaps.
// Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
// We use long non-repetitive sequences and extract only the required kmers.
let k: usize = 5;
set_k(k);
let mut g = GraphDeBruijn::new();
// Helper: insert all k-mers of a sequence.
let mut insert = |seq: &[u8]| {
for i in 0..=seq.len().saturating_sub(k) {
g.push(Kmer::from_ascii(&seq[i..i + k]).unwrap().canonical());
}
};
// Chains that realise the topology:
// A-C (A→C share 4-mer overlap)
// B-C (B→C share 4-mer overlap, different prefix)
// C-D-E-F
// F-G (F→G)
// F-H-M-N (F→H→M→N)
// J-I-F (J→I→F)
insert(b"AACGTGGCTA"); // A-C-D … part of the right branch
insert(b"TACGTGGCTA"); // B-C-D … merges at C (same C-suffix)
insert(b"CGTGGCTACG"); // continues D-E-F-G
insert(b"CGTGGCTACC"); // F-H branch (different last base)
insert(b"GTGGCTACCGT"); // H-M-N continuation
insert(b"TTCGTGGCTA"); // J-I-F (different J prefix)
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
// Collect all k-mers from unitigs.
let got = kmers_from_unitigs(&unitigs);
// Collect all distinct canonical k-mers inserted.
let mut expected: Vec<CanonicalKmer> = Vec::new();
for seq in &[
b"AACGTGGCTA".as_slice(),
b"TACGTGGCTA",
b"CGTGGCTACG",
b"CGTGGCTACC",
b"GTGGCTACCGT",
b"TTCGTGGCTA",
] {
expected.extend(canonical_kmers(seq));
}
expected.sort_unstable();
expected.dedup();
assert_eq!(
got.len(),
expected.len(),
"k-mer count mismatch: got {}, expected {}",
got.len(),
expected.len()
);
assert_eq!(got, expected, "k-mer sets differ");
}
+3
View File
@@ -6,3 +6,6 @@ edition = "2024"
[dependencies] [dependencies]
obikseq = { path = "../obikseq" } obikseq = { path = "../obikseq" }
xxhash-rust = { version = "0.8", features = ["xxh64"] } xxhash-rust = { version = "0.8", features = ["xxh64"] }
[dev-dependencies]
obikseq = { path = "../obikseq", features = ["test-utils"] }
+17 -14
View File
@@ -34,7 +34,7 @@ mod fasta;
use std::io::{self, Write}; use std::io::{self, Write};
use obikseq::{kmer::CanonicalKmer, superkmer::SuperKmer, unitig::Unitig}; use obikseq::{Minimizer, SuperKmer, Unitig};
use xxhash_rust::xxh64::xxh64; use xxhash_rust::xxh64::xxh64;
// ── public API ──────────────────────────────────────────────────────────────── // ── public API ────────────────────────────────────────────────────────────────
@@ -57,12 +57,12 @@ pub fn write_scatter<W: Write>(
k: usize, k: usize,
m: usize, m: usize,
partition: usize, partition: usize,
minimizer: CanonicalKmer, minimizer: Minimizer,
) -> io::Result<()> { ) -> io::Result<()> {
let ascii = sk.to_ascii(); let ascii = sk.to_ascii();
let id = seq_id(&ascii); let id = seq_id(&ascii);
let seq_len = ascii.len(); let seq_len = ascii.len();
let min_seq = minimizer.to_ascii(m); let min_seq = minimizer.to_ascii();
writeln!( writeln!(
out, out,
@@ -154,7 +154,6 @@ fn seq_id(ascii: &[u8]) -> String {
#[cfg(test)] #[cfg(test)]
mod tests { mod tests {
use super::*; use super::*;
use obikseq::kmer::Kmer;
use obikseq::superkmer::SuperKmer; use obikseq::superkmer::SuperKmer;
fn make(seq: &[u8]) -> SuperKmer { fn make(seq: &[u8]) -> SuperKmer {
@@ -172,23 +171,27 @@ mod tests {
#[test] #[test]
fn scatter_header_contains_minimizer_field() { fn scatter_header_contains_minimizer_field() {
let sk = make(b"ACGTACGTACGT"); let sk = make(b"ACGTACGTACGT");
let out = capture(|w| write_scatter(&sk, w, 4, 3, 7, CanonicalKmer::from_raw_unchecked(0))); let out = capture(|w| write_scatter(&sk, w, 4, 3, 7, Minimizer::from_raw_unchecked(0)));
assert!(out.contains("\"minimizer\":\"")); assert!(out.contains("\"minimizer\":\""));
assert!(!out.contains("\"count\":")); assert!(!out.contains("\"count\":"));
} }
#[test] #[test]
fn scatter_minimizer_decoded_from_hash() { fn scatter_minimizer_decoded_from_hash() {
// min_hash for "ACG" (A=0,C=1,G=2, m=3): 0*16 + 1*4 + 2 = 6 // "ACG" right-aligned: A=00, C=01, G=10 → 0b000110 = 6
// Left-aligned for m=3: shift by 64 2·3 = 58.
// set_m(3) so that Minimizer::to_ascii() decodes exactly 3 bases.
obikseq::params::set_m(3);
let sk = make(b"ACGTACGTACGT"); let sk = make(b"ACGTACGTACGT");
let out = capture(|w| write_scatter(&sk, w, 4, 3, 0, CanonicalKmer::from_raw_unchecked(Kmer::from_raw_right(6, 3).raw()))); let minimizer = Minimizer::from_raw_unchecked(6u64 << (64 - 2 * 3));
let out = capture(|w| write_scatter(&sk, w, 4, 3, 0, minimizer));
assert!(out.contains("\"minimizer\":\"ACG\""), "got: {out}"); assert!(out.contains("\"minimizer\":\"ACG\""), "got: {out}");
} }
#[test] #[test]
fn scatter_fields_present() { fn scatter_fields_present() {
let sk = make(b"ACGTACGTACGT"); let sk = make(b"ACGTACGTACGT");
let out = capture(|w| write_scatter(&sk, w, 4, 3, 5, CanonicalKmer::from_raw_unchecked(0))); let out = capture(|w| write_scatter(&sk, w, 4, 3, 5, Minimizer::from_raw_unchecked(0)));
assert!(out.contains("\"seq_length\":12")); assert!(out.contains("\"seq_length\":12"));
assert!(out.contains("\"kmer_size\":4")); assert!(out.contains("\"kmer_size\":4"));
assert!(out.contains("\"minimizer_size\":3")); assert!(out.contains("\"minimizer_size\":3"));
@@ -198,7 +201,7 @@ mod tests {
#[test] #[test]
fn scatter_sequence_line_correct() { fn scatter_sequence_line_correct() {
let sk = make(b"ACGTACGT"); let sk = make(b"ACGTACGT");
let out = capture(|w| write_scatter(&sk, w, 4, 2, 0, CanonicalKmer::from_raw_unchecked(0))); let out = capture(|w| write_scatter(&sk, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)));
let lines: Vec<&str> = out.lines().collect(); let lines: Vec<&str> = out.lines().collect();
assert_eq!(lines[1], "ACGTACGT"); assert_eq!(lines[1], "ACGTACGT");
} }
@@ -241,7 +244,7 @@ mod tests {
let sk1 = make(b"ACGTACGT"); let sk1 = make(b"ACGTACGT");
let sk2 = make(b"ACGTACGT"); let sk2 = make(b"ACGTACGT");
let id1 = capture(|w| write_scatter(&sk1, w, 4, 2, 0, CanonicalKmer::from_raw_unchecked(0))) let id1 = capture(|w| write_scatter(&sk1, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)))
.lines() .lines()
.next() .next()
.unwrap() .unwrap()
@@ -249,7 +252,7 @@ mod tests {
.next() .next()
.unwrap()[1..] .unwrap()[1..]
.to_string(); .to_string();
let id2 = capture(|w| write_scatter(&sk2, w, 4, 2, 0, CanonicalKmer::from_raw_unchecked(0))) let id2 = capture(|w| write_scatter(&sk2, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)))
.lines() .lines()
.next() .next()
.unwrap() .unwrap()
@@ -265,7 +268,7 @@ mod tests {
let sk1 = make(b"ACGTACGT"); let sk1 = make(b"ACGTACGT");
let sk2 = make(b"TTTTTTTT"); let sk2 = make(b"TTTTTTTT");
let id1 = capture(|w| write_scatter(&sk1, w, 4, 2, 0, CanonicalKmer::from_raw_unchecked(0))) let id1 = capture(|w| write_scatter(&sk1, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)))
.lines() .lines()
.next() .next()
.unwrap() .unwrap()
@@ -273,7 +276,7 @@ mod tests {
.next() .next()
.unwrap()[1..] .unwrap()[1..]
.to_string(); .to_string();
let id2 = capture(|w| write_scatter(&sk2, w, 4, 2, 0, CanonicalKmer::from_raw_unchecked(0))) let id2 = capture(|w| write_scatter(&sk2, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)))
.lines() .lines()
.next() .next()
.unwrap() .unwrap()
@@ -287,7 +290,7 @@ mod tests {
#[test] #[test]
fn id_is_16_hex_digits() { fn id_is_16_hex_digits() {
let sk = make(b"ACGTACGT"); let sk = make(b"ACGTACGT");
let out = capture(|w| write_scatter(&sk, w, 4, 2, 0, CanonicalKmer::from_raw_unchecked(0))); let out = capture(|w| write_scatter(&sk, w, 4, 2, 0, Minimizer::from_raw_unchecked(0)));
let id = &out.lines().next().unwrap()[1..17]; // skip '>' let id = &out.lines().next().unwrap()[1..17]; // skip '>'
assert_eq!(id.len(), 16); assert_eq!(id.len(), 16);
assert!(id.chars().all(|c| c.is_ascii_hexdigit())); assert!(id.chars().all(|c| c.is_ascii_hexdigit()));
+1 -1
View File
@@ -64,7 +64,7 @@ fn dump_super_kmers(kp: &KmerPartition, partition_dir: &PathBuf) {
std::process::exit(1) std::process::exit(1)
}); });
let mut reader = SKFileReader::open(&in_path, k).unwrap_or_else(|e| { let mut reader = SKFileReader::open(&in_path).unwrap_or_else(|e| {
eprintln!("error opening {}: {e}", in_path.display()); eprintln!("error opening {}: {e}", in_path.display());
std::process::exit(1) std::process::exit(1)
}); });
+5 -3
View File
@@ -7,6 +7,7 @@ use niffler::Level;
use niffler::send::compression::Format; use niffler::send::compression::Format;
use obidebruinj::GraphDeBruijn; use obidebruinj::GraphDeBruijn;
use obikpartitionner::KmerPartition; use obikpartitionner::KmerPartition;
use obikseq::set_k;
use obiskio::SKFileReader; use obiskio::SKFileReader;
use ph::fmph::GOFunction; use ph::fmph::GOFunction;
use rayon::prelude::*; use rayon::prelude::*;
@@ -33,6 +34,7 @@ pub fn run(args: LongtigArgs) {
}); });
let k = kp.kmer_size(); let k = kp.kmer_size();
set_k(k);
let n = kp.n_partitions(); let n = kp.n_partitions();
info!("building longtigs from {n} partitions (k={k}, parallel)"); info!("building longtigs from {n} partitions (k={k}, parallel)");
@@ -46,7 +48,7 @@ pub fn run(args: LongtigArgs) {
} }
let out_path = part_dir.join("longtig.fasta.gz"); let out_path = part_dir.join("longtig.fasta.gz");
let mut g = GraphDeBruijn::new(k); let mut g = GraphDeBruijn::new();
let mphf_path = part_dir.join("mphf1.bin"); let mphf_path = part_dir.join("mphf1.bin");
let counts_path = part_dir.join("counts1.bin"); let counts_path = part_dir.join("counts1.bin");
@@ -86,12 +88,12 @@ pub fn run(args: LongtigArgs) {
.as_ref() .as_ref()
.map(|m| unsafe { std::slice::from_raw_parts(m.as_ptr() as *const u32, m.len() / 4) }); .map(|m| unsafe { std::slice::from_raw_parts(m.as_ptr() as *const u32, m.len() / 4) });
let mut reader = SKFileReader::open(&in_path, k).unwrap_or_else(|e| { let mut reader = SKFileReader::open(&in_path).unwrap_or_else(|e| {
eprintln!("error opening {}: {e}", in_path.display()); eprintln!("error opening {}: {e}", in_path.display());
std::process::exit(1) std::process::exit(1)
}); });
for sk in reader.iter() { for sk in reader.iter() {
for kmer in sk.iter_canonical_kmers(k) { for kmer in sk.iter_canonical_kmers() {
let accept = match (&mphf_opt, counts_slice) { let accept = match (&mphf_opt, counts_slice) {
(Some(mphf), Some(counts)) => { (Some(mphf), Some(counts)) => {
if let Some(slot) = mphf.get(&kmer) { if let Some(slot) = mphf.get(&kmer) {
+4 -2
View File
@@ -2,7 +2,7 @@ use std::path::PathBuf;
use clap::Args; use clap::Args;
use obikpartitionner::KmerPartition; use obikpartitionner::KmerPartition;
use obikseq::RoutableSuperKmer; use obikseq::{RoutableSuperKmer, set_k, set_m};
use tracing::info; use tracing::info;
use crate::cli::{CommonArgs, PipelineData, open_chunks}; use crate::cli::{CommonArgs, PipelineData, open_chunks};
@@ -25,7 +25,9 @@ pub struct PartitionArgs {
pub fn run(args: PartitionArgs) { pub fn run(args: PartitionArgs) {
let k = args.common.kmer_size; let k = args.common.kmer_size;
set_k(k);
let m = args.common.minimizer_size; let m = args.common.minimizer_size;
set_m(m);
let theta = args.common.theta; let theta = args.common.theta;
let level_max = args.common.level_max; let level_max = args.common.level_max;
let n_workers = args.common.threads.max(1); let n_workers = args.common.threads.max(1);
@@ -42,7 +44,7 @@ pub fn run(args: PartitionArgs) {
PipelineData : PathBuf => Vec<RoutableSuperKmer>, PipelineData : PathBuf => Vec<RoutableSuperKmer>,
||? { |path| open_chunks(path) } : Path => RawChunk, ||? { |path| open_chunks(path) } : Path => RawChunk,
|? { move |rope| obiread::normalize_sequence_chunk(rope, k) } : RawChunk => NormChunk, |? { move |rope| obiread::normalize_sequence_chunk(rope, k) } : RawChunk => NormChunk,
| { move |rope| obiskbuilder::build_superkmers(rope, k, m, level_max, theta) }: NormChunk => Batch, | { move |rope| obiskbuilder::build_superkmers(rope, k, level_max, theta) }: NormChunk => Batch,
}; };
for batch in pipe.apply(path_source, n_workers, 1) { for batch in pipe.apply(path_source, n_workers, 1) {
+2 -2
View File
@@ -25,7 +25,7 @@ fn write_batch(
let partition_mask = (1u64 << partition_bits) - 1; let partition_mask = (1u64 << partition_bits) - 1;
for rsk in batch { for rsk in batch {
let minimizer = *rsk.minimizer(); let minimizer = *rsk.minimizer();
let partition = (minimizer.seq_hash(m) & partition_mask) as usize; let partition = (minimizer.seq_hash() & partition_mask) as usize;
write_scatter(rsk.superkmer(), out, k, m, partition, minimizer)?; write_scatter(rsk.superkmer(), out, k, m, partition, minimizer)?;
} }
Ok(()) Ok(())
@@ -47,7 +47,7 @@ pub fn run(args: SuperkmerArgs) {
PipelineData : PathBuf => Vec<RoutableSuperKmer>, PipelineData : PathBuf => Vec<RoutableSuperKmer>,
||? { |path| open_chunks(path) } : Path => RawChunk, ||? { |path| open_chunks(path) } : Path => RawChunk,
|? { move |rope| obiread::normalize_sequence_chunk(rope, k) } : RawChunk => NormChunk, |? { move |rope| obiread::normalize_sequence_chunk(rope, k) } : RawChunk => NormChunk,
| { move |rope| obiskbuilder::build_superkmers(rope, k, m, level_max, theta) }: NormChunk => Batch, | { move |rope| obiskbuilder::build_superkmers(rope, k, level_max, theta) }: NormChunk => Batch,
}; };
let mut out = BufWriter::new(io::stdout()); let mut out = BufWriter::new(io::stdout());
+5 -3
View File
@@ -7,6 +7,7 @@ use niffler::Level;
use niffler::send::compression::Format; use niffler::send::compression::Format;
use obidebruinj::GraphDeBruijn; use obidebruinj::GraphDeBruijn;
use obikpartitionner::KmerPartition; use obikpartitionner::KmerPartition;
use obikseq::set_k;
use obiskio::SKFileReader; use obiskio::SKFileReader;
use ph::fmph::GOFunction; use ph::fmph::GOFunction;
use rayon::prelude::*; use rayon::prelude::*;
@@ -33,6 +34,7 @@ pub fn run(args: UnitigArgs) {
}); });
let k = kp.kmer_size(); let k = kp.kmer_size();
set_k(k);
let n = kp.n_partitions(); let n = kp.n_partitions();
info!("building unitigs from {n} partitions (k={k}, parallel)"); info!("building unitigs from {n} partitions (k={k}, parallel)");
@@ -46,7 +48,7 @@ pub fn run(args: UnitigArgs) {
} }
let out_path = part_dir.join("unitig.fasta.gz"); let out_path = part_dir.join("unitig.fasta.gz");
let mut g = GraphDeBruijn::new(k); let mut g = GraphDeBruijn::new();
let mphf_path = part_dir.join("mphf1.bin"); let mphf_path = part_dir.join("mphf1.bin");
let counts_path = part_dir.join("counts1.bin"); let counts_path = part_dir.join("counts1.bin");
@@ -86,12 +88,12 @@ pub fn run(args: UnitigArgs) {
.as_ref() .as_ref()
.map(|m| unsafe { std::slice::from_raw_parts(m.as_ptr() as *const u32, m.len() / 4) }); .map(|m| unsafe { std::slice::from_raw_parts(m.as_ptr() as *const u32, m.len() / 4) });
let mut reader = SKFileReader::open(&in_path, k).unwrap_or_else(|e| { let mut reader = SKFileReader::open(&in_path).unwrap_or_else(|e| {
eprintln!("error opening {}: {e}", in_path.display()); eprintln!("error opening {}: {e}", in_path.display());
std::process::exit(1) std::process::exit(1)
}); });
for sk in reader.iter() { for sk in reader.iter() {
for kmer in sk.iter_canonical_kmers(k) { for kmer in sk.iter_canonical_kmers() {
let accept = match (&mphf_opt, counts_slice) { let accept = match (&mphf_opt, counts_slice) {
(Some(mphf), Some(counts)) => { (Some(mphf), Some(counts)) => {
if let Some(slot) = mphf.get(&kmer) { if let Some(slot) = mphf.get(&kmer) {
+18 -21
View File
@@ -15,6 +15,7 @@ use remove_dir_all::remove_dir_all;
use niffler::Level; use niffler::Level;
use niffler::send::compression::Format; use niffler::send::compression::Format;
use obikseq::RoutableSuperKmer; use obikseq::RoutableSuperKmer;
use obikseq::Sequence;
use obikseq::superkmer::SuperKmer; use obikseq::superkmer::SuperKmer;
use obiskio::{SKFileMeta, SKFileReader, SKFileWriter, SKResult}; use obiskio::{SKFileMeta, SKFileReader, SKFileWriter, SKResult};
use rayon::prelude::*; use rayon::prelude::*;
@@ -124,8 +125,7 @@ impl KmerPartition {
/// Route and write one super-kmer to its partition file. /// Route and write one super-kmer to its partition file.
pub fn write(&mut self, rsk: RoutableSuperKmer) -> SKResult<()> { pub fn write(&mut self, rsk: RoutableSuperKmer) -> SKResult<()> {
self.check_not_closed()?; self.check_not_closed()?;
let partition = let partition = (rsk.minimizer().seq_hash() & self.partitions_mask) as usize;
(rsk.minimizer().seq_hash(self.minimizer_size) & self.partitions_mask) as usize;
let sk = rsk.into_superkmer(); let sk = rsk.into_superkmer();
self.ensure_writer(partition)?.write(&sk) self.ensure_writer(partition)?.write(&sk)
} }
@@ -134,8 +134,7 @@ impl KmerPartition {
pub fn write_batch(&mut self, rsks: Vec<RoutableSuperKmer>) -> SKResult<()> { pub fn write_batch(&mut self, rsks: Vec<RoutableSuperKmer>) -> SKResult<()> {
self.check_not_closed()?; self.check_not_closed()?;
for rsk in rsks { for rsk in rsks {
let partition = let partition = (rsk.minimizer().seq_hash() & self.partitions_mask) as usize;
(rsk.minimizer().seq_hash(self.minimizer_size) & self.partitions_mask) as usize;
let sk = rsk.into_superkmer(); let sk = rsk.into_superkmer();
self.ensure_writer(partition)?.write(&sk)?; self.ensure_writer(partition)?.write(&sk)?;
} }
@@ -202,7 +201,6 @@ impl KmerPartition {
/// more temporary file descriptors — all managed by the global fd pool. /// more temporary file descriptors — all managed by the global fd pool.
pub fn dereplicate(&self) -> SKResult<()> { pub fn dereplicate(&self) -> SKResult<()> {
let level = self.level; let level = self.level;
let k = self.kmer_size;
let root = &self.root_path; let root = &self.root_path;
let sys = System::new_all(); let sys = System::new_all();
// available_memory() can return 0 on macOS when the compressor page count exceeds // available_memory() can return 0 on macOS when the compressor page count exceeds
@@ -223,7 +221,7 @@ impl KmerPartition {
} }
let raw_path = dir.join(format!("raw.{SK_EXT}")); let raw_path = dir.join(format!("raw.{SK_EXT}"));
let n_buckets = optimal_buckets(&raw_path, available_per_thread); let n_buckets = optimal_buckets(&raw_path, available_per_thread);
dereplicate_partition(&dir, level, n_buckets, k) dereplicate_partition(&dir, level, n_buckets)
}) })
.collect(); .collect();
@@ -328,8 +326,7 @@ impl KmerPartition {
let dir = self.root_path.join(format!("part_{:05}", partition)); let dir = self.root_path.join(format!("part_{:05}", partition));
fs::create_dir_all(&dir)?; fs::create_dir_all(&dir)?;
let file_path = dir.join(format!("raw.{SK_EXT}")); let file_path = dir.join(format!("raw.{SK_EXT}"));
let writer = let writer = SKFileWriter::create_with(file_path, Format::Zstd, self.level)?;
SKFileWriter::create_with(file_path, self.kmer_size, Format::Zstd, self.level)?;
self.writers[partition] = Some(writer); self.writers[partition] = Some(writer);
} }
Ok(self.writers[partition].as_mut().unwrap()) Ok(self.writers[partition].as_mut().unwrap())
@@ -415,18 +412,18 @@ fn level_from_u32(n: u32) -> Level {
const MAX_SK_COUNT: u64 = (1 << 24) - 1; const MAX_SK_COUNT: u64 = (1 << 24) - 1;
/// Deduplicate one partition directory in place (two-phase split + merge). /// Deduplicate one partition directory in place (two-phase split + merge).
fn dereplicate_partition(dir: &Path, level: Level, n_temp: usize, k: usize) -> SKResult<()> { fn dereplicate_partition(dir: &Path, level: Level, n_temp: usize) -> SKResult<()> {
let raw_path = dir.join(format!("raw.{SK_EXT}")); let raw_path = dir.join(format!("raw.{SK_EXT}"));
if !raw_path.exists() { if !raw_path.exists() {
return Ok(()); return Ok(());
} }
let out_path = dir.join(format!("dereplicated.{SK_EXT}")); let out_path = dir.join(format!("dereplicated.{SK_EXT}"));
let mut writer = SKFileWriter::create_with(&out_path, k, Format::Zstd, level)?; let mut writer = SKFileWriter::create_with(&out_path, Format::Zstd, level)?;
if n_temp == 1 { if n_temp == 1 {
// ── Direct path: partition fits in memory, no split needed ──────────── // ── Direct path: partition fits in memory, no split needed ────────────
let map = load_bucket(&raw_path, k)?; let map = load_bucket(&raw_path)?;
remove_skmer_file(&raw_path)?; remove_skmer_file(&raw_path)?;
flush_map(map, &mut writer)?; flush_map(map, &mut writer)?;
} else { } else {
@@ -439,10 +436,10 @@ fn dereplicate_partition(dir: &Path, level: Level, n_temp: usize, k: usize) -> S
{ {
let mut writers: Vec<SKFileWriter> = temp_paths let mut writers: Vec<SKFileWriter> = temp_paths
.iter() .iter()
.map(|p| SKFileWriter::create_with(p, k, Format::Zstd, level)) .map(|p| SKFileWriter::create_with(p, Format::Zstd, level))
.collect::<SKResult<_>>()?; .collect::<SKResult<_>>()?;
let mut reader = SKFileReader::open(&raw_path, k)?; let mut reader = SKFileReader::open(&raw_path)?;
while let Some(sk) = reader.read()? { while let Some(sk) = reader.read()? {
let bucket = (sk.seq_hash() & temp_mask) as usize; let bucket = (sk.seq_hash() & temp_mask) as usize;
writers[bucket].write(&sk)?; writers[bucket].write(&sk)?;
@@ -455,7 +452,7 @@ fn dereplicate_partition(dir: &Path, level: Level, n_temp: usize, k: usize) -> S
// ── Phase 2: merge each temp bucket into the output ─────────────────── // ── Phase 2: merge each temp bucket into the output ───────────────────
for temp_path in &temp_paths { for temp_path in &temp_paths {
let map = load_bucket(temp_path, k)?; let map = load_bucket(temp_path)?;
remove_skmer_file(temp_path)?; remove_skmer_file(temp_path)?;
flush_map(map, &mut writer)?; flush_map(map, &mut writer)?;
} }
@@ -466,14 +463,14 @@ fn dereplicate_partition(dir: &Path, level: Level, n_temp: usize, k: usize) -> S
} }
/// Read a SuperKmer file into a deduplication map (already canonical). /// Read a SuperKmer file into a deduplication map (already canonical).
fn load_bucket(path: &Path, k: usize) -> SKResult<HashMap<SuperKmer, u64>> { fn load_bucket(path: &Path) -> SKResult<HashMap<SuperKmer, u64>> {
let capacity = SKFileMeta::read(path) let capacity = SKFileMeta::read(path)
.ok() .ok()
.flatten() .flatten()
.map(|m| m.instances as usize) .map(|m| m.instances as usize)
.unwrap_or(0); .unwrap_or(0);
let mut map: HashMap<SuperKmer, u64> = HashMap::with_capacity(capacity); let mut map: HashMap<SuperKmer, u64> = HashMap::with_capacity(capacity);
let mut reader = SKFileReader::open(path, k)?; let mut reader = SKFileReader::open(path)?;
while let Some(sk) = reader.read()? { while let Some(sk) = reader.read()? {
let count = sk.count() as u64; let count = sk.count() as u64;
*map.entry(sk).or_insert(0) += count; *map.entry(sk).or_insert(0) += count;
@@ -512,10 +509,10 @@ fn count_partition(dir: &Path, dedup_path: &Path, k: usize) -> SKResult<()> {
let mut seen: HashSet<CanonicalKmer> = HashSet::with_capacity(capacity); let mut seen: HashSet<CanonicalKmer> = HashSet::with_capacity(capacity);
let mut pass1_superkmers: u64 = 0; let mut pass1_superkmers: u64 = 0;
{ {
let mut reader = SKFileReader::open(dedup_path, k)?; let mut reader = SKFileReader::open(dedup_path)?;
while let Some(sk) = reader.read()? { while let Some(sk) = reader.read()? {
pass1_superkmers += 1; pass1_superkmers += 1;
for kmer in sk.iter_canonical_kmers(k) { for kmer in sk.iter_canonical_kmers() {
seen.insert(kmer); seen.insert(kmer);
} }
} }
@@ -555,10 +552,10 @@ fn count_partition(dir: &Path, dedup_path: &Path, k: usize) -> SKResult<()> {
{ {
let counts = let counts =
unsafe { std::slice::from_raw_parts_mut(mmap.as_mut_ptr() as *mut u32, n_kmers) }; unsafe { std::slice::from_raw_parts_mut(mmap.as_mut_ptr() as *mut u32, n_kmers) };
let mut reader = SKFileReader::open(dedup_path, k)?; let mut reader = SKFileReader::open(dedup_path)?;
while let Some(sk) = reader.read()? { while let Some(sk) = reader.read()? {
pass2_superkmers += 1; pass2_superkmers += 1;
let seql = sk.len(); let seql = sk.seql();
let sk_count = sk.count(); let sk_count = sk.count();
if pass2_superkmers <= 3 { if pass2_superkmers <= 3 {
debug!( debug!(
@@ -570,7 +567,7 @@ fn count_partition(dir: &Path, dedup_path: &Path, k: usize) -> SKResult<()> {
continue; continue;
} }
pass2_count_sum += sk_count as u64; pass2_count_sum += sk_count as u64;
for kmer in sk.iter_canonical_kmers(k) { for kmer in sk.iter_canonical_kmers() {
if let Some(idx) = mphf.get(&kmer) { if let Some(idx) = mphf.get(&kmer) {
counts[idx as usize] = counts[idx as usize].saturating_add(sk_count); counts[idx as usize] = counts[idx as usize].saturating_add(sk_count);
pass2_kmer_hits += 1; pass2_kmer_hits += 1;
+5
View File
@@ -3,6 +3,11 @@ name = "obikseq"
version = "0.1.0" version = "0.1.0"
edition = "2024" edition = "2024"
[features]
# Replaces the OnceLock-based params with thread-local storage so that
# tests in dependent crates can call set_k / set_m freely without conflicts.
test-utils = []
[dependencies] [dependencies]
bitvec = "1" bitvec = "1"
serde = { version = "1.0", features = ["derive"] } serde = { version = "1.0", features = ["derive"] }
+8
View File
@@ -2,6 +2,14 @@ use serde::Serialize;
use serde_json; use serde_json;
use std::io::{self, Write}; use std::io::{self, Write};
/// Minimal annotation carrying only the sequence length.
#[derive(Serialize)]
pub struct BasicAnnotation {
pub seq_length: usize,
}
impl Annotation for BasicAnnotation {}
/// Serialize `self` as a single-line JSON object into a writer. /// Serialize `self` as a single-line JSON object into a writer.
pub trait Annotation: Serialize { pub trait Annotation: Serialize {
/// Write the annotation as compact JSON into `writer`. /// Write the annotation as compact JSON into `writer`.
+229 -265
View File
@@ -1,12 +1,70 @@
//! Compact 2-bit kmer stored as a left-aligned u64. //! Compact 2-bit kmer stored as a left-aligned u64.
//! //!
//! Nucleotide 0 occupies bits 6362, nucleotide i occupies bits 632i and 622i. //! Nucleotide 0 occupies bits 6362, nucleotide i occupies bits 632i and 622i.
//! The low 642k bits are always zero. k is not stored — it is a parameter of //! The low 642·len bits are always zero.
//! every operation that needs it, and will be owned by the collection-level indexer. //!
//! The length is not stored in the struct — it is supplied by the [`KmerLength`]
//! type parameter. Two public marker types cover the common cases:
//!
//! | Alias | Marker | Length source |
//! |-----------------|----------|----------------|
//! | [`Kmer`] | [`KLen`] | `params::k()` |
//! | [`CanonicalKmer`]| [`KLen`]| `params::k()` |
//! | [`Minimizer`] | [`MLen`] | `params::m()` |
//!
//! Tests that need a fixed length independent of the global singletons can use
//! [`ConstLen<N>`].
use serde::Serialize;
use std::io::{self, Write}; use std::io::{self, Write};
use std::marker::PhantomData;
use crate::Annotation;
use crate::Sequence;
use crate::encoding::{DEC4, encode_base}; use crate::encoding::{DEC4, encode_base};
use crate::params::{k, m};
use crate::sequence::mix64;
// ── KmerLength ────────────────────────────────────────────────────────────────
/// Marker trait that supplies a kmer length at runtime.
pub trait KmerLength: Copy + std::fmt::Debug + 'static {
/// Returns the length this marker represents.
fn len() -> usize;
}
/// Marker for the k-mer length (`params::k()`).
#[derive(Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash)]
pub struct KLen;
/// Marker for the minimizer length (`params::m()`).
#[derive(Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash)]
pub struct MLen;
/// Marker for a compile-time-constant length — useful for tests.
#[derive(Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash)]
pub struct ConstLen<const N: usize>;
impl KmerLength for KLen {
#[inline]
fn len() -> usize {
k()
}
}
impl KmerLength for MLen {
#[inline]
fn len() -> usize {
m()
}
}
impl<const N: usize> KmerLength for ConstLen<N> {
#[inline]
fn len() -> usize {
N
}
}
// ── KmerError ───────────────────────────────────────────────────────────────── // ── KmerError ─────────────────────────────────────────────────────────────────
@@ -43,35 +101,31 @@ impl std::fmt::Display for KmerError {
impl std::error::Error for KmerError {} impl std::error::Error for KmerError {}
// ── Kmer ────────────────────────────────────────────────────────────────────── #[derive(Serialize)]
struct KmerAnnotation {
seq_length: usize,
}
impl Annotation for KmerAnnotation {}
/// A DNA kmer of length k encoded as a left-aligned u64 (2 bits/nucleotide, MSB-first). // ── KmerOf ────────────────────────────────────────────────────────────────────
/// k is not stored in the struct — it must be supplied by the caller.
/// A DNA kmer of length `L::len()` encoded as a left-aligned u64 (2 bits/nucleotide, MSB-first).
/// The low `64 2·L::len()` bits are always zero.
#[repr(transparent)] #[repr(transparent)]
#[derive(Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash)] #[derive(Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash)]
pub struct Kmer(u64); pub struct KmerOf<L: KmerLength>(u64, PhantomData<L>);
#[inline] impl<L: KmerLength> KmerOf<L> {
fn mix64(x: u64) -> u64 { /// Wrap a raw left-aligned u64 value as a kmer.
let x = x ^ (x >> 30);
let x = x.wrapping_mul(0xbf58476d1ce4e5b9);
let x = x ^ (x >> 27);
let x = x.wrapping_mul(0x94d049bb133111eb);
x ^ (x >> 31)
}
impl Kmer {
/// Wrap a raw left-aligned u64 value as a Kmer.
#[inline] #[inline]
pub fn from_raw(raw: u64) -> Self { pub fn from_raw(raw: u64) -> Self {
Kmer(raw) KmerOf(raw, PhantomData)
} }
/// Wrap a raw right-aligned u64 value as a Kmer. /// Wrap a raw right-aligned u64 value, shifting it into left-aligned position.
/// The raw value is shifted left by `2 * k` bits to align it with the leftmost position.
#[inline] #[inline]
pub fn from_raw_right(raw: u64, k: usize) -> Self { pub fn from_raw_right(raw: u64) -> Self {
Kmer(raw << (64 - 2 * k)) KmerOf(raw << (64 - 2 * L::len()), PhantomData)
} }
/// Return the raw left-aligned u64 value. /// Return the raw left-aligned u64 value.
@@ -82,14 +136,13 @@ impl Kmer {
/// Return the raw right-aligned u64 value. /// Return the raw right-aligned u64 value.
#[inline] #[inline]
pub fn raw_right(&self, k: usize) -> u64 { pub fn raw_right(&self) -> u64 {
self.0 >> (64 - 2 * k) self.0 >> (64 - 2 * L::len())
} }
/// Encode the first k nucleotides of an ASCII slice into a Kmer. /// Encode the first `L::len()` nucleotides of an ASCII slice into a kmer.
/// Zero allocation — result lives on the stack. pub fn from_ascii(ascii: &[u8]) -> Result<Self, KmerError> {
#[inline] let k = L::len();
pub fn from_ascii(ascii: &[u8], k: usize) -> Result<Self, KmerError> {
if k == 0 || k > 32 { if k == 0 || k > 32 {
return Err(KmerError::InvalidK { k }); return Err(KmerError::InvalidK { k });
} }
@@ -104,26 +157,21 @@ impl Kmer {
for i in 0..k { for i in 0..k {
val = (val << 2) | encode_base(ascii[i]) as u64; val = (val << 2) | encode_base(ascii[i]) as u64;
} }
Ok(Kmer(val << (64 - 2 * k))) Ok(KmerOf(val << (64 - 2 * k), PhantomData))
} }
/// Extract nucleotide i (0-based from 5 end) as a 2-bit value. /// Decode into a freshly allocated ASCII `Vec<u8>`.
#[inline] #[inline]
pub fn nucleotide(&self, i: usize) -> u8 { pub fn to_ascii(&self) -> Vec<u8> {
((self.0 >> (62 - 2 * i)) & 0b11) as u8 let mut buf = Vec::with_capacity(L::len());
} self.write_ascii(&mut buf).unwrap();
/// Decode this kmer into a freshly allocated ASCII `Vec<u8>`.
#[inline]
pub fn to_ascii(&self, k: usize) -> Vec<u8> {
let mut buf = Vec::with_capacity(k);
self.write_ascii(k, &mut buf).unwrap();
buf buf
} }
/// Decode this kmer into ASCII nucleotides, writing into `writer`. /// Decode into ASCII nucleotides, writing into `writer`.
#[inline] #[inline]
pub fn write_ascii<W: Write>(&self, k: usize, writer: &mut W) -> io::Result<()> { pub fn write_ascii<W: Write>(&self, writer: &mut W) -> io::Result<()> {
let k = L::len();
let bytes = self.0.to_be_bytes(); let bytes = self.0.to_be_bytes();
let full = k / 4; let full = k / 4;
let rem = k % 4; let rem = k % 4;
@@ -137,296 +185,212 @@ impl Kmer {
Ok(()) Ok(())
} }
/// Compute the reverse complement of this kmer. /// Compute the reverse complement.
/// Zero allocation — result lives on the stack.
#[inline] #[inline]
pub fn revcomp(&self, k: usize) -> Self { pub fn revcomp(&self) -> Self {
let x = !self.0; // complement let k = L::len();
let x = x.swap_bytes(); // reverse bytes let x = !self.0;
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4); // swap nibbles let x = x.swap_bytes();
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2); // swap 2-bit groups let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
Kmer(x << (64 - 2 * k)) let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
KmerOf(x << (64 - 2 * k), PhantomData)
} }
/// Return the canonical form: lexicographic minimum of forward and reverse complement. /// Slide the window one base to the right: drop nucleotide 0, append `nuc` at position `L::len()-1`.
/// Zero allocation — result lives on the stack. pub fn push_right(self, nuc: u8) -> Self {
#[inline] let k = L::len();
pub fn canonical(&self, k: usize) -> CanonicalKmer {
let rc = self.revcomp(k);
CanonicalKmer(if self.0 <= rc.0 { *self } else { rc })
}
/// Slide the window one base to the right: drop the first nucleotide, append `nuc` at position k-1.
pub fn push_right(self, nuc: u8, k: usize) -> Self {
let shifted = self.0 << 2 & (!0u64 << (64 - 2 * (k - 1))); let shifted = self.0 << 2 & (!0u64 << (64 - 2 * (k - 1)));
let shift = 64 - 2 * k; KmerOf(shifted | ((nuc as u64 & 3) << (64 - 2 * k)), PhantomData)
Kmer(shifted | ((nuc as u64 & 3) << shift))
} }
/// Slide the window one base to the left: drop the last nucleotide, prepend `nuc` at position 0. /// Slide the window one base to the left: drop nucleotide `L::len()-1`, prepend `nuc` at position 0.
pub fn push_left(self, nuc: u8, k: usize) -> Self { pub fn push_left(self, nuc: u8) -> Self {
let k = L::len();
let shifted = (self.0 >> 2) & (!0u64 << (64 - 2 * k)); let shifted = (self.0 >> 2) & (!0u64 << (64 - 2 * k));
Kmer(shifted | ((nuc as u64 & 3) << 62)) KmerOf(shifted | ((nuc as u64 & 3) << 62), PhantomData)
} }
/// Returns `true` if `self` and `other` overlap by `k` - 1 bases. /// Returns `true` if the last `L::len()-1` nucleotides of `self` equal the first `L::len()-1` of `other`.
/// pub fn is_overlapping(self, other: Self) -> bool {
/// The last K-1 nucleotides of `self` and the first K-1 nucleotides let k = L::len();
/// of `other` must be equal. let mask = !0u64 << (64 - 2 * (k - 1));
pub fn is_overlapping(self, other: Self, k: usize) -> bool { (self.0 << 2 & mask) == (other.0 & mask)
let left = self.0 << 2 & (!0u64 << (64 - 2 * (k - 1)));
let right = other.0 & (!0u64 << (64 - 2 * (k - 1)));
left == right
} }
} }
// ── CanonicalKmer ───────────────────────────────────────────────────────────── impl<L: KmerLength> Sequence for KmerOf<L> {
type Canonical = CanonicalKmerOf<L>;
/// A [`Kmer`] guaranteed to be in canonical form (lexicographic minimum of fn seql(&self) -> usize {
L::len()
}
fn seq_hash(&self) -> u64 {
self.canonical().seq_hash()
}
#[inline]
fn nucleotide(&self, i: usize) -> u8 {
((self.0 >> (62 - 2 * i)) & 0b11) as u8
}
#[inline]
fn canonical(&self) -> Self::Canonical {
let rc = self.revcomp();
CanonicalKmerOf(if self.0 <= rc.0 { self.0 } else { rc.0 }, PhantomData)
}
fn annotation(&self) -> impl Annotation {
KmerAnnotation {
seq_length: L::len(),
}
}
}
// ── CanonicalKmerOf ───────────────────────────────────────────────────────────
/// A [`KmerOf<L>`] guaranteed to be in canonical form (lexicographic minimum of
/// forward and reverse complement). /// forward and reverse complement).
/// ///
/// The only public constructors are [`Kmer::canonical`] (checked) and /// The only public constructors are [`KmerOf::canonical`] (verified) and
/// [`CanonicalKmer::from_raw_unchecked`] (for trusted paths such as /// [`CanonicalKmerOf::from_raw_unchecked`] (trusted paths such as deserialisation).
/// deserialisation or rolling-window minimizer extraction).
#[repr(transparent)] #[repr(transparent)]
#[derive(Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash)] #[derive(Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash)]
pub struct CanonicalKmer(Kmer); pub struct CanonicalKmerOf<L: KmerLength>(u64, PhantomData<L>);
impl CanonicalKmer { impl<L: KmerLength> CanonicalKmerOf<L> {
/// Wrap a raw left-aligned u64 without verifying the canonical invariant. /// Wrap a raw left-aligned u64 without verifying the canonical invariant.
/// ///
/// # Safety (logical) /// # Safety (logical)
/// The caller must guarantee that `raw == min(raw, revcomp(raw, k))`. /// The caller must guarantee `raw == min(raw, revcomp(raw))`.
/// Violations cause silently wrong results in MPHF lookup and graph traversal.
#[inline] #[inline]
pub fn from_raw_unchecked(raw: u64) -> Self { pub fn from_raw_unchecked(raw: u64) -> Self {
CanonicalKmer(Kmer(raw)) CanonicalKmerOf(raw, PhantomData)
} }
/// Return the raw left-aligned u64 value. /// Return the raw left-aligned u64 value.
#[inline] #[inline]
pub fn raw(&self) -> u64 { pub fn raw(&self) -> u64 {
self.0.0 self.0
} }
/// Decode into a freshly allocated ASCII `Vec<u8>`. /// Decode into a freshly allocated ASCII `Vec<u8>`.
#[inline] #[inline]
pub fn to_ascii(&self, k: usize) -> Vec<u8> { pub fn to_ascii(&self) -> Vec<u8> {
self.0.to_ascii(k) self.into_kmer().to_ascii()
} }
/// Decode into ASCII nucleotides, writing into `writer`. /// Decode into ASCII nucleotides, writing into `writer`.
#[inline] #[inline]
pub fn write_ascii<W: Write>(&self, k: usize, writer: &mut W) -> io::Result<()> { pub fn write_ascii<W: Write>(&self, writer: &mut W) -> io::Result<()> {
self.0.write_ascii(k, writer) self.into_kmer().write_ascii(writer)
} }
/// Compute the reverse complement. The result is a raw [`Kmer`] — the /// Compute the reverse complement. The result is a raw [`KmerOf<L>`] — not
/// revcomp of a canonical kmer is not necessarily canonical itself. /// necessarily canonical itself.
#[inline] #[inline]
pub fn revcomp(&self, k: usize) -> Kmer { pub fn revcomp(&self) -> KmerOf<L> {
self.0.revcomp(k) self.into_kmer().revcomp()
} }
/// Hash via `mix64`. No re-canonicalisation needed. /// Hash via `mix64`.
#[inline] #[inline]
pub fn seq_hash(&self, _k: usize) -> u64 { pub fn seq_hash(&self) -> u64 {
mix64(self.0.0) hash_kmer(self.0)
} }
/// Extract nucleotide i (0-based from 5 end) as a 2-bit value. /// Extract nucleotide i (0-based from 5 end) as a 2-bit value.
#[inline] #[inline]
pub fn nucleotide(&self, i: usize) -> u8 { pub fn nucleotide(&self, i: usize) -> u8 {
self.0.nucleotide(i) self.into_kmer().nucleotide(i)
} }
/// Return the four left canonical neighbours (each already canonical). /// Return the four left canonical neighbours (each already canonical).
/// Zero allocation — result lives on the stack. pub fn left_canonical_neighbors(&self) -> [CanonicalKmerOf<L>; 4] {
pub fn left_canonical_neighbors(&self, k: usize) -> [CanonicalKmer; 4] { let k = L::len();
let shifted = (self.raw() >> 2) & (!0u64 << (64 - 2 * k)); let shifted = (self.0 >> 2) & (!0u64 << (64 - 2 * k));
[ [
Kmer(shifted).canonical(k), KmerOf::<L>(shifted, PhantomData).canonical(),
Kmer(shifted | (1u64 << 62)).canonical(k), KmerOf::<L>(shifted | (1u64 << 62), PhantomData).canonical(),
Kmer(shifted | (2u64 << 62)).canonical(k), KmerOf::<L>(shifted | (2u64 << 62), PhantomData).canonical(),
Kmer(shifted | (3u64 << 62)).canonical(k), KmerOf::<L>(shifted | (3u64 << 62), PhantomData).canonical(),
] ]
} }
/// Return the four right canonical neighbours (each already canonical). /// Return the four right canonical neighbours (each already canonical).
/// Zero allocation — result lives on the stack. pub fn right_canonical_neighbors(&self) -> [CanonicalKmerOf<L>; 4] {
pub fn right_canonical_neighbors(&self, k: usize) -> [CanonicalKmer; 4] { let k = L::len();
let shifted = self.raw() << 2 & (!0u64 << (64 - 2 * (k - 1))); let shifted = self.0 << 2 & (!0u64 << (64 - 2 * (k - 1)));
let shift = 64 - 2 * k; let shift = 64 - 2 * k;
[ [
Kmer(shifted).canonical(k), KmerOf::<L>(shifted, PhantomData).canonical(),
Kmer(shifted | (1u64 << shift)).canonical(k), KmerOf::<L>(shifted | (1u64 << shift), PhantomData).canonical(),
Kmer(shifted | (2u64 << shift)).canonical(k), KmerOf::<L>(shifted | (2u64 << shift), PhantomData).canonical(),
Kmer(shifted | (3u64 << shift)).canonical(k), KmerOf::<L>(shifted | (3u64 << shift), PhantomData).canonical(),
] ]
} }
/// Consume this wrapper and return the inner raw [`Kmer`]. /// Return the inner value as a raw [`KmerOf<L>`].
#[inline] #[inline]
pub fn into_kmer(self) -> Kmer { pub fn into_kmer(self) -> KmerOf<L> {
self.0 KmerOf(self.0, PhantomData)
} }
} }
impl From<CanonicalKmer> for Kmer { impl<L: KmerLength> Sequence for CanonicalKmerOf<L> {
#[inline] type Canonical = CanonicalKmerOf<L>;
fn from(ck: CanonicalKmer) -> Self {
ck.0 fn seql(&self) -> usize {
L::len()
} }
fn seq_hash(&self) -> u64 {
hash_kmer(self.0)
}
#[inline]
fn nucleotide(&self, i: usize) -> u8 {
((self.0 >> (62 - 2 * i)) & 0b11) as u8
}
fn canonical(&self) -> Self::Canonical {
*self
}
fn annotation(&self) -> impl Annotation {
KmerAnnotation {
seq_length: L::len(),
}
}
}
impl<L: KmerLength> From<CanonicalKmerOf<L>> for KmerOf<L> {
#[inline]
fn from(ck: CanonicalKmerOf<L>) -> Self {
ck.into_kmer()
}
}
// ── Public type aliases ───────────────────────────────────────────────────────
/// A DNA k-mer using the global `params::k()` length.
pub type Kmer = KmerOf<KLen>;
/// A canonical k-mer using the global `params::k()` length.
pub type CanonicalKmer = CanonicalKmerOf<KLen>;
/// A minimizer: a canonical k-mer using the global `params::m()` length.
pub type Minimizer = CanonicalKmerOf<MLen>;
/// Compute a hash for a raw (left-aligned) kmer value.
///
/// This is a convenience wrapper around [`mix64`] that accepts the raw
/// 64-bit representation directly, which is useful when the canonical
/// invariant is not required or has already been handled.
#[inline]
pub fn hash_kmer(raw: u64) -> u64 {
mix64(raw ^ 0x9e3779b97f4a7c15)
} }
// ── tests ───────────────────────────────────────────────────────────────────── // ── tests ─────────────────────────────────────────────────────────────────────
#[cfg(test)] #[cfg(test)]
mod tests { #[path = "tests/kmer.rs"]
use super::*; mod tests;
fn ascii_revcomp(seq: &[u8]) -> Vec<u8> {
seq.iter()
.rev()
.map(|&b| match b {
b'A' => b'T',
b'T' => b'A',
b'C' => b'G',
b'G' => b'C',
_ => b'A',
})
.collect()
}
const K_VALUES: &[usize] = &[1, 2, 3, 4, 8, 11, 16, 31, 32];
fn make_seq(k: usize) -> Vec<u8> {
(0..k).map(|i| b"ACGT"[i % 4]).collect()
}
// ── from_ascii / to_ascii ─────────────────────────────────────────────────
#[test]
fn ascii_roundtrip() {
for &k in K_VALUES {
let ascii = make_seq(k);
let kmer = Kmer::from_ascii(&ascii, k).unwrap();
assert_eq!(kmer.to_ascii(k), ascii, "roundtrip failed for k={k}");
}
}
#[test]
fn from_ascii_all_bases() {
for (base, expected) in [(b'A', b'A'), (b'C', b'C'), (b'G', b'G'), (b'T', b'T')] {
let kmer = Kmer::from_ascii(&[base], 1).unwrap();
assert_eq!(kmer.to_ascii(1), vec![expected]);
}
}
#[test]
fn from_ascii_invalid_k() {
assert!(Kmer::from_ascii(b"A", 0).is_err());
assert!(Kmer::from_ascii(b"ACGT", 33).is_err());
}
#[test]
fn from_ascii_too_short() {
assert!(Kmer::from_ascii(b"ACG", 4).is_err());
}
// ── nucleotide ────────────────────────────────────────────────────────────
#[test]
fn nucleotide_extraction() {
let kmer = Kmer::from_ascii(b"ACGT", 4).unwrap();
assert_eq!(kmer.nucleotide(0), 0b00); // A
assert_eq!(kmer.nucleotide(1), 0b01); // C
assert_eq!(kmer.nucleotide(2), 0b10); // G
assert_eq!(kmer.nucleotide(3), 0b11); // T
}
// ── revcomp ───────────────────────────────────────────────────────────────
#[test]
fn revcomp_known_values() {
let cases: &[(&[u8], &[u8])] = &[
(b"A", b"T"),
(b"AC", b"GT"),
(b"ACG", b"CGT"),
(b"ACGT", b"ACGT"), // palindrome
(b"AAAA", b"TTTT"),
(b"TTTT", b"AAAA"),
];
for (seq, expected) in cases {
let k = seq.len();
let kmer = Kmer::from_ascii(seq, k).unwrap();
let rc = kmer.revcomp(k);
assert_eq!(
rc.to_ascii(k),
*expected,
"revcomp wrong for \"{}\"",
std::str::from_utf8(seq).unwrap()
);
}
}
#[test]
fn revcomp_vs_reference() {
for &k in K_VALUES {
let ascii = make_seq(k);
let expected = ascii_revcomp(&ascii);
let rc = Kmer::from_ascii(&ascii, k).unwrap().revcomp(k);
assert_eq!(rc.to_ascii(k), expected, "revcomp wrong for k={k}");
}
}
#[test]
fn revcomp_involution() {
for &k in K_VALUES {
let ascii = make_seq(k);
let kmer = Kmer::from_ascii(&ascii, k).unwrap();
assert_eq!(
kmer.revcomp(k).revcomp(k),
kmer,
"revcomp∘revcomp≠id for k={k}"
);
}
}
// ── canonical ─────────────────────────────────────────────────────────────
#[test]
fn canonical_palindrome() {
let kmer = Kmer::from_ascii(b"ACGT", 4).unwrap();
assert_eq!(kmer.canonical(4).into_kmer(), kmer);
}
#[test]
fn canonical_chooses_lesser() {
let kmer = Kmer::from_ascii(b"TTTT", 4).unwrap();
let expected = Kmer::from_ascii(b"AAAA", 4).unwrap();
assert_eq!(kmer.canonical(4).into_kmer(), expected);
}
#[test]
fn canonical_is_minimal() {
for &k in K_VALUES {
let ascii = make_seq(k);
let ck = Kmer::from_ascii(&ascii, k).unwrap().canonical(k);
let rc = ck.revcomp(k);
assert!(ck.raw() <= rc.raw(), "canonical not minimal for k={k}");
}
}
#[test]
fn canonical_idempotent() {
for &k in K_VALUES {
let ck = Kmer::from_ascii(&make_seq(k), k).unwrap().canonical(k);
assert_eq!(
ck.into_kmer().canonical(k),
ck,
"canonical not idempotent for k={k}"
);
}
}
}
+5 -1
View File
@@ -9,6 +9,8 @@ mod annotations;
mod encoding; mod encoding;
pub mod kmer; pub mod kmer;
pub mod packed_seq;
pub mod params;
mod revcomp_lookup; mod revcomp_lookup;
/// Routable super-kmer: canonical sequence paired with its minimizer for scatter routing. /// Routable super-kmer: canonical sequence paired with its minimizer for scatter routing.
pub mod routable; pub mod routable;
@@ -18,7 +20,9 @@ pub mod superkmer;
pub mod unitig; pub mod unitig;
pub use annotations::Annotation; pub use annotations::Annotation;
pub use kmer::CanonicalKmer; pub use kmer::{CanonicalKmer, Kmer, Minimizer, hash_kmer};
pub use params::{k, m, set_k, set_m};
pub use routable::RoutableSuperKmer; pub use routable::RoutableSuperKmer;
pub use sequence::Sequence; pub use sequence::Sequence;
pub use superkmer::SuperKmer; pub use superkmer::SuperKmer;
pub use unitig::Unitig;
+361
View File
@@ -0,0 +1,361 @@
//! Compact 2-bit DNA sequence — shared substrate for [`SuperKmer`] and [`Unitig`].
//!
//! Encoding: A=00, C=01, G=10, T=11. Nucleotide 0 occupies bits 76 of `seq[0]`,
//! nucleotide i occupies bits `72*(i%4)` and `62*(i%4)` of `seq[i/4]`.
//! Padding bits in the last byte are always 0.
//!
//! The exact nucleotide count is recovered without storing it explicitly:
//!
//! ```text
//! seql = (seq.len() - 1) * 4 + tail_count(tail)
//! ```
//!
//! where `tail` encodes the number of valid nucleotides in the last byte (0 → 4).
use std::io::{self, Read, Write};
use bitvec::prelude::*;
use crate::Sequence;
use crate::encoding::{DEC4, encode_base};
use crate::kmer::{CanonicalKmer, Kmer, KmerError, KLen, KmerLength, KmerOf, MLen, Minimizer};
use crate::params::k;
use crate::revcomp_lookup::REVCOMP4;
// ── PackedSeq ─────────────────────────────────────────────────────────────────
/// 2-bit packed DNA sequence of arbitrary length ≥ 1.
///
/// `tail` encodes the number of valid nucleotides in the last byte: 0 stands for 4,
/// so the range 03 covers all four cases. Padding bits are always 0.
#[derive(Debug, Clone)]
pub struct PackedSeq {
pub(crate) tail: u8,
pub(crate) seq: Box<[u8]>,
}
impl PartialEq for PackedSeq {
fn eq(&self, other: &Self) -> bool {
self.tail == other.tail && self.seq == other.seq
}
}
impl Eq for PackedSeq {}
impl std::hash::Hash for PackedSeq {
fn hash<H: std::hash::Hasher>(&self, state: &mut H) {
self.tail.hash(state);
self.seq.hash(state);
}
}
impl PackedSeq {
/// Construct from pre-packed bytes and a `tail` value (03, where 0 means 4).
/// Caller must guarantee padding bits in the last byte are zeroed.
#[inline]
pub fn new(tail: u8, seq: Box<[u8]>) -> Self {
debug_assert!(tail <= 3, "tail must be 03");
debug_assert!(!seq.is_empty(), "seq must be non-empty");
Self { tail, seq }
}
/// Sequence length in nucleotides.
#[inline]
pub fn seql(&self) -> usize {
(self.seq.len() - 1) * 4 + tail_count(self.tail)
}
/// Read-only view of the packed 2-bit bytes.
#[inline]
pub fn seq_bytes(&self) -> &[u8] {
&self.seq
}
/// Extract nucleotide i (0-based from 5 end) as a 2-bit value. Zero copy.
#[inline]
pub fn nucleotide(&self, i: usize) -> u8 {
(self.seq[i / 4] >> (6 - 2 * (i % 4))) & 0b11
}
/// Encode an ASCII nucleotide slice (ACGT, length ≥ 1). Allocates once.
pub fn from_ascii(ascii: &[u8]) -> Self {
let seql = ascii.len();
debug_assert!(seql >= 1);
let n = byte_len(seql);
let mut seq = vec![0u8; n];
let full = seql / 4;
for i in 0..full {
seq[i] = encode_base(ascii[i * 4]) << 6
| encode_base(ascii[i * 4 + 1]) << 4
| encode_base(ascii[i * 4 + 2]) << 2
| encode_base(ascii[i * 4 + 3]);
}
let rem = seql % 4;
if rem > 0 {
let mut last = 0u8;
for j in 0..rem {
last |= encode_base(ascii[full * 4 + j]) << (6 - 2 * j);
}
seq[full] = last;
}
Self::new(count_to_tail(seql), seq.into_boxed_slice())
}
/// Encode a slice of 2-bit nucleotide values (0=A…3=T, length ≥ 1). Allocates once.
pub fn from_nucleotides(nucs: &[u8]) -> Self {
let seql = nucs.len();
debug_assert!(seql >= 1);
let n = byte_len(seql);
let mut seq = vec![0u8; n];
for (i, &nuc) in nucs.iter().enumerate() {
seq[i / 4] |= (nuc & 0b11) << (6 - 2 * (i % 4));
}
Self::new(count_to_tail(seql), seq.into_boxed_slice())
}
/// Write ASCII nucleotides into `writer`. Zero allocation.
pub fn write_ascii<W: Write>(&self, writer: &mut W) -> io::Result<()> {
let seql = self.seql();
let full = seql / 4;
for i in 0..full {
writer.write_all(&DEC4[self.seq[i] as usize].to_be_bytes())?;
}
let rem = seql % 4;
if rem > 0 {
writer.write_all(&DEC4[self.seq[full] as usize].to_be_bytes()[..rem])?;
}
Ok(())
}
/// Decode into a fresh ASCII `Vec<u8>`. Allocates.
#[inline]
pub fn to_ascii(&self) -> Vec<u8> {
let mut buf = Vec::with_capacity(self.seql());
self.write_ascii(&mut buf).unwrap();
buf
}
/// Reverse-complement in place. Zero allocation.
pub fn revcomp_inplace(&mut self) {
let seql = self.seql();
let n = self.seq.len();
{
let bytes = &mut self.seq[..n];
let (mut lo, mut hi) = (0, n - 1);
while lo < hi {
(bytes[lo], bytes[hi]) =
(REVCOMP4[bytes[hi] as usize], REVCOMP4[bytes[lo] as usize]);
lo += 1;
hi -= 1;
}
if lo == hi {
bytes[lo] = REVCOMP4[bytes[lo] as usize];
}
}
let shift = n * 8 - seql * 2;
if shift > 0 {
let bits = self.seq[..n].view_bits_mut::<Msb0>();
bits.rotate_left(shift);
let len = bits.len();
bits[len - shift..].fill(false);
}
// tail is invariant: seql is unchanged by revcomp
}
/// Returns `true` if in canonical form (lexicographic minimum of forward and revcomp).
pub fn is_canonical(&self) -> bool {
let seql = self.seql();
for i in 0..seql {
let fwd = self.nucleotide(i);
let rev = complement(self.nucleotide(seql - 1 - i));
match fwd.cmp(&rev) {
std::cmp::Ordering::Less => return true,
std::cmp::Ordering::Greater => return false,
std::cmp::Ordering::Equal => {}
}
}
true
}
/// Put in canonical form in place. Returns `true` if already canonical. Zero allocation.
#[inline]
pub fn canonicalize(&mut self) -> bool {
if self.is_canonical() {
return true;
}
self.revcomp_inplace();
false
}
/// Extract a kmer of length `L::len()` at nucleotide position `i`. Zero allocation.
fn extract<L: KmerLength>(&self, i: usize) -> Result<KmerOf<L>, KmerError> {
let len = L::len();
let seql = self.seql();
if i + len > seql {
return Err(KmerError::OutOfBounds { position: i, k: len, seql });
}
let bits = self.seq.view_bits::<Msb0>();
let raw: u64 = bits[i * 2..(i + len) * 2].load_be();
Ok(KmerOf::from_raw(raw << (64 - 2 * len)))
}
/// Extract the kmer of length `params::k()` at nucleotide position `i`. Zero allocation.
#[inline]
pub fn kmer(&self, i: usize) -> Result<Kmer, KmerError> {
self.extract::<KLen>(i)
}
/// Extract the canonical m-mer (minimizer) of length `params::m()` at position `i`. Zero allocation.
#[inline]
pub fn mmer(&self, i: usize) -> Result<Minimizer, KmerError> {
Ok(self.extract::<MLen>(i)?.canonical())
}
/// Extract the canonical kmer of length `params::k()` at position `i`. Zero allocation.
#[inline]
pub fn canonical_kmer(&self, i: usize) -> Result<CanonicalKmer, KmerError> {
Ok(self.kmer(i)?.canonical())
}
/// Iterate over all kmers of length `params::k()` in order. Zero allocation.
#[inline]
pub fn iter_kmers(&self) -> PackedSeqKmerIter<'_> {
PackedSeqKmerIter::new(self)
}
/// Iterate over all canonical kmers of length `params::k()` in order. Zero allocation.
#[inline]
pub fn iter_canonical_kmers(&self) -> impl Iterator<Item = CanonicalKmer> + '_ {
self.iter_kmers().map(|km| km.canonical())
}
/// Serialise to a compact binary representation.
///
/// Format: varint(seql) followed by raw packed bytes.
/// `tail` and `byte_len` are both derivable from `seql` and need not be stored.
pub fn write_to_binary<W: Write>(&self, w: &mut W) -> io::Result<()> {
write_varint(w, self.seql() as u64)?;
w.write_all(&self.seq)
}
/// Deserialise from the compact binary format produced by [`write_to_binary`].
/// Allocates exactly one `Box<[u8]>` for the packed bytes.
pub fn read_from_binary<R: Read>(r: &mut R) -> io::Result<Self> {
let seql = read_varint(r)? as usize;
if seql == 0 {
return Err(io::Error::new(io::ErrorKind::InvalidData, "empty sequence"));
}
let byte_len = (seql + 3) / 4;
let tail = (seql % 4) as u8;
let mut seq = vec![0u8; byte_len];
r.read_exact(&mut seq)?;
Ok(Self::new(tail, seq.into_boxed_slice()))
}
}
// ── PackedSeqKmerIter ─────────────────────────────────────────────────────────
/// Sliding-window kmer iterator over a [`PackedSeq`]. Zero allocation.
pub struct PackedSeqKmerIter<'a> {
seq: &'a PackedSeq,
mask: u64,
lshift: usize,
current: u64,
pos: usize,
max_pos: usize,
}
impl<'a> PackedSeqKmerIter<'a> {
fn new(seq: &'a PackedSeq) -> Self {
let seql = seq.seql();
let klen = k();
let lshift = 64 - klen * 2;
let mask = ((!0u128) << (lshift + 2)) as u64;
Self {
seq,
mask,
lshift,
current: if seql >= klen { seq.extract::<KLen>(0).map(|km| km.raw()).unwrap_or(0) } else { 0 },
pos: klen,
max_pos: seql,
}
}
}
impl Iterator for PackedSeqKmerIter<'_> {
type Item = Kmer;
fn next(&mut self) -> Option<Kmer> {
if self.pos > self.max_pos {
return None;
}
let result = Kmer::from_raw(self.current);
if self.pos < self.max_pos {
let inner_shift = 6 - 2 * (self.pos & 3);
let nuc = ((self.seq.seq[self.pos / 4] >> inner_shift) & 3) as u64;
self.current = ((self.current << 2) & self.mask) | (nuc << self.lshift);
}
self.pos += 1;
Some(result)
}
}
// ── varint (LEB128) ───────────────────────────────────────────────────────────
pub(crate) fn write_varint<W: Write>(w: &mut W, mut val: u64) -> io::Result<()> {
loop {
let mut byte = (val & 0x7F) as u8;
val >>= 7;
if val != 0 {
byte |= 0x80;
}
w.write_all(&[byte])?;
if val == 0 {
break;
}
}
Ok(())
}
pub(crate) fn read_varint<R: Read>(r: &mut R) -> io::Result<u64> {
let mut val = 0u64;
let mut shift = 0u32;
let mut buf = [0u8; 1];
loop {
r.read_exact(&mut buf)?;
let byte = buf[0];
val |= ((byte & 0x7F) as u64) << shift;
if byte & 0x80 == 0 {
break;
}
shift += 7;
if shift >= 64 {
return Err(io::Error::new(io::ErrorKind::InvalidData, "varint overflow"));
}
}
Ok(val)
}
// ── helpers ───────────────────────────────────────────────────────────────────
#[inline]
fn complement(base: u8) -> u8 {
!base & 0b11
}
#[inline]
fn byte_len(seql: usize) -> usize {
(seql + 3) / 4
}
/// Nucleotide count → `tail` value: 0 encodes 4, 13 are identity.
#[inline]
pub(crate) fn count_to_tail(seql: usize) -> u8 {
(seql % 4) as u8
}
/// `tail` value → nucleotide count in last byte: 0 means 4.
#[inline]
pub(crate) fn tail_count(tail: u8) -> usize {
if tail == 0 { 4 } else { tail as usize }
}
+102
View File
@@ -0,0 +1,102 @@
//! Global k-mer and minimizer length parameters, set once at program startup.
//!
//! # Production vs. test behaviour
//!
//! In production (`#[cfg(not(test))]`) both `K` and `M` are stored in a
//! [`OnceLock`]: they can be initialised exactly once; any attempt to set a
//! different value panics. This prevents silent divergence between the global
//! parameter and the values used to build data structures.
//!
//! In test builds (`#[cfg(test)]`) the same public API is backed by
//! `thread_local!` [`Cell`]s instead. Each test thread gets its own
//! independent copies of `K` and `M`, so tests can use arbitrary values
//! without coordinating with one another and without any reset mechanism.
//! The `OnceLock` constraint is deliberately absent: test isolation is
//! provided by thread locality, not by write-once semantics.
// ── Production implementation ─────────────────────────────────────────────────
#[cfg(not(any(test, feature = "test-utils")))]
mod state {
use std::sync::OnceLock;
static K: OnceLock<usize> = OnceLock::new();
static M: OnceLock<usize> = OnceLock::new();
pub fn set_k(k: usize) {
K.get_or_init(|| k);
assert_eq!(*K.get().unwrap(), k, "K already initialized to a different value");
}
pub fn k() -> usize {
*K.get().expect("K not initialized — call params::set_k or params::init first")
}
pub fn set_m(m: usize) {
M.get_or_init(|| m);
assert_eq!(*M.get().unwrap(), m, "M already initialized to a different value");
}
pub fn m() -> usize {
*M.get().expect("M not initialized — call params::set_m or params::init first")
}
}
// ── Test implementation ───────────────────────────────────────────────────────
//
// Each test thread owns its private K and M via thread_local!, so tests may
// call set_k / set_m with any value without affecting other tests.
#[cfg(any(test, feature = "test-utils"))]
mod state {
use std::cell::Cell;
thread_local! {
static K: Cell<usize> = Cell::new(0);
static M: Cell<usize> = Cell::new(0);
}
pub fn set_k(k: usize) { K.with(|c| c.set(k)); }
pub fn k() -> usize { K.with(|c| c.get()) }
pub fn set_m(m: usize) { M.with(|c| c.set(m)); }
pub fn m() -> usize { M.with(|c| c.get()) }
}
// ── Public API (identical signature in both configurations) ───────────────────
/// Initialise both K and M in one call.
///
/// In production, panics if either value has already been set to a different
/// value. In tests, simply overwrites the thread-local.
pub fn init(k: usize, m: usize) {
state::set_k(k);
state::set_m(m);
}
/// Set the k-mer length.
///
/// In production: idempotent for the same value, panics on conflict.
/// In tests: unconditionally updates the calling thread's value.
pub fn set_k(k: usize) {
state::set_k(k);
}
/// Returns the k-mer length. Panics if not yet initialized.
#[inline]
pub fn k() -> usize {
state::k()
}
/// Set the minimizer length.
///
/// In production: idempotent for the same value, panics on conflict.
/// In tests: unconditionally updates the calling thread's value.
pub fn set_m(m: usize) {
state::set_m(m);
}
/// Returns the minimizer length. Panics if not yet initialized.
#[inline]
pub fn m() -> usize {
state::m()
}
+59 -19
View File
@@ -1,9 +1,15 @@
//! Super-kmer with routing metadata: canonical sequence + pre-computed minimizer. //! Super-kmer with routing metadata: canonical sequence + pre-computed minimizer.
use super::kmer::CanonicalKmer; use serde::Serialize;
use super::SuperKmer;
/// Owned wrapper that pairs a canonical [`SuperKmer`] with its minimizer [`Kmer`]. use crate::Annotation;
use crate::Sequence;
use crate::SuperKmer;
use crate::kmer::Minimizer;
use crate::packed_seq::{PackedSeq, count_to_tail};
use crate::params::m;
/// Owned wrapper that pairs a canonical [`SuperKmer`] with its pre-computed minimizer.
/// ///
/// Created at the single point where raw sequence bytes are emitted from the /// Created at the single point where raw sequence bytes are emitted from the
/// scratch buffer. The minimizer position (given in original orientation) is /// scratch buffer. The minimizer position (given in original orientation) is
@@ -11,30 +17,37 @@ use super::SuperKmer;
/// [`into_superkmer`] to discard the metadata and continue with the bare sequence. /// [`into_superkmer`] to discard the metadata and continue with the bare sequence.
/// ///
/// [`into_superkmer`]: RoutableSuperKmer::into_superkmer /// [`into_superkmer`]: RoutableSuperKmer::into_superkmer
#[derive(Clone)]
pub struct RoutableSuperKmer { pub struct RoutableSuperKmer {
superkmer: SuperKmer, superkmer: SuperKmer,
minimizer: CanonicalKmer, minimizer: Minimizer,
} }
#[derive(Serialize)]
struct SKRAnnotation {
seq_length: usize,
count: u32,
}
impl Annotation for SKRAnnotation {}
impl RoutableSuperKmer { impl RoutableSuperKmer {
/// Construct from raw packed bytes. /// Construct from raw packed bytes.
/// ///
/// `min_pos` is the 0-based minimizer position in the **original** (pre-flip) /// `min_pos` is the 0-based minimizer position in the **original** (pre-flip)
/// orientation. `m` is the minimizer length. `seql` and `seq` are the /// orientation. `seql` is the nucleotide count. The sequence is canonicalised
/// raw length byte and 2-bit-packed nucleotides as produced by the scratch /// in place; `min_pos` is adjusted accordingly.
/// buffer. pub fn build(min_pos: usize, seql: usize, seq: Box<[u8]>) -> Self {
pub fn build(min_pos: usize, m: usize, seql: u8, seq: Box<[u8]>) -> Self { let mut inner = PackedSeq::new(count_to_tail(seql), seq);
let (sk, already_canonical) = SuperKmer::build(seql, seq); let already_canonical = inner.canonicalize();
let adjusted_pos = if already_canonical { let adjusted_pos = if already_canonical {
min_pos min_pos
} else { } else {
sk.len() - m - min_pos seql - m() - min_pos
}; };
let minimizer = sk.kmer(adjusted_pos, m).unwrap().canonical(m); let minimizer = inner.mmer(adjusted_pos).unwrap();
Self { let superkmer = SuperKmer { count: 1, inner };
superkmer: sk, Self { superkmer, minimizer }
minimizer,
}
} }
/// Borrow the canonical super-kmer sequence. /// Borrow the canonical super-kmer sequence.
@@ -42,8 +55,8 @@ impl RoutableSuperKmer {
&self.superkmer &self.superkmer
} }
/// Borrow the canonical minimizer kmer. /// Borrow the canonical minimizer.
pub fn minimizer(&self) -> &CanonicalKmer { pub fn minimizer(&self) -> &Minimizer {
&self.minimizer &self.minimizer
} }
@@ -53,7 +66,34 @@ impl RoutableSuperKmer {
} }
/// Sequence length in nucleotides. /// Sequence length in nucleotides.
pub fn len(&self) -> usize { pub fn seql(&self) -> usize {
self.superkmer.len() self.superkmer.seql()
}
}
impl Sequence for RoutableSuperKmer {
type Canonical = RoutableSuperKmer;
fn seql(&self) -> usize {
self.superkmer.seql()
}
fn nucleotide(&self, i: usize) -> u8 {
self.superkmer.nucleotide(i)
}
fn seq_hash(&self) -> u64 {
self.minimizer.seq_hash()
}
fn canonical(&self) -> Self::Canonical {
self.clone()
}
fn annotation(&self) -> impl Annotation {
SKRAnnotation {
seq_length: self.superkmer.seql(),
count: self.superkmer.count(),
}
} }
} }
+67 -4
View File
@@ -1,8 +1,71 @@
use crate::Annotation; use std::io::{self, Write};
use crate::Annotation;
use crate::annotations::BasicAnnotation;
/// Common interface for all 2-bit packed DNA sequences in the pipeline.
///
/// Required methods: `Canonical`, `seql`, `nucleotide`, `seq_hash`, `canonical`.
/// All other methods have default implementations derived from those five.
pub trait Sequence { pub trait Sequence {
fn sequence(&self) -> Box<[u8]>; /// The canonical form of this sequence type.
fn canonical(&self) -> &Self; ///
/// For types always stored canonical (`SuperKmer`, `CanonicalKmerOf`), set `Canonical = Self`.
/// For `KmerOf`, set `Canonical = CanonicalKmerOf`.
type Canonical: Sequence;
/// Sequence length in nucleotides.
fn seql(&self) -> usize;
/// Extract nucleotide `i` (0-based from 5 end) as a 2-bit value (A=0, C=1, G=2, T=3).
fn nucleotide(&self, i: usize) -> u8;
/// Hash of the sequence, used for partitioning and routing.
fn seq_hash(&self) -> u64; fn seq_hash(&self) -> u64;
fn annotation(&self) -> Annotation;
/// Return the canonical form.
///
/// For `Copy` types this is free; for heap-backed types it clones (output/debug paths only).
fn canonical(&self) -> Self::Canonical;
/// Return an annotation describing this sequence's metadata.
///
/// Default: `BasicAnnotation { seq_length }`. Override for richer metadata.
fn annotation(&self) -> impl Annotation {
BasicAnnotation { seq_length: self.seql() }
}
/// Decode into ASCII nucleotides, writing into `writer`.
///
/// Default: one byte per nucleotide via `nucleotide()`.
/// Types with packed byte access should override with the faster DEC4 path.
fn write_ascii<W: Write>(&self, w: &mut W) -> io::Result<()> {
for i in 0..self.seql() {
w.write_all(&[b"ACGT"[self.nucleotide(i) as usize]])?;
}
Ok(())
}
/// Decode into a fresh ASCII `Vec<u8>`.
fn to_ascii(&self) -> Vec<u8> {
let mut buf = Vec::with_capacity(self.seql());
self.write_ascii(&mut buf).unwrap();
buf
}
/// Partition index derived from `seq_hash`.
///
/// * `part_bits` — number of low bits to use (partition count = `1 << part_bits`).
fn partition(&self, part_bits: usize) -> usize {
(mix64(self.seq_hash()) & ((1 << part_bits) - 1)) as usize
}
}
#[inline]
pub(crate) fn mix64(x: u64) -> u64 {
let x = x ^ (x >> 30);
let x = x.wrapping_mul(0xbf58476d1ce4e5b9);
let x = x ^ (x >> 27);
let x = x.wrapping_mul(0x94d049bb133111eb);
x ^ (x >> 31)
} }
+113 -328
View File
@@ -1,84 +1,44 @@
//! Compact 2-bit DNA super-kmer with in-place reverse complement and canonical form. //! Canonical 2-bit DNA super-kmer with occurrence count.
use std::io::{self, Write}; //!
//! Delegates all sequence operations to [`PackedSeq`].
//!
//! On-disk header word (32 bits): `(count << 2) | tail` — 30-bit count, 2-bit tail.
use std::io::{self, Read, Write};
use bitvec::prelude::*;
use serde::Serialize; use serde::Serialize;
use xxhash_rust::xxh3::xxh3_64; use xxhash_rust::xxh3::xxh3_64;
use crate::Annotation;
use crate::Sequence; use crate::Sequence;
use crate::encoding::{DEC4, encode_base};
use crate::kmer::{CanonicalKmer, Kmer, KmerError}; use crate::kmer::{CanonicalKmer, Kmer, KmerError};
use crate::revcomp_lookup::REVCOMP4; use crate::packed_seq::{PackedSeq, read_varint, write_varint};
// ── SuperKmerHeader ─────────────────────────────────────────────────────────── // ── SKAnnotation ──────────────────────────────────────────────────────────────
/// 32-bit super-kmer header.
///
/// Bit layout (MSB → LSB):
///
/// ```text
/// [31 .......... 8] [7 ...... 0]
/// count (24 b) SEQL (8 b)
/// ```
///
/// SEQL encodes the sequence length: 1255 map directly; 0 encodes 256.
/// The count field starts at 1 and accumulates occurrence counts during
/// deduplication.
#[derive(Debug, Clone, Copy)]
pub(crate) struct SuperKmerHeader(u32);
impl SuperKmerHeader {
pub(crate) fn new(seql: u8) -> Self {
Self((1 << 8) | seql as u32)
}
fn seql(&self) -> u8 {
self.0 as u8
}
fn count(&self) -> u32 {
self.0 >> 8
}
fn increment(&mut self) {
self.0 += 1 << 8;
}
fn add(&mut self, n: u32) {
self.0 += n << 8;
}
fn set_count(&mut self, n: u32) {
self.0 = (self.0 & 0xFF) | (n << 8);
}
}
#[derive(Serialize)] #[derive(Serialize)]
struct SKAnnotation { struct SKAnnotation {
seq_length: usize, seq_length: usize,
kmer_size: usize,
minimizer_size: usize,
partition: u32,
count: u32, count: u32,
} }
impl Annotation for SKAnnotation {}
// ── SuperKmer ───────────────────────────────────────────────────────────────── // ── SuperKmer ─────────────────────────────────────────────────────────────────
/// Canonical super-kmer: 32-bit header followed by a byte-aligned 2-bit nucleotide sequence. /// Canonical super-kmer: occurrence count + 2-bit packed DNA sequence.
/// Nucleotide 0 is at the MSB of `seq[0]`. Always stored in canonical form.
/// ///
/// `PartialEq`, `Eq`, and `Hash` compare only sequence content (seql + seq bytes), /// Always stored in canonical form (lex min of forward and revcomp).
/// ignoring the count / minimizer-pos payload — two records with identical sequences /// `PartialEq`/`Hash` compare only sequence content, ignoring count.
/// but different counts are considered equal.
#[derive(Debug, Clone)] #[derive(Debug, Clone)]
pub struct SuperKmer { pub struct SuperKmer {
header: SuperKmerHeader, pub(crate) count: u32,
seq: Box<[u8]>, pub(crate) inner: PackedSeq,
} }
impl PartialEq for SuperKmer { impl PartialEq for SuperKmer {
fn eq(&self, other: &Self) -> bool { fn eq(&self, other: &Self) -> bool {
self.header.seql() == other.header.seql() && self.seq == other.seq self.inner == other.inner
} }
} }
@@ -86,318 +46,143 @@ impl Eq for SuperKmer {}
impl std::hash::Hash for SuperKmer { impl std::hash::Hash for SuperKmer {
fn hash<H: std::hash::Hasher>(&self, state: &mut H) { fn hash<H: std::hash::Hasher>(&self, state: &mut H) {
self.header.seql().hash(state); self.inner.hash(state);
self.seq.hash(state);
} }
} }
impl Sequence for SuperKmer { impl Sequence for SuperKmer {
fn sequence(&self) -> Box<[u8]> { type Canonical = SuperKmer;
self.seq.clone()
fn seql(&self) -> usize {
self.inner.seql()
} }
fn canonical(&self) -> &Self { fn nucleotide(&self, i: usize) -> u8 {
&self self.inner.nucleotide(i)
} }
/// Returns the XXH3-64 hash of the packed sequence bytes.
fn seq_hash(&self) -> u64 { fn seq_hash(&self) -> u64 {
xxh3_64(&self.seq) xxh3_64(self.inner.seq_bytes())
} }
fn annotation(&self) -> Annotation {} fn canonical(&self) -> Self::Canonical {
self.clone()
} }
fn annotation(&self) -> impl Annotation {
SKAnnotation {
seq_length: self.inner.seql(),
count: self.count,
}
}
}
impl SuperKmer { impl SuperKmer {
/// `seql` is the raw stored byte: 1255 for lengths 1255, 0 for length 256. /// Encode ASCII nucleotides (length ≥ 1) into a canonical SuperKmer.
pub fn new(seql: u8, seq: Box<[u8]>) -> Self {
Self::build(seql, seq).0
}
/// Construct and canonicalise in place, returning `(sk, already_canonical)`.
/// `already_canonical` is `true` when the sequence was not flipped.
pub fn build(seql: u8, seq: Box<[u8]>) -> (Self, bool) {
let mut sk = Self {
header: SuperKmerHeader::new(seql),
seq,
};
let already_canonical = sk.canonical(); // true = pas retourné
(sk, already_canonical)
}
/// Deserialise from a raw 32-bit header word and packed sequence bytes.
/// Preserves the full header payload (count or minimizer_pos in bits [31:8]).
pub fn from_header_bits(bits: u32, seq: Box<[u8]>) -> Self {
let seql = (bits & 0xFF) as u8;
let len = stored_to_len(seql);
debug_assert_eq!(seq.len(), byte_len(len));
let sk = Self {
header: SuperKmerHeader(bits),
seq,
};
debug_assert!(
sk.is_canonical(),
"SuperKmer deserialised from disk is not canonical"
);
sk
}
/// Returns the sequence length in nucleotides (1256).
pub fn len(&self) -> usize {
stored_to_len(self.header.seql())
}
/// Returns the occurrence count of this super-kmer.
pub fn count(&self) -> u32 {
self.header.count()
}
/// Increments the occurrence count by 1.
pub fn increment(&mut self) {
self.header.increment();
}
/// Adds `n` to the occurrence count.
pub fn add(&mut self, n: u32) {
self.header.add(n);
}
/// Sets the occurrence count to an absolute value.
pub fn set_count(&mut self, n: u32) {
self.header.set_count(n);
}
/// Extract nucleotide i (0-based from 5' end) as a 2-bit value.
pub fn nucleotide(&self, i: usize) -> u8 {
(self.seq[i / 4] >> (6 - 2 * (i % 4))) & 0b11
}
/// Reverse-complement this super-kmer in place.
///
/// This method is only used internally by the build method.
fn revcomp(&mut self) {
let seql = self.len();
let n = byte_len(seql);
// Step 1: swap bytes outside-in, applying revcomp4 to each.
{
let bytes = &mut self.seq[..n];
let (mut lo, mut hi) = (0, n - 1);
while lo < hi {
(bytes[lo], bytes[hi]) =
(REVCOMP4[bytes[hi] as usize], REVCOMP4[bytes[lo] as usize]);
lo += 1;
hi -= 1;
}
if lo == hi {
bytes[lo] = REVCOMP4[bytes[lo] as usize];
}
}
// Step 2: left-shift to flush padding T's introduced by complementing padding A's.
let shift = n * 8 - seql * 2;
if shift > 0 {
let bits = self.seq[..n].view_bits_mut::<Msb0>();
bits.rotate_left(shift);
let len = bits.len();
bits[len - shift..].fill(false);
}
}
/// Encode an ASCII nucleotide sequence (ACGT, length 1256) into a canonical SuperKmer.
pub fn from_ascii(ascii: &[u8]) -> Self { pub fn from_ascii(ascii: &[u8]) -> Self {
let seql = ascii.len(); let mut inner = PackedSeq::from_ascii(ascii);
debug_assert!( inner.canonicalize();
seql >= 1 && seql <= 256, Self { count: 1, inner }
"super-kmer length must be 1..=256"
);
let n = byte_len(seql);
let mut seq = vec![0u8; n];
let full = seql / 4;
for i in 0..full {
seq[i] = encode_base(ascii[i * 4]) << 6
| encode_base(ascii[i * 4 + 1]) << 4
| encode_base(ascii[i * 4 + 2]) << 2
| encode_base(ascii[i * 4 + 3]);
}
let rem = seql % 4;
if rem > 0 {
let mut last = 0u8;
for j in 0..rem {
last |= encode_base(ascii[full * 4 + j]) << (6 - 2 * j);
}
seq[full] = last;
} }
Self::new(seql as u8, seq.into_boxed_slice()) // 256usize as u8 == 0, intentional /// Wrap a pre-built [`PackedSeq`], canonicalising in place.
pub fn build(mut inner: PackedSeq) -> Self {
inner.canonicalize();
Self { count: 1, inner }
} }
/// Decode this super-kmer sequence into ASCII nucleotides, writing into `writer`. /// Serialise to compact binary. Format: varint(count) + varint((byte_len << 2) | tail) + bytes.
pub fn write_ascii<W: Write>(&self, writer: &mut W) -> io::Result<()> { pub fn write_to_binary<W: Write>(&self, w: &mut W) -> io::Result<()> {
let seql = self.len(); write_varint(w, self.count as u64)?;
let full = seql / 4; self.inner.write_to_binary(w)
for i in 0..full {
writer.write_all(&DEC4[self.seq[i] as usize].to_be_bytes())?;
}
let rem = seql % 4;
if rem > 0 {
let bytes = DEC4[self.seq[full] as usize].to_be_bytes();
writer.write_all(&bytes[..rem])?;
}
Ok(())
} }
/// Decode this super-kmer sequence into a fresh ASCII `Vec<u8>`. /// Deserialise from the binary format produced by [`write_to_binary`].
pub fn to_ascii(&self) -> Vec<u8> { /// Allocates exactly one `Box<[u8]>` for the packed bytes.
let mut buf = Vec::with_capacity(self.len()); pub fn read_from_binary<R: Read>(r: &mut R) -> io::Result<Self> {
self.write_ascii(&mut buf).unwrap(); let count = read_varint(r)? as u32;
buf let inner = PackedSeq::read_from_binary(r)?;
debug_assert!(inner.is_canonical(), "SuperKmer from disk is not canonical");
Ok(Self { count, inner })
} }
/// Returns the raw 32-bit header word for binary serialisation. /// Sequence length in nucleotides.
/// Bits [7:0] = seql encoding (0→256, 1-255 direct). Bits [31:8] = payload.
#[inline] #[inline]
pub fn header_bits(&self) -> u32 { pub fn seql(&self) -> usize {
self.header.0 self.inner.seql()
} }
/// Returns a read-only view of the packed 2-bit sequence bytes. /// Occurrence count.
/// Length is always `(seql() + 3) / 4` bytes. #[inline]
pub fn count(&self) -> u32 {
self.count
}
/// Increment occurrence count by 1.
#[inline]
pub fn increment(&mut self) {
self.count += 1;
}
/// Add `n` to the occurrence count.
#[inline]
pub fn add(&mut self, n: u32) {
self.count += n;
}
/// Set the occurrence count to `n`.
#[inline]
pub fn set_count(&mut self, n: u32) {
self.count = n;
}
/// Read-only view of packed 2-bit bytes.
#[inline] #[inline]
pub fn seq_bytes(&self) -> &[u8] { pub fn seq_bytes(&self) -> &[u8] {
&self.seq self.inner.seq_bytes()
} }
/// Extract the kmer of length k starting at nucleotide position i (0-based). /// Extract nucleotide i (0-based from 5 end) as a 2-bit value.
/// #[inline]
/// Returns an error if k is invalid (0 or > 32) or if position i + k exceeds the sequence length. pub fn nucleotide(&self, i: usize) -> u8 {
pub fn kmer(&self, i: usize, k: usize) -> Result<Kmer, KmerError> { self.inner.nucleotide(i)
if k == 0 || k > 32 {
return Err(KmerError::InvalidK { k });
}
let seql = self.len();
if i + k > seql {
return Err(KmerError::OutOfBounds {
position: i,
k,
seql,
});
}
let bits = self.seq.view_bits::<Msb0>();
let raw: u64 = bits[i * 2..(i + k) * 2].load_be();
Ok(Kmer::from_raw(raw << (64 - 2 * k)))
} }
/// Extract the canonical kmer of length k starting at nucleotide position i (0-based). /// Extract the k-mer at position `i` using `params::k()`.
/// #[inline]
/// Returns an error if k is invalid (0 or > 32) or if position i + k exceeds the sequence length. pub fn kmer(&self, i: usize) -> Result<Kmer, KmerError> {
pub fn canonical_kmer(&self, i: usize, k: usize) -> Result<CanonicalKmer, KmerError> { self.inner.kmer(i)
Ok(self.kmer(i, k)?.canonical(k))
} }
/// Put this super-kmer in canonical form (lexicographic minimum of forward and revcomp). /// Extract the canonical k-mer at position `i`.
/// #[inline]
/// Returns `true` if already canonical (no change), `false` if revcomp was applied. pub fn canonical_kmer(&self, i: usize) -> Result<CanonicalKmer, KmerError> {
fn canonical(&mut self) -> bool { self.inner.canonical_kmer(i)
if self.is_canonical() {
return true;
}
self.revcomp();
false
} }
/// Returns `true` if this super-kmer is in canonical form (lexicographic minimum of forward and revcomp). /// Decode into ASCII, writing into `writer`.
fn is_canonical(&self) -> bool { #[inline]
let seql = self.len(); pub fn write_ascii<W: std::io::Write>(&self, writer: &mut W) -> std::io::Result<()> {
for i in 0..seql { self.inner.write_ascii(writer)
let fwd = self.nucleotide(i);
let rev = complement(self.nucleotide(seql - 1 - i));
if fwd < rev {
return true;
}
if fwd > rev {
return false;
}
}
true
} }
/// Iterate over all kmers of length `k` in order, yielding each as a left-aligned [`Kmer`]. /// Decode into a fresh ASCII `Vec<u8>`.
pub fn iter_kmers(&self, k: usize) -> impl Iterator<Item = Kmer> + '_ { #[inline]
SKKmerIter::new(self, k) pub fn to_ascii(&self) -> Vec<u8> {
self.inner.to_ascii()
} }
/// Iterate over all canonical kmers of length `k` in order. /// Iterate over all k-mers of length `params::k()` in order.
pub fn iter_canonical_kmers(&self, k: usize) -> impl Iterator<Item = CanonicalKmer> + '_ { #[inline]
self.iter_kmers(k).map(move |km| km.canonical(k)) pub fn iter_kmers(&self) -> impl Iterator<Item = Kmer> + '_ {
} self.inner.iter_kmers()
} }
struct SKKmerIter<'a> { /// Iterate over all canonical k-mers in order.
skmer: &'a SuperKmer, #[inline]
mask: u64, pub fn iter_canonical_kmers(&self) -> impl Iterator<Item = CanonicalKmer> + '_ {
lshift: usize, self.inner.iter_canonical_kmers()
current: u64,
pos: usize,
max_pos: usize,
} }
impl<'a> SKKmerIter<'a> {
fn new(skmer: &'a SuperKmer, k: usize) -> Self {
let seql = skmer.len();
let lshift = 64 - k * 2;
let mask = ((!0u128) << (lshift + 2)) as u64;
Self {
skmer,
mask,
lshift,
current: if seql >= k {
skmer.kmer(0, k).unwrap().raw()
} else {
0
},
pos: k,
max_pos: seql,
}
}
}
impl<'a> Iterator for SKKmerIter<'a> {
type Item = Kmer;
fn next(&mut self) -> Option<Self::Item> {
if self.pos > self.max_pos {
return None;
}
// Emit current kmer first, then slide the window forward.
let result = Kmer::from_raw(self.current);
if self.pos < self.max_pos {
let byte_pos = self.pos / 4;
// Nucleotide at position r within its byte occupies bits 7-2r (MSB) and 6-2r (LSB).
// Extract right-aligned, then place at lshift.
let inner_shift = 6 - 2 * (self.pos & 3);
let nuc = (((self.skmer.seq[byte_pos] >> inner_shift) & 3) as u64) << self.lshift;
self.current = ((self.current << 2) & self.mask) | nuc;
}
self.pos += 1;
Some(result)
}
}
// ── helpers ───────────────────────────────────────────────────────────────────
fn complement(base: u8) -> u8 {
!base & 0b11
}
fn byte_len(seql: usize) -> usize {
(seql + 3) / 4
}
/// Stored u8 → actual length: 0 encodes 256, 1255 are identity.
fn stored_to_len(s: u8) -> usize {
if s == 0 { 256 } else { s as usize }
} }
#[cfg(test)] #[cfg(test)]
+213
View File
@@ -0,0 +1,213 @@
use super::*;
#[cfg(test)]
mod tests {
use super::*;
// Tests use ConstLen<N> — no dependency on global params singletons.
type K1 = KmerOf<ConstLen<1>>;
type K4 = KmerOf<ConstLen<4>>;
fn ascii_revcomp(seq: &[u8]) -> Vec<u8> {
seq.iter()
.rev()
.map(|&b| match b {
b'A' => b'T',
b'T' => b'A',
b'C' => b'G',
b'G' => b'C',
_ => b'A',
})
.collect()
}
fn make_seq<const N: usize>() -> Vec<u8> {
(0..N).map(|i| b"ACGT"[i % 4]).collect()
}
// ── from_ascii / to_ascii ─────────────────────────────────────────────────
#[test]
fn ascii_roundtrip() {
macro_rules! check {
($n:expr) => {{
let ascii = make_seq::<$n>();
let kmer = KmerOf::<ConstLen<$n>>::from_ascii(&ascii).unwrap();
assert_eq!(kmer.to_ascii(), ascii, "roundtrip failed for k={}", $n);
}};
}
check!(1);
check!(2);
check!(3);
check!(4);
check!(8);
check!(11);
check!(16);
check!(31);
check!(32);
}
#[test]
fn from_ascii_all_bases() {
for (base, expected) in [(b'A', b'A'), (b'C', b'C'), (b'G', b'G'), (b'T', b'T')] {
let kmer = K1::from_ascii(&[base]).unwrap();
assert_eq!(kmer.to_ascii(), vec![expected]);
}
}
#[test]
fn from_ascii_invalid_k() {
assert!(KmerOf::<ConstLen<0>>::from_ascii(b"A").is_err());
assert!(KmerOf::<ConstLen<33>>::from_ascii(b"ACGT").is_err());
}
#[test]
fn from_ascii_too_short() {
assert!(KmerOf::<ConstLen<4>>::from_ascii(b"ACG").is_err());
}
// ── nucleotide ────────────────────────────────────────────────────────────
#[test]
fn nucleotide_extraction() {
let kmer = K4::from_ascii(b"ACGT").unwrap();
assert_eq!(kmer.nucleotide(0), 0b00); // A
assert_eq!(kmer.nucleotide(1), 0b01); // C
assert_eq!(kmer.nucleotide(2), 0b10); // G
assert_eq!(kmer.nucleotide(3), 0b11); // T
}
// ── revcomp ───────────────────────────────────────────────────────────────
#[test]
fn revcomp_known_values() {
let cases: &[(&[u8], &[u8])] = &[
(b"A", b"T"),
(b"AC", b"GT"),
(b"ACG", b"CGT"),
(b"ACGT", b"ACGT"),
(b"AAAA", b"TTTT"),
(b"TTTT", b"AAAA"),
];
for (seq, expected) in cases {
macro_rules! check_len {
($n:expr) => {
if seq.len() == $n {
let kmer = KmerOf::<ConstLen<$n>>::from_ascii(seq).unwrap();
assert_eq!(
kmer.revcomp().to_ascii(),
*expected,
"revcomp wrong for \"{}\"",
std::str::from_utf8(seq).unwrap()
);
}
};
}
check_len!(1);
check_len!(2);
check_len!(3);
check_len!(4);
}
}
#[test]
fn revcomp_vs_reference() {
macro_rules! check {
($n:expr) => {{
let ascii = make_seq::<$n>();
let expected = ascii_revcomp(&ascii);
let rc = KmerOf::<ConstLen<$n>>::from_ascii(&ascii)
.unwrap()
.revcomp();
assert_eq!(rc.to_ascii(), expected, "revcomp wrong for k={}", $n);
}};
}
check!(1);
check!(4);
check!(8);
check!(11);
check!(16);
check!(31);
check!(32);
}
#[test]
fn revcomp_involution() {
macro_rules! check {
($n:expr) => {{
let ascii = make_seq::<$n>();
let kmer = KmerOf::<ConstLen<$n>>::from_ascii(&ascii).unwrap();
assert_eq!(
kmer.revcomp().revcomp(),
kmer,
"revcomp∘revcomp≠id for k={}",
$n
);
}};
}
check!(1);
check!(4);
check!(8);
check!(16);
check!(31);
check!(32);
}
// ── canonical ─────────────────────────────────────────────────────────────
#[test]
fn canonical_palindrome() {
let kmer = K4::from_ascii(b"ACGT").unwrap();
assert_eq!(kmer.canonical().into_kmer(), kmer);
}
#[test]
fn canonical_chooses_lesser() {
let kmer = K4::from_ascii(b"TTTT").unwrap();
let expected = K4::from_ascii(b"AAAA").unwrap();
assert_eq!(kmer.canonical().into_kmer(), expected);
}
#[test]
fn canonical_is_minimal() {
macro_rules! check {
($n:expr) => {{
let ascii = make_seq::<$n>();
let ck = KmerOf::<ConstLen<$n>>::from_ascii(&ascii)
.unwrap()
.canonical();
let rc = ck.revcomp();
assert!(ck.raw() <= rc.raw(), "canonical not minimal for k={}", $n);
}};
}
check!(1);
check!(4);
check!(8);
check!(16);
check!(31);
check!(32);
}
#[test]
fn canonical_idempotent() {
macro_rules! check {
($n:expr) => {{
let ck = KmerOf::<ConstLen<$n>>::from_ascii(&make_seq::<$n>())
.unwrap()
.canonical();
assert_eq!(
ck.into_kmer().canonical(),
ck,
"canonical not idempotent for k={}",
$n
);
}};
}
check!(1);
check!(4);
check!(8);
check!(16);
check!(31);
check!(32);
}
}
+150 -280
View File
@@ -1,11 +1,10 @@
use super::*; use super::*;
use crate::set_k;
/// Repeating ACGT pattern of the given length.
fn make_seq(len: usize) -> Vec<u8> { fn make_seq(len: usize) -> Vec<u8> {
(0..len).map(|i| b"ACGT"[i % 4]).collect() (0..len).map(|i| b"ACGT"[i % 4]).collect()
} }
/// Reference revcomp on ASCII bytes.
fn ascii_revcomp(seq: &[u8]) -> Vec<u8> { fn ascii_revcomp(seq: &[u8]) -> Vec<u8> {
seq.iter() seq.iter()
.rev() .rev()
@@ -20,96 +19,93 @@ fn ascii_revcomp(seq: &[u8]) -> Vec<u8> {
} }
fn all_lengths() -> impl Iterator<Item = usize> { fn all_lengths() -> impl Iterator<Item = usize> {
(1..=9).chain([255, 256]) (1..=9).chain([255, 256, 257, 1000])
} }
// ── kmer extraction ─────────────────────────────────────────────────────── // ── from_ascii / canonical form ───────────────────────────────────────────────
#[test] #[test]
fn kmer_first_matches_from_ascii() { fn ascii_roundtrip_all_lengths() {
let ascii = b"ACGTACGT"; for len in all_lengths() {
let sk = SuperKmer::from_ascii(ascii); let ascii = make_seq(len);
let k = 4; let sk = SuperKmer::from_ascii(&ascii);
let kmer = sk.kmer(0, k).unwrap(); // SuperKmer stores in canonical form; ACGT pattern is already canonical.
let expected = crate::kmer::Kmer::from_ascii(&ascii[..k], k).unwrap(); assert_eq!(sk.to_ascii(), ascii, "roundtrip failed for len={len}");
assert_eq!(kmer, expected);
}
#[test]
fn kmer_last_position() {
let ascii = b"ACGTACGT";
let seql = ascii.len();
let k = 4;
let sk = SuperKmer::from_ascii(ascii);
let kmer = sk.kmer(seql - k, k).unwrap();
let expected = crate::kmer::Kmer::from_ascii(&ascii[seql - k..], k).unwrap();
assert_eq!(kmer, expected);
}
#[test]
fn kmer_all_positions() {
let ascii = b"ACGTACGTACGT";
let k = 4;
let sk = SuperKmer::from_ascii(ascii);
for i in 0..=ascii.len() - k {
let kmer = sk.kmer(i, k).unwrap();
let expected = crate::kmer::Kmer::from_ascii(&ascii[i..i + k], k).unwrap();
assert_eq!(kmer, expected, "mismatch at position {i}");
} }
} }
#[test] #[test]
fn kmer_out_of_bounds() { fn from_ascii_canonical_all_bases() {
// G×4 revcomp is C×4; T×4 revcomp is A×4.
for (base, expected) in [(b'A', b'A'), (b'C', b'C'), (b'G', b'C'), (b'T', b'A')] {
let ascii = vec![base; 4];
let sk = SuperKmer::from_ascii(&ascii);
assert_eq!(sk.to_ascii(), vec![expected; 4]);
}
}
#[test]
fn from_ascii_is_canonical_all_lengths() {
for len in all_lengths() {
let ascii = make_seq(len);
let sk = SuperKmer::from_ascii(&ascii);
let fwd = sk.to_ascii();
let rev = ascii_revcomp(&fwd);
assert!(fwd <= rev, "not canonical for len={len}");
}
}
// ── seql ──────────────────────────────────────────────────────────────────────
#[test]
fn seql_roundtrip() {
for len in all_lengths() {
let sk = SuperKmer::from_ascii(&make_seq(len));
assert_eq!(sk.seql(), len, "seql() wrong for len={len}");
}
}
// ── binary serialisation ──────────────────────────────────────────────────────
#[test]
fn binary_roundtrip() {
for len in all_lengths() {
let mut sk = SuperKmer::from_ascii(&make_seq(len));
sk.set_count(42);
let mut buf = Vec::new();
sk.write_to_binary(&mut buf).unwrap();
let sk2 = SuperKmer::read_from_binary(&mut buf.as_slice()).unwrap();
assert_eq!(
sk.to_ascii(),
sk2.to_ascii(),
"sequence mismatch for len={len}"
);
assert_eq!(sk2.count(), 42, "count mismatch for len={len}");
}
}
#[test]
fn binary_packed_seq_roundtrip() {
use crate::packed_seq::PackedSeq;
for len in all_lengths() {
let ps = PackedSeq::from_ascii(&make_seq(len));
let mut buf = Vec::new();
ps.write_to_binary(&mut buf).unwrap();
let ps2 = PackedSeq::read_from_binary(&mut buf.as_slice()).unwrap();
assert_eq!(ps, ps2, "PackedSeq mismatch for len={len}");
}
}
#[test]
fn binary_size_is_compact() {
// seql=4 (1 byte packed): varint(count=1, 1 byte) + varint((1<<2)|0=4, 1 byte) + 1 byte = 3 bytes
let sk = SuperKmer::from_ascii(b"ACGT"); let sk = SuperKmer::from_ascii(b"ACGT");
assert!(sk.kmer(2, 4).is_err()); // 2 + 4 > 4 let mut buf = Vec::new();
assert!(sk.kmer(4, 1).is_err()); // 4 + 1 > 4 sk.write_to_binary(&mut buf).unwrap();
assert_eq!(buf.len(), 3, "expected 3 bytes for 4-nt superkmer");
} }
#[test] // ── count ─────────────────────────────────────────────────────────────────────
fn kmer_invalid_k() {
let sk = SuperKmer::from_ascii(b"ACGT");
assert!(sk.kmer(0, 0).is_err());
assert!(sk.kmer(0, 33).is_err());
}
// ── canonical_kmer ────────────────────────────────────────────────────────
#[test]
fn canonical_kmer_is_min_of_kmer_and_revcomp() {
let sk = SuperKmer::from_ascii(b"ACGTACGT");
let k = 4;
for i in 0..=(sk.len() - k) {
let ck = sk.canonical_kmer(i, k).unwrap();
let fwd = sk.kmer(i, k).unwrap();
assert_eq!(ck, fwd.canonical(k));
}
}
#[test]
fn canonical_kmer_palindrome_unchanged() {
// ACGT is its own reverse complement
let sk = SuperKmer::from_ascii(b"ACGT");
let ck = sk.canonical_kmer(0, 4).unwrap();
let fwd = sk.kmer(0, 4).unwrap();
assert_eq!(ck.into_kmer(), fwd);
}
#[test]
fn canonical_kmer_tttt_becomes_aaaa() {
let sk = SuperKmer::from_ascii(b"TTTT");
let ck = sk.canonical_kmer(0, 4).unwrap();
let expected = Kmer::from_ascii(b"AAAA", 4).unwrap();
assert_eq!(ck.into_kmer(), expected);
}
#[test]
fn canonical_kmer_errors_propagate() {
let sk = SuperKmer::from_ascii(b"ACGT");
assert!(sk.canonical_kmer(2, 4).is_err()); // out of bounds
assert!(sk.canonical_kmer(0, 0).is_err()); // invalid k
}
// ── count ─────────────────────────────────────────────────────────────────
#[test] #[test]
fn count_starts_at_one() { fn count_starts_at_one() {
@@ -144,30 +140,15 @@ fn set_count_overwrites() {
} }
#[test] #[test]
fn increment_preserves_seql() { fn count_operations_preserve_seql() {
for len in all_lengths() { for len in all_lengths() {
let mut sk = SuperKmer::from_ascii(&make_seq(len)); let mut sk = SuperKmer::from_ascii(&make_seq(len));
sk.increment(); sk.increment();
assert_eq!(sk.len(), len, "increment altered seql for len={len}"); assert_eq!(sk.seql(), len, "increment altered seql for len={len}");
}
}
#[test]
fn add_preserves_seql() {
for len in all_lengths() {
let mut sk = SuperKmer::from_ascii(&make_seq(len));
sk.add(1000); sk.add(1000);
assert_eq!(sk.len(), len, "add altered seql for len={len}"); assert_eq!(sk.seql(), len, "add altered seql for len={len}");
}
}
#[test]
fn set_count_preserves_seql() {
for len in all_lengths() {
let mut sk = SuperKmer::from_ascii(&make_seq(len));
sk.set_count(999); sk.set_count(999);
assert_eq!(sk.len(), len, "set_count altered seql for len={len}"); assert_eq!(sk.seql(), len, "set_count altered seql for len={len}");
assert_eq!(sk.count(), 999);
} }
} }
@@ -179,247 +160,136 @@ fn count_does_not_affect_sequence() {
assert_eq!(sk.to_ascii(), ascii); assert_eq!(sk.to_ascii(), ascii);
} }
// ── seql encoding ───────────────────────────────────────────────────────── // ── kmer extraction ───────────────────────────────────────────────────────────
#[test] #[test]
fn seql_roundtrip() { fn kmer_first_matches_from_ascii() {
for len in all_lengths() { set_k(4);
let sk = SuperKmer::from_ascii(&make_seq(len)); let k = crate::params::k();
assert_eq!(sk.len(), len, "seql() wrong for len={len}"); let ascii = b"ACGTACGT";
let sk = SuperKmer::from_ascii(ascii);
let kmer = sk.kmer(0).unwrap();
let expected = crate::kmer::Kmer::from_ascii(&ascii[..k]).unwrap();
assert_eq!(kmer, expected);
}
#[test]
fn kmer_all_positions() {
set_k(4);
let k = crate::params::k();
let ascii = b"ACGTACGTACGT";
let sk = SuperKmer::from_ascii(ascii);
for i in 0..=ascii.len() - k {
let kmer = sk.kmer(i).unwrap();
let expected = crate::kmer::Kmer::from_ascii(&ascii[i..i + k]).unwrap();
assert_eq!(kmer, expected, "mismatch at position {i}");
} }
} }
#[test] #[test]
fn seql_256_stored_as_zero() { fn kmer_out_of_bounds() {
let sk = SuperKmer::from_ascii(&make_seq(256)); set_k(4);
assert_eq!(sk.header.seql(), 0u8); let sk = SuperKmer::from_ascii(b"ACGT"); // seql=4, k=4
assert_eq!(sk.len(), 256); assert!(sk.kmer(1).is_err()); // 1 + 4 > 4
} }
// ── from_ascii / to_ascii roundtrip ─────────────────────────────────────── // ── canonical_kmer ────────────────────────────────────────────────────────────
#[test] #[test]
fn ascii_roundtrip_all_lengths() { fn canonical_kmer_is_min_of_kmer_and_revcomp() {
for len in all_lengths() { set_k(4);
let ascii = make_seq(len); let k = crate::params::k();
let sk = SuperKmer::from_ascii(&ascii); let sk = SuperKmer::from_ascii(b"ACGTACGT");
assert_eq!(sk.to_ascii(), ascii, "roundtrip failed for len={len}"); for i in 0..=(sk.seql() - k) {
let ck = sk.canonical_kmer(i).unwrap();
let fwd = sk.kmer(i).unwrap();
assert_eq!(ck, fwd.canonical());
} }
} }
#[test] #[test]
fn ascii_roundtrip_all_bases() { fn canonical_kmer_palindrome_unchanged() {
// Canonical form: min(seq, revcomp). G×4 flips to C×4, T×4 flips to A×4. set_k(4);
for (base, expected) in [(b'A', b'A'), (b'C', b'C'), (b'G', b'C'), (b'T', b'A')] { let sk = SuperKmer::from_ascii(b"ACGT"); // ACGT is its own revcomp
let ascii = vec![base; 4]; let ck = sk.canonical_kmer(0).unwrap();
let sk = SuperKmer::from_ascii(&ascii); let fwd = sk.kmer(0).unwrap();
assert_eq!(sk.to_ascii(), vec![expected; 4]); assert_eq!(ck.into_kmer(), fwd);
}
}
// ── revcomp correctness ───────────────────────────────────────────────────
/// Known (seq, expected_revcomp) pairs — one per shift value × two byte counts.
#[test]
fn revcomp_known_values() {
let cases = [
// shift=6
("A", "T"),
("ACGTA", "TACGT"),
// shift=4
("AC", "GT"),
("ACGTAC", "GTACGT"),
// shift=2
("ACG", "CGT"),
("ACGTACG", "CGTACGT"),
// shift=0
("ACGT", "ACGT"),
("ACGTACGT", "ACGTACGT"),
];
for (seq, expected) in cases {
let mut sk = SuperKmer::from_ascii(seq.as_bytes());
sk.revcomp();
assert_eq!(
sk.to_ascii(),
expected.as_bytes(),
"revcomp wrong for \"{seq}\""
);
}
} }
#[test] #[test]
fn revcomp_vs_reference_all_lengths() { fn canonical_kmer_errors_propagate() {
for len in all_lengths() { set_k(4);
let ascii = make_seq(len); let sk = SuperKmer::from_ascii(b"ACGT");
let expected = ascii_revcomp(&ascii); assert!(sk.canonical_kmer(1).is_err()); // out of bounds: 1 + 4 > 4
let mut sk = SuperKmer::from_ascii(&ascii);
sk.revcomp();
assert_eq!(sk.to_ascii(), expected, "revcomp wrong for len={len}");
}
} }
#[test] // ── iter_kmers ────────────────────────────────────────────────────────────────
fn revcomp_involution_all_lengths() {
for len in all_lengths() {
let ascii = make_seq(len);
let mut sk = SuperKmer::from_ascii(&ascii);
sk.revcomp();
sk.revcomp();
assert_eq!(sk.to_ascii(), ascii, "revcomp∘revcomp≠id for len={len}");
}
}
// ── canonical ─────────────────────────────────────────────────────────────
#[test]
fn canonical_palindrome_unchanged() {
// ACGT is its own revcomp
let mut sk = SuperKmer::from_ascii(b"ACGT");
sk.canonical();
assert_eq!(sk.to_ascii(), b"ACGT");
}
#[test]
fn canonical_chooses_forward() {
// "AAAA" < "TTTT" → stays as-is
let mut sk = SuperKmer::from_ascii(b"AAAA");
sk.canonical();
assert_eq!(sk.to_ascii(), b"AAAA");
}
#[test]
fn canonical_chooses_revcomp() {
// "TTTT" > "AAAA" → flipped
let mut sk = SuperKmer::from_ascii(b"TTTT");
sk.canonical();
assert_eq!(sk.to_ascii(), b"AAAA");
}
#[test]
fn canonical_is_minimal_all_lengths() {
for len in all_lengths() {
let ascii = make_seq(len);
let mut sk = SuperKmer::from_ascii(&ascii);
sk.canonical();
let fwd = sk.to_ascii();
let rev = ascii_revcomp(&fwd);
assert!(fwd <= rev, "canonical not minimal for len={len}");
}
}
// ── iter_kmers ────────────────────────────────────────────────────────────
#[test] #[test]
fn iter_kmers_count() { fn iter_kmers_count() {
set_k(4);
let k = crate::params::k();
let ascii = b"ACGTACGTACGT"; let ascii = b"ACGTACGTACGT";
let sk = SuperKmer::from_ascii(ascii); let sk = SuperKmer::from_ascii(ascii);
for k in [1usize, 3, 4, 5, 8, 12] { assert_eq!(sk.iter_kmers().count(), ascii.len() - k + 1);
let n = sk.iter_kmers(k).count();
assert_eq!(n, ascii.len() - k + 1, "count mismatch for k={k}");
}
} }
#[test] #[test]
fn iter_kmers_first_is_kmer_0() { fn iter_kmers_first_is_kmer_0() {
set_k(4);
let ascii = b"ACGTACGT"; let ascii = b"ACGTACGT";
let sk = SuperKmer::from_ascii(ascii); let sk = SuperKmer::from_ascii(ascii);
for k in 1..=ascii.len() { let first = sk.iter_kmers().next().unwrap();
let first = sk.iter_kmers(k).next().unwrap(); assert_eq!(first, sk.kmer(0).unwrap());
assert_eq!(first, sk.kmer(0, k).unwrap(), "k={k}");
}
} }
#[test] #[test]
fn iter_kmers_matches_kmer_at_each_position() { fn iter_kmers_matches_kmer_at_each_position() {
set_k(4);
let ascii = b"ACGTACGTACGT"; let ascii = b"ACGTACGTACGT";
let sk = SuperKmer::from_ascii(ascii); let sk = SuperKmer::from_ascii(ascii);
let k = 4; let kmers: Vec<crate::kmer::Kmer> = sk.iter_kmers().collect();
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
assert_eq!(kmers.len(), ascii.len() - k + 1);
for (i, &km) in kmers.iter().enumerate() { for (i, &km) in kmers.iter().enumerate() {
assert_eq!(km, sk.kmer(i, k).unwrap(), "mismatch at pos {i}"); assert_eq!(km, sk.kmer(i).unwrap(), "mismatch at pos {i}");
} }
} }
#[test] #[test]
fn iter_kmers_single_when_seql_eq_k() { fn iter_kmers_single_when_seql_eq_k() {
let ascii = b"ACGTACGT"; set_k(4);
let sk = SuperKmer::from_ascii(ascii); let k = crate::params::k();
let k = ascii.len(); let ascii = make_seq(k);
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect(); let sk = SuperKmer::from_ascii(&ascii);
assert_eq!(kmers.len(), 1); assert_eq!(sk.iter_kmers().count(), 1);
assert_eq!(kmers[0], sk.kmer(0, k).unwrap()); assert_eq!(sk.iter_kmers().next().unwrap(), sk.kmer(0).unwrap());
}
#[test]
fn iter_kmers_two_when_seql_eq_k_plus_one() {
let ascii = b"ACGTACGT";
let sk = SuperKmer::from_ascii(ascii);
let k = ascii.len() - 1;
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
assert_eq!(kmers.len(), 2);
assert_eq!(kmers[0], sk.kmer(0, k).unwrap());
assert_eq!(kmers[1], sk.kmer(1, k).unwrap());
}
#[test]
fn iter_kmers_all_k_values() {
// For every valid k, each yielded kmer must match kmer(i, k).
let ascii = b"ACGTACGTACGT";
let sk = SuperKmer::from_ascii(ascii);
let seql = ascii.len();
for k in 1..=seql {
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
assert_eq!(kmers.len(), seql - k + 1, "k={k}");
for (i, &km) in kmers.iter().enumerate() {
assert_eq!(km, sk.kmer(i, k).unwrap(), "k={k}, pos={i}");
}
}
} }
#[test] #[test]
fn iter_kmers_crosses_byte_boundary() { fn iter_kmers_crosses_byte_boundary() {
// Positions 3→4 and 7→8 cross a 4-nucleotide byte boundary. set_k(4);
let ascii = b"ACGTACGTACGT"; let ascii = b"ACGTACGTACGT";
let sk = SuperKmer::from_ascii(ascii); let sk = SuperKmer::from_ascii(ascii);
let k = 3; let kmers: Vec<crate::kmer::Kmer> = sk.iter_kmers().collect();
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect();
for boundary in [3usize, 4, 7, 8] { for boundary in [3usize, 4, 7, 8] {
if boundary + 1 < kmers.len() { if boundary + 1 < kmers.len() {
assert_eq!( assert_eq!(
kmers[boundary], kmers[boundary],
sk.kmer(boundary, k).unwrap(), sk.kmer(boundary).unwrap(),
"pos={boundary}" "pos={boundary}"
); );
assert_eq!(
kmers[boundary + 1],
sk.kmer(boundary + 1, k).unwrap(),
"pos={}",
boundary + 1
);
} }
} }
} }
#[test]
fn iter_kmers_k1_yields_all_nucleotides() {
let ascii = b"ACGT";
let sk = SuperKmer::from_ascii(ascii);
let kmers: Vec<Kmer> = sk.iter_kmers(1).collect();
assert_eq!(kmers.len(), 4);
for (i, &km) in kmers.iter().enumerate() {
assert_eq!(km, sk.kmer(i, 1).unwrap(), "pos={i}");
}
}
#[test] #[test]
fn iter_kmers_long_sequence() { fn iter_kmers_long_sequence() {
let ascii = make_seq(20); set_k(4);
let k = crate::params::k();
let ascii = make_seq(200);
let sk = SuperKmer::from_ascii(&ascii); let sk = SuperKmer::from_ascii(&ascii);
let k = 7; let kmers: Vec<crate::kmer::Kmer> = sk.iter_kmers().collect();
let kmers: Vec<Kmer> = sk.iter_kmers(k).collect(); assert_eq!(kmers.len(), 200 - k + 1);
assert_eq!(kmers.len(), ascii.len() - k + 1);
for (i, &km) in kmers.iter().enumerate() { for (i, &km) in kmers.iter().enumerate() {
assert_eq!(km, sk.kmer(i, k).unwrap(), "pos={i}"); assert_eq!(km, sk.kmer(i).unwrap(), "pos={i}");
} }
} }
+171
View File
@@ -0,0 +1,171 @@
// ── tests ─────────────────────────────────────────────────────────────────────
#[cfg(test)]
mod tests {
use crate::packed_seq::PackedSeq as Unitig;
use crate::set_k;
fn make_seq(len: usize) -> Vec<u8> {
(0..len).map(|i| b"ACGT"[i % 4]).collect()
}
fn ascii_revcomp(seq: &[u8]) -> Vec<u8> {
seq.iter()
.rev()
.map(|&b| match b {
b'A' => b'T',
b'T' => b'A',
b'C' => b'G',
b'G' => b'C',
_ => b'A',
})
.collect()
}
fn test_lengths() -> impl Iterator<Item = usize> {
(1..=9).chain([255, 256, 257, 1000, 10_000])
}
// ── from_ascii / to_ascii ─────────────────────────────────────────────────
#[test]
fn ascii_roundtrip_all_lengths() {
for len in test_lengths() {
let ascii = make_seq(len);
let u = Unitig::from_ascii(&ascii);
assert_eq!(u.to_ascii(), ascii, "roundtrip failed for len={len}");
}
}
// ── seql ──────────────────────────────────────────────────────────────────
#[test]
fn seql_roundtrip() {
for len in test_lengths() {
let u = Unitig::from_ascii(&make_seq(len));
assert_eq!(u.seql(), len);
}
}
// ── revcomp ───────────────────────────────────────────────────────────────
#[test]
fn revcomp_known_values() {
let cases = [
("A", "T"),
("AC", "GT"),
("ACG", "CGT"),
("ACGT", "ACGT"),
("ACGTA", "TACGT"),
];
for (seq, expected) in cases {
let mut u = Unitig::from_ascii(seq.as_bytes());
u.revcomp_inplace();
assert_eq!(
u.to_ascii(),
expected.as_bytes(),
"revcomp wrong for \"{seq}\""
);
}
}
#[test]
fn revcomp_vs_reference_all_lengths() {
for len in test_lengths() {
let ascii = make_seq(len);
let expected = ascii_revcomp(&ascii);
let mut u = Unitig::from_ascii(&ascii);
u.revcomp_inplace();
assert_eq!(u.to_ascii(), expected, "revcomp wrong for len={len}");
}
}
#[test]
fn revcomp_involution_all_lengths() {
for len in test_lengths() {
let ascii = make_seq(len);
let mut u = Unitig::from_ascii(&ascii);
u.revcomp_inplace();
u.revcomp_inplace();
assert_eq!(u.to_ascii(), ascii, "revcomp∘revcomp≠id for len={len}");
}
}
// ── canonicalize ──────────────────────────────────────────────────────────
#[test]
fn canonical_palindrome_unchanged() {
let mut u = Unitig::from_ascii(b"ACGT");
u.canonicalize();
assert_eq!(u.to_ascii(), b"ACGT");
}
#[test]
fn canonical_chooses_revcomp() {
let mut u = Unitig::from_ascii(b"TTTT");
u.canonicalize();
assert_eq!(u.to_ascii(), b"AAAA");
}
#[test]
fn canonical_is_minimal_all_lengths() {
for len in test_lengths() {
let ascii = make_seq(len);
let mut u = Unitig::from_ascii(&ascii);
u.canonicalize();
let fwd = u.to_ascii();
let rev = ascii_revcomp(&fwd);
assert!(fwd <= rev, "canonical not minimal for len={len}");
}
}
// ── kmer extraction ───────────────────────────────────────────────────────
#[test]
fn kmer_all_positions() {
set_k(4);
let k = crate::params::k();
let ascii = b"ACGTACGTACGT";
let u = Unitig::from_ascii(ascii);
for i in 0..=ascii.len() - k {
let kmer = u.kmer(i).unwrap();
let expected = crate::kmer::Kmer::from_ascii(&ascii[i..i + k]).unwrap();
assert_eq!(kmer, expected, "mismatch at position {i}");
}
}
// ── iter_kmers ────────────────────────────────────────────────────────────
#[test]
fn iter_kmers_matches_kmer_at_each_position() {
set_k(4);
let ascii = make_seq(20);
let u = Unitig::from_ascii(&ascii);
let kmers: Vec<crate::kmer::Kmer> = u.iter_kmers().collect();
for (i, &km) in kmers.iter().enumerate() {
assert_eq!(km, u.kmer(i).unwrap(), "pos={i}");
}
}
#[test]
fn iter_kmers_long_unitig() {
set_k(4);
let k = crate::params::k();
let ascii = make_seq(10_000);
let u = Unitig::from_ascii(&ascii);
assert_eq!(u.iter_kmers().count(), 10_000 - k + 1);
}
// ── binary serialisation ──────────────────────────────────────────────────
#[test]
fn binary_roundtrip_all_lengths() {
for len in test_lengths() {
let u = Unitig::from_ascii(&make_seq(len));
let mut buf = Vec::new();
u.write_to_binary(&mut buf).unwrap();
let u2 = Unitig::read_from_binary(&mut buf.as_slice()).unwrap();
assert_eq!(u, u2, "binary roundtrip failed for len={len}");
}
}
}
+6 -420
View File
@@ -1,424 +1,10 @@
//! Compact 2-bit DNA unitig with in-place reverse complement and canonical form. //! Unitig: a 2-bit packed DNA sequence without metadata.
//! //!
//! Same encoding as [`SuperKmer`](crate::superkmer::SuperKmer) — nucleotide 0 //! [`Unitig`] is a type alias for [`PackedSeq`] — all sequence operations,
//! at the MSB of `seq[0]`, 4 bases per byte — but without the 256-nucleotide //! binary serialisation, and k-mer iteration are available directly.
//! length cap and without the scatter/count header payload.
use std::io::{self, Write}; pub use crate::packed_seq::PackedSeq as Unitig;
use crate::encoding::{DEC4, encode_base};
use crate::kmer::{CanonicalKmer, Kmer, KmerError};
use crate::revcomp_lookup::REVCOMP4;
use bitvec::prelude::*;
// ── Unitig ────────────────────────────────────────────────────────────────────
/// Compact unitig: sequence length (usize) + byte-aligned 2-bit nucleotide sequence.
///
/// Encoding: A=00, C=01, G=10, T=11. Nucleotide 0 occupies bits 76 of `seq[0]`,
/// nucleotide i occupies bits `7 2*(i%4)` and `6 2*(i%4)` of `seq[i/4]`.
/// Padding bits in the last byte are always 0.
#[derive(Debug, Clone)]
pub struct Unitig {
seql: usize,
seq: Box<[u8]>,
}
impl PartialEq for Unitig {
fn eq(&self, other: &Self) -> bool {
self.seql == other.seql && self.seq == other.seq
}
}
impl Eq for Unitig {}
impl std::hash::Hash for Unitig {
fn hash<H: std::hash::Hasher>(&self, state: &mut H) {
self.seql.hash(state);
self.seq.hash(state);
}
}
impl Unitig {
/// Create from a pre-packed 2-bit byte slice and explicit length.
/// `seq.len()` must equal `(seql + 3) / 4`.
pub fn new(seql: usize, seq: Box<[u8]>) -> Self {
debug_assert_eq!(seq.len(), byte_len(seql));
Self { seql, seq }
}
/// Encode a slice of 2-bit nucleotide values (0=A, 1=C, 2=G, 3=T, any length ≥ 1).
/// More efficient than `from_ascii` when nucleotides are already 2-bit encoded.
pub fn from_nucleotides(nucs: &[u8]) -> Self {
let seql = nucs.len();
debug_assert!(seql >= 1, "unitig length must be ≥ 1");
let n = byte_len(seql);
let mut seq = vec![0u8; n];
for (i, &nuc) in nucs.iter().enumerate() {
seq[i / 4] |= (nuc & 0b11) << (6 - 2 * (i % 4));
}
Self::new(seql, seq.into_boxed_slice())
}
/// Encode an ASCII nucleotide slice (ACGT, any length ≥ 1) into a new Unitig.
/// The result is not yet in canonical form; call `.canonical()` if needed.
pub fn from_ascii(ascii: &[u8]) -> Self {
let seql = ascii.len();
debug_assert!(seql >= 1, "unitig length must be ≥ 1");
let n = byte_len(seql);
let mut seq = vec![0u8; n];
let full = seql / 4;
for i in 0..full {
seq[i] = encode_base(ascii[i * 4]) << 6
| encode_base(ascii[i * 4 + 1]) << 4
| encode_base(ascii[i * 4 + 2]) << 2
| encode_base(ascii[i * 4 + 3]);
}
let rem = seql % 4;
if rem > 0 {
let mut last = 0u8;
for j in 0..rem {
last |= encode_base(ascii[full * 4 + j]) << (6 - 2 * j);
}
seq[full] = last;
}
Self::new(seql, seq.into_boxed_slice())
}
/// Returns the sequence length in nucleotides.
pub fn seql(&self) -> usize {
self.seql
}
/// Returns a read-only view of the packed 2-bit sequence bytes.
/// Length is always `(seql() + 3) / 4`.
pub fn seq_bytes(&self) -> &[u8] {
&self.seq
}
/// Extract nucleotide i (0-based from 5 end) as a 2-bit value.
pub fn nucleotide(&self, i: usize) -> u8 {
(self.seq[i / 4] >> (6 - 2 * (i % 4))) & 0b11
}
/// Decode into ASCII nucleotides, writing into `writer`.
pub fn write_ascii<W: Write>(&self, writer: &mut W) -> io::Result<()> {
let full = self.seql / 4;
for i in 0..full {
writer.write_all(&DEC4[self.seq[i] as usize].to_be_bytes())?;
}
let rem = self.seql % 4;
if rem > 0 {
let bytes = DEC4[self.seq[full] as usize].to_be_bytes();
writer.write_all(&bytes[..rem])?;
}
Ok(())
}
/// Decode into a fresh ASCII `Vec<u8>`.
pub fn to_ascii(&self) -> Vec<u8> {
let mut buf = Vec::with_capacity(self.seql);
self.write_ascii(&mut buf).unwrap();
buf
}
/// Reverse-complement this unitig in place.
pub fn revcomp(&mut self) {
let n = byte_len(self.seql);
// Step 1: swap bytes outside-in, complementing each 4-base chunk via lookup.
{
let bytes = &mut self.seq[..n];
let (mut lo, mut hi) = (0, n - 1);
while lo < hi {
(bytes[lo], bytes[hi]) =
(REVCOMP4[bytes[hi] as usize], REVCOMP4[bytes[lo] as usize]);
lo += 1;
hi -= 1;
}
if lo == hi {
bytes[lo] = REVCOMP4[bytes[lo] as usize];
}
}
// Step 2: left-shift to flush the padding T's produced by complementing padding A's.
let shift = n * 8 - self.seql * 2;
if shift > 0 {
let bits = self.seq[..n].view_bits_mut::<Msb0>();
bits.rotate_left(shift);
let len = bits.len();
bits[len - shift..].fill(false);
}
}
/// Returns `true` if this unitig is in canonical form (lexicographic minimum
/// of forward and reverse complement).
pub fn is_canonical(&self) -> bool {
for i in 0..self.seql {
let fwd = self.nucleotide(i);
let rev = complement(self.nucleotide(self.seql - 1 - i));
if fwd < rev {
return true;
}
if fwd > rev {
return false;
}
}
true
}
/// Put this unitig in canonical form in place.
///
/// Returns `true` if already canonical (no change), `false` if revcomp was applied.
pub fn canonical(&mut self) -> bool {
if self.is_canonical() {
return true;
}
self.revcomp();
false
}
/// Extract the kmer of length `k` starting at nucleotide position `i` (0-based).
pub fn kmer(&self, i: usize, k: usize) -> Result<Kmer, KmerError> {
if k == 0 || k > 32 {
return Err(KmerError::InvalidK { k });
}
if i + k > self.seql {
return Err(KmerError::OutOfBounds {
position: i,
k,
seql: self.seql,
});
}
let bits = self.seq.view_bits::<Msb0>();
let raw: u64 = bits[i * 2..(i + k) * 2].load_be();
Ok(Kmer::from_raw(raw << (64 - 2 * k)))
}
/// Extract the canonical kmer of length `k` starting at position `i`.
pub fn canonical_kmer(&self, i: usize, k: usize) -> Result<CanonicalKmer, KmerError> {
Ok(self.kmer(i, k)?.canonical(k))
}
/// Iterate over all kmers of length `k` in order, yielding each as a [`Kmer`].
pub fn iter_kmers(&self, k: usize) -> impl Iterator<Item = Kmer> + '_ {
UnitigKmerIter::new(self, k)
}
/// Iterate over all canonical kmers of length `k` in order.
pub fn iter_canonical_kmers(&self, k: usize) -> impl Iterator<Item = CanonicalKmer> + '_ {
self.iter_kmers(k).map(move |km| km.canonical(k))
}
}
// ── UnitigKmerIter ────────────────────────────────────────────────────────────
struct UnitigKmerIter<'a> {
unitig: &'a Unitig,
mask: u64,
lshift: usize,
current: u64,
pos: usize,
max_pos: usize,
}
impl<'a> UnitigKmerIter<'a> {
fn new(unitig: &'a Unitig, k: usize) -> Self {
let seql = unitig.seql();
let lshift = 64 - k * 2;
let mask = ((!0u128) << (lshift + 2)) as u64;
Self {
unitig,
mask,
lshift,
current: if seql >= k { unitig.kmer(0, k).unwrap().raw() } else { 0 },
pos: k,
max_pos: seql,
}
}
}
impl<'a> Iterator for UnitigKmerIter<'a> {
type Item = Kmer;
fn next(&mut self) -> Option<Self::Item> {
if self.pos > self.max_pos {
return None;
}
let result = Kmer::from_raw(self.current);
if self.pos < self.max_pos {
let byte_pos = self.pos / 4;
// nucleotide at position p within its byte occupies bits 72*(p%4) and 62*(p%4)
let inner_shift = 6 - 2 * (self.pos & 3);
let nuc = (((self.unitig.seq[byte_pos] >> inner_shift) & 3) as u64) << self.lshift;
self.current = ((self.current << 2) & self.mask) | nuc;
}
self.pos += 1;
Some(result)
}
}
// ── helpers ───────────────────────────────────────────────────────────────────
fn complement(base: u8) -> u8 {
!base & 0b11
}
fn byte_len(seql: usize) -> usize {
(seql + 3) / 4
}
// ── tests ─────────────────────────────────────────────────────────────────────
#[cfg(test)] #[cfg(test)]
mod tests { #[path = "tests/unitig.rs"]
use super::*; mod tests;
fn make_seq(len: usize) -> Vec<u8> {
(0..len).map(|i| b"ACGT"[i % 4]).collect()
}
fn ascii_revcomp(seq: &[u8]) -> Vec<u8> {
seq.iter()
.rev()
.map(|&b| match b {
b'A' => b'T',
b'T' => b'A',
b'C' => b'G',
b'G' => b'C',
_ => b'A',
})
.collect()
}
fn test_lengths() -> impl Iterator<Item = usize> {
(1..=9).chain([255, 256, 257, 1000, 10_000])
}
// ── from_ascii / to_ascii ─────────────────────────────────────────────────
#[test]
fn ascii_roundtrip_all_lengths() {
for len in test_lengths() {
let ascii = make_seq(len);
let u = Unitig::from_ascii(&ascii);
assert_eq!(u.to_ascii(), ascii, "roundtrip failed for len={len}");
}
}
// ── seql ──────────────────────────────────────────────────────────────────
#[test]
fn seql_roundtrip() {
for len in test_lengths() {
let u = Unitig::from_ascii(&make_seq(len));
assert_eq!(u.seql(), len);
}
}
// ── revcomp ───────────────────────────────────────────────────────────────
#[test]
fn revcomp_known_values() {
let cases = [
("A", "T"),
("AC", "GT"),
("ACG", "CGT"),
("ACGT", "ACGT"),
("ACGTA", "TACGT"),
];
for (seq, expected) in cases {
let mut u = Unitig::from_ascii(seq.as_bytes());
u.revcomp();
assert_eq!(u.to_ascii(), expected.as_bytes(), "revcomp wrong for \"{seq}\"");
}
}
#[test]
fn revcomp_vs_reference_all_lengths() {
for len in test_lengths() {
let ascii = make_seq(len);
let expected = ascii_revcomp(&ascii);
let mut u = Unitig::from_ascii(&ascii);
u.revcomp();
assert_eq!(u.to_ascii(), expected, "revcomp wrong for len={len}");
}
}
#[test]
fn revcomp_involution_all_lengths() {
for len in test_lengths() {
let ascii = make_seq(len);
let mut u = Unitig::from_ascii(&ascii);
u.revcomp();
u.revcomp();
assert_eq!(u.to_ascii(), ascii, "revcomp∘revcomp≠id for len={len}");
}
}
// ── canonical ─────────────────────────────────────────────────────────────
#[test]
fn canonical_palindrome_unchanged() {
let mut u = Unitig::from_ascii(b"ACGT");
u.canonical();
assert_eq!(u.to_ascii(), b"ACGT");
}
#[test]
fn canonical_chooses_revcomp() {
let mut u = Unitig::from_ascii(b"TTTT");
u.canonical();
assert_eq!(u.to_ascii(), b"AAAA");
}
#[test]
fn canonical_is_minimal_all_lengths() {
for len in test_lengths() {
let ascii = make_seq(len);
let mut u = Unitig::from_ascii(&ascii);
u.canonical();
let fwd = u.to_ascii();
let rev = ascii_revcomp(&fwd);
assert!(fwd <= rev, "canonical not minimal for len={len}");
}
}
// ── kmer extraction ───────────────────────────────────────────────────────
#[test]
fn kmer_all_positions() {
let ascii = b"ACGTACGTACGT";
let k = 4;
let u = Unitig::from_ascii(ascii);
for i in 0..=ascii.len() - k {
let kmer = u.kmer(i, k).unwrap();
let expected = Kmer::from_ascii(&ascii[i..i + k], k).unwrap();
assert_eq!(kmer, expected, "mismatch at position {i}");
}
}
// ── iter_kmers ────────────────────────────────────────────────────────────
#[test]
fn iter_kmers_matches_kmer_at_each_position() {
let ascii = make_seq(20);
let k = 7;
let u = Unitig::from_ascii(&ascii);
let kmers: Vec<Kmer> = u.iter_kmers(k).collect();
assert_eq!(kmers.len(), ascii.len() - k + 1);
for (i, &km) in kmers.iter().enumerate() {
assert_eq!(km, u.kmer(i, k).unwrap(), "pos={i}");
}
}
#[test]
fn iter_kmers_long_unitig() {
let ascii = make_seq(10_000);
let k = 11;
let u = Unitig::from_ascii(&ascii);
assert_eq!(u.iter_kmers(k).count(), 10_000 - k + 1);
}
}
+3
View File
@@ -7,3 +7,6 @@ edition = "2024"
obikseq = { path = "../obikseq" } obikseq = { path = "../obikseq" }
obikrope = { path = "../obikrope" } obikrope = { path = "../obikrope" }
lazy_static = "1.5.0" lazy_static = "1.5.0"
[dev-dependencies]
obikseq = { path = "../obikseq", features = ["test-utils"] }
+3 -6
View File
@@ -21,7 +21,6 @@ pub(crate) static LN_CARD_ROT5: LazyLock<[f64; 1024]> =
pub(crate) static LN_CARD_ROT6: LazyLock<[f64; 4096]> = pub(crate) static LN_CARD_ROT6: LazyLock<[f64; 4096]> =
LazyLock::new(|| build_log_class_size::<4096>(&NORMK6)); LazyLock::new(|| build_log_class_size::<4096>(&NORMK6));
fn ln0(x: f64) -> f64 { fn ln0(x: f64) -> f64 {
if x == 0.0 { 0.0 } else { x.ln() } if x == 0.0 { 0.0 } else { x.ln() }
} }
@@ -47,7 +46,7 @@ fn build_normalized_kmer<const N: usize>() -> [u64; N] {
for i in 0..N { for i in 0..N {
let la = (i as u64) << shift; let la = (i as u64) << shift;
let ra = i as u64; let ra = i as u64;
let rc_ra = Kmer::from_raw(la).revcomp(k).raw() >> shift; let rc_ra = Kmer::from_raw(la).revcomp().raw() >> shift;
let circ = normalize_circular(ra, k); let circ = normalize_circular(ra, k);
let circ_rc = normalize_circular(rc_ra, k); let circ_rc = normalize_circular(rc_ra, k);
result[i] = circ.min(circ_rc); result[i] = circ.min(circ_rc);
@@ -107,12 +106,10 @@ pub(crate) const K_MAX: usize = 32;
pub(crate) const WS_MAX: usize = 6; pub(crate) const WS_MAX: usize = 6;
/// n·ln(n), with n_log_n[0] = 0. Indexed by n = 0..=K_MAX. /// n·ln(n), with n_log_n[0] = 0. Indexed by n = 0..=K_MAX.
pub(crate) static N_LOG_N: LazyLock<[f64; K_MAX + 1]> = pub(crate) static N_LOG_N: LazyLock<[f64; K_MAX + 1]> = LazyLock::new(|| build_n_log_n());
LazyLock::new(|| build_n_log_n());
/// H_max[k][ws]: maximum entropy for kmer length k and word size ws. /// H_max[k][ws]: maximum entropy for kmer length k and word size ws.
pub(crate) static EMAX: LazyLock<[[f64; WS_MAX + 1]; K_MAX + 1]> = pub(crate) static EMAX: LazyLock<[[f64; WS_MAX + 1]; K_MAX + 1]> = LazyLock::new(|| build_emax());
LazyLock::new(|| build_emax());
/// ln(k ws + 1): log of the number of ws-words in a kmer of length k. /// ln(k ws + 1): log of the number of ws-words in a kmer of length k.
pub(crate) static LOG_NWORDS: LazyLock<[[f64; WS_MAX + 1]; K_MAX + 1]> = pub(crate) static LOG_NWORDS: LazyLock<[[f64; WS_MAX + 1]; K_MAX + 1]> =
+27 -18
View File
@@ -16,8 +16,8 @@
//! | super-kmer length = 256| k | //! | super-kmer length = 256| k |
use obikrope::{ForwardCursor, Rope, RopeCursor}; use obikrope::{ForwardCursor, Rope, RopeCursor};
use obikseq::kmer::CanonicalKmer;
use obikseq::RoutableSuperKmer; use obikseq::RoutableSuperKmer;
use obikseq::kmer::Minimizer;
use crate::rolling_stat::RollingStat; use crate::rolling_stat::RollingStat;
use crate::scratch::SuperKmerScratch; use crate::scratch::SuperKmerScratch;
@@ -26,11 +26,10 @@ use crate::scratch::SuperKmerScratch;
pub struct SuperKmerIter<'a> { pub struct SuperKmerIter<'a> {
cursor: ForwardCursor<'a>, cursor: ForwardCursor<'a>,
k: usize, k: usize,
m: usize,
theta: f64, theta: f64,
scratch: SuperKmerScratch, scratch: SuperKmerScratch,
stat: RollingStat, stat: RollingStat,
prev_min: Option<CanonicalKmer>, prev_min: Option<Minimizer>,
prev_min_pos: usize, prev_min_pos: usize,
} }
@@ -41,14 +40,13 @@ impl<'a> SuperKmerIter<'a> {
/// - `m`: minimizer size (1 < m < k) /// - `m`: minimizer size (1 < m < k)
/// - `level_max`: maximum sub-word size for entropy (16) /// - `level_max`: maximum sub-word size for entropy (16)
/// - `theta`: entropy threshold; k-mers with score ≤ theta are rejected /// - `theta`: entropy threshold; k-mers with score ≤ theta are rejected
pub fn new(rope: &'a Rope, k: usize, m: usize, level_max: usize, theta: f64) -> Self { pub fn new(rope: &'a Rope, k: usize, level_max: usize, theta: f64) -> Self {
Self { Self {
cursor: rope.fw_cursor(), cursor: rope.fw_cursor(),
k, k,
m,
theta, theta,
scratch: SuperKmerScratch::new(), scratch: SuperKmerScratch::new(),
stat: RollingStat::new(k, m, level_max), stat: RollingStat::new(level_max),
prev_min: None, prev_min: None,
prev_min_pos: 0, prev_min_pos: 0,
} }
@@ -66,7 +64,7 @@ impl<'a> SuperKmerIter<'a> {
return None; return None;
} }
self.prev_min?; self.prev_min?;
Some(self.scratch.emit(self.prev_min_pos, self.m)) Some(self.scratch.emit(self.prev_min_pos))
} }
} }
@@ -149,26 +147,31 @@ mod tests {
use super::*; use super::*;
use obikrope::Rope; use obikrope::Rope;
fn setup() {
obikseq::params::set_k(K);
obikseq::params::set_m(5);
}
fn make_rope(data: &[u8]) -> Rope { fn make_rope(data: &[u8]) -> Rope {
let mut r = Rope::new(None); let mut r = Rope::new(None);
r.push(data.to_vec()); r.push(data.to_vec());
r r
} }
fn run_nofilter(data: &[u8], k: usize, m: usize) -> Vec<Vec<u8>> { fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
let rope = make_rope(data); let rope = make_rope(data);
SuperKmerIter::new(&rope, k, m, 1, 0.0) SuperKmerIter::new(&rope, k, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii()) .map(|rsk| rsk.superkmer().to_ascii())
.collect() .collect()
} }
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31]) // k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
const K: usize = 11; const K: usize = 11;
const M: usize = 5;
#[test] #[test]
fn single_segment_one_superkmer() { fn single_segment_one_superkmer() {
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K, M); setup();
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
assert!(!out.is_empty()); assert!(!out.is_empty());
let total: Vec<u8> = out.into_iter().flatten().collect(); let total: Vec<u8> = out.into_iter().flatten().collect();
assert!(total.len() >= K); assert!(total.len() >= K);
@@ -176,29 +179,33 @@ mod tests {
#[test] #[test]
fn segment_shorter_than_k_emits_nothing() { fn segment_shorter_than_k_emits_nothing() {
let out = run_nofilter(b"ACGTACGT\x00", K, M); setup();
let out = run_nofilter(b"ACGTACGT\x00", K);
assert_eq!(out, Vec::<Vec<u8>>::new()); assert_eq!(out, Vec::<Vec<u8>>::new());
} }
#[test] #[test]
fn empty_input_emits_nothing() { fn empty_input_emits_nothing() {
let out = run_nofilter(b"", K, M); setup();
let out = run_nofilter(b"", K);
assert_eq!(out, Vec::<Vec<u8>>::new()); assert_eq!(out, Vec::<Vec<u8>>::new());
} }
#[test] #[test]
fn two_segments_both_emitted() { fn two_segments_both_emitted() {
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K, M); setup();
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
assert!(!out.is_empty()); assert!(!out.is_empty());
} }
#[test] #[test]
fn low_complexity_kmer_is_rejected() { fn low_complexity_kmer_is_rejected() {
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K, M); setup();
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
assert!(!out_pass.is_empty()); assert!(!out_pass.is_empty());
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00"); let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, M, 6, 0.9) let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
.map(|rsk| rsk.superkmer().to_ascii()) .map(|rsk| rsk.superkmer().to_ascii())
.collect(); .collect();
assert!(out_reject.is_empty()); assert!(out_reject.is_empty());
@@ -206,12 +213,13 @@ mod tests {
#[test] #[test]
fn multi_slice_rope() { fn multi_slice_rope() {
setup();
let data = b"ACGTACGTACGTACGTACGT\x00"; let data = b"ACGTACGTACGTACGTACGT\x00";
let mid = data.len() / 2; let mid = data.len() / 2;
let mut rope = Rope::new(None); let mut rope = Rope::new(None);
rope.push(data[..mid].to_vec()); rope.push(data[..mid].to_vec());
rope.push(data[mid..].to_vec()); rope.push(data[mid..].to_vec());
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, M, 1, 0.0) let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii()) .map(|rsk| rsk.superkmer().to_ascii())
.collect(); .collect();
assert!(!out.is_empty()); assert!(!out.is_empty());
@@ -219,8 +227,9 @@ mod tests {
#[test] #[test]
fn yields_minimizer_value() { fn yields_minimizer_value() {
setup();
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00"); let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, M, 1, 0.0).collect(); let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
assert!(!results.is_empty()); assert!(!results.is_empty());
} }
} }
+7 -2
View File
@@ -19,6 +19,11 @@ use obikrope::Rope;
use obikseq::RoutableSuperKmer; use obikseq::RoutableSuperKmer;
/// Collect all super-kmers from a normalised rope chunk. /// Collect all super-kmers from a normalised rope chunk.
pub fn build_superkmers(rope: Rope, k: usize, m: usize, level_max: usize, theta: f64) -> Vec<RoutableSuperKmer> { pub fn build_superkmers(
SuperKmerIter::new(&rope, k, m, level_max, theta).collect() rope: Rope,
k: usize,
level_max: usize,
theta: f64,
) -> Vec<RoutableSuperKmer> {
SuperKmerIter::new(&rope, k, level_max, theta).collect()
} }
+96 -76
View File
@@ -1,4 +1,5 @@
use obikseq::kmer::{CanonicalKmer, Kmer}; use obikseq::kmer::{Minimizer, hash_kmer};
use obikseq::params;
use crate::encoding::encode_nuc; use crate::encoding::encode_nuc;
use crate::entropy_table::{WS_MAX, emax, entropy_norm_kmer, ln_class_size, log_nwords, n_log_n}; use crate::entropy_table::{WS_MAX, emax, entropy_norm_kmer, ln_class_size, log_nwords, n_log_n};
@@ -13,22 +14,7 @@ struct MmerItem {
hash: u64, hash: u64,
} }
/// Bijective hash used to randomise the minimizer ordering.
/// The XOR seed (2^64/φ) breaks the mix64 fixed point at 0,
/// preventing poly-A/T kmers (canonical = 0) from always winning.
#[inline(always)]
fn hash_mmer(canonical: u64) -> u64 {
let x = canonical ^ 0x9e3779b97f4a7c15;
let x = x ^ (x >> 30);
let x = x.wrapping_mul(0xbf58476d1ce4e5b9);
let x = x ^ (x >> 27);
let x = x.wrapping_mul(0x94d049bb133111eb);
x ^ (x >> 31)
}
pub struct RollingStat { pub struct RollingStat {
k: usize,
m: usize,
entropy_max_k: usize, entropy_max_k: usize,
rolling_k: u64, rolling_k: u64,
rolling_rck: u64, rolling_rck: u64,
@@ -53,15 +39,15 @@ pub struct RollingStat {
} }
impl RollingStat { impl RollingStat {
pub fn new(k: usize, m: usize, entropy_max_k: usize) -> Self { pub fn new(entropy_max_k: usize) -> Self {
let k = params::k();
let m = params::m();
Self { Self {
k,
m,
entropy_max_k, entropy_max_k,
rolling_k: 0, rolling_k: 0,
rolling_rck: 0, rolling_rck: 0,
k_mask: (!0) >> (64 - k * 2), k_mask: (!0u64) >> (64 - k * 2),
m_mask: (!0) >> (64 - m * 2), m_mask: (!0u64) >> (64 - m * 2),
received: 0, received: 0,
k1q: std::collections::VecDeque::with_capacity(k), k1q: std::collections::VecDeque::with_capacity(k),
k2q: std::collections::VecDeque::with_capacity(k - 1), k2q: std::collections::VecDeque::with_capacity(k - 1),
@@ -85,12 +71,24 @@ impl RollingStat {
self.rolling_k = 0; self.rolling_k = 0;
self.rolling_rck = 0; self.rolling_rck = 0;
self.received = 0; self.received = 0;
for &i in &self.k1q { self.k1c[i as usize] = 0; } for &i in &self.k1q {
for &i in &self.k2q { self.k2c[i as usize] = 0; } self.k1c[i as usize] = 0;
for &i in &self.k3q { self.k3c[i as usize] = 0; } }
for &i in &self.k4q { self.k4c[i as usize] = 0; } for &i in &self.k2q {
for &i in &self.k5q { self.k5c[i as usize] = 0; } self.k2c[i as usize] = 0;
for &i in &self.k6q { self.k6c[i as usize] = 0; } }
for &i in &self.k3q {
self.k3c[i as usize] = 0;
}
for &i in &self.k4q {
self.k4c[i as usize] = 0;
}
for &i in &self.k5q {
self.k5c[i as usize] = 0;
}
for &i in &self.k6q {
self.k6c[i as usize] = 0;
}
self.k1q.clear(); self.k1q.clear();
self.k2q.clear(); self.k2q.clear();
self.k3q.clear(); self.k3q.clear();
@@ -127,12 +125,15 @@ impl RollingStat {
} }
pub fn push(&mut self, nuc: u8) { pub fn push(&mut self, nuc: u8) {
let k = params::k();
let m = params::m();
let bnuc = encode_nuc(nuc); let bnuc = encode_nuc(nuc);
let cnuc = bnuc ^ 3; let cnuc = bnuc ^ 3;
self.rolling_k = ((self.rolling_k << 2) | (bnuc as u64)) & self.k_mask; self.rolling_k = ((self.rolling_k << 2) | (bnuc as u64)) & self.k_mask;
self.rolling_rck = self.rolling_rck =
((self.rolling_rck >> 2) | ((cnuc as u64) << ((self.k - 1) * 2))) & self.k_mask; ((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask;
let canonical_k1 = entropy_norm_kmer(self.rolling_k & 3, 1, false); let canonical_k1 = entropy_norm_kmer(self.rolling_k & 3, 1, false);
let canonical_k2 = entropy_norm_kmer(self.rolling_k & 15, 2, false); let canonical_k2 = entropy_norm_kmer(self.rolling_k & 15, 2, false);
@@ -143,30 +144,37 @@ impl RollingStat {
self.received += 1; self.received += 1;
if self.received >= self.m { if self.received >= m {
let possible_canonical_m = let possible_canonical_m =
(self.rolling_k & self.m_mask).min(self.rolling_rck >> ((self.k - self.m) * 2)); (self.rolling_k & self.m_mask).min(self.rolling_rck >> ((k - m) * 2));
let possible_hash_m = hash_mmer(possible_canonical_m); let possible_hash_m = hash_kmer(possible_canonical_m << 64 - m * 2);
let possible_pos_m = self.received - self.m; let possible_pos_m = self.received - m;
while self.minimier.back().map_or(false, |it| it.hash >= possible_hash_m) { while self
.minimier
.back()
.map_or(false, |it| it.hash >= possible_hash_m)
{
self.minimier.pop_back(); self.minimier.pop_back();
} }
self.minimier self.minimier.push_back(MmerItem {
.push_back(MmerItem { position: possible_pos_m, canonical: possible_canonical_m, hash: possible_hash_m }); position: possible_pos_m,
canonical: possible_canonical_m,
hash: possible_hash_m,
});
if self.received > self.k { if self.received > k {
while self while self
.minimier .minimier
.front() .front()
.map_or(false, |it| it.position + self.k < self.received) .map_or(false, |it| it.position + k < self.received)
{ {
self.minimier.pop_front(); self.minimier.pop_front();
} }
} }
} }
if self.received > self.k { if self.received > k {
let old1 = self.k1q.pop_front().unwrap(); let old1 = self.k1q.pop_front().unwrap();
let f1 = self.k1c[old1 as usize]; let f1 = self.k1c[old1 as usize];
Self::update_sums_decrement(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 1, old1, f1); Self::update_sums_decrement(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 1, old1, f1);
@@ -199,37 +207,73 @@ impl RollingStat {
} }
let g1 = self.k1c[canonical_k1 as usize]; let g1 = self.k1c[canonical_k1 as usize];
Self::update_sums_increment(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 1, canonical_k1, g1); Self::update_sums_increment(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
1,
canonical_k1,
g1,
);
self.k1c[canonical_k1 as usize] += 1; self.k1c[canonical_k1 as usize] += 1;
self.k1q.push_back(canonical_k1); self.k1q.push_back(canonical_k1);
if self.received >= 2 { if self.received >= 2 {
let g2 = self.k2c[canonical_k2 as usize]; let g2 = self.k2c[canonical_k2 as usize];
Self::update_sums_increment(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 2, canonical_k2, g2); Self::update_sums_increment(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
2,
canonical_k2,
g2,
);
self.k2c[canonical_k2 as usize] += 1; self.k2c[canonical_k2 as usize] += 1;
self.k2q.push_back(canonical_k2); self.k2q.push_back(canonical_k2);
if self.received >= 3 { if self.received >= 3 {
let g3 = self.k3c[canonical_k3 as usize]; let g3 = self.k3c[canonical_k3 as usize];
Self::update_sums_increment(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 3, canonical_k3, g3); Self::update_sums_increment(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
3,
canonical_k3,
g3,
);
self.k3c[canonical_k3 as usize] += 1; self.k3c[canonical_k3 as usize] += 1;
self.k3q.push_back(canonical_k3); self.k3q.push_back(canonical_k3);
if self.received >= 4 { if self.received >= 4 {
let g4 = self.k4c[canonical_k4 as usize]; let g4 = self.k4c[canonical_k4 as usize];
Self::update_sums_increment(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 4, canonical_k4, g4); Self::update_sums_increment(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
4,
canonical_k4,
g4,
);
self.k4c[canonical_k4 as usize] += 1; self.k4c[canonical_k4 as usize] += 1;
self.k4q.push_back(canonical_k4); self.k4q.push_back(canonical_k4);
if self.received >= 5 { if self.received >= 5 {
let g5 = self.k5c[canonical_k5 as usize]; let g5 = self.k5c[canonical_k5 as usize];
Self::update_sums_increment(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 5, canonical_k5, g5); Self::update_sums_increment(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
5,
canonical_k5,
g5,
);
self.k5c[canonical_k5 as usize] += 1; self.k5c[canonical_k5 as usize] += 1;
self.k5q.push_back(canonical_k5); self.k5q.push_back(canonical_k5);
if self.received >= 6 { if self.received >= 6 {
let g6 = self.k6c[canonical_k6 as usize]; let g6 = self.k6c[canonical_k6 as usize];
Self::update_sums_increment(&mut self.sum_f_log_f, &mut self.sum_f_log_s, 6, canonical_k6, g6); Self::update_sums_increment(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
6,
canonical_k6,
g6,
);
self.k6c[canonical_k6 as usize] += 1; self.k6c[canonical_k6 as usize] += 1;
self.k6q.push_back(canonical_k6); self.k6q.push_back(canonical_k6);
} }
@@ -240,31 +284,7 @@ impl RollingStat {
} }
pub fn ready(&self) -> bool { pub fn ready(&self) -> bool {
self.received >= self.k self.received >= params::k()
}
pub fn kmer(&self) -> Option<Kmer> {
if self.ready() {
Some(Kmer::from_raw_right(self.rolling_k, self.k))
} else {
None
}
}
pub fn revcomp_kmer(&self) -> Option<Kmer> {
if self.ready() {
Some(Kmer::from_raw_right(self.rolling_rck, self.k))
} else {
None
}
}
pub fn canonical_kmer(&self) -> Option<Kmer> {
if self.ready() {
Some(Kmer::from_raw_right(self.rolling_k.min(self.rolling_rck), self.k))
} else {
None
}
} }
pub fn minimizer_position(&self) -> Option<usize> { pub fn minimizer_position(&self) -> Option<usize> {
@@ -283,22 +303,22 @@ impl RollingStat {
} }
} }
pub fn canonical_minimizer(&self) -> Option<CanonicalKmer> { pub fn canonical_minimizer(&self) -> Option<Minimizer> {
self.canonical_minimizer_raw().map(|raw| { self.canonical_minimizer_raw()
CanonicalKmer::from_raw_unchecked(Kmer::from_raw_right(raw, self.m).raw()) .map(|raw| Minimizer::from_raw_unchecked(raw << (64 - params::m() * 2)))
})
} }
pub fn entropy(&self, order: usize) -> Option<f64> { pub fn entropy(&self, order: usize) -> Option<f64> {
if !self.ready() { if !self.ready() {
return None; return None;
} }
let em = emax(self.k, order); let k = params::k();
let em = emax(k, order);
if em <= 0.0 { if em <= 0.0 {
return Some(1.0); return Some(1.0);
} }
let nwords = self.k - order + 1; let nwords = k - order + 1;
let log_nw = log_nwords(self.k, order); let log_nw = log_nwords(k, order);
let nw_f = nwords as f64; let nw_f = nwords as f64;
let h_corr = log_nw + (self.sum_f_log_s[order] - self.sum_f_log_f[order]) / nw_f; let h_corr = log_nw + (self.sum_f_log_s[order] - self.sum_f_log_f[order]) / nw_f;
Some((h_corr / em).max(0.0)) Some((h_corr / em).max(0.0))
+2 -2
View File
@@ -56,14 +56,14 @@ impl SuperKmerScratch {
/// ///
/// The heap allocation (`Box<[u8]>`) is exactly sized to the sequence. /// The heap allocation (`Box<[u8]>`) is exactly sized to the sequence.
/// Resets the buffer to empty afterward. /// Resets the buffer to empty afterward.
pub fn emit(&mut self, min_pos: usize, m: usize) -> RoutableSuperKmer { pub fn emit(&mut self, min_pos: usize) -> RoutableSuperKmer {
let seql = self.len; let seql = self.len;
debug_assert!(seql >= 1 && seql <= MAX_SUPERKMER_LEN); debug_assert!(seql >= 1 && seql <= MAX_SUPERKMER_LEN);
let n = (seql + 3) / 4; let n = (seql + 3) / 4;
let seq: Box<[u8]> = self.buf[..n].into(); let seq: Box<[u8]> = self.buf[..n].into();
self.buf[..n].fill(0); self.buf[..n].fill(0);
self.len = 0; self.len = 0;
RoutableSuperKmer::build(min_pos, m, seql as u8, seq) RoutableSuperKmer::build(min_pos, seql, seq)
} }
/// Discard all accumulated nucleotides without producing a [`SuperKmer`]. /// Discard all accumulated nucleotides without producing a [`SuperKmer`].
pub fn reset(&mut self) { pub fn reset(&mut self) {
+1
View File
@@ -14,3 +14,4 @@ obikseq = { path = "../obikseq" }
[dev-dependencies] [dev-dependencies]
tempfile = "3" tempfile = "3"
obikseq = { path = "../obikseq", features = ["test-utils"] }
+20 -53
View File
@@ -1,46 +1,19 @@
use obikseq::superkmer::SuperKmer; use obikseq::SuperKmer;
use std::io::{self, Read, Write}; use std::io::{self, Read, Write};
/// Serialise one SuperKmer into `w` (uncompressed; caller must wrap with a compressor). /// Serialise one SuperKmer into `w` (uncompressed; caller must wrap with a compressor).
///
/// Bits [7:0] of the header store `n_kmers = seql - k + 1` (kmer units, 1255),
/// not the raw nucleotide length. This removes the 0=256 wrapping convention.
#[inline] #[inline]
pub(crate) fn write_superkmer<W: Write>(w: &mut W, sk: &SuperKmer, k: usize) -> io::Result<()> { pub(crate) fn write_superkmer<W: Write>(w: &mut W, sk: &SuperKmer) -> io::Result<()> {
let n_kmers = sk.len() - k + 1; sk.write_to_binary(w)
let new_bits = (sk.header_bits() & !0xFF) | (n_kmers as u32);
w.write_all(&new_bits.to_le_bytes())?;
w.write_all(sk.seq_bytes())
} }
/// Deserialise one SuperKmer from `r`. Returns `None` on clean EOF. /// Deserialise one SuperKmer from `r`. Returns `None` on clean EOF.
/// `seq_buf` is a reusable scratch buffer to avoid per-record allocation. pub(crate) fn read_superkmer<R: Read>(r: &mut R) -> io::Result<Option<SuperKmer>> {
/// Bits [7:0] of the on-disk header contain `n_kmers`; nucleotide length is match SuperKmer::read_from_binary(r) {
/// reconstructed as `n_kmers + k - 1`. Ok(sk) => Ok(Some(sk)),
pub(crate) fn read_superkmer<R: Read>( Err(e) if e.kind() == io::ErrorKind::UnexpectedEof => Ok(None),
r: &mut R, Err(e) => Err(e),
seq_buf: &mut Vec<u8>,
k: usize,
) -> io::Result<Option<SuperKmer>> {
let mut hdr = [0u8; 4];
match r.read_exact(&mut hdr) {
Ok(()) => {}
Err(e) if e.kind() == io::ErrorKind::UnexpectedEof => return Ok(None),
Err(e) => return Err(e),
} }
let bits = u32::from_le_bytes(hdr);
let n_kmers = (bits & 0xFF) as usize;
let nt_len = n_kmers + k - 1;
let byte_len = (nt_len + 3) / 4;
seq_buf.resize(byte_len, 0);
r.read_exact(seq_buf)?;
// Reconstruct the in-memory seql byte (0 encodes 256, 1-255 direct).
let seql_byte = if nt_len == 256 { 0u8 } else { nt_len as u8 };
let mem_bits = (bits & !0xFF) | (seql_byte as u32);
Ok(Some(SuperKmer::from_header_bits(
mem_bits,
seq_buf.as_slice().into(),
)))
} }
#[cfg(test)] #[cfg(test)]
@@ -54,32 +27,29 @@ mod tests {
#[test] #[test]
fn roundtrip_single() { fn roundtrip_single() {
let k = 4;
let sk = make_sk(b"ACGTACGT"); let sk = make_sk(b"ACGTACGT");
let mut buf = Vec::new(); let mut buf = Vec::new();
write_superkmer(&mut buf, &sk, k).unwrap(); write_superkmer(&mut buf, &sk).unwrap();
let mut cur = Cursor::new(&buf); let mut cur = Cursor::new(&buf);
let mut seq_buf = Vec::new(); let got = read_superkmer(&mut cur).unwrap().unwrap();
let got = read_superkmer(&mut cur, &mut seq_buf, k).unwrap().unwrap();
assert_eq!(sk.to_ascii(), got.to_ascii()); assert_eq!(sk.to_ascii(), got.to_ascii());
assert_eq!(sk.len(), got.len()); assert_eq!(sk.seql(), got.seql());
} }
#[test] #[test]
fn roundtrip_all_lengths() { fn roundtrip_all_lengths() {
let bases: Vec<u8> = (0..256).map(|i| b"ACGT"[i % 4]).collect(); let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
// k=11 is the project minimum; test seql from k to 256.
let k = 11; let k = 11;
for len in (k..=k + 8).chain([255, 256]) { for len in (k..=k + 8).chain([255, 256, 257]) {
let sk = make_sk(&bases[..len]); let sk = make_sk(&bases[..len]);
let mut buf = Vec::new(); let mut buf = Vec::new();
write_superkmer(&mut buf, &sk, k).unwrap(); write_superkmer(&mut buf, &sk).unwrap();
let mut cur = Cursor::new(&buf); let mut cur = Cursor::new(&buf);
let mut seq_buf = Vec::new(); let got = read_superkmer(&mut cur).unwrap().unwrap();
let got = read_superkmer(&mut cur, &mut seq_buf, k).unwrap().unwrap();
assert_eq!(sk.to_ascii(), got.to_ascii(), "len={len}"); assert_eq!(sk.to_ascii(), got.to_ascii(), "len={len}");
assert_eq!(sk.seql(), got.seql(), "len={len}");
} }
} }
@@ -87,26 +57,23 @@ mod tests {
fn eof_returns_none() { fn eof_returns_none() {
let buf: Vec<u8> = vec![]; let buf: Vec<u8> = vec![];
let mut cur = Cursor::new(&buf); let mut cur = Cursor::new(&buf);
let mut seq_buf = Vec::new(); assert!(read_superkmer(&mut cur).unwrap().is_none());
assert!(read_superkmer(&mut cur, &mut seq_buf, 4).unwrap().is_none());
} }
#[test] #[test]
fn multiple_records() { fn multiple_records() {
let k = 4;
let seqs: &[&[u8]] = &[b"AAAA", b"CCCC", b"GGGG", b"TTTT"]; let seqs: &[&[u8]] = &[b"AAAA", b"CCCC", b"GGGG", b"TTTT"];
let mut buf = Vec::new(); let mut buf = Vec::new();
for s in seqs { for s in seqs {
write_superkmer(&mut buf, &make_sk(s), k).unwrap(); write_superkmer(&mut buf, &make_sk(s)).unwrap();
} }
let mut cur = Cursor::new(&buf); let mut cur = Cursor::new(&buf);
let mut seq_buf = Vec::new();
for s in seqs { for s in seqs {
let got = read_superkmer(&mut cur, &mut seq_buf, k).unwrap().unwrap(); let got = read_superkmer(&mut cur).unwrap().unwrap();
let expected = make_sk(s); let expected = make_sk(s);
assert_eq!(expected.to_ascii(), got.to_ascii()); assert_eq!(expected.to_ascii(), got.to_ascii());
} }
assert!(read_superkmer(&mut cur, &mut seq_buf, k).unwrap().is_none()); assert!(read_superkmer(&mut cur).unwrap().is_none());
} }
} }
+41 -38
View File
@@ -5,7 +5,7 @@ use crate::meta::SKFileMeta;
use lru::LruCache; use lru::LruCache;
use niffler::Level; use niffler::Level;
use niffler::send::compression::Format; use niffler::send::compression::Format;
use obikseq::superkmer::SuperKmer; use obikseq::SuperKmer;
use std::fs::{File, OpenOptions}; use std::fs::{File, OpenOptions};
use std::io::{BufWriter, Write}; use std::io::{BufWriter, Write};
use std::num::NonZeroUsize; use std::num::NonZeroUsize;
@@ -222,7 +222,6 @@ pub struct SKFileWriter {
id: usize, id: usize,
pool: Arc<Mutex<SKFilePool>>, pool: Arc<Mutex<SKFilePool>>,
path: PathBuf, path: PathBuf,
k: usize,
pending: Vec<u8>, pending: Vec<u8>,
flush_threshold: usize, flush_threshold: usize,
logically_closed: bool, logically_closed: bool,
@@ -230,15 +229,14 @@ pub struct SKFileWriter {
} }
/// Create a `SKFileWriter` for a new file (Zstd, level 3). /// Create a `SKFileWriter` for a new file (Zstd, level 3).
pub fn create_token(pool: &SharedPool, path: PathBuf, k: usize) -> SKResult<SKFileWriter> { pub fn create_token(pool: &SharedPool, path: PathBuf) -> SKResult<SKFileWriter> {
create_token_with(pool, path, k, Format::Zstd, Level::Three) create_token_with(pool, path, Format::Zstd, Level::Three)
} }
/// Create a `SKFileWriter` for a new file with explicit format and level. /// Create a `SKFileWriter` for a new file with explicit format and level.
pub fn create_token_with( pub fn create_token_with(
pool: &SharedPool, pool: &SharedPool,
path: PathBuf, path: PathBuf,
k: usize,
format: Format, format: Format,
level: Level, level: Level,
) -> SKResult<SKFileWriter> { ) -> SKResult<SKFileWriter> {
@@ -247,7 +245,6 @@ pub fn create_token_with(
id, id,
pool: Arc::clone(pool), pool: Arc::clone(pool),
path, path,
k,
pending: Vec::with_capacity(DEFAULT_FLUSH_THRESHOLD + 128), pending: Vec::with_capacity(DEFAULT_FLUSH_THRESHOLD + 128),
flush_threshold: DEFAULT_FLUSH_THRESHOLD, flush_threshold: DEFAULT_FLUSH_THRESHOLD,
logically_closed: false, logically_closed: false,
@@ -258,18 +255,13 @@ pub fn create_token_with(
impl SKFileWriter { impl SKFileWriter {
/// Create a standalone file writer (Zstd, level 3). /// Create a standalone file writer (Zstd, level 3).
/// The pool is created internally and is not accessible to the caller. /// The pool is created internally and is not accessible to the caller.
pub fn create<P: AsRef<Path>>(path: P, k: usize) -> SKResult<Self> { pub fn create<P: AsRef<Path>>(path: P) -> SKResult<Self> {
Self::create_with(path, k, Format::Zstd, Level::Three) Self::create_with(path, Format::Zstd, Level::Three)
} }
/// Create a standalone file writer with explicit format and level. /// Create a standalone file writer with explicit format and level.
pub fn create_with<P: AsRef<Path>>( pub fn create_with<P: AsRef<Path>>(path: P, format: Format, level: Level) -> SKResult<Self> {
path: P, create_token_with(global_pool(), path.as_ref().to_owned(), format, level)
k: usize,
format: Format,
level: Level,
) -> SKResult<Self> {
create_token_with(global_pool(), path.as_ref().to_owned(), k, format, level)
} }
/// `true` if the underlying fd is currently open in the pool. /// `true` if the underlying fd is currently open in the pool.
@@ -280,10 +272,10 @@ impl SKFileWriter {
/// Accumulate one SuperKmer. Drains to fd when `pending ≥ flush_threshold`. /// Accumulate one SuperKmer. Drains to fd when `pending ≥ flush_threshold`.
pub fn write(&mut self, sk: &SuperKmer) -> SKResult<()> { pub fn write(&mut self, sk: &SuperKmer) -> SKResult<()> {
self.check_not_closed()?; self.check_not_closed()?;
write_superkmer(&mut self.pending, sk, self.k)?; write_superkmer(&mut self.pending, sk)?;
self.meta.instances += 1; self.meta.instances += 1;
self.meta.count_sum += sk.count() as u64; self.meta.count_sum += sk.count() as u64;
self.meta.length_sum += sk.len() as u64; self.meta.length_sum += sk.seql() as u64;
if self.pending.len() >= self.flush_threshold { if self.pending.len() >= self.flush_threshold {
self.drain()?; self.drain()?;
} }
@@ -294,10 +286,10 @@ impl SKFileWriter {
pub fn write_batch(&mut self, sks: &[SuperKmer]) -> SKResult<()> { pub fn write_batch(&mut self, sks: &[SuperKmer]) -> SKResult<()> {
self.check_not_closed()?; self.check_not_closed()?;
for sk in sks { for sk in sks {
write_superkmer(&mut self.pending, sk, self.k)?; write_superkmer(&mut self.pending, sk)?;
self.meta.instances += 1; self.meta.instances += 1;
self.meta.count_sum += sk.count() as u64; self.meta.count_sum += sk.count() as u64;
self.meta.length_sum += sk.len() as u64; self.meta.length_sum += sk.seql() as u64;
if self.pending.len() >= self.flush_threshold { if self.pending.len() >= self.flush_threshold {
self.drain()?; self.drain()?;
} }
@@ -439,7 +431,7 @@ impl Drop for SKFileWriter {
mod tests { mod tests {
use super::*; use super::*;
use crate::reader::SKFileReader; use crate::reader::SKFileReader;
use obikseq::superkmer::SuperKmer; use obikseq::{SuperKmer, set_k};
use tempfile::{NamedTempFile, TempDir}; use tempfile::{NamedTempFile, TempDir};
const TEST_K: usize = 4; const TEST_K: usize = 4;
@@ -460,22 +452,24 @@ mod tests {
#[test] #[test]
fn creation_holds_no_fd() { fn creation_holds_no_fd() {
set_k(TEST_K);
let dir = TempDir::new().unwrap(); let dir = TempDir::new().unwrap();
let p = pool(3); let p = pool(3);
for i in 0..10 { for i in 0..10 {
create_token(&p, dir.path().join(format!("p{i}.zst")), TEST_K).unwrap(); create_token(&p, dir.path().join(format!("p{i}.zst"))).unwrap();
} }
assert_eq!(p.lock().unwrap().open_count(), 0); assert_eq!(p.lock().unwrap().open_count(), 0);
} }
#[test] #[test]
fn pool_limits_open_fds() { fn pool_limits_open_fds() {
set_k(TEST_K);
let dir = TempDir::new().unwrap(); let dir = TempDir::new().unwrap();
let p = pool(3); let p = pool(3);
let sk = make_sk(0); let sk = make_sk(0);
let mut tokens: Vec<SKFileWriter> = (0..6) let mut tokens: Vec<SKFileWriter> = (0..6)
.map(|i| create_token(&p, dir.path().join(format!("p{i}.zst")), TEST_K).unwrap()) .map(|i| create_token(&p, dir.path().join(format!("p{i}.zst"))).unwrap())
.collect(); .collect();
for t in tokens.iter_mut() { for t in tokens.iter_mut() {
@@ -491,12 +485,13 @@ mod tests {
#[test] #[test]
fn evicted_token_stays_logically_open() { fn evicted_token_stays_logically_open() {
set_k(TEST_K);
let dir = TempDir::new().unwrap(); let dir = TempDir::new().unwrap();
let p = pool(1); let p = pool(1);
let sk = make_sk(0); let sk = make_sk(0);
let mut t0 = create_token(&p, dir.path().join("a.zst"), TEST_K).unwrap(); let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
let mut t1 = create_token(&p, dir.path().join("b.zst"), TEST_K).unwrap(); let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
open_token(&mut t0, &sk); // t0 fd open, pool full open_token(&mut t0, &sk); // t0 fd open, pool full
open_token(&mut t1, &sk); // evicts t0, t1 fd open open_token(&mut t1, &sk); // evicts t0, t1 fd open
@@ -507,12 +502,13 @@ mod tests {
#[test] #[test]
fn evicted_data_readable_after_close_all() { fn evicted_data_readable_after_close_all() {
set_k(TEST_K);
let dir = TempDir::new().unwrap(); let dir = TempDir::new().unwrap();
let p = pool(1); let p = pool(1);
let sk = make_sk(0); let sk = make_sk(0);
let mut t0 = create_token(&p, dir.path().join("a.zst"), TEST_K).unwrap(); let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
let mut t1 = create_token(&p, dir.path().join("b.zst"), TEST_K).unwrap(); let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
t0.set_flush_threshold(1); t0.set_flush_threshold(1);
t0.write(&sk).unwrap(); // t0 fd open, pool full t0.write(&sk).unwrap(); // t0 fd open, pool full
@@ -528,7 +524,7 @@ mod tests {
p.lock().unwrap().close_all().unwrap(); p.lock().unwrap().close_all().unwrap();
for name in &["a.zst", "b.zst"] { for name in &["a.zst", "b.zst"] {
let mut r = SKFileReader::open(dir.path().join(name), TEST_K).unwrap(); let mut r = SKFileReader::open(dir.path().join(name)).unwrap();
let got = r.read_batch(10).unwrap(); let got = r.read_batch(10).unwrap();
assert_eq!(got.len(), 1, "{name}: expected 1 record"); assert_eq!(got.len(), 1, "{name}: expected 1 record");
} }
@@ -536,13 +532,14 @@ mod tests {
#[test] #[test]
fn touch_moves_to_mru_so_lru_is_evicted() { fn touch_moves_to_mru_so_lru_is_evicted() {
set_k(TEST_K);
let dir = TempDir::new().unwrap(); let dir = TempDir::new().unwrap();
let p = pool(2); let p = pool(2);
let sk = make_sk(0); let sk = make_sk(0);
let mut t0 = create_token(&p, dir.path().join("a.zst"), TEST_K).unwrap(); let mut t0 = create_token(&p, dir.path().join("a.zst")).unwrap();
let mut t1 = create_token(&p, dir.path().join("b.zst"), TEST_K).unwrap(); let mut t1 = create_token(&p, dir.path().join("b.zst")).unwrap();
let mut t2 = create_token(&p, dir.path().join("c.zst"), TEST_K).unwrap(); let mut t2 = create_token(&p, dir.path().join("c.zst")).unwrap();
open_token(&mut t0, &sk); // t0 open open_token(&mut t0, &sk); // t0 open
open_token(&mut t1, &sk); // t1 open, t0 LRU open_token(&mut t1, &sk); // t1 open, t0 LRU
@@ -560,6 +557,7 @@ mod tests {
#[test] #[test]
fn close_all_produces_readable_files() { fn close_all_produces_readable_files() {
set_k(TEST_K);
let dir = TempDir::new().unwrap(); let dir = TempDir::new().unwrap();
let p = pool(8); let p = pool(8);
let paths: Vec<_> = (0..4) let paths: Vec<_> = (0..4)
@@ -568,7 +566,7 @@ mod tests {
let mut tokens: Vec<SKFileWriter> = paths let mut tokens: Vec<SKFileWriter> = paths
.iter() .iter()
.map(|path| create_token(&p, path.clone(), TEST_K).unwrap()) .map(|path| create_token(&p, path.clone()).unwrap())
.collect(); .collect();
for (i, t) in tokens.iter_mut().enumerate() { for (i, t) in tokens.iter_mut().enumerate() {
@@ -581,7 +579,7 @@ mod tests {
p.lock().unwrap().close_all().unwrap(); p.lock().unwrap().close_all().unwrap();
for path in &paths { for path in &paths {
let mut r = SKFileReader::open(path, TEST_K).unwrap(); let mut r = SKFileReader::open(path).unwrap();
let got = r.read_batch(10).unwrap(); let got = r.read_batch(10).unwrap();
assert_eq!(got.len(), 1); assert_eq!(got.len(), 1);
} }
@@ -589,16 +587,17 @@ mod tests {
#[test] #[test]
fn write_batch_roundtrip() { fn write_batch_roundtrip() {
set_k(TEST_K);
let dir = TempDir::new().unwrap(); let dir = TempDir::new().unwrap();
let p = pool(4); let p = pool(4);
let sks: Vec<_> = (0..50).map(make_sk).collect(); let sks: Vec<_> = (0..50).map(make_sk).collect();
let path = dir.path().join("batch.zst"); let path = dir.path().join("batch.zst");
let mut t = create_token(&p, path.clone(), TEST_K).unwrap(); let mut t = create_token(&p, path.clone()).unwrap();
t.write_batch(&sks).unwrap(); t.write_batch(&sks).unwrap();
t.close().unwrap(); t.close().unwrap();
let mut r = SKFileReader::open(&path, TEST_K).unwrap(); let mut r = SKFileReader::open(&path).unwrap();
let got = r.read_batch(100).unwrap(); let got = r.read_batch(100).unwrap();
assert_eq!(got.len(), 50); assert_eq!(got.len(), 50);
for (a, b) in sks.iter().zip(got.iter()) { for (a, b) in sks.iter().zip(got.iter()) {
@@ -608,6 +607,7 @@ mod tests {
#[test] #[test]
fn from_system_limits_bounded() { fn from_system_limits_bounded() {
set_k(TEST_K);
let pool = SKFilePool::from_system_limits(); let pool = SKFilePool::from_system_limits();
assert!(pool.max_open() >= 16); assert!(pool.max_open() >= 16);
assert!(pool.max_open() <= MAX_POOL_SIZE); assert!(pool.max_open() <= MAX_POOL_SIZE);
@@ -615,14 +615,15 @@ mod tests {
#[test] #[test]
fn standalone_roundtrip_zstd() { fn standalone_roundtrip_zstd() {
set_k(TEST_K);
let tmp = NamedTempFile::new().unwrap(); let tmp = NamedTempFile::new().unwrap();
let sks: Vec<_> = (0..100).map(make_sk).collect(); let sks: Vec<_> = (0..100).map(make_sk).collect();
{ {
let mut w = SKFileWriter::create(tmp.path(), TEST_K).unwrap(); let mut w = SKFileWriter::create(tmp.path()).unwrap();
w.write_batch(&sks).unwrap(); w.write_batch(&sks).unwrap();
w.close().unwrap(); w.close().unwrap();
} }
let mut r = SKFileReader::open(tmp.path(), TEST_K).unwrap(); let mut r = SKFileReader::open(tmp.path()).unwrap();
let got = r.read_batch(200).unwrap(); let got = r.read_batch(200).unwrap();
assert_eq!(got.len(), 100); assert_eq!(got.len(), 100);
for (a, b) in sks.iter().zip(got.iter()) { for (a, b) in sks.iter().zip(got.iter()) {
@@ -632,8 +633,9 @@ mod tests {
#[test] #[test]
fn standalone_close_prevents_write() { fn standalone_close_prevents_write() {
set_k(TEST_K);
let tmp = NamedTempFile::new().unwrap(); let tmp = NamedTempFile::new().unwrap();
let mut w = SKFileWriter::create(tmp.path(), TEST_K).unwrap(); let mut w = SKFileWriter::create(tmp.path()).unwrap();
w.close().unwrap(); w.close().unwrap();
assert!(!w.is_open()); assert!(!w.is_open());
assert!(w.write(&make_sk(0)).is_err()); assert!(w.write(&make_sk(0)).is_err());
@@ -641,8 +643,9 @@ mod tests {
#[test] #[test]
fn standalone_is_physically_open() { fn standalone_is_physically_open() {
set_k(TEST_K);
let tmp = NamedTempFile::new().unwrap(); let tmp = NamedTempFile::new().unwrap();
let mut w = SKFileWriter::create(tmp.path(), TEST_K).unwrap(); let mut w = SKFileWriter::create(tmp.path()).unwrap();
assert!(!w.is_physically_open()); // fd deferred until first drain assert!(!w.is_physically_open()); // fd deferred until first drain
w.set_flush_threshold(1); w.set_flush_threshold(1);
w.write(&make_sk(0)).unwrap(); // triggers drain → fd opened w.write(&make_sk(0)).unwrap(); // triggers drain → fd opened
+19 -15
View File
@@ -15,25 +15,20 @@ use std::path::{Path, PathBuf};
/// that it can fast-forward on next open. /// that it can fast-forward on next open.
pub struct SKFileReader { pub struct SKFileReader {
path: PathBuf, path: PathBuf,
k: usize,
reader: Option<Box<dyn std::io::Read + Send>>, reader: Option<Box<dyn std::io::Read + Send>>,
/// Reusable scratch buffer for the `seq` bytes of each record.
seq_buf: Vec<u8>,
/// Number of SuperKmers successfully read so far (for eviction recovery). /// Number of SuperKmers successfully read so far (for eviction recovery).
consumed: u64, consumed: u64,
} }
impl SKFileReader { impl SKFileReader {
/// Open a file for reading. Format is auto-detected from magic bytes. /// Open a file for reading. Format is auto-detected from magic bytes.
/// `k` is the kmer size of the partition; required to decode the on-disk n_kmers field. pub fn open<P: AsRef<Path>>(path: P) -> SKResult<Self> {
pub fn open<P: AsRef<Path>>(path: P, k: usize) -> SKResult<Self> {
let path = path.as_ref().to_owned(); let path = path.as_ref().to_owned();
let (reader, _fmt) = niffler::send::get_reader(Box::new(BufReader::new(File::open(&path)?)))?; let (reader, _fmt) =
niffler::send::get_reader(Box::new(BufReader::new(File::open(&path)?)))?;
Ok(Self { Ok(Self {
path, path,
k,
reader: Some(reader), reader: Some(reader),
seq_buf: Vec::with_capacity(64),
consumed: 0, consumed: 0,
}) })
} }
@@ -46,7 +41,7 @@ impl SKFileReader {
"read from physically closed SKFileReader", "read from physically closed SKFileReader",
) )
})?; })?;
let result = read_superkmer(r, &mut self.seq_buf, self.k)?; let result = read_superkmer(r)?;
if result.is_some() { if result.is_some() {
self.consumed += 1; self.consumed += 1;
} }
@@ -87,7 +82,10 @@ impl SKFileReader {
/// Return an iterator over this reader. /// Return an iterator over this reader.
pub fn iter(&mut self) -> SKFileIter<'_> { pub fn iter(&mut self) -> SKFileIter<'_> {
SKFileIter { reader: self, error: None } SKFileIter {
reader: self,
error: None,
}
} }
// ── pool-internal helpers ───────────────────────────────────────────────── // ── pool-internal helpers ─────────────────────────────────────────────────
@@ -103,7 +101,7 @@ impl SKFileReader {
let target = self.consumed; let target = self.consumed;
self.consumed = 0; self.consumed = 0;
for _ in 0..target { for _ in 0..target {
match read_superkmer(self.reader.as_mut().unwrap(), &mut self.seq_buf, self.k)? { match read_superkmer(self.reader.as_mut().unwrap())? {
Some(_) => self.consumed += 1, Some(_) => self.consumed += 1,
None => break, None => break,
} }
@@ -152,6 +150,10 @@ mod tests {
const TEST_K: usize = 4; // test sequences are 8 bases; k=4 gives n_kmers=5 const TEST_K: usize = 4; // test sequences are 8 bases; k=4 gives n_kmers=5
fn setup() {
obikseq::params::set_k(TEST_K);
}
fn make_sks(n: usize) -> Vec<SuperKmer> { fn make_sks(n: usize) -> Vec<SuperKmer> {
(0..n) (0..n)
.map(|i| { .map(|i| {
@@ -163,15 +165,16 @@ mod tests {
#[test] #[test]
fn iter_all() { fn iter_all() {
setup();
let tmp = NamedTempFile::new().unwrap(); let tmp = NamedTempFile::new().unwrap();
let sks = make_sks(50); let sks = make_sks(50);
{ {
let mut w = SKFileWriter::create(tmp.path(), TEST_K).unwrap(); let mut w = SKFileWriter::create(tmp.path()).unwrap();
w.write_batch(&sks).unwrap(); w.write_batch(&sks).unwrap();
} }
let mut r = SKFileReader::open(tmp.path(), TEST_K).unwrap(); let mut r = SKFileReader::open(tmp.path()).unwrap();
let got: Vec<_> = r.iter().collect(); let got: Vec<_> = r.iter().collect();
assert_eq!(got.len(), 50); assert_eq!(got.len(), 50);
for (a, b) in sks.iter().zip(got.iter()) { for (a, b) in sks.iter().zip(got.iter()) {
@@ -181,15 +184,16 @@ mod tests {
#[test] #[test]
fn reopen_and_seek() { fn reopen_and_seek() {
setup();
let tmp = NamedTempFile::new().unwrap(); let tmp = NamedTempFile::new().unwrap();
let sks = make_sks(20); let sks = make_sks(20);
{ {
let mut w = SKFileWriter::create(tmp.path(), TEST_K).unwrap(); let mut w = SKFileWriter::create(tmp.path()).unwrap();
w.write_batch(&sks).unwrap(); w.write_batch(&sks).unwrap();
} }
let mut r = SKFileReader::open(tmp.path(), TEST_K).unwrap(); let mut r = SKFileReader::open(tmp.path()).unwrap();
// Read 10, then simulate pool eviction + re-access // Read 10, then simulate pool eviction + re-access
let first = r.read_batch(10).unwrap(); let first = r.read_batch(10).unwrap();
r.close(); r.close();