Compare commits

...

125 Commits

Author SHA1 Message Date
Eric Coissac f84dd539bf feat(numa): introduce I/O sampling to prevent activation stalls
Release / create-release (push) Successful in 2m25s
Release / build-linux-x86_64 (push) Successful in 8m47s
Release / build-macos-arm64 (push) Failing after 31s
CI / build (pull_request) Successful in 3m30s
Replaces the monolithic CPU scaling threshold with separate CPU and I/O spawn thresholds. Introduces an `IoSample` struct with platform-specific byte reading and a relative throughput growth heuristic. Adds a 0.1s wall-clock guard to `CpuSample` to suppress artificial efficiency spikes, and updates `maybe_activate` to trigger worker scaling when either resource indicates headroom. Bumps `obikmer` to v1.1.33 and updates architecture documentation.
2026-07-02 10:07:22 +02:00
coissac 6378734e1c Merge pull request 'fix(obisys): remove activation guard to always update metrics' (#54) from push-vkloynurrxzu into main
Reviewed-on: #54
2026-07-01 18:34:10 +00:00
Eric Coissac b3a617cce1 fix(obisys): remove activation guard to always update metrics
Release / create-release (push) Successful in 2m26s
CI / build (pull_request) Successful in 3m35s
Release / build-linux-x86_64 (push) Successful in 8m9s
Release / build-macos-arm64 (push) Failing after 30s
Removes the `if activate` conditional in `src/obisys/src/lib.rs`, making debug logging and state updates for performance counters execute unconditionally. This ensures tracking metrics are continuously refreshed regardless of the activation threshold. Also bumps the `obikmer` dependency version.
2026-07-01 20:32:56 +02:00
coissac 2080e5e8a9 Merge pull request 'ci: fix registry auth and bump obikmer to 1.1.30' (#53) from push-zxlknspoxknt into main
Reviewed-on: #53
2026-07-01 14:20:09 +00:00
Eric Coissac 45ed2bc9b8 ci: fix registry auth and bump obikmer to 1.1.30
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m12s
Release / build-macos-arm64 (push) Failing after 1m55s
CI / build (pull_request) Successful in 3m32s
Update the release workflow to explicitly resolve the Docker registry username from repository secrets instead of inferring it from the runner's actor. Bump the obikmer package version to 1.1.30.
2026-07-01 14:31:30 +02:00
coissac aa126fd89d Merge pull request 'feat: simplify worker spawning logic and update macOS build workflow' (#52) from push-uvmlknmzqqnx into main
Reviewed-on: #52
2026-07-01 09:50:51 +00:00
Eric Coissac c612132763 feat: simplify worker spawning logic and update macOS build workflow
Release / create-release (push) Successful in 2m59s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Failing after 8s
CI / build (pull_request) Successful in 3m24s
Updates the release workflow to run macOS builds inside a Docker container with explicit registry authentication and adjusted artifact paths. Bumps the obikmer crate version to 1.1.29 and adds *.log to .gitignore. Simplifies NUMA worker spawning by lowering the activation threshold from 0.95 to 0.2, replacing complex stateful tracking with a direct efficiency check, and downgrading progress logging to debug level. Includes general code formatting improvements for readability.
2026-07-01 11:40:57 +02:00
coissac 19660f8cd0 Merge pull request 'ci: update registry auth and improve adaptive worker scaling' (#51) from push-qlpywtroutvx into main
Reviewed-on: #51
2026-06-26 13:16:23 +00:00
Eric Coissac 7b07540a69 ci: update registry auth and improve adaptive worker scaling
Release / create-release (push) Successful in 2m27s
CI / build (pull_request) Successful in 3m17s
Release / build-linux-x86_64 (push) Successful in 8m3s
Release / build-macos-arm64 (push) Failing after 1s
Refactor the release workflow to use a structured container object with authenticated pulls for macOS ARM64 builds. Replace single-worker activation with dynamic upfront provisioning based on node and worker counts. Implement an absolute efficiency gain threshold for scaling checks and add early termination to improve adaptive scaling stability. Bump obikmer crate version to 1.1.27.
2026-06-26 15:13:13 +02:00
coissac 89c43e28f5 Merge pull request 'ci: update release workflow and bump obikmer to 1.1.26' (#50) from push-npttlqpomtvz into main
Reviewed-on: #50
2026-06-24 13:55:40 +00:00
Eric Coissac b9b2e42ad2 ci: update release workflow and bump obikmer to 1.1.26
Release / create-release (push) Successful in 2m32s
CI / build (pull_request) Successful in 3m47s
Release / build-linux-x86_64 (push) Successful in 8m18s
Release / build-macos-arm64 (push) Failing after 0s
Replaces the macOS ARM64 cross-compilation container with a custom internal registry image. Adds explicit steps to install the `aarch64-apple-darwin` Rust target and `jq`, and updates the build command to use `--no-default-features`. Bumps the `obikmer` package version from 1.1.25 to 1.1.26.
2026-06-24 15:55:02 +02:00
coissac ca42fdff2f Merge pull request 'ci: update macOS ARM64 build workflow and bump obikmer version' (#49) from push-lllnsqlrqrut into main
Reviewed-on: #49
2026-06-23 13:15:20 +00:00
Eric Coissac 136cd89efb ci: update macOS ARM64 build workflow and bump obikmer version
Release / create-release (push) Successful in 2m27s
Release / build-linux-x86_64 (push) Successful in 7m52s
Release / build-macos-arm64 (push) Failing after 8m53s
CI / build (pull_request) Successful in 5m31s
Replace manual Zig/cargo-zigbuild setup with a pre-configured Docker container (`joseluisq/rust-linux-darwin-builder`). Use explicit Clang cross-compilers for native macOS ARM64 compilation. Bump the `obikmer` package version to 1.1.25.
2026-06-23 15:01:17 +02:00
coissac a4bbf607b7 Merge pull request 'Push kxsopnzprltv' (#48) from push-kxsopnzprltv into main
Reviewed-on: #48
2026-06-23 09:51:33 +00:00
Eric Coissac 9927100a1c chore: update obikmer to 1.1.24
Release / create-release (push) Successful in 2m24s
Release / build-linux-x86_64 (push) Successful in 7m49s
Release / build-macos-arm64 (push) Failing after 3m31s
CI / build (pull_request) Successful in 3m22s
Bumps the obikmer version in Cargo.toml from 1.1.21 to 1.1.24 and updates Cargo.lock to align with the upstream patch release (1.1.23). This ensures consistent dependency resolution across builds.
2026-06-23 11:47:54 +02:00
Eric Coissac 527258f822 ci: enforce macOS 11.0 deployment target for ARM builds
Adds MACOSX_DEPLOYMENT_TARGET=11.0 environment variable and updates the cargo zigbuild target to aarch64-apple-darwin11.0 to explicitly require macOS 11.0 for ARM binary compilation.
2026-06-23 11:46:09 +02:00
coissac ef62f1947e Merge pull request 'chore: bump version to 1.1.21 and update obikindex features' (#47) from push-xwutoxpnxorz into main
Reviewed-on: #47
2026-06-23 08:31:31 +00:00
Eric Coissac d02316dcf6 chore: bump version to 1.1.21 and update obikindex features
Release / create-release (push) Successful in 2m29s
CI / build (pull_request) Successful in 4m36s
Release / build-linux-x86_64 (push) Successful in 10m25s
Release / build-macos-arm64 (push) Failing after 4m50s
Disables default features for the `obikindex` dependency and introduces a `[features]` block. The new `numa` feature is set as the default, conditionally enabling NUMA support in `obikindex`.
2026-06-23 10:30:39 +02:00
coissac c323b3eaef Merge pull request 'Bump obikmer to 1.1.20 and update release workflow' (#46) from push-wpnywwlwxrps into main
Reviewed-on: #46
2026-06-23 08:03:58 +00:00
Eric Coissac b77d8e9ca0 Bump obikmer to 1.1.20 and update release workflow
Release / create-release (push) Successful in 2m26s
CI / build (pull_request) Successful in 3m14s
Release / build-linux-x86_64 (push) Successful in 7m44s
Release / build-macos-arm64 (push) Failing after 7m13s
Update the Gitea release workflow to fetch a full git clone with complete history, ensuring all commits and tags are available for accurate version resolution. This prepares the repository for the standard patch-level release of obikmer v1.1.20.
2026-06-23 10:03:15 +02:00
coissac 7c5bab3694 Merge pull request 'fix(ci): restrict workflow to PRs and improve release tagging' (#45) from push-louqrszyuqpz into main
Reviewed-on: #45
2026-06-23 07:52:35 +00:00
Eric Coissac fab4e0d6de fix(ci): restrict workflow to PRs and improve release tagging
Release / create-release (push) Failing after 26s
Release / build-linux-x86_64 (push) Has been skipped
Release / build-macos-arm64 (push) Has been skipped
CI / build (pull_request) Successful in 3m17s
Restrict the CI pipeline to pull request events only by removing the unconfigured push trigger and eliminating a duplicate pull_request block in the workflow file. Update the Makefile to suppress stderr from the aichat command and introduce a fallback release tag message for robust version tagging. Additionally, bump the obikmer crate version to 1.1.19.
2026-06-23 09:42:23 +02:00
coissac 973a3f3d6e Merge pull request 'feat: add numa feature flag and automate release workflow' (#44) from push-uymxyvsyooro into main
CI / build (push) Successful in 3m16s
Reviewed-on: #44
2026-06-23 07:22:33 +00:00
Eric Coissac 1a839a295a feat: add numa feature flag and automate release workflow
Release / create-release (push) Failing after 37s
Release / build-linux-x86_64 (push) Has been skipped
Release / build-macos-arm64 (push) Has been skipped
CI / build (pull_request) Successful in 3m23s
Refactor the Gitea release pipeline to generate releases via API and upload binaries using a shared ID. Automate changelog generation by fetching recent commits with `jj log` and producing markdown notes via `aichat`. Convert `hwlocality` to an optional dependency gated by a default `numa` feature, providing fallback implementations for graceful degradation when NUMA support is disabled. Bump obikmer to 1.1.18.
2026-06-23 09:07:04 +02:00
coissac 2ea58703c7 Merge pull request 'Push zkptpswyxnvt' (#43) from push-zkptpswyxnvt into main
CI / build (push) Successful in 3m19s
Reviewed-on: #43
2026-06-22 16:29:59 +00:00
Eric Coissac ac3ef106e7 refactor: implement adaptive worker scaling and infallible NUMA build
Release / build-linux-static (push) Successful in 8m4s
CI / build (pull_request) Successful in 3m26s
Replaces the fallible NUMA topology builder with an infallible fallback that synthesizes a single-node UMA configuration on failure or absence. Refactors PartitionRunner to pre-spawn dormant workers and dynamically activate them via CPU efficiency thresholds, replacing static upfront spawning with adaptive scaling. Bumps obikmer crate version to 1.1.15.
2026-06-22 18:29:39 +02:00
Eric Coissac 469e53b6f5 Add genomic distance benchmarking suite and test data
Introduces scripts to compute and validate pairwise genomic distance matrices across multiple metrics. Updates the Makefile with build and comparison targets, adds .gitignore rules for generated outputs, and includes test CSV matrices and a Newick phylogenetic tree for validating the distance computation pipeline.
2026-06-22 18:24:30 +02:00
Eric Coissac 9f1df96ea7 ci: restrict push trigger to main branch
Replace the wildcard `['**']` in the push trigger with `['main']`. This prevents redundant pipeline runs on non-main branches during push events.
2026-06-22 16:58:44 +02:00
coissac 4e4cce2879 Merge pull request 'fix(ci): enable cross-compilation in release workflow and bump obikmer' (#42) from push-sxlpkrkyuttk into main
CI / build (push) Successful in 3m20s
Reviewed-on: #42
2026-06-22 14:31:26 +00:00
Eric Coissac 68b05b93c4 fix(ci): enable cross-compilation in release workflow and bump obikmer
CI / build (push) Successful in 4m38s
Release / build-linux-static (push) Successful in 10m14s
CI / build (pull_request) Successful in 3m40s
Injects PKG_CONFIG_ALLOW_CROSS=1 into the static binary build step to ensure correct native dependency resolution during musl target compilation with cargo zigbuild. Also updates the obikmer crate version from 1.1.13 to 1.1.14.
2026-06-22 16:31:04 +02:00
coissac 0a668cf8a6 Merge pull request 'chore: bump obikmer to 1.1.13 and fix Makefile revision tag' (#41) from push-qwzpxktnlyls into main
CI / build (push) Has been cancelled
Reviewed-on: #41
2026-06-22 14:18:25 +00:00
Eric Coissac e6d6942e2f chore: bump obikmer to 1.1.13 and fix Makefile revision tag
CI / build (push) Has been cancelled
Release / build-linux-static (push) Has been cancelled
CI / build (pull_request) Has been cancelled
Update the obikmer crate version from 1.1.12 to 1.1.13 in Cargo.toml. Additionally, change the Makefile's Git revision specifier from @- to @ to ensure the version tag is applied to the current commit before pushing.
2026-06-22 16:17:52 +02:00
coissac bf9c9aeacb Merge pull request 'chore: bump version to 1.1.12 and fix release workflow' (#40) from push-zmkxouxypspm into main
CI / build (push) Has been cancelled
Reviewed-on: #40
2026-06-22 14:13:13 +00:00
Eric Coissac 22a65857a1 chore: bump version to 1.1.12 and fix release workflow
CI / build (push) Successful in 3m14s
CI / build (pull_request) Successful in 3m51s
Update Cargo.toml to 1.1.12 for a semver patch release. Refactor the Makefile release target to explicitly retrieve the parent commit hash via `jj log` and apply the tag, replacing implicit working directory tagging. Remove `jj auto-describe` and `--change @` in favor of an explicit `git push origin` for the version tag.
2026-06-22 16:12:56 +02:00
coissac d16a867640 Merge pull request 'ci: bypass PEP 668 restrictions and update obikmer to 1.1.11' (#39) from push-mxysluysloxr into main
CI / build (push) Successful in 4m1s
Release / build-linux-static (push) Failing after 7m28s
Reviewed-on: #39
2026-06-22 13:52:51 +00:00
Eric Coissac 616050075f ci: bypass PEP 668 restrictions and update obikmer to 1.1.11
CI / build (push) Successful in 3m41s
CI / build (pull_request) Successful in 3m49s
Add the `--break-system-packages` flag to the `pip install ziglang` command in the Gitea release workflow to bypass PEP 668 restrictions on modern Linux distributions. Additionally, bump the `obikmer` crate version from 1.1.9 to 1.1.11 across both Cargo.toml and Cargo.lock.
2026-06-22 15:52:34 +02:00
coissac e22afe9621 Merge pull request 'chore: bump obikmer to 1.1.9 and update release workflow' (#38) from push-noxuppsknsol into main
CI / build (push) Successful in 3m11s
Release / build-linux-static (push) Failing after 3m4s
Reviewed-on: #38
2026-06-22 13:32:50 +00:00
Eric Coissac bdfac71e65 chore: bump obikmer to 1.1.9 and update release workflow
CI / build (push) Successful in 3m24s
CI / build (pull_request) Failing after 0s
Bumps the obikmer crate version from 1.1.7 to 1.1.9 in Cargo.toml and Cargo.lock. Updates the Gitea release workflow to dynamically locate the Zig compiler via Python, generating musl-targeted gcc/g++ wrapper scripts installed to /usr/local/bin for static Linux cross-compilation during releases.
2026-06-22 15:32:10 +02:00
coissac a00bb37478 Merge pull request 'ci: switch to Zig build toolchain and bump obikmer to 1.1.7' (#37) from push-nvvqmzmrotxx into main
CI / build (push) Successful in 3m14s
Release / build-linux-static (push) Failing after 2m42s
Reviewed-on: #37
2026-06-22 13:20:12 +00:00
Eric Coissac d30a4efd9b ci: switch to Zig build toolchain and bump obikmer to 1.1.7
CI / build (push) Successful in 3m12s
CI / build (pull_request) Successful in 3m16s
Replaces the musl-based static Linux build toolchain with Zig (`ziglang` via pip and `cargo-zigbuild`), removing `musl-tools` dependencies. The workflow now invokes `cargo zigbuild` for cross-compiling the static binary. Additionally, bumps the `obikmer` crate version to 1.1.7.
2026-06-22 15:19:39 +02:00
coissac 6baf2e64ca Merge pull request 'chore: bump obikmer to 1.1.6 and automate git tagging' (#36) from push-yxmtknzsynpx into main
CI / build (push) Successful in 3m20s
Release / build-linux-static (push) Failing after 4m30s
Reviewed-on: #36
2026-06-22 13:01:06 +00:00
Eric Coissac c0a71a2d49 chore: bump obikmer to 1.1.6 and automate git tagging
CI / build (push) Successful in 4m46s
CI / build (pull_request) Successful in 4m27s
Bumps the obikmer crate version from 0.1.4 to 1.1.6 in Cargo.toml and Cargo.lock. Updates the Makefile release target to automatically extract the version, create a Git tag, and push it to the remote repository, extending the existing workflow with standard Git publishing steps.
2026-06-22 15:00:36 +02:00
coissac a609c1af95 Merge pull request 'ci: streamline release workflow and bump obikmer to 0.1.4' (#35) from push-zokprynyqunu into main
CI / build (push) Successful in 4m41s
Release / build-linux-static (push) Failing after 6m4s
Reviewed-on: #35
2026-06-22 09:38:36 +00:00
Eric Coissac 3d32be8a83 ci: streamline release workflow and bump obikmer to 0.1.4
CI / build (push) Successful in 4m33s
CI / build (pull_request) Successful in 4m17s
Replaces the intermediate artifact upload step in the Gitea release workflow with a direct REST API call, eliminating unnecessary dependencies and adding `jq`. Also increments the obikmer crate version to 0.1.4.
2026-06-22 11:38:19 +02:00
coissac c4c71dc892 Merge pull request 'Push mtzqmmrlmzzx' (#34) from push-mtzqmmrlmzzx into main
CI / build (push) Successful in 4m34s
Reviewed-on: #34
2026-06-22 08:47:24 +00:00
Eric Coissac 4e625afaba refactor: update CI toolchain setup and optimize parallel indexing
CI / build (push) Successful in 4m56s
CI / build (pull_request) Successful in 4m11s
Update CI workflows to explicitly install the Rust toolchain via rustup and configure musl targets for deterministic static builds in Docker containers. Bump obikmer dependency to 0.1.3. Refactor obicompactvec to reduce peak memory usage by computing column sizes from filesystem metadata, add atomic writes, and implement cleanup guards. Replace parallel iteration patterns in obikindex with a structured PartitionRunner pipeline for simplified error handling and progress tracking.
2026-06-22 10:46:24 +02:00
Eric Coissac a522c0907e feat: add CI/CD workflows, release automation, and CLI version flag
CI / build (push) Failing after 2m41s
CI / build (pull_request) Failing after 6s
Adds Gitea Actions for continuous integration and tagged releases, including static musl binary compilation and artifact upload. Introduces a Makefile target to automate semantic version bumping and publishing. Bumps the package version to 0.1.1 and enables automatic `--version` output via Clap.
2026-06-22 10:36:40 +02:00
Eric Coissac c1d6f277ce feat(select): add metrics reporting to selection methods
Integrates an obisys::Reporter across indexing and command modules to capture execution metrics. Replaces discarded timer stops with explicit rep.push() calls, adds timing instrumentation for the pack stage, and prints collected reports after each selection branch.
2026-06-22 10:25:24 +02:00
Eric Coissac 9356be4ec0 feat: introduce obitaxonomy crate for hierarchical taxonomy parsing
Adds the `obitaxonomy` crate to parse and validate hierarchical taxonomy paths using a strict `taxonomy:/name@rank/...` syntax. Replaces generic string-based path matching in predicates with structured `TaxPath` and `TaxPattern` types, enforcing explicit anchor constraints and rank-aware semantics. Updates filtering documentation to clarify optional leading slashes and segment-boundary matching rules.
2026-06-22 10:24:04 +02:00
Eric Coissac c694e1f2b0 feat: add benchmark pipeline, expose APIs, and enforce strict paths
Introduces a Make-based orchestration for simulating, indexing, merging, filtering, and verifying k-mer counts and presence. Exposes internal builder and iterator APIs publicly, enforces mandatory leading slashes for predicate patterns, registers the `obitaxonomy` crate, and updates tooling configurations alongside documentation.
2026-06-22 10:18:33 +02:00
Eric Coissac 280ca1f5a3 feat: add optimized new_ones constructor for all-ones bit vectors
Introduces `new_ones` and `add_col_ones` methods to directly initialize all-ones bit vectors and matrix columns. This replaces redundant initialization sequences that created zero-filled structures and applied bitwise NOT, with a single pass that writes contiguous 0xFF bytes to disk. The change eliminates inversion overhead, streamlines test setup, and improves performance for filter mask intersection logic while preserving identical semantics.
2026-06-22 10:00:01 +02:00
Eric Coissac 9abb2db92f refactor: replace explicit bit-setting loops with optimized bulk operations
Refactor bitmatrix, colgroup, and layer modules to replace manual iteration with concise `or_where` predicates and bulk inversion calls. This simplifies the codebase and leverages optimized internal implementations for improved performance.
2026-06-22 09:56:41 +02:00
Eric Coissac 7c1efa9cbb feat: add vectorized column filters and optimize partitioner iteration
Adds `FilterMask` and conditional bitwise methods (`*_where`) to `obicompactvec` for composable column-based slot filtering. Extends `obikpartitionner` with a `MatrixGroupOps` trait and `column_mask_expr` method to express aggregate constraints as vectorized masks. Refactors matrix builder management into a unified `Builders` enum and introduces `try_compute_combined_mask`, enabling O(1) slot checks and skipping unnecessary row reads during partitioning and rebuilding passes.
2026-06-22 09:54:51 +02:00
Eric Coissac 4c4524766c feat(matrix): add partial group reductions and column persistence
Expands MatrixGroupOps with partial_group_min/max helpers for bitwise reductions and introduces add_col_from methods to persist external vectors as matrix columns. Refactors column aggregation in the partitioner to leverage these group operations directly, replacing iterative row processing with simplified builder lifecycle management and explicit metadata serialization.
2026-06-22 09:49:04 +02:00
Eric Coissac 7eea71fdcd docs(obicompactvec): update API docs and algorithm descriptions
Replace trait-based API documentation with concrete, zero-copy view structs and update all associated diagrams. Refine algorithmic descriptions for sentinel handling, overflow stores, and bulk operations. Clarify temporary file lifecycles and group-chunking strategies to support memory-efficient parallel aggregation.
2026-06-22 09:46:19 +02:00
Eric Coissac f91c5a3f79 refactor(obicompactvec): unify bit and int vector slice views
Refactors column and matrix access to use unified `BitSliceView` and `IntSliceView` abstractions, replacing legacy `PackedCol`/`IntColView` types. Introduces `BitSlice`/`IntSlice` traits for zero-copy, trait-based bitwise and arithmetic operations across persistent and temporary vector types. Removes deprecated in-memory `MemoryBitVec` and `MemoryIntVec` implementations and their tests, while updating dependent crates to use the new view-based API and `BitSliceMut` trait.
2026-06-17 23:51:32 +02:00
Eric Coissac fb4962c4fe refactor: replace in-memory vectors with temp-file-backed storage
Introduces `TempCompactIntVec` and `TempBitVec` as temporary, file-backed intermediates to replace eager in-memory vectors, enabling OS-level paging under memory pressure. Updates the `MatrixGroupOps` trait to return `io::Result` types, allowing proper error propagation and supporting chunked accumulation for large column groups. Includes builder patterns with `.freeze()` finalization, automatic `TempDir` cleanup on drop, and necessary test updates to handle the new fallible signatures. Also fixes `Cargo.toml` section ordering.
2026-06-17 23:36:15 +02:00
Eric Coissac 1d38d87ff9 Add column group operations and mask_with trait
Introduce the `ColGroup` struct and `MatrixGroupOps` trait to manage named subsets of column indices and perform additive aggregations (count, sum, any). Implement these operations for `PersistentBitMatrix` and `PersistentCompactIntMatrix`, applying size-optimized branches for presence counts and direct accumulation for small groups. Additionally, add a `mask_with` trait method that efficiently zero-sets elements based on a mask, optimized for sparse masks with O(n_zeros) complexity. Include comprehensive tests covering overflow handling, slot masking, and result additivity across partitioned data.
2026-06-17 23:28:52 +02:00
Eric Coissac 93559c3294 feat: introduce unified column view types for bit and int matrices
This commit introduces `BitColView` and `IntColView` to abstract over Columnar and Packed storage formats, implementing `BitSlice` and `IntSlice` for uniform column access. It adds `col_view()` accessors to `PersistentBitMatrix` and `PackedCompactIntMatrix`, explicitly panicking on implicit variants. The new types are publicly re-exported, and unit tests are added to validate per-element retrieval, aggregation methods, and parity with the original columnar representation.
2026-06-17 23:24:11 +02:00
Eric Coissac 1f0d77d5bf docs: document compact vector implementation with Mermaid diagrams
Add Mermaid diagrams to visualize the trait hierarchy, compact int storage layout, and SIMD-vectorizable arithmetic operations for MemoryIntVec and PersistentCompactIntVec. Also document concrete type structures and planned layer/partition composition rules to improve documentation clarity.
2026-06-17 23:20:55 +02:00
Eric Coissac eeba43ac4f docs: add technical reference for obicompactvec module
Document the two-tier compact integer encoding, BitSlice/IntSlice trait hierarchy, and SIMD-friendly O(n+k) algorithms. Include details on concrete memory and persistent vector types, matrix aggregation traits, and planned group-filtering APIs.
2026-06-17 23:19:31 +02:00
Eric Coissac 7ed7b26039 perf: optimize vec arithmetic and add overflow tests
Refactor `cmp_scalar`, `min`, `max`, `add`, and `diff` to operate directly on the primary byte array, deferring overflow slot resolution to a secondary pass. This eliminates HashMap lookups in the hot path and enables SIMD vectorization. Add six unit tests to validate correct promotion and demotion between storage slots when values cross the 255 threshold.
2026-06-17 23:18:18 +02:00
Eric Coissac 26de90f18d feat: add iteration and aggregation to compact int vec
Implemented `sum()`, `count_nonzero()`, and `iter()` to complete the numeric vector interface. The builder now computes aggregate values across memory-mapped regions and overflow entries, while the reader delegates these operations to its inherent methods. The iterator provides zero-copy access to underlying `u32` elements.
2026-06-17 23:15:56 +02:00
Eric Coissac 497d250d8a refactor: replace byte-level bit iteration with 64-bit words
Refactor `BitIter` to process `u64` chunks using word-aligned shifts instead of byte-level operations. Introduce a dedicated `MemoryBitIter` for `MemoryBitVec`, updating its `iter()` and `IntoIterator` implementations accordingly. Hide `MemoryBitIter` from the public API to narrow the crate's interface, while leveraging explicit alignment guarantees for safer and more efficient bit extraction.
2026-06-17 23:11:12 +02:00
Eric Coissac aa98e82875 refactor: introduce PackedIntCol view and use iterators
Centralizes overflow handling and improves modularity by replacing manual mmap indexing and row loops with composable iterator patterns. This change leverages Rust's iterator traits for efficient, idiomatic column traversal while encapsulating data access in a dedicated view struct.
2026-06-17 23:09:18 +02:00
Eric Coissac 5ff5b04d2d refactor: replace manual bit ops with BitSlice traits
Refactors bit manipulation and distance calculations to leverage standardized `BitSlice` traits, replacing manual byte/word logic with safer, reusable methods. Extends `IntSlice` and `IntSliceMut` traits to expose direct memory-mapped access and overflow management, enabling efficient bulk data extraction and serialization. Replaces manual bit-shifting loops with optimized table-based unpacking and adds population count and distance metric methods for improved performance. Updates `PersistentBitVecBuilder` with file tracking and safe flushing, and aligns test imports with new trait bounds.
2026-06-17 15:28:44 +02:00
Eric Coissac df7b400fda perf: optimize aggregation with byte-level helpers and direct mmap
Introduce `byte_sum` and `byte_count_nonzero` to efficiently aggregate compact-int byte slices, bypassing per-element decoding and overflow map lookups. Refactor `sum()` and `count_nonzero()` across the matrix, reader, and traits modules to use direct memory-mapped slice iteration and idiomatic Rust iterators. Additionally, expose `MemoryIntIter` publicly and implement `IntoIterator` and `IntSlice` for `MemoryIntVec` to enable standard iteration and delegate aggregation to the new helpers.
2026-06-17 15:21:21 +02:00
Eric Coissac d1717688d2 refactor: extract matrix helpers and improve bit iteration ergonomics
Refactor parallel matrix construction by extracting reusable `pairwise_matrix` and `pairwise2_matrix` helpers, and consolidate binary record deserialization into dedicated parsing functions. Add `set` and `iter` methods to `BitSliceMut` and `MemoryBitVec` for ergonomic bit manipulation and iteration. Standardize JSON field extraction via `meta::field`, expose `MemoryBitIter`, and improve test reliability by automatically cleaning up temporary directories.
2026-06-17 15:15:39 +02:00
Eric Coissac cde6457eea feat: add memory vectors, slice traits, and column extraction methods
Introduce `MemoryBitVec` and `MemoryIntVec` for efficient in-memory storage with hybrid compression and overflow handling. Implement `BitSlice`, `BitSliceMut`, `IntSlice`, and `IntSliceMut` traits across persistent and memory-backed types to enable generic slice operations and bitwise/arithmetic overloads. Add `col_persist` and `col_as_memory` methods to `BitMatrix` and `IntMatrix` for efficient column extraction. Align with the new single-pass rebuild architecture by supporting fast kmer filtering and matrix rebuilding. Includes comprehensive tests and profiling instrumentation for the packing phase.
2026-06-17 15:03:18 +02:00
Eric Coissac b6fcbc545f refactor: replace rayon with NUMA-aware PartitionRunner
Replaces `rayon` parallel iteration across index, rebuild, reindex, and select modules with a custom `PartitionRunner`. This introduces NUMA-aware task distribution with CPU pinning and round-robin scheduling, eliminating `Arc`, `Mutex`, and atomic synchronization primitives in favor of a flat, pre-spawned worker architecture. Error handling is simplified via `.map_err()` and the `?` operator, while progress bar updates are decoupled into dedicated callbacks.
2026-06-15 18:53:31 +02:00
coissac 9578f991f4 Merge pull request 'Push pslsukyowzrp' (#32) from push-pslsukyowzrp into main
Reviewed-on: #32
2026-06-15 16:29:24 +00:00
Eric Coissac 1cd7916e06 refactor: replace rayon with NUMA-aware PartitionRunner
Replaces `rayon` parallel iteration across index, rebuild, reindex, and select modules with a custom `PartitionRunner`. This introduces NUMA-aware task distribution with CPU pinning and round-robin scheduling, eliminating `Arc`, `Mutex`, and atomic synchronization primitives in favor of a flat, pre-spawned worker architecture. Error handling is simplified via `.map_err()` and the `?` operator, while progress bar updates are decoupled into dedicated callbacks.
2026-06-15 18:29:04 +02:00
Eric Coissac bc92dc4592 refactor: restructure partitioner with shared utilities and pipeline
This commit restructures the partitioner crate by extracting shared utilities and the `ColBuilder` enum into a new `common` module. It introduces a multi-phase `graph_pipeline` for constructing and materializing De Bruijn graphs, replacing manual graph construction in `index_layer`, `merge_layer`, and `rebuild_layer`. All layer workflows now use centralized `build_graph` and `materialize_layer` abstractions, with standardized error context strings for improved diagnostics.
2026-06-15 14:08:16 +02:00
coissac a9567ad023 Merge pull request 'Push rtnzuqxzmkon' (#31) from push-rtnzuqxzmkon into main
Reviewed-on: #31
2026-06-15 09:40:35 +00:00
Eric Coissac 4a64718fd1 perf: replace partition processing with adaptive NUMA worker pool
Replaces the previous partition processing logic with an adaptive, NUMA-aware multi-threaded worker pool that dynamically scales active threads based on real-time CPU efficiency. Introduces pre-spawned, CPU-pinned threads managed via crossbeam channels and Rayon to optimize memory bandwidth and core utilization. Adds a `max_workers()` accessor to aggregate maximum worker capacity across NUMA nodes and updates diagnostics to report active versus maximum worker counts.
2026-06-15 11:40:14 +02:00
Eric Coissac 7a87e911b6 feat: introduce NUMA-aware PartitionRunner for adaptive parallelism
Replace NUMA-naive Rayon loops and ad-hoc adaptive pools with a unified `PartitionRunner` that manages a NUMA-aware worker pool. The implementation uses pinned Rayon thread pools per node and activates dormant threads based on real-time CPU efficiency metrics. This standardizes partition-level parallelism, optimizes memory locality, and eliminates cross-socket traffic. Includes architecture documentation and updates mkdocs navigation.
2026-06-15 11:34:41 +02:00
coissac 313d73838a Merge pull request 'feat: add pipeline concurrency throttling and HPC build docs' (#30) from push-owwylwtskwzw into main
Reviewed-on: #30
2026-06-15 08:33:41 +00:00
Eric Coissac 175ea5bbd0 feat: add pipeline concurrency throttling and HPC build docs
Introduces a counting semaphore-based throttling mechanism to limit concurrent file I/O and pipeline processing. Replaces custom path wrappers with standardized `Throttled` types across `obikmer` and `obikpartitionner`, ensuring RAII-based resource cleanup and explicit backpressure. Additionally, documents how to redirect Cargo build artifacts to local scratch storage on HPC filesystems to prevent compilation slowdowns.
2026-06-15 10:33:23 +02:00
coissac c6ea0c53e3 Merge pull request 'feat: implement NUMA-aware worker pools for merge command' (#29) from push-wusvurukprsr into main
Reviewed-on: #29
2026-06-14 21:57:21 +00:00
Eric Coissac ea767376bd feat: implement NUMA-aware worker pools for merge command
Replaces the global Rayon pool with per-NUMA-node thread pools that pin worker threads to their respective nodes, leveraging Linux first-touch allocation to reduce cross-NUMA memory contention and improve cache locality. Integrates the `hwlocality` crate with a vendored build, includes graceful fallbacks for single-socket or non-Linux systems, and updates dependency constraints. Also adds installation and architecture documentation, and corrects parallelism detection in the partitioner.
2026-06-14 23:56:52 +02:00
coissac f1d76f3203 Merge pull request 'refactor(merge): extract adaptive worker spawn logic' (#28) from push-yzruqtyqvopm into main
Reviewed-on: #28
2026-06-13 12:56:34 +00:00
Eric Coissac c4071eb450 refactor(merge): extract adaptive worker spawn logic
Centralize inline spawn checks into a `should_spawn_worker` function with adaptive thresholds. The first worker spawns at <95% CPU efficiency, while subsequent workers only trigger if marginal efficiency gain exceeds 25% of the expected `1/n_workers` (minimum 3%). Also increases the spawn poll interval from 10s to 20s.
2026-06-13 14:56:01 +02:00
coissac 817b02cbc1 Merge pull request 'Push zkspuxlpumpw' (#27) from push-zkspuxlpumpw into main
Reviewed-on: #27
2026-06-13 11:25:12 +00:00
Eric Coissac 547cb72d76 refactor: Enforce Rayon parallelism and fix merge_layer concurrency
Updated memory guidelines and feedback docs to explicitly classify intra-partition phases as parallel, correcting prior assumptions of sequential execution. Refactored merge_layer.rs to wrap column builders in Arc<Mutex<ColBuilder>> and use Arc::try_unwrap for safe concurrent access, eliminating race conditions and preventing double-closes during pass2.
2026-06-13 13:24:55 +02:00
Eric Coissac 6d85387077 feat: add performance instrumentation and dynamic worker scaling
This change enhances observability and adaptability in the merge pipeline. Performance timing and debug logging are added to the De Bruijn graph and partition merge layers to track phase durations and pipeline metrics. The merge module replaces blocking receives with timed polls to sample CPU efficiency, dynamically spawning workers when utilization drops below a threshold. A new script is also introduced to parse merge debug logs and generate structured Markdown reports detailing throughput, phase breakdowns, and partition performance.
2026-06-13 13:21:53 +02:00
coissac fb5b53dca9 Merge pull request 'Push ooxwzorvsqvy' (#26) from push-ooxwzorvsqvy into main
Reviewed-on: #26
2026-06-13 09:59:07 +00:00
Eric Coissac fddf630772 style: apply consistent formatting and whitespace normalization
Applies consistent formatting, whitespace normalization, and indentation standardization to `debruijn.rs` and `merge.rs`. Reorganizes imports and downgrades a unitig traversal log from `info!` to `debug!`. No functional logic or runtime behavior is altered.
2026-06-13 11:58:20 +02:00
Eric Coissac bc14346f5f feat: add CPU-aware parallel worker pool for partition merging
Introduce CpuSample to measure process-level CPU efficiency and wall-clock time. Use crossbeam-channel to distribute partition merging tasks to a dynamic worker pool that scales based on CPU utilization, capped at half the available cores. Update diagnostics to track pool usage.
2026-06-13 11:58:20 +02:00
Eric Coissac fb8c6e427c refactor: pass Unitig objects directly instead of raw byte slices
Refactored `try_for_each_unitig` and related pipelines across `obidebruinj` and `obikpartitionner` to accept `Unitig` instances directly. This eliminates manual `Unitig::from_nucleotides()` conversions, simplifies the data flow, and reduces unnecessary allocation overhead.
2026-06-13 11:52:50 +02:00
Eric Coissac 1f336fe496 refactor: replace mutex with channels for parallel debruijn processing
Add `rayon` and `crossbeam-channel` dependencies to support concurrent execution. Replace the synchronous, mutex-protected closure pattern with a channel-based producer-consumer approach using `std::thread::scope`. This decouples unitig iteration from processing, eliminating lock contention and `Mutex` overhead while enabling parallel workloads.
2026-06-13 11:49:27 +02:00
Eric Coissac 5f98d2ef96 refactor: replace explicit collect with Unitig::from_nucleotides
Introduce a thread-local buffer to materialize nucleotide iterators into contiguous slices. Update `try_for_each_unitig` across the debruijn, index, merge, and rebuild layers to directly instantiate `Unitig` via `from_nucleotides()` instead of explicitly collecting iterators. This eliminates intermediate allocations and aligns test code with the new approach.
2026-06-13 11:47:06 +02:00
Eric Coissac 8b563d0804 refactor: migrate pipeline stages and improve graph processing
Refactored neighbor resolution to explicitly track unvisited indices for degree-1 nodes, updated display formatting, and added timing and debug logging to the degree computation routine. Migrated pipeline stages from eager vector returns to explicit flat implementations, enabling backpressure-aware streaming, configurable batch processing, incremental yielding, and progress tracking via a delta channel.
2026-06-13 11:44:17 +02:00
coissac 7208dcbb4a Merge pull request 'refactor: defer SrcLayerData lookups in RawBatch' (#25) from push-nxrynoorswrw into main
Reviewed-on: #25
2026-06-12 20:19:21 +00:00
Eric Coissac 2e69b0b7fe refactor: defer SrcLayerData lookups in RawBatch
Replace eager resolution of `Vec<u32>` values with an `Arc<SrcLayerData>` handle passed alongside `Vec<CanonicalKmer>`. This shifts the lookup logic to the subsequent transform step, reducing memory overhead and enabling shared, thread-safe access to the source layer data.
2026-06-12 22:18:57 +02:00
coissac 9ea1dff5d6 Merge pull request 'Push rwqsmuvystym' (#24) from push-rwqsmuvystym into main
Reviewed-on: #24
2026-06-12 19:33:20 +00:00
Eric Coissac b2c8373586 refactor: parallelize merge layer with WorkerPool pipeline
Replaces the synchronous sequential loop with a multi-threaded pipeline using `WorkerPool` and custom stage macros. Shared mutable state is wrapped in `Arc<Mutex<>>` for thread-safe updates, while pipeline errors are centralized via `Arc<Mutex<Option<String>>>` to propagate failures before thread join.
2026-06-12 21:32:53 +02:00
Eric Coissac ba49af6f9e refactor: parallelize merge and partition logic with obipipeline
Introduce the `obipipeline` dependency and refactor merge and partition logic to leverage parallel execution. Update `merge_partitions` to use rayon with dynamic memory budgeting and concurrency control via a pilot run. Refactor Pass 1 to concurrently read unitigs, filter kmers through a shared `LayeredMap`, and populate the graph safely. Simplify diagnostics to report total kmer counts and replace manual flags with graph length validation.
2026-06-12 21:32:04 +02:00
Eric Coissac 2bc189e962 feat: dynamically compute seed expansion based on RSS
Introduce a `peak_rss_bytes()` utility for accurate per-phase RAM measurement. Replace the genome-length heuristic with a dynamic seed expansion ratio based on actual RSS delta. Explicitly drop the `GraphDeBruijn` instance before MPHF construction to prevent resource contention and ensure proper memory management.
2026-06-12 16:39:38 +02:00
coissac db9c604199 Merge pull request 'feat: enhance memory budgeting and add rebuild diagnostics' (#23) from push-nptzpkomspkv into main
Reviewed-on: #23
2026-06-12 13:21:12 +00:00
Eric Coissac 52fd2cf801 feat: enhance memory budgeting and add rebuild diagnostics
This commit improves memory management by respecting Linux cgroup v1/v2 limits and introduces a configurable memory budget for the new `rebuild` subcommand to prevent OOM during index reconstruction. The rebuild process now supports filtering, compaction, and parallelization. Diagnostic capabilities are expanded with debug-level tracing for partition merges, k-mer expansion tracking, and utility flags for label renaming, matrix size breakdowns, per-genome counts, and partition distribution reporting. Accessor methods for active and remaining memory have also been added to the stats struct.
2026-06-12 15:20:38 +02:00
coissac 97e3fb9761 Merge pull request 'Push ylnwstyzqwrt' (#22) from push-ylnwstyzqwrt into main
Reviewed-on: #22
2026-06-12 10:10:03 +00:00
Eric Coissac b5e027f23b feat: add memory-aware parallel merge scheduling and CLI flags
Introduces a memory-aware scheduling strategy for parallel partition merging that replaces unbounded concurrency with a First-Fit Decreasing approach gated by a thread-safe `MemoryBudget` semaphore. An adaptive expansion factor, seeded by a sequential pilot run, dynamically caps concurrent workers to prevent hashbrown OOMs. Adds a `--budget-fraction` CLI flag to configure RAM allocation, enhances the CLI to accept multiple indexes, and introduces comprehensive partition diagnostics including memory utilization tracking, concurrency metrics, and statistical summaries with ASCII histograms. Updates documentation and navigation accordingly.
2026-06-12 11:44:10 +02:00
Eric Coissac f44fe042bc feat: add parallel k-mer counting and stats CLI
Introduces allocation-free `sum()` and `count_nonzero()` methods for compact integer vectors, extending the `ColumnWeights` trait with `partial_kmer_counts`. Adds parallel partition scanning to the k-mer index for computing per-genome distinct k-mer counts, and exposes a new `--stats` CLI flag to output these statistics as CSV.
2026-06-12 11:29:32 +02:00
coissac 94e0a370b3 Merge pull request 'Push tmpsxsztwpxl' (#21) from push-tmpsxsztwpxl into main
Reviewed-on: #21
2026-06-09 13:31:25 +00:00
Eric Coissac 970460be42 refactor: rename rebuild subcommand to filter
Rename the `rebuild` CLI subcommand to `filter` to better reflect its primary purpose of row-level selection and k-mer filtering. Update all associated CLI arguments, logging, error messages, and module registrations accordingly. Introduce a dedicated `Rebuild` subcommand for index compaction, fully decoupling it from the filtering logic. Also refine related documentation to align with the new naming and semantics.
2026-06-09 15:26:37 +02:00
Eric Coissac e66adef23d feat: add select command for genome column projection and aggregation
Introduces the `select` CLI command to project and aggregate genome-level k-mer data by column. Adds `filter` as an alias for `rebuild`. The implementation uses parallel partition processing, supports metadata-driven grouping with configurable aggregation operators, and performs atomic in-place rewrites or filtered exports. Updates documentation and navigation accordingly.
2026-06-09 15:09:47 +02:00
coissac b0dab452f6 Merge pull request 'refactor: optimize dump partition iteration and add progress tracking' (#20) from push-xqswlxlvmyrq into main
Reviewed-on: #20
2026-06-09 09:34:13 +00:00
Eric Coissac db730e9cf6 refactor: optimize dump partition iteration and add progress tracking
Refactor partition iteration to support a generic `on_partition` callback executed after each parallel partition completes. Split the logic into bounded and unbounded paths; the bounded path uses an `AtomicUsize` to enforce row limits, while the unbounded path eliminates atomic contention to improve throughput. Additionally, integrate a progress bar into the dump command by passing an increment callback to `idx.dump()`, ensuring proper initialization and cleanup.
2026-06-09 11:07:48 +02:00
coissac f65ecd19cc Merge pull request 'Push lrwmyplxxzkn' (#19) from push-lrwmyplxxzkn into main
Reviewed-on: #19
2026-06-09 08:28:20 +00:00
Eric Coissac 7dd8db1409 docs: document conservative rounding strategy for filtering thresholds
Specifies that minimum bounds use ceiling and maximum bounds use floor to enforce strictness. Clarifies that the implementation avoids explicit rounding by directly comparing integer counts against floating-point fractions, which is mathematically equivalent.
2026-06-09 10:26:21 +02:00
Eric Coissac ce45e2fbe1 refactor: centralize k-mer filtering logic and add validation
Refactor shared `FilterArgs` and `build_group_filter` to return a `Result` with explicit validation for fraction bounds, min/max ordering, and count constraints. Update conditional defaults for `--min-frac` and `--max-outgroup-count` to depend on explicit quorum flags, preventing silent configuration conflicts. Update documentation and MkDocs navigation to reflect the new centralized k-mer filtering system across `rebuild`, `dump`, and `unitig` commands.
2026-06-09 10:22:25 +02:00
Eric Coissac 2465cfbc4b Parallelize partition iteration using Rayon
Introduce thread-local `Vec<u8>` buffers to eliminate concurrent I/O contention. Replace the mutable row counter with an `AtomicUsize` and `fetch_update` to enable lock-free early termination when the limit is reached. Collected chunks are then written sequentially to preserve partition ordering.
2026-06-09 10:04:25 +02:00
Eric Coissac d626d42ec7 feat: add --head and --presence-threshold to dump and distance
Introduces `--head N` to the `dump` command for early iteration termination and `--presence-threshold N` to the `distance` command for Jaccard filtering on count indexes. Updates filter defaults to adapt based on explicit ingroup/outgroup declarations. Fixes a Rust type mismatch in the unitig closure and updates partition iteration callbacks to return `bool` for proper early termination support. Documentation is updated accordingly.
2026-06-09 10:04:25 +02:00
coissac 650eea43b6 Merge pull request 'Push quqlpklvxsqx' (#18) from push-quqlpklvxsqx into main
Reviewed-on: #18
2026-06-08 18:15:01 +00:00
Eric Coissac eb7805c747 feat: add configurable presence threshold to kmer distance
Introduce a `--presence-threshold` CLI argument (default: 1) and update `KmerIndex::distance` to accept a `presence_threshold` parameter. This replaces hardcoded zero thresholds, enabling configurable filtering of low-abundance kmers during Jaccard distance calculations.
2026-06-08 20:14:33 +02:00
Eric Coissac 1ec65922df feat: implement parallel pairwise distance matrices
Introduces parallelized pairwise distance matrix computation for Jaccard, Hamming, Bray-Curtis, Euclidean, and Hellinger metrics across `Columnar`, `Packed`, and `Implicit` matrix variants. Adds trait methods and convenience wrappers, safely handles normalization and zero-denominator edge cases, and updates test suites to import required traits for validation.
2026-06-08 20:08:09 +02:00
Eric Coissac 09d9e21744 feat: integrate tracing and enhance bit matrix operations
Add the `tracing` crate to `obidebruinj`, `obisys`, and resolve it in `Cargo.lock`. Replace `eprintln!` statements with structured `debug!` and `info!` macros. Introduce a `TracedBar` wrapper for progress bars and enhance the `Stage` lifecycle to emit structured events for timing, memory metrics, and swap warnings. Add a progress spinner for unitig degree computation. Extend `PersistentBitMatrix` with columnar bit-vector operations and parallel distance methods, enabling uniform distance computations across all storage layouts while replacing previous panics with dimension-based fallbacks.
2026-06-08 19:55:06 +02:00
coissac 3f47e22083 Merge pull request 'Push pvqkqxlkkwry' (#17) from push-pvqkqxlkkwry into main
Reviewed-on: #17
2026-06-06 04:44:10 +00:00
Eric Coissac 03c7bb0b99 Relax unitig assertion in debruijn test
Replace the strict `unitigs.len() == 1` assertion with a non-empty check to allow multiple unitigs. Update the test comment to describe the general non-repetitive sequence recovery principle instead of a specific example. The core k-mer roundtrip validation logic remains unchanged.
2026-06-06 06:41:45 +02:00
Eric Coissac b39eee688a refactor(debruijn): unify graph traversal with WalkState iterator
Replaces deeply nested branching with early returns and `then_some`. Introduces a cycle-detecting `find_chain_start` method and updates `UnitigNucIter` to use step-based iteration with atomic node claiming. This eliminates nested iterators and redundant state management, improving code readability and maintainability.
2026-06-06 06:38:28 +02:00
Eric Coissac 95b3461405 refactor: centralize graph traversal logic in walk
Refactor `leavable` and `reachable` to eliminate duplicated graph traversal logic by mutually delegating via `WalkState`. `leavable` now returns `self.walk(graph).is_some()`, while `reachable` delegates to the inverted `direct` state's `leavable` check. This centralizes kmer extension and visited-state validation in `walk`, simplifying control flow and reducing code duplication.
2026-06-06 06:36:48 +02:00
Eric Coissac 952a21eef8 refactor: remove naked_asm and extract collect_unitigs helper
Remove the `std::arch::naked_asm` import as it is no longer required. Introduce a `collect_unitigs` helper to abstract nucleotide sequence extraction from `GraphDeBruijn`, and refactor the test suite to use it, eliminating repetitive collection code and standardizing graph iteration logic.
2026-06-06 04:33:59 +02:00
Eric Coissac 5c2f48535f refactor: rename compute_degrees and mark start nodes
Renames `compute_degrees` to `compute_degrees_and_mark_starts` across the De Bruijn graph and partitioner layers to consolidate degree calculation and start-node flagging. Introduces safe neighbor iteration methods and a debug validation block to verify graph consistency. Refactors unitig extraction to use sequential execution with a `Mutex` for safe error propagation. Fixes malformed and duplicated method calls, adds auto-generation of missing `meta.json` files, and ensures persistent matrix builders are explicitly closed to finalize metadata.
2026-06-05 19:48:59 +02:00
Eric Coissac 27088ab810 refactor: optimize unitig iteration and graph traversal
Switches unitig processing to a lazy, fallible `try_for_each_unitig` API across partitioner layers, reducing intermediate allocations and enabling proper error propagation. Refactors de Bruijn graph traversal into a two-pass algorithm with explicit node flags, named constants, and diagnostic logging. Introduces parallel chain processing and staged performance profiling for the unitig command, and adds a memory-efficient `FromIterator` implementation for packed nucleotide sequences.
2026-06-05 19:48:59 +02:00
coissac ea2c594c86 Merge pull request 'Push ruqusmkoyvwm' (#16) from push-ruqusmkoyvwm into main
Reviewed-on: #16
2026-06-05 08:41:08 +00:00
129 changed files with 11992 additions and 2168 deletions
Vendored
BIN
View File
Binary file not shown.
+35
View File
@@ -0,0 +1,35 @@
name: CI
on:
pull_request:
branches: ['main']
jobs:
build:
runs-on: ubuntu-latest
defaults:
run:
working-directory: src
steps:
- uses: actions/checkout@v4
- name: Install Rust
run: |
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh -s -- -y --default-toolchain stable
echo "$HOME/.cargo/bin" >> $GITHUB_PATH
- name: Cache cargo registry
uses: actions/cache@v4
with:
path: |
~/.cargo/registry
~/.cargo/git
src/target
key: ${{ runner.os }}-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: ${{ runner.os }}-cargo-
- name: Build
run: cargo build --release
- name: Test
run: cargo test --release
+123
View File
@@ -0,0 +1,123 @@
name: Release
on:
push:
tags:
- "v*"
jobs:
create-release:
runs-on: ubuntu-latest
outputs:
release_id: ${{ steps.create.outputs.release_id }}
steps:
- uses: actions/checkout@v4
with:
fetch-depth: 0
- name: Create Gitea release
id: create
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
TAG: ${{ github.ref_name }}
run: |
sudo apt-get update -qq && sudo apt-get install -y -qq jq
body=$(git for-each-ref --format='%(contents)' "refs/tags/$TAG")
release_id=$(curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases" \
-H "Authorization: token $GITEA_TOKEN" \
-H "Content-Type: application/json" \
-d "{\"tag_name\":\"$TAG\",\"name\":\"$TAG\",\"body\":$(echo "$body" | jq -Rs .)}" | jq -r '.id')
echo "release_id=$release_id" >> $GITHUB_OUTPUT
build-linux-x86_64:
needs: create-release
runs-on: ubuntu-latest
defaults:
run:
working-directory: src
steps:
- uses: actions/checkout@v4
- name: Install Rust + zigbuild
run: |
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh -s -- -y --default-toolchain stable
echo "$HOME/.cargo/bin" >> $GITHUB_PATH
sudo apt-get update -qq && sudo apt-get install -y -qq jq
pip install ziglang --quiet --break-system-packages
$HOME/.cargo/bin/cargo install cargo-zigbuild
$HOME/.cargo/bin/rustup target add x86_64-unknown-linux-musl
- name: Create musl C/C++ wrappers
run: |
ZIG=$(python3 -c "import ziglang, os; print(os.path.join(os.path.dirname(ziglang.__file__), 'zig'))")
printf '#!/bin/sh\nexec "%s" cc -target x86_64-linux-musl "$@"\n' "$ZIG" | sudo tee /usr/local/bin/x86_64-linux-musl-gcc > /dev/null
printf '#!/bin/sh\nexec "%s" c++ -target x86_64-linux-musl "$@"\n' "$ZIG" | sudo tee /usr/local/bin/x86_64-linux-musl-g++ > /dev/null
sudo chmod +x /usr/local/bin/x86_64-linux-musl-gcc /usr/local/bin/x86_64-linux-musl-g++
- name: Cache cargo registry
uses: actions/cache@v4
with:
path: |
~/.cargo/registry
~/.cargo/git
src/target
key: linux-musl-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: linux-musl-cargo-
- name: Build static binary
env:
PKG_CONFIG_ALLOW_CROSS: "1"
run: cargo zigbuild --release --target x86_64-unknown-linux-musl
- name: Prepare and upload artifact
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
RELEASE_ID: ${{ needs.create-release.outputs.release_id }}
run: |
mkdir -p /tmp/dist
cp target/x86_64-unknown-linux-musl/release/obikmer /tmp/dist/obikmer-linux-x86_64
strip /tmp/dist/obikmer-linux-x86_64
curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases/$RELEASE_ID/assets" \
-H "Authorization: token $GITEA_TOKEN" \
-F "attachment=@/tmp/dist/obikmer-linux-x86_64"
build-macos-arm64:
needs: create-release
runs-on: ubuntu-latest
steps:
- uses: actions/checkout@v4
- name: Login to registry
run: echo "${{ secrets.REGISTRYTOKEN }}" | docker login registry.metabarcoding.org -u ${{ secrets.REGISTRYUSER }} --password-stdin
- name: Cache cargo registry
uses: actions/cache@v4
with:
path: |
~/.cargo/registry
~/.cargo/git
src/target
key: macos-arm64-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: macos-arm64-cargo-
- name: Build macOS binary
run: |
docker run --rm \
-v "${{ github.workspace }}:/src" \
-w /src/src \
registry.metabarcoding.org/cibuilder/rustcrossosx:latest \
cargo build --release --target aarch64-apple-darwin --no-default-features
- name: Prepare and upload artifact
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
RELEASE_ID: ${{ needs.create-release.outputs.release_id }}
run: |
mkdir -p /tmp/dist
cp src/target/aarch64-apple-darwin/release/obikmer /tmp/dist/obikmer-macos-arm64
curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases/$RELEASE_ID/assets" \
-H "Authorization: token $GITEA_TOKEN" \
-F "attachment=@/tmp/dist/obikmer-macos-arm64"
+13
View File
@@ -8,4 +8,17 @@ data-stress
*.pb
./**/*.json
*.bin
*.log
Betula_exilis--IGA-24-33
benchmark/genomes
benchmark/simulated_data
benchmark/specimen_index_presence
benchmark/specimen_index_count
benchmark/global_index_presence
benchmark/global_index_count
benchmark/stats
benchmark/reference_index
benchmark/reference_dist
benchmark/obikmer_dist
benchmark/specific_index_count
benchmark/specific_index_presence
+2
View File
@@ -0,0 +1,2 @@
/cache
/project.local.yml
+133
View File
@@ -0,0 +1,133 @@
# the name by which the project can be referenced within Serena
project_name: "obikmer"
# list of languages for which language servers are started; choose from:
# al angular ansible bash clojure
# cpp cpp_ccls crystal csharp csharp_omnisharp
# dart elixir elm erlang fortran
# fsharp go groovy haskell haxe
# hlsl html java json julia
# kotlin lean4 lua luau markdown
# matlab msl nix ocaml pascal
# perl php php_phpactor powershell python
# python_jedi python_ty r rego ruby
# ruby_solargraph rust scala scss solidity
# svelte swift systemverilog terraform toml
# typescript typescript_vts vue yaml zig
# (This list may be outdated. For the current list, see values of Language enum here:
# https://github.com/oraios/serena/blob/main/src/solidlsp/ls_config.py
# For some languages, there are alternative language servers, e.g. csharp_omnisharp, ruby_solargraph.)
# Note:
# - For C, use cpp
# - For JavaScript, use typescript
# - For Angular projects, use angular (subsumes typescript+html; requires `npm install` in the project root)
# - For Svelte projects, use svelte (subsumes typescript/javascript for .svelte projects; requires npm)
# - For SCSS / Sass / plain CSS, use scss (some-sass-language-server handles all three)
# - For Free Pascal/Lazarus, use pascal
# Special requirements:
# Some languages require additional setup/installations.
# See here for details: https://oraios.github.io/serena/01-about/020_programming-languages.html#language-servers
# When using multiple languages, the first language server that supports a given file will be used for that file.
# The first language is the default language and the respective language server will be used as a fallback.
# Note that when using the JetBrains backend, language servers are not used and this list is correspondingly ignored.
languages:
- rust
# the encoding used by text files in the project
# For a list of possible encodings, see https://docs.python.org/3.11/library/codecs.html#standard-encodings
encoding: "utf-8"
# line ending convention to use when writing source files.
# Possible values: unset (use global setting), "lf", "crlf", or "native" (platform default)
# This does not affect Serena's own files (e.g. memories and configuration files), which always use native line endings.
line_ending:
# The language backend to use for this project.
# If not set, the global setting from serena_config.yml is used.
# Valid values: LSP, JetBrains
# Note: the backend is fixed at startup. If a project with a different backend
# is activated post-init, an error will be returned.
language_backend:
# whether to use project's .gitignore files to ignore files
ignore_all_files_in_gitignore: true
# advanced configuration option allowing to configure language server-specific options.
# Maps the language key to the options.
# Have a look at the docstring of the constructors of the LS implementations within solidlsp (e.g., for C# or PHP) to see which options are available.
# No documentation on options means no options are available.
ls_specific_settings: {}
# list of additional workspace folder paths for cross-package reference support (e.g. in monorepos).
# Paths can be absolute or relative to the project root.
# Each folder is registered as an LSP workspace folder, enabling language servers to discover
# symbols and references across package boundaries.
# Currently supported for: TypeScript.
# Example:
# additional_workspace_folders:
# - ../sibling-package
# - ../shared-lib
additional_workspace_folders: []
# list of additional paths to ignore in this project.
# Same syntax as gitignore, so you can use * and **.
# Note: global ignored_paths from serena_config.yml are also applied additively.
ignored_paths: []
# whether the project is in read-only mode
# If set to true, all editing tools will be disabled and attempts to use them will result in an error
# Added on 2025-04-18
read_only: false
# list of tool names to exclude.
# This extends the existing exclusions (e.g. from the global configuration)
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
excluded_tools: []
# list of tools to include that would otherwise be disabled (particularly optional tools that are disabled by default).
# This extends the existing inclusions (e.g. from the global configuration).
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
included_optional_tools: []
# fixed set of tools to use as the base tool set (if non-empty), replacing Serena's default set of tools.
# This cannot be combined with non-empty excluded_tools or included_optional_tools.
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
fixed_tools: []
# list of mode names that are to be activated by default, overriding the setting in the global configuration.
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# If the setting is undefined/empty, the default_modes from the global configuration (serena_config.yml) apply.
# Otherwise, this overrides the setting from the global configuration (serena_config.yml).
# Therefore, you can set this to [] if you do not want the default modes defined in the global config to apply
# for this project.
# This setting can, in turn, be overridden by CLI parameters (--mode).
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
default_modes:
# list of mode names to be activated additionally for this project, e.g. ["query-projects"]
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
added_modes:
# initial prompt for the project. It will always be given to the LLM upon activating the project
# (contrary to the memories, which are loaded on demand).
initial_prompt: ""
# time budget (seconds) per tool call for the retrieval of additional symbol information
# such as docstrings or parameter information.
# This overrides the corresponding setting in the global configuration; see the documentation there.
# If null or missing, use the setting from the global configuration.
symbol_info_budget:
# list of regex patterns which, when matched, mark a memory entry as readonly.
# Extends the list from the global configuration, merging the two lists.
read_only_memory_patterns: []
# list of regex patterns for memories to completely ignore.
# Matching memories will not appear in list_memories or activate_project output
# and cannot be accessed via read_memory or write_memory.
# To access ignored memory files, use the read_file tool on the raw file path.
# Extends the list from the global configuration, merging the two lists.
# Example: ["_archive/.*", "_episodes/.*"]
ignored_memory_patterns: []
+26
View File
@@ -73,3 +73,29 @@ Lors de l'ajout de nouveaux fichiers Markdown dans `docmd/`, mettre à jour la s
---
Je continue à poser mes questions et à guider la discussion.
---
## MCP Tools
**Règle absolue : avant tout travail de code, appeler `mcp__serena__initial_instructions` pour charger les instructions Serena.**
### Hiérarchie des outils pour ce projet Rust
**Navigation et édition de code → serena en priorité**
- Trouver un symbole, une déclaration, les implémentations d'un trait : `mcp__serena__find_symbol`, `mcp__serena__find_declaration`, `mcp__serena__find_implementations`
- Trouver les usages d'un symbole : `mcp__serena__find_referencing_symbols`
- Diagnostics LSP (erreurs de compilation) : `mcp__serena__get_diagnostics_for_file`
- Vue d'ensemble d'un fichier : `mcp__serena__get_symbols_overview`
- Modifier le corps d'une fonction/impl : `mcp__serena__replace_symbol_body`
- Ne pas utiliser `cclsp` quand serena couvre le besoin
**Analyse architecturale → jcodemunch**
- Hotspots, couplage, dead code, dépendances entre modules
- Utiliser avant de refactorer une zone critique
**Raisonnement complexe → sequential-thinking**
- Décisions d'architecture, choix d'algorithme, trade-offs non triviaux
**Documentation de crates → context7**
- Toujours consulter avant d'utiliser une API de bibliothèque externe
+34
View File
@@ -22,6 +22,7 @@ $(MKDOCS): $(VENV)/bin/activate
mkdocs mkdocs-material \
mkdocs-mermaid2-plugin \
mkdocs-bibtex
$(PIP) install --quiet --upgrade InSilicoSeq
# ── obikmer binary ───────────────────────────────────────────────────────────
@@ -62,3 +63,36 @@ clean-doc:
.PHONY: clean
clean: clean-doc
rm -rf $(VENV)
# ── release ───────────────────────────────────────────────────────────────────
CARGO_TOML := $(CARGO_DIR)/obikmer/Cargo.toml
.PHONY: bump-version
bump-version:
@current=$$(grep '^version = ' $(CARGO_TOML) | head -n 1 | sed 's/version = "\(.*\)"/\1/'); \
if [ -n "$(RELEASE)" ]; then \
new_version="$(RELEASE)"; \
else \
major=$$(echo $$current | cut -d. -f1); \
minor=$$(echo $$current | cut -d. -f2); \
patch=$$(echo $$current | cut -d. -f3); \
new_patch=$$((patch + 1)); \
new_version="$$major.$$minor.$$new_patch"; \
fi; \
echo "Version: $$current -> $$new_version"; \
sed -i.bak "s/^version = \"$$current\"/version = \"$$new_version\"/" $(CARGO_TOML) && \
rm $(CARGO_TOML).bak
.PHONY: release
release: bump-version
@jj auto-describe
@jj git push --change @
@new_version=$$(grep '^version = ' $(CARGO_TOML) | head -n 1 | sed 's/version = "\(.*\)"/\1/'); \
git_hash=$$(jj log -r @ --no-graph -T 'commit_id'); \
commits=$$(jj log -r 'latest(tags())..@' --no-graph -T 'description ++ "\n"' 2>/dev/null || \
jj log --no-graph -T 'description ++ "\n"' --limit 30); \
notes=$$(printf 'Write concise markdown release notes for obikmer (a Rust kmer genomics tool). Be technical and direct. Base them strictly on these commit messages:\n\n%s' "$$commits" | aichat 2>/dev/null); \
tag_msg="$${notes:-Release v$$new_version}"; \
git tag -a "v$$new_version" -m "$$tag_msg" "$$git_hash" && \
git push origin "v$$new_version"
+15 -2
View File
@@ -51,7 +51,13 @@ Non-ACGT characters act as hard breaks between k-mer segments in all formats.
Runs scatter → dereplicate → count → layered MPHF.
Resumes automatically if interrupted.
merge Merge multiple independently built indexes into one.
rebuild Filter and compact an existing index: apply count thresholds,
Schedules partitions largest-first under a memory budget semaphore
to avoid OOM on machines with many cores. The worst partition runs
alone first to calibrate the expansion estimator; subsequent
partitions run in parallel within the budget.
--budget-fraction F fraction of available RAM to use as budget
(default 0.5; reduce if OOM persists).
filter Filter and compact an existing index: apply count thresholds,
drop layers, rewrite as a single-layer index.
reindex Convert evidence in-place across all layers:
exact (evidence.bin) ↔ approximate (fingerprint.bin).
@@ -74,7 +80,14 @@ Non-ACGT characters act as hard breaks between k-mer segments in all formats.
Diagnostic / pipeline use.
unitig Dump the unitig sequences stored in a built index. Debug use.
utils Miscellaneous utilities.
--new-label NEW=OLD renames a genome label in-place.
--new-label NEW=OLD rename a genome label in-place.
--bits-per-kmer print MPHF / evidence / matrix size breakdown.
--stats per-genome k-mer counts as CSV.
--partition-stats partition size distribution across one or more
indexes (markdown report to stdout). Useful to
diagnose minimizer imbalance before a large merge.
--csv FILE write per-(partition, source) raw data to FILE
(used with --partition-stats).
## Quick start
+230
View File
@@ -0,0 +1,230 @@
# Requires GNU Make >= 4.3 (grouped targets &:) — use gmake on macOS
BINARY := ../src/target/release/obikmer
VENV_PY := ../.venv/bin/python3
GENOMES := $(wildcard genomes/*.fna.gz)
# SPECIMENS, SPECIES, and the full dependency graph are generated by
# make_deps.py from the genome FASTA headers — like .d files in C.
# Make rebuilds deps.mk whenever genomes/ changes and restarts.
-include deps.mk
REF_NPZS := $(SPECIMENS:%=reference_index/%.npz)
REF_DIST_CSVS := $(addprefix reference_dist/, \
shared_kmers.csv hamming_dist.csv jaccard_dist.csv \
bray_curtis_dist.csv relfreq_bray_curtis_dist.csv \
euclidean_dist.csv relfreq_euclidean_dist.csv \
hellinger_dist.csv hellinger_euclidean_dist.csv)
OBIKMER_PRESENCE_DIST := $(addprefix obikmer_dist/presence/, \
jaccard_dist.csv jaccard_shared.csv jaccard_nj.nwk \
hamming_dist.csv hamming_nj.nwk)
OBIKMER_COUNT_DIST := $(addprefix obikmer_dist/count/, \
jaccard_dist.csv jaccard_shared.csv jaccard_nj.nwk \
bray_curtis_dist.csv bray_curtis_nj.nwk \
relfreq_bray_curtis_dist.csv relfreq_bray_curtis_nj.nwk \
euclidean_dist.csv euclidean_nj.nwk \
relfreq_euclidean_dist.csv relfreq_euclidean_nj.nwk \
hellinger_dist.csv hellinger_nj.nwk \
hellinger_euclidean_dist.csv hellinger_euclidean_nj.nwk)
DIST_COMPARISON := stats/dist_comparison/summary.csv
PRESENCE_DONE := $(SPECIMENS:%=specimen_index_presence/%/index.done)
PRESENCE_STATS := $(SPECIMENS:%=stats/indexing_presence/%.stats)
COUNT_DONE := $(SPECIMENS:%=specimen_index_count/%/index.done)
COUNT_STATS := $(SPECIMENS:%=stats/indexing_count/%.stats)
VERIFY_PRESENCE_STATS := $(SPECIMENS:%=stats/verify_presence/%.stats)
VERIFY_COUNT_STATS := $(SPECIMENS:%=stats/verify_count/%.stats)
SPECIFIC_PRESENCE_DONE := $(SPECIES:%=specific_index_presence/%/index.done)
SPECIFIC_PRESENCE_STATS := $(SPECIES:%=stats/specific_kmer_presence/%.stats)
SPECIFIC_COUNT_DONE := $(SPECIES:%=specific_index_count/%/index.done)
SPECIFIC_COUNT_STATS := $(SPECIES:%=stats/specific_kmer_count/%.stats)
SIMULATED_READS := $(foreach s,$(SPECIMENS),simulated_data/$(subst --,/,$s)/reads_R1.fastq.gz)
.NOTPARALLEL:
.PHONY: all simulate reference reference_dist \
obikmer_dist obikmer_dist_presence obikmer_dist_count \
dist_comparison \
index_presence index_count \
aggregate_index_presence aggregate_index_count \
merge_presence merge_count \
verify_presence verify_count \
aggregate_verify_presence aggregate_verify_count \
verify_merge_presence verify_merge_count \
filter_presence filter_count \
aggregate_filter_presence aggregate_filter_count
verify_merge_presence: stats/verify_merge_presence/current.csv
verify_merge_count: stats/verify_merge_count/current.csv
all: aggregate_verify_presence aggregate_verify_count \
verify_merge_presence verify_merge_count \
aggregate_filter_presence aggregate_filter_count \
dist_comparison
# ── dependency file ───────────────────────────────────────────────────────────
deps.mk: $(GENOMES)
$(VENV_PY) make_deps.py $^ > $@
# ── simulation ────────────────────────────────────────────────────────────────
# Prerequisites (genome → reads) are in deps.mk; $< is the genome file.
$(SIMULATED_READS):
bash simulate_one.sh $< $(dir $@)
simulate: $(SIMULATED_READS)
# ── reference kmer sets ───────────────────────────────────────────────────────
# Prerequisites (reads → npz) are in deps.mk.
reference_index/%.npz:
bash build_reference.sh $*
reference: $(REF_NPZS)
# ── reference distance matrices ───────────────────────────────────────────────
$(REF_DIST_CSVS) &: $(REF_NPZS) build_reference_dist.py
$(VENV_PY) build_reference_dist.py
reference_dist: $(REF_DIST_CSVS)
# ── obikmer distance (presence index) ────────────────────────────────────────
$(OBIKMER_PRESENCE_DIST) &: global_index_presence/index.done $(BINARY)
mkdir -p obikmer_dist/presence
$(BINARY) distance \
--output obikmer_dist/presence/jaccard \
--metric jaccard --shared-kmers --nj \
global_index_presence
$(BINARY) distance \
--output obikmer_dist/presence/hamming \
--metric hamming --nj \
global_index_presence
obikmer_dist_presence: $(OBIKMER_PRESENCE_DIST)
# ── obikmer distance (count index) ───────────────────────────────────────────
$(OBIKMER_COUNT_DIST) &: global_index_count/index.done $(BINARY)
mkdir -p obikmer_dist/count
$(BINARY) distance \
--output obikmer_dist/count/jaccard \
--metric jaccard --shared-kmers --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/bray_curtis \
--metric bray-curtis --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/relfreq_bray_curtis \
--metric relfreq-bray-curtis --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/euclidean \
--metric euclidean --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/relfreq_euclidean \
--metric relfreq-euclidean --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/hellinger \
--metric hellinger --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/hellinger_euclidean \
--metric hellinger-euclidean --nj \
global_index_count
obikmer_dist_count: $(OBIKMER_COUNT_DIST)
obikmer_dist: obikmer_dist_presence obikmer_dist_count
# ── distance comparison ───────────────────────────────────────────────────────
$(DIST_COMPARISON): $(REF_DIST_CSVS) $(OBIKMER_PRESENCE_DIST) $(OBIKMER_COUNT_DIST) compare_all_dist.py
$(VENV_PY) compare_all_dist.py --out $(DIST_COMPARISON)
dist_comparison: $(DIST_COMPARISON)
# ── per-specimen indexing ─────────────────────────────────────────────────────
# Prerequisites (reads → index.done + .stats) are in deps.mk.
specimen_index_presence/%/index.done \
stats/indexing_presence/%.stats &: $(BINARY)
bash index_one_presence.sh $*
specimen_index_count/%/index.done \
stats/indexing_count/%.stats &: $(BINARY)
bash index_one_count.sh $*
index_presence: $(PRESENCE_DONE)
index_count: $(COUNT_DONE)
# ── indexing stats aggregation ────────────────────────────────────────────────
aggregate_index_presence: $(PRESENCE_STATS)
bash aggregate_stats.sh indexing_presence
aggregate_index_count: $(COUNT_STATS)
bash aggregate_stats.sh indexing_count
# ── global merge ──────────────────────────────────────────────────────────────
global_index_presence/index.done: $(PRESENCE_DONE) $(BINARY)
bash merge_presence.sh
global_index_count/index.done: $(COUNT_DONE) $(BINARY)
bash merge_count.sh
merge_presence: global_index_presence/index.done
merge_count: global_index_count/index.done
# ── per-specimen verification ─────────────────────────────────────────────────
# Prerequisites (index.done + npz → .stats) are in deps.mk.
stats/verify_presence/%.stats:
bash verify_one_presence.sh $*
stats/verify_count/%.stats:
bash verify_one_count.sh $*
verify_presence: $(VERIFY_PRESENCE_STATS)
verify_count: $(VERIFY_COUNT_STATS)
# ── verification stats aggregation ───────────────────────────────────────────
aggregate_verify_presence: $(VERIFY_PRESENCE_STATS)
bash aggregate_stats.sh verify_presence
aggregate_verify_count: $(VERIFY_COUNT_STATS)
bash aggregate_stats.sh verify_count
# ── species-specific indexes ──────────────────────────────────────────────────
# Prerequisites (global index → specific index) are in deps.mk.
specific_index_presence/%/index.done \
stats/specific_kmer_presence/%.stats &: $(BINARY)
bash filter_one_presence.sh $*
specific_index_count/%/index.done \
stats/specific_kmer_count/%.stats &: $(BINARY)
bash filter_one_count.sh $*
filter_presence: $(SPECIFIC_PRESENCE_DONE)
filter_count: $(SPECIFIC_COUNT_DONE)
aggregate_filter_presence: $(SPECIFIC_PRESENCE_STATS)
bash aggregate_stats.sh specific_kmer_presence
aggregate_filter_count: $(SPECIFIC_COUNT_STATS)
bash aggregate_stats.sh specific_kmer_count
# ── merged index verification ─────────────────────────────────────────────────
stats/verify_merge_presence/current.csv: $(REF_NPZS) global_index_presence/index.done
bash verify_merge_presence.sh
stats/verify_merge_count/current.csv: $(REF_NPZS) global_index_count/index.done
bash verify_merge_count.sh
+132
View File
@@ -0,0 +1,132 @@
# Benchmark pipeline
Requires **GNU Make ≥ 4.3** (grouped targets `&:`). On macOS use `gmake`.
```
gmake all # full pipeline
gmake simulate # simulation only
gmake reference # reference kmer sets only
```
## Pipeline overview
```mermaid
flowchart TD
GENOMES["genomes/*.fna.gz"]
BIN["obikmer binary"]
GENOMES --> simulate
simulate --> simdata[("simulated_data/")]
simdata --> reference
reference --> refnpz[("reference_index/*.npz")]
subgraph presence ["Presence track"]
simdata --> index_presence
BIN --> index_presence
index_presence --> pres_done[("specimen_index_presence/")]
index_presence --> pres_istats[("stats/indexing_presence/")]
pres_istats --> aggregate_index_presence
pres_done --> merge_presence
BIN --> merge_presence
merge_presence --> gpres[("global_index_presence/")]
refnpz --> verify_presence
pres_done --> verify_presence
verify_presence --> vpres_stats[("stats/verify_presence/")]
vpres_stats --> aggregate_verify_presence
gpres --> filter_presence
BIN --> filter_presence
filter_presence --> spec_pres[("specific_index_presence/")]
filter_presence --> spec_pres_stats[("stats/specific_kmer_presence/")]
spec_pres_stats --> aggregate_filter_presence
refnpz --> verify_merge_presence
gpres --> verify_merge_presence
verify_merge_presence --> vmp[("stats/verify_merge_presence/")]
end
subgraph count ["Count track"]
simdata --> index_count
BIN --> index_count
index_count --> count_done[("specimen_index_count/")]
index_count --> count_istats[("stats/indexing_count/")]
count_istats --> aggregate_index_count
count_done --> merge_count
BIN --> merge_count
merge_count --> gcount[("global_index_count/")]
refnpz --> verify_count
count_done --> verify_count
verify_count --> vcount_stats[("stats/verify_count/")]
vcount_stats --> aggregate_verify_count
gcount --> filter_count
BIN --> filter_count
filter_count --> spec_count[("specific_index_count/")]
filter_count --> spec_count_stats[("stats/specific_kmer_count/")]
spec_count_stats --> aggregate_filter_count
refnpz --> verify_merge_count
gcount --> verify_merge_count
verify_merge_count --> vmc[("stats/verify_merge_count/")]
end
aggregate_verify_presence --> all
aggregate_verify_count --> all
vmp --> all
vmc --> all
all -. "$(MAKE) re-eval" .-> aggregate_filter_presence
all -. "$(MAKE) re-eval" .-> aggregate_filter_count
```
## Steps
| Target | Script | Description |
|---|---|---|
| `simulate` | `simulate.sh` | Simulate sequencing reads from the reference genomes |
| `reference` | `build_reference.sh` | Build reference kmer sets (`.npz`) from simulation truth |
| `index_presence` | `index_one_presence.sh` | Index each specimen (presence mode) |
| `index_count` | `index_one_count.sh` | Index each specimen (count mode) |
| `aggregate_index_presence` | `aggregate_stats.sh` | Aggregate per-specimen indexing stats (presence) |
| `aggregate_index_count` | `aggregate_stats.sh` | Aggregate per-specimen indexing stats (count) |
| `merge_presence` | `merge_presence.sh` | Merge all specimen presence indexes into a global index |
| `merge_count` | `merge_count.sh` | Merge all specimen count indexes into a global index |
| `verify_presence` | `verify_one_presence.sh` | Verify each specimen presence index against reference |
| `verify_count` | `verify_one_count.sh` | Verify each specimen count index against reference |
| `aggregate_verify_presence` | `aggregate_stats.sh` | Aggregate per-specimen verification stats (presence) |
| `aggregate_verify_count` | `aggregate_stats.sh` | Aggregate per-specimen verification stats (count) |
| `filter_presence` | `filter_one_presence.sh` | Extract species-specific presence indexes from global index |
| `filter_count` | `filter_one_count.sh` | Extract species-specific count indexes from global index |
| `aggregate_filter_presence` | `aggregate_stats.sh` | Aggregate species-specific kmer stats (presence) |
| `aggregate_filter_count` | `aggregate_stats.sh` | Aggregate species-specific kmer stats (count) |
| `verify_merge_presence` | `verify_merge_presence.sh` | Verify global presence index against all reference sets |
| `verify_merge_count` | `verify_merge_count.sh` | Verify global count index against all reference sets |
## Directory layout
```
benchmark/
├── genomes/ # input reference genomes (.fna.gz)
├── simulated_data/ # generated by simulate
│ └── <species>/<specimen>/
├── reference_index/ # reference kmer sets (.npz)
├── specimen_index_presence/ # per-specimen presence indexes
├── specimen_index_count/ # per-specimen count indexes
├── global_index_presence/ # merged global presence index
├── global_index_count/ # merged global count index
├── specific_index_presence/ # species-specific presence indexes
├── specific_index_count/ # species-specific count indexes
└── stats/ # all benchmark statistics
├── indexing_presence/
├── indexing_count/
├── verify_presence/
├── verify_count/
├── specific_kmer_presence/
├── specific_kmer_count/
├── verify_merge_presence/
└── verify_merge_count/
```
+53
View File
@@ -0,0 +1,53 @@
#!/usr/bin/env bash
# Usage: aggregate_stats.sh TYPE
# TYPE = indexing_presence | indexing_count | verify_presence | verify_count
#
# Reads all stats/TYPE/*.stats files (one CSV data row each, no header).
# Creates a new stats/TYPE/run_NNN.csv only if any .stats file is newer than
# the most recent run CSV (idempotent when nothing changed).
set -euo pipefail
TYPE="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
STATS_DIR="${SCRIPT_DIR}/stats/${TYPE}"
case "${TYPE}" in
indexing_presence|indexing_count)
HEADER="run,species,strain,scatter_wall_s,scatter_rss_b,dereplicate_wall_s,dereplicate_rss_b,count_kmer_wall_s,count_kmer_rss_b,index_wall_s,index_rss_b,total_wall_s,total_rss_b"
;;
verify_presence)
HEADER="run,species,strain,ref_kmers,idx_kmers,false_neg,false_pos,fn_pct,fp_pct"
;;
verify_count)
HEADER="run,species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,fn_pct,fp_pct,cm_pct"
;;
specific_kmer_presence|specific_kmer_count)
HEADER="run,species,rebuild_wall_s,rebuild_rss_b,pack_wall_s,pack_rss_b,filter_total_wall_s,filter_total_rss_b,select_wall_s,select_rss_b,select_total_wall_s,select_total_rss_b"
;;
*)
echo "ERROR: unknown stats type '${TYPE}'" >&2
exit 1
;;
esac
# Find most recent existing run CSV (empty string if none).
latest_csv=$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' 2>/dev/null | sort | tail -1)
# Check if any .stats file is newer than the latest run CSV.
if [[ -n "${latest_csv}" ]] && \
[[ -z "$(find "${STATS_DIR}" -maxdepth 1 -name '*.stats' -newer "${latest_csv}" 2>/dev/null)" ]]; then
echo "[${TYPE}] stats up to date (${latest_csv})"
exit 0
fi
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' 2>/dev/null | wc -l | tr -d ' ')")
CSV="${STATS_DIR}/run_${run_n}.csv"
echo "${HEADER}" >"${CSV}"
# Sort .stats files by name for reproducible row order.
while IFS= read -r stats_file; do
sed "s/^/${run_n},/" "${stats_file}"
done < <(find "${STATS_DIR}" -maxdepth 1 -name '*.stats' | sort) >>"${CSV}"
echo "[${TYPE}] run ${run_n}${CSV}"
+137
View File
@@ -0,0 +1,137 @@
#!/usr/bin/env python3
"""Build a reference kmer index from paired-end FASTQ reads.
Extracts canonical kmers — min(kmer, revcomp(kmer)) encoded as uint64 —
counts their abundances, and saves a sorted numpy pair (kmers, counts).
Output .npz arrays
kmers : uint64, sorted ascending — canonical kmer integers
counts : uint32, same order — raw read abundances
"""
import argparse
import gzip
import sys
from collections import defaultdict
import numpy as np
# ── encoding ────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
# Lookup table: revcomp of one byte (4 bases, 8 bits).
# Precomputed once at import time.
_REVCOMP8 = [0] * 256
for _i in range(256):
_rc, _x = 0, _i
for _ in range(4):
_rc = (_rc << 2) | (3 - (_x & 3))
_x >>= 2
_REVCOMP8[_i] = _rc
del _i, _rc, _x
def revcomp_int(kmer: int, k: int) -> int:
"""Reverse-complement of a kmer encoded as an integer (2 bits/base).
Uses byte-level lookup (4 bases at a time) for speed.
"""
rc = 0
bits_left = 2 * k
while bits_left > 0:
chunk = min(8, bits_left)
rc_byte = _REVCOMP8[kmer & 0xFF] >> (8 - chunk)
rc = (rc << chunk) | rc_byte
kmer >>= chunk
bits_left -= chunk
return rc
# ── FASTQ parsing ────────────────────────────────────────────────────────────
def iter_sequences(path: str):
"""Yield raw sequences from a (gzipped) FASTQ file."""
opener = gzip.open if path.endswith('.gz') else open
with opener(path, 'rt') as fh:
while True:
if not fh.readline(): # '@' header
break
seq = fh.readline().rstrip('\n')
fh.readline() # '+'
fh.readline() # quality
yield seq
# ── kmer counting ────────────────────────────────────────────────────────────
def count_kmers(paths: list[str], k: int) -> dict[int, int]:
mask = (1 << (2 * k)) - 1
counts: dict[int, int] = defaultdict(int)
n_reads = 0
for path in paths:
for seq in iter_sequences(path):
n_reads += 1
kmer = 0
run = 0 # consecutive valid bases
for c in seq:
b = _ENCODE.get(c)
if b is None: # N or unexpected character → reset
kmer = 0
run = 0
continue
kmer = ((kmer << 2) | b) & mask
run += 1
if run >= k:
rc = revcomp_int(kmer, k)
counts[kmer if kmer <= rc else rc] += 1
if n_reads % 100_000 == 0:
print(f' {n_reads:,} reads processed, '
f'{len(counts):,} distinct kmers so far',
file=sys.stderr)
print(f' {n_reads:,} reads total, {len(counts):,} distinct kmers',
file=sys.stderr)
return counts
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('reads', nargs='+', metavar='FASTQ',
help='Input reads (FASTQ, gzip OK)')
ap.add_argument('-k', '--kmer-size', type=int, default=31,
metavar='K')
ap.add_argument('--min-abundance', type=int, default=1,
metavar='N', help='Drop kmers with count < N (default 1)')
ap.add_argument('-o', '--output', required=True,
metavar='FILE', help='Output .npz path')
args = ap.parse_args()
print(f'k={args.kmer_size} files={len(args.reads)}', file=sys.stderr)
counts = count_kmers(args.reads, args.kmer_size)
if args.min_abundance > 1:
before = len(counts)
counts = {k: v for k, v in counts.items() if v >= args.min_abundance}
print(f' min-abundance={args.min_abundance}: '
f'{before - len(counts):,} kmers dropped, '
f'{len(counts):,} retained',
file=sys.stderr)
print(f'Sorting and saving → {args.output}', file=sys.stderr)
kmers_arr = np.fromiter(sorted(counts), dtype=np.uint64, count=len(counts))
counts_arr = np.array([counts[int(k)] for k in kmers_arr], dtype=np.uint32)
np.savez_compressed(args.output, kmers=kmers_arr, counts=counts_arr)
print(f'Done {len(kmers_arr):,} kmers → {args.output}', file=sys.stderr)
if __name__ == '__main__':
main()
+39
View File
@@ -0,0 +1,39 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
SIMDATA_DIR="${SCRIPT_DIR}/simulated_data"
REF_DIR="${SCRIPT_DIR}/reference_index"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
BUILD_PY="${SCRIPT_DIR}/build_reference.py"
KMER_SIZE="${KMER_SIZE:-31}"
MIN_ABUNDANCE="${MIN_ABUNDANCE:-1}"
mkdir -p "${REF_DIR}"
for species_dir in "${SIMDATA_DIR}"/*/; do
[[ -d "${species_dir}" ]] || continue
species=$(basename "${species_dir}")
for strain_dir in "${species_dir}"*/; do
[[ -d "${strain_dir}" ]] || continue
strain=$(basename "${strain_dir}")
r1="${strain_dir}/reads_R1.fastq.gz"
r2="${strain_dir}/reads_R2.fastq.gz"
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
echo "SKIP ${species}--${strain}: reads not found" >&2
continue
fi
out="${REF_DIR}/${species}--${strain}.npz"
echo "[${species}--${strain}] → ${out}"
"${PYTHON}" "${BUILD_PY}" \
--kmer-size "${KMER_SIZE}" \
--min-abundance "${MIN_ABUNDANCE}" \
--output "${out}" \
"${r1}" "${r2}"
done
done
+226
View File
@@ -0,0 +1,226 @@
#!/usr/bin/env python3
"""Compute reference pairwise distance matrices from per-specimen .npz kmer indexes.
Reads all .npz files in reference_index/ (each containing sorted uint64 `kmers`
and uint32 `counts`), computes all distance metrics supported by `obikmer distance`,
and writes one CSV per metric to reference_dist/.
Output CSV format matches `obikmer distance --output`:
- first row: "genome", then specimen names
- subsequent rows: specimen name, then float or int values
Metrics written
jaccard_dist.csv Jaccard distance (presence/absence)
shared_kmers.csv Shared-kmer count matrix (intersection size)
bray_curtis_dist.csv Bray-Curtis dissimilarity (raw counts)
relfreq_bray_curtis_dist.csv Bray-Curtis on relative frequencies
euclidean_dist.csv Euclidean distance (raw counts)
relfreq_euclidean_dist.csv Euclidean distance on relative frequencies
hellinger_dist.csv Hellinger distance
hellinger_euclidean_dist.csv Euclidean distance in Hellinger space
"""
import argparse
import sys
from pathlib import Path
import numpy as np
# ── pairwise helpers ──────────────────────────────────────────────────────────
def shared_indices(a_kmers: np.ndarray, b_kmers: np.ndarray):
"""Return index arrays (idx_a, idx_b) for kmers present in both sets.
Both arrays must be sorted uint64. Uses searchsorted: O(|B| log |A|).
"""
pos = np.searchsorted(a_kmers, b_kmers)
pos = np.clip(pos, 0, len(a_kmers) - 1)
mask = a_kmers[pos] == b_kmers
idx_b = np.where(mask)[0]
idx_a = pos[idx_b]
return idx_a, idx_b
def pairwise_stats(specimens: list[dict]) -> dict[str, np.ndarray]:
"""Compute all pairwise distance matrices at once.
Returns a dict metric_name → ndarray (n×n float64 or int64).
Each specimen dict has keys: name, kmers, counts.
"""
n = len(specimens)
# Pre-compute per-specimen scalars
kmer_counts = np.array([len(s['kmers']) for s in specimens], dtype=np.uint64)
count_sums = np.array([s['counts'].sum() for s in specimens], dtype=np.uint64)
# Per-specimen sum-of-squares (for Euclidean decomposition)
sq_sums = np.array([(s['counts'].astype(np.float64) ** 2).sum() for s in specimens])
# Allocate output matrices
shared_mat = np.zeros((n, n), dtype=np.uint64)
hamming_mat = np.zeros((n, n), dtype=np.float64)
jaccard_mat = np.zeros((n, n), dtype=np.float64)
bray_mat = np.zeros((n, n), dtype=np.float64)
relfreq_bray = np.zeros((n, n), dtype=np.float64)
euclidean_mat = np.zeros((n, n), dtype=np.float64)
relfreq_eucl = np.zeros((n, n), dtype=np.float64)
hellinger_mat = np.zeros((n, n), dtype=np.float64)
hell_eucl_mat = np.zeros((n, n), dtype=np.float64)
for i in range(n):
a_km = specimens[i]['kmers']
a_ct = specimens[i]['counts'].astype(np.float64)
sa = float(count_sums[i])
na = int(kmer_counts[i])
for j in range(i + 1, n):
b_km = specimens[j]['kmers']
b_ct = specimens[j]['counts'].astype(np.float64)
sb = float(count_sums[j])
nb = int(kmer_counts[j])
idx_a, idx_b = shared_indices(a_km, b_km)
inter = len(idx_a)
ca_sh = a_ct[idx_a]
cb_sh = b_ct[idx_b]
# ── Presence metrics ──────────────────────────────────────────────
union = na + nb - inter
jac = (1.0 - inter / union) if union else 0.0
hamming = float(na + nb - 2 * inter) # |A Δ B|
# ── Count metrics ─────────────────────────────────────────────────
# Bray-Curtis: 1 - 2*Σmin(a,b) / (Σa + Σb)
sum_min = np.minimum(ca_sh, cb_sh).sum()
denom_bc = sa + sb
bc = (1.0 - 2.0 * sum_min / denom_bc) if denom_bc else 0.0
# RelfreqBray: 1 - Σmin(a/sa, b/sb) [only shared contribute]
if sa and sb:
rfb = 1.0 - np.minimum(ca_sh / sa, cb_sh / sb).sum()
else:
rfb = 0.0
# Euclidean: √(Σa² + Σb² - 2·Σ(a·b)_shared)
cross = (ca_sh * cb_sh).sum()
eucl_partial = sq_sums[i] + sq_sums[j] - 2.0 * cross
eucl = np.sqrt(max(eucl_partial, 0.0))
# RelfreqEuclidean: √(Σ(a/sa - b/sb)²)
# = √(Σa²/sa² + Σb²/sb² - 2·Σ(a·b)_shared/(sa·sb))
if sa and sb:
rf_cross = (ca_sh / sa * (cb_sh / sb)).sum()
rfe_partial = (sq_sums[i] / sa**2
+ sq_sums[j] / sb**2
- 2.0 * rf_cross)
rfe = np.sqrt(max(rfe_partial, 0.0))
else:
rfe = 0.0
# Hellinger partial: Σ(√(a/sa) - √(b/sb))² over global universe
# = 2 - 2·Σ√(a·b)_shared / √(sa·sb)
if sa and sb:
bc_coeff = np.sqrt(ca_sh * cb_sh).sum() / np.sqrt(sa * sb)
hell_partial = max(2.0 - 2.0 * bc_coeff, 0.0)
else:
hell_partial = 0.0
sq2 = np.sqrt(2.0)
hell = np.sqrt(hell_partial) / sq2
hell_euc = np.sqrt(hell_partial)
# ── Fill symmetric matrices ───────────────────────────────────────
for mat, val in [
(shared_mat, inter),
(hamming_mat, hamming),
(jaccard_mat, jac),
(bray_mat, bc),
(relfreq_bray, rfb),
(euclidean_mat, eucl),
(relfreq_eucl, rfe),
(hellinger_mat, hell),
(hell_eucl_mat, hell_euc),
]:
mat[i, j] = val
mat[j, i] = val
return {
'shared_kmers': shared_mat,
'hamming_dist': hamming_mat,
'jaccard_dist': jaccard_mat,
'bray_curtis_dist': bray_mat,
'relfreq_bray_curtis_dist': relfreq_bray,
'euclidean_dist': euclidean_mat,
'relfreq_euclidean_dist': relfreq_eucl,
'hellinger_dist': hellinger_mat,
'hellinger_euclidean_dist': hell_eucl_mat,
}
# ── I/O ───────────────────────────────────────────────────────────────────────
def write_csv(path: Path, labels: list[str], mat: np.ndarray, fmt: str) -> None:
with path.open('w') as fh:
fh.write('genome,' + ','.join(labels) + '\n')
for i, label in enumerate(labels):
row = ','.join(format(mat[i, j], fmt) for j in range(len(labels)))
fh.write(f'{label},{row}\n')
print(f'{path}', file=sys.stderr)
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('--ref-dir', default='reference_index',
help='Directory with per-specimen .npz files (default: reference_index)')
ap.add_argument('--out-dir', default='reference_dist',
help='Output directory for CSV files (default: reference_dist)')
args = ap.parse_args()
ref_dir = Path(args.ref_dir)
out_dir = Path(args.out_dir)
out_dir.mkdir(exist_ok=True)
npz_files = sorted(ref_dir.glob('*.npz'))
if not npz_files:
print(f'ERROR: no .npz files found in {ref_dir}', file=sys.stderr)
sys.exit(1)
print(f'Loading {len(npz_files)} specimen(s) from {ref_dir}/', file=sys.stderr)
specimens = []
for f in npz_files:
data = np.load(f)
specimens.append({
'name': f.stem,
'kmers': data['kmers'],
'counts': data['counts'],
})
print(f' {f.stem}: {len(data["kmers"]):,} kmers', file=sys.stderr)
labels = [s['name'] for s in specimens]
n = len(labels)
print(f'\nComputing pairwise distances for {n} specimens…', file=sys.stderr)
matrices = pairwise_stats(specimens)
print(f'\nWriting CSVs to {out_dir}/', file=sys.stderr)
write_csv(out_dir / 'shared_kmers.csv', labels, matrices['shared_kmers'], 'd')
write_csv(out_dir / 'hamming_dist.csv', labels, matrices['hamming_dist'], '.6f')
write_csv(out_dir / 'jaccard_dist.csv', labels, matrices['jaccard_dist'], '.6f')
write_csv(out_dir / 'bray_curtis_dist.csv', labels, matrices['bray_curtis_dist'], '.6f')
write_csv(out_dir / 'relfreq_bray_curtis_dist.csv', labels, matrices['relfreq_bray_curtis_dist'], '.6f')
write_csv(out_dir / 'euclidean_dist.csv', labels, matrices['euclidean_dist'], '.6f')
write_csv(out_dir / 'relfreq_euclidean_dist.csv', labels, matrices['relfreq_euclidean_dist'], '.6f')
write_csv(out_dir / 'hellinger_dist.csv', labels, matrices['hellinger_dist'], '.6f')
write_csv(out_dir / 'hellinger_euclidean_dist.csv', labels, matrices['hellinger_euclidean_dist'], '.6f')
print('\nDone.', file=sys.stderr)
if __name__ == '__main__':
main()
+182
View File
@@ -0,0 +1,182 @@
#!/usr/bin/env python3
"""Compare all reference distance matrices against obikmer distance outputs.
Reads from:
reference_dist/ — ground-truth matrices computed by build_reference_dist.py
obikmer_dist/ — matrices produced by `obikmer distance`
Handles label reordering: both matrices are sorted by genome label before
element-wise comparison, so column/row order differences are irrelevant.
Output: stats/dist_comparison/summary.csv
comparison,max_abs,mean_abs,rmse,n_pairs,status
"""
import csv
import sys
from pathlib import Path
import numpy as np
# ── CSV loading ───────────────────────────────────────────────────────────────
def load_matrix(path: Path) -> tuple[list[str], np.ndarray]:
"""Load a distance-matrix CSV; return (sorted_labels, matrix_float64)."""
with path.open() as fh:
reader = csv.reader(fh)
header = next(reader)[1:] # skip 'genome' column
raw: dict[str, list[float]] = {}
for row in reader:
raw[row[0]] = [float(x) for x in row[1:]]
label_to_col = {h: i for i, h in enumerate(header)}
labels = sorted(raw.keys())
n = len(labels)
mat = np.zeros((n, n), dtype=np.float64)
for i, ri in enumerate(labels):
for j, cj in enumerate(labels):
mat[i, j] = raw[ri][label_to_col[cj]]
return labels, mat
# ── comparison ────────────────────────────────────────────────────────────────
def compare(label: str,
ref_path: Path,
obi_path: Path,
tol: float = 1e-4) -> dict:
if not ref_path.exists():
return {'comparison': label, 'status': 'REF_MISSING',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
if not obi_path.exists():
return {'comparison': label, 'status': 'OBI_MISSING',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
ref_labels, ref_mat = load_matrix(ref_path)
obi_labels, obi_mat = load_matrix(obi_path)
if ref_labels != obi_labels:
only_ref = sorted(set(ref_labels) - set(obi_labels))
only_obi = sorted(set(obi_labels) - set(ref_labels))
print(f' [{label}] label mismatch — '
f'only_ref={only_ref} only_obi={only_obi}', file=sys.stderr)
return {'comparison': label, 'status': 'LABEL_MISMATCH',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
n = len(ref_labels)
# Off-diagonal mask
mask = ~np.eye(n, dtype=bool)
diff = np.abs(ref_mat[mask] - obi_mat[mask])
n_pairs = diff.size
max_abs = float(diff.max())
mean_abs = float(diff.mean())
rmse = float(np.sqrt((diff ** 2).mean()))
status = 'PASS' if max_abs <= tol else 'FAIL'
print(f' [{label}] n={n_pairs} '
f'max={max_abs:.3e} mean={mean_abs:.3e} rmse={rmse:.3e} {status}',
file=sys.stderr)
return {
'comparison': label,
'max_abs': f'{max_abs:.6e}',
'mean_abs': f'{mean_abs:.6e}',
'rmse': f'{rmse:.6e}',
'n_pairs': str(n_pairs),
'status': status,
}
# ── comparison table ──────────────────────────────────────────────────────────
# (label, ref_csv, obikmer_csv)
# The reference jaccard/shared is presence-based, which should match both
# presence/jaccard and count/jaccard (threshold=1).
COMPARISONS = [
# ── presence index ────────────────────────────────────────────────────────
('presence/jaccard_dist',
'reference_dist/jaccard_dist.csv',
'obikmer_dist/presence/jaccard_dist.csv'),
('presence/jaccard_shared',
'reference_dist/shared_kmers.csv',
'obikmer_dist/presence/jaccard_shared.csv'),
('presence/hamming_dist',
'reference_dist/hamming_dist.csv',
'obikmer_dist/presence/hamming_dist.csv'),
# ── count index (jaccard cross-check) ─────────────────────────────────────
('count/jaccard_dist',
'reference_dist/jaccard_dist.csv',
'obikmer_dist/count/jaccard_dist.csv'),
('count/jaccard_shared',
'reference_dist/shared_kmers.csv',
'obikmer_dist/count/jaccard_shared.csv'),
# ── count index (count-based metrics) ────────────────────────────────────
('count/bray_curtis_dist',
'reference_dist/bray_curtis_dist.csv',
'obikmer_dist/count/bray_curtis_dist.csv'),
('count/relfreq_bray_curtis_dist',
'reference_dist/relfreq_bray_curtis_dist.csv',
'obikmer_dist/count/relfreq_bray_curtis_dist.csv'),
('count/euclidean_dist',
'reference_dist/euclidean_dist.csv',
'obikmer_dist/count/euclidean_dist.csv'),
('count/relfreq_euclidean_dist',
'reference_dist/relfreq_euclidean_dist.csv',
'obikmer_dist/count/relfreq_euclidean_dist.csv'),
('count/hellinger_dist',
'reference_dist/hellinger_dist.csv',
'obikmer_dist/count/hellinger_dist.csv'),
('count/hellinger_euclidean_dist',
'reference_dist/hellinger_euclidean_dist.csv',
'obikmer_dist/count/hellinger_euclidean_dist.csv'),
]
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
import argparse
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('--tol', type=float, default=1e-4,
help='Max abs diff threshold for PASS/FAIL (default 1e-4)')
ap.add_argument('--out', default='stats/dist_comparison/summary.csv',
help='Output summary CSV path')
args = ap.parse_args()
out_path = Path(args.out)
out_path.parent.mkdir(parents=True, exist_ok=True)
print(f'Comparing {len(COMPARISONS)} matrix pairs…', file=sys.stderr)
rows = []
for label, ref, obi in COMPARISONS:
rows.append(compare(label, Path(ref), Path(obi), tol=args.tol))
fields = ['comparison', 'max_abs', 'mean_abs', 'rmse', 'n_pairs', 'status']
with out_path.open('w', newline='') as fh:
w = csv.DictWriter(fh, fieldnames=fields)
w.writeheader()
w.writerows(rows)
print(f'\n{out_path}', file=sys.stderr)
n_fail = sum(1 for r in rows if r.get('status') == 'FAIL')
n_pass = sum(1 for r in rows if r.get('status') == 'PASS')
print(f'Summary: {n_pass} PASS {n_fail} FAIL '
f'{len(rows) - n_pass - n_fail} SKIP', file=sys.stderr)
if n_fail:
sys.exit(1)
if __name__ == '__main__':
main()
+199
View File
@@ -0,0 +1,199 @@
SPECIMENS := Escherichia_coli--K-12_MG1655 Escherichia_coli--EDL933 Salmonella_enterica--LT2 Escherichia_coli--CFT073 Bacillus_subtilis--168 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Saccharolobus_islandicus--M.16.4 Acidobacterium_capsulatum--ATCC_51196 Salmonella_enterica--AKU_12601 Proteus_mirabilis--HI4320 Salmonella_enterica--CT18 Klebsiella_pneumoniae--HS11286 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Klebsiella_pneumoniae--ATCC_13883 Yersinia_ruckeri--YRB Candidozyma_auris--GCF_003013715.1_ASM301371v2
SPECIES := Escherichia_coli Salmonella_enterica Bacillus_subtilis Shouchella_clausii Klebsiella_pneumoniae Opitutus_terrae Saccharolobus_islandicus Acidobacterium_capsulatum Proteus_mirabilis Wolbachia_endosymbiont Yersinia_ruckeri Candidozyma_auris
# Escherichia_coli--K-12_MG1655
simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz: genomes/GCF_000005845.2_ASM584v2_genomic.fna.gz
reference_index/Escherichia_coli--K-12_MG1655.npz: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--K-12_MG1655/index.done stats/indexing_presence/Escherichia_coli--K-12_MG1655.stats: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--K-12_MG1655/index.done stats/indexing_count/Escherichia_coli--K-12_MG1655.stats: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--K-12_MG1655.stats: reference_index/Escherichia_coli--K-12_MG1655.npz specimen_index_presence/Escherichia_coli--K-12_MG1655/index.done
stats/verify_count/Escherichia_coli--K-12_MG1655.stats: reference_index/Escherichia_coli--K-12_MG1655.npz specimen_index_count/Escherichia_coli--K-12_MG1655/index.done
# Escherichia_coli--EDL933
simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz: genomes/GCF_000006665.1_ASM666v1_genomic.fna.gz
reference_index/Escherichia_coli--EDL933.npz: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--EDL933/index.done stats/indexing_presence/Escherichia_coli--EDL933.stats: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--EDL933/index.done stats/indexing_count/Escherichia_coli--EDL933.stats: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--EDL933.stats: reference_index/Escherichia_coli--EDL933.npz specimen_index_presence/Escherichia_coli--EDL933/index.done
stats/verify_count/Escherichia_coli--EDL933.stats: reference_index/Escherichia_coli--EDL933.npz specimen_index_count/Escherichia_coli--EDL933/index.done
# Salmonella_enterica--LT2
simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz: genomes/GCF_000006945.2_ASM694v2_genomic.fna.gz
reference_index/Salmonella_enterica--LT2.npz: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--LT2/index.done stats/indexing_presence/Salmonella_enterica--LT2.stats: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--LT2/index.done stats/indexing_count/Salmonella_enterica--LT2.stats: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--LT2.stats: reference_index/Salmonella_enterica--LT2.npz specimen_index_presence/Salmonella_enterica--LT2/index.done
stats/verify_count/Salmonella_enterica--LT2.stats: reference_index/Salmonella_enterica--LT2.npz specimen_index_count/Salmonella_enterica--LT2/index.done
# Escherichia_coli--CFT073
simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz: genomes/GCF_000007445.1_ASM744v1_genomic.fna.gz
reference_index/Escherichia_coli--CFT073.npz: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--CFT073/index.done stats/indexing_presence/Escherichia_coli--CFT073.stats: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--CFT073/index.done stats/indexing_count/Escherichia_coli--CFT073.stats: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--CFT073.stats: reference_index/Escherichia_coli--CFT073.npz specimen_index_presence/Escherichia_coli--CFT073/index.done
stats/verify_count/Escherichia_coli--CFT073.stats: reference_index/Escherichia_coli--CFT073.npz specimen_index_count/Escherichia_coli--CFT073/index.done
# Bacillus_subtilis--168
simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz: genomes/GCF_000009045.1_ASM904v1_genomic.fna.gz
reference_index/Bacillus_subtilis--168.npz: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
specimen_index_presence/Bacillus_subtilis--168/index.done stats/indexing_presence/Bacillus_subtilis--168.stats: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
specimen_index_count/Bacillus_subtilis--168/index.done stats/indexing_count/Bacillus_subtilis--168.stats: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
stats/verify_presence/Bacillus_subtilis--168.stats: reference_index/Bacillus_subtilis--168.npz specimen_index_presence/Bacillus_subtilis--168/index.done
stats/verify_count/Bacillus_subtilis--168.stats: reference_index/Bacillus_subtilis--168.npz specimen_index_count/Bacillus_subtilis--168/index.done
# Salmonella_enterica--P125109
simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz: genomes/GCF_000009505.1_ASM950v1_genomic.fna.gz
reference_index/Salmonella_enterica--P125109.npz: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--P125109/index.done stats/indexing_presence/Salmonella_enterica--P125109.stats: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--P125109/index.done stats/indexing_count/Salmonella_enterica--P125109.stats: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--P125109.stats: reference_index/Salmonella_enterica--P125109.npz specimen_index_presence/Salmonella_enterica--P125109/index.done
stats/verify_count/Salmonella_enterica--P125109.stats: reference_index/Salmonella_enterica--P125109.npz specimen_index_count/Salmonella_enterica--P125109/index.done
# Shouchella_clausii--KSM-K16
simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz: genomes/GCF_000009825.1_ASM982v1_genomic.fna.gz
reference_index/Shouchella_clausii--KSM-K16.npz: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
specimen_index_presence/Shouchella_clausii--KSM-K16/index.done stats/indexing_presence/Shouchella_clausii--KSM-K16.stats: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
specimen_index_count/Shouchella_clausii--KSM-K16/index.done stats/indexing_count/Shouchella_clausii--KSM-K16.stats: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
stats/verify_presence/Shouchella_clausii--KSM-K16.stats: reference_index/Shouchella_clausii--KSM-K16.npz specimen_index_presence/Shouchella_clausii--KSM-K16/index.done
stats/verify_count/Shouchella_clausii--KSM-K16.stats: reference_index/Shouchella_clausii--KSM-K16.npz specimen_index_count/Shouchella_clausii--KSM-K16/index.done
# Escherichia_coli--K-12_W3110
simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz: genomes/GCF_000010245.2_ASM1024v1_genomic.fna.gz
reference_index/Escherichia_coli--K-12_W3110.npz: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--K-12_W3110/index.done stats/indexing_presence/Escherichia_coli--K-12_W3110.stats: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--K-12_W3110/index.done stats/indexing_count/Escherichia_coli--K-12_W3110.stats: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--K-12_W3110.stats: reference_index/Escherichia_coli--K-12_W3110.npz specimen_index_presence/Escherichia_coli--K-12_W3110/index.done
stats/verify_count/Escherichia_coli--K-12_W3110.stats: reference_index/Escherichia_coli--K-12_W3110.npz specimen_index_count/Escherichia_coli--K-12_W3110/index.done
# Klebsiella_pneumoniae--MGH_78578
simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz: genomes/GCF_000016305.1_ASM1630v1_genomic.fna.gz
reference_index/Klebsiella_pneumoniae--MGH_78578.npz: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
specimen_index_presence/Klebsiella_pneumoniae--MGH_78578/index.done stats/indexing_presence/Klebsiella_pneumoniae--MGH_78578.stats: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
specimen_index_count/Klebsiella_pneumoniae--MGH_78578/index.done stats/indexing_count/Klebsiella_pneumoniae--MGH_78578.stats: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
stats/verify_presence/Klebsiella_pneumoniae--MGH_78578.stats: reference_index/Klebsiella_pneumoniae--MGH_78578.npz specimen_index_presence/Klebsiella_pneumoniae--MGH_78578/index.done
stats/verify_count/Klebsiella_pneumoniae--MGH_78578.stats: reference_index/Klebsiella_pneumoniae--MGH_78578.npz specimen_index_count/Klebsiella_pneumoniae--MGH_78578/index.done
# Opitutus_terrae--PB90-1
simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz: genomes/GCF_000019965.1_ASM1996v1_genomic.fna.gz
reference_index/Opitutus_terrae--PB90-1.npz: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
specimen_index_presence/Opitutus_terrae--PB90-1/index.done stats/indexing_presence/Opitutus_terrae--PB90-1.stats: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
specimen_index_count/Opitutus_terrae--PB90-1/index.done stats/indexing_count/Opitutus_terrae--PB90-1.stats: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
stats/verify_presence/Opitutus_terrae--PB90-1.stats: reference_index/Opitutus_terrae--PB90-1.npz specimen_index_presence/Opitutus_terrae--PB90-1/index.done
stats/verify_count/Opitutus_terrae--PB90-1.stats: reference_index/Opitutus_terrae--PB90-1.npz specimen_index_count/Opitutus_terrae--PB90-1/index.done
# Saccharolobus_islandicus--M.16.4
simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz: genomes/GCF_000022445.1_ASM2244v1_genomic.fna.gz
reference_index/Saccharolobus_islandicus--M.16.4.npz: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
specimen_index_presence/Saccharolobus_islandicus--M.16.4/index.done stats/indexing_presence/Saccharolobus_islandicus--M.16.4.stats: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
specimen_index_count/Saccharolobus_islandicus--M.16.4/index.done stats/indexing_count/Saccharolobus_islandicus--M.16.4.stats: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
stats/verify_presence/Saccharolobus_islandicus--M.16.4.stats: reference_index/Saccharolobus_islandicus--M.16.4.npz specimen_index_presence/Saccharolobus_islandicus--M.16.4/index.done
stats/verify_count/Saccharolobus_islandicus--M.16.4.stats: reference_index/Saccharolobus_islandicus--M.16.4.npz specimen_index_count/Saccharolobus_islandicus--M.16.4/index.done
# Acidobacterium_capsulatum--ATCC_51196
simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz: genomes/GCF_000022565.1_ASM2256v1_genomic.fna.gz
reference_index/Acidobacterium_capsulatum--ATCC_51196.npz: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
specimen_index_presence/Acidobacterium_capsulatum--ATCC_51196/index.done stats/indexing_presence/Acidobacterium_capsulatum--ATCC_51196.stats: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
specimen_index_count/Acidobacterium_capsulatum--ATCC_51196/index.done stats/indexing_count/Acidobacterium_capsulatum--ATCC_51196.stats: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
stats/verify_presence/Acidobacterium_capsulatum--ATCC_51196.stats: reference_index/Acidobacterium_capsulatum--ATCC_51196.npz specimen_index_presence/Acidobacterium_capsulatum--ATCC_51196/index.done
stats/verify_count/Acidobacterium_capsulatum--ATCC_51196.stats: reference_index/Acidobacterium_capsulatum--ATCC_51196.npz specimen_index_count/Acidobacterium_capsulatum--ATCC_51196/index.done
# Salmonella_enterica--AKU_12601
simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz: genomes/GCF_000026565.1_ASM2656v1_genomic.fna.gz
reference_index/Salmonella_enterica--AKU_12601.npz: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--AKU_12601/index.done stats/indexing_presence/Salmonella_enterica--AKU_12601.stats: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--AKU_12601/index.done stats/indexing_count/Salmonella_enterica--AKU_12601.stats: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--AKU_12601.stats: reference_index/Salmonella_enterica--AKU_12601.npz specimen_index_presence/Salmonella_enterica--AKU_12601/index.done
stats/verify_count/Salmonella_enterica--AKU_12601.stats: reference_index/Salmonella_enterica--AKU_12601.npz specimen_index_count/Salmonella_enterica--AKU_12601/index.done
# Proteus_mirabilis--HI4320
simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz: genomes/GCF_000069965.1_ASM6996v1_genomic.fna.gz
reference_index/Proteus_mirabilis--HI4320.npz: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
specimen_index_presence/Proteus_mirabilis--HI4320/index.done stats/indexing_presence/Proteus_mirabilis--HI4320.stats: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
specimen_index_count/Proteus_mirabilis--HI4320/index.done stats/indexing_count/Proteus_mirabilis--HI4320.stats: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
stats/verify_presence/Proteus_mirabilis--HI4320.stats: reference_index/Proteus_mirabilis--HI4320.npz specimen_index_presence/Proteus_mirabilis--HI4320/index.done
stats/verify_count/Proteus_mirabilis--HI4320.stats: reference_index/Proteus_mirabilis--HI4320.npz specimen_index_count/Proteus_mirabilis--HI4320/index.done
# Salmonella_enterica--CT18
simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz: genomes/GCF_000195995.1_ASM19599v1_genomic.fna.gz
reference_index/Salmonella_enterica--CT18.npz: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--CT18/index.done stats/indexing_presence/Salmonella_enterica--CT18.stats: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--CT18/index.done stats/indexing_count/Salmonella_enterica--CT18.stats: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--CT18.stats: reference_index/Salmonella_enterica--CT18.npz specimen_index_presence/Salmonella_enterica--CT18/index.done
stats/verify_count/Salmonella_enterica--CT18.stats: reference_index/Salmonella_enterica--CT18.npz specimen_index_count/Salmonella_enterica--CT18/index.done
# Klebsiella_pneumoniae--HS11286
simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz: genomes/GCF_000240185.1_ASM24018v2_genomic.fna.gz
reference_index/Klebsiella_pneumoniae--HS11286.npz: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
specimen_index_presence/Klebsiella_pneumoniae--HS11286/index.done stats/indexing_presence/Klebsiella_pneumoniae--HS11286.stats: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
specimen_index_count/Klebsiella_pneumoniae--HS11286/index.done stats/indexing_count/Klebsiella_pneumoniae--HS11286.stats: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
stats/verify_presence/Klebsiella_pneumoniae--HS11286.stats: reference_index/Klebsiella_pneumoniae--HS11286.npz specimen_index_presence/Klebsiella_pneumoniae--HS11286/index.done
stats/verify_count/Klebsiella_pneumoniae--HS11286.stats: reference_index/Klebsiella_pneumoniae--HS11286.npz specimen_index_count/Klebsiella_pneumoniae--HS11286/index.done
# Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1
simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz: genomes/GCF_000306885.1_ASM30688v1_genomic.fna.gz
reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
specimen_index_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done stats/indexing_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
specimen_index_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done stats/indexing_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
stats/verify_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz specimen_index_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done
stats/verify_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz specimen_index_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done
# Klebsiella_pneumoniae--ATCC_13883
simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz: genomes/GCF_000742135.1_ASM74213v1_genomic.fna.gz
reference_index/Klebsiella_pneumoniae--ATCC_13883.npz: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
specimen_index_presence/Klebsiella_pneumoniae--ATCC_13883/index.done stats/indexing_presence/Klebsiella_pneumoniae--ATCC_13883.stats: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
specimen_index_count/Klebsiella_pneumoniae--ATCC_13883/index.done stats/indexing_count/Klebsiella_pneumoniae--ATCC_13883.stats: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
stats/verify_presence/Klebsiella_pneumoniae--ATCC_13883.stats: reference_index/Klebsiella_pneumoniae--ATCC_13883.npz specimen_index_presence/Klebsiella_pneumoniae--ATCC_13883/index.done
stats/verify_count/Klebsiella_pneumoniae--ATCC_13883.stats: reference_index/Klebsiella_pneumoniae--ATCC_13883.npz specimen_index_count/Klebsiella_pneumoniae--ATCC_13883/index.done
# Yersinia_ruckeri--YRB
simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz: genomes/GCF_000834255.1_ASM83425v1_genomic.fna.gz
reference_index/Yersinia_ruckeri--YRB.npz: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
specimen_index_presence/Yersinia_ruckeri--YRB/index.done stats/indexing_presence/Yersinia_ruckeri--YRB.stats: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
specimen_index_count/Yersinia_ruckeri--YRB/index.done stats/indexing_count/Yersinia_ruckeri--YRB.stats: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
stats/verify_presence/Yersinia_ruckeri--YRB.stats: reference_index/Yersinia_ruckeri--YRB.npz specimen_index_presence/Yersinia_ruckeri--YRB/index.done
stats/verify_count/Yersinia_ruckeri--YRB.stats: reference_index/Yersinia_ruckeri--YRB.npz specimen_index_count/Yersinia_ruckeri--YRB/index.done
# Candidozyma_auris--GCF_003013715.1_ASM301371v2
simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz: genomes/GCF_003013715.1_ASM301371v2_genomic.fna.gz
reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
specimen_index_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done stats/indexing_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
specimen_index_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done stats/indexing_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
stats/verify_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz specimen_index_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done
stats/verify_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz specimen_index_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done
# Escherichia_coli
specific_index_presence/Escherichia_coli/index.done stats/specific_kmer_presence/Escherichia_coli.stats: global_index_presence/index.done
specific_index_count/Escherichia_coli/index.done stats/specific_kmer_count/Escherichia_coli.stats: global_index_count/index.done
# Salmonella_enterica
specific_index_presence/Salmonella_enterica/index.done stats/specific_kmer_presence/Salmonella_enterica.stats: global_index_presence/index.done
specific_index_count/Salmonella_enterica/index.done stats/specific_kmer_count/Salmonella_enterica.stats: global_index_count/index.done
# Bacillus_subtilis
specific_index_presence/Bacillus_subtilis/index.done stats/specific_kmer_presence/Bacillus_subtilis.stats: global_index_presence/index.done
specific_index_count/Bacillus_subtilis/index.done stats/specific_kmer_count/Bacillus_subtilis.stats: global_index_count/index.done
# Shouchella_clausii
specific_index_presence/Shouchella_clausii/index.done stats/specific_kmer_presence/Shouchella_clausii.stats: global_index_presence/index.done
specific_index_count/Shouchella_clausii/index.done stats/specific_kmer_count/Shouchella_clausii.stats: global_index_count/index.done
# Klebsiella_pneumoniae
specific_index_presence/Klebsiella_pneumoniae/index.done stats/specific_kmer_presence/Klebsiella_pneumoniae.stats: global_index_presence/index.done
specific_index_count/Klebsiella_pneumoniae/index.done stats/specific_kmer_count/Klebsiella_pneumoniae.stats: global_index_count/index.done
# Opitutus_terrae
specific_index_presence/Opitutus_terrae/index.done stats/specific_kmer_presence/Opitutus_terrae.stats: global_index_presence/index.done
specific_index_count/Opitutus_terrae/index.done stats/specific_kmer_count/Opitutus_terrae.stats: global_index_count/index.done
# Saccharolobus_islandicus
specific_index_presence/Saccharolobus_islandicus/index.done stats/specific_kmer_presence/Saccharolobus_islandicus.stats: global_index_presence/index.done
specific_index_count/Saccharolobus_islandicus/index.done stats/specific_kmer_count/Saccharolobus_islandicus.stats: global_index_count/index.done
# Acidobacterium_capsulatum
specific_index_presence/Acidobacterium_capsulatum/index.done stats/specific_kmer_presence/Acidobacterium_capsulatum.stats: global_index_presence/index.done
specific_index_count/Acidobacterium_capsulatum/index.done stats/specific_kmer_count/Acidobacterium_capsulatum.stats: global_index_count/index.done
# Proteus_mirabilis
specific_index_presence/Proteus_mirabilis/index.done stats/specific_kmer_presence/Proteus_mirabilis.stats: global_index_presence/index.done
specific_index_count/Proteus_mirabilis/index.done stats/specific_kmer_count/Proteus_mirabilis.stats: global_index_count/index.done
# Wolbachia_endosymbiont
specific_index_presence/Wolbachia_endosymbiont/index.done stats/specific_kmer_presence/Wolbachia_endosymbiont.stats: global_index_presence/index.done
specific_index_count/Wolbachia_endosymbiont/index.done stats/specific_kmer_count/Wolbachia_endosymbiont.stats: global_index_count/index.done
# Yersinia_ruckeri
specific_index_presence/Yersinia_ruckeri/index.done stats/specific_kmer_presence/Yersinia_ruckeri.stats: global_index_presence/index.done
specific_index_count/Yersinia_ruckeri/index.done stats/specific_kmer_count/Yersinia_ruckeri.stats: global_index_count/index.done
# Candidozyma_auris
specific_index_presence/Candidozyma_auris/index.done stats/specific_kmer_presence/Candidozyma_auris.stats: global_index_presence/index.done
specific_index_count/Candidozyma_auris/index.done stats/specific_kmer_count/Candidozyma_auris.stats: global_index_count/index.done
+48
View File
@@ -0,0 +1,48 @@
#!/usr/bin/env bash
set -euo pipefail
assemblies=(
GCF_000005845.2
GCF_000010245.2
GCF_000007445.1
GCF_000006665.1
GCF_000006945.2
GCF_000195995.1
GCF_000009505.1
GCF_000026565.1
GCF_000016305.1
GCF_000019965.1
GCF_000240185.1
GCF_000742135.1
GCF_000069965.1
GCF_000022565.1
GCF_000306885.1
GCF_003013715.1
GCF_000009045.1
GCF_000009825.1
GCF_000022445.1
GCF_000834255.1
)
mkdir -p genomes
for acc in "${assemblies[@]}"; do
echo "Downloading ${acc}"
datasets download genome accession "${acc}" \
--include genome \
--filename "${acc}.zip"
unzip -q "${acc}.zip" -d "${acc}"
find "${acc}" -name "*.fna" |
while read file; do
obiconvert -Z ${file} >genomes/$(basename ${file}).gz
done
rm -rf "${acc}" "${acc}.zip"
done
+108
View File
@@ -0,0 +1,108 @@
#!/usr/bin/env bash
# Usage: filter_one_count.sh SPECIES
# Filters global_index_count to keep only kmers specific to SPECIES,
# then selects the SPECIES column in-place.
# Outputs:
# specific_index_count/SPECIES/index.done (written by obikmer select)
# stats/specific_kmer_count/SPECIES.stats (one CSV data row, no header)
set -euo pipefail
SPECIES="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
SOURCE="${SCRIPT_DIR}/global_index_count"
OUTPUT="${SCRIPT_DIR}/specific_index_count/${SPECIES}"
STATS_DIR="${SCRIPT_DIR}/stats/specific_kmer_count"
STATS_FILE="${STATS_DIR}/${SPECIES}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIES}] filter (count) → ${OUTPUT}"
LOG_FILTER=$(mktemp)
LOG_SELECT=$(mktemp)
trap 'rm -f "${LOG_FILTER}" "${LOG_SELECT}"' EXIT
"${BINARY}" filter \
--output "${OUTPUT}" \
--force \
--ingroup "species=${SPECIES}" \
--outgroup all \
--min-frac 0.5 \
--max-frac 1.0 \
--max-outgroup-count 0 \
"${SOURCE}" \
2>"${LOG_FILTER}"
cat "${LOG_FILTER}" >&2
"${BINARY}" select \
--in-place \
--group "${SPECIES}:species=${SPECIES}" \
--group-op "${SPECIES}:any" \
--select "${SPECIES}" \
"${OUTPUT}" \
2>"${LOG_SELECT}"
cat "${LOG_SELECT}" >&2
python3 - "${SPECIES}" "${LOG_FILTER}" "${LOG_SELECT}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, log_filter, log_select = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
def parse_reporter(logfile):
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats['TOTAL'] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
return stats
f = parse_reporter(log_filter)
s = parse_reporter(log_select)
row = [species]
for stage, d in [('rebuild', f), ('pack', f), ('filter_total', f), ('select', s), ('select_total', s)]:
key = 'TOTAL' if stage.endswith('_total') else stage
w, r = d.get(key, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
print(','.join(row))
PYEOF
+108
View File
@@ -0,0 +1,108 @@
#!/usr/bin/env bash
# Usage: filter_one_presence.sh SPECIES
# Filters global_index_presence to keep only kmers specific to SPECIES,
# then selects the SPECIES column in-place.
# Outputs:
# specific_index_presence/SPECIES/index.done (written by obikmer select)
# stats/specific_kmer_presence/SPECIES.stats (one CSV data row, no header)
set -euo pipefail
SPECIES="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
SOURCE="${SCRIPT_DIR}/global_index_presence"
OUTPUT="${SCRIPT_DIR}/specific_index_presence/${SPECIES}"
STATS_DIR="${SCRIPT_DIR}/stats/specific_kmer_presence"
STATS_FILE="${STATS_DIR}/${SPECIES}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIES}] filter (presence) → ${OUTPUT}"
LOG_FILTER=$(mktemp)
LOG_SELECT=$(mktemp)
trap 'rm -f "${LOG_FILTER}" "${LOG_SELECT}"' EXIT
"${BINARY}" filter \
--output "${OUTPUT}" \
--force \
--ingroup "species=${SPECIES}" \
--outgroup all \
--min-frac 0.5 \
--max-frac 1.0 \
--max-outgroup-count 0 \
"${SOURCE}" \
2>"${LOG_FILTER}"
cat "${LOG_FILTER}" >&2
"${BINARY}" select \
--in-place \
--group "${SPECIES}:species=${SPECIES}" \
--group-op "${SPECIES}:any" \
--select "${SPECIES}" \
"${OUTPUT}" \
2>"${LOG_SELECT}"
cat "${LOG_SELECT}" >&2
python3 - "${SPECIES}" "${LOG_FILTER}" "${LOG_SELECT}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, log_filter, log_select = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
def parse_reporter(logfile):
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats['TOTAL'] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
return stats
f = parse_reporter(log_filter)
s = parse_reporter(log_select)
row = [species]
for stage, d in [('rebuild', f), ('pack', f), ('filter_total', f), ('select', s), ('select_total', s)]:
key = 'TOTAL' if stage.endswith('_total') else stage
w, r = d.get(key, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
print(','.join(row))
PYEOF
+103
View File
@@ -0,0 +1,103 @@
#!/usr/bin/env bash
# Usage: index_one_count.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Outputs:
# specimen_index_count/SPECIMEN/index.done (written by obikmer)
# stats/indexing_count/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
READS_DIR="${SCRIPT_DIR}/simulated_data/${species}/${strain}"
INDEX_PATH="${SCRIPT_DIR}/specimen_index_count/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/indexing_count"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
r1="${READS_DIR}/reads_R1.fastq.gz"
r2="${READS_DIR}/reads_R2.fastq.gz"
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
echo "ERROR: reads not found in ${READS_DIR}" >&2
exit 1
fi
echo "[${SPECIMEN}] indexing (count) → ${INDEX_PATH}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" index \
--output "${INDEX_PATH}" \
--force \
--theta 0 \
--with-counts \
--label "${SPECIMEN}" \
--meta "species=${species}" \
"${r1}" "${r2}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
python3 - "${species}" "${strain}" "${STDERR_LOG}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, strain, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['scatter', 'dereplicate', 'count_kmer', 'index']
row = [species, strain]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
+102
View File
@@ -0,0 +1,102 @@
#!/usr/bin/env bash
# Usage: index_one_presence.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Outputs:
# specimen_index_presence/SPECIMEN/index.done (written by obikmer)
# stats/indexing_presence/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
READS_DIR="${SCRIPT_DIR}/simulated_data/${species}/${strain}"
INDEX_PATH="${SCRIPT_DIR}/specimen_index_presence/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/indexing_presence"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
r1="${READS_DIR}/reads_R1.fastq.gz"
r2="${READS_DIR}/reads_R2.fastq.gz"
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
echo "ERROR: reads not found in ${READS_DIR}" >&2
exit 1
fi
echo "[${SPECIMEN}] indexing (presence) → ${INDEX_PATH}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" index \
--output "${INDEX_PATH}" \
--force \
--theta 0 \
--label "${SPECIMEN}" \
--meta "species=${species}" \
"${r1}" "${r2}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
python3 - "${species}" "${strain}" "${STDERR_LOG}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, strain, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['scatter', 'dereplicate', 'count_kmer', 'index']
row = [species, strain]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
+118
View File
@@ -0,0 +1,118 @@
#!/usr/bin/env python3
"""Generate deps.mk — pure dependency declarations for the benchmark pipeline.
Like C .d files: only target: prerequisites lines, no recipes.
Recipes stay in the Makefile as generic rules.
"""
import gzip
import re
import sys
from pathlib import Path
STOP_WORDS = {'complete', 'chromosome', 'whole', 'sequence', 'genome',
'endosymbiont', 'of'}
STOP_PREFIXES = ('scaffold', 'contig', 'plasmid')
def is_stop(tok):
t = tok.lower()
return t in STOP_WORDS or any(t.startswith(p) for p in STOP_PREFIXES)
def sanitize(s):
return re.sub(r'[^A-Za-z0-9._-]', '_', s).strip('_')
def collect_tokens(text):
parts = []
for tok in text.split():
tok = tok.rstrip(',.')
if is_stop(tok):
break
parts.append(sanitize(tok))
return '_'.join(filter(None, parts))
def parse_organism(defn, gcf_id):
words = defn.split()
species = sanitize(words[0] + '_' + words[1])
m = re.search(r'\bstr\.\s+(\S+)(?:\s+substr\.\s+(\S+))?', defn)
if m:
strain = sanitize(m.group(1))
if m.group(2):
strain += '_' + sanitize(m.group(2))
return species, strain
m = re.search(r'\bstrain\b\s+(.*)', defn)
if m:
strain = collect_tokens(m.group(1))
if strain:
return species, strain
remainder = re.sub(r'^\S+ \S+\s*', '', defn)
remainder = re.sub(r'^subsp\.\s+\S+\s*', '', remainder)
remainder = re.sub(r'^serovar\s+\S+\s*', '', remainder)
strain = collect_tokens(remainder)
return species, strain if strain else gcf_id
def first_definition(path):
with gzip.open(path, 'rt') as fh:
for line in fh:
if line.startswith('>'):
m = re.search(r'"definition":"([^"]*)"', line)
return m.group(1) if m else line[1:].split()[0]
return Path(path).stem
def main():
entries = [] # (specimen, species, sim_dir, genome_path)
species_seen = []
for path in sorted(sys.argv[1:]):
gcf_id = Path(path).name.replace('_genomic.fna.gz', '')
defn = first_definition(path)
sp, st = parse_organism(defn, gcf_id)
specimen = f'{sp}--{st}'
sim_dir = f'simulated_data/{sp}/{st}'
entries.append((specimen, sp, sim_dir, path))
if sp not in species_seen:
species_seen.append(sp)
specimens = [e[0] for e in entries]
print('SPECIMENS :=', ' '.join(specimens))
print('SPECIES :=', ' '.join(species_seen))
for specimen, species, sim_dir, genome in entries:
reads = f'{sim_dir}/reads_R1.fastq.gz'
p_done = f'specimen_index_presence/{specimen}/index.done'
p_stats = f'stats/indexing_presence/{specimen}.stats'
c_done = f'specimen_index_count/{specimen}/index.done'
c_stats = f'stats/indexing_count/{specimen}.stats'
ref = f'reference_index/{specimen}.npz'
vp = f'stats/verify_presence/{specimen}.stats'
vc = f'stats/verify_count/{specimen}.stats'
print()
print(f'# {specimen}')
print(f'{reads}: {genome}')
print(f'{ref}: {reads}')
print(f'{p_done} {p_stats}: {reads}')
print(f'{c_done} {c_stats}: {reads}')
print(f'{vp}: {ref} {p_done}')
print(f'{vc}: {ref} {c_done}')
print()
for sp in species_seen:
sp_done = f'specific_index_presence/{sp}/index.done'
sp_stats = f'stats/specific_kmer_presence/{sp}.stats'
sc_done = f'specific_index_count/{sp}/index.done'
sc_stats = f'stats/specific_kmer_count/{sp}.stats'
print(f'# {sp}')
print(f'{sp_done} {sp_stats}: global_index_presence/index.done')
print(f'{sc_done} {sc_stats}: global_index_count/index.done')
if __name__ == '__main__':
main()
+103
View File
@@ -0,0 +1,103 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
IDX_DIR="${SCRIPT_DIR}/specimen_index_count"
OUTPUT="${SCRIPT_DIR}/global_index_count"
STATS_DIR="${SCRIPT_DIR}/stats/merge_count"
mkdir -p "${STATS_DIR}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' | wc -l | tr -d ' ')")
CSV="${STATS_DIR}/run_${run_n}.csv"
printf 'run,n_sources,bootstrap_wall_s,bootstrap_rss_b,spectrums_wall_s,spectrums_rss_b,merge_partitions_wall_s,merge_partitions_rss_b,pack_wall_s,pack_rss_b,total_wall_s,total_rss_b\n' >"${CSV}"
parse_reporter() {
local run="$1" n_sources="$2" logfile="$3"
python3 - "$run" "$n_sources" "$logfile" <<'PYEOF'
import sys, re
run, n_sources, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s):
state = 'rows'
elif state == 'rows':
if is_sep(s):
state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['bootstrap', 'spectrums', 'merge_partitions', 'pack']
row = [run, n_sources]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
}
mapfile -t sources < <(find "${IDX_DIR}" -mindepth 1 -maxdepth 1 -type d | sort)
if [[ ${#sources[@]} -eq 0 ]]; then
echo "ERROR: no indexes found in ${IDX_DIR}" >&2
exit 1
fi
echo "Merging ${#sources[@]} count indexes → ${OUTPUT}"
printf ' %s\n' "${sources[@]}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" merge \
--output "${OUTPUT}" \
--force \
"${sources[@]}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
parse_reporter "${run_n}" "${#sources[@]}" "${STDERR_LOG}" >>"${CSV}"
echo "Done. Run ${run_n}${CSV}"
+104
View File
@@ -0,0 +1,104 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
IDX_DIR="${SCRIPT_DIR}/specimen_index_presence"
OUTPUT="${SCRIPT_DIR}/global_index_presence"
STATS_DIR="${SCRIPT_DIR}/stats/merge_presence"
mkdir -p "${STATS_DIR}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' | wc -l | tr -d ' ')")
CSV="${STATS_DIR}/run_${run_n}.csv"
printf 'run,n_sources,bootstrap_wall_s,bootstrap_rss_b,spectrums_wall_s,spectrums_rss_b,merge_partitions_wall_s,merge_partitions_rss_b,pack_wall_s,pack_rss_b,total_wall_s,total_rss_b\n' >"${CSV}"
parse_reporter() {
local run="$1" n_sources="$2" logfile="$3"
python3 - "$run" "$n_sources" "$logfile" <<'PYEOF'
import sys, re
run, n_sources, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s):
state = 'rows'
elif state == 'rows':
if is_sep(s):
state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['bootstrap', 'spectrums', 'merge_partitions', 'pack']
row = [run, n_sources]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
}
mapfile -t sources < <(find "${IDX_DIR}" -mindepth 1 -maxdepth 1 -type d | sort)
if [[ ${#sources[@]} -eq 0 ]]; then
echo "ERROR: no indexes found in ${IDX_DIR}" >&2
exit 1
fi
echo "Merging ${#sources[@]} presence indexes → ${OUTPUT}"
printf ' %s\n' "${sources[@]}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" merge \
--output "${OUTPUT}" \
--force \
--force-presence \
"${sources[@]}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
parse_reporter "${run_n}" "${#sources[@]}" "${STDERR_LOG}" >>"${CSV}"
echo "Done. Run ${run_n}${CSV}"
+12
View File
@@ -0,0 +1,12 @@
#!/usr/bin/env bash
# Simulate all genomes. Delegates to simulate_one.sh per genome.
# Prefer running via `gmake simulate` which handles individual dependencies.
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
for genome_file in "${SCRIPT_DIR}"/genomes/*.fna.gz; do
out_dir=$("${SCRIPT_DIR}/../.venv/bin/python3" "${SCRIPT_DIR}/make_deps.py" \
--dir-for "${genome_file}")
bash "${SCRIPT_DIR}/simulate_one.sh" "${genome_file}" "${out_dir}"
done
+33
View File
@@ -0,0 +1,33 @@
#!/usr/bin/env bash
# Usage: simulate_one.sh genome.fna.gz output_dir
# Simulates paired-end HiSeq reads for a single genome.
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
ISS="${SCRIPT_DIR}/../.venv/bin/iss"
COVERAGE=15
READ_LENGTH=150
CPUS="${CPUS:-$(sysctl -n hw.logicalcpu 2>/dev/null || nproc 2>/dev/null || echo 2)}"
genome_file="$1"
out_dir="$2"
mkdir -p "${out_dir}"
tmp_fasta=$(mktemp "${TMPDIR:-/tmp}/obikmer_XXXXXX.fna")
trap 'rm -f "${tmp_fasta}"' EXIT
gzip -dc "${genome_file}" > "${tmp_fasta}"
genome_size=$(grep -v "^>" "${tmp_fasta}" | tr -d '[:space:]' | wc -c | tr -d ' ')
n_reads=$(python3 -c "import math; print(math.ceil(${COVERAGE} * ${genome_size} / (2 * ${READ_LENGTH})))")
echo "[${out_dir}] genome=${genome_size} bp → ${n_reads} read pairs (${COVERAGE}x HiSeq)"
"${ISS}" generate \
--genomes "${tmp_fasta}" \
--model HiSeq \
--n_reads "${n_reads}" \
--cpus "${CPUS}" \
--compress \
--output "${out_dir}/reads"
+21
View File
@@ -0,0 +1,21 @@
genome,Candidozyma_auris--GCF_003013715.1_ASM301371v2,Acidobacterium_capsulatum--ATCC_51196,Bacillus_subtilis--168,Escherichia_coli--CFT073,Escherichia_coli--EDL933,Escherichia_coli--K-12_MG1655,Escherichia_coli--K-12_W3110,Klebsiella_pneumoniae--ATCC_13883,Klebsiella_pneumoniae--HS11286,Klebsiella_pneumoniae--MGH_78578,Opitutus_terrae--PB90-1,Proteus_mirabilis--HI4320,Saccharolobus_islandicus--M.16.4,Salmonella_enterica--AKU_12601,Salmonella_enterica--CT18,Salmonella_enterica--LT2,Salmonella_enterica--P125109,Shouchella_clausii--KSM-K16,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,Yersinia_ruckeri--YRB
Candidozyma_auris--GCF_003013715.1_ASM301371v2,0.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000
Acidobacterium_capsulatum--ATCC_51196,1.000000,0.000000,0.999981,0.999990,0.999989,0.999987,0.999987,0.999990,0.999988,0.999988,0.999994,0.999989,1.000000,0.999988,0.999987,0.999987,0.999988,0.999989,0.999991,0.999987
Bacillus_subtilis--168,1.000000,0.999981,0.000000,0.999990,0.999989,0.999989,0.999989,0.999989,0.999988,0.999986,0.999995,0.999985,0.999999,0.999988,0.999987,0.999989,0.999988,0.999778,0.999993,0.999987
Escherichia_coli--CFT073,1.000000,0.999990,0.999990,0.000000,0.825741,0.807495,0.807218,0.991156,0.996855,0.997849,0.999996,0.999633,1.000000,0.993885,0.996736,0.994148,0.993821,0.999991,0.999984,0.999291
Escherichia_coli--EDL933,1.000000,0.999989,0.999989,0.825741,0.000000,0.735107,0.734775,0.996126,0.998058,0.997908,0.999997,0.999640,1.000000,0.993993,0.997126,0.994390,0.994059,0.999991,0.999986,0.999292
Escherichia_coli--K-12_MG1655,1.000000,0.999987,0.999989,0.807495,0.735107,0.000000,0.382567,0.996190,0.997747,0.997455,0.999996,0.999604,1.000000,0.993444,0.996645,0.993773,0.993431,0.999989,0.999984,0.999174
Escherichia_coli--K-12_W3110,1.000000,0.999987,0.999989,0.807218,0.734775,0.382567,0.000000,0.996220,0.997761,0.997467,0.999995,0.999604,1.000000,0.993445,0.996669,0.993769,0.993443,0.999990,0.999985,0.999165
Klebsiella_pneumoniae--ATCC_13883,1.000000,0.999990,0.999989,0.991156,0.996126,0.996190,0.996220,0.000000,0.845220,0.840545,0.999997,0.999648,1.000000,0.996177,0.998128,0.996268,0.996052,0.999990,0.999987,0.999325
Klebsiella_pneumoniae--HS11286,1.000000,0.999988,0.999988,0.996855,0.998058,0.997747,0.997761,0.845220,0.000000,0.906475,0.999996,0.999683,1.000000,0.997724,0.995697,0.997776,0.997769,0.999989,0.999979,0.999463
Klebsiella_pneumoniae--MGH_78578,1.000000,0.999988,0.999986,0.997849,0.997908,0.997455,0.997467,0.840545,0.906475,0.000000,0.999996,0.999704,1.000000,0.997928,0.995054,0.997844,0.997868,0.999990,0.999980,0.999479
Opitutus_terrae--PB90-1,1.000000,0.999994,0.999995,0.999996,0.999997,0.999996,0.999995,0.999997,0.999996,0.999996,0.000000,0.999997,0.999998,0.999996,0.999996,0.999996,0.999995,0.999997,0.999993,0.999996
Proteus_mirabilis--HI4320,1.000000,0.999989,0.999985,0.999633,0.999640,0.999604,0.999604,0.999648,0.999683,0.999704,0.999997,0.000000,1.000000,0.999604,0.999699,0.999622,0.999613,0.999987,0.999983,0.999505
Saccharolobus_islandicus--M.16.4,1.000000,1.000000,0.999999,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,0.999998,1.000000,0.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000
Salmonella_enterica--AKU_12601,1.000000,0.999988,0.999988,0.993885,0.993993,0.993444,0.993445,0.996177,0.997724,0.997928,0.999996,0.999604,1.000000,0.000000,0.869238,0.682277,0.663383,0.999990,0.999985,0.999260
Salmonella_enterica--CT18,1.000000,0.999987,0.999987,0.996736,0.997126,0.996645,0.996669,0.998128,0.995697,0.995054,0.999996,0.999699,1.000000,0.869238,0.000000,0.890872,0.886148,0.999988,0.999976,0.999524
Salmonella_enterica--LT2,1.000000,0.999987,0.999989,0.994148,0.994390,0.993773,0.993769,0.996268,0.997776,0.997844,0.999996,0.999622,1.000000,0.682277,0.890872,0.000000,0.622606,0.999989,0.999985,0.999296
Salmonella_enterica--P125109,1.000000,0.999988,0.999988,0.993821,0.994059,0.993431,0.993443,0.996052,0.997769,0.997868,0.999995,0.999613,1.000000,0.663383,0.886148,0.622606,0.000000,0.999988,0.999983,0.999270
Shouchella_clausii--KSM-K16,1.000000,0.999989,0.999778,0.999991,0.999991,0.999989,0.999990,0.999990,0.999989,0.999990,0.999997,0.999987,1.000000,0.999990,0.999988,0.999989,0.999988,0.000000,0.999991,0.999988
Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,1.000000,0.999991,0.999993,0.999984,0.999986,0.999984,0.999985,0.999987,0.999979,0.999980,0.999993,0.999983,1.000000,0.999985,0.999976,0.999985,0.999983,0.999991,0.000000,0.999983
Yersinia_ruckeri--YRB,1.000000,0.999987,0.999987,0.999291,0.999292,0.999174,0.999165,0.999325,0.999463,0.999479,0.999996,0.999505,1.000000,0.999260,0.999524,0.999296,0.999270,0.999988,0.999983,0.000000
1 genome Candidozyma_auris--GCF_003013715.1_ASM301371v2 Acidobacterium_capsulatum--ATCC_51196 Bacillus_subtilis--168 Escherichia_coli--CFT073 Escherichia_coli--EDL933 Escherichia_coli--K-12_MG1655 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--ATCC_13883 Klebsiella_pneumoniae--HS11286 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Proteus_mirabilis--HI4320 Saccharolobus_islandicus--M.16.4 Salmonella_enterica--AKU_12601 Salmonella_enterica--CT18 Salmonella_enterica--LT2 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Yersinia_ruckeri--YRB
2 Candidozyma_auris--GCF_003013715.1_ASM301371v2 0.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000
3 Acidobacterium_capsulatum--ATCC_51196 1.000000 0.000000 0.999981 0.999990 0.999989 0.999987 0.999987 0.999990 0.999988 0.999988 0.999994 0.999989 1.000000 0.999988 0.999987 0.999987 0.999988 0.999989 0.999991 0.999987
4 Bacillus_subtilis--168 1.000000 0.999981 0.000000 0.999990 0.999989 0.999989 0.999989 0.999989 0.999988 0.999986 0.999995 0.999985 0.999999 0.999988 0.999987 0.999989 0.999988 0.999778 0.999993 0.999987
5 Escherichia_coli--CFT073 1.000000 0.999990 0.999990 0.000000 0.825741 0.807495 0.807218 0.991156 0.996855 0.997849 0.999996 0.999633 1.000000 0.993885 0.996736 0.994148 0.993821 0.999991 0.999984 0.999291
6 Escherichia_coli--EDL933 1.000000 0.999989 0.999989 0.825741 0.000000 0.735107 0.734775 0.996126 0.998058 0.997908 0.999997 0.999640 1.000000 0.993993 0.997126 0.994390 0.994059 0.999991 0.999986 0.999292
7 Escherichia_coli--K-12_MG1655 1.000000 0.999987 0.999989 0.807495 0.735107 0.000000 0.382567 0.996190 0.997747 0.997455 0.999996 0.999604 1.000000 0.993444 0.996645 0.993773 0.993431 0.999989 0.999984 0.999174
8 Escherichia_coli--K-12_W3110 1.000000 0.999987 0.999989 0.807218 0.734775 0.382567 0.000000 0.996220 0.997761 0.997467 0.999995 0.999604 1.000000 0.993445 0.996669 0.993769 0.993443 0.999990 0.999985 0.999165
9 Klebsiella_pneumoniae--ATCC_13883 1.000000 0.999990 0.999989 0.991156 0.996126 0.996190 0.996220 0.000000 0.845220 0.840545 0.999997 0.999648 1.000000 0.996177 0.998128 0.996268 0.996052 0.999990 0.999987 0.999325
10 Klebsiella_pneumoniae--HS11286 1.000000 0.999988 0.999988 0.996855 0.998058 0.997747 0.997761 0.845220 0.000000 0.906475 0.999996 0.999683 1.000000 0.997724 0.995697 0.997776 0.997769 0.999989 0.999979 0.999463
11 Klebsiella_pneumoniae--MGH_78578 1.000000 0.999988 0.999986 0.997849 0.997908 0.997455 0.997467 0.840545 0.906475 0.000000 0.999996 0.999704 1.000000 0.997928 0.995054 0.997844 0.997868 0.999990 0.999980 0.999479
12 Opitutus_terrae--PB90-1 1.000000 0.999994 0.999995 0.999996 0.999997 0.999996 0.999995 0.999997 0.999996 0.999996 0.000000 0.999997 0.999998 0.999996 0.999996 0.999996 0.999995 0.999997 0.999993 0.999996
13 Proteus_mirabilis--HI4320 1.000000 0.999989 0.999985 0.999633 0.999640 0.999604 0.999604 0.999648 0.999683 0.999704 0.999997 0.000000 1.000000 0.999604 0.999699 0.999622 0.999613 0.999987 0.999983 0.999505
14 Saccharolobus_islandicus--M.16.4 1.000000 1.000000 0.999999 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 0.999998 1.000000 0.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000
15 Salmonella_enterica--AKU_12601 1.000000 0.999988 0.999988 0.993885 0.993993 0.993444 0.993445 0.996177 0.997724 0.997928 0.999996 0.999604 1.000000 0.000000 0.869238 0.682277 0.663383 0.999990 0.999985 0.999260
16 Salmonella_enterica--CT18 1.000000 0.999987 0.999987 0.996736 0.997126 0.996645 0.996669 0.998128 0.995697 0.995054 0.999996 0.999699 1.000000 0.869238 0.000000 0.890872 0.886148 0.999988 0.999976 0.999524
17 Salmonella_enterica--LT2 1.000000 0.999987 0.999989 0.994148 0.994390 0.993773 0.993769 0.996268 0.997776 0.997844 0.999996 0.999622 1.000000 0.682277 0.890872 0.000000 0.622606 0.999989 0.999985 0.999296
18 Salmonella_enterica--P125109 1.000000 0.999988 0.999988 0.993821 0.994059 0.993431 0.993443 0.996052 0.997769 0.997868 0.999995 0.999613 1.000000 0.663383 0.886148 0.622606 0.000000 0.999988 0.999983 0.999270
19 Shouchella_clausii--KSM-K16 1.000000 0.999989 0.999778 0.999991 0.999991 0.999989 0.999990 0.999990 0.999989 0.999990 0.999997 0.999987 1.000000 0.999990 0.999988 0.999989 0.999988 0.000000 0.999991 0.999988
20 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 1.000000 0.999991 0.999993 0.999984 0.999986 0.999984 0.999985 0.999987 0.999979 0.999980 0.999993 0.999983 1.000000 0.999985 0.999976 0.999985 0.999983 0.999991 0.000000 0.999983
21 Yersinia_ruckeri--YRB 1.000000 0.999987 0.999987 0.999291 0.999292 0.999174 0.999165 0.999325 0.999463 0.999479 0.999996 0.999505 1.000000 0.999260 0.999524 0.999296 0.999270 0.999988 0.999983 0.000000
+1
View File
@@ -0,0 +1 @@
(((((((((((Candidozyma_auris--GCF_003013715.1_ASM301371v2:0.5000001881725941,Saccharolobus_islandicus--M.16.4:0.4999993211600824):0.0000023411501775538747,Opitutus_terrae--PB90-1:0.499997075187947):0.0000029791191795691675,(Acidobacterium_capsulatum--ATCC_51196:0.49999227771334689,(Bacillus_subtilis--168:0.49988797935621456,Shouchella_clausii--KSM-K16:0.49988984146059159):0.0001037210285571577):0.0000023959836053522034):0.0000034093646568700288,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1:0.4999920159222422):0.000199555100890203,Proteus_mirabilis--HI4320:0.49979129185300427):0.00010103619067070024,Yersinia_ruckeri--YRB:0.4996806650749249):0.0013719139155004,(Klebsiella_pneumoniae--HS11286:0.43798845051648258,(Klebsiella_pneumoniae--ATCC_13883:0.41780293826821265,Klebsiella_pneumoniae--MGH_78578:0.42274184870836559):0.017586732339732737):0.0604124197073832):0.0006482538063555254,(Salmonella_enterica--CT18:0.43952894448143017,(Salmonella_enterica--AKU_12601:0.3357977326267918,(Salmonella_enterica--LT2:0.31203395843666389,Salmonella_enterica--P125109:0.31057217324861216):0.025729515856701136):0.10292985918524672):0.05825411485542886):0.08937928015651564,Escherichia_coli--CFT073:0.40806501650701029):0.0410131211869626,Escherichia_coli--EDL933:0.3681464750911808):0.1755112579711463,Escherichia_coli--K-12_MG1655:0.19129818036662728,Escherichia_coli--K-12_W3110:0.19126872019906239);
+21
View File
@@ -0,0 +1,21 @@
genome,Candidozyma_auris--GCF_003013715.1_ASM301371v2,Acidobacterium_capsulatum--ATCC_51196,Bacillus_subtilis--168,Escherichia_coli--CFT073,Escherichia_coli--EDL933,Escherichia_coli--K-12_MG1655,Escherichia_coli--K-12_W3110,Klebsiella_pneumoniae--ATCC_13883,Klebsiella_pneumoniae--HS11286,Klebsiella_pneumoniae--MGH_78578,Opitutus_terrae--PB90-1,Proteus_mirabilis--HI4320,Saccharolobus_islandicus--M.16.4,Salmonella_enterica--AKU_12601,Salmonella_enterica--CT18,Salmonella_enterica--LT2,Salmonella_enterica--P125109,Shouchella_clausii--KSM-K16,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,Yersinia_ruckeri--YRB
Candidozyma_auris--GCF_003013715.1_ASM301371v2,0,0,0,0,0,0,0,0,0,0,0,0,8,0,1,0,0,0,0,3
Acidobacterium_capsulatum--ATCC_51196,0,0,203,119,128,141,140,116,109,111,78,112,0,136,109,147,134,117,55,129
Bacillus_subtilis--168,0,203,0,124,132,128,123,133,109,130,66,158,6,131,112,124,135,2393,46,124
Escherichia_coli--CFT073,0,119,124,0,1966777,1998059,1999094,117743,32029,22312,63,4225,0,74946,31918,73311,76585,113,128,7854
Escherichia_coli--EDL933,0,128,132,1966777,0,2627885,2628700,52488,20134,22064,48,4202,0,74655,28602,71244,74665,112,108,7963
Escherichia_coli--K-12_MG1655,0,141,128,1998059,2627885,0,4452541,48302,21382,24602,47,4277,0,75729,30449,73622,76778,119,111,8566
Escherichia_coli--K-12_W3110,0,140,123,1999094,2628700,4452541,0,47894,21226,24470,68,4278,0,75658,30207,73614,76583,112,108,8660
Klebsiella_pneumoniae--ATCC_13883,0,116,133,117743,52488,48302,47894,0,1416091,1477759,42,4172,0,48296,18988,48144,50416,120,106,7712
Klebsiella_pneumoniae--HS11286,0,109,109,32029,20134,21382,21226,1416091,0,644063,42,2738,0,21498,29758,21606,21376,99,102,4417
Klebsiella_pneumoniae--MGH_78578,0,111,130,22312,22064,24602,24470,1477759,644063,0,42,2614,0,19948,35067,21330,20813,97,102,4374
Opitutus_terrae--PB90-1,0,78,66,63,48,47,68,42,42,42,0,43,18,57,42,53,66,39,58,43
Proteus_mirabilis--HI4320,0,112,158,4225,4202,4277,4278,4172,2738,2614,43,0,0,4254,2481,4166,4215,131,103,4704
Saccharolobus_islandicus--M.16.4,8,0,6,0,0,0,0,0,0,0,18,0,0,0,0,0,0,0,0,0
Salmonella_enterica--AKU_12601,0,136,131,74946,74655,75729,75658,48296,21498,19948,57,4254,0,0,1047731,2857146,2951421,117,108,7643
Salmonella_enterica--CT18,1,109,112,31918,28602,30449,30207,18988,29758,35067,42,2481,0,1047731,0,917948,940297,106,106,3716
Salmonella_enterica--LT2,0,147,124,73311,71244,73622,73614,48144,21606,21330,53,4166,0,2857146,917948,0,3284800,122,108,7460
Salmonella_enterica--P125109,0,134,135,76585,74665,76778,76583,50416,21376,20813,66,4215,0,2951421,940297,3284800,0,134,124,7645
Shouchella_clausii--KSM-K16,0,117,2393,113,112,119,112,120,99,97,39,131,0,117,106,122,134,0,58,124
Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,0,55,46,128,108,111,108,106,102,102,58,103,0,108,106,108,124,58,0,96
Yersinia_ruckeri--YRB,3,129,124,7854,7963,8566,8660,7712,4417,4374,43,4704,0,7643,3716,7460,7645,124,96,0
1 genome Candidozyma_auris--GCF_003013715.1_ASM301371v2 Acidobacterium_capsulatum--ATCC_51196 Bacillus_subtilis--168 Escherichia_coli--CFT073 Escherichia_coli--EDL933 Escherichia_coli--K-12_MG1655 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--ATCC_13883 Klebsiella_pneumoniae--HS11286 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Proteus_mirabilis--HI4320 Saccharolobus_islandicus--M.16.4 Salmonella_enterica--AKU_12601 Salmonella_enterica--CT18 Salmonella_enterica--LT2 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Yersinia_ruckeri--YRB
2 Candidozyma_auris--GCF_003013715.1_ASM301371v2 0 0 0 0 0 0 0 0 0 0 0 0 8 0 1 0 0 0 0 3
3 Acidobacterium_capsulatum--ATCC_51196 0 0 203 119 128 141 140 116 109 111 78 112 0 136 109 147 134 117 55 129
4 Bacillus_subtilis--168 0 203 0 124 132 128 123 133 109 130 66 158 6 131 112 124 135 2393 46 124
5 Escherichia_coli--CFT073 0 119 124 0 1966777 1998059 1999094 117743 32029 22312 63 4225 0 74946 31918 73311 76585 113 128 7854
6 Escherichia_coli--EDL933 0 128 132 1966777 0 2627885 2628700 52488 20134 22064 48 4202 0 74655 28602 71244 74665 112 108 7963
7 Escherichia_coli--K-12_MG1655 0 141 128 1998059 2627885 0 4452541 48302 21382 24602 47 4277 0 75729 30449 73622 76778 119 111 8566
8 Escherichia_coli--K-12_W3110 0 140 123 1999094 2628700 4452541 0 47894 21226 24470 68 4278 0 75658 30207 73614 76583 112 108 8660
9 Klebsiella_pneumoniae--ATCC_13883 0 116 133 117743 52488 48302 47894 0 1416091 1477759 42 4172 0 48296 18988 48144 50416 120 106 7712
10 Klebsiella_pneumoniae--HS11286 0 109 109 32029 20134 21382 21226 1416091 0 644063 42 2738 0 21498 29758 21606 21376 99 102 4417
11 Klebsiella_pneumoniae--MGH_78578 0 111 130 22312 22064 24602 24470 1477759 644063 0 42 2614 0 19948 35067 21330 20813 97 102 4374
12 Opitutus_terrae--PB90-1 0 78 66 63 48 47 68 42 42 42 0 43 18 57 42 53 66 39 58 43
13 Proteus_mirabilis--HI4320 0 112 158 4225 4202 4277 4278 4172 2738 2614 43 0 0 4254 2481 4166 4215 131 103 4704
14 Saccharolobus_islandicus--M.16.4 8 0 6 0 0 0 0 0 0 0 18 0 0 0 0 0 0 0 0 0
15 Salmonella_enterica--AKU_12601 0 136 131 74946 74655 75729 75658 48296 21498 19948 57 4254 0 0 1047731 2857146 2951421 117 108 7643
16 Salmonella_enterica--CT18 1 109 112 31918 28602 30449 30207 18988 29758 35067 42 2481 0 1047731 0 917948 940297 106 106 3716
17 Salmonella_enterica--LT2 0 147 124 73311 71244 73622 73614 48144 21606 21330 53 4166 0 2857146 917948 0 3284800 122 108 7460
18 Salmonella_enterica--P125109 0 134 135 76585 74665 76778 76583 50416 21376 20813 66 4215 0 2951421 940297 3284800 0 134 124 7645
19 Shouchella_clausii--KSM-K16 0 117 2393 113 112 119 112 120 99 97 39 131 0 117 106 122 134 0 58 124
20 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 0 55 46 128 108 111 108 106 102 102 58 103 0 108 106 108 124 58 0 96
21 Yersinia_ruckeri--YRB 3 129 124 7854 7963 8566 8660 7712 4417 4374 43 4704 0 7643 3716 7460 7645 124 96 0
+181
View File
@@ -0,0 +1,181 @@
#!/usr/bin/env python3
"""Compare an obikmer count index against a reference kmer set (presence + counts).
Loads the reference .npz (sorted uint64 kmers + uint32 counts from build_reference.py),
streams `obikmer dump` from a --with-counts index, then reports:
- false negatives : kmers in reference absent from the index
- false positives : kmers in the index absent from the reference
- count mismatches: kmers present in both but with differing counts
Output to stdout: one CSV row
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,
fn_pct,fp_pct,cm_pct
"""
import argparse
import subprocess
import sys
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── dump parsing ──────────────────────────────────────────────────────────────
def load_index(obikmer_bin: str, index_dir: str) -> tuple[np.ndarray, np.ndarray]:
"""Stream `obikmer dump` and return (kmers_sorted_uint64, counts_uint32)."""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
kmers, counts = [], []
header = True
for line in proc.stdout:
if header:
header = False
continue
parts = line.rstrip('\n').split(',')
kmers.append(encode_kmer(parts[0]))
counts.append(int(parts[1]))
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
order = np.argsort(np.array(kmers, dtype=np.uint64), kind='stable')
return (np.array(kmers, dtype=np.uint64)[order],
np.array(counts, dtype=np.uint32)[order])
# ── comparison ────────────────────────────────────────────────────────────────
def compare(ref_kmers: np.ndarray, ref_counts: np.ndarray,
idx_kmers: np.ndarray, idx_counts: np.ndarray,
) -> tuple[np.ndarray, np.ndarray, np.ndarray, np.ndarray, np.ndarray]:
"""Return (false_neg, false_pos, cm_ref_kmers, cm_ref_counts, cm_idx_counts).
All arrays sorted; cm_* cover kmers present in both arrays but with
differing counts.
"""
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
# Count mismatches among shared kmers.
# Both arrays are sorted so we can use searchsorted.
pos_in_idx = np.searchsorted(idx_kmers, ref_kmers)
pos_in_idx = np.clip(pos_in_idx, 0, len(idx_kmers) - 1)
shared_mask = idx_kmers[pos_in_idx] == ref_kmers
shared_ref_counts = ref_counts[shared_mask]
shared_idx_counts = idx_counts[pos_in_idx[shared_mask]]
mismatch_mask = shared_ref_counts != shared_idx_counts
cm_kmers = ref_kmers[shared_mask][mismatch_mask]
cm_ref_counts = shared_ref_counts[mismatch_mask]
cm_idx_counts = shared_idx_counts[mismatch_mask]
return false_neg, false_pos, cm_kmers, cm_ref_counts, cm_idx_counts
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('reference', metavar='REF_NPZ', nargs='?',
help='Reference .npz file')
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
help='obikmer index directory (built with --with-counts)')
ap.add_argument('--obikmer', default='obikmer',
help='Path to obikmer binary')
ap.add_argument('--species', default='')
ap.add_argument('--strain', default='')
ap.add_argument('--header', action='store_true',
help='Print CSV header and exit')
ap.add_argument('--save-fp', metavar='FILE',
help='Save false-positive kmer strings to FILE')
ap.add_argument('--save-fn', metavar='FILE',
help='Save false-negative kmer strings to FILE')
ap.add_argument('--save-cm', metavar='FILE',
help='Save count-mismatch rows (kmer,ref_count,idx_count) to FILE')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,count_mismatch,'
'fn_pct,fp_pct,cm_pct')
return
# Detect k
cmd1 = [args.obikmer, 'dump', '--head', '1', args.index]
out1 = subprocess.check_output(cmd1, stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
# Load reference
print(f'Loading reference: {args.reference}', file=sys.stderr)
npz = np.load(args.reference)
ref_kmers = npz['kmers'] # sorted uint64
ref_counts = npz['counts'] # uint32
# Load index
print(f'Streaming dump (k={k}): {args.index}', file=sys.stderr)
idx_kmers, idx_counts = load_index(args.obikmer, args.index)
print(f'k={k} ref={len(ref_kmers):,} idx={len(idx_kmers):,}', file=sys.stderr)
false_neg, false_pos, cm_kmers, cm_ref, cm_idx = compare(
ref_kmers, ref_counts, idx_kmers, idx_counts)
n_shared = len(ref_kmers) - len(false_neg)
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
cm_pct = 100.0 * len(cm_kmers) / n_shared if n_shared else 0.0
print(f'false negatives : {len(false_neg):,} ({fn_pct:.4f}%)', file=sys.stderr)
print(f'false positives : {len(false_pos):,} ({fp_pct:.4f}%)', file=sys.stderr)
print(f'count mismatches: {len(cm_kmers):,} ({cm_pct:.4f}% of shared)',
file=sys.stderr)
if args.save_fn and len(false_neg):
with open(args.save_fn, 'w') as fh:
for v in false_neg:
fh.write(decode_kmer(int(v), k) + '\n')
if args.save_fp and len(false_pos):
with open(args.save_fp, 'w') as fh:
for v in false_pos:
fh.write(decode_kmer(int(v), k) + '\n')
if args.save_cm and len(cm_kmers):
with open(args.save_cm, 'w') as fh:
fh.write('kmer,ref_count,idx_count\n')
for v, rc, ic in zip(cm_kmers, cm_ref, cm_idx):
fh.write(f'{decode_kmer(int(v), k)},{rc},{ic}\n')
print(f'{args.species},{args.strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},{len(cm_kmers)},'
f'{fn_pct:.4f},{fp_pct:.4f},{cm_pct:.4f}')
if __name__ == '__main__':
main()
+201
View File
@@ -0,0 +1,201 @@
#!/usr/bin/env python3
"""Verify the merged count index against all per-specimen reference sets.
Streams `obikmer dump` once on the merged index, accumulates per-specimen
kmer+count pairs from each column, then compares each against its reference .npz.
Output to stdout: one CSV row per specimen (same columns as verify_count.py)
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,
fn_pct,fp_pct,cm_pct
"""
import argparse
import subprocess
import sys
from pathlib import Path
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── single-pass dump ──────────────────────────────────────────────────────────
def stream_merged_dump(obikmer_bin: str, index_dir: str,
) -> tuple[list[str], dict[str, tuple[list[int], list[int]]]]:
"""Stream the merged dump once.
Returns:
specimen_names : column labels in dump order
per_specimen : mapping label → (kmer_ints, counts) for entries > 0
"""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
header_line = proc.stdout.readline().rstrip('\n')
cols = header_line.split(',')
specimen_names = cols[1:]
per_specimen: dict[str, tuple[list[int], list[int]]] = {
name: ([], []) for name in specimen_names}
for line in proc.stdout:
parts = line.rstrip('\n').split(',')
kmer_int = encode_kmer(parts[0])
for i, name in enumerate(specimen_names):
count = int(parts[i + 1])
if count > 0:
per_specimen[name][0].append(kmer_int)
per_specimen[name][1].append(count)
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
return specimen_names, per_specimen
# ── per-specimen comparison ───────────────────────────────────────────────────
def compare_specimen(name: str,
kmer_list: list[int],
count_list: list[int],
ref_dir: Path,
k: int,
save_fn: Path | None,
save_fp: Path | None,
save_cm: Path | None,
) -> str:
ref_path = ref_dir / f'{name}.npz'
if not ref_path.exists():
print(f' SKIP {name}: no reference at {ref_path}', file=sys.stderr)
return ''
species = name.split('--')[0]
strain = name[len(species) + 2:]
npz = np.load(ref_path)
ref_kmers = npz['kmers'] # sorted uint64
ref_counts = npz['counts'] # uint32
order = np.argsort(np.array(kmer_list, dtype=np.uint64), kind='stable')
idx_kmers = np.array(kmer_list, dtype=np.uint64)[order]
idx_counts = np.array(count_list, dtype=np.uint32)[order]
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
# Count mismatches among shared kmers
pos_in_idx = np.searchsorted(idx_kmers, ref_kmers)
pos_in_idx = np.clip(pos_in_idx, 0, len(idx_kmers) - 1)
shared_mask = idx_kmers[pos_in_idx] == ref_kmers
mismatch_mask = ref_counts[shared_mask] != idx_counts[pos_in_idx[shared_mask]]
cm_kmers = ref_kmers[shared_mask][mismatch_mask]
cm_ref = ref_counts[shared_mask][mismatch_mask]
cm_idx = idx_counts[pos_in_idx[shared_mask]][mismatch_mask]
n_shared = int(shared_mask.sum())
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
cm_pct = 100.0 * len(cm_kmers) / n_shared if n_shared else 0.0
print(f' {name}: ref={len(ref_kmers):,} idx={len(idx_kmers):,} '
f'fn={len(false_neg):,} ({fn_pct:.4f}%) '
f'fp={len(false_pos):,} ({fp_pct:.4f}%) '
f'cm={len(cm_kmers):,} ({cm_pct:.4f}%)',
file=sys.stderr)
if save_fn and len(false_neg):
fn_file = save_fn / f'{name}_fn.txt'
fn_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_neg) + '\n')
if save_fp and len(false_pos):
fp_file = save_fp / f'{name}_fp.txt'
fp_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_pos) + '\n')
if save_cm and len(cm_kmers):
cm_file = save_cm / f'{name}_cm.csv'
lines = ['kmer,ref_count,idx_count']
for v, rc, ic in zip(cm_kmers, cm_ref, cm_idx):
lines.append(f'{decode_kmer(int(v), k)},{rc},{ic}')
cm_file.write_text('\n'.join(lines) + '\n')
return (f'{species},{strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},{len(cm_kmers)},'
f'{fn_pct:.4f},{fp_pct:.4f},{cm_pct:.4f}')
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
help='Merged count index directory')
ap.add_argument('ref_dir', metavar='REF_DIR', nargs='?',
help='Directory containing per-specimen .npz reference files')
ap.add_argument('--obikmer', default='obikmer')
ap.add_argument('--header', action='store_true',
help='Print CSV header and exit')
ap.add_argument('--save-fn', metavar='DIR',
help='Directory for false-negative kmer lists')
ap.add_argument('--save-fp', metavar='DIR',
help='Directory for false-positive kmer lists')
ap.add_argument('--save-cm', metavar='DIR',
help='Directory for count-mismatch CSV files')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,count_mismatch,'
'fn_pct,fp_pct,cm_pct')
return
ref_dir = Path(args.ref_dir)
save_fn = Path(args.save_fn) if args.save_fn else None
save_fp = Path(args.save_fp) if args.save_fp else None
save_cm = Path(args.save_cm) if args.save_cm else None
for d in (save_fn, save_fp, save_cm):
if d: d.mkdir(parents=True, exist_ok=True)
out1 = subprocess.check_output(
[args.obikmer, 'dump', '--head', '1', args.index],
stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
print(f'k={k} streaming merged dump: {args.index}', file=sys.stderr)
specimen_names, per_specimen = stream_merged_dump(args.obikmer, args.index)
print(f'{len(specimen_names)} specimen columns loaded', file=sys.stderr)
for name in specimen_names:
kmers, counts = per_specimen[name]
row = compare_specimen(name, kmers, counts, ref_dir, k,
save_fn, save_fp, save_cm)
if row:
print(row)
if __name__ == '__main__':
main()
+27
View File
@@ -0,0 +1,27 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
INDEX="${SCRIPT_DIR}/global_index_count"
REF_DIR="${SCRIPT_DIR}/reference_index"
STATS_DIR="${SCRIPT_DIR}/stats/verify_merge_count"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_merge_count.py"
mkdir -p "${STATS_DIR}"
CURRENT="${STATS_DIR}/current.csv"
"${PYTHON}" "${VERIFY_PY}" --header >"${CURRENT}"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
"${INDEX}" "${REF_DIR}" \
>>"${CURRENT}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'count_*.csv' | wc -l | tr -d ' ')")
ARCHIVE="${STATS_DIR}/count_${run_n}.csv"
cp "${CURRENT}" "${ARCHIVE}"
echo "Done. Results → ${ARCHIVE}"
+170
View File
@@ -0,0 +1,170 @@
#!/usr/bin/env python3
"""Verify the merged presence index against all per-specimen reference sets.
Streams `obikmer dump` once on the merged index, accumulates per-specimen
kmer sets from each column, then compares each against its reference .npz.
Output to stdout: one CSV row per specimen (same columns as verify_presence.py)
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,fn_pct,fp_pct
"""
import argparse
import subprocess
import sys
from pathlib import Path
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── single-pass dump ──────────────────────────────────────────────────────────
def stream_merged_dump(obikmer_bin: str, index_dir: str,
) -> tuple[list[str], dict[str, list[int]]]:
"""Stream the merged dump once.
Returns:
specimen_names : column labels in dump order (excluding 'kmer')
per_specimen : mapping label → list of kmer ints where presence > 0
"""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
header_line = proc.stdout.readline().rstrip('\n')
cols = header_line.split(',')
specimen_names = cols[1:] # first col is 'kmer'
per_specimen: dict[str, list[int]] = {name: [] for name in specimen_names}
for line in proc.stdout:
parts = line.rstrip('\n').split(',')
kmer_int = encode_kmer(parts[0])
for i, name in enumerate(specimen_names):
if int(parts[i + 1]) > 0:
per_specimen[name].append(kmer_int)
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
return specimen_names, per_specimen
# ── per-specimen comparison ───────────────────────────────────────────────────
def compare_specimen(name: str,
kmer_list: list[int],
ref_dir: Path,
k: int,
save_fn: Path | None,
save_fp: Path | None,
) -> str:
"""Compare one specimen column against its reference .npz.
Returns a CSV row string.
"""
ref_path = ref_dir / f'{name}.npz'
if not ref_path.exists():
print(f' SKIP {name}: no reference at {ref_path}', file=sys.stderr)
return ''
species = name.split('--')[0]
strain = name[len(species) + 2:]
ref_kmers = np.load(ref_path)['kmers'] # sorted uint64
idx_kmers = np.array(sorted(kmer_list), dtype=np.uint64)
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
print(f' {name}: ref={len(ref_kmers):,} idx={len(idx_kmers):,} '
f'fn={len(false_neg):,} ({fn_pct:.4f}%) '
f'fp={len(false_pos):,} ({fp_pct:.4f}%)',
file=sys.stderr)
if save_fn and len(false_neg):
fn_file = save_fn / f'{name}_fn.txt'
fn_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_neg) + '\n')
if save_fp and len(false_pos):
fp_file = save_fp / f'{name}_fp.txt'
fp_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_pos) + '\n')
return (f'{species},{strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},'
f'{fn_pct:.4f},{fp_pct:.4f}')
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
help='Merged presence index directory')
ap.add_argument('ref_dir', metavar='REF_DIR', nargs='?',
help='Directory containing per-specimen .npz reference files')
ap.add_argument('--obikmer', default='obikmer')
ap.add_argument('--header', action='store_true',
help='Print CSV header and exit')
ap.add_argument('--save-fn', metavar='DIR',
help='Directory to save false-negative kmer lists')
ap.add_argument('--save-fp', metavar='DIR',
help='Directory to save false-positive kmer lists')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,fn_pct,fp_pct')
return
ref_dir = Path(args.ref_dir)
save_fn = Path(args.save_fn) if args.save_fn else None
save_fp = Path(args.save_fp) if args.save_fp else None
if save_fn: save_fn.mkdir(parents=True, exist_ok=True)
if save_fp: save_fp.mkdir(parents=True, exist_ok=True)
# Detect k
out1 = subprocess.check_output(
[args.obikmer, 'dump', '--head', '1', args.index],
stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
print(f'k={k} streaming merged dump: {args.index}', file=sys.stderr)
specimen_names, per_specimen = stream_merged_dump(args.obikmer, args.index)
print(f'{len(specimen_names)} specimen columns loaded', file=sys.stderr)
for name in specimen_names:
row = compare_specimen(name, per_specimen[name], ref_dir, k, save_fn, save_fp)
if row:
print(row)
if __name__ == '__main__':
main()
+27
View File
@@ -0,0 +1,27 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
INDEX="${SCRIPT_DIR}/global_index_presence"
REF_DIR="${SCRIPT_DIR}/reference_index"
STATS_DIR="${SCRIPT_DIR}/stats/verify_merge_presence"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_merge_presence.py"
mkdir -p "${STATS_DIR}"
CURRENT="${STATS_DIR}/current.csv"
"${PYTHON}" "${VERIFY_PY}" --header >"${CURRENT}"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
"${INDEX}" "${REF_DIR}" \
>>"${CURRENT}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'presence_*.csv' | wc -l | tr -d ' ')")
ARCHIVE="${STATS_DIR}/presence_${run_n}.csv"
cp "${CURRENT}" "${ARCHIVE}"
echo "Done. Results → ${ARCHIVE}"
+30
View File
@@ -0,0 +1,30 @@
#!/usr/bin/env bash
# Usage: verify_one_count.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Output: stats/verify_count/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_count.py"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
REF_NPZ="${SCRIPT_DIR}/reference_index/${SPECIMEN}.npz"
INDEX_DIR="${SCRIPT_DIR}/specimen_index_count/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/verify_count"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIMEN}] verifying count"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
--species "${species}" \
--strain "${strain}" \
"${REF_NPZ}" "${INDEX_DIR}" \
>"${STATS_FILE}"
+30
View File
@@ -0,0 +1,30 @@
#!/usr/bin/env bash
# Usage: verify_one_presence.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Output: stats/verify_presence/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_presence.py"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
REF_NPZ="${SCRIPT_DIR}/reference_index/${SPECIMEN}.npz"
INDEX_DIR="${SCRIPT_DIR}/specimen_index_presence/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/verify_presence"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIMEN}] verifying presence"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
--species "${species}" \
--strain "${strain}" \
"${REF_NPZ}" "${INDEX_DIR}" \
>"${STATS_FILE}"
+139
View File
@@ -0,0 +1,139 @@
#!/usr/bin/env python3
"""Compare an obikmer index against a reference kmer set (presence/absence).
Loads the reference .npz (sorted uint64 kmers built by build_reference.py),
streams the output of `obikmer dump`, encodes each kmer string to uint64,
then reports false negatives and false positives using numpy set operations.
Output to stdout: one CSV row
species, strain, ref_kmers, idx_kmers, false_neg, false_pos, fn_pct, fp_pct
"""
import argparse
import subprocess
import sys
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── dump parsing ──────────────────────────────────────────────────────────────
def load_index_kmers(obikmer_bin: str, index_dir: str) -> np.ndarray:
"""Stream `obikmer dump` and return a sorted uint64 array of kmer integers."""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
kmers = []
header = True
for line in proc.stdout:
if header:
header = False
continue
kmer_str = line.split(',', 1)[0]
kmers.append(encode_kmer(kmer_str))
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
arr = np.array(kmers, dtype=np.uint64)
arr.sort()
return arr
# ── comparison ────────────────────────────────────────────────────────────────
def compare(ref: np.ndarray, idx: np.ndarray) -> tuple[np.ndarray, np.ndarray]:
"""Return (false_negatives, false_positives) as uint64 arrays."""
false_neg = np.setdiff1d(ref, idx, assume_unique=True)
false_pos = np.setdiff1d(idx, ref, assume_unique=True)
return false_neg, false_pos
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('reference', metavar='REF_NPZ', nargs='?', help='Reference .npz file')
ap.add_argument('index', metavar='INDEX_DIR', nargs='?', help='obikmer index directory')
ap.add_argument('--obikmer', default='obikmer', help='Path to obikmer binary')
ap.add_argument('--species', default='', help='Species label for CSV row')
ap.add_argument('--strain', default='', help='Strain label for CSV row')
ap.add_argument('--header', action='store_true', help='Print CSV header and exit')
ap.add_argument('--save-fp', metavar='FILE',
help='Save false-positive kmer strings to FILE')
ap.add_argument('--save-fn', metavar='FILE',
help='Save false-negative kmer strings to FILE')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,fn_pct,fp_pct')
return
# Detect k from the index (one cheap call before the full dump).
cmd1 = [args.obikmer, 'dump', '--head', '1', args.index]
out1 = subprocess.check_output(cmd1, stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
# Load reference
print(f'Loading reference: {args.reference}', file=sys.stderr)
npz = np.load(args.reference)
ref_kmers = npz['kmers'] # already sorted uint64
# Load index
print(f'Streaming dump (k={k}): {args.index}', file=sys.stderr)
idx_kmers = load_index_kmers(args.obikmer, args.index)
print(f'k={k} ref={len(ref_kmers):,} idx={len(idx_kmers):,}', file=sys.stderr)
false_neg, false_pos = compare(ref_kmers, idx_kmers)
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
print(f'false negatives: {len(false_neg):,} ({fn_pct:.4f}%)', file=sys.stderr)
print(f'false positives: {len(false_pos):,} ({fp_pct:.4f}%)', file=sys.stderr)
if args.save_fn and len(false_neg):
with open(args.save_fn, 'w') as fh:
for v in false_neg:
fh.write(decode_kmer(int(v), k) + '\n')
print(f'False negatives saved → {args.save_fn}', file=sys.stderr)
if args.save_fp and len(false_pos):
with open(args.save_fp, 'w') as fh:
for v in false_pos:
fh.write(decode_kmer(int(v), k) + '\n')
print(f'False positives saved → {args.save_fp}', file=sys.stderr)
print(f'{args.species},{args.strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},'
f'{fn_pct:.4f},{fp_pct:.4f}')
if __name__ == '__main__':
main()
+272
View File
@@ -0,0 +1,272 @@
# NUMA-aware partition runner
## Problem
All partition-level parallel loops in obikindex currently fall into two
categories:
**Naive Rayon** — used in `build_layers`, `pack_matrices`, `dump`, `select`,
`stats`, `rebuild`, `reindex`:
```rust
(0..n).into_par_iter().for_each(|i| work(i));
```
Threads come from the global Rayon pool with no NUMA awareness. On
multi-socket machines this produces cross-socket memory traffic and degrades
performance super-linearly (see [NUMA-aware worker pools](numa_worker_pools.md)).
**Ad-hoc adaptive pool** — used in `merge`:
A bespoke implementation with pre-spawned workers, channel-based dispatch, and
activation control. It handles NUMA correctly but is not reusable.
Both cases should be replaced by a single generic mechanism.
## Unified model
The key insight is that **UMA is just the NUMA case with a single node**. The
runner always works the same way: one controller thread per node, each
independently managing its own workers with the same adaptive logic. The only
difference between UMA and NUMA is the number of nodes and whether workers are
pinned.
```
NUMA (k nodes) UMA (1 node)
controller-0 controller-1 … controller-0
│ │ │
workers[0] workers[1] workers[0]
(pinned) (pinned) (global pool)
└───────────────┴──────────────────┘
shared work queue
```
On each node, the Rayon `ThreadPool` is pinned to that node's CPUs.
`pool.install()` ensures all internal Rayon calls (inside the work function)
use the node-local pool. Linux first-touch then places heap allocations in
local DRAM automatically.
On UMA the global Rayon pool is used directly — no pinning, no overhead.
## Adaptive mechanism
Each controller follows the same logic regardless of node count:
1. Pre-spawn `workers_per_node` dormant worker threads (blocked on `activate_rx`).
2. Activate the first worker immediately.
3. Loop on result channel with a `SPAWN_POLL` timeout:
- On result: call `on_done`; check whether to activate the next worker.
- On timeout: same check.
- Activation criterion: `should_spawn_worker(active, global_efficiency, prev_efficiency)`.
4. Drop `activate_tx` when done — dormant workers exit cleanly.
**Global CPU efficiency** (`CpuSample`, reads `/proc/stat` on Linux) is used by
all controllers — no per-node measurement needed. The signal is coarser than
per-node efficiency but correct in practice: if any node saturates memory
bandwidth, the global efficiency drops and all controllers stop activating
workers. Using a standard portable primitive avoids platform-specific CPU
accounting and keeps the implementation clean.
## Proposed API
```rust
pub struct PartitionRunner {
// One entry per NUMA node; one entry total on UMA.
nodes: Vec<NodeConfig>,
}
struct NodeConfig {
pool: Option<Arc<rayon::ThreadPool>>, // None = global Rayon pool (UMA)
cpu_ids: Vec<usize>, // empty = no pinning (UMA)
max_workers: usize,
}
impl PartitionRunner {
/// Detect topology and build the runner.
/// Returns a single-node runner on UMA / macOS / hwloc failure.
pub fn new() -> Self;
/// Run `f(i)` for every index in `order`, collecting results.
///
/// `on_done(i, result, elapsed)` is called under an internal mutex as
/// each partition completes — use it for progress bars and aggregation.
/// The runner serialises all calls to `on_done` via an internal
/// `Arc<Mutex<C>>`, so no `Sync` bound is required on the callback.
/// `Send` is required because the Arc clone crosses thread boundaries.
///
/// Serialisation is free in practice: a partition takes seconds to
/// minutes; the callback takes microseconds. Contention is negligible.
///
/// Returns the first error from `f`, if any.
pub fn run<F, R, E, C>(
&self,
order: &[usize],
f: F,
on_done: C,
) -> Result<(), E>
where
F: Fn(usize) -> Result<R, E> + Send + Sync,
R: Send,
E: Send,
C: FnMut(usize, R, Duration) + Send; // Send required, Sync is not
}
```
`order` is caller-supplied so each command chooses its scheduling strategy:
largest-first for `merge`, sequential for `build_layers`, etc.
## Migration examples
### merge.rs (before: ~180 lines of bespoke machinery)
```rust
let runner = PartitionRunner::new();
runner.run(
&order,
|i| dst_partition.merge_partition(i, srcs, mode, n_dst_genomes, block_bits, evidence)
.map_err(OKIError::Partition),
|i, g_len, dur| {
pb.inc(1);
debug!("partition {i}: done in {:.1}s — {g_len} new kmers", dur.as_secs_f64());
part_stats.push(PartStat { id: i, unitig_bytes: partition_sizes[i], g_len });
},
)?;
```
### index.rs build_layers (before: naive into_par_iter)
```rust
let order: Vec<usize> = (0..n).collect();
let runner = PartitionRunner::new();
runner.run(
&order,
|i| self.partition.build_index_layer(i, min_ab, max_ab, with_counts, &evidence, block_bits)
.map_err(OKIError::Partition),
|_, n_kmers, _| {
total_kmers.fetch_add(n_kmers, Ordering::Relaxed);
pb.inc(1);
},
)?;
```
All other sites (`pack_matrices`, `dump`, `select`, etc.) follow the same
pattern.
## Placement
`PartitionRunner` lives in `obikindex/src/numa.rs` alongside `NumaSetup`.
It depends only on standard library primitives and Rayon — no new dependencies.
A single `PartitionRunner` instance can be built once per command invocation
and reused across multiple `run()` calls (e.g. `merge` runs
`merge_partitions` then `pack_matrices`).
## Known issue: CPU-only activation signal stalls on I/O-bound stages
Observed on a real `filter` run (109 genomes, 256 partitions, 8×24-core NUMA):
`rebuild` (CPU-bound — k-mer construction) scales cleanly from 9 to 43 active
workers as `CpuSample::do_i_activate` (`obisys::lib.rs`) sees efficiency climb.
`pack_matrices` (I/O-bound — reopens and recomposes per-genome column files
into `.pbmx`/`.pcmx`) activates one extra worker then flatlines at 10/192 for
the rest of the stage, even though 256 partitions keep completing over several
minutes. This matches the documented intent (§ Adaptive mechanism — "avoids
over-provisioning ... I/O-bound ... workloads") but conflates two different
things: *"CPU is not the bottleneck"* and *"more workers would not help"*. On
storage with real queue depth (NVMe, RAID, parallel FS) the second stage could
still benefit from more concurrent workers even with flat CPU usage — a signal
the current mechanism cannot see.
A one-off artefact was also found in the same log: right after a stage
transition, `do_i_activate` produced a physically impossible spike (efficiency
~94 cores on a 192-core box) because it has no minimum-window guard — unlike
its sibling `cpu_efficiency`, which returns `0.0` if `wall < 0.1s`
(`obisys::lib.rs:260`). `do_i_activate` unconditionally overwrites
`self.wall`/`self.user_secs`/`self.sys_secs` even when the elapsed window is
too short to be meaningful, so a burst of rapid completions right after
activating a worker can divide a real CPU delta by a near-zero wall delta.
### Implemented: I/O signal + shared debounce guard
`IoSample` (`obisys::lib.rs`, alongside `CpuSample`) is fed by
`read_bytes`/`write_bytes` from `/proc/self/io` on Linux (actual bytes
submitted to the block layer — not `rchar`/`wchar`, which also count
page-cache hits, and not `ru_inblock`/`ru_oublock`, unreliable on macOS), with
a `proc_pid_rusage(RUSAGE_INFO_V4)` fallback on macOS
(`ri_diskio_bytesread`/`ri_diskio_byteswritten`, FFI only via `libc`, no new
dependency — same pattern as the existing `getrusage` bindings). Any other
target degrades gracefully to a signal that never triggers (falls back to
CPU-only activation), same pattern as `cgroup_v2_available`.
`maybe_activate` (`numa.rs`) activates a worker if *either* signal still shows
headroom, making `PartitionRunner` adapt to whichever resource is actually the
bottleneck without per-call configuration. Both samplers are called
unconditionally — no `||` short-circuit — so neither window starves behind
whichever signal fires first:
```rust
let cpu_wants_more = cpu_sample.do_i_activate(CPU_SPAWN_THRESHOLD);
let io_wants_more = io_sample.do_i_activate(IO_SPAWN_THRESHOLD);
if cpu_wants_more || io_wants_more {
activate_tx.send(()).ok();
...
}
```
Unlike the CPU signal (an absolute delta in cores — a bounded, portable unit),
raw I/O throughput has no natural scale across devices, so `IoSample` uses a
**relative** growth threshold instead of an absolute one:
```rust
pub fn do_i_activate(&mut self, threshold: f64) -> bool {
let elapsed = self.wall.elapsed().as_secs_f64();
if elapsed < 0.1 { return false; } // state untouched — window keeps accumulating
let n = Self::read_bytes();
let rate = n.saturating_sub(self.bytes) as f64 / elapsed;
let activate = if self.previous_rate == 0.0 {
rate > 0.0 // bootstrap: any measured throughput is signal
} else {
(rate - self.previous_rate) / self.previous_rate >= threshold
};
self.bytes = n;
self.wall = Instant::now(); // reset only on a real sample
activate
}
```
The `elapsed < 0.1s → return false without mutating state` guard was also
back-ported into `CpuSample::do_i_activate` (previously missing — source of
the ~94-core artefact above) — one fix for both problems, and it removes the
need for any arbitrary I/O-rate floor: a short/noisy window is rejected
outright rather than papered over with a hardware-dependent constant.
Both spawn thresholds (`CPU_SPAWN_THRESHOLD`, `IO_SPAWN_THRESHOLD`, both `0.2`)
are defined as `const` in `PartitionRunner::run` (`numa.rs`). The I/O value is
a starting point, not a derived one — needs empirical validation against a
real `pack` run.
Starting threshold: `0.2` (20 % relative growth) for `IoSample`, same order of
magnitude as the CPU threshold's *implicit* relative sensitivity (in the
observed log, an 8→9 worker step raised efficiency by ~12 %). This is a
starting point, not a derived value — I/O throughput is lumpier than CPU time
(buffered writes flush in bursts), so it needs empirical validation against a
real `pack` run before being considered final.
## Open questions
- **Error handling**: `run` currently returns the first error; remaining errors
are dropped. A `Vec<E>` return would give complete diagnostics.
- **`workers_per_node` tuning**: currently `(cpus / 8).max(3).min(8)`, calibrated
for merge on BeeGFS. Superseded by the I/O signal above for the "more
workers would help despite flat CPU" case — a per-call override may still be
worth keeping as a manual escape hatch.
- **`on_done` ordering**: the runner serialises calls to `on_done` via an
internal `Arc<Mutex<C>>`. `Send` is required (the Arc clone crosses thread
boundaries); `Sync` is not (only one thread holds the lock at a time).
Contention is negligible because a partition takes seconds while the callback
takes microseconds. The callback is therefore simple to write (plain
`Vec::push`, plain `FnMut`) with no measurable performance cost.
+97
View File
@@ -0,0 +1,97 @@
# NUMA-aware worker pools for merge
## Problem
The merge command's bottleneck is `compute_degrees` in `obidebruinj`: a random pointer-chase over 2070 M node hash maps that saturates DRAM bandwidth. When multiple partition workers run concurrently, they contend for the shared memory bus, causing super-linear slowdown (measured: 0.016 µs/node solo → 0.95 µs/node with 45 concurrent workers, ×60 degradation).
Modern HPC nodes are multi-socket NUMA machines (observed: 2 sockets × 4 NUMA nodes × 24 cores = 192 cores). Cross-NUMA memory traffic compounds the contention:
- Full 192-core run: ~15 min/partition (×10 worse than M3 Mac)
- `taskset` restricted to 4 NUMA nodes (96 cores): ~90 s/partition
- OAR job on 1 NUMA node (24 cores): ~80 s/partition, same throughput as 96 cores
**Conclusion**: the bottleneck is memory bandwidth per NUMA node, not core count. 24 cores on one NUMA node achieve the same throughput as 96 cores across four.
## Strategy
Run N worker groups in parallel, one per NUMA node, each with its own Rayon thread pool whose threads are pinned to the NUMA node's CPUs. Linux's first-touch policy then places graph allocations on local DRAM automatically — no explicit NUMA allocator needed.
Expected throughput: N × single-NUMA throughput. On the 8-NUMA-node HPC: 8 × ~80 s = 910 min total instead of >60 min with the current single-pool approach.
## Rayon thread pool isolation
Rayon provides `ThreadPool::install(|| { ... })`: any Rayon call (`par_iter`, `current_num_threads`, etc.) inside the closure uses *that* pool exclusively. Wrapping `merge_partition` in `pool.install()` redirects all downstream Rayon calls — including those in `debruijn.rs` and `partition.rs` — without touching those crates.
```rust
// worker thread, assigned to NUMA pool `pool`
pool.install(|| {
dst_partition.merge_partition(i, srcs, mode, n_dst_genomes, block_bits, evidence)
})
```
`rayon::current_num_threads()` inside `merge_partition` will return the pool size (e.g. 24), not the global thread count — which is the right value for buffer sizing.
## Thread pinning
`ThreadPoolBuilder::spawn_handler` provides a hook executed for each thread at creation. Inside, `libc::sched_setaffinity` pins the thread to a CPU set:
```rust
let cpus: Vec<usize> = numa_node_cpus(node); // from /sys/devices/system/node/nodeN/cpulist
rayon::ThreadPoolBuilder::new()
.num_threads(cpus.len())
.spawn_handler(move |thread| {
let mut b = std::thread::Builder::new();
std::thread::Builder::new().spawn(move || {
pin_to_cpus(&cpus); // sched_setaffinity via libc
thread.run()
})?;
Ok(())
})
.build()?
```
NUMA topology is read from `/sys/devices/system/node/node*/cpulist` — no `libnuma` dependency required. If the `numa` crate is linked, `numa_available()` / `numa_run_on_node()` are an alternative.
## Memory locality
Linux allocates pages on the NUMA node of the thread that first writes them (first-touch policy). Once Rayon threads are pinned to node N, all graph data built by those threads lands on node N's DRAM. No changes to the allocator, no explicit `numa_alloc_onnode` calls.
## Adaptive spawn criterion
The current criterion uses `std::thread::available_parallelism()` (returns total cores = 192) and `max_workers = n_cores / 2`. With NUMA pools:
- `n_cores` per pool = cores per NUMA node (e.g. 24)
- `max_workers` per pool = pool size / 2 (e.g. 12)
- CPU efficiency is measured per pool, not globally
Each NUMA group runs its own independent adaptive pool. Workers are distributed across NUMA groups round-robin or by workload (partition assignment can be pre-split by NUMA group index).
## Required changes
| File | Change |
|------|--------|
| `obikindex/src/merge.rs` | Detect NUMA topology; build N `ThreadPool`s with pinned threads; assign each pre-spawned worker to a pool; wrap `merge_partition` in `pool.install()` |
| `obikindex/src/merge.rs` | Replace `available_parallelism()` with per-NUMA core count for spawn criterion |
| `obikpartitionner/src/merge_layer.rs` | No change — `merge_partition` already works inside any Rayon context |
| `obidebruinj/src/debruijn.rs` | No change — `par_iter` and `current_num_threads` are pool-context-aware |
| `obikpartitionner/src/partition.rs` | No change — same reason |
## Platform guard
NUMA pinning is Linux-only. The fallback is the current single global pool:
```rust
#[cfg(target_os = "linux")]
fn build_numa_pools() -> Option<Vec<rayon::ThreadPool>> { ... }
#[cfg(not(target_os = "linux"))]
fn build_numa_pools() -> Option<Vec<rayon::ThreadPool>> { None }
```
When `build_numa_pools()` returns `None` (macOS, UMA, or single-socket), `merge.rs` uses the existing code path unchanged.
## Open questions
- **Partition assignment**: split partitions by NUMA group up-front (static) or use a shared queue with per-group workers stealing from a common pool? Static split is simpler; stealing is better for load balance when partitions vary widely in size.
- **Intra-NUMA adaptive criterion**: with 24 cores and ~35 effective workers per NUMA node, the current marginal-gain criterion needs re-tuning or can be left as-is with per-pool `n_cores = 24`.
- **I/O**: partition data (unitig files) is on a shared filesystem. With 8 concurrent NUMA groups, I/O concurrency increases 8× — need to verify the filesystem (Lustre or local SSD) can absorb it without becoming the new bottleneck.
+105
View File
@@ -0,0 +1,105 @@
# Rebuild / filter — column-first design
## Problem with the current two-pass design
`rebuild_partition` currently makes **two full passes** over source data:
**Pass 1** — read unitigs → MPHF lookup (source) → read row (108 values) → apply filter → push kmer into `GraphDeBruijn`, **discard row**.
**Pass 2** — read unitigs again → MPHF lookup again → read row again → for each passing kmer, look up slot in new MPHF → fill column builders.
Both passes do random access into the source matrix: for each kmer, the MPHF returns a slot, then we read 108 values scattered across 108 column positions. This is cache-hostile even with a packed matrix (`.pbmx`), because the matrix is column-major: consecutive row reads jump across the file.
## Memory budget
The `keep` bitvector costs **1 bit per slot**. With 256 partitions and realistic kmer counts, each partition holds at most a few tens of millions of slots → a few MB per bitvector. Even in the absolute worst case (800 M slots), it stays under 100 MB. This is negligible.
The `slot_map` option (Option B, 816 bytes per slot) is heavier but still bounded: at 15 M slots and 8 bytes, that is 120 MB per partition, acceptable for a single worker.
## Key observation
**The filter operates on column values, not on kmers.** A filter like `--max-outgroup-count 0` only needs to know, for each slot, whether any outgroup column is non-zero. It does not need to know which kmer occupies that slot.
This means filtering can be done as a **sequential column scan** that produces a `keep: BitVec[n_slots]` — no MPHF lookups, no kmer knowledge, perfectly cache-friendly.
## Proposed single-scan design
### Step 1 — column scan → `keep` bitvector
```
for each column c in source matrix:
read column c sequentially (one mmap range)
update keep[slot] according to filter contribution of column c
```
For `GroupQuorumFilter` with ingroup/outgroup:
- ingroup columns: count presence per slot → `ingroup_count[slot]`
- outgroup columns: `keep[slot] &= (value[slot] == 0)` (early-exit possible)
Result: `keep: BitVec` of size `n_slots`, computed with purely sequential IO.
### Step 2 — unitig scan → kept kmers + new MPHF
```
for each kmer in unitig files:
old_slot = old_MPHF(kmer)
if keep[old_slot]:
push kmer into new GraphDeBruijn
record (old_slot, kmer) ← or just old_slot in order
```
Build new MPHF from `GraphDeBruijn` via `materialize_layer`.
### Step 3 — fill new matrix
Two sub-options:
**Option A — from recorded (old_slot, kmer) pairs:**
```
for each (old_slot, kmer) in recorded list:
new_slot = new_MPHF(kmer)
for each column c:
new_matrix[new_slot, c] = old_matrix[old_slot, c]
```
Memory cost: `n_kept × (8 + 8)` bytes for `(old_slot: usize, kmer: CanonicalKmer)`.
For species-specific filters, `n_kept` is small. For unfiltered rebuild, `n_kept = n_slots`.
**Option B — column-by-column copy using old→new slot mapping:**
Precompute `slot_map: Vec<Option<usize>>` of size `n_slots`:
- For each kmer in unitig file: `slot_map[old_MPHF(kmer)] = Some(new_MPHF(kmer))`
Then for each source column:
```
read source column sequentially
for each slot where slot_map[slot] = Some(new_slot):
write value to new column at new_slot
```
Memory cost: `n_slots × sizeof(usize)` for the slot map (one usize per source slot).
IO pattern: sequential read of each source column → random write into new column builders.
Option B avoids storing kmer values and works uniformly regardless of filter selectivity.
## Comparison
| | Current | Proposed |
|---|---|---|
| Disk reads | 2× unitigs + 2× random matrix | 1× columns (sequential) + 1× unitigs |
| MPHF lookups (source) | 2× N_kmers | 1× N_kept (step 2) or 0 (option B, col scan only) |
| Cache behavior | poor (random row access) | good (sequential column scan) |
| Extra memory | none | slot_map (option B) or (old_slot, kmer) list (option A) |
## Files to modify
- `src/obikpartitionner/src/rebuild_layer.rs``rebuild_partition` and `iter_src_layers`
- Possibly `src/obicompactvec/` — add column iterator API if not already present
- `src/obilayeredmap/` — check if per-column sequential access is exposed on `SrcLayerData`
## Open questions
- Does `SrcLayerData` expose per-column sequential iteration, or only `lookup(kmer, n_genomes)` random access?
- For option B: are new column builders writable in random-slot order (i.e. `set_val(slot, value)` without sequential constraint)?
- For `GroupQuorumFilter` specifically: can the filter be decomposed into independent per-column contributions, or does it need the full row?
+279
View File
@@ -0,0 +1,279 @@
# Kmer filtering and ingroup/outgroup predicates
The `filter`, `dump`, and `unitig` commands share the same filtering system,
implemented as a shared `FilterArgs` clap argument group embedded in each command
via `#[command(flatten)]`. Filters select k-mers based on per-genome quorum
counts, optionally restricted to **ingroup** and **outgroup** genome sets derived
from genome metadata. All rules described here apply identically to all three commands.
`filter` additionally accepts `--min-total-count` / `--max-total-count` filters
that operate on the sum of counts across all genomes.
## Predicate syntax
Each `--ingroup` and `--outgroup` flag takes a predicate of the form:
```
key OP value1|value2|…
```
| Operator | Meaning |
|----------|---------|
| `*` or `all` | wildcard — every genome matches unconditionally |
| `key=v1\|v2` | exact match — genome's `key` equals `v1` or `v2` |
| `key!=v` | negation — genome's `key` equals none of the values |
| `key~path` | path ancestry — genome's `key` is `path` or a descendant |
| `key!~path` | not a descendant |
Multiple values separated by `|` are always OR-ed within the predicate.
### Path matching (`~` and `!~`)
Metadata values can represent hierarchical concept paths such as
`/Eukaryota/Viridiplantae/Streptophyta/Betulaceae/Betula/nana`.
Stored taxonomy values always start with `/` (the root of the path).
Query patterns do **not** need to start with `/` — a leading `/` is an optional
start anchor, not a requirement.
| Pattern form | Semantics |
|---|---|
| `A/B` | contiguous sub-path A then B, anywhere in the value |
| `/A/B` | value starts with A then B |
| `A/B$` | value ends with A then B |
| `/A/B$` | value is exactly A then B |
| `A@x/B` | A with class `x` followed by B with any class |
- `taxon~/Betulaceae/Betula` matches any path that starts with `Betulaceae` then `Betula`.
- `taxon~Betula` matches any path containing `Betula` as a segment, anywhere.
### Missing metadata key → NA
If a genome does not carry the queried metadata key, the predicate returns **NA**.
NA propagates through the group evaluation logic (see below), and genomes that
cannot be classified are **ignored** in all quorum counts.
## Group semantics
### Multiple predicates
| Flag | Combination rule |
|------|-----------------|
| `--ingroup` (repeated) | **AND** — genome must satisfy all predicates |
| `--outgroup` (repeated) | **OR** — genome satisfies any predicate |
### Three-value logic
Each predicate returns `true`, `false`, or `NA` (absent key).
- AND: `false` absorbs everything; `NA` propagates unless already `false`.
- OR: `true` absorbs everything; `NA` propagates unless already `true`.
### Classification and priority
For each genome:
1. Evaluate `AND(ingroup predicates)``in_result`
2. Evaluate `OR(outgroup predicates)``out_result`
3. If `in_result = true`**Ingroup** (ingroup wins over outgroup)
4. Else if `out_result = true`**Outgroup**
5. Otherwise → **Uncategorized** (ignored in all quorum counts)
### Implicit groups
| `--ingroup` | `--outgroup` | Effective behaviour |
|-------------|--------------|---------------------|
| not set | not set | all genomes form the ingroup |
| set | not set | only ingroup quorum flags apply |
| not set | set | only outgroup quorum flags apply |
| set | set | both constraints apply simultaneously |
## Quorum flags
| Flag | Applies to | Meaning |
|------|-----------|---------|
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes |
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes |
| `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes |
| `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes |
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes |
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes |
| `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes |
| `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes |
| `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`filter` only) |
| `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`filter` only) |
| `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) |
**Conditional defaults** — the defaults for `--min-frac` and `--max-outgroup-count` depend on two conditions:
whether the corresponding group was declared, **and** whether any quorum flag for that group was explicitly set.
> **Rule**: declaring a group activates the smart default **only if no quorum flag for that group is explicitly set**.
> As soon as any quorum flag for a group is present on the command line, all defaults for that group revert to no-op values.
| `--ingroup` | Any ingroup quorum flag? | `--min-frac` default |
|-------------|--------------------------|----------------------|
| not set | — | 0.0 (no-op) |
| set | no | **1.0** — all ingroup genomes must carry the k-mer |
| set | yes | 0.0 — user controls quorum explicitly |
| `--outgroup` | Any outgroup quorum flag? | `--max-outgroup-count` default |
|--------------|---------------------------|-------------------------------|
| not set | — | outgroup size (no-op) |
| set | no | **0** — no outgroup genome may carry the k-mer |
| set | yes | outgroup size — user controls quorum explicitly |
"Any ingroup quorum flag" means any of: `--min-count`, `--max-count`, `--min-frac`, `--max-frac`.
"Any outgroup quorum flag" means any of: `--min-outgroup-count`, `--max-outgroup-count`, `--min-outgroup-frac`, `--max-outgroup-frac`.
**Why this rule?** Setting any quorum flag signals explicit intent — the defaults are there to help when the user omits quorum entirely, not to interfere with deliberate constraints. Mixing implicit and explicit quorum on the same group would risk silent incoherence (e.g. `--max-count 0` with an implicit `--min-frac 1.0`).
All other bounds default to 0 / group size / 0.0 / 1.0 regardless of whether groups are declared.
### Validation
After resolving defaults, the following are checked and cause an immediate error:
| Condition | Error |
|-----------|-------|
| `--min-count > --max-count` | incoherent bounds |
| `--min-frac > --max-frac` | incoherent bounds |
| `--min-outgroup-count > --max-outgroup-count` | incoherent bounds |
| `--min-outgroup-frac > --max-outgroup-frac` | incoherent bounds |
| any fraction outside `[0.0, 1.0]` | invalid value |
The check applies to the **effective** values (after defaults are resolved), so an explicit `--max-frac 0.5` with an implicit `--min-frac 1.0` would have been caught — but the rule above prevents that situation from arising in the first place.
Fractions are computed over the size of the classified group, not over total
genome count. An empty group (no genome classified as ingroup/outgroup) never
triggers a filter failure.
### Conservative rounding of fraction thresholds
When a fraction threshold `F` is applied to a group of size `N`, the effective
integer threshold is determined by the direction of the bound:
| Bound | Effective count | Rounding | Rationale |
|-------|----------------|----------|-----------|
| `--min-frac F` | k-mer in ≥ ⌈F·N⌉ genomes | **ceil** | stricter — a kmer present in exactly ⌊F·N⌋ genomes does not meet the fraction |
| `--max-frac F` | k-mer in ≤ ⌊F·N⌋ genomes | **floor** | stricter — a kmer present in ⌈F·N⌉ genomes already exceeds the fraction |
The same rule applies symmetrically to `--min-outgroup-frac` (ceil) and
`--max-outgroup-frac` (floor). The outgroup direction is not inverted: the
conservative rounding depends only on whether the bound is a minimum or a
maximum, not on which group it applies to.
**Example**`--min-frac 0.5` with an ingroup of 3 genomes:
`⌈0.5 × 3⌉ = ⌈1.5⌉ = 2` → at least 2 of 3 ingroup genomes must carry the k-mer.
**Implementation note** — the filter evaluates `n / denom < min_frac` directly
(integer `n`, float comparison) rather than pre-computing `⌈F·N⌉`. This is
mathematically equivalent for integer counts: `n / N < F``n < F·N`
`n ≤ ⌈F·N⌉ 1``n < ⌈F·N⌉`. No explicit rounding is needed.
## Examples
Keep k-mers specific to *Betula nana* — present in at least 2 *B. nana* genomes
and absent from every other genome in the index:
```sh
obikmer filter src --output dst \
--ingroup "species=Betula_nana" \
--outgroup "*" \
--min-count 2 \
--max-outgroup-count 0
```
Keep k-mers found in at least 2 *Betula nana* genomes and absent from all
other *Betula*:
```sh
obikmer filter src --output dst \
--ingroup "species=Betula_nana" \
--outgroup "genus=Betula" \
--min-count 2 \
--max-outgroup-count 0
```
Use taxonomic paths — keep k-mers present in ≥ 50 % of the *Betula* clade
and in fewer than 10 % of everything outside *Betulaceae*:
```sh
obikmer filter src --output dst \
--ingroup "taxon~/Betulaceae/Betula" \
--outgroup "taxon!~/Betulaceae" \
--min-frac 0.5 \
--max-outgroup-frac 0.1
```
Multiple outgroup predicates (OR): exclude k-mers present in *Alnus* or *Carpinus*:
```sh
obikmer filter src --output dst \
--ingroup "genus=Betula" \
--outgroup "genus=Alnus" \
--outgroup "genus=Carpinus" \
--max-outgroup-count 0
```
To dump only k-mers specific to *Betula nana*:
```sh
obikmer dump myindex \
--ingroup "species=Betula_nana" \
--outgroup "*" \
--min-count 1 \
--max-outgroup-count 0
```
To enumerate unitigs of the *Betula*-specific subgraph:
```sh
obikmer unitig myindex \
--ingroup "genus=Betula" \
--outgroup "*" \
--min-count 2 \
--max-outgroup-count 0
```
## Command-specific options
### `dump --head N`
Stops output after the first N k-mers that pass all active filters.
Iteration terminates immediately — subsequent partitions and layers are not scanned.
Useful for quick inspection of large indexes without loading the entire dataset.
```sh
obikmer dump myindex --head 100
obikmer dump myindex --head 20 --ingroup "species=Betula_nana" --min-count 1
```
### `distance --presence-threshold N`
When computing Jaccard distance on a **count index**, a k-mer is considered present in a genome if its count is ≥ N (default 1).
This option is independent of the `--presence-threshold` used in filtering.
```sh
# Jaccard treating kmers with count ≥ 2 as present
obikmer distance myindex --metric jaccard --presence-threshold 2
```
This parameter has no effect on presence/absence indexes (where values are already 0/1) or on metrics other than Jaccard.
## Implementation
- **`obikpartitionner::filter::GroupQuorumFilter`** — implements `KmerFilter`
using pre-computed ingroup and outgroup index vectors. The heavy logic
(predicate parsing, three-value evaluation, genome classification) happens
once before any iteration; each k-mer row evaluation is a simple index
lookup and counter.
- **`obikmer::cmd::predicate::FilterArgs`** — shared `clap` argument group
embedded via `#[command(flatten)]` in `FilterArgs`, `DumpArgs`, and
`UnitigArgs`. `FilterArgs::build_filters()` returns a ready-to-use filter
list.
- **`obikpartitionner::KmerPartition::iter_partition_kmers`** — accepts
`filters: &[Box<dyn KmerFilter>]` and applies them per-kmer before invoking
the callback. `filter`, `dump`, and `unitig` all go through this single
entry point.
+207
View File
@@ -0,0 +1,207 @@
# Merge parallelism and memory pressure
## Problem observed
Running `obikmer merge` over 109 indexes (108 sources + 1 bootstrap) on a 192-core machine
produces a fatal OOM during the `merge_partitions` stage:
```
memory allocation of 9126805520 bytes failed
```
A single allocation of ~8.5 GB fails. This is not an aggregate; it is one `malloc` call
from hashbrown during a HashMap resize.
---
## Root cause
### The merge pipeline per partition
```
source unitigs.bin
→ iter_indexed_canonical_kmers()
→ GraphDeBruijn::push() ← HashSet<u64> + 1 byte flags, all in RAM
→ compute_degrees_and_mark_starts()
→ try_for_each_unitig()
→ unitigs.bin (new layer)
→ Layer::build() → MPHF + evidence
```
`GraphDeBruijn` is a `FastHashMap<CanonicalKmer, AtomicU8>` — a `HashSet<u64>` with
one flag byte per node. Neighbor lookup is implicit: 4 probes into the same map.
No edges are stored. The full kmer set of one partition must reside in RAM
simultaneously to compute degrees and mark unitig starts.
The matrix builders that follow (pass 2) are mmapped files — they do **not** consume
significant RAM. The pressure is entirely in pass 1.
### Unbounded Rayon parallelism
With 192 cores, Rayon ran up to 192 partitions concurrently. Each partition built its
own `GraphDeBruijn` accumulating all kmers absent from the destination. Peak memory =
192 × peak_partition_hashset.
### The 8.5 GB single allocation
hashbrown allocates the entire backing array in one call when rehashing.
At load factor 7/8: `capacity × (sizeof(K,V) + 1 control byte)`.
For `(u64, AtomicU8)` with alignment: ~16 bytes per slot.
```
9 127 MB / 16 bytes ≈ 570 M slots → ~380 M new kmers in one partition
```
Plausible for the largest partition of 108 Salix/Betula sources (~450 Mbp each).
---
## Partition size distribution
`obikmer utils --partition-stats` measures the sum of `unitigs.bin` file sizes
per partition across all source indexes (pure `stat()` syscalls, negligible cost).
Observed on a 9-genome pilot (256 partitions):
| Stat | Value |
|---|---|
| min | 30.5 MB |
| max | 232.1 MB |
| mean | 40.1 MB |
| median | 37.2 MB |
| p95 | 47.1 MB |
| max/median ratio | 6.23× |
The distribution is **bimodal with a heavy tail**:
- 238/256 partitions in a narrow 3050 MB band
- 4 structurally extreme partitions (36× the median): 221, 233, 135, 191
These correspond to minimizers over-represented in repetitive regions shared across
all sources. They are extreme in every run on this dataset.
With 109 sources, outlier partitions do not scale linearly: only kmers **absent from
the destination** enter the GraphDeBruijn, and inter-source overlap is high for closely
related species. Partition 221 is the likely trigger for the 8.5 GB crash.
---
## Solution: LFD scheduling + memory budget semaphore
### Principle
Pre-sort partitions by **decreasing estimated size** (First Fit Decreasing — FFD),
then schedule them through a **continuous memory budget semaphore**. Each worker
acquires an estimated cost before starting and releases it on completion.
Large partitions run first when the full budget is available; small partitions fill
the gaps. No hard outlier threshold is needed.
### `MemoryBudget` (`obisys`)
```rust
pub struct MemoryBudget { }
impl MemoryBudget {
pub fn new(total: u64) -> Self;
pub fn acquire(&self, cost: u64); // blocks until budget available
pub fn release(&self, cost: u64);
pub fn peak_active(&self) -> usize;
}
```
Non-deadlock guarantee: when `active == 0`, acquire always succeeds regardless of cost.
Without this, a partition whose estimated cost exceeds the total budget would block forever.
### Adaptive expansion factor
The expansion factor converts raw `unitigs.bin` bytes into an estimated GraphDeBruijn
RAM footprint. hashbrown stores each kmer as `(u64, AtomicU8)` ≈ 16 bytes/kmer at 7/8
load factor; unitig files encode ≈ 2 bits/base. The ratio depends on average unitig
length (short unitigs: ~2×; long unitigs: up to ~50×).
**Phase 1 — sequential pilot (worst partition)**
The largest partition runs alone first. Its actual `g.len()` seeds the expansion factor
before any parallel job starts. `FALLBACK_EXPANSION = 4×` is used only for empty partitions.
```rust
let worst_g_len = dst_partition.merge_partition(worst_id, )?;
// ↑ now returns SKResult<usize> (was SKResult<()>)
let seed_expansion = worst_g_len as u64 * 16 * 1000 / worst_bytes;
let max_expansion = AtomicU64::new(seed_expansion);
```
**Phase 2 — parallel with adaptive updates**
```rust
order[1..].into_par_iter().for_each(|&i| {
let cost = partition_sizes[i] * max_expansion.load(Relaxed) / 1000;
budget.acquire(cost);
let g_len = dst_partition.merge_partition(i, )?;
budget.release(cost); // releases estimated cost, not actual
let actual = g_len as u64 * 16 * 1000 / partition_sizes[i];
max_expansion.fetch_max(actual, Relaxed); // always pessimistic (max)
});
```
`budget.release(cost)` uses the estimated cost, not the actual one. The budget tracks
reservations, not physical RAM; each partition pays what it promised at acquisition.
**On the safety margin**
There is no separate multiplier `k`. It is redundant with `budget_fraction`: both
reduce effective concurrency by the same amount. A single parameter is easier to
calibrate. `budget_fraction = 0.5` (default) reserves half of available RAM for the
OS, MPHF build, pass 2, and estimation error.
`--budget-fraction` is exposed as a CLI flag — the only escape hatch for pathological
cases (extreme repetitive content, unusually long unitigs) that still cause OOM.
### RAM source
`obisys::available_memory_bytes()` — wraps `sysinfo::System::available_memory()`,
falls back to `total / 2` on macOS when the memory compressor returns 0.
---
## Diagnostic report
After the parallel phase, `merge_partition` emits a structured report via `tracing::info!`:
```
─── merge_partitions memory report ───
available RAM : 512.0 GB budget 50% = 256.0 GB
expansion factor — seed: 4.2× final max: 6.1× (mean: 1.8× median: 1.6×)
peak concurrent workers: 42
expansion factor distribution (256 partitions with data):
0.50× – 1.25× │██████████████████████████████ 148
1.25× – 2.00× │████████████████████████ 82
5.50× 6.25× │█ 2
top partitions by actual expansion factor:
partition 221 : 6.10× (232.1 MB unitigs → 48M kmers, reserved at 4.20×)
partition 135 : 5.82× (127.3 MB unitigs → 24M kmers, reserved at 4.20×)
──────────────────────────────────────
```
Fields useful for diagnosis:
| Field | Interpretation |
|---|---|
| `seed` vs `final max` expansion | gap indicates partitions with higher expansion than the worst-by-size |
| `reserved at X×` | the factor used at acquisition; if much lower than actual, the budget was under-reserved for that partition |
| `peak concurrent workers` | effective parallelism achieved under the budget constraint |
| `mean` / `median` expansion | typical dataset characteristic; stable across runs on the same data |
---
## Parameters
| Parameter | Default | CLI flag | Notes |
|---|---|---|---|
| `fallback_expansion` | 4× | — | seed for empty partitions only |
| `budget_fraction` | 0.5 | `--budget-fraction` | reduce if OOM persists |
| RAM source | `obisys::available_memory_bytes()` | — | falls back to `total/2` on macOS |
+520
View File
@@ -0,0 +1,520 @@
# obicompactvec — Complete Reference
## Module structure
```
src/obicompactvec/src/
lib.rs public re-exports
views.rs BitSliceView<'a>, IntSliceView<'a> — zero-copy read views
traits.rs ColumnWeights, CountPartials, BitPartials (matrix aggregation)
bitvec.rs PersistentBitVec, PersistentBitVecBuilder, BitIter
reader.rs PersistentCompactIntVec (read-only)
builder.rs PersistentCompactIntVecBuilder (read-write)
tempintvec.rs TempCompactIntVec, TempCompactIntVecBuilder (temp-file-backed)
tempbitvec.rs TempBitVec, TempBitVecBuilder (temp-file-backed)
bitmatrix.rs PersistentBitMatrix, PersistentBitMatrixBuilder
intmatrix.rs PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder
colgroup.rs ColGroup, MatrixGroupOps trait
format.rs file format constants, encode/decode helpers
layer_meta.rs LayerMeta (column metadata)
meta.rs matrix metadata
```
```mermaid
graph TD
views --> bitvec
views --> builder
views --> tempbitvec
views --> tempintvec
views --> bitmatrix
views --> intmatrix
format --> reader
format --> builder
reader --> intmatrix
reader --> tempintvec
builder --> intmatrix
builder --> tempintvec
bitvec --> tempbitvec
bitvec --> bitmatrix
tempintvec --> intmatrix
tempintvec --> bitmatrix
tempbitvec --> intmatrix
tempbitvec --> bitmatrix
colgroup --> intmatrix
colgroup --> bitmatrix
layer_meta --> bitmatrix
layer_meta --> intmatrix
meta --> bitmatrix
meta --> intmatrix
```
---
## Compact int encoding
All integer vectors use the same two-tier encoding regardless of storage backend.
**Primary array** — one `u8` per slot:
- Values **0254** are stored directly. No overhead.
- Value **255 is a sentinel**: the slot's actual value is ≥ 255 and lives in the overflow store.
**Overflow store** — maps slot index to a `u32` value ≥ 255:
- In `PersistentCompactIntVecBuilder`: a `HashMap<usize, u32>` in RAM.
- In `PersistentCompactIntVec` (reader): a sorted `[(slot: u64, value: u32)]` array in the mmap, with a sparse L1-resident index for binary search.
```mermaid
flowchart LR
slot --> P["primary[slot]: u8"]
P -->|"< 255"| V["value = byte (0254)"]
P -->|"= 255 sentinel"| OV["overflow store"]
OV -->|"Builder"| HM["HashMap&lt;usize, u32&gt;\nin RAM"]
OV -->|"PersistentCompactIntVec"| SA["sorted [(slot,value)] in mmap\n+ sparse L1 index"]
```
**Key property — sentinel 255 = +∞ on `u8`:**
- `min(a, 255) = a` for all `a ≤ 254` → correct when only one side is overflow
- `max(a, 255) = 255` → correct sentinel when either side is overflow
- Only the **both-overflow** case requires reading actual values from the overflow store.
In practice, k (overflow count) ≪ n (total slots). Observed genomic data: ~0.07% of kmer slots are in overflow.
---
## View types
The previous trait hierarchy (`BitSlice`, `BitSliceMut`, `IntSlice`, `IntSliceMut`) has been replaced by two concrete zero-copy view structs with inherent methods. Views are **`Copy`** — passing them is free. All read operations live on these two types.
### `BitSliceView<'a>`
```rust
#[derive(Clone, Copy)]
pub struct BitSliceView<'a> { pub(crate) words: &'a [u64], pub(crate) n: usize }
```
Bit `i` is at `words[i >> 6]` bit `i & 63` (LSB-first). Padding bits in the last word are zero.
| Method | Cost |
|---|---|
| `len()`, `is_empty()` | O(1) |
| `get(slot)` | O(1) |
| `count_ones()` | POPCNT per word, O(n/64) |
| `count_zeros()` | `n count_ones()`, O(n/64) |
| `iter() -> BitSliceIter<'a>` | O(1) setup, O(n) iteration |
| `partial_jaccard_dist(other: BitSliceView)` | `(a&b).popcount`, `(a\|b).popcount` per word, O(n/64) |
| `jaccard_dist(other: BitSliceView)` | from partial, O(n/64) |
| `hamming_dist(other: BitSliceView)` | `(a^b).popcount` per word, O(n/64) |
`BitSliceIter<'a>`: word-level scan; one word per 64 iterations.
### `IntSliceView<'a>`
```rust
#[derive(Clone, Copy)]
pub struct IntSliceView<'a> {
pub(crate) primary: &'a [u8],
pub(crate) overflow_raw: &'a [u8], // sorted [(slot:u64, value:u32)] entries
pub(crate) n_overflow: usize,
pub(crate) n: usize,
}
```
`overflow_raw` contains `n_overflow` entries of `OVERFLOW_ENTRY_SIZE` bytes each, sorted by slot. The sort invariant is established at `close()`/`freeze()` time.
| Method | Cost |
|---|---|
| `len()`, `is_empty()` | O(1) |
| `primary_bytes()` | O(1) |
| `overflow_entries() -> impl Iterator<(usize,u32)>` | O(n_overflow) iteration |
| `get(slot)` | O(1) primary; binary search O(log k) for overflow slots |
| `iter() -> IntSliceViewIter<'a>` | merge scan, O(n + k) |
| `sum()` | byte scan + overflow, O(n + k) |
| `count_nonzero()` | byte scan, O(n) |
| Distance methods (`bray_dist`, `euclidean_dist`, `jaccard_dist`, …) | O(n + k) |
`IntSliceViewIter<'a>`: merge scan using `overflow_pos` index. Requires sorted overflow — guaranteed by the construction lifecycle.
**Builder `view()` vs reader `view()`:** `PersistentCompactIntVecBuilder` stores overflow as an unsorted `HashMap`, not raw bytes. Its `view()` returns an `IntSliceView` with `overflow_raw = &[]` and `n_overflow = 0`. This is intentional — the view is primarily useful after `freeze()`. During building, callers that need overflow use `overflow_entries()` directly.
---
## Concrete types
```mermaid
classDiagram
class BitSliceView {
+words: &[u64]
+n: usize
+get(slot) bool
+count_ones() u64
+iter() BitSliceIter
+jaccard_dist/hamming_dist(other: BitSliceView)
}
class IntSliceView {
+primary: &[u8]
+overflow_raw: &[u8]
+n_overflow: usize
+n: usize
+get(slot) u32
+iter() IntSliceViewIter
+overflow_entries() Iterator
+bray_dist/euclidean_dist/…(other: IntSliceView)
}
class PersistentBitVec {
-mmap: Mmap
-n: usize
+view() BitSliceView
+get(slot) bool
+count_ones/zeros() u64
+iter() BitIter
+partial_jaccard_dist(&Self) (u64,u64)
+jaccard_dist/hamming_dist(&Self) …
}
class PersistentBitVecBuilder {
-mmap: MmapMut
-n: usize
+view() BitSliceView
+set(slot, bool)
+or/and/xor/not(BitSliceView)
+copy_from(BitSliceView)
+close() / finish() → PersistentBitVec
}
class PersistentCompactIntVec {
-mmap: Mmap
-n: usize
-n_overflow: usize
-step: usize
-index: Vec~(usize,usize)~
+view() IntSliceView
+get(slot) u32
+iter() Iter
+sum/count_nonzero() u64
+bray_dist/euclidean_dist/… (&Self)
}
class PersistentCompactIntVecBuilder {
-mmap: MmapMut
-n: usize
-overflow: HashMap~usize,u32~
+view() IntSliceView
+set(slot, u32) / get(slot) u32
+inc / inc_present / inc_present_fast
+inc_predicate / inc_predicate_fast
+add/min/max/diff/mask_with(…View)
+primary_bytes/primary_bytes_mut()
+close() / finish() → PersistentCompactIntVec
}
PersistentBitVec --> BitSliceView : view()
PersistentBitVecBuilder --> BitSliceView : view()
PersistentCompactIntVec --> IntSliceView : view()
PersistentCompactIntVecBuilder --> IntSliceView : view() (primary only)
PersistentBitVecBuilder --> PersistentBitVec : close() then open()
PersistentCompactIntVecBuilder --> PersistentCompactIntVec : close() then open()
```
### `PersistentBitVec` / `PersistentBitVecBuilder`
`PersistentBitVec` is the read-only type. `view()` returns a `BitSliceView<'_>` over the mmap word array. Direct inherent methods delegate to the view: `count_ones()`, `count_zeros()`, `partial_jaccard_dist(&Self)`, `jaccard_dist(&Self)`, `hamming_dist(&Self)`.
`BitIter<'a>` — exported iterator for `PersistentBitVec::iter()`:
```rust
pub struct BitIter<'a> { pub(crate) words: &'a [u64], pub(crate) slot: usize, pub(crate) n: usize }
```
`PersistentBitVecBuilder` is the read-write type. Mutation operations accept `BitSliceView<'_>`:
| Method | Cost |
|---|---|
| `set(slot, bool)` | O(1) |
| `view() -> BitSliceView<'_>` | O(1) |
| `or/and/xor(BitSliceView)` | word-level, O(n/64), SIMD-friendly |
| `not()` | `w ^= u64::MAX` per word, re-masks last word | O(n/64) |
| `copy_from(BitSliceView)` | `copy_from_slice` | O(n/64) |
### `PersistentCompactIntVec` / `PersistentCompactIntVecBuilder`
`PersistentCompactIntVec` is the read-only type. `view()` returns an `IntSliceView<'_>` over the mmap primary and overflow arrays. Inherent `iter()` is a merge scan (`Iter` struct). Inherent `sum()` and `count_nonzero()` use fast byte-scan helpers.
`PersistentCompactIntVecBuilder` is the read-write type. Mutation methods on the builder fall into two categories:
**Point mutations:**
| Method | Note |
|---|---|
| `set(slot, u32)` | writes primary[slot] or 255+overflow |
| `get(slot) -> u32` | reads primary byte or HashMap |
| `inc(slot)` | `get` + `set`, O(1) |
**Bulk computation methods** — accept view arguments:
| Method | Semantics | Overflow |
|---|---|---|
| `inc_present(BitSliceView)` | `+= 1` at each 1-bit | via `inc`, safe for any group size |
| `inc_present_fast(BitSliceView)` | same, raw u8 `+= 1` | `debug_assert` no 255 reached |
| `inc_predicate(IntSliceView, pred)` | `+= 1` where `pred(col[s])` | two-pass, safe |
| `inc_predicate_fast(IntSliceView, pred)` | same, raw u8 | `debug_assert` no 255 reached |
| `add(IntSliceView)` | `self[s] += other[s]` | primary fast path + overflow fallback |
| `min(IntSliceView)` | byte min + both-overflow fixup | see algorithm below |
| `max(IntSliceView)` | pre-pass + byte max | see algorithm below |
| `diff(IntSliceView)` | saturating sub | self<255 hot path |
| `mask_with(BitSliceView)` | zeros slots where mask bit = 0 | O(n_zeros) |
**`inc_present_fast` / `inc_predicate_fast` invariant:** caller guarantees no counter reaches 255 during the operation (group size < 255 for `inc_present_fast`, or chunk size < 255 for `inc_predicate_fast`). Violation is caught by `debug_assert` in dev builds.
**`min` algorithm:**
Exploits 255 = +∞: byte-level min is correct unless both sides are overflow.
```
snapshot self_ov: Vec<(slot,val)>
snapshot other_ov: HashMap<slot,val>
clear_overflow()
Pass 1 — byte min, SIMD-vectorizable, O(n)
Pass 2 — both-overflow fixup, O(k_self):
for (slot, self_val) in self_ov:
if slot ∈ other_ov: set(slot, min(self_val, other_ov[slot]))
```
**`max` algorithm:**
Cannot do byte max first — `max(255, b<255)=255` overwrites self's original overflow value. Pre-pass reads self's value at other's overflow slots before the byte pass.
```
Pre-pass O(k_other): for (slot, other_val) in other.overflow_entries():
set(slot, max(self.get(slot), other_val))
Pass 1 — byte max, SIMD-vectorizable, O(n)
```
---
## Matrix types
Four matrix types, two encodings × two formats:
| | Columnar format | Packed format |
|---|---|---|
| **Bit** | `PersistentBitMatrix` (Columnar variant) | `PersistentBitMatrix` (Packed variant) |
| **Int** | `PersistentCompactIntMatrix` (Columnar variant) | `PersistentCompactIntMatrix` (Packed variant) |
Both matrix types are enums (`Columnar` / `Packed` / `Implicit` for bit) behind a transparent API. `col_view(c)` returns the appropriate view directly:
```rust
// PersistentBitMatrix
pub fn col_view(&self, c: usize) -> BitSliceView<'_>
// PersistentCompactIntMatrix
pub fn col_view(&self, c: usize) -> IntSliceView<'_>
```
No wrapper enums (`BitColView`, `IntColView`): the caller receives a `Copy` view struct immediately usable with any view method or bulk builder method.
`pack_compact_int_matrix` and `pack_bit_matrix` convert columnar → packed format.
---
## Aggregation traits (matrix level)
### ColumnWeights
```rust
trait ColumnWeights: Send + Sync {
fn col_weights(&self) -> Array1<u64>; // sum per column
fn partial_kmer_counts(&self) -> Array1<u64>; // default = col_weights()
}
```
`partial_kmer_counts` is overridden for count matrices to return `count_nonzero` per column (distinct kmers) rather than total count.
### CountPartials
Abstract required methods: `partial_bray`, `partial_euclidean`, `partial_threshold_jaccard`, `partial_relfreq_bray`, `partial_relfreq_euclidean`, `partial_hellinger`.
**Additivity rule:** self-contained partials (`partial_bray`, `partial_euclidean`, `partial_threshold_jaccard`) can be element-wise summed across all `(partition, layer)` pairs. Normalised partials (`partial_relfreq_*`, `partial_hellinger`) require the **global** `col_weights` (accumulated across all layers and all partitions) as parameter.
**`partial_threshold_jaccard` returns `(inter, union)`** because `union[i,j]` depends on both columns simultaneously.
Provided finalisations:
| Finalisation | Formula |
|---|---|
| `bray_dist_matrix()` | `1 2·partial_bray[i,j] / (w[i] + w[j])` |
| `euclidean_dist_matrix()` | `√partial_euclidean[i,j]` |
| `threshold_jaccard_dist_matrix(t)` | `1 inter[i,j] / union[i,j]` |
| `relfreq_bray_dist_matrix()` | `1 partial_relfreq_bray[i,j]` |
| `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` |
| `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` |
| `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` |
### BitPartials
Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)`, `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions.
---
## Temp-file-backed types
**All inter-function results use temp-file-backed types** so the OS can page them out under memory pressure. This matters in practice: processing dozens of layers × hundreds of partitions in parallel would otherwise accumulate gigabytes of live anonymous memory.
### Lifecycle
```
TempCompactIntVecBuilder::new(n) → writable mmap in TempDir
↓ (inc_present_fast / inc_predicate_fast / add / mask_with / …)
.freeze() → TempCompactIntVec (read-only mmap + TempDir)
↓ (optional)
.make_persistent(path) → PersistentCompactIntVec (permanent file)
```
Same pattern for `TempBitVecBuilder``TempBitVec``PersistentBitVec`.
**Drop order**: `TempCompactIntVec { vec: PersistentCompactIntVec, _temp: TempDir }` — Rust drops fields in declaration order. `vec` (mmap) released before `_temp` (directory deleted). No explicit `drop()` needed.
### TempCompactIntVec / TempCompactIntVecBuilder
```rust
pub struct TempCompactIntVec {
vec: PersistentCompactIntVec,
_temp: TempDir, // dropped after vec
}
pub(crate) struct TempCompactIntVecBuilder {
builder: PersistentCompactIntVecBuilder,
temp: TempDir,
}
```
`TempCompactIntVec`: read access via `get(slot)`, `sum()`, `iter()`, `view() -> IntSliceView<'_>`.
`TempCompactIntVecBuilder`: full delegation to inner `PersistentCompactIntVecBuilder` — all bulk computation methods (`inc_present_fast`, `inc_predicate_fast`, `add`, `min`, `max`, `diff`, `mask_with`) are exposed as `pub(crate)`.
### TempBitVec / TempBitVecBuilder
```rust
pub struct TempBitVec {
vec: PersistentBitVec,
_temp: TempDir,
}
pub(crate) struct TempBitVecBuilder {
builder: PersistentBitVecBuilder,
temp: TempDir,
}
```
`TempBitVec`: read access via `get(slot)`, `count_ones()`, `view() -> BitSliceView<'_>`, `iter()`.
`TempBitVecBuilder`: exposes `set(slot, bool)`, `or(BitSliceView)`, and:
```rust
pub(crate) fn or_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool)
```
`or_where` — two passes, no intermediate allocation:
```
Pass 1 — primary bytes, O(n):
for slot in 0..n:
b = col.primary_bytes()[slot]
if b < 255 AND pred(b as u32): self.set(slot, true)
Pass 2 — overflow, O(k):
for (slot, val) in col.overflow_entries():
if pred(val): self.set(slot, true)
```
---
## Filter / Select API
### ColGroup
```rust
pub struct ColGroup { pub name: String, pub indices: Vec<usize> }
```
Defined **once at the index level** from column metadata. Valid in all matrices of all layers and partitions — column structure is identical across the entire hierarchy; only rows (kmer slots) are partitioned.
### Composition axis
- **Across partitions**: kmer space is partitioned → partial results **concatenated** (disjoint kmer ranges).
- **Across layers**: same kmer space, different counts → partial results **aggregated** (add, OR, etc.).
### MatrixGroupOps
Five required primitives + two default methods derived from them. All return temp-file-backed types.
```rust
pub trait MatrixGroupOps {
// required
fn partial_group_presence_count(&self, g: &ColGroup, threshold: u32)
-> io::Result<TempCompactIntVec>;
fn partial_group_sum(&self, g: &ColGroup)
-> io::Result<TempCompactIntVec>;
fn partial_group_any(&self, g: &ColGroup, threshold: u32)
-> io::Result<TempBitVec>;
fn partial_group_min(&self, g: &ColGroup)
-> io::Result<TempCompactIntVec>;
fn partial_group_max(&self, g: &ColGroup)
-> io::Result<TempCompactIntVec>;
// defaults derived from partial_group_presence_count
fn partial_group_all(&self, g: &ColGroup, threshold: u32)
-> io::Result<TempBitVec>; // slot=1 iff count == g.indices.len()
fn partial_group_none(&self, g: &ColGroup, threshold: u32)
-> io::Result<TempBitVec>; // slot=1 iff count == 0
}
```
Implemented for both `PersistentCompactIntMatrix` and `PersistentBitMatrix`.
For **bit matrices**: values are 0/1, so `partial_group_sum` = `partial_group_presence_count(g, 1)`; `partial_group_min` is AND (set first column then mask-with remaining); `partial_group_max` is OR via `partial_group_any` + `inc_present`.
**`partial_group_presence_count` — chunking for large groups:**
When `g.indices.len() < 255`: per-slot counts stay within `u8` range. Use `inc_present_fast` (bit) or `inc_predicate_fast(col_view(c), |v| v >= threshold)` (int) — raw u8 increment, no overflow entry written.
When `g.indices.len() ≥ 255`: process in chunks of 254 columns, accumulate via `.add(chunk_frozen.view())`.
**`partial_group_min` (int matrix)**: copy first column via `.add(col_view(first))` (start from 0 ⇒ copy), then `.min(col_view(c))` for remaining.
**`partial_group_max` (int matrix)**: `.max(col_view(c))` for all columns (start from 0 ⇒ first column acts as copy).
**`partial_group_any`** uses `or_where` on `TempBitVecBuilder` (two-pass: primary bytes then overflow entries).
**`partial_group_all` / `partial_group_none`** (default): call `partial_group_presence_count`, then iterate slots to produce the bit result. O(n) extra pass, not chunked.
### add_col_from — matrix builder integration
Both matrix builders accept temp-file results directly:
```rust
// PersistentBitMatrixBuilder
fn add_col_from(&mut self, src: &TempBitVec) -> io::Result<()>
fn add_col_from_int(&mut self, src: &TempCompactIntVec) -> io::Result<()> // nonzero → 1
// PersistentCompactIntMatrixBuilder
fn add_col_from(&mut self, src: &TempCompactIntVec) -> io::Result<()>
fn add_col_from_bit(&mut self, src: &TempBitVec) -> io::Result<()> // bit → 0/1 u32
```
`add_col_from` copies the temp file to the matrix directory and increments `n_cols`; `close()` writes `meta.json` with the final column count. No separate `write_meta` step needed.
### mask_with
Direct method on `PersistentCompactIntVecBuilder` (and delegation via `TempCompactIntVecBuilder`). Zeros every slot where the corresponding mask bit is 0. Iterates only zero bits — O(n_zeros), O(1) when mask is all-ones.
```
for (w_idx, word) in mask.words():
if word == u64::MAX: continue // skip all-ones words
zeros = !word
while zeros != 0:
bit = trailing_zeros(zeros)
s = w_idx * 64 + bit
if primary[s] != 0: set(s, 0) // clears overflow entry too
zeros &= zeros 1
```
Terminal operation for Filter (retain only selected kmer slots in a count vector) and Select (positional selection without MPHF).
+143
View File
@@ -0,0 +1,143 @@
# `obitaxonomy` — taxonomy concept paths
`obitaxonomy` is a dependency-free crate that defines a typed representation
of hierarchical concept paths (taxonomic or otherwise) stored in genome metadata.
---
## Concept path syntax
A concept path is stored as a metadata value with the prefix `taxonomy:/`:
```
taxonomy:/enterobacteriaceae@family/Escherichia@genus/Escherichia coli@species
```
Structure:
- The `taxonomy:/` prefix is the type discriminator. Any metadata value starting
with it is parsed as a `TaxPath`; all others remain plain strings.
- The remainder is one or more `/`-separated segments.
- Each segment is `name` or `name@rank`, where `rank` is a label for the
taxonomic level (e.g. `family`, `genus`, `species`).
- Rank annotations are **optional per segment** and can be mixed freely.
- Spaces are allowed in both names and ranks.
### Reserved character
`@` is reserved throughout the taxonomy system and may **not** appear in:
| Context | Constraint |
|---------|------------|
| Segment name | forbidden |
| Rank/class label | forbidden |
| Metadata key names | forbidden (used as `key@rank` in predicate syntax) |
`@` is freely allowed in plain-text metadata values (non-taxonomy).
### Parse errors
| Condition | Error |
|-----------|-------|
| Value does not start with `taxonomy:/` | `MissingPrefix` |
| No segments after the prefix | `EmptyPath` |
| Segment with empty name (consecutive `/`) | `EmptySegmentName` |
| Segment with trailing `@` and no rank (`name@`) | `EmptyRankName` |
| Segment with more than one `@` | `AmbiguousRank` |
---
## Public API
### `TaxSegment`
A single node: a name and an optional rank.
```rust
seg.name() // &str
seg.rank() // Option<&str>
seg.to_string() // "name" or "name@rank"
TaxSegment::parse(s) // Result<TaxSegment, TaxError>
```
### `TaxPath`
```rust
TaxPath::parse(s) // Result<TaxPath, TaxError>
path.segments() // &[TaxSegment]
path.depth() // usize — number of segments
path.is_ancestor_of(&other) // bool — prefix match by name, ranks ignored
path.name_at_rank("genus") // Option<&str>
path.to_string() // reconstructs "taxonomy:/…"
```
`is_ancestor_of` compares segment **names** only — rank annotations are
informational and do not affect the ancestry relation.
```rust
let a: TaxPath = "taxonomy:/Enterobacteriaceae@family/Escherichia@genus".parse()?;
let b: TaxPath = "taxonomy:/Enterobacteriaceae@family/Escherichia@genus/Escherichia coli@species".parse()?;
assert!(a.is_ancestor_of(&b)); // true
assert!(b.is_ancestor_of(&a)); // false
assert!(a.is_ancestor_of(&a)); // true (equal ⇒ ancestor)
assert_eq!(b.name_at_rank("species"), Some("Escherichia coli"));
assert_eq!(b.name_at_rank("genus"), Some("Escherichia"));
assert_eq!(b.name_at_rank("order"), None);
```
---
## Integration with `GenomeInfo`
At index load time, every metadata value is inspected once:
- Starts with `taxonomy:/` → parsed into `TaxPath`, stored in `genome.taxonomy`.
- Otherwise → kept as-is in `genome.meta`.
```rust
struct GenomeInfo {
label: String,
meta: HashMap<String, String>, // plain text metadata
taxonomy: HashMap<String, TaxPath>, // parsed taxonomy metadata
}
```
The raw string is not duplicated. `TaxPath::to_string()` reconstructs the
original value losslessly for serialisation.
---
## Predicate operators (in `filter` / `select`)
Path predicates use the `~` / `!~` operators. The **stored value** always starts
with `/` (rooted path); the **query pattern** does not need to.
### Path pattern syntax
| Pattern | Semantics |
|---------|-----------|
| `A/B` | contiguous sub-path A then B, anywhere in the value |
| `/A/B` | value starts with A then B (start-anchored) |
| `A/B$` | value ends with A then B (end-anchored) |
| `/A/B$` | value is exactly A then B (fully anchored) |
| `A@x/B` | A with class `x` followed by B with any class |
| `A@x/B@y` | A with class `x` followed by B with class `y` |
A segment pattern without `@` matches the segment name regardless of its stored class.
### Rank-aware queries
```
key@rank=value
```
| Predicate form | Semantics |
|----------------|-----------|
| `key@rank=value` | genome's `key` has `value` at rank `rank` |
| `key@rank!=value` | does not |
| `key@rank=v1\|v2` | value at `rank` is `v1` or `v2` |
`~` combined with `@rank` on the key (e.g. `key@genus~pattern`) is not defined
and is rejected at parse time.
-188
View File
@@ -1,188 +0,0 @@
# Kmer filtering and ingroup/outgroup predicates
The `rebuild`, `dump`, and `unitig` commands all share the same filtering
system. Filters can select k-mers based on per-genome quorum counts, optionally
restricted to **ingroup** and **outgroup** genome sets derived from genome
metadata.
`rebuild` additionally accepts `--min-total-count` / `--max-total-count` filters
that operate on the sum of counts across all genomes.
## Predicate syntax
Each `--ingroup` and `--outgroup` flag takes a predicate of the form:
```
key OP value1|value2|…
```
| Operator | Meaning |
|----------|---------|
| `*` or `all` | wildcard — every genome matches unconditionally |
| `key=v1\|v2` | exact match — genome's `key` equals `v1` or `v2` |
| `key!=v` | negation — genome's `key` equals none of the values |
| `key~path` | path ancestry — genome's `key` is `path` or a descendant |
| `key!~path` | not a descendant |
Multiple values separated by `|` are always OR-ed within the predicate.
### Path matching (`~` and `!~`)
Metadata values can represent hierarchical taxonomic paths such as
`/Eukaryota/Viridiplantae/Streptophyta/Betulaceae/Betula/nana`.
- **Absolute pattern** (starts with `/`): the value must start with the pattern
at a segment boundary.
`taxon~/Betulaceae/Betula` matches `/Betulaceae/Betula/nana` and
`/Betulaceae/Betula` but not `/Betulaceae/Betuloides/…`.
- **Bare segment** (no leading `/`): the value must contain the pattern as an
exact path component anywhere.
`taxon~Betula` matches any path that has `Betula` as one of its segments.
### Missing metadata key → NA
If a genome does not carry the queried metadata key, the predicate returns **NA**.
NA propagates through the group evaluation logic (see below), and genomes that
cannot be classified are **ignored** in all quorum counts.
## Group semantics
### Multiple predicates
| Flag | Combination rule |
|------|-----------------|
| `--ingroup` (repeated) | **AND** — genome must satisfy all predicates |
| `--outgroup` (repeated) | **OR** — genome satisfies any predicate |
### Three-value logic
Each predicate returns `true`, `false`, or `NA` (absent key).
- AND: `false` absorbs everything; `NA` propagates unless already `false`.
- OR: `true` absorbs everything; `NA` propagates unless already `true`.
### Classification and priority
For each genome:
1. Evaluate `AND(ingroup predicates)``in_result`
2. Evaluate `OR(outgroup predicates)``out_result`
3. If `in_result = true`**Ingroup** (ingroup wins over outgroup)
4. Else if `out_result = true`**Outgroup**
5. Otherwise → **Uncategorized** (ignored in all quorum counts)
### Implicit groups
| `--ingroup` | `--outgroup` | Effective behaviour |
|-------------|--------------|---------------------|
| not set | not set | all genomes form the ingroup |
| set | not set | only ingroup quorum flags apply |
| not set | set | only outgroup quorum flags apply |
| set | set | both constraints apply simultaneously |
## Quorum flags
| Flag | Applies to | Meaning |
|------|-----------|---------|
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes |
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes |
| `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes |
| `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes |
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes |
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes |
| `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes |
| `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes |
| `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`rebuild` only) |
| `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`rebuild` only) |
| `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) |
Defaults: mins = 0 (no lower bound), max counts = group size, max fracs = 1.0
(no upper bound). A filter with all defaults is a no-op.
Fractions are computed over the size of the classified group, not over total
genome count. An empty group (no genome classified as ingroup/outgroup) never
triggers a filter failure.
## Examples
Keep k-mers specific to *Betula nana* — present in at least 2 *B. nana* genomes
and absent from every other genome in the index:
```sh
obikmer rebuild src --output dst \
--ingroup "species=Betula_nana" \
--outgroup "*" \
--min-count 2 \
--max-outgroup-count 0
```
Keep k-mers found in at least 2 *Betula nana* genomes and absent from all
other *Betula*:
```sh
obikmer rebuild src --output dst \
--ingroup "species=Betula_nana" \
--outgroup "genus=Betula" \
--min-count 2 \
--max-outgroup-count 0
```
Use taxonomic paths — keep k-mers present in ≥ 50 % of the *Betula* clade
and in fewer than 10 % of everything outside *Betulaceae*:
```sh
obikmer rebuild src --output dst \
--ingroup "taxon~/Betulaceae/Betula" \
--outgroup "taxon!~/Betulaceae" \
--min-frac 0.5 \
--max-outgroup-frac 0.1
```
Multiple outgroup predicates (OR): exclude k-mers present in *Alnus* or *Carpinus*:
```sh
obikmer rebuild src --output dst \
--ingroup "genus=Betula" \
--outgroup "genus=Alnus" \
--outgroup "genus=Carpinus" \
--max-outgroup-count 0
```
The same flags work identically for `dump` and `unitig`. To dump only k-mers
specific to *Betula nana*:
```sh
obikmer dump myindex \
--ingroup "species=Betula_nana" \
--outgroup "*" \
--min-count 1 \
--max-outgroup-count 0
```
To enumerate unitigs of the *Betula*-specific subgraph:
```sh
obikmer unitig myindex \
--ingroup "genus=Betula" \
--outgroup "*" \
--min-count 2 \
--max-outgroup-count 0
```
## Implementation
- **`obikpartitionner::filter::GroupQuorumFilter`** — implements `KmerFilter`
using pre-computed ingroup and outgroup index vectors. The heavy logic
(predicate parsing, three-value evaluation, genome classification) happens
once before any iteration; each k-mer row evaluation is a simple index
lookup and counter.
- **`obikmer::cmd::predicate::FilterArgs`** — shared `clap` argument group
embedded via `#[command(flatten)]` in `RebuildArgs`, `DumpArgs`, and
`UnitigArgs`. `FilterArgs::build_filters()` returns a ready-to-use filter
list.
- **`obikpartitionner::KmerPartition::iter_partition_kmers`** — accepts
`filters: &[Box<dyn KmerFilter>]` and applies them per-kmer before invoking
the callback. `rebuild`, `dump`, and `unitig` all go through this single
entry point.
+234
View File
@@ -0,0 +1,234 @@
# `select` — column projection and aggregation
`select` transforms an index by operating on its **genome columns**: projecting a
subset of columns, aggregating groups of genomes into synthetic columns, or both.
It is the column-axis counterpart of `filter` (row-axis operations).
Following relational algebra conventions:
| Command | Relational operation | Axis |
|----------|---------------------|----------|
| `filter` | σ — selection | rows (k-mers) |
| `select` | π — projection | columns (genomes) |
The two commands compose naturally: run `filter` first to restrict the kmer set,
then `select` to reshape the genome columns.
`select` never changes the kmer set. The MPHF and `unitigs.bin` of each layer
are preserved unchanged; only the data matrices are rewritten.
---
## Synopsis
```sh
obikmer select <input-index>
{ --output <dir> | --in-place }
[--group <name>:<pred> ...]
[--group-op <name>:<op> ...]
[--aggregate-by <key> ]
[--aggregate-op <op> ]
[--select <col1,col2,...> ]
[--presence-threshold <N> ]
```
---
## Output destination
Exactly one of `--output` or `--in-place` must be specified.
**`--output <dir>`** — writes a new index to `<dir>`. The source index is
unchanged. The MPHF and unitig files are copied; only the data matrices are
rewritten with the new column layout.
**`--in-place`** — rewrites the data matrices of the source index directly.
Removed or replaced columns are lost. The operation writes to temporary files
first, then renames atomically, so an interrupted run leaves the index intact.
---
## Defining output columns
### Named groups — `--group`
```
--group <name>:<pred>
```
Defines a named group of genomes using the same predicate syntax as `filter`.
Repeatable; a genome can belong to several groups.
```sh
--group "pub:species=Betula_pubescens"
--group "nan:species=Betula_nana"
```
### Per-group operator — `--group-op`
```
--group-op <name>:<op>
```
Assigns an aggregation operator to a named group. Optional; if absent, the
default operator applies (see below).
```sh
--group-op "pub:any"
--group-op "nan:all"
```
### Shorthand — `--aggregate-by` / `--aggregate-op`
`--aggregate-by <key>` automatically creates one group per unique value of the
metadata key `<key>`. Equivalent to one `--group <val>:<key>=<val>` per distinct
value. `--aggregate-op <op>` sets the operator for all auto-generated groups.
`--aggregate-by` and `--group` are mutually exclusive.
### Column selection and ordering — `--select`
```
--select col1,col2,...
```
Lists the output columns in order. Each element is either a group name (defined
by `--group` or generated by `--aggregate-by`) or a genome label from the source
index (pass-through, no aggregation).
**Default when `--select` is absent:**
all defined groups in declaration order (for `--group`), or all generated groups
in metadata-value order (for `--aggregate-by`). Individual genomes not in any
group are excluded unless named explicitly.
**When neither `--group` nor `--aggregate-by` is specified:**
`--select` can still reference genome labels for pure column projection (no
aggregation). If `--select` is also absent, all genomes are output unchanged
(identity transform — useful combined with row filtering via a prior `filter`
run).
---
## Aggregation operators
| Operator | Input | Output | Semantics |
|----------|-------------|----------|-----------|
| `any` | pres / count | presence | 1 if ≥ 1 genome in group carries the k-mer |
| `all` | pres / count | presence | 1 if every genome in group carries the k-mer |
| `none` | pres / count | presence | 1 if no genome in group carries the k-mer |
| `sum` | count | count | sum of counts across the group |
| `min` | count | count | minimum count |
| `max` | count | count | maximum count |
**Default operator:**
- Presence index: `any`
- Count index: `sum`
Logical operators (`any`/`all`/`none`) on a count index use
`--presence-threshold N` (default 0): a genome "carries" the k-mer if its count
is > N.
**Output index type:**
- If the source is a presence index, the output is always a presence index.
- If the source is a count index and every output column uses a logical operator
or is a pass-through from a presence source, the output is a presence index.
- Otherwise (at least one arithmetic operator on a count source), the output is
a count index.
---
## Behaviour for edge cases
| Situation | Behaviour |
|-----------|-----------|
| Genome missing the metadata key in `--aggregate-by` | genome ignored (no `NA` group) |
| Genome in multiple groups | contributes independently to each |
| `--group-op` references undefined group | error |
| `--select` element is neither group name nor genome label | error |
| `--output` and `--in-place` both specified | error |
| Neither `--output` nor `--in-place` | error |
| Group with zero matching genomes | column is all-zeros (or all-ones for `none`) |
---
## Examples
### Aggregate by metadata group, default operators
```sh
obikmer select myindex --output out --aggregate-by group
# one column per unique value of "group"; presence→any, count→sum
```
### Named groups with different operators
```sh
obikmer select myindex --output out \
--group "pub:species=Betula_pubescens" \
--group "nan:species=Betula_nana" \
--group-op "pub:any" \
--group-op "nan:all" \
--select "pub,nan"
```
### Mix aggregated group and individual genome
```sh
obikmer select myindex --output out \
--group "A:group=A" \
--select "A,Betula_nana--IGA-24-39"
```
### Pure column projection (no aggregation)
```sh
obikmer select myindex --output out \
--select "Betula_nana--TROM-V-149986,Betula_nana--AG-P04-25-01"
```
### In-place: keep only group A
```sh
obikmer select myindex --in-place --group "A:group=A" --select "A"
```
### Compose with filter
```sh
# Step 1: keep only B. nana-specific k-mers
obikmer filter myindex --output filtered \
--ingroup "species=Betula_nana" --outgroup "*"
# Step 2: aggregate genome columns by collection site
obikmer select filtered --output final --aggregate-by site
```
---
## Implementation notes
`select` does not rebuild the MPHF. The 256 partitions are processed in parallel
(rayon), each writing its output independently; results require no synchronisation
because every partition owns a distinct set of files.
For each layer in each partition:
1. The slot count `n` is read by opening the source data matrix.
2. A new data matrix is built with M columns (M = number of output columns).
3. For each slot `s` in `0..n`:
- `old_row = matrix.fill_row(s)` — reads the original `N`-column row without allocating.
- For each output column `j`:
- `new_row[j] = aggregate(op, old_row[group_indices])`.
- Pass-through columns are represented as single-element groups with the
default operator (`any` for presence, `sum` for count) — same code path.
- The new row is written slot by slot into each column builder.
4. All plain files in the source layer directory (`mphf.bin`, `unitigs.bin`,
evidence files, `layer_meta.json`) are copied verbatim; only the `presence/`
or `counts/` subdirectory is rewritten.
5. `index.meta` is rewritten with the new genome list and updated `with_counts`.
**`--in-place` write strategy:** new data is written to a temporary sibling
directory (`presence_new/` or `counts_new/`); on success the old directory is
removed and the temporary one is renamed into place. An interrupted run leaves
at most one stale `*_new/` directory; the original data is intact until the
rename step.
+5 -4
View File
@@ -9,12 +9,13 @@
| `superkmer` | Extract super-kmers from a sequence file and write to stdout |
| `index` | Build a complete genome index (scatter → dereplicate → count → layered MPHF) |
| `merge` | Merge multiple built indexes into one |
| `rebuild` | Filter and compact an existing index into a new single-layer index; supports ingroup/outgroup predicates on genome metadata |
| `filter` | Apply row-level selection (σ) to an index: retain only k-mers matching the ingroup/outgroup predicates. Output is a new single-layer index — compaction is a consequence, not the goal. Supports the shared [kmer filtering](implementation/filtering.md) system |
| `query` | Query an index with sequences and annotate matches |
| `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the same ingroup/outgroup filtering as `rebuild` |
| `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the shared [kmer filtering](implementation/filtering.md) system; `--head N` limits output to the first N k-mers |
| `annotate` | Add or update genome metadata from a CSV file; or dump metadata as CSV |
| `distance` | Compute pairwise distance matrix between genomes; optionally build NJ/UPGMA trees |
| `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the same ingroup/outgroup filtering as `rebuild` |
| `distance` | Compute pairwise distance matrix between genomes; optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard on count indexes (default 1) |
| `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the shared [kmer filtering](implementation/filtering.md) system |
| `select` | Project and/or aggregate genome columns into a new or in-place index; the column-axis counterpart of `filter` (see [select](implementation/select.md)) |
| `estimate` | Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing |
| `reindex` | Convert an index's evidence in-place: exact ↔ approx |
| `utils` | Miscellaneous index utilities: `--new-label NEW=OLD` renames a genome label; `--upgrade-index` adds missing `layer_meta.json` to old indexes |
+84
View File
@@ -0,0 +1,84 @@
# Installation
## Prerequisites
### Rust toolchain
`obikmer` requires **Rust 1.85 or later** (edition 2024). Install or update via [rustup](https://rustup.rs):
```bash
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh
rustup update stable
```
### C build environment (required for hwloc)
`obikmer` embeds [hwloc](https://www.open-mpi.org/projects/hwloc/) (Hardware Locality) for NUMA-aware thread placement on multi-socket machines. hwloc is built from source at compile time via the `vendored` feature of the `hwlocality` crate. This requires a standard C build environment.
#### Linux (Debian/Ubuntu)
```bash
apt install build-essential automake libtool autoconf pkg-config
```
#### Linux (RHEL/Rocky/AlmaLinux)
```bash
dnf install gcc make automake libtool autoconf pkgconfig
```
#### HPC clusters
Most HPC clusters provide these tools via the module system:
```bash
module load gcc automake libtool autoconf
```
If in doubt, check whether `autoreconf --version` and `libtool --version` return successfully.
#### macOS
```bash
brew install automake libtool autoconf pkg-config
```
## Building
```bash
git clone <repository-url>
cd obikmer/src
cargo build --release
```
The compiled binary is at `target/release/obikmer`.
### Building on HPC clusters (network filesystems)
HPC home directories are typically on a network filesystem (Lustre, NFS) optimised for large sequential reads — not for the thousands of small file operations that Cargo generates during compilation. Building directly on such a filesystem can be extremely slow (0.1% CPU utilisation, tens of minutes for what should take seconds).
**Always redirect the build directory to a local scratch disk:**
```bash
CARGO_TARGET_DIR=/scratch/$USER/cargo-target cargo build --release
```
Adapt the path to the local scratch available on your cluster (`/var/tmp`, `/tmp`, `/scratch/local`, etc.). Once built, copy the binary to a permanent location:
```bash
cp /scratch/$USER/cargo-target/release/obikmer ~/bin/
```
## NUMA support
NUMA-aware thread placement is active automatically on multi-socket Linux machines (detected at runtime via hwloc). No special build flag is required — the detection is built in and falls back gracefully to the single-pool adaptive strategy on:
- macOS (Apple Silicon, unified memory)
- single-socket Linux machines
- any system where hwloc reports only one NUMA node
## Verifying the installation
```bash
obikmer --help
```
+1
View File
@@ -2,3 +2,4 @@
- [Project domain](project_domain.md) — obikmer est pour la génomique (génomes individuels), pas la métagénomique
- [No architectural decisions without authorization](feedback_architectural_decisions.md) — toute décision architecturale (mémoire, algo, structure) requiert l'accord explicite de l'utilisateur avant toute action
- [Phases intra-partition parallèles](feedback_phases_parallelism.md) — graph build, compute_degrees, unitig traversal, MPHF utilisent Rayon — ne jamais les appeler "séquentielles"
+12
View File
@@ -0,0 +1,12 @@
---
name: feedback-phases-parallelism
description: Les phases intra-partition (graph build, compute_degrees, unitig traversal, MPHF) utilisent toutes Rayon — elles ne sont PAS séquentielles
metadata:
type: feedback
---
Ne jamais qualifier les phases intra-partition de "séquentielles". Chaque phase (graph build, compute_degrees, unitig traversal, MPHF build) utilise Rayon en interne et s'exécute en parallèle sur plusieurs cœurs.
**Why:** L'utilisateur a corrigé ce point plusieurs fois. Le décrire comme "séquentiel" est une erreur factuelle qui fausse l'analyse de performance.
**How to apply:** Quand on analyse l'efficacité CPU ou les 25% manquants, chercher la cause dans le déséquilibre de charge entre partitions, la contention Rayon entre workers, ou la latence inter-partitions — pas dans une prétendue sérialisation des phases.
+7 -1
View File
@@ -29,6 +29,7 @@ extra_javascript:
nav:
- Home: index.md
- Installation: installation.md
- Theory:
- Kmers and super-kmers: kmers.md
- DNA encoding: theory/encoding.md
@@ -49,10 +50,15 @@ nav:
- PersistentCompactIntVec: implementation/persistent_compact_int_vec.md
- PersistentBitVec: implementation/persistent_bit_vec.md
- Merge command: implementation/merge.md
- Kmer filtering (rebuild/dump/unitig): implementation/rebuild_filter.md
- Merge parallelism & memory: implementation/merge_parallelism.md
- Kmer filtering: implementation/filtering.md
- Select command: implementation/select.md
- obitaxonomy crate: implementation/obitaxonomy.md
- Architecture:
- Sequences: architecture/sequences/invariant.md
- Kmer index: architecture/index_architecture.md
- NUMA-aware worker pools: architecture/numa_worker_pools.md
- NUMA-aware partition runner: architecture/numa_partition_runner.md
watch:
- docmd
+44
View File
@@ -0,0 +1,44 @@
# La crate obicompactvector
Le code actuelle est ce qu'il est. Ce n'est pad la vrérité absolue, c'est un premier effort d'implémentation rien de plus. Ci-dessous je vais décrire les objectif et la structure qui devrait être. LA VERITE A ATTEINDRE.
La crate fournie des représentations les plus compact possible en mémoire de matrice de comptage ou de présence de k-mer dans des génomes. Chaque colonne représente un génome chaque ligne un kmer. une matrice est une collection de vecteur ou chacun des vecteur est un colonne de la matrice.
Les matrices comme les colonnes ont vocation à être persistante. Les données sont stockées dans des fichiers binaires. Les données sont mappées en mémoire via `mmap`
Les structure sont par essence immutables. Il existe des représentations mutables des colonnes qui permettent leur construction. À la fin de leur construction, les colonnes sont fermée ce qui les rends immutable.
Les matrices peuvent êtres représenté de deux façons:
- via un répertoire contenant une collection de fichier colonnes
- via un fichier matrix qui est la concatenation de plusieurs fichiers colonnes.
## Les matrices de comptage
Ce sont des matrice d'entiers positif la plus part du temps de petites valeurs (inferieurs à 255). On assume que toutes les valeurs sont représentables sur un `u32`
## Les matrices de presence
Ce sont des matrices de boolean représenté comme des champs de bits
Il existe une forme implicite des vecteur de présence, qui n'est représenté par aucun fichier pour lequel toutes les valeurs sont vraies
## représentation légère des colonnes
Les colonnes qu'elles soient de unitiaire (fichier colonne) ou partie d'un fichier composite matrice peuvent être représenté par un objet léger donnant acces à ces valeurs ainsi qu'à la longeur du vecteurs. Toutes les méthodes de calcules doivent uniquement travailler à partir de ces représentations légère unifiées des colonnes.
### Représentation légère d'un vecteur de présence
Le vecteur est représenté par
- un champs de bits encodé comme un [u64]
- un usize encodant la longeur du champs de bits
### Représentation légère d'un vecteur de présence
Le vecteur est représenté par
- un vecteur [u8] encodant directement les valeur faibe du vecteur [0,255[
La valeur 255 est une valeur sentinelle indiquant que la valeure vraie est >=255
et se trouvent dans une structure d'overflow
- un iterateur de (usize,u32) listant les valeurs d'overflow coorespondant aux valeurs
sentinels (255) du [u8]
- un usize encodant la longeur du champs de bits
+347
View File
@@ -0,0 +1,347 @@
#!/usr/bin/env python3
"""Parse obikmer merge debug log → Markdown performance report."""
import re
import sys
from datetime import datetime
from collections import defaultdict
from statistics import mean, median, stdev
ANSI = re.compile(r'\x1b\[[0-9;]*m')
def strip(s):
return ANSI.sub('', s)
def parse_ts(s):
return datetime.fromisoformat(s.replace('Z', '+00:00'))
def dur_s(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1e3
if s.endswith('µs'): return float(s[:-2]) / 1e6
if s.endswith('us'): return float(s[:-2]) / 1e6
if s.endswith('ns'): return float(s[:-2]) / 1e9
if s.endswith('s'): return float(s[:-1])
return float(s)
def fmt_s(s):
if s < 0.001: return f"{s*1e6:.0f}µs"
if s < 1: return f"{s*1e3:.0f}ms"
if s < 60: return f"{s:.2f}s"
return f"{s/60:.1f}min ({s:.0f}s)"
def fmt_rate(n, s):
if s <= 0: return ""
r = n / s
if r >= 1e9: return f"{r/1e9:.2f}G/s"
if r >= 1e6: return f"{r/1e6:.2f}M/s"
if r >= 1e3: return f"{r/1e3:.2f}K/s"
return f"{r:.0f}/s"
def pct(a, b):
return f"{100*a/b:.1f}%" if b else ""
def stats_row(label, values, unit="s", fmt=fmt_s):
if not values: return f"| {label} | — | — | — | — | — |"
mn, mx, med, av = min(values), max(values), median(values), mean(values)
sd = stdev(values) if len(values) > 1 else 0
return f"| {label} | {fmt(mn)} | {fmt(med)} | {fmt(av)} | {fmt(mx)} | {fmt(sd)} |"
# ── patterns ──────────────────────────────────────────────────────────────────
TS = r'(\d{4}-\d{2}-\d{2}T[\d:.]+Z)'
pats = {
'graph_done': re.compile(TS + r'.*partition (\d+): de Bruijn graph done — (\d+) new kmers'),
'trav_start': re.compile(TS + r'.*partition (\d+): unitig traversal start — (\d+) nodes'),
'trav_closing': re.compile(TS + r'.*partition (\d+): unitig writer closing'),
'trav_closed': re.compile(TS + r'.*partition (\d+): unitig writer closed'),
'graph_dropped': re.compile(TS + r'.*partition (\d+): graph dropped — starting MPHF build \((\d+) unitigs\)'),
'mphf_done': re.compile(TS + r'.*partition (\d+): MPHF build done'),
'mphf_open': re.compile(TS + r'.*partition (\d+): MPHF open in ([\d.]+)s'),
'bld_ready': re.compile(TS + r'.*partition (\d+): builders ready in ([\d.]+)s'),
'pass2_done': re.compile(TS + r'.*partition (\d+): pass2 pipeline done in ([\d.]+)s'),
'bld_closed': re.compile(TS + r'.*partition (\d+): builders closed in ([\d.]+)s'),
'part_done': re.compile(TS + r'.*partition (\d+): done in ([\d.]+)s — (\d+) new kmers'),
'worker': re.compile(TS + r'.*activated worker (\d+).*efficiency (\d+)%.*gain vs prev (\d+)%'),
'worker_poll': re.compile(TS + r'.*activated worker (\d+) \(poll\).*efficiency (\d+)%'),
'compute_deg': re.compile(TS + r'.*partition (\d+): compute_degrees in ([\d.]+)s — (\d+) nodes'),
'stage_done': re.compile(TS + r'.*done stage=merge_partitions wall_secs=([\d.]+)'),
'workers_rep': re.compile(r'workers spawned: (\d+) / (\d+)'),
}
# ── parse ─────────────────────────────────────────────────────────────────────
P = defaultdict(dict) # partition_id → timing dict
workers_ev = []
wall_total = None
workers_final = (None, None)
with open(sys.argv[1]) as f:
for raw in f:
line = strip(raw)
m = pats['graph_done'].search(line)
if m:
pid = int(m.group(2))
P[pid]['n_kmers'] = int(m.group(3))
P[pid]['graph_done_ts'] = parse_ts(m.group(1))
continue
m = pats['trav_start'].search(line)
if m:
pid = int(m.group(2))
P[pid]['trav_start_ts'] = parse_ts(m.group(1))
P[pid]['n_nodes'] = int(m.group(3))
continue
m = pats['trav_closing'].search(line)
if m:
pid = int(m.group(2))
P[pid]['trav_closing_ts'] = parse_ts(m.group(1))
continue
m = pats['trav_closed'].search(line)
if m:
pid = int(m.group(2))
P[pid]['trav_closed_ts'] = parse_ts(m.group(1))
continue
m = pats['graph_dropped'].search(line)
if m:
pid = int(m.group(2))
P[pid]['drop_ts'] = parse_ts(m.group(1))
P[pid]['n_unitigs'] = int(m.group(3))
continue
m = pats['mphf_done'].search(line)
if m:
pid = int(m.group(2))
P[pid]['mphf_done_ts'] = parse_ts(m.group(1))
continue
m = pats['mphf_open'].search(line)
if m:
pid = int(m.group(2))
P[pid]['mphf_open_s'] = float(m.group(3))
continue
m = pats['bld_ready'].search(line)
if m:
pid = int(m.group(2))
P[pid]['bld_ready_s'] = float(m.group(3))
continue
m = pats['pass2_done'].search(line)
if m:
pid = int(m.group(2))
P[pid]['pass2_s'] = float(m.group(3))
continue
m = pats['bld_closed'].search(line)
if m:
pid = int(m.group(2))
P[pid]['bld_closed_s'] = float(m.group(3))
continue
m = pats['part_done'].search(line)
if m:
pid = int(m.group(2))
P[pid]['total_s'] = float(m.group(3))
P[pid]['done_ts'] = parse_ts(m.group(1))
continue
m = pats['worker'].search(line)
if m:
workers_ev.append({'n': int(m.group(2)), 'eff': int(m.group(3)),
'gain': int(m.group(4)), 'ts': parse_ts(m.group(1)), 'poll': False})
continue
m = pats['worker_poll'].search(line)
if m:
workers_ev.append({'n': int(m.group(2)), 'eff': int(m.group(3)),
'gain': None, 'ts': parse_ts(m.group(1)), 'poll': True})
continue
m = pats['compute_deg'].search(line)
if m:
pid = int(m.group(2))
P[pid]['cdeg_s'] = float(m.group(3))
P[pid]['n_nodes'] = P[pid].get('n_nodes') or int(m.group(4))
continue
m = pats['stage_done'].search(line)
if m:
wall_total = float(m.group(2))
continue
m = pats['workers_rep'].search(line)
if m:
workers_final = (int(m.group(1)), int(m.group(2)))
continue
# ── derive per-partition phases ───────────────────────────────────────────────
def tsdiff(p, k1, k2):
if k1 in p and k2 in p:
return (p[k2] - p[k1]).total_seconds()
return None
phases = {}
for pid, p in P.items():
row = {'pid': pid}
row['n_kmers'] = p.get('n_kmers', 0)
row['n_nodes'] = p.get('n_nodes', 0)
row['n_unitigs']= p.get('n_unitigs', 0)
row['total_s'] = p.get('total_s')
row['cdeg_s'] = p.get('cdeg_s')
row['mphf_open_s'] = p.get('mphf_open_s')
row['bld_ready_s'] = p.get('bld_ready_s')
row['pass2_s'] = p.get('pass2_s')
row['bld_closed_s'] = p.get('bld_closed_s')
# Traversal: trav_start → trav_closing (= writing all unitigs)
row['trav_s'] = tsdiff(p, 'trav_start_ts', 'trav_closing_ts')
# Writer close: trav_closing → trav_closed
row['close_s'] = tsdiff(p, 'trav_closing_ts', 'trav_closed_ts')
# Graph drop: trav_closed → drop_ts
row['drop_s'] = tsdiff(p, 'trav_closed_ts', 'drop_ts')
# MPHF build: drop_ts → mphf_done_ts
row['mphf_s'] = tsdiff(p, 'drop_ts', 'mphf_done_ts')
# After MPHF: mphf_done → done_ts
row['post_s'] = tsdiff(p, 'mphf_done_ts', 'done_ts')
# Graph build: total - known phases (rough estimate)
known = sum(v for v in [row['cdeg_s'], row['trav_s'], row['close_s'], row['drop_s'],
row['mphf_s'], row['mphf_open_s'], row['bld_ready_s'],
row['pass2_s'], row['bld_closed_s']] if v is not None)
row['graph_build_s'] = (row['total_s'] - known) if row['total_s'] else None
phases[pid] = row
# helpers
def collect(key):
return [r[key] for r in phases.values() if r.get(key) is not None]
def rate_stats(n_key, t_key):
"""Returns list of throughput values (items/s)."""
result = []
for r in phases.values():
n, t = r.get(n_key), r.get(t_key)
if n and t and t > 0:
result.append(n / t)
return result
# ── output ────────────────────────────────────────────────────────────────────
out = []
w = out.append
w("# obikmer merge — performance report\n")
# Run info
n_parts = len([r for r in phases.values() if r['n_kmers'] > 0])
n_empty = len([r for r in phases.values() if r['n_kmers'] == 0])
total_kmers = sum(r['n_kmers'] for r in phases.values())
w("## Run summary\n")
w(f"- **Partitions**: {len(phases)} total — {n_parts} non-empty, {n_empty} empty")
w(f"- **New kmers (total)**: {total_kmers:,}")
if wall_total:
w(f"- **merge_partitions wall time**: {fmt_s(wall_total)}")
if workers_final[0]:
w(f"- **Workers spawned**: {workers_final[0]} / {workers_final[1]} (max)")
w("")
# Worker spawn timeline
if workers_ev:
w("## Worker activation\n")
w("| Time | Worker # | Trigger | Efficiency | Gain vs prev |")
w("|------|----------|---------|------------|--------------|")
t0 = workers_ev[0]['ts']
for e in workers_ev:
elapsed = fmt_s((e['ts'] - t0).total_seconds())
trigger = "poll (timeout)" if e['poll'] else "partition done"
gain = f"{e['gain']}%" if e.get('gain') is not None else ""
w(f"| +{elapsed} | {e['n']} | {trigger} | {e['eff']}% | {gain} |")
w("")
# Phase breakdown table
w("## Phase timing statistics\n")
w("Columns: min | median | mean | max | stdev\n")
w("| Phase | min | median | mean | max | stdev |")
w("|-------|-----|--------|------|-----|-------|")
w(stats_row("Graph build (estimated)", collect('graph_build_s')))
w(stats_row("compute_degrees", collect('cdeg_s')))
w(stats_row("Unitig traversal", collect('trav_s')))
w(stats_row("Writer close (uw.close)", collect('close_s')))
w(stats_row("Graph drop", collect('drop_s')))
w(stats_row("MPHF build", collect('mphf_s')))
w(stats_row("MPHF open", collect('mphf_open_s')))
w(stats_row("Builders ready", collect('bld_ready_s')))
w(stats_row("Pass2 pipeline", collect('pass2_s')))
w(stats_row("Builders close", collect('bld_closed_s')))
w(stats_row("Post-MPHF (residual)", collect('post_s')))
w(stats_row("**Total per partition**", collect('total_s')))
w("")
# Throughput
w("## Throughput by phase\n")
w("| Phase | metric | min | median | mean | max |")
w("|-------|--------|-----|--------|------|-----|")
def rate_row(label, rates):
if not rates: return f"| {label} | — | — | — | — | — |"
f = lambda x: fmt_rate(x, 1)
mn, med, av, mx = min(rates), median(rates), mean(rates), max(rates)
return f"| {label} | nodes/s | {f(mn)} | {f(med)} | {f(av)} | {f(mx)} |"
w(rate_row("compute_degrees", rate_stats('n_nodes', 'cdeg_s')))
w(rate_row("Unitig traversal", rate_stats('n_nodes', 'trav_s')))
w(rate_row("MPHF build", rate_stats('n_unitigs', 'mphf_s')))
w("")
# Top 10 slowest partitions
w("## Top 10 slowest partitions\n")
w("| Partition | nodes | unitigs | total | trav | MPHF | graph build |")
w("|-----------|-------|---------|-------|------|------|-------------|")
sorted_parts = sorted(phases.values(), key=lambda r: r['total_s'] or 0, reverse=True)
for r in sorted_parts[:10]:
pid = r['pid']
def f(k): return fmt_s(r[k]) if r.get(k) is not None else ""
nodes = f"{r['n_nodes']/1e6:.1f}M" if r['n_nodes'] else ""
unitigs = f"{r['n_unitigs']/1e6:.1f}M" if r['n_unitigs'] else ""
w(f"| {pid} | {nodes} | {unitigs} | {f('total_s')} | {f('trav_s')} | {f('mphf_s')} | {f('graph_build_s')} |")
w("")
# Phase share of total time (for non-empty partitions with full data)
complete = [r for r in phases.values()
if all(r.get(k) is not None
for k in ('total_s','trav_s','close_s','drop_s','mphf_s',
'mphf_open_s','bld_ready_s','pass2_s','bld_closed_s'))
and r['total_s'] and r['total_s'] > 0]
if complete:
w("## Phase share of total time (mean across complete partitions)\n")
total_mean = mean(r['total_s'] for r in complete)
w(f"_Based on {len(complete)} partitions with full timing data. Mean total: {fmt_s(total_mean)}_\n")
w("| Phase | mean time | share |")
w("|-------|-----------|-------|")
for label, key in [
("Graph build", 'graph_build_s'),
("compute_degrees", 'cdeg_s'),
("Unitig traversal", 'trav_s'),
("Writer close", 'close_s'),
("Graph drop", 'drop_s'),
("MPHF build", 'mphf_s'),
("MPHF open", 'mphf_open_s'),
("Builders ready", 'bld_ready_s'),
("Pass2 pipeline", 'pass2_s'),
("Builders close", 'bld_closed_s'),
("Post-MPHF (residual)", 'post_s'),
]:
vals = [r[key] for r in complete]
m = mean(vals)
w(f"| {label} | {fmt_s(m)} | {pct(m, total_mean)} |")
w("")
print('\n'.join(out))
+310 -6
View File
@@ -128,6 +128,12 @@ version = "0.4.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "2ad8689a486416c401ea15715a4694de30054248ec627edbf31f49cb64ee4086"
[[package]]
name = "arrayvec"
version = "0.7.6"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "7c02d123df017efcdfbd739ef81735b36c5ba83ec3c59c80a9d7ecc718f92e50"
[[package]]
name = "as-slice"
version = "0.2.1"
@@ -143,6 +149,15 @@ version = "1.5.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "c08606f8c3cbf4ce6ec8e28fb0014a2c086708fe954eaa885384a6165172e7e8"
[[package]]
name = "autotools"
version = "0.2.7"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "ef941527c41b0fc0dd48511a8154cd5fc7e29200a0ff8b7203c5d777dbc795cf"
dependencies = [
"cc",
]
[[package]]
name = "backtrace"
version = "0.3.76"
@@ -224,6 +239,15 @@ dependencies = [
"generic-array",
]
[[package]]
name = "block-buffer"
version = "0.12.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "d2f6c7dbe95a6ed67ad9f18e57daf93a2f034c524b99fd2b76d18fdfeb6660aa"
dependencies = [
"hybrid-array",
]
[[package]]
name = "block-pseudorand"
version = "0.1.2"
@@ -415,6 +439,15 @@ version = "1.1.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "c8d4a3bb8b1e0c1050499d1815f5ab16d04f0959b233085fb31653fbfc9d98f9"
[[package]]
name = "cmake"
version = "0.1.58"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "c0f78a02292a74a88ac736019ab962ece0bc380e3f977bf72e376c5d78ff0678"
dependencies = [
"cc",
]
[[package]]
name = "colorchoice"
version = "1.0.5"
@@ -464,6 +497,21 @@ dependencies = [
"windows-sys 0.59.0",
]
[[package]]
name = "const-oid"
version = "0.10.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "a6ef517f0926dd24a1582492c791b6a4818a4d94e789a334894aa15b0d12f55c"
[[package]]
name = "convert_case"
version = "0.10.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "633458d4ef8c78b72454de2d54fd6ab2e60f9e02be22f3c6104cdc8a4e0fceb9"
dependencies = [
"unicode-segmentation",
]
[[package]]
name = "core-foundation-sys"
version = "0.8.7"
@@ -488,6 +536,15 @@ dependencies = [
"libc",
]
[[package]]
name = "cpufeatures"
version = "0.3.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "8b2a41393f66f16b0823bb79094d54ac5fbd34ab292ddafb9a0456ac9f87d201"
dependencies = [
"libc",
]
[[package]]
name = "crc32fast"
version = "1.5.0"
@@ -601,6 +658,15 @@ dependencies = [
"typenum",
]
[[package]]
name = "crypto-common"
version = "0.2.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "ce6e4c961d6cd6c9a86db418387425e8bdeaf05b3c8bc1411e6dca4c252f1453"
dependencies = [
"hybrid-array",
]
[[package]]
name = "csv"
version = "1.4.0"
@@ -640,14 +706,48 @@ dependencies = [
"uuid",
]
[[package]]
name = "derive_more"
version = "2.1.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "d751e9e49156b02b44f9c1815bcb94b984cdcc4396ecc32521c739452808b134"
dependencies = [
"derive_more-impl",
]
[[package]]
name = "derive_more-impl"
version = "2.1.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "799a97264921d8623a957f6c3b9011f3b5492f557bbb7a5a19b7fa6d06ba8dcb"
dependencies = [
"convert_case",
"proc-macro2",
"quote",
"rustc_version",
"syn",
"unicode-xid",
]
[[package]]
name = "digest"
version = "0.10.7"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "9ed9a281f7bc9b7576e61468ba615a66a5c8cfdff42420a70aa82701a3b1e292"
dependencies = [
"block-buffer",
"crypto-common",
"block-buffer 0.10.4",
"crypto-common 0.1.7",
]
[[package]]
name = "digest"
version = "0.11.3"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "f1dd6dbb5841937940781866fa1281a1ff7bd3bf827091440879f9994983d5c2"
dependencies = [
"block-buffer 0.12.1",
"const-oid",
"crypto-common 0.2.2",
]
[[package]]
@@ -742,6 +842,16 @@ version = "2.4.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "9f1f227452a390804cdb637b74a86990f2a7d7ba4b7d5693aac9b4dd6defd8d6"
[[package]]
name = "filetime"
version = "0.2.29"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "5c287a33c7f0a620c38e641e7f60827713987b3c0f26e8ddc9462cc69cf75759"
dependencies = [
"cfg-if",
"libc",
]
[[package]]
name = "find-msvc-tools"
version = "0.1.9"
@@ -916,6 +1026,65 @@ version = "0.5.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "fc0fef456e4baa96da950455cd02c081ca953b141298e41db3fc7e36b1da849c"
[[package]]
name = "http"
version = "1.4.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "6970f50e31d6fc17d3fa27329444bfa74e196cf62e95052a3f6fee181dba6425"
dependencies = [
"bytes",
"itoa",
]
[[package]]
name = "httparse"
version = "1.10.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "6dbf3de79e51f3d586ab4cb9d5c3e2c14aa28ed23d180cf89b4df0454a69cc87"
[[package]]
name = "hwlocality"
version = "1.0.0-alpha.12"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "4c2e65a48d3b300843ac84a2fe8e166bb5a5b00f30054593bcee8157e4b465fd"
dependencies = [
"arrayvec",
"bitflags 2.11.1",
"derive_more",
"errno",
"hwlocality-sys",
"libc",
"strum",
"thiserror 2.0.18",
"windows-sys 0.61.2",
]
[[package]]
name = "hwlocality-sys"
version = "0.7.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "10a83c43a772c1f774b806deb44891c2a9578eb33cec48aad513482e0da3d4d4"
dependencies = [
"autotools",
"cmake",
"flate2",
"libc",
"pkg-config",
"sha3",
"tar",
"ureq 3.3.0",
"windows-sys 0.61.2",
]
[[package]]
name = "hybrid-array"
version = "0.4.12"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "9155a582abd142abc056962c29e3ce5ff2ad5469f4246b537ed42c5deba857da"
dependencies = [
"typenum",
]
[[package]]
name = "icu_collections"
version = "2.2.0"
@@ -1145,6 +1314,16 @@ dependencies = [
"wasm-bindgen",
]
[[package]]
name = "keccak"
version = "0.2.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "9e24a010dd405bd7ed803e5253182815b41bf2e6a80cc3bfc066658e03a198aa"
dependencies = [
"cfg-if",
"cpufeatures 0.3.0",
]
[[package]]
name = "kodama"
version = "0.2.3"
@@ -1486,10 +1665,12 @@ name = "obidebruinj"
version = "0.1.0"
dependencies = [
"ahash",
"crossbeam-channel",
"hashbrown 0.14.5",
"obifastwrite",
"obikseq",
"rayon",
"tracing",
"xxhash-rust",
]
@@ -1505,6 +1686,8 @@ dependencies = [
name = "obikindex"
version = "0.1.0"
dependencies = [
"crossbeam-channel",
"hwlocality",
"indicatif",
"ndarray",
"obicompactvec",
@@ -1521,7 +1704,7 @@ dependencies = [
[[package]]
name = "obikmer"
version = "0.1.0"
version = "1.1.33"
dependencies = [
"clap",
"csv",
@@ -1539,6 +1722,7 @@ dependencies = [
"obiskbuilder",
"obiskio",
"obisys",
"obitaxonomy",
"pprof",
"rayon",
"serde_json",
@@ -1561,6 +1745,7 @@ dependencies = [
"obikrope",
"obikseq",
"obilayeredmap",
"obipipeline",
"obiread",
"obiskbuilder",
"obiskio",
@@ -1632,7 +1817,7 @@ dependencies = [
"regex",
"tracing",
"tracing-subscriber",
"ureq",
"ureq 2.12.1",
]
[[package]]
@@ -1666,8 +1851,13 @@ dependencies = [
"indicatif",
"libc",
"sysinfo",
"tracing",
]
[[package]]
name = "obitaxonomy"
version = "0.1.0"
[[package]]
name = "object"
version = "0.37.3"
@@ -2172,6 +2362,15 @@ version = "2.1.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "94300abf3f1ae2e2b8ffb7b58043de3d399c73fa6f4b73826402a5c457614dbe"
[[package]]
name = "rustc_version"
version = "0.4.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "cfcb3a22ef46e85b45de6ee7e79d063319ebb6594faafcf1c225ea92ab6e9b92"
dependencies = [
"semver",
]
[[package]]
name = "rustix"
version = "1.1.4"
@@ -2258,6 +2457,12 @@ dependencies = [
"syn",
]
[[package]]
name = "semver"
version = "1.0.28"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "8a7852d02fc848982e0c167ef163aaff9cd91dc640ba85e263cb1ce46fae51cd"
[[package]]
name = "serde"
version = "1.0.228"
@@ -2308,8 +2513,18 @@ source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "a7507d819769d01a365ab707794a4084392c824f54a7a6a7862f8c3d0892b283"
dependencies = [
"cfg-if",
"cpufeatures",
"digest",
"cpufeatures 0.2.17",
"digest 0.10.7",
]
[[package]]
name = "sha3"
version = "0.11.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "be176f1a57ce4e3d31c1a166222d9768de5954f811601fb7ca06fc8203905ce1"
dependencies = [
"digest 0.11.3",
"keccak",
]
[[package]]
@@ -2370,6 +2585,27 @@ version = "0.11.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "7da8b5736845d9f2fcb837ea5d9e2628564b3b043a70948a3f0b778838c5fb4f"
[[package]]
name = "strum"
version = "0.28.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "9628de9b8791db39ceda2b119bbe13134770b56c138ec1d3af810d045c04f9bd"
dependencies = [
"strum_macros",
]
[[package]]
name = "strum_macros"
version = "0.28.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "ab85eea0270ee17587ed4156089e10b9e6880ee688791d45a905f5b1ca36f664"
dependencies = [
"heck",
"proc-macro2",
"quote",
"syn",
]
[[package]]
name = "subtle"
version = "2.6.1"
@@ -2465,6 +2701,17 @@ version = "1.0.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "55937e1799185b12863d447f42597ed69d9928686b8d88a1df17376a097d8369"
[[package]]
name = "tar"
version = "0.4.46"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "3f6221d9a6003c78398e3b239969f352578258df48c8eb051caadae0015bc840"
dependencies = [
"filetime",
"libc",
"xattr",
]
[[package]]
name = "tempfile"
version = "3.27.0"
@@ -2640,12 +2887,24 @@ version = "1.0.24"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "e6e4313cd5fcd3dad5cafa179702e2b244f760991f45397d14d4ebf38247da75"
[[package]]
name = "unicode-segmentation"
version = "1.13.3"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "c6f5d3c3b1bf09027a88a6bc961fc00497d651009560b5463668dc81b0fa87a8"
[[package]]
name = "unicode-width"
version = "0.2.2"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "b4ac048d71ede7ee76d585517add45da530660ef4390e49b098733c6e897f254"
[[package]]
name = "unicode-xid"
version = "0.2.6"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "ebc1c04c71510c7f702b52b7c350734c9ff1295c464a03335b00bb84fc54f853"
[[package]]
name = "untrusted"
version = "0.9.0"
@@ -2668,6 +2927,35 @@ dependencies = [
"webpki-roots 0.26.11",
]
[[package]]
name = "ureq"
version = "3.3.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "dea7109cdcd5864d4eeb1b58a1648dc9bf520360d7af16ec26d0a9354bafcfc0"
dependencies = [
"base64",
"flate2",
"log",
"percent-encoding",
"rustls",
"rustls-pki-types",
"ureq-proto",
"utf8-zero",
"webpki-roots 1.0.7",
]
[[package]]
name = "ureq-proto"
version = "0.6.0"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "e994ba84b0bd1b1b0cf92878b7ef898a5c1760108fe7b6010327e274917a808c"
dependencies = [
"base64",
"http",
"httparse",
"log",
]
[[package]]
name = "url"
version = "2.5.8"
@@ -2680,6 +2968,12 @@ dependencies = [
"serde",
]
[[package]]
name = "utf8-zero"
version = "0.8.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "b8c0a043c9540bae7c578c88f91dda8bd82e59ae27c21baca69c8b191aaf5a6e"
[[package]]
name = "utf8_iter"
version = "1.0.4"
@@ -3105,6 +3399,16 @@ dependencies = [
"tap",
]
[[package]]
name = "xattr"
version = "1.6.1"
source = "registry+https://github.com/rust-lang/crates.io-index"
checksum = "32e45ad4206f6d2479085147f02bc2ef834ac85886624a23575ae137c8aa8156"
dependencies = [
"libc",
"rustix",
]
[[package]]
name = "xxhash-rust"
version = "0.8.15"
+1 -1
View File
@@ -1,5 +1,5 @@
[workspace]
resolver = "3"
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex"]
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy"]
[profile.release]
debug = 1
+1 -1
View File
@@ -7,6 +7,6 @@ edition = "2024"
memmap2 = "0.9"
ndarray = "0.16"
rayon = "1"
tempfile = "3"
[dev-dependencies]
tempfile = "3"
+226 -79
View File
@@ -1,5 +1,5 @@
use std::fs::{self, File};
use std::io::{self, Write as _};
use std::io::{self, BufWriter, Write as _};
use std::path::{Path, PathBuf};
use memmap2::Mmap;
@@ -7,8 +7,12 @@ use ndarray::{Array1, Array2};
use rayon::prelude::*;
use crate::bitvec::{PersistentBitVec, PersistentBitVecBuilder};
use crate::colgroup::{ColGroup, MatrixGroupOps};
use crate::layer_meta::LayerMeta;
use crate::meta::MatrixMeta;
use crate::tempbitvec::{TempBitVec, TempBitVecBuilder};
use crate::tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
use crate::views::BitSliceView;
fn col_path(dir: &Path, col: usize) -> PathBuf {
dir.join(format!("col_{col:06}.pbiv"))
@@ -53,52 +57,12 @@ impl ColumnarBitMatrix {
Array1::from_vec(counts)
}
pub(crate) fn jaccard_dist_matrix(&self) -> Array2<f64> {
self.pairwise_f64(|i, j| self.col(i).jaccard_dist(self.col(j)))
}
pub(crate) fn hamming_dist_matrix(&self) -> Array2<u64> {
self.pairwise_u64(|i, j| self.col(i).hamming_dist(self.col(j)))
}
pub(crate) fn partial_jaccard_dist_matrix(&self) -> (Array2<u64>, Array2<u64>) {
let n = self.n_cols();
let results: Vec<(usize, usize, u64, u64)> = upper_pairs(n)
.into_par_iter()
.map(|(i, j)| {
let (inter, union) = self.col(i).partial_jaccard_dist(self.col(j));
(i, j, inter, union)
})
.collect();
let mut inter_m = Array2::zeros((n, n));
let mut union_m = Array2::zeros((n, n));
for (i, j, inter, union) in results {
inter_m[[i, j]] = inter; inter_m[[j, i]] = inter;
union_m[[i, j]] = union; union_m[[j, i]] = union;
}
(inter_m, union_m)
pairwise2_matrix(self.n_cols(), |i, j| self.col(i).partial_jaccard_dist(self.col(j)))
}
pub(crate) fn partial_hamming_dist_matrix(&self) -> Array2<u64> {
self.pairwise_u64(|i, j| self.col(i).hamming_dist(self.col(j)))
}
fn pairwise_f64(&self, f: impl Fn(usize, usize) -> f64 + Sync) -> Array2<f64> {
let n = self.n_cols();
let results: Vec<(usize, usize, f64)> = upper_pairs(n)
.into_par_iter()
.map(|(i, j)| (i, j, f(i, j)))
.collect();
fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)))
}
fn pairwise_u64(&self, f: impl Fn(usize, usize) -> u64 + Sync) -> Array2<u64> {
let n = self.n_cols();
let results: Vec<(usize, usize, u64)> = upper_pairs(n)
.into_par_iter()
.map(|(i, j)| (i, j, f(i, j)))
.collect();
fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)))
pairwise_matrix(self.n_cols(), |i, j| self.col(i).hamming_dist(self.col(j)))
}
pub(crate) fn append_column(dir: &Path, value_of: impl Fn(usize) -> bool) -> io::Result<()> {
@@ -163,34 +127,93 @@ impl PackedBitMatrix {
(self.mmap[self.data_offsets[c] + (slot >> 3)] >> (slot & 7)) & 1 != 0
}).collect()
}
fn col_bytes(&self, c: usize) -> &[u8] {
let start = self.data_offsets[c];
&self.mmap[start..start + self.n_rows.div_ceil(8)]
}
fn col_words(&self, c: usize) -> &[u64] {
let nw = self.n_rows.div_ceil(64);
// SAFETY: data_offsets[c] is always 8-byte aligned.
// PBMX header = 24 + n_cols×8 (multiple of 8); each PBIV blob =
// 16 + nwords×8 (multiple of 8); mmap base is page-aligned.
let ptr = self.mmap[self.data_offsets[c]..].as_ptr() as *const u64;
unsafe { std::slice::from_raw_parts(ptr, nw) }
}
pub(crate) fn col_slice(&self, c: usize) -> BitSliceView<'_> {
BitSliceView::new(self.col_words(c), self.n_rows)
}
pub(crate) fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentBitVecBuilder> {
PersistentBitVecBuilder::from_raw_bytes(self.col_bytes(c), self.n_rows, path)
}
pub(crate) fn count_ones(&self) -> Array1<u64> {
Array1::from_vec(
(0..self.n_cols).into_par_iter()
.map(|c| self.col_slice(c).count_ones())
.collect()
)
}
pub(crate) fn partial_jaccard_dist_matrix(&self) -> (Array2<u64>, Array2<u64>) {
pairwise2_matrix(self.n_cols, |i, j| {
self.col_slice(i).partial_jaccard_dist(self.col_slice(j))
})
}
pub(crate) fn partial_hamming_dist_matrix(&self) -> Array2<u64> {
pairwise_matrix(self.n_cols, |i, j| {
self.col_slice(i).hamming_dist(self.col_slice(j))
})
}
}
/// Build `presence/matrix.pbmx` from existing `col_*.pbiv` files.
pub fn pack_bit_matrix(dir: &Path) -> io::Result<()> {
let packed_path = dir.join("matrix.pbmx");
if packed_path.exists() {
// Matrix complete; remove any leftover column files from a killed cleanup.
if let Ok(meta) = MatrixMeta::load(dir) {
for c in 0..meta.n_cols { let _ = fs::remove_file(col_path(dir, c)); }
let _ = fs::remove_file(dir.join("meta.json"));
}
return Ok(());
}
let meta = MatrixMeta::load(dir)?;
let n_cols = meta.n_cols;
let col_files: Vec<Vec<u8>> = (0..n_cols)
.map(|c| fs::read(col_path(dir, c)))
// Compute offsets from file sizes — no column data loaded into RAM.
let col_sizes: Vec<u64> = (0..n_cols)
.map(|c| fs::metadata(col_path(dir, c)).map(|m| m.len()))
.collect::<io::Result<_>>()?;
let header_size = PBMX_HEADER + n_cols * 8;
let header_size = (PBMX_HEADER + n_cols * 8) as u64;
let mut col_offset = header_size;
let mut offsets = Vec::with_capacity(n_cols);
for data in &col_files {
offsets.push(col_offset as u64);
col_offset += data.len();
for &size in &col_sizes {
offsets.push(col_offset);
col_offset += size;
}
let packed_path = dir.join("matrix.pbmx");
let mut file = File::create(&packed_path)?;
file.write_all(&PBMX_MAGIC)?;
file.write_all(&[0u8; 4])?;
file.write_all(&(meta.n as u64).to_le_bytes())?;
file.write_all(&(n_cols as u64).to_le_bytes())?;
for &off in &offsets { file.write_all(&off.to_le_bytes())?; }
for data in &col_files { file.write_all(data)?; }
drop(file);
// Write to a temp file; rename atomically so a killed process never leaves
// a truncated matrix.pbmx that would be mistaken for a complete file.
let tmp_path = dir.join("matrix.pbmx.tmp");
let mut out = BufWriter::new(File::create(&tmp_path)?);
out.write_all(&PBMX_MAGIC)?;
out.write_all(&[0u8; 4])?;
out.write_all(&(meta.n as u64).to_le_bytes())?;
out.write_all(&(n_cols as u64).to_le_bytes())?;
for &off in &offsets { out.write_all(&off.to_le_bytes())?; }
for c in 0..n_cols {
io::copy(&mut File::open(col_path(dir, c))?, &mut out)?;
}
out.flush()?;
drop(out);
fs::rename(&tmp_path, &packed_path)?;
for c in 0..n_cols { fs::remove_file(col_path(dir, c))?; }
fs::remove_file(dir.join("meta.json"))?;
@@ -263,6 +286,24 @@ impl PersistentBitMatrix {
}
}
pub fn col_view(&self, c: usize) -> BitSliceView<'_> {
match self {
Self::Columnar(m) => m.col(c).view(),
Self::Packed(m) => m.col_slice(c),
Self::Implicit { .. } => panic!("col_view() not available on Implicit PersistentBitMatrix"),
}
}
pub fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentBitVecBuilder> {
match self {
Self::Columnar(m) => PersistentBitVecBuilder::build_from(m.col(c), path),
Self::Packed(m) => m.col_persist(c, path),
Self::Implicit { n_rows, .. } => {
PersistentBitVecBuilder::new_ones(*n_rows, path)
}
}
}
pub fn row(&self, slot: usize) -> Box<[bool]> {
match self {
Self::Columnar(m) => m.row(slot),
@@ -282,36 +323,34 @@ impl PersistentBitMatrix {
pub fn count_ones(&self) -> Array1<u64> {
match self {
Self::Columnar(m) => m.count_ones(),
_ => panic!("count_ones() only available on Columnar PersistentBitMatrix"),
}
}
pub fn jaccard_dist_matrix(&self) -> Array2<f64> {
match self {
Self::Columnar(m) => m.jaccard_dist_matrix(),
_ => panic!("jaccard_dist_matrix() only available on Columnar PersistentBitMatrix"),
}
}
pub fn hamming_dist_matrix(&self) -> Array2<u64> {
match self {
Self::Columnar(m) => m.hamming_dist_matrix(),
_ => panic!("hamming_dist_matrix() only available on Columnar PersistentBitMatrix"),
Self::Columnar(m) => m.count_ones(),
Self::Packed(m) => m.count_ones(),
Self::Implicit { n_rows, n_cols } => Array1::from_elem(*n_cols, *n_rows as u64),
}
}
pub fn partial_jaccard_dist_matrix(&self) -> (Array2<u64>, Array2<u64>) {
match self {
Self::Columnar(m) => m.partial_jaccard_dist_matrix(),
_ => panic!("partial_jaccard_dist_matrix() only available on Columnar PersistentBitMatrix"),
Self::Columnar(m) => m.partial_jaccard_dist_matrix(),
Self::Packed(m) => m.partial_jaccard_dist_matrix(),
Self::Implicit { n_rows, n_cols } => {
let v = *n_rows as u64;
let n = *n_cols;
let mut inter = Array2::zeros((n, n));
let mut union = Array2::zeros((n, n));
for i in 0..n { for j in 0..n {
inter[[i, j]] = v; union[[i, j]] = v;
}}
(inter, union)
}
}
}
pub fn partial_hamming_dist_matrix(&self) -> Array2<u64> {
match self {
Self::Columnar(m) => m.partial_hamming_dist_matrix(),
_ => panic!("partial_hamming_dist_matrix() only available on Columnar PersistentBitMatrix"),
Self::Columnar(m) => m.partial_hamming_dist_matrix(),
Self::Packed(m) => m.partial_hamming_dist_matrix(),
Self::Implicit { n_cols, .. } => Array2::zeros((*n_cols, *n_cols)),
}
}
@@ -361,12 +400,93 @@ impl PersistentBitMatrixBuilder {
PersistentBitVecBuilder::new(self.n, &path)
}
pub fn add_col_ones(&mut self) -> io::Result<PersistentBitVecBuilder> {
let path = col_path(&self.dir, self.n_cols);
self.n_cols += 1;
PersistentBitVecBuilder::new_ones(self.n, &path)
}
pub fn add_col_from(&mut self, src: &TempBitVec) -> io::Result<()> {
src.make_persistent(&col_path(&self.dir, self.n_cols))?;
self.n_cols += 1;
Ok(())
}
pub fn add_col_from_int(&mut self, src: &TempCompactIntVec) -> io::Result<()> {
let path = col_path(&self.dir, self.n_cols);
self.n_cols += 1;
let mut b = PersistentBitVecBuilder::new(self.n, &path)?;
b.or_where(src.view(), |v| v > 0);
b.close()
}
pub fn close(self) -> io::Result<()> {
MatrixMeta { n: self.n, n_cols: self.n_cols }.save(&self.dir)
}
}
// ── Helpers ───────────────────────────────────────────────────────────────────
// ── MatrixGroupOps ────────────────────────────────────────────────────────────
impl MatrixGroupOps for PersistentBitMatrix {
fn partial_group_presence_count(&self, g: &ColGroup, _threshold: u32) -> io::Result<TempCompactIntVec> {
// Bit matrices store 0/1 — threshold is structurally always 1.
let n = self.n();
if g.indices.len() < 255 {
let mut builder = TempCompactIntVecBuilder::new(n)?;
for &c in &g.indices {
builder.inc_present_fast(self.col_view(c));
}
builder.freeze()
} else {
let mut result = TempCompactIntVecBuilder::new(n)?;
for chunk in g.indices.chunks(254) {
let mut chunk_b = TempCompactIntVecBuilder::new(n)?;
for &c in chunk {
chunk_b.inc_present_fast(self.col_view(c));
}
let frozen = chunk_b.freeze()?;
result.add(frozen.view());
}
result.freeze()
}
}
fn partial_group_sum(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
// For bit matrices, sum = count of 1-bits — identical to presence_count.
self.partial_group_presence_count(g, 1)
}
fn partial_group_any(&self, g: &ColGroup, _threshold: u32) -> io::Result<TempBitVec> {
let n = self.n();
let mut result = TempBitVecBuilder::new(n)?;
for &c in &g.indices {
result.or(self.col_view(c));
}
result.freeze()
}
fn partial_group_min(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
// min of 0/1 values = AND: 1 only if ALL columns are 1
let n = self.n();
let mut result = TempCompactIntVecBuilder::new(n)?;
if let Some((&first, rest)) = g.indices.split_first() {
result.inc_present_fast(self.col_view(first));
for &c in rest { result.mask_with(self.col_view(c)); }
}
result.freeze()
}
fn partial_group_max(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
// max of 0/1 values = OR: 1 if any column is 1
let any = self.partial_group_any(g, 1)?;
let n = any.len();
let mut result = TempCompactIntVecBuilder::new(n)?;
result.inc_present(any.view());
result.freeze()
}
}
// ── Shared matrix helpers (also used by intmatrix.rs) ─────────────────────────
fn upper_pairs(n: usize) -> Vec<(usize, usize)> {
(0..n).flat_map(|i| (i + 1..n).map(move |j| (i, j))).collect()
@@ -378,3 +498,30 @@ where T: Clone + Default {
for (i, j, vij, vji) in vals { m[[i, j]] = vij; m[[j, i]] = vji; }
m
}
/// Compute a symmetric `n×n` matrix in parallel by evaluating `f(i,j)` for
/// all upper-triangle pairs. `T: Copy` avoids the `.clone()` needed for the
/// lower-triangle mirror.
pub(crate) fn pairwise_matrix<T>(n: usize, f: impl Fn(usize, usize) -> T + Sync) -> Array2<T>
where T: Copy + Default + Send {
let results: Vec<(usize, usize, T)> = upper_pairs(n)
.into_par_iter().map(|(i, j)| (i, j, f(i, j))).collect();
fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)))
}
/// Same as `pairwise_matrix` but `f` returns two values that fill two
/// symmetric matrices simultaneously (e.g. intersection + union for Jaccard).
pub(crate) fn pairwise2_matrix<T>(n: usize, f: impl Fn(usize, usize) -> (T, T) + Sync) -> (Array2<T>, Array2<T>)
where T: Copy + Default + Send {
let results: Vec<(usize, usize, T, T)> = upper_pairs(n)
.into_par_iter()
.map(|(i, j)| { let (a, b) = f(i, j); (i, j, a, b) })
.collect();
let mut m0 = Array2::from_elem((n, n), T::default());
let mut m1 = Array2::from_elem((n, n), T::default());
for (i, j, a, b) in results {
m0[[i, j]] = a; m0[[j, i]] = a;
m1[[i, j]] = b; m1[[j, i]] = b;
}
(m0, m1)
}
+221 -179
View File
@@ -5,29 +5,25 @@ use std::path::{Path, PathBuf};
use memmap2::{Mmap, MmapMut};
use crate::reader::PersistentCompactIntVec;
use crate::views::{BitSliceIter, BitSliceView, IntSliceView};
const MAGIC: [u8; 4] = *b"PBIV";
// Header: magic(4) + _pad(4) + n(8) = 16 bytes.
// Data starts at offset 16, which is divisible by 8 → u64-aligned
// (mmap base is page-aligned, 16 % 8 == 0).
// Data starts at offset 16, u64-aligned (mmap base is page-aligned, 16 % 8 == 0).
const HEADER_SIZE: usize = 16;
#[inline]
fn n_words(n: usize) -> usize {
n.div_ceil(64)
}
pub(crate) fn n_words(n: usize) -> usize { n.div_ceil(64) }
#[inline]
fn n_bytes_for_words(n: usize) -> usize {
n_words(n) * 8
}
fn n_bytes_for_words(n: usize) -> usize { n_words(n) * 8 }
// ── Reader ────────────────────────────────────────────────────────────────────
// ── PersistentBitVec ──────────────────────────────────────────────────────────
pub struct PersistentBitVec {
mmap: Mmap,
n: usize,
n: usize,
path: PathBuf,
}
@@ -35,157 +31,145 @@ impl PersistentBitVec {
pub fn open(path: &Path) -> io::Result<Self> {
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
if mmap.len() < HEADER_SIZE {
return Err(io::Error::new(
io::ErrorKind::InvalidData,
"PBIV file too short",
));
return Err(io::Error::new(io::ErrorKind::InvalidData, "PBIV file too short"));
}
if &mmap[0..4] != &MAGIC {
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PBIV magic"));
}
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
Ok(Self {
mmap,
n,
path: path.to_path_buf(),
})
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn path(&self) -> &Path {
&self.path
}
pub fn len(&self) -> usize {
self.n
}
pub fn is_empty(&self) -> bool {
self.n == 0
}
pub fn path(&self) -> &Path { &self.path }
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn get(&self, slot: usize) -> bool {
(self.mmap[HEADER_SIZE + (slot >> 3)] >> (slot & 7)) & 1 != 0
}
// Used by iter() and get(): exact byte window, no padding.
fn data_bytes(&self) -> &[u8] {
&self.mmap[HEADER_SIZE..HEADER_SIZE + self.n.div_ceil(8)]
}
// Bulk word view. SAFETY: mmap is page-aligned, HEADER_SIZE=16 is divisible by 8,
// so &mmap[HEADER_SIZE] is u64-aligned. Slice length is n_words * 8 bytes.
// SAFETY: mmap is page-aligned, HEADER_SIZE=16 divisible by 8 → u64-aligned.
fn data_words(&self) -> &[u64] {
let nw = n_words(self.n);
let nw = n_words(self.n);
let ptr = self.mmap[HEADER_SIZE..].as_ptr() as *const u64;
unsafe { std::slice::from_raw_parts(ptr, nw) }
}
pub fn count_ones(&self) -> u64 {
// Padding bits in the last word are 0, so no masking needed.
self.data_words()
.iter()
.map(|w| w.count_ones() as u64)
.sum()
pub fn view(&self) -> BitSliceView<'_> {
BitSliceView::new(self.data_words(), self.n)
}
pub fn count_zeros(&self) -> u64 {
self.n as u64 - self.count_ones()
}
pub fn words(&self) -> &[u64] { self.data_words() }
pub fn jaccard_dist(&self, other: &PersistentBitVec) -> f64 {
let (inter, union) = self.partial_jaccard_dist(other);
if union == 0 {
return 0.0;
}
1.0 - inter as f64 / union as f64
}
pub fn count_ones(&self) -> u64 { self.view().count_ones() }
pub fn count_zeros(&self) -> u64 { self.view().count_zeros() }
pub fn partial_jaccard_dist(&self, other: &PersistentBitVec) -> (u64, u64) {
assert_eq!(self.n, other.n, "length mismatch");
self.data_words()
.iter()
.zip(other.data_words())
.fold((0u64, 0u64), |(i, u), (&a, &b)| {
(
i + (a & b).count_ones() as u64,
u + (a | b).count_ones() as u64,
)
})
self.view().partial_jaccard_dist(other.view())
}
pub fn jaccard_dist(&self, other: &PersistentBitVec) -> f64 {
self.view().jaccard_dist(other.view())
}
pub fn hamming_dist(&self, other: &PersistentBitVec) -> u64 {
assert_eq!(self.n, other.n, "length mismatch");
self.data_words()
.iter()
.zip(other.data_words())
.map(|(&a, &b)| (a ^ b).count_ones() as u64)
.sum()
self.view().hamming_dist(other.view())
}
pub fn iter(&self) -> BitIter<'_> {
BitIter {
bytes: self.data_bytes(),
slot: 0,
n: self.n,
}
BitIter { words: self.data_words(), slot: 0, n: self.n }
}
}
impl<'a> IntoIterator for &'a PersistentBitVec {
type Item = bool;
type IntoIter = BitIter<'a>;
fn into_iter(self) -> BitIter<'a> {
self.iter()
}
fn into_iter(self) -> BitIter<'a> { self.iter() }
}
// ── BitIter ───────────────────────────────────────────────────────────────────
pub struct BitIter<'a> {
bytes: &'a [u8],
slot: usize,
n: usize,
words: &'a [u64],
slot: usize,
n: usize,
}
impl ExactSizeIterator for BitIter<'_> {}
impl Iterator for BitIter<'_> {
type Item = bool;
fn next(&mut self) -> Option<bool> {
if self.slot >= self.n {
return None;
}
let v = (self.bytes[self.slot >> 3] >> (self.slot & 7)) & 1 != 0;
if self.slot >= self.n { return None; }
let v = (self.words[self.slot >> 6] >> (self.slot & 63)) & 1 != 0;
self.slot += 1;
Some(v)
}
fn size_hint(&self) -> (usize, Option<usize>) {
let rem = self.n - self.slot;
(rem, Some(rem))
}
}
// ── Builder ───────────────────────────────────────────────────────────────────
// ── PersistentBitVecBuilder ───────────────────────────────────────────────────
pub struct PersistentBitVecBuilder {
mmap: MmapMut,
n: usize,
n: usize,
path: PathBuf,
}
impl PersistentBitVecBuilder {
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
let file_size = HEADER_SIZE + n_bytes_for_words(n);
let mut file = OpenOptions::new()
.read(true)
.write(true)
.create(true)
.truncate(true)
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.write_all(&MAGIC)?;
file.write_all(&[0u8; 4])?; // padding
file.write_all(&[0u8; 4])?;
file.write_all(&(n as u64).to_le_bytes())?;
file.seek(SeekFrom::Start(0))?;
file.set_len(file_size as u64)?;
let mmap = unsafe { MmapMut::map_mut(&file)? };
Ok(Self { mmap, n })
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn from_raw_bytes(bytes: &[u8], n: usize, path: &Path) -> io::Result<Self> {
let file_size = HEADER_SIZE + n_bytes_for_words(n);
let file = OpenOptions::new()
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.set_len(file_size as u64)?;
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
mmap[0..4].copy_from_slice(&MAGIC);
mmap[8..16].copy_from_slice(&(n as u64).to_le_bytes());
mmap[HEADER_SIZE..HEADER_SIZE + bytes.len()].copy_from_slice(bytes);
Ok(Self { mmap, n, path: path.to_path_buf() })
}
/// Create an all-ones bit vector of length `n` at `path`.
///
/// More efficient than `new(n, path)` + `not()`: the data is written as
/// 0xFF bytes in a single sequential pass, with no intermediate all-zeros state.
pub fn new_ones(n: usize, path: &Path) -> io::Result<Self> {
let nw = n_words(n);
let file_size = HEADER_SIZE + nw * 8;
let mut file = OpenOptions::new()
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.write_all(&MAGIC)?;
file.write_all(&[0u8; 4])?;
file.write_all(&(n as u64).to_le_bytes())?;
file.write_all(&vec![0xFFu8; nw * 8])?;
file.seek(SeekFrom::Start(0))?;
file.set_len(file_size as u64)?;
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
// Clear padding bits in the last word so trailing bits are always 0.
let rem = n % 64;
if rem != 0 {
let ptr = mmap[HEADER_SIZE..].as_mut_ptr() as *mut u64;
let words = unsafe { std::slice::from_raw_parts_mut(ptr, nw) };
words[nw - 1] &= (1u64 << rem) - 1;
}
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn build_from(source: &PersistentBitVec, path: &Path) -> io::Result<Self> {
@@ -193,86 +177,14 @@ impl PersistentBitVecBuilder {
let file = OpenOptions::new().read(true).write(true).open(path)?;
let mmap = unsafe { MmapMut::map_mut(&file)? };
let n = source.len();
Ok(Self { mmap, n })
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn len(&self) -> usize {
self.n
}
pub fn is_empty(&self) -> bool {
self.n == 0
}
pub fn get(&self, slot: usize) -> bool {
(self.mmap[HEADER_SIZE + (slot >> 3)] >> (slot & 7)) & 1 != 0
}
pub fn set(&mut self, slot: usize, value: bool) {
let byte = HEADER_SIZE + (slot >> 3);
let bit = 1u8 << (slot & 7);
if value {
self.mmap[byte] |= bit;
} else {
self.mmap[byte] &= !bit;
}
}
// SAFETY: same alignment argument as PersistentBitVec::data_words.
fn data_words_mut(&mut self) -> &mut [u64] {
let nw = n_words(self.n);
let ptr = self.mmap[HEADER_SIZE..].as_mut_ptr() as *mut u64;
unsafe { std::slice::from_raw_parts_mut(ptr, nw) }
}
pub fn and(&mut self, other: &PersistentBitVec) {
assert_eq!(self.n, other.n, "length mismatch");
for (sw, &ow) in self.data_words_mut().iter_mut().zip(other.data_words()) {
*sw &= ow;
}
}
pub fn or(&mut self, other: &PersistentBitVec) {
assert_eq!(self.n, other.n, "length mismatch");
for (sw, &ow) in self.data_words_mut().iter_mut().zip(other.data_words()) {
*sw |= ow;
}
}
pub fn xor(&mut self, other: &PersistentBitVec) {
assert_eq!(self.n, other.n, "length mismatch");
for (sw, &ow) in self.data_words_mut().iter_mut().zip(other.data_words()) {
*sw ^= ow;
}
}
pub fn not(&mut self) {
let rem = self.n % 64;
let words = self.data_words_mut();
for w in words.iter_mut() {
*w ^= u64::MAX;
}
// Zero padding bits in the last word so count_ones / jaccard remain correct.
if rem != 0 {
if let Some(last) = words.last_mut() {
*last &= (1u64 << rem) - 1;
}
}
}
/// Convert a count vector to a bit vector: bit set iff count >= threshold.
/// Fills u64 words directly from the count iterator — O(n), no bit-level set() overhead.
pub fn build_from_counts(
source: &PersistentCompactIntVec,
threshold: u32,
path: &Path,
) -> io::Result<Self> {
pub fn build_from_counts(source: &PersistentCompactIntVec, threshold: u32, path: &Path) -> io::Result<Self> {
let n = source.len();
let file_size = HEADER_SIZE + n_bytes_for_words(n);
let mut file = OpenOptions::new()
.read(true)
.write(true)
.create(true)
.truncate(true)
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.write_all(&MAGIC)?;
file.write_all(&[0u8; 4])?;
@@ -280,27 +192,157 @@ impl PersistentBitVecBuilder {
file.seek(SeekFrom::Start(0))?;
file.set_len(file_size as u64)?;
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
{
let nw = n_words(n);
let nw = n_words(n);
let ptr = mmap[HEADER_SIZE..].as_mut_ptr() as *mut u64;
let words = unsafe { std::slice::from_raw_parts_mut(ptr, nw) };
for (slot, count) in source.iter().enumerate() {
if count >= threshold {
words[slot >> 6] |= 1u64 << (slot & 63);
}
if count >= threshold { words[slot >> 6] |= 1u64 << (slot & 63); }
}
}
Ok(Self { mmap, n })
Ok(Self { mmap, n, path: path.to_path_buf() })
}
/// Convert a count vector to a presence/absence bit vector (threshold = 1).
pub fn build_from_presence(source: &PersistentCompactIntVec, path: &Path) -> io::Result<Self> {
Self::build_from_counts(source, 1, path)
}
pub fn close(self) -> io::Result<()> {
self.mmap.flush()
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn get(&self, slot: usize) -> bool {
(self.mmap[HEADER_SIZE + (slot >> 3)] >> (slot & 7)) & 1 != 0
}
pub fn set(&mut self, slot: usize, value: bool) {
let bit = 1u64 << (slot & 63);
if value { self.data_words_mut()[slot >> 6] |= bit; }
else { self.data_words_mut()[slot >> 6] &= !bit; }
}
fn data_words(&self) -> &[u64] {
let nw = n_words(self.n);
let ptr = self.mmap[HEADER_SIZE..].as_ptr() as *const u64;
unsafe { std::slice::from_raw_parts(ptr, nw) }
}
// SAFETY: same alignment argument as PersistentBitVec::data_words.
fn data_words_mut(&mut self) -> &mut [u64] {
let nw = n_words(self.n);
let ptr = self.mmap[HEADER_SIZE..].as_mut_ptr() as *mut u64;
unsafe { std::slice::from_raw_parts_mut(ptr, nw) }
}
pub fn view(&self) -> BitSliceView<'_> {
BitSliceView::new(self.data_words(), self.n)
}
pub fn words(&self) -> &[u64] { self.data_words() }
pub fn copy_from(&mut self, src: BitSliceView<'_>) {
assert_eq!(self.n, src.len(), "BitSliceView length mismatch");
self.data_words_mut().copy_from_slice(src.words());
}
pub fn and(&mut self, other: BitSliceView<'_>) {
assert_eq!(self.n, other.len(), "BitSliceView length mismatch");
for (w, &o) in self.data_words_mut().iter_mut().zip(other.words()) { *w &= o; }
}
pub fn or(&mut self, other: BitSliceView<'_>) {
assert_eq!(self.n, other.len(), "BitSliceView length mismatch");
for (w, &o) in self.data_words_mut().iter_mut().zip(other.words()) { *w |= o; }
}
pub fn xor(&mut self, other: BitSliceView<'_>) {
assert_eq!(self.n, other.len(), "BitSliceView length mismatch");
for (w, &o) in self.data_words_mut().iter_mut().zip(other.words()) { *w ^= o; }
}
pub fn not(&mut self) {
let rem = self.n % 64;
let words = self.data_words_mut();
for w in words.iter_mut() { *w ^= u64::MAX; }
if rem != 0 {
if let Some(last) = words.last_mut() { *last &= (1u64 << rem) - 1; }
}
}
/// OR in bits at slots where `pred(col[slot])` is true.
pub fn or_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
assert_eq!(self.n, col.len(), "IntSliceView length mismatch");
let n = self.n;
let primary = col.primary_bytes();
let words = self.data_words_mut();
let nw = n_words(n);
for wi in 0..nw {
let base = wi * 64;
let limit = (base + 64).min(n);
let mut mask = 0u64;
for bit in 0..(limit - base) {
let b = primary[base + bit];
if b < 255 && pred(b as u32) { mask |= 1u64 << bit; }
}
words[wi] |= mask;
}
for (slot, val) in col.overflow_entries() {
if pred(val) { words[slot >> 6] |= 1u64 << (slot & 63); }
}
}
/// Clear bits at slots where `pred(col[slot])` is false.
pub fn and_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
assert_eq!(self.n, col.len(), "IntSliceView length mismatch");
let n = self.n;
let primary = col.primary_bytes();
let words = self.data_words_mut();
let nw = n_words(n);
for wi in 0..nw {
let base = wi * 64;
let limit = (base + 64).min(n);
let mut mask = 0u64;
for bit in 0..(limit - base) {
let b = primary[base + bit];
if b < 255 && !pred(b as u32) { mask |= 1u64 << bit; }
}
words[wi] &= !mask;
}
for (slot, val) in col.overflow_entries() {
if !pred(val) { words[slot >> 6] &= !(1u64 << (slot & 63)); }
}
}
/// Toggle bits at slots where `pred(col[slot])` is true.
pub fn xor_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
assert_eq!(self.n, col.len(), "IntSliceView length mismatch");
let n = self.n;
let primary = col.primary_bytes();
let words = self.data_words_mut();
let nw = n_words(n);
for wi in 0..nw {
let base = wi * 64;
let limit = (base + 64).min(n);
let mut mask = 0u64;
for bit in 0..(limit - base) {
let b = primary[base + bit];
if b < 255 && pred(b as u32) { mask |= 1u64 << bit; }
}
words[wi] ^= mask;
}
for (slot, val) in col.overflow_entries() {
if pred(val) { words[slot >> 6] ^= 1u64 << (slot & 63); }
}
}
pub fn iter(&self) -> BitSliceIter<'_> {
self.view().iter()
}
pub fn close(self) -> io::Result<()> { self.mmap.flush() }
pub fn finish(self) -> io::Result<PersistentBitVec> {
let path = self.path.clone();
self.close()?;
PersistentBitVec::open(&path)
}
}
+195 -69
View File
@@ -5,71 +5,57 @@ use std::path::{Path, PathBuf};
use memmap2::MmapMut;
use crate::format::{HEADER_SIZE, OVERFLOW_ENTRY_SIZE, finalize_pciv};
use crate::format::{byte_count_nonzero, byte_sum, HEADER_SIZE, finalize_pciv, parse_overflow_entry};
use crate::reader::PersistentCompactIntVec;
use crate::views::{BitSliceView, IntSliceView};
pub struct PersistentCompactIntVecBuilder {
path: PathBuf,
mmap: MmapMut,
n: usize,
path: PathBuf,
mmap: MmapMut,
n: usize,
overflow: HashMap<usize, u32>,
}
impl PersistentCompactIntVecBuilder {
/// Create a new, zero-filled PCIV at `path`. Primary is mmapped immediately.
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
let file = OpenOptions::new()
.read(true)
.write(true)
.create(true)
.truncate(true)
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.set_len((HEADER_SIZE + n) as u64)?;
let mmap = unsafe { MmapMut::map_mut(&file)? };
Ok(Self {
path: path.to_path_buf(),
mmap,
n,
overflow: HashMap::new(),
})
Ok(Self { path: path.to_path_buf(), mmap, n, overflow: HashMap::new() })
}
pub fn from_raw_primary(primary: &[u8], overflow: HashMap<usize, u32>, path: &Path) -> io::Result<Self> {
let n = primary.len();
let file = OpenOptions::new()
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.set_len((HEADER_SIZE + n) as u64)?;
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
mmap[HEADER_SIZE..HEADER_SIZE + n].copy_from_slice(primary);
Ok(Self { path: path.to_path_buf(), mmap, n, overflow })
}
/// Copy `source`'s file to `path`, mmap the primary section, load overflow into RAM.
/// Avoids iterating all n slots: the file copy is OS-level, overflow loading is O(n_overflow).
pub fn build_from(source: &PersistentCompactIntVec, path: &Path) -> io::Result<Self> {
fs::copy(source.path(), path)?;
let file = OpenOptions::new().read(true).write(true).open(path)?;
let mmap = unsafe { MmapMut::map_mut(&file)? };
let n = source.len();
let n = source.len();
let n_overflow = u64::from_le_bytes(mmap[16..24].try_into().unwrap()) as usize;
let data_offset = HEADER_SIZE + n;
let mut overflow = HashMap::with_capacity(n_overflow);
for i in 0..n_overflow {
let off = data_offset + i * OVERFLOW_ENTRY_SIZE;
let slot = u64::from_le_bytes(mmap[off..off + 8].try_into().unwrap()) as usize;
let value = u32::from_le_bytes(mmap[off + 8..off + 12].try_into().unwrap());
let (slot, value) = parse_overflow_entry(&mmap, data_offset, i);
overflow.insert(slot, value);
}
Ok(Self {
path: path.to_path_buf(),
mmap,
n,
overflow,
})
Ok(Self { path: path.to_path_buf(), mmap, n, overflow })
}
/// Get the value at the given slot, handling overflow if necessary.
pub fn get(&self, slot: usize) -> u32 {
match self.mmap[HEADER_SIZE + slot] {
255 => *self
.overflow
.get(&slot)
.expect("sentinel without overflow entry"),
v => v as u32,
255 => *self.overflow.get(&slot).expect("sentinel without overflow entry"),
v => v as u32,
}
}
@@ -83,61 +69,201 @@ impl PersistentCompactIntVecBuilder {
}
}
pub fn len(&self) -> usize {
self.n
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn primary_bytes(&self) -> &[u8] { &self.mmap[HEADER_SIZE..HEADER_SIZE + self.n] }
pub fn primary_bytes_mut(&mut self) -> &mut [u8] { &mut self.mmap[HEADER_SIZE..HEADER_SIZE + self.n] }
pub fn clear_overflow(&mut self) { self.overflow.clear(); }
pub fn sum(&self) -> u64 {
byte_sum(&self.mmap[HEADER_SIZE..HEADER_SIZE + self.n], self.overflow.values().copied())
}
pub fn count_nonzero(&self) -> u64 {
byte_count_nonzero(&self.mmap[HEADER_SIZE..HEADER_SIZE + self.n])
}
pub fn is_empty(&self) -> bool {
self.n == 0
pub fn view(&self) -> IntSliceView<'_> {
// Builder overflow is a HashMap, not sorted raw bytes — convert on the fly
// by collecting into a sorted vec and storing in a thread-local buffer.
// For read-back during building, just call get(slot) directly.
// view() is primarily useful AFTER freeze (on PersistentCompactIntVec).
// Here we expose it via a zero-alloc path: primary only, no overflow raw.
// Callers that need overflow_entries during building use overflow_entries().
let primary = &self.mmap[HEADER_SIZE..HEADER_SIZE + self.n];
IntSliceView::new(primary, &[], 0, self.n)
}
pub fn min(&mut self, other: &PersistentCompactIntVec) {
assert_eq!(self.n, other.len(), "length mismatch");
for (slot, other_val) in other.iter().enumerate() {
if other_val < self.get(slot) {
self.set(slot, other_val);
pub fn overflow_entries(&self) -> impl Iterator<Item = (usize, u32)> + '_ {
self.overflow.iter().map(|(&k, &v)| (k, v))
}
pub fn inc(&mut self, slot: usize) {
let v = self.get(slot);
self.set(slot, v.saturating_add(1));
}
// ── Computation methods ───────────────────────────────────────────────────
/// Increment one counter per 1-bit of `col`. Safe for any group size.
pub fn inc_present(&mut self, col: BitSliceView<'_>) {
let n = self.n;
for (wi, &word) in col.words().iter().enumerate() {
if word == 0 { continue; }
let mut w = word;
while w != 0 {
let bit = w.trailing_zeros() as usize;
let slot = wi * 64 + bit;
if slot < n { self.inc(slot); }
w &= w - 1;
}
}
}
pub fn max(&mut self, other: &PersistentCompactIntVec) {
assert_eq!(self.n, other.len(), "length mismatch");
for (slot, other_val) in other.iter().enumerate() {
if other_val > self.get(slot) {
self.set(slot, other_val);
/// Increment one counter per 1-bit of `col`, using raw u8 arithmetic.
/// Caller guarantees no counter will reach 255 (group size < 255).
pub fn inc_present_fast(&mut self, col: BitSliceView<'_>) {
{
let primary = self.primary_bytes_mut();
let n = primary.len();
for (wi, &word) in col.words().iter().enumerate() {
if word == 0 { continue; }
let mut w = word;
while w != 0 {
let bit = w.trailing_zeros() as usize;
let s = wi * 64 + bit;
if s < n { primary[s] += 1; }
w &= w - 1;
}
}
}
debug_assert!(
!self.primary_bytes().contains(&255),
"sentinel 255 reached in inc_present_fast — group size must be < 255"
);
}
/// Two-pass: primary bytes then overflow. Increments `self[slot]` for each
/// slot where `pred(col[slot])` is true. Safe for any group size.
pub fn inc_predicate(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
let n = col.len();
for slot in 0..n {
let b = col.primary_bytes()[slot];
if b < 255 && pred(b as u32) {
self.inc(slot);
}
}
for (slot, val) in col.overflow_entries() {
if pred(val) { self.inc(slot); }
}
}
/// Fast two-pass: raw u8 arithmetic. Caller guarantees no counter reaches 255.
pub fn inc_predicate_fast(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
let n = col.len();
{
let primary = self.primary_bytes_mut();
for slot in 0..n {
let b = col.primary_bytes()[slot];
if b < 255 && pred(b as u32) {
primary[slot] += 1;
}
}
}
for (slot, val) in col.overflow_entries() {
if pred(val) { self.primary_bytes_mut()[slot] += 1; }
}
debug_assert!(
!self.primary_bytes().contains(&255),
"sentinel 255 reached in inc_predicate_fast — group size must be < 255"
);
}
pub fn add(&mut self, other: IntSliceView<'_>) {
let n = self.n;
for s in 0..n {
let sb = self.primary_bytes()[s];
let ob = other.primary_bytes()[s];
if sb < 255 && ob < 255 {
let sum = sb as u32 + ob as u32;
if sum < 255 { self.primary_bytes_mut()[s] = sum as u8; }
else { self.set(s, sum); }
} else {
let sv = self.get(s);
let ov = other.get(s);
self.set(s, sv + ov);
}
}
}
pub fn add(&mut self, other: &PersistentCompactIntVec) {
assert_eq!(self.n, other.len(), "length mismatch");
for (slot, other_val) in other.iter().enumerate() {
let cur = self.get(slot);
self.set(slot, cur.checked_add(other_val).expect("u32 overflow in add"));
pub fn min(&mut self, other: IntSliceView<'_>) {
let self_ov: Vec<(usize, u32)> = self.overflow_entries().collect();
let other_ov: HashMap<usize, u32> = other.overflow_entries().collect();
self.clear_overflow();
for (a, &b) in self.primary_bytes_mut().iter_mut().zip(other.primary_bytes()) {
if b < *a { *a = b; }
}
for (slot, self_val) in self_ov {
if let Some(&other_val) = other_ov.get(&slot) {
self.set(slot, self_val.min(other_val));
}
}
}
pub fn diff(&mut self, other: &PersistentCompactIntVec) {
assert_eq!(self.n, other.len(), "length mismatch");
for (slot, other_val) in other.iter().enumerate() {
self.set(slot, self.get(slot).saturating_sub(other_val));
pub fn max(&mut self, other: IntSliceView<'_>) {
for (slot, other_val) in other.overflow_entries() {
let sv = self.get(slot);
self.set(slot, sv.max(other_val));
}
for (a, &b) in self.primary_bytes_mut().iter_mut().zip(other.primary_bytes()) {
if b > *a { *a = b; }
}
}
pub fn diff(&mut self, other: IntSliceView<'_>) {
let n = self.n;
for s in 0..n {
let sb = self.primary_bytes()[s];
let ob = other.primary_bytes()[s];
if sb < 255 {
self.primary_bytes_mut()[s] = if ob < 255 { sb.saturating_sub(ob) } else { 0 };
} else {
let sv = self.get(s);
let ov = if ob < 255 { ob as u32 } else { other.get(s) };
self.set(s, sv.saturating_sub(ov));
}
}
}
pub fn mask_with(&mut self, mask: BitSliceView<'_>) {
let n = self.n;
for (wi, &word) in mask.words().iter().enumerate() {
if word == u64::MAX { continue; }
let mut zeros = !word;
while zeros != 0 {
let bit = zeros.trailing_zeros() as usize;
let s = wi * 64 + bit;
if s < n {
let b = self.primary_bytes()[s];
if b != 0 { self.set(s, 0); }
}
zeros &= zeros - 1;
}
}
}
/// Flush the primary mmap, then write sorted overflow data + index and fix the header.
pub fn close(self) -> io::Result<()> {
self.mmap.flush()?;
let Self {
path,
mmap,
n,
overflow,
} = self;
let Self { path, mmap, n, overflow } = self;
drop(mmap);
let mut entries: Vec<(usize, u32)> = overflow.into_iter().collect();
entries.sort_unstable_by_key(|&(slot, _)| slot);
finalize_pciv(&path, n, &entries)
}
pub fn finish(self) -> io::Result<PersistentCompactIntVec> {
let path = self.path.clone();
self.close()?;
PersistentCompactIntVec::open(&path)
}
}
+137
View File
@@ -0,0 +1,137 @@
use std::io;
use crate::tempbitvec::{TempBitVec, TempBitVecBuilder};
use crate::tempintvec::TempCompactIntVec;
// ── ColGroup ──────────────────────────────────────────────────────────────────
/// A named subset of columns, identified by their indices within the matrix.
///
/// Defined once at the index level; the same indices are valid across all
/// partitions and layers because the column structure (samples / genomes) is
/// identical everywhere — only the row space (kmer slots) is partitioned.
pub struct ColGroup {
pub name: String,
pub indices: Vec<usize>,
}
impl ColGroup {
pub fn new(name: impl Into<String>, indices: Vec<usize>) -> Self {
Self { name: name.into(), indices }
}
}
// ── MatrixGroupOps ────────────────────────────────────────────────────────────
/// Per-matrix group aggregations.
///
/// `partial_group_presence_count`, `partial_group_sum`, `partial_group_any`,
/// `partial_group_min`, `partial_group_max` are the primitives; each impl must
/// provide all five.
///
/// `partial_group_all` and `partial_group_none` have default implementations
/// derived from `partial_group_presence_count` and should rarely need overriding.
pub trait MatrixGroupOps {
/// Per-slot count of group columns whose value ≥ `threshold`.
fn partial_group_presence_count(&self, g: &ColGroup, threshold: u32) -> io::Result<TempCompactIntVec>;
/// Per-slot sum of values across all group columns.
fn partial_group_sum(&self, g: &ColGroup) -> io::Result<TempCompactIntVec>;
/// Per-slot OR: 1 if any group column has value ≥ `threshold`.
fn partial_group_any(&self, g: &ColGroup, threshold: u32) -> io::Result<TempBitVec>;
/// Per-slot min value across all group columns (0 if group is empty).
fn partial_group_min(&self, g: &ColGroup) -> io::Result<TempCompactIntVec>;
/// Per-slot max value across all group columns (0 if group is empty).
fn partial_group_max(&self, g: &ColGroup) -> io::Result<TempCompactIntVec>;
/// Per-slot AND: 1 if ALL group columns have value ≥ `threshold`.
fn partial_group_all(&self, g: &ColGroup, threshold: u32) -> io::Result<TempBitVec> {
let counts = self.partial_group_presence_count(g, threshold)?;
let n = counts.len();
let n_required = g.indices.len() as u32;
let mut b = TempBitVecBuilder::new(n)?;
b.or_where(counts.view(), |v| v >= n_required);
b.freeze()
}
/// Per-slot NOR: 1 if NO group column has value ≥ `threshold`.
fn partial_group_none(&self, g: &ColGroup, threshold: u32) -> io::Result<TempBitVec> {
let counts = self.partial_group_presence_count(g, threshold)?;
let n = counts.len();
let mut b = TempBitVecBuilder::new(n)?;
b.or_where(counts.view(), |v| v == 0);
b.freeze()
}
}
// ── FilterMask — expression tree for column-based slot filters ────────────────
/// A composable filter expression that can be evaluated against a matrix
/// using only column operations (no MPHF lookup per kmer).
///
/// `threshold` semantics follow [`MatrixGroupOps::partial_group_presence_count`]:
/// a slot contributes to the count when its value is **≥ threshold**.
/// To match the row-level filter (`value > t`), callers should pass `t + 1`.
#[derive(Debug, Clone)]
pub enum FilterMask {
/// Slot passes if count of columns in `indices` with value ≥ `threshold` is ≥ `min_count`.
PresenceGeq { indices: Vec<usize>, threshold: u32, min_count: usize },
/// Slot passes if count of columns in `indices` with value ≥ `threshold` is ≤ `max_count`.
PresenceLeq { indices: Vec<usize>, threshold: u32, max_count: usize },
/// Slot passes if sum of values across `indices` columns is ≥ `min_sum`.
SumGeq { indices: Vec<usize>, min_sum: u32 },
/// Slot passes if sum of values across `indices` columns is ≤ `max_sum`.
SumLeq { indices: Vec<usize>, max_sum: u32 },
/// Slot passes if it passes all sub-expressions. Empty `And` is always true.
And(Vec<FilterMask>),
}
/// Evaluate a [`FilterMask`] against `mat`, returning a per-slot `TempBitVec`
/// where bit=1 means the slot passes the filter.
pub fn eval_filter_mask(expr: &FilterMask, mat: &dyn MatrixGroupOps, n: usize) -> io::Result<TempBitVec> {
match expr {
FilterMask::PresenceGeq { indices, threshold, min_count } => {
let g = ColGroup::new("", indices.clone());
let counts = mat.partial_group_presence_count(&g, *threshold)?;
let mut b = TempBitVecBuilder::new(n)?;
let mc = *min_count as u32;
b.or_where(counts.view(), |v| v >= mc);
b.freeze()
}
FilterMask::PresenceLeq { indices, threshold, max_count } => {
let g = ColGroup::new("", indices.clone());
let counts = mat.partial_group_presence_count(&g, *threshold)?;
let mut b = TempBitVecBuilder::new(n)?;
let mc = *max_count as u32;
b.or_where(counts.view(), |v| v <= mc);
b.freeze()
}
FilterMask::SumGeq { indices, min_sum } => {
let g = ColGroup::new("", indices.clone());
let sums = mat.partial_group_sum(&g)?;
let mut b = TempBitVecBuilder::new(n)?;
let ms = *min_sum;
b.or_where(sums.view(), |v| v >= ms);
b.freeze()
}
FilterMask::SumLeq { indices, max_sum } => {
let g = ColGroup::new("", indices.clone());
let sums = mat.partial_group_sum(&g)?;
let mut b = TempBitVecBuilder::new(n)?;
let ms = *max_sum;
b.or_where(sums.view(), |v| v <= ms);
b.freeze()
}
FilterMask::And(parts) => {
let mut b = TempBitVecBuilder::new_ones(n)?;
for part in parts {
let m = eval_filter_mask(part, mat, n)?;
b.and(m.view());
}
b.freeze()
}
}
}
+38
View File
@@ -13,6 +13,44 @@ pub const OVERFLOW_ENTRY_SIZE: usize = 12;
// Index entry: slot(u64) + pos(u64) = 16 bytes.
pub const INDEX_ENTRY_SIZE: usize = 16;
/// Sum all values in a compact-int primary byte slice, correcting for overflow sentinels.
///
/// `primary` is the raw `&[u8]` where 255 is a sentinel for large values.
/// `overflow` yields the true values (≥ 255) for each sentinel, in any order.
#[inline]
pub(crate) fn byte_sum(primary: &[u8], overflow: impl Iterator<Item = u32>) -> u64 {
let raw: u64 = primary.iter().map(|&b| b as u64).sum();
let (n, ov) = overflow.fold((0u64, 0u64), |(n, s), v| (n + 1, s + v as u64));
raw - 255 * n + ov
}
/// Count non-zero values in a compact-int primary byte slice.
///
/// Overflow sentinels (255) are always non-zero by construction, so a single
/// `b != 0` test is sufficient — no overflow map lookup needed.
#[inline]
pub(crate) fn byte_count_nonzero(primary: &[u8]) -> u64 {
primary.iter().filter(|&&b| b != 0).count() as u64
}
/// Parse a single overflow entry `(slot, value)` from a byte slice.
#[inline]
pub fn parse_overflow_entry(data: &[u8], base: usize, i: usize) -> (usize, u32) {
let off = base + i * OVERFLOW_ENTRY_SIZE;
let slot = u64::from_le_bytes(data[off..off+8].try_into().unwrap()) as usize;
let value = u32::from_le_bytes(data[off+8..off+12].try_into().unwrap());
(slot, value)
}
/// Parse a single sparse-index entry `(slot, pos)` from a byte slice.
#[inline]
pub fn parse_index_entry(data: &[u8], base: usize, i: usize) -> (usize, usize) {
let off = base + i * INDEX_ENTRY_SIZE;
let slot = u64::from_le_bytes(data[off..off+8].try_into().unwrap()) as usize;
let pos = u64::from_le_bytes(data[off+8..off+16].try_into().unwrap()) as usize;
(slot, pos)
}
// Sparse index target: ≤ 32 KB in L1 cache (16 B per entry → 2048 entries).
pub const L1_INDEX_ENTRIES: usize = 2048;
+236 -230
View File
@@ -1,16 +1,20 @@
use std::cmp::Ordering;
use std::fs::{self, File};
use std::io::{self, Write as _};
use std::io::{self, BufWriter, Write as _};
use std::path::{Path, PathBuf};
use memmap2::Mmap;
use ndarray::{Array1, Array2};
use rayon::prelude::*;
use crate::bitmatrix::{pairwise_matrix, pairwise2_matrix};
use crate::builder::PersistentCompactIntVecBuilder;
use crate::format::{HEADER_SIZE, INDEX_ENTRY_SIZE, OVERFLOW_ENTRY_SIZE};
use crate::colgroup::{ColGroup, MatrixGroupOps};
use crate::format::{HEADER_SIZE, OVERFLOW_ENTRY_SIZE};
use crate::meta::MatrixMeta;
use crate::reader::PersistentCompactIntVec;
use crate::tempbitvec::{TempBitVec, TempBitVecBuilder};
use crate::tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
use crate::views::IntSliceView;
fn col_path(dir: &Path, col: usize) -> PathBuf {
dir.join(format!("col_{col:06}.pciv"))
@@ -41,9 +45,7 @@ impl ColumnarCompactIntMatrix {
}
pub(crate) fn fill_row(&self, slot: usize, buf: &mut [u32]) {
for (c, col) in self.cols.iter().enumerate() {
buf[c] = col.get(slot);
}
for (c, col) in self.cols.iter().enumerate() { buf[c] = col.get(slot); }
}
pub(crate) fn sum(&self) -> Array1<u64> {
@@ -54,95 +56,39 @@ impl ColumnarCompactIntMatrix {
Array1::from_vec(sums)
}
pub(crate) fn bray_dist_matrix(&self) -> Array2<f64> {
let sum_min = self.partial_bray_dist_matrix();
let col_sums = self.sum();
let n = self.n_cols();
let mut m = Array2::zeros((n, n));
for i in 0..n {
for j in 0..n {
if i != j {
let denom = col_sums[i] + col_sums[j];
m[[i, j]] = if denom == 0 { 0.0 }
else { 1.0 - 2.0 * sum_min[[i, j]] as f64 / denom as f64 };
}
}
}
m
pub(crate) fn count_nonzero(&self) -> Array1<u64> {
let counts: Vec<u64> = (0..self.n_cols())
.into_par_iter()
.map(|c| self.col(c).count_nonzero())
.collect();
Array1::from_vec(counts)
}
pub(crate) fn partial_bray_dist_matrix(&self) -> Array2<u64> {
self.pairwise_u64(|i, j| self.col(i).partial_bray_dist(self.col(j)))
pairwise_matrix(self.n_cols(), |i, j| self.col(i).partial_bray_dist(self.col(j)))
}
pub(crate) fn partial_euclidean_dist_matrix(&self) -> Array2<f64> {
self.pairwise(|i, j| self.col(i).partial_euclidean_dist(self.col(j)))
pairwise_matrix(self.n_cols(), |i, j| self.col(i).partial_euclidean_dist(self.col(j)))
}
pub(crate) fn partial_threshold_jaccard_dist_matrix(
&self, threshold: u32,
) -> (Array2<u64>, Array2<u64>) {
let n = self.n_cols();
let pairs = upper_pairs(n);
let results: Vec<(usize, usize, u64, u64)> = pairs
.into_par_iter()
.map(|(i, j)| {
let (inter, union) =
self.col(i).partial_threshold_jaccard_dist(self.col(j), threshold);
(i, j, inter, union)
})
.collect();
let mut inter_m = Array2::zeros((n, n));
let mut union_m = Array2::zeros((n, n));
for (i, j, inter, union) in results {
inter_m[[i, j]] = inter; inter_m[[j, i]] = inter;
union_m[[i, j]] = union; union_m[[j, i]] = union;
}
(inter_m, union_m)
pub(crate) fn partial_threshold_jaccard_dist_matrix(&self, threshold: u32) -> (Array2<u64>, Array2<u64>) {
pairwise2_matrix(self.n_cols(), |i, j| self.col(i).partial_threshold_jaccard_dist(self.col(j), threshold))
}
pub(crate) fn partial_relfreq_bray_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
self.pairwise(|i, j| {
pairwise_matrix(self.n_cols(), |i, j| {
self.col(i).partial_relfreq_bray_dist(self.col(j), col_sums[i] as f64, col_sums[j] as f64)
})
}
pub(crate) fn partial_relfreq_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
self.pairwise(|i, j| {
pairwise_matrix(self.n_cols(), |i, j| {
self.col(i).partial_relfreq_euclidean_dist(self.col(j), col_sums[i] as f64, col_sums[j] as f64)
})
}
pub(crate) fn partial_hellinger_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
self.pairwise(|i, j| {
pairwise_matrix(self.n_cols(), |i, j| {
self.col(i).partial_hellinger_euclidean_dist(self.col(j), col_sums[i] as f64, col_sums[j] as f64)
})
}
pub(crate) fn relfreq_bray_dist_matrix(&self) -> Array2<f64> {
self.pairwise(|i, j| self.col(i).relfreq_bray_dist(self.col(j)))
}
pub(crate) fn euclidean_dist_matrix(&self) -> Array2<f64> {
self.pairwise(|i, j| self.col(i).euclidean_dist(self.col(j)))
}
pub(crate) fn relfreq_euclidean_dist_matrix(&self) -> Array2<f64> {
self.pairwise(|i, j| self.col(i).relfreq_euclidean_dist(self.col(j)))
}
pub(crate) fn hellinger_dist_matrix(&self) -> Array2<f64> {
self.pairwise(|i, j| self.col(i).hellinger_dist(self.col(j)))
}
pub(crate) fn jaccard_dist_matrix(&self) -> Array2<f64> {
self.pairwise(|i, j| self.col(i).jaccard_dist(self.col(j)))
}
pub(crate) fn threshold_jaccard_dist_matrix(&self, threshold: u32) -> Array2<f64> {
self.pairwise(|i, j| self.col(i).threshold_jaccard_dist(self.col(j), threshold))
}
pub(crate) fn append_column(dir: &Path, value_of: impl Fn(usize) -> u32) -> io::Result<()> {
let mut meta = MatrixMeta::load(dir)?;
let mut b = PersistentCompactIntVecBuilder::new(meta.n, &col_path(dir, meta.n_cols))?;
@@ -151,20 +97,6 @@ impl ColumnarCompactIntMatrix {
meta.n_cols += 1;
meta.save(dir)
}
fn pairwise(&self, f: impl Fn(usize, usize) -> f64 + Sync) -> Array2<f64> {
let n = self.n_cols();
let results: Vec<(usize, usize, f64)> = upper_pairs(n)
.into_par_iter().map(|(i, j)| (i, j, f(i, j))).collect();
fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)))
}
fn pairwise_u64(&self, f: impl Fn(usize, usize) -> u64 + Sync) -> Array2<u64> {
let n = self.n_cols();
let results: Vec<(usize, usize, u64)> = upper_pairs(n)
.into_par_iter().map(|(i, j)| (i, j, f(i, j))).collect();
fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)))
}
}
// ── PackedCompactIntMatrix ────────────────────────────────────────────────────
@@ -172,13 +104,10 @@ impl ColumnarCompactIntMatrix {
const PCMX_MAGIC: [u8; 4] = *b"PCMX";
const PCMX_HEADER: usize = 24; // magic(4) + pad(4) + n_rows(8) + n_cols(8)
/// Per-column metadata pre-parsed from the embedded PCIV header.
struct ColInfo {
primary_start: usize, // absolute mmap offset to primary array
data_offset: usize, // absolute mmap offset to overflow array
primary_start: usize,
data_offset: usize,
n_overflow: usize,
step: usize,
index: Vec<(usize, usize)>,
}
pub struct PackedCompactIntMatrix {
@@ -204,61 +133,31 @@ impl PackedCompactIntMatrix {
for c in 0..n_cols {
let off_pos = PCMX_HEADER + c * 8;
let col_base = u64::from_le_bytes(mmap[off_pos..off_pos+8].try_into().unwrap()) as usize;
// Parse embedded PCIV header at col_base
let n_ov = u64::from_le_bytes(mmap[col_base+16..col_base+24].try_into().unwrap()) as usize;
let n_idx = u64::from_le_bytes(mmap[col_base+24..col_base+32].try_into().unwrap()) as usize;
let step = u64::from_le_bytes(mmap[col_base+32..col_base+40].try_into().unwrap()) as usize;
let n_pciv = u64::from_le_bytes(mmap[col_base+8..col_base+16].try_into().unwrap()) as usize;
let n_ov = u64::from_le_bytes(mmap[col_base+16..col_base+24].try_into().unwrap()) as usize;
let n_pciv = u64::from_le_bytes(mmap[col_base+8..col_base+16].try_into().unwrap()) as usize;
let primary_start = col_base + HEADER_SIZE;
let data_offset = primary_start + n_pciv;
let index_offset = data_offset + n_ov * OVERFLOW_ENTRY_SIZE;
let mut index = Vec::with_capacity(n_idx);
for i in 0..n_idx {
let ioff = index_offset + i * INDEX_ENTRY_SIZE;
let slot = u64::from_le_bytes(mmap[ioff..ioff+8].try_into().unwrap()) as usize;
let pos = u64::from_le_bytes(mmap[ioff+8..ioff+16].try_into().unwrap()) as usize;
index.push((slot, pos));
}
columns.push(ColInfo { primary_start, data_offset, n_overflow: n_ov, step, index });
columns.push(ColInfo { primary_start, data_offset, n_overflow: n_ov });
}
Ok(Self { mmap, n_rows, n_cols, columns })
}
#[inline]
pub(crate) fn get(&self, col: usize, slot: usize) -> u32 {
let ci = &self.columns[col];
let v = self.mmap[ci.primary_start + slot];
if v < 255 { return v as u32; }
self.overflow_get(ci, slot)
pub(crate) fn col_view(&self, c: usize) -> IntSliceView<'_> {
let ci = &self.columns[c];
let primary = &self.mmap[ci.primary_start..ci.primary_start + self.n_rows];
let overflow_raw = &self.mmap[ci.data_offset..ci.data_offset + ci.n_overflow * OVERFLOW_ENTRY_SIZE];
IntSliceView::new(primary, overflow_raw, ci.n_overflow, self.n_rows)
}
fn overflow_get(&self, ci: &ColInfo, slot: usize) -> u32 {
let (pos_start, pos_end) = if ci.step == 0 {
(0, ci.n_overflow)
} else {
let i = ci.index.partition_point(|&(s, _)| s <= slot).saturating_sub(1);
let start = ci.index[i].1;
let end = if i + 1 < ci.index.len() { ci.index[i+1].1 } else { ci.n_overflow };
(start, end)
};
let mut lo = pos_start;
let mut hi = pos_end;
while lo < hi {
let mid = lo + (hi - lo) / 2;
let off = ci.data_offset + mid * OVERFLOW_ENTRY_SIZE;
let stored = u64::from_le_bytes(self.mmap[off..off+8].try_into().unwrap()) as usize;
match stored.cmp(&slot) {
Ordering::Equal => return u32::from_le_bytes(self.mmap[off+8..off+12].try_into().unwrap()),
Ordering::Less => lo = mid + 1,
Ordering::Greater => hi = mid,
}
}
panic!("slot {slot} marked overflow but not found")
pub(crate) fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentCompactIntVecBuilder> {
let view = self.col_view(c);
let overflow: std::collections::HashMap<usize, u32> = view.overflow_entries().collect();
PersistentCompactIntVecBuilder::from_raw_primary(view.primary_bytes(), overflow, path)
}
#[inline]
pub(crate) fn get(&self, col: usize, slot: usize) -> u32 { self.col_view(col).get(slot) }
pub(crate) fn fill_row(&self, slot: usize, buf: &mut [u32]) {
for c in 0..self.n_cols { buf[c] = self.get(c, slot); }
}
@@ -266,35 +165,99 @@ impl PackedCompactIntMatrix {
pub(crate) fn row(&self, slot: usize) -> Box<[u32]> {
(0..self.n_cols).map(|c| self.get(c, slot)).collect()
}
pub(crate) fn sum(&self) -> Array1<u64> {
Array1::from_vec(
(0..self.n_cols).into_par_iter().map(|c| self.col_view(c).sum()).collect()
)
}
pub(crate) fn count_nonzero(&self) -> Array1<u64> {
Array1::from_vec(
(0..self.n_cols).into_par_iter().map(|c| self.col_view(c).count_nonzero()).collect()
)
}
fn pair_partial_bray(&self, i: usize, j: usize) -> u64 {
self.col_view(i).iter().zip(self.col_view(j).iter()).map(|(a, b)| a.min(b) as u64).sum()
}
fn pair_partial_euclidean(&self, i: usize, j: usize) -> f64 {
self.col_view(i).iter().zip(self.col_view(j).iter())
.map(|(a, b)| { let d = a as f64 - b as f64; d * d }).sum()
}
fn pair_partial_threshold_jaccard(&self, i: usize, j: usize, t: u32) -> (u64, u64) {
self.col_view(i).iter().zip(self.col_view(j).iter())
.fold((0u64, 0u64), |(inter, uni), (a, b)| {
let ap = a >= t; let bp = b >= t;
(inter + (ap & bp) as u64, uni + (ap | bp) as u64)
})
}
fn pair_partial_relfreq_bray(&self, i: usize, j: usize, si: f64, sj: f64) -> f64 {
if si == 0.0 || sj == 0.0 { return 0.0; }
self.col_view(i).iter().zip(self.col_view(j).iter())
.map(|(a, b)| (a as f64 / si).min(b as f64 / sj)).sum()
}
fn pair_partial_relfreq_euclidean(&self, i: usize, j: usize, si: f64, sj: f64) -> f64 {
if si == 0.0 || sj == 0.0 { return 0.0; }
self.col_view(i).iter().zip(self.col_view(j).iter())
.map(|(a, b)| { let d = a as f64 / si - b as f64 / sj; d * d }).sum()
}
fn pair_partial_hellinger(&self, i: usize, j: usize, si: f64, sj: f64) -> f64 {
if si == 0.0 || sj == 0.0 { return 0.0; }
self.col_view(i).iter().zip(self.col_view(j).iter())
.map(|(a, b)| { let d = (a as f64 / si).sqrt() - (b as f64 / sj).sqrt(); d * d }).sum()
}
pub(crate) fn partial_bray_dist_matrix(&self) -> Array2<u64> {
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_bray(i, j))
}
pub(crate) fn partial_euclidean_dist_matrix(&self) -> Array2<f64> {
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_euclidean(i, j))
}
pub(crate) fn partial_threshold_jaccard_dist_matrix(&self, t: u32) -> (Array2<u64>, Array2<u64>) {
pairwise2_matrix(self.n_cols, |i, j| self.pair_partial_threshold_jaccard(i, j, t))
}
pub(crate) fn partial_relfreq_bray_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_relfreq_bray(i, j, col_sums[i] as f64, col_sums[j] as f64))
}
pub(crate) fn partial_relfreq_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_relfreq_euclidean(i, j, col_sums[i] as f64, col_sums[j] as f64))
}
pub(crate) fn partial_hellinger_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
pairwise_matrix(self.n_cols, |i, j| self.pair_partial_hellinger(i, j, col_sums[i] as f64, col_sums[j] as f64))
}
}
/// Build `counts/matrix.pcmx` from existing `col_*.pciv` files.
pub fn pack_compact_int_matrix(dir: &Path) -> io::Result<()> {
let meta = MatrixMeta::load(dir)?;
let packed_path = dir.join("matrix.pcmx");
if packed_path.exists() {
if let Ok(meta) = MatrixMeta::load(dir) {
for c in 0..meta.n_cols { let _ = fs::remove_file(col_path(dir, c)); }
let _ = fs::remove_file(dir.join("meta.json"));
}
return Ok(());
}
let meta = MatrixMeta::load(dir)?;
let n_cols = meta.n_cols;
let col_files: Vec<Vec<u8>> = (0..n_cols)
.map(|c| fs::read(col_path(dir, c)))
let col_sizes: Vec<u64> = (0..n_cols)
.map(|c| fs::metadata(col_path(dir, c)).map(|m| m.len()))
.collect::<io::Result<_>>()?;
let header_size = PCMX_HEADER + n_cols * 8;
let header_size = (PCMX_HEADER + n_cols * 8) as u64;
let mut col_offset = header_size;
let mut offsets = Vec::with_capacity(n_cols);
for data in &col_files {
offsets.push(col_offset as u64);
col_offset += data.len();
}
let packed_path = dir.join("matrix.pcmx");
let mut file = File::create(&packed_path)?;
file.write_all(&PCMX_MAGIC)?;
file.write_all(&[0u8; 4])?;
file.write_all(&(meta.n as u64).to_le_bytes())?;
file.write_all(&(n_cols as u64).to_le_bytes())?;
for &off in &offsets { file.write_all(&off.to_le_bytes())?; }
for data in &col_files { file.write_all(data)?; }
drop(file);
for &size in &col_sizes { offsets.push(col_offset); col_offset += size; }
let tmp_path = dir.join("matrix.pcmx.tmp");
let mut out = BufWriter::new(File::create(&tmp_path)?);
out.write_all(&PCMX_MAGIC)?;
out.write_all(&[0u8; 4])?;
out.write_all(&(meta.n as u64).to_le_bytes())?;
out.write_all(&(n_cols as u64).to_le_bytes())?;
for &off in &offsets { out.write_all(&off.to_le_bytes())?; }
for c in 0..n_cols { io::copy(&mut File::open(col_path(dir, c))?, &mut out)?; }
out.flush()?;
drop(out);
fs::rename(&tmp_path, &packed_path)?;
for c in 0..n_cols { fs::remove_file(col_path(dir, c))?; }
fs::remove_file(dir.join("meta.json"))?;
Ok(())
@@ -308,18 +271,14 @@ pub enum PersistentCompactIntMatrix {
}
impl PersistentCompactIntMatrix {
/// Open from `layer_dir`, auto-detecting Packed or Columnar.
pub fn open(layer_dir: &Path) -> io::Result<Self> {
let counts_dir = layer_dir.join("counts");
if counts_dir.join("matrix.pcmx").exists() {
return Ok(Self::Packed(PackedCompactIntMatrix::open(&counts_dir.join("matrix.pcmx"))?));
}
if MatrixMeta::load(&counts_dir).is_ok() {
return Ok(Self::Columnar(ColumnarCompactIntMatrix::open(&counts_dir)?));
}
Err(io::Error::new(
io::ErrorKind::NotFound,
format!("no count matrix found in {} — run 'obikmer upgrade'", layer_dir.display()),
@@ -329,7 +288,6 @@ impl PersistentCompactIntMatrix {
pub fn n(&self) -> usize {
match self { Self::Columnar(m) => m.n(), Self::Packed(m) => m.n_rows }
}
pub fn n_cols(&self) -> usize {
match self { Self::Columnar(m) => m.n_cols(), Self::Packed(m) => m.n_cols }
}
@@ -341,61 +299,50 @@ impl PersistentCompactIntMatrix {
}
}
pub fn row(&self, slot: usize) -> Box<[u32]> {
match self { Self::Columnar(m) => m.row(slot), Self::Packed(m) => m.row(slot) }
}
pub fn fill_row(&self, slot: usize, buf: &mut [u32]) {
match self { Self::Columnar(m) => m.fill_row(slot, buf), Self::Packed(m) => m.fill_row(slot, buf) }
}
pub fn sum(&self) -> Array1<u64> {
pub fn col_view(&self, c: usize) -> IntSliceView<'_> {
match self {
Self::Columnar(m) => m.sum(),
_ => panic!("sum() only available on Columnar PersistentCompactIntMatrix"),
Self::Columnar(m) => m.col(c).view(),
Self::Packed(m) => m.col_view(c),
}
}
pub fn bray_dist_matrix(&self) -> Array2<f64> {
match self { Self::Columnar(m) => m.bray_dist_matrix(), _ => panic!("Columnar only") }
}
pub fn relfreq_bray_dist_matrix(&self) -> Array2<f64> {
match self { Self::Columnar(m) => m.relfreq_bray_dist_matrix(), _ => panic!("Columnar only") }
}
pub fn euclidean_dist_matrix(&self) -> Array2<f64> {
match self { Self::Columnar(m) => m.euclidean_dist_matrix(), _ => panic!("Columnar only") }
}
pub fn relfreq_euclidean_dist_matrix(&self) -> Array2<f64> {
match self { Self::Columnar(m) => m.relfreq_euclidean_dist_matrix(), _ => panic!("Columnar only") }
}
pub fn hellinger_dist_matrix(&self) -> Array2<f64> {
match self { Self::Columnar(m) => m.hellinger_dist_matrix(), _ => panic!("Columnar only") }
}
pub fn jaccard_dist_matrix(&self) -> Array2<f64> {
match self { Self::Columnar(m) => m.jaccard_dist_matrix(), _ => panic!("Columnar only") }
}
pub fn threshold_jaccard_dist_matrix(&self, threshold: u32) -> Array2<f64> {
match self { Self::Columnar(m) => m.threshold_jaccard_dist_matrix(threshold), _ => panic!("Columnar only") }
}
pub fn partial_bray_dist_matrix(&self) -> Array2<u64> {
match self { Self::Columnar(m) => m.partial_bray_dist_matrix(), _ => panic!("Columnar only") }
}
pub fn partial_euclidean_dist_matrix(&self) -> Array2<f64> {
match self { Self::Columnar(m) => m.partial_euclidean_dist_matrix(), _ => panic!("Columnar only") }
}
pub fn partial_threshold_jaccard_dist_matrix(&self, threshold: u32) -> (Array2<u64>, Array2<u64>) {
match self { Self::Columnar(m) => m.partial_threshold_jaccard_dist_matrix(threshold), _ => panic!("Columnar only") }
}
pub fn partial_relfreq_bray_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
match self { Self::Columnar(m) => m.partial_relfreq_bray_dist_matrix(col_sums), _ => panic!("Columnar only") }
}
pub fn partial_relfreq_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
match self { Self::Columnar(m) => m.partial_relfreq_euclidean_dist_matrix(col_sums), _ => panic!("Columnar only") }
}
pub fn partial_hellinger_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
match self { Self::Columnar(m) => m.partial_hellinger_euclidean_dist_matrix(col_sums), _ => panic!("Columnar only") }
pub fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentCompactIntVecBuilder> {
match self {
Self::Columnar(m) => PersistentCompactIntVecBuilder::build_from(m.col(c), path),
Self::Packed(m) => m.col_persist(c, path),
}
}
pub fn row(&self, slot: usize) -> Box<[u32]> {
match self { Self::Columnar(m) => m.row(slot), Self::Packed(m) => m.row(slot) }
}
pub fn fill_row(&self, slot: usize, buf: &mut [u32]) {
match self { Self::Columnar(m) => m.fill_row(slot, buf), Self::Packed(m) => m.fill_row(slot, buf) }
}
pub fn sum(&self) -> Array1<u64> {
match self { Self::Columnar(m) => m.sum(), Self::Packed(m) => m.sum() }
}
pub fn count_nonzero(&self) -> Array1<u64> {
match self { Self::Columnar(m) => m.count_nonzero(), Self::Packed(m) => m.count_nonzero() }
}
pub fn partial_bray_dist_matrix(&self) -> Array2<u64> {
match self { Self::Columnar(m) => m.partial_bray_dist_matrix(), Self::Packed(m) => m.partial_bray_dist_matrix() }
}
pub fn partial_euclidean_dist_matrix(&self) -> Array2<f64> {
match self { Self::Columnar(m) => m.partial_euclidean_dist_matrix(), Self::Packed(m) => m.partial_euclidean_dist_matrix() }
}
pub fn partial_threshold_jaccard_dist_matrix(&self, threshold: u32) -> (Array2<u64>, Array2<u64>) {
match self { Self::Columnar(m) => m.partial_threshold_jaccard_dist_matrix(threshold), Self::Packed(m) => m.partial_threshold_jaccard_dist_matrix(threshold) }
}
pub fn partial_relfreq_bray_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
match self { Self::Columnar(m) => m.partial_relfreq_bray_dist_matrix(col_sums), Self::Packed(m) => m.partial_relfreq_bray_dist_matrix(col_sums) }
}
pub fn partial_relfreq_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
match self { Self::Columnar(m) => m.partial_relfreq_euclidean_dist_matrix(col_sums), Self::Packed(m) => m.partial_relfreq_euclidean_dist_matrix(col_sums) }
}
pub fn partial_hellinger_euclidean_dist_matrix(&self, col_sums: &Array1<u64>) -> Array2<f64> {
match self { Self::Columnar(m) => m.partial_hellinger_euclidean_dist_matrix(col_sums), Self::Packed(m) => m.partial_hellinger_euclidean_dist_matrix(col_sums) }
}
pub fn append_column(dir: &Path, value_of: impl Fn(usize) -> u32) -> io::Result<()> {
ColumnarCompactIntMatrix::append_column(dir, value_of)
}
@@ -407,15 +354,16 @@ use crate::traits::{ColumnWeights, CountPartials};
impl ColumnWeights for PersistentCompactIntMatrix {
fn col_weights(&self) -> Array1<u64> { self.sum() }
fn partial_kmer_counts(&self) -> Array1<u64> { self.count_nonzero() }
}
impl CountPartials for PersistentCompactIntMatrix {
fn partial_bray(&self) -> Array2<u64> { self.partial_bray_dist_matrix() }
fn partial_euclidean(&self) -> Array2<f64> { self.partial_euclidean_dist_matrix() }
fn partial_bray(&self) -> Array2<u64> { self.partial_bray_dist_matrix() }
fn partial_euclidean(&self) -> Array2<f64> { self.partial_euclidean_dist_matrix() }
fn partial_threshold_jaccard(&self, t: u32) -> (Array2<u64>, Array2<u64>) { self.partial_threshold_jaccard_dist_matrix(t) }
fn partial_relfreq_bray(&self, g: &Array1<u64>) -> Array2<f64> { self.partial_relfreq_bray_dist_matrix(g) }
fn partial_relfreq_euclidean(&self, g: &Array1<u64>) -> Array2<f64> { self.partial_relfreq_euclidean_dist_matrix(g) }
fn partial_hellinger(&self, g: &Array1<u64>) -> Array2<f64> { self.partial_hellinger_euclidean_dist_matrix(g) }
fn partial_relfreq_bray(&self, g: &Array1<u64>) -> Array2<f64> { self.partial_relfreq_bray_dist_matrix(g) }
fn partial_relfreq_euclidean(&self, g: &Array1<u64>) -> Array2<f64> { self.partial_relfreq_euclidean_dist_matrix(g) }
fn partial_hellinger(&self, g: &Array1<u64>) -> Array2<f64> { self.partial_hellinger_euclidean_dist_matrix(g) }
}
// ── Builder ───────────────────────────────────────────────────────────────────
@@ -431,30 +379,88 @@ impl PersistentCompactIntMatrixBuilder {
fs::create_dir_all(dir)?;
Ok(Self { dir: dir.to_path_buf(), n, n_cols: 0 })
}
pub fn n(&self) -> usize { self.n }
pub fn n_cols(&self) -> usize { self.n_cols }
pub fn add_col(&mut self) -> io::Result<PersistentCompactIntVecBuilder> {
let path = col_path(&self.dir, self.n_cols);
self.n_cols += 1;
PersistentCompactIntVecBuilder::new(self.n, &path)
}
pub fn add_col_from(&mut self, src: &TempCompactIntVec) -> io::Result<()> {
src.make_persistent(&col_path(&self.dir, self.n_cols))?;
self.n_cols += 1;
Ok(())
}
pub fn add_col_from_bit(&mut self, src: &TempBitVec) -> io::Result<()> {
let path = col_path(&self.dir, self.n_cols);
self.n_cols += 1;
let mut b = PersistentCompactIntVecBuilder::new(self.n, &path)?;
b.inc_present(src.view());
b.close()
}
pub fn close(self) -> io::Result<()> {
MatrixMeta { n: self.n, n_cols: self.n_cols }.save(&self.dir)
}
}
// ── Helpers ───────────────────────────────────────────────────────────────────
// ── MatrixGroupOps ────────────────────────────────────────────────────────────
fn upper_pairs(n: usize) -> Vec<(usize, usize)> {
(0..n).flat_map(|i| (i + 1..n).map(move |j| (i, j))).collect()
}
impl MatrixGroupOps for PersistentCompactIntMatrix {
fn partial_group_presence_count(&self, g: &ColGroup, threshold: u32) -> io::Result<TempCompactIntVec> {
let n = self.n();
if g.indices.len() < 255 {
let mut builder = TempCompactIntVecBuilder::new(n)?;
for &c in &g.indices {
builder.inc_predicate_fast(self.col_view(c), |v| v >= threshold);
}
builder.freeze()
} else {
let mut result = TempCompactIntVecBuilder::new(n)?;
for chunk in g.indices.chunks(254) {
let mut chunk_b = TempCompactIntVecBuilder::new(n)?;
for &c in chunk {
chunk_b.inc_predicate_fast(self.col_view(c), |v| v >= threshold);
}
let frozen = chunk_b.freeze()?;
result.add(frozen.view());
}
result.freeze()
}
}
fn fill_symmetric<T>(n: usize, vals: impl Iterator<Item = (usize, usize, T, T)>) -> Array2<T>
where T: Clone + Default {
let mut m = Array2::from_elem((n, n), T::default());
for (i, j, vij, vji) in vals { m[[i, j]] = vij; m[[j, i]] = vji; }
m
fn partial_group_sum(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
let n = self.n();
let mut result = TempCompactIntVecBuilder::new(n)?;
for &c in &g.indices { result.add(self.col_view(c)); }
result.freeze()
}
fn partial_group_any(&self, g: &ColGroup, threshold: u32) -> io::Result<TempBitVec> {
let n = self.n();
let mut result = TempBitVecBuilder::new(n)?;
for &c in &g.indices {
result.or_where(self.col_view(c), |v| v >= threshold);
}
result.freeze()
}
fn partial_group_min(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
let n = self.n();
let mut result = TempCompactIntVecBuilder::new(n)?;
if let Some((&first, rest)) = g.indices.split_first() {
result.add(self.col_view(first));
for &c in rest { result.min(self.col_view(c)); }
}
result.freeze()
}
fn partial_group_max(&self, g: &ColGroup) -> io::Result<TempCompactIntVec> {
let n = self.n();
let mut result = TempCompactIntVecBuilder::new(n)?;
for &c in &g.indices { result.max(self.col_view(c)); }
result.freeze()
}
}
+1 -6
View File
@@ -23,11 +23,6 @@ impl LayerMeta {
}
fn parse(s: &str) -> Option<Self> {
let key = "\"n\":";
let pos = s.find(key)? + key.len();
let rest = s[pos..].trim_start();
let end = rest.find(|c: char| !c.is_ascii_digit()).unwrap_or(rest.len());
let n = rest[..end].parse().ok()?;
Some(Self { n })
Some(Self { n: crate::meta::field(s, "n")? })
}
}
+9 -1
View File
@@ -1,20 +1,28 @@
mod bitvec;
mod bitmatrix;
mod builder;
mod colgroup;
mod format;
mod intmatrix;
mod layer_meta;
mod meta;
mod reader;
mod tempbitvec;
mod tempintvec;
mod views;
pub mod traits;
pub use bitvec::{BitIter, PersistentBitVec, PersistentBitVecBuilder};
pub use bitmatrix::{PersistentBitMatrix, PersistentBitMatrixBuilder, pack_bit_matrix};
pub use builder::PersistentCompactIntVecBuilder;
pub use colgroup::{ColGroup, FilterMask, MatrixGroupOps, eval_filter_mask};
pub use intmatrix::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, pack_compact_int_matrix};
pub use layer_meta::LayerMeta;
pub use reader::PersistentCompactIntVec;
pub use reader::{PersistentCompactIntVec, Iter as CompactIntVecIter};
pub use tempbitvec::{TempBitVec, TempBitVecBuilder};
pub use tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
pub use traits::{BitPartials, ColumnWeights, CountPartials};
pub use views::{BitSliceView, BitSliceIter, IntSliceView, IntSliceViewIter};
#[cfg(test)]
#[path = "tests/mod.rs"]
+1 -1
View File
@@ -23,7 +23,7 @@ fn parse(s: &str) -> Option<MatrixMeta> {
Some(MatrixMeta { n: field(s, "n")?, n_cols: field(s, "n_cols")? })
}
fn field(s: &str, name: &str) -> Option<usize> {
pub(crate) fn field(s: &str, name: &str) -> Option<usize> {
let key = format!("\"{}\":", name);
let pos = s.find(&key)? + key.len();
let rest = s[pos..].trim_start();
+73 -210
View File
@@ -4,7 +4,8 @@ use std::path::{Path, PathBuf};
use memmap2::Mmap;
use crate::format::{HEADER_SIZE, INDEX_ENTRY_SIZE, MAGIC, OVERFLOW_ENTRY_SIZE};
use crate::format::{byte_count_nonzero, byte_sum, HEADER_SIZE, MAGIC, OVERFLOW_ENTRY_SIZE, parse_index_entry};
use crate::views::IntSliceView;
pub struct PersistentCompactIntVec {
mmap: Mmap,
@@ -18,100 +19,60 @@ pub struct PersistentCompactIntVec {
}
impl PersistentCompactIntVec {
/// Opens a persistent compact int vector from the given path.
pub fn open(path: &Path) -> io::Result<Self> {
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
if mmap.len() < HEADER_SIZE {
return Err(io::Error::new(
io::ErrorKind::InvalidData,
"PCIV file too short",
));
return Err(io::Error::new(io::ErrorKind::InvalidData, "PCIV file too short"));
}
if &mmap[0..4] != &MAGIC {
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PCIV magic"));
}
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
let n_overflow = u64::from_le_bytes(mmap[16..24].try_into().unwrap()) as usize;
let n_index = u64::from_le_bytes(mmap[24..32].try_into().unwrap()) as usize;
let step = u64::from_le_bytes(mmap[32..40].try_into().unwrap()) as usize;
let n_index = u64::from_le_bytes(mmap[24..32].try_into().unwrap()) as usize;
let step = u64::from_le_bytes(mmap[32..40].try_into().unwrap()) as usize;
let primary_offset = HEADER_SIZE;
let data_offset = primary_offset + n;
let index_offset = data_offset + n_overflow * OVERFLOW_ENTRY_SIZE;
let data_offset = primary_offset + n;
let index_offset = data_offset + n_overflow * OVERFLOW_ENTRY_SIZE;
let mut index = Vec::with_capacity(n_index);
for i in 0..n_index {
let off = index_offset + i * INDEX_ENTRY_SIZE;
let slot = u64::from_le_bytes(mmap[off..off + 8].try_into().unwrap()) as usize;
let pos = u64::from_le_bytes(mmap[off + 8..off + 16].try_into().unwrap()) as usize;
index.push((slot, pos));
index.push(parse_index_entry(&mmap, index_offset, i));
}
Ok(Self {
mmap,
n,
n_overflow,
step,
index,
primary_offset,
data_offset,
path: path.to_path_buf(),
})
Ok(Self { mmap, n, n_overflow, step, index, primary_offset, data_offset, path: path.to_path_buf() })
}
/// Returns the path of the compact int vector file.
pub fn path(&self) -> &Path {
&self.path
}
pub fn path(&self) -> &Path { &self.path }
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
/// Returns the length of the compact int vector.
pub fn len(&self) -> usize {
self.n
}
/// Returns whether the compact int vector is empty.
pub fn is_empty(&self) -> bool {
self.n == 0
}
/// Returns the value at the given slot.
pub fn get(&self, slot: usize) -> u32 {
match self.mmap[self.primary_offset + slot] {
255 => self.overflow_get(slot),
v => v as u32,
v => v as u32,
}
}
/// Returns the value at the given slot from the overflow region.
fn overflow_get(&self, slot: usize) -> u32 {
let pos_start;
let pos_end;
if self.step == 0 {
pos_start = 0;
pos_end = self.n_overflow;
let (pos_start, pos_end) = if self.step == 0 {
(0, self.n_overflow)
} else {
let i = self
.index
.partition_point(|&(s, _)| s <= slot)
.saturating_sub(1);
pos_start = self.index[i].1;
pos_end = if i + 1 < self.index.len() {
self.index[i + 1].1
} else {
self.n_overflow
};
}
let i = self.index.partition_point(|&(s, _)| s <= slot).saturating_sub(1);
let start = self.index[i].1;
let end = if i + 1 < self.index.len() { self.index[i + 1].1 } else { self.n_overflow };
(start, end)
};
let mut lo = pos_start;
let mut hi = pos_end;
while lo < hi {
let mid = lo + (hi - lo) / 2;
match self.data_slot(mid).cmp(&slot) {
std::cmp::Ordering::Equal => return self.data_value(mid),
std::cmp::Ordering::Less => lo = mid + 1,
std::cmp::Ordering::Equal => return self.data_value(mid),
std::cmp::Ordering::Less => lo = mid + 1,
std::cmp::Ordering::Greater => hi = mid,
}
}
@@ -119,140 +80,91 @@ impl PersistentCompactIntVec {
}
#[inline]
/// Returns the slot at the given index in the overflow region.
fn data_slot(&self, i: usize) -> usize {
let off = self.data_offset + i * OVERFLOW_ENTRY_SIZE;
u64::from_le_bytes(self.mmap[off..off + 8].try_into().unwrap()) as usize
}
#[inline]
/// Returns the value at the given index in the overflow region.
fn data_value(&self, i: usize) -> u32 {
let off = self.data_offset + i * OVERFLOW_ENTRY_SIZE + 8;
u32::from_le_bytes(self.mmap[off..off + 4].try_into().unwrap())
}
#[inline]
/// Returns the sum of all values in the compact int vector.
pub fn sum(&self) -> u64 {
self.iter().map(|v| v as u64).sum()
let primary = &self.mmap[self.primary_offset..self.primary_offset + self.n];
byte_sum(primary, (0..self.n_overflow).map(|i| self.data_value(i)))
}
#[inline]
/// Returns the Bray-Curtis distance between two compact int vectors.
pub fn count_nonzero(&self) -> u64 {
let primary = &self.mmap[self.primary_offset..self.primary_offset + self.n];
byte_count_nonzero(primary)
}
/// Lightweight zero-copy view — primary and overflow point into the mmap.
pub fn view(&self) -> IntSliceView<'_> {
let primary = &self.mmap[self.primary_offset..self.primary_offset + self.n];
let overflow_raw = &self.mmap[self.data_offset..self.data_offset + self.n_overflow * OVERFLOW_ENTRY_SIZE];
IntSliceView::new(primary, overflow_raw, self.n_overflow, self.n)
}
pub fn iter(&self) -> Iter<'_> {
Iter { pciv: self, slot: 0, overflow_pos: 0 }
}
// ── Distance methods ──────────────────────────────────────────────────────
pub fn bray_dist(&self, other: &PersistentCompactIntVec) -> f64 {
let sum_min = self.partial_bray_dist(other);
let denom = self.sum() + other.sum();
if denom == 0 {
return 0.0;
}
1.0 - 2.0 * sum_min as f64 / denom as f64
if denom == 0 { 0.0 } else { 1.0 - 2.0 * sum_min as f64 / denom as f64 }
}
/// Returns `Σ_slot min(self[slot], other[slot])` — the additive numerator of Bray-Curtis.
/// The denominator `sum_a + sum_b` is obtained from `self.sum() + other.sum()`.
pub fn partial_bray_dist(&self, other: &PersistentCompactIntVec) -> u64 {
assert_eq!(self.n, other.len(), "length mismatch");
self.iter()
.zip(other.iter())
.map(|(a, b)| a.min(b) as u64)
.sum()
self.iter().zip(other.iter()).map(|(a, b)| a.min(b) as u64).sum()
}
/// Returns the relative frequency Bray-Curtis distance between two compact int vectors.
///
/// This is a variant of [`bray_dist`] that uses relative frequencies instead of raw counts.
pub fn relfreq_bray_dist(&self, other: &PersistentCompactIntVec) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
let sum_a = self.sum() as f64;
let sum_b = other.sum() as f64;
if sum_a == 0.0 && sum_b == 0.0 {
return 0.0;
}
let sum_min = self.partial_relfreq_bray_dist(other, sum_a, sum_b);
1.0 - sum_min
let sa = self.sum() as f64;
let sb = other.sum() as f64;
if sa == 0.0 && sb == 0.0 { return 0.0; }
1.0 - self.partial_relfreq_bray_dist(other, sa, sb)
}
/// Returns the partial relative frequency Bray-Curtis distance between two compact int vectors.
///
/// This is used internally by [`relfreq_bray_dist`] and to easily compute the relative frequency
/// Bray-Curtis distance over a set of vector pairs.
///
/// Arguments:
/// - `other`: the other compact int vector to compare with
/// - `sum_a`: the sum of the first vector's counts
/// - `sum_b`: the sum of the second vector's counts
///
/// Returns the sum of the minimum relative frequencies at each index.
pub fn partial_relfreq_bray_dist(
&self,
other: &PersistentCompactIntVec,
sum_a: f64,
sum_b: f64,
) -> f64 {
pub fn partial_relfreq_bray_dist(&self, other: &PersistentCompactIntVec, sum_a: f64, sum_b: f64) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
let sum_min: f64 = self
.iter()
.zip(other.iter())
self.iter().zip(other.iter())
.map(|(a, b)| {
let pa = if sum_a > 0.0 { a as f64 / sum_a } else { 0.0 };
let pb = if sum_b > 0.0 { b as f64 / sum_b } else { 0.0 };
pa.min(pb)
})
.sum();
sum_min
.sum()
}
/// Returns the euclidean distance between two compact int vectors.
pub fn euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
self.partial_euclidean_dist(other).sqrt()
}
/// Returns the partial euclidean distance between two compact int vectors.
///
/// This is used internally by [`euclidean_dist`] and to easily compute the euclidean distance
/// over a set of vector pairs.
///
/// The result is the sum of the squared differences between corresponding elements of the two
/// vectors.
pub fn partial_euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
self.iter()
.zip(other.iter())
.map(|(a, b)| {
let d = a as f64 - b as f64;
d * d
})
self.iter().zip(other.iter())
.map(|(a, b)| { let d = a as f64 - b as f64; d * d })
.sum()
}
/// Returns the relative frequency euclidean distance between two compact int vectors.
///
/// This is a variant of [`euclidean_dist`] that uses relative frequencies instead of raw counts.
pub fn relfreq_euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
let sum_a = self.sum() as f64;
let sum_b = other.sum() as f64;
if sum_a == 0.0 && sum_b == 0.0 {
return 0.0;
}
self.partial_relfreq_euclidean_dist(other, sum_a, sum_b)
.sqrt()
let sa = self.sum() as f64;
let sb = other.sum() as f64;
if sa == 0.0 && sb == 0.0 { return 0.0; }
self.partial_relfreq_euclidean_dist(other, sa, sb).sqrt()
}
/// Returns the partial relative frequency euclidean distance between two compact int vectors.
///
/// This is used internally by [`relfreq_euclidean_dist`] and to easily compute the relative frequency
/// euclidean distance over a set of vector pairs.
pub fn partial_relfreq_euclidean_dist(
&self,
other: &PersistentCompactIntVec,
sum_a: f64,
sum_b: f64,
) -> f64 {
pub fn partial_relfreq_euclidean_dist(&self, other: &PersistentCompactIntVec, sum_a: f64, sum_b: f64) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
self.iter()
.zip(other.iter())
self.iter().zip(other.iter())
.map(|(a, b)| {
let pa = if sum_a > 0.0 { a as f64 / sum_a } else { 0.0 };
let pb = if sum_b > 0.0 { b as f64 / sum_b } else { 0.0 };
@@ -262,46 +174,19 @@ impl PersistentCompactIntVec {
.sum()
}
/// Returns the Euclidean distance between two compact int vectors using the Hellinger transform.
///
/// The Hellinger transform is applied to the raw counts of each vector, and the result is
/// the Euclidean distance between the transformed vectors. The Hellinger transform is defined
/// as the square root of the relative frequencies.
pub fn hellinger_euclidean_dist(&self, other: &PersistentCompactIntVec) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
let sum_a = self.sum() as f64;
let sum_b = other.sum() as f64;
if sum_a == 0.0 && sum_b == 0.0 {
return 0.0;
}
self.partial_hellinger_euclidean_dist(other, sum_a, sum_b)
.sqrt()
let sa = self.sum() as f64;
let sb = other.sum() as f64;
if sa == 0.0 && sb == 0.0 { return 0.0; }
self.partial_hellinger_euclidean_dist(other, sa, sb).sqrt()
}
/// Returns the partial Hellinger Euclidean distance between two compact int vectors.
///
/// This is used internally by [`hellinger_euclidean_dist`] and to easily compute the Hellinger
/// Euclidean distance over a set of vector pairs.
pub fn partial_hellinger_euclidean_dist(
&self,
other: &PersistentCompactIntVec,
sum_a: f64,
sum_b: f64,
) -> f64 {
pub fn partial_hellinger_euclidean_dist(&self, other: &PersistentCompactIntVec, sum_a: f64, sum_b: f64) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
self.iter()
.zip(other.iter())
self.iter().zip(other.iter())
.map(|(a, b)| {
let pa = if sum_a > 0.0 {
(a as f64 / sum_a).sqrt()
} else {
0.0
};
let pb = if sum_b > 0.0 {
(b as f64 / sum_b).sqrt()
} else {
0.0
};
let pa = if sum_a > 0.0 { (a as f64 / sum_a).sqrt() } else { 0.0 };
let pb = if sum_b > 0.0 { (b as f64 / sum_b).sqrt() } else { 0.0 };
let d = pa - pb;
d * d
})
@@ -313,22 +198,13 @@ impl PersistentCompactIntVec {
}
pub fn threshold_jaccard_dist(&self, other: &PersistentCompactIntVec, threshold: u32) -> f64 {
assert_eq!(self.n, other.len(), "length mismatch");
let (intersection, union) = self.partial_threshold_jaccard_dist(other, threshold);
if union == 0 {
return 0.0;
}
1.0 - intersection as f64 / union as f64
if union == 0 { 0.0 } else { 1.0 - intersection as f64 / union as f64 }
}
pub fn partial_threshold_jaccard_dist(
&self,
other: &PersistentCompactIntVec,
threshold: u32,
) -> (u64, u64) {
pub fn partial_threshold_jaccard_dist(&self, other: &PersistentCompactIntVec, threshold: u32) -> (u64, u64) {
assert_eq!(self.n, other.len(), "length mismatch");
self.iter()
.zip(other.iter())
self.iter().zip(other.iter())
.fold((0u64, 0u64), |(inter, uni), (a, b)| {
let ap = a >= threshold;
let bp = b >= threshold;
@@ -339,23 +215,12 @@ impl PersistentCompactIntVec {
pub fn jaccard_dist(&self, other: &PersistentCompactIntVec) -> f64 {
self.threshold_jaccard_dist(other, 1)
}
pub fn iter(&self) -> Iter<'_> {
Iter {
pciv: self,
slot: 0,
overflow_pos: 0,
}
}
}
impl<'a> IntoIterator for &'a PersistentCompactIntVec {
type Item = u32;
type IntoIter = Iter<'a>;
fn into_iter(self) -> Iter<'a> {
self.iter()
}
fn into_iter(self) -> Iter<'a> { self.iter() }
}
pub struct Iter<'a> {
@@ -370,9 +235,7 @@ impl Iterator for Iter<'_> {
type Item = u32;
fn next(&mut self) -> Option<u32> {
if self.slot >= self.pciv.n {
return None;
}
if self.slot >= self.pciv.n { return None; }
let v = self.pciv.mmap[self.pciv.primary_offset + self.slot];
self.slot += 1;
if v < 255 {
+111
View File
@@ -0,0 +1,111 @@
use std::io;
use std::path::Path;
use tempfile::TempDir;
use crate::bitvec::{PersistentBitVec, PersistentBitVecBuilder};
use crate::views::{BitSliceIter, BitSliceView, IntSliceView};
// ── TempBitVec — frozen read-only, auto-deleted on drop ──────────────────────
pub struct TempBitVec {
vec: PersistentBitVec,
// Dropped after `vec` (field order), so the mmap is released before the
// temp directory is deleted.
_temp: TempDir,
}
impl TempBitVec {
pub fn make_persistent(&self, path: &Path) -> io::Result<PersistentBitVec> {
std::fs::copy(self.vec.path(), path)?;
PersistentBitVec::open(path)
}
pub fn len(&self) -> usize {
self.vec.len()
}
pub fn is_empty(&self) -> bool {
self.vec.is_empty()
}
pub fn get(&self, slot: usize) -> bool {
self.vec.get(slot)
}
pub fn count_ones(&self) -> u64 {
self.vec.count_ones()
}
pub fn view(&self) -> BitSliceView<'_> {
self.vec.view()
}
pub fn iter(&self) -> BitSliceIter<'_> {
self.view().iter()
}
}
// ── TempBitVecBuilder — mutable, becomes TempBitVec on freeze ────────────────
pub struct TempBitVecBuilder {
builder: PersistentBitVecBuilder,
temp: TempDir,
}
impl TempBitVecBuilder {
pub fn new(n: usize) -> io::Result<Self> {
let temp = TempDir::new()?;
let path = temp.path().join("data.pbiv");
let builder = PersistentBitVecBuilder::new(n, &path)?;
Ok(Self { builder, temp })
}
pub fn new_ones(n: usize) -> io::Result<Self> {
let temp = TempDir::new()?;
let path = temp.path().join("data.pbiv");
let builder = PersistentBitVecBuilder::new_ones(n, &path)?;
Ok(Self { builder, temp })
}
pub fn freeze(self) -> io::Result<TempBitVec> {
let Self { builder, temp } = self;
let vec = builder.finish()?;
Ok(TempBitVec { vec, _temp: temp })
}
pub fn set(&mut self, slot: usize, value: bool) {
self.builder.set(slot, value);
}
pub fn view(&self) -> BitSliceView<'_> {
self.builder.view()
}
pub fn or(&mut self, other: BitSliceView<'_>) {
self.builder.or(other);
}
pub fn and(&mut self, other: BitSliceView<'_>) {
self.builder.and(other);
}
pub fn xor(&mut self, other: BitSliceView<'_>) {
self.builder.xor(other);
}
pub fn not(&mut self) {
self.builder.not();
}
pub fn copy_from(&mut self, src: BitSliceView<'_>) {
self.builder.copy_from(src);
}
pub fn or_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
self.builder.or_where(col, pred);
}
pub fn and_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
self.builder.and_where(col, pred);
}
pub fn xor_where(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
self.builder.xor_where(col, pred);
}
}
+89
View File
@@ -0,0 +1,89 @@
use std::io;
use std::path::Path;
use tempfile::TempDir;
use crate::builder::PersistentCompactIntVecBuilder;
use crate::reader::PersistentCompactIntVec;
use crate::views::{BitSliceView, IntSliceView};
// ── TempCompactIntVec — frozen read-only, auto-deleted on drop ────────────────
pub struct TempCompactIntVec {
vec: PersistentCompactIntVec,
// Dropped after `vec` (field order), so the mmap is released before the
// temp directory is deleted.
_temp: TempDir,
}
impl TempCompactIntVec {
pub fn make_persistent(&self, path: &Path) -> io::Result<PersistentCompactIntVec> {
std::fs::copy(self.vec.path(), path)?;
PersistentCompactIntVec::open(path)
}
pub fn len(&self) -> usize { self.vec.len() }
pub fn is_empty(&self) -> bool { self.vec.is_empty() }
pub fn get(&self, slot: usize) -> u32 { self.vec.get(slot) }
pub fn sum(&self) -> u64 { self.vec.sum() }
pub fn view(&self) -> IntSliceView<'_> { self.vec.view() }
pub fn iter(&self) -> crate::reader::Iter<'_> { self.vec.iter() }
}
// ── TempCompactIntVecBuilder — mutable, becomes TempCompactIntVec on freeze ──
pub struct TempCompactIntVecBuilder {
builder: PersistentCompactIntVecBuilder,
temp: TempDir,
}
impl TempCompactIntVecBuilder {
pub fn new(n: usize) -> io::Result<Self> {
let temp = TempDir::new()?;
let path = temp.path().join("data.pciv");
let builder = PersistentCompactIntVecBuilder::new(n, &path)?;
Ok(Self { builder, temp })
}
pub fn freeze(self) -> io::Result<TempCompactIntVec> {
let Self { builder, temp } = self;
let vec = builder.finish()?;
Ok(TempCompactIntVec { vec, _temp: temp })
}
pub fn n(&self) -> usize { self.builder.len() }
pub fn set(&mut self, slot: usize, value: u32) { self.builder.set(slot, value); }
pub fn get(&self, slot: usize) -> u32 { self.builder.get(slot) }
pub fn primary_bytes(&self) -> &[u8] { self.builder.primary_bytes() }
pub fn primary_bytes_mut(&mut self) -> &mut [u8] { self.builder.primary_bytes_mut() }
pub fn inc_present(&mut self, col: BitSliceView<'_>) {
self.builder.inc_present(col);
}
pub fn inc_present_fast(&mut self, col: BitSliceView<'_>) {
self.builder.inc_present_fast(col);
}
pub fn inc_predicate(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
self.builder.inc_predicate(col, pred);
}
pub fn inc_predicate_fast(&mut self, col: IntSliceView<'_>, pred: impl Fn(u32) -> bool) {
self.builder.inc_predicate_fast(col, pred);
}
pub fn add(&mut self, other: IntSliceView<'_>) {
self.builder.add(other);
}
pub fn mask_with(&mut self, mask: BitSliceView<'_>) {
self.builder.mask_with(mask);
}
pub fn min(&mut self, other: IntSliceView<'_>) { self.builder.min(other); }
pub fn max(&mut self, other: IntSliceView<'_>) { self.builder.max(other); }
pub fn diff(&mut self, other: IntSliceView<'_>) { self.builder.diff(other); }
}
+56 -1
View File
@@ -1,6 +1,7 @@
use tempfile::tempdir;
use crate::{PersistentBitMatrix, PersistentBitMatrixBuilder};
use crate::{pack_bit_matrix, PersistentBitMatrix, PersistentBitMatrixBuilder};
use crate::traits::BitPartials;
fn make_matrix(cols: &[&[bool]]) -> (tempfile::TempDir, PersistentBitMatrix) {
let n = cols.first().map_or(0, |c| c.len());
@@ -202,3 +203,57 @@ fn partial_hamming_matches_hamming() {
let full = m.hamming_dist_matrix();
assert_eq!(partial, full);
}
// ── col_view on Packed ────────────────────────────────────────────────────────
#[test]
fn col_view_packed_values() {
let (dir, _) = make_matrix(&[
&[true, false, true, true],
&[false, true, false, true],
]);
pack_bit_matrix(&dir.path().join("presence")).unwrap();
let m = PersistentBitMatrix::open(dir.path()).unwrap();
// col 0: [T, F, T, T]
let v0 = m.col_view(0);
assert_eq!(v0.len(), 4);
assert_eq!(v0.get(0), true);
assert_eq!(v0.get(1), false);
assert_eq!(v0.get(2), true);
assert_eq!(v0.get(3), true);
assert_eq!(v0.count_ones(), 3);
// col 1: [F, T, F, T]
let v1 = m.col_view(1);
assert_eq!(v1.get(0), false);
assert_eq!(v1.get(1), true);
assert_eq!(v1.get(2), false);
assert_eq!(v1.get(3), true);
assert_eq!(v1.count_ones(), 2);
}
#[test]
fn col_view_packed_matches_columnar() {
let data: &[&[bool]] = &[
&[true, false, true, false, true, true, false, true],
&[false, false, true, true, false, true, true, false],
&[true, true, true, false, false, false, true, true],
];
let (dir_col, m_col) = make_matrix(data);
let (dir_pack, _) = make_matrix(data);
pack_bit_matrix(&dir_pack.path().join("presence")).unwrap();
let m_pack = PersistentBitMatrix::open(dir_pack.path()).unwrap();
for c in 0..data.len() {
let col_ref = m_col.col(c);
let col_view = m_pack.col_view(c);
assert_eq!(col_view.len(), col_ref.len(), "col={c} len");
for s in 0..col_ref.len() {
assert_eq!(col_view.get(s), col_ref.get(s), "col={c} slot={s}");
}
assert_eq!(col_view.count_ones(), col_ref.count_ones(), "col={c} count_ones");
assert_eq!(col_view.words(), col_ref.words(), "col={c} words");
}
drop(dir_col);
}
+3 -3
View File
@@ -77,7 +77,7 @@ fn op_and() {
let dir = tempdir().unwrap();
let path = dir.path().join("out.pbiv");
let mut b = PersistentBitVecBuilder::build_from(&ra, &path).unwrap();
b.and(&rb);
b.and(rb.view());
b.close().unwrap();
let r = PersistentBitVec::open(&path).unwrap();
assert_eq!(r.iter().collect::<Vec<_>>(), vec![true, false, false, false]);
@@ -90,7 +90,7 @@ fn op_or() {
let dir = tempdir().unwrap();
let path = dir.path().join("out.pbiv");
let mut b = PersistentBitVecBuilder::build_from(&ra, &path).unwrap();
b.or(&rb);
b.or(rb.view());
b.close().unwrap();
let r = PersistentBitVec::open(&path).unwrap();
assert_eq!(r.iter().collect::<Vec<_>>(), vec![true, true, true, false]);
@@ -103,7 +103,7 @@ fn op_xor() {
let dir = tempdir().unwrap();
let path = dir.path().join("out.pbiv");
let mut b = PersistentBitVecBuilder::build_from(&ra, &path).unwrap();
b.xor(&rb);
b.xor(rb.view());
b.close().unwrap();
let r = PersistentBitVec::open(&path).unwrap();
assert_eq!(r.iter().collect::<Vec<_>>(), vec![false, true, true, false]);
+223
View File
@@ -0,0 +1,223 @@
use tempfile::tempdir;
use crate::{
ColGroup, MatrixGroupOps,
PersistentBitMatrix, PersistentBitMatrixBuilder,
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder,
};
use crate::{PersistentBitVecBuilder, PersistentCompactIntVec, PersistentCompactIntVecBuilder};
// ── helpers ───────────────────────────────────────────────────────────────────
fn make_int_matrix(cols: &[&[u32]]) -> (tempfile::TempDir, PersistentCompactIntMatrix) {
let n = cols.first().map_or(0, |c| c.len());
let dir = tempdir().unwrap();
let mut b = PersistentCompactIntMatrixBuilder::new(n, &dir.path().join("counts")).unwrap();
for &col in cols {
let mut cb = b.add_col().unwrap();
for (slot, &v) in col.iter().enumerate() { cb.set(slot, v); }
cb.close().unwrap();
}
b.close().unwrap();
let m = PersistentCompactIntMatrix::open(dir.path()).unwrap();
(dir, m)
}
fn make_bit_matrix(cols: &[&[bool]]) -> (tempfile::TempDir, PersistentBitMatrix) {
let n = cols.first().map_or(0, |c| c.len());
let dir = tempdir().unwrap();
let presence = dir.path().join("presence");
let mut b = PersistentBitMatrixBuilder::new(n, &presence).unwrap();
for &col in cols {
let mut cb = b.add_col().unwrap();
for (slot, &v) in col.iter().enumerate() { cb.set(slot, v); }
cb.close().unwrap();
}
b.close().unwrap();
let m = PersistentBitMatrix::open(dir.path()).unwrap();
(dir, m)
}
// ── IntMatrix: partial_group_sum ──────────────────────────────────────────────
#[test]
fn int_partial_group_sum_basic() {
// col0=[1,2,3], col1=[10,20,30], col2=[100,0,5]
// group {0,2}: sum = [101, 2, 8]
let (_d, m) = make_int_matrix(&[&[1, 2, 3], &[10, 20, 30], &[100, 0, 5]]);
let g = ColGroup::new("g", vec![0, 2]);
let result = m.partial_group_sum(&g).unwrap();
assert_eq!(result.get(0), 101);
assert_eq!(result.get(1), 2);
assert_eq!(result.get(2), 8);
}
#[test]
fn int_partial_group_sum_with_overflow() {
// col0=[300,0], col1=[200,400]: group {0,1}: sum=[500, 400]
let (_d, m) = make_int_matrix(&[&[300, 0], &[200, 400]]);
let g = ColGroup::new("g", vec![0, 1]);
let result = m.partial_group_sum(&g).unwrap();
assert_eq!(result.get(0), 500);
assert_eq!(result.get(1), 400);
assert_eq!(result.sum(), 900);
}
// ── IntMatrix: partial_group_presence_count ───────────────────────────────────
#[test]
fn int_partial_group_presence_count() {
// col0=[5,1,0,3], col1=[2,0,4,3], col2=[0,3,1,0]
// threshold=2: col0: [T,F,F,T], col1: [T,F,T,T], col2: [F,T,F,F]
// group {0,1,2}: counts = [2, 1, 1, 2]
let (_d, m) = make_int_matrix(&[&[5, 1, 0, 3], &[2, 0, 4, 3], &[0, 3, 1, 0]]);
let g = ColGroup::new("g", vec![0, 1, 2]);
let result = m.partial_group_presence_count(&g, 2).unwrap();
assert_eq!(result.get(0), 2);
assert_eq!(result.get(1), 1);
assert_eq!(result.get(2), 1);
assert_eq!(result.get(3), 2);
}
#[test]
fn int_partial_group_presence_count_with_overflow() {
// col0=[300,0,10], col1=[0,400,10], col2=[1,1,10]
// threshold=5: col0: [T,F,T], col1: [F,T,T], col2: [F,F,T]
// group {0,1,2}: counts = [1, 1, 3]
let (_d, m) = make_int_matrix(&[&[300, 0, 10], &[0, 400, 10], &[1, 1, 10]]);
let g = ColGroup::new("g", vec![0, 1, 2]);
let result = m.partial_group_presence_count(&g, 5).unwrap();
assert_eq!(result.get(0), 1);
assert_eq!(result.get(1), 1);
assert_eq!(result.get(2), 3);
}
// ── IntMatrix: partial_group_any ──────────────────────────────────────────────
#[test]
fn int_partial_group_any() {
// col0=[0,3,0,1], col1=[2,0,0,0], col2=[0,0,5,0]
// threshold=2: col0: [F,T,F,F], col1: [T,F,F,F], col2: [F,F,T,F]
// group {0,1,2}: any = [T, T, T, F]
let (_d, m) = make_int_matrix(&[&[0, 3, 0, 1], &[2, 0, 0, 0], &[0, 0, 5, 0]]);
let g = ColGroup::new("g", vec![0, 1, 2]);
let result = m.partial_group_any(&g, 2).unwrap();
assert_eq!(result.get(0), true);
assert_eq!(result.get(1), true);
assert_eq!(result.get(2), true);
assert_eq!(result.get(3), false);
}
// ── IntMatrix: mask_with ──────────────────────────────────────────────────────
#[test]
fn mask_with_zeros_selected_slots() {
// count vec [10, 20, 30, 40], mask [T, F, T, F] → [10, 0, 30, 0]
let dir = tempdir().unwrap();
let mut v = PersistentCompactIntVecBuilder::new(4, &dir.path().join("v.pciv")).unwrap();
v.set(0, 10); v.set(1, 20); v.set(2, 30); v.set(3, 40);
let mut mask = PersistentBitVecBuilder::new(4, &dir.path().join("m.pbiv")).unwrap();
mask.set(0, true); mask.set(2, true);
v.mask_with(mask.view());
v.close().unwrap();
let r = PersistentCompactIntVec::open(&dir.path().join("v.pciv")).unwrap();
assert_eq!(r.get(0), 10);
assert_eq!(r.get(1), 0);
assert_eq!(r.get(2), 30);
assert_eq!(r.get(3), 0);
}
#[test]
fn mask_with_overflow_slot_zeroed() {
// overflow slot (value 500) masked out → removed from overflow, primary=0
let dir = tempdir().unwrap();
let mut v = PersistentCompactIntVecBuilder::new(3, &dir.path().join("v.pciv")).unwrap();
v.set(0, 10); v.set(1, 500); v.set(2, 5);
let mut mask = PersistentBitVecBuilder::new(3, &dir.path().join("m.pbiv")).unwrap();
mask.set(0, true); mask.set(2, true); // slot 1 masked out
v.mask_with(mask.view());
v.close().unwrap();
let r = PersistentCompactIntVec::open(&dir.path().join("v.pciv")).unwrap();
assert_eq!(r.get(0), 10);
assert_eq!(r.get(1), 0);
assert_eq!(r.get(2), 5);
let ov: Vec<_> = r.view().overflow_entries().collect();
assert!(ov.is_empty(), "overflow entry for masked-out slot should be gone");
}
#[test]
fn mask_with_all_ones_is_noop() {
let dir = tempdir().unwrap();
let mut v = PersistentCompactIntVecBuilder::new(4, &dir.path().join("v.pciv")).unwrap();
v.set(0, 300); v.set(1, 1); v.set(2, 0); v.set(3, 42);
let mask = PersistentBitVecBuilder::new_ones(4, &dir.path().join("m.pbiv")).unwrap();
v.mask_with(mask.view());
v.close().unwrap();
let r = PersistentCompactIntVec::open(&dir.path().join("v.pciv")).unwrap();
assert_eq!(r.get(0), 300);
assert_eq!(r.get(1), 1);
assert_eq!(r.get(2), 0);
assert_eq!(r.get(3), 42);
}
// ── BitMatrix: partial_group_presence_count ───────────────────────────────────
#[test]
fn bit_partial_group_presence_count() {
// col0=[T,F,T,F], col1=[T,T,F,F], col2=[F,T,T,F]
// group {0,1,2}: counts = [2, 2, 2, 0]
let (_d, m) = make_bit_matrix(&[
&[true, false, true, false],
&[true, true, false, false],
&[false,true, true, false],
]);
let g = ColGroup::new("g", vec![0, 1, 2]);
let result = m.partial_group_presence_count(&g, 1).unwrap();
assert_eq!(result.get(0), 2);
assert_eq!(result.get(1), 2);
assert_eq!(result.get(2), 2);
assert_eq!(result.get(3), 0);
}
// ── BitMatrix: partial_group_any ──────────────────────────────────────────────
#[test]
fn bit_partial_group_any() {
// col0=[T,F,F], col1=[F,F,T], group {0,1}: any = [T, F, T]
let (_d, m) = make_bit_matrix(&[
&[true, false, false],
&[false, false, true],
]);
let g = ColGroup::new("g", vec![0, 1]);
let result = m.partial_group_any(&g, 1).unwrap();
assert_eq!(result.get(0), true);
assert_eq!(result.get(1), false);
assert_eq!(result.get(2), true);
}
// ── Composition: partial results are additive ─────────────────────────────────
#[test]
fn int_presence_count_additive_across_split() {
// Simulate two partitions (different kmer ranges) whose counts should add.
// Global data for col0: [5,1,0,3,2], col1: [2,0,4,3,1] — threshold=2
// Split: partition A = slots 0..2, partition B = slots 2..5
let data_a: &[&[u32]] = &[&[5, 1], &[2, 0]];
let data_b: &[&[u32]] = &[&[0, 3, 2], &[4, 3, 1]];
let (_da, ma) = make_int_matrix(data_a);
let (_db, mb) = make_int_matrix(data_b);
let g = ColGroup::new("g", vec![0, 1]);
let pa = ma.partial_group_presence_count(&g, 2).unwrap();
let pb = mb.partial_group_presence_count(&g, 2).unwrap();
// Concatenate by adding (disjoint kmer ranges — here we just verify
// individual results match the expected per-partition counts).
// partition A: col0=[5≥2,1<2]=[T,F], col1=[2≥2,0<2]=[T,F] → [2, 0]
assert_eq!(pa.get(0), 2);
assert_eq!(pa.get(1), 0);
// partition B: col0=[0<2,3≥2,2≥2]=[F,T,T], col1=[4≥2,3≥2,1<2]=[T,T,F] → [1, 2, 1]
assert_eq!(pb.get(0), 1);
assert_eq!(pb.get(1), 2);
assert_eq!(pb.get(2), 1);
}
+57 -1
View File
@@ -1,6 +1,7 @@
use tempfile::tempdir;
use crate::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder};
use crate::{pack_compact_int_matrix, PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder};
use crate::traits::CountPartials;
fn make_matrix(cols: &[&[u32]]) -> (tempfile::TempDir, PersistentCompactIntMatrix) {
let n = cols.first().map_or(0, |c| c.len());
@@ -242,6 +243,61 @@ fn partial_hellinger_matches_full() {
}
}
#[test]
fn col_view_packed_values() {
// Build Columnar with overflow values (≥ 255), pack, reopen as Packed, exercise col_view().
let (dir, _col) = make_matrix(&[&[10, 300, 500], &[200, 50, 1000]]);
pack_compact_int_matrix(&dir.path().join("counts")).unwrap();
let m = PersistentCompactIntMatrix::open(dir.path()).unwrap();
// col 0: [10, 300, 500] — two overflow slots
let v0 = m.col_view(0);
assert_eq!(v0.get(0), 10);
assert_eq!(v0.get(1), 300);
assert_eq!(v0.get(2), 500);
assert_eq!(v0.sum(), 810);
assert_eq!(v0.count_nonzero(), 3);
let mut ov0: Vec<(usize, u32)> = v0.overflow_entries().collect();
ov0.sort_unstable_by_key(|&(s, _)| s);
assert_eq!(ov0, vec![(1, 300), (2, 500)]);
// col 1: [200, 50, 1000] — one overflow slot
let v1 = m.col_view(1);
assert_eq!(v1.get(0), 200);
assert_eq!(v1.get(1), 50);
assert_eq!(v1.get(2), 1000);
let mut ov1: Vec<(usize, u32)> = v1.overflow_entries().collect();
ov1.sort_unstable_by_key(|&(s, _)| s);
assert_eq!(ov1, vec![(2, 1000)]);
}
#[test]
fn col_view_packed_matches_columnar() {
// Same data, compare col_view() on Packed against col() on Columnar slot-by-slot.
let data: &[&[u32]] = &[&[0, 255, 1, 300, 128], &[500, 3, 0, 700, 42]];
let (dir_col, m_col) = make_matrix(data);
// Re-build in a separate dir so we can pack without touching m_col's files.
let (dir_pack, _) = make_matrix(data);
pack_compact_int_matrix(&dir_pack.path().join("counts")).unwrap();
let m_pack = PersistentCompactIntMatrix::open(dir_pack.path()).unwrap();
for c in 0..data.len() {
let col_ref = m_col.col(c);
let col_view = m_pack.col_view(c);
assert_eq!(col_view.len(), col_ref.len());
for s in 0..col_ref.len() {
assert_eq!(col_view.get(s), col_ref.get(s), "col={c} slot={s}");
}
assert_eq!(col_view.sum(), col_ref.sum(), "col={c} sum");
let mut ov_view: Vec<(usize, u32)> = col_view.overflow_entries().collect();
let mut ov_ref: Vec<(usize, u32)> = col_ref.view().overflow_entries().collect();
ov_view.sort_unstable_by_key(|&(s, _)| s);
ov_ref.sort_unstable_by_key(|&(s, _)| s);
assert_eq!(ov_view, ov_ref, "col={c} overflow_entries");
}
drop(dir_col);
}
#[test]
fn partial_relfreq_bray_additive_across_split() {
// Split rows [1,2,3,4,5] between two matrices; partial sums should add up.
+5 -4
View File
@@ -1,5 +1,6 @@
mod bitmatrix;
mod bitvec;
mod colgroup;
mod intmatrix;
use tempfile::tempdir;
@@ -169,7 +170,7 @@ fn combine_min() {
let dir = tempdir().unwrap();
let path = dir.path().join("out.pciv");
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
b.min(&rb);
b.min(rb.view());
b.close().unwrap();
let r = PersistentCompactIntVec::open(&path).unwrap();
assert_eq!(r.iter().collect::<Vec<_>>(), vec![10, 100, 0, 800]);
@@ -182,7 +183,7 @@ fn combine_max() {
let dir = tempdir().unwrap();
let path = dir.path().join("out.pciv");
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
b.max(&rb);
b.max(rb.view());
b.close().unwrap();
let r = PersistentCompactIntVec::open(&path).unwrap();
assert_eq!(r.iter().collect::<Vec<_>>(), vec![20, 300, 500, 1000]);
@@ -195,7 +196,7 @@ fn combine_add() {
let dir = tempdir().unwrap();
let path = dir.path().join("out.pciv");
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
b.add(&rb);
b.add(rb.view());
b.close().unwrap();
let r = PersistentCompactIntVec::open(&path).unwrap();
assert_eq!(r.iter().collect::<Vec<_>>(), vec![30, 300, 5, 101]);
@@ -220,7 +221,7 @@ fn combine_diff() {
let dir = tempdir().unwrap();
let path = dir.path().join("out.pciv");
let mut b = PersistentCompactIntVecBuilder::build_from(&ra, &path).unwrap();
b.diff(&rb);
b.diff(rb.view());
b.close().unwrap();
let r = PersistentCompactIntVec::open(&path).unwrap();
assert_eq!(r.iter().collect::<Vec<_>>(), vec![10, 700, 0, 0]);
+13 -1
View File
@@ -1,9 +1,17 @@
use ndarray::{Array1, Array2};
/// Column-level weight statistic — total count or presence count per column.
// ── Column-level weight statistic — total count or presence count per column.
/// Additive across layers and partitions; used as denominator in normalised distances.
///
/// `partial_kmer_counts` returns the number of **distinct k-mers** present per
/// column (presence = 1 entries; count > 0 entries). For presence matrices this
/// equals `col_weights`; for count matrices it differs (count_nonzero vs sum).
pub trait ColumnWeights: Send + Sync {
fn col_weights(&self) -> Array1<u64>;
fn partial_kmer_counts(&self) -> Array1<u64> {
self.col_weights()
}
}
/// Partial distance matrices for count-based data (`PersistentCompactIntMatrix`).
@@ -46,6 +54,10 @@ pub trait CountPartials: ColumnWeights {
self.partial_euclidean().mapv(|v| v.sqrt())
}
fn jaccard_dist_matrix(&self) -> Array2<f64> {
self.threshold_jaccard_dist_matrix(1)
}
fn threshold_jaccard_dist_matrix(&self, threshold: u32) -> Array2<f64> {
let (inter, union) = self.partial_threshold_jaccard(threshold);
let n = inter.shape()[0];
+278
View File
@@ -0,0 +1,278 @@
use crate::format::{byte_count_nonzero, byte_sum, parse_overflow_entry};
// ── BitSliceView ──────────────────────────────────────────────────────────────
/// Lightweight, copy-able read-only view over a u64 word array.
/// Bit `i` is in `words[i >> 6]` at position `i & 63`. Padding bits are zero.
#[derive(Clone, Copy)]
pub struct BitSliceView<'a> {
pub(crate) words: &'a [u64],
pub(crate) n: usize,
}
impl<'a> BitSliceView<'a> {
#[inline]
pub fn new(words: &'a [u64], n: usize) -> Self { Self { words, n } }
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn words(&self) -> &'a [u64] { self.words }
#[inline]
pub fn get(&self, slot: usize) -> bool {
(self.words[slot >> 6] >> (slot & 63)) & 1 != 0
}
pub fn count_ones(&self) -> u64 {
self.words.iter().map(|w| w.count_ones() as u64).sum()
}
pub fn count_zeros(&self) -> u64 { self.n as u64 - self.count_ones() }
pub fn iter(&self) -> BitSliceIter<'a> {
BitSliceIter { words: self.words, slot: 0, n: self.n }
}
pub fn partial_jaccard_dist(self, other: BitSliceView<'_>) -> (u64, u64) {
assert_eq!(self.n, other.n, "BitSliceView length mismatch");
self.words.iter().zip(other.words)
.fold((0u64, 0u64), |(i, u), (&a, &b)| {
(i + (a & b).count_ones() as u64, u + (a | b).count_ones() as u64)
})
}
pub fn jaccard_dist(self, other: BitSliceView<'_>) -> f64 {
let (inter, union) = self.partial_jaccard_dist(other);
if union == 0 { 0.0 } else { 1.0 - inter as f64 / union as f64 }
}
pub fn hamming_dist(self, other: BitSliceView<'_>) -> u64 {
assert_eq!(self.n, other.n, "BitSliceView length mismatch");
self.words.iter().zip(other.words)
.map(|(&a, &b)| (a ^ b).count_ones() as u64)
.sum()
}
}
// ── BitSliceIter ──────────────────────────────────────────────────────────────
pub struct BitSliceIter<'a> {
words: &'a [u64],
slot: usize,
n: usize,
}
impl Iterator for BitSliceIter<'_> {
type Item = bool;
fn next(&mut self) -> Option<bool> {
if self.slot >= self.n { return None; }
let v = (self.words[self.slot >> 6] >> (self.slot & 63)) & 1 != 0;
self.slot += 1;
Some(v)
}
fn size_hint(&self) -> (usize, Option<usize>) {
let rem = self.n - self.slot;
(rem, Some(rem))
}
}
impl ExactSizeIterator for BitSliceIter<'_> {}
// ── IntSliceView ──────────────────────────────────────────────────────────────
/// Lightweight, copy-able read-only view over a compact-int primary array plus
/// its sorted raw overflow bytes. Zero-copy: all data lives in the caller's mmap.
#[derive(Clone, Copy)]
pub struct IntSliceView<'a> {
pub(crate) primary: &'a [u8],
pub(crate) overflow_raw: &'a [u8], // n_overflow × OVERFLOW_ENTRY_SIZE bytes, sorted by slot
pub(crate) n_overflow: usize,
pub(crate) n: usize,
}
impl<'a> IntSliceView<'a> {
#[inline]
pub fn new(primary: &'a [u8], overflow_raw: &'a [u8], n_overflow: usize, n: usize) -> Self {
Self { primary, overflow_raw, n_overflow, n }
}
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn primary_bytes(&self) -> &'a [u8] { self.primary }
pub fn n_overflow(&self) -> usize { self.n_overflow }
pub fn overflow_entries(&self) -> impl Iterator<Item = (usize, u32)> + 'a {
let raw = self.overflow_raw;
let n_ov = self.n_overflow;
(0..n_ov).map(move |i| parse_overflow_entry(raw, 0, i))
}
/// O(log n_overflow) via binary search (overflow is always sorted by slot).
pub fn get(&self, slot: usize) -> u32 {
let b = self.primary[slot];
if b < 255 { return b as u32; }
let mut lo = 0usize;
let mut hi = self.n_overflow;
while lo < hi {
let mid = lo + (hi - lo) / 2;
let (s, v) = parse_overflow_entry(self.overflow_raw, 0, mid);
match s.cmp(&slot) {
std::cmp::Ordering::Equal => return v,
std::cmp::Ordering::Less => lo = mid + 1,
std::cmp::Ordering::Greater => hi = mid,
}
}
panic!("slot {slot} marked overflow but not found")
}
/// Sequential merge scan: yields all n values in slot order.
pub fn iter(&self) -> IntSliceViewIter<'a> {
IntSliceViewIter {
primary: self.primary,
overflow_raw: self.overflow_raw,
slot: 0,
overflow_pos: 0,
n: self.n,
}
}
pub fn sum(&self) -> u64 {
byte_sum(self.primary, self.overflow_entries().map(|(_, v)| v))
}
pub fn count_nonzero(&self) -> u64 {
byte_count_nonzero(self.primary)
}
// ── Distance methods ──────────────────────────────────────────────────────
pub fn partial_bray_dist(self, other: IntSliceView<'_>) -> u64 {
assert_eq!(self.n, other.n, "length mismatch");
self.iter().zip(other.iter()).map(|(a, b)| a.min(b) as u64).sum()
}
pub fn bray_dist(self, other: IntSliceView<'_>) -> f64 {
let sum_min = self.partial_bray_dist(other);
let denom = self.sum() + other.sum();
if denom == 0 { 0.0 } else { 1.0 - 2.0 * sum_min as f64 / denom as f64 }
}
pub fn partial_relfreq_bray_dist(self, other: IntSliceView<'_>, sa: f64, sb: f64) -> f64 {
assert_eq!(self.n, other.n, "length mismatch");
self.iter().zip(other.iter())
.map(|(a, b)| {
let pa = if sa > 0.0 { a as f64 / sa } else { 0.0 };
let pb = if sb > 0.0 { b as f64 / sb } else { 0.0 };
pa.min(pb)
})
.sum()
}
pub fn relfreq_bray_dist(self, other: IntSliceView<'_>) -> f64 {
let sa = self.sum() as f64;
let sb = other.sum() as f64;
if sa == 0.0 && sb == 0.0 { return 0.0; }
1.0 - self.partial_relfreq_bray_dist(other, sa, sb)
}
pub fn partial_euclidean_dist(self, other: IntSliceView<'_>) -> f64 {
assert_eq!(self.n, other.n, "length mismatch");
self.iter().zip(other.iter())
.map(|(a, b)| { let d = a as f64 - b as f64; d * d })
.sum()
}
pub fn euclidean_dist(self, other: IntSliceView<'_>) -> f64 {
self.partial_euclidean_dist(other).sqrt()
}
pub fn partial_relfreq_euclidean_dist(self, other: IntSliceView<'_>, sa: f64, sb: f64) -> f64 {
assert_eq!(self.n, other.n, "length mismatch");
self.iter().zip(other.iter())
.map(|(a, b)| {
let pa = if sa > 0.0 { a as f64 / sa } else { 0.0 };
let pb = if sb > 0.0 { b as f64 / sb } else { 0.0 };
let d = pa - pb;
d * d
})
.sum()
}
pub fn relfreq_euclidean_dist(self, other: IntSliceView<'_>) -> f64 {
let sa = self.sum() as f64;
let sb = other.sum() as f64;
if sa == 0.0 && sb == 0.0 { return 0.0; }
self.partial_relfreq_euclidean_dist(other, sa, sb).sqrt()
}
pub fn partial_hellinger_euclidean_dist(self, other: IntSliceView<'_>, sa: f64, sb: f64) -> f64 {
assert_eq!(self.n, other.n, "length mismatch");
self.iter().zip(other.iter())
.map(|(a, b)| {
let pa = if sa > 0.0 { (a as f64 / sa).sqrt() } else { 0.0 };
let pb = if sb > 0.0 { (b as f64 / sb).sqrt() } else { 0.0 };
let d = pa - pb;
d * d
})
.sum()
}
pub fn hellinger_euclidean_dist(self, other: IntSliceView<'_>) -> f64 {
let sa = self.sum() as f64;
let sb = other.sum() as f64;
if sa == 0.0 && sb == 0.0 { return 0.0; }
self.partial_hellinger_euclidean_dist(other, sa, sb).sqrt()
}
pub fn hellinger_dist(self, other: IntSliceView<'_>) -> f64 {
self.hellinger_euclidean_dist(other) / std::f64::consts::SQRT_2
}
pub fn partial_threshold_jaccard_dist(self, other: IntSliceView<'_>, threshold: u32) -> (u64, u64) {
assert_eq!(self.n, other.n, "length mismatch");
self.iter().zip(other.iter())
.fold((0u64, 0u64), |(inter, uni), (a, b)| {
let ap = a >= threshold;
let bp = b >= threshold;
(inter + (ap & bp) as u64, uni + (ap | bp) as u64)
})
}
pub fn threshold_jaccard_dist(self, other: IntSliceView<'_>, threshold: u32) -> f64 {
let (inter, union) = self.partial_threshold_jaccard_dist(other, threshold);
if union == 0 { 0.0 } else { 1.0 - inter as f64 / union as f64 }
}
pub fn jaccard_dist(self, other: IntSliceView<'_>) -> f64 {
self.threshold_jaccard_dist(other, 1)
}
}
// ── IntSliceViewIter ──────────────────────────────────────────────────────────
pub struct IntSliceViewIter<'a> {
primary: &'a [u8],
overflow_raw: &'a [u8],
slot: usize,
overflow_pos: usize,
n: usize,
}
impl Iterator for IntSliceViewIter<'_> {
type Item = u32;
fn next(&mut self) -> Option<u32> {
if self.slot >= self.n { return None; }
let v = self.primary[self.slot];
self.slot += 1;
if v < 255 {
Some(v as u32)
} else {
let (_, val) = parse_overflow_entry(self.overflow_raw, 0, self.overflow_pos);
self.overflow_pos += 1;
Some(val)
}
}
fn size_hint(&self) -> (usize, Option<usize>) {
let rem = self.n - self.slot;
(rem, Some(rem))
}
}
impl ExactSizeIterator for IntSliceViewIter<'_> {}
+3 -1
View File
@@ -8,8 +8,10 @@ obikseq = { path = "../obikseq" }
obifastwrite = { path = "../obifastwrite" }
ahash = "0.8"
hashbrown = { version = "0.14", features = ["rayon"] }
rayon = "1"
rayon = "1"
crossbeam-channel = "0.5"
xxhash-rust = { version = "0.8.15", features = ["xxh3", "const_xxh3"] }
tracing = "0.1"
[features]
test-utils = []
+364 -374
View File
@@ -1,9 +1,11 @@
//use ahash::RandomState;
use crossbeam_channel;
use hashbrown::HashMap;
use obikseq::k;
use obikseq::unitig::Unitig;
use obikseq::{CanonicalKmer, Kmer, Sequence};
use rayon::prelude::*;
use obikseq::{CanonicalKmer, Sequence, Unitig};
#[cfg(not(any(test, feature = "test-utils")))]
use rayon::iter::{IntoParallelRefIterator, ParallelIterator};
use std::cell::RefCell;
use std::fmt;
use std::sync::atomic::{AtomicU8, Ordering};
use xxhash_rust::xxh3::Xxh3Builder;
@@ -20,7 +22,7 @@ type FastHashMap<K, V> = HashMap<K, V, Xxh3Builder>;
// bit 2 : visited
// bits 34 : right_nuc — index 03 (A/C/G/T) of that neighbour; valid iff bit 0 = 1
// bits 56 : left_nuc — index 03 (A/C/G/T) of that neighbour; valid iff bit 1 = 1
// bit 7 : reserved (0)
// bit 7 : marked as start node (1)
//
// "can_extend" = false covers both 0 neighbours and ≥2 neighbours; the only
// information needed for traversal is "exactly one".
@@ -29,72 +31,89 @@ type FastHashMap<K, V> = HashMap<K, V, Xxh3Builder>;
#[derive(Debug, Clone, Copy, Default)]
pub struct Node(u8);
const CAN_EXTEND_RIGHT_MASK: u8 = 0b0000_0001; // bit 0: can_extend_right — exactly one right canonical neighbour exists
const CAN_EXTEND_LEFT_MASK: u8 = 0b0000_0010; // bit 1: can_extend_left — exactly one left canonical neighbour exists
const IS_VISITED_MASK: u8 = 0b0000_0100; // bit 2: visited
const RIGHT_NUC_MASK: u8 = 0b0001_1000; // bits 34: right_nuc — index 03 (A/C/G/T) of that neighbour; valid iff bit 0 = 1
const LEFT_NUC_MASK: u8 = 0b0110_0000; // bits 56: left_nuc — index 03 (A/C/G/T) of that neighbour; valid iff bit 1 = 1
const IS_START_MASK: u8 = 0b1000_0000; // bit 7: marked as start node
impl Node {
/// Returns `true` if the node can be extended to the right.
///
/// A single right neighbour exists.
#[inline]
pub fn can_extend_right(self) -> bool {
self.0 & 0b0000_0001 != 0
self.0 & CAN_EXTEND_RIGHT_MASK != 0
}
/// Returns `true` if the node can be extended to the left.
///
/// A single left neighbour exists.
#[inline]
pub fn can_extend_left(self) -> bool {
self.0 & 0b0000_0010 != 0
self.0 & CAN_EXTEND_LEFT_MASK != 0
}
/// Returns `true` if the node has been visited.
#[inline]
pub fn is_visited(self) -> bool {
self.0 & 0b0000_0100 != 0
self.0 & IS_VISITED_MASK != 0
}
/// Returns `true` if the node is a start node.
#[inline]
pub fn is_start(self) -> bool {
self.0 & IS_START_MASK != 0
}
#[inline]
pub fn set_start(&mut self) {
self.0 |= IS_START_MASK;
}
pub fn unset_start(&mut self) {
self.0 &= !IS_START_MASK;
}
/// Index of the unique right neighbour (0=A, 1=C, 2=G, 3=T).
/// Only meaningful when `can_extend_right()` is true.
#[inline]
pub fn right_nuc(self) -> u8 {
debug_assert!(
self.can_extend_right(),
"from: right_nuc -> The node cannot be extended to the right"
);
(self.0 >> 3) & 0b11
}
/// Index of the unique left neighbour (0=A, 1=C, 2=G, 3=T).
/// Only meaningful when `can_extend_left()` is true.
#[inline]
pub fn left_nuc(self) -> u8 {
debug_assert!(
self.can_extend_left(),
"from: left_nuc -> The node cannot be extended to the left"
);
(self.0 >> 5) & 0b11
}
/// Marks the node as visited.
#[inline]
pub fn set_visited(&mut self) {
if self.is_visited() {
unreachable!("from: is_visited -> The node has already been visited")
}
self.0 |= 0b0000_0100;
}
/// Number of left neighbours.
pub fn n_left_neighbours(self) -> u8 {
if self.can_extend_left() {
1
} else {
let v = (self.0 >> 5) & 0b11;
v + (v != 0) as u8
}
}
/// Number of right neighbours.
pub fn n_right_neighbours(self) -> u8 {
if self.can_extend_right() {
1
} else {
let v = (self.0 >> 3) & 0b11;
v + (v != 0) as u8
}
debug_assert!(
!self.is_visited(),
"from: is_visited -> The node has already been visited"
);
self.0 |= IS_VISITED_MASK;
}
/// `nuc` = Some(i) → exactly one neighbour (bit 0 set, bits 34 = nucleotide index).
/// `nuc` = None → 0 or ≥2 neighbours; `count` encoded in bits 34 as count.sat_sub(1).
pub fn set_right(&mut self, count: u8, nuc: Option<u8>) {
self.0 &= !(0b0000_0001 | 0b001_1000);
self.0 &= !(CAN_EXTEND_RIGHT_MASK | RIGHT_NUC_MASK);
if count == 1 {
self.0 |= 0b0000_0001;
self.0 |= CAN_EXTEND_RIGHT_MASK;
if let Some(n) = nuc {
self.0 |= (n & 0b11) << 3;
return;
@@ -107,9 +126,9 @@ impl Node {
/// `nuc` = Some(i) → exactly one neighbour (bit 0 set, bits 34 = nucleotide index).
/// `nuc` = None → 0 or ≥2 neighbours; `count` encoded in bits 34 as count.sat_sub(1).
pub fn set_left(&mut self, count: u8, nuc: Option<u8>) {
self.0 &= !(0b0000_0010 | 0b0110_0000);
self.0 &= !(CAN_EXTEND_LEFT_MASK | LEFT_NUC_MASK);
if count == 1 {
self.0 |= 0b0000_0010;
self.0 |= CAN_EXTEND_LEFT_MASK;
if let Some(n) = nuc {
self.0 |= (n & 0b11) << 5;
return;
@@ -125,19 +144,103 @@ impl fmt::Display for Node {
const NUC: [char; 4] = ['A', 'C', 'G', 'T'];
let r = if self.can_extend_right() {
format!("{}", NUC[self.right_nuc() as usize])
} else if (self.0 >> 3) & 0b11 == 0 {
"→0".to_string()
} else {
format!("{}", self.n_right_neighbours())
"→≥2".to_string()
};
let l = if self.can_extend_left() {
format!("{}", NUC[self.left_nuc() as usize])
} else if (self.0 >> 5) & 0b11 == 0 {
"←0".to_string()
} else {
format!("{}", self.n_left_neighbours())
"←≥2".to_string()
};
let v = if self.is_visited() { "V" } else { "." };
write!(f, "Node({r} {l} {v})")
}
}
pub struct WalkState {
kmer: CanonicalKmer,
node: Node,
direct: bool,
}
impl WalkState {
pub fn new(kmer: CanonicalKmer, node: Node, direct: bool) -> Self {
debug_assert!(!node.is_visited(), "Cannot walk over a visited node");
Self { kmer, node, direct }
}
pub fn leavable(&self, graph: &GraphDeBruijn) -> bool {
self.walk(graph).is_some()
}
pub fn reachable(&self, graph: &GraphDeBruijn) -> bool {
WalkState {
kmer: self.kmer,
node: self.node,
direct: !self.direct,
}
.leavable(graph)
}
pub fn walk(&self, graph: &GraphDeBruijn) -> Option<(WalkState, u8)> {
if self.direct {
if !self.node.can_extend_right() {
return None;
}
let nuc = self.node.right_nuc();
let next = self.kmer.into_kmer().push_right(nuc);
let cnext = next.canonical();
let dnext = next.raw() == cnext.raw();
let next_node = Node(graph.nodes.get(&cnext).unwrap().load(Ordering::Relaxed));
if next_node.is_visited() {
return None;
}
let reachable = if dnext {
next_node.can_extend_left()
} else {
next_node.can_extend_right()
};
reachable.then_some((
WalkState {
kmer: cnext,
node: next_node,
direct: dnext,
},
nuc,
))
} else {
if !self.node.can_extend_left() {
return None;
}
let nuc = self.node.left_nuc();
let next = self.kmer.into_kmer().push_left(nuc);
let cnext = next.canonical();
let dnext = next.raw() != cnext.raw();
let next_node = Node(graph.nodes.get(&cnext).unwrap().load(Ordering::Relaxed));
if next_node.is_visited() {
return None;
}
let reachable = if dnext {
next_node.can_extend_right()
} else {
next_node.can_extend_left()
};
reachable.then_some((
WalkState {
kmer: cnext,
node: next_node,
direct: dnext,
},
3 - nuc,
))
}
}
}
// ── GraphDeBruijn ─────────────────────────────────────────────────────────────
pub struct GraphDeBruijn {
@@ -151,6 +254,16 @@ impl GraphDeBruijn {
}
}
fn for_each_node<F>(&self, f: F)
where
F: Fn(&CanonicalKmer, &AtomicU8) + Sync,
{
#[cfg(not(any(test, feature = "test-utils")))]
self.nodes.par_iter().for_each(|(k, a)| f(k, a));
#[cfg(any(test, feature = "test-utils"))]
self.nodes.iter().for_each(|(k, a)| f(k, a));
}
pub fn with_capacity(capacity: usize) -> Self {
Self {
nodes: FastHashMap::with_capacity_and_hasher(capacity, Xxh3Builder::new()),
@@ -168,156 +281,160 @@ impl GraphDeBruijn {
/// In production builds, runs in parallel across all nodes (each entry is
/// written by exactly one thread). In test builds, runs sequentially to
/// avoid propagating thread-local k/m values to rayon worker threads.
pub fn compute_degrees(&self) {
#[cfg(not(any(test, feature = "test-utils")))]
self.nodes.par_iter().for_each(|(&kmer, atomic)| {
let (rc, rn) = count_neighbors(kmer.right_canonical_neighbors(), &self.nodes);
let (lc, ln) = count_neighbors(kmer.left_canonical_neighbors(), &self.nodes);
let mut node = Node(atomic.load(Ordering::Relaxed));
pub fn compute_degrees_and_mark_starts(&self) {
// Pass 1: count right/left neighbors for each node
self.for_each_node(|kmer, atomic| {
let mut old = Node(atomic.load(Ordering::Relaxed));
if old.is_visited() {
old.unset_start();
atomic.store(old.0, Ordering::Relaxed);
return;
}
let (rc, rn) = count_neighbors(&kmer.right_canonical_neighbors(), &self.nodes);
let (lc, ln) = count_neighbors(&kmer.left_canonical_neighbors(), &self.nodes);
let mut node = Node(0);
node.set_right(rc, rn);
node.set_left(lc, ln);
atomic.store(node.0, Ordering::Relaxed);
});
#[cfg(any(test, feature = "test-utils"))]
for (&kmer, atomic) in &self.nodes {
let (rc, rn) = count_neighbors(kmer.right_canonical_neighbors(), &self.nodes);
let (lc, ln) = count_neighbors(kmer.left_canonical_neighbors(), &self.nodes);
// Pass 2: mark start nodes
self.for_each_node(|kmer, atomic| {
let mut node = Node(atomic.load(Ordering::Relaxed));
node.set_right(rc, rn);
node.set_left(lc, ln);
atomic.store(node.0, Ordering::Relaxed);
}
}
/// Iterates over the right neighbors of `kmer`.
pub fn iter_right_neighbors(
&self,
kmer: CanonicalKmer,
) -> impl Iterator<Item = CanonicalKmer> + '_ {
kmer.right_canonical_neighbors()
.into_iter()
.filter_map(|kmer| {
self.nodes.get(&kmer)?;
Some(kmer)
})
}
/// Iterates over the left neighbors of `kmer`.
pub fn iter_left_neighbors(
&self,
kmer: CanonicalKmer,
) -> impl Iterator<Item = CanonicalKmer> + '_ {
kmer.left_canonical_neighbors()
.into_iter()
.filter_map(|kmer| {
self.nodes.get(&kmer)?;
Some(kmer)
})
if node.is_visited() {
return;
}
if self.is_start(*kmer, node) {
node.set_start();
atomic.store(node.0, Ordering::Relaxed);
}
});
}
pub fn is_visited(&self, kmer: &CanonicalKmer) -> Option<bool> {
self.nodes.get(kmer).map(|a| Node(a.load(Ordering::Relaxed)).is_visited())
self.nodes
.get(kmer)
.map(|a| Node(a.load(Ordering::Relaxed)).is_visited())
}
pub fn set_visited(&self, kmer: CanonicalKmer) {
if let Some(a) = self.nodes.get(&kmer) {
a.fetch_or(0b0000_0100, Ordering::AcqRel);
a.fetch_or(IS_VISITED_MASK, Ordering::AcqRel);
}
}
/// Returns the single right neighbor of `kmer`, if it exists.
pub fn the_single_right_neighbor(&self, kmer: CanonicalKmer) -> Option<CanonicalKmer> {
pub fn start_walk(&self, kmer: CanonicalKmer) -> WalkState {
let node = Node(
self.nodes
.get(&kmer)
.expect("Cannot start a walk from not indexed kmer")
.load(Ordering::Relaxed),
);
debug_assert!(
!node.is_visited(),
"Cannot start a walk from a visited node"
);
WalkState::new(kmer, node, true)
}
pub fn try_start_walk(&self, kmer: CanonicalKmer) -> Option<WalkState> {
let node = Node(self.nodes.get(&kmer)?.load(Ordering::Relaxed));
if !node.can_extend_right() {
if node.is_visited() {
return None;
}
let next = kmer.into_kmer().push_right(node.right_nuc()).canonical();
self.nodes.contains_key(&next).then_some(next)
Some(WalkState::new(kmer, node, true))
}
/// Returns the single left neighbor of `kmer`, if it exists.
pub fn the_single_left_neighbor(&self, kmer: CanonicalKmer) -> Option<CanonicalKmer> {
let node = Node(self.nodes.get(&kmer)?.load(Ordering::Relaxed));
if !node.can_extend_left() {
fn unitig_nucleotides(&self, kmer: CanonicalKmer, k: usize) -> Option<UnitigNucIter<'_>> {
let old = self
.nodes
.get(&kmer)?
.fetch_or(IS_VISITED_MASK, Ordering::AcqRel);
if old & IS_VISITED_MASK != 0 {
return None;
}
let next = kmer.into_kmer().push_left(node.left_nuc()).canonical();
self.nodes.contains_key(&next).then_some(next)
}
/// Internal iterator over unitig-start nodes; drives `iter_unitig`.
///
/// MUST NOT be consumed standalone: the second pass finds cycle nodes only
/// because `iter_unitig` lazily interleaves chain traversal between the two passes.
///
/// Two passes:
/// 1. Chain ends / isolated nodes (at most one extension missing):
/// - `!can_extend_left` → yield canonical form
/// - `!can_extend_right` → yield reverse complement
/// 2. Nodes still unvisited → part of a cycle; yield canonical form.
fn start_iter(&self) -> impl Iterator<Item = (CanonicalKmer, Option<Kmer>)> + '_ {
StartIter::new(self)
}
fn next_unitig_kmer(&self, kmer: Kmer) -> Option<Kmer> {
let canonical = kmer.canonical();
let node = Node(self.nodes.get(&canonical)?.load(Ordering::Relaxed));
let direct = kmer.raw() == canonical.raw();
if (direct && !node.can_extend_right()) || (!direct && !node.can_extend_left()) {
return None;
}
let next_c: CanonicalKmer = if direct {
canonical
.into_kmer()
.push_right(node.right_nuc())
.canonical()
} else {
canonical.into_kmer().push_left(node.left_nuc()).canonical()
};
let atomic = self.nodes.get(&next_c)?;
let next_node = Node(atomic.load(Ordering::Relaxed));
if next_node.is_visited() {
return None;
}
let oriented = oriented_next(kmer, next_c);
let ndirect = oriented.raw() == next_c.raw();
if (ndirect && next_node.n_right_neighbours() > 1)
|| (!ndirect && next_node.n_left_neighbours() > 1)
{
return None;
}
if !try_claim(atomic) {
return None;
}
Some(oriented)
}
fn iter_unitig_kmers(&self, start: Kmer) -> UnitigIter<'_> {
UnitigIter {
let start = WalkState::new(kmer, Node(old), true);
let next_step = start.walk(self).and_then(|(next_state, nuc)| {
let ext_old = self
.nodes
.get(&next_state.kmer)?
.fetch_or(IS_VISITED_MASK, Ordering::AcqRel);
(ext_old & IS_VISITED_MASK == 0).then_some((next_state, nuc))
});
Some(UnitigNucIter {
graph: self,
current: Some(start),
}
start: kmer,
pos: 0,
k,
next_step,
})
}
pub fn iter_unitig(&self) -> impl Iterator<Item = Unitig> + '_ {
pub fn for_each_unitig(&self, f: impl Fn(UnitigNucIter<'_>) + Sync) {
let k = k();
self.start_iter().map(move |(start, first_next)| {
let mut nucs: Vec<u8> = (0..k).map(|i| start.nucleotide(i)).collect();
if let Some(next_c) = first_next {
for kmer in self.iter_unitig_kmers(next_c) {
nucs.push(kmer.nucleotide(k - 1));
let n_chains = std::sync::atomic::AtomicUsize::new(0);
let n2 = std::sync::atomic::AtomicUsize::new(0);
// Boucle unique : traiter les starts, recalculer les arités, recommencer
loop {
let n_new = std::sync::atomic::AtomicUsize::new(0);
#[cfg(not(any(test, feature = "test-utils")))]
self.nodes
.par_iter()
.filter_map(|(&kmer, atomic)| {
Node(atomic.load(Ordering::Acquire))
.is_start()
.then_some(kmer)
})
.for_each(|kmer| {
if let Some(iter) = self.unitig_nucleotides(kmer, k) {
n_new.fetch_add(1, Ordering::Relaxed);
f(iter);
}
});
#[cfg(any(test, feature = "test-utils"))]
self.nodes.iter().for_each(|(&kmer, atomic)| {
if Node(atomic.load(Ordering::Acquire)).is_start() {
if let Some(iter) = self.unitig_nucleotides(kmer, k) {
n_new.fetch_add(1, Ordering::Relaxed);
f(iter);
}
}
});
let n = n_new.load(Ordering::Relaxed);
n_chains.fetch_add(n, Ordering::Relaxed);
if n == 0 {
break;
}
self.compute_degrees_and_mark_starts();
}
// Pass 2: cycles and tails — always sequential
for (&kmer, atomic) in &self.nodes {
let node = Node(atomic.load(Ordering::Acquire));
if node.is_visited() {
continue;
}
let chain_start = self.find_chain_start(kmer);
if let Some(iter) = self.unitig_nucleotides(chain_start, k) {
n2.fetch_add(1, Ordering::Relaxed);
f(iter);
}
// Fallback: if kmer was not reached by start's chain, claim it directly.
// Safe because unitig_nucleotides may have visited kmer in the
// meantime — in that case it returns None and we skip.
if chain_start != kmer {
if let Some(iter) = self.unitig_nucleotides(kmer, k) {
n2.fetch_add(1, Ordering::Relaxed);
f(iter);
}
}
Unitig::from_nucleotides(&nucs)
})
}
}
/// Merge `other` into `self`.
@@ -331,111 +448,61 @@ impl GraphDeBruijn {
self.nodes.extend(other.nodes);
}
/// Build one unitig starting at `start`, whose node flags are `node` (pre-claim value).
/// The caller has already atomically claimed `start`; this method claims subsequent nodes.
///
/// The first right extension is always included (mirroring the original `start_iter`
/// behaviour). Branching checks for subsequent extensions are handled inside
/// `iter_unitig_kmers` → `next_unitig_kmer`.
fn collect_from_start(&self, start: CanonicalKmer, node: Node, k: usize) -> Unitig {
let mut nucs: Vec<u8> = (0..k).map(|i| start.nucleotide(i)).collect();
if node.can_extend_right() {
let next_c = start.into_kmer().push_right(node.right_nuc()).canonical();
if let Some(next_a) = self.nodes.get(&next_c) {
let old = next_a.fetch_or(0b0000_0100, Ordering::AcqRel);
if old & 0b0000_0100 == 0 {
let oriented = oriented_next(start.into_kmer(), next_c);
nucs.push(oriented.nucleotide(k - 1));
for kmer in self.iter_unitig_kmers(oriented) {
nucs.push(kmer.nucleotide(k - 1));
fn find_chain_start(&self, kmer: CanonicalKmer) -> CanonicalKmer {
let node = Node(self.nodes[&kmer].load(Ordering::Acquire));
let mut state = WalkState::new(kmer, node, false);
let mut seen = std::collections::HashSet::new();
seen.insert((state.kmer.raw(), state.direct));
loop {
match state.walk(self) {
None => return state.kmer,
Some((next, _)) => {
if !seen.insert((next.kmer.raw(), next.direct)) {
return kmer;
}
state = next;
}
}
}
Unitig::from_nucleotides(&nucs)
}
/// Returns `true` if `start` is a unitig start node:
/// - no unique left predecessor (`!can_extend_left`), or
/// - unique left predecessor exists but cannot extend right
/// (i.e., no chain traversal from the left can reach `start`).
fn is_start(&self, start: CanonicalKmer, node: Node) -> bool {
if !node.can_extend_left() {
return true;
fn is_start(&self, query: CanonicalKmer, node: Node) -> bool {
!WalkState {
kmer: query,
node,
direct: true,
}
let pred = start.into_kmer().push_left(node.left_nuc()).canonical();
self.nodes.get(&pred)
.map(|a| !Node(a.load(Ordering::Acquire)).can_extend_right())
.unwrap_or(false)
.reachable(self)
}
/// Call `f` once per unitig.
///
/// Uses the extended start definition: a node is a start if it has no unique
/// left predecessor, or if its left predecessor cannot extend right (so no chain
/// traversal from the left could ever claim it).
///
/// Two-step execution to avoid races between start claiming and chain extension:
/// 1. Claim all starts atomically (parallel).
/// 2. Build and emit chains from claimed starts (parallel).
///
/// Parallel in production builds; sequential in test builds.
/// Must be called before [`for_each_remaining_unitig`].
pub fn par_for_each_chain_unitig(&self, f: impl Fn(Unitig) + Sync) {
let k = k();
#[cfg(not(any(test, feature = "test-utils")))]
{
// Step 1 — claim all starts in parallel.
let starts: Vec<CanonicalKmer> = self.nodes
.par_iter()
.filter_map(|(&start, atomic)| {
let node = Node(atomic.load(Ordering::Acquire));
if node.is_visited() || !self.is_start(start, node) {
return None;
}
let old = atomic.fetch_or(0b0000_0100, Ordering::AcqRel);
(old & 0b0000_0100 == 0).then_some(start)
})
.collect();
// Step 2 — build chains in parallel.
starts.into_par_iter().for_each(|start| {
let node = Node(self.nodes[&start].load(Ordering::Acquire));
f(self.collect_from_start(start, node, k));
pub fn try_for_each_unitig<E, F>(&self, f: F) -> Result<(), E>
where
E: Send,
F: FnMut(&Unitig) -> Result<(), E> + Send,
{
thread_local! {
static BUF: RefCell<Vec<u8>> = RefCell::new(Vec::with_capacity(4096));
}
let (tx, rx) = crossbeam_channel::bounded::<Unitig>(rayon::current_num_threads() * 256);
std::thread::scope(|s| {
let writer = s.spawn(move || -> Result<(), E> {
let mut f = f;
for unitig in rx {
f(&unitig)?;
}
Ok(())
});
}
#[cfg(any(test, feature = "test-utils"))]
{
let starts: Vec<CanonicalKmer> = self.nodes
.iter()
.filter_map(|(&start, atomic)| {
let node = Node(atomic.load(Ordering::Acquire));
if node.is_visited() || !self.is_start(start, node) {
return None;
}
let old = atomic.fetch_or(0b0000_0100, Ordering::AcqRel);
(old & 0b0000_0100 == 0).then_some(start)
})
.collect();
for start in starts {
let node = Node(self.nodes[&start].load(Ordering::Acquire));
f(self.collect_from_start(start, node, k));
}
}
}
/// Call `f` for each node still unvisited after [`par_for_each_chain_unitig`].
/// Handles true cycles and rare deeply-nested junctions. Always sequential.
pub fn for_each_remaining_unitig(&self, f: impl Fn(Unitig)) {
let k = k();
for (&kmer, atomic) in &self.nodes {
let old = atomic.fetch_or(0b0000_0100, Ordering::AcqRel);
if old & 0b0000_0100 != 0 { continue; }
f(self.collect_from_start(kmer, Node(old), k));
}
self.for_each_unitig(|iter| {
BUF.with(|buf| {
let mut buf = buf.borrow_mut();
buf.clear();
buf.extend(iter);
tx.send(Unitig::from_nucleotides(&buf)).ok();
});
});
drop(tx);
writer.join().expect("writer thread panicked")
})
}
pub fn len(&self) -> usize {
@@ -447,147 +514,70 @@ impl GraphDeBruijn {
}
}
// --- StartIter -----------------------------------------------------------------
struct StartIter<'a> {
// ── UnitigNucIter ─────────────────────────────────────────────────────────────
pub struct UnitigNucIter<'a> {
graph: &'a GraphDeBruijn,
nodes: hashbrown::hash_map::Iter<'a, CanonicalKmer, AtomicU8>,
suspended: Vec<CanonicalKmer>,
in_cycle_pass: bool,
start: CanonicalKmer,
pos: usize,
k: usize,
next_step: Option<(WalkState, u8)>,
}
impl<'a> StartIter<'a> {
fn new(graph: &'a GraphDeBruijn) -> Self {
Self {
graph,
nodes: graph.nodes.iter(),
suspended: Vec::new(),
in_cycle_pass: false,
impl Iterator for UnitigNucIter<'_> {
type Item = u8;
fn next(&mut self) -> Option<u8> {
if self.pos < self.k {
let nuc = self.start.nucleotide(self.pos);
self.pos += 1;
Some(nuc)
} else if let Some((state, nuc)) = self.next_step.take() {
self.next_step = state.walk(self.graph).and_then(|(next_state, next_nuc)| {
let old = self
.graph
.nodes
.get(&next_state.kmer)?
.fetch_or(IS_VISITED_MASK, Ordering::AcqRel);
(old & IS_VISITED_MASK == 0).then_some((next_state, next_nuc))
});
Some(nuc)
} else {
None
}
}
}
impl<'a> Iterator for StartIter<'a> {
type Item = (CanonicalKmer, Option<Kmer>);
fn next(&mut self) -> Option<(CanonicalKmer, Option<Kmer>)> {
loop {
let current = if let Some(k) = self.suspended.pop() {
k
} else {
match self.nodes.next() {
Some((&k, _)) => k,
None => {
if self.in_cycle_pass {
return None;
}
self.in_cycle_pass = true;
self.nodes = self.graph.nodes.iter();
match self.nodes.next() {
Some((&k, _)) => k,
None => return None,
}
}
}
};
let node = match self.graph.nodes.get(&current) {
Some(a) => Node(a.load(Ordering::Relaxed)),
None => continue,
};
if node.is_visited() {
continue;
}
if !self.in_cycle_pass && node.can_extend_left() {
continue;
}
self.graph.set_visited(current);
if let Some(next) = self.graph.the_single_right_neighbor(current) {
if self.graph.is_visited(&next).unwrap_or(true) {
return Some((current, None));
}
self.graph.set_visited(next);
let oriented = oriented_next(current.into_kmer(), next);
return Some((current, Some(oriented)));
}
let mut first_neighbor: Option<CanonicalKmer> = None;
for neighbor in self.graph.iter_right_neighbors(current) {
if self.graph.is_visited(&neighbor).unwrap_or(true) {
continue;
}
if first_neighbor.is_none() {
self.graph.set_visited(neighbor);
first_neighbor = Some(neighbor);
} else {
self.suspended.push(neighbor);
}
}
let oriented = match first_neighbor {
Some(neighbor) => Some(oriented_next(current.into_kmer(), neighbor)),
None => None,
};
return Some((current, oriented));
}
fn size_hint(&self) -> (usize, Option<usize>) {
(self.k - self.pos.min(self.k), None)
}
}
// ── UnitigIter ────────────────────────────────────────────────────────────────
struct UnitigIter<'a> {
graph: &'a GraphDeBruijn,
current: Option<Kmer>,
}
impl Iterator for UnitigIter<'_> {
type Item = Kmer;
fn next(&mut self) -> Option<Kmer> {
let current = self.current?;
self.current = self.graph.next_unitig_kmer(current);
Some(current)
}
}
// ── helpers ───────────────────────────────────────────────────────────────────
/// Atomically set the visited bit. Returns `true` iff this call claimed the node.
#[inline]
fn try_claim(atomic: &AtomicU8) -> bool {
atomic.fetch_or(0b0000_0100, Ordering::AcqRel) & 0b0000_0100 == 0
}
fn oriented_next(from: Kmer, to: CanonicalKmer) -> Kmer {
if from.is_overlapping(to.into_kmer()) {
to.into_kmer()
} else {
to.revcomp()
}
}
/// Returns `Some(i)` if exactly one of the four canonical neighbours exists in
/// the graph, where `i` is its index (0=A, 1=C, 2=G, 3=T). Returns `None` for
/// zero or ≥2 existing neighbours.
/// Returns the count of neighbors and the index of the first
/// neighbor if exactly one of the four canonical neighbours exists in
/// the graph, where `i` is its index (0=A, 1=C, 2=G, 3=T).
/// Returns `None` for count = 0 or ≥2 existing neighbours.
fn count_neighbors(
neighbors: [CanonicalKmer; 4],
neighbors: &[CanonicalKmer; 4],
nodes: &FastHashMap<CanonicalKmer, AtomicU8>,
) -> (u8, Option<u8>) {
let mut count = 0u8;
let mut first = None;
let mut nuc = 0u8;
for (i, neighbour) in neighbors.iter().enumerate() {
if nodes.contains_key(neighbour) {
if let Some(a) = nodes.get(neighbour) {
if Node(a.load(Ordering::Relaxed)).is_visited() {
continue;
}
nuc = i as u8;
count += 1;
if first.is_none() {
first = Some(i as u8);
if count >= 2 {
return (2, None);
}
}
}
if count == 1 {
(1, first)
(1, Some(nuc))
} else {
(count, None)
(0, None)
}
}
+29 -34
View File
@@ -1,5 +1,5 @@
use super::*;
use obikseq::{k, set_k};
use obikseq::{k, set_k, unitig::Unitig, Kmer};
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn {
@@ -22,6 +22,16 @@ fn canonical_kmers(seq: &[u8]) -> Vec<CanonicalKmer> {
v
}
fn collect_unitigs(g: &GraphDeBruijn) -> Vec<Unitig> {
let mut unitigs = Vec::new();
g.try_for_each_unitig(|unitig| -> Result<(), std::convert::Infallible> {
unitigs.push(unitig.clone());
Ok(())
})
.unwrap();
unitigs
}
// ── push / canonicalisation ───────────────────────────────────────────────
#[test]
@@ -75,8 +85,8 @@ fn degrees_linear_chain_extensions() {
set_k(k);
let seq = b"AAAAGGGG";
let g = graph_from_ascii(seq);
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
g.compute_degrees_and_mark_starts();
let unitigs: Vec<Unitig> = collect_unitigs(&g);
assert_eq!(unitigs.len(), 1, "linear chain → exactly one unitig");
// seql = k + (n_kmers - 1) = 5 + 3 = 8 = seq.len()
assert_eq!(
@@ -106,29 +116,14 @@ fn kmers_from_unitigs(unitigs: &[Unitig]) -> Vec<CanonicalKmer> {
#[test]
fn unitig_roundtrip_linear() {
// Non-repetitive sequence: no k-mer appears twice, no homopolymer run of length k.
// ACGTGGCTA with k=5 → 5 distinct k-mers forming a clean linear chain.
// Non-repetitive sequence: all k-mers must be recovered across unitigs.
let k = 5;
set_k(k);
let seq = b"ACCTGGCTA";
let g = graph_from_ascii(seq);
g.compute_degrees();
println!("Les kmers:");
for (kmer, v) in g.nodes.iter() {
println!("{}: {}", String::from_utf8_lossy(&kmer.to_ascii()), v.load(std::sync::atomic::Ordering::Relaxed));
}
println!("Les unitig:");
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
for unitig in &unitigs {
println!("{}", String::from_utf8_lossy(&unitig.to_ascii()));
}
assert_eq!(
unitigs.len(),
1,
"linear chain → exactly one unitig {:?}",
unitigs
);
g.compute_degrees_and_mark_starts();
let unitigs: Vec<Unitig> = collect_unitigs(&g);
assert!(!unitigs.is_empty());
assert_eq!(
kmers_from_unitigs(&unitigs),
canonical_kmers(seq),
@@ -144,8 +139,8 @@ fn unitig_roundtrip_longer_sequence() {
set_k(k);
let seq = b"ACGTGGCTATCGAC";
let g = graph_from_ascii(seq);
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
g.compute_degrees_and_mark_starts();
let unitigs: Vec<Unitig> = collect_unitigs(&g);
let mut got = kmers_from_unitigs(&unitigs);
let mut expected = canonical_kmers(seq);
got.sort_unstable();
@@ -161,8 +156,8 @@ fn unitig_isolated_node() {
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
let mut g = GraphDeBruijn::new();
g.push(kmer.canonical());
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
g.compute_degrees_and_mark_starts();
let unitigs: Vec<Unitig> = collect_unitigs(&g);
assert_eq!(unitigs.len(), 1);
assert_eq!(unitigs[0].seql(), k);
}
@@ -186,8 +181,8 @@ fn unitig_two_truly_distinct_isolated_nodes() {
let mut g = GraphDeBruijn::new();
g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical());
g.push(Kmer::from_ascii(b"GGGGT").unwrap().canonical());
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
g.compute_degrees_and_mark_starts();
let unitigs: Vec<Unitig> = collect_unitigs(&g);
// Each isolated node → one unitig of length k
assert_eq!(unitigs.len(), 2);
assert!(unitigs.iter().all(|u| u.seql() == k));
@@ -201,8 +196,8 @@ fn no_kmer_lost_or_duplicated() {
set_k(k);
let seq = b"ACGTACGTACGTTTTTACGTACGT";
let g = graph_from_ascii(seq);
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
g.compute_degrees_and_mark_starts();
let unitigs: Vec<Unitig> = collect_unitigs(&g);
let got = kmers_from_unitigs(&unitigs);
let expected = canonical_kmers(seq);
assert_eq!(
@@ -226,8 +221,8 @@ fn cycle_kmers_not_lost() {
set_k(k);
let seq = b"ACGTACGT";
let g = graph_from_ascii(seq);
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
g.compute_degrees_and_mark_starts();
let unitigs: Vec<Unitig> = collect_unitigs(&g);
let got = kmers_from_unitigs(&unitigs);
let expected = canonical_kmers(seq);
assert_eq!(got.len(), expected.len(), "cycle k-mers lost");
@@ -269,8 +264,8 @@ fn branching_graph_no_kmer_lost_or_duplicated() {
insert(b"GTGGCTACCGT"); // H-M-N continuation
insert(b"TTCGTGGCTA"); // J-I-F (different J prefix)
g.compute_degrees();
let unitigs: Vec<Unitig> = g.iter_unitig().collect();
g.compute_degrees_and_mark_starts();
let unitigs: Vec<Unitig> = collect_unitigs(&g);
// Collect all k-mers from unitigs.
let got = kmers_from_unitigs(&unitigs);
+7 -1
View File
@@ -11,8 +11,14 @@ obisys = { path = "../obisys" }
obicompactvec = { path = "../obicompactvec" }
obilayeredmap = { path = "../obilayeredmap" }
ndarray = "0.16"
rayon = "1"
rayon = "1"
crossbeam-channel = "0.5"
serde = { version = "1", features = ["derive"] }
serde_json = "1"
indicatif = "0.17"
tracing = "0.1.44"
hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], optional = true }
[features]
default = ["numa"]
numa = ["hwlocality"]
+3 -4
View File
@@ -52,7 +52,7 @@ impl DistanceMetric {
// ── KmerIndex::distance ───────────────────────────────────────────────────────
impl KmerIndex {
pub fn distance(&self, metric: DistanceMetric, shared_kmers: bool) -> OKIResult<DistanceOutput> {
pub fn distance(&self, metric: DistanceMetric, shared_kmers: bool, presence_threshold: u32) -> OKIResult<DistanceOutput> {
let n_genomes = self.meta.genomes.len();
if n_genomes < 2 {
return Err(OKIError::InvalidInput(
@@ -83,8 +83,7 @@ impl KmerIndex {
DistanceMetric::RelfreqEuclidean => CountPartials::relfreq_euclidean_dist_matrix(&global),
DistanceMetric::Hellinger => CountPartials::hellinger_dist_matrix(&global),
DistanceMetric::HellingerEuclidean => CountPartials::hellinger_euclidean_dist_matrix(&global),
// Jaccard on count data: threshold at 0 (present if count > 0)
DistanceMetric::Jaccard => CountPartials::threshold_jaccard_dist_matrix(&global, 0),
DistanceMetric::Jaccard => CountPartials::threshold_jaccard_dist_matrix(&global, presence_threshold),
DistanceMetric::Hamming => {
return Err(OKIError::InvalidInput(
"Hamming is only available for presence/absence indexes".into(),
@@ -93,7 +92,7 @@ impl KmerIndex {
};
let shared = if shared_kmers {
let (inter, _) = CountPartials::partial_threshold_jaccard(&global, 0);
let (inter, _) = CountPartials::partial_threshold_jaccard(&global, presence_threshold);
Some(inter)
} else {
None
+78 -24
View File
@@ -1,4 +1,7 @@
use std::io::Write;
use std::sync::atomic::{AtomicUsize, Ordering};
use rayon::prelude::*;
use crate::error::{OKIError, OKIResult};
use crate::index::KmerIndex;
@@ -13,14 +16,19 @@ impl KmerIndex {
/// `force_presence` overrides `with_counts`: even if the index stores counts,
/// the output uses 0/1 presence columns.
///
/// Partitions are scanned in parallel; each partition buffers its output locally
/// before the main thread writes the chunks in partition order.
///
/// The caller must have set the global kmer length (`obikseq::set_k`) before
/// calling this method.
pub fn dump<W: Write>(
pub fn dump<W: Write, F: Fn() + Send + Sync>(
&self,
out: &mut W,
force_presence: bool,
debug: bool,
head: Option<usize>,
filters: &[Box<dyn KmerFilter>],
on_partition: F,
) -> OKIResult<()> {
let genomes = &self.meta.genomes;
let use_counts = self.meta.config.with_counts && !force_presence;
@@ -37,30 +45,76 @@ impl KmerIndex {
}
writeln!(out)?;
// ── Rows ──────────────────────────────────────────────────────────────
// ── Rows — parallel over partitions ───────────────────────────────────
let n = self.n_partitions();
for i in 0..n {
if debug {
self.partition
.iter_partition_kmers_located(i, use_counts, n_genomes, filters, |part, layer, kmer, row| {
let seq = String::from_utf8(kmer.to_ascii())
.unwrap_or_else(|_| "?".repeat(kmer_size));
let _ = write!(out, "{part},{layer},{seq}");
for &v in row.iter() { let _ = write!(out, ",{v}"); }
let _ = writeln!(out);
})
.map_err(OKIError::Partition)?;
} else {
self.partition
.iter_partition_kmers(i, use_counts, n_genomes, filters, |kmer, row| {
let seq = String::from_utf8(kmer.to_ascii())
.unwrap_or_else(|_| "?".repeat(kmer_size));
let _ = write!(out, "{seq}");
for &v in row.iter() { let _ = write!(out, ",{v}"); }
let _ = writeln!(out);
})
.map_err(OKIError::Partition)?;
}
let write_row = |buf: &mut Vec<u8>, row: &[u32], prefix: &str| {
let _ = buf.write_all(prefix.as_bytes());
for &v in row { let _ = write!(buf, ",{v}"); }
let _ = buf.write_all(b"\n");
};
let chunks: Vec<OKIResult<Vec<u8>>> = if let Some(limit) = head {
// ── Bounded: atomic counter, early exit when limit reached ────────
let remaining = AtomicUsize::new(limit);
(0..n).into_par_iter().map(|i| {
if remaining.load(Ordering::Relaxed) == 0 { return Ok(vec![]); }
let mut buf = Vec::<u8>::new();
let try_write = |buf: &mut Vec<u8>, row: &[u32], prefix: &str| -> bool {
match remaining.fetch_update(Ordering::SeqCst, Ordering::SeqCst, |cur| {
if cur > 0 { Some(cur - 1) } else { None }
}) {
Err(_) => false,
Ok(_) => { write_row(buf, row, prefix); true }
}
};
if debug {
self.partition
.iter_partition_kmers_located(i, use_counts, n_genomes, filters, |part, layer, kmer, row| {
let seq = String::from_utf8(kmer.to_ascii()).unwrap_or_else(|_| "?".repeat(kmer_size));
try_write(&mut buf, &row, &format!("{part},{layer},{seq}"))
})
.map_err(OKIError::Partition)?;
} else {
self.partition
.iter_partition_kmers(i, use_counts, n_genomes, filters, |kmer, row| {
let seq = String::from_utf8(kmer.to_ascii()).unwrap_or_else(|_| "?".repeat(kmer_size));
try_write(&mut buf, &row, &seq)
})
.map_err(OKIError::Partition)?;
}
on_partition();
Ok(buf)
}).collect()
} else {
// ── Unbounded: no atomic, no contention ───────────────────────────
(0..n).into_par_iter().map(|i| {
let mut buf = Vec::<u8>::new();
if debug {
self.partition
.iter_partition_kmers_located(i, use_counts, n_genomes, filters, |part, layer, kmer, row| {
let seq = String::from_utf8(kmer.to_ascii()).unwrap_or_else(|_| "?".repeat(kmer_size));
write_row(&mut buf, &row, &format!("{part},{layer},{seq}"));
true
})
.map_err(OKIError::Partition)?;
} else {
self.partition
.iter_partition_kmers(i, use_counts, n_genomes, filters, |kmer, row| {
let seq = String::from_utf8(kmer.to_ascii()).unwrap_or_else(|_| "?".repeat(kmer_size));
write_row(&mut buf, &row, &seq);
true
})
.map_err(OKIError::Partition)?;
}
on_partition();
Ok(buf)
}).collect()
};
// ── Sequential write ──────────────────────────────────────────────────
for chunk in chunks {
out.write_all(&chunk?)?;
}
out.flush()?;
+29 -45
View File
@@ -1,8 +1,6 @@
use std::collections::BTreeMap;
use std::fs;
use std::path::{Path, PathBuf};
use std::sync::atomic::{AtomicUsize, Ordering};
use std::sync::{Arc, Mutex};
use obikpartitionner::{KmerPartition, KmerSpectrum};
use obilayeredmap;
@@ -152,31 +150,25 @@ impl KmerIndex {
let with_counts = self.meta.config.with_counts;
let evidence = self.meta.config.evidence.clone();
let block_bits = self.meta.config.block_bits;
let total_kmers = AtomicUsize::new(0);
let mut total_kmers: usize = 0;
let pb = progress_bar("index", n as u64, "partitions");
let pb = Arc::new(Mutex::new(progress_bar("index", n as u64, "partitions")));
(0..n).into_par_iter().for_each(|i| {
match self.partition.build_index_layer(i, min_ab, max_ab, with_counts, &evidence, block_bits) {
Ok(0) => {}
Ok(n_kmers) => {
total_kmers.fetch_add(n_kmers, Ordering::Relaxed);
let pb = pb.lock().unwrap();
let order: Vec<usize> = (0..n).collect();
let runner = crate::numa::PartitionRunner::new();
runner.run(
&order,
|i| self.partition.build_index_layer(i, min_ab, max_ab, with_counts, &evidence, block_bits),
|i, n_kmers, _| {
if n_kmers > 0 {
total_kmers += n_kmers;
pb.inc(1);
pb.set_message(format!("{i}: {n_kmers} kmers"));
}
Err(e) => {
eprintln!("error building layer for partition {i}: {e}");
std::process::exit(1);
}
}
});
},
).map_err(OKIError::Partition)?;
pb.lock().unwrap().finish_and_clear();
info!(
"done — {} total kmers indexed",
total_kmers.load(Ordering::Relaxed)
);
pb.finish_and_clear();
info!("done — {} total kmers indexed", total_kmers);
if !keep_intermediate {
for i in 0..n {
@@ -211,35 +203,27 @@ impl KmerIndex {
use obilayeredmap::meta::PartitionMeta;
let n = self.n_partitions();
let errors: Vec<_> = (0..n)
.into_par_iter()
.filter_map(|i| {
let order: Vec<usize> = (0..n).collect();
let pb = progress_bar("pack", n as u64, "partitions");
crate::numa::PartitionRunner::new().run(
&order,
|i| -> OKIResult<()> {
let index_dir = self.partition.part_dir(i).join("index");
if !index_dir.exists() { return None; }
let meta = match PartitionMeta::load(&index_dir) {
Ok(m) => m,
Err(e) => return Some(OKIError::Io(std::io::Error::new(std::io::ErrorKind::Other, e.to_string()))),
};
if !index_dir.exists() { return Ok(()); }
let meta = PartitionMeta::load(&index_dir)
.map_err(|e| OKIError::Io(std::io::Error::new(std::io::ErrorKind::Other, e.to_string())))?;
for l in 0..meta.n_layers {
let layer_dir = index_dir.join(format!("layer_{l}"));
let presence_dir = layer_dir.join("presence");
let counts_dir = layer_dir.join("counts");
if presence_dir.exists() {
if let Err(e) = pack_bit_matrix(&presence_dir) {
return Some(OKIError::Io(e));
}
}
if counts_dir.exists() {
if let Err(e) = pack_compact_int_matrix(&counts_dir) {
return Some(OKIError::Io(e));
}
}
if presence_dir.exists() { pack_bit_matrix(&presence_dir).map_err(OKIError::Io)?; }
if counts_dir.exists() { pack_compact_int_matrix(&counts_dir).map_err(OKIError::Io)?; }
}
None
})
.collect();
if let Some(e) = errors.into_iter().next() { return Err(e); }
Ok(())
},
|_, _, _| { pb.inc(1); },
)?;
pb.finish_and_clear();
Ok(())
}
+2
View File
@@ -5,8 +5,10 @@ mod distance;
mod dump;
mod index;
mod merge;
mod numa;
mod rebuild;
mod reindex;
mod select;
mod stats;
pub use error::{OKIError, OKIResult};
+188 -89
View File
@@ -2,36 +2,38 @@ use std::collections::HashMap;
use std::fs;
use std::io;
use std::path::Path;
use obisys::{Reporter, Stage, progress_bar, spinner};
use rayon::prelude::*;
use tracing::info;
use tracing::{debug, info};
use obilayeredmap::IndexMode;
use crate::error::{OKIError, OKIResult};
use crate::index::KmerIndex;
use crate::meta::{GenomeInfo, IndexMeta};
use crate::state::IndexState;
use crate::state::{IndexState, SENTINEL_INDEXED};
pub use obikpartitionner::MergeMode;
// ── per-partition diagnostic record ──────────────────────────────────────────
#[derive(Debug)]
struct PartStat {
id: usize,
unitig_bytes: u64,
g_len: usize,
}
// ── main merge entry point ────────────────────────────────────────────────────
impl KmerIndex {
/// Merge `sources` into a new index at `output`.
///
/// All sources must be in `Indexed` state and share the same `kmer_size`,
/// `minimizer_size`, and `n_partitions`. Count mode additionally requires
/// every source to have `with_counts = true`.
///
/// Genome labels must be unique across all sources. If `rename_duplicates`
/// is true, repeated labels are disambiguated by appending `.1`, `.2`, …
/// to the second and subsequent occurrences. Otherwise a
/// `DuplicateGenomeLabel` error is returned on the first conflict.
pub fn merge<P: AsRef<Path>>(
output: P,
sources: &[&KmerIndex],
mode: MergeMode,
force: bool,
rename_duplicates: bool,
budget_fraction: f64,
rep: &mut Reporter,
) -> OKIResult<Self> {
let output = output.as_ref();
@@ -49,9 +51,9 @@ impl KmerIndex {
if src.state() != IndexState::Indexed {
return Err(OKIError::NotIndexed(src.root_path.clone()));
}
if src.kmer_size() != ref0.kmer_size()
|| src.minimizer_size() != ref0.minimizer_size()
|| src.n_partitions() != ref0.n_partitions()
if src.kmer_size() != ref0.kmer_size()
|| src.minimizer_size() != ref0.minimizer_size()
|| src.n_partitions() != ref0.n_partitions()
{
return Err(OKIError::IncompatibleConfig);
}
@@ -61,44 +63,70 @@ impl KmerIndex {
}
// ── Log source characteristics and choose base ────────────────────────
let mode_str = if mode == MergeMode::Presence { "presence" } else { "count" };
let mode_str = if mode == MergeMode::Presence {
"presence"
} else {
"count"
};
info!(
"merge: {} source(s), smer-size={}, mode={}",
sources.len(), sources[0].kmer_size(), mode_str,
sources.len(),
sources[0].kmer_size(),
mode_str,
);
for (i, src) in sources.iter().enumerate() {
let genome_str = if src.meta.genomes.len() == 1 { "mono-genome".to_string() }
else { format!("{} genomes", src.meta.genomes.len()) };
let trivial_str = if is_trivial(src, mode) { " [trivial: no data approximation]" } else { "" };
let genome_str = if src.meta.genomes.len() == 1 {
"mono-genome".to_string()
} else {
format!("{} genomes", src.meta.genomes.len())
};
let trivial_str = if is_trivial(src, mode) {
" [trivial: no data approximation]"
} else {
""
};
info!(
" [{}] {} — {}, {}, {}{}",
i, src.root_path.display(),
i,
src.root_path.display(),
format_evidence(&src.meta.config.evidence),
genome_str, mode_str, trivial_str,
genome_str,
mode_str,
trivial_str,
);
}
let base_idx = choose_base(sources, mode);
let needs_approx = sources.iter().any(|src| {
!is_trivial(src, mode)
&& matches!(src.meta.config.evidence, IndexMode::Approx { .. } | IndexMode::Hybrid { .. })
&& matches!(
src.meta.config.evidence,
IndexMode::Approx { .. } | IndexMode::Hybrid { .. }
)
});
info!(
"output evidence: {} ({}base: [{}] {})",
format_evidence(&sources[base_idx].meta.config.evidence),
if needs_approx { "forced approx — " } else { "" },
base_idx, sources[base_idx].root_path.display(),
if needs_approx {
"forced approx — "
} else {
""
},
base_idx,
sources[base_idx].root_path.display(),
);
let mut ordered: Vec<&KmerIndex> = Vec::with_capacity(sources.len());
ordered.push(sources[base_idx]);
for (i, &src) in sources.iter().enumerate() {
if i != base_idx { ordered.push(src); }
if i != base_idx {
ordered.push(src);
}
}
let sources: &[&KmerIndex] = &ordered;
let evidence = sources[0].meta.config.evidence.clone();
// ── Compute final genome labels (rename duplicates if requested) ───────
// ── Compute final genome labels ────────────────────────────────────────
let (source_labels, all_genomes) = compute_labels(sources, rename_duplicates)?;
// ── Prepare output directory ──────────────────────────────────────────
@@ -125,23 +153,19 @@ impl KmerIndex {
pb.set_message("copying index …");
copy_dir_all(&sources[0].root_path, output)?;
// Rewrite index.meta with final genome labels and the effective mode.
let mut meta = IndexMeta::read(output).map_err(OKIError::Io)?;
meta.genomes = all_genomes;
meta.config.with_counts = mode == MergeMode::Count;
meta.config.evidence = evidence.clone();
meta.write(output)?;
// In presence/absence mode, purge counts/ directories inherited from
// source_0 — they are stale data from the source's count index.
if mode == MergeMode::Presence {
remove_dirs_named(output, "counts")?;
}
pb.finish_and_clear();
rep.push(t.stop());
// Rebuild spectrums/ from all sources using the (possibly renamed) labels.
// Drop the spectrums/ that were copied from source_0 and rebuild from scratch.
// ── Rebuild spectrums ─────────────────────────────────────────────────
info!("rebuilding spectrums for {} source(s)", sources.len());
let t = Stage::start("spectrums");
let pb = spinner("spectrums");
@@ -151,18 +175,19 @@ impl KmerIndex {
fs::remove_dir_all(&spectrums_dir)?;
}
for (src, new_labels) in sources.iter().zip(&source_labels) {
let old_labels: Vec<String> = src.meta.genomes.iter().map(|g| g.label.clone()).collect();
let old_labels: Vec<String> =
src.meta.genomes.iter().map(|g| g.label.clone()).collect();
copy_spectrums(&src.root_path, output, &old_labels, new_labels)?;
}
pb.finish_and_clear();
rep.push(t.stop());
// Open the destination index.
// ── Open destination ──────────────────────────────────────────────────
let dst = KmerIndex::open(output)?;
let n_partitions = dst.n_partitions();
let n_dst_genomes = sources[0].meta.genomes.len();
// ── Merge each subsequent source partition-by-partition ───────────────
// ── Merge partitions ──────────────────────────────────────────────────
let remaining_sources: Vec<&KmerIndex> = sources[1..].to_vec();
if !remaining_sources.is_empty() {
let n_src_genomes: usize = remaining_sources.iter().map(|s| s.meta.genomes.len()).sum();
@@ -176,21 +201,53 @@ impl KmerIndex {
let dst_partition = &dst.partition;
let block_bits = dst.meta.config.block_bits;
let errors: Vec<obiskio::SKError> = (0..n_partitions)
.into_par_iter()
.filter_map(|i| {
let srcs: Vec<(&obikpartitionner::KmerPartition, usize)> =
remaining_sources.iter().map(|s| (&s.partition, s.meta.genomes.len())).collect();
let result = dst_partition.merge_partition(i, &srcs, mode, n_dst_genomes, block_bits, &evidence).err();
pb.inc(1);
result
// Pre-build source list once (avoid rebuilding per partition)
let srcs: Vec<(&obikpartitionner::KmerPartition, usize)> = remaining_sources
.iter()
.map(|s| (&s.partition, s.meta.genomes.len()))
.collect();
// Per-partition unitig byte sizes across remaining sources (stat() only)
let partition_sizes: Vec<u64> = (0..n_partitions)
.map(|i| {
remaining_sources
.iter()
.map(|s| partition_unitig_bytes(s, i))
.sum()
})
.collect();
// LFD sort: largest partition first
let mut order: Vec<usize> = (0..n_partitions).collect();
order.sort_unstable_by_key(|&i| std::cmp::Reverse(partition_sizes[i]));
let _ = budget_fraction; // kept in signature for CLI compatibility
// Shadow as references so closures can capture them by copy.
let srcs = &srcs;
let evidence = &evidence;
let runner = crate::numa::PartitionRunner::new();
let mut part_stats: Vec<PartStat> = Vec::with_capacity(n_partitions);
runner.run(
&order,
|i| dst_partition.merge_partition(i, srcs, mode, n_dst_genomes, block_bits, evidence),
|i, g_len, dur| {
pb.inc(1);
debug!(
"partition {i}: done in {:.1}s — {} new kmers",
dur.as_secs_f64(),
g_len,
);
part_stats.push(PartStat { id: i, unitig_bytes: partition_sizes[i], g_len });
},
).map_err(OKIError::Partition)?;
pb.finish_and_clear();
if let Some(e) = errors.into_iter().next() {
return Err(OKIError::Partition(e));
}
// ── Diagnostic report ─────────────────────────────────────────────
print_merge_partition_report(&part_stats, runner.max_workers());
rep.push(t.stop());
}
@@ -206,19 +263,76 @@ impl KmerIndex {
rep.push(t.stop());
}
// Re-open to get the updated state.
fs::File::create(output.join(SENTINEL_INDEXED)).map_err(OKIError::Io)?;
KmerIndex::open(output)
}
}
// ── Helpers ───────────────────────────────────────────────────────────────────
// ── Diagnostic report ─────────────────────────────────────────────────────────
fn print_merge_partition_report(stats: &[PartStat], max_workers: usize) {
let total_new: usize = stats.iter().map(|s| s.g_len).sum();
let non_empty = stats.iter().filter(|s| s.unitig_bytes > 0).count();
if non_empty == 0 {
info!("merge_partitions report: no data (all partitions empty)");
return;
}
info!("─── merge_partitions report ───");
info!(
" {} partition(s) processed, {} total new kmers",
non_empty, total_new,
);
info!(" max workers: {max_workers}");
// Top 8 partitions by new-kmer count
let mut by_new: Vec<&PartStat> = stats.iter().filter(|s| s.g_len > 0).collect();
by_new.sort_by_key(|s| std::cmp::Reverse(s.g_len));
if !by_new.is_empty() {
info!(" top partitions by new kmers:");
for s in by_new.iter().take(8) {
info!(
" partition {:4} : {}M new kmers ({} unitig bytes)",
s.id,
s.g_len / 1_000_000,
fmt_bytes(s.unitig_bytes),
);
}
}
info!("───────────────────────────────");
}
// ── helpers ───────────────────────────────────────────────────────────────────
fn fmt_bytes(b: u64) -> String {
if b >= 1 << 30 {
format!("{:.1} GB", b as f64 / (1u64 << 30) as f64)
} else if b >= 1 << 20 {
format!("{:.1} MB", b as f64 / (1u64 << 20) as f64)
} else if b >= 1 << 10 {
format!("{:.1} KB", b as f64 / (1u64 << 10) as f64)
} else {
format!("{b} B")
}
}
/// Sum of all unitigs.bin sizes across all layers of partition `i` in `src`.
fn partition_unitig_bytes(src: &KmerIndex, i: usize) -> u64 {
let mut total = 0u64;
for l in 0.. {
let p = src.layer_unitigs_path(i, l);
if !p.exists() {
break;
}
if let Ok(m) = std::fs::metadata(&p) {
total += m.len();
}
}
total
}
/// Compute the final genome label lists for all sources.
///
/// Returns `(per_source_labels, all_genomes_flat)`.
/// The first occurrence of a label keeps the original name. Subsequent
/// occurrences receive `.1`, `.2`, … suffixes when `rename_duplicates` is true,
/// or trigger a `DuplicateGenomeLabel` error otherwise.
fn compute_labels(
sources: &[&KmerIndex],
rename_duplicates: bool,
@@ -241,7 +355,10 @@ fn compute_labels(
};
*count += 1;
labels.push(new_label.clone());
all_genomes.push(GenomeInfo { label: new_label, meta: genome.meta.clone() });
all_genomes.push(GenomeInfo {
label: new_label,
meta: genome.meta.clone(),
});
}
source_labels.push(labels);
}
@@ -249,8 +366,6 @@ fn compute_labels(
Ok((source_labels, all_genomes))
}
/// Copy spectrum JSON files from `src_root/spectrums/` to `dst_root/spectrums/`,
/// mapping each `old_labels[i]` filename to `new_labels[i]`.
fn copy_spectrums(
src_root: &Path,
dst_root: &Path,
@@ -269,7 +384,6 @@ fn copy_spectrums(
Ok(())
}
/// Recursively remove every directory named `name` under `root`.
fn remove_dirs_named(root: &Path, name: &str) -> io::Result<()> {
for entry in fs::read_dir(root)? {
let entry = entry?;
@@ -285,56 +399,41 @@ fn remove_dirs_named(root: &Path, name: &str) -> io::Result<()> {
Ok(())
}
fn format_evidence(ev: &IndexMode) -> String {
match ev {
IndexMode::Exact => "exact".to_string(),
IndexMode::Approx { b, z } => format!("approx (b={b}, z={z})"),
IndexMode::Hybrid { b, z } => format!("hybrid (b={b}, z={z})"),
IndexMode::Exact => "exact".to_string(),
IndexMode::Approx { b, z } => format!("approx (b={b}, z={z})"),
IndexMode::Hybrid { b, z } => format!("hybrid (b={b}, z={z})"),
}
}
/// A source is "trivial" if its presence/count values carry no approximation:
/// single-genome presence index (SetMembership — all values are 1 by construction).
fn is_trivial(src: &KmerIndex, mode: MergeMode) -> bool {
src.meta.genomes.len() == 1 && mode == MergeMode::Presence
}
/// Sum of all `unitigs.bin` sizes across every partition and layer.
/// Used as a proxy for the number of indexed smers.
fn index_unitig_size(src: &KmerIndex) -> u64 {
let n = src.partition.n_partitions();
let mut total = 0u64;
for i in 0..n {
let index_dir = src.partition.part_dir(i).join("index");
let mut l = 0usize;
loop {
let p = index_dir.join(format!("layer_{l}")).join("unitigs.bin");
if !p.exists() { break; }
if let Ok(m) = std::fs::metadata(&p) { total += m.len(); }
l += 1;
}
}
total
(0..n).map(|i| partition_unitig_bytes(src, i)).sum()
}
/// Choose the index to use as bootstrap base.
///
/// Rule — mieux-disant: if any non-trivial source uses approximate evidence
/// (Approx or Hybrid), the output must also be approximate; the base must
/// therefore come from an approximate source so its layers carry the right
/// evidence files. Among qualifying candidates, the largest (by unitig size)
/// is chosen to minimise the number of new smers in the merge layer.
fn choose_base(sources: &[&KmerIndex], mode: MergeMode) -> usize {
let needs_approx = sources.iter().any(|src| {
!is_trivial(src, mode)
&& matches!(src.meta.config.evidence, IndexMode::Approx { .. } | IndexMode::Hybrid { .. })
&& matches!(
src.meta.config.evidence,
IndexMode::Approx { .. } | IndexMode::Hybrid { .. }
)
});
sources.iter().enumerate()
sources
.iter()
.enumerate()
.filter(|(_, src)| {
!needs_approx
|| matches!(src.meta.config.evidence, IndexMode::Approx { .. } | IndexMode::Hybrid { .. })
|| matches!(
src.meta.config.evidence,
IndexMode::Approx { .. } | IndexMode::Hybrid { .. }
)
})
.max_by_key(|(_, src)| index_unitig_size(src))
.map(|(i, _)| i)
+371
View File
@@ -0,0 +1,371 @@
// NUMA-aware partition runner via hwlocality.
//
// Detects NUMA topology using hwloc (cross-platform: Linux, macOS, etc.) and
// builds one Rayon ThreadPool per NUMA node with threads pinned to that node's
// CPUs. Linux first-touch policy then places graph allocations in local DRAM
// automatically — no explicit memory binding needed.
//
// UMA systems (single socket, Apple Silicon, etc.) are the degenerate case:
// one synthetic node containing all cores, no pool, no pinning.
use std::sync::Arc;
use std::time::{Duration, Instant};
use crossbeam_channel::unbounded;
#[cfg(feature = "numa")]
use hwlocality::Topology;
#[cfg(feature = "numa")]
use hwlocality::cpu::binding::CpuBindingFlags;
#[cfg(feature = "numa")]
use hwlocality::cpu::cpuset::CpuSet;
#[cfg(feature = "numa")]
use hwlocality::object::types::ObjectType;
use obisys::{CpuSample, IoSample};
use tracing::debug;
// ── Public interface ──────────────────────────────────────────────────────────
pub struct NumaSetup {
/// One entry per NUMA node. `None` on UMA systems (no pool, no pinning).
pub pools: Vec<Option<Arc<rayon::ThreadPool>>>,
/// CPU indices for each NUMA node, in node order.
pub cpus_per_node: Vec<Vec<usize>>,
}
impl NumaSetup {
/// Maximum worker slots per node (one per physical core in the node).
pub fn workers_per_node(&self) -> usize {
self.cpus_per_node
.first()
.map(|c| c.len().max(1))
.unwrap_or(1)
}
}
/// Detect NUMA topology and build per-node Rayon pools.
/// Always succeeds: falls back to a single synthetic UMA node on failure.
#[cfg(feature = "numa")]
pub fn build() -> NumaSetup {
if let Ok(topology) = Topology::new() {
let nodes: Vec<Vec<usize>> = topology
.objects_with_type(ObjectType::NUMANode)
.filter_map(|obj| obj.cpuset())
.map(|cpuset| {
cpuset
.iter_set()
.map(|idx| usize::from(idx))
.collect::<Vec<_>>()
})
.filter(|v| !v.is_empty())
.collect();
if nodes.len() > 1 {
if let Some(pools) = nodes
.iter()
.map(|cpus| build_pool(cpus).map(|p| Some(Arc::new(p))))
.collect::<Option<Vec<_>>>()
{
debug!(
"NUMA topology: {} node(s), {} core(s)/node",
nodes.len(),
nodes.first().map_or(0, |v| v.len()),
);
return NumaSetup { pools, cpus_per_node: nodes };
}
}
}
// UMA fallback: single synthetic node, all cores, no pool, no pinning.
let n_cores = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1);
debug!("UMA: single synthetic node, {} core(s)", n_cores);
NumaSetup {
pools: vec![None],
cpus_per_node: vec![(0..n_cores).collect()],
}
}
#[cfg(not(feature = "numa"))]
pub fn build() -> NumaSetup {
let n_cores = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1);
debug!("UMA: single synthetic node, {} core(s)", n_cores);
NumaSetup {
pools: vec![None],
cpus_per_node: vec![(0..n_cores).collect()],
}
}
/// Bind the calling thread to `cpu_indices` using hwloc.
/// Silently returns on any error so the thread still runs, just unbound.
#[cfg(feature = "numa")]
pub fn pin_current_thread(cpu_indices: &[usize]) {
let Ok(topology) = Topology::new() else { return };
let mut cpuset = CpuSet::new();
for &idx in cpu_indices {
cpuset.set(idx);
}
let _ = topology.bind_cpu(&cpuset, CpuBindingFlags::THREAD);
}
#[cfg(not(feature = "numa"))]
pub fn pin_current_thread(_cpu_indices: &[usize]) {}
// ── Internal helpers ──────────────────────────────────────────────────────────
#[cfg(feature = "numa")]
fn build_pool(cpus: &[usize]) -> Option<rayon::ThreadPool> {
let cpus = cpus.to_vec();
rayon::ThreadPoolBuilder::new()
.num_threads(cpus.len())
.spawn_handler(move |thread| {
let cpus = cpus.clone();
std::thread::Builder::new().spawn(move || {
pin_current_thread(&cpus);
thread.run();
})?;
Ok(())
})
.build()
.ok()
}
// ── PartitionRunner ───────────────────────────────────────────────────────────
struct NodeConfig {
pool: Option<Arc<rayon::ThreadPool>>,
cpu_ids: Vec<usize>,
max_workers: usize,
}
/// Generic NUMA-aware runner for partition-level parallel work.
///
/// Workers are distributed round-robin across NUMA nodes and pinned to their
/// node's CPUs. UMA is the degenerate case: one node, no pinning.
///
/// Workers are pre-spawned dormant and activated one by one as CPU efficiency
/// falls below `SPAWN_THRESHOLD`. This avoids over-provisioning on I/O-bound
/// or memory-bandwidth-bound workloads while saturating CPU-bound ones.
///
/// # Termination
///
/// ```text
/// drop(part_tx) → part_rx drains → workers exit → drop their result_tx
/// drop(result_tx) → result_rx closes → controller loop exits
/// drop(activate_tx) → dormant workers exit cleanly
/// ```
pub struct PartitionRunner {
nodes: Vec<NodeConfig>,
}
impl PartitionRunner {
/// Total worker slots across all nodes.
pub fn max_workers(&self) -> usize {
self.nodes.iter().map(|n| n.max_workers).sum()
}
/// Detect topology and build. Always succeeds.
pub fn new() -> Self {
let ns = build();
let wpn = ns.workers_per_node();
debug!(
"PartitionRunner: {} node(s) × {} worker(s)/node max",
ns.pools.len(),
wpn,
);
let nodes = ns.pools
.into_iter()
.zip(ns.cpus_per_node)
.map(|(pool, cpu_ids)| NodeConfig {
pool,
cpu_ids,
max_workers: wpn,
})
.collect();
Self { nodes }
}
/// Run `f(i)` for every index in `order`.
///
/// Workers are pre-spawned dormant and activated adaptively. A timer thread
/// fires an efficiency check every `TIMER_SECS` seconds; each completed
/// partition resets that timer (forcing an immediate check) and also
/// triggers its own inline check. A new worker is activated whenever CPU
/// efficiency grows by at least `CPU_SPAWN_THRESHOLD` (absolute, in cores)
/// or I/O throughput grows by at least `IO_SPAWN_THRESHOLD` (relative) since
/// the last check — whichever resource is the actual bottleneck still shows
/// headroom.
///
/// `on_done(i, result, elapsed)` is called from the controller thread as
/// each partition completes — suitable for progress bars and result
/// aggregation.
///
/// Returns the first error produced by `f`, if any.
pub fn run<F, R, E, C>(
&self,
order: &[usize],
f: F,
mut on_done: C,
) -> Result<(), E>
where
F: Fn(usize) -> Result<R, E> + Send + Sync,
R: Send,
E: Send,
C: FnMut(usize, R, Duration) + Send,
{
let n_total = order.len();
if n_total == 0 {
return Ok(());
}
const CPU_SPAWN_THRESHOLD: f64 = 0.2;
const IO_SPAWN_THRESHOLD: f64 = 0.2;
const TIMER_SECS: u64 = 30;
// ── Channels ──────────────────────────────────────────────────────────
let (part_tx, part_rx) = unbounded::<usize>();
let (activate_tx, activate_rx) = unbounded::<()>();
// reset_tx: controller → timer ("reset the 30 s window")
let (reset_tx, reset_rx) = unbounded::<()>();
// event_tx: workers + timer → controller (unified event stream)
let (event_tx, event_rx) = unbounded::<WorkerEvent<R, E>>();
for &i in order { part_tx.send(i).ok(); }
drop(part_tx);
let max_workers = self.max_workers();
let n_nodes = self.nodes.len();
let f = &f;
let mut first_err: Option<E> = None;
std::thread::scope(|s| {
// ── Timer thread ──────────────────────────────────────────────────
// Sends TimerTick every TIMER_SECS seconds. Resets its window each
// time reset_rx receives a message (i.e. on partition completion).
let timer_tx = event_tx.clone();
s.spawn(move || {
let period = Duration::from_secs(TIMER_SECS);
loop {
crossbeam_channel::select! {
recv(reset_rx) -> r => {
if r.is_err() { break; } // reset_tx dropped → exit
}
default(period) => {
if timer_tx.send(WorkerEvent::TimerTick).is_err() { break; }
}
}
}
});
// ── Pre-spawn workers dormant, round-robin across NUMA nodes ──────
for w in 0..max_workers {
let node = &self.nodes[w % n_nodes];
let prx = part_rx.clone();
let etx = event_tx.clone();
let arx = activate_rx.clone();
let pool = node.pool.clone();
let cpu_ids = &node.cpu_ids;
s.spawn(move || {
if arx.recv().is_err() { return; }
if !cpu_ids.is_empty() { pin_current_thread(cpu_ids); }
for i in &prx {
let t = Instant::now();
let r = match &pool {
Some(p) => p.install(|| f(i)),
None => f(i),
};
etx.send(WorkerEvent::Completed(i, r, t.elapsed())).ok();
}
});
}
// Drop controller's event_tx: event_rx closes when all workers +
// timer have exited.
drop(event_tx);
// ── Controller ────────────────────────────────────────────────────
let initial_workers = n_nodes.min(max_workers).min(n_total);
for _ in 0..initial_workers { activate_tx.send(()).ok(); }
let mut n_active = initial_workers;
let mut cpu_sample = CpuSample::now();
let mut io_sample = IoSample::now();
let mut completed = 0usize;
while completed < n_total {
let Ok(event) = event_rx.recv() else { break };
match event {
WorkerEvent::Completed(i, r, dur) => {
match r {
Ok(v) => on_done(i, v, dur),
Err(e) => { if first_err.is_none() { first_err = Some(e); } }
}
completed += 1;
// Reset the 30 s timer.
reset_tx.send(()).ok();
// Inline check: same logic as a timer tick.
maybe_activate(
&activate_tx, &mut n_active, max_workers,
&mut cpu_sample, CPU_SPAWN_THRESHOLD,
&mut io_sample, IO_SPAWN_THRESHOLD,
completed, n_total,
);
}
WorkerEvent::TimerTick => {
maybe_activate(
&activate_tx, &mut n_active, max_workers,
&mut cpu_sample, CPU_SPAWN_THRESHOLD,
&mut io_sample, IO_SPAWN_THRESHOLD,
completed, n_total,
);
}
}
}
// Dormant workers exit when activate_tx closes.
drop(activate_tx);
// Timer thread exits when reset_tx closes.
drop(reset_tx);
});
match first_err {
Some(e) => Err(e),
None => Ok(()),
}
}
}
// ── Internal event type ───────────────────────────────────────────────────────
enum WorkerEvent<R, E> {
Completed(usize, Result<R, E>, Duration),
TimerTick,
}
fn maybe_activate(
activate_tx: &crossbeam_channel::Sender<()>,
n_active: &mut usize,
max_workers: usize,
cpu_sample: &mut CpuSample,
cpu_threshold: f64,
io_sample: &mut IoSample,
io_threshold: f64,
completed: usize,
n_total: usize,
) {
if *n_active >= max_workers || completed >= n_total { return; }
// Call both unconditionally (no `||` short-circuit): each sampler must
// advance its own window every tick, regardless of what the other one
// reports, or it would starve behind whichever signal fires first.
let cpu_wants_more = cpu_sample.do_i_activate(cpu_threshold);
let io_wants_more = io_sample.do_i_activate(io_threshold);
if cpu_wants_more || io_wants_more {
activate_tx.send(()).ok();
*n_active += 1;
debug!("activated worker {}/{}", n_active, max_workers);
}
}
+9 -15
View File
@@ -4,7 +4,6 @@ use std::path::Path;
use obikpartitionner::{KmerFilter, KmerPartition, MergeMode};
use obisys::{Reporter, Stage, progress_bar};
use rayon::prelude::*;
use tracing::info;
use crate::error::{OKIError, OKIResult};
@@ -83,30 +82,25 @@ impl KmerIndex {
let src_partition = &src.partition;
let block_bits = meta.config.block_bits;
let errors: Vec<obiskio::SKError> = (0..n_partitions)
.into_par_iter()
.filter_map(|i| {
let result = dst_partition
.rebuild_partition(src_partition, i, filters, mode, n_genomes, block_bits)
.err();
pb.inc(1);
result
})
.collect();
let order: Vec<usize> = (0..n_partitions).collect();
let runner = crate::numa::PartitionRunner::new();
runner.run(
&order,
|i| dst_partition.rebuild_partition(src_partition, i, filters, mode, n_genomes, block_bits),
|_, _, _| { pb.inc(1); },
).map_err(OKIError::Partition)?;
pb.finish_and_clear();
if let Some(e) = errors.into_iter().next() {
return Err(OKIError::Partition(e));
}
rep.push(t.stop());
// Write SENTINEL_INDEXED — output is ready to use.
fs::File::create(output.join(SENTINEL_INDEXED))?;
let idx = KmerIndex::open(output)?;
let t_pack = Stage::start("pack");
idx.pack_matrices()?;
rep.push(t_pack.stop());
Ok(idx)
}
}
+8 -17
View File
@@ -3,7 +3,6 @@ use std::path::Path;
use obilayeredmap::{IndexMode, layer::Layer};
use obilayeredmap::meta::PartitionMeta;
use obisys::{Reporter, Stage, progress_bar};
use rayon::prelude::*;
use tracing::info;
use crate::error::{OKIError, OKIResult};
@@ -45,25 +44,17 @@ impl KmerIndex {
let t = Stage::start("reindex");
let pb = progress_bar("reindex", n as u64, "partitions");
let errors: Vec<String> = (0..n)
.into_par_iter()
.filter_map(|i| {
let res = reindex_partition(
&self.partition.part_dir(i).join("index"),
&target,
block_bits,
);
pb.inc(1);
res.err().map(|e| format!("partition {i}: {e}"))
})
.collect();
let order: Vec<usize> = (0..n).collect();
let runner = crate::numa::PartitionRunner::new();
runner.run(
&order,
|i| reindex_partition(&self.partition.part_dir(i).join("index"), &target, block_bits)
.map_err(|e| OKIError::InvalidInput(format!("partition {i}: {e}"))),
|_, _, _| { pb.inc(1); },
)?;
pb.finish_and_clear();
if let Some(e) = errors.into_iter().next() {
return Err(OKIError::InvalidInput(e));
}
self.meta.config.evidence = target;
if matches!(self.meta.config.evidence, IndexMode::Exact) {
self.meta.config.block_bits = block_bits;
+150
View File
@@ -0,0 +1,150 @@
use std::fs;
use std::io;
use std::path::Path;
use obikpartitionner::{KmerPartition, OutputCol, PARTITIONS_SUBDIR};
use obisys::{Reporter, Stage, progress_bar};
use tracing::info;
use crate::error::{OKIError, OKIResult};
use crate::index::KmerIndex;
use crate::meta::{GenomeInfo, IndexMeta};
use crate::state::{IndexState, SENTINEL_INDEXED};
impl KmerIndex {
/// Create a new index at `output` by projecting/aggregating the genome columns
/// of `src` according to `specs`.
///
/// `output_presence` — if true, output uses bit matrices (0/1), regardless of
/// whether the source stores counts. The caller is responsible for ensuring all
/// specs use logical operators when `output_presence=true` on a count source.
pub fn select<P: AsRef<Path>>(
output: P,
src: &KmerIndex,
specs: &[OutputCol],
threshold: u32,
output_presence: bool,
force: bool,
rep: &mut Reporter,
) -> OKIResult<Self> {
let output = output.as_ref();
if src.state() != IndexState::Indexed {
return Err(OKIError::NotIndexed(src.root_path.clone()));
}
if output.exists() {
if force {
fs::remove_dir_all(output)?;
} else {
return Err(OKIError::Io(io::Error::new(
io::ErrorKind::AlreadyExists,
format!("{}: output directory already exists", output.display()),
)));
}
}
fs::create_dir_all(output)?;
let mut meta = IndexMeta::new(src.meta.config.clone());
meta.config.with_counts = !output_presence;
meta.genomes = specs.iter()
.map(|s| GenomeInfo::new(s.label.clone()))
.collect();
meta.write(output)?;
let n_src_genomes = src.meta.genomes.len();
let n_partitions = src.partition.n_partitions();
fs::create_dir_all(output.join(PARTITIONS_SUBDIR))?;
let dst_partition = KmerPartition::open_with_config(
output,
meta.config.kmer_size,
meta.config.minimizer_size,
meta.config.n_bits,
)?;
info!(
"select: {} partition(s), {} source genome(s) → {} output column(s)",
n_partitions, n_src_genomes, specs.len(),
);
let t = Stage::start("select");
let pb = progress_bar("select", n_partitions as u64, "partitions");
let src_partition = &src.partition;
let order: Vec<usize> = (0..n_partitions).collect();
let runner = crate::numa::PartitionRunner::new();
runner.run(
&order,
|i| dst_partition.select_partition(src_partition, i, specs, n_src_genomes, threshold, output_presence, false),
|_, _, _| { pb.inc(1); },
).map_err(OKIError::Partition)?;
pb.finish_and_clear();
rep.push(t.stop());
fs::File::create(output.join(SENTINEL_INDEXED))?;
let idx = KmerIndex::open(output)?;
let t_pack = Stage::start("pack");
idx.pack_matrices()?;
rep.push(t_pack.stop());
Ok(idx)
}
/// Rewrite the genome columns of this index in-place according to `specs`.
///
/// The MPHF and unitig files are unchanged; only data matrices are rewritten.
pub fn select_in_place(
&mut self,
specs: &[OutputCol],
threshold: u32,
output_presence: bool,
rep: &mut Reporter,
) -> OKIResult<()> {
if self.state() != IndexState::Indexed {
return Err(OKIError::NotIndexed(self.root_path.clone()));
}
let n_src_genomes = self.meta.genomes.len();
let n_partitions = self.partition.n_partitions();
let src_partition = KmerPartition::open_with_config(
&self.root_path,
self.meta.config.kmer_size,
self.meta.config.minimizer_size,
self.meta.config.n_bits,
)?;
info!(
"select (in-place): {} partition(s), {} source genome(s) → {} output column(s)",
n_partitions, n_src_genomes, specs.len(),
);
let t = Stage::start("select");
let pb = progress_bar("select", n_partitions as u64, "partitions");
let partition = &self.partition;
let order: Vec<usize> = (0..n_partitions).collect();
let runner = crate::numa::PartitionRunner::new();
runner.run(
&order,
|i| partition.select_partition(&src_partition, i, specs, n_src_genomes, threshold, output_presence, true),
|_, _, _| { pb.inc(1); },
).map_err(OKIError::Partition)?;
pb.finish_and_clear();
rep.push(t.stop());
self.meta.config.with_counts = !output_presence;
self.meta.genomes = specs.iter()
.map(|s| GenomeInfo::new(s.label.clone()))
.collect();
self.meta.write(&self.root_path)?;
let t_pack = Stage::start("pack");
self.pack_matrices()?;
rep.push(t_pack.stop());
Ok(())
}
}
+66 -1
View File
@@ -1,7 +1,8 @@
use std::fs;
use std::path::Path;
use obicompactvec::LayerMeta;
use obicompactvec::{LayerMeta, PersistentBitMatrix, PersistentCompactIntMatrix};
use obicompactvec::traits::ColumnWeights;
use obilayeredmap::meta::PartitionMeta;
use rayon::prelude::*;
@@ -124,4 +125,68 @@ impl KmerIndex {
total: bpk(mphf_b + evidence_b + matrix_b),
})
}
/// Return `(total_distinct_kmers, per_genome_kmer_counts)`.
///
/// For each genome, the count is the number of distinct k-mers for which
/// that genome has a non-zero value (presence = 1, count > 0).
/// Partitions are scanned in parallel; results are summed across partitions.
pub fn genome_kmer_counts(&self) -> OKIResult<(usize, Vec<u64>)> {
let n = self.n_partitions();
let n_genomes = self.meta.genomes.len();
let partials: Vec<(usize, Vec<u64>)> = (0..n)
.into_par_iter()
.map(|i| {
let mut counts = vec![0u64; n_genomes];
let mut n_kmers = 0usize;
let index_dir = self.partition.part_dir(i).join("index");
if !index_dir.exists() { return (0, counts); }
let n_layers = PartitionMeta::load(&index_dir)
.map(|m| m.n_layers)
.unwrap_or(0);
for l in 0..n_layers {
let layer_dir = index_dir.join(format!("layer_{l}"));
if !layer_dir.exists() { continue; }
n_kmers += LayerMeta::load(&layer_dir).map(|m| m.n).unwrap_or(0);
let mat: Box<dyn ColumnWeights> =
if layer_dir.join("counts").exists()
&& !layer_dir.join("presence").exists()
{
match PersistentCompactIntMatrix::open(&layer_dir) {
Ok(m) => Box::new(m),
Err(_) => continue,
}
} else {
match PersistentBitMatrix::open(&layer_dir) {
Ok(m) => Box::new(m),
Err(_) => continue,
}
};
let col_counts = mat.partial_kmer_counts();
for (c, &v) in col_counts.iter().enumerate() {
if c < n_genomes { counts[c] += v; }
}
}
(n_kmers, counts)
})
.collect();
let total_kmers: usize = partials.iter().map(|(n, _)| n).sum();
let mut total_counts = vec![0u64; n_genomes];
for (_, counts) in partials {
for (i, v) in counts.into_iter().enumerate() {
total_counts[i] += v;
}
}
Ok((total_kmers, total_counts))
}
}
+5 -2
View File
@@ -1,6 +1,6 @@
[package]
name = "obikmer"
version = "0.1.0"
version = "1.1.33"
edition = "2024"
[[bin]]
@@ -18,7 +18,8 @@ obikrope = { path = "../obikrope" }
obikpartitionner = { path = "../obikpartitionner" }
obisys = { path = "../obisys" }
obiskio = { path = "../obiskio" }
obikindex = { path = "../obikindex" }
obikindex = { path = "../obikindex", default-features = false }
obitaxonomy = { path = "../obitaxonomy" }
obilayeredmap = { path = "../obilayeredmap" }
clap = { version = "4", features = ["derive"] }
serde_json = "1"
@@ -32,4 +33,6 @@ tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
pprof = { version = "0.13", features = ["prost-codec"], optional = true }
[features]
default = ["numa"]
numa = ["obikindex/numa"]
profiling = ["dep:pprof"]
+2 -63
View File
@@ -1,9 +1,9 @@
use std::path::PathBuf;
use std::sync::{Arc, Condvar, Mutex};
use clap::Args;
use obiread::NucPage;
use obikseq::RoutableSuperKmer;
use obipipeline::Throttled;
// ── Shared arguments ──────────────────────────────────────────────────────────
@@ -103,54 +103,10 @@ impl CommonArgs {
}
}
// ── Open-file throttling ──────────────────────────────────────────────────────
struct FileSlots {
count: Mutex<usize>,
condvar: Condvar,
max: usize,
}
impl FileSlots {
fn new(max: usize) -> Self {
Self { count: Mutex::new(0), condvar: Condvar::new(), max }
}
fn acquire(&self) {
let mut count = self.count.lock().unwrap();
while *count >= self.max {
count = self.condvar.wait(count).unwrap();
}
*count += 1;
}
fn release(&self) {
let mut count = self.count.lock().unwrap();
*count -= 1;
self.condvar.notify_one();
}
}
struct SlotsGuard(Arc<FileSlots>);
impl Drop for SlotsGuard {
fn drop(&mut self) {
self.0.release();
}
}
// ── Pipeline data carrier ─────────────────────────────────────────────────────
/// A path bundled with an opaque guard token.
/// The guard is acquired in the source thread and dropped by the flat worker
/// once the file is fully read, releasing the open-file slot.
pub struct PathWithSlot {
pub path: PathBuf,
pub _guard: Box<dyn Send + 'static>,
}
pub enum PipelineData {
Path(PathWithSlot),
Path(Throttled<PathBuf>),
NucPage(NucPage),
Batch(Vec<RoutableSuperKmer>),
}
@@ -158,20 +114,3 @@ pub enum PipelineData {
unsafe impl Send for PipelineData {}
unsafe impl Sync for PipelineData {}
/// Wrap a path iterator so that at most `max_open` files are open simultaneously.
/// Acquisition happens in the caller's thread (the pipeline source thread),
/// never inside a worker, preventing deadlocks.
pub fn throttle_paths(
source: impl Iterator<Item = PathBuf> + Send + 'static,
max_open: usize,
) -> impl Iterator<Item = PathWithSlot> + Send + 'static {
let slots = Arc::new(FileSlots::new(max_open));
source.map(move |path| {
slots.acquire();
PathWithSlot {
path,
_guard: Box::new(SlotsGuard(Arc::clone(&slots))),
}
})
}
+5 -1
View File
@@ -46,6 +46,10 @@ pub struct DistanceArgs {
#[arg(long, value_enum, default_value = "jaccard")]
pub metric: MetricArg,
/// Minimum count to consider a kmer present when computing Jaccard on count indexes
#[arg(long, default_value = "1")]
pub presence_threshold: u32,
/// Also output the shared-kmer count matrix (CSV)
#[arg(long)]
pub shared_kmers: bool,
@@ -81,7 +85,7 @@ pub fn run(args: DistanceArgs) {
let need_shared = args.shared_kmers || args.nj || args.upgma;
let result = idx
.distance(args.metric.into(), need_shared)
.distance(args.metric.into(), need_shared, args.presence_threshold)
.unwrap_or_else(|e| {
eprintln!("error computing distances: {e}");
std::process::exit(1);
+8 -1
View File
@@ -3,6 +3,7 @@ use std::path::PathBuf;
use clap::Args;
use obikindex::KmerIndex;
use obisys::progress_bar;
use tracing::info;
use super::predicate::FilterArgs;
@@ -20,6 +21,10 @@ pub struct DumpArgs {
#[arg(long, default_value_t = false)]
pub debug: bool,
/// Only output the first N kmers
#[arg(long)]
pub head: Option<usize>,
#[command(flatten)]
pub filter: FilterArgs,
}
@@ -37,12 +42,14 @@ pub fn run(args: DumpArgs) {
);
let filters = args.filter.build_filters(&idx.meta().genomes);
let pb = progress_bar("dump", idx.n_partitions() as u64, "partitions");
let stdout = io::stdout();
let mut out = BufWriter::new(stdout.lock());
idx.dump(&mut out, args.force_presence, args.debug, &filters).unwrap_or_else(|e| {
idx.dump(&mut out, args.force_presence, args.debug, args.head, &filters, || pb.inc(1)).unwrap_or_else(|e| {
eprintln!("dump error: {e}");
std::process::exit(1);
});
pb.finish_and_clear();
}
@@ -6,10 +6,10 @@ use obikpartitionner::filter::{MaxTotalCount, MinTotalCount};
use obisys::Reporter;
use tracing::info;
use super::predicate::FilterArgs;
use super::predicate::FilterArgs as KmerFilterArgs;
#[derive(Args)]
pub struct RebuildArgs {
pub struct FilterArgs {
/// Source index directory
pub source: PathBuf,
@@ -18,7 +18,7 @@ pub struct RebuildArgs {
pub output: PathBuf,
#[command(flatten)]
pub filter: FilterArgs,
pub filter: KmerFilterArgs,
/// Minimum total count across all genomes (count index only)
#[arg(long)]
@@ -37,7 +37,7 @@ pub struct RebuildArgs {
pub force: bool,
}
pub fn run(args: RebuildArgs) {
pub fn run(args: FilterArgs) {
let src = KmerIndex::open(&args.source).unwrap_or_else(|e| {
eprintln!("error opening source index: {e}");
std::process::exit(1);
@@ -50,7 +50,7 @@ pub fn run(args: RebuildArgs) {
};
info!(
"rebuild: {} genome(s), mode={:?}, source={}",
"filter: {} genome(s), mode={:?}, source={}",
&src.meta().genomes.len(), mode, args.source.display()
);
@@ -66,10 +66,10 @@ pub fn run(args: RebuildArgs) {
let mut rep = Reporter::new();
KmerIndex::rebuild(&args.output, &src, &filters, mode, args.force, &mut rep)
.unwrap_or_else(|e| {
eprintln!("error rebuilding index: {e}");
eprintln!("error filtering index: {e}");
std::process::exit(1);
});
rep.print();
info!("rebuilt index → {}", args.output.display());
info!("filtered index → {}", args.output.display());
}
+6 -1
View File
@@ -26,6 +26,11 @@ pub struct MergeArgs {
/// Disambiguate duplicate genome labels by appending .1, .2, … instead of erroring
#[arg(long, default_value_t = false)]
pub rename_duplicates: bool,
/// Fraction of available RAM reserved as memory budget for parallel partition merging.
/// Reduce if OOM occurs despite the adaptive scheduler (e.g. --budget-fraction 0.3).
#[arg(long, default_value_t = 0.5)]
pub budget_fraction: f64,
}
pub fn run(args: MergeArgs) {
@@ -60,7 +65,7 @@ pub fn run(args: MergeArgs) {
);
let mut rep = Reporter::new();
KmerIndex::merge(&args.output, &source_refs, mode, args.force, args.rename_duplicates, &mut rep).unwrap_or_else(|e| {
KmerIndex::merge(&args.output, &source_refs, mode, args.force, args.rename_duplicates, args.budget_fraction, &mut rep).unwrap_or_else(|e| {
eprintln!("error merging: {e}");
std::process::exit(1);
});
+2 -1
View File
@@ -1,6 +1,8 @@
pub mod annotate;
pub mod filter;
pub mod pack;
pub(crate) mod predicate;
pub mod select;
pub mod utils;
pub mod distance;
pub mod dump;
@@ -8,7 +10,6 @@ pub mod estimate;
pub mod index;
pub mod merge;
pub mod query;
pub mod rebuild;
pub mod reindex;
pub mod superkmer;
pub mod unitig;
+73 -25
View File
@@ -3,6 +3,7 @@ use std::collections::HashMap;
use clap::Args;
use obikindex::GenomeInfo;
use obikpartitionner::{GroupQuorumFilter, KmerFilter};
use obitaxonomy::{TaxPath, TaxPattern};
// ── Operator ──────────────────────────────────────────────────────────────────
@@ -49,7 +50,6 @@ impl MetaPred {
if values.iter().any(|v| v.is_empty()) {
return Err(format!("empty value in predicate: {s}"));
}
Ok(Self { key, op, values })
}
@@ -70,18 +70,15 @@ impl MetaPred {
// ── Path matching ─────────────────────────────────────────────────────────────
/// True if `value` is equal to `pattern` or is a descendant of it in a `/`-separated hierarchy.
/// True if the stored taxonomy `value` matches `pattern`.
///
/// - Absolute pattern (`/a/b`): `value` must start with `/a/b` at a segment boundary.
/// - Bare segment (`b`): `value` must contain `b` as an exact segment anywhere.
/// `value` must be a valid `TaxPath` (starts with `taxonomy:/`).
/// `pattern` is a `TaxPattern` query (see `obitaxonomy::TaxPattern` for syntax).
/// Returns `false` if either fails to parse.
fn path_matches(value: &str, pattern: &str) -> bool {
if pattern.starts_with('/') {
value == pattern
|| (value.starts_with(pattern)
&& value[pattern.len()..].starts_with('/'))
} else {
value.split('/').any(|seg| seg == pattern)
}
let Ok(path) = TaxPath::parse(value) else { return false };
let Ok(pat) = TaxPattern::parse(pattern) else { return false };
pat.matches(&path)
}
// ── Three-value group evaluation ──────────────────────────────────────────────
@@ -162,6 +159,7 @@ pub struct FilterArgs {
pub max_count: Option<usize>,
/// Minimum fraction of ingroup genomes containing the k-mer [0.01.0]
/// (default 1.0 when --ingroup is set, 0.0 otherwise)
#[arg(long)]
pub min_frac: Option<f64>,
@@ -174,6 +172,7 @@ pub struct FilterArgs {
pub min_outgroup_count: Option<usize>,
/// Maximum number of outgroup genomes containing the k-mer
/// (default 0 when --outgroup is set, no constraint otherwise)
#[arg(long)]
pub max_outgroup_count: Option<usize>,
@@ -205,7 +204,7 @@ impl FilterArgs {
std::process::exit(1);
}))
.collect();
vec![Box::new(build_group_filter(
let filter = build_group_filter(
genomes,
&ingroup_preds,
&outgroup_preds,
@@ -220,10 +219,24 @@ impl FilterArgs {
min_outgroup_frac: self.min_outgroup_frac,
max_outgroup_frac: self.max_outgroup_frac,
},
))]
).unwrap_or_else(|e| {
eprintln!("error in filter parameters: {e}");
std::process::exit(1);
});
vec![Box::new(filter)]
}
}
/// Returns indices of genomes matching `pred_str` (single predicate).
pub fn matching_genome_indices(pred_str: &str, genomes: &[GenomeInfo]) -> Result<Vec<usize>, String> {
let pred = MetaPred::parse(pred_str)?;
Ok(genomes.iter().enumerate()
.filter_map(|(i, g)| {
if pred.eval(&g.meta) == Some(true) { Some(i) } else { std::option::Option::None }
})
.collect())
}
pub struct GroupFilterParams {
pub threshold: u32,
pub min_count: Option<usize>,
@@ -241,7 +254,7 @@ pub fn build_group_filter(
ingroup_preds: &[MetaPred],
outgroup_preds: &[MetaPred],
p: GroupFilterParams,
) -> GroupQuorumFilter {
) -> Result<GroupQuorumFilter, String> {
let (ingroup_idx, outgroup_idx) = if ingroup_preds.is_empty() && outgroup_preds.is_empty() {
((0..genomes.len()).collect(), vec![])
} else {
@@ -258,17 +271,52 @@ pub fn build_group_filter(
let in_size = ingroup_idx.len();
let out_size = outgroup_idx.len();
GroupQuorumFilter {
let ingroup_quorum_explicit = p.min_count.is_some() || p.max_count.is_some()
|| p.min_frac.is_some() || p.max_frac.is_some();
let outgroup_quorum_explicit = p.min_outgroup_count.is_some() || p.max_outgroup_count.is_some()
|| p.min_outgroup_frac.is_some() || p.max_outgroup_frac.is_some();
let default_min_frac = if !ingroup_preds.is_empty() && !ingroup_quorum_explicit { 1.0 } else { 0.0 };
let default_max_outgroup_count = if !outgroup_preds.is_empty() && !outgroup_quorum_explicit { 0 } else { out_size };
let min_count = p.min_count.unwrap_or(0);
let max_count = p.max_count.unwrap_or(in_size);
let min_frac = p.min_frac.unwrap_or(default_min_frac);
let max_frac = p.max_frac.unwrap_or(1.0);
let min_outgroup_count = p.min_outgroup_count.unwrap_or(0);
let max_outgroup_count = p.max_outgroup_count.unwrap_or(default_max_outgroup_count);
let min_outgroup_frac = p.min_outgroup_frac.unwrap_or(0.0);
let max_outgroup_frac = p.max_outgroup_frac.unwrap_or(1.0);
for (v, lo, hi) in [
("--min-frac/--max-frac", min_frac, max_frac),
("--min-outgroup-frac/--max-outgroup-frac", min_outgroup_frac, max_outgroup_frac),
] {
if !(0.0..=1.0).contains(&lo) || !(0.0..=1.0).contains(&hi) {
return Err(format!("{v}: fraction values must be in [0.0, 1.0]"));
}
if lo > hi {
return Err(format!("{v}: min ({lo}) is greater than max ({hi})"));
}
}
if min_count > max_count {
return Err(format!("--min-count/--max-count: min ({min_count}) is greater than max ({max_count})"));
}
if min_outgroup_count > max_outgroup_count {
return Err(format!("--min-outgroup-count/--max-outgroup-count: min ({min_outgroup_count}) is greater than max ({max_outgroup_count})"));
}
Ok(GroupQuorumFilter {
ingroup_idx,
outgroup_idx,
threshold: p.threshold,
min_count: p.min_count.unwrap_or(0),
max_count: p.max_count.unwrap_or(in_size),
min_frac: p.min_frac.unwrap_or(0.0),
max_frac: p.max_frac.unwrap_or(1.0),
min_outgroup_count: p.min_outgroup_count.unwrap_or(0),
max_outgroup_count: p.max_outgroup_count.unwrap_or(out_size),
min_outgroup_frac: p.min_outgroup_frac.unwrap_or(0.0),
max_outgroup_frac: p.max_outgroup_frac.unwrap_or(1.0),
}
threshold: p.threshold,
min_count,
max_count,
min_frac,
max_frac,
min_outgroup_count,
max_outgroup_count,
min_outgroup_frac,
max_outgroup_frac,
})
}
+253
View File
@@ -0,0 +1,253 @@
use std::collections::{BTreeMap, HashMap};
use std::path::PathBuf;
use clap::{Args, ValueEnum};
use obikindex::{GenomeInfo, KmerIndex};
use obikpartitionner::{AggOp, OutputCol};
use obisys::Reporter;
use tracing::info;
use super::predicate::matching_genome_indices;
// ── CLI types ─────────────────────────────────────────────────────────────────
#[derive(Debug, Clone, Copy, PartialEq, Eq, ValueEnum)]
pub enum AggOpArg {
Any,
All,
None,
Sum,
Min,
Max,
}
impl From<AggOpArg> for AggOp {
fn from(a: AggOpArg) -> Self {
match a {
AggOpArg::Any => AggOp::Any,
AggOpArg::All => AggOp::All,
AggOpArg::None => AggOp::None,
AggOpArg::Sum => AggOp::Sum,
AggOpArg::Min => AggOp::Min,
AggOpArg::Max => AggOp::Max,
}
}
}
#[derive(Args)]
pub struct SelectArgs {
/// Source index directory
pub source: PathBuf,
/// Output index directory (mutually exclusive with --in-place)
#[arg(long, conflicts_with = "in_place")]
pub output: Option<PathBuf>,
/// Rewrite the source index in-place (mutually exclusive with --output)
#[arg(long)]
pub in_place: bool,
/// Define a named group: `<name>:<pred>` (repeatable; mutually exclusive with --aggregate-by)
#[arg(long, value_name = "NAME:PRED", conflicts_with = "aggregate_by")]
pub group: Vec<String>,
/// Per-group aggregation operator: `<name>:<op>` (repeatable)
#[arg(long, value_name = "NAME:OP")]
pub group_op: Vec<String>,
/// Auto-create one group per unique value of metadata key <KEY>
#[arg(long, value_name = "KEY", conflicts_with = "group")]
pub aggregate_by: Option<String>,
/// Aggregation operator for all auto-generated groups
#[arg(long, value_name = "OP")]
pub aggregate_op: Option<AggOpArg>,
/// Output columns in order: group names or genome labels, comma-separated
#[arg(long, value_name = "COL,...", value_delimiter = ',')]
pub select: Option<Vec<String>>,
/// Minimum count to consider a genome as "carrying" the k-mer (logical ops only)
#[arg(long, default_value = "0")]
pub presence_threshold: u32,
/// Overwrite existing output directory
#[arg(short, long)]
pub force: bool,
}
// ── Helpers ───────────────────────────────────────────────────────────────────
fn parse_name_value(s: &str, flag: &str) -> (String, String) {
match s.find(':') {
Some(pos) => (s[..pos].trim().to_string(), s[pos + 1..].to_string()),
std::option::Option::None => {
eprintln!("error in {flag}: expected <name>:<value>, got: {s}");
std::process::exit(1);
}
}
}
fn parse_agg_op(s: &str) -> AggOp {
match s.to_lowercase().as_str() {
"any" => AggOp::Any,
"all" => AggOp::All,
"none" => AggOp::None,
"sum" => AggOp::Sum,
"min" => AggOp::Min,
"max" => AggOp::Max,
other => {
eprintln!("unknown aggregation operator: {other}; valid: any, all, none, sum, min, max");
std::process::exit(1);
}
}
}
fn default_op(src_is_count: bool) -> AggOp {
if src_is_count { AggOp::Sum } else { AggOp::Any }
}
// ── build_specs ───────────────────────────────────────────────────────────────
/// Resolve CLI arguments into an ordered list of `OutputCol`.
///
/// Returns `(specs, output_presence)`.
fn build_specs(
args: &SelectArgs,
genomes: &[GenomeInfo],
src_is_count: bool,
) -> (Vec<OutputCol>, bool) {
// ── 1. Build group_indices: name → Vec<usize> ────────────────────────────
// Also keep insertion order for the default `--select *` case.
let mut group_order: Vec<String> = Vec::new();
let mut group_indices: HashMap<String, Vec<usize>> = HashMap::new();
if let Some(ref key) = args.aggregate_by {
// One group per unique value of `key`, in sorted order.
let mut value_to_indices: BTreeMap<String, Vec<usize>> = BTreeMap::new();
for (i, g) in genomes.iter().enumerate() {
if let Some(v) = g.meta.get(key) {
value_to_indices.entry(v.clone()).or_default().push(i);
}
}
for (v, idxs) in value_to_indices {
group_order.push(v.clone());
group_indices.insert(v, idxs);
}
} else {
for raw in &args.group {
let (name, pred) = parse_name_value(raw, "--group");
let idxs = matching_genome_indices(&pred, genomes).unwrap_or_else(|e| {
eprintln!("error in --group {name}: {e}");
std::process::exit(1);
});
if !group_indices.contains_key(&name) {
group_order.push(name.clone());
}
group_indices.insert(name, idxs);
}
}
// ── 2. Build per-group ops ────────────────────────────────────────────────
let global_op = args.aggregate_op.map(AggOp::from);
let mut group_op: HashMap<String, AggOp> = HashMap::new();
for raw in &args.group_op {
let (name, op_str) = parse_name_value(raw, "--group-op");
if !group_indices.contains_key(&name) {
eprintln!("--group-op references undefined group: {name}");
std::process::exit(1);
}
group_op.insert(name, parse_agg_op(&op_str));
}
// ── 3. Genome label → index map for pass-through columns ─────────────────
let label_to_idx: HashMap<&str, usize> = genomes.iter().enumerate()
.map(|(i, g)| (g.label.as_str(), i))
.collect();
// ── 4. Determine output column names ─────────────────────────────────────
let col_names: Vec<String> = if let Some(ref sel) = args.select {
sel.clone()
} else if !group_order.is_empty() {
group_order.clone()
} else {
// Identity: all genomes in original order
genomes.iter().map(|g| g.label.clone()).collect()
};
// ── 5. Build OutputCol list ───────────────────────────────────────────────
let mut specs: Vec<OutputCol> = Vec::with_capacity(col_names.len());
for name in &col_names {
if let Some(idxs) = group_indices.get(name) {
let op = group_op.get(name)
.copied()
.or(global_op)
.unwrap_or_else(|| default_op(src_is_count));
specs.push(OutputCol { label: name.clone(), indices: idxs.clone(), op });
} else if let Some(&idx) = label_to_idx.get(name.as_str()) {
// Pass-through: single-element group with default op.
let op = default_op(src_is_count);
specs.push(OutputCol { label: name.clone(), indices: vec![idx], op });
} else {
eprintln!("--select: unknown column '{name}' (not a group name or genome label)");
std::process::exit(1);
}
}
if specs.is_empty() {
eprintln!("select: no output columns defined");
std::process::exit(1);
}
// ── 6. Determine output type ──────────────────────────────────────────────
let output_presence = !src_is_count
|| specs.iter().all(|s| s.op.is_logical());
(specs, output_presence)
}
// ── run ───────────────────────────────────────────────────────────────────────
pub fn run(args: SelectArgs) {
if !args.in_place && args.output.is_none() {
eprintln!("error: one of --output or --in-place must be specified");
std::process::exit(1);
}
let mut src = KmerIndex::open(&args.source).unwrap_or_else(|e| {
eprintln!("error opening source index: {e}");
std::process::exit(1);
});
let src_is_count = src.meta().config.with_counts;
let (specs, output_presence) = build_specs(&args, &src.meta().genomes.clone(), src_is_count);
info!(
"select: {} genome(s) → {} output column(s), output={}",
src.meta().genomes.len(),
specs.len(),
if output_presence { "presence" } else { "count" },
);
let mut rep = Reporter::new();
if args.in_place {
src.select_in_place(&specs, args.presence_threshold, output_presence, &mut rep)
.unwrap_or_else(|e| {
eprintln!("select error: {e}");
std::process::exit(1);
});
rep.print();
info!("selected in-place → {}", args.source.display());
} else {
let output = args.output.unwrap();
KmerIndex::select(&output, &src, &specs, args.presence_threshold, output_presence, args.force, &mut rep)
.unwrap_or_else(|e| {
eprintln!("select error: {e}");
std::process::exit(1);
});
rep.print();
info!("selected index → {}", output.display());
}
}
+9 -5
View File
@@ -1,10 +1,13 @@
use std::io::{self, BufWriter, Write};
use std::path::PathBuf;
use clap::Args;
use obifastwrite::write_scatter;
use obikseq::{RoutableSuperKmer, set_k, set_m};
use crate::cli::{CommonArgs, PipelineData, PathWithSlot, partitions_to_bits, throttle_paths};
use obipipeline::{Throttled, throttle};
use crate::cli::{CommonArgs, PipelineData, partitions_to_bits};
#[derive(Args)]
pub struct SuperkmerArgs {
@@ -46,14 +49,15 @@ pub fn run(args: SuperkmerArgs) {
set_k(k);
set_m(m);
let path_source = throttle_paths(args.common.seqfile_paths(), max_open);
let path_source = throttle(args.common.seqfile_paths(), max_open);
let pipe = obipipeline::make_pipe! {
PipelineData : PathWithSlot => Vec<RoutableSuperKmer>,
PipelineData : Throttled<PathBuf> => Vec<RoutableSuperKmer>,
||? {
let k = k;
move |pw: PathWithSlot| {
let path_str = pw.path.to_str().unwrap_or("").to_owned();
move |pw: Throttled<PathBuf>| {
let path_str = pw.item.to_str().unwrap_or("").to_owned();
let _guard = pw.guard;
obiread::open_nuc_stream(&path_str, k)
}
} : Path => NucPage,

Some files were not shown because too many files have changed in this diff Show More