mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-02-03 14:50:33 +00:00
New version of LCS computation, with abug on alignment length patched patched
This commit is contained in:
@@ -1,15 +1,65 @@
|
|||||||
package main
|
package main
|
||||||
|
|
||||||
import (
|
import (
|
||||||
|
"fmt"
|
||||||
"log"
|
"log"
|
||||||
"os"
|
"os"
|
||||||
"runtime/trace"
|
"runtime/trace"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
|
"cloudeng.io/algo/lcs"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiclean"
|
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obialign"
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
func SESStat(script *lcs.EditScript[byte]) (int, int) {
|
||||||
|
llcs := 0
|
||||||
|
gaps := 0
|
||||||
|
extra := 0
|
||||||
|
i := 0
|
||||||
|
ls := len(*script)
|
||||||
|
for i < ls {
|
||||||
|
e := (*script)[i]
|
||||||
|
// log.Println(i,e,e.Op)
|
||||||
|
switch e.Op {
|
||||||
|
case lcs.Identical: // 2
|
||||||
|
if gaps > 0 {
|
||||||
|
extra += gaps
|
||||||
|
}
|
||||||
|
llcs++
|
||||||
|
gaps = 0
|
||||||
|
i++
|
||||||
|
case lcs.Delete: // 1
|
||||||
|
if i+1 < ls {
|
||||||
|
en := (*script)[i+1]
|
||||||
|
if en.Op == lcs.Identical && e.Val == en.Val {
|
||||||
|
log.Println("Swap delete")
|
||||||
|
(*script)[i], (*script)[i+1] = (*script)[i+1], (*script)[i]
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
}
|
||||||
|
gaps--
|
||||||
|
i++
|
||||||
|
case lcs.Insert: // 0
|
||||||
|
if i+1 < ls {
|
||||||
|
en := (*script)[i+1]
|
||||||
|
if en.Op == lcs.Identical && e.Val == en.Val {
|
||||||
|
log.Println("Swap Insert")
|
||||||
|
(*script)[i], (*script)[i+1] = (*script)[i+1], (*script)[i]
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
}
|
||||||
|
gaps++
|
||||||
|
i++
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if gaps > 0 {
|
||||||
|
extra += gaps
|
||||||
|
}
|
||||||
|
|
||||||
|
return llcs, extra
|
||||||
|
}
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
|
|
||||||
// Creating a file called cpu.trace.
|
// Creating a file called cpu.trace.
|
||||||
@@ -20,15 +70,46 @@ func main() {
|
|||||||
trace.Start(ftrace)
|
trace.Start(ftrace)
|
||||||
defer trace.Stop()
|
defer trace.Stop()
|
||||||
|
|
||||||
option_parser := obioptions.GenerateOptionParser(
|
// "---CACGATCGTGC-CAGTCAT-GGCTAT"
|
||||||
obiconvert.InputOptionSet,
|
// "CCCCA-GATCGTGCG-AGTCATGGGCTAT"
|
||||||
)
|
|
||||||
|
|
||||||
_, args, _ := option_parser(os.Args)
|
// 00 0 00000000 1111111 111222
|
||||||
|
// 01 2 34567889 0123456 789012
|
||||||
|
// "CA-C-GATCGTGC-CAGTCAT-GGCTAT"
|
||||||
|
// "CCCCAGATCGTGCG-AGTCATGGGCTAT"
|
||||||
|
|
||||||
fs, _ := obiconvert.ReadBioSequencesBatch(args...)
|
//A := "CACGATCGTGCCCCCAGTCATGGCTAT"
|
||||||
|
A := "AAATGCCCCAGATCGTGC"
|
||||||
|
B := "TGCCCCAGAT"
|
||||||
|
|
||||||
obiclean.IOBIClean(fs)
|
//A = "aaaggaacttggactgaagatttccacagaggttgcgaatgaaaaacacgtattcgaatgcctcaaatacggaatcgatcttgtctg"
|
||||||
|
A = "aaaggaacttggactgaagatttccacagaggttgcgaatgaaaaacacgtattcgaatgcctcaaatacggaatcgatcttgtctg"
|
||||||
|
B = "atccggttttacgaaaatgcgtgtggtaggggcttatgaaaacgataatcgaataaaaaagggtaggtgcagagactcaacggaagatgttctaacaaatgg"
|
||||||
|
// A = "aataa"
|
||||||
|
// B = "ttttt"
|
||||||
|
sA := obiseq.NewBioSequence("A", []byte(A), "")
|
||||||
|
sB := obiseq.NewBioSequence("A", []byte(B), "")
|
||||||
|
// M := lcs.NewMyers([]byte(A), []byte(B))
|
||||||
|
// fmt.Println(M.LCS())
|
||||||
|
// fmt.Println(M.SES())
|
||||||
|
// fmt.Println(len(M.LCS()))
|
||||||
|
// M.SES().FormatHorizontal(os.Stdout, []byte(B))
|
||||||
|
// llcs, extra := SESStat(M.SES())
|
||||||
|
// nlcs, nali := obialign.LCSScore(sA, sB, sB.Length(), nil)
|
||||||
|
// fmt.Println(llcs, extra, len(A)+extra)
|
||||||
|
// fmt.Println(nlcs, nali)
|
||||||
|
nlcs, nali := obialign.FastLCSScore(sA, sB, sB.Length(), nil)
|
||||||
|
fmt.Println(nlcs, nali)
|
||||||
|
|
||||||
|
// option_parser := obioptions.GenerateOptionParser(
|
||||||
|
// obiconvert.InputOptionSet,
|
||||||
|
// )
|
||||||
|
|
||||||
|
// _, args, _ := option_parser(os.Args)
|
||||||
|
|
||||||
|
// fs, _ := obiconvert.ReadBioSequencesBatch(args...)
|
||||||
|
|
||||||
|
// obiclean.IOBIClean(fs)
|
||||||
|
|
||||||
// buffer := make([]byte, 0)
|
// buffer := make([]byte, 0)
|
||||||
// fs.Next()
|
// fs.Next()
|
||||||
|
|||||||
@@ -1,29 +1,42 @@
|
|||||||
package obialign
|
package obialign
|
||||||
|
|
||||||
import (
|
import (
|
||||||
"log"
|
"git.metabarcoding.org/lecasofts/go/obitools/pkg/goutils"
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
const wsize = 16
|
||||||
|
const dwsize = wsize * 2
|
||||||
|
|
||||||
// Out values are always the smallest
|
// Out values are always the smallest
|
||||||
// Among in values, they rank according to their score
|
// Among in values, they rank according to their score
|
||||||
// For equal score the shortest path is the best
|
// For equal score the shortest path is the best
|
||||||
func _encodeValues(score, length int, out bool) uint64 {
|
func encodeValues(score, length int, out bool) uint64 {
|
||||||
const mask = uint64(1<<16) - 1
|
const mask = uint64(1<<wsize) - 1
|
||||||
us := uint64(score)
|
us := uint64(score)
|
||||||
fo := (us << 16) | (uint64((^length)-1) & mask)
|
fo := (us << wsize) | (uint64((^length)-1) & mask)
|
||||||
if !out {
|
if !out {
|
||||||
fo |= (uint64(1) << 32)
|
fo |= (uint64(1) << dwsize)
|
||||||
}
|
}
|
||||||
return fo
|
return fo
|
||||||
}
|
}
|
||||||
|
|
||||||
func _decodeValues(value uint64) (int, int, bool) {
|
func _isout(value uint64) bool {
|
||||||
const mask = uint64(1<<16) - 1
|
const outmask = uint64(1) << dwsize
|
||||||
score := int((value >> 16) & mask)
|
return (value & outmask) == 0
|
||||||
|
}
|
||||||
|
|
||||||
|
func _lpath(value uint64) int {
|
||||||
|
const mask = uint64(1<<wsize) - 1
|
||||||
|
return int(((value + 1) ^ mask) & mask)
|
||||||
|
}
|
||||||
|
|
||||||
|
func decodeValues(value uint64) (int, int, bool) {
|
||||||
|
const mask = uint64(1<<wsize) - 1
|
||||||
|
const outmask = uint64(1) << dwsize
|
||||||
|
score := int((value >> wsize) & mask)
|
||||||
length := int(((value + 1) ^ mask) & mask)
|
length := int(((value + 1) ^ mask) & mask)
|
||||||
out := (value & (1 << 32)) == 0
|
out := (value & outmask) == 0
|
||||||
return score, length, out
|
return score, length, out
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -32,34 +45,20 @@ func _incpath(value uint64) uint64 {
|
|||||||
}
|
}
|
||||||
|
|
||||||
func _incscore(value uint64) uint64 {
|
func _incscore(value uint64) uint64 {
|
||||||
const incr = uint64(1) << 16
|
const incr = uint64(1) << wsize
|
||||||
return value + incr
|
return value + incr
|
||||||
}
|
}
|
||||||
|
|
||||||
func _setout(value uint64) uint64 {
|
func _setout(value uint64) uint64 {
|
||||||
const outmask = uint64(1) << 32
|
const outmask = ^(uint64(1) << dwsize)
|
||||||
return value | outmask
|
return value & outmask
|
||||||
}
|
}
|
||||||
|
|
||||||
func _isout(value uint64) bool {
|
var _empty = encodeValues(0, 0, false)
|
||||||
const outmask = uint64(1) << 32
|
var _out = encodeValues(0, 30000, true)
|
||||||
return (value & outmask) == 0
|
var _notavail = encodeValues(0, 30000, false)
|
||||||
}
|
|
||||||
|
|
||||||
var _empty = _encodeValues(0, 0, false)
|
func FastLCSScore(seqA, seqB *obiseq.BioSequence, maxError int, buffer *[]uint64) (int, int) {
|
||||||
var _out = _encodeValues(0, 3000, true)
|
|
||||||
|
|
||||||
func FastLCSScore(seqA, seqB *obiseq.BioSequence, maxError int) (int, int) {
|
|
||||||
|
|
||||||
// x:=_encodeValues(12,0,false)
|
|
||||||
// xs,xl,xo := _decodeValues(x)
|
|
||||||
// log.Println(x,xs,xl,xo)
|
|
||||||
// x=_encodeValues(12,1,false)
|
|
||||||
// xs,xl,xo = _decodeValues(x)
|
|
||||||
// log.Println(x,xs,xl,xo)
|
|
||||||
// x=_encodeValues(12,2,false)
|
|
||||||
// xs,xl,xo = _decodeValues(x)
|
|
||||||
// log.Println(x,xs,xl,xo)
|
|
||||||
|
|
||||||
lA := seqA.Length()
|
lA := seqA.Length()
|
||||||
lB := seqB.Length()
|
lB := seqB.Length()
|
||||||
@@ -74,76 +73,72 @@ func FastLCSScore(seqA, seqB *obiseq.BioSequence, maxError int) (int, int) {
|
|||||||
|
|
||||||
// The difference of length is larger the maximum allowed errors
|
// The difference of length is larger the maximum allowed errors
|
||||||
if delta > maxError {
|
if delta > maxError {
|
||||||
// log.Println("Too large difference of length")
|
|
||||||
return -1, -1
|
return -1, -1
|
||||||
}
|
}
|
||||||
|
|
||||||
// Doit-on vraiment diviser par deux ??? pas certain
|
// Doit-on vraiment diviser par deux ??? pas certain
|
||||||
extra := ((maxError - delta) / 2) + 1
|
extra := (maxError - delta) + 1
|
||||||
|
|
||||||
even := 1 + delta + 2*extra
|
even := 1 + delta + 2*extra
|
||||||
width := 2*even - 1
|
width := 2*even - 1
|
||||||
|
|
||||||
previous := make([]uint64, width)
|
if buffer == nil {
|
||||||
current := make([]uint64, width)
|
var local []uint64
|
||||||
|
buffer = &local
|
||||||
// Initialise the first line
|
|
||||||
|
|
||||||
for j := 0; j < width; j++ {
|
|
||||||
if (j == extra+even) || (j == extra+even-1) {
|
|
||||||
previous[j] = _encodeValues(0, 1, false)
|
|
||||||
} else {
|
|
||||||
previous[j] = _empty
|
|
||||||
}
|
}
|
||||||
|
|
||||||
|
if cap(*buffer) < 2*width {
|
||||||
|
*buffer = make([]uint64, 3*width)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
previous := (*buffer)[0:width]
|
||||||
|
current := (*buffer)[width:(2 * width)]
|
||||||
|
|
||||||
|
previous[extra] = _empty
|
||||||
|
previous[extra+even] = encodeValues(0, 1, false)
|
||||||
|
previous[extra+even-1] = encodeValues(0, 1, false)
|
||||||
|
|
||||||
N := lB + ((delta) >> 1)
|
N := lB + ((delta) >> 1)
|
||||||
X := width
|
|
||||||
|
bA := seqA.Sequence()
|
||||||
|
bB := seqB.Sequence()
|
||||||
|
|
||||||
// log.Println("N = ", N)
|
// log.Println("N = ", N)
|
||||||
|
|
||||||
for y := 1; y <= N; y++ {
|
for y := 1; y <= N; y++ {
|
||||||
// in_matrix := false
|
// in_matrix := false
|
||||||
for x := 0; x < width; x++ {
|
x1 := y - lB + extra
|
||||||
X = y * width + x
|
x2 := extra - y
|
||||||
modulo := X % width
|
xs := goutils.MaxInt(goutils.MaxInt(x1, x2), 0)
|
||||||
begin := X - modulo
|
|
||||||
quotien := begin / width
|
|
||||||
|
|
||||||
i := quotien + extra - modulo
|
x1 = y + extra
|
||||||
j := quotien - extra + modulo
|
x2 = lA + extra - y
|
||||||
|
xf := goutils.MinInt(goutils.MinInt(x1, x2), even-1) + 1
|
||||||
|
|
||||||
if x >= even {
|
for x := xs; x < xf; x++ {
|
||||||
i += even
|
|
||||||
j += 1 - even
|
|
||||||
}
|
|
||||||
|
|
||||||
//log.Println(X, i, j, i < 0 || j < 0 || i > lB || j > lA)
|
i := y - x + extra
|
||||||
|
j := y + x - extra
|
||||||
// We are out of tha alignement matrix
|
|
||||||
if i < 0 || j < 0 || i > lB || j > lA {
|
|
||||||
X++
|
|
||||||
continue
|
|
||||||
}
|
|
||||||
|
|
||||||
var Sdiag, Sleft, Sup uint64
|
var Sdiag, Sleft, Sup uint64
|
||||||
|
|
||||||
switch {
|
switch {
|
||||||
|
|
||||||
case i == 0:
|
case i == 0:
|
||||||
Sup = _encodeValues(0, 30000, false)
|
Sup = _notavail
|
||||||
Sdiag = _encodeValues(0, 30000, false)
|
Sdiag = _notavail
|
||||||
Sleft = _encodeValues(0, j-1, false)
|
Sleft = encodeValues(0, j-1, false)
|
||||||
case j == 0:
|
case j == 0:
|
||||||
Sup = _encodeValues(0, i-1, false)
|
Sup = encodeValues(0, i-1, false)
|
||||||
Sdiag = _encodeValues(0, 30000, false)
|
Sdiag = _notavail
|
||||||
Sleft = _encodeValues(0, 30000, false)
|
Sleft = _notavail
|
||||||
default:
|
default:
|
||||||
Sdiag = previous[x]
|
Sdiag = previous[x]
|
||||||
if x >= even {
|
|
||||||
Sleft = current[x-even]
|
if bA[j-1] == bB[i-1] {
|
||||||
Sup = current[x-even+1]
|
Sdiag = _incscore(Sdiag)
|
||||||
} else {
|
}
|
||||||
|
|
||||||
if x < (even - 1) {
|
if x < (even - 1) {
|
||||||
Sup = previous[x+even]
|
Sup = previous[x+even]
|
||||||
} else {
|
} else {
|
||||||
@@ -155,22 +150,11 @@ func FastLCSScore(seqA, seqB *obiseq.BioSequence, maxError int) (int, int) {
|
|||||||
Sleft = _out
|
Sleft = _out
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
|
||||||
|
|
||||||
// log.Println("scores @",i,j,": ",Sdiag,Sup,Sleft)
|
|
||||||
// ds,dl,ol := _decodeValues(Sdiag)
|
|
||||||
// log.Println(ds,dl,ol)
|
|
||||||
// ds,dl,ol = _decodeValues(Sup)
|
|
||||||
// log.Println(ds,dl,ol)
|
|
||||||
// ds,dl,ol = _decodeValues(Sleft)
|
|
||||||
// log.Println(ds,dl,ol)
|
|
||||||
var score uint64
|
var score uint64
|
||||||
switch {
|
switch {
|
||||||
case Sdiag >= Sup && Sdiag >= Sleft:
|
case Sdiag >= Sup && Sdiag >= Sleft:
|
||||||
score = Sdiag
|
score = Sdiag
|
||||||
if seqA.Sequence()[j-1] == seqB.Sequence()[i-1] {
|
|
||||||
score = _incscore(score)
|
|
||||||
}
|
|
||||||
case Sup >= Sleft:
|
case Sup >= Sleft:
|
||||||
score = Sup
|
score = Sup
|
||||||
default:
|
default:
|
||||||
@@ -181,36 +165,72 @@ func FastLCSScore(seqA, seqB *obiseq.BioSequence, maxError int) (int, int) {
|
|||||||
score = _setout(score)
|
score = _setout(score)
|
||||||
}
|
}
|
||||||
|
|
||||||
// if i < 5 && j < 5 {
|
current[x] = _incpath(score)
|
||||||
// ds, dl, ol := _decodeValues(_incpath(score))
|
}
|
||||||
// log.Println("@", i, j,":", ds, dl, ol)
|
// . 9 10 + 2 - 1
|
||||||
// }
|
x1 = y - lB + extra + even
|
||||||
|
x2 = extra - y + even - 1
|
||||||
|
xs = goutils.MaxInt(goutils.MaxInt(x1, x2), even)
|
||||||
|
|
||||||
|
x1 = y + extra + even
|
||||||
|
x2 = lA + extra - y + even - 1
|
||||||
|
xf = goutils.MinInt(goutils.MinInt(x1, x2), width-1) + 1
|
||||||
|
|
||||||
|
for x := xs; x < xf; x++ {
|
||||||
|
|
||||||
|
i := y - x + extra + even
|
||||||
|
j := y + x - extra - even + 1
|
||||||
|
|
||||||
|
var Sdiag, Sleft, Sup uint64
|
||||||
|
|
||||||
|
switch {
|
||||||
|
|
||||||
|
case i == 0:
|
||||||
|
Sup = _notavail
|
||||||
|
Sdiag = _notavail
|
||||||
|
Sleft = encodeValues(0, j-1, false)
|
||||||
|
case j == 0:
|
||||||
|
Sup = encodeValues(0, i-1, false)
|
||||||
|
Sdiag = _notavail
|
||||||
|
Sleft = _notavail
|
||||||
|
default:
|
||||||
|
Sdiag = previous[x]
|
||||||
|
|
||||||
|
if bA[j-1] == bB[i-1] {
|
||||||
|
Sdiag = _incscore(Sdiag)
|
||||||
|
}
|
||||||
|
|
||||||
|
Sleft = current[x-even]
|
||||||
|
Sup = current[x-even+1]
|
||||||
|
|
||||||
|
}
|
||||||
|
|
||||||
|
var score uint64
|
||||||
|
switch {
|
||||||
|
case Sdiag >= Sup && Sdiag >= Sleft:
|
||||||
|
score = Sdiag
|
||||||
|
case Sup >= Sleft:
|
||||||
|
score = Sup
|
||||||
|
default:
|
||||||
|
score = Sleft
|
||||||
|
}
|
||||||
|
|
||||||
|
if _isout(Sdiag) || _isout(Sup) || _isout(Sleft) {
|
||||||
|
score = _setout(score)
|
||||||
|
}
|
||||||
|
|
||||||
current[x] = _incpath(score)
|
current[x] = _incpath(score)
|
||||||
|
|
||||||
// if i == lB && j == lA {
|
|
||||||
// s, l, o := _decodeValues(current[x])
|
|
||||||
// log.Println("Results in ", x, y, "(", i, j, ") values : ", s, l, o)
|
|
||||||
// }
|
|
||||||
|
|
||||||
X++
|
|
||||||
}
|
}
|
||||||
// if !in_matrix {
|
|
||||||
// log.Fatalln("Never entred in the matrix", y, "/", N)
|
|
||||||
// }
|
|
||||||
previous, current = current, previous
|
previous, current = current, previous
|
||||||
|
|
||||||
}
|
}
|
||||||
|
|
||||||
s, l, o := _decodeValues(previous[(delta%2)*even+extra+(delta>>1)])
|
s, l, o := decodeValues(previous[(delta%2)*even+extra+(delta>>1)])
|
||||||
|
|
||||||
if o {
|
if o {
|
||||||
log.Println("Too much error", s, l, (lA%2)*even+(lA-lB), lA, lB, width, even, N)
|
|
||||||
return -1, -1
|
return -1, -1
|
||||||
}
|
}
|
||||||
|
|
||||||
return s, l
|
return s, l
|
||||||
}
|
}
|
||||||
|
|
||||||
// width * j + modulo + width * extra - width * modulo= X
|
|
||||||
// i = (X - modulo)/width - modulo + extra
|
|
||||||
|
|||||||
@@ -1,240 +0,0 @@
|
|||||||
package obialign
|
|
||||||
|
|
||||||
import (
|
|
||||||
"log"
|
|
||||||
|
|
||||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
|
||||||
)
|
|
||||||
|
|
||||||
func max(a, b int) int {
|
|
||||||
if a > b {
|
|
||||||
return a
|
|
||||||
}
|
|
||||||
return b
|
|
||||||
}
|
|
||||||
|
|
||||||
func min(a, b int) int {
|
|
||||||
if a < b {
|
|
||||||
return a
|
|
||||||
}
|
|
||||||
return b
|
|
||||||
}
|
|
||||||
|
|
||||||
type LCSMatrix struct {
|
|
||||||
matrix []int16 // Score matrix
|
|
||||||
//lenght []int16 // Alignment length matrix
|
|
||||||
ll int // Length of the longest sequence
|
|
||||||
l int // Length of the shortest sequence
|
|
||||||
delta int // ll - l
|
|
||||||
extra int
|
|
||||||
w int
|
|
||||||
}
|
|
||||||
|
|
||||||
func NewLCSMatrix(matrix *LCSMatrix, L, l int, maxError int) *LCSMatrix {
|
|
||||||
if matrix == nil {
|
|
||||||
matrix = &LCSMatrix{}
|
|
||||||
}
|
|
||||||
|
|
||||||
if l > L {
|
|
||||||
log.Panicf("L (%d) must be greater or equal to l (%d)", L, l)
|
|
||||||
}
|
|
||||||
|
|
||||||
delta := L - l
|
|
||||||
extra := ((maxError - delta) / 2) + 1
|
|
||||||
|
|
||||||
needed := (L * (1 + delta + 2*extra)) * 2
|
|
||||||
|
|
||||||
if needed > matrix.Cap() {
|
|
||||||
matrix.matrix = make([]int16, needed)
|
|
||||||
//matrix.lenght = make([]int16, needed)
|
|
||||||
}
|
|
||||||
|
|
||||||
matrix.matrix = matrix.matrix[0:needed]
|
|
||||||
// matrix.lenght = matrix.lenght[:needed]
|
|
||||||
|
|
||||||
matrix.ll = L
|
|
||||||
matrix.l = l
|
|
||||||
matrix.delta = delta
|
|
||||||
matrix.extra = extra
|
|
||||||
matrix.w = delta + 1 + 2*extra
|
|
||||||
|
|
||||||
return matrix
|
|
||||||
}
|
|
||||||
|
|
||||||
func (matrix *LCSMatrix) Cap() int {
|
|
||||||
return cap(matrix.matrix)
|
|
||||||
}
|
|
||||||
|
|
||||||
func (matrix *LCSMatrix) Length() int {
|
|
||||||
return len(matrix.matrix)
|
|
||||||
}
|
|
||||||
|
|
||||||
func (matrix *LCSMatrix) Get(i, j int) (int, int) {
|
|
||||||
ij := max(0, i-matrix.extra)
|
|
||||||
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
|
|
||||||
|
|
||||||
switch {
|
|
||||||
case i == 0:
|
|
||||||
return 0,j
|
|
||||||
case j == 0:
|
|
||||||
return 0,i
|
|
||||||
case j < ij || j > sj:
|
|
||||||
return -1, 30000
|
|
||||||
default:
|
|
||||||
offset := (matrix.extra + matrix.w*(i-1) + (matrix.w-1)*(j-i)) * 2
|
|
||||||
return int(matrix.matrix[offset]), int(matrix.matrix[offset+1])
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
func (matrix *LCSMatrix) GetNeibourgh(i, j int) (
|
|
||||||
sd int, ld int,
|
|
||||||
sup int, lup int,
|
|
||||||
sleft int, lleft int) {
|
|
||||||
offset := matrix.extra + matrix.w*(j-2) + i - j
|
|
||||||
|
|
||||||
it := i - 1
|
|
||||||
jt := j - 1
|
|
||||||
|
|
||||||
ij0 := max(0, i-matrix.extra)
|
|
||||||
sj0 := min(i+matrix.delta+matrix.extra, matrix.ll)
|
|
||||||
ij1 := max(0, it-matrix.extra)
|
|
||||||
sj1 := min(it+matrix.delta+matrix.extra, matrix.ll)
|
|
||||||
|
|
||||||
switch {
|
|
||||||
case i == 1:
|
|
||||||
sd = 0
|
|
||||||
ld = jt
|
|
||||||
case j == 1:
|
|
||||||
sd = 0
|
|
||||||
ld = it
|
|
||||||
case jt < ij1 || jt > sj1:
|
|
||||||
sd = -1
|
|
||||||
ld = 30000
|
|
||||||
default:
|
|
||||||
sd = int(matrix.matrix[offset*2])
|
|
||||||
ld = int(matrix.matrix[offset*2+1])
|
|
||||||
}
|
|
||||||
|
|
||||||
offset++
|
|
||||||
|
|
||||||
|
|
||||||
switch {
|
|
||||||
case i == 0:
|
|
||||||
sleft = 0
|
|
||||||
lleft = jt
|
|
||||||
case j == 1:
|
|
||||||
sleft = 0
|
|
||||||
lleft = i
|
|
||||||
case jt < ij0 || jt > sj0:
|
|
||||||
sleft = -1
|
|
||||||
lleft = 30000
|
|
||||||
default:
|
|
||||||
sleft = int(matrix.matrix[offset*2])
|
|
||||||
lleft = int(matrix.matrix[offset*2+1])
|
|
||||||
}
|
|
||||||
|
|
||||||
offset += matrix.w - 2
|
|
||||||
|
|
||||||
switch {
|
|
||||||
case i == 1:
|
|
||||||
sup = 0
|
|
||||||
lup = j
|
|
||||||
case j == 0:
|
|
||||||
sup = 0
|
|
||||||
lup = it
|
|
||||||
case j < ij1 || j > sj1:
|
|
||||||
sup = -1
|
|
||||||
lup = 30000
|
|
||||||
default:
|
|
||||||
sup = int(matrix.matrix[offset*2])
|
|
||||||
lup = int(matrix.matrix[offset*2+1])
|
|
||||||
}
|
|
||||||
|
|
||||||
return
|
|
||||||
}
|
|
||||||
|
|
||||||
func (matrix *LCSMatrix) Set(i, j int, score, length int) {
|
|
||||||
ij := max(0, i-matrix.extra)
|
|
||||||
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
|
|
||||||
|
|
||||||
if i > 0 && j > 0 && j >= ij && j <= sj {
|
|
||||||
offset := (matrix.extra + matrix.w*(i-1) + (matrix.w-1)*(j-i)) * 2
|
|
||||||
matrix.matrix[offset] = int16(score)
|
|
||||||
matrix.matrix[offset+1] = int16(length)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Computes the LCS between two DNA sequences and the length of the
|
|
||||||
// corresponding alignment
|
|
||||||
func LCSScore(seqA, seqB *obiseq.BioSequence, maxError int,
|
|
||||||
matrix *LCSMatrix) (int, int) {
|
|
||||||
|
|
||||||
if seqA.Length() == 0 {
|
|
||||||
log.Fatal("Sequence A has a length of 0")
|
|
||||||
}
|
|
||||||
|
|
||||||
if seqB.Length() == 0 {
|
|
||||||
log.Fatal("Sequence B has a length of 0")
|
|
||||||
}
|
|
||||||
// swapped := false
|
|
||||||
|
|
||||||
if seqA.Length() < seqB.Length() {
|
|
||||||
seqA, seqB = seqB, seqA
|
|
||||||
// swapped = true
|
|
||||||
}
|
|
||||||
|
|
||||||
if (seqA.Length() - seqB.Length()) > maxError {
|
|
||||||
return -1, -1
|
|
||||||
}
|
|
||||||
|
|
||||||
la := seqA.Length()
|
|
||||||
lb := seqB.Length()
|
|
||||||
sa := seqA.Sequence()
|
|
||||||
sb := seqB.Sequence()
|
|
||||||
|
|
||||||
matrix = NewLCSMatrix(matrix, la, lb, maxError)
|
|
||||||
|
|
||||||
for i := 1; i <= matrix.l; i++ {
|
|
||||||
ij := max(1, i-matrix.extra)
|
|
||||||
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
|
|
||||||
for j := ij; j <= sj; j++ {
|
|
||||||
sd, ld, sup, lup, sleft, lleft := matrix.GetNeibourgh(i, j)
|
|
||||||
if i > lb {
|
|
||||||
log.Println("Error on seq B ", 1, matrix.l)
|
|
||||||
log.Println(i)
|
|
||||||
log.Println(seqB.Length(), "/", lb)
|
|
||||||
log.Println(string(sa))
|
|
||||||
log.Fatalln(string(sb))
|
|
||||||
}
|
|
||||||
if j > la {
|
|
||||||
log.Println("Error on seq A ", ij, sj)
|
|
||||||
log.Println(j)
|
|
||||||
log.Println(seqA.Length(), "/", la)
|
|
||||||
log.Println(string(sa))
|
|
||||||
log.Fatalln(string(sb))
|
|
||||||
}
|
|
||||||
if sb[i-1] == sa[j-1] {
|
|
||||||
sd++
|
|
||||||
}
|
|
||||||
// sup, lup := matrix.Get(i-1, j)
|
|
||||||
// sleft, lleft := matrix.Get(i, j-1)
|
|
||||||
switch {
|
|
||||||
case sd >= sup && sd >= sleft:
|
|
||||||
matrix.Set(i, j, sd, ld+1)
|
|
||||||
case sup >= sleft && sup >= sd:
|
|
||||||
matrix.Set(i, j, sup, lup+1)
|
|
||||||
default:
|
|
||||||
matrix.Set(i, j, sleft, lleft+1)
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
s, l := matrix.Get(lb, la)
|
|
||||||
|
|
||||||
if (l - s) > maxError {
|
|
||||||
// log.Println(l,s,l-s,maxError)
|
|
||||||
return -1, -1
|
|
||||||
}
|
|
||||||
|
|
||||||
return int(s), int(l)
|
|
||||||
}
|
|
||||||
@@ -360,14 +360,14 @@ func extendSimilarityGraph(seqs *[]*seqPCR, step int, workers int) int {
|
|||||||
nseq := len(*seqs)
|
nseq := len(*seqs)
|
||||||
running := sync.WaitGroup{}
|
running := sync.WaitGroup{}
|
||||||
|
|
||||||
linePairs := func(matrix *obialign.LCSMatrix, i int) {
|
linePairs := func(matrix *[]uint64, i int) {
|
||||||
son := (*seqs)[i]
|
son := (*seqs)[i]
|
||||||
for j := i + 1; j < nseq; j++ {
|
for j := i + 1; j < nseq; j++ {
|
||||||
father := (*seqs)[j]
|
father := (*seqs)[j]
|
||||||
d, _, _, _ := obialign.D1Or0(son.Sequence, father.Sequence)
|
d, _, _, _ := obialign.D1Or0(son.Sequence, father.Sequence)
|
||||||
|
|
||||||
if d < 0 {
|
if d < 0 {
|
||||||
lcs, lali := obialign.LCSScore(son.Sequence, father.Sequence,
|
lcs, lali := obialign.FastLCSScore(son.Sequence, father.Sequence,
|
||||||
step,
|
step,
|
||||||
matrix)
|
matrix)
|
||||||
d := (lali - lcs)
|
d := (lali - lcs)
|
||||||
@@ -385,9 +385,10 @@ func extendSimilarityGraph(seqs *[]*seqPCR, step int, workers int) int {
|
|||||||
// idxChan := make(chan [][]Ratio)
|
// idxChan := make(chan [][]Ratio)
|
||||||
|
|
||||||
ff := func() {
|
ff := func() {
|
||||||
matrix := obialign.NewLCSMatrix(nil, 150, 150, step)
|
var matrix []uint64
|
||||||
|
|
||||||
for i := range lineChan {
|
for i := range lineChan {
|
||||||
linePairs(matrix, i)
|
linePairs(&matrix, i)
|
||||||
}
|
}
|
||||||
|
|
||||||
running.Done()
|
running.Done()
|
||||||
|
|||||||
@@ -22,34 +22,26 @@ func FindClosests(sequence *obiseq.BioSequence,
|
|||||||
refcounts []*obikmer.Table4mer,
|
refcounts []*obikmer.Table4mer,
|
||||||
runExact bool) (obiseq.BioSequenceSlice, int, float64, string, []int) {
|
runExact bool) (obiseq.BioSequenceSlice, int, float64, string, []int) {
|
||||||
|
|
||||||
matrix := obialign.NewLCSMatrix(nil,
|
var matrix []uint64
|
||||||
sequence.Length(),
|
|
||||||
sequence.Length(),
|
|
||||||
sequence.Length())
|
|
||||||
|
|
||||||
seqwords := obikmer.Count4Mer(sequence, nil, nil)
|
seqwords := obikmer.Count4Mer(sequence, nil, nil)
|
||||||
cw := make([]int, len(refcounts))
|
cw := make([]int, len(refcounts))
|
||||||
|
|
||||||
for i, ref := range refcounts {
|
for i, ref := range refcounts {
|
||||||
cw[i] = obikmer.Common4Mer(seqwords, ref)
|
cw[i] = obikmer.Common4Mer(seqwords, ref)
|
||||||
// if i < 50 {
|
|
||||||
// print(cw[i])
|
|
||||||
// print(";")
|
|
||||||
// }
|
|
||||||
}
|
}
|
||||||
// print("\n")
|
|
||||||
|
|
||||||
o := goutils.ReverseIntOrder(cw)
|
o := goutils.ReverseIntOrder(cw)
|
||||||
|
|
||||||
mcw := 100000
|
// mcw := 100000
|
||||||
for _, i := range o {
|
// for _, i := range o {
|
||||||
if cw[i] < mcw {
|
// if cw[i] < mcw {
|
||||||
mcw = cw[i]
|
// mcw = cw[i]
|
||||||
}
|
// }
|
||||||
if cw[i] > mcw {
|
// if cw[i] > mcw {
|
||||||
log.Panicln("wrong order")
|
// log.Panicln("wrong order")
|
||||||
}
|
// }
|
||||||
}
|
// }
|
||||||
|
|
||||||
bests := obiseq.MakeBioSequenceSlice()
|
bests := obiseq.MakeBioSequenceSlice()
|
||||||
bests = append(bests, references[o[0]])
|
bests = append(bests, references[o[0]])
|
||||||
@@ -74,7 +66,8 @@ func FindClosests(sequence *obiseq.BioSequence,
|
|||||||
|
|
||||||
// log.Println(sequence.Id(),cw[j], maxe)
|
// log.Println(sequence.Id(),cw[j], maxe)
|
||||||
if runExact || (atMost <= (maxe + 1)) {
|
if runExact || (atMost <= (maxe + 1)) {
|
||||||
lcs, alilength := obialign.LCSScore(sequence, ref, maxe+1, matrix)
|
lcs, alilength := obialign.FastLCSScore(sequence, ref, maxe+1,&matrix)
|
||||||
|
// lcs, alilength := obialign.LCSScore(sequence, ref, maxe+1, matrix)
|
||||||
n++
|
n++
|
||||||
if lcs == -1 {
|
if lcs == -1 {
|
||||||
nf++
|
nf++
|
||||||
|
|||||||
Reference in New Issue
Block a user