mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-09-24 18:30:40 +00:00
New version of LCS computation, with abug on alignment length patched patched
This commit is contained in:
+90
-9
@@ -1,15 +1,65 @@
|
||||
package main
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"log"
|
||||
"os"
|
||||
"runtime/trace"
|
||||
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiclean"
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
||||
"cloudeng.io/algo/lcs"
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obialign"
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
||||
)
|
||||
|
||||
func SESStat(script *lcs.EditScript[byte]) (int, int) {
|
||||
llcs := 0
|
||||
gaps := 0
|
||||
extra := 0
|
||||
i := 0
|
||||
ls := len(*script)
|
||||
for i < ls {
|
||||
e := (*script)[i]
|
||||
// log.Println(i,e,e.Op)
|
||||
switch e.Op {
|
||||
case lcs.Identical: // 2
|
||||
if gaps > 0 {
|
||||
extra += gaps
|
||||
}
|
||||
llcs++
|
||||
gaps = 0
|
||||
i++
|
||||
case lcs.Delete: // 1
|
||||
if i+1 < ls {
|
||||
en := (*script)[i+1]
|
||||
if en.Op == lcs.Identical && e.Val == en.Val {
|
||||
log.Println("Swap delete")
|
||||
(*script)[i], (*script)[i+1] = (*script)[i+1], (*script)[i]
|
||||
continue
|
||||
}
|
||||
}
|
||||
gaps--
|
||||
i++
|
||||
case lcs.Insert: // 0
|
||||
if i+1 < ls {
|
||||
en := (*script)[i+1]
|
||||
if en.Op == lcs.Identical && e.Val == en.Val {
|
||||
log.Println("Swap Insert")
|
||||
(*script)[i], (*script)[i+1] = (*script)[i+1], (*script)[i]
|
||||
continue
|
||||
}
|
||||
}
|
||||
gaps++
|
||||
i++
|
||||
}
|
||||
}
|
||||
|
||||
if gaps > 0 {
|
||||
extra += gaps
|
||||
}
|
||||
|
||||
return llcs, extra
|
||||
}
|
||||
|
||||
func main() {
|
||||
|
||||
// Creating a file called cpu.trace.
|
||||
@@ -20,15 +70,46 @@ func main() {
|
||||
trace.Start(ftrace)
|
||||
defer trace.Stop()
|
||||
|
||||
option_parser := obioptions.GenerateOptionParser(
|
||||
obiconvert.InputOptionSet,
|
||||
)
|
||||
// "---CACGATCGTGC-CAGTCAT-GGCTAT"
|
||||
// "CCCCA-GATCGTGCG-AGTCATGGGCTAT"
|
||||
|
||||
_, args, _ := option_parser(os.Args)
|
||||
// 00 0 00000000 1111111 111222
|
||||
// 01 2 34567889 0123456 789012
|
||||
// "CA-C-GATCGTGC-CAGTCAT-GGCTAT"
|
||||
// "CCCCAGATCGTGCG-AGTCATGGGCTAT"
|
||||
|
||||
fs, _ := obiconvert.ReadBioSequencesBatch(args...)
|
||||
//A := "CACGATCGTGCCCCCAGTCATGGCTAT"
|
||||
A := "AAATGCCCCAGATCGTGC"
|
||||
B := "TGCCCCAGAT"
|
||||
|
||||
obiclean.IOBIClean(fs)
|
||||
//A = "aaaggaacttggactgaagatttccacagaggttgcgaatgaaaaacacgtattcgaatgcctcaaatacggaatcgatcttgtctg"
|
||||
A = "aaaggaacttggactgaagatttccacagaggttgcgaatgaaaaacacgtattcgaatgcctcaaatacggaatcgatcttgtctg"
|
||||
B = "atccggttttacgaaaatgcgtgtggtaggggcttatgaaaacgataatcgaataaaaaagggtaggtgcagagactcaacggaagatgttctaacaaatgg"
|
||||
// A = "aataa"
|
||||
// B = "ttttt"
|
||||
sA := obiseq.NewBioSequence("A", []byte(A), "")
|
||||
sB := obiseq.NewBioSequence("A", []byte(B), "")
|
||||
// M := lcs.NewMyers([]byte(A), []byte(B))
|
||||
// fmt.Println(M.LCS())
|
||||
// fmt.Println(M.SES())
|
||||
// fmt.Println(len(M.LCS()))
|
||||
// M.SES().FormatHorizontal(os.Stdout, []byte(B))
|
||||
// llcs, extra := SESStat(M.SES())
|
||||
// nlcs, nali := obialign.LCSScore(sA, sB, sB.Length(), nil)
|
||||
// fmt.Println(llcs, extra, len(A)+extra)
|
||||
// fmt.Println(nlcs, nali)
|
||||
nlcs, nali := obialign.FastLCSScore(sA, sB, sB.Length(), nil)
|
||||
fmt.Println(nlcs, nali)
|
||||
|
||||
// option_parser := obioptions.GenerateOptionParser(
|
||||
// obiconvert.InputOptionSet,
|
||||
// )
|
||||
|
||||
// _, args, _ := option_parser(os.Args)
|
||||
|
||||
// fs, _ := obiconvert.ReadBioSequencesBatch(args...)
|
||||
|
||||
// obiclean.IOBIClean(fs)
|
||||
|
||||
// buffer := make([]byte, 0)
|
||||
// fs.Next()
|
||||
|
||||
+131
-111
@@ -1,29 +1,42 @@
|
||||
package obialign
|
||||
|
||||
import (
|
||||
"log"
|
||||
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/goutils"
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
||||
)
|
||||
|
||||
const wsize = 16
|
||||
const dwsize = wsize * 2
|
||||
|
||||
// Out values are always the smallest
|
||||
// Among in values, they rank according to their score
|
||||
// For equal score the shortest path is the best
|
||||
func _encodeValues(score, length int, out bool) uint64 {
|
||||
const mask = uint64(1<<16) - 1
|
||||
func encodeValues(score, length int, out bool) uint64 {
|
||||
const mask = uint64(1<<wsize) - 1
|
||||
us := uint64(score)
|
||||
fo := (us << 16) | (uint64((^length)-1) & mask)
|
||||
fo := (us << wsize) | (uint64((^length)-1) & mask)
|
||||
if !out {
|
||||
fo |= (uint64(1) << 32)
|
||||
fo |= (uint64(1) << dwsize)
|
||||
}
|
||||
return fo
|
||||
}
|
||||
|
||||
func _decodeValues(value uint64) (int, int, bool) {
|
||||
const mask = uint64(1<<16) - 1
|
||||
score := int((value >> 16) & mask)
|
||||
func _isout(value uint64) bool {
|
||||
const outmask = uint64(1) << dwsize
|
||||
return (value & outmask) == 0
|
||||
}
|
||||
|
||||
func _lpath(value uint64) int {
|
||||
const mask = uint64(1<<wsize) - 1
|
||||
return int(((value + 1) ^ mask) & mask)
|
||||
}
|
||||
|
||||
func decodeValues(value uint64) (int, int, bool) {
|
||||
const mask = uint64(1<<wsize) - 1
|
||||
const outmask = uint64(1) << dwsize
|
||||
score := int((value >> wsize) & mask)
|
||||
length := int(((value + 1) ^ mask) & mask)
|
||||
out := (value & (1 << 32)) == 0
|
||||
out := (value & outmask) == 0
|
||||
return score, length, out
|
||||
}
|
||||
|
||||
@@ -32,34 +45,20 @@ func _incpath(value uint64) uint64 {
|
||||
}
|
||||
|
||||
func _incscore(value uint64) uint64 {
|
||||
const incr = uint64(1) << 16
|
||||
const incr = uint64(1) << wsize
|
||||
return value + incr
|
||||
}
|
||||
|
||||
func _setout(value uint64) uint64 {
|
||||
const outmask = uint64(1) << 32
|
||||
return value | outmask
|
||||
const outmask = ^(uint64(1) << dwsize)
|
||||
return value & outmask
|
||||
}
|
||||
|
||||
func _isout(value uint64) bool {
|
||||
const outmask = uint64(1) << 32
|
||||
return (value & outmask) == 0
|
||||
}
|
||||
var _empty = encodeValues(0, 0, false)
|
||||
var _out = encodeValues(0, 30000, true)
|
||||
var _notavail = encodeValues(0, 30000, false)
|
||||
|
||||
var _empty = _encodeValues(0, 0, false)
|
||||
var _out = _encodeValues(0, 3000, true)
|
||||
|
||||
func FastLCSScore(seqA, seqB *obiseq.BioSequence, maxError int) (int, int) {
|
||||
|
||||
// x:=_encodeValues(12,0,false)
|
||||
// xs,xl,xo := _decodeValues(x)
|
||||
// log.Println(x,xs,xl,xo)
|
||||
// x=_encodeValues(12,1,false)
|
||||
// xs,xl,xo = _decodeValues(x)
|
||||
// log.Println(x,xs,xl,xo)
|
||||
// x=_encodeValues(12,2,false)
|
||||
// xs,xl,xo = _decodeValues(x)
|
||||
// log.Println(x,xs,xl,xo)
|
||||
func FastLCSScore(seqA, seqB *obiseq.BioSequence, maxError int, buffer *[]uint64) (int, int) {
|
||||
|
||||
lA := seqA.Length()
|
||||
lB := seqB.Length()
|
||||
@@ -74,103 +73,88 @@ func FastLCSScore(seqA, seqB *obiseq.BioSequence, maxError int) (int, int) {
|
||||
|
||||
// The difference of length is larger the maximum allowed errors
|
||||
if delta > maxError {
|
||||
// log.Println("Too large difference of length")
|
||||
return -1, -1
|
||||
}
|
||||
|
||||
// Doit-on vraiment diviser par deux ??? pas certain
|
||||
extra := ((maxError - delta) / 2) + 1
|
||||
extra := (maxError - delta) + 1
|
||||
|
||||
even := 1 + delta + 2*extra
|
||||
width := 2*even - 1
|
||||
|
||||
previous := make([]uint64, width)
|
||||
current := make([]uint64, width)
|
||||
|
||||
// Initialise the first line
|
||||
|
||||
for j := 0; j < width; j++ {
|
||||
if (j == extra+even) || (j == extra+even-1) {
|
||||
previous[j] = _encodeValues(0, 1, false)
|
||||
} else {
|
||||
previous[j] = _empty
|
||||
}
|
||||
if buffer == nil {
|
||||
var local []uint64
|
||||
buffer = &local
|
||||
}
|
||||
|
||||
if cap(*buffer) < 2*width {
|
||||
*buffer = make([]uint64, 3*width)
|
||||
}
|
||||
|
||||
previous := (*buffer)[0:width]
|
||||
current := (*buffer)[width:(2 * width)]
|
||||
|
||||
previous[extra] = _empty
|
||||
previous[extra+even] = encodeValues(0, 1, false)
|
||||
previous[extra+even-1] = encodeValues(0, 1, false)
|
||||
|
||||
N := lB + ((delta) >> 1)
|
||||
X := width
|
||||
|
||||
bA := seqA.Sequence()
|
||||
bB := seqB.Sequence()
|
||||
|
||||
// log.Println("N = ", N)
|
||||
|
||||
for y := 1; y <= N; y++ {
|
||||
// in_matrix := false
|
||||
for x := 0; x < width; x++ {
|
||||
X = y * width + x
|
||||
modulo := X % width
|
||||
begin := X - modulo
|
||||
quotien := begin / width
|
||||
x1 := y - lB + extra
|
||||
x2 := extra - y
|
||||
xs := goutils.MaxInt(goutils.MaxInt(x1, x2), 0)
|
||||
|
||||
i := quotien + extra - modulo
|
||||
j := quotien - extra + modulo
|
||||
x1 = y + extra
|
||||
x2 = lA + extra - y
|
||||
xf := goutils.MinInt(goutils.MinInt(x1, x2), even-1) + 1
|
||||
|
||||
if x >= even {
|
||||
i += even
|
||||
j += 1 - even
|
||||
}
|
||||
for x := xs; x < xf; x++ {
|
||||
|
||||
//log.Println(X, i, j, i < 0 || j < 0 || i > lB || j > lA)
|
||||
|
||||
// We are out of tha alignement matrix
|
||||
if i < 0 || j < 0 || i > lB || j > lA {
|
||||
X++
|
||||
continue
|
||||
}
|
||||
i := y - x + extra
|
||||
j := y + x - extra
|
||||
|
||||
var Sdiag, Sleft, Sup uint64
|
||||
|
||||
switch {
|
||||
|
||||
case i == 0:
|
||||
Sup = _encodeValues(0, 30000, false)
|
||||
Sdiag = _encodeValues(0, 30000, false)
|
||||
Sleft = _encodeValues(0, j-1, false)
|
||||
Sup = _notavail
|
||||
Sdiag = _notavail
|
||||
Sleft = encodeValues(0, j-1, false)
|
||||
case j == 0:
|
||||
Sup = _encodeValues(0, i-1, false)
|
||||
Sdiag = _encodeValues(0, 30000, false)
|
||||
Sleft = _encodeValues(0, 30000, false)
|
||||
Sup = encodeValues(0, i-1, false)
|
||||
Sdiag = _notavail
|
||||
Sleft = _notavail
|
||||
default:
|
||||
Sdiag = previous[x]
|
||||
if x >= even {
|
||||
Sleft = current[x-even]
|
||||
Sup = current[x-even+1]
|
||||
|
||||
if bA[j-1] == bB[i-1] {
|
||||
Sdiag = _incscore(Sdiag)
|
||||
}
|
||||
|
||||
if x < (even - 1) {
|
||||
Sup = previous[x+even]
|
||||
} else {
|
||||
if x < (even - 1) {
|
||||
Sup = previous[x+even]
|
||||
} else {
|
||||
Sup = _out
|
||||
}
|
||||
if x > 0 {
|
||||
Sleft = previous[x+even-1]
|
||||
} else {
|
||||
Sleft = _out
|
||||
}
|
||||
Sup = _out
|
||||
}
|
||||
if x > 0 {
|
||||
Sleft = previous[x+even-1]
|
||||
} else {
|
||||
Sleft = _out
|
||||
}
|
||||
}
|
||||
|
||||
// log.Println("scores @",i,j,": ",Sdiag,Sup,Sleft)
|
||||
// ds,dl,ol := _decodeValues(Sdiag)
|
||||
// log.Println(ds,dl,ol)
|
||||
// ds,dl,ol = _decodeValues(Sup)
|
||||
// log.Println(ds,dl,ol)
|
||||
// ds,dl,ol = _decodeValues(Sleft)
|
||||
// log.Println(ds,dl,ol)
|
||||
var score uint64
|
||||
switch {
|
||||
case Sdiag >= Sup && Sdiag >= Sleft:
|
||||
score = Sdiag
|
||||
if seqA.Sequence()[j-1] == seqB.Sequence()[i-1] {
|
||||
score = _incscore(score)
|
||||
}
|
||||
case Sup >= Sleft:
|
||||
score = Sup
|
||||
default:
|
||||
@@ -181,36 +165,72 @@ func FastLCSScore(seqA, seqB *obiseq.BioSequence, maxError int) (int, int) {
|
||||
score = _setout(score)
|
||||
}
|
||||
|
||||
// if i < 5 && j < 5 {
|
||||
// ds, dl, ol := _decodeValues(_incpath(score))
|
||||
// log.Println("@", i, j,":", ds, dl, ol)
|
||||
// }
|
||||
current[x] = _incpath(score)
|
||||
}
|
||||
// . 9 10 + 2 - 1
|
||||
x1 = y - lB + extra + even
|
||||
x2 = extra - y + even - 1
|
||||
xs = goutils.MaxInt(goutils.MaxInt(x1, x2), even)
|
||||
|
||||
x1 = y + extra + even
|
||||
x2 = lA + extra - y + even - 1
|
||||
xf = goutils.MinInt(goutils.MinInt(x1, x2), width-1) + 1
|
||||
|
||||
for x := xs; x < xf; x++ {
|
||||
|
||||
i := y - x + extra + even
|
||||
j := y + x - extra - even + 1
|
||||
|
||||
var Sdiag, Sleft, Sup uint64
|
||||
|
||||
switch {
|
||||
|
||||
case i == 0:
|
||||
Sup = _notavail
|
||||
Sdiag = _notavail
|
||||
Sleft = encodeValues(0, j-1, false)
|
||||
case j == 0:
|
||||
Sup = encodeValues(0, i-1, false)
|
||||
Sdiag = _notavail
|
||||
Sleft = _notavail
|
||||
default:
|
||||
Sdiag = previous[x]
|
||||
|
||||
if bA[j-1] == bB[i-1] {
|
||||
Sdiag = _incscore(Sdiag)
|
||||
}
|
||||
|
||||
Sleft = current[x-even]
|
||||
Sup = current[x-even+1]
|
||||
|
||||
}
|
||||
|
||||
var score uint64
|
||||
switch {
|
||||
case Sdiag >= Sup && Sdiag >= Sleft:
|
||||
score = Sdiag
|
||||
case Sup >= Sleft:
|
||||
score = Sup
|
||||
default:
|
||||
score = Sleft
|
||||
}
|
||||
|
||||
if _isout(Sdiag) || _isout(Sup) || _isout(Sleft) {
|
||||
score = _setout(score)
|
||||
}
|
||||
|
||||
current[x] = _incpath(score)
|
||||
|
||||
// if i == lB && j == lA {
|
||||
// s, l, o := _decodeValues(current[x])
|
||||
// log.Println("Results in ", x, y, "(", i, j, ") values : ", s, l, o)
|
||||
// }
|
||||
|
||||
X++
|
||||
}
|
||||
// if !in_matrix {
|
||||
// log.Fatalln("Never entred in the matrix", y, "/", N)
|
||||
// }
|
||||
|
||||
previous, current = current, previous
|
||||
|
||||
}
|
||||
|
||||
s, l, o := _decodeValues(previous[(delta%2)*even+extra+(delta>>1)])
|
||||
s, l, o := decodeValues(previous[(delta%2)*even+extra+(delta>>1)])
|
||||
|
||||
if o {
|
||||
log.Println("Too much error", s, l, (lA%2)*even+(lA-lB), lA, lB, width, even, N)
|
||||
return -1, -1
|
||||
}
|
||||
|
||||
return s, l
|
||||
}
|
||||
|
||||
// width * j + modulo + width * extra - width * modulo= X
|
||||
// i = (X - modulo)/width - modulo + extra
|
||||
|
||||
@@ -1,240 +0,0 @@
|
||||
package obialign
|
||||
|
||||
import (
|
||||
"log"
|
||||
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
||||
)
|
||||
|
||||
func max(a, b int) int {
|
||||
if a > b {
|
||||
return a
|
||||
}
|
||||
return b
|
||||
}
|
||||
|
||||
func min(a, b int) int {
|
||||
if a < b {
|
||||
return a
|
||||
}
|
||||
return b
|
||||
}
|
||||
|
||||
type LCSMatrix struct {
|
||||
matrix []int16 // Score matrix
|
||||
//lenght []int16 // Alignment length matrix
|
||||
ll int // Length of the longest sequence
|
||||
l int // Length of the shortest sequence
|
||||
delta int // ll - l
|
||||
extra int
|
||||
w int
|
||||
}
|
||||
|
||||
func NewLCSMatrix(matrix *LCSMatrix, L, l int, maxError int) *LCSMatrix {
|
||||
if matrix == nil {
|
||||
matrix = &LCSMatrix{}
|
||||
}
|
||||
|
||||
if l > L {
|
||||
log.Panicf("L (%d) must be greater or equal to l (%d)", L, l)
|
||||
}
|
||||
|
||||
delta := L - l
|
||||
extra := ((maxError - delta) / 2) + 1
|
||||
|
||||
needed := (L * (1 + delta + 2*extra)) * 2
|
||||
|
||||
if needed > matrix.Cap() {
|
||||
matrix.matrix = make([]int16, needed)
|
||||
//matrix.lenght = make([]int16, needed)
|
||||
}
|
||||
|
||||
matrix.matrix = matrix.matrix[0:needed]
|
||||
// matrix.lenght = matrix.lenght[:needed]
|
||||
|
||||
matrix.ll = L
|
||||
matrix.l = l
|
||||
matrix.delta = delta
|
||||
matrix.extra = extra
|
||||
matrix.w = delta + 1 + 2*extra
|
||||
|
||||
return matrix
|
||||
}
|
||||
|
||||
func (matrix *LCSMatrix) Cap() int {
|
||||
return cap(matrix.matrix)
|
||||
}
|
||||
|
||||
func (matrix *LCSMatrix) Length() int {
|
||||
return len(matrix.matrix)
|
||||
}
|
||||
|
||||
func (matrix *LCSMatrix) Get(i, j int) (int, int) {
|
||||
ij := max(0, i-matrix.extra)
|
||||
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
|
||||
|
||||
switch {
|
||||
case i == 0:
|
||||
return 0,j
|
||||
case j == 0:
|
||||
return 0,i
|
||||
case j < ij || j > sj:
|
||||
return -1, 30000
|
||||
default:
|
||||
offset := (matrix.extra + matrix.w*(i-1) + (matrix.w-1)*(j-i)) * 2
|
||||
return int(matrix.matrix[offset]), int(matrix.matrix[offset+1])
|
||||
}
|
||||
}
|
||||
|
||||
func (matrix *LCSMatrix) GetNeibourgh(i, j int) (
|
||||
sd int, ld int,
|
||||
sup int, lup int,
|
||||
sleft int, lleft int) {
|
||||
offset := matrix.extra + matrix.w*(j-2) + i - j
|
||||
|
||||
it := i - 1
|
||||
jt := j - 1
|
||||
|
||||
ij0 := max(0, i-matrix.extra)
|
||||
sj0 := min(i+matrix.delta+matrix.extra, matrix.ll)
|
||||
ij1 := max(0, it-matrix.extra)
|
||||
sj1 := min(it+matrix.delta+matrix.extra, matrix.ll)
|
||||
|
||||
switch {
|
||||
case i == 1:
|
||||
sd = 0
|
||||
ld = jt
|
||||
case j == 1:
|
||||
sd = 0
|
||||
ld = it
|
||||
case jt < ij1 || jt > sj1:
|
||||
sd = -1
|
||||
ld = 30000
|
||||
default:
|
||||
sd = int(matrix.matrix[offset*2])
|
||||
ld = int(matrix.matrix[offset*2+1])
|
||||
}
|
||||
|
||||
offset++
|
||||
|
||||
|
||||
switch {
|
||||
case i == 0:
|
||||
sleft = 0
|
||||
lleft = jt
|
||||
case j == 1:
|
||||
sleft = 0
|
||||
lleft = i
|
||||
case jt < ij0 || jt > sj0:
|
||||
sleft = -1
|
||||
lleft = 30000
|
||||
default:
|
||||
sleft = int(matrix.matrix[offset*2])
|
||||
lleft = int(matrix.matrix[offset*2+1])
|
||||
}
|
||||
|
||||
offset += matrix.w - 2
|
||||
|
||||
switch {
|
||||
case i == 1:
|
||||
sup = 0
|
||||
lup = j
|
||||
case j == 0:
|
||||
sup = 0
|
||||
lup = it
|
||||
case j < ij1 || j > sj1:
|
||||
sup = -1
|
||||
lup = 30000
|
||||
default:
|
||||
sup = int(matrix.matrix[offset*2])
|
||||
lup = int(matrix.matrix[offset*2+1])
|
||||
}
|
||||
|
||||
return
|
||||
}
|
||||
|
||||
func (matrix *LCSMatrix) Set(i, j int, score, length int) {
|
||||
ij := max(0, i-matrix.extra)
|
||||
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
|
||||
|
||||
if i > 0 && j > 0 && j >= ij && j <= sj {
|
||||
offset := (matrix.extra + matrix.w*(i-1) + (matrix.w-1)*(j-i)) * 2
|
||||
matrix.matrix[offset] = int16(score)
|
||||
matrix.matrix[offset+1] = int16(length)
|
||||
}
|
||||
}
|
||||
|
||||
// Computes the LCS between two DNA sequences and the length of the
|
||||
// corresponding alignment
|
||||
func LCSScore(seqA, seqB *obiseq.BioSequence, maxError int,
|
||||
matrix *LCSMatrix) (int, int) {
|
||||
|
||||
if seqA.Length() == 0 {
|
||||
log.Fatal("Sequence A has a length of 0")
|
||||
}
|
||||
|
||||
if seqB.Length() == 0 {
|
||||
log.Fatal("Sequence B has a length of 0")
|
||||
}
|
||||
// swapped := false
|
||||
|
||||
if seqA.Length() < seqB.Length() {
|
||||
seqA, seqB = seqB, seqA
|
||||
// swapped = true
|
||||
}
|
||||
|
||||
if (seqA.Length() - seqB.Length()) > maxError {
|
||||
return -1, -1
|
||||
}
|
||||
|
||||
la := seqA.Length()
|
||||
lb := seqB.Length()
|
||||
sa := seqA.Sequence()
|
||||
sb := seqB.Sequence()
|
||||
|
||||
matrix = NewLCSMatrix(matrix, la, lb, maxError)
|
||||
|
||||
for i := 1; i <= matrix.l; i++ {
|
||||
ij := max(1, i-matrix.extra)
|
||||
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
|
||||
for j := ij; j <= sj; j++ {
|
||||
sd, ld, sup, lup, sleft, lleft := matrix.GetNeibourgh(i, j)
|
||||
if i > lb {
|
||||
log.Println("Error on seq B ", 1, matrix.l)
|
||||
log.Println(i)
|
||||
log.Println(seqB.Length(), "/", lb)
|
||||
log.Println(string(sa))
|
||||
log.Fatalln(string(sb))
|
||||
}
|
||||
if j > la {
|
||||
log.Println("Error on seq A ", ij, sj)
|
||||
log.Println(j)
|
||||
log.Println(seqA.Length(), "/", la)
|
||||
log.Println(string(sa))
|
||||
log.Fatalln(string(sb))
|
||||
}
|
||||
if sb[i-1] == sa[j-1] {
|
||||
sd++
|
||||
}
|
||||
// sup, lup := matrix.Get(i-1, j)
|
||||
// sleft, lleft := matrix.Get(i, j-1)
|
||||
switch {
|
||||
case sd >= sup && sd >= sleft:
|
||||
matrix.Set(i, j, sd, ld+1)
|
||||
case sup >= sleft && sup >= sd:
|
||||
matrix.Set(i, j, sup, lup+1)
|
||||
default:
|
||||
matrix.Set(i, j, sleft, lleft+1)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
s, l := matrix.Get(lb, la)
|
||||
|
||||
if (l - s) > maxError {
|
||||
// log.Println(l,s,l-s,maxError)
|
||||
return -1, -1
|
||||
}
|
||||
|
||||
return int(s), int(l)
|
||||
}
|
||||
@@ -360,14 +360,14 @@ func extendSimilarityGraph(seqs *[]*seqPCR, step int, workers int) int {
|
||||
nseq := len(*seqs)
|
||||
running := sync.WaitGroup{}
|
||||
|
||||
linePairs := func(matrix *obialign.LCSMatrix, i int) {
|
||||
linePairs := func(matrix *[]uint64, i int) {
|
||||
son := (*seqs)[i]
|
||||
for j := i + 1; j < nseq; j++ {
|
||||
father := (*seqs)[j]
|
||||
d, _, _, _ := obialign.D1Or0(son.Sequence, father.Sequence)
|
||||
|
||||
if d < 0 {
|
||||
lcs, lali := obialign.LCSScore(son.Sequence, father.Sequence,
|
||||
lcs, lali := obialign.FastLCSScore(son.Sequence, father.Sequence,
|
||||
step,
|
||||
matrix)
|
||||
d := (lali - lcs)
|
||||
@@ -385,9 +385,10 @@ func extendSimilarityGraph(seqs *[]*seqPCR, step int, workers int) int {
|
||||
// idxChan := make(chan [][]Ratio)
|
||||
|
||||
ff := func() {
|
||||
matrix := obialign.NewLCSMatrix(nil, 150, 150, step)
|
||||
var matrix []uint64
|
||||
|
||||
for i := range lineChan {
|
||||
linePairs(matrix, i)
|
||||
linePairs(&matrix, i)
|
||||
}
|
||||
|
||||
running.Done()
|
||||
|
||||
@@ -22,34 +22,26 @@ func FindClosests(sequence *obiseq.BioSequence,
|
||||
refcounts []*obikmer.Table4mer,
|
||||
runExact bool) (obiseq.BioSequenceSlice, int, float64, string, []int) {
|
||||
|
||||
matrix := obialign.NewLCSMatrix(nil,
|
||||
sequence.Length(),
|
||||
sequence.Length(),
|
||||
sequence.Length())
|
||||
var matrix []uint64
|
||||
|
||||
seqwords := obikmer.Count4Mer(sequence, nil, nil)
|
||||
cw := make([]int, len(refcounts))
|
||||
|
||||
for i, ref := range refcounts {
|
||||
cw[i] = obikmer.Common4Mer(seqwords, ref)
|
||||
// if i < 50 {
|
||||
// print(cw[i])
|
||||
// print(";")
|
||||
// }
|
||||
}
|
||||
// print("\n")
|
||||
|
||||
o := goutils.ReverseIntOrder(cw)
|
||||
|
||||
mcw := 100000
|
||||
for _, i := range o {
|
||||
if cw[i] < mcw {
|
||||
mcw = cw[i]
|
||||
}
|
||||
if cw[i] > mcw {
|
||||
log.Panicln("wrong order")
|
||||
}
|
||||
}
|
||||
// mcw := 100000
|
||||
// for _, i := range o {
|
||||
// if cw[i] < mcw {
|
||||
// mcw = cw[i]
|
||||
// }
|
||||
// if cw[i] > mcw {
|
||||
// log.Panicln("wrong order")
|
||||
// }
|
||||
// }
|
||||
|
||||
bests := obiseq.MakeBioSequenceSlice()
|
||||
bests = append(bests, references[o[0]])
|
||||
@@ -74,7 +66,8 @@ func FindClosests(sequence *obiseq.BioSequence,
|
||||
|
||||
// log.Println(sequence.Id(),cw[j], maxe)
|
||||
if runExact || (atMost <= (maxe + 1)) {
|
||||
lcs, alilength := obialign.LCSScore(sequence, ref, maxe+1, matrix)
|
||||
lcs, alilength := obialign.FastLCSScore(sequence, ref, maxe+1,&matrix)
|
||||
// lcs, alilength := obialign.LCSScore(sequence, ref, maxe+1, matrix)
|
||||
n++
|
||||
if lcs == -1 {
|
||||
nf++
|
||||
|
||||
Reference in New Issue
Block a user