Compare commits

...
18 Commits
Author SHA1 Message Date
coissac 14aa82521d Merge pull request 'fix: resolve test race conditions, add logging, and fix CI deadlock' (#66) from push-kywuzlnvrqyx into main
Reviewed-on: #66
2026-08-11 21:05:09 +00:00
Eric Coissac c95c47155e fix: resolve test race conditions, add logging, and fix CI deadlock
Release / create-release (push) Successful in 2m26s
ci.yml / build (pull_request) Successful in 4m4s
Release / build-linux-x86_64 (push) Successful in 8m19s
Release / build-macos-arm64 (push) Successful in 1m48s
Re-enables the `numa` feature in CI workflows to prevent container/cgroup deadlocks while preserving validation correctness. Fixes concurrent test race conditions by replacing thread-local parameter storage with process-wide atomics and mutex locks. Integrates `tracing-subscriber` for structured logging and adds thread-ID tracking to debug worker lifecycles. Additionally bumps the crate version, updates `.gitignore`, documents experimental evolutionary distance pipelines, and refactors hardcoded test constants.
2026-08-11 23:04:06 +02:00
coissac 4f6d442688 Merge pull request 'ci: disable numa feature, bump obikmer, and document Sankoff costs' (#65) from push-oruynkvporsn into main
Reviewed-on: #65
2026-08-11 16:28:07 +00:00
Eric Coissac e6f0ca472c ci: disable numa feature, bump obikmer, and document Sankoff costs
Release / create-release (push) Successful in 2m28s
ci.yml / build (pull_request) Failing after 3h0m41s
Release / build-linux-x86_64 (push) Successful in 8m31s
Release / build-macos-arm64 (push) Successful in 1m53s
Disable the `numa` default feature in CI build and test steps to prevent container environment deadlocks, and add comments explaining the cache key salt bump (`v2`) to mitigate incremental compilation corruption. Document a 16-state Sankoff cost matrix derived from set-edit distances, including substitution, gain/loss, and context-disappearance costs compatible with TNT's interface. Bump `obikmer` crate version to 1.1.43.
2026-08-11 18:26:54 +02:00
coissac 442f7a9e4c Merge pull request 'chore: update ci cache, document distance metrics, and bump version' (#64) from push-wpxsvyylwmsq into main
Reviewed-on: #64
2026-08-11 15:17:42 +00:00
Eric Coissac a63692b8c4 chore: update ci cache, document distance metrics, and bump version
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m43s
Release / build-macos-arm64 (push) Successful in 2m7s
ci.yml / build (pull_request) Canceled after 59m15s
Updated CI workflow cache keys with a `v2` salt and `Cargo.lock` hash to prevent stale incremental compilation caches and deadlocks, while updating restore keys and documenting interrupted job state. Introduced a 3-way ordinal distance metric framework that replaces ambiguous IUPAC encoding with explicit k-mer scoring, bridging pairwise methods to character-based phylogenetics via Sankoff parsimony. Bumped the `obikmer` crate version to 1.1.42.
2026-08-11 17:12:28 +02:00
coissac fa82989ea9 Merge pull request 'refactor: centralize CPU core detection using cgroup-aware utility' (#63) from push-lqzukpulzykz into main
Reviewed-on: #63
2026-08-11 10:35:06 +00:00
Eric Coissac 5f95e866f8 refactor: centralize CPU core detection using cgroup-aware utility
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Successful in 1m43s
ci.yml / build (pull_request) Canceled after 1h29m17s
Introduce `obisys::effective_parallelism()` to read Linux cgroup v1/v2 CPU quotas from sysfs, preventing thread pool oversubscription in containerized environments. Replace direct `std::thread::available_parallelism()` calls across `obikindex` and `obikmer` with this centralized function. Bump `obikmer` version to 1.1.41.
2026-08-11 12:23:05 +02:00
coissac 2e7cfc4368 Merge pull request 'Push lsqnpxrxuvpp' (#62) from push-lsqnpxrxuvpp into main
Reviewed-on: #62
2026-08-11 09:09:23 +00:00
Eric Coissac f5e508ed33 feat: add multi-genome SNP pseudo-alignment and CLI export
Release / create-release (push) Successful in 5m58s
Release / build-macos-arm64 (push) Successful in 2m47s
Release / build-linux-x86_64 (push) Successful in 8m50s
CI / build (pull_request) Canceled after 5m42s
Introduces a `SnpAlignment` struct and helper methods to construct per-genome SNP pseudo-alignments from sibling k-mer data, filtering monomorphic families and encoding bases as IUPAC ambiguity codes. Exposes the type at the crate root for simplified imports. Adds a `--snp` CLI flag to compute and export these alignments as an IUPAC-coded FASTA file. Updates theory documentation to propose a multi-genome framing approach for joint phylogenetic inference, resolving pairwise correspondence ambiguities through positional homology and partial coverage thresholds. Bumps crate version to 1.1.40.
2026-08-10 22:38:38 +02:00
Eric Coissac 49f329edd5 feat: add raw SNP distance calculation and CLI flag
Exposes RawSnpDistanceOutput and implements KmerIndex::raw_snp_distance() to compute pairwise single-copy locus counts under a paralogy-aware rule. The implementation leverages ndarray for parallel matrix aggregation, producing raw p-distance matrices for sanity-checking. A --raw-snp-distance CLI flag is added to export results as CSV, mapping zero-eligible pairs to NA.
2026-08-10 22:17:07 +02:00
Eric Coissac 1a470eab9e Refactor k-mer sibling tracking to compact bitmask and on-demand counts
Replaces the explicit `SiblingInfo` struct and 3-bit minorant flags with a derived 4-bit presence mask (`FamilyMask`) that tracks observed bases per family. This eliminates redundant file I/O overhead by introducing a `PartitionCache` for batch lookups, simplifies serialization, and updates all downstream builders, stats computation, and tests to operate on the new bitmask representation. Adjusts CLI output to report deduplicated family sizes instead of histograms, ignores generated CSV files, and updates documentation to reflect the fixed canonical reference and new theory.
2026-08-10 17:53:52 +02:00
Eric Coissac ba990a48a0 feat: add obipipeline for concurrent sibling annex stats
Add the `obipipeline` crate and replace sequential scatter/gather logic with a concurrent pipeline using `Flat` and `Transform` stages. Introduce `SiblingAnnexStats` API to compute distributions, and add CLI flags to `distance.rs` for constructing the annex and exporting statistics as CSV.
2026-08-10 15:31:04 +02:00
Eric Coissac ea914bb536 feat: implement per-k-mer sibling counts and central neighbor generation
Introduce the siblingannex module in obicompactvec to store per-slot minorant flags and sibling counts in a memory-mapped annex file. Add a scatter-gather pipeline in obikindex to compute these values across index layers and write them to .psib files. Implement central_canonical_neighbors in obikseq for generating strand-aware k-mer variants around the middle base. Expose rolling statistics in obiskbuilder and update dependency graphs accordingly.
2026-08-10 15:01:59 +02:00
Eric Coissac 8bc6d533e5 feat: support negative count filters as group size offsets
Updates CLI parsing to accept negative integers for count filters, interpreting them as offsets from the group size (e.g., `-1` means all but one). A resolution closure enforces a floor of 1 to prevent unconstrained filtering on small groups. Additionally, refines evolutionary distance documentation to condition comparisons on local homology, replacing union-based Jaccard with a self-contained `SnpTally`. This unified approach streamlines SNP and shared count computation, incorporates paralogy and heterozygosity handling, and enables direct derivation of corrected distance matrices without external dependencies.
2026-08-10 12:38:35 +02:00
Eric Coissac 45df9919e5 docs: add central-position SNP distance estimator spec
Introduces a design specification for inferring substitution rates directly from k-mers with conserved flanks. The document details a memory-efficient implementation that computes 4x4 base-pair tallies using existing MPHF structures, enabling classical corrections without de Bruijn graph materialization. Updates MkDocs navigation to include the new theory page.
2026-07-10 09:49:49 +02:00
Eric Coissac 2610a4af79 feat: add Mash distance metric and rolling entropy support
Implement the Mash distance metric across the CLI, index, and compact vector traits. This includes adding a `Mash` variant to the `DistanceMetric` enum and `MetricArg` CLI argument, implementing the conversion from Jaccard distances using the standard mutation-rate estimator formula, and updating documentation with supported metrics and algorithmic references. Additionally, add an `entropy` method to rolling statistics for computing order-specific entropy.
2026-07-09 11:40:48 +02:00
coissac dc3392865f Merge pull request 'Push qowsvpqmoukq' (#61) from push-qowsvpqmoukq into main
Reviewed-on: #61
2026-07-08 18:05:42 +00:00
30 changed files with 3109 additions and 72 deletions
+3 -3
View File
@@ -1,4 +1,4 @@
name: CI
pname: CI
on:
pull_request:
@@ -25,8 +25,8 @@ jobs:
~/.cargo/registry
~/.cargo/git
src/target
key: ${{ runner.os }}-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: ${{ runner.os }}-cargo-
key: ${{ runner.os }}-cargo-v2-${{ hashFiles('src/Cargo.lock') }}
restore-keys: ${{ runner.os }}-cargo-v2-
- name: Build
run: cargo build --release
+3
View File
@@ -9,6 +9,7 @@ data-stress
./**/*.json
*.bin
*.log
*.csv
Betula_exilis--IGA-24-33
benchmark/genomes
benchmark/simulated_data
@@ -23,3 +24,5 @@ benchmark/reference_dist
benchmark/obikmer_dist
benchmark/specific_index_count
benchmark/specific_index_presence
TNT
phyg
+45 -4
View File
@@ -92,18 +92,48 @@ For each genome:
| Flag | Applies to | Meaning |
|------|-----------|---------|
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes |
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes |
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes (N may be negative, see below) |
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes (N may be negative, see below) |
| `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes |
| `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes |
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes |
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes |
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes (N may be negative, see below) |
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes (N may be negative, see below) |
| `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes |
| `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes |
| `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`filter` only) |
| `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`filter` only) |
| `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) |
### Negative counts — offset from group size
The four integer count flags (`--min-count`, `--max-count`, `--min-outgroup-count`,
`--max-outgroup-count`) accept **negative** values, interpreted as an offset counted
down from the group size `n`, resolved at run time once `n` is known:
| Value | Effective threshold |
|-------|---------------------|
| `N ≥ 0` | literal absolute count `N` |
| `-x` (x > 0) | `max(1, n − x)` — "all but x" |
`-1` literally means *all but one*, `-2` *all but two*, and so on. This expresses
a quorum relative to the group size that a plain fraction cannot state exactly
(e.g. "present in every genome except at most one" is `n−1`, which is `0.9` for
`n = 10` but `0.857…` for `n = 7`).
The threshold is **floored at 1**, never 0: the negative form always keeps
constraining the group. Without the floor, `--min-count -1` on a singleton
ingroup (`n = 1`) would resolve to `0` ("at least 0") and silently drop the
constraint; the floor makes it `1` ("present in that one genome") instead.
To express a count of `0` (e.g. "absent from the ingroup"), use the literal `0`,
not a negative — `0` and `-0` are indistinguishable, so the offset form starts at
`-1`.
> **Edge case** — on an *empty* group (`n = 0`, e.g. a predicate matching no
> genome), a negative count still resolves to `1`, an impossible constraint that
> rejects every k-mer. This is consistent with an empty group letting nothing
> through, but differs from the "no constraint" behaviour of the fraction flags.
**Conditional defaults** — the defaults for `--min-frac` and `--max-outgroup-count` depend on two conditions:
whether the corresponding group was declared, **and** whether any quorum flag for that group was explicitly set.
@@ -215,6 +245,17 @@ obikmer filter src --output dst \
--max-outgroup-count 0
```
Noise-tolerant core — keep k-mers present in *all but one* ingroup genome
(`-1` = `n−1`) and absent from *all but one* of the outgroup:
```sh
obikmer filter src --output dst \
--ingroup "genus=Betula" \
--outgroup "*" \
--min-count -1 \
--max-outgroup-count -1
```
To dump only k-mers specific to *Betula nana*:
```sh
+13
View File
@@ -347,11 +347,24 @@ Provided finalisations:
| `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` |
| `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` |
| `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` |
| `threshold_mash_dist_matrix(k, t)` | Mash distance, derived from `threshold_jaccard_dist_matrix(t)` — no separate partial |
### BitPartials
Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)`, `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions.
Provided finalisations also include `jaccard_dist_matrix()`, `hamming_dist_matrix()`, and `mash_dist_matrix(k)`.
### Mash distance
`mash_dist_matrix`/`threshold_mash_dist_matrix` add no new additive primitive: both are a pointwise transform of the existing Jaccard distance matrix, per the Mash mutation-rate estimator [@Mash-distances-doc; @Fan2015-mash-formula]:
```
D = -1/k · ln(2J / (1+J)), J = 1 - d_jaccard
```
`J ≤ 0` (i.e. `d_jaccard ≥ 1`, no shared k-mers) maps to `D = 1` (maximal distance) rather than the `ln` singularity at `J = 0`.
---
## Temp-file-backed types
+1 -1
View File
@@ -13,7 +13,7 @@
| `query` | Query an index with sequences and annotate matches |
| `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the shared [kmer filtering](implementation/filtering.md) system; `--head N` limits output to the first N k-mers |
| `annotate` | Add or update genome metadata from a CSV file; or dump metadata as CSV |
| `distance` | Compute pairwise distance matrix between genomes; optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard on count indexes (default 1) |
| `distance` | Compute pairwise distance matrix between genomes (`--metric jaccard\|mash\|hamming\|bray-curtis\|relfreq-bray-curtis\|euclidean\|relfreq-euclidean\|hellinger\|hellinger-euclidean`); optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard/Mash on count indexes (default 1) |
| `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the shared [kmer filtering](implementation/filtering.md) system |
| `select` | Project and/or aggregate genome columns into a new or in-place index; the column-axis counterpart of `filter` (see [select](implementation/select.md)) |
| `estimate` | Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing |
+18
View File
@@ -241,3 +241,21 @@
volume = 33,
year = 2017,
bdsk-url-1 = {http://dx.doi.org/10.1093/bioinformatics/btw832}}
@misc{Mash-distances-doc,
author = {{Marbl Lab}},
howpublished = {Mash documentation},
title = {Mash Distance},
url = {https://mash.readthedocs.io/en/latest/distances.html},
urldate = {2026-07-09},
year = 2026}
@article{Fan2015-mash-formula,
author = {Fan, Huan and Ives, Anthony R and Surget-Groba, Yann and Cannon, Charles H},
doi = {10.1186/s12864-015-1647-5},
journal = {BMC Genomics},
number = 1,
title = {An assembly and alignment-free method of phylogeny reconstruction from next-generation sequencing data},
url = {https://doi.org/10.1186/s12864-015-1647-5},
volume = 16,
year = 2015}
File diff suppressed because it is too large Load Diff
+1
View File
@@ -36,6 +36,7 @@ nav:
- Entropy filter: theory/entropy.md
- Minimizer selection: theory/minimizer.md
- Partitioning architecture: theory/indexing.md
- Central-position SNP distance (discussion): theory/evolutionary_distances.md
- Implementation:
- SuperKmer: implementation/superkmer.md
- Kmer: implementation/kmer.md
+6 -1
View File
@@ -1701,17 +1701,22 @@ dependencies = [
"obikpartitionner",
"obikseq",
"obilayeredmap",
"obipipeline",
"obiread",
"obiskbuilder",
"obiskio",
"obisys",
"rayon",
"serde",
"serde_json",
"tempfile",
"tracing",
"tracing-subscriber",
]
[[package]]
name = "obikmer"
version = "1.1.39"
version = "1.1.44"
dependencies = [
"clap",
"csv",
+2
View File
@@ -7,6 +7,7 @@ mod intmatrix;
mod layer_meta;
mod meta;
mod reader;
mod siblingannex;
mod tempbitvec;
mod tempintvec;
mod views;
@@ -18,6 +19,7 @@ pub use builder::PersistentCompactIntVecBuilder;
pub use colgroup::{ColGroup, FilterMask, MatrixGroupOps, eval_filter_mask};
pub use intmatrix::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, pack_compact_int_matrix};
pub use layer_meta::LayerMeta;
pub use siblingannex::{FamilyMask, SiblingAnnex, SiblingAnnexBuilder};
pub use reader::{PersistentCompactIntVec, Iter as CompactIntVecIter};
pub use tempbitvec::{TempBitVec, TempBitVecBuilder};
pub use tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
+245
View File
@@ -0,0 +1,245 @@
//! Family presence-mask annex: a compact, read-only-after-build, per-slot
//! derived value used by the central-position SNP distance estimator (see
//! `docmd/theory/evolutionary_distances.md`, "Step 2b" and "Definitions:
//! family, and the canonical form of a family").
//!
//! One byte is stored per MPHF slot of a partition/layer, its low 4 bits
//! encoding a **presence mask** for the slot's k-mer's "family" (the up to 4
//! k-mers sharing the same flanks, differing only at the central base):
//! bit `b` (`b` = 0..3, in the fixed A/C/G/T = 0/1/2/3 encoding already used
//! for a single nucleotide) is set iff the family member whose *own* central
//! base — in its own canonical orientation — is `b`, is observed anywhere in
//! the current multi-genome index. This is a property of the whole index,
//! not of any one genome.
//!
//! Both facts the earlier (superseded) 3-bit design stored explicitly are
//! derived from the mask instead, not stored:
//! - sibling count = `popcount(mask) - 1`;
//! - minorant = regenerate the family's 4 canonical forms from the slot's
//! own k-mer (`CanonicalKmerOf::central_canonical_neighbors`, cheap, no
//! lookup), compare the raw encodings of whichever are set in the mask,
//! take the smallest — see `obikindex::siblings`.
//!
//! Mask value 0 is logically unreachable as a real result (a slot's own base
//! is always present in its own family) and is reused as the "not yet
//! computed" sentinel: annex files are pre-initialised to all-zero, and a
//! real value is only ever written once, by the computation pass.
//!
//! Deliberately simpler than a true 4-bit pack (1 byte/slot instead of 4
//! bits/slot): correctness and simplicity first, for a first implementation.
//! Packing to 4 bits/slot is a pure storage-density follow-up, not a
//! behavioural change, left for later.
use std::fs::{File, OpenOptions};
use std::io;
use std::path::{Path, PathBuf};
use memmap2::{Mmap, MmapMut};
const MAGIC: [u8; 4] = *b"PSIB";
// Header: magic(4) + _pad(4) + n(8) = 16 bytes. Data (1 byte/slot) follows.
const HEADER_SIZE: usize = 16;
/// A family presence mask: bit `b` set iff the member whose own canonical
/// central base is `b` (0=A, 1=C, 2=G, 3=T) is observed in the index.
#[derive(Debug, Clone, Copy, PartialEq, Eq)]
pub struct FamilyMask(u8);
impl FamilyMask {
/// The empty mask — never a valid *computed* result (a slot's own base
/// is always present in its own family) — used only to build up a mask
/// via repeated [`with`](Self::with) calls before storing it.
pub const EMPTY: FamilyMask = FamilyMask(0);
/// Set bit `base` (0=A, 1=C, 2=G, 3=T).
#[inline]
pub fn with(self, base: u8) -> Self {
debug_assert!(base < 4, "base out of range: {base}");
FamilyMask(self.0 | (1 << base))
}
/// Is the member with central base `base` (0..3) present?
#[inline]
pub fn has(self, base: u8) -> bool {
debug_assert!(base < 4, "base out of range: {base}");
self.0 & (1 << base) != 0
}
/// Number of family members observed anywhere in the index (1..=4).
#[inline]
pub fn family_size(self) -> u32 {
self.0.count_ones()
}
/// Number of *other* members observed (0..=3) — `family_size() - 1`.
#[inline]
pub fn siblings(self) -> u32 {
self.family_size() - 1
}
/// Raw bitmask (bit `b` = base `b` present) — for callers that build up
/// a mask via their own bit operations (e.g. concurrently, via an
/// `AtomicU8`) and only need the `FamilyMask` wrapper at the end.
#[inline]
pub fn bits(self) -> u8 {
self.0
}
/// Construct from a raw bitmask (only the low 4 bits are kept).
#[inline]
pub fn from_bits(bits: u8) -> Self {
FamilyMask(bits & 0b1111)
}
#[inline]
fn encode(self) -> u8 {
self.0
}
#[inline]
fn decode(byte: u8) -> Option<Self> {
if byte == 0 {
// Unreachable for a real result — reserved as the "not yet
// computed" sentinel.
return None;
}
Some(FamilyMask(byte & 0b1111))
}
}
// ── SiblingAnnex (reader) ───────────────────────────────────────────────────
pub struct SiblingAnnex {
mmap: Mmap,
n: usize,
path: PathBuf,
}
impl SiblingAnnex {
pub fn open(path: &Path) -> io::Result<Self> {
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
if mmap.len() < HEADER_SIZE {
return Err(io::Error::new(io::ErrorKind::InvalidData, "PSIB file too short"));
}
if mmap[0..4] != MAGIC {
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PSIB magic"));
}
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
if mmap.len() < HEADER_SIZE + n {
return Err(io::Error::new(io::ErrorKind::InvalidData, "PSIB file truncated"));
}
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn path(&self) -> &Path { &self.path }
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
/// `None` means the slot has not (yet) been computed — see module docs.
pub fn get(&self, slot: usize) -> Option<FamilyMask> {
FamilyMask::decode(self.mmap[HEADER_SIZE + slot])
}
}
// ── SiblingAnnexBuilder (writer) ────────────────────────────────────────────
pub struct SiblingAnnexBuilder {
mmap: MmapMut,
n: usize,
path: PathBuf,
}
impl SiblingAnnexBuilder {
/// Create a new annex of `n` slots at `path`, pre-initialised to the
/// "not yet computed" sentinel (all-zero).
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
let file_size = HEADER_SIZE + n;
let file = OpenOptions::new()
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.set_len(file_size as u64)?;
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
mmap[0..4].copy_from_slice(&MAGIC);
mmap[4..8].copy_from_slice(&[0u8; 4]);
mmap[8..16].copy_from_slice(&(n as u64).to_le_bytes());
// Data region left at 0 by `set_len`/mmap — the sentinel value.
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn get(&self, slot: usize) -> Option<FamilyMask> {
FamilyMask::decode(self.mmap[HEADER_SIZE + slot])
}
pub fn set(&mut self, slot: usize, mask: FamilyMask) {
// Redundant concurrent writes from independent recomputation paths
// converge to the same encoded byte for a given slot, so a plain
// store here is safe even without external synchronisation, as long
// as the byte write itself is atomic (true for a single aligned
// byte on every platform this project targets).
self.mmap[HEADER_SIZE + slot] = mask.encode();
}
pub fn close(self) -> io::Result<()> { self.mmap.flush() }
pub fn finish(self) -> io::Result<SiblingAnnex> {
let path = self.path.clone();
self.close()?;
SiblingAnnex::open(&path)
}
}
#[cfg(test)]
mod tests {
use super::*;
use tempfile::tempdir;
#[test]
fn sentinel_is_zero_and_unset_slots_read_as_uncomputed() {
let dir = tempdir().unwrap();
let path = dir.path().join("test.psib");
let builder = SiblingAnnexBuilder::new(4, &path).unwrap();
for slot in 0..4 {
assert_eq!(builder.get(slot), None);
}
builder.close().unwrap();
}
#[test]
fn roundtrip_all_valid_masks() {
let dir = tempdir().unwrap();
let path = dir.path().join("test.psib");
let mut builder = SiblingAnnexBuilder::new(4, &path).unwrap();
let masks = [
FamilyMask::EMPTY.with(0), // just A: family size 1
FamilyMask::EMPTY.with(0).with(3), // A + T: size 2
FamilyMask::EMPTY.with(1).with(2).with(3), // C+G+T: size 3
FamilyMask::EMPTY.with(0).with(1).with(2).with(3), // all 4
];
for (slot, mask) in masks.iter().enumerate() {
builder.set(slot, *mask);
}
let annex = builder.finish().unwrap();
for (slot, mask) in masks.iter().enumerate() {
assert_eq!(annex.get(slot), Some(*mask));
}
assert_eq!(annex.get(0).unwrap().siblings(), 0);
assert_eq!(annex.get(1).unwrap().siblings(), 1);
assert_eq!(annex.get(2).unwrap().siblings(), 2);
assert_eq!(annex.get(3).unwrap().siblings(), 3);
assert_eq!(annex.get(3).unwrap().family_size(), 4);
}
#[test]
fn has_reflects_individual_bits() {
let mask = FamilyMask::EMPTY.with(0).with(2);
assert!(mask.has(0));
assert!(!mask.has(1));
assert!(mask.has(2));
assert!(!mask.has(3));
}
}
+23
View File
@@ -1,5 +1,16 @@
use ndarray::{Array1, Array2};
/// Convert a Jaccard distance matrix (`1 - J`) into a Mash distance matrix, per
/// https://mash.readthedocs.io/en/latest/distances.html:
/// `D = -1/k * ln(2J / (1+J))`.
fn jaccard_to_mash(d_jaccard: &Array2<f64>, k: usize) -> Array2<f64> {
d_jaccard.mapv(|d| {
let j = 1.0 - d;
if j <= 0.0 { 1.0 }
else { -1.0 / k as f64 * (2.0 * j / (1.0 + j)).ln() }
})
}
// ── Column-level weight statistic — total count or presence count per column.
/// Additive across layers and partitions; used as denominator in normalised distances.
///
@@ -74,6 +85,12 @@ pub trait CountPartials: ColumnWeights {
m
}
/// Mash distance (https://mash.readthedocs.io/en/latest/distances.html), derived
/// from the presence-threshold Jaccard distance.
fn threshold_mash_dist_matrix(&self, k: usize, threshold: u32) -> Array2<f64> {
jaccard_to_mash(&self.threshold_jaccard_dist_matrix(threshold), k)
}
fn relfreq_bray_dist_matrix(&self) -> Array2<f64> {
let global = self.col_weights();
let mut m = self.partial_relfreq_bray(&global).mapv(|v| 1.0 - v);
@@ -126,6 +143,12 @@ pub trait BitPartials: ColumnWeights {
m
}
/// Mash distance (https://mash.readthedocs.io/en/latest/distances.html), derived
/// from the Jaccard distance.
fn mash_dist_matrix(&self, k: usize) -> Array2<f64> {
jaccard_to_mash(&self.jaccard_dist_matrix(), k)
}
fn hamming_dist_matrix(&self) -> Array2<u64> {
self.partial_hamming()
}
+24 -1
View File
@@ -1,6 +1,17 @@
use super::*;
use obikseq::{k, set_k, unitig::Unitig, Kmer};
// `obikseq::params` is process-wide (see obikseq/src/params.rs): tests in this
// file don't all use the same `k` (`push_palindrome_single_node` needs an
// even k=4 — no odd-length self-revcomp palindrome exists — while the rest
// use k=5), and they run concurrently by default. Serialize the
// set_k-through-use critical section across this file's tests so one test's
// `k` can never be overwritten mid-flight by another.
static K_LOCK: std::sync::Mutex<()> = std::sync::Mutex::new(());
fn lock_k() -> std::sync::MutexGuard<'static, ()> {
K_LOCK.lock().unwrap_or_else(|e| e.into_inner())
}
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn {
let mut g = GraphDeBruijn::new();
@@ -37,6 +48,7 @@ fn collect_unitigs(g: &GraphDeBruijn) -> Vec<Unitig> {
#[test]
fn push_deduplicates_revcomp() {
let k = 5;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
let mut g = GraphDeBruijn::new();
@@ -49,6 +61,7 @@ fn push_deduplicates_revcomp() {
fn push_palindrome_single_node() {
// ACGT is its own revcomp
let k = 4;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGT").unwrap();
assert_eq!(kmer, kmer.revcomp(), "test requires a palindrome");
@@ -71,6 +84,7 @@ fn linear_chain_graph() -> (GraphDeBruijn, Vec<CanonicalKmer>) {
#[test]
fn degrees_linear_chain_node_count() {
let k = 5;
let _guard = lock_k();
set_k(k);
let (g, kmers) = linear_chain_graph();
assert_eq!(g.len(), kmers.len());
@@ -82,6 +96,7 @@ fn degrees_linear_chain_extensions() {
// Note: start_iter must not be consumed standalone — its second pass only
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"AAAAGGGG";
let g = graph_from_ascii(seq);
@@ -118,6 +133,7 @@ fn kmers_from_unitigs(unitigs: &[Unitig]) -> Vec<CanonicalKmer> {
fn unitig_roundtrip_linear() {
// Non-repetitive sequence: all k-mers must be recovered across unitigs.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACCTGGCTA";
let g = graph_from_ascii(seq);
@@ -136,6 +152,7 @@ fn unitig_roundtrip_longer_sequence() {
// Longer non-repetitive sequence with no repeated k-mer of length k.
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTGGCTATCGAC";
let g = graph_from_ascii(seq);
@@ -152,6 +169,7 @@ fn unitig_roundtrip_longer_sequence() {
fn unitig_isolated_node() {
// Single k-mer with no neighbours
let k = 5;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
let mut g = GraphDeBruijn::new();
@@ -165,6 +183,7 @@ fn unitig_isolated_node() {
#[test]
fn unitig_two_isolated_nodes() {
let k = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
// Two k-mers that share no (k-1)-overlap
@@ -177,6 +196,7 @@ fn unitig_two_isolated_nodes() {
#[test]
fn unitig_two_truly_distinct_isolated_nodes() {
let k = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical());
@@ -192,7 +212,8 @@ fn unitig_two_truly_distinct_isolated_nodes() {
#[test]
fn no_kmer_lost_or_duplicated() {
let k = 7;
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTACGTACGTTTTTACGTACGT";
let g = graph_from_ascii(seq);
@@ -218,6 +239,7 @@ fn cycle_kmers_not_lost() {
// start_iter first pass yields nothing (all nodes internal); second pass
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTACGT";
let g = graph_from_ascii(seq);
@@ -240,6 +262,7 @@ fn branching_graph_no_kmer_lost_or_duplicated() {
// Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
// We use long non-repetitive sequences and extract only the required kmers.
let k: usize = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
+7
View File
@@ -10,6 +10,8 @@ obiskio = { path = "../obiskio" }
obisys = { path = "../obisys" }
obicompactvec = { path = "../obicompactvec" }
obilayeredmap = { path = "../obilayeredmap" }
obiskbuilder = { path = "../obiskbuilder" }
obipipeline = { path = "../obipipeline" }
ndarray = "0.16"
rayon = "1"
crossbeam-channel = "0.5"
@@ -19,6 +21,11 @@ indicatif = "0.17"
tracing = "0.1.44"
hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], optional = true }
[dev-dependencies]
obiread = { path = "../obiread" }
tempfile = "3"
tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
[features]
default = ["numa"]
numa = ["hwlocality"]
+4
View File
@@ -14,6 +14,8 @@ pub enum DistanceMetric {
Jaccard,
/// Hamming distance (number of differing kmer positions) on presence/absence data.
Hamming,
/// Mash distance on presence/absence data (Jaccard-derived mutation-rate estimate).
Mash,
/// Bray-Curtis dissimilarity on raw counts.
BrayCurtis,
/// Bray-Curtis dissimilarity normalised by per-genome total counts.
@@ -84,6 +86,7 @@ impl KmerIndex {
DistanceMetric::Hellinger => CountPartials::hellinger_dist_matrix(&global),
DistanceMetric::HellingerEuclidean => CountPartials::hellinger_euclidean_dist_matrix(&global),
DistanceMetric::Jaccard => CountPartials::threshold_jaccard_dist_matrix(&global, presence_threshold),
DistanceMetric::Mash => CountPartials::threshold_mash_dist_matrix(&global, self.kmer_size(), presence_threshold),
DistanceMetric::Hamming => {
return Err(OKIError::InvalidInput(
"Hamming is only available for presence/absence indexes".into(),
@@ -108,6 +111,7 @@ impl KmerIndex {
let matrix = match metric {
DistanceMetric::Jaccard => BitPartials::jaccard_dist_matrix(&global),
DistanceMetric::Mash => BitPartials::mash_dist_matrix(&global, self.kmer_size()),
DistanceMetric::Hamming => {
BitPartials::hamming_dist_matrix(&global).mapv(|v| v as f64)
}
+2
View File
@@ -9,6 +9,7 @@ mod numa;
mod rebuild;
mod reindex;
mod select;
mod siblings;
mod stats;
pub use error::{OKIError, OKIResult};
@@ -18,3 +19,4 @@ pub use merge::MergeMode;
pub use meta::{validate_label, GenomeInfo, IndexConfig, IndexMeta, META_FILENAME};
pub use state::{IndexState, SENTINEL_COUNTED, SENTINEL_INDEXED, SENTINEL_SCATTERED};
pub use stats::IndexBitsPerKmer;
pub use siblings::{RawSnpDistanceOutput, SiblingAnnexStats, SnpAlignment};
+15 -7
View File
@@ -79,9 +79,7 @@ pub fn build() -> NumaSetup {
}
// UMA fallback: single synthetic node, all cores, no pool, no pinning.
let n_cores = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1);
let n_cores = obisys::effective_parallelism();
debug!("UMA: single synthetic node, {} core(s)", n_cores);
NumaSetup {
pools: vec![None],
@@ -91,9 +89,7 @@ pub fn build() -> NumaSetup {
#[cfg(not(feature = "numa"))]
pub fn build() -> NumaSetup {
let n_cores = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1);
let n_cores = obisys::effective_parallelism();
debug!("UMA: single synthetic node, {} core(s)", n_cores);
NumaSetup {
pools: vec![None],
@@ -299,20 +295,27 @@ impl PartitionRunner {
let pool = node.pool.clone();
s.spawn(move || {
let tid = std::thread::current().id();
debug!(?tid, "PartitionRunner worker: waiting on activation");
if arx.recv().is_err() {
debug!(?tid, "PartitionRunner worker: activation channel closed, exiting");
return;
}
debug!(?tid, "PartitionRunner worker: activated");
if !cpu_ids.is_empty() {
pin_current_thread(cpu_ids);
}
for i in &prx {
debug!(?tid, partition = i, "PartitionRunner worker: picked partition");
let t = Instant::now();
let r = match &pool {
Some(p) => p.install(|| f(i)),
None => f(i),
};
debug!(?tid, partition = i, "PartitionRunner worker: partition done");
etx.send(WorkerEvent::Completed(i, r, t.elapsed())).ok();
}
debug!(?tid, "PartitionRunner worker: no more partitions, exiting");
});
}
}
@@ -323,13 +326,18 @@ impl PartitionRunner {
// ── Controller ────────────────────────────────────────────────────
let mut activation = NodeActivation::new(&activate_txs, &node_caps, max_workers);
activation.activate_initial(INITIAL_DIVISOR, n_total);
debug!(n_total, activated = activation.total(), "PartitionRunner controller: initial activation");
let mut cpu_sample = CpuSample::now();
let mut io_sample = IoSample::now();
let mut completed = 0usize;
while completed < n_total {
let Ok(event) = event_rx.recv() else { break };
debug!(completed, n_total, "PartitionRunner controller: waiting for an event");
let Ok(event) = event_rx.recv() else {
debug!("PartitionRunner controller: event channel closed, stopping");
break;
};
match event {
WorkerEvent::Completed(i, r, dur) => {
match r {
File diff suppressed because it is too large Load Diff
+1 -1
View File
@@ -1,6 +1,6 @@
[package]
name = "obikmer"
version = "1.1.39"
version = "1.1.44"
edition = "2024"
[[bin]]
+1 -3
View File
@@ -38,9 +38,7 @@ pub struct CommonArgs {
#[arg(
short = 'T',
long,
default_value_t = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1)
default_value_t = obisys::effective_parallelism()
)]
pub threads: usize,
+176 -1
View File
@@ -3,13 +3,15 @@ use std::path::PathBuf;
use clap::Args;
use kodama::{Method, linkage};
use obikindex::{DistanceMetric, KmerIndex};
use obifastwrite::{JsonVal, write_record};
use obikindex::{DistanceMetric, KmerIndex, RawSnpDistanceOutput, SiblingAnnexStats, SnpAlignment};
use speedytree::{DistanceMatrix, Hybrid, NeighborJoiningSolver, to_newick};
use tracing::info;
#[derive(clap::ValueEnum, Clone, Copy, Debug)]
pub enum MetricArg {
Jaccard,
Mash,
Hamming,
BrayCurtis,
#[value(name = "relfreq-bray-curtis")]
@@ -26,6 +28,7 @@ impl From<MetricArg> for DistanceMetric {
fn from(m: MetricArg) -> Self {
match m {
MetricArg::Jaccard => DistanceMetric::Jaccard,
MetricArg::Mash => DistanceMetric::Mash,
MetricArg::Hamming => DistanceMetric::Hamming,
MetricArg::BrayCurtis => DistanceMetric::BrayCurtis,
MetricArg::RelfreqBrayCurtis => DistanceMetric::RelfreqBrayCurtis,
@@ -62,7 +65,37 @@ pub struct DistanceArgs {
#[arg(long)]
pub upgma: bool,
/// Build the sibling-count/minorant annex on this (multi-genome) index
/// — see `docmd/theory/evolutionary_distances.md`, Step 2b. Construction
/// only; does not by itself compute or write any statistics.
#[arg(long)]
pub sibling_annex: bool,
/// Tally the sibling-count distribution (CSV) of an already-built annex
/// (run with `--sibling-annex` first, in this invocation or an earlier
/// one). A separate, occasional diagnostic pass — not run every time the
/// annex itself is (re)built.
#[arg(long)]
pub sibling_stats: bool,
/// Compute the raw p-distance restricted to loci that are single-copy
/// in both genomes of each pair (an already-built sibling annex is
/// required — run with `--sibling-annex` first, in this invocation or
/// an earlier one). A quick way to test the central-position SNP
/// estimator against a real index; not the full `SnpTally` design.
#[arg(long)]
pub raw_snp_distance: bool,
/// Write a SNP-only pseudo-alignment (FASTA, IUPAC-coded) from an
/// already-built sibling annex — one row per genome, one column per
/// variable family (monomorphic families skipped), no flanking
/// sequence. See `docmd/theory/evolutionary_distances.md`,
/// "Multi-genome framing: family as pseudo-alignment column".
#[arg(long)]
pub snp: bool,
/// Output prefix: <prefix>_dist.csv, <prefix>_shared.csv,
/// <prefix>_siblings.csv, <prefix>_rawsnp.csv, <prefix>_snp.fasta,
/// <prefix>_nj.nwk, <prefix>_upgma.nwk.
/// If omitted, the distance matrix is written to stdout.
#[arg(short, long)]
@@ -78,6 +111,51 @@ pub fn run(args: DistanceArgs) {
let labels: Vec<String> = idx.meta().genomes.iter().map(|g| g.label.clone()).collect();
let n = labels.len();
// ── Sibling-count/minorant annex (independent of the distance metric) ──
// Construction (`--sibling-annex`) and stats (`--sibling-stats`) are
// deliberately decoupled: the annex is meant to be (re)built routinely,
// the distribution only occasionally, on demand.
if args.sibling_annex {
info!("building sibling-count/minorant annex");
idx.build_sibling_annex().unwrap_or_else(|e| {
eprintln!("error building sibling annex: {e}");
std::process::exit(1);
});
}
if args.sibling_stats {
let stats = idx.sibling_annex_stats().unwrap_or_else(|e| {
eprintln!("error computing sibling-annex stats: {e}");
std::process::exit(1);
});
write_sibling_stats_csv(&stats, &labels, &args.output);
}
if args.raw_snp_distance {
let result = idx.raw_snp_distance().unwrap_or_else(|e| {
eprintln!("error computing raw SNP distance: {e}");
std::process::exit(1);
});
write_raw_snp_distance_csv(&result, &labels, &args.output);
}
if args.snp {
let alignment = idx.snp_pseudo_alignment().unwrap_or_else(|e| {
eprintln!("error computing SNP pseudo-alignment: {e}");
std::process::exit(1);
});
write_snp_fasta(&alignment, &labels, &args.output);
}
// `--sibling-annex`/`--sibling-stats`/`--raw-snp-distance`/`--snp` are
// their own operation, not a modifier on top of a distance-metric
// computation — a metric was never requested by asking for any of them,
// so there is nothing for the rest of this function to compute. Not a
// historical accident to keep: stop here rather than always also
// running a Jaccard (or whichever `--metric` defaults to) pass and
// printing an unrequested matrix.
if args.sibling_annex || args.sibling_stats || args.raw_snp_distance || args.snp {
return;
}
info!(
"computing {:?} distances for {} genome(s)",
args.metric, n
@@ -189,6 +267,103 @@ pub fn run(args: DistanceArgs) {
}
}
// ── Family-size distribution → CSV ──────────────────────────────────────────
//
// Each row is a family (the up-to-4 k-mers sharing flanks, differing only at
// the centre), counted once — at its minorant — regardless of how many of
// its members are observed. Family size 1..4 (not "sibling count" 0..3):
// see `docmd/theory/evolutionary_distances.md`, "Definitions".
fn write_sibling_stats_csv(stats: &SiblingAnnexStats, labels: &[String], output: &Option<PathBuf>) {
// One row per genome (4 columns, family size 1-4: number of families of
// that size for which the genome carries at least one member), plus a
// `global` row — the actual deduplicated family-size histogram
// (`stats.counts`), NOT a sum of the per-genome columns (a family shared
// by several genomes would otherwise be counted once per genome it
// appears in, inflating the total beyond the real family count).
let path = output.as_ref()
.map(|p| format!("{}_siblings.csv", p.display()))
.unwrap_or_else(|| "siblings.csv".into());
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
eprintln!("error creating {path}: {e}");
std::process::exit(1);
}));
writeln!(f, "genome,1,2,3,4").unwrap();
for (label, counts) in labels.iter().zip(stats.per_genome.iter()) {
writeln!(f, "{label},{},{},{},{}", counts[0], counts[1], counts[2], counts[3]).unwrap();
}
writeln!(
f, "global,{},{},{},{}",
stats.counts[0], stats.counts[1], stats.counts[2], stats.counts[3],
).unwrap();
let total: u64 = stats.counts.iter().sum();
info!("family-size distribution → {path} (total {total} famil{})",
if total == 1 { "y" } else { "ies" });
}
// ── Raw single-copy SNP distance → CSV ──────────────────────────────────────
//
// p_hat[i,j] = snp[i,j] / (snp[i,j] + shared[i,j]) over loci single-copy in
// both i and j — see `RawSnpDistanceOutput` / `KmerIndex::raw_snp_distance`.
// A single file: the distance matrix, with an eligible-loci count alongside
// each value so a 0/0 pair (no eligible locus at all) is distinguishable
// from a genuinely identical pair.
fn write_raw_snp_distance_csv(result: &RawSnpDistanceOutput, labels: &[String], output: &Option<PathBuf>) {
let path = output.as_ref()
.map(|p| format!("{}_rawsnp.csv", p.display()))
.unwrap_or_else(|| "rawsnp.csv".into());
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
eprintln!("error creating {path}: {e}");
std::process::exit(1);
}));
let n = labels.len();
write!(f, "genome").unwrap();
for g in labels { write!(f, ",{g}").unwrap(); }
writeln!(f).unwrap();
for (i, g) in labels.iter().enumerate() {
write!(f, "{g}").unwrap();
for j in 0..n {
let snp = result.snp[[i, j]];
let shared = result.shared[[i, j]];
let eligible = snp + shared;
if eligible == 0 {
write!(f, ",NA").unwrap();
} else {
write!(f, ",{:.6}", snp as f64 / eligible as f64).unwrap();
}
}
writeln!(f).unwrap();
}
info!("raw single-copy SNP distance matrix → {path}");
}
// ── SNP-only pseudo-alignment → FASTA ───────────────────────────────────────
//
// One record per genome, IUPAC-coded, no flanking sequence — see
// `SnpAlignment` / `KmerIndex::snp_pseudo_alignment`. Uses the project's
// existing FASTA writer (`obifastwrite::write_record`) rather than
// hand-rolling one.
fn write_snp_fasta(alignment: &SnpAlignment, labels: &[String], output: &Option<PathBuf>) {
let path = output.as_ref()
.map(|p| format!("{}_snp.fasta", p.display()))
.unwrap_or_else(|| "snp.fasta".into());
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
eprintln!("error creating {path}: {e}");
std::process::exit(1);
}));
let n_sites = alignment.sequences.first().map(|s| s.len()).unwrap_or(0);
for (label, seq) in labels.iter().zip(alignment.sequences.iter()) {
write_record(seq, label, &[("n_sites", JsonVal::Num(n_sites as u64))], &mut f).unwrap_or_else(|e| {
eprintln!("error writing {path}: {e}");
std::process::exit(1);
});
}
info!("SNP pseudo-alignment → {path} ({n_sites} site{})",
if n_sites == 1 { "" } else { "s" });
}
// ── UPGMA Newick from kodama dendrogram ───────────────────────────────────────
fn upgma_to_newick(dendro: &kodama::Dendrogram<f64>, names: &[String]) -> String {
+29 -17
View File
@@ -151,12 +151,14 @@ pub struct FilterArgs {
pub outgroup: Vec<String>,
/// Minimum number of ingroup genomes containing the k-mer
#[arg(long)]
pub min_count: Option<usize>,
/// (negative: offset from group size, e.g. -1 = all but one)
#[arg(long, allow_hyphen_values = true)]
pub min_count: Option<isize>,
/// Maximum number of ingroup genomes containing the k-mer
#[arg(long)]
pub max_count: Option<usize>,
/// (negative: offset from group size, e.g. -1 = all but one)
#[arg(long, allow_hyphen_values = true)]
pub max_count: Option<isize>,
/// Minimum fraction of ingroup genomes containing the k-mer [0.0–1.0]
/// (default 1.0 when --ingroup is set, 0.0 otherwise)
@@ -168,13 +170,15 @@ pub struct FilterArgs {
pub max_frac: Option<f64>,
/// Minimum number of outgroup genomes containing the k-mer
#[arg(long)]
pub min_outgroup_count: Option<usize>,
/// (negative: offset from outgroup size, e.g. -1 = all but one)
#[arg(long, allow_hyphen_values = true)]
pub min_outgroup_count: Option<isize>,
/// Maximum number of outgroup genomes containing the k-mer
/// (default 0 when --outgroup is set, no constraint otherwise)
#[arg(long)]
pub max_outgroup_count: Option<usize>,
/// (default 0 when --outgroup is set, no constraint otherwise;
/// negative: offset from outgroup size, e.g. -1 = all but one)
#[arg(long, allow_hyphen_values = true)]
pub max_outgroup_count: Option<isize>,
/// Minimum fraction of outgroup genomes containing the k-mer [0.0–1.0]
#[arg(long)]
@@ -239,12 +243,12 @@ pub fn matching_genome_indices(pred_str: &str, genomes: &[GenomeInfo]) -> Result
pub struct GroupFilterParams {
pub threshold: u32,
pub min_count: Option<usize>,
pub max_count: Option<usize>,
pub min_count: Option<isize>,
pub max_count: Option<isize>,
pub min_frac: Option<f64>,
pub max_frac: Option<f64>,
pub min_outgroup_count: Option<usize>,
pub max_outgroup_count: Option<usize>,
pub min_outgroup_count: Option<isize>,
pub max_outgroup_count: Option<isize>,
pub min_outgroup_frac: Option<f64>,
pub max_outgroup_frac: Option<f64>,
}
@@ -279,12 +283,20 @@ pub fn build_group_filter(
let default_min_frac = if !ingroup_preds.is_empty() && !ingroup_quorum_explicit { 1.0 } else { 0.0 };
let default_max_outgroup_count = if !outgroup_preds.is_empty() && !outgroup_quorum_explicit { 0 } else { out_size };
let min_count = p.min_count.unwrap_or(0);
let max_count = p.max_count.unwrap_or(in_size);
// Resolve a signed count: negative means an offset from the group size
// (e.g. -1 = all but one), floored at 1 so the negative form always keeps
// constraining the group — even a singleton group, where n-1 would be 0
// and would otherwise drop the constraint entirely.
let resolve = |v: isize, size: usize| -> usize {
if v < 0 { (size as isize + v).max(1) as usize } else { v as usize }
};
let min_count = p.min_count.map(|v| resolve(v, in_size)).unwrap_or(0);
let max_count = p.max_count.map(|v| resolve(v, in_size)).unwrap_or(in_size);
let min_frac = p.min_frac.unwrap_or(default_min_frac);
let max_frac = p.max_frac.unwrap_or(1.0);
let min_outgroup_count = p.min_outgroup_count.unwrap_or(0);
let max_outgroup_count = p.max_outgroup_count.unwrap_or(default_max_outgroup_count);
let min_outgroup_count = p.min_outgroup_count.map(|v| resolve(v, out_size)).unwrap_or(0);
let max_outgroup_count = p.max_outgroup_count.map(|v| resolve(v, out_size)).unwrap_or(default_max_outgroup_count);
let min_outgroup_frac = p.min_outgroup_frac.unwrap_or(0.0);
let max_outgroup_frac = p.max_outgroup_frac.unwrap_or(1.0);
+1 -3
View File
@@ -70,9 +70,7 @@ pub struct QueryArgs {
#[arg(
short = 'T',
long,
default_value_t = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1)
default_value_t = obisys::effective_parallelism()
)]
pub threads: usize,
+21
View File
@@ -341,6 +341,27 @@ impl<L: KmerLength> CanonicalKmerOf<L> {
]
}
/// Return the four central canonical neighbours (each already canonical),
/// substituting the base at the middle position `m = (L::len()-1)/2`
/// (well-defined for odd `L::len()`). Each of the 4 substitutions is
/// canonicalised independently — this correctly handles the case where a
/// substitution flips the canonical orientation, unlike inferring the
/// variant from a fixed-orientation flank key. One of the 4 equals
/// `self`'s own canonical form (the identity substitution); callers that
/// only want the 3 genuine variants should skip it.
pub fn central_canonical_neighbors(&self) -> [CanonicalKmerOf<L>; 4] {
let k = L::len();
let m = (k - 1) / 2;
let shift = KMER_BITS - 2 - 2 * m;
let cleared = self.0 & !((0b11 as RawKmer) << shift);
[
KmerOf::<L>(cleared | ((0 as RawKmer) << shift), PhantomData).canonical(),
KmerOf::<L>(cleared | ((1 as RawKmer) << shift), PhantomData).canonical(),
KmerOf::<L>(cleared | ((2 as RawKmer) << shift), PhantomData).canonical(),
KmerOf::<L>(cleared | ((3 as RawKmer) << shift), PhantomData).canonical(),
]
}
/// Return the inner value as a raw [`KmerOf<L>`].
#[inline]
pub fn into_kmer(self) -> KmerOf<L> {
+33 -17
View File
@@ -7,12 +7,28 @@
//! different value panics. This prevents silent divergence between the global
//! parameter and the values used to build data structures.
//!
//! In test builds (`#[cfg(test)]`) the same public API is backed by
//! `thread_local!` [`Cell`]s instead. Each test thread gets its own
//! independent copies of `K` and `M`, so tests can use arbitrary values
//! without coordinating with one another and without any reset mechanism.
//! The `OnceLock` constraint is deliberately absent: test isolation is
//! provided by thread locality, not by write-once semantics.
//! In test builds (`#[cfg(test)]`) the same public API is backed by plain
//! process-wide atomics instead, freely overwritable (no write-once
//! constraint) so tests don't need a reset mechanism between runs.
//!
//! An earlier version of this module used `thread_local!` `Cell`s here,
//! reasoning that "each test thread gets its own copy" gives isolation
//! between tests using different `k`/`m` values. That assumption broke as
//! soon as any code under test fanned work out to *other* threads it
//! doesn't control — `PartitionRunner`'s pre-spawned workers, or a bare
//! `rayon::par_iter()` — since a freshly spawned thread never inherits the
//! calling test thread's thread-local state, silently reading back `k=0`
//! there instead (surfaced as a `bitvec`/slice-indexing panic deep inside
//! whatever used the bogus length). Process-wide atomics make `k()`/`m()`
//! correct on *any* thread without every call site having to know to
//! re-propagate them. Unset still silently reads back as `0` (same as the
//! old `Cell` default) rather than panicking: several existing tests read
//! `m()` without ever calling `set_m` themselves, relying on that default.
//! The trade-off: tests that genuinely need different `k`/`m` values from
//! other tests must not run concurrently with them in the same process (in
//! practice: every test file in this workspace already uses one fixed
//! `k`/`m` pair for all its own tests, so this doesn't currently cost
//! anything).
// ── Production implementation ─────────────────────────────────────────────────
@@ -44,22 +60,22 @@ mod state {
// ── Test implementation ───────────────────────────────────────────────────────
//
// Each test thread owns its private K and M via thread_local!, so tests may
// call set_k / set_m with any value without affecting other tests.
// Process-wide, freely overwritable (no write-once constraint), visible from
// any thread — including threads a test doesn't spawn itself (rayon workers,
// PartitionRunner workers, ...). `0` (never explicitly set) is returned as-is,
// same default as the old thread-local `Cell`.
#[cfg(any(test, feature = "test-utils"))]
mod state {
use std::cell::Cell;
use std::sync::atomic::{AtomicUsize, Ordering};
thread_local! {
static K: Cell<usize> = Cell::new(0);
static M: Cell<usize> = Cell::new(0);
}
static K: AtomicUsize = AtomicUsize::new(0);
static M: AtomicUsize = AtomicUsize::new(0);
pub fn set_k(k: usize) { K.with(|c| c.set(k)); }
pub fn k() -> usize { K.with(|c| c.get()) }
pub fn set_m(m: usize) { M.with(|c| c.set(m)); }
pub fn m() -> usize { M.with(|c| c.get()) }
pub fn set_k(k: usize) { K.store(k, Ordering::SeqCst); }
pub fn k() -> usize { K.load(Ordering::SeqCst) }
pub fn set_m(m: usize) { M.store(m, Ordering::SeqCst); }
pub fn m() -> usize { M.load(Ordering::SeqCst) }
}
// ── Public API (identical signature in both configurations) ───────────────────
+42
View File
@@ -210,4 +210,46 @@ mod tests {
check!(31);
check!(32);
}
// ── central_canonical_neighbors ─────────────────────────────────────────
#[test]
fn central_canonical_neighbors_hand_checked_k3() {
// k=3, centre = index 1. For "ACG", every one of the 4 central
// substitutions ("AAG","ACG","AGG","ATG") happens to stay in forward
// orientation when canonicalised (verified by hand: each is already
// lexicographically <= its own reverse complement), so this case
// exercises the substitution logic without the RC-flip edge case.
let ck = KmerOf::<ConstLen<3>>::from_ascii(b"ACG").unwrap().canonical();
let neighbours = ck.central_canonical_neighbors();
let ascii: Vec<Vec<u8>> = neighbours.iter().map(|n| n.to_ascii()).collect();
assert_eq!(ascii, vec![b"AAG".to_vec(), b"ACG".to_vec(), b"AGG".to_vec(), b"ATG".to_vec()]);
// The identity substitution (centre unchanged) must reproduce `ck`.
assert!(neighbours.contains(&ck));
}
#[test]
fn central_canonical_neighbors_identity_present_for_various_k() {
macro_rules! check {
($n:expr) => {{
let ck = KmerOf::<ConstLen<$n>>::from_ascii(&make_seq::<$n>())
.unwrap()
.canonical();
let neighbours = ck.central_canonical_neighbors();
assert!(
neighbours.contains(&ck),
"identity substitution missing from central_canonical_neighbors for k={}",
$n
);
// Every returned neighbour must itself already be canonical.
for n in &neighbours {
assert_eq!(n.into_kmer().canonical(), *n, "neighbour not canonical for k={}", $n);
}
}};
}
check!(1);
check!(3);
check!(5);
check!(31);
}
}
+2 -1
View File
@@ -10,7 +10,8 @@ pub mod stream_iter;
mod scratch;
pub(crate) mod encoding;
pub(crate) mod rolling_stat;
#[allow(missing_docs)]
pub mod rolling_stat;
pub use iter::SuperKmerIter;
pub use scratch::SuperKmerScratch;
-7
View File
@@ -196,13 +196,6 @@ impl RollingStat {
.map(|raw| Minimizer::from_raw_unchecked(raw << (64 - self.m * 2)))
}
pub fn entropy(&self, order: usize) -> Option<f64> {
if !self.ready() {
return None;
}
Some(self.entropy.entropy(order))
}
pub fn normalized_entropy(&self) -> Option<f64> {
if !self.ready() {
return None;
+2 -2
View File
@@ -102,9 +102,9 @@ fn roundtrip_single() {
#[test]
fn roundtrip_all_lengths() {
obikseq::params::set_k(11);
setup();
let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
for len in (11..=19).chain([255, 256, 257]) {
for len in (TEST_K..=19).chain([255, 256, 257]) {
let sk = make_sk(&bases[..len]);
let mut buf = Vec::new();
sk.write_to_binary(&mut buf).unwrap();
+89 -3
View File
@@ -202,6 +202,94 @@ fn cgroup_v1_available() -> Option<u64> {
Some(limit.saturating_sub(used))
}
// ── CPU parallelism query ────────────────────────────────────────────────────
/// Returns the number of cores this process can actually use concurrently.
///
/// `std::thread::available_parallelism()` reads CPU affinity
/// (`sched_getaffinity`), not the container's CPU quota — a Docker/cgroup
/// container commonly reports the *host's* full core count this way while
/// actually being throttled (via `cpu.max`/`cpu.cfs_quota_us`) to a fraction
/// of a core. Sizing a thread/worker pool off the unthrottled count causes
/// severe oversubscription: dozens of threads contending for a sliver of
/// real CPU time, which can look indistinguishable from a hang for minutes
/// or hours (observed in CI). On Linux, this reads the cgroup CPU quota
/// first and returns `min(cgroup_quota, host_parallelism)` when a finite
/// quota is found; falls back to `available_parallelism()` otherwise (same
/// convention as [`available_memory_bytes`]).
pub fn effective_parallelism() -> usize {
let host = std::thread::available_parallelism().map(|n| n.get()).unwrap_or(1);
#[cfg(target_os = "linux")]
{
if let Some(quota) = cgroup_v2_cpu_quota() {
let effective = quota.clamp(1, host);
tracing::debug!(host, quota, effective, source = "cgroup v2", "effective_parallelism");
return effective;
}
if let Some(quota) = cgroup_v1_cpu_quota() {
let effective = quota.clamp(1, host);
tracing::debug!(host, quota, effective, source = "cgroup v1", "effective_parallelism");
return effective;
}
}
tracing::debug!(host, effective = host, source = "available_parallelism (no cgroup quota found)", "effective_parallelism");
host
}
/// cgroup v2 (unified hierarchy): reads `cpu.max` ("<quota> <period>", or
/// "max <period>" when unlimited) for the current process's cgroup, rounded
/// up to whole cores. Returns `None` if unlimited or on any parse error.
#[cfg(target_os = "linux")]
fn cgroup_v2_cpu_quota() -> Option<usize> {
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
let rel = cgroup
.lines()
.find(|l| l.starts_with("0::"))?
.strip_prefix("0::")?
.trim();
let base = format!("/sys/fs/cgroup{rel}");
let raw = std::fs::read_to_string(format!("{base}/cpu.max")).ok()?;
let mut parts = raw.split_whitespace();
let quota_str = parts.next()?;
let period: f64 = parts.next()?.parse().ok()?;
if quota_str == "max" {
return None; // unlimited
}
let quota: f64 = quota_str.parse().ok()?;
Some((quota / period).ceil().max(1.0) as usize)
}
/// cgroup v1 (cpu subsystem): reads `cpu.cfs_quota_us`/`cpu.cfs_period_us`,
/// rounded up to whole cores. Returns `None` if unlimited (quota <= 0) or on
/// any parse error.
#[cfg(target_os = "linux")]
fn cgroup_v1_cpu_quota() -> Option<usize> {
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
let path = cgroup
.lines()
.find(|l| l.contains(":cpu:") || l.contains(":cpu,cpuacct:"))?
.split(':')
.nth(2)?;
let base = format!("/sys/fs/cgroup/cpu{path}");
let quota: i64 = std::fs::read_to_string(format!("{base}/cpu.cfs_quota_us"))
.ok()?
.trim()
.parse()
.ok()?;
if quota <= 0 {
return None; // unlimited
}
let period: i64 = std::fs::read_to_string(format!("{base}/cpu.cfs_period_us"))
.ok()?
.trim()
.parse()
.ok()?;
if period <= 0 {
return None;
}
Some(((quota as f64) / (period as f64)).ceil().max(1.0) as usize)
}
// ── raw helpers ───────────────────────────────────────────────────────────────
fn get_rusage() -> rusage {
@@ -654,9 +742,7 @@ impl fmt::Display for Reporter {
return Ok(());
}
let n_cores = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1);
let n_cores = effective_parallelism();
// column widths
let nw = self