Merge pull request #72 from metabarcoding/push-zsprzlqxurrp

Push zsprzlqxurrp

Makefile

@@ -62,10 +62,10 @@ OUTPUT:=$(shell mktemp)
 
 all: install-githook obitools
 
-obitools: $(patsubst %,$(OBITOOLS_PREFIX)%,$(OBITOOLS)) 
+obitools: $(patsubst %,$(OBITOOLS_PREFIX)%,$(OBITOOLS))
 
 install-githook: $(GITHOOKS)
-	
+
 $(GITHOOK_DIR)/%: $(GITHOOK_SRC_DIR)/%
 	@echo installing $$(basename $@)...
 	@mkdir -p $(GITHOOK_DIR)
@@ -79,10 +79,10 @@ update-deps:
 test: .FORCE
 	$(GOTEST) ./...
 
-obitests: 
+obitests:
 	@for t in $$(find obitests -name test.sh -print) ; do \
 		bash $${t} || exit 1;\
-	done 
+	done
 
 githubtests: obitools obitests
 
@@ -94,19 +94,60 @@ $(foreach P,$(PACKAGE_DIRS),$(eval $(call MAKE_PKG_RULE,$(P))))
 
 $(foreach P,$(OBITOOLS_DIRS),$(eval $(call MAKE_OBITOOLS_RULE,$(P))))
 
-pkg/obioptions/version.go: .FORCE
-ifneq ($(strip $(COMMIT_ID)),)
-	@cat $@ \
-	| sed  -E 's/^var _Commit = "[^"]*"/var _Commit = "'$(COMMIT_ID)'"/' \
-	| sed  -E 's/^var _Version = "[^"]*"/var _Version = "'"$(LAST_TAG)"'"/' \
+pkg/obioptions/version.go: version.txt .FORCE
+	@version=$$(cat version.txt); \
+	cat $@ \
+	| sed  -E 's/^var _Version = "[^"]*"/var _Version = "Release '$$version'"/' \
 	> $(OUTPUT)
 
 	@diff $@ $(OUTPUT) 2>&1 > /dev/null \
-    	|| echo "Update version.go : $@ to $(LAST_TAG) ($(COMMIT_ID))" \
-    	&& mv $(OUTPUT) $@
+    	|| (echo "Update version.go to $$(cat version.txt)" && mv $(OUTPUT) $@)
 
 	@rm -f $(OUTPUT)
-endif
 
-.PHONY: all obitools update-deps obitests githubtests .FORCE
-.FORCE:
+bump-version:
+	@echo "Incrementing version..."
+	@current=$$(cat version.txt); \
+	echo "  Current version: $$current"; \
+	major=$$(echo $$current | cut -d. -f1); \
+	minor=$$(echo $$current | cut -d. -f2); \
+	patch=$$(echo $$current | cut -d. -f3); \
+	new_patch=$$((patch + 1)); \
+	new_version="$$major.$$minor.$$new_patch"; \
+	echo "  New version: $$new_version"; \
+	echo "$$new_version" > version.txt
+	@echo "✓ Version updated in version.txt"
+	@$(MAKE) pkg/obioptions/version.go
+
+jjnew:
+	@echo "$(YELLOW)→ Creating a new commit...$(NC)"
+	@echo "$(BLUE)→ Documenting current commit...$(NC)"
+	@jj auto-describe
+	@echo "$(BLUE)→ Done.$(NC)"
+	@jj new
+	@echo "$(GREEN)✓ New commit created$(NC)"
+
+jjpush:
+	@echo "$(YELLOW)→ Pushing commit to repository...$(NC)"
+	@echo "$(BLUE)→ Documenting current commit...$(NC)"
+	@jj auto-describe
+	@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
+	@jj new
+	@$(MAKE) bump-version
+	@echo "$(BLUE)→ Documenting version bump commit...$(NC)"
+	@jj auto-describe
+	@version=$$(cat version.txt); \
+	echo "$(BLUE)→ Pushing commits and creating tag v$$version...$(NC)"; \
+	jj git push --change @; \
+	git tag -a "v$$version" -m "Release $$version" 2>/dev/null || echo "Tag v$$version already exists"; \
+	git push origin "v$$version" 2>/dev/null || echo "Tag already pushed"
+	@echo "$(GREEN)✓ Commits and tag pushed to repository$(NC)"
+
+jjfetch:
+	@echo "$(YELLOW)→ Pulling latest commits...$(NC)"
+	@jj git fetch
+	@jj new master@origin
+	@echo "$(GREEN)✓ Latest commits pulled$(NC)"
+
+.PHONY: all obitools update-deps obitests githubtests jjnew jjpush jjfetch bump-version .FORCE
+.FORCE:

blackboard/Prospective/kmer_index_design.md

@@ -0,0 +1,213 @@
+# Index de k-mers pour génomes de grande taille
+
+## Contexte et objectifs
+
+### Cas d'usage
+
+- Indexation de k-mers longs (k=31) pour des génomes de grande taille (< 10 Go par génome)
+- Nombre de génomes : plusieurs dizaines à quelques centaines
+- Indexation en parallèle
+- Stockage sur disque
+- Possibilité d'ajouter des génomes, mais pas de modifier un génome existant
+
+### Requêtes cibles
+
+- **Présence/absence** d'un k-mer dans un génome
+- **Intersection** entre génomes
+- **Distances** : Jaccard (présence/absence) et potentiellement Bray-Curtis (comptage)
+
+### Ressources disponibles
+
+- 128 Go de RAM
+- Stockage disque
+
+---
+
+## Estimation des volumes
+
+### Par génome
+
+- **10 Go de séquence** → ~10¹⁰ k-mers bruts (chevauchants)
+- **Après déduplication** : typiquement 10-50% de k-mers uniques → **~1-5 × 10⁹ k-mers distincts**
+
+### Espace théorique
+
+- **k=31** → 62 bits → ~4.6 × 10¹⁸ k-mers possibles
+- Table d'indexation directe impossible
+
+---
+
+## Métriques de distance
+
+### Présence/absence (binaire)
+
+- **Jaccard** : |A ∩ B| / |A ∪ B|
+- **Sørensen-Dice** : 2|A ∩ B| / (|A| + |B|)
+
+### Comptage (abondance)
+
+- **Bray-Curtis** : 1 - (2 × Σ min(aᵢ, bᵢ)) / (Σ aᵢ + Σ bᵢ)
+
+Note : Pour Bray-Curtis, le stockage des comptages est nécessaire, ce qui augmente significativement la taille de l'index.
+
+---
+
+## Options d'indexation
+
+### Option 1 : Bloom Filter par génome
+
+**Principe** : Structure probabiliste pour test d'appartenance.
+
+**Avantages :**
+- Très compact : ~10 bits/élément pour FPR ~1%
+- Construction rapide, streaming
+- Facile à sérialiser/désérialiser
+- Intersection et Jaccard estimables via formules analytiques
+
+**Inconvénients :**
+- Faux positifs (pas de faux négatifs)
+- Distances approximatives
+
+**Taille estimée** : 1-6 Go par génome (selon FPR cible)
+
+#### Dimensionnement des Bloom filters
+
+```
+\mathrm{FPR} ;=; \left(1 - e^{-h n / m}\right)^h
+```
+
+
+| Bits/élément | FPR optimal | k (hash functions) |
+|--------------|-------------|---------------------|
+| 8            | ~2%         | 5-6                 |
+| 10           | ~1%         | 7                   |
+| 12           | ~0.3%       | 8                   |
+| 16           | ~0.01%      | 11                  |
+
+Formule du taux de faux positifs :
+```
+FPR ≈ (1 - e^(-kn/m))^k
+```
+Où n = nombre d'éléments, m = nombre de bits, k = nombre de hash functions.
+
+### Option 2 : Ensemble trié de k-mers
+
+**Principe** : Stocker les k-mers (uint64) triés, avec compression possible.
+
+**Avantages :**
+- Exact (pas de faux positifs)
+- Intersection/union par merge sort O(n+m)
+- Compression efficace (delta encoding sur k-mers triés)
+
+**Inconvénients :**
+- Plus volumineux : 8 octets/k-mer
+- Construction plus lente (tri nécessaire)
+
+**Taille estimée** : 8-40 Go par génome (non compressé)
+
+### Option 3 : MPHF (Minimal Perfect Hash Function)
+
+**Principe** : Fonction de hash parfaite minimale pour les k-mers présents.
+
+**Avantages :**
+- Très compact : ~3-4 bits/élément
+- Lookup O(1)
+- Exact pour les k-mers présents
+
+**Inconvénients :**
+- Construction coûteuse (plusieurs passes)
+- Statique (pas d'ajout de k-mers après construction)
+- Ne distingue pas "absent" vs "jamais vu" sans structure auxiliaire
+
+### Option 4 : Hybride MPHF + Bloom filter
+
+- MPHF pour mapping compact des k-mers présents
+- Bloom filter pour pré-filtrage des absents
+
+---
+
+## Optimisation : Indexation de (k-2)-mers pour requêtes k-mers
+
+### Principe
+
+Au lieu d'indexer directement les 31-mers dans un Bloom filter, on indexe les 29-mers. Pour tester la présence d'un 31-mer, on vérifie que les **trois 29-mers** qu'il contient sont présents :
+
+- positions 0-28
+- positions 1-29
+- positions 2-30
+
+### Analyse probabiliste
+
+Si le Bloom filter a un FPR de p pour un 29-mer individuel, le FPR effectif pour un 31-mer devient **p³** (les trois requêtes doivent toutes être des faux positifs).
+
+| FPR 29-mer | FPR 31-mer effectif |
+|------------|---------------------|
+| 10%        | 0.1%                |
+| 5%         | 0.0125%             |
+| 1%         | 0.0001%             |
+
+### Avantages
+
+1. **Moins d'éléments à stocker** : il y a moins de 29-mers distincts que de 31-mers distincts dans un génome (deux 31-mers différents peuvent partager un même 29-mer)
+
+2. **FPR drastiquement réduit** : FPR³ avec seulement 3 requêtes
+
+3. **Index plus compact** : on peut utiliser moins de bits par élément (FPR plus élevé acceptable sur le 29-mer) tout en obtenant un FPR très bas sur le 31-mer
+
+### Trade-off
+
+Un Bloom filter à **5-6 bits/élément** pour les 29-mers donnerait un FPR effectif < 0.01% pour les 31-mers, soit environ **2× plus compact** que l'approche directe à qualité égale.
+
+**Coût** : 3× plus de requêtes par lookup (mais les requêtes Bloom sont très rapides).
+
+---
+
+## Accélération des calculs de distance : MinHash
+
+### Principe
+
+Pré-calculer une "signature" compacte (sketch) de chaque génome permettant d'estimer rapidement Jaccard sans charger les index complets.
+
+### Avantages
+
+- Matrice de distances entre 100+ génomes en quelques secondes
+- Signature de taille fixe (ex: 1000-10000 hash values) quel que soit le génome
+- Stockage minimal
+
+### Utilisation
+
+1. Construction : une passe sur les k-mers de chaque génome
+2. Distance : comparaison des sketches en O(taille du sketch)
+
+---
+
+## Architecture recommandée
+
+### Pour présence/absence + Jaccard
+
+1. **Index principal** : Bloom filter de (k-2)-mers avec l'optimisation décrite
+   - Compact (~3-5 Go par génome)
+   - FPR très bas pour les k-mers grâce aux requêtes triples
+
+2. **Sketches MinHash** : pour calcul rapide des distances entre génomes
+   - Quelques Ko par génome
+   - Permet exploration rapide de la matrice de distances
+
+### Pour comptage + Bray-Curtis
+
+1. **Index principal** : k-mers triés + comptages
+   - uint64 (k-mer) + uint8/uint16 (count)
+   - Compression delta possible
+   - Plus volumineux mais exact
+
+2. **Sketches** : variantes de MinHash pour données pondérées (ex: HyperMinHash)
+
+---
+
+## Prochaines étapes
+
+1. Implémenter un Bloom filter optimisé pour k-mers
+2. Implémenter l'optimisation (k-2)-mer → k-mer
+3. Implémenter MinHash pour les sketches
+4. Définir le format de sérialisation sur disque
+5. Benchmarker sur des génomes réels

go.mod

@@ -27,10 +27,14 @@ require (
 )
 
 require (
+	github.com/RoaringBitmap/roaring v1.9.4 // indirect
+	github.com/bits-and-blooms/bitset v1.12.0 // indirect
 	github.com/davecgh/go-spew v1.1.1 // indirect
 	github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 // indirect
 	github.com/kr/pretty v0.3.1 // indirect
 	github.com/kr/text v0.2.0 // indirect
+	github.com/mschoch/smat v0.2.0 // indirect
+	github.com/pelletier/go-toml/v2 v2.2.4 // indirect
 	github.com/pmezard/go-difflib v1.0.0 // indirect
 	github.com/rogpeppe/go-internal v1.12.0 // indirect
 )

go.sum

@@ -4,8 +4,12 @@ github.com/PaesslerAG/gval v1.2.2 h1:Y7iBzhgE09IGTt5QgGQ2IdaYYYOU134YGHBThD+wm9E
 github.com/PaesslerAG/gval v1.2.2/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
 github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
 github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
+github.com/RoaringBitmap/roaring v1.9.4 h1:yhEIoH4YezLYT04s1nHehNO64EKFTop/wBhxv2QzDdQ=
+github.com/RoaringBitmap/roaring v1.9.4/go.mod h1:6AXUsoIEzDTFFQCe1RbGA6uFONMhvejWj5rqITANK90=
 github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
 github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
+github.com/bits-and-blooms/bitset v1.12.0 h1:U/q1fAF7xXRhFCrhROzIfffYnu+dlS38vCZtmFVPHmA=
+github.com/bits-and-blooms/bitset v1.12.0/go.mod h1:7hO7Gc7Pp1vODcmWvKMRA9BNmbv6a/7QIWpPxHddWR8=
 github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
 github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
 github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
@@ -47,8 +51,12 @@ github.com/mattn/go-runewidth v0.0.15 h1:UNAjwbU9l54TA3KzvqLGxwWjHmMgBUVhBiTjelZ
 github.com/mattn/go-runewidth v0.0.15/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
 github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2EmQ4l5rM/4FEfDWcRD+abF5XlKShorW5LRoQ=
 github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
+github.com/mschoch/smat v0.2.0 h1:8imxQsjDm8yFEAVBe7azKmKSgzSkZXDuKkSq9374khM=
+github.com/mschoch/smat v0.2.0/go.mod h1:kc9mz7DoBKqDyiRL7VZN8KvXQMWeTaVnttLRXOlotKw=
 github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
 github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58/go.mod h1:DXv8WO4yhMYhSNPKjeNKa5WY9YCIEBRbNzFFPJbWO6Y=
+github.com/pelletier/go-toml/v2 v2.2.4 h1:mye9XuhQ6gvn5h28+VilKrrPoQVanw5PMw/TB0t5Ec4=
+github.com/pelletier/go-toml/v2 v2.2.4/go.mod h1:2gIqNv+qfxSVS7cM2xJQKtLSTLUE9V8t9Stt+h56mCY=
 github.com/pkg/diff v0.0.0-20210226163009-20ebb0f2a09e/go.mod h1:pJLUxLENpZxwdsKMEsNbx1VGcRFpLqf3715MtcvvzbA=
 github.com/pmezard/go-difflib v1.0.0 h1:4DBwDE0NGyQoBHbLQYPwSUPoCMWR5BEzIk/f1lZbAQM=
 github.com/pmezard/go-difflib v1.0.0/go.mod h1:iKH77koFhYxTK1pcRnkKkqfTogsbg7gZNVY4sRDYZ/4=

kmer_roaring_index/FREQUENCY_FILTER_FINAL.md

@@ -0,0 +1,292 @@
+# Filtre de Fréquence avec v Niveaux de Roaring Bitmaps
+
+## Algorithme
+
+```go
+Pour chaque k-mer rencontré dans les données:
+    c = 0
+    tant que (k-mer ∈ index[c] ET c < v):
+        c++
+    
+    si c < v:
+        index[c].insert(k-mer)
+```
+
+**Résultat** : `index[v-1]` contient les k-mers vus **≥ v fois**
+
+---
+
+## Exemple d'exécution (v=3)
+
+```
+Données:
+  Read1: kmer X
+  Read2: kmer X
+  Read3: kmer X  (X vu 3 fois)
+  Read4: kmer Y
+  Read5: kmer Y  (Y vu 2 fois)
+  Read6: kmer Z  (Z vu 1 fois)
+
+Exécution:
+
+Read1 (X):
+  c=0: X ∉ index[0] → index[0].add(X)
+  État: index[0]={X}, index[1]={}, index[2]={}
+
+Read2 (X):
+  c=0: X ∈ index[0] → c=1
+  c=1: X ∉ index[1] → index[1].add(X)
+  État: index[0]={X}, index[1]={X}, index[2]={}
+
+Read3 (X):
+  c=0: X ∈ index[0] → c=1
+  c=1: X ∈ index[1] → c=2
+  c=2: X ∉ index[2] → index[2].add(X)
+  État: index[0]={X}, index[1]={X}, index[2]={X}
+
+Read4 (Y):
+  c=0: Y ∉ index[0] → index[0].add(Y)
+  État: index[0]={X,Y}, index[1]={X}, index[2]={X}
+
+Read5 (Y):
+  c=0: Y ∈ index[0] → c=1
+  c=1: Y ∉ index[1] → index[1].add(Y)
+  État: index[0]={X,Y}, index[1]={X,Y}, index[2]={X}
+
+Read6 (Z):
+  c=0: Z ∉ index[0] → index[0].add(Z)
+  État: index[0]={X,Y,Z}, index[1]={X,Y}, index[2]={X}
+
+Résultat final:
+  index[0] (freq≥1): {X, Y, Z}
+  index[1] (freq≥2): {X, Y}
+  index[2] (freq≥3): {X}  ← K-mers filtrés ✓
+```
+
+---
+
+## Utilisation
+
+```go
+// Créer le filtre
+filter := obikmer.NewFrequencyFilter(31, 3) // k=31, minFreq=3
+
+// Ajouter les séquences
+for _, read := range reads {
+    filter.AddSequence(read)
+}
+
+// Récupérer les k-mers filtrés (freq ≥ 3)
+filtered := filter.GetFilteredSet("filtered")
+fmt.Printf("K-mers de qualité: %d\n", filtered.Cardinality())
+
+// Statistiques
+stats := filter.Stats()
+fmt.Println(stats.String())
+```
+
+---
+
+## Performance
+
+### Complexité
+
+**Par k-mer** :
+- Lookups : Moyenne ~v/2, pire cas v
+- Insertions : 1 Add
+- **Pas de Remove** ✅
+
+**Total pour n k-mers** :
+- Temps : O(n × v/2)
+- Mémoire : O(unique_kmers × v × 2 bytes)
+
+### Early exit pour distribution skewed
+
+Avec distribution typique (séquençage) :
+```
+80% singletons → 1 lookup (early exit)
+15% freq 2-3   → 2-3 lookups
+5% freq ≥4     → jusqu'à v lookups
+
+Moyenne réelle : ~2 lookups/kmer (au lieu de v/2)
+```
+
+---
+
+## Mémoire
+
+### Pour 10^8 k-mers uniques
+
+| v (minFreq) | Nombre bitmaps | Mémoire | vs map simple |
+|-------------|----------------|---------|---------------|
+| v=2 | 2 | ~400 MB | 6x moins |
+| v=3 | 3 | ~600 MB | 4x moins |
+| v=5 | 5 | ~1 GB | 2.4x moins |
+| v=10 | 10 | ~2 GB | 1.2x moins |
+| v=20 | 20 | ~4 GB | ~égal |
+
+**Note** : Avec distribution skewed (beaucoup de singletons), la mémoire réelle est bien plus faible car les niveaux hauts ont peu d'éléments.
+
+### Exemple réaliste (séquençage)
+
+Pour 10^8 k-mers totaux, v=3 :
+```
+Distribution:
+  80% singletons  → 80M dans index[0]
+  15% freq 2-3    → 15M dans index[1]
+  5% freq ≥3      → 5M dans index[2]
+
+Mémoire:
+  index[0]: 80M × 2 bytes = 160 MB
+  index[1]: 15M × 2 bytes = 30 MB
+  index[2]: 5M × 2 bytes = 10 MB
+  Total: ~200 MB ✅
+
+vs map simple: 80M × 24 bytes = ~2 GB
+Réduction: 10x
+```
+
+---
+
+## Comparaison des approches
+
+| Approche | Mémoire (10^8 kmers) | Passes | Lookups/kmer | Quand utiliser |
+|----------|----------------------|--------|--------------|----------------|
+| **v-Bitmaps** | **200-600 MB** | **1** | **~2 (avg)** | **Standard** ✅ |
+| Map simple | 2.4 GB | 1 | 1 | Si RAM illimitée |
+| Multi-pass | 400 MB | v | v | Si I/O pas cher |
+
+---
+
+## Avantages de v-Bitmaps
+
+✅ **Une seule passe** sur les données  
+✅ **Mémoire optimale** avec Roaring bitmaps  
+✅ **Pas de Remove** (seulement Contains + Add)  
+✅ **Early exit** efficace sur singletons  
+✅ **Scalable** jusqu'à v~10-20  
+✅ **Simple** à implémenter et comprendre  
+
+---
+
+## Cas d'usage typiques
+
+### 1. Éliminer erreurs de séquençage
+
+```go
+filter := obikmer.NewFrequencyFilter(31, 3)
+
+// Traiter FASTQ
+for read := range StreamFastq("sample.fastq") {
+    filter.AddSequence(read)
+}
+
+// K-mers de qualité (pas d'erreurs)
+cleaned := filter.GetFilteredSet("cleaned")
+```
+
+**Résultat** : Élimine 70-80% des k-mers (erreurs)
+
+### 2. Assemblage de génome
+
+```go
+filter := obikmer.NewFrequencyFilter(31, 2)
+
+// Filtrer avant l'assemblage
+for read := range reads {
+    filter.AddSequence(read)
+}
+
+solidKmers := filter.GetFilteredSet("solid")
+// Utiliser solidKmers pour le graphe de Bruijn
+```
+
+### 3. Comparaison de génomes
+
+```go
+collection := obikmer.NewKmerSetCollection(31)
+
+for _, genome := range genomes {
+    filter := obikmer.NewFrequencyFilter(31, 3)
+    filter.AddSequences(genome.Reads)
+    
+    cleaned := filter.GetFilteredSet(genome.ID)
+    collection.Add(cleaned)
+}
+
+// Analyses comparatives sur k-mers de qualité
+matrix := collection.ParallelPairwiseJaccard(8)
+```
+
+---
+
+## Limites
+
+**Pour v > 20** :
+- Trop de lookups (v lookups/kmer)
+- Mémoire importante (v × 200MB pour 10^8 kmers)
+
+**Solutions alternatives pour v > 20** :
+- Utiliser map simple (9 bytes/kmer) si RAM disponible
+- Algorithme différent (sketch, probabiliste)
+
+---
+
+## Optimisations possibles
+
+### 1. Parallélisation
+
+```go
+// Traiter plusieurs fichiers en parallèle
+filters := make([]*FrequencyFilter, numFiles)
+
+var wg sync.WaitGroup
+for i, file := range files {
+    wg.Add(1)
+    go func(idx int, f string) {
+        defer wg.Done()
+        filters[idx] = ProcessFile(f, k, minFreq)
+    }(i, file)
+}
+wg.Wait()
+
+// Merger les résultats
+merged := MergeFilters(filters)
+```
+
+### 2. Streaming avec seuil adaptatif
+
+```go
+// Commencer avec v=5, réduire progressivement
+filter := obikmer.NewFrequencyFilter(31, 5)
+
+// ... traitement ...
+
+// Si trop de mémoire, réduire à v=3
+if filter.MemoryUsage() > threshold {
+    filter = ConvertToLowerThreshold(filter, 3)
+}
+```
+
+---
+
+## Récapitulatif final
+
+**Pour filtrer les k-mers par fréquence ≥ v :**
+
+1. **Créer** : `filter := NewFrequencyFilter(k, v)`
+2. **Traiter** : `filter.AddSequence(read)` pour chaque read
+3. **Résultat** : `filtered := filter.GetFilteredSet(id)`
+
+**Mémoire** : ~2v MB par million de k-mers uniques  
+**Temps** : Une seule passe, ~2 lookups/kmer en moyenne  
+**Optimal pour** : v ≤ 20, distribution skewed (séquençage)  
+
+---
+
+## Code fourni
+
+1. **frequency_filter.go** - Implémentation complète
+2. **examples_frequency_filter_final.go** - Exemples d'utilisation
+
+**Tout est prêt à utiliser !** 🚀

kmer_roaring_index/examples_frequency_filter_final.go

@@ -0,0 +1,320 @@
+package main
+
+import (
+	"fmt"
+	"obikmer"
+)
+
+func main() {
+	// ==========================================
+	// EXEMPLE 1 : Utilisation basique
+	// ==========================================
+	fmt.Println("=== EXEMPLE 1 : Utilisation basique ===\n")
+
+	k := 31
+	minFreq := 3 // Garder les k-mers vus ≥3 fois
+
+	// Créer le filtre
+	filter := obikmer.NewFrequencyFilter(k, minFreq)
+
+	// Simuler des séquences avec différentes fréquences
+	sequences := [][]byte{
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X (freq=2)
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X (freq=3) ✓
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Kmer Y
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Kmer Y (freq=2) ✗
+		[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // Kmer Z (freq=1) ✗
+	}
+
+	fmt.Printf("Traitement de %d séquences...\n", len(sequences))
+	for _, seq := range sequences {
+		filter.AddSequence(seq)
+	}
+
+	// Récupérer les k-mers filtrés
+	filtered := filter.GetFilteredSet("filtered")
+	fmt.Printf("\nK-mers avec freq ≥ %d: %d\n", minFreq, filtered.Cardinality())
+
+	// Statistiques
+	stats := filter.Stats()
+	fmt.Println("\n" + stats.String())
+
+	// ==========================================
+	// EXEMPLE 2 : Vérifier les niveaux
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 2 : Inspection des niveaux ===\n")
+
+	// Vérifier chaque niveau
+	for level := 0; level < minFreq; level++ {
+		levelSet := filter.GetKmersAtLevel(level)
+		fmt.Printf("Niveau %d (freq≥%d): %d k-mers\n",
+			level+1, level+1, levelSet.Cardinality())
+	}
+
+	// ==========================================
+	// EXEMPLE 3 : Données réalistes
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 3 : Simulation données séquençage ===\n")
+
+	filter2 := obikmer.NewFrequencyFilter(31, 3)
+
+	// Simuler un dataset réaliste :
+	// - 1000 reads
+	// - 80% contiennent des erreurs (singletons)
+	// - 15% vrais k-mers à basse fréquence
+	// - 5% vrais k-mers à haute fréquence
+
+	// Vraie séquence répétée
+	trueSeq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
+	for i := 0; i < 50; i++ {
+		filter2.AddSequence(trueSeq)
+	}
+
+	// Séquence à fréquence moyenne
+	mediumSeq := []byte("CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC")
+	for i := 0; i < 5; i++ {
+		filter2.AddSequence(mediumSeq)
+	}
+
+	// Erreurs de séquençage (singletons)
+	for i := 0; i < 100; i++ {
+		errorSeq := []byte(fmt.Sprintf("TTTTTTTTTTTTTTTTTTTTTTTTTTTT%03d", i))
+		filter2.AddSequence(errorSeq)
+	}
+
+	stats2 := filter2.Stats()
+	fmt.Println(stats2.String())
+
+	fmt.Println("Distribution attendue:")
+	fmt.Println("  - Beaucoup de singletons (erreurs)")
+	fmt.Println("  - Peu de k-mers à haute fréquence (signal)")
+	fmt.Println("  → Filtrage efficace !")
+
+	// ==========================================
+	// EXEMPLE 4 : Tester différents seuils
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 4 : Comparaison de seuils ===\n")
+
+	testSeqs := [][]byte{
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // freq=5
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"),
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"),
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // freq=3
+		[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // freq=1
+	}
+
+	for _, minFreq := range []int{2, 3, 5} {
+		f := obikmer.NewFrequencyFilter(31, minFreq)
+		f.AddSequences(testSeqs)
+
+		fmt.Printf("minFreq=%d: %d k-mers retenus (%.2f MB)\n",
+			minFreq,
+			f.Cardinality(),
+			float64(f.MemoryUsage())/1024/1024)
+	}
+
+	// ==========================================
+	// EXEMPLE 5 : Comparaison mémoire
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 5 : Comparaison mémoire ===\n")
+
+	filter3 := obikmer.NewFrequencyFilter(31, 3)
+
+	// Simuler 10000 séquences
+	for i := 0; i < 10000; i++ {
+		seq := make([]byte, 100)
+		for j := range seq {
+			seq[j] = "ACGT"[(i+j)%4]
+		}
+		filter3.AddSequence(seq)
+	}
+
+	fmt.Println(filter3.CompareWithSimpleMap())
+
+	// ==========================================
+	// EXEMPLE 6 : Workflow complet
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 6 : Workflow complet ===\n")
+
+	fmt.Println("1. Créer le filtre")
+	finalFilter := obikmer.NewFrequencyFilter(31, 3)
+
+	fmt.Println("2. Traiter les données (simulation)")
+	// En pratique : lire depuis FASTQ
+	// for read := range ReadFastq("data.fastq") {
+	//     finalFilter.AddSequence(read)
+	// }
+
+	// Simulation
+	for i := 0; i < 1000; i++ {
+		seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
+		finalFilter.AddSequence(seq)
+	}
+
+	fmt.Println("3. Récupérer les k-mers filtrés")
+	result := finalFilter.GetFilteredSet("final")
+
+	fmt.Println("4. Utiliser le résultat")
+	fmt.Printf("   K-mers de qualité: %d\n", result.Cardinality())
+	fmt.Printf("   Mémoire utilisée: %.2f MB\n", float64(finalFilter.MemoryUsage())/1024/1024)
+
+	fmt.Println("5. Sauvegarder (optionnel)")
+	// result.Save("filtered_kmers.bin")
+
+	// ==========================================
+	// EXEMPLE 7 : Vérification individuelle
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 7 : Vérification de k-mers spécifiques ===\n")
+
+	checkFilter := obikmer.NewFrequencyFilter(31, 3)
+
+	testSeq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
+	for i := 0; i < 5; i++ {
+		checkFilter.AddSequence(testSeq)
+	}
+
+	var kmers []uint64
+	kmers = obikmer.EncodeKmers(testSeq, 31, &kmers)
+
+	if len(kmers) > 0 {
+		testKmer := kmers[0]
+
+		fmt.Printf("K-mer test: 0x%016X\n", testKmer)
+		fmt.Printf("  Présent dans filtre: %v\n", checkFilter.Contains(testKmer))
+		fmt.Printf("  Fréquence approx: %d\n", checkFilter.GetFrequency(testKmer))
+	}
+
+	// ==========================================
+	// EXEMPLE 8 : Intégration avec collection
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 8 : Intégration avec KmerSetCollection ===\n")
+
+	// Créer une collection de génomes filtrés
+	collection := obikmer.NewKmerSetCollection(31)
+
+	genomes := map[string][][]byte{
+		"Genome1": {
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Erreur
+		},
+		"Genome2": {
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // Erreur
+		},
+	}
+
+	for id, sequences := range genomes {
+		// Filtrer chaque génome
+		genomeFilter := obikmer.NewFrequencyFilter(31, 3)
+		genomeFilter.AddSequences(sequences)
+
+		// Ajouter à la collection
+		filteredSet := genomeFilter.GetFilteredSet(id)
+		collection.Add(filteredSet)
+
+		fmt.Printf("%s: %d k-mers de qualité\n", id, filteredSet.Cardinality())
+	}
+
+	// Analyser la collection
+	fmt.Println("\nAnalyse comparative:")
+	collectionStats := collection.ComputeStats()
+	fmt.Printf("  Core genome: %d k-mers\n", collectionStats.CoreSize)
+	fmt.Printf("  Pan genome: %d k-mers\n", collectionStats.PanGenomeSize)
+
+	// ==========================================
+	// RÉSUMÉ
+	// ==========================================
+	fmt.Println("\n=== RÉSUMÉ ===\n")
+	fmt.Println("Le FrequencyFilter permet de:")
+	fmt.Println("  ✓ Filtrer les k-mers par fréquence minimale")
+	fmt.Println("  ✓ Utiliser une mémoire optimale avec Roaring bitmaps")
+	fmt.Println("  ✓ Une seule passe sur les données")
+	fmt.Println("  ✓ Éliminer efficacement les erreurs de séquençage")
+	fmt.Println("")
+	fmt.Println("Workflow typique:")
+	fmt.Println("  1. filter := NewFrequencyFilter(k, minFreq)")
+	fmt.Println("  2. for each sequence: filter.AddSequence(seq)")
+	fmt.Println("  3. filtered := filter.GetFilteredSet(id)")
+	fmt.Println("  4. Utiliser filtered dans vos analyses")
+}
+
+// ==================================
+// FONCTION HELPER POUR BENCHMARKS
+// ==================================
+
+func BenchmarkFrequencyFilter() {
+	k := 31
+	minFreq := 3
+
+	// Test avec différentes tailles
+	sizes := []int{1000, 10000, 100000}
+
+	fmt.Println("\n=== BENCHMARK ===\n")
+
+	for _, size := range sizes {
+		filter := obikmer.NewFrequencyFilter(k, minFreq)
+
+		// Générer des séquences
+		for i := 0; i < size; i++ {
+			seq := make([]byte, 100)
+			for j := range seq {
+				seq[j] = "ACGT"[(i+j)%4]
+			}
+			filter.AddSequence(seq)
+		}
+
+		fmt.Printf("Size=%d reads:\n", size)
+		fmt.Printf("  Filtered k-mers: %d\n", filter.Cardinality())
+		fmt.Printf("  Memory: %.2f MB\n", float64(filter.MemoryUsage())/1024/1024)
+		fmt.Println()
+	}
+}
+
+// ==================================
+// FONCTION POUR DONNÉES RÉELLES
+// ==================================
+
+func ProcessRealData() {
+	// Exemple pour traiter de vraies données FASTQ
+
+	k := 31
+	minFreq := 3
+
+	filter := obikmer.NewFrequencyFilter(k, minFreq)
+
+	// Pseudo-code pour lire un FASTQ
+	/*
+	fastqFile := "sample.fastq"
+	reader := NewFastqReader(fastqFile)
+
+	for reader.HasNext() {
+		read := reader.Next()
+		filter.AddSequence(read.Sequence)
+	}
+
+	// Récupérer le résultat
+	filtered := filter.GetFilteredSet("sample_filtered")
+	filtered.Save("sample_filtered_kmers.bin")
+
+	// Stats
+	stats := filter.Stats()
+	fmt.Println(stats.String())
+	*/
+
+	fmt.Println("Workflow pour données réelles:")
+	fmt.Println("  1. Créer le filtre avec minFreq approprié (2-5 typique)")
+	fmt.Println("  2. Stream les reads depuis FASTQ")
+	fmt.Println("  3. Récupérer les k-mers filtrés")
+	fmt.Println("  4. Utiliser pour assemblage/comparaison/etc.")
+
+	_ = filter // unused
+}

pkg/obidist/dist_matrix.go

@@ -0,0 +1,272 @@
+package obidist
+
+import (
+	"fmt"
+)
+
+// DistMatrix represents a symmetric matrix stored as a triangular matrix.
+// The diagonal has a constant value (typically 0 for distances, 1 for similarities).
+// Only the upper triangle (i < j) is stored to save memory.
+//
+// For an n×n matrix, we store n(n-1)/2 values.
+type DistMatrix struct {
+	n            int       // Number of elements (matrix dimension)
+	data         []float64 // Triangular storage: upper triangle only
+	labels       []string  // Optional labels for rows/columns
+	diagonalValue float64  // Value on the diagonal
+}
+
+// NewDistMatrix creates a new distance matrix of size n×n.
+// All distances are initialized to 0.0, diagonal is 0.0.
+func NewDistMatrix(n int) *DistMatrix {
+	if n < 0 {
+		panic("matrix size must be non-negative")
+	}
+
+	// Number of elements in upper triangle: n(n-1)/2
+	size := n * (n - 1) / 2
+
+	return &DistMatrix{
+		n:             n,
+		data:          make([]float64, size),
+		labels:        make([]string, n),
+		diagonalValue: 0.0,
+	}
+}
+
+// NewDistMatrixWithLabels creates a new distance matrix with labels.
+// Diagonal is 0.0 by default.
+func NewDistMatrixWithLabels(labels []string) *DistMatrix {
+	dm := NewDistMatrix(len(labels))
+	copy(dm.labels, labels)
+	return dm
+}
+
+// NewSimilarityMatrix creates a new similarity matrix of size n×n.
+// All off-diagonal values are initialized to 0.0, diagonal is 1.0.
+func NewSimilarityMatrix(n int) *DistMatrix {
+	if n < 0 {
+		panic("matrix size must be non-negative")
+	}
+
+	// Number of elements in upper triangle: n(n-1)/2
+	size := n * (n - 1) / 2
+
+	return &DistMatrix{
+		n:             n,
+		data:          make([]float64, size),
+		labels:        make([]string, n),
+		diagonalValue: 1.0,
+	}
+}
+
+// NewSimilarityMatrixWithLabels creates a new similarity matrix with labels.
+// Diagonal is 1.0.
+func NewSimilarityMatrixWithLabels(labels []string) *DistMatrix {
+	dm := NewSimilarityMatrix(len(labels))
+	copy(dm.labels, labels)
+	return dm
+}
+
+// Size returns the dimension of the matrix (n for an n×n matrix).
+func (dm *DistMatrix) Size() int {
+	return dm.n
+}
+
+// indexFor computes the index in the data array for element (i, j).
+// Assumes i < j (upper triangle).
+//
+// The upper triangle is stored row by row:
+// (0,1), (0,2), ..., (0,n-1), (1,2), (1,3), ..., (1,n-1), (2,3), ...
+//
+// For element (i, j) where i < j:
+// index = i*(n-1) + j - 1 - i*(i+1)/2
+//
+// This can be simplified to:
+// index = i*n - i*(i+1)/2 + j - i - 1
+//       = i*(n - (i+1)/2 - 1) + j - 1
+//       = i*(n - 1 - i/2 - 1/2) + j - 1
+//
+// But the clearest formula is:
+// index = i*n - i*(i+3)/2 + j - 1
+func (dm *DistMatrix) indexFor(i, j int) int {
+	if i >= j {
+		panic(fmt.Sprintf("indexFor expects i < j, got i=%d, j=%d", i, j))
+	}
+	// Formula: number of elements in previous rows + position in current row
+	// Previous rows (0 to i-1): sum from k=0 to i-1 of (n-1-k) = i*n - i*(i+1)/2
+	// Current row position: j - i - 1
+	return i*dm.n - i*(i+1)/2 + j - i - 1
+}
+
+// Get returns the value at position (i, j).
+// The matrix is symmetric, so Get(i, j) == Get(j, i).
+// The diagonal returns the diagonalValue (0.0 for distances, 1.0 for similarities).
+func (dm *DistMatrix) Get(i, j int) float64 {
+	if i < 0 || i >= dm.n || j < 0 || j >= dm.n {
+		panic(fmt.Sprintf("indices out of bounds: i=%d, j=%d, n=%d", i, j, dm.n))
+	}
+
+	// Diagonal: return the diagonal value
+	if i == j {
+		return dm.diagonalValue
+	}
+
+	// Ensure i < j for indexing
+	if i > j {
+		i, j = j, i
+	}
+
+	return dm.data[dm.indexFor(i, j)]
+}
+
+// Set sets the value at position (i, j).
+// The matrix is symmetric, so Set(i, j, v) also sets (j, i) to v.
+// Setting the diagonal (i == j) is ignored (diagonal has a fixed value).
+func (dm *DistMatrix) Set(i, j int, value float64) {
+	if i < 0 || i >= dm.n || j < 0 || j >= dm.n {
+		panic(fmt.Sprintf("indices out of bounds: i=%d, j=%d, n=%d", i, j, dm.n))
+	}
+
+	// Ignore diagonal assignments (diagonal has a fixed value)
+	if i == j {
+		return
+	}
+
+	// Ensure i < j for indexing
+	if i > j {
+		i, j = j, i
+	}
+
+	dm.data[dm.indexFor(i, j)] = value
+}
+
+// GetLabel returns the label for element i.
+func (dm *DistMatrix) GetLabel(i int) string {
+	if i < 0 || i >= dm.n {
+		panic(fmt.Sprintf("index out of bounds: i=%d, n=%d", i, dm.n))
+	}
+	return dm.labels[i]
+}
+
+// SetLabel sets the label for element i.
+func (dm *DistMatrix) SetLabel(i int, label string) {
+	if i < 0 || i >= dm.n {
+		panic(fmt.Sprintf("index out of bounds: i=%d, n=%d", i, dm.n))
+	}
+	dm.labels[i] = label
+}
+
+// Labels returns a copy of all labels.
+func (dm *DistMatrix) Labels() []string {
+	labels := make([]string, dm.n)
+	copy(labels, dm.labels)
+	return labels
+}
+
+// GetRow returns the i-th row of the distance matrix.
+// The returned slice is a copy.
+func (dm *DistMatrix) GetRow(i int) []float64 {
+	if i < 0 || i >= dm.n {
+		panic(fmt.Sprintf("index out of bounds: i=%d, n=%d", i, dm.n))
+	}
+
+	row := make([]float64, dm.n)
+	for j := 0; j < dm.n; j++ {
+		row[j] = dm.Get(i, j)
+	}
+	return row
+}
+
+// GetColumn returns the j-th column of the distance matrix.
+// Since the matrix is symmetric, GetColumn(j) == GetRow(j).
+// The returned slice is a copy.
+func (dm *DistMatrix) GetColumn(j int) []float64 {
+	return dm.GetRow(j)
+}
+
+// MinDistance returns the minimum non-zero distance in the matrix,
+// along with the indices (i, j) where it occurs.
+// Returns (0.0, -1, -1) if the matrix is empty or all distances are 0.
+func (dm *DistMatrix) MinDistance() (float64, int, int) {
+	if dm.n <= 1 {
+		return 0.0, -1, -1
+	}
+
+	minDist := -1.0
+	minI, minJ := -1, -1
+
+	for i := 0; i < dm.n-1; i++ {
+		for j := i + 1; j < dm.n; j++ {
+			dist := dm.Get(i, j)
+			if minDist < 0 || dist < minDist {
+				minDist = dist
+				minI = i
+				minJ = j
+			}
+		}
+	}
+
+	if minI < 0 {
+		return 0.0, -1, -1
+	}
+
+	return minDist, minI, minJ
+}
+
+// MaxDistance returns the maximum distance in the matrix,
+// along with the indices (i, j) where it occurs.
+// Returns (0.0, -1, -1) if the matrix is empty.
+func (dm *DistMatrix) MaxDistance() (float64, int, int) {
+	if dm.n <= 1 {
+		return 0.0, -1, -1
+	}
+
+	maxDist := -1.0
+	maxI, maxJ := -1, -1
+
+	for i := 0; i < dm.n-1; i++ {
+		for j := i + 1; j < dm.n; j++ {
+			dist := dm.Get(i, j)
+			if maxDist < 0 || dist > maxDist {
+				maxDist = dist
+				maxI = i
+				maxJ = j
+			}
+		}
+	}
+
+	if maxI < 0 {
+		return 0.0, -1, -1
+	}
+
+	return maxDist, maxI, maxJ
+}
+
+// Copy creates a deep copy of the matrix.
+func (dm *DistMatrix) Copy() *DistMatrix {
+	newDM := &DistMatrix{
+		n:             dm.n,
+		data:          make([]float64, len(dm.data)),
+		labels:        make([]string, dm.n),
+		diagonalValue: dm.diagonalValue,
+	}
+
+	copy(newDM.data, dm.data)
+	copy(newDM.labels, dm.labels)
+
+	return newDM
+}
+
+// ToFullMatrix returns a full n×n matrix representation.
+// This allocates n² values, so use only when needed.
+func (dm *DistMatrix) ToFullMatrix() [][]float64 {
+	matrix := make([][]float64, dm.n)
+	for i := 0; i < dm.n; i++ {
+		matrix[i] = make([]float64, dm.n)
+		for j := 0; j < dm.n; j++ {
+			matrix[i][j] = dm.Get(i, j)
+		}
+	}
+	return matrix
+}

pkg/obidist/dist_matrix_test.go

@@ -0,0 +1,386 @@
+package obidist
+
+import (
+	"math"
+	"testing"
+)
+
+func TestNewDistMatrix(t *testing.T) {
+	dm := NewDistMatrix(5)
+
+	if dm.Size() != 5 {
+		t.Errorf("Expected size 5, got %d", dm.Size())
+	}
+
+	// Check that all values are initialized to 0
+	for i := 0; i < 5; i++ {
+		for j := 0; j < 5; j++ {
+			if dm.Get(i, j) != 0.0 {
+				t.Errorf("Expected 0.0 at (%d, %d), got %f", i, j, dm.Get(i, j))
+			}
+		}
+	}
+}
+
+func TestDistMatrixDiagonal(t *testing.T) {
+	dm := NewDistMatrix(5)
+
+	// Diagonal should always be 0
+	for i := 0; i < 5; i++ {
+		if dm.Get(i, i) != 0.0 {
+			t.Errorf("Expected diagonal element (%d, %d) to be 0.0, got %f", i, i, dm.Get(i, i))
+		}
+	}
+
+	// Try to set diagonal (should be ignored)
+	dm.Set(2, 2, 5.0)
+	if dm.Get(2, 2) != 0.0 {
+		t.Errorf("Diagonal should remain 0.0 even after Set, got %f", dm.Get(2, 2))
+	}
+}
+
+func TestDistMatrixSymmetry(t *testing.T) {
+	dm := NewDistMatrix(4)
+
+	dm.Set(0, 1, 1.5)
+	dm.Set(0, 2, 2.5)
+	dm.Set(1, 3, 3.5)
+
+	// Check symmetry
+	if dm.Get(0, 1) != dm.Get(1, 0) {
+		t.Errorf("Matrix not symmetric: Get(0,1)=%f, Get(1,0)=%f", dm.Get(0, 1), dm.Get(1, 0))
+	}
+
+	if dm.Get(0, 2) != dm.Get(2, 0) {
+		t.Errorf("Matrix not symmetric: Get(0,2)=%f, Get(2,0)=%f", dm.Get(0, 2), dm.Get(2, 0))
+	}
+
+	if dm.Get(1, 3) != dm.Get(3, 1) {
+		t.Errorf("Matrix not symmetric: Get(1,3)=%f, Get(3,1)=%f", dm.Get(1, 3), dm.Get(3, 1))
+	}
+}
+
+func TestDistMatrixSetGet(t *testing.T) {
+	dm := NewDistMatrix(4)
+
+	testCases := []struct {
+		i     int
+		j     int
+		value float64
+	}{
+		{0, 1, 1.5},
+		{0, 2, 2.5},
+		{0, 3, 3.5},
+		{1, 2, 4.5},
+		{1, 3, 5.5},
+		{2, 3, 6.5},
+	}
+
+	for _, tc := range testCases {
+		dm.Set(tc.i, tc.j, tc.value)
+	}
+
+	for _, tc := range testCases {
+		got := dm.Get(tc.i, tc.j)
+		if math.Abs(got-tc.value) > 1e-10 {
+			t.Errorf("Get(%d, %d): expected %f, got %f", tc.i, tc.j, tc.value, got)
+		}
+
+		// Check symmetry
+		got = dm.Get(tc.j, tc.i)
+		if math.Abs(got-tc.value) > 1e-10 {
+			t.Errorf("Get(%d, %d) (symmetric): expected %f, got %f", tc.j, tc.i, tc.value, got)
+		}
+	}
+}
+
+func TestDistMatrixLabels(t *testing.T) {
+	labels := []string{"A", "B", "C", "D"}
+	dm := NewDistMatrixWithLabels(labels)
+
+	if dm.Size() != 4 {
+		t.Errorf("Expected size 4, got %d", dm.Size())
+	}
+
+	for i, label := range labels {
+		if dm.GetLabel(i) != label {
+			t.Errorf("Expected label %s at index %d, got %s", label, i, dm.GetLabel(i))
+		}
+	}
+
+	// Modify a label
+	dm.SetLabel(1, "Modified")
+	if dm.GetLabel(1) != "Modified" {
+		t.Errorf("Expected label 'Modified' at index 1, got %s", dm.GetLabel(1))
+	}
+
+	// Check Labels() returns a copy
+	labelsCopy := dm.Labels()
+	labelsCopy[0] = "ChangedCopy"
+	if dm.GetLabel(0) != "A" {
+		t.Errorf("Modifying Labels() return value should not affect original labels")
+	}
+}
+
+func TestDistMatrixMinDistance(t *testing.T) {
+	dm := NewDistMatrix(4)
+
+	dm.Set(0, 1, 2.5)
+	dm.Set(0, 2, 1.5) // minimum
+	dm.Set(0, 3, 3.5)
+	dm.Set(1, 2, 4.5)
+	dm.Set(1, 3, 5.5)
+	dm.Set(2, 3, 6.5)
+
+	minDist, minI, minJ := dm.MinDistance()
+
+	if math.Abs(minDist-1.5) > 1e-10 {
+		t.Errorf("Expected min distance 1.5, got %f", minDist)
+	}
+
+	if (minI != 0 || minJ != 2) && (minI != 2 || minJ != 0) {
+		t.Errorf("Expected min at (0, 2) or (2, 0), got (%d, %d)", minI, minJ)
+	}
+}
+
+func TestDistMatrixMaxDistance(t *testing.T) {
+	dm := NewDistMatrix(4)
+
+	dm.Set(0, 1, 2.5)
+	dm.Set(0, 2, 1.5)
+	dm.Set(0, 3, 3.5)
+	dm.Set(1, 2, 4.5)
+	dm.Set(1, 3, 5.5)
+	dm.Set(2, 3, 6.5) // maximum
+
+	maxDist, maxI, maxJ := dm.MaxDistance()
+
+	if math.Abs(maxDist-6.5) > 1e-10 {
+		t.Errorf("Expected max distance 6.5, got %f", maxDist)
+	}
+
+	if (maxI != 2 || maxJ != 3) && (maxI != 3 || maxJ != 2) {
+		t.Errorf("Expected max at (2, 3) or (3, 2), got (%d, %d)", maxI, maxJ)
+	}
+}
+
+func TestDistMatrixGetRow(t *testing.T) {
+	dm := NewDistMatrix(3)
+
+	dm.Set(0, 1, 1.0)
+	dm.Set(0, 2, 2.0)
+	dm.Set(1, 2, 3.0)
+
+	row0 := dm.GetRow(0)
+	expected0 := []float64{0.0, 1.0, 2.0}
+
+	for i, val := range expected0 {
+		if math.Abs(row0[i]-val) > 1e-10 {
+			t.Errorf("Row 0[%d]: expected %f, got %f", i, val, row0[i])
+		}
+	}
+
+	row1 := dm.GetRow(1)
+	expected1 := []float64{1.0, 0.0, 3.0}
+
+	for i, val := range expected1 {
+		if math.Abs(row1[i]-val) > 1e-10 {
+			t.Errorf("Row 1[%d]: expected %f, got %f", i, val, row1[i])
+		}
+	}
+}
+
+func TestDistMatrixCopy(t *testing.T) {
+	dm := NewDistMatrixWithLabels([]string{"A", "B", "C"})
+	dm.Set(0, 1, 1.5)
+	dm.Set(0, 2, 2.5)
+	dm.Set(1, 2, 3.5)
+
+	dmCopy := dm.Copy()
+
+	// Check values are copied
+	if dmCopy.Get(0, 1) != dm.Get(0, 1) {
+		t.Errorf("Copy has different value at (0, 1)")
+	}
+
+	// Check labels are copied
+	if dmCopy.GetLabel(0) != dm.GetLabel(0) {
+		t.Errorf("Copy has different label at index 0")
+	}
+
+	// Modify copy and ensure original unchanged
+	dmCopy.Set(0, 1, 99.9)
+	if dm.Get(0, 1) == 99.9 {
+		t.Errorf("Modifying copy affected original matrix")
+	}
+
+	dmCopy.SetLabel(0, "Modified")
+	if dm.GetLabel(0) == "Modified" {
+		t.Errorf("Modifying copy label affected original matrix")
+	}
+}
+
+func TestDistMatrixToFullMatrix(t *testing.T) {
+	dm := NewDistMatrix(3)
+	dm.Set(0, 1, 1.0)
+	dm.Set(0, 2, 2.0)
+	dm.Set(1, 2, 3.0)
+
+	full := dm.ToFullMatrix()
+
+	expected := [][]float64{
+		{0.0, 1.0, 2.0},
+		{1.0, 0.0, 3.0},
+		{2.0, 3.0, 0.0},
+	}
+
+	for i := 0; i < 3; i++ {
+		for j := 0; j < 3; j++ {
+			if math.Abs(full[i][j]-expected[i][j]) > 1e-10 {
+				t.Errorf("Full matrix[%d][%d]: expected %f, got %f",
+					i, j, expected[i][j], full[i][j])
+			}
+		}
+	}
+}
+
+func TestDistMatrixBoundsChecking(t *testing.T) {
+	dm := NewDistMatrix(3)
+
+	// Test Get out of bounds
+	testPanic := func(f func()) {
+		defer func() {
+			if r := recover(); r == nil {
+				t.Errorf("Expected panic, but didn't get one")
+			}
+		}()
+		f()
+	}
+
+	testPanic(func() { dm.Get(-1, 0) })
+	testPanic(func() { dm.Get(0, 3) })
+	testPanic(func() { dm.Set(3, 0, 1.0) })
+	testPanic(func() { dm.GetLabel(-1) })
+	testPanic(func() { dm.SetLabel(3, "Invalid") })
+	testPanic(func() { dm.GetRow(3) })
+}
+
+func TestDistMatrixEmptyMatrix(t *testing.T) {
+	dm := NewDistMatrix(0)
+
+	if dm.Size() != 0 {
+		t.Errorf("Expected size 0, got %d", dm.Size())
+	}
+
+	minDist, minI, minJ := dm.MinDistance()
+	if minDist != 0.0 || minI != -1 || minJ != -1 {
+		t.Errorf("Empty matrix MinDistance should return (0.0, -1, -1), got (%f, %d, %d)",
+			minDist, minI, minJ)
+	}
+
+	maxDist, maxI, maxJ := dm.MaxDistance()
+	if maxDist != 0.0 || maxI != -1 || maxJ != -1 {
+		t.Errorf("Empty matrix MaxDistance should return (0.0, -1, -1), got (%f, %d, %d)",
+			maxDist, maxI, maxJ)
+	}
+}
+
+func TestDistMatrixSingleElement(t *testing.T) {
+	dm := NewDistMatrix(1)
+
+	if dm.Size() != 1 {
+		t.Errorf("Expected size 1, got %d", dm.Size())
+	}
+
+	// Only element is diagonal (always 0)
+	if dm.Get(0, 0) != 0.0 {
+		t.Errorf("Expected 0.0 at (0, 0), got %f", dm.Get(0, 0))
+	}
+
+	minDist, minI, minJ := dm.MinDistance()
+	if minDist != 0.0 || minI != -1 || minJ != -1 {
+		t.Errorf("Single element matrix MinDistance should return (0.0, -1, -1), got (%f, %d, %d)",
+			minDist, minI, minJ)
+	}
+}
+
+func TestNewSimilarityMatrix(t *testing.T) {
+	sm := NewSimilarityMatrix(4)
+
+	if sm.Size() != 4 {
+		t.Errorf("Expected size 4, got %d", sm.Size())
+	}
+
+	// Check diagonal is 1.0
+	for i := 0; i < 4; i++ {
+		if sm.Get(i, i) != 1.0 {
+			t.Errorf("Expected diagonal element (%d, %d) to be 1.0, got %f", i, i, sm.Get(i, i))
+		}
+	}
+
+	// Check off-diagonal is 0.0
+	if sm.Get(0, 1) != 0.0 {
+		t.Errorf("Expected off-diagonal to be 0.0, got %f", sm.Get(0, 1))
+	}
+}
+
+func TestNewSimilarityMatrixWithLabels(t *testing.T) {
+	labels := []string{"A", "B", "C"}
+	sm := NewSimilarityMatrixWithLabels(labels)
+
+	if sm.Size() != 3 {
+		t.Errorf("Expected size 3, got %d", sm.Size())
+	}
+
+	// Check labels
+	for i, label := range labels {
+		if sm.GetLabel(i) != label {
+			t.Errorf("Expected label %s at index %d, got %s", label, i, sm.GetLabel(i))
+		}
+	}
+
+	// Check diagonal is 1.0
+	for i := 0; i < 3; i++ {
+		if sm.Get(i, i) != 1.0 {
+			t.Errorf("Expected diagonal element (%d, %d) to be 1.0, got %f", i, i, sm.Get(i, i))
+		}
+	}
+
+	// Set some similarities
+	sm.Set(0, 1, 0.8)
+	sm.Set(0, 2, 0.6)
+	sm.Set(1, 2, 0.7)
+
+	// Check values
+	if math.Abs(sm.Get(0, 1)-0.8) > 1e-10 {
+		t.Errorf("Expected 0.8 at (0, 1), got %f", sm.Get(0, 1))
+	}
+
+	if math.Abs(sm.Get(1, 0)-0.8) > 1e-10 {
+		t.Errorf("Expected 0.8 at (1, 0) (symmetry), got %f", sm.Get(1, 0))
+	}
+}
+
+func TestSimilarityMatrixCopy(t *testing.T) {
+	sm := NewSimilarityMatrix(3)
+	sm.Set(0, 1, 0.9)
+	sm.Set(0, 2, 0.7)
+
+	smCopy := sm.Copy()
+
+	// Check diagonal is preserved
+	if smCopy.Get(0, 0) != 1.0 {
+		t.Errorf("Copied similarity matrix should have diagonal 1.0, got %f", smCopy.Get(0, 0))
+	}
+
+	// Check values are preserved
+	if math.Abs(smCopy.Get(0, 1)-0.9) > 1e-10 {
+		t.Errorf("Copy should preserve values, expected 0.9, got %f", smCopy.Get(0, 1))
+	}
+
+	// Modify copy and ensure original unchanged
+	smCopy.Set(0, 1, 0.5)
+	if math.Abs(sm.Get(0, 1)-0.9) > 1e-10 {
+		t.Errorf("Modifying copy should not affect original, expected 0.9, got %f", sm.Get(0, 1))
+	}
+}

pkg/obikmer/encodefourmer.go

@@ -5,6 +5,11 @@ import (
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
 )
 
+// __single_base_code__ encodes DNA bases to 2-bit values.
+// Standard bases: A=0, C=1, G=2, T/U=3
+// Ambiguous bases (N, R, Y, W, S, K, M, B, D, H, V) and other characters: encoded as 0 (A)
+// Note: For error detection with ambiguous bases, use __single_base_code_err__ in encodekmer.go
+
 var __single_base_code__ = []byte{0,
 	//     A,  B,  C,  D,
 	0, 0, 1, 0,

pkg/obikmer/encodekmer.go

@@ -0,0 +1,903 @@
+package obikmer
+
+import "iter"
+
+var __single_base_code_err__ = []byte{0,
+	//     A,     B,     C,     D,
+	0, 0xFF, 1, 0xFF,
+	//     E,     F,     G,     H,
+	0xFF, 0xFF, 2, 0xFF,
+	//     I,     J,     K,     L,
+	0xFF, 0xFF, 0xFF, 0xFF,
+	//     M,     N,     O,     P,
+	0xFF, 0xFF, 0xFF, 0xFF,
+	//     Q,     R,     S,     T,
+	0xFF, 0xFF, 0xFF, 3,
+	//     U,     V,     W,     X,
+	3, 0xFF, 0xFF, 0xFF,
+	//     Y,     Z,     .,     .
+	0xFF, 0xFF, 0xFF, 0xFF,
+	0xFF, 0xFF, 0xFF,
+}
+
+const ambiguousBaseCode = byte(0xFF)
+
+// Error markers for k-mers of odd length ≤ 31
+// For odd k ≤ 31, only k*2 bits are used (max 62 bits), leaving 2 high bits
+// available for error coding in the top 2 bits (bits 62-63).
+//
+// Error codes are simple integers:
+//
+//	0 = no error
+//	1 = error type 1
+//	2 = error type 2
+//	3 = error type 3
+//
+// Use SetKmerError(kmer, code) and GetKmerError(kmer) to manipulate error bits.
+const (
+	KmerErrorMask    uint64 = 0b11 << 62     // Mask to extract error bits (bits 62-63)
+	KmerSequenceMask uint64 = ^KmerErrorMask // Mask to extract sequence bits (bits 0-61)
+)
+
+// SetKmerError sets the error marker bits on a k-mer encoded value.
+// Only valid for odd k-mer sizes ≤ 31 where 2 bits remain unused.
+//
+// Parameters:
+//   - kmer: the encoded k-mer value
+//   - errorCode: error code (0-3), where 0=no error, 1-3=error types
+//
+// Returns:
+//   - k-mer with error bits set
+func SetKmerError(kmer uint64, errorCode uint64) uint64 {
+	return (kmer & KmerSequenceMask) | ((errorCode & 0b11) << 62)
+}
+
+// GetKmerError extracts the error marker bits from a k-mer encoded value.
+//
+// Returns:
+//   - error code (0-3) as raw value (not shifted)
+func GetKmerError(kmer uint64) uint64 {
+	return (kmer & KmerErrorMask) >> 62
+}
+
+// ClearKmerError removes the error marker bits from a k-mer, returning
+// just the sequence encoding.
+//
+// Returns:
+//   - k-mer with error bits cleared (set to 00)
+func ClearKmerError(kmer uint64) uint64 {
+	return kmer & KmerSequenceMask
+}
+
+// EncodeKmer encodes a single k-mer sequence to uint64.
+// This is the optimal zero-allocation function for encoding a single k-mer.
+//
+// Each nucleotide is encoded on 2 bits according to __single_base_code__:
+//   - A = 0 (00)
+//   - C = 1 (01)
+//   - G = 2 (10)
+//   - T/U = 3 (11)
+//
+// The maximum k-mer size is 31 (using 62 bits), leaving the top 2 bits
+// available for error markers if needed.
+//
+// Parameters:
+//   - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
+//   - k: k-mer size (must be between 1 and 31)
+//
+// Returns:
+//   - encoded k-mer as uint64
+//   - panics if len(seq) != k or k is invalid
+//
+// Example:
+//
+//	kmer := EncodeKmer([]byte("ACGT"), 4)
+func EncodeKmer(seq []byte, k int) uint64 {
+	if k < 1 || k > 31 {
+		panic("k must be between 1 and 31")
+	}
+	if len(seq) != k {
+		panic("sequence length must equal k")
+	}
+
+	var kmer uint64
+	for i := 0; i < k; i++ {
+		kmer <<= 2
+		kmer |= uint64(__single_base_code__[seq[i]&31])
+	}
+	return kmer
+}
+
+// EncodeCanonicalKmer encodes a single k-mer sequence to its canonical form (uint64).
+// Returns the lexicographically smaller of the k-mer and its reverse complement.
+// This is the optimal zero-allocation function for encoding a single canonical k-mer.
+//
+// Parameters:
+//   - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
+//   - k: k-mer size (must be between 1 and 31)
+//
+// Returns:
+//   - canonical k-mer as uint64
+//   - panics if len(seq) != k or k is invalid
+//
+// Example:
+//
+//	canonical := EncodeCanonicalKmer([]byte("ACGT"), 4)
+func EncodeCanonicalKmer(seq []byte, k int) uint64 {
+	if k < 1 || k > 31 {
+		panic("k must be between 1 and 31")
+	}
+	if len(seq) != k {
+		panic("sequence length must equal k")
+	}
+
+	rcShift := uint((k - 1) * 2)
+
+	var fwd, rvc uint64
+	for i := 0; i < k; i++ {
+		code := uint64(__single_base_code__[seq[i]&31])
+		fwd <<= 2
+		fwd |= code
+		rvc >>= 2
+		rvc |= (code ^ 3) << rcShift
+	}
+
+	if fwd <= rvc {
+		return fwd
+	}
+	return rvc
+}
+
+// DecodeKmer decodes a uint64 k-mer back to a DNA sequence.
+// This function reuses a provided buffer to avoid allocation.
+//
+// Parameters:
+//   - kmer: encoded k-mer as uint64
+//   - k: k-mer size (number of nucleotides)
+//   - buffer: pre-allocated buffer of length >= k (if nil, allocates new slice)
+//
+// Returns:
+//   - decoded DNA sequence as []byte (lowercase acgt)
+//
+// Example:
+//
+//	var buf [32]byte
+//	seq := DecodeKmer(kmer, 21, buf[:])
+func DecodeKmer(kmer uint64, k int, buffer []byte) []byte {
+	var result []byte
+	if buffer == nil || len(buffer) < k {
+		result = make([]byte, k)
+	} else {
+		result = buffer[:k]
+	}
+
+	bases := [4]byte{'a', 'c', 'g', 't'}
+	for i := k - 1; i >= 0; i-- {
+		result[i] = bases[kmer&3]
+		kmer >>= 2
+	}
+	return result
+}
+
+// EncodeKmers converts a DNA sequence to a slice of encoded k-mers.
+// Each nucleotide is encoded on 2 bits according to __single_base_code__:
+//   - A = 0 (00)
+//   - C = 1 (01)
+//   - G = 2 (10)
+//   - T/U = 3 (11)
+//
+// The function returns overlapping k-mers of size k encoded as uint64.
+// For a sequence of length n, it returns n-k+1 k-mers.
+//
+// The maximum k-mer size is 31 (using 62 bits), leaving the top 2 bits
+// available for error markers (see SetKmerError).
+//
+// Parameters:
+//   - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
+//   - k: k-mer size (must be between 1 and 31)
+//   - buffer: optional pre-allocated buffer for results. If nil, a new slice is created.
+//
+// Returns:
+//   - slice of uint64 encoded k-mers
+//   - nil if sequence is shorter than k or k is invalid
+func EncodeKmers(seq []byte, k int, buffer *[]uint64) []uint64 {
+	if k < 1 || k > 31 || len(seq) < k {
+		return nil
+	}
+
+	var result []uint64
+	if buffer == nil {
+		result = make([]uint64, 0, len(seq)-k+1)
+	} else {
+		result = (*buffer)[:0]
+	}
+
+	for kmer := range IterKmers(seq, k) {
+		result = append(result, kmer)
+	}
+
+	return result
+}
+
+// IterKmers returns an iterator over all k-mers in the sequence.
+// No intermediate slice is allocated, making it memory-efficient for
+// processing k-mers one by one (e.g., adding to a Roaring Bitmap).
+//
+// Parameters:
+//   - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
+//   - k: k-mer size (must be between 1 and 31)
+//
+// Returns:
+//   - iterator yielding uint64 encoded k-mers
+//
+// Example:
+//
+//	for kmer := range IterKmers(seq, 21) {
+//	    bitmap.Add(kmer)
+//	}
+func IterKmers(seq []byte, k int) iter.Seq[uint64] {
+	return func(yield func(uint64) bool) {
+		if k < 1 || k > 31 || len(seq) < k {
+			return
+		}
+
+		mask := uint64(1)<<(k*2) - 1
+
+		var kmer uint64
+		for i := 0; i < k; i++ {
+			kmer <<= 2
+			kmer |= uint64(__single_base_code__[seq[i]&31])
+		}
+
+		if !yield(kmer) {
+			return
+		}
+
+		for i := k; i < len(seq); i++ {
+			kmer <<= 2
+			kmer |= uint64(__single_base_code__[seq[i]&31])
+			kmer &= mask
+
+			if !yield(kmer) {
+				return
+			}
+		}
+	}
+}
+
+// IterCanonicalKmersWithErrors returns an iterator over all canonical k-mers
+// with error markers for ambiguous bases. No intermediate slice is allocated.
+//
+// Ambiguous bases (N, R, Y, W, S, K, M, B, D, H, V) are encoded as 0xFF and detected
+// during k-mer construction. The error code in bits 62-63 indicates the number of
+// ambiguous bases in each k-mer (0=clean, 1-3=error count).
+//
+// Only valid for odd k ≤ 31 where 2 bits remain unused for error markers.
+//
+// Parameters:
+//   - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U, and ambiguous bases)
+//   - k: k-mer size (must be odd, between 1 and 31)
+//
+// Returns:
+//   - iterator yielding uint64 canonical k-mers with error markers
+//
+// Example:
+//
+//	for kmer := range IterCanonicalKmersWithErrors(seq, 21) {
+//	    if GetKmerError(kmer) == 0 {
+//	        bitmap.Add(kmer) // Only add clean k-mers
+//	    }
+//	}
+func IterCanonicalKmersWithErrors(seq []byte, k int) iter.Seq[uint64] {
+	return func(yield func(uint64) bool) {
+		if k < 1 || k > 31 || k%2 == 0 || len(seq) < k {
+			return
+		}
+
+		mask := uint64(1)<<(k*2) - 1
+
+		rcShift := uint((k - 1) * 2)
+
+		ambiguousCount := 0
+		const ambiguousCode = byte(0xFF)
+
+		var fwd, rvc uint64
+		hasError := false
+		for i := 0; i < k; i++ {
+			code := __single_base_code_err__[seq[i]&31]
+
+			if code == ambiguousCode {
+				ambiguousCount++
+				hasError = true
+				code = 0
+			}
+
+			codeUint := uint64(code)
+			fwd <<= 2
+			fwd |= codeUint
+			rvc >>= 2
+			rvc |= (codeUint ^ 3) << rcShift
+		}
+
+		var canonical uint64
+		if fwd <= rvc {
+			canonical = fwd
+		} else {
+			canonical = rvc
+		}
+
+		if hasError {
+			errorCode := uint64(ambiguousCount)
+			if errorCode > 3 {
+				errorCode = 3
+			}
+			canonical = SetKmerError(canonical, errorCode)
+		}
+
+		if !yield(canonical) {
+			return
+		}
+
+		for i := k; i < len(seq); i++ {
+			outgoingCode := __single_base_code_err__[seq[i-k]&31]
+			if outgoingCode == ambiguousCode {
+				ambiguousCount--
+			}
+
+			code := __single_base_code_err__[seq[i]&31]
+			if code == ambiguousCode {
+				ambiguousCount++
+				code = 0
+			}
+
+			codeUint := uint64(code)
+
+			fwd <<= 2
+			fwd |= codeUint
+			fwd &= mask
+
+			rvc >>= 2
+			rvc |= (codeUint ^ 3) << rcShift
+
+			if fwd <= rvc {
+				canonical = fwd
+			} else {
+				canonical = rvc
+			}
+
+			if ambiguousCount > 0 {
+				errorCode := uint64(ambiguousCount)
+				if errorCode > 3 {
+					errorCode = 3
+				}
+				canonical = SetKmerError(canonical, errorCode)
+			}
+
+			if !yield(canonical) {
+				return
+			}
+		}
+	}
+}
+
+// IterCanonicalKmers returns an iterator over all canonical k-mers.
+// No intermediate slice is allocated, making it memory-efficient.
+//
+// Parameters:
+//   - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
+//   - k: k-mer size (must be between 1 and 31)
+//
+// Returns:
+//   - iterator yielding uint64 canonical k-mers
+//
+// Example:
+//
+//	for canonical := range IterCanonicalKmers(seq, 21) {
+//	    bitmap.Add(canonical)
+//	}
+func IterCanonicalKmers(seq []byte, k int) iter.Seq[uint64] {
+	return func(yield func(uint64) bool) {
+		if k < 1 || k > 31 || len(seq) < k {
+			return
+		}
+
+		mask := uint64(1)<<(k*2) - 1
+
+		rcShift := uint((k - 1) * 2)
+
+		var fwd, rvc uint64
+		for i := 0; i < k; i++ {
+			code := uint64(__single_base_code__[seq[i]&31])
+			fwd <<= 2
+			fwd |= code
+			rvc >>= 2
+			rvc |= (code ^ 3) << rcShift
+		}
+
+		var canonical uint64
+		if fwd <= rvc {
+			canonical = fwd
+		} else {
+			canonical = rvc
+		}
+
+		if !yield(canonical) {
+			return
+		}
+
+		for i := k; i < len(seq); i++ {
+			code := uint64(__single_base_code__[seq[i]&31])
+
+			fwd <<= 2
+			fwd |= code
+			fwd &= mask
+
+			rvc >>= 2
+			rvc |= (code ^ 3) << rcShift
+
+			if fwd <= rvc {
+				canonical = fwd
+			} else {
+				canonical = rvc
+			}
+
+			if !yield(canonical) {
+				return
+			}
+		}
+	}
+}
+
+// SuperKmer represents a maximal subsequence where all consecutive k-mers
+// share the same minimizer. A minimizer is the smallest canonical m-mer
+// among the (k-m+1) m-mers contained in a k-mer.
+type SuperKmer struct {
+	Minimizer uint64 // The canonical minimizer value (normalized m-mer)
+	Start     int    // Starting position in the original sequence (0-indexed)
+	End       int    // Ending position (exclusive, like Go slice notation)
+	Sequence  []byte // The actual DNA subsequence [Start:End]
+}
+
+// dequeItem represents an element in the monotone deque used for
+// tracking minimizers in a sliding window.
+type dequeItem struct {
+	position  int    // Position of the m-mer in the sequence
+	canonical uint64 // Canonical (normalized) m-mer value
+}
+
+// ExtractSuperKmers extracts super k-mers from a DNA sequence.
+// A super k-mer is a maximal subsequence where all consecutive k-mers
+// share the same minimizer. The minimizer of a k-mer is the smallest
+// canonical m-mer among its (k-m+1) constituent m-mers.
+//
+// The algorithm uses:
+// - Simultaneous forward/reverse m-mer encoding for O(1) canonical m-mer computation
+// - Monotone deque for O(1) amortized minimizer tracking per position
+//
+// The maximum k-mer size is 31 (using 62 bits), leaving the top 2 bits
+// available for error markers if needed.
+//
+// Parameters:
+//   - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
+//   - k: k-mer size (must be between m+1 and 31)
+//   - m: minimizer size (must be between 1 and k-1)
+//   - buffer: optional pre-allocated buffer for results. If nil, a new slice is created.
+//
+// Returns:
+//   - slice of SuperKmer structs representing maximal subsequences
+//   - nil if parameters are invalid or sequence is too short
+//
+// Time complexity: O(n) where n is the sequence length
+// Space complexity: O(k-m+1) for the deque + O(number of super k-mers) for results
+func ExtractSuperKmers(seq []byte, k int, m int, buffer *[]SuperKmer) []SuperKmer {
+	if m < 1 || m >= k || k < 2 || k > 31 || len(seq) < k {
+		return nil
+	}
+
+	var result []SuperKmer
+	if buffer == nil {
+		estimatedSize := len(seq) / k
+		if estimatedSize < 1 {
+			estimatedSize = 1
+		}
+		result = make([]SuperKmer, 0, estimatedSize)
+	} else {
+		result = (*buffer)[:0]
+	}
+
+	deque := make([]dequeItem, 0, k-m+1)
+
+	mMask := uint64(1)<<(m*2) - 1
+	rcShift := uint((m - 1) * 2)
+
+	var fwdMmer, rvcMmer uint64
+	for i := 0; i < m-1 && i < len(seq); i++ {
+		code := uint64(__single_base_code__[seq[i]&31])
+		fwdMmer = (fwdMmer << 2) | code
+		rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
+	}
+
+	superKmerStart := 0
+	var currentMinimizer uint64
+	firstKmer := true
+
+	for pos := m - 1; pos < len(seq); pos++ {
+		code := uint64(__single_base_code__[seq[pos]&31])
+		fwdMmer = ((fwdMmer << 2) | code) & mMask
+		rvcMmer = (rvcMmer >> 2) | ((code ^ 3) << rcShift)
+
+		canonical := fwdMmer
+		if rvcMmer < fwdMmer {
+			canonical = rvcMmer
+		}
+
+		mmerPos := pos - m + 1
+
+		if pos >= k-1 {
+			windowStart := pos - k + 1
+			for len(deque) > 0 && deque[0].position < windowStart {
+				deque = deque[1:]
+			}
+		}
+
+		for len(deque) > 0 && deque[len(deque)-1].canonical >= canonical {
+			deque = deque[:len(deque)-1]
+		}
+
+		deque = append(deque, dequeItem{position: mmerPos, canonical: canonical})
+
+		if pos >= k-1 {
+			newMinimizer := deque[0].canonical
+			kmerStart := pos - k + 1
+
+			if firstKmer {
+				currentMinimizer = newMinimizer
+				firstKmer = false
+			} else if newMinimizer != currentMinimizer {
+				endPos := kmerStart + k - 1
+				superKmer := SuperKmer{
+					Minimizer: currentMinimizer,
+					Start:     superKmerStart,
+					End:       endPos,
+					Sequence:  seq[superKmerStart:endPos],
+				}
+				result = append(result, superKmer)
+
+				superKmerStart = kmerStart
+				currentMinimizer = newMinimizer
+			}
+		}
+	}
+
+	if !firstKmer {
+		superKmer := SuperKmer{
+			Minimizer: currentMinimizer,
+			Start:     superKmerStart,
+			End:       len(seq),
+			Sequence:  seq[superKmerStart:],
+		}
+		result = append(result, superKmer)
+	}
+
+	return result
+}
+
+// ReverseComplement computes the reverse complement of an encoded k-mer.
+// The k-mer is encoded with 2 bits per nucleotide (A=00, C=01, G=10, T=11).
+// The complement is: A↔T (00↔11), C↔G (01↔10), which is simply XOR with 11.
+// The reverse swaps the order of 2-bit pairs.
+//
+// For k-mers with error markers (top 2 bits), the error bits are preserved
+// and transferred to the reverse complement.
+//
+// Parameters:
+//   - kmer: the encoded k-mer (possibly with error bits in positions 62-63)
+//   - k: the k-mer size (number of nucleotides)
+//
+// Returns:
+//   - the reverse complement of the k-mer with error bits preserved
+func ReverseComplement(kmer uint64, k int) uint64 {
+	errorBits := kmer & KmerErrorMask
+
+	mask := uint64(1)<<(k*2) - 1
+	rc := (^kmer) & mask
+
+	rc = ((rc & 0x3333333333333333) << 2) | ((rc & 0xCCCCCCCCCCCCCCCC) >> 2)
+	rc = ((rc & 0x0F0F0F0F0F0F0F0F) << 4) | ((rc & 0xF0F0F0F0F0F0F0F0) >> 4)
+	rc = ((rc & 0x00FF00FF00FF00FF) << 8) | ((rc & 0xFF00FF00FF00FF00) >> 8)
+	rc = ((rc & 0x0000FFFF0000FFFF) << 16) | ((rc & 0xFFFF0000FFFF0000) >> 16)
+	rc = (rc << 32) | (rc >> 32)
+
+	rc >>= (64 - k*2)
+
+	rc |= errorBits
+
+	return rc
+}
+
+// CanonicalKmer returns the lexicographically smaller of a k-mer and its
+// reverse complement. This canonical form ensures that a k-mer and its
+// reverse complement map to the same value.
+//
+// This implements REVERSE COMPLEMENT canonicalization (biological canonical form).
+//
+// Parameters:
+//   - kmer: the encoded k-mer
+//   - k: the k-mer size (number of nucleotides)
+//
+// Returns:
+//   - the canonical k-mer
+func CanonicalKmer(kmer uint64, k int) uint64 {
+	rc := ReverseComplement(kmer, k)
+	if rc < kmer {
+		return rc
+	}
+	return kmer
+}
+
+// NormalizeCircular returns the lexicographically smallest circular rotation
+// of a k-mer. This is used for entropy calculations in low-complexity masking.
+//
+// This implements CIRCULAR PERMUTATION normalization (rotation-based canonicalization).
+// Example: ACGT → min(ACGT, CGTA, GTAC, TACG) by circular rotation
+//
+// This is DIFFERENT from NormalizeKmer which uses reverse complement.
+//
+// Parameters:
+//   - kmer: the encoded k-mer
+//   - k: the k-mer size (number of nucleotides)
+//
+// Returns:
+//   - the lexicographically smallest circular rotation
+//
+// Time complexity: O(k) - checks all k rotations
+func NormalizeCircular(kmer uint64, k int) uint64 {
+	if k < 1 || k > 31 {
+		return kmer
+	}
+
+	mask := uint64(1)<<(k*2) - 1
+	canonical := kmer
+	current := kmer
+
+	// Try all k rotations
+	for i := 0; i < k; i++ {
+		// Rotate: take top 2 bits, shift left, add to bottom
+		top := (current >> ((k - 1) * 2)) & 3
+		current = ((current << 2) | top) & mask
+
+		if current < canonical {
+			canonical = current
+		}
+	}
+
+	return canonical
+}
+
+// EncodeCircularCanonicalKmer encodes a k-mer and returns its lexicographically
+// smallest circular rotation. This is optimized for single k-mer encoding with
+// circular canonicalization.
+//
+// This implements CIRCULAR PERMUTATION canonicalization, used for entropy-based
+// low-complexity masking. This is DIFFERENT from EncodeCanonicalKmer which
+// uses reverse complement canonicalization.
+//
+// Parameters:
+//   - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
+//   - k: k-mer size (must be between 1 and 31)
+//
+// Returns:
+//   - canonical k-mer as uint64 (smallest circular rotation)
+//   - panics if len(seq) != k or k is invalid
+//
+// Example:
+//
+//	canonical := EncodeCircularCanonicalKmer([]byte("ACGT"), 4)
+func EncodeCircularCanonicalKmer(seq []byte, k int) uint64 {
+	kmer := EncodeKmer(seq, k)
+	return NormalizeCircular(kmer, k)
+}
+
+// CanonicalCircularKmerCount returns the number of unique canonical k-mers
+// under circular permutation normalization for DNA sequences (4-letter alphabet).
+//
+// This counts equivalence classes where k-mers are considered the same if one
+// is a circular rotation of another (e.g., "ACGT", "CGTA", "GTAC", "TACG" are
+// all equivalent).
+//
+// Uses Moreau's necklace-counting formula for exact counts:
+//
+//	N(n, a) = (1/n) * Σ φ(d) * a^(n/d)
+//
+// where the sum is over all divisors d of n, and φ is Euler's totient function.
+//
+// Parameters:
+//   - k: k-mer size
+//
+// Returns:
+//   - number of unique canonical k-mers under circular rotation
+//
+// Example:
+//
+//	count := CanonicalCircularKmerCount(4) // Returns 70 (not 256)
+func CanonicalCircularKmerCount(k int) int {
+	// Hardcoded exact counts for k=1 to 6 (optimization)
+	switch k {
+	case 1:
+		return 4
+	case 2:
+		return 10
+	case 3:
+		return 24
+	case 4:
+		return 70
+	case 5:
+		return 208
+	case 6:
+		return 700
+	default:
+		// For k>6, use Moreau's necklace-counting formula
+		return necklaceCount(k, 4)
+	}
+}
+
+// eulerTotient computes Euler's totient function φ(n), which counts
+// the number of integers from 1 to n that are coprime with n.
+func eulerTotient(n int) int {
+	if n <= 0 {
+		return 0
+	}
+
+	result := n
+
+	// Process all prime factors
+	for p := 2; p*p <= n; p++ {
+		if n%p == 0 {
+			// Remove all occurrences of p
+			for n%p == 0 {
+				n /= p
+			}
+			// Apply: φ(n) = n * (1 - 1/p) = n * (p-1)/p
+			result -= result / p
+		}
+	}
+
+	// If n is still greater than 1, then it's a prime factor
+	if n > 1 {
+		result -= result / n
+	}
+
+	return result
+}
+
+// divisors returns all divisors of n in ascending order.
+func divisors(n int) []int {
+	if n <= 0 {
+		return []int{}
+	}
+
+	divs := []int{}
+	for i := 1; i*i <= n; i++ {
+		if n%i == 0 {
+			divs = append(divs, i)
+			if i != n/i {
+				divs = append(divs, n/i)
+			}
+		}
+	}
+
+	// Bubble sort in ascending order
+	for i := 0; i < len(divs)-1; i++ {
+		for j := i + 1; j < len(divs); j++ {
+			if divs[i] > divs[j] {
+				divs[i], divs[j] = divs[j], divs[i]
+			}
+		}
+	}
+
+	return divs
+}
+
+// necklaceCount computes the number of distinct necklaces (equivalence classes
+// under rotation) for sequences of length n over an alphabet of size a.
+// Uses Moreau's necklace-counting formula:
+//
+//	N(n, a) = (1/n) * Σ φ(d) * a^(n/d)
+//
+// where the sum is over all divisors d of n, and φ is Euler's totient function.
+func necklaceCount(n, alphabetSize int) int {
+	if n <= 0 {
+		return 0
+	}
+
+	divs := divisors(n)
+	sum := 0
+
+	for _, d := range divs {
+		// Compute a^(n/d)
+		power := 1
+		exp := n / d
+		for i := 0; i < exp; i++ {
+			power *= alphabetSize
+		}
+
+		sum += eulerTotient(d) * power
+	}
+
+	return sum / n
+}
+
+// EncodeCanonicalKmersWithErrors converts a DNA sequence to a slice of canonical k-mers
+// with error markers for ambiguous bases (N, R, Y, W, S, K, M, B, D, H, V).
+//
+// Ambiguous bases are encoded as 0xFF by __single_base_code__ and detected during
+// k-mer construction. The error code in bits 62-63 indicates the number of ambiguous
+// bases in each k-mer:
+//   - errorCode 0: no ambiguous bases (clean k-mer)
+//   - errorCode 1: 1 ambiguous base
+//   - errorCode 2: 2 ambiguous bases
+//   - errorCode 3: 3 or more ambiguous bases
+//
+// Only valid for odd k ≤ 31 where 2 bits remain unused for error markers.
+//
+// Parameters:
+//   - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U, and ambiguous bases)
+//   - k: k-mer size (must be odd, between 1 and 31)
+//   - buffer: optional pre-allocated buffer for results. If nil, a new slice is created.
+//
+// Returns:
+//   - slice of uint64 canonical k-mers with error markers
+//   - nil if sequence is shorter than k, k is invalid, or k is even
+func EncodeCanonicalKmersWithErrors(seq []byte, k int, buffer *[]uint64) []uint64 {
+	if k < 1 || k > 31 || k%2 == 0 || len(seq) < k {
+		return nil
+	}
+
+	var result []uint64
+	if buffer == nil {
+		result = make([]uint64, 0, len(seq)-k+1)
+	} else {
+		result = (*buffer)[:0]
+	}
+
+	for kmer := range IterCanonicalKmersWithErrors(seq, k) {
+		result = append(result, kmer)
+	}
+
+	return result
+}
+
+// EncodeCanonicalKmers converts a DNA sequence to a slice of canonical k-mers.
+// Each k-mer is replaced by the lexicographically smaller of itself and its
+// reverse complement. This ensures that forward and reverse complement sequences
+// produce the same k-mer set.
+//
+// The maximum k-mer size is 31 (using 62 bits), leaving the top 2 bits
+// available for error markers (see SetKmerError).
+//
+// Parameters:
+//   - seq: DNA sequence as a byte slice (case insensitive, supports A, C, G, T, U)
+//   - k: k-mer size (must be between 1 and 31)
+//   - buffer: optional pre-allocated buffer for results. If nil, a new slice is created.
+//
+// Returns:
+//   - slice of uint64 canonical k-mers
+//   - nil if sequence is shorter than k or k is invalid
+func EncodeCanonicalKmers(seq []byte, k int, buffer *[]uint64) []uint64 {
+	if k < 1 || k > 31 || len(seq) < k {
+		return nil
+	}
+
+	var result []uint64
+	if buffer == nil {
+		result = make([]uint64, 0, len(seq)-k+1)
+	} else {
+		result = (*buffer)[:0]
+	}
+
+	for kmer := range IterCanonicalKmers(seq, k) {
+		result = append(result, kmer)
+	}
+
+	return result
+}

pkg/obikmer/frequency_filter.go

@@ -0,0 +1,310 @@
+package obikmer
+
+import (
+	"fmt"
+
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
+)
+
+// FrequencyFilter filters k-mers by minimum frequency
+// Specialization of KmerSetGroup where index[i] contains k-mers seen at least i+1 times
+type FrequencyFilter struct {
+	*KmerSetGroup          // Group of KmerSet (one per frequency level)
+	MinFreq       int      // v - minimum required frequency
+}
+
+// NewFrequencyFilter creates a new frequency filter
+// minFreq: minimum number d'occurrences required (v)
+func NewFrequencyFilter(k, minFreq int) *FrequencyFilter {
+	ff := &FrequencyFilter{
+		KmerSetGroup: NewKmerSetGroup(k, minFreq),
+		MinFreq:      minFreq,
+	}
+
+	// Initialize group metadata
+	ff.SetAttribute("type", "FrequencyFilter")
+	ff.SetAttribute("min_freq", minFreq)
+
+	// Initialize metadata for each level
+	for i := 0; i < minFreq; i++ {
+		level := ff.Get(i)
+		level.SetAttribute("level", i)
+		level.SetAttribute("min_occurrences", i+1)
+		level.SetId(fmt.Sprintf("level_%d", i))
+	}
+
+	return ff
+}
+
+// AddSequence adds all k-mers from a sequence to the filter
+// Uses an iterator to avoid allocating an intermediate vector
+func (ff *FrequencyFilter) AddSequence(seq *obiseq.BioSequence) {
+	rawSeq := seq.Sequence()
+	for canonical := range IterCanonicalKmers(rawSeq, ff.K()) {
+		ff.AddKmerCode(canonical)
+	}
+}
+
+// AddKmerCode adds an encoded k-mer to the filter (main algorithm)
+func (ff *FrequencyFilter) AddKmerCode(kmer uint64) {
+	// Find the current level of the k-mer
+	c := 0
+	for c < ff.MinFreq && ff.Get(c).Contains(kmer) {
+		c++
+	}
+
+	// Add to next level (if not yet at maximum)
+	if c < ff.MinFreq {
+		ff.Get(c).AddKmerCode(kmer)
+	}
+}
+
+// AddCanonicalKmerCode adds an encoded canonical k-mer to the filter
+func (ff *FrequencyFilter) AddCanonicalKmerCode(kmer uint64) {
+	canonical := CanonicalKmer(kmer, ff.K())
+	ff.AddKmerCode(canonical)
+}
+
+// AddKmer adds a k-mer to the filter by encoding the sequence
+// The sequence must have exactly k nucleotides
+// Zero-allocation: encodes directly without creating an intermediate slice
+func (ff *FrequencyFilter) AddKmer(seq []byte) {
+	kmer := EncodeKmer(seq, ff.K())
+	ff.AddKmerCode(kmer)
+}
+
+// AddCanonicalKmer adds a canonical k-mer to the filter by encoding the sequence
+// The sequence must have exactly k nucleotides
+// Zero-allocation: encodes directly in canonical form without creating an intermediate slice
+func (ff *FrequencyFilter) AddCanonicalKmer(seq []byte) {
+	canonical := EncodeCanonicalKmer(seq, ff.K())
+	ff.AddKmerCode(canonical)
+}
+
+// GetFilteredSet returns a KmerSet of k-mers with frequency ≥ minFreq
+func (ff *FrequencyFilter) GetFilteredSet() *KmerSet {
+	// Filtered k-mers are in the last level
+	return ff.Get(ff.MinFreq - 1).Copy()
+}
+
+// GetKmersAtLevel returns a KmerSet of k-mers seen at least (level+1) times
+// level doit être dans [0, minFreq-1]
+func (ff *FrequencyFilter) GetKmersAtLevel(level int) *KmerSet {
+	ks := ff.Get(level)
+	if ks == nil {
+		return NewKmerSet(ff.K())
+	}
+	return ks.Copy()
+}
+
+// Stats returns statistics on frequency levels
+func (ff *FrequencyFilter) Stats() FrequencyFilterStats {
+	stats := FrequencyFilterStats{
+		MinFreq: ff.MinFreq,
+		Levels:  make([]LevelStats, ff.MinFreq),
+	}
+
+	for i := 0; i < ff.MinFreq; i++ {
+		ks := ff.Get(i)
+		card := ks.Len()
+		sizeBytes := ks.MemoryUsage()
+
+		stats.Levels[i] = LevelStats{
+			Level:       i + 1, // Level 1 = freq ≥ 1
+			Cardinality: card,
+			SizeBytes:   sizeBytes,
+		}
+
+		stats.TotalBytes += sizeBytes
+	}
+
+	// The last level contains the result
+	stats.FilteredKmers = stats.Levels[ff.MinFreq-1].Cardinality
+
+	return stats
+}
+
+// FrequencyFilterStats contains the filter statistics
+type FrequencyFilterStats struct {
+	MinFreq       int
+	FilteredKmers uint64      // K-mers with freq ≥ minFreq
+	TotalBytes    uint64      // Total memory used
+	Levels        []LevelStats
+}
+
+// LevelStats contains the stats of a level
+type LevelStats struct {
+	Level       int    // freq ≥ Level
+	Cardinality uint64 // Number of k-mers
+	SizeBytes   uint64 // Size in bytes
+}
+
+func (ffs FrequencyFilterStats) String() string {
+	result := fmt.Sprintf(`Frequency Filter Statistics (minFreq=%d):
+  Filtered k-mers (freq≥%d): %d
+  Total memory: %.2f MB
+
+Level breakdown:
+`, ffs.MinFreq, ffs.MinFreq, ffs.FilteredKmers, float64(ffs.TotalBytes)/1024/1024)
+
+	for _, level := range ffs.Levels {
+		result += fmt.Sprintf("  freq≥%d: %d k-mers (%.2f MB)\n",
+			level.Level,
+			level.Cardinality,
+			float64(level.SizeBytes)/1024/1024)
+	}
+
+	return result
+}
+
+// Clear libère la mémoire de tous les niveaux
+// (héritée de KmerSetGroup mais redéfinie pour clarté)
+func (ff *FrequencyFilter) Clear() {
+	ff.KmerSetGroup.Clear()
+}
+
+// ==================================
+// BATCH PROCESSING
+// ==================================
+
+// AddSequences adds multiple sequences in batch
+func (ff *FrequencyFilter) AddSequences(sequences *obiseq.BioSequenceSlice) {
+	for _, seq := range *sequences {
+		ff.AddSequence(seq)
+	}
+}
+
+// ==================================
+// PERSISTANCE
+// ==================================
+
+// Save sauvegarde le FrequencyFilter dans un répertoire
+// Utilise le format de sérialisation du KmerSetGroup sous-jacent
+// Les métadonnées incluent le type "FrequencyFilter" et min_freq
+//
+// Format:
+//   - directory/metadata.{toml,yaml,json} - métadonnées du filtre
+//   - directory/set_0.roaring - k-mers vus ≥1 fois
+//   - directory/set_1.roaring - k-mers vus ≥2 fois
+//   - ...
+//   - directory/set_{minFreq-1}.roaring - k-mers vus ≥minFreq fois
+//
+// Parameters:
+//   - directory: répertoire de destination
+//   - format: format des métadonnées (FormatTOML, FormatYAML, FormatJSON)
+//
+// Example:
+//
+//	err := ff.Save("./my_filter", obikmer.FormatTOML)
+func (ff *FrequencyFilter) Save(directory string, format MetadataFormat) error {
+	// Déléguer à KmerSetGroup qui gère déjà tout
+	return ff.KmerSetGroup.Save(directory, format)
+}
+
+// LoadFrequencyFilter charge un FrequencyFilter depuis un répertoire
+// Vérifie que les métadonnées correspondent à un FrequencyFilter
+//
+// Parameters:
+//   - directory: répertoire source
+//
+// Returns:
+//   - *FrequencyFilter: le filtre chargé
+//   - error: erreur si le chargement échoue ou si ce n'est pas un FrequencyFilter
+//
+// Example:
+//
+//	ff, err := obikmer.LoadFrequencyFilter("./my_filter")
+func LoadFrequencyFilter(directory string) (*FrequencyFilter, error) {
+	// Charger le KmerSetGroup
+	ksg, err := LoadKmerSetGroup(directory)
+	if err != nil {
+		return nil, err
+	}
+
+	// Vérifier que c'est bien un FrequencyFilter
+	if typeAttr, ok := ksg.GetAttribute("type"); !ok || typeAttr != "FrequencyFilter" {
+		return nil, fmt.Errorf("loaded data is not a FrequencyFilter (type=%v)", typeAttr)
+	}
+
+	// Récupérer min_freq
+	minFreqAttr, ok := ksg.GetIntAttribute("min_freq")
+	if !ok {
+		return nil, fmt.Errorf("FrequencyFilter missing min_freq attribute")
+	}
+
+	// Créer le FrequencyFilter
+	ff := &FrequencyFilter{
+		KmerSetGroup: ksg,
+		MinFreq:      minFreqAttr,
+	}
+
+	return ff, nil
+}
+
+// ==================================
+// UTILITAIRES
+// ==================================
+
+// Contains vérifie si un k-mer a atteint la fréquence minimale
+func (ff *FrequencyFilter) Contains(kmer uint64) bool {
+	canonical := CanonicalKmer(kmer, ff.K())
+	return ff.Get(ff.MinFreq - 1).Contains(canonical)
+}
+
+// GetFrequency returns the approximate frequency of a k-mer
+// Retourne le niveau maximum atteint (freq ≥ niveau)
+func (ff *FrequencyFilter) GetFrequency(kmer uint64) int {
+	canonical := CanonicalKmer(kmer, ff.K())
+
+	freq := 0
+	for i := 0; i < ff.MinFreq; i++ {
+		if ff.Get(i).Contains(canonical) {
+			freq = i + 1
+		} else {
+			break
+		}
+	}
+
+	return freq
+}
+
+// Len returns the number of filtered k-mers or at a specific level
+// Without argument: returns the number of k-mers with freq ≥ minFreq (last level)
+// With argument level: returns the number of k-mers with freq ≥ (level+1)
+// Exemple: Len() pour les k-mers filtrés, Len(2) pour freq ≥ 3
+// (héritée de KmerSetGroup mais redéfinie pour la documentation)
+func (ff *FrequencyFilter) Len(level ...int) uint64 {
+	return ff.KmerSetGroup.Len(level...)
+}
+
+// MemoryUsage returns memory usage in bytes
+// (héritée de KmerSetGroup mais redéfinie pour clarté)
+func (ff *FrequencyFilter) MemoryUsage() uint64 {
+	return ff.KmerSetGroup.MemoryUsage()
+}
+
+// ==================================
+// COMPARAISON AVEC D'AUTRES APPROCHES
+// ==================================
+
+// CompareWithSimpleMap compare la mémoire avec une simple map
+func (ff *FrequencyFilter) CompareWithSimpleMap() string {
+	totalKmers := ff.Get(0).Len()
+
+	simpleMapBytes := totalKmers * 24 // ~24 bytes par entrée
+	roaringBytes := ff.MemoryUsage()
+
+	reduction := float64(simpleMapBytes) / float64(roaringBytes)
+
+	return fmt.Sprintf(`Memory Comparison for %d k-mers:
+  Simple map[uint64]uint32: %.2f MB
+  Roaring filter (v=%d):    %.2f MB
+  Reduction:                %.1fx
+`,
+		totalKmers,
+		float64(simpleMapBytes)/1024/1024,
+		ff.MinFreq,
+		float64(roaringBytes)/1024/1024,
+		reduction,
+	)
+}

pkg/obikmer/kmer_set.go

@@ -0,0 +1,217 @@
+package obikmer
+
+import (
+	"fmt"
+
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
+	"github.com/RoaringBitmap/roaring/roaring64"
+)
+
+// KmerSet wraps a set of k-mers stored in a Roaring Bitmap
+// Provides utility methods for manipulating k-mer sets
+type KmerSet struct {
+	id       string                 // Unique identifier of the KmerSet
+	k        int                    // Size of k-mers (immutable)
+	bitmap   *roaring64.Bitmap      // Bitmap containing the k-mers
+	Metadata map[string]interface{} // User metadata (key=atomic value)
+}
+
+// NewKmerSet creates a new empty KmerSet
+func NewKmerSet(k int) *KmerSet {
+	return &KmerSet{
+		k:        k,
+		bitmap:   roaring64.New(),
+		Metadata: make(map[string]interface{}),
+	}
+}
+
+// NewKmerSetFromBitmap creates a KmerSet from an existing bitmap
+func NewKmerSetFromBitmap(k int, bitmap *roaring64.Bitmap) *KmerSet {
+	return &KmerSet{
+		k:        k,
+		bitmap:   bitmap,
+		Metadata: make(map[string]interface{}),
+	}
+}
+
+// K returns the size of k-mers (immutable)
+func (ks *KmerSet) K() int {
+	return ks.k
+}
+
+// AddKmerCode adds an encoded k-mer to the set
+func (ks *KmerSet) AddKmerCode(kmer uint64) {
+	ks.bitmap.Add(kmer)
+}
+
+// AddCanonicalKmerCode adds an encoded canonical k-mer to the set
+func (ks *KmerSet) AddCanonicalKmerCode(kmer uint64) {
+	canonical := CanonicalKmer(kmer, ks.k)
+	ks.bitmap.Add(canonical)
+}
+
+// AddKmer adds a k-mer to the set by encoding the sequence
+// The sequence must have exactly k nucleotides
+// Zero-allocation: encodes directly without creating an intermediate slice
+func (ks *KmerSet) AddKmer(seq []byte) {
+	kmer := EncodeKmer(seq, ks.k)
+	ks.bitmap.Add(kmer)
+}
+
+// AddCanonicalKmer adds a canonical k-mer to the set by encoding the sequence
+// The sequence must have exactly k nucleotides
+// Zero-allocation: encodes directly in canonical form without creating an intermediate slice
+func (ks *KmerSet) AddCanonicalKmer(seq []byte) {
+	canonical := EncodeCanonicalKmer(seq, ks.k)
+	ks.bitmap.Add(canonical)
+}
+
+// AddSequence adds all k-mers from a sequence to the set
+// Uses an iterator to avoid allocating an intermediate vector
+func (ks *KmerSet) AddSequence(seq *obiseq.BioSequence) {
+	rawSeq := seq.Sequence()
+	for canonical := range IterCanonicalKmers(rawSeq, ks.k) {
+		ks.bitmap.Add(canonical)
+	}
+}
+
+// AddSequences adds all k-mers from multiple sequences in batch
+func (ks *KmerSet) AddSequences(sequences *obiseq.BioSequenceSlice) {
+	for _, seq := range *sequences {
+		ks.AddSequence(seq)
+	}
+}
+
+// Contains checks if a k-mer is in the set
+func (ks *KmerSet) Contains(kmer uint64) bool {
+	return ks.bitmap.Contains(kmer)
+}
+
+// Len returns the number of k-mers in the set
+func (ks *KmerSet) Len() uint64 {
+	return ks.bitmap.GetCardinality()
+}
+
+// MemoryUsage returns memory usage in bytes
+func (ks *KmerSet) MemoryUsage() uint64 {
+	return ks.bitmap.GetSizeInBytes()
+}
+
+// Clear empties the set
+func (ks *KmerSet) Clear() {
+	ks.bitmap.Clear()
+}
+
+// Copy creates a copy of the set (consistent with BioSequence.Copy)
+func (ks *KmerSet) Copy() *KmerSet {
+	// Copy metadata
+	metadata := make(map[string]interface{}, len(ks.Metadata))
+	for k, v := range ks.Metadata {
+		metadata[k] = v
+	}
+
+	return &KmerSet{
+		id:       ks.id,
+		k:        ks.k,
+		bitmap:   ks.bitmap.Clone(),
+		Metadata: metadata,
+	}
+}
+
+// Id returns the identifier of the KmerSet (consistent with BioSequence.Id)
+func (ks *KmerSet) Id() string {
+	return ks.id
+}
+
+// SetId sets the identifier of the KmerSet (consistent with BioSequence.SetId)
+func (ks *KmerSet) SetId(id string) {
+	ks.id = id
+}
+
+// Union returns the union of this set with another
+func (ks *KmerSet) Union(other *KmerSet) *KmerSet {
+	if ks.k != other.k {
+		panic(fmt.Sprintf("Cannot union KmerSets with different k values: %d vs %d", ks.k, other.k))
+	}
+	result := ks.bitmap.Clone()
+	result.Or(other.bitmap)
+	return NewKmerSetFromBitmap(ks.k, result)
+}
+
+// Intersect returns the intersection of this set with another
+func (ks *KmerSet) Intersect(other *KmerSet) *KmerSet {
+	if ks.k != other.k {
+		panic(fmt.Sprintf("Cannot intersect KmerSets with different k values: %d vs %d", ks.k, other.k))
+	}
+	result := ks.bitmap.Clone()
+	result.And(other.bitmap)
+	return NewKmerSetFromBitmap(ks.k, result)
+}
+
+// Difference returns the difference of this set with another (this - other)
+func (ks *KmerSet) Difference(other *KmerSet) *KmerSet {
+	if ks.k != other.k {
+		panic(fmt.Sprintf("Cannot subtract KmerSets with different k values: %d vs %d", ks.k, other.k))
+	}
+	result := ks.bitmap.Clone()
+	result.AndNot(other.bitmap)
+	return NewKmerSetFromBitmap(ks.k, result)
+}
+
+// JaccardDistance computes the Jaccard distance between two KmerSets.
+// The Jaccard distance is defined as: 1 - (|A ∩ B| / |A ∪ B|)
+// where A and B are the two sets.
+//
+// Returns:
+//   - 0.0 when sets are identical (distance = 0, similarity = 1)
+//   - 1.0 when sets are completely disjoint (distance = 1, similarity = 0)
+//   - 1.0 when both sets are empty (by convention)
+//
+// Time complexity: O(|A| + |B|) for Roaring Bitmap operations
+// Space complexity: O(1) as operations are done in-place on temporary bitmaps
+func (ks *KmerSet) JaccardDistance(other *KmerSet) float64 {
+	if ks.k != other.k {
+		panic(fmt.Sprintf("Cannot compute Jaccard distance between KmerSets with different k values: %d vs %d", ks.k, other.k))
+	}
+
+	// Compute intersection cardinality
+	intersectionCard := ks.bitmap.AndCardinality(other.bitmap)
+
+	// Compute union cardinality
+	unionCard := ks.bitmap.OrCardinality(other.bitmap)
+
+	// If union is empty, both sets are empty - return 1.0 by convention
+	if unionCard == 0 {
+		return 1.0
+	}
+
+	// Jaccard similarity = |A ∩ B| / |A ∪ B|
+	similarity := float64(intersectionCard) / float64(unionCard)
+
+	// Jaccard distance = 1 - similarity
+	return 1.0 - similarity
+}
+
+// JaccardSimilarity computes the Jaccard similarity coefficient between two KmerSets.
+// The Jaccard similarity is defined as: |A ∩ B| / |A ∪ B|
+//
+// Returns:
+//   - 1.0 when sets are identical (maximum similarity)
+//   - 0.0 when sets are completely disjoint (no similarity)
+//   - 0.0 when both sets are empty (by convention)
+//
+// Time complexity: O(|A| + |B|) for Roaring Bitmap operations
+// Space complexity: O(1) as operations are done in-place on temporary bitmaps
+func (ks *KmerSet) JaccardSimilarity(other *KmerSet) float64 {
+	return 1.0 - ks.JaccardDistance(other)
+}
+
+// Iterator returns an iterator over all k-mers in the set
+func (ks *KmerSet) Iterator() roaring64.IntIterable64 {
+	return ks.bitmap.Iterator()
+}
+
+// Bitmap returns the underlying bitmap (for compatibility)
+func (ks *KmerSet) Bitmap() *roaring64.Bitmap {
+	return ks.bitmap
+}

pkg/obikmer/kmer_set_attributes.go

@@ -0,0 +1,362 @@
+package obikmer
+
+import (
+	"fmt"
+	"strconv"
+
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
+)
+
+// ==================================
+// KMER SET ATTRIBUTE API
+// Mimic BioSequence attribute API from obiseq/attributes.go
+// ==================================
+
+// HasAttribute vérifie si une clé d'attribut existe
+func (ks *KmerSet) HasAttribute(key string) bool {
+	_, ok := ks.Metadata[key]
+	return ok
+}
+
+// GetAttribute récupère la valeur d'un attribut
+// Cas particuliers: "id" utilise Id(), "k" utilise K()
+func (ks *KmerSet) GetAttribute(key string) (interface{}, bool) {
+	switch key {
+	case "id":
+		return ks.Id(), true
+	case "k":
+		return ks.K(), true
+	default:
+		value, ok := ks.Metadata[key]
+		return value, ok
+	}
+}
+
+// SetAttribute sets the value of an attribute
+// Cas particuliers: "id" utilise SetId(), "k" est immutable (panique)
+func (ks *KmerSet) SetAttribute(key string, value interface{}) {
+	switch key {
+	case "id":
+		if id, ok := value.(string); ok {
+			ks.SetId(id)
+		} else {
+			panic(fmt.Sprintf("id must be a string, got %T", value))
+		}
+	case "k":
+		panic("k is immutable and cannot be modified via SetAttribute")
+	default:
+		ks.Metadata[key] = value
+	}
+}
+
+// DeleteAttribute supprime un attribut
+func (ks *KmerSet) DeleteAttribute(key string) {
+	delete(ks.Metadata, key)
+}
+
+// RemoveAttribute supprime un attribut (alias de DeleteAttribute)
+func (ks *KmerSet) RemoveAttribute(key string) {
+	ks.DeleteAttribute(key)
+}
+
+// RenameAttribute renomme un attribut
+func (ks *KmerSet) RenameAttribute(newName, oldName string) {
+	if value, ok := ks.Metadata[oldName]; ok {
+		ks.Metadata[newName] = value
+		delete(ks.Metadata, oldName)
+	}
+}
+
+// GetIntAttribute récupère un attribut en tant qu'entier
+func (ks *KmerSet) GetIntAttribute(key string) (int, bool) {
+	value, ok := ks.Metadata[key]
+	if !ok {
+		return 0, false
+	}
+
+	switch v := value.(type) {
+	case int:
+		return v, true
+	case int64:
+		return int(v), true
+	case float64:
+		return int(v), true
+	case string:
+		if i, err := strconv.Atoi(v); err == nil {
+			return i, true
+		}
+	}
+	return 0, false
+}
+
+// GetFloatAttribute récupère un attribut en tant que float64
+func (ks *KmerSet) GetFloatAttribute(key string) (float64, bool) {
+	value, ok := ks.Metadata[key]
+	if !ok {
+		return 0, false
+	}
+
+	switch v := value.(type) {
+	case float64:
+		return v, true
+	case float32:
+		return float64(v), true
+	case int:
+		return float64(v), true
+	case int64:
+		return float64(v), true
+	case string:
+		if f, err := strconv.ParseFloat(v, 64); err == nil {
+			return f, true
+		}
+	}
+	return 0, false
+}
+
+// GetNumericAttribute récupère un attribut numérique (alias de GetFloatAttribute)
+func (ks *KmerSet) GetNumericAttribute(key string) (float64, bool) {
+	return ks.GetFloatAttribute(key)
+}
+
+// GetStringAttribute récupère un attribut en tant que chaîne
+func (ks *KmerSet) GetStringAttribute(key string) (string, bool) {
+	value, ok := ks.Metadata[key]
+	if !ok {
+		return "", false
+	}
+
+	switch v := value.(type) {
+	case string:
+		return v, true
+	default:
+		return fmt.Sprintf("%v", v), true
+	}
+}
+
+// GetBoolAttribute récupère un attribut en tant que booléen
+func (ks *KmerSet) GetBoolAttribute(key string) (bool, bool) {
+	value, ok := ks.Metadata[key]
+	if !ok {
+		return false, false
+	}
+
+	switch v := value.(type) {
+	case bool:
+		return v, true
+	case int:
+		return v != 0, true
+	case string:
+		if b, err := strconv.ParseBool(v); err == nil {
+			return b, true
+		}
+	}
+	return false, false
+}
+
+// AttributeKeys returns the set of attribute keys
+func (ks *KmerSet) AttributeKeys() obiutils.Set[string] {
+	keys := obiutils.MakeSet[string]()
+	for key := range ks.Metadata {
+		keys.Add(key)
+	}
+	return keys
+}
+
+// Keys returns the set of attribute keys (alias of AttributeKeys)
+func (ks *KmerSet) Keys() obiutils.Set[string] {
+	return ks.AttributeKeys()
+}
+
+// ==================================
+// KMER SET GROUP ATTRIBUTE API
+// Métadonnées du groupe + accès via Get() pour les sets individuels
+// ==================================
+
+// HasAttribute vérifie si une clé d'attribut existe pour le groupe
+func (ksg *KmerSetGroup) HasAttribute(key string) bool {
+	_, ok := ksg.Metadata[key]
+	return ok
+}
+
+// GetAttribute récupère la valeur d'un attribut du groupe
+// Cas particuliers: "id" utilise Id(), "k" utilise K()
+func (ksg *KmerSetGroup) GetAttribute(key string) (interface{}, bool) {
+	switch key {
+	case "id":
+		return ksg.Id(), true
+	case "k":
+		return ksg.K(), true
+	default:
+		value, ok := ksg.Metadata[key]
+		return value, ok
+	}
+}
+
+// SetAttribute sets the value of an attribute du groupe
+// Cas particuliers: "id" utilise SetId(), "k" est immutable (panique)
+func (ksg *KmerSetGroup) SetAttribute(key string, value interface{}) {
+	switch key {
+	case "id":
+		if id, ok := value.(string); ok {
+			ksg.SetId(id)
+		} else {
+			panic(fmt.Sprintf("id must be a string, got %T", value))
+		}
+	case "k":
+		panic("k is immutable and cannot be modified via SetAttribute")
+	default:
+		ksg.Metadata[key] = value
+	}
+}
+
+// DeleteAttribute supprime un attribut du groupe
+func (ksg *KmerSetGroup) DeleteAttribute(key string) {
+	delete(ksg.Metadata, key)
+}
+
+// RemoveAttribute supprime un attribut du groupe (alias)
+func (ksg *KmerSetGroup) RemoveAttribute(key string) {
+	ksg.DeleteAttribute(key)
+}
+
+// RenameAttribute renomme un attribut du groupe
+func (ksg *KmerSetGroup) RenameAttribute(newName, oldName string) {
+	if value, ok := ksg.Metadata[oldName]; ok {
+		ksg.Metadata[newName] = value
+		delete(ksg.Metadata, oldName)
+	}
+}
+
+// GetIntAttribute récupère un attribut entier du groupe
+func (ksg *KmerSetGroup) GetIntAttribute(key string) (int, bool) {
+	value, ok := ksg.GetAttribute(key)
+	if !ok {
+		return 0, false
+	}
+
+	switch v := value.(type) {
+	case int:
+		return v, true
+	case int64:
+		return int(v), true
+	case float64:
+		return int(v), true
+	case string:
+		if i, err := strconv.Atoi(v); err == nil {
+			return i, true
+		}
+	}
+	return 0, false
+}
+
+// GetFloatAttribute récupère un attribut float64 du groupe
+func (ksg *KmerSetGroup) GetFloatAttribute(key string) (float64, bool) {
+	value, ok := ksg.GetAttribute(key)
+	if !ok {
+		return 0, false
+	}
+
+	switch v := value.(type) {
+	case float64:
+		return v, true
+	case float32:
+		return float64(v), true
+	case int:
+		return float64(v), true
+	case int64:
+		return float64(v), true
+	case string:
+		if f, err := strconv.ParseFloat(v, 64); err == nil {
+			return f, true
+		}
+	}
+	return 0, false
+}
+
+// GetNumericAttribute récupère un attribut numérique du groupe
+func (ksg *KmerSetGroup) GetNumericAttribute(key string) (float64, bool) {
+	return ksg.GetFloatAttribute(key)
+}
+
+// GetStringAttribute récupère un attribut chaîne du groupe
+func (ksg *KmerSetGroup) GetStringAttribute(key string) (string, bool) {
+	value, ok := ksg.GetAttribute(key)
+	if !ok {
+		return "", false
+	}
+
+	switch v := value.(type) {
+	case string:
+		return v, true
+	default:
+		return fmt.Sprintf("%v", v), true
+	}
+}
+
+// GetBoolAttribute récupère un attribut booléen du groupe
+func (ksg *KmerSetGroup) GetBoolAttribute(key string) (bool, bool) {
+	value, ok := ksg.GetAttribute(key)
+	if !ok {
+		return false, false
+	}
+
+	switch v := value.(type) {
+	case bool:
+		return v, true
+	case int:
+		return v != 0, true
+	case string:
+		if b, err := strconv.ParseBool(v); err == nil {
+			return b, true
+		}
+	}
+	return false, false
+}
+
+// AttributeKeys returns the set of attribute keys du groupe
+func (ksg *KmerSetGroup) AttributeKeys() obiutils.Set[string] {
+	keys := obiutils.MakeSet[string]()
+	for key := range ksg.Metadata {
+		keys.Add(key)
+	}
+	return keys
+}
+
+// Keys returns the set of group attribute keys (alias)
+func (ksg *KmerSetGroup) Keys() obiutils.Set[string] {
+	return ksg.AttributeKeys()
+}
+
+// ==================================
+// MÉTHODES POUR ACCÉDER AUX ATTRIBUTS DES SETS INDIVIDUELS VIA Get()
+// Architecture zero-copy: ksg.Get(i).SetAttribute(...)
+// ==================================
+
+// Exemple d'utilisation:
+// Pour accéder aux métadonnées d'un KmerSet individuel dans un groupe:
+//   ks := ksg.Get(0)
+//   ks.SetAttribute("level", 1)
+//   hasLevel := ks.HasAttribute("level")
+//
+// Pour les métadonnées du groupe:
+//   ksg.SetAttribute("name", "FrequencyFilter")
+//   name, ok := ksg.GetStringAttribute("name")
+
+// AllAttributeKeys returns all unique attribute keys of the group AND all its sets
+func (ksg *KmerSetGroup) AllAttributeKeys() obiutils.Set[string] {
+	keys := obiutils.MakeSet[string]()
+
+	// Ajouter les clés du groupe
+	for key := range ksg.Metadata {
+		keys.Add(key)
+	}
+
+	// Ajouter les clés de chaque set
+	for _, ks := range ksg.sets {
+		for key := range ks.Metadata {
+			keys.Add(key)
+		}
+	}
+
+	return keys
+}

pkg/obikmer/kmer_set_group.go

@@ -0,0 +1,339 @@
+package obikmer
+
+import (
+	"fmt"
+
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidist"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
+)
+
+// KmerSetGroup represents a vector of KmerSet
+// Used to manage multiple k-mer sets (for example, by frequency level)
+type KmerSetGroup struct {
+	id       string                 // Unique identifier of the KmerSetGroup
+	k        int                    // Size of k-mers (immutable)
+	sets     []*KmerSet             // Vector of KmerSet
+	Metadata map[string]interface{} // Group metadata (not individual sets)
+}
+
+// NewKmerSetGroup creates a new group of n KmerSets
+func NewKmerSetGroup(k int, n int) *KmerSetGroup {
+	if n < 1 {
+		panic("KmerSetGroup size must be >= 1")
+	}
+
+	sets := make([]*KmerSet, n)
+	for i := range sets {
+		sets[i] = NewKmerSet(k)
+	}
+
+	return &KmerSetGroup{
+		k:        k,
+		sets:     sets,
+		Metadata: make(map[string]interface{}),
+	}
+}
+
+// K returns the size of k-mers (immutable)
+func (ksg *KmerSetGroup) K() int {
+	return ksg.k
+}
+
+// Size returns the number of KmerSet in the group
+func (ksg *KmerSetGroup) Size() int {
+	return len(ksg.sets)
+}
+
+// Get returns the KmerSet at the given index
+// Returns nil if the index is invalid
+func (ksg *KmerSetGroup) Get(index int) *KmerSet {
+	if index < 0 || index >= len(ksg.sets) {
+		return nil
+	}
+	return ksg.sets[index]
+}
+
+// Set replaces the KmerSet at the given index
+// Panics if the index is invalid or if k does not match
+func (ksg *KmerSetGroup) Set(index int, ks *KmerSet) {
+	if index < 0 || index >= len(ksg.sets) {
+		panic(fmt.Sprintf("Index out of bounds: %d (size: %d)", index, len(ksg.sets)))
+	}
+	if ks.k != ksg.k {
+		panic(fmt.Sprintf("KmerSet k mismatch: expected %d, got %d", ksg.k, ks.k))
+	}
+	ksg.sets[index] = ks
+}
+
+// Len returns the number of k-mers in a specific KmerSet
+// Without argument: returns the number of k-mers in the last KmerSet
+// With argument index: returns the number of k-mers in the KmerSet at this index
+func (ksg *KmerSetGroup) Len(index ...int) uint64 {
+	if len(index) == 0 {
+		// Without argument: last KmerSet
+		return ksg.sets[len(ksg.sets)-1].Len()
+	}
+
+	// With argument: specific KmerSet
+	idx := index[0]
+	if idx < 0 || idx >= len(ksg.sets) {
+		return 0
+	}
+	return ksg.sets[idx].Len()
+}
+
+// MemoryUsage returns the total memory usage in bytes
+func (ksg *KmerSetGroup) MemoryUsage() uint64 {
+	total := uint64(0)
+	for _, ks := range ksg.sets {
+		total += ks.MemoryUsage()
+	}
+	return total
+}
+
+// Clear empties all KmerSet in the group
+func (ksg *KmerSetGroup) Clear() {
+	for _, ks := range ksg.sets {
+		ks.Clear()
+	}
+}
+
+// Copy creates a complete copy of the group (consistent with BioSequence.Copy)
+func (ksg *KmerSetGroup) Copy() *KmerSetGroup {
+	copiedSets := make([]*KmerSet, len(ksg.sets))
+	for i, ks := range ksg.sets {
+		copiedSets[i] = ks.Copy() // Copy each KmerSet with its metadata
+	}
+
+	// Copy group metadata
+	groupMetadata := make(map[string]interface{}, len(ksg.Metadata))
+	for k, v := range ksg.Metadata {
+		groupMetadata[k] = v
+	}
+
+	return &KmerSetGroup{
+		id:       ksg.id,
+		k:        ksg.k,
+		sets:     copiedSets,
+		Metadata: groupMetadata,
+	}
+}
+
+// Id returns the identifier of the KmerSetGroup (consistent with BioSequence.Id)
+func (ksg *KmerSetGroup) Id() string {
+	return ksg.id
+}
+
+// SetId sets the identifier of the KmerSetGroup (consistent with BioSequence.SetId)
+func (ksg *KmerSetGroup) SetId(id string) {
+	ksg.id = id
+}
+
+// AddSequence adds all k-mers from a sequence to a specific KmerSet
+func (ksg *KmerSetGroup) AddSequence(seq *obiseq.BioSequence, index int) {
+	if index < 0 || index >= len(ksg.sets) {
+		panic(fmt.Sprintf("Index out of bounds: %d (size: %d)", index, len(ksg.sets)))
+	}
+	ksg.sets[index].AddSequence(seq)
+}
+
+// AddSequences adds all k-mers from multiple sequences to a specific KmerSet
+func (ksg *KmerSetGroup) AddSequences(sequences *obiseq.BioSequenceSlice, index int) {
+	if index < 0 || index >= len(ksg.sets) {
+		panic(fmt.Sprintf("Index out of bounds: %d (size: %d)", index, len(ksg.sets)))
+	}
+	ksg.sets[index].AddSequences(sequences)
+}
+
+// Union returns the union of all KmerSet in the group
+// Optimization: starts from the largest set to minimize operations
+func (ksg *KmerSetGroup) Union() *KmerSet {
+	if len(ksg.sets) == 0 {
+		return NewKmerSet(ksg.k)
+	}
+
+	if len(ksg.sets) == 1 {
+		return ksg.sets[0].Copy()
+	}
+
+	// Find the index of the largest set (the one with the most k-mers)
+	maxIdx := 0
+	maxCard := ksg.sets[0].Len()
+	for i := 1; i < len(ksg.sets); i++ {
+		card := ksg.sets[i].Len()
+		if card > maxCard {
+			maxCard = card
+			maxIdx = i
+		}
+	}
+
+	// Copy the largest set and perform unions in-place
+	result := ksg.sets[maxIdx].bitmap.Clone()
+	for i := 0; i < len(ksg.sets); i++ {
+		if i != maxIdx {
+			result.Or(ksg.sets[i].bitmap)
+		}
+	}
+
+	return NewKmerSetFromBitmap(ksg.k, result)
+}
+
+// Intersect returns the intersection of all KmerSet in the group
+// Optimization: starts from the smallest set to minimize operations
+func (ksg *KmerSetGroup) Intersect() *KmerSet {
+	if len(ksg.sets) == 0 {
+		return NewKmerSet(ksg.k)
+	}
+
+	if len(ksg.sets) == 1 {
+		return ksg.sets[0].Copy()
+	}
+
+	// Find the index of the smallest set (the one with the fewest k-mers)
+	minIdx := 0
+	minCard := ksg.sets[0].Len()
+	for i := 1; i < len(ksg.sets); i++ {
+		card := ksg.sets[i].Len()
+		if card < minCard {
+			minCard = card
+			minIdx = i
+		}
+	}
+
+	// Copy the smallest set and perform intersections in-place
+	result := ksg.sets[minIdx].bitmap.Clone()
+	for i := 0; i < len(ksg.sets); i++ {
+		if i != minIdx {
+			result.And(ksg.sets[i].bitmap)
+		}
+	}
+
+	return NewKmerSetFromBitmap(ksg.k, result)
+}
+
+// Stats returns statistics for each KmerSet in the group
+type KmerSetGroupStats struct {
+	K          int
+	Size       int              // Number of KmerSet
+	TotalBytes uint64           // Total memory used
+	Sets       []KmerSetStats   // Stats of each KmerSet
+}
+
+type KmerSetStats struct {
+	Index     int    // Index of the KmerSet in the group
+	Len       uint64 // Number of k-mers
+	SizeBytes uint64 // Size in bytes
+}
+
+func (ksg *KmerSetGroup) Stats() KmerSetGroupStats {
+	stats := KmerSetGroupStats{
+		K:    ksg.k,
+		Size: len(ksg.sets),
+		Sets: make([]KmerSetStats, len(ksg.sets)),
+	}
+
+	for i, ks := range ksg.sets {
+		sizeBytes := ks.MemoryUsage()
+		stats.Sets[i] = KmerSetStats{
+			Index:     i,
+			Len:       ks.Len(),
+			SizeBytes: sizeBytes,
+		}
+		stats.TotalBytes += sizeBytes
+	}
+
+	return stats
+}
+
+func (ksgs KmerSetGroupStats) String() string {
+	result := fmt.Sprintf(`KmerSetGroup Statistics (k=%d, size=%d):
+  Total memory: %.2f MB
+
+Set breakdown:
+`, ksgs.K, ksgs.Size, float64(ksgs.TotalBytes)/1024/1024)
+
+	for _, set := range ksgs.Sets {
+		result += fmt.Sprintf("  Set[%d]: %d k-mers (%.2f MB)\n",
+			set.Index,
+			set.Len,
+			float64(set.SizeBytes)/1024/1024)
+	}
+
+	return result
+}
+
+// JaccardDistanceMatrix computes a pairwise Jaccard distance matrix for all KmerSets in the group.
+// Returns a triangular distance matrix where element (i, j) represents the Jaccard distance
+// between set i and set j.
+//
+// The Jaccard distance is: 1 - (|A ∩ B| / |A ∪ B|)
+//
+// The matrix labels are set to the IDs of the individual KmerSets if available,
+// otherwise they are set to "set_0", "set_1", etc.
+//
+// Time complexity: O(n² × (|A| + |B|)) where n is the number of sets
+// Space complexity: O(n²) for the distance matrix
+func (ksg *KmerSetGroup) JaccardDistanceMatrix() *obidist.DistMatrix {
+	n := len(ksg.sets)
+
+	// Create labels from set IDs
+	labels := make([]string, n)
+	for i, ks := range ksg.sets {
+		if ks.Id() != "" {
+			labels[i] = ks.Id()
+		} else {
+			labels[i] = fmt.Sprintf("set_%d", i)
+		}
+	}
+
+	dm := obidist.NewDistMatrixWithLabels(labels)
+
+	// Compute pairwise distances
+	for i := 0; i < n-1; i++ {
+		for j := i + 1; j < n; j++ {
+			distance := ksg.sets[i].JaccardDistance(ksg.sets[j])
+			dm.Set(i, j, distance)
+		}
+	}
+
+	return dm
+}
+
+// JaccardSimilarityMatrix computes a pairwise Jaccard similarity matrix for all KmerSets in the group.
+// Returns a similarity matrix where element (i, j) represents the Jaccard similarity
+// between set i and set j.
+//
+// The Jaccard similarity is: |A ∩ B| / |A ∪ B|
+//
+// The diagonal is 1.0 (similarity of a set to itself).
+//
+// The matrix labels are set to the IDs of the individual KmerSets if available,
+// otherwise they are set to "set_0", "set_1", etc.
+//
+// Time complexity: O(n² × (|A| + |B|)) where n is the number of sets
+// Space complexity: O(n²) for the similarity matrix
+func (ksg *KmerSetGroup) JaccardSimilarityMatrix() *obidist.DistMatrix {
+	n := len(ksg.sets)
+
+	// Create labels from set IDs
+	labels := make([]string, n)
+	for i, ks := range ksg.sets {
+		if ks.Id() != "" {
+			labels[i] = ks.Id()
+		} else {
+			labels[i] = fmt.Sprintf("set_%d", i)
+		}
+	}
+
+	sm := obidist.NewSimilarityMatrixWithLabels(labels)
+
+	// Compute pairwise similarities
+	for i := 0; i < n-1; i++ {
+		for j := i + 1; j < n; j++ {
+			similarity := ksg.sets[i].JaccardSimilarity(ksg.sets[j])
+			sm.Set(i, j, similarity)
+		}
+	}
+
+	return sm
+}

pkg/obikmer/kmer_set_group_jaccard_test.go

@@ -0,0 +1,231 @@
+package obikmer
+
+import (
+	"math"
+	"testing"
+)
+
+func TestKmerSetGroupJaccardDistanceMatrix(t *testing.T) {
+	ksg := NewKmerSetGroup(5, 3)
+
+	// Set 0: {1, 2, 3}
+	ksg.Get(0).AddKmerCode(1)
+	ksg.Get(0).AddKmerCode(2)
+	ksg.Get(0).AddKmerCode(3)
+	ksg.Get(0).SetId("set_A")
+
+	// Set 1: {2, 3, 4}
+	ksg.Get(1).AddKmerCode(2)
+	ksg.Get(1).AddKmerCode(3)
+	ksg.Get(1).AddKmerCode(4)
+	ksg.Get(1).SetId("set_B")
+
+	// Set 2: {5, 6, 7}
+	ksg.Get(2).AddKmerCode(5)
+	ksg.Get(2).AddKmerCode(6)
+	ksg.Get(2).AddKmerCode(7)
+	ksg.Get(2).SetId("set_C")
+
+	dm := ksg.JaccardDistanceMatrix()
+
+	// Check labels
+	if dm.GetLabel(0) != "set_A" {
+		t.Errorf("Expected label 'set_A' at index 0, got '%s'", dm.GetLabel(0))
+	}
+	if dm.GetLabel(1) != "set_B" {
+		t.Errorf("Expected label 'set_B' at index 1, got '%s'", dm.GetLabel(1))
+	}
+	if dm.GetLabel(2) != "set_C" {
+		t.Errorf("Expected label 'set_C' at index 2, got '%s'", dm.GetLabel(2))
+	}
+
+	// Check distances
+	// Distance(0, 1):
+	// Intersection: {2, 3} -> 2 elements
+	// Union: {1, 2, 3, 4} -> 4 elements
+	// Similarity: 2/4 = 0.5
+	// Distance: 1 - 0.5 = 0.5
+	expectedDist01 := 0.5
+	actualDist01 := dm.Get(0, 1)
+	if math.Abs(actualDist01-expectedDist01) > 1e-10 {
+		t.Errorf("Distance(0, 1): expected %f, got %f", expectedDist01, actualDist01)
+	}
+
+	// Distance(0, 2):
+	// Intersection: {} -> 0 elements
+	// Union: {1, 2, 3, 5, 6, 7} -> 6 elements
+	// Similarity: 0/6 = 0
+	// Distance: 1 - 0 = 1.0
+	expectedDist02 := 1.0
+	actualDist02 := dm.Get(0, 2)
+	if math.Abs(actualDist02-expectedDist02) > 1e-10 {
+		t.Errorf("Distance(0, 2): expected %f, got %f", expectedDist02, actualDist02)
+	}
+
+	// Distance(1, 2):
+	// Intersection: {} -> 0 elements
+	// Union: {2, 3, 4, 5, 6, 7} -> 6 elements
+	// Similarity: 0/6 = 0
+	// Distance: 1 - 0 = 1.0
+	expectedDist12 := 1.0
+	actualDist12 := dm.Get(1, 2)
+	if math.Abs(actualDist12-expectedDist12) > 1e-10 {
+		t.Errorf("Distance(1, 2): expected %f, got %f", expectedDist12, actualDist12)
+	}
+
+	// Check symmetry
+	if dm.Get(0, 1) != dm.Get(1, 0) {
+		t.Errorf("Matrix not symmetric: Get(0, 1) = %f, Get(1, 0) = %f",
+			dm.Get(0, 1), dm.Get(1, 0))
+	}
+
+	// Check diagonal
+	if dm.Get(0, 0) != 0.0 {
+		t.Errorf("Diagonal should be 0, got %f", dm.Get(0, 0))
+	}
+	if dm.Get(1, 1) != 0.0 {
+		t.Errorf("Diagonal should be 0, got %f", dm.Get(1, 1))
+	}
+	if dm.Get(2, 2) != 0.0 {
+		t.Errorf("Diagonal should be 0, got %f", dm.Get(2, 2))
+	}
+}
+
+func TestKmerSetGroupJaccardSimilarityMatrix(t *testing.T) {
+	ksg := NewKmerSetGroup(5, 3)
+
+	// Set 0: {1, 2, 3}
+	ksg.Get(0).AddKmerCode(1)
+	ksg.Get(0).AddKmerCode(2)
+	ksg.Get(0).AddKmerCode(3)
+
+	// Set 1: {2, 3, 4}
+	ksg.Get(1).AddKmerCode(2)
+	ksg.Get(1).AddKmerCode(3)
+	ksg.Get(1).AddKmerCode(4)
+
+	// Set 2: {1, 2, 3} (same as set 0)
+	ksg.Get(2).AddKmerCode(1)
+	ksg.Get(2).AddKmerCode(2)
+	ksg.Get(2).AddKmerCode(3)
+
+	sm := ksg.JaccardSimilarityMatrix()
+
+	// Check similarities
+	// Similarity(0, 1): 0.5 (as calculated above)
+	expectedSim01 := 0.5
+	actualSim01 := sm.Get(0, 1)
+	if math.Abs(actualSim01-expectedSim01) > 1e-10 {
+		t.Errorf("Similarity(0, 1): expected %f, got %f", expectedSim01, actualSim01)
+	}
+
+	// Similarity(0, 2): 1.0 (identical sets)
+	expectedSim02 := 1.0
+	actualSim02 := sm.Get(0, 2)
+	if math.Abs(actualSim02-expectedSim02) > 1e-10 {
+		t.Errorf("Similarity(0, 2): expected %f, got %f", expectedSim02, actualSim02)
+	}
+
+	// Similarity(1, 2): 0.5
+	// Intersection: {2, 3} -> 2
+	// Union: {1, 2, 3, 4} -> 4
+	// Similarity: 2/4 = 0.5
+	expectedSim12 := 0.5
+	actualSim12 := sm.Get(1, 2)
+	if math.Abs(actualSim12-expectedSim12) > 1e-10 {
+		t.Errorf("Similarity(1, 2): expected %f, got %f", expectedSim12, actualSim12)
+	}
+
+	// Check diagonal (similarity to self = 1.0)
+	if sm.Get(0, 0) != 1.0 {
+		t.Errorf("Diagonal should be 1.0, got %f", sm.Get(0, 0))
+	}
+	if sm.Get(1, 1) != 1.0 {
+		t.Errorf("Diagonal should be 1.0, got %f", sm.Get(1, 1))
+	}
+	if sm.Get(2, 2) != 1.0 {
+		t.Errorf("Diagonal should be 1.0, got %f", sm.Get(2, 2))
+	}
+}
+
+func TestKmerSetGroupJaccardMatricesRelation(t *testing.T) {
+	ksg := NewKmerSetGroup(5, 4)
+
+	// Create different sets
+	ksg.Get(0).AddKmerCode(1)
+	ksg.Get(0).AddKmerCode(2)
+
+	ksg.Get(1).AddKmerCode(2)
+	ksg.Get(1).AddKmerCode(3)
+
+	ksg.Get(2).AddKmerCode(1)
+	ksg.Get(2).AddKmerCode(2)
+	ksg.Get(2).AddKmerCode(3)
+
+	ksg.Get(3).AddKmerCode(10)
+	ksg.Get(3).AddKmerCode(20)
+
+	dm := ksg.JaccardDistanceMatrix()
+	sm := ksg.JaccardSimilarityMatrix()
+
+	// For all pairs (including diagonal), distance + similarity should equal 1.0
+	for i := 0; i < 4; i++ {
+		for j := 0; j < 4; j++ {
+			distance := dm.Get(i, j)
+			similarity := sm.Get(i, j)
+			sum := distance + similarity
+
+			if math.Abs(sum-1.0) > 1e-10 {
+				t.Errorf("At (%d, %d): distance %f + similarity %f = %f, expected 1.0",
+					i, j, distance, similarity, sum)
+			}
+		}
+	}
+}
+
+func TestKmerSetGroupJaccardMatrixLabels(t *testing.T) {
+	ksg := NewKmerSetGroup(5, 3)
+
+	// Don't set IDs - should use default labels
+	ksg.Get(0).AddKmerCode(1)
+	ksg.Get(1).AddKmerCode(2)
+	ksg.Get(2).AddKmerCode(3)
+
+	dm := ksg.JaccardDistanceMatrix()
+
+	// Check default labels
+	if dm.GetLabel(0) != "set_0" {
+		t.Errorf("Expected default label 'set_0', got '%s'", dm.GetLabel(0))
+	}
+	if dm.GetLabel(1) != "set_1" {
+		t.Errorf("Expected default label 'set_1', got '%s'", dm.GetLabel(1))
+	}
+	if dm.GetLabel(2) != "set_2" {
+		t.Errorf("Expected default label 'set_2', got '%s'", dm.GetLabel(2))
+	}
+}
+
+func TestKmerSetGroupJaccardMatrixSize(t *testing.T) {
+	ksg := NewKmerSetGroup(5, 5)
+
+	for i := 0; i < 5; i++ {
+		ksg.Get(i).AddKmerCode(uint64(i))
+	}
+
+	dm := ksg.JaccardDistanceMatrix()
+
+	if dm.Size() != 5 {
+		t.Errorf("Expected matrix size 5, got %d", dm.Size())
+	}
+
+	// All sets are disjoint, so all distances should be 1.0
+	for i := 0; i < 5; i++ {
+		for j := i + 1; j < 5; j++ {
+			dist := dm.Get(i, j)
+			if math.Abs(dist-1.0) > 1e-10 {
+				t.Errorf("Expected distance 1.0 for disjoint sets (%d, %d), got %f",
+					i, j, dist)
+			}
+		}
+	}
+}

pkg/obikmer/kmer_set_group_quorum.go

@@ -0,0 +1,235 @@
+package obikmer
+
+import (
+	"container/heap"
+
+	"github.com/RoaringBitmap/roaring/roaring64"
+)
+
+// heapItem represents an element in the min-heap for k-way merge
+type heapItem struct {
+	value uint64
+	idx   int
+}
+
+// kmerMinHeap implements heap.Interface for k-way merge algorithm
+type kmerMinHeap []heapItem
+
+func (h kmerMinHeap) Len() int           { return len(h) }
+func (h kmerMinHeap) Less(i, j int) bool { return h[i].value < h[j].value }
+func (h kmerMinHeap) Swap(i, j int)      { h[i], h[j] = h[j], h[i] }
+
+func (h *kmerMinHeap) Push(x interface{}) {
+	*h = append(*h, x.(heapItem))
+}
+
+func (h *kmerMinHeap) Pop() interface{} {
+	old := *h
+	n := len(old)
+	x := old[n-1]
+	*h = old[0 : n-1]
+	return x
+}
+
+// QuorumAtLeast returns k-mers present in at least q sets
+//
+// Algorithm: K-way merge with min-heap counting
+//
+// The algorithm processes all k-mers in sorted order using a min-heap:
+//
+//  1. Initialize one iterator per non-empty set
+//  2. Build a min-heap of (value, set_index) pairs, one per iterator
+//  3. While heap is not empty:
+//     a. Extract the minimum value v from heap
+//     b. Pop ALL heap items with value == v (counting occurrences)
+//     c. If count >= q, add v to result
+//     d. Advance each popped iterator and re-insert into heap if valid
+//
+// This ensures each unique k-mer is counted exactly once across all sets.
+//
+// Time complexity: O(M log N)
+//   - M = sum of all set cardinalities (total k-mer occurrences)
+//   - N = number of sets
+//   - Each k-mer occurrence is inserted/extracted from heap once: O(M) operations
+//   - Each heap operation costs O(log N)
+//
+// Space complexity: O(N)
+//   - Heap contains at most N elements (one per set iterator)
+//   - Output bitmap size depends on quorum result
+//
+// Special cases (optimized):
+//   - q <= 0: returns empty set
+//   - q == 1: delegates to Union() (native OR operations)
+//   - q == n: delegates to Intersect() (native AND operations)
+//   - q > n: returns empty set (impossible to satisfy)
+func (ksg *KmerSetGroup) QuorumAtLeast(q int) *KmerSet {
+	n := len(ksg.sets)
+
+	// Edge cases
+	if q <= 0 || n == 0 {
+		return NewKmerSet(ksg.k)
+	}
+	if q > n {
+		return NewKmerSet(ksg.k)
+	}
+	if q == 1 {
+		return ksg.Union()
+	}
+	if q == n {
+		return ksg.Intersect()
+	}
+
+	// Initialize iterators for all non-empty sets
+	iterators := make([]roaring64.IntIterable64, 0, n)
+	iterIndices := make([]int, 0, n)
+
+	for i, set := range ksg.sets {
+		if set.Len() > 0 {
+			iter := set.bitmap.Iterator()
+			if iter.HasNext() {
+				iterators = append(iterators, iter)
+				iterIndices = append(iterIndices, i)
+			}
+		}
+	}
+
+	if len(iterators) == 0 {
+		return NewKmerSet(ksg.k)
+	}
+
+	// Initialize heap with first value from each iterator
+	h := make(kmerMinHeap, len(iterators))
+	for i, iter := range iterators {
+		h[i] = heapItem{value: iter.Next(), idx: i}
+	}
+	heap.Init(&h)
+
+	// Result bitmap
+	result := roaring64.New()
+
+	// K-way merge with counting
+	for len(h) > 0 {
+		minVal := h[0].value
+		count := 0
+		activeIndices := make([]int, 0, len(h))
+
+		// Pop all elements with same value (count occurrences)
+		for len(h) > 0 && h[0].value == minVal {
+			item := heap.Pop(&h).(heapItem)
+			count++
+			activeIndices = append(activeIndices, item.idx)
+		}
+
+		// Add to result if quorum reached
+		if count >= q {
+			result.Add(minVal)
+		}
+
+		// Advance iterators and re-insert into heap
+		for _, iterIdx := range activeIndices {
+			if iterators[iterIdx].HasNext() {
+				heap.Push(&h, heapItem{
+					value: iterators[iterIdx].Next(),
+					idx:   iterIdx,
+				})
+			}
+		}
+	}
+
+	return NewKmerSetFromBitmap(ksg.k, result)
+}
+
+// QuorumAtMost returns k-mers present in at most q sets
+//
+// Algorithm: Uses the mathematical identity
+//   AtMost(q) = Union() - AtLeast(q+1)
+//
+// Proof:
+//   - Union() contains all k-mers present in at least 1 set
+//   - AtLeast(q+1) contains all k-mers present in q+1 or more sets
+//   - Their difference contains only k-mers present in at most q sets
+//
+// Implementation:
+//  1. Compute U = Union()
+//  2. Compute A = QuorumAtLeast(q+1)
+//  3. Return U - A using bitmap AndNot operation
+//
+// Time complexity: O(M log N)
+//   - Union(): O(M) with native OR operations
+//   - QuorumAtLeast(q+1): O(M log N)
+//   - AndNot: O(|U|) where |U| <= M
+//   - Total: O(M log N)
+//
+// Space complexity: O(N)
+//   - Inherited from QuorumAtLeast heap
+//
+// Special cases:
+//   - q <= 0: returns empty set
+//   - q >= n: returns Union() (all k-mers are in at most n sets)
+func (ksg *KmerSetGroup) QuorumAtMost(q int) *KmerSet {
+	n := len(ksg.sets)
+
+	// Edge cases
+	if q <= 0 {
+		return NewKmerSet(ksg.k)
+	}
+	if q >= n {
+		return ksg.Union()
+	}
+
+	// Compute Union() - AtLeast(q+1)
+	union := ksg.Union()
+	atLeastQ1 := ksg.QuorumAtLeast(q + 1)
+
+	// Difference: elements in union but not in atLeastQ1
+	result := union.bitmap.Clone()
+	result.AndNot(atLeastQ1.bitmap)
+
+	return NewKmerSetFromBitmap(ksg.k, result)
+}
+
+// QuorumExactly returns k-mers present in exactly q sets
+//
+// Algorithm: Uses the mathematical identity
+//   Exactly(q) = AtLeast(q) - AtLeast(q+1)
+//
+// Proof:
+//   - AtLeast(q) contains all k-mers present in q or more sets
+//   - AtLeast(q+1) contains all k-mers present in q+1 or more sets
+//   - Their difference contains only k-mers present in exactly q sets
+//
+// Implementation:
+//  1. Compute A = QuorumAtLeast(q)
+//  2. Compute B = QuorumAtLeast(q+1)
+//  3. Return A - B using bitmap AndNot operation
+//
+// Time complexity: O(M log N)
+//   - Two calls to QuorumAtLeast: 2 * O(M log N)
+//   - One AndNot operation: O(|A|) where |A| <= M
+//   - Total: O(M log N) since AndNot is dominated by merge operations
+//
+// Space complexity: O(N)
+//   - Inherited from QuorumAtLeast heap
+//   - Two temporary bitmaps for intermediate results
+//
+// Special cases:
+//   - q <= 0: returns empty set
+//   - q > n: returns empty set (impossible to have k-mer in more than n sets)
+func (ksg *KmerSetGroup) QuorumExactly(q int) *KmerSet {
+	n := len(ksg.sets)
+
+	// Edge cases
+	if q <= 0 || q > n {
+		return NewKmerSet(ksg.k)
+	}
+
+	// Compute AtLeast(q) - AtLeast(q+1)
+	aq := ksg.QuorumAtLeast(q)
+	aq1 := ksg.QuorumAtLeast(q + 1)
+
+	// Difference: elements in aq but not in aq1
+	result := aq.bitmap.Clone()
+	result.AndNot(aq1.bitmap)
+
+	return NewKmerSetFromBitmap(ksg.k, result)
+}

pkg/obikmer/kmer_set_group_quorum_test.go

@@ -0,0 +1,395 @@
+package obikmer
+
+import (
+	"testing"
+)
+
+// TestQuorumAtLeastEdgeCases tests edge cases for QuorumAtLeast
+func TestQuorumAtLeastEdgeCases(t *testing.T) {
+	k := 5
+
+	// Test group with all empty sets
+	emptyGroup := NewKmerSetGroup(k, 3)
+	result := emptyGroup.QuorumAtLeast(1)
+	if result.Len() != 0 {
+		t.Errorf("Empty sets: expected 0 k-mers, got %d", result.Len())
+	}
+
+	// Test q <= 0
+	group := NewKmerSetGroup(k, 3)
+	result = group.QuorumAtLeast(0)
+	if result.Len() != 0 {
+		t.Errorf("q=0: expected 0 k-mers, got %d", result.Len())
+	}
+
+	result = group.QuorumAtLeast(-1)
+	if result.Len() != 0 {
+		t.Errorf("q=-1: expected 0 k-mers, got %d", result.Len())
+	}
+
+	// Test q > n
+	group.Get(0).AddKmerCode(1)
+	result = group.QuorumAtLeast(10)
+	if result.Len() != 0 {
+		t.Errorf("q>n: expected 0 k-mers, got %d", result.Len())
+	}
+}
+
+// TestQuorumAtLeastQ1 tests q=1 (should equal Union)
+func TestQuorumAtLeastQ1(t *testing.T) {
+	k := 5
+	group := NewKmerSetGroup(k, 3)
+
+	// Add different k-mers to each set
+	group.Get(0).AddKmerCode(1)
+	group.Get(0).AddKmerCode(2)
+	group.Get(1).AddKmerCode(2)
+	group.Get(1).AddKmerCode(3)
+	group.Get(2).AddKmerCode(3)
+	group.Get(2).AddKmerCode(4)
+
+	quorum := group.QuorumAtLeast(1)
+	union := group.Union()
+
+	if quorum.Len() != union.Len() {
+		t.Errorf("QuorumAtLeast(1) length %d != Union length %d", quorum.Len(), union.Len())
+	}
+
+	// Check all elements match
+	for kmer := uint64(1); kmer <= 4; kmer++ {
+		if quorum.Contains(kmer) != union.Contains(kmer) {
+			t.Errorf("Mismatch for k-mer %d", kmer)
+		}
+	}
+}
+
+// TestQuorumAtLeastQN tests q=n (should equal Intersect)
+func TestQuorumAtLeastQN(t *testing.T) {
+	k := 5
+	group := NewKmerSetGroup(k, 3)
+
+	// Add some common k-mers and some unique
+	for i := 0; i < 3; i++ {
+		group.Get(i).AddKmerCode(10) // common to all
+		group.Get(i).AddKmerCode(20) // common to all
+	}
+	group.Get(0).AddKmerCode(1) // unique to set 0
+	group.Get(1).AddKmerCode(2) // unique to set 1
+
+	quorum := group.QuorumAtLeast(3)
+	intersect := group.Intersect()
+
+	if quorum.Len() != intersect.Len() {
+		t.Errorf("QuorumAtLeast(n) length %d != Intersect length %d", quorum.Len(), intersect.Len())
+	}
+
+	if quorum.Len() != 2 {
+		t.Errorf("Expected 2 common k-mers, got %d", quorum.Len())
+	}
+
+	if !quorum.Contains(10) || !quorum.Contains(20) {
+		t.Error("Missing common k-mers")
+	}
+
+	if quorum.Contains(1) || quorum.Contains(2) {
+		t.Error("Unique k-mers should not be in result")
+	}
+}
+
+// TestQuorumAtLeastGeneral tests general quorum values
+func TestQuorumAtLeastGeneral(t *testing.T) {
+	k := 5
+	group := NewKmerSetGroup(k, 5)
+
+	// Setup: k-mer i appears in i sets (for i=1..5)
+	// k-mer 1: in set 0
+	// k-mer 2: in sets 0,1
+	// k-mer 3: in sets 0,1,2
+	// k-mer 4: in sets 0,1,2,3
+	// k-mer 5: in sets 0,1,2,3,4 (all)
+
+	for kmer := uint64(1); kmer <= 5; kmer++ {
+		for setIdx := 0; setIdx < int(kmer); setIdx++ {
+			group.Get(setIdx).AddKmerCode(kmer)
+		}
+	}
+
+	tests := []struct {
+		q        int
+		expected map[uint64]bool
+	}{
+		{1, map[uint64]bool{1: true, 2: true, 3: true, 4: true, 5: true}},
+		{2, map[uint64]bool{2: true, 3: true, 4: true, 5: true}},
+		{3, map[uint64]bool{3: true, 4: true, 5: true}},
+		{4, map[uint64]bool{4: true, 5: true}},
+		{5, map[uint64]bool{5: true}},
+	}
+
+	for _, tt := range tests {
+		result := group.QuorumAtLeast(tt.q)
+
+		if result.Len() != uint64(len(tt.expected)) {
+			t.Errorf("q=%d: expected %d k-mers, got %d", tt.q, len(tt.expected), result.Len())
+		}
+
+		for kmer := uint64(1); kmer <= 5; kmer++ {
+			shouldContain := tt.expected[kmer]
+			doesContain := result.Contains(kmer)
+			if shouldContain != doesContain {
+				t.Errorf("q=%d, k-mer=%d: expected contains=%v, got %v", tt.q, kmer, shouldContain, doesContain)
+			}
+		}
+	}
+}
+
+// TestQuorumExactlyBasic tests QuorumExactly basic functionality
+func TestQuorumExactlyBasic(t *testing.T) {
+	k := 5
+	group := NewKmerSetGroup(k, 5)
+
+	// Setup: k-mer i appears in exactly i sets
+	for kmer := uint64(1); kmer <= 5; kmer++ {
+		for setIdx := 0; setIdx < int(kmer); setIdx++ {
+			group.Get(setIdx).AddKmerCode(kmer)
+		}
+	}
+
+	tests := []struct {
+		q        int
+		expected []uint64
+	}{
+		{1, []uint64{1}},
+		{2, []uint64{2}},
+		{3, []uint64{3}},
+		{4, []uint64{4}},
+		{5, []uint64{5}},
+	}
+
+	for _, tt := range tests {
+		result := group.QuorumExactly(tt.q)
+
+		if result.Len() != uint64(len(tt.expected)) {
+			t.Errorf("q=%d: expected %d k-mers, got %d", tt.q, len(tt.expected), result.Len())
+		}
+
+		for _, kmer := range tt.expected {
+			if !result.Contains(kmer) {
+				t.Errorf("q=%d: missing k-mer %d", tt.q, kmer)
+			}
+		}
+	}
+}
+
+// TestQuorumIdentity tests the mathematical identity: Exactly(q) = AtLeast(q) - AtLeast(q+1)
+func TestQuorumIdentity(t *testing.T) {
+	k := 5
+	group := NewKmerSetGroup(k, 4)
+
+	// Add random distribution
+	group.Get(0).AddKmerCode(1)
+	group.Get(0).AddKmerCode(2)
+	group.Get(0).AddKmerCode(3)
+
+	group.Get(1).AddKmerCode(2)
+	group.Get(1).AddKmerCode(3)
+	group.Get(1).AddKmerCode(4)
+
+	group.Get(2).AddKmerCode(3)
+	group.Get(2).AddKmerCode(4)
+
+	group.Get(3).AddKmerCode(4)
+
+	for q := 1; q <= 4; q++ {
+		exactly := group.QuorumExactly(q)
+		atLeast := group.QuorumAtLeast(q)
+		atLeastPlus1 := group.QuorumAtLeast(q + 1)
+
+		// Verify: every element in exactly(q) is in atLeast(q)
+		iter := exactly.Iterator()
+		for iter.HasNext() {
+			kmer := iter.Next()
+			if !atLeast.Contains(kmer) {
+				t.Errorf("q=%d: k-mer %d in Exactly but not in AtLeast", q, kmer)
+			}
+			if atLeastPlus1.Contains(kmer) {
+				t.Errorf("q=%d: k-mer %d in Exactly but also in AtLeast(q+1)", q, kmer)
+			}
+		}
+	}
+}
+
+// TestQuorumDisjointSets tests quorum on completely disjoint sets
+func TestQuorumDisjointSets(t *testing.T) {
+	k := 5
+	group := NewKmerSetGroup(k, 3)
+
+	// Each set has unique k-mers
+	group.Get(0).AddKmerCode(1)
+	group.Get(1).AddKmerCode(2)
+	group.Get(2).AddKmerCode(3)
+
+	// q=1 should give all
+	result := group.QuorumAtLeast(1)
+	if result.Len() != 3 {
+		t.Errorf("Disjoint sets q=1: expected 3, got %d", result.Len())
+	}
+
+	// q=2 should give none
+	result = group.QuorumAtLeast(2)
+	if result.Len() != 0 {
+		t.Errorf("Disjoint sets q=2: expected 0, got %d", result.Len())
+	}
+}
+
+// TestQuorumIdenticalSets tests quorum on identical sets
+func TestQuorumIdenticalSets(t *testing.T) {
+	k := 5
+	group := NewKmerSetGroup(k, 3)
+
+	// All sets have same k-mers
+	for i := 0; i < 3; i++ {
+		group.Get(i).AddKmerCode(10)
+		group.Get(i).AddKmerCode(20)
+		group.Get(i).AddKmerCode(30)
+	}
+
+	// Any q <= n should give all k-mers
+	for q := 1; q <= 3; q++ {
+		result := group.QuorumAtLeast(q)
+		if result.Len() != 3 {
+			t.Errorf("Identical sets q=%d: expected 3, got %d", q, result.Len())
+		}
+	}
+}
+
+// TestQuorumLargeNumbers tests with large k-mer values
+func TestQuorumLargeNumbers(t *testing.T) {
+	k := 21
+	group := NewKmerSetGroup(k, 3)
+
+	// Use large uint64 values (actual k-mer encodings)
+	largeKmers := []uint64{
+		0x1234567890ABCDEF,
+		0xFEDCBA0987654321,
+		0xAAAAAAAAAAAAAAAA,
+	}
+
+	// Add to multiple sets
+	for i := 0; i < 3; i++ {
+		for j := 0; j <= i; j++ {
+			group.Get(j).AddKmerCode(largeKmers[i])
+		}
+	}
+
+	result := group.QuorumAtLeast(2)
+	if result.Len() != 2 {
+		t.Errorf("Large numbers q=2: expected 2, got %d", result.Len())
+	}
+
+	if !result.Contains(largeKmers[1]) || !result.Contains(largeKmers[2]) {
+		t.Error("Large numbers: wrong k-mers in result")
+	}
+}
+
+// TestQuorumAtMostBasic tests QuorumAtMost basic functionality
+func TestQuorumAtMostBasic(t *testing.T) {
+	k := 5
+	group := NewKmerSetGroup(k, 5)
+
+	// Setup: k-mer i appears in exactly i sets
+	for kmer := uint64(1); kmer <= 5; kmer++ {
+		for setIdx := 0; setIdx < int(kmer); setIdx++ {
+			group.Get(setIdx).AddKmerCode(kmer)
+		}
+	}
+
+	tests := []struct {
+		q        int
+		expected []uint64
+	}{
+		{0, []uint64{}},                          // at most 0: none
+		{1, []uint64{1}},                         // at most 1: only k-mer 1
+		{2, []uint64{1, 2}},                      // at most 2: k-mers 1,2
+		{3, []uint64{1, 2, 3}},                   // at most 3: k-mers 1,2,3
+		{4, []uint64{1, 2, 3, 4}},                // at most 4: k-mers 1,2,3,4
+		{5, []uint64{1, 2, 3, 4, 5}},             // at most 5: all k-mers
+		{10, []uint64{1, 2, 3, 4, 5}},            // at most 10: all k-mers
+	}
+
+	for _, tt := range tests {
+		result := group.QuorumAtMost(tt.q)
+
+		if result.Len() != uint64(len(tt.expected)) {
+			t.Errorf("q=%d: expected %d k-mers, got %d", tt.q, len(tt.expected), result.Len())
+		}
+
+		for _, kmer := range tt.expected {
+			if !result.Contains(kmer) {
+				t.Errorf("q=%d: missing k-mer %d", tt.q, kmer)
+			}
+		}
+	}
+}
+
+// TestQuorumComplementIdentity tests that AtLeast and AtMost are complementary
+func TestQuorumComplementIdentity(t *testing.T) {
+	k := 5
+	group := NewKmerSetGroup(k, 4)
+
+	// Add random distribution
+	group.Get(0).AddKmerCode(1)
+	group.Get(0).AddKmerCode(2)
+	group.Get(0).AddKmerCode(3)
+
+	group.Get(1).AddKmerCode(2)
+	group.Get(1).AddKmerCode(3)
+	group.Get(1).AddKmerCode(4)
+
+	group.Get(2).AddKmerCode(3)
+	group.Get(2).AddKmerCode(4)
+
+	group.Get(3).AddKmerCode(4)
+
+	union := group.Union()
+
+	for q := 1; q < 4; q++ {
+		atMost := group.QuorumAtMost(q)
+		atLeast := group.QuorumAtLeast(q + 1)
+
+		// Verify: AtMost(q) ∪ AtLeast(q+1) = Union()
+		combined := atMost.Union(atLeast)
+
+		if combined.Len() != union.Len() {
+			t.Errorf("q=%d: AtMost(q) ∪ AtLeast(q+1) has %d k-mers, Union has %d",
+				q, combined.Len(), union.Len())
+		}
+
+		// Verify: AtMost(q) ∩ AtLeast(q+1) = ∅
+		overlap := atMost.Intersect(atLeast)
+		if overlap.Len() != 0 {
+			t.Errorf("q=%d: AtMost(q) and AtLeast(q+1) overlap with %d k-mers",
+				q, overlap.Len())
+		}
+	}
+}
+
+// BenchmarkQuorumAtLeast benchmarks quorum operations
+func BenchmarkQuorumAtLeast(b *testing.B) {
+	k := 21
+	n := 10
+	group := NewKmerSetGroup(k, n)
+
+	// Populate with realistic data
+	for i := 0; i < n; i++ {
+		for j := uint64(0); j < 10000; j++ {
+			if (j % uint64(n)) <= uint64(i) {
+				group.Get(i).AddKmerCode(j)
+			}
+		}
+	}
+
+	b.ResetTimer()
+	for i := 0; i < b.N; i++ {
+		_ = group.QuorumAtLeast(5)
+	}
+}

pkg/obikmer/kmer_set_persistence.go

@@ -0,0 +1,376 @@
+package obikmer
+
+import (
+	"encoding/json"
+	"fmt"
+	"os"
+	"path/filepath"
+	"strings"
+
+	"github.com/pelletier/go-toml/v2"
+	"gopkg.in/yaml.v3"
+)
+
+// MetadataFormat represents the metadata serialization format
+type MetadataFormat int
+
+const (
+	FormatTOML MetadataFormat = iota
+	FormatYAML
+	FormatJSON
+)
+
+// String returns the file extension for the format
+func (f MetadataFormat) String() string {
+	switch f {
+	case FormatTOML:
+		return "toml"
+	case FormatYAML:
+		return "yaml"
+	case FormatJSON:
+		return "json"
+	default:
+		return "toml"
+	}
+}
+
+// KmerSetMetadata contient les métadonnées d'un KmerSet ou KmerSetGroup
+type KmerSetMetadata struct {
+	ID            string                   `toml:"id,omitempty" yaml:"id,omitempty" json:"id,omitempty"`                        // Identifiant unique
+	K             int                      `toml:"k" yaml:"k" json:"k"`                                                         // Taille des k-mers
+	Type          string                   `toml:"type" yaml:"type" json:"type"`                                                // "KmerSet" ou "KmerSetGroup"
+	Size          int                      `toml:"size" yaml:"size" json:"size"`                                                // 1 pour KmerSet, n pour KmerSetGroup
+	Files         []string                 `toml:"files" yaml:"files" json:"files"`                                             // Liste des fichiers .roaring
+	SetsIDs       []string                 `toml:"sets_ids,omitempty" yaml:"sets_ids,omitempty" json:"sets_ids,omitempty"`      // IDs des KmerSet individuels
+	UserMetadata  map[string]interface{}   `toml:"user_metadata,omitempty" yaml:"user_metadata,omitempty" json:"user_metadata,omitempty"`         // Métadonnées KmerSet ou KmerSetGroup
+	SetsMetadata  []map[string]interface{} `toml:"sets_metadata,omitempty" yaml:"sets_metadata,omitempty" json:"sets_metadata,omitempty"`         // Métadonnées des KmerSet individuels dans un KmerSetGroup
+}
+
+// SaveKmerSet sauvegarde un KmerSet dans un répertoire
+// Format: directory/metadata.{toml,yaml,json} + directory/set_0.roaring
+func (ks *KmerSet) Save(directory string, format MetadataFormat) error {
+	// Créer le répertoire si nécessaire
+	if err := os.MkdirAll(directory, 0755); err != nil {
+		return fmt.Errorf("failed to create directory %s: %w", directory, err)
+	}
+
+	// Métadonnées
+	metadata := KmerSetMetadata{
+		ID:           ks.id,
+		K:            ks.k,
+		Type:         "KmerSet",
+		Size:         1,
+		Files:        []string{"set_0.roaring"},
+		UserMetadata: ks.Metadata, // Sauvegarder les métadonnées utilisateur
+	}
+
+	// Sauvegarder les métadonnées
+	if err := saveMetadata(filepath.Join(directory, "metadata."+format.String()), metadata, format); err != nil {
+		return err
+	}
+
+	// Sauvegarder le bitmap
+	bitmapPath := filepath.Join(directory, "set_0.roaring")
+	file, err := os.Create(bitmapPath)
+	if err != nil {
+		return fmt.Errorf("failed to create bitmap file %s: %w", bitmapPath, err)
+	}
+	defer file.Close()
+
+	if _, err := ks.bitmap.WriteTo(file); err != nil {
+		return fmt.Errorf("failed to write bitmap: %w", err)
+	}
+
+	return nil
+}
+
+// LoadKmerSet charge un KmerSet depuis un répertoire
+func LoadKmerSet(directory string) (*KmerSet, error) {
+	// Lire les métadonnées (essayer tous les formats)
+	metadata, err := loadMetadata(directory)
+	if err != nil {
+		return nil, err
+	}
+
+	// Vérifier le type
+	if metadata.Type != "KmerSet" {
+		return nil, fmt.Errorf("invalid type: expected KmerSet, got %s", metadata.Type)
+	}
+
+	// Vérifier qu'il n'y a qu'un seul fichier
+	if metadata.Size != 1 || len(metadata.Files) != 1 {
+		return nil, fmt.Errorf("KmerSet must have exactly 1 bitmap file, got %d", len(metadata.Files))
+	}
+
+	// Charger le bitmap
+	bitmapPath := filepath.Join(directory, metadata.Files[0])
+	file, err := os.Open(bitmapPath)
+	if err != nil {
+		return nil, fmt.Errorf("failed to open bitmap file %s: %w", bitmapPath, err)
+	}
+	defer file.Close()
+
+	ks := NewKmerSet(metadata.K)
+
+	// Charger l'ID
+	ks.id = metadata.ID
+
+	// Charger les métadonnées utilisateur
+	if metadata.UserMetadata != nil {
+		ks.Metadata = metadata.UserMetadata
+	}
+
+	if _, err := ks.bitmap.ReadFrom(file); err != nil {
+		return nil, fmt.Errorf("failed to read bitmap: %w", err)
+	}
+
+	return ks, nil
+}
+
+// SaveKmerSetGroup sauvegarde un KmerSetGroup dans un répertoire
+// Format: directory/metadata.{toml,yaml,json} + directory/set_0.roaring, set_1.roaring, ...
+func (ksg *KmerSetGroup) Save(directory string, format MetadataFormat) error {
+	// Créer le répertoire si nécessaire
+	if err := os.MkdirAll(directory, 0755); err != nil {
+		return fmt.Errorf("failed to create directory %s: %w", directory, err)
+	}
+
+	// Métadonnées
+	files := make([]string, len(ksg.sets))
+	for i := range ksg.sets {
+		files[i] = fmt.Sprintf("set_%d.roaring", i)
+	}
+
+	// Collecter les IDs et métadonnées de chaque KmerSet individuel
+	setsIDs := make([]string, len(ksg.sets))
+	setsMetadata := make([]map[string]interface{}, len(ksg.sets))
+	for i, ks := range ksg.sets {
+		setsIDs[i] = ks.id
+		setsMetadata[i] = ks.Metadata
+	}
+
+	metadata := KmerSetMetadata{
+		ID:           ksg.id,
+		K:            ksg.k,
+		Type:         "KmerSetGroup",
+		Size:         len(ksg.sets),
+		Files:        files,
+		SetsIDs:      setsIDs,          // IDs de chaque set
+		UserMetadata: ksg.Metadata,     // Métadonnées du groupe
+		SetsMetadata: setsMetadata,     // Métadonnées de chaque set
+	}
+
+	// Sauvegarder les métadonnées
+	if err := saveMetadata(filepath.Join(directory, "metadata."+format.String()), metadata, format); err != nil {
+		return err
+	}
+
+	// Sauvegarder chaque bitmap
+	for i, ks := range ksg.sets {
+		bitmapPath := filepath.Join(directory, files[i])
+		file, err := os.Create(bitmapPath)
+		if err != nil {
+			return fmt.Errorf("failed to create bitmap file %s: %w", bitmapPath, err)
+		}
+
+		if _, err := ks.bitmap.WriteTo(file); err != nil {
+			file.Close()
+			return fmt.Errorf("failed to write bitmap %d: %w", i, err)
+		}
+		file.Close()
+	}
+
+	return nil
+}
+
+// LoadKmerSetGroup charge un KmerSetGroup depuis un répertoire
+func LoadKmerSetGroup(directory string) (*KmerSetGroup, error) {
+	// Lire les métadonnées (essayer tous les formats)
+	metadata, err := loadMetadata(directory)
+	if err != nil {
+		return nil, err
+	}
+
+	// Vérifier le type
+	if metadata.Type != "KmerSetGroup" {
+		return nil, fmt.Errorf("invalid type: expected KmerSetGroup, got %s", metadata.Type)
+	}
+
+	// Vérifier la cohérence
+	if metadata.Size != len(metadata.Files) {
+		return nil, fmt.Errorf("size mismatch: size=%d but %d files listed", metadata.Size, len(metadata.Files))
+	}
+
+	// Créer le groupe
+	ksg := NewKmerSetGroup(metadata.K, metadata.Size)
+
+	// Charger l'ID du groupe
+	ksg.id = metadata.ID
+
+	// Charger les métadonnées du groupe
+	if metadata.UserMetadata != nil {
+		ksg.Metadata = metadata.UserMetadata
+	}
+
+	// Charger les IDs de chaque KmerSet
+	if metadata.SetsIDs != nil && len(metadata.SetsIDs) == metadata.Size {
+		for i := range ksg.sets {
+			ksg.sets[i].id = metadata.SetsIDs[i]
+		}
+	}
+
+	// Charger les métadonnées de chaque KmerSet individuel
+	if metadata.SetsMetadata != nil {
+		if len(metadata.SetsMetadata) != metadata.Size {
+			return nil, fmt.Errorf("sets metadata size mismatch: expected %d, got %d", metadata.Size, len(metadata.SetsMetadata))
+		}
+		for i := range ksg.sets {
+			ksg.sets[i].Metadata = metadata.SetsMetadata[i]
+		}
+	}
+
+	// Charger chaque bitmap
+	for i, filename := range metadata.Files {
+		bitmapPath := filepath.Join(directory, filename)
+		file, err := os.Open(bitmapPath)
+		if err != nil {
+			return nil, fmt.Errorf("failed to open bitmap file %s: %w", bitmapPath, err)
+		}
+
+		if _, err := ksg.sets[i].bitmap.ReadFrom(file); err != nil {
+			file.Close()
+			return nil, fmt.Errorf("failed to read bitmap %d: %w", i, err)
+		}
+		file.Close()
+	}
+
+	return ksg, nil
+}
+
+// saveMetadata sauvegarde les métadonnées dans le format spécifié
+func saveMetadata(path string, metadata KmerSetMetadata, format MetadataFormat) error {
+	file, err := os.Create(path)
+	if err != nil {
+		return fmt.Errorf("failed to create metadata file %s: %w", path, err)
+	}
+	defer file.Close()
+
+	var encoder interface{ Encode(interface{}) error }
+
+	switch format {
+	case FormatTOML:
+		encoder = toml.NewEncoder(file)
+	case FormatYAML:
+		encoder = yaml.NewEncoder(file)
+	case FormatJSON:
+		jsonEncoder := json.NewEncoder(file)
+		jsonEncoder.SetIndent("", "  ")
+		encoder = jsonEncoder
+	default:
+		return fmt.Errorf("unsupported format: %v", format)
+	}
+
+	if err := encoder.Encode(metadata); err != nil {
+		return fmt.Errorf("failed to encode metadata: %w", err)
+	}
+
+	return nil
+}
+
+// loadMetadata charge les métadonnées depuis un répertoire
+// Essaie tous les formats (TOML, YAML, JSON) dans l'ordre
+func loadMetadata(directory string) (*KmerSetMetadata, error) {
+	formats := []MetadataFormat{FormatTOML, FormatYAML, FormatJSON}
+
+	var lastErr error
+	for _, format := range formats {
+		path := filepath.Join(directory, "metadata."+format.String())
+
+		// Vérifier si le fichier existe
+		if _, err := os.Stat(path); os.IsNotExist(err) {
+			continue
+		}
+
+		metadata, err := loadMetadataFromFile(path, format)
+		if err != nil {
+			lastErr = err
+			continue
+		}
+		return metadata, nil
+	}
+
+	if lastErr != nil {
+		return nil, fmt.Errorf("failed to load metadata: %w", lastErr)
+	}
+	return nil, fmt.Errorf("no metadata file found in %s (tried .toml, .yaml, .json)", directory)
+}
+
+// loadMetadataFromFile charge les métadonnées depuis un fichier spécifique
+func loadMetadataFromFile(path string, format MetadataFormat) (*KmerSetMetadata, error) {
+	file, err := os.Open(path)
+	if err != nil {
+		return nil, fmt.Errorf("failed to open metadata file %s: %w", path, err)
+	}
+	defer file.Close()
+
+	var metadata KmerSetMetadata
+	var decoder interface{ Decode(interface{}) error }
+
+	switch format {
+	case FormatTOML:
+		decoder = toml.NewDecoder(file)
+	case FormatYAML:
+		decoder = yaml.NewDecoder(file)
+	case FormatJSON:
+		decoder = json.NewDecoder(file)
+	default:
+		return nil, fmt.Errorf("unsupported format: %v", format)
+	}
+
+	if err := decoder.Decode(&metadata); err != nil {
+		return nil, fmt.Errorf("failed to decode metadata: %w", err)
+	}
+
+	return &metadata, nil
+}
+
+// DetectFormat détecte le format des métadonnées dans un répertoire
+func DetectFormat(directory string) (MetadataFormat, error) {
+	formats := []MetadataFormat{FormatTOML, FormatYAML, FormatJSON}
+
+	for _, format := range formats {
+		path := filepath.Join(directory, "metadata."+format.String())
+		if _, err := os.Stat(path); err == nil {
+			return format, nil
+		}
+	}
+
+	return FormatTOML, fmt.Errorf("no metadata file found in %s", directory)
+}
+
+// IsKmerSetDirectory vérifie si un répertoire contient un KmerSet ou KmerSetGroup
+func IsKmerSetDirectory(directory string) (bool, string, error) {
+	metadata, err := loadMetadata(directory)
+	if err != nil {
+		return false, "", err
+	}
+
+	return true, metadata.Type, nil
+}
+
+// ListBitmapFiles liste tous les fichiers .roaring dans un répertoire
+func ListBitmapFiles(directory string) ([]string, error) {
+	entries, err := os.ReadDir(directory)
+	if err != nil {
+		return nil, fmt.Errorf("failed to read directory %s: %w", directory, err)
+	}
+
+	var files []string
+	for _, entry := range entries {
+		if !entry.IsDir() && strings.HasSuffix(entry.Name(), ".roaring") {
+			files = append(files, entry.Name())
+		}
+	}
+
+	return files, nil
+}

pkg/obikmer/kmer_set_test.go

@@ -0,0 +1,272 @@
+package obikmer
+
+import (
+	"math"
+	"testing"
+)
+
+func TestJaccardDistanceIdentical(t *testing.T) {
+	ks1 := NewKmerSet(5)
+	ks1.AddKmerCode(100)
+	ks1.AddKmerCode(200)
+	ks1.AddKmerCode(300)
+
+	ks2 := NewKmerSet(5)
+	ks2.AddKmerCode(100)
+	ks2.AddKmerCode(200)
+	ks2.AddKmerCode(300)
+
+	distance := ks1.JaccardDistance(ks2)
+	similarity := ks1.JaccardSimilarity(ks2)
+
+	if distance != 0.0 {
+		t.Errorf("Expected distance 0.0 for identical sets, got %f", distance)
+	}
+
+	if similarity != 1.0 {
+		t.Errorf("Expected similarity 1.0 for identical sets, got %f", similarity)
+	}
+}
+
+func TestJaccardDistanceDisjoint(t *testing.T) {
+	ks1 := NewKmerSet(5)
+	ks1.AddKmerCode(100)
+	ks1.AddKmerCode(200)
+	ks1.AddKmerCode(300)
+
+	ks2 := NewKmerSet(5)
+	ks2.AddKmerCode(400)
+	ks2.AddKmerCode(500)
+	ks2.AddKmerCode(600)
+
+	distance := ks1.JaccardDistance(ks2)
+	similarity := ks1.JaccardSimilarity(ks2)
+
+	if distance != 1.0 {
+		t.Errorf("Expected distance 1.0 for disjoint sets, got %f", distance)
+	}
+
+	if similarity != 0.0 {
+		t.Errorf("Expected similarity 0.0 for disjoint sets, got %f", similarity)
+	}
+}
+
+func TestJaccardDistancePartialOverlap(t *testing.T) {
+	// Set 1: {1, 2, 3}
+	ks1 := NewKmerSet(5)
+	ks1.AddKmerCode(1)
+	ks1.AddKmerCode(2)
+	ks1.AddKmerCode(3)
+
+	// Set 2: {2, 3, 4}
+	ks2 := NewKmerSet(5)
+	ks2.AddKmerCode(2)
+	ks2.AddKmerCode(3)
+	ks2.AddKmerCode(4)
+
+	// Intersection: {2, 3} -> cardinality = 2
+	// Union: {1, 2, 3, 4} -> cardinality = 4
+	// Similarity = 2/4 = 0.5
+	// Distance = 1 - 0.5 = 0.5
+
+	distance := ks1.JaccardDistance(ks2)
+	similarity := ks1.JaccardSimilarity(ks2)
+
+	expectedDistance := 0.5
+	expectedSimilarity := 0.5
+
+	if math.Abs(distance-expectedDistance) > 1e-10 {
+		t.Errorf("Expected distance %f, got %f", expectedDistance, distance)
+	}
+
+	if math.Abs(similarity-expectedSimilarity) > 1e-10 {
+		t.Errorf("Expected similarity %f, got %f", expectedSimilarity, similarity)
+	}
+}
+
+func TestJaccardDistanceOneSubsetOfOther(t *testing.T) {
+	// Set 1: {1, 2}
+	ks1 := NewKmerSet(5)
+	ks1.AddKmerCode(1)
+	ks1.AddKmerCode(2)
+
+	// Set 2: {1, 2, 3, 4}
+	ks2 := NewKmerSet(5)
+	ks2.AddKmerCode(1)
+	ks2.AddKmerCode(2)
+	ks2.AddKmerCode(3)
+	ks2.AddKmerCode(4)
+
+	// Intersection: {1, 2} -> cardinality = 2
+	// Union: {1, 2, 3, 4} -> cardinality = 4
+	// Similarity = 2/4 = 0.5
+	// Distance = 1 - 0.5 = 0.5
+
+	distance := ks1.JaccardDistance(ks2)
+	similarity := ks1.JaccardSimilarity(ks2)
+
+	expectedDistance := 0.5
+	expectedSimilarity := 0.5
+
+	if math.Abs(distance-expectedDistance) > 1e-10 {
+		t.Errorf("Expected distance %f, got %f", expectedDistance, distance)
+	}
+
+	if math.Abs(similarity-expectedSimilarity) > 1e-10 {
+		t.Errorf("Expected similarity %f, got %f", expectedSimilarity, similarity)
+	}
+}
+
+func TestJaccardDistanceEmptySets(t *testing.T) {
+	ks1 := NewKmerSet(5)
+	ks2 := NewKmerSet(5)
+
+	distance := ks1.JaccardDistance(ks2)
+	similarity := ks1.JaccardSimilarity(ks2)
+
+	// By convention, distance = 1.0 for empty sets
+	if distance != 1.0 {
+		t.Errorf("Expected distance 1.0 for empty sets, got %f", distance)
+	}
+
+	if similarity != 0.0 {
+		t.Errorf("Expected similarity 0.0 for empty sets, got %f", similarity)
+	}
+}
+
+func TestJaccardDistanceOneEmpty(t *testing.T) {
+	ks1 := NewKmerSet(5)
+	ks1.AddKmerCode(1)
+	ks1.AddKmerCode(2)
+	ks1.AddKmerCode(3)
+
+	ks2 := NewKmerSet(5)
+
+	distance := ks1.JaccardDistance(ks2)
+	similarity := ks1.JaccardSimilarity(ks2)
+
+	// Intersection: {} -> cardinality = 0
+	// Union: {1, 2, 3} -> cardinality = 3
+	// Similarity = 0/3 = 0.0
+	// Distance = 1.0
+
+	if distance != 1.0 {
+		t.Errorf("Expected distance 1.0 when one set is empty, got %f", distance)
+	}
+
+	if similarity != 0.0 {
+		t.Errorf("Expected similarity 0.0 when one set is empty, got %f", similarity)
+	}
+}
+
+func TestJaccardDistanceDifferentK(t *testing.T) {
+	ks1 := NewKmerSet(5)
+	ks1.AddKmerCode(1)
+
+	ks2 := NewKmerSet(7)
+	ks2.AddKmerCode(1)
+
+	defer func() {
+		if r := recover(); r == nil {
+			t.Errorf("Expected panic when computing Jaccard distance with different k values")
+		}
+	}()
+
+	_ = ks1.JaccardDistance(ks2)
+}
+
+func TestJaccardDistanceSimilarityRelation(t *testing.T) {
+	// Test that distance + similarity = 1.0 for all cases
+	testCases := []struct {
+		name string
+		ks1  *KmerSet
+		ks2  *KmerSet
+	}{
+		{
+			name: "partial overlap",
+			ks1: func() *KmerSet {
+				ks := NewKmerSet(5)
+				ks.AddKmerCode(1)
+				ks.AddKmerCode(2)
+				ks.AddKmerCode(3)
+				return ks
+			}(),
+			ks2: func() *KmerSet {
+				ks := NewKmerSet(5)
+				ks.AddKmerCode(2)
+				ks.AddKmerCode(3)
+				ks.AddKmerCode(4)
+				ks.AddKmerCode(5)
+				return ks
+			}(),
+		},
+		{
+			name: "identical",
+			ks1: func() *KmerSet {
+				ks := NewKmerSet(5)
+				ks.AddKmerCode(10)
+				ks.AddKmerCode(20)
+				return ks
+			}(),
+			ks2: func() *KmerSet {
+				ks := NewKmerSet(5)
+				ks.AddKmerCode(10)
+				ks.AddKmerCode(20)
+				return ks
+			}(),
+		},
+		{
+			name: "disjoint",
+			ks1: func() *KmerSet {
+				ks := NewKmerSet(5)
+				ks.AddKmerCode(1)
+				return ks
+			}(),
+			ks2: func() *KmerSet {
+				ks := NewKmerSet(5)
+				ks.AddKmerCode(100)
+				return ks
+			}(),
+		},
+	}
+
+	for _, tc := range testCases {
+		t.Run(tc.name, func(t *testing.T) {
+			distance := tc.ks1.JaccardDistance(tc.ks2)
+			similarity := tc.ks1.JaccardSimilarity(tc.ks2)
+
+			sum := distance + similarity
+
+			if math.Abs(sum-1.0) > 1e-10 {
+				t.Errorf("Expected distance + similarity = 1.0, got %f + %f = %f",
+					distance, similarity, sum)
+			}
+		})
+	}
+}
+
+func TestJaccardDistanceSymmetry(t *testing.T) {
+	ks1 := NewKmerSet(5)
+	ks1.AddKmerCode(1)
+	ks1.AddKmerCode(2)
+	ks1.AddKmerCode(3)
+
+	ks2 := NewKmerSet(5)
+	ks2.AddKmerCode(2)
+	ks2.AddKmerCode(3)
+	ks2.AddKmerCode(4)
+
+	distance1 := ks1.JaccardDistance(ks2)
+	distance2 := ks2.JaccardDistance(ks1)
+
+	similarity1 := ks1.JaccardSimilarity(ks2)
+	similarity2 := ks2.JaccardSimilarity(ks1)
+
+	if math.Abs(distance1-distance2) > 1e-10 {
+		t.Errorf("Jaccard distance not symmetric: %f vs %f", distance1, distance2)
+	}
+
+	if math.Abs(similarity1-similarity2) > 1e-10 {
+		t.Errorf("Jaccard similarity not symmetric: %f vs %f", similarity1, similarity2)
+	}
+}

pkg/obikmer/kmernorm_test.go

@@ -1,77 +0,0 @@
-package obikmer
-
-import "testing"
-
-func TestNormalize(t *testing.T) {
-	tests := []struct {
-		name     string
-		kmer     string
-		expected string
-	}{
-		// Test avec k=1
-		{"k=1 a", "a", "a"},
-		{"k=1 c", "c", "c"},
-
-		// Test avec k=2
-		{"k=2 ca", "ca", "ac"},
-		{"k=2 ac", "ac", "ac"},
-
-		// Test avec k=4
-		{"k=4 acgt", "acgt", "acgt"},
-		{"k=4 cgta", "cgta", "acgt"},
-		{"k=4 gtac", "gtac", "acgt"},
-		{"k=4 tacg", "tacg", "acgt"},
-		{"k=4 tgca", "tgca", "atgc"},
-
-		// Test avec k=6
-		{"k=6 aaaaaa", "aaaaaa", "aaaaaa"},
-		{"k=6 tttttt", "tttttt", "tttttt"},
-
-		// Test avec k>6 (calcul à la volée)
-		{"k=7 aaaaaaa", "aaaaaaa", "aaaaaaa"},
-		{"k=7 tgcatgc", "tgcatgc", "atgctgc"},
-		{"k=7 gcatgct", "gcatgct", "atgctgc"},
-		{"k=8 acgtacgt", "acgtacgt", "acgtacgt"},
-		{"k=8 gtacgtac", "gtacgtac", "acgtacgt"},
-		{"k=10 acgtacgtac", "acgtacgtac", "acacgtacgt"},
-	}
-
-	for _, tt := range tests {
-		t.Run(tt.name, func(t *testing.T) {
-			result := Normalize(tt.kmer)
-			if result != tt.expected {
-				t.Errorf("Normalize(%q) = %q, want %q", tt.kmer, result, tt.expected)
-			}
-		})
-	}
-}
-
-func TestNormalizeTableConsistency(t *testing.T) {
-	// Vérifier que tous les kmers de la table donnent le bon résultat
-	// en comparant avec le calcul à la volée
-	for kmer, expected := range LexicographicNormalization {
-		calculated := getCanonicalCircular(kmer)
-		if calculated != expected {
-			t.Errorf("Table inconsistency for %q: table=%q, calculated=%q",
-				kmer, expected, calculated)
-		}
-	}
-}
-
-func BenchmarkNormalizeSmall(b *testing.B) {
-	// Benchmark pour k<=6 (utilise la table)
-	kmer := "acgtac"
-	b.ResetTimer()
-	for i := 0; i < b.N; i++ {
-		_ = Normalize(kmer)
-	}
-}
-
-func BenchmarkNormalizeLarge(b *testing.B) {
-	// Benchmark pour k>6 (calcul à la volée)
-	kmer := "acgtacgtac"
-	b.ResetTimer()
-	for i := 0; i < b.N; i++ {
-		_ = Normalize(kmer)
-	}
-}

pkg/obikmer/kmernormint_test.go

@@ -1,357 +0,0 @@
-package obikmer
-
-import (
-	"fmt"
-	"testing"
-)
-
-func TestEncodeDecodeKmer(t *testing.T) {
-	tests := []struct {
-		kmer string
-		code int
-	}{
-		{"a", 0},
-		{"c", 1},
-		{"g", 2},
-		{"t", 3},
-		{"aa", 0},
-		{"ac", 1},
-		{"ca", 4},
-		{"acgt", 27}, // 0b00011011
-		{"cgta", 108}, // 0b01101100
-		{"tttt", 255}, // 0b11111111
-	}
-
-	for _, tt := range tests {
-		t.Run(tt.kmer, func(t *testing.T) {
-			// Test encoding
-			encoded := EncodeKmer(tt.kmer)
-			if encoded != tt.code {
-				t.Errorf("EncodeKmer(%q) = %d, want %d", tt.kmer, encoded, tt.code)
-			}
-
-			// Test decoding
-			decoded := DecodeKmer(tt.code, len(tt.kmer))
-			if decoded != tt.kmer {
-				t.Errorf("DecodeKmer(%d, %d) = %q, want %q", tt.code, len(tt.kmer), decoded, tt.kmer)
-			}
-		})
-	}
-}
-
-func TestNormalizeInt(t *testing.T) {
-	tests := []struct {
-		name     string
-		kmer     string
-		expected string
-	}{
-		// Test avec k=1
-		{"k=1 a", "a", "a"},
-		{"k=1 c", "c", "c"},
-
-		// Test avec k=2
-		{"k=2 ca", "ca", "ac"},
-		{"k=2 ac", "ac", "ac"},
-		{"k=2 ta", "ta", "at"},
-
-		// Test avec k=4 - toutes les rotations de "acgt"
-		{"k=4 acgt", "acgt", "acgt"},
-		{"k=4 cgta", "cgta", "acgt"},
-		{"k=4 gtac", "gtac", "acgt"},
-		{"k=4 tacg", "tacg", "acgt"},
-
-		// Test avec k=4 - rotations de "tgca"
-		{"k=4 tgca", "tgca", "atgc"},
-		{"k=4 gcat", "gcat", "atgc"},
-		{"k=4 catg", "catg", "atgc"},
-		{"k=4 atgc", "atgc", "atgc"},
-
-		// Test avec k=3 - rotations de "atg"
-		{"k=3 atg", "atg", "atg"},
-		{"k=3 tga", "tga", "atg"},
-		{"k=3 gat", "gat", "atg"},
-
-		// Test avec k=6
-		{"k=6 aaaaaa", "aaaaaa", "aaaaaa"},
-		{"k=6 tttttt", "tttttt", "tttttt"},
-
-		// Test avec k>6 (calcul à la volée)
-		{"k=7 aaaaaaa", "aaaaaaa", "aaaaaaa"},
-		{"k=7 tgcatgc", "tgcatgc", "atgctgc"},
-		{"k=7 gcatgct", "gcatgct", "atgctgc"},
-		{"k=8 acgtacgt", "acgtacgt", "acgtacgt"},
-		{"k=8 gtacgtac", "gtacgtac", "acgtacgt"},
-	}
-
-	for _, tt := range tests {
-		t.Run(tt.name, func(t *testing.T) {
-			kmerCode := EncodeKmer(tt.kmer)
-			expectedCode := EncodeKmer(tt.expected)
-
-			result := NormalizeInt(kmerCode, len(tt.kmer))
-
-			if result != expectedCode {
-				resultKmer := DecodeKmer(result, len(tt.kmer))
-				t.Errorf("NormalizeInt(%q) = %q (code %d), want %q (code %d)",
-					tt.kmer, resultKmer, result, tt.expected, expectedCode)
-			}
-		})
-	}
-}
-
-func TestNormalizeIntConsistencyWithString(t *testing.T) {
-	// Vérifier que NormalizeInt donne le même résultat que Normalize
-	// pour tous les k-mers de taille 1 à 4 (pour ne pas trop ralentir les tests)
-	bases := []byte{'a', 'c', 'g', 't'}
-
-	var testKmers func(current string, maxSize int)
-	testKmers = func(current string, maxSize int) {
-		if len(current) > 0 {
-			// Test normalization
-			normalizedStr := Normalize(current)
-			normalizedStrCode := EncodeKmer(normalizedStr)
-
-			kmerCode := EncodeKmer(current)
-			normalizedInt := NormalizeInt(kmerCode, len(current))
-
-			if normalizedInt != normalizedStrCode {
-				normalizedIntStr := DecodeKmer(normalizedInt, len(current))
-				t.Errorf("Inconsistency for %q: Normalize=%q (code %d), NormalizeInt=%q (code %d)",
-					current, normalizedStr, normalizedStrCode, normalizedIntStr, normalizedInt)
-			}
-		}
-
-		if len(current) < maxSize {
-			for _, base := range bases {
-				testKmers(current+string(base), maxSize)
-			}
-		}
-	}
-
-	testKmers("", 4) // Test jusqu'à k=4 pour rester raisonnable
-}
-
-func TestCircularRotations(t *testing.T) {
-	// Test que toutes les rotations circulaires donnent le même canonical
-	tests := []struct {
-		kmers []string
-		canonical string
-	}{
-		{[]string{"atg", "tga", "gat"}, "atg"},
-		{[]string{"acgt", "cgta", "gtac", "tacg"}, "acgt"},
-		{[]string{"tgca", "gcat", "catg", "atgc"}, "atgc"},
-	}
-
-	for _, tt := range tests {
-		canonicalCode := EncodeKmer(tt.canonical)
-
-		for _, kmer := range tt.kmers {
-			kmerCode := EncodeKmer(kmer)
-			result := NormalizeInt(kmerCode, len(kmer))
-
-			if result != canonicalCode {
-				resultKmer := DecodeKmer(result, len(kmer))
-				t.Errorf("NormalizeInt(%q) = %q, want %q", kmer, resultKmer, tt.canonical)
-			}
-		}
-	}
-}
-
-func BenchmarkNormalizeIntSmall(b *testing.B) {
-	// Benchmark pour k<=6 (utilise la table)
-	kmer := "acgtac"
-	kmerCode := EncodeKmer(kmer)
-	kmerSize := len(kmer)
-
-	b.ResetTimer()
-	for i := 0; i < b.N; i++ {
-		_ = NormalizeInt(kmerCode, kmerSize)
-	}
-}
-
-func BenchmarkNormalizeIntLarge(b *testing.B) {
-	// Benchmark pour k>6 (calcul à la volée)
-	kmer := "acgtacgtac"
-	kmerCode := EncodeKmer(kmer)
-	kmerSize := len(kmer)
-
-	b.ResetTimer()
-	for i := 0; i < b.N; i++ {
-		_ = NormalizeInt(kmerCode, kmerSize)
-	}
-}
-
-func BenchmarkEncodeKmer(b *testing.B) {
-	kmer := "acgtacgt"
-
-	b.ResetTimer()
-	for i := 0; i < b.N; i++ {
-		_ = EncodeKmer(kmer)
-	}
-}
-
-func TestCanonicalKmerCount(t *testing.T) {
-	// Test exact counts for k=1 to 6
-	tests := []struct {
-		k        int
-		expected int
-	}{
-		{1, 4},
-		{2, 10},
-		{3, 24},
-		{4, 70},
-		{5, 208},
-		{6, 700},
-	}
-
-	for _, tt := range tests {
-		t.Run(fmt.Sprintf("k=%d", tt.k), func(t *testing.T) {
-			result := CanonicalKmerCount(tt.k)
-			if result != tt.expected {
-				t.Errorf("CanonicalKmerCount(%d) = %d, want %d", tt.k, result, tt.expected)
-			}
-		})
-	}
-
-	// Verify counts match table sizes
-	for k := 1; k <= 6; k++ {
-		// Count unique canonical codes in the table
-		uniqueCodes := make(map[int]bool)
-		for _, canonicalCode := range LexicographicNormalizationInt[k] {
-			uniqueCodes[canonicalCode] = true
-		}
-
-		expected := len(uniqueCodes)
-		result := CanonicalKmerCount(k)
-
-		if result != expected {
-			t.Errorf("CanonicalKmerCount(%d) = %d, but table has %d unique canonical codes",
-				k, result, expected)
-		}
-	}
-}
-
-func TestNecklaceCountFormula(t *testing.T) {
-	// Verify Moreau's formula gives the same results as hardcoded values for k=1 to 6
-	// and compute exact values for k=7+
-	tests := []struct {
-		k        int
-		expected int
-	}{
-		{1, 4},
-		{2, 10},
-		{3, 24},
-		{4, 70},
-		{5, 208},
-		{6, 700},
-	}
-
-	for _, tt := range tests {
-		t.Run(fmt.Sprintf("k=%d", tt.k), func(t *testing.T) {
-			result := necklaceCount(tt.k, 4)
-			if result != tt.expected {
-				t.Errorf("necklaceCount(%d, 4) = %d, want %d", tt.k, result, tt.expected)
-			}
-		})
-	}
-}
-
-func TestNecklaceCountByBruteForce(t *testing.T) {
-	// Verify necklace count for k=7 and k=8 by brute force
-	// Generate all 4^k k-mers and count unique normalized ones
-	bases := []byte{'a', 'c', 'g', 't'}
-
-	for _, k := range []int{7, 8} {
-		t.Run(fmt.Sprintf("k=%d", k), func(t *testing.T) {
-			unique := make(map[int]bool)
-
-			// Generate all possible k-mers
-			var generate func(current int, depth int)
-			generate = func(current int, depth int) {
-				if depth == k {
-					// Normalize and add to set
-					normalized := NormalizeInt(current, k)
-					unique[normalized] = true
-					return
-				}
-
-				for _, base := range bases {
-					newCode := (current << 2) | int(EncodeNucleotide(base))
-					generate(newCode, depth+1)
-				}
-			}
-
-			generate(0, 0)
-
-			bruteForceCount := len(unique)
-			formulaCount := necklaceCount(k, 4)
-
-			if bruteForceCount != formulaCount {
-				t.Errorf("For k=%d: brute force count = %d, formula count = %d",
-					k, bruteForceCount, formulaCount)
-			}
-
-			t.Logf("k=%d: unique canonical k-mers = %d (formula matches brute force)", k, bruteForceCount)
-		})
-	}
-}
-
-func TestEulerTotient(t *testing.T) {
-	tests := []struct {
-		n        int
-		expected int
-	}{
-		{1, 1},
-		{2, 1},
-		{3, 2},
-		{4, 2},
-		{5, 4},
-		{6, 2},
-		{7, 6},
-		{8, 4},
-		{9, 6},
-		{10, 4},
-		{12, 4},
-		{15, 8},
-		{20, 8},
-	}
-
-	for _, tt := range tests {
-		t.Run(fmt.Sprintf("φ(%d)", tt.n), func(t *testing.T) {
-			result := eulerTotient(tt.n)
-			if result != tt.expected {
-				t.Errorf("eulerTotient(%d) = %d, want %d", tt.n, result, tt.expected)
-			}
-		})
-	}
-}
-
-func TestDivisors(t *testing.T) {
-	tests := []struct {
-		n        int
-		expected []int
-	}{
-		{1, []int{1}},
-		{2, []int{1, 2}},
-		{6, []int{1, 2, 3, 6}},
-		{12, []int{1, 2, 3, 4, 6, 12}},
-		{15, []int{1, 3, 5, 15}},
-		{20, []int{1, 2, 4, 5, 10, 20}},
-	}
-
-	for _, tt := range tests {
-		t.Run(fmt.Sprintf("divisors(%d)", tt.n), func(t *testing.T) {
-			result := divisors(tt.n)
-			if len(result) != len(tt.expected) {
-				t.Errorf("divisors(%d) = %v, want %v", tt.n, result, tt.expected)
-				return
-			}
-			for i := range result {
-				if result[i] != tt.expected[i] {
-					t.Errorf("divisors(%d) = %v, want %v", tt.n, result, tt.expected)
-					return
-				}
-			}
-		})
-	}
-}

pkg/obioptions/version.go

@@ -1,20 +1,14 @@
 package obioptions
 
-import (
-	"fmt"
-)
+// Version is automatically updated by the Makefile from version.txt
+// The patch number (third digit) is incremented on each push to the repository
 
-// TODO: The version number is extracted from git. This induces that the version
-// corresponds to the last commit, and not the one when the file will be
-// commited
-
-var _Commit = "52244cd"
-var _Version = "Release 4.4.0"
+var _Version = "Release 4.4.4"
 
 // Version returns the version of the obitools package.
 //
 // No parameters.
 // Returns a string representing the version of the obitools package.
 func VersionString() string {
-	return fmt.Sprintf("%s (%s)", _Version, _Commit)
+	return _Version
 }

pkg/obitools/obilowmask/obilowmask.go

@@ -48,12 +48,12 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
 	// - We calculate the entropy of a distribution where all words appear
 	//   cov or cov+1 times (most uniform distribution possible)
 	//
-	// IMPORTANT: Uses CanonicalKmerCount to get the actual number of canonical words
+	// IMPORTANT: Uses CanonicalCircularKmerCount to get the actual number of canonical words
 	// after circular normalization (e.g., "atg", "tga", "gat" → all "atg").
 	// This is much smaller than 4^word_size (e.g., 10 instead of 16 for word_size=2).
 	emax := func(lseq, word_size int) float64 {
-		nw := lseq - word_size + 1                  // Number of words in a k-mer of length lseq
-		na := obikmer.CanonicalKmerCount(word_size) // Number of canonical words after normalization
+		nw := lseq - word_size + 1                            // Number of words in a k-mer of length lseq
+		na := obikmer.CanonicalCircularKmerCount(word_size) // Number of canonical words after normalization
 
 		// Case 1: Fewer positions than possible words
 		// Maximum entropy is simply log(nw) since we can have at most nw different words
@@ -215,7 +215,8 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
 			// *** CIRCULAR NORMALIZATION ***
 			// Convert word to its canonical form (smallest by circular rotation)
 			// This is where "atg", "tga", "gat" all become "atg"
-			words[i] = obikmer.NormalizeInt(word_index, wordSize)
+			// Now using uint64-based NormalizeCircular for better performance
+			words[i] = int(obikmer.NormalizeCircular(uint64(word_index), wordSize))
 		}
 
 		// ========================================================================

version.txt

@@ -0,0 +1 @@
+4.4.4