Compare commits

...
21 Commits
Author SHA1 Message Date
Eric Coissac c95c47155e fix: resolve test race conditions, add logging, and fix CI deadlock
Release / create-release (push) Successful in 2m26s
ci.yml / build (pull_request) Successful in 4m4s
Release / build-linux-x86_64 (push) Successful in 8m19s
Release / build-macos-arm64 (push) Successful in 1m48s
Re-enables the `numa` feature in CI workflows to prevent container/cgroup deadlocks while preserving validation correctness. Fixes concurrent test race conditions by replacing thread-local parameter storage with process-wide atomics and mutex locks. Integrates `tracing-subscriber` for structured logging and adds thread-ID tracking to debug worker lifecycles. Additionally bumps the crate version, updates `.gitignore`, documents experimental evolutionary distance pipelines, and refactors hardcoded test constants.
2026-08-11 23:04:06 +02:00
coissac 4f6d442688 Merge pull request 'ci: disable numa feature, bump obikmer, and document Sankoff costs' (#65) from push-oruynkvporsn into main
Reviewed-on: #65
2026-08-11 16:28:07 +00:00
Eric Coissac e6f0ca472c ci: disable numa feature, bump obikmer, and document Sankoff costs
Release / create-release (push) Successful in 2m28s
ci.yml / build (pull_request) Failing after 3h0m41s
Release / build-linux-x86_64 (push) Successful in 8m31s
Release / build-macos-arm64 (push) Successful in 1m53s
Disable the `numa` default feature in CI build and test steps to prevent container environment deadlocks, and add comments explaining the cache key salt bump (`v2`) to mitigate incremental compilation corruption. Document a 16-state Sankoff cost matrix derived from set-edit distances, including substitution, gain/loss, and context-disappearance costs compatible with TNT's interface. Bump `obikmer` crate version to 1.1.43.
2026-08-11 18:26:54 +02:00
coissac 442f7a9e4c Merge pull request 'chore: update ci cache, document distance metrics, and bump version' (#64) from push-wpxsvyylwmsq into main
Reviewed-on: #64
2026-08-11 15:17:42 +00:00
Eric Coissac a63692b8c4 chore: update ci cache, document distance metrics, and bump version
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m43s
Release / build-macos-arm64 (push) Successful in 2m7s
ci.yml / build (pull_request) Canceled after 59m15s
Updated CI workflow cache keys with a `v2` salt and `Cargo.lock` hash to prevent stale incremental compilation caches and deadlocks, while updating restore keys and documenting interrupted job state. Introduced a 3-way ordinal distance metric framework that replaces ambiguous IUPAC encoding with explicit k-mer scoring, bridging pairwise methods to character-based phylogenetics via Sankoff parsimony. Bumped the `obikmer` crate version to 1.1.42.
2026-08-11 17:12:28 +02:00
coissac fa82989ea9 Merge pull request 'refactor: centralize CPU core detection using cgroup-aware utility' (#63) from push-lqzukpulzykz into main
Reviewed-on: #63
2026-08-11 10:35:06 +00:00
Eric Coissac 5f95e866f8 refactor: centralize CPU core detection using cgroup-aware utility
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Successful in 1m43s
ci.yml / build (pull_request) Canceled after 1h29m17s
Introduce `obisys::effective_parallelism()` to read Linux cgroup v1/v2 CPU quotas from sysfs, preventing thread pool oversubscription in containerized environments. Replace direct `std::thread::available_parallelism()` calls across `obikindex` and `obikmer` with this centralized function. Bump `obikmer` version to 1.1.41.
2026-08-11 12:23:05 +02:00
coissac 2e7cfc4368 Merge pull request 'Push lsqnpxrxuvpp' (#62) from push-lsqnpxrxuvpp into main
Reviewed-on: #62
2026-08-11 09:09:23 +00:00
Eric Coissac f5e508ed33 feat: add multi-genome SNP pseudo-alignment and CLI export
Release / create-release (push) Successful in 5m58s
Release / build-macos-arm64 (push) Successful in 2m47s
Release / build-linux-x86_64 (push) Successful in 8m50s
CI / build (pull_request) Canceled after 5m42s
Introduces a `SnpAlignment` struct and helper methods to construct per-genome SNP pseudo-alignments from sibling k-mer data, filtering monomorphic families and encoding bases as IUPAC ambiguity codes. Exposes the type at the crate root for simplified imports. Adds a `--snp` CLI flag to compute and export these alignments as an IUPAC-coded FASTA file. Updates theory documentation to propose a multi-genome framing approach for joint phylogenetic inference, resolving pairwise correspondence ambiguities through positional homology and partial coverage thresholds. Bumps crate version to 1.1.40.
2026-08-10 22:38:38 +02:00
Eric Coissac 49f329edd5 feat: add raw SNP distance calculation and CLI flag
Exposes RawSnpDistanceOutput and implements KmerIndex::raw_snp_distance() to compute pairwise single-copy locus counts under a paralogy-aware rule. The implementation leverages ndarray for parallel matrix aggregation, producing raw p-distance matrices for sanity-checking. A --raw-snp-distance CLI flag is added to export results as CSV, mapping zero-eligible pairs to NA.
2026-08-10 22:17:07 +02:00
Eric Coissac 1a470eab9e Refactor k-mer sibling tracking to compact bitmask and on-demand counts
Replaces the explicit `SiblingInfo` struct and 3-bit minorant flags with a derived 4-bit presence mask (`FamilyMask`) that tracks observed bases per family. This eliminates redundant file I/O overhead by introducing a `PartitionCache` for batch lookups, simplifies serialization, and updates all downstream builders, stats computation, and tests to operate on the new bitmask representation. Adjusts CLI output to report deduplicated family sizes instead of histograms, ignores generated CSV files, and updates documentation to reflect the fixed canonical reference and new theory.
2026-08-10 17:53:52 +02:00
Eric Coissac ba990a48a0 feat: add obipipeline for concurrent sibling annex stats
Add the `obipipeline` crate and replace sequential scatter/gather logic with a concurrent pipeline using `Flat` and `Transform` stages. Introduce `SiblingAnnexStats` API to compute distributions, and add CLI flags to `distance.rs` for constructing the annex and exporting statistics as CSV.
2026-08-10 15:31:04 +02:00
Eric Coissac ea914bb536 feat: implement per-k-mer sibling counts and central neighbor generation
Introduce the siblingannex module in obicompactvec to store per-slot minorant flags and sibling counts in a memory-mapped annex file. Add a scatter-gather pipeline in obikindex to compute these values across index layers and write them to .psib files. Implement central_canonical_neighbors in obikseq for generating strand-aware k-mer variants around the middle base. Expose rolling statistics in obiskbuilder and update dependency graphs accordingly.
2026-08-10 15:01:59 +02:00
Eric Coissac 8bc6d533e5 feat: support negative count filters as group size offsets
Updates CLI parsing to accept negative integers for count filters, interpreting them as offsets from the group size (e.g., `-1` means all but one). A resolution closure enforces a floor of 1 to prevent unconstrained filtering on small groups. Additionally, refines evolutionary distance documentation to condition comparisons on local homology, replacing union-based Jaccard with a self-contained `SnpTally`. This unified approach streamlines SNP and shared count computation, incorporates paralogy and heterozygosity handling, and enables direct derivation of corrected distance matrices without external dependencies.
2026-08-10 12:38:35 +02:00
Eric Coissac 45df9919e5 docs: add central-position SNP distance estimator spec
Introduces a design specification for inferring substitution rates directly from k-mers with conserved flanks. The document details a memory-efficient implementation that computes 4x4 base-pair tallies using existing MPHF structures, enabling classical corrections without de Bruijn graph materialization. Updates MkDocs navigation to include the new theory page.
2026-07-10 09:49:49 +02:00
Eric Coissac 2610a4af79 feat: add Mash distance metric and rolling entropy support
Implement the Mash distance metric across the CLI, index, and compact vector traits. This includes adding a `Mash` variant to the `DistanceMetric` enum and `MetricArg` CLI argument, implementing the conversion from Jaccard distances using the standard mutation-rate estimator formula, and updating documentation with supported metrics and algorithmic references. Additionally, add an `entropy` method to rolling statistics for computing order-specific entropy.
2026-07-09 11:40:48 +02:00
coissac dc3392865f Merge pull request 'Push qowsvpqmoukq' (#61) from push-qowsvpqmoukq into main
Reviewed-on: #61
2026-07-08 18:05:42 +00:00
Eric Coissac fd2c23e7df refactor: remove equivalence class folding from entropy pipeline
Release / create-release (push) Successful in 2m27s
Release / build-linux-x86_64 (push) Successful in 8m17s
Release / build-macos-arm64 (push) Successful in 1m41s
CI / build (pull_request) Successful in 3m33s
Removes circular-reverse complement machinery and explicit k-mer canonicalization across the entropy pipeline. Frequency tallying and Shannon entropy computation now operate directly on raw k-mer values, eliminating prior score inflation and alignment-dependent artifacts while preserving orientation invariance. Updates build scripts to generate normalized lookup tables for k-mer lengths 1–6, restricts the public API to `EntropyTracker`, and bumps crate versions. Documentation is updated to reflect the simplified raw-value approach and revised module structure.
2026-07-08 19:36:30 +02:00
Eric Coissac 912f788f7f feat: extract k-mer entropy computation into new obikentropy crate
Extracts streaming entropy logic and sliding-window frequency tracking from obiskbuilder into a dedicated obikentropy crate. Introduces an EntropyTracker accumulator for O(1) per-base normalized Shannon entropy, replaces inline rolling statistics with delegated state management, and updates workspace dependencies across obikindex, obikpartitionner, and obiskbuilder. Adds criterion benchmarks to validate the refactored pipeline throughput.
2026-07-08 18:36:16 +02:00
Eric Coissac e725523898 feat: add entropy-driven k-mer complexity filtering
Introduces a MinComplexity filter driven by new CLI arguments, enabling sequence-aware threshold checks during index reconstruction and partitioning. Adds the kmer_entropy module for normalized complexity scoring, updates the KmerFilter trait to evaluate per-kmer context, and refactors test modules for better organization.
2026-07-08 12:48:25 +02:00
coissac 165982fb07 Merge pull request 'Bump obikmer version to 1.1.38 and add memory footprint logging' (#60) from push-slxmykzqmzzv into main
Reviewed-on: #60
2026-07-08 10:15:51 +00:00
52 changed files with 3928 additions and 700 deletions
+3 -3
View File
@@ -1,4 +1,4 @@
name: CI
pname: CI
on:
pull_request:
@@ -25,8 +25,8 @@ jobs:
~/.cargo/registry
~/.cargo/git
src/target
key: ${{ runner.os }}-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: ${{ runner.os }}-cargo-
key: ${{ runner.os }}-cargo-v2-${{ hashFiles('src/Cargo.lock') }}
restore-keys: ${{ runner.os }}-cargo-v2-
- name: Build
run: cargo build --release
+3
View File
@@ -9,6 +9,7 @@ data-stress
./**/*.json
*.bin
*.log
*.csv
Betula_exilis--IGA-24-33
benchmark/genomes
benchmark/simulated_data
@@ -23,3 +24,5 @@ benchmark/reference_dist
benchmark/obikmer_dist
benchmark/specific_index_count
benchmark/specific_index_presence
TNT
phyg
+45 -4
View File
@@ -92,18 +92,48 @@ For each genome:
| Flag | Applies to | Meaning |
|------|-----------|---------|
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes |
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes |
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes (N may be negative, see below) |
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes (N may be negative, see below) |
| `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes |
| `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes |
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes |
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes |
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes (N may be negative, see below) |
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes (N may be negative, see below) |
| `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes |
| `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes |
| `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`filter` only) |
| `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`filter` only) |
| `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) |
### Negative counts — offset from group size
The four integer count flags (`--min-count`, `--max-count`, `--min-outgroup-count`,
`--max-outgroup-count`) accept **negative** values, interpreted as an offset counted
down from the group size `n`, resolved at run time once `n` is known:
| Value | Effective threshold |
|-------|---------------------|
| `N ≥ 0` | literal absolute count `N` |
| `-x` (x > 0) | `max(1, n x)` — "all but x" |
`-1` literally means *all but one*, `-2` *all but two*, and so on. This expresses
a quorum relative to the group size that a plain fraction cannot state exactly
(e.g. "present in every genome except at most one" is `n1`, which is `0.9` for
`n = 10` but `0.857…` for `n = 7`).
The threshold is **floored at 1**, never 0: the negative form always keeps
constraining the group. Without the floor, `--min-count -1` on a singleton
ingroup (`n = 1`) would resolve to `0` ("at least 0") and silently drop the
constraint; the floor makes it `1` ("present in that one genome") instead.
To express a count of `0` (e.g. "absent from the ingroup"), use the literal `0`,
not a negative — `0` and `-0` are indistinguishable, so the offset form starts at
`-1`.
> **Edge case** — on an *empty* group (`n = 0`, e.g. a predicate matching no
> genome), a negative count still resolves to `1`, an impossible constraint that
> rejects every k-mer. This is consistent with an empty group letting nothing
> through, but differs from the "no constraint" behaviour of the fraction flags.
**Conditional defaults** — the defaults for `--min-frac` and `--max-outgroup-count` depend on two conditions:
whether the corresponding group was declared, **and** whether any quorum flag for that group was explicitly set.
@@ -215,6 +245,17 @@ obikmer filter src --output dst \
--max-outgroup-count 0
```
Noise-tolerant core — keep k-mers present in *all but one* ingroup genome
(`-1` = `n1`) and absent from *all but one* of the outgroup:
```sh
obikmer filter src --output dst \
--ingroup "genus=Betula" \
--outgroup "*" \
--min-count -1 \
--max-outgroup-count -1
```
To dump only k-mers specific to *Betula nana*:
```sh
+13
View File
@@ -347,11 +347,24 @@ Provided finalisations:
| `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` |
| `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` |
| `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` |
| `threshold_mash_dist_matrix(k, t)` | Mash distance, derived from `threshold_jaccard_dist_matrix(t)` — no separate partial |
### BitPartials
Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)`, `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions.
Provided finalisations also include `jaccard_dist_matrix()`, `hamming_dist_matrix()`, and `mash_dist_matrix(k)`.
### Mash distance
`mash_dist_matrix`/`threshold_mash_dist_matrix` add no new additive primitive: both are a pointwise transform of the existing Jaccard distance matrix, per the Mash mutation-rate estimator [@Mash-distances-doc; @Fan2015-mash-formula]:
```
D = -1/k · ln(2J / (1+J)), J = 1 - d_jaccard
```
`J ≤ 0` (i.e. `d_jaccard ≥ 1`, no shared k-mers) maps to `D = 1` (maximal distance) rather than the `ln` singularity at `J = 0`.
---
## Temp-file-backed types
+1 -1
View File
@@ -13,7 +13,7 @@
| `query` | Query an index with sequences and annotate matches |
| `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the shared [kmer filtering](implementation/filtering.md) system; `--head N` limits output to the first N k-mers |
| `annotate` | Add or update genome metadata from a CSV file; or dump metadata as CSV |
| `distance` | Compute pairwise distance matrix between genomes; optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard on count indexes (default 1) |
| `distance` | Compute pairwise distance matrix between genomes (`--metric jaccard\|mash\|hamming\|bray-curtis\|relfreq-bray-curtis\|euclidean\|relfreq-euclidean\|hellinger\|hellinger-euclidean`); optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard/Mash on count indexes (default 1) |
| `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the shared [kmer filtering](implementation/filtering.md) system |
| `select` | Project and/or aggregate genome columns into a new or in-place index; the column-axis counterpart of `filter` (see [select](implementation/select.md)) |
| `estimate` | Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing |
+18
View File
@@ -241,3 +241,21 @@
volume = 33,
year = 2017,
bdsk-url-1 = {http://dx.doi.org/10.1093/bioinformatics/btw832}}
@misc{Mash-distances-doc,
author = {{Marbl Lab}},
howpublished = {Mash documentation},
title = {Mash Distance},
url = {https://mash.readthedocs.io/en/latest/distances.html},
urldate = {2026-07-09},
year = 2026}
@article{Fan2015-mash-formula,
author = {Fan, Huan and Ives, Anthony R and Surget-Groba, Yann and Cannon, Charles H},
doi = {10.1186/s12864-015-1647-5},
journal = {BMC Genomics},
number = 1,
title = {An assembly and alignment-free method of phylogeny reconstruction from next-generation sequencing data},
url = {https://doi.org/10.1186/s12864-015-1647-5},
volume = 16,
year = 2015}
+32 -16
View File
@@ -1,6 +1,6 @@
# Kmer entropy filter
Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for two sources of bias: the small number of observations within a single kmer, and the unequal sizes of circular equivalence classes.
Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for one source of bias: the small number of observations within a single kmer relative to the number of possible sub-words.
## Sub-word frequencies
@@ -8,17 +8,15 @@ For a kmer of length k and a sub-word size ws (1 ≤ ws ≤ ws_max, typically ws
$$w_i = \text{kmer}[i \mathinner{..} i+ws-1], \quad i = 0, \ldots, n_{\text{words}}-1$$
Each sub-word is mapped to its **circular canonical form**: the lexicographic minimum among all cyclic rotations of the word **and all cyclic rotations of its reverse complement**. This extended equivalence relation ensures that entropy(K) = entropy(revcomp(K)) — the filter is strand-symmetric. Let $s_j$ be the size of equivalence class $j$ (number of distinct raw words mapping to canonical form $j$), and $f_j$ the count of canonical form $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$).
Each sub-word is tallied under its own raw 2-bit-packed value — **no canonicalization**. Let $f_j$ be the count of raw word $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$), over the $4^{ws}$ possible raw words.
An earlier version of this filter first folded each sub-word into a circular+reverse-complement equivalence class, then "unfolded" the observed class frequency back onto its members to correct for unequal class sizes. That machinery bought nothing it was claimed for — see *Why no equivalence classes* below — while measurably weakening detection of the very sequences the filter exists to catch, so it was removed.
## Corrected Shannon entropy
The circular equivalence classes have unequal sizes: under a uniform distribution over all $4^{ws}$ raw words, class $j$ is visited with probability $s_j / 4^{ws}$, not $1/n_a$. Computing entropy directly over canonical classes therefore underestimates the entropy of a random sequence.
$$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j$$
The correction "unfolds" each canonical class back to its member raw words, redistributing each observation of class $j$ equally among its $s_j$ members:
$$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j + \frac{1}{n_{\text{words}}} \sum_j f_j \log s_j$$
The last term is the correction for unequal class sizes. For a uniformly random sequence ($f_j \approx n_{\text{words}} \cdot s_j / 4^{ws}$), this gives $H_{\text{corr}} \approx \log(4^{ws}) = 2 \cdot ws \cdot \log 2$, the maximum entropy over raw words.
This is a plain Shannon entropy over the observed raw-word frequencies.
## Maximum entropy correction for small samples
@@ -42,27 +40,45 @@ $$\text{entropy}(kmer) = \min_{ws=1}^{ws_{\max}} \hat{H}(ws)$$
A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if $\text{entropy}(kmer) < \theta$, where $\theta$ is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc.
## Why no equivalence classes
A prior design folded each sub-word into the canonical form of its circular-rotation + reverse-complement equivalence class before tallying, on the reasoning that (a) it guarantees $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, and (b) collapsing phase-shifted repeats (e.g. `ATG``TGA``GAT`) into one class better reflects that they are "the same" low-complexity pattern.
Both properties already hold for the raw, unfolded entropy above, without any class machinery:
- **Reverse complement**: for any K of length n, window $j$ of $\text{revcomp}(K)$ equals $\text{revcomp}$ of window $(n{-}ws{-}j)$ of K. This is a bijection between the window sets under which each window maps to its own revcomp — and revcomp is itself a bijection (involution) on the space of raw ws-mers. So the multiset of raw-word frequencies for $\text{revcomp}(K)$ is exactly a relabeling of the multiset for K, and Shannon entropy — a function of the frequency multiset alone — is exactly invariant. No folding required, for any K.
- **Tandem repeats**: a period-p repeat sampled by a stride-1 sliding window naturally cycles through its own rotations as raw tokens (e.g. `ATGATGATG…` yields the raw words `ATG`, `TGA`, `GAT` in rotation as the window slides). The low diversity this represents (few distinct raw words out of $4^{ws}$ possible) is already visible in the raw frequency distribution — no folding needed to detect it.
What the fold-then-unfold step actually did was credit each observed class with the frequency of equivalence-class members that were **never observed on the read strand**, inflating $H_{\text{corr}}$ for genuine repeats. Worked example: k=31, ws=3, kmer = `ATG` repeated ($n_{\text{words}}=29$, all 29 windows fall into one class of size 6 under the old scheme — 3 rotations × forward/revcomp):
| | $H_{\text{corr}}$ | normalized |
|---|---|---|
| old (folded, class size 6) | $\log 6 \approx 1.79$ | $\approx 0.53$ |
| current (raw, unfolded) | $\log 3 \approx 1.10$ | $\approx 0.33$ |
The gap is not a rounding artifact: per sub-word order, the folded score for this same repeat swings from 0.53 (ws=3, aligned with the period) up to **1.03** (ws=5, misaligned with the period) — i.e. a period-3 repeat could score *above* the theoretical maximum for a random sequence, depending on which ws happens to divide the repeat's period. The raw formula stays flat at ≈0.330.40 across ws=2..6 regardless of alignment, which is the robustness the "minimum across ws" design was meant to provide in the first place.
## Interpretation as an effective number of classes
$H_{\text{corr}}$ is a standard Shannon entropy over raw words (after unfolding the equivalence classes), so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable classes that would yield the same entropy.
$H_{\text{corr}}$ is a standard Shannon entropy over raw words, so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable raw words that would yield the same entropy.
For the normalised score $\hat{H}$, dividing by $H_{\text{max}}$ changes the logarithm base:
For the normalised score $\hat{H}$, dividing by $H_{\max}$ changes the logarithm base:
$$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\text{max}}} = \log_{N_{\text{max}}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\text{max}}^{\,\hat{H}}$$
$$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\max}} = \log_{N_{\max}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\max}^{\,\hat{H}}$$
The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\text{max}}$) of the effective number of equi-represented classes.
The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\max}$) of the effective number of equi-represented raw words.
In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\text{max}} \approx 4^{ws}$, giving:
In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\max} \approx 4^{ws}$, giving:
$$N_{\text{eff}} \approx 4^{ws \cdot \hat{H}}$$
This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective classes out of 16 are occupied.
This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective words out of 16 are occupied.
In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\text{max}} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\text{max}}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$.
In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\max} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\max}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$.
## Properties
The entropy score is a function of the kmer sequence alone — it does not depend on the surrounding context or on the position within any genome. Two consequences:
- **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, guaranteed by the strand-symmetric canonical form.
- **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$ — see *Why no equivalence classes* above for why this holds without any explicit strand-folding step.
- **Context independence**: the same kmer is always rejected or always kept, regardless of which genome it occurs in, where in that genome it appears, or which strand is considered. The filter defines a fixed partition of the kmer space into low-complexity and valid kmers.
+7 -3
View File
@@ -3,10 +3,14 @@
## Code couvert
- `obiskbuilder/src/entropy_table.rs` — filtre Shannon sur les kmers à basse complexité
- `obiskbuilder/src/lib.rs` — application du filtre lors du scatter (phase 1)
- `obikentropy/src/table.rs`, `obikentropy/src/tracker.rs` — formule d'entropie et tables de correction petits effectifs
- `obikentropy/src/kmer_entropy.rs` — entropie d'un kmer isolé (`KmerEntropy`)
- `obiskbuilder/src/rolling_stat.rs` — composition de `obikentropy::EntropyTracker` dans le suivi streaming (sélection de minimiseur + entropie)
- `obiskbuilder/src/iter.rs`, `obiskbuilder/src/stream_iter.rs` — application du filtre lors du scatter (phase 1)
## Notes
Document théorique stable. Vérifier que les paramètres `theta` et `level_max` dans le CLI
Le repli en classes d'équivalence circulaires + brin inverse (décrit dans une version antérieure de ce document) a été supprimé : voir la section « Why no equivalence classes » de `entropy.md` pour la justification théorique et numérique.
Vérifier que les paramètres `theta` et `level_max` dans le CLI
(`obikmer/src/cli.rs``CommonArgs`) correspondent bien à ce qui est décrit.
File diff suppressed because it is too large Load Diff
+1
View File
@@ -36,6 +36,7 @@ nav:
- Entropy filter: theory/entropy.md
- Minimizer selection: theory/minimizer.md
- Partitioning architecture: theory/indexing.md
- Central-position SNP distance (discussion): theory/evolutionary_distances.md
- Implementation:
- SuperKmer: implementation/superkmer.md
- Kmer: implementation/kmer.md
+16 -1
View File
@@ -1682,6 +1682,13 @@ dependencies = [
"xxhash-rust",
]
[[package]]
name = "obikentropy"
version = "0.1.0"
dependencies = [
"obikseq",
]
[[package]]
name = "obikindex"
version = "0.1.0"
@@ -1694,17 +1701,22 @@ dependencies = [
"obikpartitionner",
"obikseq",
"obilayeredmap",
"obipipeline",
"obiread",
"obiskbuilder",
"obiskio",
"obisys",
"rayon",
"serde",
"serde_json",
"tempfile",
"tracing",
"tracing-subscriber",
]
[[package]]
name = "obikmer"
version = "1.1.38"
version = "1.1.44"
dependencies = [
"clap",
"csv",
@@ -1742,6 +1754,7 @@ dependencies = [
"niffler 3.0.0",
"obicompactvec",
"obidebruinj",
"obikentropy",
"obikrope",
"obikseq",
"obilayeredmap",
@@ -1824,7 +1837,9 @@ dependencies = [
name = "obiskbuilder"
version = "0.1.0"
dependencies = [
"criterion2",
"lazy_static",
"obikentropy",
"obikrope",
"obikseq",
"obiread",
+1 -1
View File
@@ -1,5 +1,5 @@
[workspace]
resolver = "3"
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy"]
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy", "obikentropy"]
[profile.release]
debug = 1
+2
View File
@@ -7,6 +7,7 @@ mod intmatrix;
mod layer_meta;
mod meta;
mod reader;
mod siblingannex;
mod tempbitvec;
mod tempintvec;
mod views;
@@ -18,6 +19,7 @@ pub use builder::PersistentCompactIntVecBuilder;
pub use colgroup::{ColGroup, FilterMask, MatrixGroupOps, eval_filter_mask};
pub use intmatrix::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, pack_compact_int_matrix};
pub use layer_meta::LayerMeta;
pub use siblingannex::{FamilyMask, SiblingAnnex, SiblingAnnexBuilder};
pub use reader::{PersistentCompactIntVec, Iter as CompactIntVecIter};
pub use tempbitvec::{TempBitVec, TempBitVecBuilder};
pub use tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
+245
View File
@@ -0,0 +1,245 @@
//! Family presence-mask annex: a compact, read-only-after-build, per-slot
//! derived value used by the central-position SNP distance estimator (see
//! `docmd/theory/evolutionary_distances.md`, "Step 2b" and "Definitions:
//! family, and the canonical form of a family").
//!
//! One byte is stored per MPHF slot of a partition/layer, its low 4 bits
//! encoding a **presence mask** for the slot's k-mer's "family" (the up to 4
//! k-mers sharing the same flanks, differing only at the central base):
//! bit `b` (`b` = 0..3, in the fixed A/C/G/T = 0/1/2/3 encoding already used
//! for a single nucleotide) is set iff the family member whose *own* central
//! base — in its own canonical orientation — is `b`, is observed anywhere in
//! the current multi-genome index. This is a property of the whole index,
//! not of any one genome.
//!
//! Both facts the earlier (superseded) 3-bit design stored explicitly are
//! derived from the mask instead, not stored:
//! - sibling count = `popcount(mask) - 1`;
//! - minorant = regenerate the family's 4 canonical forms from the slot's
//! own k-mer (`CanonicalKmerOf::central_canonical_neighbors`, cheap, no
//! lookup), compare the raw encodings of whichever are set in the mask,
//! take the smallest — see `obikindex::siblings`.
//!
//! Mask value 0 is logically unreachable as a real result (a slot's own base
//! is always present in its own family) and is reused as the "not yet
//! computed" sentinel: annex files are pre-initialised to all-zero, and a
//! real value is only ever written once, by the computation pass.
//!
//! Deliberately simpler than a true 4-bit pack (1 byte/slot instead of 4
//! bits/slot): correctness and simplicity first, for a first implementation.
//! Packing to 4 bits/slot is a pure storage-density follow-up, not a
//! behavioural change, left for later.
use std::fs::{File, OpenOptions};
use std::io;
use std::path::{Path, PathBuf};
use memmap2::{Mmap, MmapMut};
const MAGIC: [u8; 4] = *b"PSIB";
// Header: magic(4) + _pad(4) + n(8) = 16 bytes. Data (1 byte/slot) follows.
const HEADER_SIZE: usize = 16;
/// A family presence mask: bit `b` set iff the member whose own canonical
/// central base is `b` (0=A, 1=C, 2=G, 3=T) is observed in the index.
#[derive(Debug, Clone, Copy, PartialEq, Eq)]
pub struct FamilyMask(u8);
impl FamilyMask {
/// The empty mask — never a valid *computed* result (a slot's own base
/// is always present in its own family) — used only to build up a mask
/// via repeated [`with`](Self::with) calls before storing it.
pub const EMPTY: FamilyMask = FamilyMask(0);
/// Set bit `base` (0=A, 1=C, 2=G, 3=T).
#[inline]
pub fn with(self, base: u8) -> Self {
debug_assert!(base < 4, "base out of range: {base}");
FamilyMask(self.0 | (1 << base))
}
/// Is the member with central base `base` (0..3) present?
#[inline]
pub fn has(self, base: u8) -> bool {
debug_assert!(base < 4, "base out of range: {base}");
self.0 & (1 << base) != 0
}
/// Number of family members observed anywhere in the index (1..=4).
#[inline]
pub fn family_size(self) -> u32 {
self.0.count_ones()
}
/// Number of *other* members observed (0..=3) — `family_size() - 1`.
#[inline]
pub fn siblings(self) -> u32 {
self.family_size() - 1
}
/// Raw bitmask (bit `b` = base `b` present) — for callers that build up
/// a mask via their own bit operations (e.g. concurrently, via an
/// `AtomicU8`) and only need the `FamilyMask` wrapper at the end.
#[inline]
pub fn bits(self) -> u8 {
self.0
}
/// Construct from a raw bitmask (only the low 4 bits are kept).
#[inline]
pub fn from_bits(bits: u8) -> Self {
FamilyMask(bits & 0b1111)
}
#[inline]
fn encode(self) -> u8 {
self.0
}
#[inline]
fn decode(byte: u8) -> Option<Self> {
if byte == 0 {
// Unreachable for a real result — reserved as the "not yet
// computed" sentinel.
return None;
}
Some(FamilyMask(byte & 0b1111))
}
}
// ── SiblingAnnex (reader) ───────────────────────────────────────────────────
pub struct SiblingAnnex {
mmap: Mmap,
n: usize,
path: PathBuf,
}
impl SiblingAnnex {
pub fn open(path: &Path) -> io::Result<Self> {
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
if mmap.len() < HEADER_SIZE {
return Err(io::Error::new(io::ErrorKind::InvalidData, "PSIB file too short"));
}
if mmap[0..4] != MAGIC {
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PSIB magic"));
}
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
if mmap.len() < HEADER_SIZE + n {
return Err(io::Error::new(io::ErrorKind::InvalidData, "PSIB file truncated"));
}
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn path(&self) -> &Path { &self.path }
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
/// `None` means the slot has not (yet) been computed — see module docs.
pub fn get(&self, slot: usize) -> Option<FamilyMask> {
FamilyMask::decode(self.mmap[HEADER_SIZE + slot])
}
}
// ── SiblingAnnexBuilder (writer) ────────────────────────────────────────────
pub struct SiblingAnnexBuilder {
mmap: MmapMut,
n: usize,
path: PathBuf,
}
impl SiblingAnnexBuilder {
/// Create a new annex of `n` slots at `path`, pre-initialised to the
/// "not yet computed" sentinel (all-zero).
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
let file_size = HEADER_SIZE + n;
let file = OpenOptions::new()
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.set_len(file_size as u64)?;
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
mmap[0..4].copy_from_slice(&MAGIC);
mmap[4..8].copy_from_slice(&[0u8; 4]);
mmap[8..16].copy_from_slice(&(n as u64).to_le_bytes());
// Data region left at 0 by `set_len`/mmap — the sentinel value.
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn get(&self, slot: usize) -> Option<FamilyMask> {
FamilyMask::decode(self.mmap[HEADER_SIZE + slot])
}
pub fn set(&mut self, slot: usize, mask: FamilyMask) {
// Redundant concurrent writes from independent recomputation paths
// converge to the same encoded byte for a given slot, so a plain
// store here is safe even without external synchronisation, as long
// as the byte write itself is atomic (true for a single aligned
// byte on every platform this project targets).
self.mmap[HEADER_SIZE + slot] = mask.encode();
}
pub fn close(self) -> io::Result<()> { self.mmap.flush() }
pub fn finish(self) -> io::Result<SiblingAnnex> {
let path = self.path.clone();
self.close()?;
SiblingAnnex::open(&path)
}
}
#[cfg(test)]
mod tests {
use super::*;
use tempfile::tempdir;
#[test]
fn sentinel_is_zero_and_unset_slots_read_as_uncomputed() {
let dir = tempdir().unwrap();
let path = dir.path().join("test.psib");
let builder = SiblingAnnexBuilder::new(4, &path).unwrap();
for slot in 0..4 {
assert_eq!(builder.get(slot), None);
}
builder.close().unwrap();
}
#[test]
fn roundtrip_all_valid_masks() {
let dir = tempdir().unwrap();
let path = dir.path().join("test.psib");
let mut builder = SiblingAnnexBuilder::new(4, &path).unwrap();
let masks = [
FamilyMask::EMPTY.with(0), // just A: family size 1
FamilyMask::EMPTY.with(0).with(3), // A + T: size 2
FamilyMask::EMPTY.with(1).with(2).with(3), // C+G+T: size 3
FamilyMask::EMPTY.with(0).with(1).with(2).with(3), // all 4
];
for (slot, mask) in masks.iter().enumerate() {
builder.set(slot, *mask);
}
let annex = builder.finish().unwrap();
for (slot, mask) in masks.iter().enumerate() {
assert_eq!(annex.get(slot), Some(*mask));
}
assert_eq!(annex.get(0).unwrap().siblings(), 0);
assert_eq!(annex.get(1).unwrap().siblings(), 1);
assert_eq!(annex.get(2).unwrap().siblings(), 2);
assert_eq!(annex.get(3).unwrap().siblings(), 3);
assert_eq!(annex.get(3).unwrap().family_size(), 4);
}
#[test]
fn has_reflects_individual_bits() {
let mask = FamilyMask::EMPTY.with(0).with(2);
assert!(mask.has(0));
assert!(!mask.has(1));
assert!(mask.has(2));
assert!(!mask.has(3));
}
}
+23
View File
@@ -1,5 +1,16 @@
use ndarray::{Array1, Array2};
/// Convert a Jaccard distance matrix (`1 - J`) into a Mash distance matrix, per
/// https://mash.readthedocs.io/en/latest/distances.html:
/// `D = -1/k * ln(2J / (1+J))`.
fn jaccard_to_mash(d_jaccard: &Array2<f64>, k: usize) -> Array2<f64> {
d_jaccard.mapv(|d| {
let j = 1.0 - d;
if j <= 0.0 { 1.0 }
else { -1.0 / k as f64 * (2.0 * j / (1.0 + j)).ln() }
})
}
// ── Column-level weight statistic — total count or presence count per column.
/// Additive across layers and partitions; used as denominator in normalised distances.
///
@@ -74,6 +85,12 @@ pub trait CountPartials: ColumnWeights {
m
}
/// Mash distance (https://mash.readthedocs.io/en/latest/distances.html), derived
/// from the presence-threshold Jaccard distance.
fn threshold_mash_dist_matrix(&self, k: usize, threshold: u32) -> Array2<f64> {
jaccard_to_mash(&self.threshold_jaccard_dist_matrix(threshold), k)
}
fn relfreq_bray_dist_matrix(&self) -> Array2<f64> {
let global = self.col_weights();
let mut m = self.partial_relfreq_bray(&global).mapv(|v| 1.0 - v);
@@ -126,6 +143,12 @@ pub trait BitPartials: ColumnWeights {
m
}
/// Mash distance (https://mash.readthedocs.io/en/latest/distances.html), derived
/// from the Jaccard distance.
fn mash_dist_matrix(&self, k: usize) -> Array2<f64> {
jaccard_to_mash(&self.jaccard_dist_matrix(), k)
}
fn hamming_dist_matrix(&self) -> Array2<u64> {
self.partial_hamming()
}
+24 -1
View File
@@ -1,6 +1,17 @@
use super::*;
use obikseq::{k, set_k, unitig::Unitig, Kmer};
// `obikseq::params` is process-wide (see obikseq/src/params.rs): tests in this
// file don't all use the same `k` (`push_palindrome_single_node` needs an
// even k=4 — no odd-length self-revcomp palindrome exists — while the rest
// use k=5), and they run concurrently by default. Serialize the
// set_k-through-use critical section across this file's tests so one test's
// `k` can never be overwritten mid-flight by another.
static K_LOCK: std::sync::Mutex<()> = std::sync::Mutex::new(());
fn lock_k() -> std::sync::MutexGuard<'static, ()> {
K_LOCK.lock().unwrap_or_else(|e| e.into_inner())
}
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn {
let mut g = GraphDeBruijn::new();
@@ -37,6 +48,7 @@ fn collect_unitigs(g: &GraphDeBruijn) -> Vec<Unitig> {
#[test]
fn push_deduplicates_revcomp() {
let k = 5;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
let mut g = GraphDeBruijn::new();
@@ -49,6 +61,7 @@ fn push_deduplicates_revcomp() {
fn push_palindrome_single_node() {
// ACGT is its own revcomp
let k = 4;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGT").unwrap();
assert_eq!(kmer, kmer.revcomp(), "test requires a palindrome");
@@ -71,6 +84,7 @@ fn linear_chain_graph() -> (GraphDeBruijn, Vec<CanonicalKmer>) {
#[test]
fn degrees_linear_chain_node_count() {
let k = 5;
let _guard = lock_k();
set_k(k);
let (g, kmers) = linear_chain_graph();
assert_eq!(g.len(), kmers.len());
@@ -82,6 +96,7 @@ fn degrees_linear_chain_extensions() {
// Note: start_iter must not be consumed standalone — its second pass only
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"AAAAGGGG";
let g = graph_from_ascii(seq);
@@ -118,6 +133,7 @@ fn kmers_from_unitigs(unitigs: &[Unitig]) -> Vec<CanonicalKmer> {
fn unitig_roundtrip_linear() {
// Non-repetitive sequence: all k-mers must be recovered across unitigs.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACCTGGCTA";
let g = graph_from_ascii(seq);
@@ -136,6 +152,7 @@ fn unitig_roundtrip_longer_sequence() {
// Longer non-repetitive sequence with no repeated k-mer of length k.
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTGGCTATCGAC";
let g = graph_from_ascii(seq);
@@ -152,6 +169,7 @@ fn unitig_roundtrip_longer_sequence() {
fn unitig_isolated_node() {
// Single k-mer with no neighbours
let k = 5;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
let mut g = GraphDeBruijn::new();
@@ -165,6 +183,7 @@ fn unitig_isolated_node() {
#[test]
fn unitig_two_isolated_nodes() {
let k = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
// Two k-mers that share no (k-1)-overlap
@@ -177,6 +196,7 @@ fn unitig_two_isolated_nodes() {
#[test]
fn unitig_two_truly_distinct_isolated_nodes() {
let k = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical());
@@ -192,7 +212,8 @@ fn unitig_two_truly_distinct_isolated_nodes() {
#[test]
fn no_kmer_lost_or_duplicated() {
let k = 7;
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTACGTACGTTTTTACGTACGT";
let g = graph_from_ascii(seq);
@@ -218,6 +239,7 @@ fn cycle_kmers_not_lost() {
// start_iter first pass yields nothing (all nodes internal); second pass
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTACGT";
let g = graph_from_ascii(seq);
@@ -240,6 +262,7 @@ fn branching_graph_no_kmer_lost_or_duplicated() {
// Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
// We use long non-repetitive sequences and extract only the required kmers.
let k: usize = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
+10
View File
@@ -0,0 +1,10 @@
[package]
name = "obikentropy"
version = "0.1.0"
edition = "2024"
[dependencies]
obikseq = { path = "../obikseq" }
[dev-dependencies]
obikseq = { path = "../obikseq", features = ["test-utils"] }
@@ -4,57 +4,6 @@ use std::path::PathBuf;
const K_MAX: usize = 32;
const WS_MAX: usize = 6;
fn normalize_circular(kmer: u64, ws: usize) -> u64 {
let mask = (1u64 << (ws * 2)) - 1;
let mut canonical = kmer & mask;
let mut current = canonical;
for _ in 0..ws - 1 {
let top = (current >> ((ws - 1) * 2)) & 3;
current = ((current << 2) | top) & mask;
if current < canonical {
canonical = current;
}
}
canonical
}
fn revcomp_raw(x: u64, k: usize) -> u64 {
let x = !x;
let x = x.swap_bytes();
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
x << (64 - 2 * k)
}
fn build_normalized_kmer(k: usize) -> Vec<u64> {
let n = 1usize << (k * 2);
let shift = 64 - k * 2;
let mut result = vec![0u64; n];
for i in 0..n {
let la = (i as u64) << shift;
let ra = i as u64;
let rc_ra = revcomp_raw(la, k) >> shift;
let circ = normalize_circular(ra, k);
let circ_rc = normalize_circular(rc_ra, k);
result[i] = if circ < circ_rc { circ } else { circ_rc };
}
result
}
fn build_ln_class(norm: &[u64]) -> Vec<f64> {
let n = norm.len();
let mut sizes = vec![0u32; n];
for &c in norm {
sizes[c as usize] += 1;
}
norm.iter()
.map(|&c| {
let s = sizes[c as usize];
if s > 0 { (s as f64).ln() } else { 0.0 }
})
.collect()
}
fn build_n_log_n() -> [f64; K_MAX + 1] {
let mut t = [0.0f64; K_MAX + 1];
for n in 1..=K_MAX {
@@ -63,6 +12,9 @@ fn build_n_log_n() -> [f64; K_MAX + 1] {
t
}
/// Max achievable entropy over `4^ws` raw sub-words given only `nwords`
/// observations (most-uniform integer partition), per
/// `docmd/theory/entropy.md`.
fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] {
let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1];
for k in 2..=K_MAX {
@@ -125,13 +77,6 @@ fn main() {
let out_dir = PathBuf::from(std::env::var("OUT_DIR").unwrap());
let mut out = String::new();
for k in 1..=6usize {
let n = 1usize << (k * 2);
let norm = build_normalized_kmer(k);
let ln_class = build_ln_class(&norm);
emit_f64_1d(&mut out, &format!("LN_CLASS{k}"), n, &ln_class);
}
let n_log_n = build_n_log_n();
emit_f64_1d(&mut out, "N_LOG_N", K_MAX + 1, &n_log_n);
@@ -141,5 +86,5 @@ fn main() {
let log_nwords = build_log_nwords();
emit_f64_2d(&mut out, "LOG_NWORDS", K_MAX + 1, WS_MAX + 1, &log_nwords);
fs::write(out_dir.join("ln_class_tables.rs"), out).unwrap();
fs::write(out_dir.join("entropy_tables.rs"), out).unwrap();
}
+41
View File
@@ -0,0 +1,41 @@
//! Normalized entropy of an isolated, already-built k-mer (e.g. one
//! reconstructed from an index's `unitigs.bin`, with no surrounding
//! sequence) — drives the window through [`EntropyTracker`] one base at a
//! time, exactly like the streaming path, so a `theta` threshold means the
//! same thing whether applied during index construction or after the fact
//! (e.g. `obikmer filter`).
use obikseq::CanonicalKmer;
use crate::tracker::EntropyTracker;
/// Extension trait: compute the normalized entropy of a single canonical
/// k-mer, independent of any surrounding sequence.
pub trait KmerEntropy {
/// Normalized entropy across sub-word orders `1..=level_max` (the
/// minimum is taken across orders). Lower means less complex; `theta`
/// in `index`/`filter` rejects k-mers with a score `< theta`.
fn entropy(&self, level_max: usize) -> f64;
}
impl KmerEntropy for CanonicalKmer {
fn entropy(&self, level_max: usize) -> f64 {
let raw = self.raw(); // left-aligned, 2 bits/base, MSB-first
let k = obikseq::params::k();
let mask = (!0u64) >> (64 - k * 2);
let mut tracker = EntropyTracker::new(k);
let mut rolling: u64 = 0;
for i in 0..k {
let shift = 64 - 2 * (i + 1);
let base = (raw >> shift) & 3;
rolling = ((rolling << 2) | base) & mask;
tracker.push(i + 1, rolling);
}
tracker.normalized_entropy(level_max)
}
}
#[cfg(test)]
#[path = "tests/kmer_entropy.rs"]
mod tests;
+17
View File
@@ -0,0 +1,17 @@
//! Normalized k-mer entropy: formulas, tables, and a streaming tracker.
//!
//! This crate holds every piece of the entropy computation described in
//! `docmd/theory/entropy.md`: the compile-time tables ([`table`], private),
//! the incremental accumulator ([`EntropyTracker`]) that callers compose
//! into their own streaming state, and the [`KmerEntropy`] convenience trait
//! for scoring a single, already-built k-mer.
#![deny(missing_docs)]
mod kmer_entropy;
mod ring;
mod table;
mod tracker;
pub use kmer_entropy::KmerEntropy;
pub use tracker::EntropyTracker;
+40
View File
@@ -0,0 +1,40 @@
//! Stack-allocated ring buffer backing the sliding sub-word windows.
/// Fixed-capacity ring buffer backed by a stack array.
/// N must be a power of two; operations are branchless via `% N`.
pub(crate) struct Ring<T: Copy + Default, const N: usize> {
buf: [T; N],
head: usize,
len: usize,
}
impl<T: Copy + Default, const N: usize> Ring<T, N> {
#[inline]
pub(crate) fn new() -> Self {
Self {
buf: [T::default(); N],
head: 0,
len: 0,
}
}
#[inline]
pub(crate) fn clear(&mut self) {
self.len = 0;
self.head = 0;
}
#[inline]
pub(crate) fn push_back(&mut self, val: T) {
self.buf[(self.head + self.len) % N] = val;
self.len += 1;
}
#[inline]
pub(crate) fn pop_front(&mut self) -> T {
let val = self.buf[self.head];
self.head = (self.head + 1) % N;
self.len -= 1;
val
}
}
+30
View File
@@ -0,0 +1,30 @@
//! Compile-time tables backing the normalized k-mer entropy formula: the
//! max-entropy correction for small samples. See `docmd/theory/entropy.md`.
//!
//! Entropy is computed directly on raw (non-canonicalized) sub-words — no
//! equivalence-class folding. Empirically (see the discussion that produced
//! this crate's history), folding sub-words into circular/revcomp classes
//! before unfolding them back buys nothing for the invariances it was meant
//! to guarantee (both hold for raw sub-word entropy already, by a direct
//! bijection argument for revcomp and by the sliding window's own dynamics
//! for tandem repeats), while it measurably *weakens* detection of the
//! low-complexity sequences the filter exists to catch.
include!(concat!(env!("OUT_DIR"), "/entropy_tables.rs"));
pub(crate) const WS_MAX: usize = 6;
#[inline(always)]
pub(crate) const fn n_log_n(n: usize) -> f64 {
N_LOG_N[n]
}
#[inline(always)]
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
EMAX[k][ws]
}
#[inline(always)]
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
LOG_NWORDS[k][ws]
}
+52
View File
@@ -0,0 +1,52 @@
use super::*;
use obikseq::Sequence;
use obikseq::kmer::Kmer;
const K: usize = 21;
const LEVEL_MAX: usize = 6;
fn kmer_from_ascii(seq: &[u8]) -> CanonicalKmer {
obikseq::set_k(K);
Kmer::from_ascii(seq).expect("valid k-mer sequence").canonical()
}
#[test]
fn homopolymer_scores_lower_than_diverse_sequence() {
let homopolymer = kmer_from_ascii(b"AAAAAAAAAAAAAAAAAAAAA"); // 21 bases
let diverse = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT"); // 21 bases, same as used elsewhere in this workspace's tests
let e_homopolymer = homopolymer.entropy(LEVEL_MAX);
let e_diverse = diverse.entropy(LEVEL_MAX);
assert!(
e_homopolymer < e_diverse,
"homopolymer ({e_homopolymer}) should score lower than a diverse sequence ({e_diverse})"
);
// A pure homopolymer is the most degenerate case representable — its
// score should sit near the bottom of the range, not just "somewhat lower".
assert!(e_homopolymer < 0.3, "homopolymer entropy unexpectedly high: {e_homopolymer}");
}
#[test]
fn entropy_is_deterministic_for_the_same_kmer() {
let a = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
let b = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
assert_eq!(a.entropy(LEVEL_MAX), b.entropy(LEVEL_MAX));
}
#[test]
fn entropy_is_within_zero_one_range() {
let mut repeat = "AT".repeat(K / 2 + 1);
repeat.truncate(K);
for seq in [
"AAAAAAAAAAAAAAAAAAAAA".to_string(),
repeat,
"CATTAGCGTACCTGATCAGGT".to_string(),
] {
assert_eq!(seq.len(), K, "test sequence must be exactly K bases: {seq:?}");
let kmer = kmer_from_ascii(seq.as_bytes());
let e = kmer.entropy(LEVEL_MAX);
assert!((0.0..=1.0).contains(&e), "entropy {e} out of [0,1] for {seq:?}");
}
}
+255
View File
@@ -0,0 +1,255 @@
//! Incremental (streaming) normalized k-mer entropy.
//!
//! [`EntropyTracker`] maintains, over a sliding window of the last `k` bases,
//! the per-sub-word-size raw-word frequency statistics needed to evaluate
//! the corrected Shannon entropy described in `docmd/theory/entropy.md`,
//! updated in O(1) per base rather than recomputed from scratch. No
//! canonicalization is applied — each sub-word is tallied under its own raw
//! 2-bit-packed value; only the small-sample max-entropy correction departs
//! from a textbook Shannon entropy.
//!
//! It carries no notion of minimizers or superkmer segmentation — callers
//! that need both (e.g. `obiskbuilder::RollingStat`) compose an
//! `EntropyTracker` as a plain field alongside their own state, so the two
//! concerns update in the same streaming pass without being conflated in one
//! struct.
use crate::ring::Ring;
use crate::table::{WS_MAX, emax, log_nwords, n_log_n};
/// Incremental normalized-entropy accumulator over a sliding window of `k`
/// bases. Composed as a plain field by callers that also need other
/// per-base state (e.g. minimizer selection) in the same streaming pass.
pub struct EntropyTracker {
k: usize,
steady: bool,
// Sliding-window queues over the last `k` raw sub-words, one per word
// size — stack-allocated, capacity ≤ k ≤ 31.
k1q: Ring<u64, 32>,
k2q: Ring<u64, 32>,
k3q: Ring<u64, 32>,
k4q: Ring<u64, 32>,
k5q: Ring<u64, 32>,
k6q: Ring<u64, 32>,
// Frequency count arrays, indexed by the raw sub-word value (2 bits per
// base). Max count per cell ≤ k ≤ 31 → u8 is sufficient.
k1c: [u8; 4],
k2c: [u8; 16],
k3c: [u8; 64],
k4c: [u8; 256],
k5c: [u8; 1024],
k6c: [u8; 4096],
sum_f_log_f: [f64; WS_MAX + 1],
}
impl EntropyTracker {
/// New tracker for a window of `k` bases (1..=31).
pub fn new(k: usize) -> Self {
Self {
k,
steady: false,
k1q: Ring::new(),
k2q: Ring::new(),
k3q: Ring::new(),
k4q: Ring::new(),
k5q: Ring::new(),
k6q: Ring::new(),
k1c: [0; 4],
k2c: [0; 16],
k3c: [0; 64],
k4c: [0; 256],
k5c: [0; 1024],
k6c: [0; 4096],
sum_f_log_f: [0.0; WS_MAX + 1],
}
}
/// Clear all accumulated state, ready to track a new window from
/// scratch (`k` is unchanged).
pub fn reset(&mut self) {
self.steady = false;
self.k1c.fill(0);
self.k2c.fill(0);
self.k3c.fill(0);
self.k4c.fill(0);
self.k5c.fill(0);
self.k6c.fill(0);
self.k1q.clear();
self.k2q.clear();
self.k3q.clear();
self.k4q.clear();
self.k5q.clear();
self.k6q.clear();
self.sum_f_log_f = [0.0; WS_MAX + 1];
}
#[inline]
fn update_sums_decrement<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], f: usize) {
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
}
#[inline]
fn update_sums_increment<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], g: usize) {
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
}
/// Advance the window by one base. `received` is the caller's running
/// count of bases pushed so far (1-based, i.e. after this base);
/// `rolling_kmer` is the current right-aligned, 2-bit-packed k-mer
/// window (same convention as `obiskbuilder::RollingStat::rolling_k`).
pub fn push(&mut self, received: usize, rolling_kmer: u64) {
let raw1 = rolling_kmer & 3;
let raw2 = rolling_kmer & 15;
let raw3 = rolling_kmer & 63;
let raw4 = rolling_kmer & 255;
let raw5 = rolling_kmer & 1023;
let raw6 = rolling_kmer & 4095;
if received > self.k {
let old1 = self.k1q.pop_front();
let f1 = self.k1c[old1 as usize] as usize;
Self::update_sums_decrement::<1>(&mut self.sum_f_log_f, f1);
self.k1c[old1 as usize] -= 1;
let old2 = self.k2q.pop_front();
let f2 = self.k2c[old2 as usize] as usize;
Self::update_sums_decrement::<2>(&mut self.sum_f_log_f, f2);
self.k2c[old2 as usize] -= 1;
let old3 = self.k3q.pop_front();
let f3 = self.k3c[old3 as usize] as usize;
Self::update_sums_decrement::<3>(&mut self.sum_f_log_f, f3);
self.k3c[old3 as usize] -= 1;
let old4 = self.k4q.pop_front();
let f4 = self.k4c[old4 as usize] as usize;
Self::update_sums_decrement::<4>(&mut self.sum_f_log_f, f4);
self.k4c[old4 as usize] -= 1;
let old5 = self.k5q.pop_front();
let f5 = self.k5c[old5 as usize] as usize;
Self::update_sums_decrement::<5>(&mut self.sum_f_log_f, f5);
self.k5c[old5 as usize] -= 1;
let old6 = self.k6q.pop_front();
let f6 = self.k6c[old6 as usize] as usize;
Self::update_sums_decrement::<6>(&mut self.sum_f_log_f, f6);
self.k6c[old6 as usize] -= 1;
}
if self.steady {
let g1 = self.k1c[raw1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
self.k1c[raw1 as usize] += 1;
self.k1q.push_back(raw1);
let g2 = self.k2c[raw2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
self.k2c[raw2 as usize] += 1;
self.k2q.push_back(raw2);
let g3 = self.k3c[raw3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
self.k3c[raw3 as usize] += 1;
self.k3q.push_back(raw3);
let g4 = self.k4c[raw4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
self.k4c[raw4 as usize] += 1;
self.k4q.push_back(raw4);
let g5 = self.k5c[raw5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
self.k5c[raw5 as usize] += 1;
self.k5q.push_back(raw5);
let g6 = self.k6c[raw6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
self.k6c[raw6 as usize] += 1;
self.k6q.push_back(raw6);
} else {
self.push_warmup_increments(received, raw1, raw2, raw3, raw4, raw5, raw6);
}
}
#[cold]
#[inline(never)]
fn push_warmup_increments(
&mut self,
received: usize,
raw1: u64, raw2: u64, raw3: u64,
raw4: u64, raw5: u64, raw6: u64,
) {
let g1 = self.k1c[raw1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
self.k1c[raw1 as usize] += 1;
self.k1q.push_back(raw1);
if received >= 2 {
let g2 = self.k2c[raw2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
self.k2c[raw2 as usize] += 1;
self.k2q.push_back(raw2);
if received >= 3 {
let g3 = self.k3c[raw3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
self.k3c[raw3 as usize] += 1;
self.k3q.push_back(raw3);
if received >= 4 {
let g4 = self.k4c[raw4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
self.k4c[raw4 as usize] += 1;
self.k4q.push_back(raw4);
if received >= 5 {
let g5 = self.k5c[raw5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
self.k5c[raw5 as usize] += 1;
self.k5q.push_back(raw5);
if received >= 6 {
let g6 = self.k6c[raw6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
self.k6c[raw6 as usize] += 1;
self.k6q.push_back(raw6);
self.steady = true;
}
}
}
}
}
}
/// Normalized entropy at sub-word size `order` (1..=6). The caller is
/// responsible for not calling this before the window is full (`k`
/// bases pushed) — an empty/partial window yields a meaningless value.
pub fn entropy(&self, order: usize) -> f64 {
let k = self.k;
let em = emax(k, order);
if em <= 0.0 {
return 1.0;
}
let nwords = k - order + 1;
let log_nw = log_nwords(k, order);
let nw_f = nwords as f64;
let h_corr = log_nw - self.sum_f_log_f[order] / nw_f;
(h_corr / em).max(0.0)
}
/// Minimum of [`Self::entropy`] over sub-word sizes `1..=order_max`, same
/// caller responsibility re: window readiness as `entropy`.
pub fn normalized_entropy(&self, order_max: usize) -> f64 {
let min_e = (1..=order_max)
.map(|ws| self.entropy(ws))
.fold(f64::MAX, f64::min);
if min_e == f64::MAX { 1.0 } else { min_e }
}
}
+7
View File
@@ -10,6 +10,8 @@ obiskio = { path = "../obiskio" }
obisys = { path = "../obisys" }
obicompactvec = { path = "../obicompactvec" }
obilayeredmap = { path = "../obilayeredmap" }
obiskbuilder = { path = "../obiskbuilder" }
obipipeline = { path = "../obipipeline" }
ndarray = "0.16"
rayon = "1"
crossbeam-channel = "0.5"
@@ -19,6 +21,11 @@ indicatif = "0.17"
tracing = "0.1.44"
hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], optional = true }
[dev-dependencies]
obiread = { path = "../obiread" }
tempfile = "3"
tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
[features]
default = ["numa"]
numa = ["hwlocality"]
+4
View File
@@ -14,6 +14,8 @@ pub enum DistanceMetric {
Jaccard,
/// Hamming distance (number of differing kmer positions) on presence/absence data.
Hamming,
/// Mash distance on presence/absence data (Jaccard-derived mutation-rate estimate).
Mash,
/// Bray-Curtis dissimilarity on raw counts.
BrayCurtis,
/// Bray-Curtis dissimilarity normalised by per-genome total counts.
@@ -84,6 +86,7 @@ impl KmerIndex {
DistanceMetric::Hellinger => CountPartials::hellinger_dist_matrix(&global),
DistanceMetric::HellingerEuclidean => CountPartials::hellinger_euclidean_dist_matrix(&global),
DistanceMetric::Jaccard => CountPartials::threshold_jaccard_dist_matrix(&global, presence_threshold),
DistanceMetric::Mash => CountPartials::threshold_mash_dist_matrix(&global, self.kmer_size(), presence_threshold),
DistanceMetric::Hamming => {
return Err(OKIError::InvalidInput(
"Hamming is only available for presence/absence indexes".into(),
@@ -108,6 +111,7 @@ impl KmerIndex {
let matrix = match metric {
DistanceMetric::Jaccard => BitPartials::jaccard_dist_matrix(&global),
DistanceMetric::Mash => BitPartials::mash_dist_matrix(&global, self.kmer_size()),
DistanceMetric::Hamming => {
BitPartials::hamming_dist_matrix(&global).mapv(|v| v as f64)
}
+2
View File
@@ -9,6 +9,7 @@ mod numa;
mod rebuild;
mod reindex;
mod select;
mod siblings;
mod stats;
pub use error::{OKIError, OKIResult};
@@ -18,3 +19,4 @@ pub use merge::MergeMode;
pub use meta::{validate_label, GenomeInfo, IndexConfig, IndexMeta, META_FILENAME};
pub use state::{IndexState, SENTINEL_COUNTED, SENTINEL_INDEXED, SENTINEL_SCATTERED};
pub use stats::IndexBitsPerKmer;
pub use siblings::{RawSnpDistanceOutput, SiblingAnnexStats, SnpAlignment};
+15 -7
View File
@@ -79,9 +79,7 @@ pub fn build() -> NumaSetup {
}
// UMA fallback: single synthetic node, all cores, no pool, no pinning.
let n_cores = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1);
let n_cores = obisys::effective_parallelism();
debug!("UMA: single synthetic node, {} core(s)", n_cores);
NumaSetup {
pools: vec![None],
@@ -91,9 +89,7 @@ pub fn build() -> NumaSetup {
#[cfg(not(feature = "numa"))]
pub fn build() -> NumaSetup {
let n_cores = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1);
let n_cores = obisys::effective_parallelism();
debug!("UMA: single synthetic node, {} core(s)", n_cores);
NumaSetup {
pools: vec![None],
@@ -299,20 +295,27 @@ impl PartitionRunner {
let pool = node.pool.clone();
s.spawn(move || {
let tid = std::thread::current().id();
debug!(?tid, "PartitionRunner worker: waiting on activation");
if arx.recv().is_err() {
debug!(?tid, "PartitionRunner worker: activation channel closed, exiting");
return;
}
debug!(?tid, "PartitionRunner worker: activated");
if !cpu_ids.is_empty() {
pin_current_thread(cpu_ids);
}
for i in &prx {
debug!(?tid, partition = i, "PartitionRunner worker: picked partition");
let t = Instant::now();
let r = match &pool {
Some(p) => p.install(|| f(i)),
None => f(i),
};
debug!(?tid, partition = i, "PartitionRunner worker: partition done");
etx.send(WorkerEvent::Completed(i, r, t.elapsed())).ok();
}
debug!(?tid, "PartitionRunner worker: no more partitions, exiting");
});
}
}
@@ -323,13 +326,18 @@ impl PartitionRunner {
// ── Controller ────────────────────────────────────────────────────
let mut activation = NodeActivation::new(&activate_txs, &node_caps, max_workers);
activation.activate_initial(INITIAL_DIVISOR, n_total);
debug!(n_total, activated = activation.total(), "PartitionRunner controller: initial activation");
let mut cpu_sample = CpuSample::now();
let mut io_sample = IoSample::now();
let mut completed = 0usize;
while completed < n_total {
let Ok(event) = event_rx.recv() else { break };
debug!(completed, n_total, "PartitionRunner controller: waiting for an event");
let Ok(event) = event_rx.recv() else {
debug!("PartitionRunner controller: event channel closed, stopping");
break;
};
match event {
WorkerEvent::Completed(i, r, dur) => {
match r {
File diff suppressed because it is too large Load Diff
+1 -1
View File
@@ -1,6 +1,6 @@
[package]
name = "obikmer"
version = "1.1.38"
version = "1.1.44"
edition = "2024"
[[bin]]
+1 -3
View File
@@ -38,9 +38,7 @@ pub struct CommonArgs {
#[arg(
short = 'T',
long,
default_value_t = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1)
default_value_t = obisys::effective_parallelism()
)]
pub threads: usize,
+176 -1
View File
@@ -3,13 +3,15 @@ use std::path::PathBuf;
use clap::Args;
use kodama::{Method, linkage};
use obikindex::{DistanceMetric, KmerIndex};
use obifastwrite::{JsonVal, write_record};
use obikindex::{DistanceMetric, KmerIndex, RawSnpDistanceOutput, SiblingAnnexStats, SnpAlignment};
use speedytree::{DistanceMatrix, Hybrid, NeighborJoiningSolver, to_newick};
use tracing::info;
#[derive(clap::ValueEnum, Clone, Copy, Debug)]
pub enum MetricArg {
Jaccard,
Mash,
Hamming,
BrayCurtis,
#[value(name = "relfreq-bray-curtis")]
@@ -26,6 +28,7 @@ impl From<MetricArg> for DistanceMetric {
fn from(m: MetricArg) -> Self {
match m {
MetricArg::Jaccard => DistanceMetric::Jaccard,
MetricArg::Mash => DistanceMetric::Mash,
MetricArg::Hamming => DistanceMetric::Hamming,
MetricArg::BrayCurtis => DistanceMetric::BrayCurtis,
MetricArg::RelfreqBrayCurtis => DistanceMetric::RelfreqBrayCurtis,
@@ -62,7 +65,37 @@ pub struct DistanceArgs {
#[arg(long)]
pub upgma: bool,
/// Build the sibling-count/minorant annex on this (multi-genome) index
/// — see `docmd/theory/evolutionary_distances.md`, Step 2b. Construction
/// only; does not by itself compute or write any statistics.
#[arg(long)]
pub sibling_annex: bool,
/// Tally the sibling-count distribution (CSV) of an already-built annex
/// (run with `--sibling-annex` first, in this invocation or an earlier
/// one). A separate, occasional diagnostic pass — not run every time the
/// annex itself is (re)built.
#[arg(long)]
pub sibling_stats: bool,
/// Compute the raw p-distance restricted to loci that are single-copy
/// in both genomes of each pair (an already-built sibling annex is
/// required — run with `--sibling-annex` first, in this invocation or
/// an earlier one). A quick way to test the central-position SNP
/// estimator against a real index; not the full `SnpTally` design.
#[arg(long)]
pub raw_snp_distance: bool,
/// Write a SNP-only pseudo-alignment (FASTA, IUPAC-coded) from an
/// already-built sibling annex — one row per genome, one column per
/// variable family (monomorphic families skipped), no flanking
/// sequence. See `docmd/theory/evolutionary_distances.md`,
/// "Multi-genome framing: family as pseudo-alignment column".
#[arg(long)]
pub snp: bool,
/// Output prefix: <prefix>_dist.csv, <prefix>_shared.csv,
/// <prefix>_siblings.csv, <prefix>_rawsnp.csv, <prefix>_snp.fasta,
/// <prefix>_nj.nwk, <prefix>_upgma.nwk.
/// If omitted, the distance matrix is written to stdout.
#[arg(short, long)]
@@ -78,6 +111,51 @@ pub fn run(args: DistanceArgs) {
let labels: Vec<String> = idx.meta().genomes.iter().map(|g| g.label.clone()).collect();
let n = labels.len();
// ── Sibling-count/minorant annex (independent of the distance metric) ──
// Construction (`--sibling-annex`) and stats (`--sibling-stats`) are
// deliberately decoupled: the annex is meant to be (re)built routinely,
// the distribution only occasionally, on demand.
if args.sibling_annex {
info!("building sibling-count/minorant annex");
idx.build_sibling_annex().unwrap_or_else(|e| {
eprintln!("error building sibling annex: {e}");
std::process::exit(1);
});
}
if args.sibling_stats {
let stats = idx.sibling_annex_stats().unwrap_or_else(|e| {
eprintln!("error computing sibling-annex stats: {e}");
std::process::exit(1);
});
write_sibling_stats_csv(&stats, &labels, &args.output);
}
if args.raw_snp_distance {
let result = idx.raw_snp_distance().unwrap_or_else(|e| {
eprintln!("error computing raw SNP distance: {e}");
std::process::exit(1);
});
write_raw_snp_distance_csv(&result, &labels, &args.output);
}
if args.snp {
let alignment = idx.snp_pseudo_alignment().unwrap_or_else(|e| {
eprintln!("error computing SNP pseudo-alignment: {e}");
std::process::exit(1);
});
write_snp_fasta(&alignment, &labels, &args.output);
}
// `--sibling-annex`/`--sibling-stats`/`--raw-snp-distance`/`--snp` are
// their own operation, not a modifier on top of a distance-metric
// computation — a metric was never requested by asking for any of them,
// so there is nothing for the rest of this function to compute. Not a
// historical accident to keep: stop here rather than always also
// running a Jaccard (or whichever `--metric` defaults to) pass and
// printing an unrequested matrix.
if args.sibling_annex || args.sibling_stats || args.raw_snp_distance || args.snp {
return;
}
info!(
"computing {:?} distances for {} genome(s)",
args.metric, n
@@ -189,6 +267,103 @@ pub fn run(args: DistanceArgs) {
}
}
// ── Family-size distribution → CSV ──────────────────────────────────────────
//
// Each row is a family (the up-to-4 k-mers sharing flanks, differing only at
// the centre), counted once — at its minorant — regardless of how many of
// its members are observed. Family size 1..4 (not "sibling count" 0..3):
// see `docmd/theory/evolutionary_distances.md`, "Definitions".
fn write_sibling_stats_csv(stats: &SiblingAnnexStats, labels: &[String], output: &Option<PathBuf>) {
// One row per genome (4 columns, family size 1-4: number of families of
// that size for which the genome carries at least one member), plus a
// `global` row — the actual deduplicated family-size histogram
// (`stats.counts`), NOT a sum of the per-genome columns (a family shared
// by several genomes would otherwise be counted once per genome it
// appears in, inflating the total beyond the real family count).
let path = output.as_ref()
.map(|p| format!("{}_siblings.csv", p.display()))
.unwrap_or_else(|| "siblings.csv".into());
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
eprintln!("error creating {path}: {e}");
std::process::exit(1);
}));
writeln!(f, "genome,1,2,3,4").unwrap();
for (label, counts) in labels.iter().zip(stats.per_genome.iter()) {
writeln!(f, "{label},{},{},{},{}", counts[0], counts[1], counts[2], counts[3]).unwrap();
}
writeln!(
f, "global,{},{},{},{}",
stats.counts[0], stats.counts[1], stats.counts[2], stats.counts[3],
).unwrap();
let total: u64 = stats.counts.iter().sum();
info!("family-size distribution → {path} (total {total} famil{})",
if total == 1 { "y" } else { "ies" });
}
// ── Raw single-copy SNP distance → CSV ──────────────────────────────────────
//
// p_hat[i,j] = snp[i,j] / (snp[i,j] + shared[i,j]) over loci single-copy in
// both i and j — see `RawSnpDistanceOutput` / `KmerIndex::raw_snp_distance`.
// A single file: the distance matrix, with an eligible-loci count alongside
// each value so a 0/0 pair (no eligible locus at all) is distinguishable
// from a genuinely identical pair.
fn write_raw_snp_distance_csv(result: &RawSnpDistanceOutput, labels: &[String], output: &Option<PathBuf>) {
let path = output.as_ref()
.map(|p| format!("{}_rawsnp.csv", p.display()))
.unwrap_or_else(|| "rawsnp.csv".into());
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
eprintln!("error creating {path}: {e}");
std::process::exit(1);
}));
let n = labels.len();
write!(f, "genome").unwrap();
for g in labels { write!(f, ",{g}").unwrap(); }
writeln!(f).unwrap();
for (i, g) in labels.iter().enumerate() {
write!(f, "{g}").unwrap();
for j in 0..n {
let snp = result.snp[[i, j]];
let shared = result.shared[[i, j]];
let eligible = snp + shared;
if eligible == 0 {
write!(f, ",NA").unwrap();
} else {
write!(f, ",{:.6}", snp as f64 / eligible as f64).unwrap();
}
}
writeln!(f).unwrap();
}
info!("raw single-copy SNP distance matrix → {path}");
}
// ── SNP-only pseudo-alignment → FASTA ───────────────────────────────────────
//
// One record per genome, IUPAC-coded, no flanking sequence — see
// `SnpAlignment` / `KmerIndex::snp_pseudo_alignment`. Uses the project's
// existing FASTA writer (`obifastwrite::write_record`) rather than
// hand-rolling one.
fn write_snp_fasta(alignment: &SnpAlignment, labels: &[String], output: &Option<PathBuf>) {
let path = output.as_ref()
.map(|p| format!("{}_snp.fasta", p.display()))
.unwrap_or_else(|| "snp.fasta".into());
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
eprintln!("error creating {path}: {e}");
std::process::exit(1);
}));
let n_sites = alignment.sequences.first().map(|s| s.len()).unwrap_or(0);
for (label, seq) in labels.iter().zip(alignment.sequences.iter()) {
write_record(seq, label, &[("n_sites", JsonVal::Num(n_sites as u64))], &mut f).unwrap_or_else(|e| {
eprintln!("error writing {path}: {e}");
std::process::exit(1);
});
}
info!("SNP pseudo-alignment → {path} ({n_sites} site{})",
if n_sites == 1 { "" } else { "s" });
}
// ── UPGMA Newick from kodama dendrogram ───────────────────────────────────────
fn upgma_to_newick(dendro: &kodama::Dendrogram<f64>, names: &[String]) -> String {
+18 -3
View File
@@ -2,14 +2,14 @@ use std::path::PathBuf;
use clap::Args;
use obikindex::{KmerIndex, MergeMode};
use obikpartitionner::filter::{MaxTotalCount, MinTotalCount};
use obikpartitionner::filter::{MaxTotalCount, MinComplexity, MinTotalCount};
use obisys::Reporter;
use tracing::info;
use super::predicate::FilterArgs as KmerFilterArgs;
#[derive(Args)]
pub struct FilterArgs {
pub struct FilterCmdArgs {
/// Source index directory
pub source: PathBuf,
@@ -28,6 +28,18 @@ pub struct FilterArgs {
#[arg(long)]
pub max_total_count: Option<u32>,
/// Minimum normalized entropy (complexity) to keep a k-mer — same metric
/// as `obikmer index`'s --theta, applied here to k-mers already committed
/// to the source index (reconstructed from unitigs.bin). K-mers scoring
/// below this are removed.
#[arg(long)]
pub min_complexity: Option<f64>,
/// Maximum sub-word size for the complexity computation (see `obikmer
/// index`'s --level-max). Only used when --min-complexity is set.
#[arg(long, default_value_t = 6)]
pub complexity_level_max: usize,
/// Output as presence/absence instead of counts
#[arg(long)]
pub presence: bool,
@@ -37,7 +49,7 @@ pub struct FilterArgs {
pub force: bool,
}
pub fn run(args: FilterArgs) {
pub fn run(args: FilterCmdArgs) {
let src = KmerIndex::open(&args.source).unwrap_or_else(|e| {
eprintln!("error opening source index: {e}");
std::process::exit(1);
@@ -62,6 +74,9 @@ pub fn run(args: FilterArgs) {
if let Some(v) = args.max_total_count {
filters.push(Box::new(MaxTotalCount { total: v }));
}
if let Some(theta) = args.min_complexity {
filters.push(Box::new(MinComplexity { level_max: args.complexity_level_max, theta }));
}
let mut rep = Reporter::new();
KmerIndex::rebuild(&args.output, &src, &filters, mode, args.force, &mut rep)
+29 -17
View File
@@ -151,12 +151,14 @@ pub struct FilterArgs {
pub outgroup: Vec<String>,
/// Minimum number of ingroup genomes containing the k-mer
#[arg(long)]
pub min_count: Option<usize>,
/// (negative: offset from group size, e.g. -1 = all but one)
#[arg(long, allow_hyphen_values = true)]
pub min_count: Option<isize>,
/// Maximum number of ingroup genomes containing the k-mer
#[arg(long)]
pub max_count: Option<usize>,
/// (negative: offset from group size, e.g. -1 = all but one)
#[arg(long, allow_hyphen_values = true)]
pub max_count: Option<isize>,
/// Minimum fraction of ingroup genomes containing the k-mer [0.01.0]
/// (default 1.0 when --ingroup is set, 0.0 otherwise)
@@ -168,13 +170,15 @@ pub struct FilterArgs {
pub max_frac: Option<f64>,
/// Minimum number of outgroup genomes containing the k-mer
#[arg(long)]
pub min_outgroup_count: Option<usize>,
/// (negative: offset from outgroup size, e.g. -1 = all but one)
#[arg(long, allow_hyphen_values = true)]
pub min_outgroup_count: Option<isize>,
/// Maximum number of outgroup genomes containing the k-mer
/// (default 0 when --outgroup is set, no constraint otherwise)
#[arg(long)]
pub max_outgroup_count: Option<usize>,
/// (default 0 when --outgroup is set, no constraint otherwise;
/// negative: offset from outgroup size, e.g. -1 = all but one)
#[arg(long, allow_hyphen_values = true)]
pub max_outgroup_count: Option<isize>,
/// Minimum fraction of outgroup genomes containing the k-mer [0.01.0]
#[arg(long)]
@@ -239,12 +243,12 @@ pub fn matching_genome_indices(pred_str: &str, genomes: &[GenomeInfo]) -> Result
pub struct GroupFilterParams {
pub threshold: u32,
pub min_count: Option<usize>,
pub max_count: Option<usize>,
pub min_count: Option<isize>,
pub max_count: Option<isize>,
pub min_frac: Option<f64>,
pub max_frac: Option<f64>,
pub min_outgroup_count: Option<usize>,
pub max_outgroup_count: Option<usize>,
pub min_outgroup_count: Option<isize>,
pub max_outgroup_count: Option<isize>,
pub min_outgroup_frac: Option<f64>,
pub max_outgroup_frac: Option<f64>,
}
@@ -279,12 +283,20 @@ pub fn build_group_filter(
let default_min_frac = if !ingroup_preds.is_empty() && !ingroup_quorum_explicit { 1.0 } else { 0.0 };
let default_max_outgroup_count = if !outgroup_preds.is_empty() && !outgroup_quorum_explicit { 0 } else { out_size };
let min_count = p.min_count.unwrap_or(0);
let max_count = p.max_count.unwrap_or(in_size);
// Resolve a signed count: negative means an offset from the group size
// (e.g. -1 = all but one), floored at 1 so the negative form always keeps
// constraining the group — even a singleton group, where n-1 would be 0
// and would otherwise drop the constraint entirely.
let resolve = |v: isize, size: usize| -> usize {
if v < 0 { (size as isize + v).max(1) as usize } else { v as usize }
};
let min_count = p.min_count.map(|v| resolve(v, in_size)).unwrap_or(0);
let max_count = p.max_count.map(|v| resolve(v, in_size)).unwrap_or(in_size);
let min_frac = p.min_frac.unwrap_or(default_min_frac);
let max_frac = p.max_frac.unwrap_or(1.0);
let min_outgroup_count = p.min_outgroup_count.unwrap_or(0);
let max_outgroup_count = p.max_outgroup_count.unwrap_or(default_max_outgroup_count);
let min_outgroup_count = p.min_outgroup_count.map(|v| resolve(v, out_size)).unwrap_or(0);
let max_outgroup_count = p.max_outgroup_count.map(|v| resolve(v, out_size)).unwrap_or(default_max_outgroup_count);
let min_outgroup_frac = p.min_outgroup_frac.unwrap_or(0.0);
let max_outgroup_frac = p.max_outgroup_frac.unwrap_or(1.0);
+1 -3
View File
@@ -70,9 +70,7 @@ pub struct QueryArgs {
#[arg(
short = 'T',
long,
default_value_t = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1)
default_value_t = obisys::effective_parallelism()
)]
pub threads: usize,
+1 -1
View File
@@ -21,7 +21,7 @@ enum Commands {
/// Merge multiple built indexes into one
Merge(cmd::merge::MergeArgs),
/// Apply row-level selection (σ) to an index: retain only k-mers matching the predicates
Filter(cmd::filter::FilterArgs),
Filter(cmd::filter::FilterCmdArgs),
/// Project and/or aggregate genome columns into a new or in-place index
Select(cmd::select::SelectArgs),
/// Query an index with sequences and annotate matches
+2 -1
View File
@@ -6,7 +6,6 @@ edition = "2024"
[dev-dependencies]
tempfile = "3"
obikseq = { path = "../obikseq", features = ["test-utils"] }
obiskbuilder = { path = "../obiskbuilder" }
obiread = { path = "../obiread" }
obikrope = { path = "../obikrope" }
@@ -14,6 +13,8 @@ obikrope = { path = "../obikrope" }
niffler = "3.0.0"
remove_dir_all = "0.8"
obikseq = { path = "../obikseq" }
obikentropy = { path = "../obikentropy" }
obiskbuilder = { path = "../obiskbuilder" }
obiskio = { path = "../obiskio" }
obidebruinj = { path = "../obidebruinj" }
obilayeredmap = { path = "../obilayeredmap" }
+20 -18
View File
@@ -62,7 +62,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) {
let row = mat.row(slot);
if passes_all(filters, &row, n_genomes) {
if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(kmer, row);
if !cont { break; }
}
@@ -75,7 +75,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) {
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
if passes_all(filters, &row, n_genomes) {
if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(kmer, row);
if !cont { break; }
}
@@ -83,16 +83,17 @@ impl KmerPartition {
}
cont
} else {
// No data matrix: implicit presence — all values are 1.
// The filter result is identical for every kmer, so evaluate once.
// No data matrix: implicit presence — all values are 1. `row`
// is identical for every kmer, but a filter can still depend
// on the kmer's own sequence (e.g. MinComplexity), so this
// cannot be evaluated once for the whole layer — filters must
// still be tested per kmer.
let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
let mut cont = true;
if passes_all(filters, &all_present, n_genomes) {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if mphf.find(kmer).is_some() {
cont = cb(kmer, all_present.clone());
if !cont { break; }
}
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
cont = cb(kmer, all_present.clone());
if !cont { break; }
}
}
cont
@@ -140,7 +141,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) {
let row = mat.row(slot);
if passes_all(filters, &row, n_genomes) {
if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(part, layer, kmer, row);
if !cont { break; }
}
@@ -153,7 +154,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) {
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
if passes_all(filters, &row, n_genomes) {
if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(part, layer, kmer, row);
if !cont { break; }
}
@@ -161,14 +162,15 @@ impl KmerPartition {
}
cont
} else {
// Same as iter_partition_kmers: row is constant but a filter
// may still depend on the kmer's own sequence, so this must
// be tested per kmer, not once for the whole layer.
let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
let mut cont = true;
if passes_all(filters, &all_present, n_genomes) {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if mphf.find(kmer).is_some() {
cont = cb(part, layer, kmer, all_present.clone());
if !cont { break; }
}
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
cont = cb(part, layer, kmer, all_present.clone());
if !cont { break; }
}
}
cont
+49 -13
View File
@@ -1,17 +1,24 @@
use obicompactvec::FilterMask;
use obikseq::CanonicalKmer;
/// Trait for kmer row filters.
/// Trait for kmer filters.
///
/// `kmer` is the k-mer's own canonical sequence, reconstructed from the
/// source index's `unitigs.bin` (always present — see `rebuild_layer.rs`);
/// `row` contains raw per-genome counts (or 0/1 for presence/absence data).
/// `n_genomes` equals `row.len()`.
/// `n_genomes` equals `row.len()`. Most filters only need `row` — `kmer` is
/// there for filters that reason about the k-mer's sequence itself (e.g.
/// [`MinComplexity`]).
pub trait KmerFilter: Send + Sync {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool;
fn passes(&self, kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool;
/// Express this filter as a [`FilterMask`] column-operation expression.
///
/// Returns `Some(expr)` if the filter can be evaluated solely from matrix
/// column aggregates (no per-kmer row scan needed). Returns `None` if the
/// filter requires row-level inspection.
/// filter requires row-level inspection — always the case for a filter
/// that needs the k-mer's sequence, since a `FilterMask` only expresses
/// per-genome column aggregates, never per-slot sequence data.
///
/// `threshold` semantics in the returned mask use `>= threshold`, matching
/// [`obicompactvec::MatrixGroupOps`]. Implementations must add 1 to any
@@ -23,8 +30,13 @@ pub trait KmerFilter: Send + Sync {
/// True when `row` passes every filter in `filters`.
/// Returns `true` if `filters` is empty.
pub fn passes_all(filters: &[Box<dyn KmerFilter>], row: &[u32], n_genomes: usize) -> bool {
filters.iter().all(|f| f.passes(row, n_genomes))
pub fn passes_all(
filters: &[Box<dyn KmerFilter>],
kmer: CanonicalKmer,
row: &[u32],
n_genomes: usize,
) -> bool {
filters.iter().all(|f| f.passes(kmer, row, n_genomes))
}
// ── Quorum filters ─────────────────────────────────────────────────────────────
@@ -40,7 +52,7 @@ pub struct MinGenomeFraction {
}
impl KmerFilter for MinGenomeFraction {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool {
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool {
let p = present_count(row, self.threshold);
p as f64 / n_genomes as f64 >= self.frac
}
@@ -63,7 +75,7 @@ pub struct MaxGenomeFraction {
}
impl KmerFilter for MaxGenomeFraction {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool {
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool {
let p = present_count(row, self.threshold);
p as f64 / n_genomes as f64 <= self.frac
}
@@ -86,7 +98,7 @@ pub struct MinGenomeCount {
}
impl KmerFilter for MinGenomeCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
present_count(row, self.threshold) >= self.count
}
@@ -107,7 +119,7 @@ pub struct MaxGenomeCount {
}
impl KmerFilter for MaxGenomeCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
present_count(row, self.threshold) <= self.count
}
@@ -129,7 +141,7 @@ pub struct MinTotalCount {
}
impl KmerFilter for MinTotalCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
row.iter().sum::<u32>() >= self.total
}
@@ -147,7 +159,7 @@ pub struct MaxTotalCount {
}
impl KmerFilter for MaxTotalCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
row.iter().sum::<u32>() <= self.total
}
@@ -212,7 +224,7 @@ impl GroupQuorumFilter {
}
impl KmerFilter for GroupQuorumFilter {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
if !self.ingroup_idx.is_empty() {
let n = self.ingroup_idx.iter()
.filter(|&&i| row.get(i).copied().unwrap_or(0) > self.threshold)
@@ -260,3 +272,27 @@ impl KmerFilter for GroupQuorumFilter {
Some(FilterMask::And(parts))
}
}
// ── Complexity filter (post-hoc, sequence-based) ──────────────────────────────
/// Reject k-mers with normalized entropy below `theta` — the same complexity
/// metric `obikmer index`'s `--theta`/`--level-max` apply *during* superkmer
/// construction (see [`obikentropy::KmerEntropy`]), applied here after the
/// fact, to k-mers already committed to a built index.
///
/// Unlike every other filter in this module, this one needs the k-mer's own
/// sequence, not its per-genome row — `column_mask_expr` is never overridden
/// (stays `None`), so this filter always forces the row-level scan path in
/// `rebuild_layer.rs` (which reconstructs the sequence from `unitigs.bin`
/// regardless, so no extra I/O beyond what filtering already requires).
pub struct MinComplexity {
pub level_max: usize,
pub theta: f64,
}
impl KmerFilter for MinComplexity {
fn passes(&self, kmer: CanonicalKmer, _row: &[u32], _n_genomes: usize) -> bool {
use obikentropy::KmerEntropy;
kmer.entropy(self.level_max) >= self.theta
}
}
+2 -2
View File
@@ -126,7 +126,7 @@ fn iter_src_kmers_masked(
Some(m) => m.get(slot),
None => {
let row = src_data.fill_row_by_slot(slot, n_genomes);
filters.iter().all(|f| f.passes(&row, n_genomes))
filters.iter().all(|f| f.passes(kmer, &row, n_genomes))
}
};
if passes { cb(kmer); }
@@ -165,7 +165,7 @@ fn iter_src_layers(
cb(kmer, row.into_boxed_slice());
} else {
let row = src_data.fill_row_by_slot(slot, n_genomes);
if filters.iter().all(|f| f.passes(&row, n_genomes)) {
if filters.iter().all(|f| f.passes(kmer, &row, n_genomes)) {
cb(kmer, row.into_boxed_slice());
}
}
+21
View File
@@ -341,6 +341,27 @@ impl<L: KmerLength> CanonicalKmerOf<L> {
]
}
/// Return the four central canonical neighbours (each already canonical),
/// substituting the base at the middle position `m = (L::len()-1)/2`
/// (well-defined for odd `L::len()`). Each of the 4 substitutions is
/// canonicalised independently — this correctly handles the case where a
/// substitution flips the canonical orientation, unlike inferring the
/// variant from a fixed-orientation flank key. One of the 4 equals
/// `self`'s own canonical form (the identity substitution); callers that
/// only want the 3 genuine variants should skip it.
pub fn central_canonical_neighbors(&self) -> [CanonicalKmerOf<L>; 4] {
let k = L::len();
let m = (k - 1) / 2;
let shift = KMER_BITS - 2 - 2 * m;
let cleared = self.0 & !((0b11 as RawKmer) << shift);
[
KmerOf::<L>(cleared | ((0 as RawKmer) << shift), PhantomData).canonical(),
KmerOf::<L>(cleared | ((1 as RawKmer) << shift), PhantomData).canonical(),
KmerOf::<L>(cleared | ((2 as RawKmer) << shift), PhantomData).canonical(),
KmerOf::<L>(cleared | ((3 as RawKmer) << shift), PhantomData).canonical(),
]
}
/// Return the inner value as a raw [`KmerOf<L>`].
#[inline]
pub fn into_kmer(self) -> KmerOf<L> {
+33 -17
View File
@@ -7,12 +7,28 @@
//! different value panics. This prevents silent divergence between the global
//! parameter and the values used to build data structures.
//!
//! In test builds (`#[cfg(test)]`) the same public API is backed by
//! `thread_local!` [`Cell`]s instead. Each test thread gets its own
//! independent copies of `K` and `M`, so tests can use arbitrary values
//! without coordinating with one another and without any reset mechanism.
//! The `OnceLock` constraint is deliberately absent: test isolation is
//! provided by thread locality, not by write-once semantics.
//! In test builds (`#[cfg(test)]`) the same public API is backed by plain
//! process-wide atomics instead, freely overwritable (no write-once
//! constraint) so tests don't need a reset mechanism between runs.
//!
//! An earlier version of this module used `thread_local!` `Cell`s here,
//! reasoning that "each test thread gets its own copy" gives isolation
//! between tests using different `k`/`m` values. That assumption broke as
//! soon as any code under test fanned work out to *other* threads it
//! doesn't control — `PartitionRunner`'s pre-spawned workers, or a bare
//! `rayon::par_iter()` — since a freshly spawned thread never inherits the
//! calling test thread's thread-local state, silently reading back `k=0`
//! there instead (surfaced as a `bitvec`/slice-indexing panic deep inside
//! whatever used the bogus length). Process-wide atomics make `k()`/`m()`
//! correct on *any* thread without every call site having to know to
//! re-propagate them. Unset still silently reads back as `0` (same as the
//! old `Cell` default) rather than panicking: several existing tests read
//! `m()` without ever calling `set_m` themselves, relying on that default.
//! The trade-off: tests that genuinely need different `k`/`m` values from
//! other tests must not run concurrently with them in the same process (in
//! practice: every test file in this workspace already uses one fixed
//! `k`/`m` pair for all its own tests, so this doesn't currently cost
//! anything).
// ── Production implementation ─────────────────────────────────────────────────
@@ -44,22 +60,22 @@ mod state {
// ── Test implementation ───────────────────────────────────────────────────────
//
// Each test thread owns its private K and M via thread_local!, so tests may
// call set_k / set_m with any value without affecting other tests.
// Process-wide, freely overwritable (no write-once constraint), visible from
// any thread — including threads a test doesn't spawn itself (rayon workers,
// PartitionRunner workers, ...). `0` (never explicitly set) is returned as-is,
// same default as the old thread-local `Cell`.
#[cfg(any(test, feature = "test-utils"))]
mod state {
use std::cell::Cell;
use std::sync::atomic::{AtomicUsize, Ordering};
thread_local! {
static K: Cell<usize> = Cell::new(0);
static M: Cell<usize> = Cell::new(0);
}
static K: AtomicUsize = AtomicUsize::new(0);
static M: AtomicUsize = AtomicUsize::new(0);
pub fn set_k(k: usize) { K.with(|c| c.set(k)); }
pub fn k() -> usize { K.with(|c| c.get()) }
pub fn set_m(m: usize) { M.with(|c| c.set(m)); }
pub fn m() -> usize { M.with(|c| c.get()) }
pub fn set_k(k: usize) { K.store(k, Ordering::SeqCst); }
pub fn k() -> usize { K.load(Ordering::SeqCst) }
pub fn set_m(m: usize) { M.store(m, Ordering::SeqCst); }
pub fn m() -> usize { M.load(Ordering::SeqCst) }
}
// ── Public API (identical signature in both configurations) ───────────────────
+42
View File
@@ -210,4 +210,46 @@ mod tests {
check!(31);
check!(32);
}
// ── central_canonical_neighbors ─────────────────────────────────────────
#[test]
fn central_canonical_neighbors_hand_checked_k3() {
// k=3, centre = index 1. For "ACG", every one of the 4 central
// substitutions ("AAG","ACG","AGG","ATG") happens to stay in forward
// orientation when canonicalised (verified by hand: each is already
// lexicographically <= its own reverse complement), so this case
// exercises the substitution logic without the RC-flip edge case.
let ck = KmerOf::<ConstLen<3>>::from_ascii(b"ACG").unwrap().canonical();
let neighbours = ck.central_canonical_neighbors();
let ascii: Vec<Vec<u8>> = neighbours.iter().map(|n| n.to_ascii()).collect();
assert_eq!(ascii, vec![b"AAG".to_vec(), b"ACG".to_vec(), b"AGG".to_vec(), b"ATG".to_vec()]);
// The identity substitution (centre unchanged) must reproduce `ck`.
assert!(neighbours.contains(&ck));
}
#[test]
fn central_canonical_neighbors_identity_present_for_various_k() {
macro_rules! check {
($n:expr) => {{
let ck = KmerOf::<ConstLen<$n>>::from_ascii(&make_seq::<$n>())
.unwrap()
.canonical();
let neighbours = ck.central_canonical_neighbors();
assert!(
neighbours.contains(&ck),
"identity substitution missing from central_canonical_neighbors for k={}",
$n
);
// Every returned neighbour must itself already be canonical.
for n in &neighbours {
assert_eq!(n.into_kmer().canonical(), *n, "neighbour not canonical for k={}", $n);
}
}};
}
check!(1);
check!(3);
check!(5);
check!(31);
}
}
+6
View File
@@ -7,7 +7,13 @@ edition = "2024"
obikseq = { path = "../obikseq" }
obikrope = { path = "../obikrope" }
obiread = { path = "../obiread" }
obikentropy = { path = "../obikentropy" }
lazy_static = "1.5.0"
[dev-dependencies]
obikseq = { path = "../obikseq", features = ["test-utils"] }
criterion2 = { version = "3", features = ["cargo_bench_support"] }
[[bench]]
name = "superkmer_stream"
harness = false
@@ -0,0 +1,58 @@
//! Throughput of the streaming superkmer pipeline (`RollingStat`'s hot path:
//! minimizer selection + entropy tracking fused in a single pass).
//!
//! Reference point for the `obikentropy` extraction: the entropy bookkeeping
//! that used to live inline in `RollingStat` was pulled out into a composed
//! `EntropyTracker`. This benchmark is run before and after that change to
//! confirm no regression.
use criterion::{Criterion, Throughput, criterion_group, criterion_main};
use obikrope::Rope;
use obiskbuilder::SuperKmerIter;
const K: usize = 21;
const M: usize = 9;
const LEVEL_MAX: usize = 6;
const THETA: f64 = 0.7;
const SEQ_LEN: usize = 200_000;
/// Deterministic pseudo-random ACGT sequence — high enough complexity that
/// the entropy filter rarely rejects, so the bench stays on the steady-state
/// path rather than repeatedly resetting.
fn make_sequence(len: usize) -> Vec<u8> {
let mut state: u64 = 0x9E3779B97F4A7C15;
(0..len)
.map(|_| {
state ^= state << 13;
state ^= state >> 7;
state ^= state << 17;
b"ACGT"[(state % 4) as usize]
})
.collect()
}
fn make_rope(seq: &[u8]) -> Rope {
let mut rope = Rope::new(None);
rope.push(seq.to_vec());
rope
}
fn bench_build_superkmers(c: &mut Criterion) {
obikseq::set_k(K);
obikseq::set_m(M);
let seq = make_sequence(SEQ_LEN);
let rope = make_rope(&seq);
let mut group = c.benchmark_group("build_superkmers");
group.throughput(Throughput::Bytes(SEQ_LEN as u64));
group.bench_function("stream", |b| {
b.iter(|| {
SuperKmerIter::new(std::hint::black_box(&rope), K, LEVEL_MAX, THETA).count()
});
});
group.finish();
}
criterion_group!(benches, bench_build_superkmers);
criterion_main!(benches);
-108
View File
@@ -1,108 +0,0 @@
pub(crate) const NORMK1: [u64; 4] = build_normalized_kmer::<4>();
pub(crate) const NORMK2: [u64; 16] = build_normalized_kmer::<16>();
pub(crate) const NORMK3: [u64; 64] = build_normalized_kmer::<64>();
pub(crate) const NORMK4: [u64; 256] = build_normalized_kmer::<256>();
pub(crate) const NORMK5: [u64; 1024] = build_normalized_kmer::<1024>();
pub(crate) const NORMK6: [u64; 4096] = build_normalized_kmer::<4096>();
include!(concat!(env!("OUT_DIR"), "/ln_class_tables.rs"));
const fn normalize_circular(kmer: u64, ws: usize) -> u64 {
let mask = (1u64 << (ws * 2)) - 1;
let mut canonical = kmer & mask;
let mut current = canonical;
let mut i = 0;
while i < (ws - 1) {
let top = (current >> ((ws - 1) * 2)) & 3;
current = ((current << 2) | top) & mask;
if current < canonical {
canonical = current;
}
i += 1;
}
canonical
}
const fn build_normalized_kmer<const N: usize>() -> [u64; N] {
let mut result = [0u64; N];
let k = k_from_n::<N>();
let shift = 64 - k * 2;
let mut i = 0;
while i < N {
let la = (i as u64) << shift;
let ra = i as u64;
let rc_ra = revcomp_raw(la, k) >> shift;
let circ = normalize_circular(ra, k);
let circ_rc = normalize_circular(rc_ra, k);
result[i] = if circ < circ_rc { circ } else { circ_rc };
i += 1;
}
result
}
const fn revcomp_raw(x: u64, k: usize) -> u64 {
let x = !x;
let x = x.swap_bytes();
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
x << (64 - 2 * k)
}
const fn k_from_n<const N: usize>() -> usize {
match N {
4 => 1,
16 => 2,
64 => 3,
256 => 4,
1024 => 5,
4096 => 6,
_ => panic!("N must be a power of 4"),
}
}
pub(crate) const WS_MAX: usize = 6;
#[inline(always)]
pub(crate) const fn n_log_n(n: usize) -> f64 {
N_LOG_N[n]
}
#[inline(always)]
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
EMAX[k][ws]
}
#[inline(always)]
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
LOG_NWORDS[k][ws]
}
#[inline(always)]
pub(crate) const fn entropy_norm_kmer<const LEFT: bool, const K: usize>(kmer: u64) -> u64 {
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
const NORM: [&[u64]; 7] = [&[], &NORMK1, &NORMK2, &NORMK3, &NORMK4, &NORMK5, &NORMK6];
let shift = SHIFT[K];
let ra = if LEFT { kmer >> shift } else { kmer };
let canonical_ra = NORM[K][ra as usize];
if LEFT {
canonical_ra << shift
} else {
canonical_ra
}
}
#[inline(always)]
pub(crate) const fn ln_class_size<const LEFT: bool, const K: usize>(kmer: u64) -> f64 {
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
let ra = if LEFT { kmer >> SHIFT[K] } else { kmer };
match K {
1 => LN_CLASS1[ra as usize],
2 => LN_CLASS2[ra as usize],
3 => LN_CLASS3[ra as usize],
4 => LN_CLASS4[ra as usize],
5 => LN_CLASS5[ra as usize],
6 => LN_CLASS6[ra as usize],
_ => panic!("k must be 1..=6"),
}
}
+2 -154
View File
@@ -149,157 +149,5 @@ impl Iterator for SuperKmerIter<'_> {
// ── tests ─────────────────────────────────────────────────────────────────────
#[cfg(test)]
mod tests {
use super::*;
use obikrope::Rope;
fn setup() {
obikseq::params::set_k(K);
obikseq::params::set_m(5);
}
fn make_rope(data: &[u8]) -> Rope {
let mut r = Rope::new(None);
r.push(data.to_vec());
r
}
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
let rope = make_rope(data);
SuperKmerIter::new(&rope, k, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect()
}
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
const K: usize = 11;
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
(0..seq.len().saturating_sub(K - 1))
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
.collect()
}
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
SuperKmerIter::new(rope, K, 1, 0.0)
.flat_map(|rsk| {
rsk.superkmer()
.iter_canonical_kmers()
.map(|km| km.to_ascii())
.collect::<Vec<_>>()
})
.collect()
}
#[test]
fn coverage_single_segment() {
setup();
let seq = b"ACGTACGTACGTACGTACGT";
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
let direct = direct_canonical_kmers(seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans segment unique : {missing:?}"
);
}
#[test]
fn coverage_two_segments() {
setup();
let seg1 = b"ACGTACGTACGTACGTACGT";
let seg2 = b"TGCATGCATGCATGCATGCA";
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
let mut direct = direct_canonical_kmers(seg1);
direct.extend(direct_canonical_kmers(seg2));
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans deux segments : {missing:?}"
);
}
#[test]
fn coverage_minimizer_boundary() {
setup();
// sequence assez longue pour forcer plusieurs changements de minimiseur
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
let direct = direct_canonical_kmers(&seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus à la frontière de minimiseur : {missing:?}"
);
}
#[test]
fn single_segment_one_superkmer() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
assert!(!out.is_empty());
let total: Vec<u8> = out.into_iter().flatten().collect();
assert!(total.len() >= K);
}
#[test]
fn segment_shorter_than_k_emits_nothing() {
setup();
let out = run_nofilter(b"ACGTACGT\x00", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn empty_input_emits_nothing() {
setup();
let out = run_nofilter(b"", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn two_segments_both_emitted() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
assert!(!out.is_empty());
}
#[test]
fn low_complexity_kmer_is_rejected() {
setup();
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
assert!(!out_pass.is_empty());
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(out_reject.is_empty());
}
#[test]
fn multi_slice_rope() {
setup();
let data = b"ACGTACGTACGTACGTACGT\x00";
let mid = data.len() / 2;
let mut rope = Rope::new(None);
rope.push(data[..mid].to_vec());
rope.push(data[mid..].to_vec());
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(!out.is_empty());
}
#[test]
fn yields_minimizer_value() {
setup();
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
assert!(!results.is_empty());
}
}
#[path = "tests/iter.rs"]
mod tests;
+2 -2
View File
@@ -10,8 +10,8 @@ pub mod stream_iter;
mod scratch;
pub(crate) mod encoding;
pub(crate) mod entropy_table;
pub(crate) mod rolling_stat;
#[allow(missing_docs)]
pub mod rolling_stat;
pub use iter::SuperKmerIter;
pub use scratch::SuperKmerScratch;
+10 -255
View File
@@ -1,8 +1,8 @@
use obikentropy::EntropyTracker;
use obikseq::kmer::{Minimizer, hash_kmer};
use obikseq::params;
use crate::encoding::encode_nuc;
use crate::entropy_table::{WS_MAX, emax, entropy_norm_kmer, ln_class_size, log_nwords, n_log_n};
// ── Stack-allocated ring buffer ───────────────────────────────────────────────
@@ -83,33 +83,19 @@ pub struct RollingStat {
entropy_max_k: usize,
k: usize,
m: usize,
steady: bool,
rolling_k: u64,
rolling_rck: u64,
k_mask: u64,
m_mask: u64,
received: usize,
// Sliding-window queues — stack-allocated, capacity ≤ k ≤ 31.
k1q: Ring<u64, 32>,
k2q: Ring<u64, 32>,
k3q: Ring<u64, 32>,
k4q: Ring<u64, 32>,
k5q: Ring<u64, 32>,
k6q: Ring<u64, 32>,
// Minimizer selection state.
minimier: Ring<MmerItem, 32>,
// Frequency count arrays.
// Max count per cell ≤ k ≤ 31 → u8 is sufficient.
k1c: [u8; 4],
k2c: [u8; 16],
k3c: [u8; 64],
k4c: [u8; 256],
k5c: [u8; 1024],
k6c: [u8; 4096],
sum_f_log_f: [f64; WS_MAX + 1],
sum_f_log_s: [f64; WS_MAX + 1],
// Entropy tracking, composed as a plain inline field so both concerns
// update in the same streaming pass without being conflated in one
// struct — see `obikentropy::EntropyTracker`.
entropy: EntropyTracker,
}
impl RollingStat {
@@ -120,27 +106,13 @@ impl RollingStat {
entropy_max_k,
k,
m,
steady: false,
rolling_k: 0,
rolling_rck: 0,
k_mask: (!0u64) >> (64 - k * 2),
m_mask: (!0u64) >> (64 - m * 2),
received: 0,
k1q: Ring::new(),
k2q: Ring::new(),
k3q: Ring::new(),
k4q: Ring::new(),
k5q: Ring::new(),
k6q: Ring::new(),
minimier: Ring::new(),
k1c: [0; 4],
k2c: [0; 16],
k3c: [0; 64],
k4c: [0; 256],
k5c: [0; 1024],
k6c: [0; 4096],
sum_f_log_f: [0.0; WS_MAX + 1],
sum_f_log_s: [0.0; WS_MAX + 1],
entropy: EntropyTracker::new(k),
}
}
@@ -148,54 +120,9 @@ impl RollingStat {
self.rolling_k = 0;
self.rolling_rck = 0;
self.received = 0;
self.steady = false;
// for i in self.k1q.iter() { self.k1c[i as usize] = 0; }
// for i in self.k2q.iter() { self.k2c[i as usize] = 0; }
// for i in self.k3q.iter() { self.k3c[i as usize] = 0; }
// for i in self.k4q.iter() { self.k4c[i as usize] = 0; }
// for i in self.k5q.iter() { self.k5c[i as usize] = 0; }
// for i in self.k6q.iter() { self.k6c[i as usize] = 0; }
self.k1c.fill(0);
self.k2c.fill(0);
self.k3c.fill(0);
self.k4c.fill(0);
self.k5c.fill(0);
self.k6c.fill(0);
self.k1q.clear();
self.k2q.clear();
self.k3q.clear();
self.k4q.clear();
self.k5q.clear();
self.k6q.clear();
self.minimier.clear();
self.sum_f_log_f = [0.0; WS_MAX + 1];
self.sum_f_log_s = [0.0; WS_MAX + 1];
}
#[inline]
fn update_sums_decrement<const K: usize>(
sum_f_log_f: &mut [f64; WS_MAX + 1],
sum_f_log_s: &mut [f64; WS_MAX + 1],
canonical: u64,
f: usize,
) {
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
sum_f_log_s[K] -= ln_class_size::<false, K>(canonical);
}
#[inline]
fn update_sums_increment<const K: usize>(
sum_f_log_f: &mut [f64; WS_MAX + 1],
sum_f_log_s: &mut [f64; WS_MAX + 1],
canonical: u64,
g: usize,
) {
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
sum_f_log_s[K] += ln_class_size::<false, K>(canonical);
self.entropy.reset();
}
pub fn push(&mut self, nuc: u8) {
@@ -209,13 +136,6 @@ impl RollingStat {
self.rolling_rck =
((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask;
let canonical_k1 = entropy_norm_kmer::<false, 1>(self.rolling_k & 3);
let canonical_k2 = entropy_norm_kmer::<false, 2>(self.rolling_k & 15);
let canonical_k3 = entropy_norm_kmer::<false, 3>(self.rolling_k & 63);
let canonical_k4 = entropy_norm_kmer::<false, 4>(self.rolling_k & 255);
let canonical_k5 = entropy_norm_kmer::<false, 5>(self.rolling_k & 1023);
let canonical_k6 = entropy_norm_kmer::<false, 6>(self.rolling_k & 4095);
self.received += 1;
if self.received >= m {
@@ -248,153 +168,7 @@ impl RollingStat {
}
}
if self.received > k {
let old1 = self.k1q.pop_front();
let f1 = self.k1c[old1 as usize] as usize;
Self::update_sums_decrement::<1>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old1,
f1,
);
self.k1c[old1 as usize] -= 1;
let old2 = self.k2q.pop_front();
let f2 = self.k2c[old2 as usize] as usize;
Self::update_sums_decrement::<2>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old2,
f2,
);
self.k2c[old2 as usize] -= 1;
let old3 = self.k3q.pop_front();
let f3 = self.k3c[old3 as usize] as usize;
Self::update_sums_decrement::<3>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old3,
f3,
);
self.k3c[old3 as usize] -= 1;
let old4 = self.k4q.pop_front();
let f4 = self.k4c[old4 as usize] as usize;
Self::update_sums_decrement::<4>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old4,
f4,
);
self.k4c[old4 as usize] -= 1;
let old5 = self.k5q.pop_front();
let f5 = self.k5c[old5 as usize] as usize;
Self::update_sums_decrement::<5>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old5,
f5,
);
self.k5c[old5 as usize] -= 1;
let old6 = self.k6q.pop_front();
let f6 = self.k6c[old6 as usize] as usize;
Self::update_sums_decrement::<6>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old6,
f6,
);
self.k6c[old6 as usize] -= 1;
}
if self.steady {
let g1 = self.k1c[canonical_k1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
self.k1c[canonical_k1 as usize] += 1;
self.k1q.push_back(canonical_k1);
let g2 = self.k2c[canonical_k2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
self.k2c[canonical_k2 as usize] += 1;
self.k2q.push_back(canonical_k2);
let g3 = self.k3c[canonical_k3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
self.k3c[canonical_k3 as usize] += 1;
self.k3q.push_back(canonical_k3);
let g4 = self.k4c[canonical_k4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
self.k4c[canonical_k4 as usize] += 1;
self.k4q.push_back(canonical_k4);
let g5 = self.k5c[canonical_k5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
self.k5c[canonical_k5 as usize] += 1;
self.k5q.push_back(canonical_k5);
let g6 = self.k6c[canonical_k6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
self.k6c[canonical_k6 as usize] += 1;
self.k6q.push_back(canonical_k6);
} else {
self.push_warmup_increments(
canonical_k1, canonical_k2, canonical_k3,
canonical_k4, canonical_k5, canonical_k6,
);
}
}
#[cold]
#[inline(never)]
fn push_warmup_increments(
&mut self,
canonical_k1: u64, canonical_k2: u64, canonical_k3: u64,
canonical_k4: u64, canonical_k5: u64, canonical_k6: u64,
) {
let g1 = self.k1c[canonical_k1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
self.k1c[canonical_k1 as usize] += 1;
self.k1q.push_back(canonical_k1);
if self.received >= 2 {
let g2 = self.k2c[canonical_k2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
self.k2c[canonical_k2 as usize] += 1;
self.k2q.push_back(canonical_k2);
if self.received >= 3 {
let g3 = self.k3c[canonical_k3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
self.k3c[canonical_k3 as usize] += 1;
self.k3q.push_back(canonical_k3);
if self.received >= 4 {
let g4 = self.k4c[canonical_k4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
self.k4c[canonical_k4 as usize] += 1;
self.k4q.push_back(canonical_k4);
if self.received >= 5 {
let g5 = self.k5c[canonical_k5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
self.k5c[canonical_k5 as usize] += 1;
self.k5q.push_back(canonical_k5);
if self.received >= 6 {
let g6 = self.k6c[canonical_k6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
self.k6c[canonical_k6 as usize] += 1;
self.k6q.push_back(canonical_k6);
self.steady = true;
}
}
}
}
}
self.entropy.push(self.received, self.rolling_k);
}
pub fn ready(&self) -> bool {
@@ -422,29 +196,10 @@ impl RollingStat {
.map(|raw| Minimizer::from_raw_unchecked(raw << (64 - self.m * 2)))
}
pub fn entropy(&self, order: usize) -> Option<f64> {
if !self.ready() {
return None;
}
let k = self.k;
let em = emax(k, order);
if em <= 0.0 {
return Some(1.0);
}
let nwords = k - order + 1;
let log_nw = log_nwords(k, order);
let nw_f = nwords as f64;
let h_corr = log_nw + (self.sum_f_log_s[order] - self.sum_f_log_f[order]) / nw_f;
Some((h_corr / em).max(0.0))
}
pub fn normalized_entropy(&self) -> Option<f64> {
if !self.ready() {
return None;
}
let min_e = (1..=self.entropy_max_k)
.filter_map(|ws| self.entropy(ws))
.fold(f64::MAX, f64::min);
Some(if min_e == f64::MAX { 1.0 } else { min_e })
Some(self.entropy.normalized_entropy(self.entropy_max_k))
}
}
+152
View File
@@ -0,0 +1,152 @@
use super::*;
use obikrope::Rope;
fn setup() {
obikseq::params::set_k(K);
obikseq::params::set_m(5);
}
fn make_rope(data: &[u8]) -> Rope {
let mut r = Rope::new(None);
r.push(data.to_vec());
r
}
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
let rope = make_rope(data);
SuperKmerIter::new(&rope, k, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect()
}
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
const K: usize = 11;
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
(0..seq.len().saturating_sub(K - 1))
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
.collect()
}
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
SuperKmerIter::new(rope, K, 1, 0.0)
.flat_map(|rsk| {
rsk.superkmer()
.iter_canonical_kmers()
.map(|km| km.to_ascii())
.collect::<Vec<_>>()
})
.collect()
}
#[test]
fn coverage_single_segment() {
setup();
let seq = b"ACGTACGTACGTACGTACGT";
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
let direct = direct_canonical_kmers(seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans segment unique : {missing:?}"
);
}
#[test]
fn coverage_two_segments() {
setup();
let seg1 = b"ACGTACGTACGTACGTACGT";
let seg2 = b"TGCATGCATGCATGCATGCA";
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
let mut direct = direct_canonical_kmers(seg1);
direct.extend(direct_canonical_kmers(seg2));
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans deux segments : {missing:?}"
);
}
#[test]
fn coverage_minimizer_boundary() {
setup();
// sequence assez longue pour forcer plusieurs changements de minimiseur
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
let direct = direct_canonical_kmers(&seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus à la frontière de minimiseur : {missing:?}"
);
}
#[test]
fn single_segment_one_superkmer() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
assert!(!out.is_empty());
let total: Vec<u8> = out.into_iter().flatten().collect();
assert!(total.len() >= K);
}
#[test]
fn segment_shorter_than_k_emits_nothing() {
setup();
let out = run_nofilter(b"ACGTACGT\x00", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn empty_input_emits_nothing() {
setup();
let out = run_nofilter(b"", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn two_segments_both_emitted() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
assert!(!out.is_empty());
}
#[test]
fn low_complexity_kmer_is_rejected() {
setup();
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
assert!(!out_pass.is_empty());
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(out_reject.is_empty());
}
#[test]
fn multi_slice_rope() {
setup();
let data = b"ACGTACGTACGTACGTACGT\x00";
let mid = data.len() / 2;
let mut rope = Rope::new(None);
rope.push(data[..mid].to_vec());
rope.push(data[mid..].to_vec());
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(!out.is_empty());
}
#[test]
fn yields_minimizer_value() {
setup();
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
assert!(!results.is_empty());
}
+2 -2
View File
@@ -102,9 +102,9 @@ fn roundtrip_single() {
#[test]
fn roundtrip_all_lengths() {
obikseq::params::set_k(11);
setup();
let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
for len in (11..=19).chain([255, 256, 257]) {
for len in (TEST_K..=19).chain([255, 256, 257]) {
let sk = make_sk(&bases[..len]);
let mut buf = Vec::new();
sk.write_to_binary(&mut buf).unwrap();
+89 -3
View File
@@ -202,6 +202,94 @@ fn cgroup_v1_available() -> Option<u64> {
Some(limit.saturating_sub(used))
}
// ── CPU parallelism query ────────────────────────────────────────────────────
/// Returns the number of cores this process can actually use concurrently.
///
/// `std::thread::available_parallelism()` reads CPU affinity
/// (`sched_getaffinity`), not the container's CPU quota — a Docker/cgroup
/// container commonly reports the *host's* full core count this way while
/// actually being throttled (via `cpu.max`/`cpu.cfs_quota_us`) to a fraction
/// of a core. Sizing a thread/worker pool off the unthrottled count causes
/// severe oversubscription: dozens of threads contending for a sliver of
/// real CPU time, which can look indistinguishable from a hang for minutes
/// or hours (observed in CI). On Linux, this reads the cgroup CPU quota
/// first and returns `min(cgroup_quota, host_parallelism)` when a finite
/// quota is found; falls back to `available_parallelism()` otherwise (same
/// convention as [`available_memory_bytes`]).
pub fn effective_parallelism() -> usize {
let host = std::thread::available_parallelism().map(|n| n.get()).unwrap_or(1);
#[cfg(target_os = "linux")]
{
if let Some(quota) = cgroup_v2_cpu_quota() {
let effective = quota.clamp(1, host);
tracing::debug!(host, quota, effective, source = "cgroup v2", "effective_parallelism");
return effective;
}
if let Some(quota) = cgroup_v1_cpu_quota() {
let effective = quota.clamp(1, host);
tracing::debug!(host, quota, effective, source = "cgroup v1", "effective_parallelism");
return effective;
}
}
tracing::debug!(host, effective = host, source = "available_parallelism (no cgroup quota found)", "effective_parallelism");
host
}
/// cgroup v2 (unified hierarchy): reads `cpu.max` ("<quota> <period>", or
/// "max <period>" when unlimited) for the current process's cgroup, rounded
/// up to whole cores. Returns `None` if unlimited or on any parse error.
#[cfg(target_os = "linux")]
fn cgroup_v2_cpu_quota() -> Option<usize> {
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
let rel = cgroup
.lines()
.find(|l| l.starts_with("0::"))?
.strip_prefix("0::")?
.trim();
let base = format!("/sys/fs/cgroup{rel}");
let raw = std::fs::read_to_string(format!("{base}/cpu.max")).ok()?;
let mut parts = raw.split_whitespace();
let quota_str = parts.next()?;
let period: f64 = parts.next()?.parse().ok()?;
if quota_str == "max" {
return None; // unlimited
}
let quota: f64 = quota_str.parse().ok()?;
Some((quota / period).ceil().max(1.0) as usize)
}
/// cgroup v1 (cpu subsystem): reads `cpu.cfs_quota_us`/`cpu.cfs_period_us`,
/// rounded up to whole cores. Returns `None` if unlimited (quota <= 0) or on
/// any parse error.
#[cfg(target_os = "linux")]
fn cgroup_v1_cpu_quota() -> Option<usize> {
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
let path = cgroup
.lines()
.find(|l| l.contains(":cpu:") || l.contains(":cpu,cpuacct:"))?
.split(':')
.nth(2)?;
let base = format!("/sys/fs/cgroup/cpu{path}");
let quota: i64 = std::fs::read_to_string(format!("{base}/cpu.cfs_quota_us"))
.ok()?
.trim()
.parse()
.ok()?;
if quota <= 0 {
return None; // unlimited
}
let period: i64 = std::fs::read_to_string(format!("{base}/cpu.cfs_period_us"))
.ok()?
.trim()
.parse()
.ok()?;
if period <= 0 {
return None;
}
Some(((quota as f64) / (period as f64)).ceil().max(1.0) as usize)
}
// ── raw helpers ───────────────────────────────────────────────────────────────
fn get_rusage() -> rusage {
@@ -654,9 +742,7 @@ impl fmt::Display for Reporter {
return Ok(());
}
let n_cores = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1);
let n_cores = effective_parallelism();
// column widths
let nw = self