A fiirst version of LCS score function

This commit is contained in:
2022-03-07 16:37:21 +01:00
parent 62cd1c44dc
commit 656eda1f73
3 changed files with 1242 additions and 20 deletions
File diff suppressed because it is too large Load Diff
+31 -22
View File
@@ -6,9 +6,9 @@ import (
"os"
"runtime/trace"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiapat"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiformats"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obialign"
)
func main() {
@@ -41,29 +41,38 @@ func main() {
// fmt.Printf("Shift : %d Score : %d\n", maxshift, maxcount)
// }
A := []byte("ccgcctccttagaacaggctcctctagaaaaccatagtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg")
A := []byte("ccgcctccttagaacaggctcctctagaaaaccatgtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg")
B := []byte("ccgcctccttagaacaggctcctctagaaaaaccatgtgggatatctaaagaaggcggagatagaaagagcggttcagcaggaatgccgagatggacggcgtgtgacg")
// B := []byte("cgccaccaccgagatctacactctttccctacacgacgctcttccgatctccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg")
sA := obiseq.NewBioSequence("A", A, "")
// sB := obiseq.MakeBioSequence("B", B, "")
sB := obiseq.MakeBioSequence("B", B, "")
pat, _ := obiapat.MakeApatPattern("TCCTTCCAACAGGCTCCTC", 3)
as, _ := obiapat.MakeApatSequence(sA, false)
fmt.Println(pat.FindAllIndex(as))
s, l := obialign.LCSScore(sA, &sB, 2, nil)
file, _ := os.Open("sample/wolf_diet_ngsfilter.txt")
xxx, _ := obiformats.ReadNGSFilter(file)
xxx.Compile(2)
fmt.Printf("%v\n==================\n", xxx)
fmt.Printf("score : %d length : %d error : %d\n", s, l, l-s)
for pp, m := range xxx {
fmt.Printf("%v %v\n", pp, *m)
}
seqfile, _ := obiformats.ReadFastSeqFromFile("xxxx.fastq")
for seqfile.Next() {
seq := seqfile.Get()
barcode, _ := xxx.ExtractBarcode(seq, true)
fmt.Println(obiformats.FormatFasta(barcode, obiformats.FormatFastSeqOBIHeader))
}
s, l = obialign.LCSScore(&sB, &sB, 2, nil)
fmt.Printf("score : %d length : %d error : %d\n", s, l, l-s)
// pat, _ := obiapat.MakeApatPattern("TCCTTCCAACAGGCTCCTC", 3)
// as, _ := obiapat.MakeApatSequence(sA, false)
// fmt.Println(pat.FindAllIndex(as))
// file, _ := os.Open("sample/wolf_diet_ngsfilter.txt")
// xxx, _ := obiformats.ReadNGSFilter(file)
// xxx.Compile(2)
// fmt.Printf("%v\n==================\n", xxx)
// for pp, m := range xxx {
// fmt.Printf("%v %v\n", pp, *m)
// }
// seqfile, _ := obiformats.ReadFastSeqFromFile("xxxx.fastq")
// for seqfile.Next() {
// seq := seqfile.Get()
// barcode, _ := xxx.ExtractBarcode(seq, true)
// fmt.Println(obiformats.FormatFasta(barcode, obiformats.FormatFastSeqOBIHeader))
// }
}
+142
View File
@@ -0,0 +1,142 @@
package obialign
import (
"log"
"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"
)
func max(a, b int) int {
if a > b {
return a
}
return b
}
func min(a, b int) int {
if a < b {
return a
}
return b
}
type LCSMatrix struct {
matrix []int16 // Score matrix
lenght []int16 // Alignment length matrix
ll int // Length of the longest sequence
l int // Length of the shortest sequence
delta int // ll - l
extra int
w int
}
func NewLCSMatrix(matrix *LCSMatrix, L, l int, maxError int) *LCSMatrix {
if matrix == nil {
matrix = &LCSMatrix{}
}
if l > L {
log.Panicf("L (%d) must be greater or equal to l (%d)", L, l)
}
delta := L - l
extra := ((maxError - delta) / 2) + 1
needed := L * (1 + delta + 2*extra)
if needed > matrix.Cap() {
matrix.matrix = make([]int16, needed)
matrix.lenght = make([]int16, needed)
}
matrix.matrix = matrix.matrix[:needed]
matrix.lenght = matrix.lenght[:needed]
matrix.ll = L
matrix.l = l
matrix.delta = delta
matrix.extra = extra
matrix.w = delta + 1 + 2*extra
return matrix
}
func (matrix *LCSMatrix) Cap() int {
return cap(matrix.matrix)
}
func (matrix *LCSMatrix) Length() int {
return len(matrix.matrix)
}
func (matrix *LCSMatrix) Get(i, j int) (int16, int16) {
ij := max(0, i-matrix.extra)
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
switch {
case i == 0:
return int16(0), int16(j)
case j == 0:
return int16(0), int16(i)
case j < ij || j > sj:
return -1, 30000
default:
return matrix.matrix[matrix.extra+matrix.w*(i-1)+(matrix.w-1)*(j-i)],
matrix.lenght[matrix.extra+matrix.w*(i-1)+(matrix.w-1)*(j-i)]
}
}
func (matrix *LCSMatrix) Set(i, j int, score, length int16) {
ij := max(0, i-matrix.extra)
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
if i > 0 && j > 0 && j >= ij && j <= sj {
matrix.matrix[matrix.extra+matrix.w*(i-1)+(matrix.w-1)*(j-i)] = score
matrix.lenght[matrix.extra+matrix.w*(i-1)+(matrix.w-1)*(j-i)] = length
}
}
func LCSScore(seqA, seqB *obiseq.BioSequence, maxError int,
matrix *LCSMatrix) (int, int) {
// swapped := false
if seqA.Length() < seqB.Length() {
seqA, seqB = seqB, seqA
// swapped = true
}
if (seqA.Length() - seqB.Length()) > maxError {
return -1, -1
}
matrix = NewLCSMatrix(matrix, seqA.Length(), seqB.Length(), maxError)
for i := 1; i <= matrix.l; i++ {
ij := max(1, i-matrix.extra)
sj := min(i+matrix.delta+matrix.extra, matrix.ll)
for j := ij; j <= sj; j++ {
sd, ld := matrix.Get(i-1, j-1)
if seqB.Sequence()[i-1] == seqA.Sequence()[j-1] {
sd++
}
sup, lup := matrix.Get(i-1, j)
sleft, lleft := matrix.Get(i, j-1)
switch {
case sd >= sup && sd >= sleft:
matrix.Set(i, j, sd, ld+1)
case sup >= sleft && sup >= sd:
matrix.Set(i, j, sup, lup+1)
default:
matrix.Set(i, j, sleft, lleft+1)
}
}
}
s, l := matrix.Get(seqB.Length(), seqA.Length())
if (l - s) > int16(maxError) {
return -1, -1
}
return int(s), int(l)
}