mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-04-22 16:30:43 +00:00
A fiirst version of LCS score function
This commit is contained in:
File diff suppressed because it is too large
Load Diff
+29
-20
@@ -6,9 +6,9 @@ import (
|
||||
"os"
|
||||
"runtime/trace"
|
||||
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiapat"
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiformats"
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
||||
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obialign"
|
||||
)
|
||||
|
||||
func main() {
|
||||
@@ -41,29 +41,38 @@ func main() {
|
||||
// fmt.Printf("Shift : %d Score : %d\n", maxshift, maxcount)
|
||||
// }
|
||||
|
||||
A := []byte("ccgcctccttagaacaggctcctctagaaaaccatagtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg")
|
||||
A := []byte("ccgcctccttagaacaggctcctctagaaaaccatgtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg")
|
||||
B := []byte("ccgcctccttagaacaggctcctctagaaaaaccatgtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg")
|
||||
// B := []byte("cgccaccaccgagatctacactctttccctacacgacgctcttccgatctccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg")
|
||||
sA := obiseq.NewBioSequence("A", A, "")
|
||||
// sB := obiseq.MakeBioSequence("B", B, "")
|
||||
sB := obiseq.MakeBioSequence("B", B, "")
|
||||
|
||||
pat, _ := obiapat.MakeApatPattern("TCCTTCCAACAGGCTCCTC", 3)
|
||||
as, _ := obiapat.MakeApatSequence(sA, false)
|
||||
fmt.Println(pat.FindAllIndex(as))
|
||||
s, l := obialign.LCSScore(sA, &sB, 2, nil)
|
||||
|
||||
file, _ := os.Open("sample/wolf_diet_ngsfilter.txt")
|
||||
xxx, _ := obiformats.ReadNGSFilter(file)
|
||||
xxx.Compile(2)
|
||||
fmt.Printf("%v\n==================\n", xxx)
|
||||
fmt.Printf("score : %d length : %d error : %d\n", s, l, l-s)
|
||||
|
||||
for pp, m := range xxx {
|
||||
fmt.Printf("%v %v\n", pp, *m)
|
||||
}
|
||||
s, l = obialign.LCSScore(&sB, &sB, 2, nil)
|
||||
|
||||
seqfile, _ := obiformats.ReadFastSeqFromFile("xxxx.fastq")
|
||||
fmt.Printf("score : %d length : %d error : %d\n", s, l, l-s)
|
||||
|
||||
for seqfile.Next() {
|
||||
seq := seqfile.Get()
|
||||
barcode, _ := xxx.ExtractBarcode(seq, true)
|
||||
fmt.Println(obiformats.FormatFasta(barcode, obiformats.FormatFastSeqOBIHeader))
|
||||
}
|
||||
// pat, _ := obiapat.MakeApatPattern("TCCTTCCAACAGGCTCCTC", 3)
|
||||
// as, _ := obiapat.MakeApatSequence(sA, false)
|
||||
// fmt.Println(pat.FindAllIndex(as))
|
||||
|
||||
// file, _ := os.Open("sample/wolf_diet_ngsfilter.txt")
|
||||
// xxx, _ := obiformats.ReadNGSFilter(file)
|
||||
// xxx.Compile(2)
|
||||
// fmt.Printf("%v\n==================\n", xxx)
|
||||
|
||||
// for pp, m := range xxx {
|
||||
// fmt.Printf("%v %v\n", pp, *m)
|
||||
// }
|
||||
|
||||
// seqfile, _ := obiformats.ReadFastSeqFromFile("xxxx.fastq")
|
||||
|
||||
// for seqfile.Next() {
|
||||
// seq := seqfile.Get()
|
||||
// barcode, _ := xxx.ExtractBarcode(seq, true)
|
||||
// fmt.Println(obiformats.FormatFasta(barcode, obiformats.FormatFastSeqOBIHeader))
|
||||
// }
|
||||
}
|
||||
|
||||
@@ -0,0 +1,142 @@
|
||||
package obialign
|
||||
|
||||
import (
|
||||
"log"
|
||||
|
||||
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
|
||||
)
|
||||
|
||||
func max(a, b int) int {
|
||||
if a > b {
|
||||
return a
|
||||
}
|
||||
return b
|
||||
}
|
||||
|
||||
func min(a, b int) int {
|
||||
if a < b {
|
||||
return a
|
||||
}
|
||||
return b
|
||||
}
|
||||
|
||||
type LCSMatrix struct {
|
||||
matrix []int16 // Score matrix
|
||||
lenght []int16 // Alignment length matrix
|
||||
ll int // Length of the longest sequence
|
||||
l int // Length of the shortest sequence
|
||||
delta int // ll - l
|
||||
extra int
|
||||
w int
|
||||
}
|
||||
|
||||
func NewLCSMatrix(matrix *LCSMatrix, L, l int, maxError int) *LCSMatrix {
|
||||
if matrix == nil {
|
||||
matrix = &LCSMatrix{}
|
||||
}
|
||||
|
||||
if l > L {
|
||||
log.Panicf("L (%d) must be greater or equal to l (%d)", L, l)
|
||||
}
|
||||
|
||||
delta := L - l
|
||||
extra := ((maxError - delta) / 2) + 1
|
||||
|
||||
needed := L * (1 + delta + 2*extra)
|
||||
|
||||
if needed > matrix.Cap() {
|
||||
matrix.matrix = make([]int16, needed)
|
||||
matrix.lenght = make([]int16, needed)
|
||||
}
|
||||
|
||||
matrix.matrix = matrix.matrix[:needed]
|
||||
matrix.lenght = matrix.lenght[:needed]
|
||||
|
||||
matrix.ll = L
|
||||
matrix.l = l
|
||||
matrix.delta = delta
|
||||
matrix.extra = extra
|
||||
matrix.w = delta + 1 + 2*extra
|
||||
|
||||
return matrix
|
||||
}
|
||||
|
||||
func (matrix *LCSMatrix) Cap() int {
|
||||
return cap(matrix.matrix)
|
||||
}
|
||||
|
||||
func (matrix *LCSMatrix) Length() int {
|
||||
return len(matrix.matrix)
|
||||
}
|
||||
|
||||
func (matrix *LCSMatrix) Get(i, j int) (int16, int16) {
|
||||
ij := max(0, i-matrix.extra)
|
||||
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
|
||||
|
||||
switch {
|
||||
case i == 0:
|
||||
return int16(0), int16(j)
|
||||
case j == 0:
|
||||
return int16(0), int16(i)
|
||||
case j < ij || j > sj:
|
||||
return -1, 30000
|
||||
default:
|
||||
return matrix.matrix[matrix.extra+matrix.w*(i-1)+(matrix.w-1)*(j-i)],
|
||||
matrix.lenght[matrix.extra+matrix.w*(i-1)+(matrix.w-1)*(j-i)]
|
||||
}
|
||||
}
|
||||
|
||||
func (matrix *LCSMatrix) Set(i, j int, score, length int16) {
|
||||
ij := max(0, i-matrix.extra)
|
||||
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
|
||||
|
||||
if i > 0 && j > 0 && j >= ij && j <= sj {
|
||||
matrix.matrix[matrix.extra+matrix.w*(i-1)+(matrix.w-1)*(j-i)] = score
|
||||
matrix.lenght[matrix.extra+matrix.w*(i-1)+(matrix.w-1)*(j-i)] = length
|
||||
}
|
||||
}
|
||||
|
||||
func LCSScore(seqA, seqB *obiseq.BioSequence, maxError int,
|
||||
matrix *LCSMatrix) (int, int) {
|
||||
// swapped := false
|
||||
|
||||
if seqA.Length() < seqB.Length() {
|
||||
seqA, seqB = seqB, seqA
|
||||
// swapped = true
|
||||
}
|
||||
|
||||
if (seqA.Length() - seqB.Length()) > maxError {
|
||||
return -1, -1
|
||||
}
|
||||
|
||||
matrix = NewLCSMatrix(matrix, seqA.Length(), seqB.Length(), maxError)
|
||||
|
||||
for i := 1; i <= matrix.l; i++ {
|
||||
ij := max(1, i-matrix.extra)
|
||||
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
|
||||
for j := ij; j <= sj; j++ {
|
||||
sd, ld := matrix.Get(i-1, j-1)
|
||||
if seqB.Sequence()[i-1] == seqA.Sequence()[j-1] {
|
||||
sd++
|
||||
}
|
||||
sup, lup := matrix.Get(i-1, j)
|
||||
sleft, lleft := matrix.Get(i, j-1)
|
||||
switch {
|
||||
case sd >= sup && sd >= sleft:
|
||||
matrix.Set(i, j, sd, ld+1)
|
||||
case sup >= sleft && sup >= sd:
|
||||
matrix.Set(i, j, sup, lup+1)
|
||||
default:
|
||||
matrix.Set(i, j, sleft, lleft+1)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
s, l := matrix.Get(seqB.Length(), seqA.Length())
|
||||
|
||||
if (l - s) > int16(maxError) {
|
||||
return -1, -1
|
||||
}
|
||||
|
||||
return int(s), int(l)
|
||||
}
|
||||
Reference in New Issue
Block a user