New version of LCS computation, with abug on alignment length patched patched

This commit is contained in:
2022-11-15 08:21:46 +01:00
parent 18be4becec
commit 340579f6d7
5 changed files with 238 additions and 383 deletions
+90 -9
View File
@@ -1,15 +1,65 @@
package main
import (
"fmt"
"log"
"os"
"runtime/trace"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obioptions"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiclean"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obitools/obiconvert"
"cloudeng.io/algo/lcs"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obialign"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
)
func SESStat(script *lcs.EditScript[byte]) (int, int) {
llcs := 0
gaps := 0
extra := 0
i := 0
ls := len(*script)
for i < ls {
e := (*script)[i]
// log.Println(i,e,e.Op)
switch e.Op {
case lcs.Identical: // 2
if gaps > 0 {
extra += gaps
}
llcs++
gaps = 0
i++
case lcs.Delete: // 1
if i+1 < ls {
en := (*script)[i+1]
if en.Op == lcs.Identical && e.Val == en.Val {
log.Println("Swap delete")
(*script)[i], (*script)[i+1] = (*script)[i+1], (*script)[i]
continue
}
}
gaps--
i++
case lcs.Insert: // 0
if i+1 < ls {
en := (*script)[i+1]
if en.Op == lcs.Identical && e.Val == en.Val {
log.Println("Swap Insert")
(*script)[i], (*script)[i+1] = (*script)[i+1], (*script)[i]
continue
}
}
gaps++
i++
}
}
if gaps > 0 {
extra += gaps
}
return llcs, extra
}
func main() {
// Creating a file called cpu.trace.
@@ -20,15 +70,46 @@ func main() {
trace.Start(ftrace)
defer trace.Stop()
option_parser := obioptions.GenerateOptionParser(
obiconvert.InputOptionSet,
)
// "---CACGATCGTGC-CAGTCAT-GGCTAT"
// "CCCCA-GATCGTGCG-AGTCATGGGCTAT"
_, args, _ := option_parser(os.Args)
// 00 0 00000000 1111111 111222
// 01 2 34567889 0123456 789012
// "CA-C-GATCGTGC-CAGTCAT-GGCTAT"
// "CCCCAGATCGTGCG-AGTCATGGGCTAT"
fs, _ := obiconvert.ReadBioSequencesBatch(args...)
//A := "CACGATCGTGCCCCCAGTCATGGCTAT"
A := "AAATGCCCCAGATCGTGC"
B := "TGCCCCAGAT"
obiclean.IOBIClean(fs)
//A = "aaaggaacttggactgaagatttccacagaggttgcgaatgaaaaacacgtattcgaatgcctcaaatacggaatcgatcttgtctg"
A = "aaaggaacttggactgaagatttccacagaggttgcgaatgaaaaacacgtattcgaatgcctcaaatacggaatcgatcttgtctg"
B = "atccggttttacgaaaatgcgtgtggtaggggcttatgaaaacgataatcgaataaaaaagggtaggtgcagagactcaacggaagatgttctaacaaatgg"
// A = "aataa"
// B = "ttttt"
sA := obiseq.NewBioSequence("A", []byte(A), "")
sB := obiseq.NewBioSequence("A", []byte(B), "")
// M := lcs.NewMyers([]byte(A), []byte(B))
// fmt.Println(M.LCS())
// fmt.Println(M.SES())
// fmt.Println(len(M.LCS()))
// M.SES().FormatHorizontal(os.Stdout, []byte(B))
// llcs, extra := SESStat(M.SES())
// nlcs, nali := obialign.LCSScore(sA, sB, sB.Length(), nil)
// fmt.Println(llcs, extra, len(A)+extra)
// fmt.Println(nlcs, nali)
nlcs, nali := obialign.FastLCSScore(sA, sB, sB.Length(), nil)
fmt.Println(nlcs, nali)
// option_parser := obioptions.GenerateOptionParser(
// obiconvert.InputOptionSet,
// )
// _, args, _ := option_parser(os.Args)
// fs, _ := obiconvert.ReadBioSequencesBatch(args...)
// obiclean.IOBIClean(fs)
// buffer := make([]byte, 0)
// fs.Next()
+122 -102
View File
@@ -1,29 +1,42 @@
package obialign
import (
"log"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/goutils"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
)
const wsize = 16
const dwsize = wsize * 2
// Out values are always the smallest
// Among in values, they rank according to their score
// For equal score the shortest path is the best
func _encodeValues(score, length int, out bool) uint64 {
const mask = uint64(1<<16) - 1
func encodeValues(score, length int, out bool) uint64 {
const mask = uint64(1<<wsize) - 1
us := uint64(score)
fo := (us << 16) | (uint64((^length)-1) & mask)
fo := (us << wsize) | (uint64((^length)-1) & mask)
if !out {
fo |= (uint64(1) << 32)
fo |= (uint64(1) << dwsize)
}
return fo
}
func _decodeValues(value uint64) (int, int, bool) {
const mask = uint64(1<<16) - 1
score := int((value >> 16) & mask)
func _isout(value uint64) bool {
const outmask = uint64(1) << dwsize
return (value & outmask) == 0
}
func _lpath(value uint64) int {
const mask = uint64(1<<wsize) - 1
return int(((value + 1) ^ mask) & mask)
}
func decodeValues(value uint64) (int, int, bool) {
const mask = uint64(1<<wsize) - 1
const outmask = uint64(1) << dwsize
score := int((value >> wsize) & mask)
length := int(((value + 1) ^ mask) & mask)
out := (value & (1 << 32)) == 0
out := (value & outmask) == 0
return score, length, out
}
@@ -32,34 +45,20 @@ func _incpath(value uint64) uint64 {
}
func _incscore(value uint64) uint64 {
const incr = uint64(1) << 16
const incr = uint64(1) << wsize
return value + incr
}
func _setout(value uint64) uint64 {
const outmask = uint64(1) << 32
return value | outmask
const outmask = ^(uint64(1) << dwsize)
return value & outmask
}
func _isout(value uint64) bool {
const outmask = uint64(1) << 32
return (value & outmask) == 0
}
var _empty = encodeValues(0, 0, false)
var _out = encodeValues(0, 30000, true)
var _notavail = encodeValues(0, 30000, false)
var _empty = _encodeValues(0, 0, false)
var _out = _encodeValues(0, 3000, true)
func FastLCSScore(seqA, seqB *obiseq.BioSequence, maxError int) (int, int) {
// x:=_encodeValues(12,0,false)
// xs,xl,xo := _decodeValues(x)
// log.Println(x,xs,xl,xo)
// x=_encodeValues(12,1,false)
// xs,xl,xo = _decodeValues(x)
// log.Println(x,xs,xl,xo)
// x=_encodeValues(12,2,false)
// xs,xl,xo = _decodeValues(x)
// log.Println(x,xs,xl,xo)
func FastLCSScore(seqA, seqB *obiseq.BioSequence, maxError int, buffer *[]uint64) (int, int) {
lA := seqA.Length()
lB := seqB.Length()
@@ -74,76 +73,72 @@ func FastLCSScore(seqA, seqB *obiseq.BioSequence, maxError int) (int, int) {
// The difference of length is larger the maximum allowed errors
if delta > maxError {
// log.Println("Too large difference of length")
return -1, -1
}
// Doit-on vraiment diviser par deux ??? pas certain
extra := ((maxError - delta) / 2) + 1
extra := (maxError - delta) + 1
even := 1 + delta + 2*extra
width := 2*even - 1
previous := make([]uint64, width)
current := make([]uint64, width)
// Initialise the first line
for j := 0; j < width; j++ {
if (j == extra+even) || (j == extra+even-1) {
previous[j] = _encodeValues(0, 1, false)
} else {
previous[j] = _empty
if buffer == nil {
var local []uint64
buffer = &local
}
if cap(*buffer) < 2*width {
*buffer = make([]uint64, 3*width)
}
previous := (*buffer)[0:width]
current := (*buffer)[width:(2 * width)]
previous[extra] = _empty
previous[extra+even] = encodeValues(0, 1, false)
previous[extra+even-1] = encodeValues(0, 1, false)
N := lB + ((delta) >> 1)
X := width
bA := seqA.Sequence()
bB := seqB.Sequence()
// log.Println("N = ", N)
for y := 1; y <= N; y++ {
// in_matrix := false
for x := 0; x < width; x++ {
X = y * width + x
modulo := X % width
begin := X - modulo
quotien := begin / width
x1 := y - lB + extra
x2 := extra - y
xs := goutils.MaxInt(goutils.MaxInt(x1, x2), 0)
i := quotien + extra - modulo
j := quotien - extra + modulo
x1 = y + extra
x2 = lA + extra - y
xf := goutils.MinInt(goutils.MinInt(x1, x2), even-1) + 1
if x >= even {
i += even
j += 1 - even
}
for x := xs; x < xf; x++ {
//log.Println(X, i, j, i < 0 || j < 0 || i > lB || j > lA)
// We are out of tha alignement matrix
if i < 0 || j < 0 || i > lB || j > lA {
X++
continue
}
i := y - x + extra
j := y + x - extra
var Sdiag, Sleft, Sup uint64
switch {
case i == 0:
Sup = _encodeValues(0, 30000, false)
Sdiag = _encodeValues(0, 30000, false)
Sleft = _encodeValues(0, j-1, false)
Sup = _notavail
Sdiag = _notavail
Sleft = encodeValues(0, j-1, false)
case j == 0:
Sup = _encodeValues(0, i-1, false)
Sdiag = _encodeValues(0, 30000, false)
Sleft = _encodeValues(0, 30000, false)
Sup = encodeValues(0, i-1, false)
Sdiag = _notavail
Sleft = _notavail
default:
Sdiag = previous[x]
if x >= even {
Sleft = current[x-even]
Sup = current[x-even+1]
} else {
if bA[j-1] == bB[i-1] {
Sdiag = _incscore(Sdiag)
}
if x < (even - 1) {
Sup = previous[x+even]
} else {
@@ -155,22 +150,11 @@ func FastLCSScore(seqA, seqB *obiseq.BioSequence, maxError int) (int, int) {
Sleft = _out
}
}
}
// log.Println("scores @",i,j,": ",Sdiag,Sup,Sleft)
// ds,dl,ol := _decodeValues(Sdiag)
// log.Println(ds,dl,ol)
// ds,dl,ol = _decodeValues(Sup)
// log.Println(ds,dl,ol)
// ds,dl,ol = _decodeValues(Sleft)
// log.Println(ds,dl,ol)
var score uint64
switch {
case Sdiag >= Sup && Sdiag >= Sleft:
score = Sdiag
if seqA.Sequence()[j-1] == seqB.Sequence()[i-1] {
score = _incscore(score)
}
case Sup >= Sleft:
score = Sup
default:
@@ -181,36 +165,72 @@ func FastLCSScore(seqA, seqB *obiseq.BioSequence, maxError int) (int, int) {
score = _setout(score)
}
// if i < 5 && j < 5 {
// ds, dl, ol := _decodeValues(_incpath(score))
// log.Println("@", i, j,":", ds, dl, ol)
// }
current[x] = _incpath(score)
}
// . 9 10 + 2 - 1
x1 = y - lB + extra + even
x2 = extra - y + even - 1
xs = goutils.MaxInt(goutils.MaxInt(x1, x2), even)
x1 = y + extra + even
x2 = lA + extra - y + even - 1
xf = goutils.MinInt(goutils.MinInt(x1, x2), width-1) + 1
for x := xs; x < xf; x++ {
i := y - x + extra + even
j := y + x - extra - even + 1
var Sdiag, Sleft, Sup uint64
switch {
case i == 0:
Sup = _notavail
Sdiag = _notavail
Sleft = encodeValues(0, j-1, false)
case j == 0:
Sup = encodeValues(0, i-1, false)
Sdiag = _notavail
Sleft = _notavail
default:
Sdiag = previous[x]
if bA[j-1] == bB[i-1] {
Sdiag = _incscore(Sdiag)
}
Sleft = current[x-even]
Sup = current[x-even+1]
}
var score uint64
switch {
case Sdiag >= Sup && Sdiag >= Sleft:
score = Sdiag
case Sup >= Sleft:
score = Sup
default:
score = Sleft
}
if _isout(Sdiag) || _isout(Sup) || _isout(Sleft) {
score = _setout(score)
}
current[x] = _incpath(score)
// if i == lB && j == lA {
// s, l, o := _decodeValues(current[x])
// log.Println("Results in ", x, y, "(", i, j, ") values : ", s, l, o)
// }
X++
}
// if !in_matrix {
// log.Fatalln("Never entred in the matrix", y, "/", N)
// }
previous, current = current, previous
}
s, l, o := _decodeValues(previous[(delta%2)*even+extra+(delta>>1)])
s, l, o := decodeValues(previous[(delta%2)*even+extra+(delta>>1)])
if o {
log.Println("Too much error", s, l, (lA%2)*even+(lA-lB), lA, lB, width, even, N)
return -1, -1
}
return s, l
}
// width * j + modulo + width * extra - width * modulo= X
// i = (X - modulo)/width - modulo + extra
-240
View File
@@ -1,240 +0,0 @@
package obialign
import (
"log"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
)
func max(a, b int) int {
if a > b {
return a
}
return b
}
func min(a, b int) int {
if a < b {
return a
}
return b
}
type LCSMatrix struct {
matrix []int16 // Score matrix
//lenght []int16 // Alignment length matrix
ll int // Length of the longest sequence
l int // Length of the shortest sequence
delta int // ll - l
extra int
w int
}
func NewLCSMatrix(matrix *LCSMatrix, L, l int, maxError int) *LCSMatrix {
if matrix == nil {
matrix = &LCSMatrix{}
}
if l > L {
log.Panicf("L (%d) must be greater or equal to l (%d)", L, l)
}
delta := L - l
extra := ((maxError - delta) / 2) + 1
needed := (L * (1 + delta + 2*extra)) * 2
if needed > matrix.Cap() {
matrix.matrix = make([]int16, needed)
//matrix.lenght = make([]int16, needed)
}
matrix.matrix = matrix.matrix[0:needed]
// matrix.lenght = matrix.lenght[:needed]
matrix.ll = L
matrix.l = l
matrix.delta = delta
matrix.extra = extra
matrix.w = delta + 1 + 2*extra
return matrix
}
func (matrix *LCSMatrix) Cap() int {
return cap(matrix.matrix)
}
func (matrix *LCSMatrix) Length() int {
return len(matrix.matrix)
}
func (matrix *LCSMatrix) Get(i, j int) (int, int) {
ij := max(0, i-matrix.extra)
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
switch {
case i == 0:
return 0,j
case j == 0:
return 0,i
case j < ij || j > sj:
return -1, 30000
default:
offset := (matrix.extra + matrix.w*(i-1) + (matrix.w-1)*(j-i)) * 2
return int(matrix.matrix[offset]), int(matrix.matrix[offset+1])
}
}
func (matrix *LCSMatrix) GetNeibourgh(i, j int) (
sd int, ld int,
sup int, lup int,
sleft int, lleft int) {
offset := matrix.extra + matrix.w*(j-2) + i - j
it := i - 1
jt := j - 1
ij0 := max(0, i-matrix.extra)
sj0 := min(i+matrix.delta+matrix.extra, matrix.ll)
ij1 := max(0, it-matrix.extra)
sj1 := min(it+matrix.delta+matrix.extra, matrix.ll)
switch {
case i == 1:
sd = 0
ld = jt
case j == 1:
sd = 0
ld = it
case jt < ij1 || jt > sj1:
sd = -1
ld = 30000
default:
sd = int(matrix.matrix[offset*2])
ld = int(matrix.matrix[offset*2+1])
}
offset++
switch {
case i == 0:
sleft = 0
lleft = jt
case j == 1:
sleft = 0
lleft = i
case jt < ij0 || jt > sj0:
sleft = -1
lleft = 30000
default:
sleft = int(matrix.matrix[offset*2])
lleft = int(matrix.matrix[offset*2+1])
}
offset += matrix.w - 2
switch {
case i == 1:
sup = 0
lup = j
case j == 0:
sup = 0
lup = it
case j < ij1 || j > sj1:
sup = -1
lup = 30000
default:
sup = int(matrix.matrix[offset*2])
lup = int(matrix.matrix[offset*2+1])
}
return
}
func (matrix *LCSMatrix) Set(i, j int, score, length int) {
ij := max(0, i-matrix.extra)
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
if i > 0 && j > 0 && j >= ij && j <= sj {
offset := (matrix.extra + matrix.w*(i-1) + (matrix.w-1)*(j-i)) * 2
matrix.matrix[offset] = int16(score)
matrix.matrix[offset+1] = int16(length)
}
}
// Computes the LCS between two DNA sequences and the length of the
// corresponding alignment
func LCSScore(seqA, seqB *obiseq.BioSequence, maxError int,
matrix *LCSMatrix) (int, int) {
if seqA.Length() == 0 {
log.Fatal("Sequence A has a length of 0")
}
if seqB.Length() == 0 {
log.Fatal("Sequence B has a length of 0")
}
// swapped := false
if seqA.Length() < seqB.Length() {
seqA, seqB = seqB, seqA
// swapped = true
}
if (seqA.Length() - seqB.Length()) > maxError {
return -1, -1
}
la := seqA.Length()
lb := seqB.Length()
sa := seqA.Sequence()
sb := seqB.Sequence()
matrix = NewLCSMatrix(matrix, la, lb, maxError)
for i := 1; i <= matrix.l; i++ {
ij := max(1, i-matrix.extra)
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
for j := ij; j <= sj; j++ {
sd, ld, sup, lup, sleft, lleft := matrix.GetNeibourgh(i, j)
if i > lb {
log.Println("Error on seq B ", 1, matrix.l)
log.Println(i)
log.Println(seqB.Length(), "/", lb)
log.Println(string(sa))
log.Fatalln(string(sb))
}
if j > la {
log.Println("Error on seq A ", ij, sj)
log.Println(j)
log.Println(seqA.Length(), "/", la)
log.Println(string(sa))
log.Fatalln(string(sb))
}
if sb[i-1] == sa[j-1] {
sd++
}
// sup, lup := matrix.Get(i-1, j)
// sleft, lleft := matrix.Get(i, j-1)
switch {
case sd >= sup && sd >= sleft:
matrix.Set(i, j, sd, ld+1)
case sup >= sleft && sup >= sd:
matrix.Set(i, j, sup, lup+1)
default:
matrix.Set(i, j, sleft, lleft+1)
}
}
}
s, l := matrix.Get(lb, la)
if (l - s) > maxError {
// log.Println(l,s,l-s,maxError)
return -1, -1
}
return int(s), int(l)
}
+5 -4
View File
@@ -360,14 +360,14 @@ func extendSimilarityGraph(seqs *[]*seqPCR, step int, workers int) int {
nseq := len(*seqs)
running := sync.WaitGroup{}
linePairs := func(matrix *obialign.LCSMatrix, i int) {
linePairs := func(matrix *[]uint64, i int) {
son := (*seqs)[i]
for j := i + 1; j < nseq; j++ {
father := (*seqs)[j]
d, _, _, _ := obialign.D1Or0(son.Sequence, father.Sequence)
if d < 0 {
lcs, lali := obialign.LCSScore(son.Sequence, father.Sequence,
lcs, lali := obialign.FastLCSScore(son.Sequence, father.Sequence,
step,
matrix)
d := (lali - lcs)
@@ -385,9 +385,10 @@ func extendSimilarityGraph(seqs *[]*seqPCR, step int, workers int) int {
// idxChan := make(chan [][]Ratio)
ff := func() {
matrix := obialign.NewLCSMatrix(nil, 150, 150, step)
var matrix []uint64
for i := range lineChan {
linePairs(matrix, i)
linePairs(&matrix, i)
}
running.Done()
+12 -19
View File
@@ -22,34 +22,26 @@ func FindClosests(sequence *obiseq.BioSequence,
refcounts []*obikmer.Table4mer,
runExact bool) (obiseq.BioSequenceSlice, int, float64, string, []int) {
matrix := obialign.NewLCSMatrix(nil,
sequence.Length(),
sequence.Length(),
sequence.Length())
var matrix []uint64
seqwords := obikmer.Count4Mer(sequence, nil, nil)
cw := make([]int, len(refcounts))
for i, ref := range refcounts {
cw[i] = obikmer.Common4Mer(seqwords, ref)
// if i < 50 {
// print(cw[i])
// print(";")
// }
}
// print("\n")
o := goutils.ReverseIntOrder(cw)
mcw := 100000
for _, i := range o {
if cw[i] < mcw {
mcw = cw[i]
}
if cw[i] > mcw {
log.Panicln("wrong order")
}
}
// mcw := 100000
// for _, i := range o {
// if cw[i] < mcw {
// mcw = cw[i]
// }
// if cw[i] > mcw {
// log.Panicln("wrong order")
// }
// }
bests := obiseq.MakeBioSequenceSlice()
bests = append(bests, references[o[0]])
@@ -74,7 +66,8 @@ func FindClosests(sequence *obiseq.BioSequence,
// log.Println(sequence.Id(),cw[j], maxe)
if runExact || (atMost <= (maxe + 1)) {
lcs, alilength := obialign.LCSScore(sequence, ref, maxe+1, matrix)
lcs, alilength := obialign.FastLCSScore(sequence, ref, maxe+1,&matrix)
// lcs, alilength := obialign.LCSScore(sequence, ref, maxe+1, matrix)
n++
if lcs == -1 {
nf++