Compare commits

...
3 Commits
Author SHA1 Message Date
coissac 14aa82521d Merge pull request 'fix: resolve test race conditions, add logging, and fix CI deadlock' (#66) from push-kywuzlnvrqyx into main
Reviewed-on: #66
2026-08-11 21:05:09 +00:00
Eric Coissac c95c47155e fix: resolve test race conditions, add logging, and fix CI deadlock
Release / create-release (push) Successful in 2m26s
ci.yml / build (pull_request) Successful in 4m4s
Release / build-linux-x86_64 (push) Successful in 8m19s
Release / build-macos-arm64 (push) Successful in 1m48s
Re-enables the `numa` feature in CI workflows to prevent container/cgroup deadlocks while preserving validation correctness. Fixes concurrent test race conditions by replacing thread-local parameter storage with process-wide atomics and mutex locks. Integrates `tracing-subscriber` for structured logging and adds thread-ID tracking to debug worker lifecycles. Additionally bumps the crate version, updates `.gitignore`, documents experimental evolutionary distance pipelines, and refactors hardcoded test constants.
2026-08-11 23:04:06 +02:00
coissac 4f6d442688 Merge pull request 'ci: disable numa feature, bump obikmer, and document Sankoff costs' (#65) from push-oruynkvporsn into main
Reviewed-on: #65
2026-08-11 16:28:07 +00:00
11 changed files with 169 additions and 33 deletions
+2 -10
View File
@@ -28,16 +28,8 @@ jobs:
key: ${{ runner.os }}-cargo-v2-${{ hashFiles('src/Cargo.lock') }}
restore-keys: ${{ runner.os }}-cargo-v2-
# Both `obikmer` and `obikindex` default to the `numa` feature
# (hwloc-based topology detection + CPU pinning), which is only useful
# on bare-metal multi-socket indexing hosts. Under this runner's
# container/cgroup setup it deadlocks at startup — confirmed live
# (2026-08-11): the same test binary hangs indefinitely with `numa` on
# and passes instantly, repeatedly, with it off, on the same
# container. Disable it for CI; it has nothing to do with test
# correctness.
- name: Build
run: cargo build --release --no-default-features
run: cargo build --release
- name: Test
run: cargo test --release --no-default-features
run: cargo test --release
+2
View File
@@ -24,3 +24,5 @@ benchmark/reference_dist
benchmark/obikmer_dist
benchmark/specific_index_count
benchmark/specific_index_presence
TNT
phyg
+73
View File
@@ -473,6 +473,79 @@ matrix derived from the state graph, `c_ts`/`c_tv`/`c_gl`/`c_ctx` as
tunable parameters) is directly usable there — no new tooling required
before testing it.
### Experiment: TNT run on real data (2026-08-11)
**Status:** validated at genus/family/order scale within Bacteria; not
informative across domains with this character type. Exploratory only —
run entirely outside the repo (`/tmp/tnt_run`, TNT installed locally under
`TNT/`), no new Rust code. Kept here as the record of what was learned.
**Pipeline.** `obikmer distance --snp` emits one IUPAC-coded pseudo-alignment
row per genome (`snp_pseudo_alignment`, one column per family with
`family_size() >= 2`). A small external Python script decodes IUPAC back to
the 16-state bitmask, applies the set-edit-distance formula above, and
emits a complete TNT script (`xread` matrix + `smatrix` step-matrix + `hold`/
`mult` search). No new Rust code was needed for this pass.
**Calibration ("quick option").** Rather than modifying
`write_raw_snp_distance_csv` to emit raw counts, `c_ctx` was approximated as
the unweighted mean of the pairwise `snp/(snp+shared)` ratios already
present in `rawsnp.csv`, restricted to the relevant taxon subset. Used
values: `mu = gamma = 10`, `c_ctx = 18` (ratio `c_ctx/mu = 1.8`, consistent
with the observed pairwise ratios for genomes within Enterobacteriaceae/
Eubacteria, which cluster around 1.5-2 and barely move as the taxon set
widens — the context signal is stable, not sensitive to which subset is
chosen). The more principled route (raw counts, weighted `p_hat`, Ts/Tv
split) remains a follow-up, not yet done.
**Run 1 — Enterobacteriaceae (11 taxa: 4 *E. coli*, 4 *Salmonella enterica*,
3 *Klebsiella pneumoniae*).** All three genera recovered as monophyletic.
Initial read of the exported (unrooted, TNT/Nexus `[&U]`) tree as showing a
genus-arrangement disagreement with known systematics (*Escherichieae*:
*Escherichia*+*Salmonella* sister vs. more distant *Klebsielleae*) was
**wrong** — diagnosed via `force = (taxa);` monophyly-constraint test
(identical score constrained vs. free ⟹ no real disagreement). Root cause of
the misreading: with exactly 3 clades and no outgroup, an unrooted tree has
only **one possible topology** (a single trifurcation) — there is no
internal arrangement to get right or wrong. This run cannot test
inter-genus relationships at all; it can only test intra-genus monophyly
(which held).
**Run 2 — Eubacteria (18 taxa: run 1 + *Acidobacterium capsulatum*,
*Opitutus terrae*, *Bacillus subtilis*, *Shouchella clausii*, *Wolbachia*
endosymbiont, *Proteus mirabilis*, *Yersinia ruckeri*).** The
Enterobacteriaceae substructure from run 1 is reproduced identically, now
correctly rooted by real outgroups, resolving the tribal arrangement left
undetermined in run 1: *Escherichia*+*Salmonella* sister, *Klebsiella* more
distant — matching known systematics. Outgroup placement: `(Bacillus,
Shouchella)` sister pair (Firmicutes/*Bacillales*) splits from all
Proteobacteria — a correct phylum-level split; `Wolbachia`
(Alphaproteobacteria) splits from the Gammaproteobacteria block
(`Proteus`, `Yersinia`, Enterobacteriaceae) — a correct class-level split.
Lower confidence: the fine nested order `(Proteus, (Yersinia,
Enterobacteriaceae))` and the relative position of `Acidobacterium` vs.
`Opitutus` — plausible, not independently verified against current
Enterobacterales family-level literature.
**Run 3 — full domain set (20 taxa: run 2 + *Candidozyma auris* [yeast] and
*Saccharolobus islandicus* [archaeon]).** The bacterial clade from run 2 is
reproduced **unchanged and intact** — a real robustness signal, the method
does not fragment the ingroup when unrelated deep taxa are added. But the
result carries **no information on Bacteria/Archaea/Eukarya relationships**:
with exactly one eukaryote, one archaeon and one bacterial clade, the
unrooted tree is again forced into the single 3-clade trifurcation from run
1's caveat — there is no second representative of either outgroup domain to
resolve internal arrangement, so nothing about their relative position can
be read from the topology (a "ladder" ordering in the exported tree is
serialization, not signal). Independently, `rawsnp.csv` shows *why* this
character type cannot reach further: pairwise ratios involving
*Candidozyma*/*Saccharolobus* are almost all `NA` (no central-position
family shared at all) or saturated at `1.0` (every shared family differs) —
central-position families require literal 31 bp context conservation, which
simply does not survive domain-level divergence. Cross-domain placement
would need conserved-marker characters (rRNA, ribosomal proteins), not this
estimator.
## Heterozygosity, ploidy, and consensus-assembly inputs
A within-genome multiplicity signal (more than one of the 4 central forms
+2 -1
View File
@@ -1711,11 +1711,12 @@ dependencies = [
"serde_json",
"tempfile",
"tracing",
"tracing-subscriber",
]
[[package]]
name = "obikmer"
version = "1.1.43"
version = "1.1.44"
dependencies = [
"clap",
"csv",
+24 -1
View File
@@ -1,6 +1,17 @@
use super::*;
use obikseq::{k, set_k, unitig::Unitig, Kmer};
// `obikseq::params` is process-wide (see obikseq/src/params.rs): tests in this
// file don't all use the same `k` (`push_palindrome_single_node` needs an
// even k=4 — no odd-length self-revcomp palindrome exists — while the rest
// use k=5), and they run concurrently by default. Serialize the
// set_k-through-use critical section across this file's tests so one test's
// `k` can never be overwritten mid-flight by another.
static K_LOCK: std::sync::Mutex<()> = std::sync::Mutex::new(());
fn lock_k() -> std::sync::MutexGuard<'static, ()> {
K_LOCK.lock().unwrap_or_else(|e| e.into_inner())
}
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn {
let mut g = GraphDeBruijn::new();
@@ -37,6 +48,7 @@ fn collect_unitigs(g: &GraphDeBruijn) -> Vec<Unitig> {
#[test]
fn push_deduplicates_revcomp() {
let k = 5;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
let mut g = GraphDeBruijn::new();
@@ -49,6 +61,7 @@ fn push_deduplicates_revcomp() {
fn push_palindrome_single_node() {
// ACGT is its own revcomp
let k = 4;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGT").unwrap();
assert_eq!(kmer, kmer.revcomp(), "test requires a palindrome");
@@ -71,6 +84,7 @@ fn linear_chain_graph() -> (GraphDeBruijn, Vec<CanonicalKmer>) {
#[test]
fn degrees_linear_chain_node_count() {
let k = 5;
let _guard = lock_k();
set_k(k);
let (g, kmers) = linear_chain_graph();
assert_eq!(g.len(), kmers.len());
@@ -82,6 +96,7 @@ fn degrees_linear_chain_extensions() {
// Note: start_iter must not be consumed standalone — its second pass only
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"AAAAGGGG";
let g = graph_from_ascii(seq);
@@ -118,6 +133,7 @@ fn kmers_from_unitigs(unitigs: &[Unitig]) -> Vec<CanonicalKmer> {
fn unitig_roundtrip_linear() {
// Non-repetitive sequence: all k-mers must be recovered across unitigs.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACCTGGCTA";
let g = graph_from_ascii(seq);
@@ -136,6 +152,7 @@ fn unitig_roundtrip_longer_sequence() {
// Longer non-repetitive sequence with no repeated k-mer of length k.
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTGGCTATCGAC";
let g = graph_from_ascii(seq);
@@ -152,6 +169,7 @@ fn unitig_roundtrip_longer_sequence() {
fn unitig_isolated_node() {
// Single k-mer with no neighbours
let k = 5;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
let mut g = GraphDeBruijn::new();
@@ -165,6 +183,7 @@ fn unitig_isolated_node() {
#[test]
fn unitig_two_isolated_nodes() {
let k = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
// Two k-mers that share no (k-1)-overlap
@@ -177,6 +196,7 @@ fn unitig_two_isolated_nodes() {
#[test]
fn unitig_two_truly_distinct_isolated_nodes() {
let k = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical());
@@ -192,7 +212,8 @@ fn unitig_two_truly_distinct_isolated_nodes() {
#[test]
fn no_kmer_lost_or_duplicated() {
let k = 7;
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTACGTACGTTTTTACGTACGT";
let g = graph_from_ascii(seq);
@@ -218,6 +239,7 @@ fn cycle_kmers_not_lost() {
// start_iter first pass yields nothing (all nodes internal); second pass
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTACGT";
let g = graph_from_ascii(seq);
@@ -240,6 +262,7 @@ fn branching_graph_no_kmer_lost_or_duplicated() {
// Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
// We use long non-repetitive sequences and extract only the required kmers.
let k: usize = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
+1
View File
@@ -24,6 +24,7 @@ hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], option
[dev-dependencies]
obiread = { path = "../obiread" }
tempfile = "3"
tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
[features]
default = ["numa"]
+13 -1
View File
@@ -295,20 +295,27 @@ impl PartitionRunner {
let pool = node.pool.clone();
s.spawn(move || {
let tid = std::thread::current().id();
debug!(?tid, "PartitionRunner worker: waiting on activation");
if arx.recv().is_err() {
debug!(?tid, "PartitionRunner worker: activation channel closed, exiting");
return;
}
debug!(?tid, "PartitionRunner worker: activated");
if !cpu_ids.is_empty() {
pin_current_thread(cpu_ids);
}
for i in &prx {
debug!(?tid, partition = i, "PartitionRunner worker: picked partition");
let t = Instant::now();
let r = match &pool {
Some(p) => p.install(|| f(i)),
None => f(i),
};
debug!(?tid, partition = i, "PartitionRunner worker: partition done");
etx.send(WorkerEvent::Completed(i, r, t.elapsed())).ok();
}
debug!(?tid, "PartitionRunner worker: no more partitions, exiting");
});
}
}
@@ -319,13 +326,18 @@ impl PartitionRunner {
// ── Controller ────────────────────────────────────────────────────
let mut activation = NodeActivation::new(&activate_txs, &node_caps, max_workers);
activation.activate_initial(INITIAL_DIVISOR, n_total);
debug!(n_total, activated = activation.total(), "PartitionRunner controller: initial activation");
let mut cpu_sample = CpuSample::now();
let mut io_sample = IoSample::now();
let mut completed = 0usize;
while completed < n_total {
let Ok(event) = event_rx.recv() else { break };
debug!(completed, n_total, "PartitionRunner controller: waiting for an event");
let Ok(event) = event_rx.recv() else {
debug!("PartitionRunner controller: event channel closed, stopping");
break;
};
match event {
WorkerEvent::Completed(i, r, dur) => {
match r {
+16
View File
@@ -976,7 +976,23 @@ mod tests {
/// the same primitives `obikmer`'s `scatter` step uses (minus the
/// multi-file `obipipeline` wrapper — a single sequence needs none of
/// that): normalise -> build superkmers -> route -> write.
/// `cargo test` doesn't install a `tracing` subscriber the way `obikmer`'s
/// CLI does, so `debug!`/etc. are silent no-ops by default — including the
/// `PartitionRunner` instrumentation that would matter most for
/// re-diagnosing a hang here. `try_init` is idempotent across concurrently
/// running tests (later calls just find a subscriber already installed).
fn init_tracing() {
let _ = tracing_subscriber::fmt()
.with_env_filter(
tracing_subscriber::EnvFilter::try_from_default_env()
.unwrap_or_else(|_| tracing_subscriber::EnvFilter::new("info")),
)
.with_writer(std::io::stderr)
.try_init();
}
fn build_single_genome_index(dir: &Path, label: &str, seq: &[u8]) -> KmerIndex {
init_tracing();
let fasta_path = dir.join(format!("{label}.fasta"));
let mut f = std::fs::File::create(&fasta_path).unwrap();
writeln!(f, ">{label}").unwrap();
+1 -1
View File
@@ -1,6 +1,6 @@
[package]
name = "obikmer"
version = "1.1.43"
version = "1.1.44"
edition = "2024"
[[bin]]
+33 -17
View File
@@ -7,12 +7,28 @@
//! different value panics. This prevents silent divergence between the global
//! parameter and the values used to build data structures.
//!
//! In test builds (`#[cfg(test)]`) the same public API is backed by
//! `thread_local!` [`Cell`]s instead. Each test thread gets its own
//! independent copies of `K` and `M`, so tests can use arbitrary values
//! without coordinating with one another and without any reset mechanism.
//! The `OnceLock` constraint is deliberately absent: test isolation is
//! provided by thread locality, not by write-once semantics.
//! In test builds (`#[cfg(test)]`) the same public API is backed by plain
//! process-wide atomics instead, freely overwritable (no write-once
//! constraint) so tests don't need a reset mechanism between runs.
//!
//! An earlier version of this module used `thread_local!` `Cell`s here,
//! reasoning that "each test thread gets its own copy" gives isolation
//! between tests using different `k`/`m` values. That assumption broke as
//! soon as any code under test fanned work out to *other* threads it
//! doesn't control — `PartitionRunner`'s pre-spawned workers, or a bare
//! `rayon::par_iter()` — since a freshly spawned thread never inherits the
//! calling test thread's thread-local state, silently reading back `k=0`
//! there instead (surfaced as a `bitvec`/slice-indexing panic deep inside
//! whatever used the bogus length). Process-wide atomics make `k()`/`m()`
//! correct on *any* thread without every call site having to know to
//! re-propagate them. Unset still silently reads back as `0` (same as the
//! old `Cell` default) rather than panicking: several existing tests read
//! `m()` without ever calling `set_m` themselves, relying on that default.
//! The trade-off: tests that genuinely need different `k`/`m` values from
//! other tests must not run concurrently with them in the same process (in
//! practice: every test file in this workspace already uses one fixed
//! `k`/`m` pair for all its own tests, so this doesn't currently cost
//! anything).
// ── Production implementation ─────────────────────────────────────────────────
@@ -44,22 +60,22 @@ mod state {
// ── Test implementation ───────────────────────────────────────────────────────
//
// Each test thread owns its private K and M via thread_local!, so tests may
// call set_k / set_m with any value without affecting other tests.
// Process-wide, freely overwritable (no write-once constraint), visible from
// any thread — including threads a test doesn't spawn itself (rayon workers,
// PartitionRunner workers, ...). `0` (never explicitly set) is returned as-is,
// same default as the old thread-local `Cell`.
#[cfg(any(test, feature = "test-utils"))]
mod state {
use std::cell::Cell;
use std::sync::atomic::{AtomicUsize, Ordering};
thread_local! {
static K: Cell<usize> = Cell::new(0);
static M: Cell<usize> = Cell::new(0);
}
static K: AtomicUsize = AtomicUsize::new(0);
static M: AtomicUsize = AtomicUsize::new(0);
pub fn set_k(k: usize) { K.with(|c| c.set(k)); }
pub fn k() -> usize { K.with(|c| c.get()) }
pub fn set_m(m: usize) { M.with(|c| c.set(m)); }
pub fn m() -> usize { M.with(|c| c.get()) }
pub fn set_k(k: usize) { K.store(k, Ordering::SeqCst); }
pub fn k() -> usize { K.load(Ordering::SeqCst) }
pub fn set_m(m: usize) { M.store(m, Ordering::SeqCst); }
pub fn m() -> usize { M.load(Ordering::SeqCst) }
}
// ── Public API (identical signature in both configurations) ───────────────────
+2 -2
View File
@@ -102,9 +102,9 @@ fn roundtrip_single() {
#[test]
fn roundtrip_all_lengths() {
obikseq::params::set_k(11);
setup();
let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
for len in (11..=19).chain([255, 256, 257]) {
for len in (TEST_K..=19).chain([255, 256, 257]) {
let sk = make_sk(&bases[..len]);
let mut buf = Vec::new();
sk.write_to_binary(&mut buf).unwrap();