Compare commits

...
15 Commits
Author SHA1 Message Date
Eric Coissac f5e508ed33 feat: add multi-genome SNP pseudo-alignment and CLI export
Release / create-release (push) Successful in 5m58s
Release / build-macos-arm64 (push) Successful in 2m47s
Release / build-linux-x86_64 (push) Successful in 8m50s
CI / build (pull_request) Canceled after 5m42s
Introduces a `SnpAlignment` struct and helper methods to construct per-genome SNP pseudo-alignments from sibling k-mer data, filtering monomorphic families and encoding bases as IUPAC ambiguity codes. Exposes the type at the crate root for simplified imports. Adds a `--snp` CLI flag to compute and export these alignments as an IUPAC-coded FASTA file. Updates theory documentation to propose a multi-genome framing approach for joint phylogenetic inference, resolving pairwise correspondence ambiguities through positional homology and partial coverage thresholds. Bumps crate version to 1.1.40.
2026-08-10 22:38:38 +02:00
Eric Coissac 49f329edd5 feat: add raw SNP distance calculation and CLI flag
Exposes RawSnpDistanceOutput and implements KmerIndex::raw_snp_distance() to compute pairwise single-copy locus counts under a paralogy-aware rule. The implementation leverages ndarray for parallel matrix aggregation, producing raw p-distance matrices for sanity-checking. A --raw-snp-distance CLI flag is added to export results as CSV, mapping zero-eligible pairs to NA.
2026-08-10 22:17:07 +02:00
Eric Coissac 1a470eab9e Refactor k-mer sibling tracking to compact bitmask and on-demand counts
Replaces the explicit `SiblingInfo` struct and 3-bit minorant flags with a derived 4-bit presence mask (`FamilyMask`) that tracks observed bases per family. This eliminates redundant file I/O overhead by introducing a `PartitionCache` for batch lookups, simplifies serialization, and updates all downstream builders, stats computation, and tests to operate on the new bitmask representation. Adjusts CLI output to report deduplicated family sizes instead of histograms, ignores generated CSV files, and updates documentation to reflect the fixed canonical reference and new theory.
2026-08-10 17:53:52 +02:00
Eric Coissac ba990a48a0 feat: add obipipeline for concurrent sibling annex stats
Add the `obipipeline` crate and replace sequential scatter/gather logic with a concurrent pipeline using `Flat` and `Transform` stages. Introduce `SiblingAnnexStats` API to compute distributions, and add CLI flags to `distance.rs` for constructing the annex and exporting statistics as CSV.
2026-08-10 15:31:04 +02:00
Eric Coissac ea914bb536 feat: implement per-k-mer sibling counts and central neighbor generation
Introduce the siblingannex module in obicompactvec to store per-slot minorant flags and sibling counts in a memory-mapped annex file. Add a scatter-gather pipeline in obikindex to compute these values across index layers and write them to .psib files. Implement central_canonical_neighbors in obikseq for generating strand-aware k-mer variants around the middle base. Expose rolling statistics in obiskbuilder and update dependency graphs accordingly.
2026-08-10 15:01:59 +02:00
Eric Coissac 8bc6d533e5 feat: support negative count filters as group size offsets
Updates CLI parsing to accept negative integers for count filters, interpreting them as offsets from the group size (e.g., `-1` means all but one). A resolution closure enforces a floor of 1 to prevent unconstrained filtering on small groups. Additionally, refines evolutionary distance documentation to condition comparisons on local homology, replacing union-based Jaccard with a self-contained `SnpTally`. This unified approach streamlines SNP and shared count computation, incorporates paralogy and heterozygosity handling, and enables direct derivation of corrected distance matrices without external dependencies.
2026-08-10 12:38:35 +02:00
Eric Coissac 45df9919e5 docs: add central-position SNP distance estimator spec
Introduces a design specification for inferring substitution rates directly from k-mers with conserved flanks. The document details a memory-efficient implementation that computes 4x4 base-pair tallies using existing MPHF structures, enabling classical corrections without de Bruijn graph materialization. Updates MkDocs navigation to include the new theory page.
2026-07-10 09:49:49 +02:00
Eric Coissac 2610a4af79 feat: add Mash distance metric and rolling entropy support
Implement the Mash distance metric across the CLI, index, and compact vector traits. This includes adding a `Mash` variant to the `DistanceMetric` enum and `MetricArg` CLI argument, implementing the conversion from Jaccard distances using the standard mutation-rate estimator formula, and updating documentation with supported metrics and algorithmic references. Additionally, add an `entropy` method to rolling statistics for computing order-specific entropy.
2026-07-09 11:40:48 +02:00
coissac dc3392865f Merge pull request 'Push qowsvpqmoukq' (#61) from push-qowsvpqmoukq into main
Reviewed-on: #61
2026-07-08 18:05:42 +00:00
Eric Coissac fd2c23e7df refactor: remove equivalence class folding from entropy pipeline
Release / create-release (push) Successful in 2m27s
Release / build-linux-x86_64 (push) Successful in 8m17s
Release / build-macos-arm64 (push) Successful in 1m41s
CI / build (pull_request) Successful in 3m33s
Removes circular-reverse complement machinery and explicit k-mer canonicalization across the entropy pipeline. Frequency tallying and Shannon entropy computation now operate directly on raw k-mer values, eliminating prior score inflation and alignment-dependent artifacts while preserving orientation invariance. Updates build scripts to generate normalized lookup tables for k-mer lengths 1–6, restricts the public API to `EntropyTracker`, and bumps crate versions. Documentation is updated to reflect the simplified raw-value approach and revised module structure.
2026-07-08 19:36:30 +02:00
Eric Coissac 912f788f7f feat: extract k-mer entropy computation into new obikentropy crate
Extracts streaming entropy logic and sliding-window frequency tracking from obiskbuilder into a dedicated obikentropy crate. Introduces an EntropyTracker accumulator for O(1) per-base normalized Shannon entropy, replaces inline rolling statistics with delegated state management, and updates workspace dependencies across obikindex, obikpartitionner, and obiskbuilder. Adds criterion benchmarks to validate the refactored pipeline throughput.
2026-07-08 18:36:16 +02:00
Eric Coissac e725523898 feat: add entropy-driven k-mer complexity filtering
Introduces a MinComplexity filter driven by new CLI arguments, enabling sequence-aware threshold checks during index reconstruction and partitioning. Adds the kmer_entropy module for normalized complexity scoring, updates the KmerFilter trait to evaluate per-kmer context, and refactors test modules for better organization.
2026-07-08 12:48:25 +02:00
coissac 165982fb07 Merge pull request 'Bump obikmer version to 1.1.38 and add memory footprint logging' (#60) from push-slxmykzqmzzv into main
Reviewed-on: #60
2026-07-08 10:15:51 +00:00
Eric Coissac 2740f52326 Bump obikmer version to 1.1.38 and add memory footprint logging
Release / create-release (push) Successful in 2m26s
CI / build (pull_request) Successful in 3m32s
Release / build-linux-x86_64 (push) Successful in 8m8s
Release / build-macos-arm64 (push) Successful in 1m43s
Updates Cargo.toml version from 1.1.37 to 1.1.38. Adds explicit memory footprint estimation for the `by_partition` k-mer dedup HashMap by computing capacity-based byte sizes for map slots and stored descriptors. These metrics are logged via `debug!` to track actual memory pressure during chunk processing.
2026-07-08 12:14:58 +02:00
coissac dff5d2f457 Merge pull request 'Push smluomvxpptv' (#59) from push-smluomvxpptv into main
Reviewed-on: #59
2026-07-07 17:13:03 +00:00
45 changed files with 3433 additions and 661 deletions
+1
View File
@@ -9,6 +9,7 @@ data-stress
./**/*.json ./**/*.json
*.bin *.bin
*.log *.log
*.csv
Betula_exilis--IGA-24-33 Betula_exilis--IGA-24-33
benchmark/genomes benchmark/genomes
benchmark/simulated_data benchmark/simulated_data
+45 -4
View File
@@ -92,18 +92,48 @@ For each genome:
| Flag | Applies to | Meaning | | Flag | Applies to | Meaning |
|------|-----------|---------| |------|-----------|---------|
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes | | `--min-count N` | ingroup | k-mer present in at least N ingroup genomes (N may be negative, see below) |
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes | | `--max-count N` | ingroup | k-mer present in at most N ingroup genomes (N may be negative, see below) |
| `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes | | `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes |
| `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes | | `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes |
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes | | `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes (N may be negative, see below) |
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes | | `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes (N may be negative, see below) |
| `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes | | `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes |
| `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes | | `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes |
| `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`filter` only) | | `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`filter` only) |
| `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`filter` only) | | `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`filter` only) |
| `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) | | `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) |
### Negative counts — offset from group size
The four integer count flags (`--min-count`, `--max-count`, `--min-outgroup-count`,
`--max-outgroup-count`) accept **negative** values, interpreted as an offset counted
down from the group size `n`, resolved at run time once `n` is known:
| Value | Effective threshold |
|-------|---------------------|
| `N ≥ 0` | literal absolute count `N` |
| `-x` (x > 0) | `max(1, n x)` — "all but x" |
`-1` literally means *all but one*, `-2` *all but two*, and so on. This expresses
a quorum relative to the group size that a plain fraction cannot state exactly
(e.g. "present in every genome except at most one" is `n1`, which is `0.9` for
`n = 10` but `0.857…` for `n = 7`).
The threshold is **floored at 1**, never 0: the negative form always keeps
constraining the group. Without the floor, `--min-count -1` on a singleton
ingroup (`n = 1`) would resolve to `0` ("at least 0") and silently drop the
constraint; the floor makes it `1` ("present in that one genome") instead.
To express a count of `0` (e.g. "absent from the ingroup"), use the literal `0`,
not a negative — `0` and `-0` are indistinguishable, so the offset form starts at
`-1`.
> **Edge case** — on an *empty* group (`n = 0`, e.g. a predicate matching no
> genome), a negative count still resolves to `1`, an impossible constraint that
> rejects every k-mer. This is consistent with an empty group letting nothing
> through, but differs from the "no constraint" behaviour of the fraction flags.
**Conditional defaults** — the defaults for `--min-frac` and `--max-outgroup-count` depend on two conditions: **Conditional defaults** — the defaults for `--min-frac` and `--max-outgroup-count` depend on two conditions:
whether the corresponding group was declared, **and** whether any quorum flag for that group was explicitly set. whether the corresponding group was declared, **and** whether any quorum flag for that group was explicitly set.
@@ -215,6 +245,17 @@ obikmer filter src --output dst \
--max-outgroup-count 0 --max-outgroup-count 0
``` ```
Noise-tolerant core — keep k-mers present in *all but one* ingroup genome
(`-1` = `n1`) and absent from *all but one* of the outgroup:
```sh
obikmer filter src --output dst \
--ingroup "genus=Betula" \
--outgroup "*" \
--min-count -1 \
--max-outgroup-count -1
```
To dump only k-mers specific to *Betula nana*: To dump only k-mers specific to *Betula nana*:
```sh ```sh
+13
View File
@@ -347,11 +347,24 @@ Provided finalisations:
| `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` | | `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` |
| `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` | | `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` |
| `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` | | `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` |
| `threshold_mash_dist_matrix(k, t)` | Mash distance, derived from `threshold_jaccard_dist_matrix(t)` — no separate partial |
### BitPartials ### BitPartials
Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)`, `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions. Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)`, `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions.
Provided finalisations also include `jaccard_dist_matrix()`, `hamming_dist_matrix()`, and `mash_dist_matrix(k)`.
### Mash distance
`mash_dist_matrix`/`threshold_mash_dist_matrix` add no new additive primitive: both are a pointwise transform of the existing Jaccard distance matrix, per the Mash mutation-rate estimator [@Mash-distances-doc; @Fan2015-mash-formula]:
```
D = -1/k · ln(2J / (1+J)), J = 1 - d_jaccard
```
`J ≤ 0` (i.e. `d_jaccard ≥ 1`, no shared k-mers) maps to `D = 1` (maximal distance) rather than the `ln` singularity at `J = 0`.
--- ---
## Temp-file-backed types ## Temp-file-backed types
+1 -1
View File
@@ -13,7 +13,7 @@
| `query` | Query an index with sequences and annotate matches | | `query` | Query an index with sequences and annotate matches |
| `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the shared [kmer filtering](implementation/filtering.md) system; `--head N` limits output to the first N k-mers | | `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the shared [kmer filtering](implementation/filtering.md) system; `--head N` limits output to the first N k-mers |
| `annotate` | Add or update genome metadata from a CSV file; or dump metadata as CSV | | `annotate` | Add or update genome metadata from a CSV file; or dump metadata as CSV |
| `distance` | Compute pairwise distance matrix between genomes; optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard on count indexes (default 1) | | `distance` | Compute pairwise distance matrix between genomes (`--metric jaccard\|mash\|hamming\|bray-curtis\|relfreq-bray-curtis\|euclidean\|relfreq-euclidean\|hellinger\|hellinger-euclidean`); optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard/Mash on count indexes (default 1) |
| `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the shared [kmer filtering](implementation/filtering.md) system | | `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the shared [kmer filtering](implementation/filtering.md) system |
| `select` | Project and/or aggregate genome columns into a new or in-place index; the column-axis counterpart of `filter` (see [select](implementation/select.md)) | | `select` | Project and/or aggregate genome columns into a new or in-place index; the column-axis counterpart of `filter` (see [select](implementation/select.md)) |
| `estimate` | Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing | | `estimate` | Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing |
+18
View File
@@ -241,3 +241,21 @@
volume = 33, volume = 33,
year = 2017, year = 2017,
bdsk-url-1 = {http://dx.doi.org/10.1093/bioinformatics/btw832}} bdsk-url-1 = {http://dx.doi.org/10.1093/bioinformatics/btw832}}
@misc{Mash-distances-doc,
author = {{Marbl Lab}},
howpublished = {Mash documentation},
title = {Mash Distance},
url = {https://mash.readthedocs.io/en/latest/distances.html},
urldate = {2026-07-09},
year = 2026}
@article{Fan2015-mash-formula,
author = {Fan, Huan and Ives, Anthony R and Surget-Groba, Yann and Cannon, Charles H},
doi = {10.1186/s12864-015-1647-5},
journal = {BMC Genomics},
number = 1,
title = {An assembly and alignment-free method of phylogeny reconstruction from next-generation sequencing data},
url = {https://doi.org/10.1186/s12864-015-1647-5},
volume = 16,
year = 2015}
+32 -16
View File
@@ -1,6 +1,6 @@
# Kmer entropy filter # Kmer entropy filter
Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for two sources of bias: the small number of observations within a single kmer, and the unequal sizes of circular equivalence classes. Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for one source of bias: the small number of observations within a single kmer relative to the number of possible sub-words.
## Sub-word frequencies ## Sub-word frequencies
@@ -8,17 +8,15 @@ For a kmer of length k and a sub-word size ws (1 ≤ ws ≤ ws_max, typically ws
$$w_i = \text{kmer}[i \mathinner{..} i+ws-1], \quad i = 0, \ldots, n_{\text{words}}-1$$ $$w_i = \text{kmer}[i \mathinner{..} i+ws-1], \quad i = 0, \ldots, n_{\text{words}}-1$$
Each sub-word is mapped to its **circular canonical form**: the lexicographic minimum among all cyclic rotations of the word **and all cyclic rotations of its reverse complement**. This extended equivalence relation ensures that entropy(K) = entropy(revcomp(K)) — the filter is strand-symmetric. Let $s_j$ be the size of equivalence class $j$ (number of distinct raw words mapping to canonical form $j$), and $f_j$ the count of canonical form $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$). Each sub-word is tallied under its own raw 2-bit-packed value — **no canonicalization**. Let $f_j$ be the count of raw word $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$), over the $4^{ws}$ possible raw words.
An earlier version of this filter first folded each sub-word into a circular+reverse-complement equivalence class, then "unfolded" the observed class frequency back onto its members to correct for unequal class sizes. That machinery bought nothing it was claimed for — see *Why no equivalence classes* below — while measurably weakening detection of the very sequences the filter exists to catch, so it was removed.
## Corrected Shannon entropy ## Corrected Shannon entropy
The circular equivalence classes have unequal sizes: under a uniform distribution over all $4^{ws}$ raw words, class $j$ is visited with probability $s_j / 4^{ws}$, not $1/n_a$. Computing entropy directly over canonical classes therefore underestimates the entropy of a random sequence. $$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j$$
The correction "unfolds" each canonical class back to its member raw words, redistributing each observation of class $j$ equally among its $s_j$ members: This is a plain Shannon entropy over the observed raw-word frequencies.
$$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j + \frac{1}{n_{\text{words}}} \sum_j f_j \log s_j$$
The last term is the correction for unequal class sizes. For a uniformly random sequence ($f_j \approx n_{\text{words}} \cdot s_j / 4^{ws}$), this gives $H_{\text{corr}} \approx \log(4^{ws}) = 2 \cdot ws \cdot \log 2$, the maximum entropy over raw words.
## Maximum entropy correction for small samples ## Maximum entropy correction for small samples
@@ -42,27 +40,45 @@ $$\text{entropy}(kmer) = \min_{ws=1}^{ws_{\max}} \hat{H}(ws)$$
A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if $\text{entropy}(kmer) < \theta$, where $\theta$ is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc. A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if $\text{entropy}(kmer) < \theta$, where $\theta$ is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc.
## Why no equivalence classes
A prior design folded each sub-word into the canonical form of its circular-rotation + reverse-complement equivalence class before tallying, on the reasoning that (a) it guarantees $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, and (b) collapsing phase-shifted repeats (e.g. `ATG``TGA``GAT`) into one class better reflects that they are "the same" low-complexity pattern.
Both properties already hold for the raw, unfolded entropy above, without any class machinery:
- **Reverse complement**: for any K of length n, window $j$ of $\text{revcomp}(K)$ equals $\text{revcomp}$ of window $(n{-}ws{-}j)$ of K. This is a bijection between the window sets under which each window maps to its own revcomp — and revcomp is itself a bijection (involution) on the space of raw ws-mers. So the multiset of raw-word frequencies for $\text{revcomp}(K)$ is exactly a relabeling of the multiset for K, and Shannon entropy — a function of the frequency multiset alone — is exactly invariant. No folding required, for any K.
- **Tandem repeats**: a period-p repeat sampled by a stride-1 sliding window naturally cycles through its own rotations as raw tokens (e.g. `ATGATGATG…` yields the raw words `ATG`, `TGA`, `GAT` in rotation as the window slides). The low diversity this represents (few distinct raw words out of $4^{ws}$ possible) is already visible in the raw frequency distribution — no folding needed to detect it.
What the fold-then-unfold step actually did was credit each observed class with the frequency of equivalence-class members that were **never observed on the read strand**, inflating $H_{\text{corr}}$ for genuine repeats. Worked example: k=31, ws=3, kmer = `ATG` repeated ($n_{\text{words}}=29$, all 29 windows fall into one class of size 6 under the old scheme — 3 rotations × forward/revcomp):
| | $H_{\text{corr}}$ | normalized |
|---|---|---|
| old (folded, class size 6) | $\log 6 \approx 1.79$ | $\approx 0.53$ |
| current (raw, unfolded) | $\log 3 \approx 1.10$ | $\approx 0.33$ |
The gap is not a rounding artifact: per sub-word order, the folded score for this same repeat swings from 0.53 (ws=3, aligned with the period) up to **1.03** (ws=5, misaligned with the period) — i.e. a period-3 repeat could score *above* the theoretical maximum for a random sequence, depending on which ws happens to divide the repeat's period. The raw formula stays flat at ≈0.330.40 across ws=2..6 regardless of alignment, which is the robustness the "minimum across ws" design was meant to provide in the first place.
## Interpretation as an effective number of classes ## Interpretation as an effective number of classes
$H_{\text{corr}}$ is a standard Shannon entropy over raw words (after unfolding the equivalence classes), so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable classes that would yield the same entropy. $H_{\text{corr}}$ is a standard Shannon entropy over raw words, so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable raw words that would yield the same entropy.
For the normalised score $\hat{H}$, dividing by $H_{\text{max}}$ changes the logarithm base: For the normalised score $\hat{H}$, dividing by $H_{\max}$ changes the logarithm base:
$$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\text{max}}} = \log_{N_{\text{max}}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\text{max}}^{\,\hat{H}}$$ $$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\max}} = \log_{N_{\max}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\max}^{\,\hat{H}}$$
The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\text{max}}$) of the effective number of equi-represented classes. The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\max}$) of the effective number of equi-represented raw words.
In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\text{max}} \approx 4^{ws}$, giving: In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\max} \approx 4^{ws}$, giving:
$$N_{\text{eff}} \approx 4^{ws \cdot \hat{H}}$$ $$N_{\text{eff}} \approx 4^{ws \cdot \hat{H}}$$
This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective classes out of 16 are occupied. This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective words out of 16 are occupied.
In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\text{max}} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\text{max}}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$. In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\max} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\max}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$.
## Properties ## Properties
The entropy score is a function of the kmer sequence alone — it does not depend on the surrounding context or on the position within any genome. Two consequences: The entropy score is a function of the kmer sequence alone — it does not depend on the surrounding context or on the position within any genome. Two consequences:
- **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, guaranteed by the strand-symmetric canonical form. - **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$ — see *Why no equivalence classes* above for why this holds without any explicit strand-folding step.
- **Context independence**: the same kmer is always rejected or always kept, regardless of which genome it occurs in, where in that genome it appears, or which strand is considered. The filter defines a fixed partition of the kmer space into low-complexity and valid kmers. - **Context independence**: the same kmer is always rejected or always kept, regardless of which genome it occurs in, where in that genome it appears, or which strand is considered. The filter defines a fixed partition of the kmer space into low-complexity and valid kmers.
+7 -3
View File
@@ -3,10 +3,14 @@
## Code couvert ## Code couvert
- `obiskbuilder/src/entropy_table.rs` — filtre Shannon sur les kmers à basse complexité - `obikentropy/src/table.rs`, `obikentropy/src/tracker.rs` — formule d'entropie et tables de correction petits effectifs
- `obiskbuilder/src/lib.rs` — application du filtre lors du scatter (phase 1) - `obikentropy/src/kmer_entropy.rs` — entropie d'un kmer isolé (`KmerEntropy`)
- `obiskbuilder/src/rolling_stat.rs` — composition de `obikentropy::EntropyTracker` dans le suivi streaming (sélection de minimiseur + entropie)
- `obiskbuilder/src/iter.rs`, `obiskbuilder/src/stream_iter.rs` — application du filtre lors du scatter (phase 1)
## Notes ## Notes
Document théorique stable. Vérifier que les paramètres `theta` et `level_max` dans le CLI Le repli en classes d'équivalence circulaires + brin inverse (décrit dans une version antérieure de ce document) a été supprimé : voir la section « Why no equivalence classes » de `entropy.md` pour la justification théorique et numérique.
Vérifier que les paramètres `theta` et `level_max` dans le CLI
(`obikmer/src/cli.rs``CommonArgs`) correspondent bien à ce qui est décrit. (`obikmer/src/cli.rs``CommonArgs`) correspondent bien à ce qui est décrit.
+820
View File
@@ -0,0 +1,820 @@
# Central-position SNP distance (discussion)
Not implemented. Design discussion for a substitution-rate estimator that
observes SNPs directly from paired-genome k-mer comparison, as an alternative
to Mash's Poisson-Jaccard inference (see [obicompactvec](../implementation/obicompactvec.md)
for the implemented Jaccard/Mash distances).
## Motivation
**Primary intent: restrict the comparison to what is actually comparable.**
Mash's Jaccard is computed over the **union** of both genomes' k-mer content:
anything not identically shared is folded into a single undifferentiated
mass, whether the cause is a point substitution, a genuinely absent
homologous region (lineage-specific content, gene-family expansion, HGT,
genome-size asymmetry), or a diverged paralogous copy. The model then
back-infers a single mutation rate from that mass, silently attributing
non-homology to mutation. The central-SNP approach instead conditions every
comparison on local, positive evidence of homology: a locus only enters the
statistic if its `2m` flanking bases (`m = (k-1)/2`) are found intact in
*both* genomes — genuinely absent or non-homologous content is excluded from
the comparison entirely (neither numerator nor denominator), rather than
silently counted as divergence. This is a conditioning on comparability, not
just a richer summary statistic — see "Statistic and correspondence with
`shared`" below for how it plays out against genome-size asymmetry and
diverged gene families, and "Heterozygosity, ploidy, and consensus-assembly
inputs" for the corresponding paralogy/heterozygosity filter.
**Secondary benefit: access to the substitution's nature.** Because the
central base of an odd-k window is directly observable once the flanks are
confirmed conserved, this also yields more than a rate — the
transition/transversion split — enabling classical corrected distances
(Jukes-Cantor, Kimura 2-parameter, LogDet) that a single Jaccard scalar
cannot support.
## Statistic and correspondence with `shared`
A genomic position `p` is covered by `k` overlapping k-mer windows. Requiring
the substitution to sit at the window's **center** makes exactly one window
per SNP eligible — a 1:1 correspondence between SNP and center-neighbor k-mer
pair, avoiding the ~k-fold overcount of an any-position neighbor search.
A locus with a fully conserved `k`-window (flanks **and** center) is an
exact-shared k-mer at that locus; a locus with conserved flanks but a
substituted center is a "central SNP". Both count each locus exactly once, in
matching units:
```
p_hat[i,j] = SNP[i,j] / (SNP[i,j] + shared[i,j])
```
`p_hat` is `P(center substituted | 2m flanks conserved)`. `shared[i,j]` here
is **not** the general-purpose `shared_kmers` matrix used by Jaccard/Mash
(`--shared-kmers`, `BitPartials::partial_jaccard` /
`CountPartials::partial_threshold_jaccard`) — that matrix counts raw k-mer
identity with no per-genome copy-number constraint, whereas `p_hat`'s
denominator applies the eligibility rule defined below (raw or
paralogy-filtered). Both `SNP` and `shared` are accumulated by the same
sweep, from the same per-locus candidate set (source k-mer + 3 variants),
under the same eligibility rule — see "Locus eligibility" below, and
"Heterozygosity, ploidy, and consensus-assembly inputs" for why the
copy-number constraint matters and what it costs.
**Canonical invariance**: for odd k, the central position maps to itself under
reverse-complement (`m -> k-1-m = m`, base complemented). A transition maps to
a transition, a transversion to a transversion — the transition/transversion
split is well-defined in canonical space.
### Definitions: family, and the canonical form of a family
**Family.** The family of a k-mer `x` is the set of (up to) 4 k-mers sharing
`x`'s `2m` flanking bases, differing only at the central base `m`. Membership
is a property of the flank pattern, not of `x` itself: any of the 4 possible
central substitutions belongs to the same family.
**`central_canonical_neighbors()`** (`obikseq`, `CanonicalKmerOf::central_canonical_neighbors`)
generates all 4 members from any one of them (observed or not), each
independently canonicalised (`.canonical()`, i.e. `min(kmer, revcomp(kmer))`).
This independent canonicalisation is necessary because a central substitution
can flip which orientation is lexicographically smaller — two members of the
same family can end up canonicalised in *different* orientations. Despite
that, the **set** of 4 resulting canonical k-mers is invariant: calling
`central_canonical_neighbors()` on any member of a family — present in the
index or not — yields the same 4 values. This is relied upon throughout the
rest of this document.
**Canonical form of a family.** Because orientation can differ member to
member, "which of the 4 is the reference" cannot be defined relative to
*whichever member happened to be visited first*, nor relative to the
minorant (see below) — both are data-dependent (they depend on what is
actually observed), so using either as the reference would make the
reference itself vary depending on what happens to be present in a given
index. Instead: **the canonical form of a family is, by definition, the
member whose own central base — read in its own already-canonical
orientation — is `A`.** This is well-defined for every family, computed
purely from the flank pattern, whether or not that specific member (or any
member at all) is actually observed anywhere in the index. Concretely: call
`central_canonical_neighbors()` on any member (observed or not) to get the
family's 4 canonical forms; the one among them whose own centre nucleotide is
`A` is the family's canonical form. The other 3 (`C`, `G`, `T`) are labelled
relative to *that* fixed reference, not relative to the calling member's own
orientation.
**Consequence for the minorant.** With this fixed A-referenced labelling,
`minorant` (the smallest raw encoding among the family's *observed* members,
introduced further below) becomes directly computable rather than needing to
be tracked as extra state: regenerate the family's 4 canonical forms from
any member's own k-mer (cheap, no lookup), compare the raw encodings of
whichever are marked present, and take the smallest. No separate stored bit
is required — see Step 2b below, where this replaces the earlier
minorant-bit design.
## Locus eligibility: raw definition vs. paralogy filter
For each k-mer `x` observed in genome A (source, one MPHF slot; the 3
central-position variants generated as in the sweep below): check whether
A's locus (flanks fixed) is resolvable in genome B under one of the 4
central forms.
**Raw / no model.** The locus counts in the denominator iff at least one of
the 4 forms is present in B; it counts in the numerator iff the form found in
B differs from A's own. No constraint on A's or B's own copy number at this
locus. Open question, not resolved: what if **more than one** of the 4 forms
is present in B simultaneously (ambiguous target — count once arbitrarily,
count all, or drop)? The stringent filter below sidesteps the question by
construction rather than answering it.
**Stringent / paralogy-aware.** The locus counts only if exactly one of the
4 forms is present in A **and** exactly one is present in B (`count == 1` at
that slot too, when a count index is available, to also exclude same-allele
duplicates that presence alone cannot see). This drops the raw definition's
ambiguous-B case automatically, at the cost of also dropping heterozygous
sites indiscriminately alongside true duplications (see "Heterozygosity,
ploidy, and consensus-assembly inputs" below).
**Rejected: parsimony-based multiset pairing for multiplicity > 1.** Rather
than dropping ambiguous loci, pair identical alleles between A and B first
(0-mutation explanation preferred), then take `min(unmatched_A, unmatched_B)`
as inferred SNP pairs. Rejected on two grounds: (1) circularity — selecting
pairs by minimal apparent divergence, then measuring divergence on those same
pairs, deflates the estimate by construction, not a neutral heuristic; (2)
the discriminating signal is a single base among 4 possible values, and the
flanks are *already* guaranteed identical for every candidate by
construction (that is how the locus was selected) — no information remains
in a k-mer window to tell which copy in B truly corresponds to which copy in
A once multiplicity > 1 on either side. Any pairing rule invents a
correspondence the data cannot support. Multiplicity > 1 is treated as
non-identifiable, not as a puzzle to solve with a heuristic.
## Multi-genome framing: family as pseudo-alignment column
**Idea.** Instead of resolving locus eligibility and correspondence one
genome pair at a time, treat a family as a column of a pseudo multiple
alignment across *all* genomes simultaneously: for each family, each genome
has either a net single-copy state (`A`/`C`/`G`/`T`, when the genome carries
exactly one of the 4 forms) or "missing" (`?`, multi-copy or absent). Flank
conservation (the `2m` bases fixed by construction) supplies positional
homology for free — the same role a real MSA would play, without alignment
software, gap penalties, or progressive-alignment approximations. Stacking
one such column per family, genomes as rows, produces a genuine SNP
pseudo-alignment matrix, not just a bag of pairwise distances.
**Precedent.** This is the same principle behind reference-free
k-mer-based phylogenomics tools — SKA (Split K-mer Analysis, Harris 2018) and
kSNP: split the k-mer around a variable center, use flank identity to call
homologous columns across arbitrarily many genomes with no reference and no
MSA step, then feed the resulting pseudo-alignment to standard phylogenetic
tools. Landing on the same design independently is a good sign, not a
coincidence.
**Resolves the pairwise-correspondence problem, properly.** The "Rejected:
parsimony-based multiset pairing" case above failed because, with only two
genomes' cardinalities to look at, there is no external constraint to justify
picking one correspondence between leftover alleles over another — `min(a,b)`
is a lower bound dressed up as a point estimate (see the follow-up discussion
on Felsenstein-style parsimony inconsistency: minimum-event explanations are
systematically biased low whenever homoplasy/multiplicity is real, not
noise-cancelling). With `N` genomes and many families jointly, the same
question can be answered the way real phylogenetics answers it: ancestral
state reconstruction / ML mapping over a tree estimated from the whole
column set. The tree supplies the missing constraint that two isolated
columns cannot — this is the principled way out, not a heuristic replacement
for one.
**Relation to what's already implemented.** `KmerIndex::raw_snp_distance`
already computes, internally, per family, exactly this row — `single_form:
Vec<Option<u8>>`, one entry per genome, `None` where ambiguous/absent —
before immediately collapsing it into pairwise `snp[i,j]`/`shared[i,j]`
tallies. The pivot this section proposes is small at the implementation
level: stop collapsing early, and surface the per-family row as a first-class
artifact (a `families x genomes` matrix). Pairwise raw p-distance becomes one
projection of that matrix (what's computed today), not the primary object;
downstream, the matrix itself could feed real phylogenetic tools (parsimony/
ML, e.g. RAxML/IQ-TREE-style) instead of only NJ/UPGMA on a homemade
pairwise-distance matrix.
**Caveat: column completeness shrinks with `N`.** The probability that a
family's flanks stay intact simultaneously across all `N` genomes decays with
`N` (same ascertainment-bias mechanism as Bias 1 above, compounded over more
genomes) — fully-resolved columns (no `?` anywhere) become rare as more
genomes are added. Same missing-data situation any real multi-species
alignment faces, and phylogenetic tools already handle it well; the practical
implication is that columns should be allowed partial coverage (>=2 resolved
genomes, not unanimous) rather than requiring every genome to be net
single-copy at that locus.
## Heterozygosity, ploidy, and consensus-assembly inputs
A within-genome multiplicity signal (more than one of the 4 central forms
present at a locus) is produced identically by two distinct causes:
paralogous duplication and diploid/polyploid heterozygosity. K-mer data alone
cannot distinguish them. The one real discriminator is sequencing depth
(heterozygous site: total depth of the present forms ~= the genome's
single-copy average; duplication: ~2x or more) — but that signal only exists
if genome "counts" are raw-read depth (FASTQ input), not occurrence counts in
an assembled FASTA, where per-locus depth is not preserved.
**Magnitude is taxon- and mating-system-dependent, not universal.**
Heterozygosity density: mammals ~1 site / 1-1.5 kb (~0.1%); highly
outcrossing plants (maize, poplar) reported an order of magnitude higher
(~1%); self-fertilising plants (*Arabidopsis thaliana*) near zero — but with
a documented failure mode where segmental duplication masquerades as
"pseudo-heterozygosity"; fungi split between haploid vegetative stages
(non-issue) and dikaryotic Basidiomycetes, where two long-diverged haploid
nuclei coexist without fusing. The estimator's target use case (closely
related genomes, k=31) is exactly where the stringent filter above costs the
least for low-heterozygosity taxa and the most for outcrossing/dikaryotic
ones — no universal threshold; this is a scope caveat to document, not a
problem to solve generically.
**Why assembled-consensus inputs don't make measured distances wrong.**
Phylogenetic inputs are near-universally assemblies, not raw reads, and
assemblers collapse heterozygous sites to one consensus allele per
position — effectively an arbitrary, largely uncorrelated-between-assemblies
choice at each het site. This does not inject unbounded noise: standard
population genetics gives `d_xy = d_a + (pi_A + pi_B)/2` — the expected
pairwise difference between a random allele of population A and a random
allele of population B equals the net (fixed) divergence `d_a` plus the
average of the two populations' own within-population diversity `pi`.
Consensus flattening realises exactly this random-allele draw, so the
measured genome-to-genome distance is a `d_xy`-like quantity, not `d_a`
inflated by heterozygosity by a well-characterised additive term, not
distorted unpredictably. The term is negligible when `pi << d_xy` (the common
case for cross-species comparisons), and becomes material precisely in the
two cases already flagged above: very closely related genomes (this
estimator's explicit target) and highly heterozygous outcrossing organisms,
where `pi` and `d_xy` are the same order of magnitude.
Caveat: this assumes the flattening is uncorrelated with the phylogenetic
signal — plausible for de novo assembly, not guaranteed for reference-guided
assembly biased toward one allele (e.g. the reference's) at each het site,
which would turn the noise term into a systematic bias toward the reference
lineage. Not evaluated here.
**Forward-looking implication, not part of the current design.** The
multiplicity > 1 signal discarded by the stringent filter is a crude
per-genome proxy for `pi` (under low background paralogy). If a `pi_hat` per
genome were tallied alongside `SnpTally`, a `d_a` correction
(`p_hat - mean(pi_hat_i, pi_hat_j)/2`, roughly) could recover an estimate
closer to net divergence instead of `d_xy` — a possible extension, not
scoped here.
## Sufficient statistic: 4x4 base-pair tally
Tabulating the joint distribution of `(center_i, center_j)` over conserved-flank
loci, per genome pair, is sufficient for every downstream correction:
| Estimator | Input | Formula |
|---|---|---|
| Raw p-distance | total off-diagonal / total | `p = SNP / (SNP + shared)` |
| Jukes-Cantor | p | `d = -3/4 * ln(1 - 4p/3)` |
| Kimura 2-parameter | transition rate P, transversion rate Q | `d = 1/2 ln(1/(1-2P-Q)) + 1/4 ln(1/(1-2Q))` |
| LogDet/paralinear | full 4x4 + base-composition margins | `d ~= -1/4 ln det(F)`, robust to non-stationary base composition |
JC/K2P need only the total and the transition/transversion split (the
diagonal collapses to a single "shared" total). LogDet needs the full 4x4,
already populated at no extra cost (see Step 1/2 below).
Memory for the 4x4 tally: `n^2 * 16` counters. Trivial for the project's
genome-scale use case (tens to hundreds of genomes); ~13 GB at n=10^4 — outside
scope but worth flagging if n grows.
## Biases (properties of the estimator, not defects)
1. **Conserved-flank ascertainment bias.** Only SNPs with intact `2m`-base
flanks are visible; window-intact probability decays as `(1-p)^{2m}`. For
k=31 (2m=30): 0.74 at p=1%, 0.21 at p=5%, 0.04 at p=10%. This estimator
targets **closely related genomes**. Under rate heterogeneity across sites
(universal in practice), conserved flanks correlate with slow centers, so
`p_hat` underestimates the genome-wide average rate — it specifically
estimates the substitution rate of **conserved regions**.
Two distinct factors are at play here, not one: `P(centre of a given
window is a SNP) = p` exactly, **independent of k** — a direct restatement
of the raw per-site rate via the bijective window<->centre-position
correspondence (Statistic section above), not a k-dependent quantity.
`(1-p)^{2m}` is the *separate*, genuinely k-dependent ascertainment factor
(are the flanks also intact). The two multiply:
`P(usable window showing a central SNP) = p * (1-p)^{2m}` — e.g. at
p=1/31 (~3.2%), k=31: `p * (1-p)^30 ~= 0.0323 * 0.374 ~= 1.2%`, i.e. about
1 window in 83, not 1 in 31 (which is only the centre-mutated fraction,
before requiring intact flanks).
2. **Bias toward isolated SNPs.** Two SNPs within k of each other disqualify
each other's flanks. Hypervariable regions are invisible by construction.
3. **Indels are invisible.** A frameshift destroys k-mer matches in a block;
this channel captures substitutions only. Indel divergence shows up as lost
shared k-mers (lower Jaccard/Mash), not as SNP signal.
4. **k-dependent specificity.** "A k-mer match implies common ancestry" is
quantitative. For a 3 Gbp genome, expected random flank-30 collisions
(k=31): `(3e9)^2 / 4^30 ~= 8` — negligible. At k=21: `(3e9)^2 / 4^20 ~= 2e6`
— no longer negligible. k=31 is safe; k<=21 is marginal to unreliable for
large genomes. The large k that guarantees homology is the same k that
shrinks the detectable-divergence window — an inherent tension.
## Implementation: avoid materializing a de Bruijn graph
A central-SNP pair is topologically a simple bubble in the colored de Bruijn
graph (source/sink k-mer shared, two length-k branches differing only at the
midpoint). Classical bubble-calling (Cortex/discoSNP-style) finds these, but
requires the graph — nodes plus adjacency for ~10^9 colored k-mers — resident
in memory. **Rejected**: prohibitive RAM for this project's scale.
A naive per-pair generalisation of variant lookup across n genomes (query each
non-shared k-mer's 3 central variants against every counterpart genome's
index) costs `O(n^2 . N . 3)` random lookups, with the same k-mer's 3 variants
regenerated and requeried once per counterpart genome — pure redundant work.
**Rejected** as the basis for an n-genome design.
## Implementation: sequential per-partition sweep (no scratch, no graph)
`KmerIndex::distance()` already opens every partition's `presence_store`/
`count_store` simultaneously, memory-mapped, into one `LayeredStore`
(`distance.rs:73-77`). "Querying another partition" is therefore not a new
I/O pattern to design — it is the same O(1) MPHF+evidence lookup the `query`
command already performs at scale. This lets the SNP tally be computed with
**no scratch files and no auxiliary graph**, by sweeping partitions once each
as a source:
1. For source partition `p`, enumerate its **distinct** k-mers (one per MPHF
slot; each already carries its full multi-genome presence/count vector —
no need to explode per (k-mer, genome) occurrence).
2. For each, generate the 3 central-substitution variants and **canonicalise
each independently** (`min(kmer, revcomp)`, exactly as any normal query) —
this avoids the orientation edge case a masked-flank grouping would have
(a substitution that flips canonical orientation is handled correctly
because each variant is canonicalised on its own, not inferred from a
fixed-orientation flank key).
3. Compute each variant's target partition `q` via its minimizer; batch/sort
the partition's outgoing variant queries by `q` for locality.
4. Look up each variant in `q`'s already-mmap'd MPHF+evidence; on a hit,
combine the source's presence vector (base `a`) with the variant's
presence vector (base `b`): for every `i` carrying `a` and `j` carrying
`b`, `tally[i,j][a,b] += 1`.
**Deduplication needs no persisted state.** Sweeping partitions in a fixed
order `p = 0, 1, ..., P-1` and only acting on a variant when its target
partition `q >= p` guarantees each unordered SNP pair is counted exactly
once: a pair with `q < p` was already resolved earlier, when `q` was itself
the source partition and `p` (being `>= q`) was a valid forward target. No
cross-partition flag array is needed — the sweep order *is* the
deduplication rule. Within the same partition (`q == p`), a lightweight
transient tie-break suffices: either a `#slots(p)`-bit scratch flag reset per
partition, or simply comparing the two k-mers' raw `u64` encodings and only
counting when `kmer_source < kmer_variant` — no storage at all.
This is a distinct computation stage, not a `partial_*` in the existing
additive-by-partition sense: step 3-4 read across partition boundaries by
construction, unlike the row-local `partial_jaccard`/`partial_threshold_jaccard`
primitives. But it requires no new index files, permanent or scratch:
`unitigs.bin`, `mphf.bin`, `evidence.bin`, and the presence/count columns are
read as-is, and the only extra memory is the current partition's small
outgoing-query batch (`#kmers(p) * 3`, released once `p` is done) plus the
persistent `tally` accumulator (`n^2 * 16` counters, see above).
**Outer loop (over source partitions `p`) must stay sequential.** Two
independent reasons, not just one: (a) memory — the bounded-footprint claim
above only holds with one partition's outgoing-query batch in flight; running
`T` source partitions concurrently multiplies that batch by `T`, exactly the
blowup the design avoids; (b) correctness — the `q >= p` deduplication rule
requires partitions to be claimed as sources in a fixed order; running `p1 <
p2` concurrently gives no guarantee `p1` has finished claiming its `q >= p1`
targets before `p2` starts claiming its own, breaking the "counted exactly
once" property.
**Inner loop (target-partition lookups for a fixed `p`) parallelises safely.**
Each lookup is an O(1) read against an already-mmap'd structure, independent
of the others, with no growing allocation — no memory blowup, no ordering
dependency between different `q`. The only shared mutable state is `tally`;
give each worker thread a **thread-local partial tally** (fixed `n^2 * 16`
size, independent of partition size) and merge into the global `tally` once
`p`'s inner loop completes — the same reduce-then-merge pattern Rayon already
uses elsewhere in this codebase to open partitions in parallel. Extra memory:
`#threads * n^2 * 16`, negligible (~512 MB at n~1000, 32 threads) and
unrelated to partition size.
**Cost**: `3 * N_distinct` MPHF lookups total across the whole index (each
partition swept once as source) — the same order of magnitude and the same
operation as running `query` over the index's entire k-mer content against
itself, three times. This is the tool's already-optimized regime, not a new
I/O profile to validate.
## Cheaper: subsampling
Since the target is a ratio, restricting the source-partition sweep to a
bottom-`s` hash sketch (only enumerate k-mers with `hash < threshold` as
sources) divides the lookup count by the sampling factor without biasing
`p_hat`. Mash-like tradeoff: rate estimated from a sample, not the full
k-mer set.
## Recommendation
Sequential per-partition sweep (Route D): reuse the already-mmap'd
per-partition MPHF/evidence/presence structures for O(1) variant lookups,
dedup via the fixed sweep-order rule (`q >= p`, plus an in-partition
tie-break), no scratch files, no graph materialisation. Both the SNP
(off-diagonal) and shared (diagonal) counts are accumulated by this same
sweep, under the locus-eligibility rule chosen (raw or paralogy-filtered) —
not reused from the general-purpose `shared_kmers` matrix, whose raw-identity
definition does not apply the same copy-number constraint. Distances (p, JC,
K2P, LogDet) as finalisations of the resulting 4x4 tally, mirroring the
`partial_* -> *_dist_matrix` pattern used for Jaccard/Mash/Bray-Curtis/etc.
## Detailed implementation plan
Grounded in the current codebase. File/type references are anchors, not
prescriptions; adjust to reality when implementing.
### Step 0 — new low-level primitives (`obikseq`)
Two helpers do not yet exist and are prerequisites:
1. **Central neighbours.** `CanonicalKmerOf<L>` already exposes
`left_canonical_neighbors()` / `right_canonical_neighbors()`
(`obikseq/src/kmer.rs`), each returning the 4 canonicalised neighbours at
an end position. Add `central_canonical_neighbors()` returning the 4
variants at position `m = (k-1)/2` (each independently canonicalised via
`.canonical()`). The 3 that differ from the source are the query variants;
skip the identity. Building on `nucleotide(i)` / the raw 2-bit layout keeps
it O(1).
2. **Lone-k-mer minimiser.** Routing a *synthetic* variant to its partition
needs its minimiser, but `RollingStat` (`obiskbuilder/src/rolling_stat.rs`)
only computes minimisers incrementally along a sequence. Add a standalone
`minimizer(kmer) -> Minimizer` that scans the `k-m+1` m-mer windows
(`PackedSeq::mmer`, `obikseq/src/packed_seq.rs`), canonicalises each, and
takes the min by `seq_hash()` — the same selection `RollingStat` performs,
evaluated once. Partition index is then
`(minimizer.seq_hash() & (n_partitions - 1)) as usize`, exactly as
`QueryBatch::from_records` (`obikmer/src/cmd/query.rs:142`); `n_partitions`
is a power of two so the mask is valid.
### Step 1 — the tally accumulator (`obikindex`)
A `SnpTally` holding, per genome pair, the 4x4 joint count of central bases:
`n * n * 4 * 4` `u64` (or a packed lower-triangular form since it is
symmetric). Provide `merge(&mut self, other: &SnpTally)` for the thread-local
reduce, and accessors yielding, per pair `(i,j)`: total off-diagonal (SNP),
diagonal (shared, i.e. `p_hat`'s denominator minus SNP), transition count
`P`, transversion count `Q`. The diagonal is always populated — it is not an
optional LogDet-only extra, since `p_hat`'s denominator is no longer sourced
from the external `shared_kmers` matrix (see "Locus eligibility" and
"Statistic and correspondence with `shared`" above): the source k-mer's own
presence/count vector, already in hand when it is enumerated, supplies the
diagonal entry directly, at no extra lookup cost.
### Step 2 — the sweep (`obikindex`, new `snp.rs`)
Mirror `distance.rs`: open the presence or count store per partition. But
instead of a per-partition `partial_*`, run the sequential source sweep:
```text
for p in 0..n_partitions: # OUTER — sequential
open source partition p's layers (QueryLayer-style, obikpartitionner)
enumerate distinct canonical k-mers of p (one per MPHF slot) with their
presence/count vectors # column-major, as query stage 2
par_iter over these source k-mers: # INNER — rayon, thread-local tally
apply eligibility rule to the source's own vector (raw: none; # diagonal
stringent: exactly one of the 4 forms present in each genome) # gate
for i in genomes eligible with source base a:
for j in genomes eligible with source base a:
thread_tally[i,j][a,a] += 1 # diagonal — no extra lookup
for each of the 3 central variants:
q = partition_of(variant)
if q < p: continue # dedup: forward targets only
if q == p and variant <= source.raw(): continue # in-partition tie-break
slot = layers[q].find_slot(variant) # MphfLayer::find, mmap'd
if hit:
vb = variant presence/count vector
apply eligibility rule to vb (as above)
for i in eligible genomes with source base a:
for j in eligible genomes with variant base b:
thread_tally[i,j][a,b] += 1
merge thread-local tallies into global SnpTally
```
The inner lookup is precisely `QueryLayer::find_slot` +
`col_value(g, slot)` (`obikpartitionner/src/query_layer.rs`) — reuse or factor
out that path rather than reimplementing MPHF access. Enumerating "all distinct
k-mers of a partition with their vectors" is the `dump`/`query` stage-2
column-major scan already implemented in `dump_layer.rs` /
`query_partition_with`; factor a reusable iterator if none fits.
`presence_threshold` applies exactly as elsewhere: a genome "carries base b"
iff its count at that slot is `>= presence_threshold` (trivially `>= 1` for
presence indexes).
### Open problem (unresolved, session end — not yet fully convinced)
The `q >= p` / tie-break dedup rule in Step 2's pseudocode above is **flawed**
for the stringent (paralogy-filtered) eligibility rule: it only ever brings
two family members into view at once (the source and one looked-up variant),
never all four simultaneously, and which subset gets compared depends on
partition sweep order. "Exactly one of the 4 forms present in genome A" is a
whole-family property and cannot be decided correctly from a sequence of
pairwise, order-dependent glimpses — the pseudocode above needs revision, not
just the eligibility gate bolted onto it as written.
Direction discussed, **not yet settled**:
1. **Every distinct source k-mer looks up all 3 variants unconditionally**
(drop the `q < p` skip entirely) so that every observed family member
independently gathers all 4 vectors (its own + whichever of the 3
variants exist) at once — a whole-family, order-independent view, computed
redundantly once per observed member. Same total lookup order of
magnitude as already budgeted (`3 * N_distinct`), just organised
differently (no lookup actually skipped, versus the original rule which
skipped roughly half).
2. **Tie-break after gathering, not before**: only the member whose own
canonical encoding is the smallest *among the members actually observed*
(now known, since all were just looked up) writes to `SnpTally`; the
others silently discard their redundant computation. Deterministic,
order-independent — as a side effect this also removes the "outer loop
must stay sequential" constraint from the cost/parallelism discussion
above, since no step depends on partition processing order any more.
3. **Proposed optimisation**: precompute, once at index build time, a
compact global (not per-genome) annex per MPHF slot — the count of
*other* family members observed anywhere in the dataset (0-3). Slots with
count 0 (majority under low divergence and few genomes, but see the
scaling caveat below) need no cross-lookup at all: eligibility reduces to
a local `count == 1` check at that single slot, and only slots with count
>= 1 enter the 3-lookup sweep machinery above. Revised (see Step 2b
below): minorant status *is* stored alongside the count after all, on 3
bits rather than 2 — it comes for free from the same lookups needed to
count siblings, and storing it lets the sweep discard non-minorant slots
without re-fetching anything.
**Minorant/sibling-count relationship, worked out precisely.** "Minorant" is
a one-way implication from sibling count, not an equivalence: `0 siblings
=> minorant` (trivially — with no other observed member, the k-mer is by
definition the smallest of the observed set, itself alone), and its
contrapositive `not minorant => >= 1 sibling`. The converse does not hold:
being the minorant says nothing about sibling count — a minorant can have 0,
1, 2 or 3 siblings, all with larger encodings than itself. Consequence: this
confirms, as a logical necessity rather than a heuristic, that a 0-sibling
slot can always write its diagonal contribution with zero ambiguity and no
lookup (it is unconditionally its own minorant) — but it gives no shortcut
for the >= 1-sibling case, where minorant status still requires the actual
comparison of gathered encodings; sibling count alone never determines it.
**When to compute the annex, and cache invalidation.** Sibling count is a
property of the whole set of columns (genomes/groups) currently in the
index, not of any single genome — it cannot be computed correctly at
mono-genome build time (a family may gain siblings, or its minorant may
change, once more genomes are merged in later). Computing it eagerly at
every `merge` would also waste work on intermediate merged states nobody
ever queries. Instead: compute it lazily, on first `distance` call against a
given index, and persist the result alongside that index for subsequent
calls — the same lazy-derived-cache pattern `PersistentBitMatrix` already
uses for `Columnar` -> `Packed`. This requires no explicit invalidation for
`merge` or `filter` (`obikindex/src/merge.rs`, `obikmer/src/cmd/filter.rs`):
both only ever write to a fresh `--output` directory, never mutate an input
index in place, so a re-merged/re-filtered index is simply a new state with
no annex yet. `select --in-place` (`select_layer.rs:139-235`) is the
exception: it aggregates genome columns into groups (Any/All/None/Sum/Min/
Max) by mutating the existing index's files without changing its location.
It does not remove k-mer rows, but it can still change eligibility and
sibling counts derived from those rows (e.g. a `Sum` over several
single-copy genomes can read as multi-copy at the group level). Because it
mutates in place, **`select --in-place` must explicitly invalidate (delete
or mark stale) any cached sibling-count annex for that index** — the one
operation in the current pipeline where this doesn't happen for free.
Not yet convinced this is the right shape, and Step 2's pseudocode above has
not been rewritten to match — flagged for the next pass rather than resolved
here.
### Step 2b — sibling-count / minorant annex (consolidated plan)
Scope: only the precursor annex — not the SNP tally itself, whose Step 2
sweep remains unresolved above. This piece is simpler than the sweep,
because it writes to an independent per-slot value, not a shared
cross-k-mer accumulator, so it needs no dedup/ownership logic at all at this
stage.
**Revised annex encoding — 4-bit presence mask, not 3-bit (minorant +
count).** Superseded after settling the "canonical form of a family"
definition above. The 3-bit design (1 minorant bit + 2-bit sibling count,
§ below, kept for the historical record) had two problems: it discards
*which* variants are present (only how many), so any future consumer
(the SNP sweep, or a stats pass — see below) that needs to know which bases
exist still has to regenerate and blindly re-query all 3 candidates; and
the minorant bit's meaning was tied to whichever member was visited, not to
a fixed reference. Storing instead a **4-bit mask** — one bit per base
(A/C/G/T), set iff that member of the family (labelled relative to the
family's fixed canonical form, i.e. the member with `A` at the centre — see
above) is observed anywhere in the index — fixes both:
- **Sibling count is derived, not stored**: `siblings = popcount(mask) - 1`.
- **Minorant is derived, not stored**: regenerate the family's 4 canonical
forms from the slot's own k-mer (cheap, no lookup — see above), compare
the raw encodings of whichever bits are set in the mask, take the
smallest.
- **A future consumer knows exactly which variants to (re-)query** —
`popcount(mask) - 1` lookups instead of always 3, and it knows *which*
3 (or fewer) to issue, not just how many hits to expect.
- The all-zero value (no base present at all) is still logically
unreachable as a real result — the slot's *own* base is always present in
its own family — so it remains available as a free "not yet computed"
sentinel, exactly as before.
1. **Primitive.** Reuse `central_canonical_neighbors()` from Step 0
unchanged — the 3 canonicalised central-substitution variants of a k-mer
(plus the identity, i.e. all 4 members of the family — see "Definitions"
above).
2. **New annex type** (`obicompactvec`, alongside `bitmatrix.rs`): a 4-bit-
per-slot packed array (the presence mask above), one per partition — same
on-disk shape family as `PersistentBitMatrix`'s `Packed` variant, but
simpler (no per-genome columns, a single derived read-only value per
slot).
<details><summary>Superseded 3-bit design (historical)</summary>
3 bits, storing minorant status alongside sibling count directly, since
it came for free from the same lookups (point 3 below) — 5 real states
(not-minorant; minorant with 0/1/2/3 siblings) fit in 3 bits (8 states,
3 unused). This let the future SNP sweep discard a non-minorant slot
instantly, with no lookup at all. The otherwise-unreachable combination
"not-minorant + 0 siblings" (0 siblings always implies minorant) doubled
as the "not yet computed" sentinel. Replaced by the 4-bit mask above,
which subsumes this benefit (minorant still derivable, now for free at
read time rather than stored) while also fixing the "which variant"
blindness.
</details>
3. **Computation pass** (`obikindex`, new `siblings.rs`): **one
`obipipeline` run per layer, iterated sequentially over the index's
layers** — settled after two false starts, worth recording both.
- *False start 1*: "fully parallel over every partition/slot at once,
no ordering at all". Correctness is fine with this (sibling count and
minorant are order-independent, unlike the old `q >= p` dedup they
replace), but it reintroduces, at a larger scale, exactly the
memory-blowup the original Step 2 sweep's sequential-outer-loop
constraint existed to prevent: scattering every source partition at
once multiplies the in-flight outgoing-query volume by the number of
partitions.
- *False start 2*: push the layer loop itself into the pipeline (source
= the index's layers, a first `Flat` stage expands each layer into
its k-mers). `obipipeline`'s scheduler already bounds memory on its
own — it dispatches every item through a **shared** worker pool at
each stage boundary (`scheduler.rs:217-372`, `dispatch()` into a
common `worker_tx` queue, any free worker picks up any pending item;
not "one worker owns a chunk end to end"), with a biased `Select`
that prioritises draining items already advanced in the chain over
admitting new source items (`scheduler.rs:271-282`: stage results
outrank the source, "vider le pipeline en priorité" / "dernier
recours" for new data) — so bounded channel `capacity` plus this
drain-first bias already caps in-flight work without any external
sequential discipline. Correct, but it means k-mers from several
layers can be completing concurrently, so the sink would need to
track several open per-layer annex-file writers at once — real,
avoidable complexity.
- **Settled design**: keep the layer loop external and sequential —
not for memory (the pipeline's own `capacity`/priority mechanism
already provides that, for free, regardless), but so each pipeline
run's sink targets exactly one layer's annex file, no concurrent
multi-writer bookkeeping. Per layer: source = that layer's distinct
k-mers; a `Flat` (1->N) stage generates the 3 central variants of a
k-mer, each tagged with its origin (local slot); a transform stage
routes each variant to its target partition (unchanged per-k-mer
minimiser); a transform stage performs the lookup (existence-only —
`find_slot` hit/miss, cheaper than the SNP sweep's full column
fetch); a final stage/sink folds each answer into its origin's
running state (below) and, once a layer's k-mers are all resolved,
flushes the completed array to that layer's annex file. Many small,
single-purpose stages on purpose, to let the scheduler interleave
them finely across many in-flight items — this deliberately does
**not** mirror how `obipipeline` is used elsewhere today: `query.rs`'s
`process_chunk` lumps parse+route+query+serialise into one closure
(`query.rs:325,743-758`), and `scatter.rs` only pipelines file-
reading/superkmer construction, routing partitions afterwards in a
plain sequential loop (`KmerPartition::write_batch`,
`partition.rs:140`) — both under-use the fine-grained scheduling the
mechanism offers, so they are not precedents to copy, only existing
(and arguably improvable, out of scope here) usages. Cross-partition
lookups (querying another layer's MPHF for a variant) remain
necessary as before — only the *output* side is kept single-layer.
- **Reconciliation**: processed at the granularity of one *answer batch
per destination partition*, not one source k-mer at a time — this is a
proper shuffle, not a per-k-mer wait. Each source partition `p` holds a
small array of running states `(minorant = true, siblings = 0)`, one
per local slot, initialised at scatter time and **persisting across
however many destination-partition batches answer it** (up to 3, one
per variant, not necessarily all from the same `q`). Every scattered
query carries an origin tag (source partition + local slot) so its
answer can be routed back. When target partition `q` returns its batch
(all answers for every query that named `q`, regardless of which source
k-mer or which source partition they came from), that batch is walked
once, locally, and each answer updates — via its origin tag — the
matching entry in *its* source partition's array: a miss changes
nothing; a hit does `siblings += 1`, and if the found sibling's own
encoding is smaller than the source's, `minorant = false`. A given
source k-mer's state is final only once every destination batch
concerning it has been folded in; its partition's array is flushed to
the persistent annex once complete. Commutative per entry, so the order
in which destination batches arrive and get folded in doesn't matter.
**Open optimisation, not adopted yet — real tradeoff, not a free win.**
Since looking up sibling `y` from `x`'s visit already yields everything
needed to fill `y`'s own annex entry too, one visit per *family* could in
principle replace one visit per *observed family member* — cutting this
pass's cost roughly by the average family size instead of paying
`3 * N_distinct` regardless. But it means threads processing different
source k-mers can end up writing the *same* sibling's slot concurrently —
the fully independent, ownership-free parallelism of the plan above is
deliberately traded away for this gain. It stays safe only because the
computed value for a given slot is deterministic regardless of who
computes it, so redundant concurrent writes converge to the same
value — correct as long as each write is atomic, no locking needed — but
it is a real design complexity increase over "every member redoes its
own 3 lookups independently," not a strict improvement to adopt by
default.
4. **Trigger and caching** (`obikindex::KmerIndex`/`distance.rs`): compute
lazily on first `distance` call for an SNP-family metric against a given
index; check for an existing annex file first (mirrors
`PersistentBitMatrix::open()`'s auto-detect-and-fall-back,
`bitmatrix.rs:264-287`); if absent, run step 3 and persist; if present,
mmap and reuse.
5. **Invalidation.** `merge` and `filter` always write to a fresh `--output`
directory (`obikindex/src/merge.rs`, `obikmer/src/cmd/filter.rs`) so a
re-merged/re-filtered index simply has no annex yet — nothing to
invalidate. `select --in-place` (`select_layer.rs:139-235`) mutates
columns of an existing index without changing its location, which can
change sibling counts without removing rows — it must explicitly delete
any cached annex for that index as part of its in-place rewrite.
6. **Testing**: hand-built tiny indexes with known sibling counts (0-3);
order-independence (recompute twice on a static index, identical
result, given the fully-parallel no-ownership design); invalidation
(annex absent/correctly recomputed after `select --in-place`); once
Step 2's sweep is fixed, a regression check that sibling_count == 0
slots are never looked up cross-partition during the sweep.
Cost: `3 * N_distinct` existence-only lookups, computed once per index
state and amortised over every subsequent `distance` call that reuses the
cached annex — cheaper per-lookup than the sweep itself (hit/miss only, no
column fetch).
### Step 3 — finalisation (`obikindex`)
From the global `SnpTally` alone (diagonal and off-diagonal both populated by
the sweep, see Step 1/2 — no dependency on the external `shared_kmers`
matrix), derive n x n distance matrices, each a pure function of the
accumulated counts (same shape as `jaccard_to_mash`):
- `p_hat[i,j] = SNP / (SNP + shared)`
- Jukes-Cantor, Kimura-2P (from `P`, `Q`), optionally LogDet (needs the
diagonal + base-composition margins).
Guard the singularities (`p >= 3/4` for JC, `1-2P-Q <= 0` or `1-2Q <= 0` for
K2P) by clamping to a max distance, as `jaccard_to_mash` clamps `J <= 0`.
### Step 4 — surfacing (`obikindex` + `obikmer` CLI)
These metrics do not fit `DistanceMetric`'s current `LayeredStore`-partial
dispatch (they need the cross-partition sweep and produce a different
intermediate). Two options, to decide:
- **(a)** New `DistanceMetric` variants (`Pdistance`, `JukesCantor`,
`Kimura2P`, `LogDet`) whose `KmerIndex::distance` arm calls the sweep
(`snp.rs`) instead of the partial path, still returning `DistanceOutput`.
Keeps one CLI surface (`--metric jukes-cantor`), at the cost of a branch in
`distance()` that ignores the `LayeredStore` it built.
- **(b)** A dedicated pathway (`KmerIndex::snp_distance`) and a distinct CLI
entry, if mixing a cross-partition sweep into the partition-local `distance`
command is judged architecturally muddy.
Recommendation: (a) for user ergonomics (all pairwise distances under
`distance`, all feeding NJ/UPGMA/`--shared-kmers` unchanged), but compute the
sweep lazily only when an SNP-family metric is requested, so the existing
metrics keep their partition-local fast path untouched.
### Step 5 — subsampling flag
Add `--snp-sample <fraction>` (or a bottom-`s` hash threshold): restrict the
source-k-mer enumeration in Step 2 to `seq_hash(kmer) < threshold`. Divides
lookups proportionally; `p_hat` is unbiased. Off by default (exact).
### Testing
- **Primitive unit tests**: `central_canonical_neighbors` on hand-checked
k-mers incl. palindrome-boundary cases; lone-k-mer `minimizer` against
`RollingStat`'s incremental result on the same k-mer.
- **End-to-end tiny index**: two 1-genome indexes differing by a handful of
known isolated SNPs (transitions and transversions placed by hand), assert
exact `SNP`, `P`, `Q` counts and the resulting JC/K2P values.
- **Dedup invariant**: assert the tally is identical regardless of genome/
partition order and that no pair is double-counted (compare against a
brute-force all-pairs reference on a small index).
- **Subsampling**: `p_hat` within sampling error of the exact run.
### Suggested phasing
1. Step 0 primitives + their unit tests (self-contained, no distance wiring).
This also unblocks the long-declared-but-unimplemented `query --mismatch`
(`obikmer/src/cmd/query.rs:676`, currently a warning), which needs the same
neighbour + routing machinery.
2. `SnpTally` + finalisation math with a brute-force (non-swept) reference
backend, validated on a tiny index.
3. The real per-partition sweep (Step 2) behind the same finalisation; assert
it matches the brute-force backend.
4. CLI surfacing (Step 4a) and NJ/UPGMA integration (already generic over the
matrix).
5. Subsampling (Step 5).
## References
The Mash mutation-rate model this discussion contrasts with:
[@Mash-distances-doc; @Fan2015-mash-formula].
+1
View File
@@ -36,6 +36,7 @@ nav:
- Entropy filter: theory/entropy.md - Entropy filter: theory/entropy.md
- Minimizer selection: theory/minimizer.md - Minimizer selection: theory/minimizer.md
- Partitioning architecture: theory/indexing.md - Partitioning architecture: theory/indexing.md
- Central-position SNP distance (discussion): theory/evolutionary_distances.md
- Implementation: - Implementation:
- SuperKmer: implementation/superkmer.md - SuperKmer: implementation/superkmer.md
- Kmer: implementation/kmer.md - Kmer: implementation/kmer.md
+15 -1
View File
@@ -1682,6 +1682,13 @@ dependencies = [
"xxhash-rust", "xxhash-rust",
] ]
[[package]]
name = "obikentropy"
version = "0.1.0"
dependencies = [
"obikseq",
]
[[package]] [[package]]
name = "obikindex" name = "obikindex"
version = "0.1.0" version = "0.1.0"
@@ -1694,17 +1701,21 @@ dependencies = [
"obikpartitionner", "obikpartitionner",
"obikseq", "obikseq",
"obilayeredmap", "obilayeredmap",
"obipipeline",
"obiread",
"obiskbuilder",
"obiskio", "obiskio",
"obisys", "obisys",
"rayon", "rayon",
"serde", "serde",
"serde_json", "serde_json",
"tempfile",
"tracing", "tracing",
] ]
[[package]] [[package]]
name = "obikmer" name = "obikmer"
version = "1.1.37" version = "1.1.40"
dependencies = [ dependencies = [
"clap", "clap",
"csv", "csv",
@@ -1742,6 +1753,7 @@ dependencies = [
"niffler 3.0.0", "niffler 3.0.0",
"obicompactvec", "obicompactvec",
"obidebruinj", "obidebruinj",
"obikentropy",
"obikrope", "obikrope",
"obikseq", "obikseq",
"obilayeredmap", "obilayeredmap",
@@ -1824,7 +1836,9 @@ dependencies = [
name = "obiskbuilder" name = "obiskbuilder"
version = "0.1.0" version = "0.1.0"
dependencies = [ dependencies = [
"criterion2",
"lazy_static", "lazy_static",
"obikentropy",
"obikrope", "obikrope",
"obikseq", "obikseq",
"obiread", "obiread",
+1 -1
View File
@@ -1,5 +1,5 @@
[workspace] [workspace]
resolver = "3" resolver = "3"
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy"] members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy", "obikentropy"]
[profile.release] [profile.release]
debug = 1 debug = 1
+2
View File
@@ -7,6 +7,7 @@ mod intmatrix;
mod layer_meta; mod layer_meta;
mod meta; mod meta;
mod reader; mod reader;
mod siblingannex;
mod tempbitvec; mod tempbitvec;
mod tempintvec; mod tempintvec;
mod views; mod views;
@@ -18,6 +19,7 @@ pub use builder::PersistentCompactIntVecBuilder;
pub use colgroup::{ColGroup, FilterMask, MatrixGroupOps, eval_filter_mask}; pub use colgroup::{ColGroup, FilterMask, MatrixGroupOps, eval_filter_mask};
pub use intmatrix::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, pack_compact_int_matrix}; pub use intmatrix::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, pack_compact_int_matrix};
pub use layer_meta::LayerMeta; pub use layer_meta::LayerMeta;
pub use siblingannex::{FamilyMask, SiblingAnnex, SiblingAnnexBuilder};
pub use reader::{PersistentCompactIntVec, Iter as CompactIntVecIter}; pub use reader::{PersistentCompactIntVec, Iter as CompactIntVecIter};
pub use tempbitvec::{TempBitVec, TempBitVecBuilder}; pub use tempbitvec::{TempBitVec, TempBitVecBuilder};
pub use tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder}; pub use tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
+245
View File
@@ -0,0 +1,245 @@
//! Family presence-mask annex: a compact, read-only-after-build, per-slot
//! derived value used by the central-position SNP distance estimator (see
//! `docmd/theory/evolutionary_distances.md`, "Step 2b" and "Definitions:
//! family, and the canonical form of a family").
//!
//! One byte is stored per MPHF slot of a partition/layer, its low 4 bits
//! encoding a **presence mask** for the slot's k-mer's "family" (the up to 4
//! k-mers sharing the same flanks, differing only at the central base):
//! bit `b` (`b` = 0..3, in the fixed A/C/G/T = 0/1/2/3 encoding already used
//! for a single nucleotide) is set iff the family member whose *own* central
//! base — in its own canonical orientation — is `b`, is observed anywhere in
//! the current multi-genome index. This is a property of the whole index,
//! not of any one genome.
//!
//! Both facts the earlier (superseded) 3-bit design stored explicitly are
//! derived from the mask instead, not stored:
//! - sibling count = `popcount(mask) - 1`;
//! - minorant = regenerate the family's 4 canonical forms from the slot's
//! own k-mer (`CanonicalKmerOf::central_canonical_neighbors`, cheap, no
//! lookup), compare the raw encodings of whichever are set in the mask,
//! take the smallest — see `obikindex::siblings`.
//!
//! Mask value 0 is logically unreachable as a real result (a slot's own base
//! is always present in its own family) and is reused as the "not yet
//! computed" sentinel: annex files are pre-initialised to all-zero, and a
//! real value is only ever written once, by the computation pass.
//!
//! Deliberately simpler than a true 4-bit pack (1 byte/slot instead of 4
//! bits/slot): correctness and simplicity first, for a first implementation.
//! Packing to 4 bits/slot is a pure storage-density follow-up, not a
//! behavioural change, left for later.
use std::fs::{File, OpenOptions};
use std::io;
use std::path::{Path, PathBuf};
use memmap2::{Mmap, MmapMut};
const MAGIC: [u8; 4] = *b"PSIB";
// Header: magic(4) + _pad(4) + n(8) = 16 bytes. Data (1 byte/slot) follows.
const HEADER_SIZE: usize = 16;
/// A family presence mask: bit `b` set iff the member whose own canonical
/// central base is `b` (0=A, 1=C, 2=G, 3=T) is observed in the index.
#[derive(Debug, Clone, Copy, PartialEq, Eq)]
pub struct FamilyMask(u8);
impl FamilyMask {
/// The empty mask — never a valid *computed* result (a slot's own base
/// is always present in its own family) — used only to build up a mask
/// via repeated [`with`](Self::with) calls before storing it.
pub const EMPTY: FamilyMask = FamilyMask(0);
/// Set bit `base` (0=A, 1=C, 2=G, 3=T).
#[inline]
pub fn with(self, base: u8) -> Self {
debug_assert!(base < 4, "base out of range: {base}");
FamilyMask(self.0 | (1 << base))
}
/// Is the member with central base `base` (0..3) present?
#[inline]
pub fn has(self, base: u8) -> bool {
debug_assert!(base < 4, "base out of range: {base}");
self.0 & (1 << base) != 0
}
/// Number of family members observed anywhere in the index (1..=4).
#[inline]
pub fn family_size(self) -> u32 {
self.0.count_ones()
}
/// Number of *other* members observed (0..=3) — `family_size() - 1`.
#[inline]
pub fn siblings(self) -> u32 {
self.family_size() - 1
}
/// Raw bitmask (bit `b` = base `b` present) — for callers that build up
/// a mask via their own bit operations (e.g. concurrently, via an
/// `AtomicU8`) and only need the `FamilyMask` wrapper at the end.
#[inline]
pub fn bits(self) -> u8 {
self.0
}
/// Construct from a raw bitmask (only the low 4 bits are kept).
#[inline]
pub fn from_bits(bits: u8) -> Self {
FamilyMask(bits & 0b1111)
}
#[inline]
fn encode(self) -> u8 {
self.0
}
#[inline]
fn decode(byte: u8) -> Option<Self> {
if byte == 0 {
// Unreachable for a real result — reserved as the "not yet
// computed" sentinel.
return None;
}
Some(FamilyMask(byte & 0b1111))
}
}
// ── SiblingAnnex (reader) ───────────────────────────────────────────────────
pub struct SiblingAnnex {
mmap: Mmap,
n: usize,
path: PathBuf,
}
impl SiblingAnnex {
pub fn open(path: &Path) -> io::Result<Self> {
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
if mmap.len() < HEADER_SIZE {
return Err(io::Error::new(io::ErrorKind::InvalidData, "PSIB file too short"));
}
if mmap[0..4] != MAGIC {
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PSIB magic"));
}
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
if mmap.len() < HEADER_SIZE + n {
return Err(io::Error::new(io::ErrorKind::InvalidData, "PSIB file truncated"));
}
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn path(&self) -> &Path { &self.path }
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
/// `None` means the slot has not (yet) been computed — see module docs.
pub fn get(&self, slot: usize) -> Option<FamilyMask> {
FamilyMask::decode(self.mmap[HEADER_SIZE + slot])
}
}
// ── SiblingAnnexBuilder (writer) ────────────────────────────────────────────
pub struct SiblingAnnexBuilder {
mmap: MmapMut,
n: usize,
path: PathBuf,
}
impl SiblingAnnexBuilder {
/// Create a new annex of `n` slots at `path`, pre-initialised to the
/// "not yet computed" sentinel (all-zero).
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
let file_size = HEADER_SIZE + n;
let file = OpenOptions::new()
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.set_len(file_size as u64)?;
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
mmap[0..4].copy_from_slice(&MAGIC);
mmap[4..8].copy_from_slice(&[0u8; 4]);
mmap[8..16].copy_from_slice(&(n as u64).to_le_bytes());
// Data region left at 0 by `set_len`/mmap — the sentinel value.
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn get(&self, slot: usize) -> Option<FamilyMask> {
FamilyMask::decode(self.mmap[HEADER_SIZE + slot])
}
pub fn set(&mut self, slot: usize, mask: FamilyMask) {
// Redundant concurrent writes from independent recomputation paths
// converge to the same encoded byte for a given slot, so a plain
// store here is safe even without external synchronisation, as long
// as the byte write itself is atomic (true for a single aligned
// byte on every platform this project targets).
self.mmap[HEADER_SIZE + slot] = mask.encode();
}
pub fn close(self) -> io::Result<()> { self.mmap.flush() }
pub fn finish(self) -> io::Result<SiblingAnnex> {
let path = self.path.clone();
self.close()?;
SiblingAnnex::open(&path)
}
}
#[cfg(test)]
mod tests {
use super::*;
use tempfile::tempdir;
#[test]
fn sentinel_is_zero_and_unset_slots_read_as_uncomputed() {
let dir = tempdir().unwrap();
let path = dir.path().join("test.psib");
let builder = SiblingAnnexBuilder::new(4, &path).unwrap();
for slot in 0..4 {
assert_eq!(builder.get(slot), None);
}
builder.close().unwrap();
}
#[test]
fn roundtrip_all_valid_masks() {
let dir = tempdir().unwrap();
let path = dir.path().join("test.psib");
let mut builder = SiblingAnnexBuilder::new(4, &path).unwrap();
let masks = [
FamilyMask::EMPTY.with(0), // just A: family size 1
FamilyMask::EMPTY.with(0).with(3), // A + T: size 2
FamilyMask::EMPTY.with(1).with(2).with(3), // C+G+T: size 3
FamilyMask::EMPTY.with(0).with(1).with(2).with(3), // all 4
];
for (slot, mask) in masks.iter().enumerate() {
builder.set(slot, *mask);
}
let annex = builder.finish().unwrap();
for (slot, mask) in masks.iter().enumerate() {
assert_eq!(annex.get(slot), Some(*mask));
}
assert_eq!(annex.get(0).unwrap().siblings(), 0);
assert_eq!(annex.get(1).unwrap().siblings(), 1);
assert_eq!(annex.get(2).unwrap().siblings(), 2);
assert_eq!(annex.get(3).unwrap().siblings(), 3);
assert_eq!(annex.get(3).unwrap().family_size(), 4);
}
#[test]
fn has_reflects_individual_bits() {
let mask = FamilyMask::EMPTY.with(0).with(2);
assert!(mask.has(0));
assert!(!mask.has(1));
assert!(mask.has(2));
assert!(!mask.has(3));
}
}
+23
View File
@@ -1,5 +1,16 @@
use ndarray::{Array1, Array2}; use ndarray::{Array1, Array2};
/// Convert a Jaccard distance matrix (`1 - J`) into a Mash distance matrix, per
/// https://mash.readthedocs.io/en/latest/distances.html:
/// `D = -1/k * ln(2J / (1+J))`.
fn jaccard_to_mash(d_jaccard: &Array2<f64>, k: usize) -> Array2<f64> {
d_jaccard.mapv(|d| {
let j = 1.0 - d;
if j <= 0.0 { 1.0 }
else { -1.0 / k as f64 * (2.0 * j / (1.0 + j)).ln() }
})
}
// ── Column-level weight statistic — total count or presence count per column. // ── Column-level weight statistic — total count or presence count per column.
/// Additive across layers and partitions; used as denominator in normalised distances. /// Additive across layers and partitions; used as denominator in normalised distances.
/// ///
@@ -74,6 +85,12 @@ pub trait CountPartials: ColumnWeights {
m m
} }
/// Mash distance (https://mash.readthedocs.io/en/latest/distances.html), derived
/// from the presence-threshold Jaccard distance.
fn threshold_mash_dist_matrix(&self, k: usize, threshold: u32) -> Array2<f64> {
jaccard_to_mash(&self.threshold_jaccard_dist_matrix(threshold), k)
}
fn relfreq_bray_dist_matrix(&self) -> Array2<f64> { fn relfreq_bray_dist_matrix(&self) -> Array2<f64> {
let global = self.col_weights(); let global = self.col_weights();
let mut m = self.partial_relfreq_bray(&global).mapv(|v| 1.0 - v); let mut m = self.partial_relfreq_bray(&global).mapv(|v| 1.0 - v);
@@ -126,6 +143,12 @@ pub trait BitPartials: ColumnWeights {
m m
} }
/// Mash distance (https://mash.readthedocs.io/en/latest/distances.html), derived
/// from the Jaccard distance.
fn mash_dist_matrix(&self, k: usize) -> Array2<f64> {
jaccard_to_mash(&self.jaccard_dist_matrix(), k)
}
fn hamming_dist_matrix(&self) -> Array2<u64> { fn hamming_dist_matrix(&self) -> Array2<u64> {
self.partial_hamming() self.partial_hamming()
} }
+10
View File
@@ -0,0 +1,10 @@
[package]
name = "obikentropy"
version = "0.1.0"
edition = "2024"
[dependencies]
obikseq = { path = "../obikseq" }
[dev-dependencies]
obikseq = { path = "../obikseq", features = ["test-utils"] }
@@ -4,57 +4,6 @@ use std::path::PathBuf;
const K_MAX: usize = 32; const K_MAX: usize = 32;
const WS_MAX: usize = 6; const WS_MAX: usize = 6;
fn normalize_circular(kmer: u64, ws: usize) -> u64 {
let mask = (1u64 << (ws * 2)) - 1;
let mut canonical = kmer & mask;
let mut current = canonical;
for _ in 0..ws - 1 {
let top = (current >> ((ws - 1) * 2)) & 3;
current = ((current << 2) | top) & mask;
if current < canonical {
canonical = current;
}
}
canonical
}
fn revcomp_raw(x: u64, k: usize) -> u64 {
let x = !x;
let x = x.swap_bytes();
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
x << (64 - 2 * k)
}
fn build_normalized_kmer(k: usize) -> Vec<u64> {
let n = 1usize << (k * 2);
let shift = 64 - k * 2;
let mut result = vec![0u64; n];
for i in 0..n {
let la = (i as u64) << shift;
let ra = i as u64;
let rc_ra = revcomp_raw(la, k) >> shift;
let circ = normalize_circular(ra, k);
let circ_rc = normalize_circular(rc_ra, k);
result[i] = if circ < circ_rc { circ } else { circ_rc };
}
result
}
fn build_ln_class(norm: &[u64]) -> Vec<f64> {
let n = norm.len();
let mut sizes = vec![0u32; n];
for &c in norm {
sizes[c as usize] += 1;
}
norm.iter()
.map(|&c| {
let s = sizes[c as usize];
if s > 0 { (s as f64).ln() } else { 0.0 }
})
.collect()
}
fn build_n_log_n() -> [f64; K_MAX + 1] { fn build_n_log_n() -> [f64; K_MAX + 1] {
let mut t = [0.0f64; K_MAX + 1]; let mut t = [0.0f64; K_MAX + 1];
for n in 1..=K_MAX { for n in 1..=K_MAX {
@@ -63,6 +12,9 @@ fn build_n_log_n() -> [f64; K_MAX + 1] {
t t
} }
/// Max achievable entropy over `4^ws` raw sub-words given only `nwords`
/// observations (most-uniform integer partition), per
/// `docmd/theory/entropy.md`.
fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] { fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] {
let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1]; let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1];
for k in 2..=K_MAX { for k in 2..=K_MAX {
@@ -125,13 +77,6 @@ fn main() {
let out_dir = PathBuf::from(std::env::var("OUT_DIR").unwrap()); let out_dir = PathBuf::from(std::env::var("OUT_DIR").unwrap());
let mut out = String::new(); let mut out = String::new();
for k in 1..=6usize {
let n = 1usize << (k * 2);
let norm = build_normalized_kmer(k);
let ln_class = build_ln_class(&norm);
emit_f64_1d(&mut out, &format!("LN_CLASS{k}"), n, &ln_class);
}
let n_log_n = build_n_log_n(); let n_log_n = build_n_log_n();
emit_f64_1d(&mut out, "N_LOG_N", K_MAX + 1, &n_log_n); emit_f64_1d(&mut out, "N_LOG_N", K_MAX + 1, &n_log_n);
@@ -141,5 +86,5 @@ fn main() {
let log_nwords = build_log_nwords(); let log_nwords = build_log_nwords();
emit_f64_2d(&mut out, "LOG_NWORDS", K_MAX + 1, WS_MAX + 1, &log_nwords); emit_f64_2d(&mut out, "LOG_NWORDS", K_MAX + 1, WS_MAX + 1, &log_nwords);
fs::write(out_dir.join("ln_class_tables.rs"), out).unwrap(); fs::write(out_dir.join("entropy_tables.rs"), out).unwrap();
} }
+41
View File
@@ -0,0 +1,41 @@
//! Normalized entropy of an isolated, already-built k-mer (e.g. one
//! reconstructed from an index's `unitigs.bin`, with no surrounding
//! sequence) — drives the window through [`EntropyTracker`] one base at a
//! time, exactly like the streaming path, so a `theta` threshold means the
//! same thing whether applied during index construction or after the fact
//! (e.g. `obikmer filter`).
use obikseq::CanonicalKmer;
use crate::tracker::EntropyTracker;
/// Extension trait: compute the normalized entropy of a single canonical
/// k-mer, independent of any surrounding sequence.
pub trait KmerEntropy {
/// Normalized entropy across sub-word orders `1..=level_max` (the
/// minimum is taken across orders). Lower means less complex; `theta`
/// in `index`/`filter` rejects k-mers with a score `< theta`.
fn entropy(&self, level_max: usize) -> f64;
}
impl KmerEntropy for CanonicalKmer {
fn entropy(&self, level_max: usize) -> f64 {
let raw = self.raw(); // left-aligned, 2 bits/base, MSB-first
let k = obikseq::params::k();
let mask = (!0u64) >> (64 - k * 2);
let mut tracker = EntropyTracker::new(k);
let mut rolling: u64 = 0;
for i in 0..k {
let shift = 64 - 2 * (i + 1);
let base = (raw >> shift) & 3;
rolling = ((rolling << 2) | base) & mask;
tracker.push(i + 1, rolling);
}
tracker.normalized_entropy(level_max)
}
}
#[cfg(test)]
#[path = "tests/kmer_entropy.rs"]
mod tests;
+17
View File
@@ -0,0 +1,17 @@
//! Normalized k-mer entropy: formulas, tables, and a streaming tracker.
//!
//! This crate holds every piece of the entropy computation described in
//! `docmd/theory/entropy.md`: the compile-time tables ([`table`], private),
//! the incremental accumulator ([`EntropyTracker`]) that callers compose
//! into their own streaming state, and the [`KmerEntropy`] convenience trait
//! for scoring a single, already-built k-mer.
#![deny(missing_docs)]
mod kmer_entropy;
mod ring;
mod table;
mod tracker;
pub use kmer_entropy::KmerEntropy;
pub use tracker::EntropyTracker;
+40
View File
@@ -0,0 +1,40 @@
//! Stack-allocated ring buffer backing the sliding sub-word windows.
/// Fixed-capacity ring buffer backed by a stack array.
/// N must be a power of two; operations are branchless via `% N`.
pub(crate) struct Ring<T: Copy + Default, const N: usize> {
buf: [T; N],
head: usize,
len: usize,
}
impl<T: Copy + Default, const N: usize> Ring<T, N> {
#[inline]
pub(crate) fn new() -> Self {
Self {
buf: [T::default(); N],
head: 0,
len: 0,
}
}
#[inline]
pub(crate) fn clear(&mut self) {
self.len = 0;
self.head = 0;
}
#[inline]
pub(crate) fn push_back(&mut self, val: T) {
self.buf[(self.head + self.len) % N] = val;
self.len += 1;
}
#[inline]
pub(crate) fn pop_front(&mut self) -> T {
let val = self.buf[self.head];
self.head = (self.head + 1) % N;
self.len -= 1;
val
}
}
+30
View File
@@ -0,0 +1,30 @@
//! Compile-time tables backing the normalized k-mer entropy formula: the
//! max-entropy correction for small samples. See `docmd/theory/entropy.md`.
//!
//! Entropy is computed directly on raw (non-canonicalized) sub-words — no
//! equivalence-class folding. Empirically (see the discussion that produced
//! this crate's history), folding sub-words into circular/revcomp classes
//! before unfolding them back buys nothing for the invariances it was meant
//! to guarantee (both hold for raw sub-word entropy already, by a direct
//! bijection argument for revcomp and by the sliding window's own dynamics
//! for tandem repeats), while it measurably *weakens* detection of the
//! low-complexity sequences the filter exists to catch.
include!(concat!(env!("OUT_DIR"), "/entropy_tables.rs"));
pub(crate) const WS_MAX: usize = 6;
#[inline(always)]
pub(crate) const fn n_log_n(n: usize) -> f64 {
N_LOG_N[n]
}
#[inline(always)]
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
EMAX[k][ws]
}
#[inline(always)]
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
LOG_NWORDS[k][ws]
}
+52
View File
@@ -0,0 +1,52 @@
use super::*;
use obikseq::Sequence;
use obikseq::kmer::Kmer;
const K: usize = 21;
const LEVEL_MAX: usize = 6;
fn kmer_from_ascii(seq: &[u8]) -> CanonicalKmer {
obikseq::set_k(K);
Kmer::from_ascii(seq).expect("valid k-mer sequence").canonical()
}
#[test]
fn homopolymer_scores_lower_than_diverse_sequence() {
let homopolymer = kmer_from_ascii(b"AAAAAAAAAAAAAAAAAAAAA"); // 21 bases
let diverse = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT"); // 21 bases, same as used elsewhere in this workspace's tests
let e_homopolymer = homopolymer.entropy(LEVEL_MAX);
let e_diverse = diverse.entropy(LEVEL_MAX);
assert!(
e_homopolymer < e_diverse,
"homopolymer ({e_homopolymer}) should score lower than a diverse sequence ({e_diverse})"
);
// A pure homopolymer is the most degenerate case representable — its
// score should sit near the bottom of the range, not just "somewhat lower".
assert!(e_homopolymer < 0.3, "homopolymer entropy unexpectedly high: {e_homopolymer}");
}
#[test]
fn entropy_is_deterministic_for_the_same_kmer() {
let a = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
let b = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
assert_eq!(a.entropy(LEVEL_MAX), b.entropy(LEVEL_MAX));
}
#[test]
fn entropy_is_within_zero_one_range() {
let mut repeat = "AT".repeat(K / 2 + 1);
repeat.truncate(K);
for seq in [
"AAAAAAAAAAAAAAAAAAAAA".to_string(),
repeat,
"CATTAGCGTACCTGATCAGGT".to_string(),
] {
assert_eq!(seq.len(), K, "test sequence must be exactly K bases: {seq:?}");
let kmer = kmer_from_ascii(seq.as_bytes());
let e = kmer.entropy(LEVEL_MAX);
assert!((0.0..=1.0).contains(&e), "entropy {e} out of [0,1] for {seq:?}");
}
}
+255
View File
@@ -0,0 +1,255 @@
//! Incremental (streaming) normalized k-mer entropy.
//!
//! [`EntropyTracker`] maintains, over a sliding window of the last `k` bases,
//! the per-sub-word-size raw-word frequency statistics needed to evaluate
//! the corrected Shannon entropy described in `docmd/theory/entropy.md`,
//! updated in O(1) per base rather than recomputed from scratch. No
//! canonicalization is applied — each sub-word is tallied under its own raw
//! 2-bit-packed value; only the small-sample max-entropy correction departs
//! from a textbook Shannon entropy.
//!
//! It carries no notion of minimizers or superkmer segmentation — callers
//! that need both (e.g. `obiskbuilder::RollingStat`) compose an
//! `EntropyTracker` as a plain field alongside their own state, so the two
//! concerns update in the same streaming pass without being conflated in one
//! struct.
use crate::ring::Ring;
use crate::table::{WS_MAX, emax, log_nwords, n_log_n};
/// Incremental normalized-entropy accumulator over a sliding window of `k`
/// bases. Composed as a plain field by callers that also need other
/// per-base state (e.g. minimizer selection) in the same streaming pass.
pub struct EntropyTracker {
k: usize,
steady: bool,
// Sliding-window queues over the last `k` raw sub-words, one per word
// size — stack-allocated, capacity ≤ k ≤ 31.
k1q: Ring<u64, 32>,
k2q: Ring<u64, 32>,
k3q: Ring<u64, 32>,
k4q: Ring<u64, 32>,
k5q: Ring<u64, 32>,
k6q: Ring<u64, 32>,
// Frequency count arrays, indexed by the raw sub-word value (2 bits per
// base). Max count per cell ≤ k ≤ 31 → u8 is sufficient.
k1c: [u8; 4],
k2c: [u8; 16],
k3c: [u8; 64],
k4c: [u8; 256],
k5c: [u8; 1024],
k6c: [u8; 4096],
sum_f_log_f: [f64; WS_MAX + 1],
}
impl EntropyTracker {
/// New tracker for a window of `k` bases (1..=31).
pub fn new(k: usize) -> Self {
Self {
k,
steady: false,
k1q: Ring::new(),
k2q: Ring::new(),
k3q: Ring::new(),
k4q: Ring::new(),
k5q: Ring::new(),
k6q: Ring::new(),
k1c: [0; 4],
k2c: [0; 16],
k3c: [0; 64],
k4c: [0; 256],
k5c: [0; 1024],
k6c: [0; 4096],
sum_f_log_f: [0.0; WS_MAX + 1],
}
}
/// Clear all accumulated state, ready to track a new window from
/// scratch (`k` is unchanged).
pub fn reset(&mut self) {
self.steady = false;
self.k1c.fill(0);
self.k2c.fill(0);
self.k3c.fill(0);
self.k4c.fill(0);
self.k5c.fill(0);
self.k6c.fill(0);
self.k1q.clear();
self.k2q.clear();
self.k3q.clear();
self.k4q.clear();
self.k5q.clear();
self.k6q.clear();
self.sum_f_log_f = [0.0; WS_MAX + 1];
}
#[inline]
fn update_sums_decrement<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], f: usize) {
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
}
#[inline]
fn update_sums_increment<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], g: usize) {
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
}
/// Advance the window by one base. `received` is the caller's running
/// count of bases pushed so far (1-based, i.e. after this base);
/// `rolling_kmer` is the current right-aligned, 2-bit-packed k-mer
/// window (same convention as `obiskbuilder::RollingStat::rolling_k`).
pub fn push(&mut self, received: usize, rolling_kmer: u64) {
let raw1 = rolling_kmer & 3;
let raw2 = rolling_kmer & 15;
let raw3 = rolling_kmer & 63;
let raw4 = rolling_kmer & 255;
let raw5 = rolling_kmer & 1023;
let raw6 = rolling_kmer & 4095;
if received > self.k {
let old1 = self.k1q.pop_front();
let f1 = self.k1c[old1 as usize] as usize;
Self::update_sums_decrement::<1>(&mut self.sum_f_log_f, f1);
self.k1c[old1 as usize] -= 1;
let old2 = self.k2q.pop_front();
let f2 = self.k2c[old2 as usize] as usize;
Self::update_sums_decrement::<2>(&mut self.sum_f_log_f, f2);
self.k2c[old2 as usize] -= 1;
let old3 = self.k3q.pop_front();
let f3 = self.k3c[old3 as usize] as usize;
Self::update_sums_decrement::<3>(&mut self.sum_f_log_f, f3);
self.k3c[old3 as usize] -= 1;
let old4 = self.k4q.pop_front();
let f4 = self.k4c[old4 as usize] as usize;
Self::update_sums_decrement::<4>(&mut self.sum_f_log_f, f4);
self.k4c[old4 as usize] -= 1;
let old5 = self.k5q.pop_front();
let f5 = self.k5c[old5 as usize] as usize;
Self::update_sums_decrement::<5>(&mut self.sum_f_log_f, f5);
self.k5c[old5 as usize] -= 1;
let old6 = self.k6q.pop_front();
let f6 = self.k6c[old6 as usize] as usize;
Self::update_sums_decrement::<6>(&mut self.sum_f_log_f, f6);
self.k6c[old6 as usize] -= 1;
}
if self.steady {
let g1 = self.k1c[raw1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
self.k1c[raw1 as usize] += 1;
self.k1q.push_back(raw1);
let g2 = self.k2c[raw2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
self.k2c[raw2 as usize] += 1;
self.k2q.push_back(raw2);
let g3 = self.k3c[raw3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
self.k3c[raw3 as usize] += 1;
self.k3q.push_back(raw3);
let g4 = self.k4c[raw4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
self.k4c[raw4 as usize] += 1;
self.k4q.push_back(raw4);
let g5 = self.k5c[raw5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
self.k5c[raw5 as usize] += 1;
self.k5q.push_back(raw5);
let g6 = self.k6c[raw6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
self.k6c[raw6 as usize] += 1;
self.k6q.push_back(raw6);
} else {
self.push_warmup_increments(received, raw1, raw2, raw3, raw4, raw5, raw6);
}
}
#[cold]
#[inline(never)]
fn push_warmup_increments(
&mut self,
received: usize,
raw1: u64, raw2: u64, raw3: u64,
raw4: u64, raw5: u64, raw6: u64,
) {
let g1 = self.k1c[raw1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
self.k1c[raw1 as usize] += 1;
self.k1q.push_back(raw1);
if received >= 2 {
let g2 = self.k2c[raw2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
self.k2c[raw2 as usize] += 1;
self.k2q.push_back(raw2);
if received >= 3 {
let g3 = self.k3c[raw3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
self.k3c[raw3 as usize] += 1;
self.k3q.push_back(raw3);
if received >= 4 {
let g4 = self.k4c[raw4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
self.k4c[raw4 as usize] += 1;
self.k4q.push_back(raw4);
if received >= 5 {
let g5 = self.k5c[raw5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
self.k5c[raw5 as usize] += 1;
self.k5q.push_back(raw5);
if received >= 6 {
let g6 = self.k6c[raw6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
self.k6c[raw6 as usize] += 1;
self.k6q.push_back(raw6);
self.steady = true;
}
}
}
}
}
}
/// Normalized entropy at sub-word size `order` (1..=6). The caller is
/// responsible for not calling this before the window is full (`k`
/// bases pushed) — an empty/partial window yields a meaningless value.
pub fn entropy(&self, order: usize) -> f64 {
let k = self.k;
let em = emax(k, order);
if em <= 0.0 {
return 1.0;
}
let nwords = k - order + 1;
let log_nw = log_nwords(k, order);
let nw_f = nwords as f64;
let h_corr = log_nw - self.sum_f_log_f[order] / nw_f;
(h_corr / em).max(0.0)
}
/// Minimum of [`Self::entropy`] over sub-word sizes `1..=order_max`, same
/// caller responsibility re: window readiness as `entropy`.
pub fn normalized_entropy(&self, order_max: usize) -> f64 {
let min_e = (1..=order_max)
.map(|ws| self.entropy(ws))
.fold(f64::MAX, f64::min);
if min_e == f64::MAX { 1.0 } else { min_e }
}
}
+6
View File
@@ -10,6 +10,8 @@ obiskio = { path = "../obiskio" }
obisys = { path = "../obisys" } obisys = { path = "../obisys" }
obicompactvec = { path = "../obicompactvec" } obicompactvec = { path = "../obicompactvec" }
obilayeredmap = { path = "../obilayeredmap" } obilayeredmap = { path = "../obilayeredmap" }
obiskbuilder = { path = "../obiskbuilder" }
obipipeline = { path = "../obipipeline" }
ndarray = "0.16" ndarray = "0.16"
rayon = "1" rayon = "1"
crossbeam-channel = "0.5" crossbeam-channel = "0.5"
@@ -19,6 +21,10 @@ indicatif = "0.17"
tracing = "0.1.44" tracing = "0.1.44"
hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], optional = true } hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], optional = true }
[dev-dependencies]
obiread = { path = "../obiread" }
tempfile = "3"
[features] [features]
default = ["numa"] default = ["numa"]
numa = ["hwlocality"] numa = ["hwlocality"]
+4
View File
@@ -14,6 +14,8 @@ pub enum DistanceMetric {
Jaccard, Jaccard,
/// Hamming distance (number of differing kmer positions) on presence/absence data. /// Hamming distance (number of differing kmer positions) on presence/absence data.
Hamming, Hamming,
/// Mash distance on presence/absence data (Jaccard-derived mutation-rate estimate).
Mash,
/// Bray-Curtis dissimilarity on raw counts. /// Bray-Curtis dissimilarity on raw counts.
BrayCurtis, BrayCurtis,
/// Bray-Curtis dissimilarity normalised by per-genome total counts. /// Bray-Curtis dissimilarity normalised by per-genome total counts.
@@ -84,6 +86,7 @@ impl KmerIndex {
DistanceMetric::Hellinger => CountPartials::hellinger_dist_matrix(&global), DistanceMetric::Hellinger => CountPartials::hellinger_dist_matrix(&global),
DistanceMetric::HellingerEuclidean => CountPartials::hellinger_euclidean_dist_matrix(&global), DistanceMetric::HellingerEuclidean => CountPartials::hellinger_euclidean_dist_matrix(&global),
DistanceMetric::Jaccard => CountPartials::threshold_jaccard_dist_matrix(&global, presence_threshold), DistanceMetric::Jaccard => CountPartials::threshold_jaccard_dist_matrix(&global, presence_threshold),
DistanceMetric::Mash => CountPartials::threshold_mash_dist_matrix(&global, self.kmer_size(), presence_threshold),
DistanceMetric::Hamming => { DistanceMetric::Hamming => {
return Err(OKIError::InvalidInput( return Err(OKIError::InvalidInput(
"Hamming is only available for presence/absence indexes".into(), "Hamming is only available for presence/absence indexes".into(),
@@ -108,6 +111,7 @@ impl KmerIndex {
let matrix = match metric { let matrix = match metric {
DistanceMetric::Jaccard => BitPartials::jaccard_dist_matrix(&global), DistanceMetric::Jaccard => BitPartials::jaccard_dist_matrix(&global),
DistanceMetric::Mash => BitPartials::mash_dist_matrix(&global, self.kmer_size()),
DistanceMetric::Hamming => { DistanceMetric::Hamming => {
BitPartials::hamming_dist_matrix(&global).mapv(|v| v as f64) BitPartials::hamming_dist_matrix(&global).mapv(|v| v as f64)
} }
+2
View File
@@ -9,6 +9,7 @@ mod numa;
mod rebuild; mod rebuild;
mod reindex; mod reindex;
mod select; mod select;
mod siblings;
mod stats; mod stats;
pub use error::{OKIError, OKIResult}; pub use error::{OKIError, OKIResult};
@@ -18,3 +19,4 @@ pub use merge::MergeMode;
pub use meta::{validate_label, GenomeInfo, IndexConfig, IndexMeta, META_FILENAME}; pub use meta::{validate_label, GenomeInfo, IndexConfig, IndexMeta, META_FILENAME};
pub use state::{IndexState, SENTINEL_COUNTED, SENTINEL_INDEXED, SENTINEL_SCATTERED}; pub use state::{IndexState, SENTINEL_COUNTED, SENTINEL_INDEXED, SENTINEL_SCATTERED};
pub use stats::IndexBitsPerKmer; pub use stats::IndexBitsPerKmer;
pub use siblings::{RawSnpDistanceOutput, SiblingAnnexStats, SnpAlignment};
File diff suppressed because it is too large Load Diff
+1 -1
View File
@@ -1,6 +1,6 @@
[package] [package]
name = "obikmer" name = "obikmer"
version = "1.1.37" version = "1.1.40"
edition = "2024" edition = "2024"
[[bin]] [[bin]]
+176 -1
View File
@@ -3,13 +3,15 @@ use std::path::PathBuf;
use clap::Args; use clap::Args;
use kodama::{Method, linkage}; use kodama::{Method, linkage};
use obikindex::{DistanceMetric, KmerIndex}; use obifastwrite::{JsonVal, write_record};
use obikindex::{DistanceMetric, KmerIndex, RawSnpDistanceOutput, SiblingAnnexStats, SnpAlignment};
use speedytree::{DistanceMatrix, Hybrid, NeighborJoiningSolver, to_newick}; use speedytree::{DistanceMatrix, Hybrid, NeighborJoiningSolver, to_newick};
use tracing::info; use tracing::info;
#[derive(clap::ValueEnum, Clone, Copy, Debug)] #[derive(clap::ValueEnum, Clone, Copy, Debug)]
pub enum MetricArg { pub enum MetricArg {
Jaccard, Jaccard,
Mash,
Hamming, Hamming,
BrayCurtis, BrayCurtis,
#[value(name = "relfreq-bray-curtis")] #[value(name = "relfreq-bray-curtis")]
@@ -26,6 +28,7 @@ impl From<MetricArg> for DistanceMetric {
fn from(m: MetricArg) -> Self { fn from(m: MetricArg) -> Self {
match m { match m {
MetricArg::Jaccard => DistanceMetric::Jaccard, MetricArg::Jaccard => DistanceMetric::Jaccard,
MetricArg::Mash => DistanceMetric::Mash,
MetricArg::Hamming => DistanceMetric::Hamming, MetricArg::Hamming => DistanceMetric::Hamming,
MetricArg::BrayCurtis => DistanceMetric::BrayCurtis, MetricArg::BrayCurtis => DistanceMetric::BrayCurtis,
MetricArg::RelfreqBrayCurtis => DistanceMetric::RelfreqBrayCurtis, MetricArg::RelfreqBrayCurtis => DistanceMetric::RelfreqBrayCurtis,
@@ -62,7 +65,37 @@ pub struct DistanceArgs {
#[arg(long)] #[arg(long)]
pub upgma: bool, pub upgma: bool,
/// Build the sibling-count/minorant annex on this (multi-genome) index
/// — see `docmd/theory/evolutionary_distances.md`, Step 2b. Construction
/// only; does not by itself compute or write any statistics.
#[arg(long)]
pub sibling_annex: bool,
/// Tally the sibling-count distribution (CSV) of an already-built annex
/// (run with `--sibling-annex` first, in this invocation or an earlier
/// one). A separate, occasional diagnostic pass — not run every time the
/// annex itself is (re)built.
#[arg(long)]
pub sibling_stats: bool,
/// Compute the raw p-distance restricted to loci that are single-copy
/// in both genomes of each pair (an already-built sibling annex is
/// required — run with `--sibling-annex` first, in this invocation or
/// an earlier one). A quick way to test the central-position SNP
/// estimator against a real index; not the full `SnpTally` design.
#[arg(long)]
pub raw_snp_distance: bool,
/// Write a SNP-only pseudo-alignment (FASTA, IUPAC-coded) from an
/// already-built sibling annex — one row per genome, one column per
/// variable family (monomorphic families skipped), no flanking
/// sequence. See `docmd/theory/evolutionary_distances.md`,
/// "Multi-genome framing: family as pseudo-alignment column".
#[arg(long)]
pub snp: bool,
/// Output prefix: <prefix>_dist.csv, <prefix>_shared.csv, /// Output prefix: <prefix>_dist.csv, <prefix>_shared.csv,
/// <prefix>_siblings.csv, <prefix>_rawsnp.csv, <prefix>_snp.fasta,
/// <prefix>_nj.nwk, <prefix>_upgma.nwk. /// <prefix>_nj.nwk, <prefix>_upgma.nwk.
/// If omitted, the distance matrix is written to stdout. /// If omitted, the distance matrix is written to stdout.
#[arg(short, long)] #[arg(short, long)]
@@ -78,6 +111,51 @@ pub fn run(args: DistanceArgs) {
let labels: Vec<String> = idx.meta().genomes.iter().map(|g| g.label.clone()).collect(); let labels: Vec<String> = idx.meta().genomes.iter().map(|g| g.label.clone()).collect();
let n = labels.len(); let n = labels.len();
// ── Sibling-count/minorant annex (independent of the distance metric) ──
// Construction (`--sibling-annex`) and stats (`--sibling-stats`) are
// deliberately decoupled: the annex is meant to be (re)built routinely,
// the distribution only occasionally, on demand.
if args.sibling_annex {
info!("building sibling-count/minorant annex");
idx.build_sibling_annex().unwrap_or_else(|e| {
eprintln!("error building sibling annex: {e}");
std::process::exit(1);
});
}
if args.sibling_stats {
let stats = idx.sibling_annex_stats().unwrap_or_else(|e| {
eprintln!("error computing sibling-annex stats: {e}");
std::process::exit(1);
});
write_sibling_stats_csv(&stats, &labels, &args.output);
}
if args.raw_snp_distance {
let result = idx.raw_snp_distance().unwrap_or_else(|e| {
eprintln!("error computing raw SNP distance: {e}");
std::process::exit(1);
});
write_raw_snp_distance_csv(&result, &labels, &args.output);
}
if args.snp {
let alignment = idx.snp_pseudo_alignment().unwrap_or_else(|e| {
eprintln!("error computing SNP pseudo-alignment: {e}");
std::process::exit(1);
});
write_snp_fasta(&alignment, &labels, &args.output);
}
// `--sibling-annex`/`--sibling-stats`/`--raw-snp-distance`/`--snp` are
// their own operation, not a modifier on top of a distance-metric
// computation — a metric was never requested by asking for any of them,
// so there is nothing for the rest of this function to compute. Not a
// historical accident to keep: stop here rather than always also
// running a Jaccard (or whichever `--metric` defaults to) pass and
// printing an unrequested matrix.
if args.sibling_annex || args.sibling_stats || args.raw_snp_distance || args.snp {
return;
}
info!( info!(
"computing {:?} distances for {} genome(s)", "computing {:?} distances for {} genome(s)",
args.metric, n args.metric, n
@@ -189,6 +267,103 @@ pub fn run(args: DistanceArgs) {
} }
} }
// ── Family-size distribution → CSV ──────────────────────────────────────────
//
// Each row is a family (the up-to-4 k-mers sharing flanks, differing only at
// the centre), counted once — at its minorant — regardless of how many of
// its members are observed. Family size 1..4 (not "sibling count" 0..3):
// see `docmd/theory/evolutionary_distances.md`, "Definitions".
fn write_sibling_stats_csv(stats: &SiblingAnnexStats, labels: &[String], output: &Option<PathBuf>) {
// One row per genome (4 columns, family size 1-4: number of families of
// that size for which the genome carries at least one member), plus a
// `global` row — the actual deduplicated family-size histogram
// (`stats.counts`), NOT a sum of the per-genome columns (a family shared
// by several genomes would otherwise be counted once per genome it
// appears in, inflating the total beyond the real family count).
let path = output.as_ref()
.map(|p| format!("{}_siblings.csv", p.display()))
.unwrap_or_else(|| "siblings.csv".into());
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
eprintln!("error creating {path}: {e}");
std::process::exit(1);
}));
writeln!(f, "genome,1,2,3,4").unwrap();
for (label, counts) in labels.iter().zip(stats.per_genome.iter()) {
writeln!(f, "{label},{},{},{},{}", counts[0], counts[1], counts[2], counts[3]).unwrap();
}
writeln!(
f, "global,{},{},{},{}",
stats.counts[0], stats.counts[1], stats.counts[2], stats.counts[3],
).unwrap();
let total: u64 = stats.counts.iter().sum();
info!("family-size distribution → {path} (total {total} famil{})",
if total == 1 { "y" } else { "ies" });
}
// ── Raw single-copy SNP distance → CSV ──────────────────────────────────────
//
// p_hat[i,j] = snp[i,j] / (snp[i,j] + shared[i,j]) over loci single-copy in
// both i and j — see `RawSnpDistanceOutput` / `KmerIndex::raw_snp_distance`.
// A single file: the distance matrix, with an eligible-loci count alongside
// each value so a 0/0 pair (no eligible locus at all) is distinguishable
// from a genuinely identical pair.
fn write_raw_snp_distance_csv(result: &RawSnpDistanceOutput, labels: &[String], output: &Option<PathBuf>) {
let path = output.as_ref()
.map(|p| format!("{}_rawsnp.csv", p.display()))
.unwrap_or_else(|| "rawsnp.csv".into());
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
eprintln!("error creating {path}: {e}");
std::process::exit(1);
}));
let n = labels.len();
write!(f, "genome").unwrap();
for g in labels { write!(f, ",{g}").unwrap(); }
writeln!(f).unwrap();
for (i, g) in labels.iter().enumerate() {
write!(f, "{g}").unwrap();
for j in 0..n {
let snp = result.snp[[i, j]];
let shared = result.shared[[i, j]];
let eligible = snp + shared;
if eligible == 0 {
write!(f, ",NA").unwrap();
} else {
write!(f, ",{:.6}", snp as f64 / eligible as f64).unwrap();
}
}
writeln!(f).unwrap();
}
info!("raw single-copy SNP distance matrix → {path}");
}
// ── SNP-only pseudo-alignment → FASTA ───────────────────────────────────────
//
// One record per genome, IUPAC-coded, no flanking sequence — see
// `SnpAlignment` / `KmerIndex::snp_pseudo_alignment`. Uses the project's
// existing FASTA writer (`obifastwrite::write_record`) rather than
// hand-rolling one.
fn write_snp_fasta(alignment: &SnpAlignment, labels: &[String], output: &Option<PathBuf>) {
let path = output.as_ref()
.map(|p| format!("{}_snp.fasta", p.display()))
.unwrap_or_else(|| "snp.fasta".into());
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
eprintln!("error creating {path}: {e}");
std::process::exit(1);
}));
let n_sites = alignment.sequences.first().map(|s| s.len()).unwrap_or(0);
for (label, seq) in labels.iter().zip(alignment.sequences.iter()) {
write_record(seq, label, &[("n_sites", JsonVal::Num(n_sites as u64))], &mut f).unwrap_or_else(|e| {
eprintln!("error writing {path}: {e}");
std::process::exit(1);
});
}
info!("SNP pseudo-alignment → {path} ({n_sites} site{})",
if n_sites == 1 { "" } else { "s" });
}
// ── UPGMA Newick from kodama dendrogram ─────────────────────────────────────── // ── UPGMA Newick from kodama dendrogram ───────────────────────────────────────
fn upgma_to_newick(dendro: &kodama::Dendrogram<f64>, names: &[String]) -> String { fn upgma_to_newick(dendro: &kodama::Dendrogram<f64>, names: &[String]) -> String {
+18 -3
View File
@@ -2,14 +2,14 @@ use std::path::PathBuf;
use clap::Args; use clap::Args;
use obikindex::{KmerIndex, MergeMode}; use obikindex::{KmerIndex, MergeMode};
use obikpartitionner::filter::{MaxTotalCount, MinTotalCount}; use obikpartitionner::filter::{MaxTotalCount, MinComplexity, MinTotalCount};
use obisys::Reporter; use obisys::Reporter;
use tracing::info; use tracing::info;
use super::predicate::FilterArgs as KmerFilterArgs; use super::predicate::FilterArgs as KmerFilterArgs;
#[derive(Args)] #[derive(Args)]
pub struct FilterArgs { pub struct FilterCmdArgs {
/// Source index directory /// Source index directory
pub source: PathBuf, pub source: PathBuf,
@@ -28,6 +28,18 @@ pub struct FilterArgs {
#[arg(long)] #[arg(long)]
pub max_total_count: Option<u32>, pub max_total_count: Option<u32>,
/// Minimum normalized entropy (complexity) to keep a k-mer — same metric
/// as `obikmer index`'s --theta, applied here to k-mers already committed
/// to the source index (reconstructed from unitigs.bin). K-mers scoring
/// below this are removed.
#[arg(long)]
pub min_complexity: Option<f64>,
/// Maximum sub-word size for the complexity computation (see `obikmer
/// index`'s --level-max). Only used when --min-complexity is set.
#[arg(long, default_value_t = 6)]
pub complexity_level_max: usize,
/// Output as presence/absence instead of counts /// Output as presence/absence instead of counts
#[arg(long)] #[arg(long)]
pub presence: bool, pub presence: bool,
@@ -37,7 +49,7 @@ pub struct FilterArgs {
pub force: bool, pub force: bool,
} }
pub fn run(args: FilterArgs) { pub fn run(args: FilterCmdArgs) {
let src = KmerIndex::open(&args.source).unwrap_or_else(|e| { let src = KmerIndex::open(&args.source).unwrap_or_else(|e| {
eprintln!("error opening source index: {e}"); eprintln!("error opening source index: {e}");
std::process::exit(1); std::process::exit(1);
@@ -62,6 +74,9 @@ pub fn run(args: FilterArgs) {
if let Some(v) = args.max_total_count { if let Some(v) = args.max_total_count {
filters.push(Box::new(MaxTotalCount { total: v })); filters.push(Box::new(MaxTotalCount { total: v }));
} }
if let Some(theta) = args.min_complexity {
filters.push(Box::new(MinComplexity { level_max: args.complexity_level_max, theta }));
}
let mut rep = Reporter::new(); let mut rep = Reporter::new();
KmerIndex::rebuild(&args.output, &src, &filters, mode, args.force, &mut rep) KmerIndex::rebuild(&args.output, &src, &filters, mode, args.force, &mut rep)
+29 -17
View File
@@ -151,12 +151,14 @@ pub struct FilterArgs {
pub outgroup: Vec<String>, pub outgroup: Vec<String>,
/// Minimum number of ingroup genomes containing the k-mer /// Minimum number of ingroup genomes containing the k-mer
#[arg(long)] /// (negative: offset from group size, e.g. -1 = all but one)
pub min_count: Option<usize>, #[arg(long, allow_hyphen_values = true)]
pub min_count: Option<isize>,
/// Maximum number of ingroup genomes containing the k-mer /// Maximum number of ingroup genomes containing the k-mer
#[arg(long)] /// (negative: offset from group size, e.g. -1 = all but one)
pub max_count: Option<usize>, #[arg(long, allow_hyphen_values = true)]
pub max_count: Option<isize>,
/// Minimum fraction of ingroup genomes containing the k-mer [0.01.0] /// Minimum fraction of ingroup genomes containing the k-mer [0.01.0]
/// (default 1.0 when --ingroup is set, 0.0 otherwise) /// (default 1.0 when --ingroup is set, 0.0 otherwise)
@@ -168,13 +170,15 @@ pub struct FilterArgs {
pub max_frac: Option<f64>, pub max_frac: Option<f64>,
/// Minimum number of outgroup genomes containing the k-mer /// Minimum number of outgroup genomes containing the k-mer
#[arg(long)] /// (negative: offset from outgroup size, e.g. -1 = all but one)
pub min_outgroup_count: Option<usize>, #[arg(long, allow_hyphen_values = true)]
pub min_outgroup_count: Option<isize>,
/// Maximum number of outgroup genomes containing the k-mer /// Maximum number of outgroup genomes containing the k-mer
/// (default 0 when --outgroup is set, no constraint otherwise) /// (default 0 when --outgroup is set, no constraint otherwise;
#[arg(long)] /// negative: offset from outgroup size, e.g. -1 = all but one)
pub max_outgroup_count: Option<usize>, #[arg(long, allow_hyphen_values = true)]
pub max_outgroup_count: Option<isize>,
/// Minimum fraction of outgroup genomes containing the k-mer [0.01.0] /// Minimum fraction of outgroup genomes containing the k-mer [0.01.0]
#[arg(long)] #[arg(long)]
@@ -239,12 +243,12 @@ pub fn matching_genome_indices(pred_str: &str, genomes: &[GenomeInfo]) -> Result
pub struct GroupFilterParams { pub struct GroupFilterParams {
pub threshold: u32, pub threshold: u32,
pub min_count: Option<usize>, pub min_count: Option<isize>,
pub max_count: Option<usize>, pub max_count: Option<isize>,
pub min_frac: Option<f64>, pub min_frac: Option<f64>,
pub max_frac: Option<f64>, pub max_frac: Option<f64>,
pub min_outgroup_count: Option<usize>, pub min_outgroup_count: Option<isize>,
pub max_outgroup_count: Option<usize>, pub max_outgroup_count: Option<isize>,
pub min_outgroup_frac: Option<f64>, pub min_outgroup_frac: Option<f64>,
pub max_outgroup_frac: Option<f64>, pub max_outgroup_frac: Option<f64>,
} }
@@ -279,12 +283,20 @@ pub fn build_group_filter(
let default_min_frac = if !ingroup_preds.is_empty() && !ingroup_quorum_explicit { 1.0 } else { 0.0 }; let default_min_frac = if !ingroup_preds.is_empty() && !ingroup_quorum_explicit { 1.0 } else { 0.0 };
let default_max_outgroup_count = if !outgroup_preds.is_empty() && !outgroup_quorum_explicit { 0 } else { out_size }; let default_max_outgroup_count = if !outgroup_preds.is_empty() && !outgroup_quorum_explicit { 0 } else { out_size };
let min_count = p.min_count.unwrap_or(0); // Resolve a signed count: negative means an offset from the group size
let max_count = p.max_count.unwrap_or(in_size); // (e.g. -1 = all but one), floored at 1 so the negative form always keeps
// constraining the group — even a singleton group, where n-1 would be 0
// and would otherwise drop the constraint entirely.
let resolve = |v: isize, size: usize| -> usize {
if v < 0 { (size as isize + v).max(1) as usize } else { v as usize }
};
let min_count = p.min_count.map(|v| resolve(v, in_size)).unwrap_or(0);
let max_count = p.max_count.map(|v| resolve(v, in_size)).unwrap_or(in_size);
let min_frac = p.min_frac.unwrap_or(default_min_frac); let min_frac = p.min_frac.unwrap_or(default_min_frac);
let max_frac = p.max_frac.unwrap_or(1.0); let max_frac = p.max_frac.unwrap_or(1.0);
let min_outgroup_count = p.min_outgroup_count.unwrap_or(0); let min_outgroup_count = p.min_outgroup_count.map(|v| resolve(v, out_size)).unwrap_or(0);
let max_outgroup_count = p.max_outgroup_count.unwrap_or(default_max_outgroup_count); let max_outgroup_count = p.max_outgroup_count.map(|v| resolve(v, out_size)).unwrap_or(default_max_outgroup_count);
let min_outgroup_frac = p.min_outgroup_frac.unwrap_or(0.0); let min_outgroup_frac = p.min_outgroup_frac.unwrap_or(0.0);
let max_outgroup_frac = p.max_outgroup_frac.unwrap_or(1.0); let max_outgroup_frac = p.max_outgroup_frac.unwrap_or(1.0);
+36
View File
@@ -325,6 +325,42 @@ fn process_chunk(
let batch = QueryBatch::from_records(records, k, 6, 0.7, n_partitions); let batch = QueryBatch::from_records(records, k, 6, 0.7, n_partitions);
let n_seqs = batch.ids.len(); let n_seqs = batch.ids.len();
// Estimate QueryBatch::by_partition's actual memory footprint: the
// k-mer-level dedup map (roadmap point 5) — one HashMap<CanonicalKmer,
// Vec<KmerDesc>> per partition, sized by *unique* k-mers, not shrunk by
// dedup. On real workloads with a low intra-chunk duplication rate this
// can dwarf every other per-chunk structure, including the sparse
// Findere ones logged further down — unlike those, chunk_bytes's formula
// (run()) does not account for this at all today. Measured by allocated
// capacity, not logical length, to reflect real memory pressure
// (HashMap/Vec growth slack) — `by_partition` is alive for the entire
// process_chunk call (never drained, only iterated by reference), so
// this is its footprint for the whole chunk lifetime, not a transient.
let hashmap_slot_bytes = (std::mem::size_of::<CanonicalKmer>()
+ std::mem::size_of::<Vec<KmerDesc>>()
+ 1) as u64; // +1 ≈ hashbrown control byte per slot
let by_partition_map_bytes: u64 = batch
.by_partition
.iter()
.map(|m| m.capacity() as u64 * hashmap_slot_bytes)
.sum();
let by_partition_desc_bytes: u64 = batch
.by_partition
.iter()
.flat_map(|m| m.values())
.map(|v| v.capacity() as u64 * std::mem::size_of::<KmerDesc>() as u64)
.sum();
let by_partition_bytes = by_partition_map_bytes + by_partition_desc_bytes;
debug!(
n_unique_kmers_total = batch.by_partition.iter().map(|m| m.len() as u64).sum::<u64>(),
by_partition_map_bytes,
by_partition_desc_bytes,
by_partition_bytes,
chunk_bytes,
"by_partition memory retained"
);
// Sparse bookkeeping for the whole chunk: // Sparse bookkeeping for the whole chunk:
// - smer_index: O(total_smers) — is this s-mer in the index at all. // - smer_index: O(total_smers) — is this s-mer in the index at all.
// - by_genome[g]: raw (seq_idx, pos_smer, value) hits for genome g, only // - by_genome[g]: raw (seq_idx, pos_smer, value) hits for genome g, only
+1 -1
View File
@@ -21,7 +21,7 @@ enum Commands {
/// Merge multiple built indexes into one /// Merge multiple built indexes into one
Merge(cmd::merge::MergeArgs), Merge(cmd::merge::MergeArgs),
/// Apply row-level selection (σ) to an index: retain only k-mers matching the predicates /// Apply row-level selection (σ) to an index: retain only k-mers matching the predicates
Filter(cmd::filter::FilterArgs), Filter(cmd::filter::FilterCmdArgs),
/// Project and/or aggregate genome columns into a new or in-place index /// Project and/or aggregate genome columns into a new or in-place index
Select(cmd::select::SelectArgs), Select(cmd::select::SelectArgs),
/// Query an index with sequences and annotate matches /// Query an index with sequences and annotate matches
+2 -1
View File
@@ -6,7 +6,6 @@ edition = "2024"
[dev-dependencies] [dev-dependencies]
tempfile = "3" tempfile = "3"
obikseq = { path = "../obikseq", features = ["test-utils"] } obikseq = { path = "../obikseq", features = ["test-utils"] }
obiskbuilder = { path = "../obiskbuilder" }
obiread = { path = "../obiread" } obiread = { path = "../obiread" }
obikrope = { path = "../obikrope" } obikrope = { path = "../obikrope" }
@@ -14,6 +13,8 @@ obikrope = { path = "../obikrope" }
niffler = "3.0.0" niffler = "3.0.0"
remove_dir_all = "0.8" remove_dir_all = "0.8"
obikseq = { path = "../obikseq" } obikseq = { path = "../obikseq" }
obikentropy = { path = "../obikentropy" }
obiskbuilder = { path = "../obiskbuilder" }
obiskio = { path = "../obiskio" } obiskio = { path = "../obiskio" }
obidebruinj = { path = "../obidebruinj" } obidebruinj = { path = "../obidebruinj" }
obilayeredmap = { path = "../obilayeredmap" } obilayeredmap = { path = "../obilayeredmap" }
+14 -12
View File
@@ -62,7 +62,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row = mat.row(slot); let row = mat.row(slot);
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(kmer, row); cont = cb(kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -75,7 +75,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect(); let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(kmer, row); cont = cb(kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -83,18 +83,19 @@ impl KmerPartition {
} }
cont cont
} else { } else {
// No data matrix: implicit presence — all values are 1. // No data matrix: implicit presence — all values are 1. `row`
// The filter result is identical for every kmer, so evaluate once. // is identical for every kmer, but a filter can still depend
// on the kmer's own sequence (e.g. MinComplexity), so this
// cannot be evaluated once for the whole layer — filters must
// still be tested per kmer.
let all_present: Box<[u32]> = vec![1u32; n_genomes].into(); let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
let mut cont = true; let mut cont = true;
if passes_all(filters, &all_present, n_genomes) {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if mphf.find(kmer).is_some() { if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
cont = cb(kmer, all_present.clone()); cont = cb(kmer, all_present.clone());
if !cont { break; } if !cont { break; }
} }
} }
}
cont cont
}; };
@@ -140,7 +141,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row = mat.row(slot); let row = mat.row(slot);
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(part, layer, kmer, row); cont = cb(part, layer, kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -153,7 +154,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect(); let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(part, layer, kmer, row); cont = cb(part, layer, kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -161,16 +162,17 @@ impl KmerPartition {
} }
cont cont
} else { } else {
// Same as iter_partition_kmers: row is constant but a filter
// may still depend on the kmer's own sequence, so this must
// be tested per kmer, not once for the whole layer.
let all_present: Box<[u32]> = vec![1u32; n_genomes].into(); let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
let mut cont = true; let mut cont = true;
if passes_all(filters, &all_present, n_genomes) {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if mphf.find(kmer).is_some() { if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
cont = cb(part, layer, kmer, all_present.clone()); cont = cb(part, layer, kmer, all_present.clone());
if !cont { break; } if !cont { break; }
} }
} }
}
cont cont
}; };
+49 -13
View File
@@ -1,17 +1,24 @@
use obicompactvec::FilterMask; use obicompactvec::FilterMask;
use obikseq::CanonicalKmer;
/// Trait for kmer row filters. /// Trait for kmer filters.
/// ///
/// `kmer` is the k-mer's own canonical sequence, reconstructed from the
/// source index's `unitigs.bin` (always present — see `rebuild_layer.rs`);
/// `row` contains raw per-genome counts (or 0/1 for presence/absence data). /// `row` contains raw per-genome counts (or 0/1 for presence/absence data).
/// `n_genomes` equals `row.len()`. /// `n_genomes` equals `row.len()`. Most filters only need `row` — `kmer` is
/// there for filters that reason about the k-mer's sequence itself (e.g.
/// [`MinComplexity`]).
pub trait KmerFilter: Send + Sync { pub trait KmerFilter: Send + Sync {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool; fn passes(&self, kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool;
/// Express this filter as a [`FilterMask`] column-operation expression. /// Express this filter as a [`FilterMask`] column-operation expression.
/// ///
/// Returns `Some(expr)` if the filter can be evaluated solely from matrix /// Returns `Some(expr)` if the filter can be evaluated solely from matrix
/// column aggregates (no per-kmer row scan needed). Returns `None` if the /// column aggregates (no per-kmer row scan needed). Returns `None` if the
/// filter requires row-level inspection. /// filter requires row-level inspection — always the case for a filter
/// that needs the k-mer's sequence, since a `FilterMask` only expresses
/// per-genome column aggregates, never per-slot sequence data.
/// ///
/// `threshold` semantics in the returned mask use `>= threshold`, matching /// `threshold` semantics in the returned mask use `>= threshold`, matching
/// [`obicompactvec::MatrixGroupOps`]. Implementations must add 1 to any /// [`obicompactvec::MatrixGroupOps`]. Implementations must add 1 to any
@@ -23,8 +30,13 @@ pub trait KmerFilter: Send + Sync {
/// True when `row` passes every filter in `filters`. /// True when `row` passes every filter in `filters`.
/// Returns `true` if `filters` is empty. /// Returns `true` if `filters` is empty.
pub fn passes_all(filters: &[Box<dyn KmerFilter>], row: &[u32], n_genomes: usize) -> bool { pub fn passes_all(
filters.iter().all(|f| f.passes(row, n_genomes)) filters: &[Box<dyn KmerFilter>],
kmer: CanonicalKmer,
row: &[u32],
n_genomes: usize,
) -> bool {
filters.iter().all(|f| f.passes(kmer, row, n_genomes))
} }
// ── Quorum filters ───────────────────────────────────────────────────────────── // ── Quorum filters ─────────────────────────────────────────────────────────────
@@ -40,7 +52,7 @@ pub struct MinGenomeFraction {
} }
impl KmerFilter for MinGenomeFraction { impl KmerFilter for MinGenomeFraction {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool {
let p = present_count(row, self.threshold); let p = present_count(row, self.threshold);
p as f64 / n_genomes as f64 >= self.frac p as f64 / n_genomes as f64 >= self.frac
} }
@@ -63,7 +75,7 @@ pub struct MaxGenomeFraction {
} }
impl KmerFilter for MaxGenomeFraction { impl KmerFilter for MaxGenomeFraction {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool {
let p = present_count(row, self.threshold); let p = present_count(row, self.threshold);
p as f64 / n_genomes as f64 <= self.frac p as f64 / n_genomes as f64 <= self.frac
} }
@@ -86,7 +98,7 @@ pub struct MinGenomeCount {
} }
impl KmerFilter for MinGenomeCount { impl KmerFilter for MinGenomeCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
present_count(row, self.threshold) >= self.count present_count(row, self.threshold) >= self.count
} }
@@ -107,7 +119,7 @@ pub struct MaxGenomeCount {
} }
impl KmerFilter for MaxGenomeCount { impl KmerFilter for MaxGenomeCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
present_count(row, self.threshold) <= self.count present_count(row, self.threshold) <= self.count
} }
@@ -129,7 +141,7 @@ pub struct MinTotalCount {
} }
impl KmerFilter for MinTotalCount { impl KmerFilter for MinTotalCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
row.iter().sum::<u32>() >= self.total row.iter().sum::<u32>() >= self.total
} }
@@ -147,7 +159,7 @@ pub struct MaxTotalCount {
} }
impl KmerFilter for MaxTotalCount { impl KmerFilter for MaxTotalCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
row.iter().sum::<u32>() <= self.total row.iter().sum::<u32>() <= self.total
} }
@@ -212,7 +224,7 @@ impl GroupQuorumFilter {
} }
impl KmerFilter for GroupQuorumFilter { impl KmerFilter for GroupQuorumFilter {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
if !self.ingroup_idx.is_empty() { if !self.ingroup_idx.is_empty() {
let n = self.ingroup_idx.iter() let n = self.ingroup_idx.iter()
.filter(|&&i| row.get(i).copied().unwrap_or(0) > self.threshold) .filter(|&&i| row.get(i).copied().unwrap_or(0) > self.threshold)
@@ -260,3 +272,27 @@ impl KmerFilter for GroupQuorumFilter {
Some(FilterMask::And(parts)) Some(FilterMask::And(parts))
} }
} }
// ── Complexity filter (post-hoc, sequence-based) ──────────────────────────────
/// Reject k-mers with normalized entropy below `theta` — the same complexity
/// metric `obikmer index`'s `--theta`/`--level-max` apply *during* superkmer
/// construction (see [`obikentropy::KmerEntropy`]), applied here after the
/// fact, to k-mers already committed to a built index.
///
/// Unlike every other filter in this module, this one needs the k-mer's own
/// sequence, not its per-genome row — `column_mask_expr` is never overridden
/// (stays `None`), so this filter always forces the row-level scan path in
/// `rebuild_layer.rs` (which reconstructs the sequence from `unitigs.bin`
/// regardless, so no extra I/O beyond what filtering already requires).
pub struct MinComplexity {
pub level_max: usize,
pub theta: f64,
}
impl KmerFilter for MinComplexity {
fn passes(&self, kmer: CanonicalKmer, _row: &[u32], _n_genomes: usize) -> bool {
use obikentropy::KmerEntropy;
kmer.entropy(self.level_max) >= self.theta
}
}
+2 -2
View File
@@ -126,7 +126,7 @@ fn iter_src_kmers_masked(
Some(m) => m.get(slot), Some(m) => m.get(slot),
None => { None => {
let row = src_data.fill_row_by_slot(slot, n_genomes); let row = src_data.fill_row_by_slot(slot, n_genomes);
filters.iter().all(|f| f.passes(&row, n_genomes)) filters.iter().all(|f| f.passes(kmer, &row, n_genomes))
} }
}; };
if passes { cb(kmer); } if passes { cb(kmer); }
@@ -165,7 +165,7 @@ fn iter_src_layers(
cb(kmer, row.into_boxed_slice()); cb(kmer, row.into_boxed_slice());
} else { } else {
let row = src_data.fill_row_by_slot(slot, n_genomes); let row = src_data.fill_row_by_slot(slot, n_genomes);
if filters.iter().all(|f| f.passes(&row, n_genomes)) { if filters.iter().all(|f| f.passes(kmer, &row, n_genomes)) {
cb(kmer, row.into_boxed_slice()); cb(kmer, row.into_boxed_slice());
} }
} }
+21
View File
@@ -341,6 +341,27 @@ impl<L: KmerLength> CanonicalKmerOf<L> {
] ]
} }
/// Return the four central canonical neighbours (each already canonical),
/// substituting the base at the middle position `m = (L::len()-1)/2`
/// (well-defined for odd `L::len()`). Each of the 4 substitutions is
/// canonicalised independently — this correctly handles the case where a
/// substitution flips the canonical orientation, unlike inferring the
/// variant from a fixed-orientation flank key. One of the 4 equals
/// `self`'s own canonical form (the identity substitution); callers that
/// only want the 3 genuine variants should skip it.
pub fn central_canonical_neighbors(&self) -> [CanonicalKmerOf<L>; 4] {
let k = L::len();
let m = (k - 1) / 2;
let shift = KMER_BITS - 2 - 2 * m;
let cleared = self.0 & !((0b11 as RawKmer) << shift);
[
KmerOf::<L>(cleared | ((0 as RawKmer) << shift), PhantomData).canonical(),
KmerOf::<L>(cleared | ((1 as RawKmer) << shift), PhantomData).canonical(),
KmerOf::<L>(cleared | ((2 as RawKmer) << shift), PhantomData).canonical(),
KmerOf::<L>(cleared | ((3 as RawKmer) << shift), PhantomData).canonical(),
]
}
/// Return the inner value as a raw [`KmerOf<L>`]. /// Return the inner value as a raw [`KmerOf<L>`].
#[inline] #[inline]
pub fn into_kmer(self) -> KmerOf<L> { pub fn into_kmer(self) -> KmerOf<L> {
+42
View File
@@ -210,4 +210,46 @@ mod tests {
check!(31); check!(31);
check!(32); check!(32);
} }
// ── central_canonical_neighbors ─────────────────────────────────────────
#[test]
fn central_canonical_neighbors_hand_checked_k3() {
// k=3, centre = index 1. For "ACG", every one of the 4 central
// substitutions ("AAG","ACG","AGG","ATG") happens to stay in forward
// orientation when canonicalised (verified by hand: each is already
// lexicographically <= its own reverse complement), so this case
// exercises the substitution logic without the RC-flip edge case.
let ck = KmerOf::<ConstLen<3>>::from_ascii(b"ACG").unwrap().canonical();
let neighbours = ck.central_canonical_neighbors();
let ascii: Vec<Vec<u8>> = neighbours.iter().map(|n| n.to_ascii()).collect();
assert_eq!(ascii, vec![b"AAG".to_vec(), b"ACG".to_vec(), b"AGG".to_vec(), b"ATG".to_vec()]);
// The identity substitution (centre unchanged) must reproduce `ck`.
assert!(neighbours.contains(&ck));
}
#[test]
fn central_canonical_neighbors_identity_present_for_various_k() {
macro_rules! check {
($n:expr) => {{
let ck = KmerOf::<ConstLen<$n>>::from_ascii(&make_seq::<$n>())
.unwrap()
.canonical();
let neighbours = ck.central_canonical_neighbors();
assert!(
neighbours.contains(&ck),
"identity substitution missing from central_canonical_neighbors for k={}",
$n
);
// Every returned neighbour must itself already be canonical.
for n in &neighbours {
assert_eq!(n.into_kmer().canonical(), *n, "neighbour not canonical for k={}", $n);
}
}};
}
check!(1);
check!(3);
check!(5);
check!(31);
}
} }
+6
View File
@@ -7,7 +7,13 @@ edition = "2024"
obikseq = { path = "../obikseq" } obikseq = { path = "../obikseq" }
obikrope = { path = "../obikrope" } obikrope = { path = "../obikrope" }
obiread = { path = "../obiread" } obiread = { path = "../obiread" }
obikentropy = { path = "../obikentropy" }
lazy_static = "1.5.0" lazy_static = "1.5.0"
[dev-dependencies] [dev-dependencies]
obikseq = { path = "../obikseq", features = ["test-utils"] } obikseq = { path = "../obikseq", features = ["test-utils"] }
criterion2 = { version = "3", features = ["cargo_bench_support"] }
[[bench]]
name = "superkmer_stream"
harness = false
@@ -0,0 +1,58 @@
//! Throughput of the streaming superkmer pipeline (`RollingStat`'s hot path:
//! minimizer selection + entropy tracking fused in a single pass).
//!
//! Reference point for the `obikentropy` extraction: the entropy bookkeeping
//! that used to live inline in `RollingStat` was pulled out into a composed
//! `EntropyTracker`. This benchmark is run before and after that change to
//! confirm no regression.
use criterion::{Criterion, Throughput, criterion_group, criterion_main};
use obikrope::Rope;
use obiskbuilder::SuperKmerIter;
const K: usize = 21;
const M: usize = 9;
const LEVEL_MAX: usize = 6;
const THETA: f64 = 0.7;
const SEQ_LEN: usize = 200_000;
/// Deterministic pseudo-random ACGT sequence — high enough complexity that
/// the entropy filter rarely rejects, so the bench stays on the steady-state
/// path rather than repeatedly resetting.
fn make_sequence(len: usize) -> Vec<u8> {
let mut state: u64 = 0x9E3779B97F4A7C15;
(0..len)
.map(|_| {
state ^= state << 13;
state ^= state >> 7;
state ^= state << 17;
b"ACGT"[(state % 4) as usize]
})
.collect()
}
fn make_rope(seq: &[u8]) -> Rope {
let mut rope = Rope::new(None);
rope.push(seq.to_vec());
rope
}
fn bench_build_superkmers(c: &mut Criterion) {
obikseq::set_k(K);
obikseq::set_m(M);
let seq = make_sequence(SEQ_LEN);
let rope = make_rope(&seq);
let mut group = c.benchmark_group("build_superkmers");
group.throughput(Throughput::Bytes(SEQ_LEN as u64));
group.bench_function("stream", |b| {
b.iter(|| {
SuperKmerIter::new(std::hint::black_box(&rope), K, LEVEL_MAX, THETA).count()
});
});
group.finish();
}
criterion_group!(benches, bench_build_superkmers);
criterion_main!(benches);
-108
View File
@@ -1,108 +0,0 @@
pub(crate) const NORMK1: [u64; 4] = build_normalized_kmer::<4>();
pub(crate) const NORMK2: [u64; 16] = build_normalized_kmer::<16>();
pub(crate) const NORMK3: [u64; 64] = build_normalized_kmer::<64>();
pub(crate) const NORMK4: [u64; 256] = build_normalized_kmer::<256>();
pub(crate) const NORMK5: [u64; 1024] = build_normalized_kmer::<1024>();
pub(crate) const NORMK6: [u64; 4096] = build_normalized_kmer::<4096>();
include!(concat!(env!("OUT_DIR"), "/ln_class_tables.rs"));
const fn normalize_circular(kmer: u64, ws: usize) -> u64 {
let mask = (1u64 << (ws * 2)) - 1;
let mut canonical = kmer & mask;
let mut current = canonical;
let mut i = 0;
while i < (ws - 1) {
let top = (current >> ((ws - 1) * 2)) & 3;
current = ((current << 2) | top) & mask;
if current < canonical {
canonical = current;
}
i += 1;
}
canonical
}
const fn build_normalized_kmer<const N: usize>() -> [u64; N] {
let mut result = [0u64; N];
let k = k_from_n::<N>();
let shift = 64 - k * 2;
let mut i = 0;
while i < N {
let la = (i as u64) << shift;
let ra = i as u64;
let rc_ra = revcomp_raw(la, k) >> shift;
let circ = normalize_circular(ra, k);
let circ_rc = normalize_circular(rc_ra, k);
result[i] = if circ < circ_rc { circ } else { circ_rc };
i += 1;
}
result
}
const fn revcomp_raw(x: u64, k: usize) -> u64 {
let x = !x;
let x = x.swap_bytes();
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
x << (64 - 2 * k)
}
const fn k_from_n<const N: usize>() -> usize {
match N {
4 => 1,
16 => 2,
64 => 3,
256 => 4,
1024 => 5,
4096 => 6,
_ => panic!("N must be a power of 4"),
}
}
pub(crate) const WS_MAX: usize = 6;
#[inline(always)]
pub(crate) const fn n_log_n(n: usize) -> f64 {
N_LOG_N[n]
}
#[inline(always)]
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
EMAX[k][ws]
}
#[inline(always)]
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
LOG_NWORDS[k][ws]
}
#[inline(always)]
pub(crate) const fn entropy_norm_kmer<const LEFT: bool, const K: usize>(kmer: u64) -> u64 {
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
const NORM: [&[u64]; 7] = [&[], &NORMK1, &NORMK2, &NORMK3, &NORMK4, &NORMK5, &NORMK6];
let shift = SHIFT[K];
let ra = if LEFT { kmer >> shift } else { kmer };
let canonical_ra = NORM[K][ra as usize];
if LEFT {
canonical_ra << shift
} else {
canonical_ra
}
}
#[inline(always)]
pub(crate) const fn ln_class_size<const LEFT: bool, const K: usize>(kmer: u64) -> f64 {
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
let ra = if LEFT { kmer >> SHIFT[K] } else { kmer };
match K {
1 => LN_CLASS1[ra as usize],
2 => LN_CLASS2[ra as usize],
3 => LN_CLASS3[ra as usize],
4 => LN_CLASS4[ra as usize],
5 => LN_CLASS5[ra as usize],
6 => LN_CLASS6[ra as usize],
_ => panic!("k must be 1..=6"),
}
}
+2 -154
View File
@@ -149,157 +149,5 @@ impl Iterator for SuperKmerIter<'_> {
// ── tests ───────────────────────────────────────────────────────────────────── // ── tests ─────────────────────────────────────────────────────────────────────
#[cfg(test)] #[cfg(test)]
mod tests { #[path = "tests/iter.rs"]
use super::*; mod tests;
use obikrope::Rope;
fn setup() {
obikseq::params::set_k(K);
obikseq::params::set_m(5);
}
fn make_rope(data: &[u8]) -> Rope {
let mut r = Rope::new(None);
r.push(data.to_vec());
r
}
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
let rope = make_rope(data);
SuperKmerIter::new(&rope, k, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect()
}
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
const K: usize = 11;
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
(0..seq.len().saturating_sub(K - 1))
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
.collect()
}
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
SuperKmerIter::new(rope, K, 1, 0.0)
.flat_map(|rsk| {
rsk.superkmer()
.iter_canonical_kmers()
.map(|km| km.to_ascii())
.collect::<Vec<_>>()
})
.collect()
}
#[test]
fn coverage_single_segment() {
setup();
let seq = b"ACGTACGTACGTACGTACGT";
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
let direct = direct_canonical_kmers(seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans segment unique : {missing:?}"
);
}
#[test]
fn coverage_two_segments() {
setup();
let seg1 = b"ACGTACGTACGTACGTACGT";
let seg2 = b"TGCATGCATGCATGCATGCA";
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
let mut direct = direct_canonical_kmers(seg1);
direct.extend(direct_canonical_kmers(seg2));
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans deux segments : {missing:?}"
);
}
#[test]
fn coverage_minimizer_boundary() {
setup();
// sequence assez longue pour forcer plusieurs changements de minimiseur
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
let direct = direct_canonical_kmers(&seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus à la frontière de minimiseur : {missing:?}"
);
}
#[test]
fn single_segment_one_superkmer() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
assert!(!out.is_empty());
let total: Vec<u8> = out.into_iter().flatten().collect();
assert!(total.len() >= K);
}
#[test]
fn segment_shorter_than_k_emits_nothing() {
setup();
let out = run_nofilter(b"ACGTACGT\x00", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn empty_input_emits_nothing() {
setup();
let out = run_nofilter(b"", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn two_segments_both_emitted() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
assert!(!out.is_empty());
}
#[test]
fn low_complexity_kmer_is_rejected() {
setup();
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
assert!(!out_pass.is_empty());
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(out_reject.is_empty());
}
#[test]
fn multi_slice_rope() {
setup();
let data = b"ACGTACGTACGTACGTACGT\x00";
let mid = data.len() / 2;
let mut rope = Rope::new(None);
rope.push(data[..mid].to_vec());
rope.push(data[mid..].to_vec());
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(!out.is_empty());
}
#[test]
fn yields_minimizer_value() {
setup();
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
assert!(!results.is_empty());
}
}
+2 -2
View File
@@ -10,8 +10,8 @@ pub mod stream_iter;
mod scratch; mod scratch;
pub(crate) mod encoding; pub(crate) mod encoding;
pub(crate) mod entropy_table; #[allow(missing_docs)]
pub(crate) mod rolling_stat; pub mod rolling_stat;
pub use iter::SuperKmerIter; pub use iter::SuperKmerIter;
pub use scratch::SuperKmerScratch; pub use scratch::SuperKmerScratch;
+10 -255
View File
@@ -1,8 +1,8 @@
use obikentropy::EntropyTracker;
use obikseq::kmer::{Minimizer, hash_kmer}; use obikseq::kmer::{Minimizer, hash_kmer};
use obikseq::params; use obikseq::params;
use crate::encoding::encode_nuc; use crate::encoding::encode_nuc;
use crate::entropy_table::{WS_MAX, emax, entropy_norm_kmer, ln_class_size, log_nwords, n_log_n};
// ── Stack-allocated ring buffer ─────────────────────────────────────────────── // ── Stack-allocated ring buffer ───────────────────────────────────────────────
@@ -83,33 +83,19 @@ pub struct RollingStat {
entropy_max_k: usize, entropy_max_k: usize,
k: usize, k: usize,
m: usize, m: usize,
steady: bool,
rolling_k: u64, rolling_k: u64,
rolling_rck: u64, rolling_rck: u64,
k_mask: u64, k_mask: u64,
m_mask: u64, m_mask: u64,
received: usize, received: usize,
// Sliding-window queues — stack-allocated, capacity ≤ k ≤ 31. // Minimizer selection state.
k1q: Ring<u64, 32>,
k2q: Ring<u64, 32>,
k3q: Ring<u64, 32>,
k4q: Ring<u64, 32>,
k5q: Ring<u64, 32>,
k6q: Ring<u64, 32>,
minimier: Ring<MmerItem, 32>, minimier: Ring<MmerItem, 32>,
// Frequency count arrays. // Entropy tracking, composed as a plain inline field so both concerns
// Max count per cell ≤ k ≤ 31 → u8 is sufficient. // update in the same streaming pass without being conflated in one
k1c: [u8; 4], // struct — see `obikentropy::EntropyTracker`.
k2c: [u8; 16], entropy: EntropyTracker,
k3c: [u8; 64],
k4c: [u8; 256],
k5c: [u8; 1024],
k6c: [u8; 4096],
sum_f_log_f: [f64; WS_MAX + 1],
sum_f_log_s: [f64; WS_MAX + 1],
} }
impl RollingStat { impl RollingStat {
@@ -120,27 +106,13 @@ impl RollingStat {
entropy_max_k, entropy_max_k,
k, k,
m, m,
steady: false,
rolling_k: 0, rolling_k: 0,
rolling_rck: 0, rolling_rck: 0,
k_mask: (!0u64) >> (64 - k * 2), k_mask: (!0u64) >> (64 - k * 2),
m_mask: (!0u64) >> (64 - m * 2), m_mask: (!0u64) >> (64 - m * 2),
received: 0, received: 0,
k1q: Ring::new(),
k2q: Ring::new(),
k3q: Ring::new(),
k4q: Ring::new(),
k5q: Ring::new(),
k6q: Ring::new(),
minimier: Ring::new(), minimier: Ring::new(),
k1c: [0; 4], entropy: EntropyTracker::new(k),
k2c: [0; 16],
k3c: [0; 64],
k4c: [0; 256],
k5c: [0; 1024],
k6c: [0; 4096],
sum_f_log_f: [0.0; WS_MAX + 1],
sum_f_log_s: [0.0; WS_MAX + 1],
} }
} }
@@ -148,54 +120,9 @@ impl RollingStat {
self.rolling_k = 0; self.rolling_k = 0;
self.rolling_rck = 0; self.rolling_rck = 0;
self.received = 0; self.received = 0;
self.steady = false;
// for i in self.k1q.iter() { self.k1c[i as usize] = 0; }
// for i in self.k2q.iter() { self.k2c[i as usize] = 0; }
// for i in self.k3q.iter() { self.k3c[i as usize] = 0; }
// for i in self.k4q.iter() { self.k4c[i as usize] = 0; }
// for i in self.k5q.iter() { self.k5c[i as usize] = 0; }
// for i in self.k6q.iter() { self.k6c[i as usize] = 0; }
self.k1c.fill(0);
self.k2c.fill(0);
self.k3c.fill(0);
self.k4c.fill(0);
self.k5c.fill(0);
self.k6c.fill(0);
self.k1q.clear();
self.k2q.clear();
self.k3q.clear();
self.k4q.clear();
self.k5q.clear();
self.k6q.clear();
self.minimier.clear(); self.minimier.clear();
self.entropy.reset();
self.sum_f_log_f = [0.0; WS_MAX + 1];
self.sum_f_log_s = [0.0; WS_MAX + 1];
}
#[inline]
fn update_sums_decrement<const K: usize>(
sum_f_log_f: &mut [f64; WS_MAX + 1],
sum_f_log_s: &mut [f64; WS_MAX + 1],
canonical: u64,
f: usize,
) {
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
sum_f_log_s[K] -= ln_class_size::<false, K>(canonical);
}
#[inline]
fn update_sums_increment<const K: usize>(
sum_f_log_f: &mut [f64; WS_MAX + 1],
sum_f_log_s: &mut [f64; WS_MAX + 1],
canonical: u64,
g: usize,
) {
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
sum_f_log_s[K] += ln_class_size::<false, K>(canonical);
} }
pub fn push(&mut self, nuc: u8) { pub fn push(&mut self, nuc: u8) {
@@ -209,13 +136,6 @@ impl RollingStat {
self.rolling_rck = self.rolling_rck =
((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask; ((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask;
let canonical_k1 = entropy_norm_kmer::<false, 1>(self.rolling_k & 3);
let canonical_k2 = entropy_norm_kmer::<false, 2>(self.rolling_k & 15);
let canonical_k3 = entropy_norm_kmer::<false, 3>(self.rolling_k & 63);
let canonical_k4 = entropy_norm_kmer::<false, 4>(self.rolling_k & 255);
let canonical_k5 = entropy_norm_kmer::<false, 5>(self.rolling_k & 1023);
let canonical_k6 = entropy_norm_kmer::<false, 6>(self.rolling_k & 4095);
self.received += 1; self.received += 1;
if self.received >= m { if self.received >= m {
@@ -248,153 +168,7 @@ impl RollingStat {
} }
} }
if self.received > k { self.entropy.push(self.received, self.rolling_k);
let old1 = self.k1q.pop_front();
let f1 = self.k1c[old1 as usize] as usize;
Self::update_sums_decrement::<1>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old1,
f1,
);
self.k1c[old1 as usize] -= 1;
let old2 = self.k2q.pop_front();
let f2 = self.k2c[old2 as usize] as usize;
Self::update_sums_decrement::<2>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old2,
f2,
);
self.k2c[old2 as usize] -= 1;
let old3 = self.k3q.pop_front();
let f3 = self.k3c[old3 as usize] as usize;
Self::update_sums_decrement::<3>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old3,
f3,
);
self.k3c[old3 as usize] -= 1;
let old4 = self.k4q.pop_front();
let f4 = self.k4c[old4 as usize] as usize;
Self::update_sums_decrement::<4>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old4,
f4,
);
self.k4c[old4 as usize] -= 1;
let old5 = self.k5q.pop_front();
let f5 = self.k5c[old5 as usize] as usize;
Self::update_sums_decrement::<5>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old5,
f5,
);
self.k5c[old5 as usize] -= 1;
let old6 = self.k6q.pop_front();
let f6 = self.k6c[old6 as usize] as usize;
Self::update_sums_decrement::<6>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old6,
f6,
);
self.k6c[old6 as usize] -= 1;
}
if self.steady {
let g1 = self.k1c[canonical_k1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
self.k1c[canonical_k1 as usize] += 1;
self.k1q.push_back(canonical_k1);
let g2 = self.k2c[canonical_k2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
self.k2c[canonical_k2 as usize] += 1;
self.k2q.push_back(canonical_k2);
let g3 = self.k3c[canonical_k3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
self.k3c[canonical_k3 as usize] += 1;
self.k3q.push_back(canonical_k3);
let g4 = self.k4c[canonical_k4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
self.k4c[canonical_k4 as usize] += 1;
self.k4q.push_back(canonical_k4);
let g5 = self.k5c[canonical_k5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
self.k5c[canonical_k5 as usize] += 1;
self.k5q.push_back(canonical_k5);
let g6 = self.k6c[canonical_k6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
self.k6c[canonical_k6 as usize] += 1;
self.k6q.push_back(canonical_k6);
} else {
self.push_warmup_increments(
canonical_k1, canonical_k2, canonical_k3,
canonical_k4, canonical_k5, canonical_k6,
);
}
}
#[cold]
#[inline(never)]
fn push_warmup_increments(
&mut self,
canonical_k1: u64, canonical_k2: u64, canonical_k3: u64,
canonical_k4: u64, canonical_k5: u64, canonical_k6: u64,
) {
let g1 = self.k1c[canonical_k1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
self.k1c[canonical_k1 as usize] += 1;
self.k1q.push_back(canonical_k1);
if self.received >= 2 {
let g2 = self.k2c[canonical_k2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
self.k2c[canonical_k2 as usize] += 1;
self.k2q.push_back(canonical_k2);
if self.received >= 3 {
let g3 = self.k3c[canonical_k3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
self.k3c[canonical_k3 as usize] += 1;
self.k3q.push_back(canonical_k3);
if self.received >= 4 {
let g4 = self.k4c[canonical_k4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
self.k4c[canonical_k4 as usize] += 1;
self.k4q.push_back(canonical_k4);
if self.received >= 5 {
let g5 = self.k5c[canonical_k5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
self.k5c[canonical_k5 as usize] += 1;
self.k5q.push_back(canonical_k5);
if self.received >= 6 {
let g6 = self.k6c[canonical_k6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
self.k6c[canonical_k6 as usize] += 1;
self.k6q.push_back(canonical_k6);
self.steady = true;
}
}
}
}
}
} }
pub fn ready(&self) -> bool { pub fn ready(&self) -> bool {
@@ -422,29 +196,10 @@ impl RollingStat {
.map(|raw| Minimizer::from_raw_unchecked(raw << (64 - self.m * 2))) .map(|raw| Minimizer::from_raw_unchecked(raw << (64 - self.m * 2)))
} }
pub fn entropy(&self, order: usize) -> Option<f64> {
if !self.ready() {
return None;
}
let k = self.k;
let em = emax(k, order);
if em <= 0.0 {
return Some(1.0);
}
let nwords = k - order + 1;
let log_nw = log_nwords(k, order);
let nw_f = nwords as f64;
let h_corr = log_nw + (self.sum_f_log_s[order] - self.sum_f_log_f[order]) / nw_f;
Some((h_corr / em).max(0.0))
}
pub fn normalized_entropy(&self) -> Option<f64> { pub fn normalized_entropy(&self) -> Option<f64> {
if !self.ready() { if !self.ready() {
return None; return None;
} }
let min_e = (1..=self.entropy_max_k) Some(self.entropy.normalized_entropy(self.entropy_max_k))
.filter_map(|ws| self.entropy(ws))
.fold(f64::MAX, f64::min);
Some(if min_e == f64::MAX { 1.0 } else { min_e })
} }
} }
+152
View File
@@ -0,0 +1,152 @@
use super::*;
use obikrope::Rope;
fn setup() {
obikseq::params::set_k(K);
obikseq::params::set_m(5);
}
fn make_rope(data: &[u8]) -> Rope {
let mut r = Rope::new(None);
r.push(data.to_vec());
r
}
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
let rope = make_rope(data);
SuperKmerIter::new(&rope, k, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect()
}
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
const K: usize = 11;
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
(0..seq.len().saturating_sub(K - 1))
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
.collect()
}
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
SuperKmerIter::new(rope, K, 1, 0.0)
.flat_map(|rsk| {
rsk.superkmer()
.iter_canonical_kmers()
.map(|km| km.to_ascii())
.collect::<Vec<_>>()
})
.collect()
}
#[test]
fn coverage_single_segment() {
setup();
let seq = b"ACGTACGTACGTACGTACGT";
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
let direct = direct_canonical_kmers(seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans segment unique : {missing:?}"
);
}
#[test]
fn coverage_two_segments() {
setup();
let seg1 = b"ACGTACGTACGTACGTACGT";
let seg2 = b"TGCATGCATGCATGCATGCA";
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
let mut direct = direct_canonical_kmers(seg1);
direct.extend(direct_canonical_kmers(seg2));
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans deux segments : {missing:?}"
);
}
#[test]
fn coverage_minimizer_boundary() {
setup();
// sequence assez longue pour forcer plusieurs changements de minimiseur
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
let direct = direct_canonical_kmers(&seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus à la frontière de minimiseur : {missing:?}"
);
}
#[test]
fn single_segment_one_superkmer() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
assert!(!out.is_empty());
let total: Vec<u8> = out.into_iter().flatten().collect();
assert!(total.len() >= K);
}
#[test]
fn segment_shorter_than_k_emits_nothing() {
setup();
let out = run_nofilter(b"ACGTACGT\x00", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn empty_input_emits_nothing() {
setup();
let out = run_nofilter(b"", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn two_segments_both_emitted() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
assert!(!out.is_empty());
}
#[test]
fn low_complexity_kmer_is_rejected() {
setup();
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
assert!(!out_pass.is_empty());
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(out_reject.is_empty());
}
#[test]
fn multi_slice_rope() {
setup();
let data = b"ACGTACGTACGTACGTACGT\x00";
let mid = data.len() / 2;
let mut rope = Rope::new(None);
rope.push(data[..mid].to_vec());
rope.push(data[mid..].to_vec());
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(!out.is_empty());
}
#[test]
fn yields_minimizer_value() {
setup();
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
assert!(!results.is_empty());
}