First draft of a sphinx doc
This commit is contained in:
@@ -0,0 +1,89 @@
|
||||
# Makefile for Sphinx documentation
|
||||
#
|
||||
|
||||
# You can set these variables from the command line.
|
||||
SPHINXOPTS =
|
||||
SPHINXBUILD = sphinx-build
|
||||
PAPER =
|
||||
BUILDDIR = build
|
||||
|
||||
# Internal variables.
|
||||
PAPEROPT_a4 = -D latex_paper_size=a4
|
||||
PAPEROPT_letter = -D latex_paper_size=letter
|
||||
ALLSPHINXOPTS = -d $(BUILDDIR)/doctrees $(PAPEROPT_$(PAPER)) $(SPHINXOPTS) source
|
||||
|
||||
.PHONY: help clean html dirhtml pickle json htmlhelp qthelp latex changes linkcheck doctest
|
||||
|
||||
help:
|
||||
@echo "Please use \`make <target>' where <target> is one of"
|
||||
@echo " html to make standalone HTML files"
|
||||
@echo " dirhtml to make HTML files named index.html in directories"
|
||||
@echo " pickle to make pickle files"
|
||||
@echo " json to make JSON files"
|
||||
@echo " htmlhelp to make HTML files and a HTML help project"
|
||||
@echo " qthelp to make HTML files and a qthelp project"
|
||||
@echo " latex to make LaTeX files, you can set PAPER=a4 or PAPER=letter"
|
||||
@echo " changes to make an overview of all changed/added/deprecated items"
|
||||
@echo " linkcheck to check all external links for integrity"
|
||||
@echo " doctest to run all doctests embedded in the documentation (if enabled)"
|
||||
|
||||
clean:
|
||||
-rm -rf $(BUILDDIR)/*
|
||||
|
||||
html:
|
||||
$(SPHINXBUILD) -b html $(ALLSPHINXOPTS) $(BUILDDIR)/html
|
||||
@echo
|
||||
@echo "Build finished. The HTML pages are in $(BUILDDIR)/html."
|
||||
|
||||
dirhtml:
|
||||
$(SPHINXBUILD) -b dirhtml $(ALLSPHINXOPTS) $(BUILDDIR)/dirhtml
|
||||
@echo
|
||||
@echo "Build finished. The HTML pages are in $(BUILDDIR)/dirhtml."
|
||||
|
||||
pickle:
|
||||
$(SPHINXBUILD) -b pickle $(ALLSPHINXOPTS) $(BUILDDIR)/pickle
|
||||
@echo
|
||||
@echo "Build finished; now you can process the pickle files."
|
||||
|
||||
json:
|
||||
$(SPHINXBUILD) -b json $(ALLSPHINXOPTS) $(BUILDDIR)/json
|
||||
@echo
|
||||
@echo "Build finished; now you can process the JSON files."
|
||||
|
||||
htmlhelp:
|
||||
$(SPHINXBUILD) -b htmlhelp $(ALLSPHINXOPTS) $(BUILDDIR)/htmlhelp
|
||||
@echo
|
||||
@echo "Build finished; now you can run HTML Help Workshop with the" \
|
||||
".hhp project file in $(BUILDDIR)/htmlhelp."
|
||||
|
||||
qthelp:
|
||||
$(SPHINXBUILD) -b qthelp $(ALLSPHINXOPTS) $(BUILDDIR)/qthelp
|
||||
@echo
|
||||
@echo "Build finished; now you can run "qcollectiongenerator" with the" \
|
||||
".qhcp project file in $(BUILDDIR)/qthelp, like this:"
|
||||
@echo "# qcollectiongenerator $(BUILDDIR)/qthelp/OBITools.qhcp"
|
||||
@echo "To view the help file:"
|
||||
@echo "# assistant -collectionFile $(BUILDDIR)/qthelp/OBITools.qhc"
|
||||
|
||||
latex:
|
||||
$(SPHINXBUILD) -b latex $(ALLSPHINXOPTS) $(BUILDDIR)/latex
|
||||
@echo
|
||||
@echo "Build finished; the LaTeX files are in $(BUILDDIR)/latex."
|
||||
@echo "Run \`make all-pdf' or \`make all-ps' in that directory to" \
|
||||
"run these through (pdf)latex."
|
||||
|
||||
changes:
|
||||
$(SPHINXBUILD) -b changes $(ALLSPHINXOPTS) $(BUILDDIR)/changes
|
||||
@echo
|
||||
@echo "The overview file is in $(BUILDDIR)/changes."
|
||||
|
||||
linkcheck:
|
||||
$(SPHINXBUILD) -b linkcheck $(ALLSPHINXOPTS) $(BUILDDIR)/linkcheck
|
||||
@echo
|
||||
@echo "Link check complete; look for any errors in the above output " \
|
||||
"or in $(BUILDDIR)/linkcheck/output.txt."
|
||||
|
||||
doctest:
|
||||
$(SPHINXBUILD) -b doctest $(ALLSPHINXOPTS) $(BUILDDIR)/doctest
|
||||
@echo "Testing of doctests in the sources finished, look at the " \
|
||||
"results in $(BUILDDIR)/doctest/output.txt."
|
||||
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
@@ -0,0 +1,4 @@
|
||||
# Sphinx build info version 1
|
||||
# This file hashes the configuration used when building these files. When it is not found, a full rebuild will be done.
|
||||
config: c8cf90f918980d07f2eb7578215449db
|
||||
tags: fbb0d17656682115ca4d033fb2f83ba1
|
||||
@@ -0,0 +1,31 @@
|
||||
File format conversions
|
||||
=======================
|
||||
|
||||
Several OBITools exist for converting files from one format to another.
|
||||
As :doc:`fasta file <fasta>` is the central format for OBITools, many of
|
||||
these converters convert to :doc:`extended OBITools fasta format <obifasta>`.
|
||||
|
||||
Convert to extended OBITools fasta format
|
||||
-----------------------------------------
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
scripts/convert2fasta
|
||||
scripts/ecopcr2fasta
|
||||
|
||||
Convert taxonomic data
|
||||
----------------------
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
scripts/buildOBITaxonomy
|
||||
|
||||
Convert to tabular data files
|
||||
-----------------------------
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
scripts/fasta2tab
|
||||
@@ -0,0 +1,2 @@
|
||||
The EMBL sequence format
|
||||
========================
|
||||
@@ -0,0 +1,56 @@
|
||||
The fasta format
|
||||
================
|
||||
|
||||
|
||||
The fasta format is certainly the most widely used sequence file format.
|
||||
This is certainly due to its great simplicity. It was originally created
|
||||
for the ''Lipman'' and ''Pearson'' `FASTA program`_. OBITools use in more
|
||||
of :ref:`the classical fasta format <classical-fasta>` several extended
|
||||
version of this format where structured data are included in the title line.
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
obifasta
|
||||
|
||||
.. _classical-fasta:
|
||||
|
||||
The classical fasta format
|
||||
--------------------------
|
||||
|
||||
In fasta format a sequence is represented by a title line beginning with a **>** character and
|
||||
the sequences by itself following :doc:`iupac`. The sequence is usually split other severals
|
||||
lines of the same length (expected for the last one) ::
|
||||
|
||||
|
||||
>my_sequence this is my pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
|
||||
|
||||
This is no special format for the title line excepting that this line should be unique.
|
||||
Usually the first word following the **>** character is considered as the sequence identifier.
|
||||
The end of the title line corresponding to a description of the sequence.
|
||||
|
||||
Several sequences can be concatenated in a same file. The description of the next sequence
|
||||
is just pasted at the end of the description of the previous one ::
|
||||
|
||||
|
||||
>sequence_A this is my first pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
>sequence_B this is my second pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
>sequence_C this is my third pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
|
||||
|
||||
|
||||
|
||||
.. _`FASTA program`: http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation
|
||||
@@ -0,0 +1,54 @@
|
||||
File formats usable with OBITools
|
||||
=================================
|
||||
|
||||
|
||||
|
||||
The sequence files
|
||||
------------------
|
||||
|
||||
Sequences can be stored following various format. OBITools knows
|
||||
some of them. The central format for sequence files manipulated by OBITools scripts
|
||||
is the :doc:`fasta format <fasta>`. OBITools extends the fasta format by specifying
|
||||
a syntax to include in the definition line data qualifying the sequence.
|
||||
All file formats use the :doc:`IUPAC <iupac>` code for encoding nucleotides and
|
||||
amino-acids.
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
iupac
|
||||
fasta
|
||||
genbank
|
||||
embl
|
||||
|
||||
|
||||
The taxonomy files
|
||||
------------------
|
||||
|
||||
Many OBITools are able to take into account taxonomic data. These data
|
||||
are manipulated following the `NCBI taxonomy`_.
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
taxdump
|
||||
obitaxonomy
|
||||
|
||||
The ecoPCR files
|
||||
----------------
|
||||
|
||||
ecoPCR_ is a software developed in LECA_. It simulates a PCR experiment by
|
||||
selecting in a sequence database, sequences matching simultaneously two
|
||||
primers sequences in a way allowing a PCR amplification of a DNA region.
|
||||
|
||||
The ecoPrimer files
|
||||
-------------------
|
||||
|
||||
|
||||
The OBITools files
|
||||
------------------
|
||||
|
||||
|
||||
.. _ecoPCR: http://www.grenoble.prabi.fr/trac/ecoPCR
|
||||
.. _LECA: http://www-leca.ujf-grenoble.fr
|
||||
.. _`NCBI taxonomy`: http://www.ncbi.nlm.nih.gov/taxonomy
|
||||
@@ -0,0 +1,2 @@
|
||||
The genbank sequence format
|
||||
===========================
|
||||
@@ -0,0 +1,22 @@
|
||||
.. OBITools documentation master file, created by
|
||||
sphinx-quickstart on Tue Dec 8 21:30:02 2009.
|
||||
You can adapt this file completely to your liking, but it should at least
|
||||
contain the root `toctree` directive.
|
||||
|
||||
Welcome to OBITools's documentation!
|
||||
====================================
|
||||
|
||||
Contents:
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
The OBITools scripts <scripts>
|
||||
|
||||
Indices and tables
|
||||
==================
|
||||
|
||||
* :ref:`genindex`
|
||||
* :ref:`modindex`
|
||||
* :ref:`search`
|
||||
|
||||
@@ -0,0 +1,63 @@
|
||||
The IUPAC code
|
||||
==============
|
||||
|
||||
The International Union of Pure and Applied Chemistry (IUPAC_) defined
|
||||
the standard code for representing protein or DNA sequences.
|
||||
|
||||
Nucleic IUPAC Code
|
||||
------------------
|
||||
|
||||
======== =================================
|
||||
**Code** **Nucleotide**
|
||||
======== =================================
|
||||
A Adenine
|
||||
C Cytosine
|
||||
G Guanine
|
||||
T Thymine
|
||||
U Uracil
|
||||
R Purine (A or G)
|
||||
Y Pyrimidine (C, T, or U)
|
||||
M C or A
|
||||
K T, U, or G
|
||||
W T, U, or A
|
||||
S C or G
|
||||
B C, T, U, or G (not A)
|
||||
D A, T, U, or G (not C)
|
||||
H A, T, U, or C (not G)
|
||||
V A, C, or G (not T, not U)
|
||||
N Any base (A, C, G, T, or U)
|
||||
======== =================================
|
||||
|
||||
|
||||
Peptidic one and three letters IUPAC code
|
||||
-----------------------------------------
|
||||
|
||||
============ ============= =======================================
|
||||
**1-letter** **3-letters** **Amino acid**
|
||||
============ ============= =======================================
|
||||
A Ala Alanine
|
||||
R Arg Arginine
|
||||
N Asn Asparagine
|
||||
D Asp Aspartic acid
|
||||
C Cys Cysteine
|
||||
Q Gln Glutamine
|
||||
E Glu Glutamic acid
|
||||
G Gly Glycine
|
||||
H His Histidine
|
||||
I Ile Isoleucine
|
||||
L Leu Leucine
|
||||
K Lys Lysine
|
||||
M Met Methionine
|
||||
F Phe Phenylalanine
|
||||
P Pro Proline
|
||||
S Ser Serine
|
||||
T Thr Threonine
|
||||
W Trp Tryptophan
|
||||
Y Tyr Tyrosine
|
||||
V Val Valine
|
||||
B Asx Aspartic acid or Asparagine
|
||||
Z Glx Glutamine or Glutamic acid
|
||||
X Xaa Any amino acid
|
||||
============ ============= =======================================
|
||||
|
||||
.. _IUPAC: http://www.iupac.org/
|
||||
@@ -0,0 +1,35 @@
|
||||
The extended OBITools fasta format
|
||||
==================================
|
||||
|
||||
The *extended OBITools Fasta format* is a strict :doc:`fasta format file <fasta>`.
|
||||
The file in *extended OBITools Fasta format* can be readed by all programs
|
||||
reading fasta files.
|
||||
|
||||
Difference between standard and extended fasta is just the structure of the title
|
||||
line. For OBITools title line is divided in three parts :
|
||||
|
||||
- Seqid : the sequence identifier
|
||||
- key=value; : a set of key/value keys
|
||||
- the sequence definition
|
||||
|
||||
|
||||
::
|
||||
|
||||
>my_sequence taxid=3456; direct=True; sample=A354; this is my pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
|
||||
Following these rules, the title line can be parsed :
|
||||
|
||||
- The sequence identifier of this sequence is *my_sequence*
|
||||
- Three keys are assigned to this sequence :
|
||||
- Key *taxid* with value *3456*
|
||||
- Key *direct* with value *True*
|
||||
- Key *sample* with value *A354*
|
||||
- The definition of this sequence is this is *my pretty sequence*
|
||||
|
||||
Key value can be any valid python expression. If a key value cannot be evaluated as
|
||||
a python expression, it is them assumed as a simple string. Following this rule,
|
||||
taxid value is considered as an integer value, direct value as a boolean and sample
|
||||
value is not a valid python expression so it is considered as a string value.
|
||||
@@ -0,0 +1,3 @@
|
||||
The OBITools formated taxonomy
|
||||
==============================
|
||||
|
||||
@@ -0,0 +1,13 @@
|
||||
OBITools scripts
|
||||
================
|
||||
|
||||
OBITools scripts are developed mainly for manipulating large sequence
|
||||
files generated by the next generation sequencers.
|
||||
|
||||
Contents:
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
Usable file formats with OBITools <formats>
|
||||
File format conversions <conversions>
|
||||
@@ -0,0 +1,51 @@
|
||||
Convert NCBI taxdump to binary formated OBITools taxonomy database
|
||||
==================================================================
|
||||
|
||||
:command:`buildOBITaxonomy.py` -t <taxdump dir> -d <db name>
|
||||
|
||||
Convert an text dump directory of the NCBI Taxonomy database to the binary
|
||||
format used by ecoPCR and many OBITools scripts. An archive corresponding to
|
||||
this directory can be downloaded at the following URL
|
||||
|
||||
`ftp://ftp.ncbi.nlm.nih.gov/pub/taxonomy/ <ftp://ftp.ncbi.nlm.nih.gov/pub/taxonomy/>`_
|
||||
|
||||
obitools common options
|
||||
-----------------------
|
||||
|
||||
.. program:: obitools
|
||||
|
||||
.. cmdoption:: -h, --help
|
||||
|
||||
show this help message and exit
|
||||
|
||||
.. cmdoption:: --DEBUG
|
||||
|
||||
Set logging in debug mode
|
||||
|
||||
.. cmdoption:: --no-psyco
|
||||
|
||||
Don't use psyco even if it installed
|
||||
|
||||
taxonomy related options
|
||||
------------------------
|
||||
|
||||
.. program:: taxonomy
|
||||
|
||||
.. cmdoption:: -d <FILENAME>, --database=<FILENAME>
|
||||
|
||||
ecoPCR taxonomy Database name
|
||||
|
||||
.. cmdoption:: -t <FILENAME>, --taxonomy-dump=<FILENAME>
|
||||
|
||||
NCBI Taxonomy dump repository name
|
||||
|
||||
example
|
||||
-------
|
||||
|
||||
for building a new taxonomy database named *ncbitaxonomy* from a taxdump dir ::
|
||||
|
||||
% curl ftp://ftp.ncbi.nlm.nih.gov/pub/taxonomy/taxdump.tar.gz | tar zxf -
|
||||
% buildOBITaxonomy.py --taxonomy-dump taxdump --database ncbitaxonomy
|
||||
|
||||
|
||||
|
||||
@@ -0,0 +1,58 @@
|
||||
Convert sequence files to extended OBITools fasta format
|
||||
========================================================
|
||||
|
||||
:command:`convert2fasta.py` [options] [filename 1] [filename 2] ...
|
||||
|
||||
Convert sequence files to the extended OBITools fasta format. If no
|
||||
file name are specified data are read from standard input.
|
||||
|
||||
obitools common options
|
||||
-----------------------
|
||||
|
||||
.. program:: obitools
|
||||
|
||||
.. cmdoption:: -h, --help
|
||||
|
||||
show this help message and exit
|
||||
|
||||
.. cmdoption:: --DEBUG
|
||||
|
||||
Set logging in debug mode
|
||||
|
||||
.. cmdoption:: --no-psyco
|
||||
|
||||
Don't use psyco even if it installed
|
||||
|
||||
convert2fasta.py specific options
|
||||
---------------------------------
|
||||
|
||||
.. program:: convert2fasta.py
|
||||
|
||||
.. cmdoption:: --genbank
|
||||
|
||||
input file is in :doc:`genbank format <../genbank>`
|
||||
|
||||
.. cmdoption:: --embl
|
||||
|
||||
input file is in :doc:`embl format <../embl>`
|
||||
|
||||
.. cmdoption:: --fna
|
||||
|
||||
input file is in fasta nucleic format produced by 454 sequencer
|
||||
pipeline
|
||||
|
||||
.. cmdoption:: --nuc
|
||||
|
||||
input file contains nucleic sequences
|
||||
|
||||
.. cmdoption:: --prot
|
||||
|
||||
input file contains protein sequences
|
||||
|
||||
example
|
||||
-------
|
||||
|
||||
for converting a genbank file to fasta ::
|
||||
|
||||
% convert2fasta.py --genbank --nuc sequences.gb > sequences.fasta
|
||||
|
||||
@@ -0,0 +1,2 @@
|
||||
Convert ecoPCR result files to extended OBITools fasta file
|
||||
===========================================================
|
||||
@@ -0,0 +1,2 @@
|
||||
Convert extended OBITools fasta file to a tabular format
|
||||
========================================================
|
||||
@@ -0,0 +1,2 @@
|
||||
The NCBI taxonomy dump files
|
||||
============================
|
||||
@@ -0,0 +1,405 @@
|
||||
/**
|
||||
* Sphinx stylesheet -- basic theme
|
||||
* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
|
||||
*/
|
||||
|
||||
/* -- main layout ----------------------------------------------------------- */
|
||||
|
||||
div.clearer {
|
||||
clear: both;
|
||||
}
|
||||
|
||||
/* -- relbar ---------------------------------------------------------------- */
|
||||
|
||||
div.related {
|
||||
width: 100%;
|
||||
font-size: 90%;
|
||||
}
|
||||
|
||||
div.related h3 {
|
||||
display: none;
|
||||
}
|
||||
|
||||
div.related ul {
|
||||
margin: 0;
|
||||
padding: 0 0 0 10px;
|
||||
list-style: none;
|
||||
}
|
||||
|
||||
div.related li {
|
||||
display: inline;
|
||||
}
|
||||
|
||||
div.related li.right {
|
||||
float: right;
|
||||
margin-right: 5px;
|
||||
}
|
||||
|
||||
/* -- sidebar --------------------------------------------------------------- */
|
||||
|
||||
div.sphinxsidebarwrapper {
|
||||
padding: 10px 5px 0 10px;
|
||||
}
|
||||
|
||||
div.sphinxsidebar {
|
||||
float: left;
|
||||
width: 230px;
|
||||
margin-left: -100%;
|
||||
font-size: 90%;
|
||||
}
|
||||
|
||||
div.sphinxsidebar ul {
|
||||
list-style: none;
|
||||
}
|
||||
|
||||
div.sphinxsidebar ul ul,
|
||||
div.sphinxsidebar ul.want-points {
|
||||
margin-left: 20px;
|
||||
list-style: square;
|
||||
}
|
||||
|
||||
div.sphinxsidebar ul ul {
|
||||
margin-top: 0;
|
||||
margin-bottom: 0;
|
||||
}
|
||||
|
||||
div.sphinxsidebar form {
|
||||
margin-top: 10px;
|
||||
}
|
||||
|
||||
div.sphinxsidebar input {
|
||||
border: 1px solid #98dbcc;
|
||||
font-family: sans-serif;
|
||||
font-size: 1em;
|
||||
}
|
||||
|
||||
img {
|
||||
border: 0;
|
||||
}
|
||||
|
||||
/* -- search page ----------------------------------------------------------- */
|
||||
|
||||
ul.search {
|
||||
margin: 10px 0 0 20px;
|
||||
padding: 0;
|
||||
}
|
||||
|
||||
ul.search li {
|
||||
padding: 5px 0 5px 20px;
|
||||
background-image: url(file.png);
|
||||
background-repeat: no-repeat;
|
||||
background-position: 0 7px;
|
||||
}
|
||||
|
||||
ul.search li a {
|
||||
font-weight: bold;
|
||||
}
|
||||
|
||||
ul.search li div.context {
|
||||
color: #888;
|
||||
margin: 2px 0 0 30px;
|
||||
text-align: left;
|
||||
}
|
||||
|
||||
ul.keywordmatches li.goodmatch a {
|
||||
font-weight: bold;
|
||||
}
|
||||
|
||||
/* -- index page ------------------------------------------------------------ */
|
||||
|
||||
table.contentstable {
|
||||
width: 90%;
|
||||
}
|
||||
|
||||
table.contentstable p.biglink {
|
||||
line-height: 150%;
|
||||
}
|
||||
|
||||
a.biglink {
|
||||
font-size: 1.3em;
|
||||
}
|
||||
|
||||
span.linkdescr {
|
||||
font-style: italic;
|
||||
padding-top: 5px;
|
||||
font-size: 90%;
|
||||
}
|
||||
|
||||
/* -- general index --------------------------------------------------------- */
|
||||
|
||||
table.indextable td {
|
||||
text-align: left;
|
||||
vertical-align: top;
|
||||
}
|
||||
|
||||
table.indextable dl, table.indextable dd {
|
||||
margin-top: 0;
|
||||
margin-bottom: 0;
|
||||
}
|
||||
|
||||
table.indextable tr.pcap {
|
||||
height: 10px;
|
||||
}
|
||||
|
||||
table.indextable tr.cap {
|
||||
margin-top: 10px;
|
||||
background-color: #f2f2f2;
|
||||
}
|
||||
|
||||
img.toggler {
|
||||
margin-right: 3px;
|
||||
margin-top: 3px;
|
||||
cursor: pointer;
|
||||
}
|
||||
|
||||
/* -- general body styles --------------------------------------------------- */
|
||||
|
||||
a.headerlink {
|
||||
visibility: hidden;
|
||||
}
|
||||
|
||||
h1:hover > a.headerlink,
|
||||
h2:hover > a.headerlink,
|
||||
h3:hover > a.headerlink,
|
||||
h4:hover > a.headerlink,
|
||||
h5:hover > a.headerlink,
|
||||
h6:hover > a.headerlink,
|
||||
dt:hover > a.headerlink {
|
||||
visibility: visible;
|
||||
}
|
||||
|
||||
div.body p.caption {
|
||||
text-align: inherit;
|
||||
}
|
||||
|
||||
div.body td {
|
||||
text-align: left;
|
||||
}
|
||||
|
||||
.field-list ul {
|
||||
padding-left: 1em;
|
||||
}
|
||||
|
||||
.first {
|
||||
margin-top: 0 !important;
|
||||
}
|
||||
|
||||
p.rubric {
|
||||
margin-top: 30px;
|
||||
font-weight: bold;
|
||||
}
|
||||
|
||||
/* -- sidebars -------------------------------------------------------------- */
|
||||
|
||||
div.sidebar {
|
||||
margin: 0 0 0.5em 1em;
|
||||
border: 1px solid #ddb;
|
||||
padding: 7px 7px 0 7px;
|
||||
background-color: #ffe;
|
||||
width: 40%;
|
||||
float: right;
|
||||
}
|
||||
|
||||
p.sidebar-title {
|
||||
font-weight: bold;
|
||||
}
|
||||
|
||||
/* -- topics ---------------------------------------------------------------- */
|
||||
|
||||
div.topic {
|
||||
border: 1px solid #ccc;
|
||||
padding: 7px 7px 0 7px;
|
||||
margin: 10px 0 10px 0;
|
||||
}
|
||||
|
||||
p.topic-title {
|
||||
font-size: 1.1em;
|
||||
font-weight: bold;
|
||||
margin-top: 10px;
|
||||
}
|
||||
|
||||
/* -- admonitions ----------------------------------------------------------- */
|
||||
|
||||
div.admonition {
|
||||
margin-top: 10px;
|
||||
margin-bottom: 10px;
|
||||
padding: 7px;
|
||||
}
|
||||
|
||||
div.admonition dt {
|
||||
font-weight: bold;
|
||||
}
|
||||
|
||||
div.admonition dl {
|
||||
margin-bottom: 0;
|
||||
}
|
||||
|
||||
p.admonition-title {
|
||||
margin: 0px 10px 5px 0px;
|
||||
font-weight: bold;
|
||||
}
|
||||
|
||||
div.body p.centered {
|
||||
text-align: center;
|
||||
margin-top: 25px;
|
||||
}
|
||||
|
||||
/* -- tables ---------------------------------------------------------------- */
|
||||
|
||||
table.docutils {
|
||||
border: 0;
|
||||
border-collapse: collapse;
|
||||
}
|
||||
|
||||
table.docutils td, table.docutils th {
|
||||
padding: 1px 8px 1px 0;
|
||||
border-top: 0;
|
||||
border-left: 0;
|
||||
border-right: 0;
|
||||
border-bottom: 1px solid #aaa;
|
||||
}
|
||||
|
||||
table.field-list td, table.field-list th {
|
||||
border: 0 !important;
|
||||
}
|
||||
|
||||
table.footnote td, table.footnote th {
|
||||
border: 0 !important;
|
||||
}
|
||||
|
||||
th {
|
||||
text-align: left;
|
||||
padding-right: 5px;
|
||||
}
|
||||
|
||||
/* -- other body styles ----------------------------------------------------- */
|
||||
|
||||
dl {
|
||||
margin-bottom: 15px;
|
||||
}
|
||||
|
||||
dd p {
|
||||
margin-top: 0px;
|
||||
}
|
||||
|
||||
dd ul, dd table {
|
||||
margin-bottom: 10px;
|
||||
}
|
||||
|
||||
dd {
|
||||
margin-top: 3px;
|
||||
margin-bottom: 10px;
|
||||
margin-left: 30px;
|
||||
}
|
||||
|
||||
dt:target, .highlight {
|
||||
background-color: #fbe54e;
|
||||
}
|
||||
|
||||
dl.glossary dt {
|
||||
font-weight: bold;
|
||||
font-size: 1.1em;
|
||||
}
|
||||
|
||||
.field-list ul {
|
||||
margin: 0;
|
||||
padding-left: 1em;
|
||||
}
|
||||
|
||||
.field-list p {
|
||||
margin: 0;
|
||||
}
|
||||
|
||||
.refcount {
|
||||
color: #060;
|
||||
}
|
||||
|
||||
.optional {
|
||||
font-size: 1.3em;
|
||||
}
|
||||
|
||||
.versionmodified {
|
||||
font-style: italic;
|
||||
}
|
||||
|
||||
.system-message {
|
||||
background-color: #fda;
|
||||
padding: 5px;
|
||||
border: 3px solid red;
|
||||
}
|
||||
|
||||
.footnote:target {
|
||||
background-color: #ffa
|
||||
}
|
||||
|
||||
/* -- code displays --------------------------------------------------------- */
|
||||
|
||||
pre {
|
||||
overflow: auto;
|
||||
}
|
||||
|
||||
td.linenos pre {
|
||||
padding: 5px 0px;
|
||||
border: 0;
|
||||
background-color: transparent;
|
||||
color: #aaa;
|
||||
}
|
||||
|
||||
table.highlighttable {
|
||||
margin-left: 0.5em;
|
||||
}
|
||||
|
||||
table.highlighttable td {
|
||||
padding: 0 0.5em 0 0.5em;
|
||||
}
|
||||
|
||||
tt.descname {
|
||||
background-color: transparent;
|
||||
font-weight: bold;
|
||||
font-size: 1.2em;
|
||||
}
|
||||
|
||||
tt.descclassname {
|
||||
background-color: transparent;
|
||||
}
|
||||
|
||||
tt.xref, a tt {
|
||||
background-color: transparent;
|
||||
font-weight: bold;
|
||||
}
|
||||
|
||||
h1 tt, h2 tt, h3 tt, h4 tt, h5 tt, h6 tt {
|
||||
background-color: transparent;
|
||||
}
|
||||
|
||||
/* -- math display ---------------------------------------------------------- */
|
||||
|
||||
img.math {
|
||||
vertical-align: middle;
|
||||
}
|
||||
|
||||
div.body div.math p {
|
||||
text-align: center;
|
||||
}
|
||||
|
||||
span.eqno {
|
||||
float: right;
|
||||
}
|
||||
|
||||
/* -- printout stylesheet --------------------------------------------------- */
|
||||
|
||||
@media print {
|
||||
div.document,
|
||||
div.documentwrapper,
|
||||
div.bodywrapper {
|
||||
margin: 0;
|
||||
width: 100%;
|
||||
}
|
||||
|
||||
div.sphinxsidebar,
|
||||
div.related,
|
||||
div.footer,
|
||||
#top-link {
|
||||
display: none;
|
||||
}
|
||||
}
|
||||
@@ -0,0 +1,210 @@
|
||||
/**
|
||||
* Sphinx stylesheet -- default theme
|
||||
* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
|
||||
*/
|
||||
|
||||
@import url("basic.css");
|
||||
|
||||
/* -- page layout ----------------------------------------------------------- */
|
||||
|
||||
body {
|
||||
font-family: sans-serif;
|
||||
font-size: 100%;
|
||||
background-color: #11303d;
|
||||
color: #000;
|
||||
margin: 0;
|
||||
padding: 0;
|
||||
}
|
||||
|
||||
div.document {
|
||||
background-color: #1c4e63;
|
||||
}
|
||||
|
||||
div.documentwrapper {
|
||||
float: left;
|
||||
width: 100%;
|
||||
}
|
||||
|
||||
div.bodywrapper {
|
||||
margin: 0 0 0 230px;
|
||||
}
|
||||
|
||||
div.body {
|
||||
background-color: #ffffff;
|
||||
color: #000000;
|
||||
padding: 0 20px 30px 20px;
|
||||
}
|
||||
|
||||
div.footer {
|
||||
color: #ffffff;
|
||||
width: 100%;
|
||||
padding: 9px 0 9px 0;
|
||||
text-align: center;
|
||||
font-size: 75%;
|
||||
}
|
||||
|
||||
div.footer a {
|
||||
color: #ffffff;
|
||||
text-decoration: underline;
|
||||
}
|
||||
|
||||
div.related {
|
||||
background-color: #133f52;
|
||||
line-height: 30px;
|
||||
color: #ffffff;
|
||||
}
|
||||
|
||||
div.related a {
|
||||
color: #ffffff;
|
||||
}
|
||||
|
||||
div.sphinxsidebar {
|
||||
}
|
||||
|
||||
div.sphinxsidebar h3 {
|
||||
font-family: 'Trebuchet MS', sans-serif;
|
||||
color: #ffffff;
|
||||
font-size: 1.4em;
|
||||
font-weight: normal;
|
||||
margin: 0;
|
||||
padding: 0;
|
||||
}
|
||||
|
||||
div.sphinxsidebar h3 a {
|
||||
color: #ffffff;
|
||||
}
|
||||
|
||||
div.sphinxsidebar h4 {
|
||||
font-family: 'Trebuchet MS', sans-serif;
|
||||
color: #ffffff;
|
||||
font-size: 1.3em;
|
||||
font-weight: normal;
|
||||
margin: 5px 0 0 0;
|
||||
padding: 0;
|
||||
}
|
||||
|
||||
div.sphinxsidebar p {
|
||||
color: #ffffff;
|
||||
}
|
||||
|
||||
div.sphinxsidebar p.topless {
|
||||
margin: 5px 10px 10px 10px;
|
||||
}
|
||||
|
||||
div.sphinxsidebar ul {
|
||||
margin: 10px;
|
||||
padding: 0;
|
||||
color: #ffffff;
|
||||
}
|
||||
|
||||
div.sphinxsidebar a {
|
||||
color: #98dbcc;
|
||||
}
|
||||
|
||||
div.sphinxsidebar input {
|
||||
border: 1px solid #98dbcc;
|
||||
font-family: sans-serif;
|
||||
font-size: 1em;
|
||||
}
|
||||
|
||||
/* -- body styles ----------------------------------------------------------- */
|
||||
|
||||
a {
|
||||
color: #355f7c;
|
||||
text-decoration: none;
|
||||
}
|
||||
|
||||
a:hover {
|
||||
text-decoration: underline;
|
||||
}
|
||||
|
||||
div.body p, div.body dd, div.body li {
|
||||
text-align: justify;
|
||||
line-height: 130%;
|
||||
}
|
||||
|
||||
div.body h1,
|
||||
div.body h2,
|
||||
div.body h3,
|
||||
div.body h4,
|
||||
div.body h5,
|
||||
div.body h6 {
|
||||
font-family: 'Trebuchet MS', sans-serif;
|
||||
background-color: #f2f2f2;
|
||||
font-weight: normal;
|
||||
color: #20435c;
|
||||
border-bottom: 1px solid #ccc;
|
||||
margin: 20px -20px 10px -20px;
|
||||
padding: 3px 0 3px 10px;
|
||||
}
|
||||
|
||||
div.body h1 { margin-top: 0; font-size: 200%; }
|
||||
div.body h2 { font-size: 160%; }
|
||||
div.body h3 { font-size: 140%; }
|
||||
div.body h4 { font-size: 120%; }
|
||||
div.body h5 { font-size: 110%; }
|
||||
div.body h6 { font-size: 100%; }
|
||||
|
||||
a.headerlink {
|
||||
color: #c60f0f;
|
||||
font-size: 0.8em;
|
||||
padding: 0 4px 0 4px;
|
||||
text-decoration: none;
|
||||
}
|
||||
|
||||
a.headerlink:hover {
|
||||
background-color: #c60f0f;
|
||||
color: white;
|
||||
}
|
||||
|
||||
div.body p, div.body dd, div.body li {
|
||||
text-align: justify;
|
||||
line-height: 130%;
|
||||
}
|
||||
|
||||
div.admonition p.admonition-title + p {
|
||||
display: inline;
|
||||
}
|
||||
|
||||
div.note {
|
||||
background-color: #eee;
|
||||
border: 1px solid #ccc;
|
||||
}
|
||||
|
||||
div.seealso {
|
||||
background-color: #ffc;
|
||||
border: 1px solid #ff6;
|
||||
}
|
||||
|
||||
div.topic {
|
||||
background-color: #eee;
|
||||
}
|
||||
|
||||
div.warning {
|
||||
background-color: #ffe4e4;
|
||||
border: 1px solid #f66;
|
||||
}
|
||||
|
||||
p.admonition-title {
|
||||
display: inline;
|
||||
}
|
||||
|
||||
p.admonition-title:after {
|
||||
content: ":";
|
||||
}
|
||||
|
||||
pre {
|
||||
padding: 5px;
|
||||
background-color: #eeffcc;
|
||||
color: #333333;
|
||||
line-height: 120%;
|
||||
border: 1px solid #ac9;
|
||||
border-left: none;
|
||||
border-right: none;
|
||||
}
|
||||
|
||||
tt {
|
||||
background-color: #ecf0f3;
|
||||
padding: 0 1px 0 1px;
|
||||
font-size: 0.95em;
|
||||
}
|
||||
@@ -0,0 +1,232 @@
|
||||
/// XXX: make it cross browser
|
||||
|
||||
/**
|
||||
* make the code below compatible with browsers without
|
||||
* an installed firebug like debugger
|
||||
*/
|
||||
if (!window.console || !console.firebug) {
|
||||
var names = ["log", "debug", "info", "warn", "error", "assert", "dir", "dirxml",
|
||||
"group", "groupEnd", "time", "timeEnd", "count", "trace", "profile", "profileEnd"];
|
||||
window.console = {};
|
||||
for (var i = 0; i < names.length; ++i)
|
||||
window.console[names[i]] = function() {}
|
||||
}
|
||||
|
||||
/**
|
||||
* small helper function to urldecode strings
|
||||
*/
|
||||
jQuery.urldecode = function(x) {
|
||||
return decodeURIComponent(x).replace(/\+/g, ' ');
|
||||
}
|
||||
|
||||
/**
|
||||
* small helper function to urlencode strings
|
||||
*/
|
||||
jQuery.urlencode = encodeURIComponent;
|
||||
|
||||
/**
|
||||
* This function returns the parsed url parameters of the
|
||||
* current request. Multiple values per key are supported,
|
||||
* it will always return arrays of strings for the value parts.
|
||||
*/
|
||||
jQuery.getQueryParameters = function(s) {
|
||||
if (typeof s == 'undefined')
|
||||
s = document.location.search;
|
||||
var parts = s.substr(s.indexOf('?') + 1).split('&');
|
||||
var result = {};
|
||||
for (var i = 0; i < parts.length; i++) {
|
||||
var tmp = parts[i].split('=', 2);
|
||||
var key = jQuery.urldecode(tmp[0]);
|
||||
var value = jQuery.urldecode(tmp[1]);
|
||||
if (key in result)
|
||||
result[key].push(value);
|
||||
else
|
||||
result[key] = [value];
|
||||
}
|
||||
return result;
|
||||
}
|
||||
|
||||
/**
|
||||
* small function to check if an array contains
|
||||
* a given item.
|
||||
*/
|
||||
jQuery.contains = function(arr, item) {
|
||||
for (var i = 0; i < arr.length; i++) {
|
||||
if (arr[i] == item)
|
||||
return true;
|
||||
}
|
||||
return false;
|
||||
}
|
||||
|
||||
/**
|
||||
* highlight a given string on a jquery object by wrapping it in
|
||||
* span elements with the given class name.
|
||||
*/
|
||||
jQuery.fn.highlightText = function(text, className) {
|
||||
function highlight(node) {
|
||||
if (node.nodeType == 3) {
|
||||
var val = node.nodeValue;
|
||||
var pos = val.toLowerCase().indexOf(text);
|
||||
if (pos >= 0 && !jQuery.className.has(node.parentNode, className)) {
|
||||
var span = document.createElement("span");
|
||||
span.className = className;
|
||||
span.appendChild(document.createTextNode(val.substr(pos, text.length)));
|
||||
node.parentNode.insertBefore(span, node.parentNode.insertBefore(
|
||||
document.createTextNode(val.substr(pos + text.length)),
|
||||
node.nextSibling));
|
||||
node.nodeValue = val.substr(0, pos);
|
||||
}
|
||||
}
|
||||
else if (!jQuery(node).is("button, select, textarea")) {
|
||||
jQuery.each(node.childNodes, function() {
|
||||
highlight(this)
|
||||
});
|
||||
}
|
||||
}
|
||||
return this.each(function() {
|
||||
highlight(this);
|
||||
});
|
||||
}
|
||||
|
||||
/**
|
||||
* Small JavaScript module for the documentation.
|
||||
*/
|
||||
var Documentation = {
|
||||
|
||||
init : function() {
|
||||
this.fixFirefoxAnchorBug();
|
||||
this.highlightSearchWords();
|
||||
this.initModIndex();
|
||||
},
|
||||
|
||||
/**
|
||||
* i18n support
|
||||
*/
|
||||
TRANSLATIONS : {},
|
||||
PLURAL_EXPR : function(n) { return n == 1 ? 0 : 1; },
|
||||
LOCALE : 'unknown',
|
||||
|
||||
// gettext and ngettext don't access this so that the functions
|
||||
// can savely bound to a different name (_ = Documentation.gettext)
|
||||
gettext : function(string) {
|
||||
var translated = Documentation.TRANSLATIONS[string];
|
||||
if (typeof translated == 'undefined')
|
||||
return string;
|
||||
return (typeof translated == 'string') ? translated : translated[0];
|
||||
},
|
||||
|
||||
ngettext : function(singular, plural, n) {
|
||||
var translated = Documentation.TRANSLATIONS[singular];
|
||||
if (typeof translated == 'undefined')
|
||||
return (n == 1) ? singular : plural;
|
||||
return translated[Documentation.PLURALEXPR(n)];
|
||||
},
|
||||
|
||||
addTranslations : function(catalog) {
|
||||
for (var key in catalog.messages)
|
||||
this.TRANSLATIONS[key] = catalog.messages[key];
|
||||
this.PLURAL_EXPR = new Function('n', 'return +(' + catalog.plural_expr + ')');
|
||||
this.LOCALE = catalog.locale;
|
||||
},
|
||||
|
||||
/**
|
||||
* add context elements like header anchor links
|
||||
*/
|
||||
addContextElements : function() {
|
||||
$('div[id] > :header:first').each(function() {
|
||||
$('<a class="headerlink">\u00B6</a>').
|
||||
attr('href', '#' + this.id).
|
||||
attr('title', _('Permalink to this headline')).
|
||||
appendTo(this);
|
||||
});
|
||||
$('dt[id]').each(function() {
|
||||
$('<a class="headerlink">\u00B6</a>').
|
||||
attr('href', '#' + this.id).
|
||||
attr('title', _('Permalink to this definition')).
|
||||
appendTo(this);
|
||||
});
|
||||
},
|
||||
|
||||
/**
|
||||
* workaround a firefox stupidity
|
||||
*/
|
||||
fixFirefoxAnchorBug : function() {
|
||||
if (document.location.hash && $.browser.mozilla)
|
||||
window.setTimeout(function() {
|
||||
document.location.href += '';
|
||||
}, 10);
|
||||
},
|
||||
|
||||
/**
|
||||
* highlight the search words provided in the url in the text
|
||||
*/
|
||||
highlightSearchWords : function() {
|
||||
var params = $.getQueryParameters();
|
||||
var terms = (params.highlight) ? params.highlight[0].split(/\s+/) : [];
|
||||
if (terms.length) {
|
||||
var body = $('div.body');
|
||||
window.setTimeout(function() {
|
||||
$.each(terms, function() {
|
||||
body.highlightText(this.toLowerCase(), 'highlight');
|
||||
});
|
||||
}, 10);
|
||||
$('<li class="highlight-link"><a href="javascript:Documentation.' +
|
||||
'hideSearchWords()">' + _('Hide Search Matches') + '</a></li>')
|
||||
.appendTo($('.sidebar .this-page-menu'));
|
||||
}
|
||||
},
|
||||
|
||||
/**
|
||||
* init the modindex toggle buttons
|
||||
*/
|
||||
initModIndex : function() {
|
||||
var togglers = $('img.toggler').click(function() {
|
||||
var src = $(this).attr('src');
|
||||
var idnum = $(this).attr('id').substr(7);
|
||||
console.log($('tr.cg-' + idnum).toggle());
|
||||
if (src.substr(-9) == 'minus.png')
|
||||
$(this).attr('src', src.substr(0, src.length-9) + 'plus.png');
|
||||
else
|
||||
$(this).attr('src', src.substr(0, src.length-8) + 'minus.png');
|
||||
}).css('display', '');
|
||||
if (DOCUMENTATION_OPTIONS.COLLAPSE_MODINDEX) {
|
||||
togglers.click();
|
||||
}
|
||||
},
|
||||
|
||||
/**
|
||||
* helper function to hide the search marks again
|
||||
*/
|
||||
hideSearchWords : function() {
|
||||
$('.sidebar .this-page-menu li.highlight-link').fadeOut(300);
|
||||
$('span.highlight').removeClass('highlight');
|
||||
},
|
||||
|
||||
/**
|
||||
* make the url absolute
|
||||
*/
|
||||
makeURL : function(relativeURL) {
|
||||
return DOCUMENTATION_OPTIONS.URL_ROOT + '/' + relativeURL;
|
||||
},
|
||||
|
||||
/**
|
||||
* get the current relative url
|
||||
*/
|
||||
getCurrentURL : function() {
|
||||
var path = document.location.pathname;
|
||||
var parts = path.split(/\//);
|
||||
$.each(DOCUMENTATION_OPTIONS.URL_ROOT.split(/\//), function() {
|
||||
if (this == '..')
|
||||
parts.pop();
|
||||
});
|
||||
var url = parts.join('/');
|
||||
return path.substring(url.lastIndexOf('/') + 1, path.length - 1);
|
||||
}
|
||||
};
|
||||
|
||||
// quick alias for translations
|
||||
_ = Documentation.gettext;
|
||||
|
||||
$(document).ready(function() {
|
||||
Documentation.init();
|
||||
});
|
||||
Binary file not shown.
|
After Width: | Height: | Size: 392 B |
+32
File diff suppressed because one or more lines are too long
Binary file not shown.
|
After Width: | Height: | Size: 199 B |
Binary file not shown.
|
After Width: | Height: | Size: 199 B |
@@ -0,0 +1,61 @@
|
||||
.hll { background-color: #ffffcc }
|
||||
.c { color: #408090; font-style: italic } /* Comment */
|
||||
.err { border: 1px solid #FF0000 } /* Error */
|
||||
.k { color: #007020; font-weight: bold } /* Keyword */
|
||||
.o { color: #666666 } /* Operator */
|
||||
.cm { color: #408090; font-style: italic } /* Comment.Multiline */
|
||||
.cp { color: #007020 } /* Comment.Preproc */
|
||||
.c1 { color: #408090; font-style: italic } /* Comment.Single */
|
||||
.cs { color: #408090; background-color: #fff0f0 } /* Comment.Special */
|
||||
.gd { color: #A00000 } /* Generic.Deleted */
|
||||
.ge { font-style: italic } /* Generic.Emph */
|
||||
.gr { color: #FF0000 } /* Generic.Error */
|
||||
.gh { color: #000080; font-weight: bold } /* Generic.Heading */
|
||||
.gi { color: #00A000 } /* Generic.Inserted */
|
||||
.go { color: #303030 } /* Generic.Output */
|
||||
.gp { color: #c65d09; font-weight: bold } /* Generic.Prompt */
|
||||
.gs { font-weight: bold } /* Generic.Strong */
|
||||
.gu { color: #800080; font-weight: bold } /* Generic.Subheading */
|
||||
.gt { color: #0040D0 } /* Generic.Traceback */
|
||||
.kc { color: #007020; font-weight: bold } /* Keyword.Constant */
|
||||
.kd { color: #007020; font-weight: bold } /* Keyword.Declaration */
|
||||
.kn { color: #007020; font-weight: bold } /* Keyword.Namespace */
|
||||
.kp { color: #007020 } /* Keyword.Pseudo */
|
||||
.kr { color: #007020; font-weight: bold } /* Keyword.Reserved */
|
||||
.kt { color: #902000 } /* Keyword.Type */
|
||||
.m { color: #208050 } /* Literal.Number */
|
||||
.s { color: #4070a0 } /* Literal.String */
|
||||
.na { color: #4070a0 } /* Name.Attribute */
|
||||
.nb { color: #007020 } /* Name.Builtin */
|
||||
.nc { color: #0e84b5; font-weight: bold } /* Name.Class */
|
||||
.no { color: #60add5 } /* Name.Constant */
|
||||
.nd { color: #555555; font-weight: bold } /* Name.Decorator */
|
||||
.ni { color: #d55537; font-weight: bold } /* Name.Entity */
|
||||
.ne { color: #007020 } /* Name.Exception */
|
||||
.nf { color: #06287e } /* Name.Function */
|
||||
.nl { color: #002070; font-weight: bold } /* Name.Label */
|
||||
.nn { color: #0e84b5; font-weight: bold } /* Name.Namespace */
|
||||
.nt { color: #062873; font-weight: bold } /* Name.Tag */
|
||||
.nv { color: #bb60d5 } /* Name.Variable */
|
||||
.ow { color: #007020; font-weight: bold } /* Operator.Word */
|
||||
.w { color: #bbbbbb } /* Text.Whitespace */
|
||||
.mf { color: #208050 } /* Literal.Number.Float */
|
||||
.mh { color: #208050 } /* Literal.Number.Hex */
|
||||
.mi { color: #208050 } /* Literal.Number.Integer */
|
||||
.mo { color: #208050 } /* Literal.Number.Oct */
|
||||
.sb { color: #4070a0 } /* Literal.String.Backtick */
|
||||
.sc { color: #4070a0 } /* Literal.String.Char */
|
||||
.sd { color: #4070a0; font-style: italic } /* Literal.String.Doc */
|
||||
.s2 { color: #4070a0 } /* Literal.String.Double */
|
||||
.se { color: #4070a0; font-weight: bold } /* Literal.String.Escape */
|
||||
.sh { color: #4070a0 } /* Literal.String.Heredoc */
|
||||
.si { color: #70a0d0; font-style: italic } /* Literal.String.Interpol */
|
||||
.sx { color: #c65d09 } /* Literal.String.Other */
|
||||
.sr { color: #235388 } /* Literal.String.Regex */
|
||||
.s1 { color: #4070a0 } /* Literal.String.Single */
|
||||
.ss { color: #517918 } /* Literal.String.Symbol */
|
||||
.bp { color: #007020 } /* Name.Builtin.Pseudo */
|
||||
.vc { color: #bb60d5 } /* Name.Variable.Class */
|
||||
.vg { color: #bb60d5 } /* Name.Variable.Global */
|
||||
.vi { color: #bb60d5 } /* Name.Variable.Instance */
|
||||
.il { color: #208050 } /* Literal.Number.Integer.Long */
|
||||
@@ -0,0 +1,467 @@
|
||||
/**
|
||||
* helper function to return a node containing the
|
||||
* search summary for a given text. keywords is a list
|
||||
* of stemmed words, hlwords is the list of normal, unstemmed
|
||||
* words. the first one is used to find the occurance, the
|
||||
* latter for highlighting it.
|
||||
*/
|
||||
|
||||
jQuery.makeSearchSummary = function(text, keywords, hlwords) {
|
||||
var textLower = text.toLowerCase();
|
||||
var start = 0;
|
||||
$.each(keywords, function() {
|
||||
var i = textLower.indexOf(this.toLowerCase());
|
||||
if (i > -1)
|
||||
start = i;
|
||||
});
|
||||
start = Math.max(start - 120, 0);
|
||||
var excerpt = ((start > 0) ? '...' : '') +
|
||||
$.trim(text.substr(start, 240)) +
|
||||
((start + 240 - text.length) ? '...' : '');
|
||||
var rv = $('<div class="context"></div>').text(excerpt);
|
||||
$.each(hlwords, function() {
|
||||
rv = rv.highlightText(this, 'highlight');
|
||||
});
|
||||
return rv;
|
||||
}
|
||||
|
||||
/**
|
||||
* Porter Stemmer
|
||||
*/
|
||||
var PorterStemmer = function() {
|
||||
|
||||
var step2list = {
|
||||
ational: 'ate',
|
||||
tional: 'tion',
|
||||
enci: 'ence',
|
||||
anci: 'ance',
|
||||
izer: 'ize',
|
||||
bli: 'ble',
|
||||
alli: 'al',
|
||||
entli: 'ent',
|
||||
eli: 'e',
|
||||
ousli: 'ous',
|
||||
ization: 'ize',
|
||||
ation: 'ate',
|
||||
ator: 'ate',
|
||||
alism: 'al',
|
||||
iveness: 'ive',
|
||||
fulness: 'ful',
|
||||
ousness: 'ous',
|
||||
aliti: 'al',
|
||||
iviti: 'ive',
|
||||
biliti: 'ble',
|
||||
logi: 'log'
|
||||
};
|
||||
|
||||
var step3list = {
|
||||
icate: 'ic',
|
||||
ative: '',
|
||||
alize: 'al',
|
||||
iciti: 'ic',
|
||||
ical: 'ic',
|
||||
ful: '',
|
||||
ness: ''
|
||||
};
|
||||
|
||||
var c = "[^aeiou]"; // consonant
|
||||
var v = "[aeiouy]"; // vowel
|
||||
var C = c + "[^aeiouy]*"; // consonant sequence
|
||||
var V = v + "[aeiou]*"; // vowel sequence
|
||||
|
||||
var mgr0 = "^(" + C + ")?" + V + C; // [C]VC... is m>0
|
||||
var meq1 = "^(" + C + ")?" + V + C + "(" + V + ")?$"; // [C]VC[V] is m=1
|
||||
var mgr1 = "^(" + C + ")?" + V + C + V + C; // [C]VCVC... is m>1
|
||||
var s_v = "^(" + C + ")?" + v; // vowel in stem
|
||||
|
||||
this.stemWord = function (w) {
|
||||
var stem;
|
||||
var suffix;
|
||||
var firstch;
|
||||
var origword = w;
|
||||
|
||||
if (w.length < 3)
|
||||
return w;
|
||||
|
||||
var re;
|
||||
var re2;
|
||||
var re3;
|
||||
var re4;
|
||||
|
||||
firstch = w.substr(0,1);
|
||||
if (firstch == "y")
|
||||
w = firstch.toUpperCase() + w.substr(1);
|
||||
|
||||
// Step 1a
|
||||
re = /^(.+?)(ss|i)es$/;
|
||||
re2 = /^(.+?)([^s])s$/;
|
||||
|
||||
if (re.test(w))
|
||||
w = w.replace(re,"$1$2");
|
||||
else if (re2.test(w))
|
||||
w = w.replace(re2,"$1$2");
|
||||
|
||||
// Step 1b
|
||||
re = /^(.+?)eed$/;
|
||||
re2 = /^(.+?)(ed|ing)$/;
|
||||
if (re.test(w)) {
|
||||
var fp = re.exec(w);
|
||||
re = new RegExp(mgr0);
|
||||
if (re.test(fp[1])) {
|
||||
re = /.$/;
|
||||
w = w.replace(re,"");
|
||||
}
|
||||
}
|
||||
else if (re2.test(w)) {
|
||||
var fp = re2.exec(w);
|
||||
stem = fp[1];
|
||||
re2 = new RegExp(s_v);
|
||||
if (re2.test(stem)) {
|
||||
w = stem;
|
||||
re2 = /(at|bl|iz)$/;
|
||||
re3 = new RegExp("([^aeiouylsz])\\1$");
|
||||
re4 = new RegExp("^" + C + v + "[^aeiouwxy]$");
|
||||
if (re2.test(w))
|
||||
w = w + "e";
|
||||
else if (re3.test(w)) {
|
||||
re = /.$/;
|
||||
w = w.replace(re,"");
|
||||
}
|
||||
else if (re4.test(w))
|
||||
w = w + "e";
|
||||
}
|
||||
}
|
||||
|
||||
// Step 1c
|
||||
re = /^(.+?)y$/;
|
||||
if (re.test(w)) {
|
||||
var fp = re.exec(w);
|
||||
stem = fp[1];
|
||||
re = new RegExp(s_v);
|
||||
if (re.test(stem))
|
||||
w = stem + "i";
|
||||
}
|
||||
|
||||
// Step 2
|
||||
re = /^(.+?)(ational|tional|enci|anci|izer|bli|alli|entli|eli|ousli|ization|ation|ator|alism|iveness|fulness|ousness|aliti|iviti|biliti|logi)$/;
|
||||
if (re.test(w)) {
|
||||
var fp = re.exec(w);
|
||||
stem = fp[1];
|
||||
suffix = fp[2];
|
||||
re = new RegExp(mgr0);
|
||||
if (re.test(stem))
|
||||
w = stem + step2list[suffix];
|
||||
}
|
||||
|
||||
// Step 3
|
||||
re = /^(.+?)(icate|ative|alize|iciti|ical|ful|ness)$/;
|
||||
if (re.test(w)) {
|
||||
var fp = re.exec(w);
|
||||
stem = fp[1];
|
||||
suffix = fp[2];
|
||||
re = new RegExp(mgr0);
|
||||
if (re.test(stem))
|
||||
w = stem + step3list[suffix];
|
||||
}
|
||||
|
||||
// Step 4
|
||||
re = /^(.+?)(al|ance|ence|er|ic|able|ible|ant|ement|ment|ent|ou|ism|ate|iti|ous|ive|ize)$/;
|
||||
re2 = /^(.+?)(s|t)(ion)$/;
|
||||
if (re.test(w)) {
|
||||
var fp = re.exec(w);
|
||||
stem = fp[1];
|
||||
re = new RegExp(mgr1);
|
||||
if (re.test(stem))
|
||||
w = stem;
|
||||
}
|
||||
else if (re2.test(w)) {
|
||||
var fp = re2.exec(w);
|
||||
stem = fp[1] + fp[2];
|
||||
re2 = new RegExp(mgr1);
|
||||
if (re2.test(stem))
|
||||
w = stem;
|
||||
}
|
||||
|
||||
// Step 5
|
||||
re = /^(.+?)e$/;
|
||||
if (re.test(w)) {
|
||||
var fp = re.exec(w);
|
||||
stem = fp[1];
|
||||
re = new RegExp(mgr1);
|
||||
re2 = new RegExp(meq1);
|
||||
re3 = new RegExp("^" + C + v + "[^aeiouwxy]$");
|
||||
if (re.test(stem) || (re2.test(stem) && !(re3.test(stem))))
|
||||
w = stem;
|
||||
}
|
||||
re = /ll$/;
|
||||
re2 = new RegExp(mgr1);
|
||||
if (re.test(w) && re2.test(w)) {
|
||||
re = /.$/;
|
||||
w = w.replace(re,"");
|
||||
}
|
||||
|
||||
// and turn initial Y back to y
|
||||
if (firstch == "y")
|
||||
w = firstch.toLowerCase() + w.substr(1);
|
||||
return w;
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
/**
|
||||
* Search Module
|
||||
*/
|
||||
var Search = {
|
||||
|
||||
_index : null,
|
||||
_queued_query : null,
|
||||
_pulse_status : -1,
|
||||
|
||||
init : function() {
|
||||
var params = $.getQueryParameters();
|
||||
if (params.q) {
|
||||
var query = params.q[0];
|
||||
$('input[name="q"]')[0].value = query;
|
||||
this.performSearch(query);
|
||||
}
|
||||
},
|
||||
|
||||
/**
|
||||
* Sets the index
|
||||
*/
|
||||
setIndex : function(index) {
|
||||
var q;
|
||||
this._index = index;
|
||||
if ((q = this._queued_query) !== null) {
|
||||
this._queued_query = null;
|
||||
Search.query(q);
|
||||
}
|
||||
},
|
||||
|
||||
hasIndex : function() {
|
||||
return this._index !== null;
|
||||
},
|
||||
|
||||
deferQuery : function(query) {
|
||||
this._queued_query = query;
|
||||
},
|
||||
|
||||
stopPulse : function() {
|
||||
this._pulse_status = 0;
|
||||
},
|
||||
|
||||
startPulse : function() {
|
||||
if (this._pulse_status >= 0)
|
||||
return;
|
||||
function pulse() {
|
||||
Search._pulse_status = (Search._pulse_status + 1) % 4;
|
||||
var dotString = '';
|
||||
for (var i = 0; i < Search._pulse_status; i++)
|
||||
dotString += '.';
|
||||
Search.dots.text(dotString);
|
||||
if (Search._pulse_status > -1)
|
||||
window.setTimeout(pulse, 500);
|
||||
};
|
||||
pulse();
|
||||
},
|
||||
|
||||
/**
|
||||
* perform a search for something
|
||||
*/
|
||||
performSearch : function(query) {
|
||||
// create the required interface elements
|
||||
this.out = $('#search-results');
|
||||
this.title = $('<h2>' + _('Searching') + '</h2>').appendTo(this.out);
|
||||
this.dots = $('<span></span>').appendTo(this.title);
|
||||
this.status = $('<p style="display: none"></p>').appendTo(this.out);
|
||||
this.output = $('<ul class="search"/>').appendTo(this.out);
|
||||
|
||||
$('#search-progress').text(_('Preparing search...'));
|
||||
this.startPulse();
|
||||
|
||||
// index already loaded, the browser was quick!
|
||||
if (this.hasIndex())
|
||||
this.query(query);
|
||||
else
|
||||
this.deferQuery(query);
|
||||
},
|
||||
|
||||
query : function(query) {
|
||||
// stem the searchterms and add them to the
|
||||
// correct list
|
||||
var stemmer = new PorterStemmer();
|
||||
var searchterms = [];
|
||||
var excluded = [];
|
||||
var hlterms = [];
|
||||
var tmp = query.split(/\s+/);
|
||||
var object = (tmp.length == 1) ? tmp[0].toLowerCase() : null;
|
||||
for (var i = 0; i < tmp.length; i++) {
|
||||
// stem the word
|
||||
var word = stemmer.stemWord(tmp[i]).toLowerCase();
|
||||
// select the correct list
|
||||
if (word[0] == '-') {
|
||||
var toAppend = excluded;
|
||||
word = word.substr(1);
|
||||
}
|
||||
else {
|
||||
var toAppend = searchterms;
|
||||
hlterms.push(tmp[i].toLowerCase());
|
||||
}
|
||||
// only add if not already in the list
|
||||
if (!$.contains(toAppend, word))
|
||||
toAppend.push(word);
|
||||
};
|
||||
var highlightstring = '?highlight=' + $.urlencode(hlterms.join(" "));
|
||||
|
||||
console.debug('SEARCH: searching for:');
|
||||
console.info('required: ', searchterms);
|
||||
console.info('excluded: ', excluded);
|
||||
|
||||
// prepare search
|
||||
var filenames = this._index.filenames;
|
||||
var titles = this._index.titles;
|
||||
var terms = this._index.terms;
|
||||
var descrefs = this._index.descrefs;
|
||||
var modules = this._index.modules;
|
||||
var desctypes = this._index.desctypes;
|
||||
var fileMap = {};
|
||||
var files = null;
|
||||
var objectResults = [];
|
||||
var regularResults = [];
|
||||
$('#search-progress').empty();
|
||||
|
||||
// lookup as object
|
||||
if (object != null) {
|
||||
for (var module in modules) {
|
||||
if (module.indexOf(object) > -1) {
|
||||
fn = modules[module];
|
||||
descr = _('module, in ') + titles[fn];
|
||||
objectResults.push([filenames[fn], module, '#module-'+module, descr]);
|
||||
}
|
||||
}
|
||||
for (var prefix in descrefs) {
|
||||
for (var name in descrefs[prefix]) {
|
||||
var fullname = (prefix ? prefix + '.' : '') + name;
|
||||
if (fullname.toLowerCase().indexOf(object) > -1) {
|
||||
match = descrefs[prefix][name];
|
||||
descr = desctypes[match[1]] + _(', in ') + titles[match[0]];
|
||||
objectResults.push([filenames[match[0]], fullname, '#'+fullname, descr]);
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// sort results descending
|
||||
objectResults.sort(function(a, b) {
|
||||
return (a[1] > b[1]) ? -1 : ((a[1] < b[1]) ? 1 : 0);
|
||||
});
|
||||
|
||||
|
||||
// perform the search on the required terms
|
||||
for (var i = 0; i < searchterms.length; i++) {
|
||||
var word = searchterms[i];
|
||||
// no match but word was a required one
|
||||
if ((files = terms[word]) == null)
|
||||
break;
|
||||
if (files.length == undefined) {
|
||||
files = [files];
|
||||
}
|
||||
// create the mapping
|
||||
for (var j = 0; j < files.length; j++) {
|
||||
var file = files[j];
|
||||
if (file in fileMap)
|
||||
fileMap[file].push(word);
|
||||
else
|
||||
fileMap[file] = [word];
|
||||
}
|
||||
}
|
||||
|
||||
// now check if the files don't contain excluded terms
|
||||
for (var file in fileMap) {
|
||||
var valid = true;
|
||||
|
||||
// check if all requirements are matched
|
||||
if (fileMap[file].length != searchterms.length)
|
||||
continue;
|
||||
|
||||
// ensure that none of the excluded terms is in the
|
||||
// search result.
|
||||
for (var i = 0; i < excluded.length; i++) {
|
||||
if (terms[excluded[i]] == file ||
|
||||
$.contains(terms[excluded[i]] || [], file)) {
|
||||
valid = false;
|
||||
break;
|
||||
}
|
||||
}
|
||||
|
||||
// if we have still a valid result we can add it
|
||||
// to the result list
|
||||
if (valid)
|
||||
regularResults.push([filenames[file], titles[file], '', null]);
|
||||
}
|
||||
|
||||
// delete unused variables in order to not waste
|
||||
// memory until list is retrieved completely
|
||||
delete filenames, titles, terms;
|
||||
|
||||
// now sort the regular results descending by title
|
||||
regularResults.sort(function(a, b) {
|
||||
var left = a[1].toLowerCase();
|
||||
var right = b[1].toLowerCase();
|
||||
return (left > right) ? -1 : ((left < right) ? 1 : 0);
|
||||
});
|
||||
|
||||
// combine both
|
||||
var results = regularResults.concat(objectResults);
|
||||
|
||||
// print the results
|
||||
var resultCount = results.length;
|
||||
function displayNextItem() {
|
||||
// results left, load the summary and display it
|
||||
if (results.length) {
|
||||
var item = results.pop();
|
||||
var listItem = $('<li style="display:none"></li>');
|
||||
listItem.append($('<a/>').attr(
|
||||
'href',
|
||||
item[0] + DOCUMENTATION_OPTIONS.FILE_SUFFIX +
|
||||
highlightstring + item[2]).html(item[1]));
|
||||
if (item[3]) {
|
||||
listItem.append($('<span> (' + item[3] + ')</span>'));
|
||||
Search.output.append(listItem);
|
||||
listItem.slideDown(5, function() {
|
||||
displayNextItem();
|
||||
});
|
||||
} else if (DOCUMENTATION_OPTIONS.HAS_SOURCE) {
|
||||
$.get('_sources/' + item[0] + '.txt', function(data) {
|
||||
listItem.append($.makeSearchSummary(data, searchterms, hlterms));
|
||||
Search.output.append(listItem);
|
||||
listItem.slideDown(5, function() {
|
||||
displayNextItem();
|
||||
});
|
||||
});
|
||||
} else {
|
||||
// no source available, just display title
|
||||
Search.output.append(listItem);
|
||||
listItem.slideDown(5, function() {
|
||||
displayNextItem();
|
||||
});
|
||||
}
|
||||
}
|
||||
// search finished, update title and status message
|
||||
else {
|
||||
Search.stopPulse();
|
||||
Search.title.text(_('Search Results'));
|
||||
if (!resultCount)
|
||||
Search.status.text(_('Your search did not match any documents. Please make sure that all words are spelled correctly and that you\'ve selected enough categories.'));
|
||||
else
|
||||
Search.status.text(_('Search finished, found %s page(s) matching the search query.').replace('%s', resultCount));
|
||||
Search.status.fadeIn(500);
|
||||
}
|
||||
}
|
||||
displayNextItem();
|
||||
}
|
||||
}
|
||||
|
||||
$(document).ready(function() {
|
||||
Search.init();
|
||||
});
|
||||
@@ -0,0 +1,157 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>File format conversions — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="index.html" />
|
||||
<link rel="up" title="OBITools scripts" href="scripts.html" />
|
||||
<link rel="next" title="Convert sequence files to extended OBITools fasta format" href="scripts/convert2fasta.html" />
|
||||
<link rel="prev" title="The OBITools formated taxonomy" href="obitaxonomy.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="scripts/convert2fasta.html" title="Convert sequence files to extended OBITools fasta format"
|
||||
accesskey="N">next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="obitaxonomy.html" title="The OBITools formated taxonomy"
|
||||
accesskey="P">previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" accesskey="U">OBITools scripts</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="file-format-conversions">
|
||||
<h1>File format conversions<a class="headerlink" href="#file-format-conversions" title="Permalink to this headline">¶</a></h1>
|
||||
<p>Several OBITools exist for converting files from one format to another.
|
||||
As <a class="reference external" href="fasta.html"><em>fasta file</em></a> is the central format for OBITools, many of
|
||||
these converters convert to <a class="reference external" href="obifasta.html"><em>extended OBITools fasta format</em></a>.</p>
|
||||
<div class="section" id="convert-to-extended-obitools-fasta-format">
|
||||
<h2>Convert to extended OBITools fasta format<a class="headerlink" href="#convert-to-extended-obitools-fasta-format" title="Permalink to this headline">¶</a></h2>
|
||||
<ul>
|
||||
<li class="toctree-l1"><a class="reference external" href="scripts/convert2fasta.html">Convert sequence files to extended OBITools fasta format</a><ul>
|
||||
<li class="toctree-l2"><a class="reference external" href="scripts/convert2fasta.html#obitools-common-options">obitools common options</a></li>
|
||||
<li class="toctree-l2"><a class="reference external" href="scripts/convert2fasta.html#convert2fasta-py-specific-options">convert2fasta.py specific options</a></li>
|
||||
<li class="toctree-l2"><a class="reference external" href="scripts/convert2fasta.html#example">example</a></li>
|
||||
</ul>
|
||||
</li>
|
||||
<li class="toctree-l1"><a class="reference external" href="scripts/ecopcr2fasta.html">Convert ecoPCR result files to extended OBITools fasta file</a></li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="section" id="convert-taxonomic-data">
|
||||
<h2>Convert taxonomic data<a class="headerlink" href="#convert-taxonomic-data" title="Permalink to this headline">¶</a></h2>
|
||||
<ul>
|
||||
<li class="toctree-l1"><a class="reference external" href="scripts/buildOBITaxonomy.html">Convert NCBI taxdump to binary formated OBITools taxonomy database</a><ul>
|
||||
<li class="toctree-l2"><a class="reference external" href="scripts/buildOBITaxonomy.html#obitools-common-options">obitools common options</a></li>
|
||||
<li class="toctree-l2"><a class="reference external" href="scripts/buildOBITaxonomy.html#taxonomy-related-options">taxonomy related options</a></li>
|
||||
<li class="toctree-l2"><a class="reference external" href="scripts/buildOBITaxonomy.html#example">example</a></li>
|
||||
</ul>
|
||||
</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="section" id="convert-to-tabular-data-files">
|
||||
<h2>Convert to tabular data files<a class="headerlink" href="#convert-to-tabular-data-files" title="Permalink to this headline">¶</a></h2>
|
||||
<ul>
|
||||
<li class="toctree-l1"><a class="reference external" href="scripts/fasta2tab.html">Convert extended OBITools fasta file to a tabular format</a></li>
|
||||
</ul>
|
||||
</div>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h3><a href="index.html">Table Of Contents</a></h3>
|
||||
<ul>
|
||||
<li><a class="reference external" href="">File format conversions</a><ul>
|
||||
<li><a class="reference external" href="#convert-to-extended-obitools-fasta-format">Convert to extended OBITools fasta format</a><ul>
|
||||
</ul>
|
||||
</li>
|
||||
<li><a class="reference external" href="#convert-taxonomic-data">Convert taxonomic data</a><ul>
|
||||
</ul>
|
||||
</li>
|
||||
<li><a class="reference external" href="#convert-to-tabular-data-files">Convert to tabular data files</a><ul>
|
||||
</ul>
|
||||
</li>
|
||||
</ul>
|
||||
</li>
|
||||
</ul>
|
||||
|
||||
<h4>Previous topic</h4>
|
||||
<p class="topless"><a href="obitaxonomy.html"
|
||||
title="previous chapter">The OBITools formated taxonomy</a></p>
|
||||
<h4>Next topic</h4>
|
||||
<p class="topless"><a href="scripts/convert2fasta.html"
|
||||
title="next chapter">Convert sequence files to extended OBITools fasta format</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="_sources/conversions.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="scripts/convert2fasta.html" title="Convert sequence files to extended OBITools fasta format"
|
||||
>next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="obitaxonomy.html" title="The OBITools formated taxonomy"
|
||||
>previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,111 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>The EMBL sequence format — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="index.html" />
|
||||
<link rel="up" title="File formats usable with OBITools" href="formats.html" />
|
||||
<link rel="next" title="The NCBI taxonomy dump files" href="taxdump.html" />
|
||||
<link rel="prev" title="The genbank sequence format" href="genbank.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="taxdump.html" title="The NCBI taxonomy dump files"
|
||||
accesskey="N">next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="genbank.html" title="The genbank sequence format"
|
||||
accesskey="P">previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="formats.html" accesskey="U">File formats usable with OBITools</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="the-embl-sequence-format">
|
||||
<h1>The EMBL sequence format<a class="headerlink" href="#the-embl-sequence-format" title="Permalink to this headline">¶</a></h1>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h4>Previous topic</h4>
|
||||
<p class="topless"><a href="genbank.html"
|
||||
title="previous chapter">The genbank sequence format</a></p>
|
||||
<h4>Next topic</h4>
|
||||
<p class="topless"><a href="taxdump.html"
|
||||
title="next chapter">The NCBI taxonomy dump files</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="_sources/embl.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="taxdump.html" title="The NCBI taxonomy dump files"
|
||||
>next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="genbank.html" title="The genbank sequence format"
|
||||
>previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="formats.html" >File formats usable with OBITools</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,156 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>The fasta format — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="index.html" />
|
||||
<link rel="up" title="File formats usable with OBITools" href="formats.html" />
|
||||
<link rel="next" title="The extended OBITools fasta format" href="obifasta.html" />
|
||||
<link rel="prev" title="The IUPAC code" href="iupac.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="obifasta.html" title="The extended OBITools fasta format"
|
||||
accesskey="N">next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="iupac.html" title="The IUPAC code"
|
||||
accesskey="P">previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="formats.html" accesskey="U">File formats usable with OBITools</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="the-fasta-format">
|
||||
<h1>The fasta format<a class="headerlink" href="#the-fasta-format" title="Permalink to this headline">¶</a></h1>
|
||||
<p>The fasta format is certainly the most widely used sequence file format.
|
||||
This is certainly due to its great simplicity. It was originally created
|
||||
for the ‘’Lipman’’ and ‘’Pearson’’ <a class="reference external" href="http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation">FASTA program</a>. OBITools use in more
|
||||
of <a class="reference internal" href="#classical-fasta"><em>the classical fasta format</em></a> several extended
|
||||
version of this format where structured data are included in the title line.</p>
|
||||
<ul>
|
||||
<li class="toctree-l1"><a class="reference external" href="obifasta.html">The extended OBITools fasta format</a></li>
|
||||
</ul>
|
||||
<div class="section" id="the-classical-fasta-format">
|
||||
<span id="classical-fasta"></span><h2>The classical fasta format<a class="headerlink" href="#the-classical-fasta-format" title="Permalink to this headline">¶</a></h2>
|
||||
<p>In fasta format a sequence is represented by a title line beginning with a <strong>></strong> character and
|
||||
the sequences by itself following <a class="reference external" href="iupac.html"><em>The IUPAC code</em></a>. The sequence is usually split other severals
|
||||
lines of the same length (expected for the last one)</p>
|
||||
<div class="highlight-python"><pre>>my_sequence this is my pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT</pre>
|
||||
</div>
|
||||
<p>This is no special format for the title line excepting that this line should be unique.
|
||||
Usually the first word following the <strong>></strong> character is considered as the sequence identifier.
|
||||
The end of the title line corresponding to a description of the sequence.</p>
|
||||
<p>Several sequences can be concatenated in a same file. The description of the next sequence
|
||||
is just pasted at the end of the description of the previous one</p>
|
||||
<div class="highlight-python"><pre>>sequence_A this is my first pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
>sequence_B this is my second pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
>sequence_C this is my third pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT</pre>
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h3><a href="index.html">Table Of Contents</a></h3>
|
||||
<ul>
|
||||
<li><a class="reference external" href="">The fasta format</a><ul>
|
||||
<li><a class="reference external" href="#the-classical-fasta-format">The classical fasta format</a></li>
|
||||
</ul>
|
||||
</li>
|
||||
</ul>
|
||||
|
||||
<h4>Previous topic</h4>
|
||||
<p class="topless"><a href="iupac.html"
|
||||
title="previous chapter">The IUPAC code</a></p>
|
||||
<h4>Next topic</h4>
|
||||
<p class="topless"><a href="obifasta.html"
|
||||
title="next chapter">The extended OBITools fasta format</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="_sources/fasta.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="obifasta.html" title="The extended OBITools fasta format"
|
||||
>next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="iupac.html" title="The IUPAC code"
|
||||
>previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="formats.html" >File formats usable with OBITools</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,169 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>File formats usable with OBITools — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="index.html" />
|
||||
<link rel="up" title="OBITools scripts" href="scripts.html" />
|
||||
<link rel="next" title="The IUPAC code" href="iupac.html" />
|
||||
<link rel="prev" title="OBITools scripts" href="scripts.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="iupac.html" title="The IUPAC code"
|
||||
accesskey="N">next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="scripts.html" title="OBITools scripts"
|
||||
accesskey="P">previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" accesskey="U">OBITools scripts</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="file-formats-usable-with-obitools">
|
||||
<h1>File formats usable with OBITools<a class="headerlink" href="#file-formats-usable-with-obitools" title="Permalink to this headline">¶</a></h1>
|
||||
<div class="section" id="the-sequence-files">
|
||||
<h2>The sequence files<a class="headerlink" href="#the-sequence-files" title="Permalink to this headline">¶</a></h2>
|
||||
<p>Sequences can be stored following various format. OBITools knows
|
||||
some of them. The central format for sequence files manipulated by OBITools scripts
|
||||
is the <a class="reference external" href="fasta.html"><em>fasta format</em></a>. OBITools extends the fasta format by specifying
|
||||
a syntax to include in the definition line data qualifying the sequence.
|
||||
All file formats use the <a class="reference external" href="iupac.html"><em>IUPAC</em></a> code for encoding nucleotides and
|
||||
amino-acids.</p>
|
||||
<ul>
|
||||
<li class="toctree-l1"><a class="reference external" href="iupac.html">The IUPAC code</a><ul>
|
||||
<li class="toctree-l2"><a class="reference external" href="iupac.html#nucleic-iupac-code">Nucleic IUPAC Code</a></li>
|
||||
<li class="toctree-l2"><a class="reference external" href="iupac.html#peptidic-one-and-three-letters-iupac-code">Peptidic one and three letters IUPAC code</a></li>
|
||||
</ul>
|
||||
</li>
|
||||
<li class="toctree-l1"><a class="reference external" href="fasta.html">The fasta format</a><ul>
|
||||
<li class="toctree-l2"><a class="reference external" href="obifasta.html">The extended OBITools fasta format</a></li>
|
||||
<li class="toctree-l2"><a class="reference external" href="fasta.html#the-classical-fasta-format">The classical fasta format</a></li>
|
||||
</ul>
|
||||
</li>
|
||||
<li class="toctree-l1"><a class="reference external" href="genbank.html">The genbank sequence format</a></li>
|
||||
<li class="toctree-l1"><a class="reference external" href="embl.html">The EMBL sequence format</a></li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="section" id="the-taxonomy-files">
|
||||
<h2>The taxonomy files<a class="headerlink" href="#the-taxonomy-files" title="Permalink to this headline">¶</a></h2>
|
||||
<p>Many OBITools are able to take into account taxonomic data. These data
|
||||
are manipulated following the <a class="reference external" href="http://www.ncbi.nlm.nih.gov/taxonomy">NCBI taxonomy</a>.</p>
|
||||
<ul>
|
||||
<li class="toctree-l1"><a class="reference external" href="taxdump.html">The NCBI taxonomy dump files</a></li>
|
||||
<li class="toctree-l1"><a class="reference external" href="obitaxonomy.html">The OBITools formated taxonomy</a></li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="section" id="the-ecopcr-files">
|
||||
<h2>The ecoPCR files<a class="headerlink" href="#the-ecopcr-files" title="Permalink to this headline">¶</a></h2>
|
||||
<p><a class="reference external" href="http://www.grenoble.prabi.fr/trac/ecoPCR">ecoPCR</a> is a software developed in <a class="reference external" href="http://www-leca.ujf-grenoble.fr">LECA</a>. It simulates a PCR experiment by
|
||||
selecting in a sequence database, sequences matching simultaneously two
|
||||
primers sequences in a way allowing a PCR amplification of a DNA region.</p>
|
||||
</div>
|
||||
<div class="section" id="the-ecoprimer-files">
|
||||
<h2>The ecoPrimer files<a class="headerlink" href="#the-ecoprimer-files" title="Permalink to this headline">¶</a></h2>
|
||||
</div>
|
||||
<div class="section" id="the-obitools-files">
|
||||
<h2>The OBITools files<a class="headerlink" href="#the-obitools-files" title="Permalink to this headline">¶</a></h2>
|
||||
</div>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h3><a href="index.html">Table Of Contents</a></h3>
|
||||
<ul>
|
||||
<li><a class="reference external" href="">File formats usable with OBITools</a><ul>
|
||||
<li><a class="reference external" href="#the-sequence-files">The sequence files</a><ul>
|
||||
</ul>
|
||||
</li>
|
||||
<li><a class="reference external" href="#the-taxonomy-files">The taxonomy files</a><ul>
|
||||
</ul>
|
||||
</li>
|
||||
<li><a class="reference external" href="#the-ecopcr-files">The ecoPCR files</a></li>
|
||||
<li><a class="reference external" href="#the-ecoprimer-files">The ecoPrimer files</a></li>
|
||||
<li><a class="reference external" href="#the-obitools-files">The OBITools files</a></li>
|
||||
</ul>
|
||||
</li>
|
||||
</ul>
|
||||
|
||||
<h4>Previous topic</h4>
|
||||
<p class="topless"><a href="scripts.html"
|
||||
title="previous chapter">OBITools scripts</a></p>
|
||||
<h4>Next topic</h4>
|
||||
<p class="topless"><a href="iupac.html"
|
||||
title="next chapter">The IUPAC code</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="_sources/formats.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="iupac.html" title="The IUPAC code"
|
||||
>next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="scripts.html" title="OBITools scripts"
|
||||
>previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,111 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>The genbank sequence format — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="index.html" />
|
||||
<link rel="up" title="File formats usable with OBITools" href="formats.html" />
|
||||
<link rel="next" title="The EMBL sequence format" href="embl.html" />
|
||||
<link rel="prev" title="The extended OBITools fasta format" href="obifasta.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="embl.html" title="The EMBL sequence format"
|
||||
accesskey="N">next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="obifasta.html" title="The extended OBITools fasta format"
|
||||
accesskey="P">previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="formats.html" accesskey="U">File formats usable with OBITools</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="the-genbank-sequence-format">
|
||||
<h1>The genbank sequence format<a class="headerlink" href="#the-genbank-sequence-format" title="Permalink to this headline">¶</a></h1>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h4>Previous topic</h4>
|
||||
<p class="topless"><a href="obifasta.html"
|
||||
title="previous chapter">The extended OBITools fasta format</a></p>
|
||||
<h4>Next topic</h4>
|
||||
<p class="topless"><a href="embl.html"
|
||||
title="next chapter">The EMBL sequence format</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="_sources/genbank.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="embl.html" title="The EMBL sequence format"
|
||||
>next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="obifasta.html" title="The extended OBITools fasta format"
|
||||
>previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="formats.html" >File formats usable with OBITools</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,172 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>Index — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="index.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
|
||||
<h1 id="index">Index</h1>
|
||||
|
||||
<a href="#Symbols"><strong>Symbols</strong></a> | <a href="#C"><strong>C</strong></a> | <a href="#O"><strong>O</strong></a> | <a href="#T"><strong>T</strong></a>
|
||||
|
||||
<hr />
|
||||
|
||||
|
||||
<h2 id="Symbols">Symbols</h2>
|
||||
<table width="100%" class="indextable"><tr><td width="33%" valign="top">
|
||||
<dl>
|
||||
|
||||
<dt>--DEBUG</dt>
|
||||
<dd><dl>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-obitools--DEBUG">obitools command line option</a>, <a href="scripts/buildOBITaxonomy.html#cmdoption-obitools--DEBUG">[1]</a></dt>
|
||||
</dl></dd>
|
||||
<dt>--embl</dt>
|
||||
<dd><dl>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-convert2fasta.py--embl">convert2fasta.py command line option</a></dt>
|
||||
</dl></dd>
|
||||
<dt>--fna</dt>
|
||||
<dd><dl>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-convert2fasta.py--fna">convert2fasta.py command line option</a></dt>
|
||||
</dl></dd>
|
||||
<dt>--genbank</dt>
|
||||
<dd><dl>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-convert2fasta.py--genbank">convert2fasta.py command line option</a></dt>
|
||||
</dl></dd>
|
||||
<dt>--no-psyco</dt>
|
||||
<dd><dl>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-obitools--no-psyco">obitools command line option</a>, <a href="scripts/buildOBITaxonomy.html#cmdoption-obitools--no-psyco">[1]</a></dt>
|
||||
</dl></dd>
|
||||
<dt>--nuc</dt>
|
||||
<dd><dl>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-convert2fasta.py--nuc">convert2fasta.py command line option</a></dt>
|
||||
</dl></dd></dl></td><td width="33%" valign="top"><dl>
|
||||
<dt>--prot</dt>
|
||||
<dd><dl>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-convert2fasta.py--prot">convert2fasta.py command line option</a></dt>
|
||||
</dl></dd>
|
||||
<dt>-d <FILENAME>, --database=<FILENAME></dt>
|
||||
<dd><dl>
|
||||
<dt><a href="scripts/buildOBITaxonomy.html#cmdoption-taxonomy-d">taxonomy command line option</a></dt>
|
||||
</dl></dd>
|
||||
<dt>-h, --help</dt>
|
||||
<dd><dl>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-obitools-h">obitools command line option</a>, <a href="scripts/buildOBITaxonomy.html#cmdoption-obitools-h">[1]</a></dt>
|
||||
</dl></dd>
|
||||
<dt>-t <FILENAME>, --taxonomy-dump=<FILENAME></dt>
|
||||
<dd><dl>
|
||||
<dt><a href="scripts/buildOBITaxonomy.html#cmdoption-taxonomy-t">taxonomy command line option</a></dt>
|
||||
</dl></dd>
|
||||
</dl></td></tr></table>
|
||||
|
||||
<h2 id="C">C</h2>
|
||||
<table width="100%" class="indextable"><tr><td width="33%" valign="top">
|
||||
<dl>
|
||||
|
||||
<dt>convert2fasta.py command line option</dt>
|
||||
<dd><dl>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-convert2fasta.py--embl">--embl</a></dt>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-convert2fasta.py--fna">--fna</a></dt>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-convert2fasta.py--genbank">--genbank</a></dt>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-convert2fasta.py--nuc">--nuc</a></dt>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-convert2fasta.py--prot">--prot</a></dt>
|
||||
</dl></dd></dl></td><td width="33%" valign="top"><dl>
|
||||
</dl></td></tr></table>
|
||||
|
||||
<h2 id="O">O</h2>
|
||||
<table width="100%" class="indextable"><tr><td width="33%" valign="top">
|
||||
<dl>
|
||||
|
||||
<dt>obitools command line option</dt>
|
||||
<dd><dl>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-obitools--DEBUG">--DEBUG</a>, <a href="scripts/buildOBITaxonomy.html#cmdoption-obitools--DEBUG">[1]</a></dt>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-obitools--no-psyco">--no-psyco</a>, <a href="scripts/buildOBITaxonomy.html#cmdoption-obitools--no-psyco">[1]</a></dt>
|
||||
<dt><a href="scripts/convert2fasta.html#cmdoption-obitools-h">-h, --help</a>, <a href="scripts/buildOBITaxonomy.html#cmdoption-obitools-h">[1]</a></dt>
|
||||
</dl></dd></dl></td><td width="33%" valign="top"><dl>
|
||||
</dl></td></tr></table>
|
||||
|
||||
<h2 id="T">T</h2>
|
||||
<table width="100%" class="indextable"><tr><td width="33%" valign="top">
|
||||
<dl>
|
||||
|
||||
<dt>taxonomy command line option</dt>
|
||||
<dd><dl>
|
||||
<dt><a href="scripts/buildOBITaxonomy.html#cmdoption-taxonomy-d">-d <FILENAME>, --database=<FILENAME></a></dt>
|
||||
<dt><a href="scripts/buildOBITaxonomy.html#cmdoption-taxonomy-t">-t <FILENAME>, --taxonomy-dump=<FILENAME></a></dt>
|
||||
</dl></dd></dl></td><td width="33%" valign="top"><dl>
|
||||
</dl></td></tr></table>
|
||||
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
|
||||
|
||||
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="" title="General Index"
|
||||
>index</a></li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,120 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>Welcome to OBITools’s documentation! — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="" />
|
||||
<link rel="next" title="OBITools scripts" href="scripts.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="scripts.html" title="OBITools scripts"
|
||||
accesskey="N">next</a> |</li>
|
||||
<li><a href="">OBITools v0.1.3 documentation</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="welcome-to-obitools-s-documentation">
|
||||
<h1>Welcome to OBITools’s documentation!<a class="headerlink" href="#welcome-to-obitools-s-documentation" title="Permalink to this headline">¶</a></h1>
|
||||
<p>Contents:</p>
|
||||
<ul>
|
||||
<li class="toctree-l1"><a class="reference external" href="scripts.html">The OBITools scripts</a><ul>
|
||||
<li class="toctree-l2"><a class="reference external" href="formats.html">Usable file formats with OBITools</a></li>
|
||||
<li class="toctree-l2"><a class="reference external" href="conversions.html">File format conversions</a></li>
|
||||
</ul>
|
||||
</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="section" id="indices-and-tables">
|
||||
<h1>Indices and tables<a class="headerlink" href="#indices-and-tables" title="Permalink to this headline">¶</a></h1>
|
||||
<ul class="simple">
|
||||
<li><a class="reference external" href="genindex.html"><em>Index</em></a></li>
|
||||
<li><a class="reference external" href="modindex.html"><em>Module Index</em></a></li>
|
||||
<li><a class="reference external" href="search.html"><em>Search Page</em></a></li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h3><a href="">Table Of Contents</a></h3>
|
||||
<ul>
|
||||
<li><a class="reference external" href="">Welcome to OBITools’s documentation!</a><ul>
|
||||
</ul>
|
||||
</li>
|
||||
<li><a class="reference external" href="#indices-and-tables">Indices and tables</a></li>
|
||||
</ul>
|
||||
|
||||
<h4>Next topic</h4>
|
||||
<p class="topless"><a href="scripts.html"
|
||||
title="next chapter">OBITools scripts</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="_sources/index.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="scripts.html" title="OBITools scripts"
|
||||
>next</a> |</li>
|
||||
<li><a href="">OBITools v0.1.3 documentation</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,296 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>The IUPAC code — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="index.html" />
|
||||
<link rel="up" title="File formats usable with OBITools" href="formats.html" />
|
||||
<link rel="next" title="The fasta format" href="fasta.html" />
|
||||
<link rel="prev" title="File formats usable with OBITools" href="formats.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="fasta.html" title="The fasta format"
|
||||
accesskey="N">next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="formats.html" title="File formats usable with OBITools"
|
||||
accesskey="P">previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="formats.html" accesskey="U">File formats usable with OBITools</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="the-iupac-code">
|
||||
<h1>The IUPAC code<a class="headerlink" href="#the-iupac-code" title="Permalink to this headline">¶</a></h1>
|
||||
<p>The International Union of Pure and Applied Chemistry (<a class="reference external" href="http://www.iupac.org/">IUPAC</a>) defined
|
||||
the standard code for representing protein or DNA sequences.</p>
|
||||
<div class="section" id="nucleic-iupac-code">
|
||||
<h2>Nucleic IUPAC Code<a class="headerlink" href="#nucleic-iupac-code" title="Permalink to this headline">¶</a></h2>
|
||||
<table border="1" class="docutils">
|
||||
<colgroup>
|
||||
<col width="20%" />
|
||||
<col width="80%" />
|
||||
</colgroup>
|
||||
<thead valign="bottom">
|
||||
<tr><th class="head"><strong>Code</strong></th>
|
||||
<th class="head"><strong>Nucleotide</strong></th>
|
||||
</tr>
|
||||
</thead>
|
||||
<tbody valign="top">
|
||||
<tr><td>A</td>
|
||||
<td>Adenine</td>
|
||||
</tr>
|
||||
<tr><td>C</td>
|
||||
<td>Cytosine</td>
|
||||
</tr>
|
||||
<tr><td>G</td>
|
||||
<td>Guanine</td>
|
||||
</tr>
|
||||
<tr><td>T</td>
|
||||
<td>Thymine</td>
|
||||
</tr>
|
||||
<tr><td>U</td>
|
||||
<td>Uracil</td>
|
||||
</tr>
|
||||
<tr><td>R</td>
|
||||
<td>Purine (A or G)</td>
|
||||
</tr>
|
||||
<tr><td>Y</td>
|
||||
<td>Pyrimidine (C, T, or U)</td>
|
||||
</tr>
|
||||
<tr><td>M</td>
|
||||
<td>C or A</td>
|
||||
</tr>
|
||||
<tr><td>K</td>
|
||||
<td>T, U, or G</td>
|
||||
</tr>
|
||||
<tr><td>W</td>
|
||||
<td>T, U, or A</td>
|
||||
</tr>
|
||||
<tr><td>S</td>
|
||||
<td>C or G</td>
|
||||
</tr>
|
||||
<tr><td>B</td>
|
||||
<td>C, T, U, or G (not A)</td>
|
||||
</tr>
|
||||
<tr><td>D</td>
|
||||
<td>A, T, U, or G (not C)</td>
|
||||
</tr>
|
||||
<tr><td>H</td>
|
||||
<td>A, T, U, or C (not G)</td>
|
||||
</tr>
|
||||
<tr><td>V</td>
|
||||
<td>A, C, or G (not T, not U)</td>
|
||||
</tr>
|
||||
<tr><td>N</td>
|
||||
<td>Any base (A, C, G, T, or U)</td>
|
||||
</tr>
|
||||
</tbody>
|
||||
</table>
|
||||
</div>
|
||||
<div class="section" id="peptidic-one-and-three-letters-iupac-code">
|
||||
<h2>Peptidic one and three letters IUPAC code<a class="headerlink" href="#peptidic-one-and-three-letters-iupac-code" title="Permalink to this headline">¶</a></h2>
|
||||
<table border="1" class="docutils">
|
||||
<colgroup>
|
||||
<col width="19%" />
|
||||
<col width="20%" />
|
||||
<col width="61%" />
|
||||
</colgroup>
|
||||
<thead valign="bottom">
|
||||
<tr><th class="head"><strong>1-letter</strong></th>
|
||||
<th class="head"><strong>3-letters</strong></th>
|
||||
<th class="head"><strong>Amino acid</strong></th>
|
||||
</tr>
|
||||
</thead>
|
||||
<tbody valign="top">
|
||||
<tr><td>A</td>
|
||||
<td>Ala</td>
|
||||
<td>Alanine</td>
|
||||
</tr>
|
||||
<tr><td>R</td>
|
||||
<td>Arg</td>
|
||||
<td>Arginine</td>
|
||||
</tr>
|
||||
<tr><td>N</td>
|
||||
<td>Asn</td>
|
||||
<td>Asparagine</td>
|
||||
</tr>
|
||||
<tr><td>D</td>
|
||||
<td>Asp</td>
|
||||
<td>Aspartic acid</td>
|
||||
</tr>
|
||||
<tr><td>C</td>
|
||||
<td>Cys</td>
|
||||
<td>Cysteine</td>
|
||||
</tr>
|
||||
<tr><td>Q</td>
|
||||
<td>Gln</td>
|
||||
<td>Glutamine</td>
|
||||
</tr>
|
||||
<tr><td>E</td>
|
||||
<td>Glu</td>
|
||||
<td>Glutamic acid</td>
|
||||
</tr>
|
||||
<tr><td>G</td>
|
||||
<td>Gly</td>
|
||||
<td>Glycine</td>
|
||||
</tr>
|
||||
<tr><td>H</td>
|
||||
<td>His</td>
|
||||
<td>Histidine</td>
|
||||
</tr>
|
||||
<tr><td>I</td>
|
||||
<td>Ile</td>
|
||||
<td>Isoleucine</td>
|
||||
</tr>
|
||||
<tr><td>L</td>
|
||||
<td>Leu</td>
|
||||
<td>Leucine</td>
|
||||
</tr>
|
||||
<tr><td>K</td>
|
||||
<td>Lys</td>
|
||||
<td>Lysine</td>
|
||||
</tr>
|
||||
<tr><td>M</td>
|
||||
<td>Met</td>
|
||||
<td>Methionine</td>
|
||||
</tr>
|
||||
<tr><td>F</td>
|
||||
<td>Phe</td>
|
||||
<td>Phenylalanine</td>
|
||||
</tr>
|
||||
<tr><td>P</td>
|
||||
<td>Pro</td>
|
||||
<td>Proline</td>
|
||||
</tr>
|
||||
<tr><td>S</td>
|
||||
<td>Ser</td>
|
||||
<td>Serine</td>
|
||||
</tr>
|
||||
<tr><td>T</td>
|
||||
<td>Thr</td>
|
||||
<td>Threonine</td>
|
||||
</tr>
|
||||
<tr><td>W</td>
|
||||
<td>Trp</td>
|
||||
<td>Tryptophan</td>
|
||||
</tr>
|
||||
<tr><td>Y</td>
|
||||
<td>Tyr</td>
|
||||
<td>Tyrosine</td>
|
||||
</tr>
|
||||
<tr><td>V</td>
|
||||
<td>Val</td>
|
||||
<td>Valine</td>
|
||||
</tr>
|
||||
<tr><td>B</td>
|
||||
<td>Asx</td>
|
||||
<td>Aspartic acid or Asparagine</td>
|
||||
</tr>
|
||||
<tr><td>Z</td>
|
||||
<td>Glx</td>
|
||||
<td>Glutamine or Glutamic acid</td>
|
||||
</tr>
|
||||
<tr><td>X</td>
|
||||
<td>Xaa</td>
|
||||
<td>Any amino acid</td>
|
||||
</tr>
|
||||
</tbody>
|
||||
</table>
|
||||
</div>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h3><a href="index.html">Table Of Contents</a></h3>
|
||||
<ul>
|
||||
<li><a class="reference external" href="">The IUPAC code</a><ul>
|
||||
<li><a class="reference external" href="#nucleic-iupac-code">Nucleic IUPAC Code</a></li>
|
||||
<li><a class="reference external" href="#peptidic-one-and-three-letters-iupac-code">Peptidic one and three letters IUPAC code</a></li>
|
||||
</ul>
|
||||
</li>
|
||||
</ul>
|
||||
|
||||
<h4>Previous topic</h4>
|
||||
<p class="topless"><a href="formats.html"
|
||||
title="previous chapter">File formats usable with OBITools</a></p>
|
||||
<h4>Next topic</h4>
|
||||
<p class="topless"><a href="fasta.html"
|
||||
title="next chapter">The fasta format</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="_sources/iupac.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="fasta.html" title="The fasta format"
|
||||
>next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="formats.html" title="File formats usable with OBITools"
|
||||
>previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="formats.html" >File formats usable with OBITools</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,151 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>The extended OBITools fasta format — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="index.html" />
|
||||
<link rel="up" title="File formats usable with OBITools" href="formats.html" />
|
||||
<link rel="next" title="The NCBI taxonomy dump files" href="taxdump.html" />
|
||||
<link rel="prev" title="The extended OBITools fasta format" href="" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="taxdump.html" title="The NCBI taxonomy dump files"
|
||||
accesskey="N">next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="" title="The extended OBITools fasta format"
|
||||
accesskey="P">previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="formats.html" accesskey="U">File formats usable with OBITools</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="the-extended-obitools-fasta-format">
|
||||
<h1>The extended OBITools fasta format<a class="headerlink" href="#the-extended-obitools-fasta-format" title="Permalink to this headline">¶</a></h1>
|
||||
<p>The <em>extended OBITools Fasta format</em> is a strict <a class="reference external" href="fasta.html"><em>fasta format file</em></a>.
|
||||
The file in <em>extended OBITools Fasta format</em> can be readed by all programs
|
||||
reading fasta files.</p>
|
||||
<p>Difference between standard and extended fasta is just the structure of the title
|
||||
line. For OBITools title line is divided in three parts :</p>
|
||||
<blockquote>
|
||||
<ul class="simple">
|
||||
<li>Seqid : the sequence identifier</li>
|
||||
<li>key=value; : a set of key/value keys</li>
|
||||
<li>the sequence definition</li>
|
||||
</ul>
|
||||
</blockquote>
|
||||
<div class="highlight-python"><pre>>my_sequence taxid=3456; direct=True; sample=A354; this is my pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT</pre>
|
||||
</div>
|
||||
<p>Following these rules, the title line can be parsed :</p>
|
||||
<blockquote>
|
||||
<ul>
|
||||
<li><p class="first">The sequence identifier of this sequence is <em>my_sequence</em></p>
|
||||
</li>
|
||||
<li><dl class="first docutils">
|
||||
<dt>Three keys are assigned to this sequence :</dt>
|
||||
<dd><ul class="first last simple">
|
||||
<li>Key <em>taxid</em> with value <em>3456</em></li>
|
||||
<li>Key <em>direct</em> with value <em>True</em></li>
|
||||
<li>Key <em>sample</em> with value <em>A354</em></li>
|
||||
</ul>
|
||||
</dd>
|
||||
</dl>
|
||||
</li>
|
||||
<li><p class="first">The definition of this sequence is this is <em>my pretty sequence</em></p>
|
||||
</li>
|
||||
</ul>
|
||||
</blockquote>
|
||||
<p>Key value can be any valid python expression. If a key value cannot be evaluated as
|
||||
a python expression, it is them assumed as a simple string. Following this rule,
|
||||
taxid value is considered as an integer value, direct value as a boolean and sample
|
||||
value is not a valid python expression so it is considered as a string value.</p>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h4>Previous topic</h4>
|
||||
<p class="topless"><a href=""
|
||||
title="previous chapter">The extended OBITools fasta format</a></p>
|
||||
<h4>Next topic</h4>
|
||||
<p class="topless"><a href="taxdump.html"
|
||||
title="next chapter">The NCBI taxonomy dump files</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="_sources/obifasta.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="taxdump.html" title="The NCBI taxonomy dump files"
|
||||
>next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="" title="The extended OBITools fasta format"
|
||||
>previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="formats.html" >File formats usable with OBITools</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,111 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>The OBITools formated taxonomy — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="index.html" />
|
||||
<link rel="up" title="File formats usable with OBITools" href="formats.html" />
|
||||
<link rel="next" title="File format conversions" href="conversions.html" />
|
||||
<link rel="prev" title="The NCBI taxonomy dump files" href="taxdump.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="conversions.html" title="File format conversions"
|
||||
accesskey="N">next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="taxdump.html" title="The NCBI taxonomy dump files"
|
||||
accesskey="P">previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="formats.html" accesskey="U">File formats usable with OBITools</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="the-obitools-formated-taxonomy">
|
||||
<h1>The OBITools formated taxonomy<a class="headerlink" href="#the-obitools-formated-taxonomy" title="Permalink to this headline">¶</a></h1>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h4>Previous topic</h4>
|
||||
<p class="topless"><a href="taxdump.html"
|
||||
title="previous chapter">The NCBI taxonomy dump files</a></p>
|
||||
<h4>Next topic</h4>
|
||||
<p class="topless"><a href="conversions.html"
|
||||
title="next chapter">File format conversions</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="_sources/obitaxonomy.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="conversions.html" title="File format conversions"
|
||||
>next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="taxdump.html" title="The NCBI taxonomy dump files"
|
||||
>previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="formats.html" >File formats usable with OBITools</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,3 @@
|
||||
# Sphinx inventory version 1
|
||||
# Project: OBITools
|
||||
# Version: 0.1.3
|
||||
@@ -0,0 +1,125 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>OBITools scripts — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="index.html" />
|
||||
<link rel="next" title="File formats usable with OBITools" href="formats.html" />
|
||||
<link rel="prev" title="Welcome to OBITools’s documentation!" href="index.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="formats.html" title="File formats usable with OBITools"
|
||||
accesskey="N">next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="index.html" title="Welcome to OBITools’s documentation!"
|
||||
accesskey="P">previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="obitools-scripts">
|
||||
<h1>OBITools scripts<a class="headerlink" href="#obitools-scripts" title="Permalink to this headline">¶</a></h1>
|
||||
<p>OBITools scripts are developed mainly for manipulating large sequence
|
||||
files generated by the next generation sequencers.</p>
|
||||
<p>Contents:</p>
|
||||
<ul>
|
||||
<li class="toctree-l1"><a class="reference external" href="formats.html">Usable file formats with OBITools</a><ul>
|
||||
<li class="toctree-l2"><a class="reference external" href="formats.html#the-sequence-files">The sequence files</a></li>
|
||||
<li class="toctree-l2"><a class="reference external" href="formats.html#the-taxonomy-files">The taxonomy files</a></li>
|
||||
<li class="toctree-l2"><a class="reference external" href="formats.html#the-ecopcr-files">The ecoPCR files</a></li>
|
||||
<li class="toctree-l2"><a class="reference external" href="formats.html#the-ecoprimer-files">The ecoPrimer files</a></li>
|
||||
<li class="toctree-l2"><a class="reference external" href="formats.html#the-obitools-files">The OBITools files</a></li>
|
||||
</ul>
|
||||
</li>
|
||||
<li class="toctree-l1"><a class="reference external" href="conversions.html">File format conversions</a><ul>
|
||||
<li class="toctree-l2"><a class="reference external" href="conversions.html#convert-to-extended-obitools-fasta-format">Convert to extended OBITools fasta format</a></li>
|
||||
<li class="toctree-l2"><a class="reference external" href="conversions.html#convert-taxonomic-data">Convert taxonomic data</a></li>
|
||||
<li class="toctree-l2"><a class="reference external" href="conversions.html#convert-to-tabular-data-files">Convert to tabular data files</a></li>
|
||||
</ul>
|
||||
</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h4>Previous topic</h4>
|
||||
<p class="topless"><a href="index.html"
|
||||
title="previous chapter">Welcome to OBITools’s documentation!</a></p>
|
||||
<h4>Next topic</h4>
|
||||
<p class="topless"><a href="formats.html"
|
||||
title="next chapter">File formats usable with OBITools</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="_sources/scripts.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="formats.html" title="File formats usable with OBITools"
|
||||
>next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="index.html" title="Welcome to OBITools’s documentation!"
|
||||
>previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,165 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>Convert NCBI taxdump to binary formated OBITools taxonomy database — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="../_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="../_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '../',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="../_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="../_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="../index.html" />
|
||||
<link rel="up" title="File format conversions" href="../conversions.html" />
|
||||
<link rel="next" title="Convert extended OBITools fasta file to a tabular format" href="fasta2tab.html" />
|
||||
<link rel="prev" title="Convert ecoPCR result files to extended OBITools fasta file" href="ecopcr2fasta.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="../genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="fasta2tab.html" title="Convert extended OBITools fasta file to a tabular format"
|
||||
accesskey="N">next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="ecopcr2fasta.html" title="Convert ecoPCR result files to extended OBITools fasta file"
|
||||
accesskey="P">previous</a> |</li>
|
||||
<li><a href="../index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="../scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="../conversions.html" accesskey="U">File format conversions</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="convert-ncbi-taxdump-to-binary-formated-obitools-taxonomy-database">
|
||||
<h1>Convert NCBI taxdump to binary formated OBITools taxonomy database<a class="headerlink" href="#convert-ncbi-taxdump-to-binary-formated-obitools-taxonomy-database" title="Permalink to this headline">¶</a></h1>
|
||||
<p><strong>buildOBITaxonomy.py</strong> -t <taxdump dir> -d <db name></p>
|
||||
<p>Convert an text dump directory of the NCBI Taxonomy database to the binary
|
||||
format used by ecoPCR and many OBITools scripts. An archive corresponding to
|
||||
this directory can be downloaded at the following URL</p>
|
||||
<blockquote>
|
||||
<a class="reference external" href="ftp://ftp.ncbi.nlm.nih.gov/pub/taxonomy/">ftp://ftp.ncbi.nlm.nih.gov/pub/taxonomy/</a></blockquote>
|
||||
<div class="section" id="obitools-common-options">
|
||||
<h2>obitools common options<a class="headerlink" href="#obitools-common-options" title="Permalink to this headline">¶</a></h2>
|
||||
<dl class="cmdoption">
|
||||
<dt id="cmdoption-obitools-h">
|
||||
<tt class="descname">-h</tt><tt class="descclassname"></tt><tt class="descclassname">, </tt><tt class="descname">--help</tt><tt class="descclassname"></tt><a class="headerlink" href="#cmdoption-obitools-h" title="Permalink to this definition">¶</a></dt>
|
||||
<dd>show this help message and exit</dd></dl>
|
||||
|
||||
<dl class="cmdoption">
|
||||
<dt id="cmdoption-obitools--DEBUG">
|
||||
<tt class="descname">--DEBUG</tt><tt class="descclassname"></tt><a class="headerlink" href="#cmdoption-obitools--DEBUG" title="Permalink to this definition">¶</a></dt>
|
||||
<dd>Set logging in debug mode</dd></dl>
|
||||
|
||||
<dl class="cmdoption">
|
||||
<dt id="cmdoption-obitools--no-psyco">
|
||||
<tt class="descname">--no-psyco</tt><tt class="descclassname"></tt><a class="headerlink" href="#cmdoption-obitools--no-psyco" title="Permalink to this definition">¶</a></dt>
|
||||
<dd>Don’t use psyco even if it installed</dd></dl>
|
||||
|
||||
</div>
|
||||
<div class="section" id="taxonomy-related-options">
|
||||
<h2>taxonomy related options<a class="headerlink" href="#taxonomy-related-options" title="Permalink to this headline">¶</a></h2>
|
||||
<dl class="cmdoption">
|
||||
<dt id="cmdoption-taxonomy-d">
|
||||
<tt class="descname">-d</tt><tt class="descclassname"> <FILENAME></tt><tt class="descclassname">, </tt><tt class="descname">--database</tt><tt class="descclassname">=<FILENAME></tt><a class="headerlink" href="#cmdoption-taxonomy-d" title="Permalink to this definition">¶</a></dt>
|
||||
<dd>ecoPCR taxonomy Database name</dd></dl>
|
||||
|
||||
<dl class="cmdoption">
|
||||
<dt id="cmdoption-taxonomy-t">
|
||||
<tt class="descname">-t</tt><tt class="descclassname"> <FILENAME></tt><tt class="descclassname">, </tt><tt class="descname">--taxonomy-dump</tt><tt class="descclassname">=<FILENAME></tt><a class="headerlink" href="#cmdoption-taxonomy-t" title="Permalink to this definition">¶</a></dt>
|
||||
<dd>NCBI Taxonomy dump repository name</dd></dl>
|
||||
|
||||
</div>
|
||||
<div class="section" id="example">
|
||||
<h2>example<a class="headerlink" href="#example" title="Permalink to this headline">¶</a></h2>
|
||||
<p>for building a new taxonomy database named <em>ncbitaxonomy</em> from a taxdump dir</p>
|
||||
<div class="highlight-python"><pre>% curl ftp://ftp.ncbi.nlm.nih.gov/pub/taxonomy/taxdump.tar.gz | tar zxf -
|
||||
% buildOBITaxonomy.py --taxonomy-dump taxdump --database ncbitaxonomy</pre>
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h3><a href="../index.html">Table Of Contents</a></h3>
|
||||
<ul>
|
||||
<li><a class="reference external" href="">Convert NCBI taxdump to binary formated OBITools taxonomy database</a><ul>
|
||||
<li><a class="reference external" href="#obitools-common-options">obitools common options</a></li>
|
||||
<li><a class="reference external" href="#taxonomy-related-options">taxonomy related options</a></li>
|
||||
<li><a class="reference external" href="#example">example</a></li>
|
||||
</ul>
|
||||
</li>
|
||||
</ul>
|
||||
|
||||
<h4>Previous topic</h4>
|
||||
<p class="topless"><a href="ecopcr2fasta.html"
|
||||
title="previous chapter">Convert ecoPCR result files to extended OBITools fasta file</a></p>
|
||||
<h4>Next topic</h4>
|
||||
<p class="topless"><a href="fasta2tab.html"
|
||||
title="next chapter">Convert extended OBITools fasta file to a tabular format</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="../_sources/scripts/buildOBITaxonomy.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="../search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="../genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="fasta2tab.html" title="Convert extended OBITools fasta file to a tabular format"
|
||||
>next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="ecopcr2fasta.html" title="Convert ecoPCR result files to extended OBITools fasta file"
|
||||
>previous</a> |</li>
|
||||
<li><a href="../index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="../scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="../conversions.html" >File format conversions</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,177 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>Convert sequence files to extended OBITools fasta format — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="../_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="../_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '../',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="../_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="../_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="../index.html" />
|
||||
<link rel="up" title="File format conversions" href="../conversions.html" />
|
||||
<link rel="next" title="Convert ecoPCR result files to extended OBITools fasta file" href="ecopcr2fasta.html" />
|
||||
<link rel="prev" title="File format conversions" href="../conversions.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="../genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="ecopcr2fasta.html" title="Convert ecoPCR result files to extended OBITools fasta file"
|
||||
accesskey="N">next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="../conversions.html" title="File format conversions"
|
||||
accesskey="P">previous</a> |</li>
|
||||
<li><a href="../index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="../scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="../conversions.html" accesskey="U">File format conversions</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="convert-sequence-files-to-extended-obitools-fasta-format">
|
||||
<h1>Convert sequence files to extended OBITools fasta format<a class="headerlink" href="#convert-sequence-files-to-extended-obitools-fasta-format" title="Permalink to this headline">¶</a></h1>
|
||||
<p><strong>convert2fasta.py</strong> [options] [filename 1] [filename 2] ...</p>
|
||||
<p>Convert sequence files to the extended OBITools fasta format. If no
|
||||
file name are specified data are read from standard input.</p>
|
||||
<div class="section" id="obitools-common-options">
|
||||
<h2>obitools common options<a class="headerlink" href="#obitools-common-options" title="Permalink to this headline">¶</a></h2>
|
||||
<dl class="cmdoption">
|
||||
<dt id="cmdoption-obitools-h">
|
||||
<tt class="descname">-h</tt><tt class="descclassname"></tt><tt class="descclassname">, </tt><tt class="descname">--help</tt><tt class="descclassname"></tt><a class="headerlink" href="#cmdoption-obitools-h" title="Permalink to this definition">¶</a></dt>
|
||||
<dd>show this help message and exit</dd></dl>
|
||||
|
||||
<dl class="cmdoption">
|
||||
<dt id="cmdoption-obitools--DEBUG">
|
||||
<tt class="descname">--DEBUG</tt><tt class="descclassname"></tt><a class="headerlink" href="#cmdoption-obitools--DEBUG" title="Permalink to this definition">¶</a></dt>
|
||||
<dd>Set logging in debug mode</dd></dl>
|
||||
|
||||
<dl class="cmdoption">
|
||||
<dt id="cmdoption-obitools--no-psyco">
|
||||
<tt class="descname">--no-psyco</tt><tt class="descclassname"></tt><a class="headerlink" href="#cmdoption-obitools--no-psyco" title="Permalink to this definition">¶</a></dt>
|
||||
<dd>Don’t use psyco even if it installed</dd></dl>
|
||||
|
||||
</div>
|
||||
<div class="section" id="convert2fasta-py-specific-options">
|
||||
<h2>convert2fasta.py specific options<a class="headerlink" href="#convert2fasta-py-specific-options" title="Permalink to this headline">¶</a></h2>
|
||||
<dl class="cmdoption">
|
||||
<dt id="cmdoption-convert2fasta.py--genbank">
|
||||
<tt class="descname">--genbank</tt><tt class="descclassname"></tt><a class="headerlink" href="#cmdoption-convert2fasta.py--genbank" title="Permalink to this definition">¶</a></dt>
|
||||
<dd>input file is in <a class="reference external" href="../genbank.html"><em>genbank format</em></a></dd></dl>
|
||||
|
||||
<dl class="cmdoption">
|
||||
<dt id="cmdoption-convert2fasta.py--embl">
|
||||
<tt class="descname">--embl</tt><tt class="descclassname"></tt><a class="headerlink" href="#cmdoption-convert2fasta.py--embl" title="Permalink to this definition">¶</a></dt>
|
||||
<dd>input file is in <a class="reference external" href="../embl.html"><em>embl format</em></a></dd></dl>
|
||||
|
||||
<dl class="cmdoption">
|
||||
<dt id="cmdoption-convert2fasta.py--fna">
|
||||
<tt class="descname">--fna</tt><tt class="descclassname"></tt><a class="headerlink" href="#cmdoption-convert2fasta.py--fna" title="Permalink to this definition">¶</a></dt>
|
||||
<dd>input file is in fasta nucleic format produced by 454 sequencer
|
||||
pipeline</dd></dl>
|
||||
|
||||
<dl class="cmdoption">
|
||||
<dt id="cmdoption-convert2fasta.py--nuc">
|
||||
<tt class="descname">--nuc</tt><tt class="descclassname"></tt><a class="headerlink" href="#cmdoption-convert2fasta.py--nuc" title="Permalink to this definition">¶</a></dt>
|
||||
<dd>input file contains nucleic sequences</dd></dl>
|
||||
|
||||
<dl class="cmdoption">
|
||||
<dt id="cmdoption-convert2fasta.py--prot">
|
||||
<tt class="descname">--prot</tt><tt class="descclassname"></tt><a class="headerlink" href="#cmdoption-convert2fasta.py--prot" title="Permalink to this definition">¶</a></dt>
|
||||
<dd>input file contains protein sequences</dd></dl>
|
||||
|
||||
</div>
|
||||
<div class="section" id="example">
|
||||
<h2>example<a class="headerlink" href="#example" title="Permalink to this headline">¶</a></h2>
|
||||
<p>for converting a genbank file to fasta</p>
|
||||
<div class="highlight-python"><pre>% convert2fasta.py --genbank --nuc sequences.gb > sequences.fasta</pre>
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h3><a href="../index.html">Table Of Contents</a></h3>
|
||||
<ul>
|
||||
<li><a class="reference external" href="">Convert sequence files to extended OBITools fasta format</a><ul>
|
||||
<li><a class="reference external" href="#obitools-common-options">obitools common options</a></li>
|
||||
<li><a class="reference external" href="#convert2fasta-py-specific-options">convert2fasta.py specific options</a></li>
|
||||
<li><a class="reference external" href="#example">example</a></li>
|
||||
</ul>
|
||||
</li>
|
||||
</ul>
|
||||
|
||||
<h4>Previous topic</h4>
|
||||
<p class="topless"><a href="../conversions.html"
|
||||
title="previous chapter">File format conversions</a></p>
|
||||
<h4>Next topic</h4>
|
||||
<p class="topless"><a href="ecopcr2fasta.html"
|
||||
title="next chapter">Convert ecoPCR result files to extended OBITools fasta file</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="../_sources/scripts/convert2fasta.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="../search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="../genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="ecopcr2fasta.html" title="Convert ecoPCR result files to extended OBITools fasta file"
|
||||
>next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="../conversions.html" title="File format conversions"
|
||||
>previous</a> |</li>
|
||||
<li><a href="../index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="../scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="../conversions.html" >File format conversions</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,111 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>Convert ecoPCR result files to extended OBITools fasta file — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="../_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="../_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '../',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="../_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="../_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="../index.html" />
|
||||
<link rel="up" title="File format conversions" href="../conversions.html" />
|
||||
<link rel="next" title="Convert NCBI taxdump to binary formated OBITools taxonomy database" href="buildOBITaxonomy.html" />
|
||||
<link rel="prev" title="Convert sequence files to extended OBITools fasta format" href="convert2fasta.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="../genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="buildOBITaxonomy.html" title="Convert NCBI taxdump to binary formated OBITools taxonomy database"
|
||||
accesskey="N">next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="convert2fasta.html" title="Convert sequence files to extended OBITools fasta format"
|
||||
accesskey="P">previous</a> |</li>
|
||||
<li><a href="../index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="../scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="../conversions.html" accesskey="U">File format conversions</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="convert-ecopcr-result-files-to-extended-obitools-fasta-file">
|
||||
<h1>Convert ecoPCR result files to extended OBITools fasta file<a class="headerlink" href="#convert-ecopcr-result-files-to-extended-obitools-fasta-file" title="Permalink to this headline">¶</a></h1>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h4>Previous topic</h4>
|
||||
<p class="topless"><a href="convert2fasta.html"
|
||||
title="previous chapter">Convert sequence files to extended OBITools fasta format</a></p>
|
||||
<h4>Next topic</h4>
|
||||
<p class="topless"><a href="buildOBITaxonomy.html"
|
||||
title="next chapter">Convert NCBI taxdump to binary formated OBITools taxonomy database</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="../_sources/scripts/ecopcr2fasta.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="../search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="../genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="buildOBITaxonomy.html" title="Convert NCBI taxdump to binary formated OBITools taxonomy database"
|
||||
>next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="convert2fasta.html" title="Convert sequence files to extended OBITools fasta format"
|
||||
>previous</a> |</li>
|
||||
<li><a href="../index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="../scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="../conversions.html" >File format conversions</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,101 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>Convert extended OBITools fasta file to a tabular format — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="../_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="../_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '../',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="../_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="../_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="../index.html" />
|
||||
<link rel="up" title="File format conversions" href="../conversions.html" />
|
||||
<link rel="prev" title="Convert NCBI taxdump to binary formated OBITools taxonomy database" href="buildOBITaxonomy.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="../genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="buildOBITaxonomy.html" title="Convert NCBI taxdump to binary formated OBITools taxonomy database"
|
||||
accesskey="P">previous</a> |</li>
|
||||
<li><a href="../index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="../scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="../conversions.html" accesskey="U">File format conversions</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="convert-extended-obitools-fasta-file-to-a-tabular-format">
|
||||
<h1>Convert extended OBITools fasta file to a tabular format<a class="headerlink" href="#convert-extended-obitools-fasta-file-to-a-tabular-format" title="Permalink to this headline">¶</a></h1>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h4>Previous topic</h4>
|
||||
<p class="topless"><a href="buildOBITaxonomy.html"
|
||||
title="previous chapter">Convert NCBI taxdump to binary formated OBITools taxonomy database</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="../_sources/scripts/fasta2tab.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="../search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="../genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="buildOBITaxonomy.html" title="Convert NCBI taxdump to binary formated OBITools taxonomy database"
|
||||
>previous</a> |</li>
|
||||
<li><a href="../index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="../scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="../conversions.html" >File format conversions</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,91 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>Search — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="_static/doctools.js"></script>
|
||||
<script type="text/javascript" src="_static/searchtools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="index.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<h1 id="search-documentation">Search</h1>
|
||||
<div id="fallback" class="admonition warning">
|
||||
<script type="text/javascript">$('#fallback').hide();</script>
|
||||
<p>
|
||||
Please activate JavaScript to enable the search
|
||||
functionality.
|
||||
</p>
|
||||
</div>
|
||||
<p>
|
||||
From here you can search these documents. Enter your search
|
||||
words into the box below and click "search". Note that the search
|
||||
function will automatically search for all of the words. Pages
|
||||
containing fewer words won't appear in the result list.
|
||||
</p>
|
||||
<form action="" method="get">
|
||||
<input type="text" name="q" value="" />
|
||||
<input type="submit" value="search" />
|
||||
<span id="search-progress" style="padding-left: 10px"></span>
|
||||
</form>
|
||||
|
||||
<div id="search-results">
|
||||
|
||||
</div>
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
<script type="text/javascript" src="searchindex.js"></script>
|
||||
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1 @@
|
||||
Search.setIndex({desctypes:{},terms:{all:[14,9],code:[12,5,9],identifi:[12,14],help:[10,13],just:[12,14],show:[10,13],acgttgcagtacgttgcagtacgttgcagtacgttgcagtacgttgcagtacgttgcagt:[12,14],text:13,alanin:5,syntax:9,psyco:[10,13],follow:[12,14,13,9],simultan:9,mainli:8,line:[12,14,9],begin:12,leca:9,pretti:[12,14],binari:[0,13],pcr:9,except:12,should:12,certainli:12,program:[12,14],creat:12,larg:8,match:9,split:12,them:[14,9],lipman:12,embl:[10,3,9],string:14,variou:9,format:[0,1,3,4,8,6,11,9,10,12,13,14],read:[10,14],glutam:5,express:14,uracil:5,cannot:14,my_sequ:[12,14],know:9,consid:[12,14],ala:5,buildobitaxonomi:13,gtgctgacgttgcagtacgttgcagtacgttgcagtacgttgcagtacgttgcagtgttt:[12,14],thymin:5,pyrimidin:5,search:1,pearson:12,name:[10,13],specif:[0,10],arginin:5,integ:14,seqid:14,mode:[10,13],contain:10,debug:[10,13],trp:5,where:12,sequence_a:12,sequence_b:12,sequence_c:12,wiki:[],phenylalanin:5,taxdump:[0,13],set:[10,14,13],ecopcr:[0,8,7,13,9],ser:5,dump:[2,13,9],ncbitaxonomi:13,some:9,direct:14,uniqu:12,nucleic:[10,5,9],adenin:5,second:12,sampl:14,expect:12,taxonomi:[0,2,4,9,8,13],download:13,acid:[5,9],aacgacgttgcagtacgttgcagt:[12,14],nuc:10,special:12,even:[10,13],index:1,primer:9,kei:14,databas:[0,13,9],prot:10,abl:9,nlm:13,content:[1,8],version:12,exit:[10,13],wide:12,between:14,"new":13,experi:9,common:[0,10,13],aspart:5,qualifi:9,asp:5,extend:[0,9,14,11,8,10,7,12],gener:8,manipul:[8,9],amplif:9,pub:13,standard:[10,5,14],met:5,base:5,ecoprim:[8,9],leu:5,repositori:13,taxonim:[],asn:5,valu:14,log:[10,13],convert:[0,11,8,10,7,13],central:[0,9],convers:[0,1,8],gln:5,purin:5,usabl:[1,8,9],region:9,zxf:13,histidin:5,page:1,glx:5,gly:5,length:12,dir:13,fna:10,mani:[0,13,9],glu:5,first:12,origin:12,softwar:9,arg:5,gov:13,can:[12,14,13,9],appli:5,modul:1,encod:9,three:[14,5,9],filenam:[10,13],"boolean":14,url:13,lysin:5,taxonom:[0,8,9],assum:14,select:9,amino:[5,9],differ:14,dna:[5,9],tar:13,wai:9,script:[1,8,13,9],union:5,asparagin:5,due:12,messag:[10,13],next:[12,8],strict:14,genbank:[10,6,9],includ:[12,9],xaa:5,instal:[10,13],store:9,a354:14,tyrosin:5,from:[0,10,13],assign:14,option:[0,10,13],relat:[0,13],great:12,specifi:[10,9],part:14,pars:14,intern:5,input:10,tryptophan:5,serin:5,"true":14,concaten:12,account:9,word:12,last:12,asx:5,past:12,taxid:14,structur:[12,14],charact:12,defin:5,archiv:13,cystein:5,threonin:5,convert2fasta:[0,10],more:12,correspond:[12,13],result:[0,7],methionin:5,glutamin:5,iupac:[12,5,9],evalu:14,classic:[12,9],pro:5,ncbi:[0,2,13,9],ani:[5,14],indic:1,repres:[12,5],tabular:[0,11,8],tag:[],exist:0,isoleucin:5,file:[0,1,2,9,14,7,8,10,11,12],tabl:1,take:9,fasta:[0,9,14,11,8,10,7,12],simul:9,cytosin:5,protein:[10,5],sever:[0,12],val:5,develop:[8,9],welcom:1,divid:14,titl:[12,14],same:12,python:14,other:12,build:13,pure:5,valin:5,document:1,simpl:14,peptid:[5,9],pipelin:10,allow:9,see:[],ftp:13,sequenc:[0,9,3,5,6,8,10,12,14],glycin:5,previou:12,prolin:5,phe:5,guanin:5,most:12,definit:[14,9],two:9,letter:[5,9],thi:[10,12,14,13],nucleotid:[5,9],end:12,data:[0,10,12,8,9],tyr:5,obitool:[0,1,4,9,14,7,8,10,11,12,13],simplic:12,don:[10,13],curl:13,third:12,directori:13,doc:[],valid:14,chemistri:5,descript:12,thr:5,rule:14,produc:10,nih:13,itself:12,exampl:[0,10,13],leucin:5,anoth:0,usual:12},titles:["File format conversions","Welcome to OBITools’s documentation!","The NCBI taxonomy dump files","The EMBL sequence format","The OBITools formated taxonomy","The IUPAC code","The genbank sequence format","Convert ecoPCR result files to extended OBITools fasta file","OBITools scripts","File formats usable with OBITools","Convert sequence files to extended OBITools fasta format","Convert extended OBITools fasta file to a tabular format","The fasta format","Convert NCBI taxdump to binary formated OBITools taxonomy database","The extended OBITools fasta format"],modules:{},descrefs:{},filenames:["conversions","index","taxdump","embl","obitaxonomy","iupac","genbank","scripts/ecopcr2fasta","scripts","formats","scripts/convert2fasta","scripts/fasta2tab","fasta","scripts/buildOBITaxonomy","obifasta"]})
|
||||
@@ -0,0 +1,111 @@
|
||||
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN"
|
||||
"http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
|
||||
|
||||
<html xmlns="http://www.w3.org/1999/xhtml">
|
||||
<head>
|
||||
<meta http-equiv="Content-Type" content="text/html; charset=utf-8" />
|
||||
|
||||
<title>The NCBI taxonomy dump files — OBITools v0.1.3 documentation</title>
|
||||
<link rel="stylesheet" href="_static/default.css" type="text/css" />
|
||||
<link rel="stylesheet" href="_static/pygments.css" type="text/css" />
|
||||
<script type="text/javascript">
|
||||
var DOCUMENTATION_OPTIONS = {
|
||||
URL_ROOT: '',
|
||||
VERSION: '0.1.3',
|
||||
COLLAPSE_MODINDEX: false,
|
||||
FILE_SUFFIX: '.html',
|
||||
HAS_SOURCE: true
|
||||
};
|
||||
</script>
|
||||
<script type="text/javascript" src="_static/jquery.js"></script>
|
||||
<script type="text/javascript" src="_static/doctools.js"></script>
|
||||
<link rel="top" title="OBITools v0.1.3 documentation" href="index.html" />
|
||||
<link rel="up" title="File formats usable with OBITools" href="formats.html" />
|
||||
<link rel="next" title="The OBITools formated taxonomy" href="obitaxonomy.html" />
|
||||
<link rel="prev" title="The extended OBITools fasta format" href="obifasta.html" />
|
||||
</head>
|
||||
<body>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
accesskey="I">index</a></li>
|
||||
<li class="right" >
|
||||
<a href="obitaxonomy.html" title="The OBITools formated taxonomy"
|
||||
accesskey="N">next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="obifasta.html" title="The extended OBITools fasta format"
|
||||
accesskey="P">previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="formats.html" accesskey="U">File formats usable with OBITools</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
|
||||
<div class="document">
|
||||
<div class="documentwrapper">
|
||||
<div class="bodywrapper">
|
||||
<div class="body">
|
||||
|
||||
<div class="section" id="the-ncbi-taxonomy-dump-files">
|
||||
<h1>The NCBI taxonomy dump files<a class="headerlink" href="#the-ncbi-taxonomy-dump-files" title="Permalink to this headline">¶</a></h1>
|
||||
</div>
|
||||
|
||||
|
||||
</div>
|
||||
</div>
|
||||
</div>
|
||||
<div class="sphinxsidebar">
|
||||
<div class="sphinxsidebarwrapper">
|
||||
<h4>Previous topic</h4>
|
||||
<p class="topless"><a href="obifasta.html"
|
||||
title="previous chapter">The extended OBITools fasta format</a></p>
|
||||
<h4>Next topic</h4>
|
||||
<p class="topless"><a href="obitaxonomy.html"
|
||||
title="next chapter">The OBITools formated taxonomy</a></p>
|
||||
<h3>This Page</h3>
|
||||
<ul class="this-page-menu">
|
||||
<li><a href="_sources/taxdump.txt"
|
||||
rel="nofollow">Show Source</a></li>
|
||||
</ul>
|
||||
<div id="searchbox" style="display: none">
|
||||
<h3>Quick search</h3>
|
||||
<form class="search" action="search.html" method="get">
|
||||
<input type="text" name="q" size="18" />
|
||||
<input type="submit" value="Go" />
|
||||
<input type="hidden" name="check_keywords" value="yes" />
|
||||
<input type="hidden" name="area" value="default" />
|
||||
</form>
|
||||
<p class="searchtip" style="font-size: 90%">
|
||||
Enter search terms or a module, class or function name.
|
||||
</p>
|
||||
</div>
|
||||
<script type="text/javascript">$('#searchbox').show(0);</script>
|
||||
</div>
|
||||
</div>
|
||||
<div class="clearer"></div>
|
||||
</div>
|
||||
<div class="related">
|
||||
<h3>Navigation</h3>
|
||||
<ul>
|
||||
<li class="right" style="margin-right: 10px">
|
||||
<a href="genindex.html" title="General Index"
|
||||
>index</a></li>
|
||||
<li class="right" >
|
||||
<a href="obitaxonomy.html" title="The OBITools formated taxonomy"
|
||||
>next</a> |</li>
|
||||
<li class="right" >
|
||||
<a href="obifasta.html" title="The extended OBITools fasta format"
|
||||
>previous</a> |</li>
|
||||
<li><a href="index.html">OBITools v0.1.3 documentation</a> »</li>
|
||||
<li><a href="scripts.html" >OBITools scripts</a> »</li>
|
||||
<li><a href="formats.html" >File formats usable with OBITools</a> »</li>
|
||||
</ul>
|
||||
</div>
|
||||
<div class="footer">
|
||||
© Copyright 2009, Eric Coissac.
|
||||
Created using <a href="http://sphinx.pocoo.org/">Sphinx</a> 0.6.3.
|
||||
</div>
|
||||
</body>
|
||||
</html>
|
||||
@@ -0,0 +1,58 @@
|
||||
# Makefile for Sphinx LaTeX output
|
||||
|
||||
ALLDOCS = $(basename $(wildcard *.tex))
|
||||
ALLPDF = $(addsuffix .pdf,$(ALLDOCS))
|
||||
ALLDVI = $(addsuffix .dvi,$(ALLDOCS))
|
||||
|
||||
# Prefix for archive names
|
||||
ARCHIVEPRREFIX =
|
||||
# Additional LaTeX options
|
||||
LATEXOPTS =
|
||||
|
||||
all: $(ALLPDF)
|
||||
all-pdf: $(ALLPDF)
|
||||
all-dvi: $(ALLDVI)
|
||||
all-ps: all-dvi
|
||||
for f in *.dvi; do dvips $$f; done
|
||||
|
||||
zip: all-$(FMT)
|
||||
mkdir $(ARCHIVEPREFIX)docs-$(FMT)
|
||||
cp $(ALLPDF) $(ARCHIVEPREFIX)docs-$(FMT)
|
||||
zip -q -r -9 $(ARCHIVEPREFIX)docs-$(FMT).zip $(ARCHIVEPREFIX)docs-$(FMT)
|
||||
rm -r $(ARCHIVEPREFIX)docs-$(FMT)
|
||||
|
||||
tar: all-$(FMT)
|
||||
mkdir $(ARCHIVEPREFIX)docs-$(FMT)
|
||||
cp $(ALLPDF) $(ARCHIVEPREFIX)docs-$(FMT)
|
||||
tar cf $(ARCHIVEPREFIX)docs-$(FMT).tar $(ARCHIVEPREFIX)docs-$(FMT)
|
||||
rm -r $(ARCHIVEPREFIX)docs-$(FMT)
|
||||
|
||||
bz2: tar
|
||||
bzip2 -9 -k $(ARCHIVEPREFIX)docs-$(FMT).tar
|
||||
|
||||
# The number of LaTeX runs is quite conservative, but I don't expect it
|
||||
# to get run often, so the little extra time won't hurt.
|
||||
%.dvi: %.tex
|
||||
latex $(LATEXOPTS) '$<'
|
||||
latex $(LATEXOPTS) '$<'
|
||||
latex $(LATEXOPTS) '$<'
|
||||
-makeindex -s python.ist '$(basename $<).idx'
|
||||
-makeindex -s python.ist '$(basename mod$<).idx'
|
||||
latex $(LATEXOPTS) '$<'
|
||||
latex $(LATEXOPTS) '$<'
|
||||
|
||||
%.pdf: %.tex
|
||||
pdflatex $(LATEXOPTS) '$<'
|
||||
pdflatex $(LATEXOPTS) '$<'
|
||||
pdflatex $(LATEXOPTS) '$<'
|
||||
-makeindex -s python.ist '$(basename $<).idx'
|
||||
-makeindex -s python.ist '$(basename mod$<).idx'
|
||||
pdflatex $(LATEXOPTS) '$<'
|
||||
pdflatex $(LATEXOPTS) '$<'
|
||||
|
||||
clean:
|
||||
rm -f *.pdf *.dvi *.ps
|
||||
rm -f *.log *.ind *.aux *.toc *.syn *.idx *.out *.ilg *.pla
|
||||
|
||||
.PHONY: all all-pdf all-dvi all-ps clean
|
||||
|
||||
@@ -0,0 +1,54 @@
|
||||
\relax
|
||||
\ifx\hyper@anchor\@undefined
|
||||
\global \let \oldcontentsline\contentsline
|
||||
\gdef \contentsline#1#2#3#4{\oldcontentsline{#1}{#2}{#3}}
|
||||
\global \let \oldnewlabel\newlabel
|
||||
\gdef \newlabel#1#2{\newlabelxx{#1}#2}
|
||||
\gdef \newlabelxx#1#2#3#4#5#6{\oldnewlabel{#1}{{#2}{#3}}}
|
||||
\AtEndDocument{\let \contentsline\oldcontentsline
|
||||
\let \newlabel\oldnewlabel}
|
||||
\else
|
||||
\global \let \hyper@last\relax
|
||||
\fi
|
||||
|
||||
\select@language{english}
|
||||
\@writefile{toc}{\select@language{english}}
|
||||
\@writefile{lof}{\select@language{english}}
|
||||
\@writefile{lot}{\select@language{english}}
|
||||
\@writefile{toc}{\contentsline {chapter}{\numberline {1}OBITools scripts}{3}{chapter.1}}
|
||||
\@writefile{lof}{\addvspace {10\p@ }}
|
||||
\@writefile{lot}{\addvspace {10\p@ }}
|
||||
\@writefile{toc}{\contentsline {section}{\numberline {1.1}File formats usable with OBITools}{3}{section.1.1}}
|
||||
\@writefile{toc}{\contentsline {subsection}{\numberline {1.1.1}The sequence files}{3}{subsection.1.1.1}}
|
||||
\@writefile{toc}{\contentsline {subsubsection}{The IUPAC code}{3}{subsubsection*.2}}
|
||||
\@writefile{toc}{\contentsline {paragraph}{Nucleic IUPAC Code}{4}{paragraph*.3}}
|
||||
\@writefile{toc}{\contentsline {paragraph}{Peptidic one and three letters IUPAC code}{4}{paragraph*.4}}
|
||||
\@writefile{toc}{\contentsline {subsubsection}{The fasta format}{4}{subsubsection*.5}}
|
||||
\@writefile{toc}{\contentsline {paragraph}{The extended OBITools fasta format}{5}{paragraph*.6}}
|
||||
\@writefile{toc}{\contentsline {paragraph}{The classical fasta format}{5}{paragraph*.7}}
|
||||
\@writefile{toc}{\contentsline {subsubsection}{The genbank sequence format}{6}{subsubsection*.8}}
|
||||
\@writefile{toc}{\contentsline {subsubsection}{The EMBL sequence format}{6}{subsubsection*.9}}
|
||||
\@writefile{toc}{\contentsline {subsection}{\numberline {1.1.2}The taxonomy files}{6}{subsection.1.1.2}}
|
||||
\@writefile{toc}{\contentsline {subsubsection}{The NCBI taxonomy dump files}{6}{subsubsection*.10}}
|
||||
\@writefile{toc}{\contentsline {subsubsection}{The OBITools formated taxonomy}{6}{subsubsection*.11}}
|
||||
\@writefile{toc}{\contentsline {subsection}{\numberline {1.1.3}The ecoPCR files}{6}{subsection.1.1.3}}
|
||||
\@writefile{toc}{\contentsline {subsection}{\numberline {1.1.4}The ecoPrimer files}{6}{subsection.1.1.4}}
|
||||
\@writefile{toc}{\contentsline {subsection}{\numberline {1.1.5}The OBITools files}{6}{subsection.1.1.5}}
|
||||
\@writefile{toc}{\contentsline {section}{\numberline {1.2}File format conversions}{6}{section.1.2}}
|
||||
\@writefile{toc}{\contentsline {subsection}{\numberline {1.2.1}Convert to extended OBITools fasta format}{6}{subsection.1.2.1}}
|
||||
\@writefile{toc}{\contentsline {subsubsection}{Convert sequence files to extended OBITools fasta format}{6}{subsubsection*.12}}
|
||||
\@writefile{toc}{\contentsline {paragraph}{obitools common options}{7}{paragraph*.13}}
|
||||
\@writefile{toc}{\contentsline {paragraph}{convert2fasta.py specific options}{7}{paragraph*.14}}
|
||||
\@writefile{toc}{\contentsline {paragraph}{example}{7}{paragraph*.15}}
|
||||
\@writefile{toc}{\contentsline {subsubsection}{Convert ecoPCR result files to extended OBITools fasta file}{7}{subsubsection*.16}}
|
||||
\@writefile{toc}{\contentsline {subsection}{\numberline {1.2.2}Convert taxonomic data}{7}{subsection.1.2.2}}
|
||||
\@writefile{toc}{\contentsline {subsubsection}{Convert NCBI taxdump to binary formated OBITools taxonomy database}{7}{subsubsection*.17}}
|
||||
\@writefile{toc}{\contentsline {paragraph}{obitools common options}{7}{paragraph*.18}}
|
||||
\@writefile{toc}{\contentsline {paragraph}{taxonomy related options}{8}{paragraph*.19}}
|
||||
\@writefile{toc}{\contentsline {paragraph}{example}{8}{paragraph*.20}}
|
||||
\@writefile{toc}{\contentsline {subsection}{\numberline {1.2.3}Convert to tabular data files}{8}{subsection.1.2.3}}
|
||||
\@writefile{toc}{\contentsline {subsubsection}{Convert extended OBITools fasta file to a tabular format}{8}{subsubsection*.21}}
|
||||
\@writefile{toc}{\contentsline {chapter}{\numberline {2}Indices and tables}{9}{chapter.2}}
|
||||
\@writefile{lof}{\addvspace {10\p@ }}
|
||||
\@writefile{lot}{\addvspace {10\p@ }}
|
||||
\@writefile{toc}{\contentsline {chapter}{Index}{11}{section*.22}}
|
||||
@@ -0,0 +1,26 @@
|
||||
\indexentry{obitools command line option!-h, --help|hyperpage}{7}
|
||||
\indexentry{-h, --help!obitools command line option|hyperpage}{7}
|
||||
\indexentry{obitools command line option!--DEBUG|hyperpage}{7}
|
||||
\indexentry{--DEBUG!obitools command line option|hyperpage}{7}
|
||||
\indexentry{obitools command line option!--no-psyco|hyperpage}{7}
|
||||
\indexentry{--no-psyco!obitools command line option|hyperpage}{7}
|
||||
\indexentry{convert2fasta.py command line option!--genbank|hyperpage}{7}
|
||||
\indexentry{--genbank!convert2fasta.py command line option|hyperpage}{7}
|
||||
\indexentry{convert2fasta.py command line option!--embl|hyperpage}{7}
|
||||
\indexentry{--embl!convert2fasta.py command line option|hyperpage}{7}
|
||||
\indexentry{convert2fasta.py command line option!--fna|hyperpage}{7}
|
||||
\indexentry{--fna!convert2fasta.py command line option|hyperpage}{7}
|
||||
\indexentry{convert2fasta.py command line option!--nuc|hyperpage}{7}
|
||||
\indexentry{--nuc!convert2fasta.py command line option|hyperpage}{7}
|
||||
\indexentry{convert2fasta.py command line option!--prot|hyperpage}{7}
|
||||
\indexentry{--prot!convert2fasta.py command line option|hyperpage}{7}
|
||||
\indexentry{obitools command line option!-h, --help|hyperpage}{7}
|
||||
\indexentry{-h, --help!obitools command line option|hyperpage}{7}
|
||||
\indexentry{obitools command line option!--DEBUG|hyperpage}{7}
|
||||
\indexentry{--DEBUG!obitools command line option|hyperpage}{7}
|
||||
\indexentry{obitools command line option!--no-psyco|hyperpage}{8}
|
||||
\indexentry{--no-psyco!obitools command line option|hyperpage}{8}
|
||||
\indexentry{taxonomy command line option!-d \textless {}FILENAME\textgreater {}, --database=\textless {}FILENAME\textgreater {}|hyperpage}{8}
|
||||
\indexentry{-d \textless {}FILENAME\textgreater {}, --database=\textless {}FILENAME\textgreater {}!taxonomy command line option|hyperpage}{8}
|
||||
\indexentry{taxonomy command line option!-t \textless {}FILENAME\textgreater {}, --taxonomy-dump=\textless {}FILENAME\textgreater {}|hyperpage}{8}
|
||||
\indexentry{-t \textless {}FILENAME\textgreater {}, --taxonomy-dump=\textless {}FILENAME\textgreater {}!taxonomy command line option|hyperpage}{8}
|
||||
@@ -0,0 +1,7 @@
|
||||
This is makeindex, version 2.15 [20-Nov-2007] (kpathsea + Thai support).
|
||||
Scanning style file ./python.ist......done (6 attributes redefined, 0 ignored).
|
||||
Scanning input file OBITools.idx....done (26 entries accepted, 0 rejected).
|
||||
Sorting entries....done (124 comparisons).
|
||||
Generating output file OBITools.ind....done (50 lines written, 0 warnings).
|
||||
Output written in OBITools.ind.
|
||||
Transcript written in OBITools.ilg.
|
||||
@@ -0,0 +1,50 @@
|
||||
\begin{theindex}
|
||||
\def\bigletter#1{{\Large\sffamily#1}\nopagebreak\vspace{1mm}}
|
||||
|
||||
\bigletter {Symbols}
|
||||
\item --DEBUG
|
||||
\subitem obitools command line option, \hyperpage{7}
|
||||
\item --embl
|
||||
\subitem convert2fasta.py command line option, \hyperpage{7}
|
||||
\item --fna
|
||||
\subitem convert2fasta.py command line option, \hyperpage{7}
|
||||
\item --genbank
|
||||
\subitem convert2fasta.py command line option, \hyperpage{7}
|
||||
\item --no-psyco
|
||||
\subitem obitools command line option, \hyperpage{7, 8}
|
||||
\item --nuc
|
||||
\subitem convert2fasta.py command line option, \hyperpage{7}
|
||||
\item --prot
|
||||
\subitem convert2fasta.py command line option, \hyperpage{7}
|
||||
\item -d \textless {}FILENAME\textgreater {}, --database=\textless {}FILENAME\textgreater {}
|
||||
\subitem taxonomy command line option, \hyperpage{8}
|
||||
\item -h, --help
|
||||
\subitem obitools command line option, \hyperpage{7}
|
||||
\item -t \textless {}FILENAME\textgreater {}, --taxonomy-dump=\textless {}FILENAME\textgreater {}
|
||||
\subitem taxonomy command line option, \hyperpage{8}
|
||||
|
||||
\indexspace
|
||||
\bigletter C
|
||||
\item convert2fasta.py command line option
|
||||
\subitem --embl, \hyperpage{7}
|
||||
\subitem --fna, \hyperpage{7}
|
||||
\subitem --genbank, \hyperpage{7}
|
||||
\subitem --nuc, \hyperpage{7}
|
||||
\subitem --prot, \hyperpage{7}
|
||||
|
||||
\indexspace
|
||||
\bigletter O
|
||||
\item obitools command line option
|
||||
\subitem --DEBUG, \hyperpage{7}
|
||||
\subitem --no-psyco, \hyperpage{7, 8}
|
||||
\subitem -h, --help, \hyperpage{7}
|
||||
|
||||
\indexspace
|
||||
\bigletter T
|
||||
\item taxonomy command line option
|
||||
\subitem -d \textless {}FILENAME\textgreater {}, --database=\textless {}FILENAME\textgreater {},
|
||||
\hyperpage{8}
|
||||
\subitem -t \textless {}FILENAME\textgreater {}, --taxonomy-dump=\textless {}FILENAME\textgreater {},
|
||||
\hyperpage{8}
|
||||
|
||||
\end{theindex}
|
||||
@@ -0,0 +1,5 @@
|
||||
\BOOKMARK [0][-]{chapter.1}{OBITools scripts}{}
|
||||
\BOOKMARK [1][-]{section.1.1}{File formats usable with OBITools}{chapter.1}
|
||||
\BOOKMARK [1][-]{section.1.2}{File format conversions}{chapter.1}
|
||||
\BOOKMARK [0][-]{chapter.2}{Indices and tables}{}
|
||||
\BOOKMARK [0][-]{section*.22}{Index}{}
|
||||
Binary file not shown.
@@ -0,0 +1,728 @@
|
||||
% Generated by Sphinx.
|
||||
\documentclass[letterpaper,10pt,english]{manual}
|
||||
\usepackage[utf8]{inputenc}
|
||||
\usepackage[T1]{fontenc}
|
||||
\usepackage{babel}
|
||||
\usepackage{times}
|
||||
\usepackage[Bjarne]{fncychap}
|
||||
\usepackage{longtable}
|
||||
\usepackage{sphinx}
|
||||
|
||||
|
||||
\title{OBITools Documentation}
|
||||
\date{December 10, 2009}
|
||||
\release{0.1.3}
|
||||
\author{Eric Coissac}
|
||||
\newcommand{\sphinxlogo}{}
|
||||
\renewcommand{\releasename}{Release}
|
||||
\makeindex
|
||||
\makemodindex
|
||||
|
||||
\makeatletter
|
||||
\def\PYG@reset{\let\PYG@it=\relax \let\PYG@bf=\relax%
|
||||
\let\PYG@ul=\relax \let\PYG@tc=\relax%
|
||||
\let\PYG@bc=\relax \let\PYG@ff=\relax}
|
||||
\def\PYG@tok#1{\csname PYG@tok@#1\endcsname}
|
||||
\def\PYG@toks#1+{\ifx\relax#1\empty\else%
|
||||
\PYG@tok{#1}\expandafter\PYG@toks\fi}
|
||||
\def\PYG@do#1{\PYG@bc{\PYG@tc{\PYG@ul{%
|
||||
\PYG@it{\PYG@bf{\PYG@ff{#1}}}}}}}
|
||||
\def\PYG#1#2{\PYG@reset\PYG@toks#1+\relax+\PYG@do{#2}}
|
||||
|
||||
\def\PYG@tok@gd{\def\PYG@tc##1{\textcolor[rgb]{0.63,0.00,0.00}{##1}}}
|
||||
\def\PYG@tok@gu{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.50,0.00,0.50}{##1}}}
|
||||
\def\PYG@tok@gt{\def\PYG@tc##1{\textcolor[rgb]{0.00,0.25,0.82}{##1}}}
|
||||
\def\PYG@tok@gs{\let\PYG@bf=\textbf}
|
||||
\def\PYG@tok@gr{\def\PYG@tc##1{\textcolor[rgb]{1.00,0.00,0.00}{##1}}}
|
||||
\def\PYG@tok@cm{\let\PYG@it=\textit\def\PYG@tc##1{\textcolor[rgb]{0.25,0.50,0.56}{##1}}}
|
||||
\def\PYG@tok@vg{\def\PYG@tc##1{\textcolor[rgb]{0.73,0.38,0.84}{##1}}}
|
||||
\def\PYG@tok@m{\def\PYG@tc##1{\textcolor[rgb]{0.13,0.50,0.31}{##1}}}
|
||||
\def\PYG@tok@mh{\def\PYG@tc##1{\textcolor[rgb]{0.13,0.50,0.31}{##1}}}
|
||||
\def\PYG@tok@cs{\def\PYG@tc##1{\textcolor[rgb]{0.25,0.50,0.56}{##1}}\def\PYG@bc##1{\colorbox[rgb]{1.00,0.94,0.94}{##1}}}
|
||||
\def\PYG@tok@ge{\let\PYG@it=\textit}
|
||||
\def\PYG@tok@vc{\def\PYG@tc##1{\textcolor[rgb]{0.73,0.38,0.84}{##1}}}
|
||||
\def\PYG@tok@il{\def\PYG@tc##1{\textcolor[rgb]{0.13,0.50,0.31}{##1}}}
|
||||
\def\PYG@tok@go{\def\PYG@tc##1{\textcolor[rgb]{0.19,0.19,0.19}{##1}}}
|
||||
\def\PYG@tok@cp{\def\PYG@tc##1{\textcolor[rgb]{0.00,0.44,0.13}{##1}}}
|
||||
\def\PYG@tok@gi{\def\PYG@tc##1{\textcolor[rgb]{0.00,0.63,0.00}{##1}}}
|
||||
\def\PYG@tok@gh{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.00,0.00,0.50}{##1}}}
|
||||
\def\PYG@tok@ni{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.84,0.33,0.22}{##1}}}
|
||||
\def\PYG@tok@nl{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.00,0.13,0.44}{##1}}}
|
||||
\def\PYG@tok@nn{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.05,0.52,0.71}{##1}}}
|
||||
\def\PYG@tok@no{\def\PYG@tc##1{\textcolor[rgb]{0.38,0.68,0.84}{##1}}}
|
||||
\def\PYG@tok@na{\def\PYG@tc##1{\textcolor[rgb]{0.25,0.44,0.63}{##1}}}
|
||||
\def\PYG@tok@nb{\def\PYG@tc##1{\textcolor[rgb]{0.00,0.44,0.13}{##1}}}
|
||||
\def\PYG@tok@nc{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.05,0.52,0.71}{##1}}}
|
||||
\def\PYG@tok@nd{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.33,0.33,0.33}{##1}}}
|
||||
\def\PYG@tok@ne{\def\PYG@tc##1{\textcolor[rgb]{0.00,0.44,0.13}{##1}}}
|
||||
\def\PYG@tok@nf{\def\PYG@tc##1{\textcolor[rgb]{0.02,0.16,0.49}{##1}}}
|
||||
\def\PYG@tok@si{\let\PYG@it=\textit\def\PYG@tc##1{\textcolor[rgb]{0.44,0.63,0.82}{##1}}}
|
||||
\def\PYG@tok@s2{\def\PYG@tc##1{\textcolor[rgb]{0.25,0.44,0.63}{##1}}}
|
||||
\def\PYG@tok@vi{\def\PYG@tc##1{\textcolor[rgb]{0.73,0.38,0.84}{##1}}}
|
||||
\def\PYG@tok@nt{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.02,0.16,0.45}{##1}}}
|
||||
\def\PYG@tok@nv{\def\PYG@tc##1{\textcolor[rgb]{0.73,0.38,0.84}{##1}}}
|
||||
\def\PYG@tok@s1{\def\PYG@tc##1{\textcolor[rgb]{0.25,0.44,0.63}{##1}}}
|
||||
\def\PYG@tok@gp{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.78,0.36,0.04}{##1}}}
|
||||
\def\PYG@tok@sh{\def\PYG@tc##1{\textcolor[rgb]{0.25,0.44,0.63}{##1}}}
|
||||
\def\PYG@tok@ow{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.00,0.44,0.13}{##1}}}
|
||||
\def\PYG@tok@sx{\def\PYG@tc##1{\textcolor[rgb]{0.78,0.36,0.04}{##1}}}
|
||||
\def\PYG@tok@bp{\def\PYG@tc##1{\textcolor[rgb]{0.00,0.44,0.13}{##1}}}
|
||||
\def\PYG@tok@c1{\let\PYG@it=\textit\def\PYG@tc##1{\textcolor[rgb]{0.25,0.50,0.56}{##1}}}
|
||||
\def\PYG@tok@kc{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.00,0.44,0.13}{##1}}}
|
||||
\def\PYG@tok@c{\let\PYG@it=\textit\def\PYG@tc##1{\textcolor[rgb]{0.25,0.50,0.56}{##1}}}
|
||||
\def\PYG@tok@mf{\def\PYG@tc##1{\textcolor[rgb]{0.13,0.50,0.31}{##1}}}
|
||||
\def\PYG@tok@err{\def\PYG@bc##1{\fcolorbox[rgb]{1.00,0.00,0.00}{1,1,1}{##1}}}
|
||||
\def\PYG@tok@kd{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.00,0.44,0.13}{##1}}}
|
||||
\def\PYG@tok@ss{\def\PYG@tc##1{\textcolor[rgb]{0.32,0.47,0.09}{##1}}}
|
||||
\def\PYG@tok@sr{\def\PYG@tc##1{\textcolor[rgb]{0.14,0.33,0.53}{##1}}}
|
||||
\def\PYG@tok@mo{\def\PYG@tc##1{\textcolor[rgb]{0.13,0.50,0.31}{##1}}}
|
||||
\def\PYG@tok@mi{\def\PYG@tc##1{\textcolor[rgb]{0.13,0.50,0.31}{##1}}}
|
||||
\def\PYG@tok@kn{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.00,0.44,0.13}{##1}}}
|
||||
\def\PYG@tok@o{\def\PYG@tc##1{\textcolor[rgb]{0.40,0.40,0.40}{##1}}}
|
||||
\def\PYG@tok@kr{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.00,0.44,0.13}{##1}}}
|
||||
\def\PYG@tok@s{\def\PYG@tc##1{\textcolor[rgb]{0.25,0.44,0.63}{##1}}}
|
||||
\def\PYG@tok@kp{\def\PYG@tc##1{\textcolor[rgb]{0.00,0.44,0.13}{##1}}}
|
||||
\def\PYG@tok@w{\def\PYG@tc##1{\textcolor[rgb]{0.73,0.73,0.73}{##1}}}
|
||||
\def\PYG@tok@kt{\def\PYG@tc##1{\textcolor[rgb]{0.56,0.13,0.00}{##1}}}
|
||||
\def\PYG@tok@sc{\def\PYG@tc##1{\textcolor[rgb]{0.25,0.44,0.63}{##1}}}
|
||||
\def\PYG@tok@sb{\def\PYG@tc##1{\textcolor[rgb]{0.25,0.44,0.63}{##1}}}
|
||||
\def\PYG@tok@k{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.00,0.44,0.13}{##1}}}
|
||||
\def\PYG@tok@se{\let\PYG@bf=\textbf\def\PYG@tc##1{\textcolor[rgb]{0.25,0.44,0.63}{##1}}}
|
||||
\def\PYG@tok@sd{\let\PYG@it=\textit\def\PYG@tc##1{\textcolor[rgb]{0.25,0.44,0.63}{##1}}}
|
||||
|
||||
\def\PYGZat{@}
|
||||
\def\PYGZlb{[}
|
||||
\def\PYGZrb{]}
|
||||
\makeatother
|
||||
|
||||
\begin{document}
|
||||
|
||||
\maketitle
|
||||
\tableofcontents
|
||||
\hypertarget{--doc-index}{}
|
||||
|
||||
|
||||
Contents:
|
||||
|
||||
\resetcurrentobjects
|
||||
\hypertarget{--doc-scripts}{}
|
||||
|
||||
\chapter{OBITools scripts}
|
||||
|
||||
OBITools scripts are developed mainly for manipulating large sequence
|
||||
files generated by the next generation sequencers.
|
||||
|
||||
Contents:
|
||||
|
||||
\resetcurrentobjects
|
||||
\hypertarget{--doc-formats}{}
|
||||
|
||||
\section{File formats usable with OBITools}
|
||||
|
||||
|
||||
\subsection{The sequence files}
|
||||
|
||||
Sequences can be stored following various format. OBITools knows
|
||||
some of them. The central format for sequence files manipulated by OBITools scripts
|
||||
is the \hyperlink{--doc-fasta}{\emph{fasta format}}. OBITools extends the fasta format by specifying
|
||||
a syntax to include in the definition line data qualifying the sequence.
|
||||
All file formats use the \hyperlink{--doc-iupac}{\emph{IUPAC}} code for encoding nucleotides and
|
||||
amino-acids.
|
||||
|
||||
\resetcurrentobjects
|
||||
\hypertarget{--doc-iupac}{}
|
||||
|
||||
\subsubsection{The IUPAC code}
|
||||
|
||||
The International Union of Pure and Applied Chemistry (\href{http://www.iupac.org/}{IUPAC}) defined
|
||||
the standard code for representing protein or DNA sequences.
|
||||
|
||||
|
||||
\paragraph{Nucleic IUPAC Code}
|
||||
|
||||
\begin{tabulary}{\textwidth}{|L|L|}
|
||||
\hline
|
||||
\textbf{
|
||||
\textbf{Code}
|
||||
} & \textbf{
|
||||
\textbf{Nucleotide}
|
||||
}\\
|
||||
\hline
|
||||
|
||||
A
|
||||
&
|
||||
Adenine
|
||||
\\
|
||||
|
||||
C
|
||||
&
|
||||
Cytosine
|
||||
\\
|
||||
|
||||
G
|
||||
&
|
||||
Guanine
|
||||
\\
|
||||
|
||||
T
|
||||
&
|
||||
Thymine
|
||||
\\
|
||||
|
||||
U
|
||||
&
|
||||
Uracil
|
||||
\\
|
||||
|
||||
R
|
||||
&
|
||||
Purine (A or G)
|
||||
\\
|
||||
|
||||
Y
|
||||
&
|
||||
Pyrimidine (C, T, or U)
|
||||
\\
|
||||
|
||||
M
|
||||
&
|
||||
C or A
|
||||
\\
|
||||
|
||||
K
|
||||
&
|
||||
T, U, or G
|
||||
\\
|
||||
|
||||
W
|
||||
&
|
||||
T, U, or A
|
||||
\\
|
||||
|
||||
S
|
||||
&
|
||||
C or G
|
||||
\\
|
||||
|
||||
B
|
||||
&
|
||||
C, T, U, or G (not A)
|
||||
\\
|
||||
|
||||
D
|
||||
&
|
||||
A, T, U, or G (not C)
|
||||
\\
|
||||
|
||||
H
|
||||
&
|
||||
A, T, U, or C (not G)
|
||||
\\
|
||||
|
||||
V
|
||||
&
|
||||
A, C, or G (not T, not U)
|
||||
\\
|
||||
|
||||
N
|
||||
&
|
||||
Any base (A, C, G, T, or U)
|
||||
\\
|
||||
\hline
|
||||
\end{tabulary}
|
||||
|
||||
|
||||
|
||||
\paragraph{Peptidic one and three letters IUPAC code}
|
||||
|
||||
\begin{tabulary}{\textwidth}{|L|L|L|}
|
||||
\hline
|
||||
\textbf{
|
||||
\textbf{1-letter}
|
||||
} & \textbf{
|
||||
\textbf{3-letters}
|
||||
} & \textbf{
|
||||
\textbf{Amino acid}
|
||||
}\\
|
||||
\hline
|
||||
|
||||
A
|
||||
&
|
||||
Ala
|
||||
&
|
||||
Alanine
|
||||
\\
|
||||
|
||||
R
|
||||
&
|
||||
Arg
|
||||
&
|
||||
Arginine
|
||||
\\
|
||||
|
||||
N
|
||||
&
|
||||
Asn
|
||||
&
|
||||
Asparagine
|
||||
\\
|
||||
|
||||
D
|
||||
&
|
||||
Asp
|
||||
&
|
||||
Aspartic acid
|
||||
\\
|
||||
|
||||
C
|
||||
&
|
||||
Cys
|
||||
&
|
||||
Cysteine
|
||||
\\
|
||||
|
||||
Q
|
||||
&
|
||||
Gln
|
||||
&
|
||||
Glutamine
|
||||
\\
|
||||
|
||||
E
|
||||
&
|
||||
Glu
|
||||
&
|
||||
Glutamic acid
|
||||
\\
|
||||
|
||||
G
|
||||
&
|
||||
Gly
|
||||
&
|
||||
Glycine
|
||||
\\
|
||||
|
||||
H
|
||||
&
|
||||
His
|
||||
&
|
||||
Histidine
|
||||
\\
|
||||
|
||||
I
|
||||
&
|
||||
Ile
|
||||
&
|
||||
Isoleucine
|
||||
\\
|
||||
|
||||
L
|
||||
&
|
||||
Leu
|
||||
&
|
||||
Leucine
|
||||
\\
|
||||
|
||||
K
|
||||
&
|
||||
Lys
|
||||
&
|
||||
Lysine
|
||||
\\
|
||||
|
||||
M
|
||||
&
|
||||
Met
|
||||
&
|
||||
Methionine
|
||||
\\
|
||||
|
||||
F
|
||||
&
|
||||
Phe
|
||||
&
|
||||
Phenylalanine
|
||||
\\
|
||||
|
||||
P
|
||||
&
|
||||
Pro
|
||||
&
|
||||
Proline
|
||||
\\
|
||||
|
||||
S
|
||||
&
|
||||
Ser
|
||||
&
|
||||
Serine
|
||||
\\
|
||||
|
||||
T
|
||||
&
|
||||
Thr
|
||||
&
|
||||
Threonine
|
||||
\\
|
||||
|
||||
W
|
||||
&
|
||||
Trp
|
||||
&
|
||||
Tryptophan
|
||||
\\
|
||||
|
||||
Y
|
||||
&
|
||||
Tyr
|
||||
&
|
||||
Tyrosine
|
||||
\\
|
||||
|
||||
V
|
||||
&
|
||||
Val
|
||||
&
|
||||
Valine
|
||||
\\
|
||||
|
||||
B
|
||||
&
|
||||
Asx
|
||||
&
|
||||
Aspartic acid or Asparagine
|
||||
\\
|
||||
|
||||
Z
|
||||
&
|
||||
Glx
|
||||
&
|
||||
Glutamine or Glutamic acid
|
||||
\\
|
||||
|
||||
X
|
||||
&
|
||||
Xaa
|
||||
&
|
||||
Any amino acid
|
||||
\\
|
||||
\hline
|
||||
\end{tabulary}
|
||||
|
||||
|
||||
\resetcurrentobjects
|
||||
\hypertarget{--doc-fasta}{}
|
||||
|
||||
\subsubsection{The fasta format}
|
||||
|
||||
The fasta format is certainly the most widely used sequence file format.
|
||||
This is certainly due to its great simplicity. It was originally created
|
||||
for the `'Lipman'' and `'Pearson'' \href{http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation}{FASTA program}. OBITools use in more
|
||||
of \hyperlink{classical-fasta}{\emph{the classical fasta format}} several extended
|
||||
version of this format where structured data are included in the title line.
|
||||
|
||||
\resetcurrentobjects
|
||||
\hypertarget{--doc-obifasta}{}
|
||||
|
||||
\paragraph{The extended OBITools fasta format}
|
||||
|
||||
The \emph{extended OBITools Fasta format} is a strict \hyperlink{--doc-fasta}{\emph{fasta format file}}.
|
||||
The file in \emph{extended OBITools Fasta format} can be readed by all programs
|
||||
reading fasta files.
|
||||
|
||||
Difference between standard and extended fasta is just the structure of the title
|
||||
line. For OBITools title line is divided in three parts :
|
||||
\begin{itemize}
|
||||
\item {}
|
||||
Seqid : the sequence identifier
|
||||
|
||||
\item {}
|
||||
key=value; : a set of key/value keys
|
||||
|
||||
\item {}
|
||||
the sequence definition
|
||||
|
||||
\end{itemize}
|
||||
|
||||
\begin{Verbatim}[commandchars=@\[\]]
|
||||
@textgreater[]my@_sequence taxid=3456; direct=True; sample=A354; this is my pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
\end{Verbatim}
|
||||
|
||||
Following these rules, the title line can be parsed :
|
||||
\begin{itemize}
|
||||
\item {}
|
||||
The sequence identifier of this sequence is \emph{my\_sequence}
|
||||
|
||||
\item {} \begin{description}
|
||||
\item[Three keys are assigned to this sequence :] \leavevmode\begin{itemize}
|
||||
\item {}
|
||||
Key \emph{taxid} with value \emph{3456}
|
||||
|
||||
\item {}
|
||||
Key \emph{direct} with value \emph{True}
|
||||
|
||||
\item {}
|
||||
Key \emph{sample} with value \emph{A354}
|
||||
|
||||
\end{itemize}
|
||||
|
||||
\end{description}
|
||||
|
||||
\item {}
|
||||
The definition of this sequence is this is \emph{my pretty sequence}
|
||||
|
||||
\end{itemize}
|
||||
|
||||
Key value can be any valid python expression. If a key value cannot be evaluated as
|
||||
a python expression, it is them assumed as a simple string. Following this rule,
|
||||
taxid value is considered as an integer value, direct value as a boolean and sample
|
||||
value is not a valid python expression so it is considered as a string value.
|
||||
|
||||
|
||||
\hypertarget{classical-fasta}{}\paragraph{The classical fasta format}
|
||||
|
||||
In fasta format a sequence is represented by a title line beginning with a \textbf{\textgreater{}} character and
|
||||
the sequences by itself following \hyperlink{--doc-iupac}{\emph{The IUPAC code}}. The sequence is usually split other severals
|
||||
lines of the same length (expected for the last one)
|
||||
|
||||
\begin{Verbatim}[commandchars=@\[\]]
|
||||
@textgreater[]my@_sequence this is my pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
\end{Verbatim}
|
||||
|
||||
This is no special format for the title line excepting that this line should be unique.
|
||||
Usually the first word following the \textbf{\textgreater{}} character is considered as the sequence identifier.
|
||||
The end of the title line corresponding to a description of the sequence.
|
||||
|
||||
Several sequences can be concatenated in a same file. The description of the next sequence
|
||||
is just pasted at the end of the description of the previous one
|
||||
|
||||
\begin{Verbatim}[commandchars=@\[\]]
|
||||
@textgreater[]sequence@_A this is my first pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
@textgreater[]sequence@_B this is my second pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
@textgreater[]sequence@_C this is my third pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
\end{Verbatim}
|
||||
|
||||
\resetcurrentobjects
|
||||
\hypertarget{--doc-genbank}{}
|
||||
|
||||
\subsubsection{The genbank sequence format}
|
||||
|
||||
\resetcurrentobjects
|
||||
\hypertarget{--doc-embl}{}
|
||||
|
||||
\subsubsection{The EMBL sequence format}
|
||||
|
||||
|
||||
\subsection{The taxonomy files}
|
||||
|
||||
Many OBITools are able to take into account taxonomic data. These data
|
||||
are manipulated following the \href{http://www.ncbi.nlm.nih.gov/taxonomy}{NCBI taxonomy}.
|
||||
|
||||
\resetcurrentobjects
|
||||
\hypertarget{--doc-taxdump}{}
|
||||
|
||||
\subsubsection{The NCBI taxonomy dump files}
|
||||
|
||||
\resetcurrentobjects
|
||||
\hypertarget{--doc-obitaxonomy}{}
|
||||
|
||||
\subsubsection{The OBITools formated taxonomy}
|
||||
|
||||
|
||||
\subsection{The ecoPCR files}
|
||||
|
||||
\href{http://www.grenoble.prabi.fr/trac/ecoPCR}{ecoPCR} is a software developed in \href{http://www-leca.ujf-grenoble.fr}{LECA}. It simulates a PCR experiment by
|
||||
selecting in a sequence database, sequences matching simultaneously two
|
||||
primers sequences in a way allowing a PCR amplification of a DNA region.
|
||||
|
||||
|
||||
\subsection{The ecoPrimer files}
|
||||
|
||||
|
||||
\subsection{The OBITools files}
|
||||
|
||||
\resetcurrentobjects
|
||||
\hypertarget{--doc-conversions}{}
|
||||
|
||||
\section{File format conversions}
|
||||
|
||||
Several OBITools exist for converting files from one format to another.
|
||||
As \hyperlink{--doc-fasta}{\emph{fasta file}} is the central format for OBITools, many of
|
||||
these converters convert to \hyperlink{--doc-obifasta}{\emph{extended OBITools fasta format}}.
|
||||
|
||||
|
||||
\subsection{Convert to extended OBITools fasta format}
|
||||
|
||||
\resetcurrentobjects
|
||||
\hypertarget{--doc-scripts/convert2fasta}{}
|
||||
|
||||
\subsubsection{Convert sequence files to extended OBITools fasta format}
|
||||
|
||||
\textbf{convert2fasta.py} {[}options{]} {[}filename 1{]} {[}filename 2{]} ...
|
||||
|
||||
Convert sequence files to the extended OBITools fasta format. If no
|
||||
file name are specified data are read from standard input.
|
||||
|
||||
|
||||
\paragraph{obitools common options}
|
||||
\indexii{obitools command line option}{-h, --help}
|
||||
|
||||
\hypertarget{cmdoption-obitools-h}{}\begin{describe}{-h, --help}
|
||||
show this help message and exit
|
||||
\end{describe}
|
||||
\indexii{obitools command line option}{--DEBUG}
|
||||
|
||||
\hypertarget{cmdoption-obitools--DEBUG}{}\begin{describe}{--DEBUG}
|
||||
Set logging in debug mode
|
||||
\end{describe}
|
||||
\indexii{obitools command line option}{--no-psyco}
|
||||
|
||||
\hypertarget{cmdoption-obitools--no-psyco}{}\begin{describe}{--no-psyco}
|
||||
Don't use psyco even if it installed
|
||||
\end{describe}
|
||||
|
||||
|
||||
\paragraph{convert2fasta.py specific options}
|
||||
\indexii{convert2fasta.py command line option}{--genbank}
|
||||
|
||||
\hypertarget{cmdoption-convert2fasta.py--genbank}{}\begin{describe}{--genbank}
|
||||
input file is in \hyperlink{--doc-genbank}{\emph{genbank format}}
|
||||
\end{describe}
|
||||
\indexii{convert2fasta.py command line option}{--embl}
|
||||
|
||||
\hypertarget{cmdoption-convert2fasta.py--embl}{}\begin{describe}{--embl}
|
||||
input file is in \hyperlink{--doc-embl}{\emph{embl format}}
|
||||
\end{describe}
|
||||
\indexii{convert2fasta.py command line option}{--fna}
|
||||
|
||||
\hypertarget{cmdoption-convert2fasta.py--fna}{}\begin{describe}{--fna}
|
||||
input file is in fasta nucleic format produced by 454 sequencer
|
||||
pipeline
|
||||
\end{describe}
|
||||
\indexii{convert2fasta.py command line option}{--nuc}
|
||||
|
||||
\hypertarget{cmdoption-convert2fasta.py--nuc}{}\begin{describe}{--nuc}
|
||||
input file contains nucleic sequences
|
||||
\end{describe}
|
||||
\indexii{convert2fasta.py command line option}{--prot}
|
||||
|
||||
\hypertarget{cmdoption-convert2fasta.py--prot}{}\begin{describe}{--prot}
|
||||
input file contains protein sequences
|
||||
\end{describe}
|
||||
|
||||
|
||||
\paragraph{example}
|
||||
|
||||
for converting a genbank file to fasta
|
||||
|
||||
\begin{Verbatim}[commandchars=@\[\]]
|
||||
@% convert2fasta.py --genbank --nuc sequences.gb @textgreater[] sequences.fasta
|
||||
\end{Verbatim}
|
||||
|
||||
\resetcurrentobjects
|
||||
\hypertarget{--doc-scripts/ecopcr2fasta}{}
|
||||
|
||||
\subsubsection{Convert ecoPCR result files to extended OBITools fasta file}
|
||||
|
||||
|
||||
\subsection{Convert taxonomic data}
|
||||
|
||||
\resetcurrentobjects
|
||||
\hypertarget{--doc-scripts/buildOBITaxonomy}{}
|
||||
|
||||
\subsubsection{Convert NCBI taxdump to binary formated OBITools taxonomy database}
|
||||
|
||||
\textbf{buildOBITaxonomy.py} -t \textless{}taxdump dir\textgreater{} -d \textless{}db name\textgreater{}
|
||||
|
||||
Convert an text dump directory of the NCBI Taxonomy database to the binary
|
||||
format used by ecoPCR and many \emph{OBITools} scripts. An archive corresponding to
|
||||
this directory can be downloaded at the following URL
|
||||
\begin{quote}
|
||||
|
||||
\href{ftp://ftp.ncbi.nlm.nih.gov/pub/taxonomy/}{ftp://ftp.ncbi.nlm.nih.gov/pub/taxonomy/}
|
||||
\end{quote}
|
||||
|
||||
|
||||
\paragraph{obitools common options}
|
||||
\indexii{obitools command line option}{-h, --help}
|
||||
|
||||
\hypertarget{cmdoption-obitools-h}{}\begin{describe}{-h, --help}
|
||||
show this help message and exit
|
||||
\end{describe}
|
||||
\indexii{obitools command line option}{--DEBUG}
|
||||
|
||||
\hypertarget{cmdoption-obitools--DEBUG}{}\begin{describe}{--DEBUG}
|
||||
Set logging in debug mode
|
||||
\end{describe}
|
||||
\indexii{obitools command line option}{--no-psyco}
|
||||
|
||||
\hypertarget{cmdoption-obitools--no-psyco}{}\begin{describe}{--no-psyco}
|
||||
Don't use psyco even if it installed
|
||||
\end{describe}
|
||||
|
||||
|
||||
\paragraph{taxonomy related options}
|
||||
\indexii{taxonomy command line option}{-d \textless{}FILENAME\textgreater{}, --database=\textless{}FILENAME\textgreater{}}
|
||||
|
||||
\hypertarget{cmdoption-taxonomy-d}{}\begin{describe}{-d \textless{}FILENAME\textgreater{}, --database=\textless{}FILENAME\textgreater{}}
|
||||
ecoPCR taxonomy Database name
|
||||
\end{describe}
|
||||
\indexii{taxonomy command line option}{-t \textless{}FILENAME\textgreater{}, --taxonomy-dump=\textless{}FILENAME\textgreater{}}
|
||||
|
||||
\hypertarget{cmdoption-taxonomy-t}{}\begin{describe}{-t \textless{}FILENAME\textgreater{}, --taxonomy-dump=\textless{}FILENAME\textgreater{}}
|
||||
NCBI Taxonomy dump repository name
|
||||
\end{describe}
|
||||
|
||||
|
||||
\paragraph{example}
|
||||
|
||||
for building a new taxonomy database named \emph{ncbitaxonomy} from a taxdump dir
|
||||
|
||||
\begin{Verbatim}[commandchars=@\[\]]
|
||||
@% curl ftp://ftp.ncbi.nlm.nih.gov/pub/taxonomy/taxdump.tar.gz @textbar[] tar zxf -
|
||||
@% buildOBITaxonomy.py --taxonomy-dump taxdump --database ncbitaxonomy
|
||||
\end{Verbatim}
|
||||
|
||||
|
||||
\subsection{Convert to tabular data files}
|
||||
|
||||
\resetcurrentobjects
|
||||
\hypertarget{--doc-scripts/fasta2tab}{}
|
||||
|
||||
\subsubsection{Convert extended OBITools fasta file to a tabular format}
|
||||
|
||||
|
||||
\chapter{Indices and tables}
|
||||
\begin{itemize}
|
||||
\item {}
|
||||
\emph{Index}
|
||||
|
||||
\item {}
|
||||
\emph{Module Index}
|
||||
|
||||
\item {}
|
||||
\emph{Search Page}
|
||||
|
||||
\end{itemize}
|
||||
|
||||
|
||||
\renewcommand{\indexname}{Module Index}
|
||||
\printmodindex
|
||||
\renewcommand{\indexname}{Index}
|
||||
\printindex
|
||||
\end{document}
|
||||
@@ -0,0 +1,34 @@
|
||||
\select@language {english}
|
||||
\contentsline {chapter}{\numberline {1}OBITools scripts}{3}{chapter.1}
|
||||
\contentsline {section}{\numberline {1.1}File formats usable with OBITools}{3}{section.1.1}
|
||||
\contentsline {subsection}{\numberline {1.1.1}The sequence files}{3}{subsection.1.1.1}
|
||||
\contentsline {subsubsection}{The IUPAC code}{3}{subsubsection*.2}
|
||||
\contentsline {paragraph}{Nucleic IUPAC Code}{4}{paragraph*.3}
|
||||
\contentsline {paragraph}{Peptidic one and three letters IUPAC code}{4}{paragraph*.4}
|
||||
\contentsline {subsubsection}{The fasta format}{4}{subsubsection*.5}
|
||||
\contentsline {paragraph}{The extended OBITools fasta format}{5}{paragraph*.6}
|
||||
\contentsline {paragraph}{The classical fasta format}{5}{paragraph*.7}
|
||||
\contentsline {subsubsection}{The genbank sequence format}{6}{subsubsection*.8}
|
||||
\contentsline {subsubsection}{The EMBL sequence format}{6}{subsubsection*.9}
|
||||
\contentsline {subsection}{\numberline {1.1.2}The taxonomy files}{6}{subsection.1.1.2}
|
||||
\contentsline {subsubsection}{The NCBI taxonomy dump files}{6}{subsubsection*.10}
|
||||
\contentsline {subsubsection}{The OBITools formated taxonomy}{6}{subsubsection*.11}
|
||||
\contentsline {subsection}{\numberline {1.1.3}The ecoPCR files}{6}{subsection.1.1.3}
|
||||
\contentsline {subsection}{\numberline {1.1.4}The ecoPrimer files}{6}{subsection.1.1.4}
|
||||
\contentsline {subsection}{\numberline {1.1.5}The OBITools files}{6}{subsection.1.1.5}
|
||||
\contentsline {section}{\numberline {1.2}File format conversions}{6}{section.1.2}
|
||||
\contentsline {subsection}{\numberline {1.2.1}Convert to extended OBITools fasta format}{6}{subsection.1.2.1}
|
||||
\contentsline {subsubsection}{Convert sequence files to extended OBITools fasta format}{6}{subsubsection*.12}
|
||||
\contentsline {paragraph}{obitools common options}{7}{paragraph*.13}
|
||||
\contentsline {paragraph}{convert2fasta.py specific options}{7}{paragraph*.14}
|
||||
\contentsline {paragraph}{example}{7}{paragraph*.15}
|
||||
\contentsline {subsubsection}{Convert ecoPCR result files to extended OBITools fasta file}{7}{subsubsection*.16}
|
||||
\contentsline {subsection}{\numberline {1.2.2}Convert taxonomic data}{7}{subsection.1.2.2}
|
||||
\contentsline {subsubsection}{Convert NCBI taxdump to binary formated OBITools taxonomy database}{7}{subsubsection*.17}
|
||||
\contentsline {paragraph}{obitools common options}{7}{paragraph*.18}
|
||||
\contentsline {paragraph}{taxonomy related options}{8}{paragraph*.19}
|
||||
\contentsline {paragraph}{example}{8}{paragraph*.20}
|
||||
\contentsline {subsection}{\numberline {1.2.3}Convert to tabular data files}{8}{subsection.1.2.3}
|
||||
\contentsline {subsubsection}{Convert extended OBITools fasta file to a tabular format}{8}{subsubsection*.21}
|
||||
\contentsline {chapter}{\numberline {2}Indices and tables}{9}{chapter.2}
|
||||
\contentsline {chapter}{Index}{11}{section*.22}
|
||||
@@ -0,0 +1,683 @@
|
||||
%%% Copyright Ulf A. Lindgren
|
||||
%%%
|
||||
%%% Note Premission is granted to modify this file under
|
||||
%%% the condition that it is saved using another
|
||||
%%% file and package name.
|
||||
%%%
|
||||
%%% Revision 1.1 (1997)
|
||||
%%%
|
||||
%%% Jan. 8th Modified package name base date option
|
||||
%%% Jan. 22th Modified FmN and FmTi for error in book.cls
|
||||
%%% \MakeUppercase{#}->{\MakeUppercase#}
|
||||
%%% Apr. 6th Modified Lenny option to prevent undesired
|
||||
%%% skip of line.
|
||||
%%% Nov. 8th Fixed \@chapapp for AMS
|
||||
%%%
|
||||
%%% Revision 1.2 (1998)
|
||||
%%%
|
||||
%%% Feb. 11th Fixed appendix problem related to Bjarne
|
||||
%%% Aug. 11th Fixed problem related to 11pt and 12pt
|
||||
%%% suggested by Tomas Lundberg. THANKS!
|
||||
%%%
|
||||
%%% Revision 1.3 (2004)
|
||||
%%% Sep. 20th problem with frontmatter, mainmatter and
|
||||
%%% backmatter, pointed out by Lapo Mori
|
||||
%%%
|
||||
%%% Revision 1.31 (2004)
|
||||
%%% Sep. 21th problem with the Rejne definition streched text
|
||||
%%% caused ugly gaps in the vrule aligned with the title
|
||||
%%% text. Kindly pointed out to me by Hendri Adriaens
|
||||
%%%
|
||||
%%% Revision 1.32 (2005)
|
||||
%%% Jun. 23th compatibility problem with the KOMA class 'scrbook.cls'
|
||||
%%% a remedy is a redefinition of '\@schapter' in
|
||||
%%% line with that used in KOMA. The problem was pointed
|
||||
%%% out to me by Mikkel Holm Olsen
|
||||
%%%
|
||||
%%% Revision 1.33 (2005)
|
||||
%%% Aug. 9th misspelled ``TWELV'' corrected, the error was pointed
|
||||
%%% out to me by George Pearson
|
||||
%%%
|
||||
%%% Revision 1.34 (2007)
|
||||
%%% Added an alternative to Lenny provided by Peter
|
||||
%%% Osborne (2005-11-28)
|
||||
%%% Corrected front, main and back matter, based on input
|
||||
%%% from Bas van Gils (2006-04-24)
|
||||
%%% Jul. 30th Added Bjornstrup option provided by Jean-Marc
|
||||
%%% Francois (2007-01-05).
|
||||
%%% Reverted to \MakeUppercase{#} see rev 1.1, solved
|
||||
%%% problem with MakeUppercase and MakeLowercase pointed
|
||||
%%% out by Marco Feuerstein (2007-06-06)
|
||||
|
||||
|
||||
%%% Last modified Jul. 2007
|
||||
|
||||
\NeedsTeXFormat{LaTeX2e}[1995/12/01]
|
||||
\ProvidesPackage{fncychap}
|
||||
[2007/07/30 v1.34
|
||||
LaTeX package (Revised chapters)]
|
||||
|
||||
%%%% For conditional inclusion of color
|
||||
\newif\ifusecolor
|
||||
\usecolorfalse
|
||||
|
||||
|
||||
|
||||
%%%% DEFINITION OF Chapapp variables
|
||||
\newcommand{\CNV}{\huge\bfseries}
|
||||
\newcommand{\ChNameVar}[1]{\renewcommand{\CNV}{#1}}
|
||||
|
||||
|
||||
%%%% DEFINITION OF TheChapter variables
|
||||
\newcommand{\CNoV}{\huge\bfseries}
|
||||
\newcommand{\ChNumVar}[1]{\renewcommand{\CNoV}{#1}}
|
||||
|
||||
\newif\ifUCN
|
||||
\UCNfalse
|
||||
\newif\ifLCN
|
||||
\LCNfalse
|
||||
\def\ChNameLowerCase{\LCNtrue\UCNfalse}
|
||||
\def\ChNameUpperCase{\UCNtrue\LCNfalse}
|
||||
\def\ChNameAsIs{\UCNfalse\LCNfalse}
|
||||
|
||||
%%%%% Fix for AMSBook 971008
|
||||
|
||||
\@ifundefined{@chapapp}{\let\@chapapp\chaptername}{}
|
||||
|
||||
|
||||
%%%%% Fix for Bjarne and appendix 980211
|
||||
|
||||
\newif\ifinapp
|
||||
\inappfalse
|
||||
\renewcommand\appendix{\par
|
||||
\setcounter{chapter}{0}%
|
||||
\setcounter{section}{0}%
|
||||
\inapptrue%
|
||||
\renewcommand\@chapapp{\appendixname}%
|
||||
\renewcommand\thechapter{\@Alph\c@chapter}}
|
||||
|
||||
%%%%% Fix for frontmatter, mainmatter, and backmatter 040920
|
||||
|
||||
\@ifundefined{@mainmatter}{\newif\if@mainmatter \@mainmattertrue}{}
|
||||
|
||||
%%%%%
|
||||
|
||||
|
||||
|
||||
\newcommand{\FmN}[1]{%
|
||||
\ifUCN
|
||||
{\MakeUppercase{#1}}\LCNfalse
|
||||
\else
|
||||
\ifLCN
|
||||
{\MakeLowercase{#1}}\UCNfalse
|
||||
\else #1
|
||||
\fi
|
||||
\fi}
|
||||
|
||||
|
||||
%%%% DEFINITION OF Title variables
|
||||
\newcommand{\CTV}{\Huge\bfseries}
|
||||
\newcommand{\ChTitleVar}[1]{\renewcommand{\CTV}{#1}}
|
||||
|
||||
%%%% DEFINITION OF the basic rule width
|
||||
\newlength{\RW}
|
||||
\setlength{\RW}{1pt}
|
||||
\newcommand{\ChRuleWidth}[1]{\setlength{\RW}{#1}}
|
||||
|
||||
\newif\ifUCT
|
||||
\UCTfalse
|
||||
\newif\ifLCT
|
||||
\LCTfalse
|
||||
\def\ChTitleLowerCase{\LCTtrue\UCTfalse}
|
||||
\def\ChTitleUpperCase{\UCTtrue\LCTfalse}
|
||||
\def\ChTitleAsIs{\UCTfalse\LCTfalse}
|
||||
\newcommand{\FmTi}[1]{%
|
||||
\ifUCT
|
||||
{\MakeUppercase{#1}}\LCTfalse
|
||||
\else
|
||||
\ifLCT
|
||||
{\MakeLowercase{#1}}\UCTfalse
|
||||
\else {#1}
|
||||
\fi
|
||||
\fi}
|
||||
|
||||
|
||||
|
||||
\newlength{\mylen}
|
||||
\newlength{\myhi}
|
||||
\newlength{\px}
|
||||
\newlength{\py}
|
||||
\newlength{\pyy}
|
||||
\newlength{\pxx}
|
||||
|
||||
|
||||
\def\mghrulefill#1{\leavevmode\leaders\hrule\@height #1\hfill\kern\z@}
|
||||
|
||||
\newcommand{\DOCH}{%
|
||||
\CNV\FmN{\@chapapp}\space \CNoV\thechapter
|
||||
\par\nobreak
|
||||
\vskip 20\p@
|
||||
}
|
||||
\newcommand{\DOTI}[1]{%
|
||||
\CTV\FmTi{#1}\par\nobreak
|
||||
\vskip 40\p@
|
||||
}
|
||||
\newcommand{\DOTIS}[1]{%
|
||||
\CTV\FmTi{#1}\par\nobreak
|
||||
\vskip 40\p@
|
||||
}
|
||||
|
||||
%%%%%% SONNY DEF
|
||||
|
||||
\DeclareOption{Sonny}{%
|
||||
\ChNameVar{\Large\sf}
|
||||
\ChNumVar{\Huge}
|
||||
\ChTitleVar{\Large\sf}
|
||||
\ChRuleWidth{0.5pt}
|
||||
\ChNameUpperCase
|
||||
\renewcommand{\DOCH}{%
|
||||
\raggedleft
|
||||
\CNV\FmN{\@chapapp}\space \CNoV\thechapter
|
||||
\par\nobreak
|
||||
\vskip 40\p@}
|
||||
\renewcommand{\DOTI}[1]{%
|
||||
\CTV\raggedleft\mghrulefill{\RW}\par\nobreak
|
||||
\vskip 5\p@
|
||||
\CTV\FmTi{#1}\par\nobreak
|
||||
\mghrulefill{\RW}\par\nobreak
|
||||
\vskip 40\p@}
|
||||
\renewcommand{\DOTIS}[1]{%
|
||||
\CTV\raggedleft\mghrulefill{\RW}\par\nobreak
|
||||
\vskip 5\p@
|
||||
\CTV\FmTi{#1}\par\nobreak
|
||||
\mghrulefill{\RW}\par\nobreak
|
||||
\vskip 40\p@}
|
||||
}
|
||||
|
||||
%%%%%% LENNY DEF
|
||||
|
||||
\DeclareOption{Lenny}{%
|
||||
|
||||
\ChNameVar{\fontsize{14}{16}\usefont{OT1}{phv}{m}{n}\selectfont}
|
||||
\ChNumVar{\fontsize{60}{62}\usefont{OT1}{ptm}{m}{n}\selectfont}
|
||||
\ChTitleVar{\Huge\bfseries\rm}
|
||||
\ChRuleWidth{1pt}
|
||||
\renewcommand{\DOCH}{%
|
||||
\settowidth{\px}{\CNV\FmN{\@chapapp}}
|
||||
\addtolength{\px}{2pt}
|
||||
\settoheight{\py}{\CNV\FmN{\@chapapp}}
|
||||
\addtolength{\py}{1pt}
|
||||
|
||||
\settowidth{\mylen}{\CNV\FmN{\@chapapp}\space\CNoV\thechapter}
|
||||
\addtolength{\mylen}{1pt}
|
||||
\settowidth{\pxx}{\CNoV\thechapter}
|
||||
\addtolength{\pxx}{-1pt}
|
||||
|
||||
\settoheight{\pyy}{\CNoV\thechapter}
|
||||
\addtolength{\pyy}{-2pt}
|
||||
\setlength{\myhi}{\pyy}
|
||||
\addtolength{\myhi}{-1\py}
|
||||
\par
|
||||
\parbox[b]{\textwidth}{%
|
||||
\rule[\py]{\RW}{\myhi}%
|
||||
\hskip -\RW%
|
||||
\rule[\pyy]{\px}{\RW}%
|
||||
\hskip -\px%
|
||||
\raggedright%
|
||||
\CNV\FmN{\@chapapp}\space\CNoV\thechapter%
|
||||
\hskip1pt%
|
||||
\mghrulefill{\RW}%
|
||||
\rule{\RW}{\pyy}\par\nobreak%
|
||||
\vskip -\baselineskip%
|
||||
\vskip -\pyy%
|
||||
\hskip \mylen%
|
||||
\mghrulefill{\RW}\par\nobreak%
|
||||
\vskip \pyy}%
|
||||
\vskip 20\p@}
|
||||
|
||||
|
||||
\renewcommand{\DOTI}[1]{%
|
||||
\raggedright
|
||||
\CTV\FmTi{#1}\par\nobreak
|
||||
\vskip 40\p@}
|
||||
|
||||
\renewcommand{\DOTIS}[1]{%
|
||||
\raggedright
|
||||
\CTV\FmTi{#1}\par\nobreak
|
||||
\vskip 40\p@}
|
||||
}
|
||||
|
||||
%%%%%% Peter Osbornes' version of LENNY DEF
|
||||
|
||||
\DeclareOption{PetersLenny}{%
|
||||
|
||||
% five new lengths
|
||||
\newlength{\bl} % bottom left : orig \space
|
||||
\setlength{\bl}{6pt}
|
||||
\newcommand{\BL}[1]{\setlength{\bl}{#1}}
|
||||
\newlength{\br} % bottom right : orig 1pt
|
||||
\setlength{\br}{1pt}
|
||||
\newcommand{\BR}[1]{\setlength{\br}{#1}}
|
||||
\newlength{\tl} % top left : orig 2pt
|
||||
\setlength{\tl}{2pt}
|
||||
\newcommand{\TL}[1]{\setlength{\tl}{#1}}
|
||||
\newlength{\trr} % top right :orig 1pt
|
||||
\setlength{\trr}{1pt}
|
||||
\newcommand{\TR}[1]{\setlength{\trr}{#1}}
|
||||
\newlength{\blrule} % top right :orig 1pt
|
||||
\setlength{\trr}{0pt}
|
||||
\newcommand{\BLrule}[1]{\setlength{\blrule}{#1}}
|
||||
|
||||
|
||||
\ChNameVar{\fontsize{14}{16}\usefont{OT1}{phv}{m}{n}\selectfont}
|
||||
\ChNumVar{\fontsize{60}{62}\usefont{OT1}{ptm}{m}{n}\selectfont}
|
||||
\ChTitleVar{\Huge\bfseries\rm}
|
||||
\ChRuleWidth{1pt}
|
||||
\renewcommand{\DOCH}{%
|
||||
|
||||
|
||||
%%%%%%% tweaks for 1--9 and A--Z
|
||||
\ifcase\c@chapter\relax%
|
||||
\or\BL{-3pt}\TL{-4pt}\BR{0pt}\TR{-6pt}%1
|
||||
\or\BL{0pt}\TL{-4pt}\BR{2pt}\TR{-4pt}%2
|
||||
\or\BL{0pt}\TL{-4pt}\BR{2pt}\TR{-4pt}%3
|
||||
\or\BL{0pt}\TL{5pt}\BR{2pt}\TR{-4pt}%4
|
||||
\or\BL{0pt}\TL{3pt}\BR{2pt}\TR{-4pt}%5
|
||||
\or\BL{-1pt}\TL{0pt}\BR{2pt}\TR{-2pt}%6
|
||||
\or\BL{0pt}\TL{-3pt}\BR{2pt}\TR{-2pt}%7
|
||||
\or\BL{0pt}\TL{-3pt}\BR{2pt}\TR{-2pt}%8
|
||||
\or\BL{0pt}\TL{-3pt}\BR{-4pt}\TR{-2pt}%9
|
||||
\or\BL{-3pt}\TL{-3pt}\BR{2pt}\TR{-7pt}%10
|
||||
\or\BL{-6pt}\TL{-6pt}\BR{0pt}\TR{-9pt}%11
|
||||
\or\BL{-6pt}\TL{-6pt}\BR{2pt}\TR{-7pt}%12
|
||||
\or\BL{-5pt}\TL{-5pt}\BR{0pt}\TR{-9pt}%13
|
||||
\or\BL{-6pt}\TL{-6pt}\BR{0pt}\TR{-9pt}%14
|
||||
\or\BL{-3pt}\TL{-3pt}\BR{3pt}\TR{-6pt}%15
|
||||
\or\BL{-3pt}\TL{-3pt}\BR{3pt}\TR{-6pt}%16
|
||||
\or\BL{-5pt}\TL{-3pt}\BR{-8pt}\TR{-6pt}%17
|
||||
\or\BL{-5pt}\TL{-5pt}\BR{0pt}\TR{-9pt}%18
|
||||
\or\BL{-3pt}\TL{-3pt}\BR{-6pt}\TR{-9pt}%19
|
||||
\or\BL{0pt}\TL{0pt}\BR{0pt}\TR{-5pt}%20
|
||||
\fi
|
||||
|
||||
\ifinapp\ifcase\c@chapter\relax%
|
||||
\or\BL{0pt}\TL{14pt}\BR{5pt}\TR{-19pt}%A
|
||||
\or\BL{0pt}\TL{-5pt}\BR{-3pt}\TR{-8pt}%B
|
||||
\or\BL{-3pt}\TL{-2pt}\BR{1pt}\TR{-6pt}\BLrule{0pt}%C
|
||||
\or\BL{0pt}\TL{-5pt}\BR{-3pt}\TR{-8pt}\BLrule{0pt}%D
|
||||
\or\BL{0pt}\TL{-5pt}\BR{2pt}\TR{-3pt}%E
|
||||
\or\BL{0pt}\TL{-5pt}\BR{-10pt}\TR{-1pt}%F
|
||||
\or\BL{-3pt}\TL{0pt}\BR{0pt}\TR{-7pt}%G
|
||||
\or\BL{0pt}\TL{-5pt}\BR{3pt}\TR{-1pt}%H
|
||||
\or\BL{0pt}\TL{-5pt}\BR{3pt}\TR{-1pt}%I
|
||||
\or\BL{2pt}\TL{0pt}\BR{-3pt}\TR{1pt}%J
|
||||
\or\BL{0pt}\TL{-5pt}\BR{3pt}\TR{-1pt}%K
|
||||
\or\BL{0pt}\TL{-5pt}\BR{2pt}\TR{-19pt}%L
|
||||
\or\BL{0pt}\TL{-5pt}\BR{3pt}\TR{-1pt}%M
|
||||
\or\BL{0pt}\TL{-5pt}\BR{-2pt}\TR{-1pt}%N
|
||||
\or\BL{-3pt}\TL{-2pt}\BR{-3pt}\TR{-11pt}%O
|
||||
\or\BL{0pt}\TL{-5pt}\BR{-9pt}\TR{-3pt}%P
|
||||
\or\BL{-3pt}\TL{-2pt}\BR{-3pt}\TR{-11pt}%Q
|
||||
\or\BL{0pt}\TL{-5pt}\BR{4pt}\TR{-8pt}%R
|
||||
\or\BL{-2pt}\TL{-2pt}\BR{-2pt}\TR{-7pt}%S
|
||||
\or\BL{-3pt}\TL{0pt}\BR{-5pt}\TR{4pt}\BLrule{8pt}%T
|
||||
\or\BL{-7pt}\TL{-11pt}\BR{-5pt}\TR{-7pt}\BLrule{0pt}%U
|
||||
\or\BL{-14pt}\TL{-5pt}\BR{-14pt}\TR{-1pt}\BLrule{14pt}%V
|
||||
\or\BL{-10pt}\TL{-9pt}\BR{-13pt}\TR{-3pt}\BLrule{7pt}%W
|
||||
\or\BL{0pt}\TL{-5pt}\BR{3pt}\TR{-1pt}\BLrule{0pt}%X
|
||||
\or\BL{-6pt}\TL{-4pt}\BR{-7pt}\TR{1pt}\BLrule{7pt}%Y
|
||||
\or\BL{0pt}\TL{-5pt}\BR{3pt}\TR{-1pt}\BLrule{0pt}%Z
|
||||
\fi\fi
|
||||
%%%%%%%
|
||||
\settowidth{\px}{\CNV\FmN{\@chapapp}}
|
||||
\addtolength{\px}{\tl} %MOD change 2pt to \tl
|
||||
\settoheight{\py}{\CNV\FmN{\@chapapp}}
|
||||
\addtolength{\py}{1pt}
|
||||
|
||||
\settowidth{\mylen}{\CNV\FmN{\@chapapp}\space\CNoV\thechapter}
|
||||
\addtolength{\mylen}{\trr}% MOD change 1pt to \tr
|
||||
\settowidth{\pxx}{\CNoV\thechapter}
|
||||
\addtolength{\pxx}{-1pt}
|
||||
|
||||
\settoheight{\pyy}{\CNoV\thechapter}
|
||||
\addtolength{\pyy}{-2pt}
|
||||
\setlength{\myhi}{\pyy}
|
||||
\addtolength{\myhi}{-1\py}
|
||||
\par
|
||||
\parbox[b]{\textwidth}{%
|
||||
\rule[\py]{\RW}{\myhi}%
|
||||
\hskip -\RW%
|
||||
\rule[\pyy]{\px}{\RW}%
|
||||
\hskip -\px%
|
||||
\raggedright%
|
||||
\CNV\FmN{\@chapapp}\rule{\blrule}{\RW}\hskip\bl\CNoV\thechapter%MOD
|
||||
% \CNV\FmN{\@chapapp}\space\CNoV\thechapter %ORIGINAL
|
||||
\hskip\br% %MOD 1pt to \br
|
||||
\mghrulefill{\RW}%
|
||||
\rule{\RW}{\pyy}\par\nobreak%
|
||||
\vskip -\baselineskip%
|
||||
\vskip -\pyy%
|
||||
\hskip \mylen%
|
||||
\mghrulefill{\RW}\par\nobreak%
|
||||
\vskip \pyy}%
|
||||
\vskip 20\p@}
|
||||
|
||||
|
||||
\renewcommand{\DOTI}[1]{%
|
||||
\raggedright
|
||||
\CTV\FmTi{#1}\par\nobreak
|
||||
\vskip 40\p@}
|
||||
|
||||
\renewcommand{\DOTIS}[1]{%
|
||||
\raggedright
|
||||
\CTV\FmTi{#1}\par\nobreak
|
||||
\vskip 40\p@}
|
||||
}
|
||||
|
||||
|
||||
%
|
||||
|
||||
|
||||
%%%%%% BJORNSTRUP DEF
|
||||
|
||||
\DeclareOption{Bjornstrup}{%
|
||||
\usecolortrue
|
||||
% pzc (Zapf Chancelery) is nice. ppl (Palatino) is cool too.
|
||||
\ChNumVar{\fontsize{76}{80}\usefont{OT1}{pzc}{m}{n}\selectfont}
|
||||
\ChTitleVar{\raggedleft\Large\sffamily\bfseries}
|
||||
|
||||
\setlength{\myhi}{10pt} % Space between grey box border and text
|
||||
\setlength{\mylen}{\textwidth}
|
||||
\addtolength{\mylen}{-2\myhi}
|
||||
\renewcommand{\DOCH}{%
|
||||
\settowidth{\py}{\CNoV\thechapter}
|
||||
\addtolength{\py}{-10pt} % Amount of space by which the
|
||||
% % number is shifted right
|
||||
\fboxsep=0pt%
|
||||
\colorbox[gray]{.85}{\rule{0pt}{40pt}\parbox[b]{\textwidth}{\hfill}}%
|
||||
\kern-\py\raise20pt%
|
||||
\hbox{\color[gray]{.5}\CNoV\thechapter}\\%
|
||||
}
|
||||
|
||||
\renewcommand{\DOTI}[1]{%
|
||||
\nointerlineskip\raggedright%
|
||||
\fboxsep=\myhi%
|
||||
\vskip-1ex%
|
||||
\colorbox[gray]{.85}{\parbox[t]{\mylen}{\CTV\FmTi{#1}}}\par\nobreak%
|
||||
\vskip 40\p@%
|
||||
}
|
||||
|
||||
\renewcommand{\DOTIS}[1]{%
|
||||
\fboxsep=0pt
|
||||
\colorbox[gray]{.85}{\rule{0pt}{40pt}\parbox[b]{\textwidth}{\hfill}}\\%
|
||||
\nointerlineskip\raggedright%
|
||||
\fboxsep=\myhi%
|
||||
\colorbox[gray]{.85}{\parbox[t]{\mylen}{\CTV\FmTi{#1}}}\par\nobreak%
|
||||
\vskip 40\p@%
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
%%%%%%% GLENN DEF
|
||||
|
||||
|
||||
\DeclareOption{Glenn}{%
|
||||
\ChNameVar{\bfseries\Large\sf}
|
||||
\ChNumVar{\Huge}
|
||||
\ChTitleVar{\bfseries\Large\rm}
|
||||
\ChRuleWidth{1pt}
|
||||
\ChNameUpperCase
|
||||
\ChTitleUpperCase
|
||||
\renewcommand{\DOCH}{%
|
||||
\settoheight{\myhi}{\CTV\FmTi{Test}}
|
||||
\setlength{\py}{\baselineskip}
|
||||
\addtolength{\py}{\RW}
|
||||
\addtolength{\py}{\myhi}
|
||||
\setlength{\pyy}{\py}
|
||||
\addtolength{\pyy}{-1\RW}
|
||||
|
||||
\raggedright
|
||||
\CNV\FmN{\@chapapp}\space\CNoV\thechapter
|
||||
\hskip 3pt\mghrulefill{\RW}\rule[-1\pyy]{2\RW}{\py}\par\nobreak}
|
||||
|
||||
\renewcommand{\DOTI}[1]{%
|
||||
\addtolength{\pyy}{-4pt}
|
||||
\settoheight{\myhi}{\CTV\FmTi{#1}}
|
||||
\addtolength{\myhi}{\py}
|
||||
\addtolength{\myhi}{-1\RW}
|
||||
\vskip -1\pyy
|
||||
\rule{2\RW}{\myhi}\mghrulefill{\RW}\hskip 2pt
|
||||
\raggedleft\CTV\FmTi{#1}\par\nobreak
|
||||
\vskip 80\p@}
|
||||
|
||||
\newlength{\backskip}
|
||||
\renewcommand{\DOTIS}[1]{%
|
||||
% \setlength{\py}{10pt}
|
||||
% \setlength{\pyy}{\py}
|
||||
% \addtolength{\pyy}{\RW}
|
||||
% \setlength{\myhi}{\baselineskip}
|
||||
% \addtolength{\myhi}{\pyy}
|
||||
% \mghrulefill{\RW}\rule[-1\py]{2\RW}{\pyy}\par\nobreak
|
||||
% \addtolength{}{}
|
||||
%\vskip -1\baselineskip
|
||||
% \rule{2\RW}{\myhi}\mghrulefill{\RW}\hskip 2pt
|
||||
% \raggedleft\CTV\FmTi{#1}\par\nobreak
|
||||
% \vskip 60\p@}
|
||||
%% Fix suggested by Tomas Lundberg
|
||||
\setlength{\py}{25pt} % eller vad man vill
|
||||
\setlength{\pyy}{\py}
|
||||
\setlength{\backskip}{\py}
|
||||
\addtolength{\backskip}{2pt}
|
||||
\addtolength{\pyy}{\RW}
|
||||
\setlength{\myhi}{\baselineskip}
|
||||
\addtolength{\myhi}{\pyy}
|
||||
\mghrulefill{\RW}\rule[-1\py]{2\RW}{\pyy}\par\nobreak
|
||||
\vskip -1\backskip
|
||||
\rule{2\RW}{\myhi}\mghrulefill{\RW}\hskip 3pt %
|
||||
\raggedleft\CTV\FmTi{#1}\par\nobreak
|
||||
\vskip 40\p@}
|
||||
}
|
||||
|
||||
%%%%%%% CONNY DEF
|
||||
|
||||
\DeclareOption{Conny}{%
|
||||
\ChNameUpperCase
|
||||
\ChTitleUpperCase
|
||||
\ChNameVar{\centering\Huge\rm\bfseries}
|
||||
\ChNumVar{\Huge}
|
||||
\ChTitleVar{\centering\Huge\rm}
|
||||
\ChRuleWidth{2pt}
|
||||
|
||||
\renewcommand{\DOCH}{%
|
||||
\mghrulefill{3\RW}\par\nobreak
|
||||
\vskip -0.5\baselineskip
|
||||
\mghrulefill{\RW}\par\nobreak
|
||||
\CNV\FmN{\@chapapp}\space \CNoV\thechapter
|
||||
\par\nobreak
|
||||
\vskip -0.5\baselineskip
|
||||
}
|
||||
\renewcommand{\DOTI}[1]{%
|
||||
\mghrulefill{\RW}\par\nobreak
|
||||
\CTV\FmTi{#1}\par\nobreak
|
||||
\vskip 60\p@
|
||||
}
|
||||
\renewcommand{\DOTIS}[1]{%
|
||||
\mghrulefill{\RW}\par\nobreak
|
||||
\CTV\FmTi{#1}\par\nobreak
|
||||
\vskip 60\p@
|
||||
}
|
||||
}
|
||||
|
||||
%%%%%%% REJNE DEF
|
||||
|
||||
\DeclareOption{Rejne}{%
|
||||
|
||||
\ChNameUpperCase
|
||||
\ChTitleUpperCase
|
||||
\ChNameVar{\centering\Large\rm}
|
||||
\ChNumVar{\Huge}
|
||||
\ChTitleVar{\centering\Huge\rm}
|
||||
\ChRuleWidth{1pt}
|
||||
\renewcommand{\DOCH}{%
|
||||
\settoheight{\py}{\CNoV\thechapter}
|
||||
\parskip=0pt plus 1pt % Set parskip to default, just in case v1.31
|
||||
\addtolength{\py}{-1pt}
|
||||
\CNV\FmN{\@chapapp}\par\nobreak
|
||||
\vskip 20\p@
|
||||
\setlength{\myhi}{2\baselineskip}
|
||||
\setlength{\px}{\myhi}
|
||||
\addtolength{\px}{-1\RW}
|
||||
\rule[-1\px]{\RW}{\myhi}\mghrulefill{\RW}\hskip
|
||||
10pt\raisebox{-0.5\py}{\CNoV\thechapter}\hskip 10pt\mghrulefill{\RW}\rule[-1\px]{\RW}{\myhi}\par\nobreak
|
||||
\vskip -3\p@% Added -2pt vskip to correct for streched text v1.31
|
||||
}
|
||||
\renewcommand{\DOTI}[1]{%
|
||||
\setlength{\mylen}{\textwidth}
|
||||
\parskip=0pt plus 1pt % Set parskip to default, just in case v1.31
|
||||
\addtolength{\mylen}{-2\RW}
|
||||
{\vrule width\RW}\parbox{\mylen}{\CTV\FmTi{#1}}{\vrule width\RW}\par\nobreak%
|
||||
\vskip -3pt\rule{\RW}{2\baselineskip}\mghrulefill{\RW}\rule{\RW}{2\baselineskip}%
|
||||
\vskip 60\p@% Added -2pt in vskip to correct for streched text v1.31
|
||||
}
|
||||
\renewcommand{\DOTIS}[1]{%
|
||||
\setlength{\py}{\fboxrule}
|
||||
\setlength{\fboxrule}{\RW}
|
||||
\setlength{\mylen}{\textwidth}
|
||||
\addtolength{\mylen}{-2\RW}
|
||||
\fbox{\parbox{\mylen}{\vskip 2\baselineskip\CTV\FmTi{#1}\par\nobreak\vskip \baselineskip}}
|
||||
\setlength{\fboxrule}{\py}
|
||||
\vskip 60\p@
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
%%%%%%% BJARNE DEF
|
||||
|
||||
\DeclareOption{Bjarne}{%
|
||||
\ChNameUpperCase
|
||||
\ChTitleUpperCase
|
||||
\ChNameVar{\raggedleft\normalsize\rm}
|
||||
\ChNumVar{\raggedleft \bfseries\Large}
|
||||
\ChTitleVar{\raggedleft \Large\rm}
|
||||
\ChRuleWidth{1pt}
|
||||
|
||||
|
||||
%% Note thechapter -> c@chapter fix appendix bug
|
||||
%% Fixed misspelled 12
|
||||
|
||||
\newcounter{AlphaCnt}
|
||||
\newcounter{AlphaDecCnt}
|
||||
\newcommand{\AlphaNo}{%
|
||||
\ifcase\number\theAlphaCnt
|
||||
\ifnum\c@chapter=0
|
||||
ZERO\else{}\fi
|
||||
\or ONE\or TWO\or THREE\or FOUR\or FIVE
|
||||
\or SIX\or SEVEN\or EIGHT\or NINE\or TEN
|
||||
\or ELEVEN\or TWELVE\or THIRTEEN\or FOURTEEN\or FIFTEEN
|
||||
\or SIXTEEN\or SEVENTEEN\or EIGHTEEN\or NINETEEN\fi
|
||||
}
|
||||
|
||||
\newcommand{\AlphaDecNo}{%
|
||||
\setcounter{AlphaDecCnt}{0}
|
||||
\@whilenum\number\theAlphaCnt>0\do
|
||||
{\addtocounter{AlphaCnt}{-10}
|
||||
\addtocounter{AlphaDecCnt}{1}}
|
||||
\ifnum\number\theAlphaCnt=0
|
||||
\else
|
||||
\addtocounter{AlphaDecCnt}{-1}
|
||||
\addtocounter{AlphaCnt}{10}
|
||||
\fi
|
||||
|
||||
|
||||
\ifcase\number\theAlphaDecCnt\or TEN\or TWENTY\or THIRTY\or
|
||||
FORTY\or FIFTY\or SIXTY\or SEVENTY\or EIGHTY\or NINETY\fi
|
||||
}
|
||||
\newcommand{\TheAlphaChapter}{%
|
||||
|
||||
\ifinapp
|
||||
\thechapter
|
||||
\else
|
||||
\setcounter{AlphaCnt}{\c@chapter}
|
||||
\ifnum\c@chapter<20
|
||||
\AlphaNo
|
||||
\else
|
||||
\AlphaDecNo\AlphaNo
|
||||
\fi
|
||||
\fi
|
||||
}
|
||||
\renewcommand{\DOCH}{%
|
||||
\mghrulefill{\RW}\par\nobreak
|
||||
\CNV\FmN{\@chapapp}\par\nobreak
|
||||
\CNoV\TheAlphaChapter\par\nobreak
|
||||
\vskip -1\baselineskip\vskip 5pt\mghrulefill{\RW}\par\nobreak
|
||||
\vskip 20\p@
|
||||
}
|
||||
\renewcommand{\DOTI}[1]{%
|
||||
\CTV\FmTi{#1}\par\nobreak
|
||||
\vskip 40\p@
|
||||
}
|
||||
\renewcommand{\DOTIS}[1]{%
|
||||
\CTV\FmTi{#1}\par\nobreak
|
||||
\vskip 40\p@
|
||||
}
|
||||
}
|
||||
|
||||
\DeclareOption*{%
|
||||
\PackageWarning{fancychapter}{unknown style option}
|
||||
}
|
||||
|
||||
\ProcessOptions* \relax
|
||||
|
||||
\ifusecolor
|
||||
\RequirePackage{color}
|
||||
\fi
|
||||
\def\@makechapterhead#1{%
|
||||
\vspace*{50\p@}%
|
||||
{\parindent \z@ \raggedright \normalfont
|
||||
\ifnum \c@secnumdepth >\m@ne
|
||||
\if@mainmatter%%%%% Fix for frontmatter, mainmatter, and backmatter 040920
|
||||
\DOCH
|
||||
\fi
|
||||
\fi
|
||||
\interlinepenalty\@M
|
||||
\if@mainmatter%%%%% Fix for frontmatter, mainmatter, and backmatter 060424
|
||||
\DOTI{#1}%
|
||||
\else%
|
||||
\DOTIS{#1}%
|
||||
\fi
|
||||
}}
|
||||
|
||||
|
||||
%%% Begin: To avoid problem with scrbook.cls (fncychap version 1.32)
|
||||
|
||||
%%OUT:
|
||||
%\def\@schapter#1{\if@twocolumn
|
||||
% \@topnewpage[\@makeschapterhead{#1}]%
|
||||
% \else
|
||||
% \@makeschapterhead{#1}%
|
||||
% \@afterheading
|
||||
% \fi}
|
||||
|
||||
%%IN:
|
||||
\def\@schapter#1{%
|
||||
\if@twocolumn%
|
||||
\@makeschapterhead{#1}%
|
||||
\else%
|
||||
\@makeschapterhead{#1}%
|
||||
\@afterheading%
|
||||
\fi}
|
||||
|
||||
%%% End: To avoid problem with scrbook.cls (fncychap version 1.32)
|
||||
|
||||
\def\@makeschapterhead#1{%
|
||||
\vspace*{50\p@}%
|
||||
{\parindent \z@ \raggedright
|
||||
\normalfont
|
||||
\interlinepenalty\@M
|
||||
\DOTIS{#1}
|
||||
\vskip 40\p@
|
||||
}}
|
||||
|
||||
\endinput
|
||||
|
||||
|
||||
@@ -0,0 +1,66 @@
|
||||
%
|
||||
% howto.cls for Sphinx
|
||||
%
|
||||
|
||||
\NeedsTeXFormat{LaTeX2e}[1995/12/01]
|
||||
\ProvidesClass{howto}[2008/10/18 Document class (Sphinx HOWTO)]
|
||||
|
||||
% Pass all given class options to the parent class.
|
||||
\DeclareOption*{\PassOptionsToClass{\CurrentOption}{article}}
|
||||
\ProcessOptions\relax
|
||||
\LoadClass[twoside]{article}
|
||||
|
||||
% Set some sane defaults for section numbering depth and TOC depth. You can
|
||||
% reset these counters in your preamble.
|
||||
%
|
||||
\setcounter{secnumdepth}{2}
|
||||
|
||||
% Change the title page to look a bit better, and fit in with the fncychap
|
||||
% ``Bjarne'' style a bit better.
|
||||
%
|
||||
\renewcommand{\maketitle}{
|
||||
\rule{\textwidth}{1pt}
|
||||
\ifsphinxpdfoutput
|
||||
\begingroup
|
||||
% This \def is required to deal with multi-line authors; it
|
||||
% changes \\ to ', ' (comma-space), making it pass muster for
|
||||
% generating document info in the PDF file.
|
||||
\def\\{, }
|
||||
\pdfinfo{
|
||||
/Author (\@author)
|
||||
/Title (\@title)
|
||||
}
|
||||
\endgroup
|
||||
\fi
|
||||
\begin{flushright}
|
||||
\sphinxlogo%
|
||||
{\rm\Huge\py@HeaderFamily \@title} \par
|
||||
{\em\large\py@HeaderFamily \py@release\releaseinfo} \par
|
||||
\vspace{25pt}
|
||||
{\Large\py@HeaderFamily \@author} \par
|
||||
\vspace{25pt}
|
||||
\@date \par
|
||||
\py@authoraddress \par
|
||||
\end{flushright}
|
||||
\@thanks
|
||||
\setcounter{footnote}{0}
|
||||
\let\thanks\relax\let\maketitle\relax
|
||||
%\gdef\@thanks{}\gdef\@author{}\gdef\@title{}
|
||||
}
|
||||
|
||||
\let\py@OldTableofcontents=\tableofcontents
|
||||
\renewcommand{\tableofcontents}{
|
||||
\begingroup
|
||||
\parskip = 0mm
|
||||
\py@OldTableofcontents
|
||||
\endgroup
|
||||
\rule{\textwidth}{1pt}
|
||||
\vspace{12pt}
|
||||
}
|
||||
|
||||
\@ifundefined{fancyhf}{
|
||||
\pagestyle{plain}}{
|
||||
\pagestyle{normal}} % start this way; change for
|
||||
\pagenumbering{arabic} % ToC & chapters
|
||||
|
||||
\thispagestyle{empty}
|
||||
@@ -0,0 +1,103 @@
|
||||
%
|
||||
% manual.cls for Sphinx
|
||||
%
|
||||
|
||||
\NeedsTeXFormat{LaTeX2e}[1995/12/01]
|
||||
\ProvidesClass{manual}[2008/10/18 Document class (Sphinx manual)]
|
||||
|
||||
% Pass all given class options to the parent class.
|
||||
\DeclareOption*{\PassOptionsToClass{\CurrentOption}{report}}
|
||||
\ProcessOptions\relax
|
||||
\LoadClass[twoside,openright]{report}
|
||||
|
||||
% Set some sane defaults for section numbering depth and TOC depth. You can
|
||||
% reset these counters in your preamble.
|
||||
%
|
||||
\setcounter{secnumdepth}{2}
|
||||
\setcounter{tocdepth}{1}
|
||||
|
||||
% Change the title page to look a bit better, and fit in with the fncychap
|
||||
% ``Bjarne'' style a bit better.
|
||||
%
|
||||
\renewcommand{\maketitle}{%
|
||||
\begin{titlepage}%
|
||||
\let\footnotesize\small
|
||||
\let\footnoterule\relax
|
||||
\rule{\textwidth}{1pt}%
|
||||
\ifsphinxpdfoutput
|
||||
\begingroup
|
||||
% This \def is required to deal with multi-line authors; it
|
||||
% changes \\ to ', ' (comma-space), making it pass muster for
|
||||
% generating document info in the PDF file.
|
||||
\def\\{, }
|
||||
\pdfinfo{
|
||||
/Author (\@author)
|
||||
/Title (\@title)
|
||||
}
|
||||
\endgroup
|
||||
\fi
|
||||
\begin{flushright}%
|
||||
\sphinxlogo%
|
||||
{\rm\Huge\py@HeaderFamily \@title \par}%
|
||||
{\em\LARGE\py@HeaderFamily \py@release\releaseinfo \par}
|
||||
\vfill
|
||||
{\LARGE\py@HeaderFamily \@author \par}
|
||||
\vfill\vfill
|
||||
{\large
|
||||
\@date \par
|
||||
\vfill
|
||||
\py@authoraddress \par
|
||||
}%
|
||||
\end{flushright}%\par
|
||||
\@thanks
|
||||
\end{titlepage}%
|
||||
\cleardoublepage%
|
||||
\setcounter{footnote}{0}%
|
||||
\let\thanks\relax\let\maketitle\relax
|
||||
%\gdef\@thanks{}\gdef\@author{}\gdef\@title{}
|
||||
}
|
||||
|
||||
|
||||
% Catch the end of the {abstract} environment, but here make sure the abstract
|
||||
% is followed by a blank page if the 'openright' option is used.
|
||||
%
|
||||
\let\py@OldEndAbstract=\endabstract
|
||||
\renewcommand{\endabstract}{
|
||||
\if@openright
|
||||
\ifodd\value{page}
|
||||
\typeout{Adding blank page after the abstract.}
|
||||
\vfil\pagebreak
|
||||
\fi
|
||||
\fi
|
||||
\py@OldEndAbstract
|
||||
}
|
||||
|
||||
% This wraps the \tableofcontents macro with all the magic to get the spacing
|
||||
% right and have the right number of pages if the 'openright' option has been
|
||||
% used. This eliminates a fair amount of crud in the individual document files.
|
||||
%
|
||||
\let\py@OldTableofcontents=\tableofcontents
|
||||
\renewcommand{\tableofcontents}{%
|
||||
\setcounter{page}{1}%
|
||||
\pagebreak%
|
||||
\pagestyle{plain}%
|
||||
{%
|
||||
\parskip = 0mm%
|
||||
\py@OldTableofcontents%
|
||||
\if@openright%
|
||||
\ifodd\value{page}%
|
||||
\typeout{Adding blank page after the table of contents.}%
|
||||
\pagebreak\hspace{0pt}%
|
||||
\fi%
|
||||
\fi%
|
||||
\cleardoublepage%
|
||||
}%
|
||||
\pagenumbering{arabic}%
|
||||
\@ifundefined{fancyhf}{}{\pagestyle{normal}}%
|
||||
}
|
||||
|
||||
% This is needed to get the width of the section # area wide enough in the
|
||||
% library reference. Doing it here keeps it the same for all the manuals.
|
||||
%
|
||||
\renewcommand*\l@section{\@dottedtocline{1}{1.5em}{2.6em}}
|
||||
\renewcommand*\l@subsection{\@dottedtocline{2}{4.1em}{3.5em}}
|
||||
@@ -0,0 +1,5 @@
|
||||
This is makeindex, version 2.15 [20-Nov-2007] (kpathsea + Thai support).
|
||||
Scanning style file ./python.ist......done (6 attributes redefined, 0 ignored).
|
||||
Scanning input file modOBITools.idx...done (0 entries accepted, 0 rejected).
|
||||
Nothing written in modOBITools.ind.
|
||||
Transcript written in modOBITools.ilg.
|
||||
@@ -0,0 +1,11 @@
|
||||
line_max 100
|
||||
headings_flag 1
|
||||
heading_prefix " \\bigletter "
|
||||
|
||||
preamble "\\begin{theindex}
|
||||
\\def\\bigletter#1{{\\Large\\sffamily#1}\\nopagebreak\\vspace{1mm}}
|
||||
|
||||
"
|
||||
|
||||
symhead_positive "{Symbols}"
|
||||
numhead_positive "{Numbers}"
|
||||
@@ -0,0 +1,744 @@
|
||||
%
|
||||
% sphinx.sty
|
||||
%
|
||||
% Adapted from the old python.sty, mostly written by Fred Drake,
|
||||
% by Georg Brandl.
|
||||
%
|
||||
|
||||
\NeedsTeXFormat{LaTeX2e}[1995/12/01]
|
||||
\ProvidesPackage{sphinx}[2008/05/01 LaTeX package (Sphinx markup)]
|
||||
|
||||
\RequirePackage{textcomp}
|
||||
\RequirePackage{fancyhdr}
|
||||
\RequirePackage{fancybox}
|
||||
\RequirePackage{titlesec}
|
||||
\RequirePackage{tabulary}
|
||||
\RequirePackage{amsmath} % for \text
|
||||
\RequirePackage{makeidx}
|
||||
\RequirePackage{framed}
|
||||
\RequirePackage{color}
|
||||
% For highlighted code.
|
||||
\RequirePackage{fancyvrb}
|
||||
% For table captions.
|
||||
\RequirePackage{threeparttable}
|
||||
% Handle footnotes in tables.
|
||||
\RequirePackage{footnote}
|
||||
\makesavenoteenv{tabulary}
|
||||
% For floating figures in the text.
|
||||
\RequirePackage{wrapfig}
|
||||
% Separate paragraphs by space by default.
|
||||
\RequirePackage{parskip}
|
||||
|
||||
% Redefine these colors to your liking in the preamble.
|
||||
\definecolor{TitleColor}{rgb}{0.126,0.263,0.361}
|
||||
\definecolor{InnerLinkColor}{rgb}{0.208,0.374,0.486}
|
||||
\definecolor{OuterLinkColor}{rgb}{0.216,0.439,0.388}
|
||||
% Redefine these colors to something not white if you want to have colored
|
||||
% background and border for code examples.
|
||||
\definecolor{VerbatimColor}{rgb}{1,1,1}
|
||||
\definecolor{VerbatimBorderColor}{rgb}{1,1,1}
|
||||
|
||||
% Uncomment these two lines to ignore the paper size and make the page
|
||||
% size more like a typical published manual.
|
||||
%\renewcommand{\paperheight}{9in}
|
||||
%\renewcommand{\paperwidth}{8.5in} % typical squarish manual
|
||||
%\renewcommand{\paperwidth}{7in} % O'Reilly ``Programmming Python''
|
||||
|
||||
% For graphicx, check if we are compiling under latex or pdflatex.
|
||||
\ifx\pdftexversion\undefined
|
||||
\usepackage{graphicx}
|
||||
\else
|
||||
\usepackage[pdftex]{graphicx}
|
||||
\fi
|
||||
|
||||
% for PDF output, use colors and maximal compression
|
||||
\newif\ifsphinxpdfoutput\sphinxpdfoutputfalse
|
||||
\ifx\pdfoutput\undefined\else\ifcase\pdfoutput
|
||||
\let\py@NormalColor\relax
|
||||
\let\py@TitleColor\relax
|
||||
\else
|
||||
\sphinxpdfoutputtrue
|
||||
\input{pdfcolor}
|
||||
\def\py@NormalColor{\color[rgb]{0.0,0.0,0.0}}
|
||||
\def\py@TitleColor{\color{TitleColor}}
|
||||
\pdfcompresslevel=9
|
||||
\fi\fi
|
||||
|
||||
% XeLaTeX can do colors, too
|
||||
\ifx\XeTeXrevision\undefined\else
|
||||
\def\py@NormalColor{\color[rgb]{0.0,0.0,0.0}}
|
||||
\def\py@TitleColor{\color{TitleColor}}
|
||||
\fi
|
||||
|
||||
% Increase printable page size (copied from fullpage.sty)
|
||||
\topmargin 0pt
|
||||
\advance \topmargin by -\headheight
|
||||
\advance \topmargin by -\headsep
|
||||
|
||||
% attempt to work a little better for A4 users
|
||||
\textheight \paperheight
|
||||
\advance\textheight by -2in
|
||||
|
||||
\oddsidemargin 0pt
|
||||
\evensidemargin 0pt
|
||||
%\evensidemargin -.25in % for ``manual size'' documents
|
||||
\marginparwidth 0.5in
|
||||
|
||||
\textwidth \paperwidth
|
||||
\advance\textwidth by -2in
|
||||
|
||||
|
||||
% Style parameters and macros used by most documents here
|
||||
\raggedbottom
|
||||
\sloppy
|
||||
\hbadness = 5000 % don't print trivial gripes
|
||||
|
||||
\pagestyle{empty} % start this way; change for
|
||||
\pagenumbering{roman} % ToC & chapters
|
||||
|
||||
% Use this to set the font family for headers and other decor:
|
||||
\newcommand{\py@HeaderFamily}{\sffamily\bfseries}
|
||||
|
||||
% Redefine the 'normal' header/footer style when using "fancyhdr" package:
|
||||
\@ifundefined{fancyhf}{}{
|
||||
% Use \pagestyle{normal} as the primary pagestyle for text.
|
||||
\fancypagestyle{normal}{
|
||||
\fancyhf{}
|
||||
\fancyfoot[LE,RO]{{\py@HeaderFamily\thepage}}
|
||||
\fancyfoot[LO]{{\py@HeaderFamily\nouppercase{\rightmark}}}
|
||||
\fancyfoot[RE]{{\py@HeaderFamily\nouppercase{\leftmark}}}
|
||||
\fancyhead[LE,RO]{{\py@HeaderFamily \@title, \py@release}}
|
||||
\renewcommand{\headrulewidth}{0.4pt}
|
||||
\renewcommand{\footrulewidth}{0.4pt}
|
||||
}
|
||||
% Update the plain style so we get the page number & footer line,
|
||||
% but not a chapter or section title. This is to keep the first
|
||||
% page of a chapter and the blank page between chapters `clean.'
|
||||
\fancypagestyle{plain}{
|
||||
\fancyhf{}
|
||||
\fancyfoot[LE,RO]{{\py@HeaderFamily\thepage}}
|
||||
\renewcommand{\headrulewidth}{0pt}
|
||||
\renewcommand{\footrulewidth}{0.4pt}
|
||||
}
|
||||
}
|
||||
|
||||
% Some custom font markup commands.
|
||||
%
|
||||
\newcommand{\strong}[1]{{\bf #1}}
|
||||
\newcommand{\code}[1]{\texttt{#1}}
|
||||
\newcommand{\bfcode}[1]{\code{\bfseries#1}}
|
||||
\newcommand{\samp}[1]{`\code{#1}'}
|
||||
\newcommand{\email}[1]{\textsf{#1}}
|
||||
|
||||
\newcommand{\py@modulebadkey}{{--just-some-junk--}}
|
||||
|
||||
% Redefine the Verbatim environment to allow border and background colors.
|
||||
% The original environment is still used for verbatims within tables.
|
||||
\let\OriginalVerbatim=\Verbatim
|
||||
\let\endOriginalVerbatim=\endVerbatim
|
||||
|
||||
% Play with vspace to be able to keep the indentation.
|
||||
\newlength\distancetoright
|
||||
\newlength\leftsidespace
|
||||
\def\mycolorbox#1{%
|
||||
\setlength\leftsidespace{\@totalleftmargin}%
|
||||
\setlength\distancetoright{\textwidth}%
|
||||
\advance\distancetoright -\@totalleftmargin %
|
||||
\noindent\hspace*{\@totalleftmargin}%
|
||||
\fcolorbox{VerbatimBorderColor}{VerbatimColor}{%
|
||||
\begin{minipage}{\distancetoright}%
|
||||
\smallskip%
|
||||
\noindent\hspace*{-\leftsidespace}%
|
||||
#1
|
||||
\end{minipage}%
|
||||
}%
|
||||
}
|
||||
\def\FrameCommand{\mycolorbox}
|
||||
|
||||
\renewcommand{\Verbatim}[1][1]{%
|
||||
% The list environement is needed to control perfectly the vertical
|
||||
% space.
|
||||
\list{}{%
|
||||
\setlength\parskip{0pt}%
|
||||
\setlength\itemsep{0ex}%
|
||||
\setlength\topsep{0ex}%
|
||||
\setlength\partopsep{0pt}%
|
||||
\setlength\leftmargin{0pt}%
|
||||
}%
|
||||
\item\MakeFramed {\FrameRestore}%
|
||||
\small%
|
||||
\OriginalVerbatim[#1]%
|
||||
}
|
||||
\renewcommand{\endVerbatim}{%
|
||||
\endOriginalVerbatim%
|
||||
\endMakeFramed%
|
||||
\endlist%
|
||||
}
|
||||
|
||||
|
||||
% Index-entry generation support.
|
||||
%
|
||||
|
||||
% Command to generate two index entries (using subentries)
|
||||
\newcommand{\indexii}[2]{\index{#1!#2}\index{#2!#1}}
|
||||
|
||||
% And three entries (using only one level of subentries)
|
||||
\newcommand{\indexiii}[3]{\index{#1!#2 #3}\index{#2!#3, #1}\index{#3!#1 #2}}
|
||||
|
||||
% And four (again, using only one level of subentries)
|
||||
\newcommand{\indexiv}[4]{
|
||||
\index{#1!#2 #3 #4}
|
||||
\index{#2!#3 #4, #1}
|
||||
\index{#3!#4, #1 #2}
|
||||
\index{#4!#1 #2 #3}
|
||||
}
|
||||
|
||||
% support for the module index
|
||||
\newif\ifpy@UseModuleIndex
|
||||
\py@UseModuleIndexfalse
|
||||
|
||||
\newcommand{\makemodindex}{
|
||||
\newwrite\modindexfile
|
||||
\openout\modindexfile=mod\jobname.idx
|
||||
\py@UseModuleIndextrue
|
||||
}
|
||||
|
||||
\newcommand{\printmodindex}{
|
||||
\@input@{mod\jobname.ind}
|
||||
}
|
||||
|
||||
% Add the defining entry for a module
|
||||
\newcommand{\py@modindex}[2]{%
|
||||
\renewcommand{\py@thismodule}{#1}
|
||||
\ifpy@UseModuleIndex%
|
||||
\@ifundefined{py@modplat@\py@thismodulekey}{
|
||||
\write\modindexfile{\protect\indexentry{#1@{\texttt{#1}}|hyperpage}{\thepage}}%
|
||||
}{\write\modindexfile{\protect\indexentry{#1@{\texttt{#1 }%
|
||||
\emph{(\platformof{\py@thismodulekey})}}|hyperpage}{\thepage}}%
|
||||
}
|
||||
\fi%
|
||||
}
|
||||
|
||||
% "Current" keys
|
||||
\newcommand{\py@thisclass}{}
|
||||
\newcommand{\py@thismodule}{}
|
||||
\newcommand{\py@thismodulekey}{}
|
||||
\newcommand{\py@thismoduletype}{}
|
||||
\newcommand{\py@emptymodule}{}
|
||||
|
||||
% \declaremodule[key]{type}{name}
|
||||
\newcommand{\declaremodule}[3][\py@modulebadkey]{
|
||||
\renewcommand{\py@thismoduletype}{#2}
|
||||
\ifx\py@modulebadkey#1
|
||||
\renewcommand{\py@thismodulekey}{#3}
|
||||
\else
|
||||
\renewcommand{\py@thismodulekey}{#1}
|
||||
\fi
|
||||
\py@modindex{#3}{}
|
||||
%\label{module-\py@thismodulekey}
|
||||
}
|
||||
|
||||
% Record module platforms for the Module Index
|
||||
\newif\ifpy@ModPlatformFileIsOpen \py@ModPlatformFileIsOpenfalse
|
||||
\long\def\py@writeModPlatformFile#1{%
|
||||
\protected@write\py@ModPlatformFile%
|
||||
{\let\label\@gobble \let\index\@gobble \let\glossary\@gobble}%
|
||||
{\string#1}%
|
||||
}
|
||||
\newcommand{\py@ModPlatformFilename}{\jobname.pla}
|
||||
\newcommand{\platform}[1]{
|
||||
\ifpy@ModPlatformFileIsOpen\else
|
||||
\newwrite\py@ModPlatformFile
|
||||
\openout\py@ModPlatformFile=\py@ModPlatformFilename
|
||||
\py@ModPlatformFileIsOpentrue
|
||||
\fi
|
||||
\py@writeModPlatformFile{\py@defplatform{\py@thismodulekey}{#1}}
|
||||
}
|
||||
\newcommand{\py@defplatform}[2]{\expandafter\def\csname py@modplat@#1\endcsname{#2}}
|
||||
\newcommand{\platformof}[1]{\csname py@modplat@#1\endcsname}
|
||||
|
||||
\InputIfFileExists{\jobname.pla}{}{}
|
||||
|
||||
% \moduleauthor{name}{email}
|
||||
\newcommand{\moduleauthor}[2]{}
|
||||
|
||||
% \sectionauthor{name}{email}
|
||||
\newcommand{\sectionauthor}[2]{}
|
||||
|
||||
% Ignore module synopsis.
|
||||
\newcommand{\modulesynopsis}[1]{}
|
||||
|
||||
% Reset "current" objects.
|
||||
\newcommand{\resetcurrentobjects}{
|
||||
\renewcommand{\py@thisclass}{}
|
||||
\renewcommand{\py@thismodule}{}
|
||||
\renewcommand{\py@thismodulekey}{}
|
||||
\renewcommand{\py@thismoduletype}{}
|
||||
}
|
||||
|
||||
% Augment the sectioning commands used to get our own font family in place,
|
||||
% and reset some internal data items:
|
||||
\titleformat{\section}{\Large\py@HeaderFamily}%
|
||||
{\py@TitleColor\thesection}{0.5em}{\py@TitleColor}{\py@NormalColor}
|
||||
\titleformat{\subsection}{\large\py@HeaderFamily}%
|
||||
{\py@TitleColor\thesubsection}{0.5em}{\py@TitleColor}{\py@NormalColor}
|
||||
\titleformat{\subsubsection}{\py@HeaderFamily}%
|
||||
{\py@TitleColor\thesubsubsection}{0.5em}{\py@TitleColor}{\py@NormalColor}
|
||||
\titleformat{\paragraph}{\large\py@HeaderFamily}%
|
||||
{\py@TitleColor}{0em}{\py@TitleColor}{\py@NormalColor}
|
||||
|
||||
|
||||
% Now for a lot of semantically-loaded environments that do a ton of magical
|
||||
% things to get the right formatting and index entries for the stuff in
|
||||
% Python modules and C API.
|
||||
|
||||
|
||||
% {fulllineitems} is used in one place in libregex.tex, but is really for
|
||||
% internal use in this file.
|
||||
%
|
||||
\newcommand{\py@itemnewline}[1]{%
|
||||
\@tempdima\linewidth%
|
||||
\advance\@tempdima \leftmargin\makebox[\@tempdima][l]{#1}%
|
||||
}
|
||||
|
||||
\newenvironment{fulllineitems}{
|
||||
\begin{list}{}{\labelwidth \leftmargin \labelsep 0pt
|
||||
\rightmargin 0pt \topsep -\parskip \partopsep \parskip
|
||||
\itemsep -\parsep
|
||||
\let\makelabel=\py@itemnewline}
|
||||
}{\end{list}}
|
||||
|
||||
% \optional is mostly for use in the arguments parameters to the various
|
||||
% {*desc} environments defined below, but may be used elsewhere. Known to
|
||||
% be used in the debugger chapter.
|
||||
%
|
||||
% Typical usage:
|
||||
%
|
||||
% \begin{funcdesc}{myfunc}{reqparm\optional{, optparm}}
|
||||
% ^^^ ^^^
|
||||
% No space here No space here
|
||||
%
|
||||
% When a function has multiple optional parameters, \optional should be
|
||||
% nested, not chained. This is right:
|
||||
%
|
||||
% \begin{funcdesc}{myfunc}{\optional{parm1\optional{, parm2}}}
|
||||
%
|
||||
\let\py@badkey=\@undefined
|
||||
|
||||
\newcommand{\optional}[1]{%
|
||||
{\textnormal{\Large[}}{#1}\hspace{0.5mm}{\textnormal{\Large]}}}
|
||||
|
||||
% This can be used when a function or method accepts an varying number
|
||||
% of arguments, such as by using the *args syntax in the parameter list.
|
||||
\newcommand{\py@moreargs}{...}
|
||||
|
||||
% This can be used when you don't want to document the parameters to a
|
||||
% function or method, but simply state that it's an alias for
|
||||
% something else.
|
||||
\newcommand{\py@unspecified}{...}
|
||||
|
||||
\newcommand{\py@varvars}[1]{{%
|
||||
{\let\unspecified=\py@unspecified%
|
||||
\let\moreargs=\py@moreargs%
|
||||
\emph{#1}}}}
|
||||
|
||||
\newlength{\py@argswidth}
|
||||
\newcommand{\py@sigparams}[1]{%
|
||||
\parbox[t]{\py@argswidth}{\py@varvars{#1}\code{)}}}
|
||||
\newcommand{\py@sigline}[2]{%
|
||||
\settowidth{\py@argswidth}{#1\code{(}}%
|
||||
\addtolength{\py@argswidth}{-2\py@argswidth}%
|
||||
\addtolength{\py@argswidth}{\textwidth}%
|
||||
\item[#1\code{(}\py@sigparams{#2}]}
|
||||
|
||||
% C functions ------------------------------------------------------------
|
||||
% \begin{cfuncdesc}[refcount]{type}{name}{arglist}
|
||||
% Note that the [refcount] slot should only be filled in by
|
||||
% tools/anno-api.py; it pulls the value from the refcounts database.
|
||||
\newcommand{\cfuncline}[3]{
|
||||
\py@sigline{\code{#1 \bfcode{#2}}}{#3}%
|
||||
}
|
||||
\newenvironment{cfuncdesc}[3]{
|
||||
\begin{fulllineitems}
|
||||
\cfuncline{#1}{#2}{#3}
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% C variables ------------------------------------------------------------
|
||||
% \begin{cvardesc}{type}{name}
|
||||
\newenvironment{cvardesc}[2]{
|
||||
\begin{fulllineitems}
|
||||
\item[\code{#1 \bfcode{#2}}]
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% C data types -----------------------------------------------------------
|
||||
% \begin{ctypedesc}[index name]{typedef name}
|
||||
\newenvironment{ctypedesc}[2][\py@badkey]{
|
||||
\begin{fulllineitems}
|
||||
\item[\bfcode{#2}]
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% C type fields ----------------------------------------------------------
|
||||
% \begin{cmemberdesc}{container type}{ctype}{membername}
|
||||
\newcommand{\cmemberline}[3]{
|
||||
\item[\code{#2 \bfcode{#3}}]
|
||||
}
|
||||
\newenvironment{cmemberdesc}[3]{
|
||||
\begin{fulllineitems}
|
||||
\cmemberline{#1}{#2}{#3}
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% Funky macros -----------------------------------------------------------
|
||||
% \begin{csimplemacrodesc}{name}
|
||||
% -- "simple" because it has no args; NOT for constant definitions!
|
||||
\newenvironment{csimplemacrodesc}[1]{
|
||||
\begin{fulllineitems}
|
||||
\item[\bfcode{#1}]
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% simple functions (not methods) -----------------------------------------
|
||||
% \begin{funcdesc}{name}{args}
|
||||
\newcommand{\funcline}[2]{%
|
||||
\py@sigline{\bfcode{#1}}{#2}}
|
||||
\newenvironment{funcdesc}[2]{
|
||||
\begin{fulllineitems}
|
||||
\funcline{#1}{#2}
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% classes ----------------------------------------------------------------
|
||||
% \begin{classdesc}{name}{constructor args}
|
||||
\newcommand{\classline}[2]{
|
||||
\py@sigline{\strong{class }\bfcode{#1}}{#2}}
|
||||
\newenvironment{classdesc}[2]{
|
||||
% Using \renewcommand doesn't work for this, for unknown reasons:
|
||||
\global\def\py@thisclass{#1}
|
||||
\begin{fulllineitems}
|
||||
\classline{#1}{#2}
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% \begin{excclassdesc}{name}{constructor args}
|
||||
% but indexes as an exception
|
||||
\newenvironment{excclassdesc}[2]{
|
||||
% Using \renewcommand doesn't work for this, for unknown reasons:
|
||||
\global\def\py@thisclass{#1}
|
||||
\begin{fulllineitems}
|
||||
\py@sigline{\strong{exception }\bfcode{#1}}{#2}%
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% There is no corresponding {excclassdesc*} environment. To describe
|
||||
% a class exception without parameters, use the {excdesc} environment.
|
||||
|
||||
|
||||
\let\py@classbadkey=\@undefined
|
||||
|
||||
% object method ----------------------------------------------------------
|
||||
% \begin{methoddesc}[classname]{methodname}{args}
|
||||
\newcommand{\methodline}[3][\@undefined]{
|
||||
\py@sigline{\bfcode{#2}}{#3}}
|
||||
\newenvironment{methoddesc}[3][\@undefined]{
|
||||
\begin{fulllineitems}
|
||||
\ifx\@undefined#1\relax
|
||||
\methodline{#2}{#3}
|
||||
\else
|
||||
\def\py@thisclass{#1}
|
||||
\methodline{#2}{#3}
|
||||
\fi
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% static method ----------------------------------------------------------
|
||||
% \begin{staticmethoddesc}[classname]{methodname}{args}
|
||||
\newcommand{\staticmethodline}[3][\@undefined]{
|
||||
\py@sigline{static \bfcode{#2}}{#3}}
|
||||
\newenvironment{staticmethoddesc}[3][\@undefined]{
|
||||
\begin{fulllineitems}
|
||||
\ifx\@undefined#1\relax
|
||||
\staticmethodline{#2}{#3}
|
||||
\else
|
||||
\def\py@thisclass{#1}
|
||||
\staticmethodline{#2}{#3}
|
||||
\fi
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% class method ----------------------------------------------------------
|
||||
% \begin{classmethoddesc}[classname]{methodname}{args}
|
||||
\newcommand{\classmethodline}[3][\@undefined]{
|
||||
\py@sigline{class \bfcode{#2}}{#3}}
|
||||
\newenvironment{classmethoddesc}[3][\@undefined]{
|
||||
\begin{fulllineitems}
|
||||
\ifx\@undefined#1\relax
|
||||
\classmethodline{#2}{#3}
|
||||
\else
|
||||
\def\py@thisclass{#1}
|
||||
\classmethodline{#2}{#3}
|
||||
\fi
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% object data attribute --------------------------------------------------
|
||||
% \begin{memberdesc}[classname]{membername}
|
||||
\newcommand{\memberline}[2][\py@classbadkey]{%
|
||||
\ifx\@undefined#1\relax
|
||||
\item[\bfcode{#2}]
|
||||
\else
|
||||
\item[\bfcode{#2}]
|
||||
\fi
|
||||
}
|
||||
\newenvironment{memberdesc}[2][\py@classbadkey]{
|
||||
\begin{fulllineitems}
|
||||
\ifx\@undefined#1\relax
|
||||
\memberline{#2}
|
||||
\else
|
||||
\def\py@thisclass{#1}
|
||||
\memberline{#2}
|
||||
\fi
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% For exceptions: --------------------------------------------------------
|
||||
% \begin{excdesc}{name}
|
||||
% -- for constructor information, use excclassdesc instead
|
||||
\newenvironment{excdesc}[1]{
|
||||
\begin{fulllineitems}
|
||||
\item[\strong{exception }\bfcode{#1}]
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% Module data or constants: ----------------------------------------------
|
||||
% \begin{datadesc}{name}
|
||||
\newcommand{\dataline}[1]{%
|
||||
\item[\bfcode{#1}]\nopagebreak}
|
||||
\newenvironment{datadesc}[1]{
|
||||
\begin{fulllineitems}
|
||||
\dataline{#1}
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% bytecode instruction ---------------------------------------------------
|
||||
% \begin{opcodedesc}{name}{var}
|
||||
% -- {var} may be {}
|
||||
\newenvironment{opcodedesc}[2]{
|
||||
\begin{fulllineitems}
|
||||
\item[\bfcode{#1}\quad\emph{#2}]
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% generic description ----------------------------------------------------
|
||||
\newcommand{\descline}[1]{%
|
||||
\item[\bfcode{#1}]\nopagebreak%
|
||||
}
|
||||
\newenvironment{describe}[1]{
|
||||
\begin{fulllineitems}
|
||||
\descline{#1}
|
||||
}{\end{fulllineitems}}
|
||||
|
||||
% This version is being checked in for the historical record; it shows
|
||||
% how I've managed to get some aspects of this to work. It will not
|
||||
% be used in practice, so a subsequent revision will change things
|
||||
% again. This version has problems, but shows how to do something
|
||||
% that proved more tedious than I'd expected, so I don't want to lose
|
||||
% the example completely.
|
||||
%
|
||||
\newcommand{\grammartoken}[1]{\texttt{#1}}
|
||||
\newenvironment{productionlist}[1][\py@badkey]{
|
||||
\def\optional##1{{\Large[}##1{\Large]}}
|
||||
\def\production##1##2{\code{##1}&::=&\code{##2}\\}
|
||||
\def\productioncont##1{& &\code{##1}\\}
|
||||
\def\token##1{##1}
|
||||
\let\grammartoken=\token
|
||||
\parindent=2em
|
||||
\indent
|
||||
\begin{tabular}{lcl}
|
||||
}{%
|
||||
\end{tabular}
|
||||
}
|
||||
|
||||
% Notices / Admonitions
|
||||
%
|
||||
\newlength{\py@noticelength}
|
||||
|
||||
\newcommand{\py@heavybox}{
|
||||
\setlength{\fboxrule}{1pt}
|
||||
\setlength{\fboxsep}{7pt}
|
||||
\setlength{\py@noticelength}{\linewidth}
|
||||
\addtolength{\py@noticelength}{-2\fboxsep}
|
||||
\addtolength{\py@noticelength}{-2\fboxrule}
|
||||
\setlength{\shadowsize}{3pt}
|
||||
\Sbox
|
||||
\minipage{\py@noticelength}
|
||||
}
|
||||
\newcommand{\py@endheavybox}{
|
||||
\endminipage
|
||||
\endSbox
|
||||
\fbox{\TheSbox}
|
||||
}
|
||||
|
||||
% Some are quite plain:
|
||||
\newcommand{\py@noticestart@note}{}
|
||||
\newcommand{\py@noticeend@note}{}
|
||||
\newcommand{\py@noticestart@hint}{}
|
||||
\newcommand{\py@noticeend@hint}{}
|
||||
\newcommand{\py@noticestart@important}{}
|
||||
\newcommand{\py@noticeend@important}{}
|
||||
\newcommand{\py@noticestart@tip}{}
|
||||
\newcommand{\py@noticeend@tip}{}
|
||||
|
||||
% Others gets more visible distinction:
|
||||
\newcommand{\py@noticestart@warning}{\py@heavybox}
|
||||
\newcommand{\py@noticeend@warning}{\py@endheavybox}
|
||||
\newcommand{\py@noticestart@caution}{\py@heavybox}
|
||||
\newcommand{\py@noticeend@caution}{\py@endheavybox}
|
||||
\newcommand{\py@noticestart@attention}{\py@heavybox}
|
||||
\newcommand{\py@noticeend@attention}{\py@endheavybox}
|
||||
\newcommand{\py@noticestart@danger}{\py@heavybox}
|
||||
\newcommand{\py@noticeend@danger}{\py@endheavybox}
|
||||
\newcommand{\py@noticestart@error}{\py@heavybox}
|
||||
\newcommand{\py@noticeend@error}{\py@endheavybox}
|
||||
|
||||
\newenvironment{notice}[2]{
|
||||
\def\py@noticetype{#1}
|
||||
\csname py@noticestart@#1\endcsname
|
||||
\par\strong{#2}
|
||||
}{\csname py@noticeend@\py@noticetype\endcsname}
|
||||
|
||||
% Allow the release number to be specified independently of the
|
||||
% \date{}. This allows the date to reflect the document's date and
|
||||
% release to specify the release that is documented.
|
||||
%
|
||||
\newcommand{\py@release}{}
|
||||
\newcommand{\version}{}
|
||||
\newcommand{\shortversion}{}
|
||||
\newcommand{\releaseinfo}{}
|
||||
\newcommand{\releasename}{Release}
|
||||
\newcommand{\release}[1]{%
|
||||
\renewcommand{\py@release}{\releasename\space\version}%
|
||||
\renewcommand{\version}{#1}}
|
||||
\newcommand{\setshortversion}[1]{%
|
||||
\renewcommand{\shortversion}{#1}}
|
||||
\newcommand{\setreleaseinfo}[1]{%
|
||||
\renewcommand{\releaseinfo}{#1}}
|
||||
|
||||
% Allow specification of the author's address separately from the
|
||||
% author's name. This can be used to format them differently, which
|
||||
% is a good thing.
|
||||
%
|
||||
\newcommand{\py@authoraddress}{}
|
||||
\newcommand{\authoraddress}[1]{\renewcommand{\py@authoraddress}{#1}}
|
||||
|
||||
% This sets up the fancy chapter headings that make the documents look
|
||||
% at least a little better than the usual LaTeX output.
|
||||
%
|
||||
\@ifundefined{ChTitleVar}{}{
|
||||
\ChNameVar{\raggedleft\normalsize\py@HeaderFamily}
|
||||
\ChNumVar{\raggedleft \bfseries\Large\py@HeaderFamily}
|
||||
\ChTitleVar{\raggedleft \rm\Huge\py@HeaderFamily}
|
||||
% This creates chapter heads without the leading \vspace*{}:
|
||||
\def\@makechapterhead#1{%
|
||||
{\parindent \z@ \raggedright \normalfont
|
||||
\ifnum \c@secnumdepth >\m@ne
|
||||
\DOCH
|
||||
\fi
|
||||
\interlinepenalty\@M
|
||||
\DOTI{#1}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
% Redefine description environment so that it is usable inside fulllineitems.
|
||||
%
|
||||
\renewcommand{\description}{%
|
||||
\list{}{\labelwidth\z@%
|
||||
\itemindent-\leftmargin%
|
||||
\labelsep5pt%
|
||||
\let\makelabel=\descriptionlabel}}
|
||||
|
||||
% Definition lists; requested by AMK for HOWTO documents. Probably useful
|
||||
% elsewhere as well, so keep in in the general style support.
|
||||
%
|
||||
\newenvironment{definitions}{%
|
||||
\begin{description}%
|
||||
\def\term##1{\item[##1]\mbox{}\\*[0mm]}
|
||||
}{%
|
||||
\end{description}%
|
||||
}
|
||||
|
||||
% Tell TeX about pathological hyphenation cases:
|
||||
\hyphenation{Base-HTTP-Re-quest-Hand-ler}
|
||||
|
||||
|
||||
% The following is stuff copied from docutils' latex writer.
|
||||
%
|
||||
\newcommand{\optionlistlabel}[1]{\bf #1 \hfill}
|
||||
\newenvironment{optionlist}[1]
|
||||
{\begin{list}{}
|
||||
{\setlength{\labelwidth}{#1}
|
||||
\setlength{\rightmargin}{1cm}
|
||||
\setlength{\leftmargin}{\rightmargin}
|
||||
\addtolength{\leftmargin}{\labelwidth}
|
||||
\addtolength{\leftmargin}{\labelsep}
|
||||
\renewcommand{\makelabel}{\optionlistlabel}}
|
||||
}{\end{list}}
|
||||
|
||||
\newlength{\lineblockindentation}
|
||||
\setlength{\lineblockindentation}{2.5em}
|
||||
\newenvironment{lineblock}[1]
|
||||
{\begin{list}{}
|
||||
{\setlength{\partopsep}{\parskip}
|
||||
\addtolength{\partopsep}{\baselineskip}
|
||||
\topsep0pt\itemsep0.15\baselineskip\parsep0pt
|
||||
\leftmargin#1}
|
||||
\raggedright}
|
||||
{\end{list}}
|
||||
|
||||
% Redefine includgraphics for avoiding images larger than the screen size
|
||||
% If the size is not specified.
|
||||
\let\py@Oldincludegraphics\includegraphics
|
||||
|
||||
\newbox\image@box%
|
||||
\newdimen\image@width%
|
||||
\renewcommand\includegraphics[2][\@empty]{%
|
||||
\ifx#1\@empty%
|
||||
\setbox\image@box=\hbox{\py@Oldincludegraphics{#2}}%
|
||||
\image@width\wd\image@box%
|
||||
\ifdim \image@width>\linewidth%
|
||||
\setbox\image@box=\hbox{\py@Oldincludegraphics[width=\linewidth]{#2}}%
|
||||
\box\image@box%
|
||||
\else%
|
||||
\py@Oldincludegraphics{#2}%
|
||||
\fi%
|
||||
\else%
|
||||
\py@Oldincludegraphics[#1]{#2}%
|
||||
\fi%
|
||||
}
|
||||
|
||||
|
||||
% Fix the index and bibliography environments to add an entry to the Table of
|
||||
% Contents; this is much nicer than just having to jump to the end of the book
|
||||
% and flip around, especially with multiple indexes.
|
||||
%
|
||||
\let\py@OldTheindex=\theindex
|
||||
\renewcommand{\theindex}{
|
||||
\cleardoublepage
|
||||
\phantomsection
|
||||
\py@OldTheindex
|
||||
\addcontentsline{toc}{chapter}{\indexname}
|
||||
}
|
||||
|
||||
\let\py@OldThebibliography=\thebibliography
|
||||
\renewcommand{\thebibliography}[1]{
|
||||
\cleardoublepage
|
||||
\phantomsection
|
||||
\py@OldThebibliography{1}
|
||||
\addcontentsline{toc}{chapter}{\bibname}
|
||||
}
|
||||
|
||||
% Include hyperref last.
|
||||
\RequirePackage[colorlinks,breaklinks,
|
||||
linkcolor=InnerLinkColor,filecolor=OuterLinkColor,
|
||||
menucolor=OuterLinkColor,pagecolor=OuterLinkColor,
|
||||
urlcolor=OuterLinkColor]{hyperref}
|
||||
|
||||
% From docutils.writers.latex2e
|
||||
\providecommand{\DUspan}[2]{%
|
||||
{% group ("span") to limit the scope of styling commands
|
||||
\@for\node@class@name:=#1\do{%
|
||||
\ifcsname docutilsrole\node@class@name\endcsname%
|
||||
\csname docutilsrole\node@class@name\endcsname%
|
||||
\fi%
|
||||
}%
|
||||
{#2}% node content
|
||||
}% close "span"
|
||||
}
|
||||
@@ -0,0 +1,452 @@
|
||||
%%
|
||||
%% This is file `tabulary.sty',
|
||||
%% generated with the docstrip utility.
|
||||
%%
|
||||
%% The original source files were:
|
||||
%%
|
||||
%% tabulary.dtx (with options: `package')
|
||||
%% DRAFT VERSION
|
||||
%%
|
||||
%% File `tabulary.dtx'.
|
||||
%% Copyright (C) 1995 1996 2003 David Carlisle
|
||||
%% This file may be distributed under the terms of the LPPL.
|
||||
%% See 00readme.txt for details.
|
||||
%%
|
||||
\NeedsTeXFormat{LaTeX2e}
|
||||
\ProvidesPackage{tabulary}
|
||||
[2007/10/02 v0.9 tabulary package (DPC)]
|
||||
\RequirePackage{array}
|
||||
\catcode`\Z=14
|
||||
\DeclareOption{debugshow}{\catcode`\Z=9\relax}
|
||||
\ProcessOptions
|
||||
\def\arraybackslash{\let\\=\@arraycr}
|
||||
\def\@finalstrut#1{%
|
||||
\unskip\ifhmode\nobreak\fi\vrule\@width\z@\@height\z@\@depth\dp#1}
|
||||
\newcount\TY@count
|
||||
\def\tabulary{%
|
||||
\let\TY@final\tabular
|
||||
\let\endTY@final\endtabular
|
||||
\TY@tabular}
|
||||
\def\TY@tabular#1{%
|
||||
\edef\TY@{\@currenvir}%
|
||||
{\ifnum0=`}\fi
|
||||
\@ovxx\TY@linewidth
|
||||
\@ovyy\TY@tablewidth
|
||||
\count@\z@
|
||||
\@tempswatrue
|
||||
\@whilesw\if@tempswa\fi{%
|
||||
\advance\count@\@ne
|
||||
\expandafter\ifx\csname TY@F\the\count@\endcsname\relax
|
||||
\@tempswafalse
|
||||
\else
|
||||
\expandafter\let\csname TY@SF\the\count@\expandafter\endcsname
|
||||
\csname TY@F\the\count@\endcsname
|
||||
\global\expandafter\let\csname TY@F\the\count@\endcsname\relax
|
||||
\expandafter\let\csname TY@S\the\count@\expandafter\endcsname
|
||||
\csname TY@\the\count@\endcsname
|
||||
\fi}%
|
||||
\global\TY@count\@ne
|
||||
\TY@width\xdef{0pt}%
|
||||
\global\TY@tablewidth\z@
|
||||
\global\TY@linewidth#1\relax
|
||||
Z\message{^^J^^JTable^^J%
|
||||
Z Target Width: \the\TY@linewidth^^J%
|
||||
Z \string\tabcolsep: \the\tabcolsep\space
|
||||
Z \string\arrayrulewidth: \the\arrayrulewidth\space
|
||||
Z \string\doublerulesep: \the\doublerulesep^^J%
|
||||
Z \string\tymin: \the\tymin\space
|
||||
Z \string\tymax: \the\tymax^^J}%
|
||||
\let\@classz\TY@classz
|
||||
\let\verb\TX@verb
|
||||
\toks@{}\TY@get@body}
|
||||
\let\TY@@mkpream\@mkpream
|
||||
\def\TY@mkpream{%
|
||||
\def\@addamp{%
|
||||
\if@firstamp \@firstampfalse \else
|
||||
\global\advance\TY@count\@ne
|
||||
\edef\@preamble{\@preamble &}\fi
|
||||
\TY@width\xdef{0pt}}%
|
||||
\def\@acol{%
|
||||
\TY@subwidth\col@sep
|
||||
\@addtopreamble{\hskip\col@sep}}%
|
||||
\let\@arrayrule\TY@arrayrule
|
||||
\let\@classvi\TY@classvi
|
||||
\def\@classv{\save@decl
|
||||
\expandafter\NC@ecs\@nextchar\extracolsep{}\extracolsep\@@@
|
||||
\sbox\z@{\d@llarbegin\@nextchar\d@llarend}%
|
||||
\TY@subwidth{\wd\z@}%
|
||||
\@addtopreamble{\d@llarbegin\the@toks\the\count@\relax\d@llarend}%
|
||||
\prepnext@tok}%
|
||||
\global\let\@mkpream\TY@@mkpream
|
||||
\TY@@mkpream}
|
||||
\def\TY@arrayrule{%
|
||||
\TY@subwidth\arrayrulewidth
|
||||
\@addtopreamble \vline}
|
||||
\def\TY@classvi{\ifcase \@lastchclass
|
||||
\@acol \or
|
||||
\TY@subwidth\doublerulesep
|
||||
\@addtopreamble{\hskip \doublerulesep}\or
|
||||
\@acol \or
|
||||
\@classvii
|
||||
\fi}
|
||||
\def\TY@tab{%
|
||||
\setbox\z@\hbox\bgroup
|
||||
\let\[$\let\]$%
|
||||
\let\equation$\let\endequation$%
|
||||
\col@sep\tabcolsep
|
||||
\let\d@llarbegin\begingroup\let\d@llarend\endgroup
|
||||
\let\@mkpream\TY@mkpream
|
||||
\def\multicolumn##1##2##3{\multispan##1\relax}%
|
||||
\CT@start\TY@tabarray}
|
||||
\def\TY@tabarray{\@ifnextchar[{\TY@array}{\@array[t]}}
|
||||
\def\TY@array[#1]{\@array[t]}
|
||||
\def\TY@width#1{%
|
||||
\expandafter#1\csname TY@\the\TY@count\endcsname}
|
||||
\def\TY@subwidth#1{%
|
||||
\TY@width\dimen@
|
||||
\advance\dimen@-#1\relax
|
||||
\TY@width\xdef{\the\dimen@}%
|
||||
\global\advance\TY@linewidth-#1\relax}
|
||||
\def\endtabulary{%
|
||||
\gdef\@halignto{}%
|
||||
\let\TY@footnote\footnote%
|
||||
\def\footnote{}% prevent footnotes from doing anything
|
||||
\expandafter\TY@tab\the\toks@
|
||||
\crcr\omit
|
||||
{\xdef\TY@save@row{}%
|
||||
\loop
|
||||
\advance\TY@count\m@ne
|
||||
\ifnum\TY@count>\z@
|
||||
\xdef\TY@save@row{\TY@save@row&\omit}%
|
||||
\repeat}\TY@save@row
|
||||
\endarray\global\setbox1=\lastbox\setbox0=\vbox{\unvbox1
|
||||
\unskip\global\setbox1=\lastbox}\egroup
|
||||
\dimen@\TY@linewidth
|
||||
\divide\dimen@\TY@count
|
||||
\ifdim\dimen@<\tymin
|
||||
\TY@warn{tymin too large (\the\tymin), resetting to \the\dimen@}%
|
||||
\tymin\dimen@
|
||||
\fi
|
||||
\setbox\tw@=\hbox{\unhbox\@ne
|
||||
\loop
|
||||
\@tempdima=\lastskip
|
||||
\ifdim\@tempdima>\z@
|
||||
Z \message{ecs=\the\@tempdima^^J}%
|
||||
\global\advance\TY@linewidth-\@tempdima
|
||||
\fi
|
||||
\unskip
|
||||
\setbox\tw@=\lastbox
|
||||
\ifhbox\tw@
|
||||
Z \message{Col \the\TY@count: Initial=\the\wd\tw@\space}%
|
||||
\ifdim\wd\tw@>\tymax
|
||||
\wd\tw@\tymax
|
||||
Z \message{> max\space}%
|
||||
Z \else
|
||||
Z \message{ \@spaces\space}%
|
||||
\fi
|
||||
\TY@width\dimen@
|
||||
Z \message{\the\dimen@\space}%
|
||||
\advance\dimen@\wd\tw@
|
||||
Z \message{Final=\the\dimen@\space}%
|
||||
\TY@width\xdef{\the\dimen@}%
|
||||
\ifdim\dimen@<\tymin
|
||||
Z \message{< tymin}%
|
||||
\global\advance\TY@linewidth-\dimen@
|
||||
\expandafter\xdef\csname TY@F\the\TY@count\endcsname
|
||||
{\the\dimen@}%
|
||||
\else
|
||||
\expandafter\ifx\csname TY@F\the\TY@count\endcsname\z@
|
||||
Z \message{***}%
|
||||
\global\advance\TY@linewidth-\dimen@
|
||||
\expandafter\xdef\csname TY@F\the\TY@count\endcsname
|
||||
{\the\dimen@}%
|
||||
\else
|
||||
Z \message{> tymin}%
|
||||
\global\advance\TY@tablewidth\dimen@
|
||||
\global\expandafter\let\csname TY@F\the\TY@count\endcsname
|
||||
\maxdimen
|
||||
\fi\fi
|
||||
\advance\TY@count\m@ne
|
||||
\repeat}%
|
||||
\TY@checkmin
|
||||
\TY@checkmin
|
||||
\TY@checkmin
|
||||
\TY@checkmin
|
||||
\TY@count\z@
|
||||
\let\TY@box\TY@box@v
|
||||
\let\footnote\TY@footnote % restore footnotes
|
||||
{\expandafter\TY@final\the\toks@\endTY@final}%
|
||||
\count@\z@
|
||||
\@tempswatrue
|
||||
\@whilesw\if@tempswa\fi{%
|
||||
\advance\count@\@ne
|
||||
\expandafter\ifx\csname TY@SF\the\count@\endcsname\relax
|
||||
\@tempswafalse
|
||||
\else
|
||||
\global\expandafter\let\csname TY@F\the\count@\expandafter\endcsname
|
||||
\csname TY@SF\the\count@\endcsname
|
||||
\global\expandafter\let\csname TY@\the\count@\expandafter\endcsname
|
||||
\csname TY@S\the\count@\endcsname
|
||||
\fi}%
|
||||
\TY@linewidth\@ovxx
|
||||
\TY@tablewidth\@ovyy
|
||||
\ifnum0=`{\fi}}
|
||||
\def\TY@checkmin{%
|
||||
\let\TY@checkmin\relax
|
||||
\ifdim\TY@tablewidth>\z@
|
||||
\Gscale@div\TY@ratio\TY@linewidth\TY@tablewidth
|
||||
\ifdim\TY@tablewidth <\linewidth
|
||||
\def\TY@ratio{1}%
|
||||
\fi
|
||||
\else
|
||||
\TY@warn{No suitable columns!}%
|
||||
\def\TY@ratio{1}%
|
||||
\fi
|
||||
\count@\z@
|
||||
Z \message{^^JLine Width: \the\TY@linewidth,
|
||||
Z Natural Width: \the\TY@tablewidth,
|
||||
Z Ratio: \TY@ratio^^J}%
|
||||
\@tempdima\z@
|
||||
\loop
|
||||
\ifnum\count@<\TY@count
|
||||
\advance\count@\@ne
|
||||
\ifdim\csname TY@F\the\count@\endcsname>\tymin
|
||||
\dimen@\csname TY@\the\count@\endcsname
|
||||
\dimen@\TY@ratio\dimen@
|
||||
\ifdim\dimen@<\tymin
|
||||
Z \message{Column \the\count@\space ->}%
|
||||
\global\expandafter\let\csname TY@F\the\count@\endcsname\tymin
|
||||
\global\advance\TY@linewidth-\tymin
|
||||
\global\advance\TY@tablewidth-\csname TY@\the\count@\endcsname
|
||||
\let\TY@checkmin\TY@@checkmin
|
||||
\else
|
||||
\expandafter\xdef\csname TY@F\the\count@\endcsname{\the\dimen@}%
|
||||
\advance\@tempdima\csname TY@F\the\count@\endcsname
|
||||
\fi
|
||||
\fi
|
||||
Z \dimen@\csname TY@F\the\count@\endcsname\message{\the\dimen@, }%
|
||||
\repeat
|
||||
Z \message{^^JTotal:\the\@tempdima^^J}%
|
||||
}
|
||||
\let\TY@@checkmin\TY@checkmin
|
||||
\newdimen\TY@linewidth
|
||||
\def\tyformat{\everypar{{\nobreak\hskip\z@skip}}}
|
||||
\newdimen\tymin
|
||||
\tymin=10pt
|
||||
\newdimen\tymax
|
||||
\tymax=2\textwidth
|
||||
\def\@testpach{\@chclass
|
||||
\ifnum \@lastchclass=6 \@ne \@chnum \@ne \else
|
||||
\ifnum \@lastchclass=7 5 \else
|
||||
\ifnum \@lastchclass=8 \tw@ \else
|
||||
\ifnum \@lastchclass=9 \thr@@
|
||||
\else \z@
|
||||
\ifnum \@lastchclass = 10 \else
|
||||
\edef\@nextchar{\expandafter\string\@nextchar}%
|
||||
\@chnum
|
||||
\if \@nextchar c\z@ \else
|
||||
\if \@nextchar l\@ne \else
|
||||
\if \@nextchar r\tw@ \else
|
||||
\if \@nextchar C7 \else
|
||||
\if \@nextchar L8 \else
|
||||
\if \@nextchar R9 \else
|
||||
\if \@nextchar J10 \else
|
||||
\z@ \@chclass
|
||||
\if\@nextchar |\@ne \else
|
||||
\if \@nextchar !6 \else
|
||||
\if \@nextchar @7 \else
|
||||
\if \@nextchar <8 \else
|
||||
\if \@nextchar >9 \else
|
||||
10
|
||||
\@chnum
|
||||
\if \@nextchar m\thr@@\else
|
||||
\if \@nextchar p4 \else
|
||||
\if \@nextchar b5 \else
|
||||
\z@ \@chclass \z@ \@preamerr \z@ \fi \fi \fi \fi\fi \fi \fi\fi \fi
|
||||
\fi \fi \fi \fi \fi \fi \fi \fi \fi \fi \fi}
|
||||
\def\TY@classz{%
|
||||
\@classx
|
||||
\@tempcnta\count@
|
||||
\ifx\TY@box\TY@box@v
|
||||
\global\advance\TY@count\@ne
|
||||
\fi
|
||||
\let\centering c%
|
||||
\let\raggedright\noindent
|
||||
\let\raggedleft\indent
|
||||
\let\arraybackslash\relax
|
||||
\prepnext@tok
|
||||
\ifnum\@chnum<4
|
||||
\global\expandafter\let\csname TY@F\the\TY@count\endcsname\z@
|
||||
\fi
|
||||
\ifnum\@chnum=6
|
||||
\global\expandafter\let\csname TY@F\the\TY@count\endcsname\z@
|
||||
\fi
|
||||
\@addtopreamble{%
|
||||
\ifcase\@chnum
|
||||
\hfil \d@llarbegin\insert@column\d@llarend \hfil \or
|
||||
\kern\z@
|
||||
\d@llarbegin \insert@column \d@llarend \hfil \or
|
||||
\hfil\kern\z@ \d@llarbegin \insert@column \d@llarend \or
|
||||
$\vcenter\@startpbox{\@nextchar}\insert@column \@endpbox $\or
|
||||
\vtop \@startpbox{\@nextchar}\insert@column \@endpbox \or
|
||||
\vbox \@startpbox{\@nextchar}\insert@column \@endpbox \or
|
||||
\d@llarbegin \insert@column \d@llarend \or% dubious "s" case
|
||||
\TY@box\centering\or
|
||||
\TY@box\raggedright\or
|
||||
\TY@box\raggedleft\or
|
||||
\TY@box\relax
|
||||
\fi}\prepnext@tok}
|
||||
\def\TY@box#1{%
|
||||
\ifx\centering#1%
|
||||
\hfil \d@llarbegin\insert@column\d@llarend \hfil \else
|
||||
\ifx\raggedright#1%
|
||||
\kern\z@%<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
|
||||
\d@llarbegin \insert@column \d@llarend \hfil \else
|
||||
\ifx\raggedleft#1%
|
||||
\hfil\kern\z@ \d@llarbegin \insert@column \d@llarend \else
|
||||
\ifx\relax#1%
|
||||
\d@llarbegin \insert@column \d@llarend
|
||||
\fi \fi \fi \fi}
|
||||
\def\TY@box@v#1{%
|
||||
\vtop \@startpbox{\csname TY@F\the\TY@count\endcsname}%
|
||||
#1\arraybackslash\tyformat
|
||||
\insert@column\@endpbox}
|
||||
\newdimen\TY@tablewidth
|
||||
\def\Gscale@div#1#2#3{%
|
||||
\setlength\dimen@{#3}%
|
||||
\ifdim\dimen@=\z@
|
||||
\PackageError{graphics}{Division by 0}\@eha
|
||||
\dimen@#2%
|
||||
\fi
|
||||
\edef\@tempd{\the\dimen@}%
|
||||
\setlength\dimen@{#2}%
|
||||
\count@65536\relax
|
||||
\ifdim\dimen@<\z@
|
||||
\dimen@-\dimen@
|
||||
\count@-\count@
|
||||
\fi
|
||||
\loop
|
||||
\ifdim\dimen@<8192\p@
|
||||
\dimen@\tw@\dimen@
|
||||
\divide\count@\tw@
|
||||
\repeat
|
||||
\dimen@ii=\@tempd\relax
|
||||
\divide\dimen@ii\count@
|
||||
\divide\dimen@\dimen@ii
|
||||
\edef#1{\strip@pt\dimen@}}
|
||||
\long\def\TY@get@body#1\end
|
||||
{\toks@\expandafter{\the\toks@#1}\TY@find@end}
|
||||
\def\TY@find@end#1{%
|
||||
\def\@tempa{#1}%
|
||||
\ifx\@tempa\TY@\def\@tempa{\end{#1}}\expandafter\@tempa
|
||||
\else\toks@\expandafter
|
||||
{\the\toks@\end{#1}}\expandafter\TY@get@body\fi}
|
||||
\def\TY@warn{%
|
||||
\PackageWarning{tabulary}}
|
||||
\catcode`\Z=11
|
||||
\AtBeginDocument{
|
||||
\@ifpackageloaded{colortbl}{%
|
||||
\expandafter\def\expandafter\@mkpream\expandafter#\expandafter1%
|
||||
\expandafter{%
|
||||
\expandafter\let\expandafter\CT@setup\expandafter\relax
|
||||
\expandafter\let\expandafter\CT@color\expandafter\relax
|
||||
\expandafter\let\expandafter\CT@do@color\expandafter\relax
|
||||
\expandafter\let\expandafter\color\expandafter\relax
|
||||
\expandafter\let\expandafter\CT@column@color\expandafter\relax
|
||||
\expandafter\let\expandafter\CT@row@color\expandafter\relax
|
||||
\@mkpream{#1}}
|
||||
\let\TY@@mkpream\@mkpream
|
||||
\def\TY@classz{%
|
||||
\@classx
|
||||
\@tempcnta\count@
|
||||
\ifx\TY@box\TY@box@v
|
||||
\global\advance\TY@count\@ne
|
||||
\fi
|
||||
\let\centering c%
|
||||
\let\raggedright\noindent
|
||||
\let\raggedleft\indent
|
||||
\let\arraybackslash\relax
|
||||
\prepnext@tok
|
||||
\expandafter\CT@extract\the\toks\@tempcnta\columncolor!\@nil
|
||||
\ifnum\@chnum<4
|
||||
\global\expandafter\let\csname TY@F\the\TY@count\endcsname\z@
|
||||
\fi
|
||||
\ifnum\@chnum=6
|
||||
\global\expandafter\let\csname TY@F\the\TY@count\endcsname\z@
|
||||
\fi
|
||||
\@addtopreamble{%
|
||||
\setbox\z@\hbox\bgroup\bgroup
|
||||
\ifcase\@chnum
|
||||
\hskip\stretch{.5}\kern\z@
|
||||
\d@llarbegin\insert@column\d@llarend\hskip\stretch{.5}\or
|
||||
\kern\z@%<<<<<<<<<<<<<<<<<<<<<<<<<<<
|
||||
\d@llarbegin \insert@column \d@llarend \hfill \or
|
||||
\hfill\kern\z@ \d@llarbegin \insert@column \d@llarend \or
|
||||
$\vcenter\@startpbox{\@nextchar}\insert@column \@endpbox $\or
|
||||
\vtop \@startpbox{\@nextchar}\insert@column \@endpbox \or
|
||||
\vbox \@startpbox{\@nextchar}\insert@column \@endpbox \or
|
||||
\d@llarbegin \insert@column \d@llarend \or% dubious s case
|
||||
\TY@box\centering\or
|
||||
\TY@box\raggedright\or
|
||||
\TY@box\raggedleft\or
|
||||
\TY@box\relax
|
||||
\fi
|
||||
\egroup\egroup
|
||||
\begingroup
|
||||
\CT@setup
|
||||
\CT@column@color
|
||||
\CT@row@color
|
||||
\CT@do@color
|
||||
\endgroup
|
||||
\@tempdima\ht\z@
|
||||
\advance\@tempdima\minrowclearance
|
||||
\vrule\@height\@tempdima\@width\z@
|
||||
\unhbox\z@
|
||||
}\prepnext@tok}%
|
||||
\def\TY@arrayrule{%
|
||||
\TY@subwidth\arrayrulewidth
|
||||
\@addtopreamble{{\CT@arc@\vline}}}%
|
||||
\def\TY@classvi{\ifcase \@lastchclass
|
||||
\@acol \or
|
||||
\TY@subwidth\doublerulesep
|
||||
\ifx\CT@drsc@\relax
|
||||
\@addtopreamble{\hskip\doublerulesep}%
|
||||
\else
|
||||
\@addtopreamble{{\CT@drsc@\vrule\@width\doublerulesep}}%
|
||||
\fi\or
|
||||
\@acol \or
|
||||
\@classvii
|
||||
\fi}%
|
||||
}{%
|
||||
\let\CT@start\relax
|
||||
}
|
||||
}
|
||||
{\uccode`\*=`\ %
|
||||
\uppercase{\gdef\TX@verb{%
|
||||
\leavevmode\null\TX@vwarn
|
||||
{\ifnum0=`}\fi\ttfamily\let\\\ignorespaces
|
||||
\@ifstar{\let~*\TX@vb}{\TX@vb}}}}
|
||||
\def\TX@vb#1{\def\@tempa##1#1{\toks@{##1}\edef\@tempa{\the\toks@}%
|
||||
\expandafter\TX@v\meaning\@tempa\\ \\\ifnum0=`{\fi}}\@tempa!}
|
||||
\def\TX@v#1!{\afterassignment\TX@vfirst\let\@tempa= }
|
||||
\begingroup
|
||||
\catcode`\*=\catcode`\#
|
||||
\catcode`\#=12
|
||||
\gdef\TX@vfirst{%
|
||||
\if\@tempa#%
|
||||
\def\@tempb{\TX@v@#}%
|
||||
\else
|
||||
\let\@tempb\TX@v@
|
||||
\if\@tempa\space~\else\@tempa\fi
|
||||
\fi
|
||||
\@tempb}
|
||||
\gdef\TX@v@*1 *2{%
|
||||
\TX@v@hash*1##\relax\if*2\\\else~\expandafter\TX@v@\fi*2}
|
||||
\gdef\TX@v@hash*1##*2{*1\ifx*2\relax\else#\expandafter\TX@v@hash\fi*2}
|
||||
\endgroup
|
||||
\def\TX@vwarn{%
|
||||
\@warning{\noexpand\verb may be unreliable inside tabularx/y}%
|
||||
\global\let\TX@vwarn\@empty}
|
||||
\endinput
|
||||
%%
|
||||
%% End of file `tabulary.sty'.
|
||||
@@ -0,0 +1,113 @@
|
||||
@ECHO OFF
|
||||
|
||||
REM Command file for Sphinx documentation
|
||||
|
||||
set SPHINXBUILD=sphinx-build
|
||||
set BUILDDIR=build
|
||||
set ALLSPHINXOPTS=-d %BUILDDIR%/doctrees %SPHINXOPTS% source
|
||||
if NOT "%PAPER%" == "" (
|
||||
set ALLSPHINXOPTS=-D latex_paper_size=%PAPER% %ALLSPHINXOPTS%
|
||||
)
|
||||
|
||||
if "%1" == "" goto help
|
||||
|
||||
if "%1" == "help" (
|
||||
:help
|
||||
echo.Please use `make ^<target^>` where ^<target^> is one of
|
||||
echo. html to make standalone HTML files
|
||||
echo. dirhtml to make HTML files named index.html in directories
|
||||
echo. pickle to make pickle files
|
||||
echo. json to make JSON files
|
||||
echo. htmlhelp to make HTML files and a HTML help project
|
||||
echo. qthelp to make HTML files and a qthelp project
|
||||
echo. latex to make LaTeX files, you can set PAPER=a4 or PAPER=letter
|
||||
echo. changes to make an overview over all changed/added/deprecated items
|
||||
echo. linkcheck to check all external links for integrity
|
||||
echo. doctest to run all doctests embedded in the documentation if enabled
|
||||
goto end
|
||||
)
|
||||
|
||||
if "%1" == "clean" (
|
||||
for /d %%i in (%BUILDDIR%\*) do rmdir /q /s %%i
|
||||
del /q /s %BUILDDIR%\*
|
||||
goto end
|
||||
)
|
||||
|
||||
if "%1" == "html" (
|
||||
%SPHINXBUILD% -b html %ALLSPHINXOPTS% %BUILDDIR%/html
|
||||
echo.
|
||||
echo.Build finished. The HTML pages are in %BUILDDIR%/html.
|
||||
goto end
|
||||
)
|
||||
|
||||
if "%1" == "dirhtml" (
|
||||
%SPHINXBUILD% -b dirhtml %ALLSPHINXOPTS% %BUILDDIR%/dirhtml
|
||||
echo.
|
||||
echo.Build finished. The HTML pages are in %BUILDDIR%/dirhtml.
|
||||
goto end
|
||||
)
|
||||
|
||||
if "%1" == "pickle" (
|
||||
%SPHINXBUILD% -b pickle %ALLSPHINXOPTS% %BUILDDIR%/pickle
|
||||
echo.
|
||||
echo.Build finished; now you can process the pickle files.
|
||||
goto end
|
||||
)
|
||||
|
||||
if "%1" == "json" (
|
||||
%SPHINXBUILD% -b json %ALLSPHINXOPTS% %BUILDDIR%/json
|
||||
echo.
|
||||
echo.Build finished; now you can process the JSON files.
|
||||
goto end
|
||||
)
|
||||
|
||||
if "%1" == "htmlhelp" (
|
||||
%SPHINXBUILD% -b htmlhelp %ALLSPHINXOPTS% %BUILDDIR%/htmlhelp
|
||||
echo.
|
||||
echo.Build finished; now you can run HTML Help Workshop with the ^
|
||||
.hhp project file in %BUILDDIR%/htmlhelp.
|
||||
goto end
|
||||
)
|
||||
|
||||
if "%1" == "qthelp" (
|
||||
%SPHINXBUILD% -b qthelp %ALLSPHINXOPTS% %BUILDDIR%/qthelp
|
||||
echo.
|
||||
echo.Build finished; now you can run "qcollectiongenerator" with the ^
|
||||
.qhcp project file in %BUILDDIR%/qthelp, like this:
|
||||
echo.^> qcollectiongenerator %BUILDDIR%\qthelp\OBITools.qhcp
|
||||
echo.To view the help file:
|
||||
echo.^> assistant -collectionFile %BUILDDIR%\qthelp\OBITools.ghc
|
||||
goto end
|
||||
)
|
||||
|
||||
if "%1" == "latex" (
|
||||
%SPHINXBUILD% -b latex %ALLSPHINXOPTS% %BUILDDIR%/latex
|
||||
echo.
|
||||
echo.Build finished; the LaTeX files are in %BUILDDIR%/latex.
|
||||
goto end
|
||||
)
|
||||
|
||||
if "%1" == "changes" (
|
||||
%SPHINXBUILD% -b changes %ALLSPHINXOPTS% %BUILDDIR%/changes
|
||||
echo.
|
||||
echo.The overview file is in %BUILDDIR%/changes.
|
||||
goto end
|
||||
)
|
||||
|
||||
if "%1" == "linkcheck" (
|
||||
%SPHINXBUILD% -b linkcheck %ALLSPHINXOPTS% %BUILDDIR%/linkcheck
|
||||
echo.
|
||||
echo.Link check complete; look for any errors in the above output ^
|
||||
or in %BUILDDIR%/linkcheck/output.txt.
|
||||
goto end
|
||||
)
|
||||
|
||||
if "%1" == "doctest" (
|
||||
%SPHINXBUILD% -b doctest %ALLSPHINXOPTS% %BUILDDIR%/doctest
|
||||
echo.
|
||||
echo.Testing of doctests in the sources finished, look at the ^
|
||||
results in %BUILDDIR%/doctest/output.txt.
|
||||
goto end
|
||||
)
|
||||
|
||||
:end
|
||||
@@ -0,0 +1,194 @@
|
||||
# -*- coding: utf-8 -*-
|
||||
#
|
||||
# OBITools documentation build configuration file, created by
|
||||
# sphinx-quickstart on Tue Dec 8 21:30:02 2009.
|
||||
#
|
||||
# This file is execfile()d with the current directory set to its containing dir.
|
||||
#
|
||||
# Note that not all possible configuration values are present in this
|
||||
# autogenerated file.
|
||||
#
|
||||
# All configuration values have a default; values that are commented out
|
||||
# serve to show the default.
|
||||
|
||||
import sys, os
|
||||
|
||||
# If extensions (or modules to document with autodoc) are in another directory,
|
||||
# add these directories to sys.path here. If the directory is relative to the
|
||||
# documentation root, use os.path.abspath to make it absolute, like shown here.
|
||||
#sys.path.append(os.path.abspath('.'))
|
||||
|
||||
# -- General configuration -----------------------------------------------------
|
||||
|
||||
# Add any Sphinx extension module names here, as strings. They can be extensions
|
||||
# coming with Sphinx (named 'sphinx.ext.*') or your custom ones.
|
||||
extensions = ['sphinx.ext.todo', 'sphinx.ext.coverage', 'sphinx.ext.pngmath']
|
||||
|
||||
# Add any paths that contain templates here, relative to this directory.
|
||||
templates_path = ['_templates']
|
||||
|
||||
# The suffix of source filenames.
|
||||
source_suffix = '.rst'
|
||||
|
||||
# The encoding of source files.
|
||||
#source_encoding = 'utf-8'
|
||||
|
||||
# The master toctree document.
|
||||
master_doc = 'index'
|
||||
|
||||
# General information about the project.
|
||||
project = u'OBITools'
|
||||
copyright = u'2009, Eric Coissac'
|
||||
|
||||
# The version info for the project you're documenting, acts as replacement for
|
||||
# |version| and |release|, also used in various other places throughout the
|
||||
# built documents.
|
||||
#
|
||||
# The short X.Y version.
|
||||
version = '0.1.3'
|
||||
# The full version, including alpha/beta/rc tags.
|
||||
release = '0.1.3'
|
||||
|
||||
# The language for content autogenerated by Sphinx. Refer to documentation
|
||||
# for a list of supported languages.
|
||||
#language = None
|
||||
|
||||
# There are two options for replacing |today|: either, you set today to some
|
||||
# non-false value, then it is used:
|
||||
#today = ''
|
||||
# Else, today_fmt is used as the format for a strftime call.
|
||||
#today_fmt = '%B %d, %Y'
|
||||
|
||||
# List of documents that shouldn't be included in the build.
|
||||
#unused_docs = []
|
||||
|
||||
# List of directories, relative to source directory, that shouldn't be searched
|
||||
# for source files.
|
||||
exclude_trees = []
|
||||
|
||||
# The reST default role (used for this markup: `text`) to use for all documents.
|
||||
#default_role = None
|
||||
|
||||
# If true, '()' will be appended to :func: etc. cross-reference text.
|
||||
#add_function_parentheses = True
|
||||
|
||||
# If true, the current module name will be prepended to all description
|
||||
# unit titles (such as .. function::).
|
||||
#add_module_names = True
|
||||
|
||||
# If true, sectionauthor and moduleauthor directives will be shown in the
|
||||
# output. They are ignored by default.
|
||||
#show_authors = False
|
||||
|
||||
# The name of the Pygments (syntax highlighting) style to use.
|
||||
pygments_style = 'sphinx'
|
||||
|
||||
# A list of ignored prefixes for module index sorting.
|
||||
#modindex_common_prefix = []
|
||||
|
||||
|
||||
# -- Options for HTML output ---------------------------------------------------
|
||||
|
||||
# The theme to use for HTML and HTML Help pages. Major themes that come with
|
||||
# Sphinx are currently 'default' and 'sphinxdoc'.
|
||||
html_theme = 'default'
|
||||
|
||||
# Theme options are theme-specific and customize the look and feel of a theme
|
||||
# further. For a list of options available for each theme, see the
|
||||
# documentation.
|
||||
#html_theme_options = {}
|
||||
|
||||
# Add any paths that contain custom themes here, relative to this directory.
|
||||
#html_theme_path = []
|
||||
|
||||
# The name for this set of Sphinx documents. If None, it defaults to
|
||||
# "<project> v<release> documentation".
|
||||
#html_title = None
|
||||
|
||||
# A shorter title for the navigation bar. Default is the same as html_title.
|
||||
#html_short_title = None
|
||||
|
||||
# The name of an image file (relative to this directory) to place at the top
|
||||
# of the sidebar.
|
||||
#html_logo = None
|
||||
|
||||
# The name of an image file (within the static path) to use as favicon of the
|
||||
# docs. This file should be a Windows icon file (.ico) being 16x16 or 32x32
|
||||
# pixels large.
|
||||
#html_favicon = None
|
||||
|
||||
# Add any paths that contain custom static files (such as style sheets) here,
|
||||
# relative to this directory. They are copied after the builtin static files,
|
||||
# so a file named "default.css" will overwrite the builtin "default.css".
|
||||
html_static_path = ['_static']
|
||||
|
||||
# If not '', a 'Last updated on:' timestamp is inserted at every page bottom,
|
||||
# using the given strftime format.
|
||||
#html_last_updated_fmt = '%b %d, %Y'
|
||||
|
||||
# If true, SmartyPants will be used to convert quotes and dashes to
|
||||
# typographically correct entities.
|
||||
#html_use_smartypants = True
|
||||
|
||||
# Custom sidebar templates, maps document names to template names.
|
||||
#html_sidebars = {}
|
||||
|
||||
# Additional templates that should be rendered to pages, maps page names to
|
||||
# template names.
|
||||
#html_additional_pages = {}
|
||||
|
||||
# If false, no module index is generated.
|
||||
#html_use_modindex = True
|
||||
|
||||
# If false, no index is generated.
|
||||
#html_use_index = True
|
||||
|
||||
# If true, the index is split into individual pages for each letter.
|
||||
#html_split_index = False
|
||||
|
||||
# If true, links to the reST sources are added to the pages.
|
||||
#html_show_sourcelink = True
|
||||
|
||||
# If true, an OpenSearch description file will be output, and all pages will
|
||||
# contain a <link> tag referring to it. The value of this option must be the
|
||||
# base URL from which the finished HTML is served.
|
||||
#html_use_opensearch = ''
|
||||
|
||||
# If nonempty, this is the file name suffix for HTML files (e.g. ".xhtml").
|
||||
#html_file_suffix = ''
|
||||
|
||||
# Output file base name for HTML help builder.
|
||||
htmlhelp_basename = 'OBIToolsdoc'
|
||||
|
||||
|
||||
# -- Options for LaTeX output --------------------------------------------------
|
||||
|
||||
# The paper size ('letter' or 'a4').
|
||||
#latex_paper_size = 'letter'
|
||||
|
||||
# The font size ('10pt', '11pt' or '12pt').
|
||||
#latex_font_size = '10pt'
|
||||
|
||||
# Grouping the document tree into LaTeX files. List of tuples
|
||||
# (source start file, target name, title, author, documentclass [howto/manual]).
|
||||
latex_documents = [
|
||||
('index', 'OBITools.tex', u'OBITools Documentation',
|
||||
u'Eric Coissac', 'manual'),
|
||||
]
|
||||
|
||||
# The name of an image file (relative to this directory) to place at the top of
|
||||
# the title page.
|
||||
#latex_logo = None
|
||||
|
||||
# For "manual" documents, if this is true, then toplevel headings are parts,
|
||||
# not chapters.
|
||||
#latex_use_parts = False
|
||||
|
||||
# Additional stuff for the LaTeX preamble.
|
||||
#latex_preamble = ''
|
||||
|
||||
# Documents to append as an appendix to all manuals.
|
||||
#latex_appendices = []
|
||||
|
||||
# If false, no module index is generated.
|
||||
#latex_use_modindex = True
|
||||
@@ -0,0 +1,31 @@
|
||||
File format conversions
|
||||
=======================
|
||||
|
||||
Several OBITools exist for converting files from one format to another.
|
||||
As :doc:`fasta file <fasta>` is the central format for OBITools, many of
|
||||
these converters convert to :doc:`extended OBITools fasta format <obifasta>`.
|
||||
|
||||
Convert to extended OBITools fasta format
|
||||
-----------------------------------------
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
scripts/convert2fasta
|
||||
scripts/ecopcr2fasta
|
||||
|
||||
Convert taxonomic data
|
||||
----------------------
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
scripts/buildOBITaxonomy
|
||||
|
||||
Convert to tabular data files
|
||||
-----------------------------
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
scripts/fasta2tab
|
||||
@@ -0,0 +1,2 @@
|
||||
The EMBL sequence format
|
||||
========================
|
||||
@@ -0,0 +1,56 @@
|
||||
The fasta format
|
||||
================
|
||||
|
||||
|
||||
The fasta format is certainly the most widely used sequence file format.
|
||||
This is certainly due to its great simplicity. It was originally created
|
||||
for the ''Lipman'' and ''Pearson'' `FASTA program`_. OBITools use in more
|
||||
of :ref:`the classical fasta format <classical-fasta>` several extended
|
||||
version of this format where structured data are included in the title line.
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
obifasta
|
||||
|
||||
.. _classical-fasta:
|
||||
|
||||
The classical fasta format
|
||||
--------------------------
|
||||
|
||||
In fasta format a sequence is represented by a title line beginning with a **>** character and
|
||||
the sequences by itself following :doc:`iupac`. The sequence is usually split other severals
|
||||
lines of the same length (expected for the last one) ::
|
||||
|
||||
|
||||
>my_sequence this is my pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
|
||||
|
||||
This is no special format for the title line excepting that this line should be unique.
|
||||
Usually the first word following the **>** character is considered as the sequence identifier.
|
||||
The end of the title line corresponding to a description of the sequence.
|
||||
|
||||
Several sequences can be concatenated in a same file. The description of the next sequence
|
||||
is just pasted at the end of the description of the previous one ::
|
||||
|
||||
|
||||
>sequence_A this is my first pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
>sequence_B this is my second pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
>sequence_C this is my third pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
|
||||
|
||||
|
||||
|
||||
.. _`FASTA program`: http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation
|
||||
@@ -0,0 +1,54 @@
|
||||
File formats usable with OBITools
|
||||
=================================
|
||||
|
||||
|
||||
|
||||
The sequence files
|
||||
------------------
|
||||
|
||||
Sequences can be stored following various format. OBITools knows
|
||||
some of them. The central format for sequence files manipulated by OBITools scripts
|
||||
is the :doc:`fasta format <fasta>`. OBITools extends the fasta format by specifying
|
||||
a syntax to include in the definition line data qualifying the sequence.
|
||||
All file formats use the :doc:`IUPAC <iupac>` code for encoding nucleotides and
|
||||
amino-acids.
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
iupac
|
||||
fasta
|
||||
genbank
|
||||
embl
|
||||
|
||||
|
||||
The taxonomy files
|
||||
------------------
|
||||
|
||||
Many OBITools are able to take into account taxonomic data. These data
|
||||
are manipulated following the `NCBI taxonomy`_.
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
taxdump
|
||||
obitaxonomy
|
||||
|
||||
The ecoPCR files
|
||||
----------------
|
||||
|
||||
ecoPCR_ is a software developed in LECA_. It simulates a PCR experiment by
|
||||
selecting in a sequence database, sequences matching simultaneously two
|
||||
primers sequences in a way allowing a PCR amplification of a DNA region.
|
||||
|
||||
The ecoPrimer files
|
||||
-------------------
|
||||
|
||||
|
||||
The OBITools files
|
||||
------------------
|
||||
|
||||
|
||||
.. _ecoPCR: http://www.grenoble.prabi.fr/trac/ecoPCR
|
||||
.. _LECA: http://www-leca.ujf-grenoble.fr
|
||||
.. _`NCBI taxonomy`: http://www.ncbi.nlm.nih.gov/taxonomy
|
||||
@@ -0,0 +1,2 @@
|
||||
The genbank sequence format
|
||||
===========================
|
||||
@@ -0,0 +1,22 @@
|
||||
.. OBITools documentation master file, created by
|
||||
sphinx-quickstart on Tue Dec 8 21:30:02 2009.
|
||||
You can adapt this file completely to your liking, but it should at least
|
||||
contain the root `toctree` directive.
|
||||
|
||||
Welcome to OBITools's documentation!
|
||||
====================================
|
||||
|
||||
Contents:
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
The OBITools scripts <scripts>
|
||||
|
||||
Indices and tables
|
||||
==================
|
||||
|
||||
* :ref:`genindex`
|
||||
* :ref:`modindex`
|
||||
* :ref:`search`
|
||||
|
||||
@@ -0,0 +1,63 @@
|
||||
The IUPAC code
|
||||
==============
|
||||
|
||||
The International Union of Pure and Applied Chemistry (IUPAC_) defined
|
||||
the standard code for representing protein or DNA sequences.
|
||||
|
||||
Nucleic IUPAC Code
|
||||
------------------
|
||||
|
||||
======== =================================
|
||||
**Code** **Nucleotide**
|
||||
======== =================================
|
||||
A Adenine
|
||||
C Cytosine
|
||||
G Guanine
|
||||
T Thymine
|
||||
U Uracil
|
||||
R Purine (A or G)
|
||||
Y Pyrimidine (C, T, or U)
|
||||
M C or A
|
||||
K T, U, or G
|
||||
W T, U, or A
|
||||
S C or G
|
||||
B C, T, U, or G (not A)
|
||||
D A, T, U, or G (not C)
|
||||
H A, T, U, or C (not G)
|
||||
V A, C, or G (not T, not U)
|
||||
N Any base (A, C, G, T, or U)
|
||||
======== =================================
|
||||
|
||||
|
||||
Peptidic one and three letters IUPAC code
|
||||
-----------------------------------------
|
||||
|
||||
============ ============= =======================================
|
||||
**1-letter** **3-letters** **Amino acid**
|
||||
============ ============= =======================================
|
||||
A Ala Alanine
|
||||
R Arg Arginine
|
||||
N Asn Asparagine
|
||||
D Asp Aspartic acid
|
||||
C Cys Cysteine
|
||||
Q Gln Glutamine
|
||||
E Glu Glutamic acid
|
||||
G Gly Glycine
|
||||
H His Histidine
|
||||
I Ile Isoleucine
|
||||
L Leu Leucine
|
||||
K Lys Lysine
|
||||
M Met Methionine
|
||||
F Phe Phenylalanine
|
||||
P Pro Proline
|
||||
S Ser Serine
|
||||
T Thr Threonine
|
||||
W Trp Tryptophan
|
||||
Y Tyr Tyrosine
|
||||
V Val Valine
|
||||
B Asx Aspartic acid or Asparagine
|
||||
Z Glx Glutamine or Glutamic acid
|
||||
X Xaa Any amino acid
|
||||
============ ============= =======================================
|
||||
|
||||
.. _IUPAC: http://www.iupac.org/
|
||||
@@ -0,0 +1,35 @@
|
||||
The extended OBITools fasta format
|
||||
==================================
|
||||
|
||||
The *extended OBITools Fasta format* is a strict :doc:`fasta format file <fasta>`.
|
||||
The file in *extended OBITools Fasta format* can be readed by all programs
|
||||
reading fasta files.
|
||||
|
||||
Difference between standard and extended fasta is just the structure of the title
|
||||
line. For OBITools title line is divided in three parts :
|
||||
|
||||
- Seqid : the sequence identifier
|
||||
- key=value; : a set of key/value keys
|
||||
- the sequence definition
|
||||
|
||||
|
||||
::
|
||||
|
||||
>my_sequence taxid=3456; direct=True; sample=A354; this is my pretty sequence
|
||||
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
||||
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
||||
AACGACGTTGCAGTACGTTGCAGT
|
||||
|
||||
Following these rules, the title line can be parsed :
|
||||
|
||||
- The sequence identifier of this sequence is *my_sequence*
|
||||
- Three keys are assigned to this sequence :
|
||||
- Key *taxid* with value *3456*
|
||||
- Key *direct* with value *True*
|
||||
- Key *sample* with value *A354*
|
||||
- The definition of this sequence is this is *my pretty sequence*
|
||||
|
||||
Key value can be any valid python expression. If a key value cannot be evaluated as
|
||||
a python expression, it is them assumed as a simple string. Following this rule,
|
||||
taxid value is considered as an integer value, direct value as a boolean and sample
|
||||
value is not a valid python expression so it is considered as a string value.
|
||||
@@ -0,0 +1,3 @@
|
||||
The OBITools formated taxonomy
|
||||
==============================
|
||||
|
||||
@@ -0,0 +1,13 @@
|
||||
OBITools scripts
|
||||
================
|
||||
|
||||
OBITools scripts are developed mainly for manipulating large sequence
|
||||
files generated by the next generation sequencers.
|
||||
|
||||
Contents:
|
||||
|
||||
.. toctree::
|
||||
:maxdepth: 2
|
||||
|
||||
Usable file formats with OBITools <formats>
|
||||
File format conversions <conversions>
|
||||
@@ -0,0 +1,51 @@
|
||||
Convert NCBI taxdump to binary formated OBITools taxonomy database
|
||||
==================================================================
|
||||
|
||||
:command:`buildOBITaxonomy.py` -t <taxdump dir> -d <db name>
|
||||
|
||||
Convert an text dump directory of the NCBI Taxonomy database to the binary
|
||||
format used by ecoPCR and many *OBITools* scripts. An archive corresponding to
|
||||
this directory can be downloaded at the following URL
|
||||
|
||||
`ftp://ftp.ncbi.nlm.nih.gov/pub/taxonomy/ <ftp://ftp.ncbi.nlm.nih.gov/pub/taxonomy/>`_
|
||||
|
||||
obitools common options
|
||||
-----------------------
|
||||
|
||||
.. program:: obitools
|
||||
|
||||
.. cmdoption:: -h, --help
|
||||
|
||||
show this help message and exit
|
||||
|
||||
.. cmdoption:: --DEBUG
|
||||
|
||||
Set logging in debug mode
|
||||
|
||||
.. cmdoption:: --no-psyco
|
||||
|
||||
Don't use psyco even if it installed
|
||||
|
||||
taxonomy related options
|
||||
------------------------
|
||||
|
||||
.. program:: taxonomy
|
||||
|
||||
.. cmdoption:: -d <FILENAME>, --database=<FILENAME>
|
||||
|
||||
ecoPCR taxonomy Database name
|
||||
|
||||
.. cmdoption:: -t <FILENAME>, --taxonomy-dump=<FILENAME>
|
||||
|
||||
NCBI Taxonomy dump repository name
|
||||
|
||||
example
|
||||
-------
|
||||
|
||||
for building a new taxonomy database named *ncbitaxonomy* from a taxdump dir ::
|
||||
|
||||
% curl ftp://ftp.ncbi.nlm.nih.gov/pub/taxonomy/taxdump.tar.gz | tar zxf -
|
||||
% buildOBITaxonomy.py --taxonomy-dump taxdump --database ncbitaxonomy
|
||||
|
||||
|
||||
|
||||
@@ -0,0 +1,58 @@
|
||||
Convert sequence files to extended OBITools fasta format
|
||||
========================================================
|
||||
|
||||
:command:`convert2fasta.py` [options] [filename 1] [filename 2] ...
|
||||
|
||||
Convert sequence files to the extended OBITools fasta format. If no
|
||||
file name are specified data are read from standard input.
|
||||
|
||||
obitools common options
|
||||
-----------------------
|
||||
|
||||
.. program:: obitools
|
||||
|
||||
.. cmdoption:: -h, --help
|
||||
|
||||
show this help message and exit
|
||||
|
||||
.. cmdoption:: --DEBUG
|
||||
|
||||
Set logging in debug mode
|
||||
|
||||
.. cmdoption:: --no-psyco
|
||||
|
||||
Don't use psyco even if it installed
|
||||
|
||||
convert2fasta.py specific options
|
||||
---------------------------------
|
||||
|
||||
.. program:: convert2fasta.py
|
||||
|
||||
.. cmdoption:: --genbank
|
||||
|
||||
input file is in :doc:`genbank format <../genbank>`
|
||||
|
||||
.. cmdoption:: --embl
|
||||
|
||||
input file is in :doc:`embl format <../embl>`
|
||||
|
||||
.. cmdoption:: --fna
|
||||
|
||||
input file is in fasta nucleic format produced by 454 sequencer
|
||||
pipeline
|
||||
|
||||
.. cmdoption:: --nuc
|
||||
|
||||
input file contains nucleic sequences
|
||||
|
||||
.. cmdoption:: --prot
|
||||
|
||||
input file contains protein sequences
|
||||
|
||||
example
|
||||
-------
|
||||
|
||||
for converting a genbank file to fasta ::
|
||||
|
||||
% convert2fasta.py --genbank --nuc sequences.gb > sequences.fasta
|
||||
|
||||
@@ -0,0 +1,2 @@
|
||||
Convert ecoPCR result files to extended OBITools fasta file
|
||||
===========================================================
|
||||
@@ -0,0 +1,2 @@
|
||||
Convert extended OBITools fasta file to a tabular format
|
||||
========================================================
|
||||
@@ -0,0 +1,2 @@
|
||||
The NCBI taxonomy dump files
|
||||
============================
|
||||
Reference in New Issue
Block a user