mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-09-24 02:10:41 +00:00
Compare commits
39
Commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
cdc72c5346 | ||
|
|
82a9972be7 | ||
|
|
ff6e515b2a | ||
|
|
cd0c525f50 | ||
|
|
abe935aa18 | ||
|
|
8dd32dc1bf | ||
|
|
6ee8750635 | ||
|
|
8c318c480e | ||
|
|
09fbc217d3 | ||
|
|
3d2e205722 | ||
|
|
623116ab13 | ||
|
|
1e4509cb63 | ||
|
|
b33d7705a8 | ||
|
|
1342c83db6 | ||
|
|
b246025907 | ||
|
|
761e0dbed3 | ||
|
|
a7ea47624b | ||
|
|
61e346658e | ||
|
|
1ba1294b11 | ||
|
|
b2476fffcb | ||
|
|
b05404721e | ||
|
|
c57e788459 | ||
|
|
1cecf23978 | ||
|
|
4c824ef9b7 | ||
|
|
1ce5da9bee | ||
|
|
dc23d9de9a | ||
|
|
aa9d7bbf72 | ||
|
|
db22d20d0a | ||
|
|
7c05bdb01c | ||
|
|
b6542c4523 | ||
|
|
ac41dd8a22 | ||
|
|
bebbbbfe7d | ||
|
|
c6e04265f1 | ||
|
|
9babcc0fae | ||
|
|
e775f7e256 | ||
|
|
f2937af1ad | ||
|
|
56c1f4180c | ||
|
|
f78543ee75 | ||
|
|
a016ad5b8a |
@@ -16,6 +16,7 @@
|
||||
**/*.tgz
|
||||
**/*.yaml
|
||||
**/*.csv
|
||||
**/*.pb.gz
|
||||
xx
|
||||
|
||||
.rhistory
|
||||
@@ -33,3 +34,4 @@ LLM/**
|
||||
entropy.html
|
||||
bug_id.txt
|
||||
obilowmask_ref
|
||||
test_*
|
||||
|
||||
@@ -2,6 +2,13 @@
|
||||
#export GOBIN=$(GOPATH)/bin
|
||||
#export PATH=$(GOBIN):$(shell echo $${PATH})
|
||||
|
||||
.DEFAULT_GOAL := all
|
||||
|
||||
GREEN := \033[0;32m
|
||||
YELLOW := \033[0;33m
|
||||
BLUE := \033[0;34m
|
||||
NC := \033[0m
|
||||
|
||||
GOFLAGS=
|
||||
GOCMD=go
|
||||
GOBUILD=$(GOCMD) build $(GOFLAGS)
|
||||
@@ -60,6 +67,28 @@ endif
|
||||
|
||||
OUTPUT:=$(shell mktemp)
|
||||
|
||||
help:
|
||||
@printf "$(GREEN)OBITools4 Makefile$(NC)\n\n"
|
||||
@printf "$(BLUE)Main targets:$(NC)\n"
|
||||
@printf " %-20s %s\n" "all" "Build all obitools (default)"
|
||||
@printf " %-20s %s\n" "obitools" "Build all obitools binaries to build/"
|
||||
@printf " %-20s %s\n" "test" "Run Go unit tests"
|
||||
@printf " %-20s %s\n" "obitests" "Run integration tests (obitests/)"
|
||||
@printf " %-20s %s\n" "bump-version" "Increment patch version (or set with VERSION=x.y.z)"
|
||||
@printf " %-20s %s\n" "update-deps" "Update all Go dependencies"
|
||||
@printf "\n$(BLUE)Jujutsu workflow:$(NC)\n"
|
||||
@printf " %-20s %s\n" "jjnew" "Document current commit and start a new one"
|
||||
@printf " %-20s %s\n" "jjpush" "Release: describe, bump, generate notes, push PR, tag (VERSION=x.y.z optional)"
|
||||
@printf " %-20s %s\n" "jjfetch" "Fetch latest commits from origin"
|
||||
@printf "\n$(BLUE)Required tools:$(NC)\n"
|
||||
@printf " %-20s " "go"; command -v go >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(go version)" || printf "$(YELLOW)✗ not found$(NC)\n"
|
||||
@printf " %-20s " "git"; command -v git >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(git --version)" || printf "$(YELLOW)✗ not found$(NC)\n"
|
||||
@printf " %-20s " "jj"; command -v jj >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(jj --version)" || printf "$(YELLOW)✗ not found$(NC)\n"
|
||||
@printf " %-20s " "gh"; command -v gh >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(gh --version | head -1)" || printf "$(YELLOW)✗ not found$(NC) (brew install gh)\n"
|
||||
@printf "\n$(BLUE)Optional tools (release notes generation):$(NC)\n"
|
||||
@printf " %-20s " "aichat"; command -v aichat >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(aichat --version)" || printf "$(YELLOW)✗ not found$(NC) (https://github.com/sigoden/aichat)\n"
|
||||
@printf " %-20s " "jq"; command -v jq >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(jq --version)" || printf "$(YELLOW)✗ not found$(NC) (brew install jq)\n"
|
||||
|
||||
all: install-githook obitools
|
||||
|
||||
obitools: $(patsubst %,$(OBITOOLS_PREFIX)%,$(OBITOOLS))
|
||||
@@ -106,8 +135,12 @@ pkg/obioptions/version.go: version.txt .FORCE
|
||||
@rm -f $(OUTPUT)
|
||||
|
||||
bump-version:
|
||||
@echo "Incrementing version..."
|
||||
@current=$$(cat version.txt); \
|
||||
if [ -n "$(VERSION)" ]; then \
|
||||
new_version="$(VERSION)"; \
|
||||
echo "Setting version to $$new_version (was $$current)"; \
|
||||
else \
|
||||
echo "Incrementing version..."; \
|
||||
echo " Current version: $$current"; \
|
||||
major=$$(echo $$current | cut -d. -f1); \
|
||||
minor=$$(echo $$current | cut -d. -f2); \
|
||||
@@ -115,6 +148,7 @@ bump-version:
|
||||
new_patch=$$((patch + 1)); \
|
||||
new_version="$$major.$$minor.$$new_patch"; \
|
||||
echo " New version: $$new_version"; \
|
||||
fi; \
|
||||
echo "$$new_version" > version.txt
|
||||
@echo "✓ Version updated in version.txt"
|
||||
@$(MAKE) pkg/obioptions/version.go
|
||||
@@ -128,40 +162,76 @@ jjnew:
|
||||
@echo "$(GREEN)✓ New commit created$(NC)"
|
||||
|
||||
jjpush:
|
||||
@echo "$(YELLOW)→ Pushing commit to repository...$(NC)"
|
||||
@$(MAKE) jjpush-describe
|
||||
@$(MAKE) jjpush-bump
|
||||
@$(MAKE) jjpush-notes
|
||||
@$(MAKE) jjpush-push
|
||||
@$(MAKE) jjpush-tag
|
||||
@echo "$(GREEN)✓ Release complete$(NC)"
|
||||
|
||||
jjpush-describe:
|
||||
@echo "$(BLUE)→ Documenting current commit...$(NC)"
|
||||
@jj auto-describe
|
||||
|
||||
jjpush-bump:
|
||||
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
|
||||
@jj new
|
||||
@previous_version=$$(cat version.txt); \
|
||||
$(MAKE) bump-version; \
|
||||
version=$$(cat version.txt); \
|
||||
@$(MAKE) bump-version
|
||||
|
||||
jjpush-notes:
|
||||
@version=$$(cat version.txt); \
|
||||
echo "$(BLUE)→ Generating release notes for version $$version...$(NC)"; \
|
||||
release_title="Release $$version"; \
|
||||
release_body=""; \
|
||||
if command -v aichat >/dev/null 2>&1; then \
|
||||
previous_tag=$$(git describe --tags --abbrev=0 --match 'Release_*' 2>/dev/null); \
|
||||
if [ -z "$$previous_tag" ]; then \
|
||||
echo "$(YELLOW)⚠ No previous Release tag found, skipping release notes$(NC)"; \
|
||||
else \
|
||||
raw_output=$$(git log --format="%h %B" "$$previous_tag..HEAD" | \
|
||||
aichat \
|
||||
"Summarize the following commits into a GitHub release note for version $$version. Ignore commits related to version bumps, .gitignore changes, or any internal housekeeping that is irrelevant to end users. Describe each user-facing change precisely without exposing code. Eliminate redundancy. Output strictly valid JSON with no surrounding text, using this exact schema: {\"title\": \"<short release title>\", \"body\": \"<detailed markdown release notes>\"}" 2>/dev/null) || true; \
|
||||
if [ -n "$$raw_output" ]; then \
|
||||
notes=$$(printf '%s\n' "$$raw_output" | python3 tools/json2md.py 2>/dev/null); \
|
||||
if [ -n "$$notes" ]; then \
|
||||
release_title=$$(echo "$$notes" | head -1); \
|
||||
release_body=$$(echo "$$notes" | tail -n +3); \
|
||||
else \
|
||||
echo "$(YELLOW)⚠ JSON parsing failed, using default release message$(NC)"; \
|
||||
fi; \
|
||||
fi; \
|
||||
fi; \
|
||||
fi; \
|
||||
printf '%s' "$$release_title" > /tmp/obitools4-release-title.txt; \
|
||||
printf '%s' "$$release_body" > /tmp/obitools4-release-body.txt; \
|
||||
echo "$(BLUE)→ Setting release notes as commit description...$(NC)"; \
|
||||
jj desc -m "$$release_title"$$'\n\n'"$$release_body"
|
||||
|
||||
jjpush-push:
|
||||
@echo "$(BLUE)→ Pushing commits...$(NC)"
|
||||
@jj git push --change @
|
||||
@echo "$(BLUE)→ Creating/updating PR...$(NC)"
|
||||
@release_title=$$(cat /tmp/obitools4-release-title.txt 2>/dev/null || echo "Release $$(cat version.txt)"); \
|
||||
release_body=$$(cat /tmp/obitools4-release-body.txt 2>/dev/null || echo ""); \
|
||||
branch=$$(jj log -r @ --no-graph -T 'bookmarks.map(|b| b.name()).join("\n")' 2>/dev/null | head -1); \
|
||||
if [ -n "$$branch" ] && command -v gh >/dev/null 2>&1; then \
|
||||
gh pr create --title "$$release_title" --body "$$release_body" --base master --head "$$branch" 2>/dev/null \
|
||||
|| gh pr edit "$$branch" --title "$$release_title" --body "$$release_body" 2>/dev/null \
|
||||
|| echo "$(YELLOW)⚠ Could not create/update PR$(NC)"; \
|
||||
fi
|
||||
|
||||
jjpush-tag:
|
||||
@version=$$(cat version.txt); \
|
||||
tag_name="Release_$$version"; \
|
||||
previous_tag="Release_$$previous_version"; \
|
||||
echo "$(BLUE)→ Documenting version bump commit...$(NC)"; \
|
||||
jj auto-describe; \
|
||||
echo "$(BLUE)→ Generating release notes from $$previous_tag to current commit...$(NC)"; \
|
||||
if command -v orla >/dev/null 2>&1 && command -v jq >/dev/null 2>&1; then \
|
||||
release_json=$$(ORLA_MAX_TOOL_CALLS=50 jj log -r "$$previous_tag::@" -T 'commit_id.short() ++ " " ++ description' | \
|
||||
orla agent -m ollama:qwen3-coder-next:latest \
|
||||
"Summarize the following commits into a GitHub release note for version $$version. Ignore commits related to version bumps, .gitignore changes, or any internal housekeeping that is irrelevant to end users. Describe each user-facing change precisely without exposing code. Eliminate redundancy. Output strictly valid JSON with no surrounding text, using this exact schema: {\"title\": \"<short release title>\", \"body\": \"<detailed markdown release notes>\"}"); \
|
||||
release_json=$$(echo "$$release_json" | sed -n '/^{/,/^}/p'); \
|
||||
release_title=$$(echo "$$release_json" | jq -r '.title // empty') ; \
|
||||
release_body=$$(echo "$$release_json" | jq -r '.body // empty') ; \
|
||||
if [ -n "$$release_title" ] && [ -n "$$release_body" ]; then \
|
||||
release_message="$$release_title"$$'\n\n'"$$release_body"; \
|
||||
else \
|
||||
echo "$(YELLOW)⚠ JSON parsing failed, falling back to raw output$(NC)"; \
|
||||
release_message="Release $$version"$$'\n\n'"$$release_json"; \
|
||||
fi; \
|
||||
else \
|
||||
release_message="Release $$version"; \
|
||||
fi; \
|
||||
echo "$(BLUE)→ Pushing commits and creating tag $$tag_name...$(NC)"; \
|
||||
jj git push --change @; \
|
||||
git tag -a "$$tag_name" -m "$$release_message" 2>/dev/null || echo "Tag $$tag_name already exists"; \
|
||||
git push origin "$$tag_name" 2>/dev/null || echo "Tag already pushed"
|
||||
@echo "$(GREEN)✓ Commits and tag pushed to repository$(NC)"
|
||||
release_title=$$(cat /tmp/obitools4-release-title.txt 2>/dev/null || echo "Release $$version"); \
|
||||
release_body=$$(cat /tmp/obitools4-release-body.txt 2>/dev/null || echo ""); \
|
||||
install_section=$$'\n## Installation\n\n### Pre-built binaries\n\nDownload the appropriate archive for your system from the\n[release assets](https://github.com/metabarcoding/obitools4/releases/tag/Release_'"$$version"')\nand extract it:\n\n#### Linux (AMD64)\n```bash\ntar -xzf obitools4_'"$$version"'_linux_amd64.tar.gz\n```\n\n#### Linux (ARM64)\n```bash\ntar -xzf obitools4_'"$$version"'_linux_arm64.tar.gz\n```\n\n#### macOS (Intel)\n```bash\ntar -xzf obitools4_'"$$version"'_darwin_amd64.tar.gz\n```\n\n#### macOS (Apple Silicon)\n```bash\ntar -xzf obitools4_'"$$version"'_darwin_arm64.tar.gz\n```\n\nAll OBITools4 binaries are included in each archive.\n\n### From source\n\nYou can also compile and install OBITools4 directly from source using the\ninstallation script:\n\n```bash\ncurl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --version '"$$version"'\n```\n\nBy default binaries are installed in `/usr/local/bin`. Use `--install-dir` to\nchange the destination and `--obitools-prefix` to add a prefix to command names:\n\n```bash\ncurl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | \\\n bash -s -- --version '"$$version"' --install-dir ~/local --obitools-prefix k\n```\n'; \
|
||||
release_message="$$release_title"$$'\n\n'"$$release_body$$install_section"; \
|
||||
echo "$(BLUE)→ Creating tag $$tag_name...$(NC)"; \
|
||||
git tag -a "$$tag_name" -m "$$release_message" 2>/dev/null || echo "$(YELLOW)⚠ Tag $$tag_name already exists$(NC)"; \
|
||||
echo "$(BLUE)→ Pushing tag $$tag_name...$(NC)"; \
|
||||
git push origin "$$tag_name" 2>/dev/null || echo "$(YELLOW)⚠ Tag push failed or already pushed$(NC)"; \
|
||||
rm -f /tmp/obitools4-release-title.txt /tmp/obitools4-release-body.txt
|
||||
|
||||
jjfetch:
|
||||
@echo "$(YELLOW)→ Pulling latest commits...$(NC)"
|
||||
@@ -169,5 +239,5 @@ jjfetch:
|
||||
@jj new master@origin
|
||||
@echo "$(GREEN)✓ Latest commits pulled$(NC)"
|
||||
|
||||
.PHONY: all obitools update-deps obitests githubtests jjnew jjpush jjfetch bump-version .FORCE
|
||||
.PHONY: all obitools update-deps obitests githubtests help jjnew jjpush jjpush-describe jjpush-bump jjpush-notes jjpush-push jjpush-tag jjfetch bump-version .FORCE
|
||||
.FORCE:
|
||||
|
||||
@@ -34,6 +34,10 @@ The installation script offers several options:
|
||||
> want to have several versions of obitools at the
|
||||
> same time on your system (as example `-p g` will produce
|
||||
> `gobigrep` command instead of `obigrep`).
|
||||
>
|
||||
> -j, --jobs Number of parallel jobs used for compilation
|
||||
> (default: 1). Increase this value to speed up
|
||||
> compilation on multi-core systems (e.g., `-j 4`).
|
||||
|
||||
### Examples
|
||||
|
||||
|
||||
@@ -0,0 +1,508 @@
|
||||
# Plan de refonte du package obikmer : index disk-based par partitions minimizer
|
||||
|
||||
## Constat
|
||||
|
||||
Les roaring64 bitmaps ne sont pas adaptés au stockage de 10^10 k-mers
|
||||
(k=31) dispersés sur un espace de 2^62. L'overhead structurel (containers
|
||||
roaring par high key 32 bits) dépasse la taille des données elles-mêmes,
|
||||
et les opérations `Or()` entre bitmaps fragmentés ne terminent pas en
|
||||
temps raisonnable.
|
||||
|
||||
## Principe de la nouvelle architecture
|
||||
|
||||
Un `KmerSet` est un ensemble trié de k-mers canoniques (uint64) stocké
|
||||
sur disque, partitionné par minimizer. Chaque partition est un fichier
|
||||
binaire contenant des uint64 triés, compressés par delta-varint.
|
||||
|
||||
Un `KmerSetGroup` est un répertoire contenant N ensembles partitionnés
|
||||
de la même façon (même k, même m, même P).
|
||||
|
||||
Un `KmerSet` est un `KmerSetGroup` de taille 1 (singleton).
|
||||
|
||||
Les opérations ensemblistes se font partition par partition, en merge
|
||||
streaming, sans charger l'index complet en mémoire.
|
||||
|
||||
## Cycle de vie d'un index
|
||||
|
||||
L'index a deux phases distinctes :
|
||||
|
||||
1. **Phase de construction (mutable)** : on ouvre un index, on y ajoute
|
||||
des séquences. Pour chaque séquence, les super-kmers sont extraits
|
||||
et écrits de manière compacte (2 bits/base) dans le fichier
|
||||
temporaire de partition correspondant (`minimizer % P`). Les
|
||||
super-kmers sont une représentation compressée naturelle des k-mers
|
||||
chevauchants : un super-kmer de longueur L encode L-k+1 k-mers en
|
||||
ne stockant que ~L/4 bytes au lieu de (L-k+1) × 8 bytes.
|
||||
|
||||
2. **Phase de clôture (optimisation)** : on ferme l'index, ce qui
|
||||
déclenche le traitement **partition par partition** (indépendant,
|
||||
parallélisable) :
|
||||
- Charger les super-kmers de la partition
|
||||
- En extraire tous les k-mers canoniques
|
||||
- Trier le tableau de k-mers
|
||||
- Dédupliquer (et compter si FrequencyFilter)
|
||||
- Delta-encoder et écrire le fichier .kdi final
|
||||
Après clôture, l'index est statique et immuable.
|
||||
|
||||
3. **Phase de lecture (immutable)** : opérations ensemblistes,
|
||||
Jaccard, Quorum, Contains, itération. Toutes en streaming.
|
||||
|
||||
---
|
||||
|
||||
## Format sur disque
|
||||
|
||||
### Index finalisé
|
||||
|
||||
```
|
||||
index_dir/
|
||||
metadata.toml
|
||||
set_0/
|
||||
part_0000.kdi
|
||||
part_0001.kdi
|
||||
...
|
||||
part_{P-1}.kdi
|
||||
set_1/
|
||||
part_0000.kdi
|
||||
...
|
||||
...
|
||||
set_{N-1}/
|
||||
...
|
||||
```
|
||||
|
||||
### Fichiers temporaires pendant la construction
|
||||
|
||||
```
|
||||
index_dir/
|
||||
.build/
|
||||
set_0/
|
||||
part_0000.skm # super-kmers encodés 2 bits/base
|
||||
part_0001.skm
|
||||
...
|
||||
set_1/
|
||||
...
|
||||
```
|
||||
|
||||
Le répertoire `.build/` est supprimé après Close().
|
||||
|
||||
### metadata.toml
|
||||
|
||||
```toml
|
||||
id = "mon_index"
|
||||
k = 31
|
||||
m = 13
|
||||
partitions = 1024
|
||||
type = "KmerSetGroup" # ou "KmerSet" (N=1)
|
||||
size = 3 # nombre de sets (N)
|
||||
sets_ids = ["genome_A", "genome_B", "genome_C"]
|
||||
|
||||
[user_metadata]
|
||||
organism = "Triticum aestivum"
|
||||
|
||||
[sets_metadata]
|
||||
# métadonnées individuelles par set si nécessaire
|
||||
```
|
||||
|
||||
### Fichier .kdi (Kmer Delta Index)
|
||||
|
||||
Format binaire :
|
||||
|
||||
```
|
||||
[magic: 4 bytes "KDI\x01"]
|
||||
[count: uint64 little-endian] # nombre de k-mers dans cette partition
|
||||
[first: uint64 little-endian] # premier k-mer (valeur absolue)
|
||||
[delta_1: varint] # arr[1] - arr[0]
|
||||
[delta_2: varint] # arr[2] - arr[1]
|
||||
...
|
||||
[delta_{count-1}: varint] # arr[count-1] - arr[count-2]
|
||||
```
|
||||
|
||||
Varint : encoding unsigned, 7 bits utiles par byte, bit de poids fort
|
||||
= continuation (identique au varint protobuf).
|
||||
|
||||
Fichier vide (partition sans k-mer) : magic + count=0.
|
||||
|
||||
### Fichier .skm (Super-Kmer temporaire)
|
||||
|
||||
Format binaire, séquence de super-kmers encodés :
|
||||
|
||||
```
|
||||
[len: uint16 little-endian] # longueur du super-kmer en bases
|
||||
[sequence: ceil(len/4) bytes] # séquence encodée 2 bits/base, packed
|
||||
...
|
||||
```
|
||||
|
||||
**Compression par rapport au stockage de k-mers bruts** :
|
||||
|
||||
Un super-kmer de longueur L contient L-k+1 k-mers.
|
||||
- Stockage super-kmer : 2 + ceil(L/4) bytes
|
||||
- Stockage k-mers bruts : (L-k+1) × 8 bytes
|
||||
|
||||
Exemple avec k=31, super-kmer typique L=50 :
|
||||
- Super-kmer : 2 + 13 = 15 bytes → encode 20 k-mers
|
||||
- K-mers bruts : 20 × 8 = 160 bytes
|
||||
- **Facteur de compression : ~10×**
|
||||
|
||||
Pour un génome de 10 Gbases (~10^10 k-mers bruts) :
|
||||
- K-mers bruts : ~80 Go par set temporaire
|
||||
- Super-kmers : **~8 Go** par set temporaire
|
||||
|
||||
Avec FrequencyFilter et couverture 30× :
|
||||
- K-mers bruts : ~2.4 To
|
||||
- Super-kmers : **~240 Go**
|
||||
|
||||
---
|
||||
|
||||
## FrequencyFilter
|
||||
|
||||
Le FrequencyFilter n'est plus un type de données séparé. C'est un
|
||||
**mode de construction** du builder. Le résultat est un KmerSetGroup
|
||||
standard.
|
||||
|
||||
### Principe
|
||||
|
||||
Pendant la construction, tous les super-kmers sont écrits dans les
|
||||
fichiers temporaires .skm, y compris les doublons (chaque occurrence
|
||||
de chaque séquence est écrite).
|
||||
|
||||
Pendant Close(), pour chaque partition :
|
||||
1. Charger tous les super-kmers de la partition
|
||||
2. Extraire tous les k-mers canoniques dans un tableau []uint64
|
||||
3. Trier le tableau
|
||||
4. Parcourir linéairement : les k-mers identiques sont consécutifs
|
||||
5. Compter les occurrences de chaque k-mer
|
||||
6. Si count >= minFreq → écrire dans le .kdi final (une seule fois)
|
||||
7. Sinon → ignorer
|
||||
|
||||
### Dimensionnement
|
||||
|
||||
Pour un génome de 10 Gbases avec couverture 30× :
|
||||
- N_brut ≈ 3×10^11 k-mers bruts
|
||||
- Espace temporaire .skm ≈ 240 Go (compressé super-kmer)
|
||||
- RAM par partition pendant Close() :
|
||||
Avec P=1024 : ~3×10^8 k-mers/partition × 8 = **~2.4 Go**
|
||||
Avec P=4096 : ~7.3×10^7 k-mers/partition × 8 = **~600 Mo**
|
||||
|
||||
Le choix de P détermine le compromis nombre de fichiers vs RAM par
|
||||
partition.
|
||||
|
||||
### Sans FrequencyFilter (déduplication simple)
|
||||
|
||||
Pour de la déduplication simple (chaque k-mer écrit une fois), le
|
||||
builder peut dédupliquer au niveau des buffers en RAM avant flush.
|
||||
Cela réduit significativement l'espace temporaire car les doublons
|
||||
au sein d'un même buffer (provenant de séquences proches) sont
|
||||
éliminés immédiatement.
|
||||
|
||||
---
|
||||
|
||||
## API publique visée
|
||||
|
||||
### Structures
|
||||
|
||||
```go
|
||||
// KmerSetGroup est l'entité de base.
|
||||
// Un KmerSet est un KmerSetGroup avec Size() == 1.
|
||||
type KmerSetGroup struct {
|
||||
// champs internes : path, k, m, P, N, metadata, état
|
||||
}
|
||||
|
||||
// KmerSetGroupBuilder construit un KmerSetGroup mutable.
|
||||
type KmerSetGroupBuilder struct {
|
||||
// champs internes : buffers I/O par partition et par set,
|
||||
// fichiers temporaires .skm, paramètres (minFreq, etc.)
|
||||
}
|
||||
```
|
||||
|
||||
### Construction
|
||||
|
||||
```go
|
||||
// NewKmerSetGroupBuilder crée un builder pour un nouveau KmerSetGroup.
|
||||
// directory : répertoire de destination
|
||||
// k : taille des k-mers (1-31)
|
||||
// m : taille des minimizers (-1 pour auto = ceil(k/2.5))
|
||||
// n : nombre de sets dans le groupe
|
||||
// P : nombre de partitions (-1 pour auto)
|
||||
// options : options de construction (FrequencyFilter, etc.)
|
||||
func NewKmerSetGroupBuilder(directory string, k, m, n, P int,
|
||||
options ...BuilderOption) (*KmerSetGroupBuilder, error)
|
||||
|
||||
// WithMinFrequency active le mode FrequencyFilter.
|
||||
// Seuls les k-mers vus >= minFreq fois sont conservés dans l'index
|
||||
// final. Les super-kmers sont écrits avec leurs doublons pendant
|
||||
// la construction ; le comptage exact se fait au Close().
|
||||
func WithMinFrequency(minFreq int) BuilderOption
|
||||
|
||||
// AddSequence extrait les super-kmers d'une séquence et les écrit
|
||||
// dans les fichiers temporaires de partition du set i.
|
||||
func (b *KmerSetGroupBuilder) AddSequence(setIndex int, seq *obiseq.BioSequence)
|
||||
|
||||
// AddSuperKmer écrit un super-kmer dans le fichier temporaire de
|
||||
// sa partition pour le set i.
|
||||
func (b *KmerSetGroupBuilder) AddSuperKmer(setIndex int, sk SuperKmer)
|
||||
|
||||
// Close finalise la construction :
|
||||
// - flush des buffers d'écriture
|
||||
// - pour chaque partition de chaque set (parallélisable) :
|
||||
// - charger les super-kmers depuis le .skm
|
||||
// - extraire les k-mers canoniques
|
||||
// - trier, dédupliquer (compter si freq filter)
|
||||
// - delta-encoder et écrire le .kdi
|
||||
// - écrire metadata.toml
|
||||
// - supprimer le répertoire .build/
|
||||
// Retourne le KmerSetGroup en lecture seule.
|
||||
func (b *KmerSetGroupBuilder) Close() (*KmerSetGroup, error)
|
||||
```
|
||||
|
||||
### Lecture et opérations
|
||||
|
||||
```go
|
||||
// OpenKmerSetGroup ouvre un index finalisé en lecture seule.
|
||||
func OpenKmerSetGroup(directory string) (*KmerSetGroup, error)
|
||||
|
||||
// --- Métadonnées (API inchangée) ---
|
||||
func (ksg *KmerSetGroup) K() int
|
||||
func (ksg *KmerSetGroup) M() int // nouveau : taille du minimizer
|
||||
func (ksg *KmerSetGroup) Partitions() int // nouveau : nombre de partitions
|
||||
func (ksg *KmerSetGroup) Size() int
|
||||
func (ksg *KmerSetGroup) Id() string
|
||||
func (ksg *KmerSetGroup) SetId(id string)
|
||||
func (ksg *KmerSetGroup) HasAttribute(key string) bool
|
||||
func (ksg *KmerSetGroup) GetAttribute(key string) (interface{}, bool)
|
||||
func (ksg *KmerSetGroup) SetAttribute(key string, value interface{})
|
||||
// ... etc (toute l'API attributs actuelle est conservée)
|
||||
|
||||
// --- Opérations ensemblistes ---
|
||||
// Toutes produisent un nouveau KmerSetGroup singleton sur disque.
|
||||
// Opèrent partition par partition en streaming.
|
||||
|
||||
func (ksg *KmerSetGroup) Union(outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) Intersect(outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) Difference(outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) QuorumAtLeast(q int, outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) QuorumExactly(q int, outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) QuorumAtMost(q int, outputDir string) (*KmerSetGroup, error)
|
||||
|
||||
// --- Opérations entre deux KmerSetGroups ---
|
||||
// Les deux groupes doivent avoir les mêmes k, m, P.
|
||||
|
||||
func (ksg *KmerSetGroup) UnionWith(other *KmerSetGroup, outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) IntersectWith(other *KmerSetGroup, outputDir string) (*KmerSetGroup, error)
|
||||
|
||||
// --- Métriques (résultat en mémoire, pas de sortie disque) ---
|
||||
|
||||
func (ksg *KmerSetGroup) JaccardDistanceMatrix() *obidist.DistMatrix
|
||||
func (ksg *KmerSetGroup) JaccardSimilarityMatrix() *obidist.DistMatrix
|
||||
|
||||
// --- Accès individuel ---
|
||||
|
||||
func (ksg *KmerSetGroup) Len(setIndex ...int) uint64
|
||||
func (ksg *KmerSetGroup) Contains(setIndex int, kmer uint64) bool
|
||||
func (ksg *KmerSetGroup) Iterator(setIndex int) iter.Seq[uint64]
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Implémentation interne
|
||||
|
||||
### Primitives bas niveau
|
||||
|
||||
**`varint.go`** : encode/decode varint uint64
|
||||
|
||||
```go
|
||||
func EncodeVarint(w io.Writer, v uint64) (int, error)
|
||||
func DecodeVarint(r io.Reader) (uint64, error)
|
||||
```
|
||||
|
||||
### Format .kdi
|
||||
|
||||
**`kdi_writer.go`** : écriture d'un fichier .kdi à partir d'un flux
|
||||
trié de uint64 (delta-encode au vol).
|
||||
|
||||
```go
|
||||
type KdiWriter struct { ... }
|
||||
func NewKdiWriter(path string) (*KdiWriter, error)
|
||||
func (w *KdiWriter) Write(kmer uint64) error
|
||||
func (w *KdiWriter) Close() error
|
||||
```
|
||||
|
||||
**`kdi_reader.go`** : lecture streaming d'un fichier .kdi (décode
|
||||
les deltas au vol).
|
||||
|
||||
```go
|
||||
type KdiReader struct { ... }
|
||||
func NewKdiReader(path string) (*KdiReader, error)
|
||||
func (r *KdiReader) Next() (uint64, bool)
|
||||
func (r *KdiReader) Count() uint64
|
||||
func (r *KdiReader) Close() error
|
||||
```
|
||||
|
||||
### Format .skm
|
||||
|
||||
**`skm_writer.go`** : écriture de super-kmers encodés 2 bits/base.
|
||||
|
||||
```go
|
||||
type SkmWriter struct { ... }
|
||||
func NewSkmWriter(path string) (*SkmWriter, error)
|
||||
func (w *SkmWriter) Write(sk SuperKmer) error
|
||||
func (w *SkmWriter) Close() error
|
||||
```
|
||||
|
||||
**`skm_reader.go`** : lecture de super-kmers depuis un fichier .skm.
|
||||
|
||||
```go
|
||||
type SkmReader struct { ... }
|
||||
func NewSkmReader(path string) (*SkmReader, error)
|
||||
func (r *SkmReader) Next() (SuperKmer, bool)
|
||||
func (r *SkmReader) Close() error
|
||||
```
|
||||
|
||||
### Merge streaming
|
||||
|
||||
**`kdi_merge.go`** : k-way merge de plusieurs flux triés.
|
||||
|
||||
```go
|
||||
type KWayMerge struct { ... }
|
||||
func NewKWayMerge(readers []*KdiReader) *KWayMerge
|
||||
func (m *KWayMerge) Next() (kmer uint64, count int, ok bool)
|
||||
func (m *KWayMerge) Close() error
|
||||
```
|
||||
|
||||
### Builder
|
||||
|
||||
**`kmer_set_builder.go`** : construction d'un KmerSetGroup.
|
||||
|
||||
Le builder gère :
|
||||
- P × N écrivains .skm bufferisés (un par partition × set)
|
||||
- À la clôture : traitement partition par partition
|
||||
(parallélisable sur plusieurs cores)
|
||||
|
||||
Gestion mémoire des buffers d'écriture :
|
||||
- Chaque SkmWriter a un buffer I/O de taille raisonnable (~64 Ko)
|
||||
- Avec P=1024 et N=1 : 1024 × 64 Ko = 64 Mo de buffers
|
||||
- Avec P=1024 et N=10 : 640 Mo de buffers
|
||||
- Pas de buffer de k-mers en RAM : tout est écrit sur disque
|
||||
immédiatement via les super-kmers
|
||||
|
||||
RAM pendant Close() (tri d'une partition) :
|
||||
- Charger les super-kmers → extraire les k-mers → tableau []uint64
|
||||
- Avec P=1024 et 10^10 k-mers/set : ~10^7 k-mers/partition × 8 = ~80 Mo
|
||||
- Avec FrequencyFilter (doublons) et couverture 30× :
|
||||
~3×10^8/partition × 8 = ~2.4 Go (ajustable via P)
|
||||
|
||||
### Structure disk-based
|
||||
|
||||
**`kmer_set_disk.go`** : KmerSetGroup en lecture seule.
|
||||
|
||||
**`kmer_set_disk_ops.go`** : opérations ensemblistes par merge
|
||||
streaming partition par partition.
|
||||
|
||||
---
|
||||
|
||||
## Ce qui change par rapport à l'API actuelle
|
||||
|
||||
### Changements de sémantique
|
||||
|
||||
| Aspect | Ancien (roaring) | Nouveau (disk-based) |
|
||||
|---|---|---|
|
||||
| Stockage | En mémoire (roaring64.Bitmap) | Sur disque (.kdi delta-encoded) |
|
||||
| Temporaire construction | En mémoire | Super-kmers sur disque (.skm 2 bits/base) |
|
||||
| Mutabilité | Mutable à tout moment | Builder → Close() → immutable |
|
||||
| Opérations ensemblistes | Résultat en mémoire | Résultat sur disque (nouveau répertoire) |
|
||||
| Contains | O(1) roaring lookup | O(log n) recherche binaire sur .kdi |
|
||||
| Itération | Roaring iterator | Streaming décodage delta-varint |
|
||||
|
||||
### API conservée (signatures identiques ou quasi-identiques)
|
||||
|
||||
- `KmerSetGroup` : `K()`, `Size()`, `Id()`, `SetId()`
|
||||
- Toute l'API attributs
|
||||
- `JaccardDistanceMatrix()`, `JaccardSimilarityMatrix()`
|
||||
- `Len()`, `Contains()`
|
||||
|
||||
### API modifiée
|
||||
|
||||
- `Union()`, `Intersect()`, etc. : ajout du paramètre `outputDir`
|
||||
- `QuorumAtLeast()`, etc. : idem
|
||||
- Construction : `NewKmerSetGroupBuilder()` + `AddSequence()` + `Close()`
|
||||
au lieu de manipulation directe
|
||||
|
||||
### API supprimée
|
||||
|
||||
- `KmerSet` comme type distinct (remplacé par KmerSetGroup singleton)
|
||||
- `FrequencyFilter` comme type distinct (mode du Builder)
|
||||
- Tout accès direct à `roaring64.Bitmap`
|
||||
- `KmerSet.Copy()` (copie de répertoire à la place)
|
||||
- `KmerSet.Union()`, `.Intersect()`, `.Difference()` (deviennent méthodes
|
||||
de KmerSetGroup avec outputDir)
|
||||
|
||||
---
|
||||
|
||||
## Fichiers à créer / modifier dans pkg/obikmer
|
||||
|
||||
### Nouveaux fichiers
|
||||
|
||||
| Fichier | Contenu |
|
||||
|---|---|
|
||||
| `varint.go` | Encode/Decode varint uint64 |
|
||||
| `kdi_writer.go` | Écrivain de fichiers .kdi (delta-encoded) |
|
||||
| `kdi_reader.go` | Lecteur streaming de fichiers .kdi |
|
||||
| `skm_writer.go` | Écrivain de super-kmers encodés 2 bits/base |
|
||||
| `skm_reader.go` | Lecteur de super-kmers depuis .skm |
|
||||
| `kdi_merge.go` | K-way merge streaming de flux triés |
|
||||
| `kmer_set_builder.go` | KmerSetGroupBuilder (construction) |
|
||||
| `kmer_set_disk.go` | KmerSetGroup disk-based (lecture, métadonnées) |
|
||||
| `kmer_set_disk_ops.go` | Opérations ensemblistes streaming |
|
||||
|
||||
### Fichiers à supprimer
|
||||
|
||||
| Fichier | Raison |
|
||||
|---|---|
|
||||
| `kmer_set.go` | Remplacé par kmer_set_disk.go |
|
||||
| `kmer_set_group.go` | Idem |
|
||||
| `kmer_set_attributes.go` | Intégré dans kmer_set_disk.go |
|
||||
| `kmer_set_persistence.go` | L'index est nativement sur disque |
|
||||
| `kmer_set_group_quorum.go` | Intégré dans kmer_set_disk_ops.go |
|
||||
| `frequency_filter.go` | Mode du Builder, plus de type séparé |
|
||||
| `kmer_index_builder.go` | Remplacé par kmer_set_builder.go |
|
||||
|
||||
### Fichiers conservés tels quels
|
||||
|
||||
| Fichier | Contenu |
|
||||
|---|---|
|
||||
| `encodekmer.go` | Encodage/décodage k-mers |
|
||||
| `superkmer.go` | Structure SuperKmer |
|
||||
| `superkmer_iter.go` | IterSuperKmers, IterCanonicalKmers |
|
||||
| `encodefourmer.go` | Encode4mer |
|
||||
| `counting.go` | Count4Mer |
|
||||
| `kmermap.go` | KmerMap (usage indépendant) |
|
||||
| `debruijn.go` | Graphe de de Bruijn |
|
||||
|
||||
---
|
||||
|
||||
## Ordre d'implémentation
|
||||
|
||||
1. `varint.go` + tests
|
||||
2. `skm_writer.go` + `skm_reader.go` + tests
|
||||
3. `kdi_writer.go` + `kdi_reader.go` + tests
|
||||
4. `kdi_merge.go` + tests
|
||||
5. `kmer_set_builder.go` + tests (construction + Close)
|
||||
6. `kmer_set_disk.go` (structure, métadonnées, Open)
|
||||
7. `kmer_set_disk_ops.go` + tests (Union, Intersect, Quorum, Jaccard)
|
||||
8. Adaptation de `pkg/obitools/obikindex/`
|
||||
9. Suppression des anciens fichiers roaring
|
||||
10. Adaptation des tests existants
|
||||
|
||||
Chaque étape est testable indépendamment.
|
||||
|
||||
---
|
||||
|
||||
## Dépendances externes
|
||||
|
||||
### Supprimées
|
||||
|
||||
- `github.com/RoaringBitmap/roaring` : plus nécessaire pour les
|
||||
index k-mers (vérifier si d'autres packages l'utilisent encore)
|
||||
|
||||
### Ajoutées
|
||||
|
||||
- Aucune. Varint, delta-encoding, merge, encodage 2 bits/base :
|
||||
tout est implémentable en Go standard.
|
||||
@@ -0,0 +1,264 @@
|
||||
# Optimisation du parsing des grandes séquences
|
||||
|
||||
## Contexte
|
||||
|
||||
OBITools4 doit pouvoir traiter des séquences de taille chromosomique (plusieurs Gbp), notamment
|
||||
issues de fichiers GenBank/EMBL (assemblages de génomes) ou de fichiers FASTA convertis depuis
|
||||
ces formats.
|
||||
|
||||
## Architecture actuelle
|
||||
|
||||
### Pipeline de lecture (`pkg/obiformats/`)
|
||||
|
||||
```
|
||||
ReadFileChunk (goroutine)
|
||||
→ ChannelFileChunk
|
||||
→ N × _ParseGenbankFile / _ParseFastaFile (goroutines)
|
||||
→ IBioSequence
|
||||
```
|
||||
|
||||
`ReadFileChunk` (`file_chunk_read.go`) lit le fichier par morceaux via une chaîne de
|
||||
`PieceOfChunk` (rope). Chaque nœud fait `fileChunkSize` bytes :
|
||||
|
||||
- GenBank/EMBL : 128 MB (`1024*1024*128`)
|
||||
- FASTA/FASTQ : 1 MB (`1024*1024`)
|
||||
|
||||
La chaîne est accumulée jusqu'à trouver la fin du dernier enregistrement complet (splitter),
|
||||
puis `Pack()` est appelé pour fusionner tous les nœuds en un seul buffer contigu. Ce buffer
|
||||
est transmis au parseur via `FileChunk.Raw *bytes.Buffer`.
|
||||
|
||||
### Parseur GenBank (`genbank_read.go`)
|
||||
|
||||
`GenbankChunkParser` reçoit un `io.Reader` sur le buffer packé, lit ligne par ligne via
|
||||
`bufio.NewReader` (buffer 4096 bytes), et pour chaque ligne de la section `ORIGIN` :
|
||||
|
||||
```go
|
||||
line = string(bline) // allocation par ligne
|
||||
cleanline := strings.TrimSpace(line) // allocation
|
||||
parts := strings.SplitN(cleanline, " ", 7) // allocation []string + substrings
|
||||
for i := 1; i < lparts; i++ {
|
||||
seqBytes.WriteString(parts[i])
|
||||
}
|
||||
```
|
||||
|
||||
Point positif : `seqBytes` est pré-alloué grâce à `lseq` extrait de la ligne `LOCUS`.
|
||||
|
||||
### Parseur FASTA (`fastaseq_read.go`)
|
||||
|
||||
`FastaChunkParser` lit **octet par octet** via `scanner.ReadByte()`. Pour 3 Gbp :
|
||||
3 milliards d'appels. `seqBytes` est un `bytes.Buffer{}` sans pré-allocation.
|
||||
|
||||
## Problème principal
|
||||
|
||||
Pour une séquence de plusieurs Gbp, `Pack()` fusionne une chaîne de ~N nœuds de 128 MB en
|
||||
un seul buffer contigu. C'est une allocation de N × 128 MB suivie d'une copie de toutes les
|
||||
données. Bien que l'implémentation de `Pack()` soit efficace (libère les nœuds au fur et à
|
||||
mesure via `slices.Grow`), la copie est inévitable avec l'architecture actuelle.
|
||||
|
||||
De plus, le parseur GenBank produit des dizaines de millions d'allocations temporaires pour
|
||||
parser la section `ORIGIN` (une par ligne).
|
||||
|
||||
## Invariant clé découvert
|
||||
|
||||
**Si la rope a plus d'un nœud, le premier nœud seul ne se termine pas sur une frontière
|
||||
d'enregistrement** (pas de `//\n` en fin de `piece1`).
|
||||
|
||||
Preuve par construction dans `ReadFileChunk` :
|
||||
- `splitter` est appelé dès le premier nœud (ligne 157)
|
||||
- Si `end >= 0` → frontière trouvée dans 128 MB → boucle interne sautée → rope à 1 nœud
|
||||
- Si `end < 0` → boucle interne ajoute des nœuds → rope à ≥ 2 nœuds
|
||||
|
||||
Corollaire : si rope à 1 nœud, `Pack()` ne fait rien (aucun nœud suivant).
|
||||
|
||||
**Attention** : rope à ≥ 2 nœuds ne signifie pas qu'il n'y a qu'une seule séquence dans
|
||||
la rope. La rope packée peut contenir plusieurs enregistrements complets. Exemple : records
|
||||
de 80 MB → `nextpieces` (48 MB de reste) + nouveau nœud (128 MB) = rope à 2 nœuds
|
||||
contenant 2 records complets + début d'un troisième.
|
||||
|
||||
L'invariant dit seulement que `piece1` seul est incomplet — pas que la rope entière
|
||||
ne contient qu'un seul record.
|
||||
|
||||
**Invariant : le dernier FileChunk envoyé finit sur une frontière d'enregistrement.**
|
||||
|
||||
Deux chemins dans `ReadFileChunk` :
|
||||
|
||||
1. **Chemin normal** (`end >= 0` via `splitter`) : le buffer est explicitement tronqué à
|
||||
`end` (ligne 200 : `pieces.data = pieces.data[:end]`). Frontière garantie par construction
|
||||
pour tous les formats. ✓
|
||||
|
||||
2. **Chemin EOF** (`end < 0`, `end = pieces.Len()`) : tout le reste du fichier est envoyé.
|
||||
- **GenBank/EMBL** : présuppose fichier bien formé (se termine par `//\n`). Le parseur
|
||||
lève un `log.Fatalf` sur tout état inattendu — filet de sécurité suffisant. ✓
|
||||
- **FASTQ** : présupposé, vérifié par le parseur. ✓
|
||||
- **FASTA** : garanti par le format lui-même (fin d'enregistrement = EOF ou `>`). ✓
|
||||
|
||||
**Hypothèse de travail adoptée** : les fichiers d'entrée sont bien formés. Dans le pire cas,
|
||||
le parseur lèvera une erreur explicite. Il n'y a pas de risque de corruption silencieuse.
|
||||
|
||||
## Piste d'optimisation : se dispenser de Pack()
|
||||
|
||||
### Idée centrale
|
||||
|
||||
Au lieu de fusionner la rope avant de la passer au parseur, **parser directement la rope
|
||||
nœud par nœud**, et **écrire la séquence compactée in-place dans le premier nœud**.
|
||||
|
||||
Pourquoi c'est sûr :
|
||||
- Le header (LOCUS, DEFINITION, SOURCE, FEATURES) est **petit** et traité en premier
|
||||
- La séquence (ORIGIN) est **à la fin** du record
|
||||
- Au moment d'écrire la séquence depuis l'offset 0 de `piece1`, le pointeur de lecture
|
||||
est profond dans la rope (offset >> 0) → jamais de collision
|
||||
- La séquence compactée est toujours plus courte que les données brutes
|
||||
|
||||
### Pré-allocation
|
||||
|
||||
Pour GenBank/EMBL : `lseq` est connu dès la ligne `LOCUS`/`ID` (première ligne, dans
|
||||
`piece1`). On peut faire `slices.Grow(piece1.data, lseq)` dès ce moment.
|
||||
|
||||
Pour FASTA : pas de taille garantie dans le header, mais `rope.Len()` donne un majorant.
|
||||
On peut utiliser `rope.Len() / 2` comme estimation initiale.
|
||||
|
||||
### Gestion des jonctions entre nœuds
|
||||
|
||||
Une ligne peut chevaucher deux nœuds (rare avec 128 MB, mais possible). Solution : carry
|
||||
buffer de ~128 bytes pour les quelques bytes en fin de nœud.
|
||||
|
||||
### Cas FASTA/FASTQ multi-séquences
|
||||
|
||||
Un FileChunk peut contenir N séquences (notamment FASTA/FASTQ courts). Dans ce cas
|
||||
l'écriture in-place dans `piece1` n'est pas applicable directement — on écrase des données
|
||||
nécessaires aux séquences suivantes.
|
||||
|
||||
Stratégie par cas :
|
||||
- **Rope à 1 nœud** (record ≤ 128 MB) : `Pack()` est trivial (no-op), parseur actuel OK
|
||||
- **Rope à ≥ 2 nœuds** : par l'invariant, `piece1` ne contient pas de record complet →
|
||||
une seule grande séquence → in-place applicable
|
||||
|
||||
### Format d'une ligne séquence GenBank (Après ORIGIN)
|
||||
|
||||
```
|
||||
/^ *[0-9]+( [nuc]{10}){0,5} [nuc]{1,10}/
|
||||
```
|
||||
|
||||
### Format d'une ligne séquence GenBank (Après SQ)
|
||||
|
||||
La ligne SQ contient aussi la taille de la séquence
|
||||
|
||||
```
|
||||
/^ *( [nuc]{10}){0,5} [nuc]{1,10} *[0-9]+/
|
||||
```
|
||||
|
||||
Compactage in-place sur `bline` ([]byte brut, sans conversion `string`) :
|
||||
|
||||
```go
|
||||
w := 0
|
||||
i := 0
|
||||
for i < len(bline) && bline[i] == ' ' { i++ } // skip indentation
|
||||
for i < len(bline) && bline[i] <= '9' { i++ } // skip position number
|
||||
for ; i < len(bline); i++ {
|
||||
if bline[i] != ' ' {
|
||||
bline[w] = bline[i]
|
||||
w++
|
||||
}
|
||||
}
|
||||
// écrire bline[:w] directement dans piece1.data[seqOffset:]
|
||||
```
|
||||
|
||||
## Changements nécessaires
|
||||
|
||||
1. **`FileChunk`** : exposer la rope `*PieceOfChunk` non-packée en plus (ou à la place)
|
||||
de `Raw *bytes.Buffer`
|
||||
2. **`GenbankChunkParser` / `EmblChunkParser`** : accepter `*PieceOfChunk`, parser la
|
||||
rope séquentiellement avec carry buffer pour les jonctions
|
||||
3. **`FastaChunkParser`** : idem, avec in-place conditionnel selon taille de la rope
|
||||
4. **`ReadFileChunk`** : ne pas appeler `Pack()` avant envoi sur le channel (ou version
|
||||
alternative `ReadFileChunkRope`)
|
||||
|
||||
## Fichiers concernés
|
||||
|
||||
- `pkg/obiformats/file_chunk_read.go` — structure rope, `ReadFileChunk`
|
||||
- `pkg/obiformats/genbank_read.go` — `GenbankChunkParser`, `_ParseGenbankFile`
|
||||
- `pkg/obiformats/embl_read.go` — `EmblChunkParser`, `ReadEMBL`
|
||||
- `pkg/obiformats/fastaseq_read.go` — `FastaChunkParser`, `_ParseFastaFile`
|
||||
- `pkg/obiformats/fastqseq_read.go` — parseur FASTQ (même structure)
|
||||
|
||||
## Plan d'implémentation : parseur GenBank sur rope
|
||||
|
||||
### Contexte
|
||||
|
||||
Baseline mesurée : `obiconvert gbpln640.seq.gz` → 49s real, 42s user, 29s sys, **57 GB RSS**.
|
||||
Le sys élevé indique des allocations massives. Deux causes :
|
||||
1. `Pack()` : fusionne toute la rope (N × 128 MB) en un buffer contigu avant de parser
|
||||
2. Parser ORIGIN : `string(bline)` + `TrimSpace` + `SplitN` × millions de lignes
|
||||
|
||||
### 1. `gbRopeScanner`
|
||||
|
||||
Struct de lecture ligne par ligne sur la rope, sans allocation heap :
|
||||
|
||||
```go
|
||||
type gbRopeScanner struct {
|
||||
current *PieceOfChunk
|
||||
pos int
|
||||
carry [256]byte // stack-allocated, max GenBank line = 80 chars
|
||||
carryN int
|
||||
}
|
||||
```
|
||||
|
||||
`ReadLine()` :
|
||||
- Cherche `\n` dans `current.data[pos:]` via `bytes.IndexByte`
|
||||
- Si trouvé sans carry : retourne slice direct du node (zéro alloc)
|
||||
- Si trouvé avec carry : copie dans carry buffer, retourne `carry[:n]`
|
||||
- Si non trouvé : copie le reste dans carry, avance au node suivant, recommence
|
||||
- EOF : retourne `carry[:carryN]` puis nil
|
||||
|
||||
`extractSequence(dest []byte, UtoT bool) int` :
|
||||
- Scan direct des bytes pour section ORIGIN, sans passer par ReadLine
|
||||
- Machine d'états : lineStart → skip espaces/digits → copier nucléotides dans dest
|
||||
- Stop sur `//` en début de ligne
|
||||
- Zéro allocation, UtoT inline
|
||||
|
||||
### 2. `GenbankChunkParserRope`
|
||||
|
||||
```go
|
||||
func GenbankChunkParserRope(source string, rope *PieceOfChunk,
|
||||
withFeatureTable, UtoT bool) (obiseq.BioSequenceSlice, error)
|
||||
```
|
||||
|
||||
- Même machine d'états que `GenbankChunkParser`, sur `[]byte` (`bytes.HasPrefix`)
|
||||
- LOCUS : extrait `id` et `lseq` par scan direct (remplace `_seqlenght_rx`)
|
||||
- FEATURES / default inFeature : taxid extrait par scan de `/db_xref="taxon:`
|
||||
dans la source feature ; `featBytes` rempli seulement si `withFeatureTable=true`
|
||||
- DEFINITION : toujours conservée
|
||||
- ORIGIN : `dest = make([]byte, 0, lseq+20)` puis `s.extractSequence(dest, UtoT)`
|
||||
|
||||
### 3. Modifications `_ParseGenbankFile` et `ReadGenbank`
|
||||
|
||||
`_ParseGenbankFile` utilise `chunk.Rope` :
|
||||
```go
|
||||
sequences, err := GenbankChunkParserRope(chunk.Source, chunk.Rope, ...)
|
||||
```
|
||||
|
||||
`ReadGenbank` passe `pack=false` :
|
||||
```go
|
||||
entry_channel := ReadFileChunk(..., false)
|
||||
```
|
||||
|
||||
### 4. Ce qui NE change pas
|
||||
|
||||
- `GenbankChunkParser` reste (référence, tests)
|
||||
- `ReadFileChunk`, `Pack()`, autres parseurs (EMBL, FASTA, FASTQ) : inchangés
|
||||
|
||||
### 5. Gains attendus
|
||||
|
||||
- **RSS** : pic ≈ 128 MB × workers (au lieu de N × 128 MB)
|
||||
- **Temps sys** : élimination des mmap/munmap pour les gros buffers
|
||||
- **Temps user** : ~50M allocations éliminées
|
||||
|
||||
### 6. Vérification
|
||||
|
||||
```bash
|
||||
/usr/local/go/bin/go build ./...
|
||||
diff <(obiconvert gbpln640.seq.gz) gbpln640.reference.fasta
|
||||
cd bugs/genbank && ./benchmark.sh gbpln640.seq.gz
|
||||
```
|
||||
|
||||
Cible : RSS < 1 GB, temps comparable ou meilleur.
|
||||
@@ -0,0 +1,34 @@
|
||||
package main
|
||||
|
||||
import (
|
||||
"context"
|
||||
"errors"
|
||||
"os"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obik"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
func main() {
|
||||
defer obiseq.LogBioSeqStatus()
|
||||
|
||||
opt, parser := obioptions.GenerateSubcommandParser(
|
||||
"obik",
|
||||
"Manage disk-based kmer indices",
|
||||
obik.OptionSet,
|
||||
)
|
||||
|
||||
_, remaining := parser(os.Args)
|
||||
|
||||
err := opt.Dispatch(context.Background(), remaining)
|
||||
if err != nil {
|
||||
if errors.Is(err, getoptions.ErrorHelpCalled) {
|
||||
os.Exit(0)
|
||||
}
|
||||
log.Fatalf("Error: %v", err)
|
||||
}
|
||||
}
|
||||
@@ -1,47 +0,0 @@
|
||||
package main
|
||||
|
||||
import (
|
||||
"os"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obilowmask"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
)
|
||||
|
||||
func main() {
|
||||
|
||||
defer obiseq.LogBioSeqStatus()
|
||||
|
||||
// go tool pprof -http=":8000" ./obipairing ./cpu.pprof
|
||||
// f, err := os.Create("cpu.pprof")
|
||||
// if err != nil {
|
||||
// log.Fatal(err)
|
||||
// }
|
||||
// pprof.StartCPUProfile(f)
|
||||
// defer pprof.StopCPUProfile()
|
||||
|
||||
// go tool trace cpu.trace
|
||||
// ftrace, err := os.Create("cpu.trace")
|
||||
// if err != nil {
|
||||
// log.Fatal(err)
|
||||
// }
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obimicrosat",
|
||||
"looks for microsatellites sequences in a sequence file",
|
||||
obilowmask.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||
|
||||
selected := obilowmask.CLISequenceEntropyMasker(sequences)
|
||||
obiconvert.CLIWriteBioSequences(selected, true)
|
||||
obiutils.WaitForLastPipe()
|
||||
|
||||
}
|
||||
@@ -1,34 +0,0 @@
|
||||
package main
|
||||
|
||||
import (
|
||||
"os"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obisuperkmer"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
)
|
||||
|
||||
func main() {
|
||||
// Generate option parser
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obisuperkmer",
|
||||
"extract super k-mers from sequence files",
|
||||
obisuperkmer.OptionSet)
|
||||
|
||||
// Parse command-line arguments
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
// Read input sequences
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||
|
||||
// Extract super k-mers
|
||||
superkmers := obisuperkmer.CLIExtractSuperKmers(sequences)
|
||||
|
||||
// Write output sequences
|
||||
obiconvert.CLIWriteBioSequences(superkmers, true)
|
||||
|
||||
// Wait for pipeline completion
|
||||
obiutils.WaitForLastPipe()
|
||||
}
|
||||
@@ -14,6 +14,7 @@ require (
|
||||
github.com/goccy/go-json v0.10.3
|
||||
github.com/klauspost/pgzip v1.2.6
|
||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58
|
||||
github.com/pelletier/go-toml/v2 v2.2.4
|
||||
github.com/rrethy/ahocorasick v1.0.0
|
||||
github.com/schollz/progressbar/v3 v3.13.1
|
||||
github.com/sirupsen/logrus v1.9.3
|
||||
@@ -27,14 +28,10 @@ require (
|
||||
)
|
||||
|
||||
require (
|
||||
github.com/RoaringBitmap/roaring v1.9.4 // indirect
|
||||
github.com/bits-and-blooms/bitset v1.12.0 // indirect
|
||||
github.com/davecgh/go-spew v1.1.1 // indirect
|
||||
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 // indirect
|
||||
github.com/kr/pretty v0.3.1 // indirect
|
||||
github.com/kr/text v0.2.0 // indirect
|
||||
github.com/mschoch/smat v0.2.0 // indirect
|
||||
github.com/pelletier/go-toml/v2 v2.2.4 // indirect
|
||||
github.com/pmezard/go-difflib v1.0.0 // indirect
|
||||
github.com/rogpeppe/go-internal v1.12.0 // indirect
|
||||
)
|
||||
|
||||
@@ -4,12 +4,8 @@ github.com/PaesslerAG/gval v1.2.2 h1:Y7iBzhgE09IGTt5QgGQ2IdaYYYOU134YGHBThD+wm9E
|
||||
github.com/PaesslerAG/gval v1.2.2/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
|
||||
github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
|
||||
github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
|
||||
github.com/RoaringBitmap/roaring v1.9.4 h1:yhEIoH4YezLYT04s1nHehNO64EKFTop/wBhxv2QzDdQ=
|
||||
github.com/RoaringBitmap/roaring v1.9.4/go.mod h1:6AXUsoIEzDTFFQCe1RbGA6uFONMhvejWj5rqITANK90=
|
||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
|
||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
|
||||
github.com/bits-and-blooms/bitset v1.12.0 h1:U/q1fAF7xXRhFCrhROzIfffYnu+dlS38vCZtmFVPHmA=
|
||||
github.com/bits-and-blooms/bitset v1.12.0/go.mod h1:7hO7Gc7Pp1vODcmWvKMRA9BNmbv6a/7QIWpPxHddWR8=
|
||||
github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
|
||||
github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
|
||||
github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
|
||||
@@ -51,8 +47,6 @@ github.com/mattn/go-runewidth v0.0.15 h1:UNAjwbU9l54TA3KzvqLGxwWjHmMgBUVhBiTjelZ
|
||||
github.com/mattn/go-runewidth v0.0.15/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
|
||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2EmQ4l5rM/4FEfDWcRD+abF5XlKShorW5LRoQ=
|
||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
|
||||
github.com/mschoch/smat v0.2.0 h1:8imxQsjDm8yFEAVBe7azKmKSgzSkZXDuKkSq9374khM=
|
||||
github.com/mschoch/smat v0.2.0/go.mod h1:kc9mz7DoBKqDyiRL7VZN8KvXQMWeTaVnttLRXOlotKw=
|
||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
|
||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58/go.mod h1:DXv8WO4yhMYhSNPKjeNKa5WY9YCIEBRbNzFFPJbWO6Y=
|
||||
github.com/pelletier/go-toml/v2 v2.2.4 h1:mye9XuhQ6gvn5h28+VilKrrPoQVanw5PMw/TB0t5Ec4=
|
||||
|
||||
+33
-8
@@ -7,6 +7,7 @@ INSTALL_DIR="/usr/local"
|
||||
OBITOOLS_PREFIX=""
|
||||
VERSION=""
|
||||
LIST_VERSIONS=false
|
||||
JOBS=1
|
||||
|
||||
# Help message
|
||||
function display_help {
|
||||
@@ -21,6 +22,7 @@ function display_help {
|
||||
echo " gobigrep command instead of obigrep)."
|
||||
echo " -v, --version Install a specific version (e.g., 4.4.8)."
|
||||
echo " If not specified, installs the latest version."
|
||||
echo " -j, --jobs Number of parallel jobs for compilation (default: 1)."
|
||||
echo " -l, --list List all available versions and exit."
|
||||
echo " -h, --help Display this help message."
|
||||
echo ""
|
||||
@@ -65,6 +67,10 @@ while [ "$#" -gt 0 ]; do
|
||||
VERSION="$2"
|
||||
shift 2
|
||||
;;
|
||||
-j|--jobs)
|
||||
JOBS="$2"
|
||||
shift 2
|
||||
;;
|
||||
-l|--list)
|
||||
LIST_VERSIONS=true
|
||||
shift
|
||||
@@ -122,9 +128,15 @@ mkdir -p "${WORK_DIR}/cache" \
|
||||
exit 1)
|
||||
|
||||
# Create installation directory
|
||||
mkdir -p "${INSTALL_DIR}/bin" 2> /dev/null \
|
||||
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
||||
sudo mkdir -p "${INSTALL_DIR}/bin")
|
||||
if ! mkdir -p "${INSTALL_DIR}/bin" 2>/dev/null; then
|
||||
if [ ! -w "$(dirname "${INSTALL_DIR}")" ] && [ ! -w "${INSTALL_DIR}" ]; then
|
||||
echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
||||
sudo mkdir -p "${INSTALL_DIR}/bin"
|
||||
else
|
||||
echo "Error: Could not create ${INSTALL_DIR}/bin (check path or disk space)" 1>&2
|
||||
exit 1
|
||||
fi
|
||||
fi
|
||||
|
||||
if [[ ! -d "${INSTALL_DIR}/bin" ]]; then
|
||||
echo "Could not create ${INSTALL_DIR}/bin directory for installing obitools" 1>&2
|
||||
@@ -208,16 +220,29 @@ mkdir -p vendor
|
||||
|
||||
# Build with or without prefix
|
||||
if [[ -z "$OBITOOLS_PREFIX" ]] ; then
|
||||
make GOFLAGS="-buildvcs=false"
|
||||
make -j"${JOBS}" obitools GOFLAGS="-buildvcs=false"
|
||||
else
|
||||
make GOFLAGS="-buildvcs=false" OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
|
||||
make -j"${JOBS}" obitools GOFLAGS="-buildvcs=false" OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
|
||||
fi
|
||||
|
||||
# Install binaries
|
||||
echo "Installing binaries to ${INSTALL_DIR}/bin..." 1>&2
|
||||
(cp build/* "${INSTALL_DIR}/bin" 2> /dev/null) \
|
||||
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
||||
sudo cp build/* "${INSTALL_DIR}/bin")
|
||||
if ! cp build/* "${INSTALL_DIR}/bin" 2>/dev/null; then
|
||||
if [ ! -w "${INSTALL_DIR}/bin" ]; then
|
||||
echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
||||
sudo cp build/* "${INSTALL_DIR}/bin"
|
||||
else
|
||||
echo "Error: Could not copy binaries to ${INSTALL_DIR}/bin" 1>&2
|
||||
echo " Source files: $(ls build/ 2>/dev/null || echo 'none found')" 1>&2
|
||||
echo "" 1>&2
|
||||
echo "The build directory has been preserved for manual recovery:" 1>&2
|
||||
echo " $(pwd)/build/" 1>&2
|
||||
echo "You can install manually with:" 1>&2
|
||||
echo " cp $(pwd)/build/* ${INSTALL_DIR}/bin/" 1>&2
|
||||
popd > /dev/null || true
|
||||
exit 1
|
||||
fi
|
||||
fi
|
||||
|
||||
popd > /dev/null || exit
|
||||
|
||||
|
||||
@@ -1,292 +0,0 @@
|
||||
# Filtre de Fréquence avec v Niveaux de Roaring Bitmaps
|
||||
|
||||
## Algorithme
|
||||
|
||||
```go
|
||||
Pour chaque k-mer rencontré dans les données:
|
||||
c = 0
|
||||
tant que (k-mer ∈ index[c] ET c < v):
|
||||
c++
|
||||
|
||||
si c < v:
|
||||
index[c].insert(k-mer)
|
||||
```
|
||||
|
||||
**Résultat** : `index[v-1]` contient les k-mers vus **≥ v fois**
|
||||
|
||||
---
|
||||
|
||||
## Exemple d'exécution (v=3)
|
||||
|
||||
```
|
||||
Données:
|
||||
Read1: kmer X
|
||||
Read2: kmer X
|
||||
Read3: kmer X (X vu 3 fois)
|
||||
Read4: kmer Y
|
||||
Read5: kmer Y (Y vu 2 fois)
|
||||
Read6: kmer Z (Z vu 1 fois)
|
||||
|
||||
Exécution:
|
||||
|
||||
Read1 (X):
|
||||
c=0: X ∉ index[0] → index[0].add(X)
|
||||
État: index[0]={X}, index[1]={}, index[2]={}
|
||||
|
||||
Read2 (X):
|
||||
c=0: X ∈ index[0] → c=1
|
||||
c=1: X ∉ index[1] → index[1].add(X)
|
||||
État: index[0]={X}, index[1]={X}, index[2]={}
|
||||
|
||||
Read3 (X):
|
||||
c=0: X ∈ index[0] → c=1
|
||||
c=1: X ∈ index[1] → c=2
|
||||
c=2: X ∉ index[2] → index[2].add(X)
|
||||
État: index[0]={X}, index[1]={X}, index[2]={X}
|
||||
|
||||
Read4 (Y):
|
||||
c=0: Y ∉ index[0] → index[0].add(Y)
|
||||
État: index[0]={X,Y}, index[1]={X}, index[2]={X}
|
||||
|
||||
Read5 (Y):
|
||||
c=0: Y ∈ index[0] → c=1
|
||||
c=1: Y ∉ index[1] → index[1].add(Y)
|
||||
État: index[0]={X,Y}, index[1]={X,Y}, index[2]={X}
|
||||
|
||||
Read6 (Z):
|
||||
c=0: Z ∉ index[0] → index[0].add(Z)
|
||||
État: index[0]={X,Y,Z}, index[1]={X,Y}, index[2]={X}
|
||||
|
||||
Résultat final:
|
||||
index[0] (freq≥1): {X, Y, Z}
|
||||
index[1] (freq≥2): {X, Y}
|
||||
index[2] (freq≥3): {X} ← K-mers filtrés ✓
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Utilisation
|
||||
|
||||
```go
|
||||
// Créer le filtre
|
||||
filter := obikmer.NewFrequencyFilter(31, 3) // k=31, minFreq=3
|
||||
|
||||
// Ajouter les séquences
|
||||
for _, read := range reads {
|
||||
filter.AddSequence(read)
|
||||
}
|
||||
|
||||
// Récupérer les k-mers filtrés (freq ≥ 3)
|
||||
filtered := filter.GetFilteredSet("filtered")
|
||||
fmt.Printf("K-mers de qualité: %d\n", filtered.Cardinality())
|
||||
|
||||
// Statistiques
|
||||
stats := filter.Stats()
|
||||
fmt.Println(stats.String())
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Performance
|
||||
|
||||
### Complexité
|
||||
|
||||
**Par k-mer** :
|
||||
- Lookups : Moyenne ~v/2, pire cas v
|
||||
- Insertions : 1 Add
|
||||
- **Pas de Remove** ✅
|
||||
|
||||
**Total pour n k-mers** :
|
||||
- Temps : O(n × v/2)
|
||||
- Mémoire : O(unique_kmers × v × 2 bytes)
|
||||
|
||||
### Early exit pour distribution skewed
|
||||
|
||||
Avec distribution typique (séquençage) :
|
||||
```
|
||||
80% singletons → 1 lookup (early exit)
|
||||
15% freq 2-3 → 2-3 lookups
|
||||
5% freq ≥4 → jusqu'à v lookups
|
||||
|
||||
Moyenne réelle : ~2 lookups/kmer (au lieu de v/2)
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Mémoire
|
||||
|
||||
### Pour 10^8 k-mers uniques
|
||||
|
||||
| v (minFreq) | Nombre bitmaps | Mémoire | vs map simple |
|
||||
|-------------|----------------|---------|---------------|
|
||||
| v=2 | 2 | ~400 MB | 6x moins |
|
||||
| v=3 | 3 | ~600 MB | 4x moins |
|
||||
| v=5 | 5 | ~1 GB | 2.4x moins |
|
||||
| v=10 | 10 | ~2 GB | 1.2x moins |
|
||||
| v=20 | 20 | ~4 GB | ~égal |
|
||||
|
||||
**Note** : Avec distribution skewed (beaucoup de singletons), la mémoire réelle est bien plus faible car les niveaux hauts ont peu d'éléments.
|
||||
|
||||
### Exemple réaliste (séquençage)
|
||||
|
||||
Pour 10^8 k-mers totaux, v=3 :
|
||||
```
|
||||
Distribution:
|
||||
80% singletons → 80M dans index[0]
|
||||
15% freq 2-3 → 15M dans index[1]
|
||||
5% freq ≥3 → 5M dans index[2]
|
||||
|
||||
Mémoire:
|
||||
index[0]: 80M × 2 bytes = 160 MB
|
||||
index[1]: 15M × 2 bytes = 30 MB
|
||||
index[2]: 5M × 2 bytes = 10 MB
|
||||
Total: ~200 MB ✅
|
||||
|
||||
vs map simple: 80M × 24 bytes = ~2 GB
|
||||
Réduction: 10x
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Comparaison des approches
|
||||
|
||||
| Approche | Mémoire (10^8 kmers) | Passes | Lookups/kmer | Quand utiliser |
|
||||
|----------|----------------------|--------|--------------|----------------|
|
||||
| **v-Bitmaps** | **200-600 MB** | **1** | **~2 (avg)** | **Standard** ✅ |
|
||||
| Map simple | 2.4 GB | 1 | 1 | Si RAM illimitée |
|
||||
| Multi-pass | 400 MB | v | v | Si I/O pas cher |
|
||||
|
||||
---
|
||||
|
||||
## Avantages de v-Bitmaps
|
||||
|
||||
✅ **Une seule passe** sur les données
|
||||
✅ **Mémoire optimale** avec Roaring bitmaps
|
||||
✅ **Pas de Remove** (seulement Contains + Add)
|
||||
✅ **Early exit** efficace sur singletons
|
||||
✅ **Scalable** jusqu'à v~10-20
|
||||
✅ **Simple** à implémenter et comprendre
|
||||
|
||||
---
|
||||
|
||||
## Cas d'usage typiques
|
||||
|
||||
### 1. Éliminer erreurs de séquençage
|
||||
|
||||
```go
|
||||
filter := obikmer.NewFrequencyFilter(31, 3)
|
||||
|
||||
// Traiter FASTQ
|
||||
for read := range StreamFastq("sample.fastq") {
|
||||
filter.AddSequence(read)
|
||||
}
|
||||
|
||||
// K-mers de qualité (pas d'erreurs)
|
||||
cleaned := filter.GetFilteredSet("cleaned")
|
||||
```
|
||||
|
||||
**Résultat** : Élimine 70-80% des k-mers (erreurs)
|
||||
|
||||
### 2. Assemblage de génome
|
||||
|
||||
```go
|
||||
filter := obikmer.NewFrequencyFilter(31, 2)
|
||||
|
||||
// Filtrer avant l'assemblage
|
||||
for read := range reads {
|
||||
filter.AddSequence(read)
|
||||
}
|
||||
|
||||
solidKmers := filter.GetFilteredSet("solid")
|
||||
// Utiliser solidKmers pour le graphe de Bruijn
|
||||
```
|
||||
|
||||
### 3. Comparaison de génomes
|
||||
|
||||
```go
|
||||
collection := obikmer.NewKmerSetCollection(31)
|
||||
|
||||
for _, genome := range genomes {
|
||||
filter := obikmer.NewFrequencyFilter(31, 3)
|
||||
filter.AddSequences(genome.Reads)
|
||||
|
||||
cleaned := filter.GetFilteredSet(genome.ID)
|
||||
collection.Add(cleaned)
|
||||
}
|
||||
|
||||
// Analyses comparatives sur k-mers de qualité
|
||||
matrix := collection.ParallelPairwiseJaccard(8)
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Limites
|
||||
|
||||
**Pour v > 20** :
|
||||
- Trop de lookups (v lookups/kmer)
|
||||
- Mémoire importante (v × 200MB pour 10^8 kmers)
|
||||
|
||||
**Solutions alternatives pour v > 20** :
|
||||
- Utiliser map simple (9 bytes/kmer) si RAM disponible
|
||||
- Algorithme différent (sketch, probabiliste)
|
||||
|
||||
---
|
||||
|
||||
## Optimisations possibles
|
||||
|
||||
### 1. Parallélisation
|
||||
|
||||
```go
|
||||
// Traiter plusieurs fichiers en parallèle
|
||||
filters := make([]*FrequencyFilter, numFiles)
|
||||
|
||||
var wg sync.WaitGroup
|
||||
for i, file := range files {
|
||||
wg.Add(1)
|
||||
go func(idx int, f string) {
|
||||
defer wg.Done()
|
||||
filters[idx] = ProcessFile(f, k, minFreq)
|
||||
}(i, file)
|
||||
}
|
||||
wg.Wait()
|
||||
|
||||
// Merger les résultats
|
||||
merged := MergeFilters(filters)
|
||||
```
|
||||
|
||||
### 2. Streaming avec seuil adaptatif
|
||||
|
||||
```go
|
||||
// Commencer avec v=5, réduire progressivement
|
||||
filter := obikmer.NewFrequencyFilter(31, 5)
|
||||
|
||||
// ... traitement ...
|
||||
|
||||
// Si trop de mémoire, réduire à v=3
|
||||
if filter.MemoryUsage() > threshold {
|
||||
filter = ConvertToLowerThreshold(filter, 3)
|
||||
}
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Récapitulatif final
|
||||
|
||||
**Pour filtrer les k-mers par fréquence ≥ v :**
|
||||
|
||||
1. **Créer** : `filter := NewFrequencyFilter(k, v)`
|
||||
2. **Traiter** : `filter.AddSequence(read)` pour chaque read
|
||||
3. **Résultat** : `filtered := filter.GetFilteredSet(id)`
|
||||
|
||||
**Mémoire** : ~2v MB par million de k-mers uniques
|
||||
**Temps** : Une seule passe, ~2 lookups/kmer en moyenne
|
||||
**Optimal pour** : v ≤ 20, distribution skewed (séquençage)
|
||||
|
||||
---
|
||||
|
||||
## Code fourni
|
||||
|
||||
1. **frequency_filter.go** - Implémentation complète
|
||||
2. **examples_frequency_filter_final.go** - Exemples d'utilisation
|
||||
|
||||
**Tout est prêt à utiliser !** 🚀
|
||||
@@ -1,320 +0,0 @@
|
||||
package main
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"obikmer"
|
||||
)
|
||||
|
||||
func main() {
|
||||
// ==========================================
|
||||
// EXEMPLE 1 : Utilisation basique
|
||||
// ==========================================
|
||||
fmt.Println("=== EXEMPLE 1 : Utilisation basique ===\n")
|
||||
|
||||
k := 31
|
||||
minFreq := 3 // Garder les k-mers vus ≥3 fois
|
||||
|
||||
// Créer le filtre
|
||||
filter := obikmer.NewFrequencyFilter(k, minFreq)
|
||||
|
||||
// Simuler des séquences avec différentes fréquences
|
||||
sequences := [][]byte{
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X (freq=2)
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X (freq=3) ✓
|
||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Kmer Y
|
||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Kmer Y (freq=2) ✗
|
||||
[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // Kmer Z (freq=1) ✗
|
||||
}
|
||||
|
||||
fmt.Printf("Traitement de %d séquences...\n", len(sequences))
|
||||
for _, seq := range sequences {
|
||||
filter.AddSequence(seq)
|
||||
}
|
||||
|
||||
// Récupérer les k-mers filtrés
|
||||
filtered := filter.GetFilteredSet("filtered")
|
||||
fmt.Printf("\nK-mers avec freq ≥ %d: %d\n", minFreq, filtered.Cardinality())
|
||||
|
||||
// Statistiques
|
||||
stats := filter.Stats()
|
||||
fmt.Println("\n" + stats.String())
|
||||
|
||||
// ==========================================
|
||||
// EXEMPLE 2 : Vérifier les niveaux
|
||||
// ==========================================
|
||||
fmt.Println("\n=== EXEMPLE 2 : Inspection des niveaux ===\n")
|
||||
|
||||
// Vérifier chaque niveau
|
||||
for level := 0; level < minFreq; level++ {
|
||||
levelSet := filter.GetKmersAtLevel(level)
|
||||
fmt.Printf("Niveau %d (freq≥%d): %d k-mers\n",
|
||||
level+1, level+1, levelSet.Cardinality())
|
||||
}
|
||||
|
||||
// ==========================================
|
||||
// EXEMPLE 3 : Données réalistes
|
||||
// ==========================================
|
||||
fmt.Println("\n=== EXEMPLE 3 : Simulation données séquençage ===\n")
|
||||
|
||||
filter2 := obikmer.NewFrequencyFilter(31, 3)
|
||||
|
||||
// Simuler un dataset réaliste :
|
||||
// - 1000 reads
|
||||
// - 80% contiennent des erreurs (singletons)
|
||||
// - 15% vrais k-mers à basse fréquence
|
||||
// - 5% vrais k-mers à haute fréquence
|
||||
|
||||
// Vraie séquence répétée
|
||||
trueSeq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
|
||||
for i := 0; i < 50; i++ {
|
||||
filter2.AddSequence(trueSeq)
|
||||
}
|
||||
|
||||
// Séquence à fréquence moyenne
|
||||
mediumSeq := []byte("CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC")
|
||||
for i := 0; i < 5; i++ {
|
||||
filter2.AddSequence(mediumSeq)
|
||||
}
|
||||
|
||||
// Erreurs de séquençage (singletons)
|
||||
for i := 0; i < 100; i++ {
|
||||
errorSeq := []byte(fmt.Sprintf("TTTTTTTTTTTTTTTTTTTTTTTTTTTT%03d", i))
|
||||
filter2.AddSequence(errorSeq)
|
||||
}
|
||||
|
||||
stats2 := filter2.Stats()
|
||||
fmt.Println(stats2.String())
|
||||
|
||||
fmt.Println("Distribution attendue:")
|
||||
fmt.Println(" - Beaucoup de singletons (erreurs)")
|
||||
fmt.Println(" - Peu de k-mers à haute fréquence (signal)")
|
||||
fmt.Println(" → Filtrage efficace !")
|
||||
|
||||
// ==========================================
|
||||
// EXEMPLE 4 : Tester différents seuils
|
||||
// ==========================================
|
||||
fmt.Println("\n=== EXEMPLE 4 : Comparaison de seuils ===\n")
|
||||
|
||||
testSeqs := [][]byte{
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // freq=5
|
||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"),
|
||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"),
|
||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // freq=3
|
||||
[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // freq=1
|
||||
}
|
||||
|
||||
for _, minFreq := range []int{2, 3, 5} {
|
||||
f := obikmer.NewFrequencyFilter(31, minFreq)
|
||||
f.AddSequences(testSeqs)
|
||||
|
||||
fmt.Printf("minFreq=%d: %d k-mers retenus (%.2f MB)\n",
|
||||
minFreq,
|
||||
f.Cardinality(),
|
||||
float64(f.MemoryUsage())/1024/1024)
|
||||
}
|
||||
|
||||
// ==========================================
|
||||
// EXEMPLE 5 : Comparaison mémoire
|
||||
// ==========================================
|
||||
fmt.Println("\n=== EXEMPLE 5 : Comparaison mémoire ===\n")
|
||||
|
||||
filter3 := obikmer.NewFrequencyFilter(31, 3)
|
||||
|
||||
// Simuler 10000 séquences
|
||||
for i := 0; i < 10000; i++ {
|
||||
seq := make([]byte, 100)
|
||||
for j := range seq {
|
||||
seq[j] = "ACGT"[(i+j)%4]
|
||||
}
|
||||
filter3.AddSequence(seq)
|
||||
}
|
||||
|
||||
fmt.Println(filter3.CompareWithSimpleMap())
|
||||
|
||||
// ==========================================
|
||||
// EXEMPLE 6 : Workflow complet
|
||||
// ==========================================
|
||||
fmt.Println("\n=== EXEMPLE 6 : Workflow complet ===\n")
|
||||
|
||||
fmt.Println("1. Créer le filtre")
|
||||
finalFilter := obikmer.NewFrequencyFilter(31, 3)
|
||||
|
||||
fmt.Println("2. Traiter les données (simulation)")
|
||||
// En pratique : lire depuis FASTQ
|
||||
// for read := range ReadFastq("data.fastq") {
|
||||
// finalFilter.AddSequence(read)
|
||||
// }
|
||||
|
||||
// Simulation
|
||||
for i := 0; i < 1000; i++ {
|
||||
seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
|
||||
finalFilter.AddSequence(seq)
|
||||
}
|
||||
|
||||
fmt.Println("3. Récupérer les k-mers filtrés")
|
||||
result := finalFilter.GetFilteredSet("final")
|
||||
|
||||
fmt.Println("4. Utiliser le résultat")
|
||||
fmt.Printf(" K-mers de qualité: %d\n", result.Cardinality())
|
||||
fmt.Printf(" Mémoire utilisée: %.2f MB\n", float64(finalFilter.MemoryUsage())/1024/1024)
|
||||
|
||||
fmt.Println("5. Sauvegarder (optionnel)")
|
||||
// result.Save("filtered_kmers.bin")
|
||||
|
||||
// ==========================================
|
||||
// EXEMPLE 7 : Vérification individuelle
|
||||
// ==========================================
|
||||
fmt.Println("\n=== EXEMPLE 7 : Vérification de k-mers spécifiques ===\n")
|
||||
|
||||
checkFilter := obikmer.NewFrequencyFilter(31, 3)
|
||||
|
||||
testSeq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
|
||||
for i := 0; i < 5; i++ {
|
||||
checkFilter.AddSequence(testSeq)
|
||||
}
|
||||
|
||||
var kmers []uint64
|
||||
kmers = obikmer.EncodeKmers(testSeq, 31, &kmers)
|
||||
|
||||
if len(kmers) > 0 {
|
||||
testKmer := kmers[0]
|
||||
|
||||
fmt.Printf("K-mer test: 0x%016X\n", testKmer)
|
||||
fmt.Printf(" Présent dans filtre: %v\n", checkFilter.Contains(testKmer))
|
||||
fmt.Printf(" Fréquence approx: %d\n", checkFilter.GetFrequency(testKmer))
|
||||
}
|
||||
|
||||
// ==========================================
|
||||
// EXEMPLE 8 : Intégration avec collection
|
||||
// ==========================================
|
||||
fmt.Println("\n=== EXEMPLE 8 : Intégration avec KmerSetCollection ===\n")
|
||||
|
||||
// Créer une collection de génomes filtrés
|
||||
collection := obikmer.NewKmerSetCollection(31)
|
||||
|
||||
genomes := map[string][][]byte{
|
||||
"Genome1": {
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Erreur
|
||||
},
|
||||
"Genome2": {
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
||||
[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // Erreur
|
||||
},
|
||||
}
|
||||
|
||||
for id, sequences := range genomes {
|
||||
// Filtrer chaque génome
|
||||
genomeFilter := obikmer.NewFrequencyFilter(31, 3)
|
||||
genomeFilter.AddSequences(sequences)
|
||||
|
||||
// Ajouter à la collection
|
||||
filteredSet := genomeFilter.GetFilteredSet(id)
|
||||
collection.Add(filteredSet)
|
||||
|
||||
fmt.Printf("%s: %d k-mers de qualité\n", id, filteredSet.Cardinality())
|
||||
}
|
||||
|
||||
// Analyser la collection
|
||||
fmt.Println("\nAnalyse comparative:")
|
||||
collectionStats := collection.ComputeStats()
|
||||
fmt.Printf(" Core genome: %d k-mers\n", collectionStats.CoreSize)
|
||||
fmt.Printf(" Pan genome: %d k-mers\n", collectionStats.PanGenomeSize)
|
||||
|
||||
// ==========================================
|
||||
// RÉSUMÉ
|
||||
// ==========================================
|
||||
fmt.Println("\n=== RÉSUMÉ ===\n")
|
||||
fmt.Println("Le FrequencyFilter permet de:")
|
||||
fmt.Println(" ✓ Filtrer les k-mers par fréquence minimale")
|
||||
fmt.Println(" ✓ Utiliser une mémoire optimale avec Roaring bitmaps")
|
||||
fmt.Println(" ✓ Une seule passe sur les données")
|
||||
fmt.Println(" ✓ Éliminer efficacement les erreurs de séquençage")
|
||||
fmt.Println("")
|
||||
fmt.Println("Workflow typique:")
|
||||
fmt.Println(" 1. filter := NewFrequencyFilter(k, minFreq)")
|
||||
fmt.Println(" 2. for each sequence: filter.AddSequence(seq)")
|
||||
fmt.Println(" 3. filtered := filter.GetFilteredSet(id)")
|
||||
fmt.Println(" 4. Utiliser filtered dans vos analyses")
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// FONCTION HELPER POUR BENCHMARKS
|
||||
// ==================================
|
||||
|
||||
func BenchmarkFrequencyFilter() {
|
||||
k := 31
|
||||
minFreq := 3
|
||||
|
||||
// Test avec différentes tailles
|
||||
sizes := []int{1000, 10000, 100000}
|
||||
|
||||
fmt.Println("\n=== BENCHMARK ===\n")
|
||||
|
||||
for _, size := range sizes {
|
||||
filter := obikmer.NewFrequencyFilter(k, minFreq)
|
||||
|
||||
// Générer des séquences
|
||||
for i := 0; i < size; i++ {
|
||||
seq := make([]byte, 100)
|
||||
for j := range seq {
|
||||
seq[j] = "ACGT"[(i+j)%4]
|
||||
}
|
||||
filter.AddSequence(seq)
|
||||
}
|
||||
|
||||
fmt.Printf("Size=%d reads:\n", size)
|
||||
fmt.Printf(" Filtered k-mers: %d\n", filter.Cardinality())
|
||||
fmt.Printf(" Memory: %.2f MB\n", float64(filter.MemoryUsage())/1024/1024)
|
||||
fmt.Println()
|
||||
}
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// FONCTION POUR DONNÉES RÉELLES
|
||||
// ==================================
|
||||
|
||||
func ProcessRealData() {
|
||||
// Exemple pour traiter de vraies données FASTQ
|
||||
|
||||
k := 31
|
||||
minFreq := 3
|
||||
|
||||
filter := obikmer.NewFrequencyFilter(k, minFreq)
|
||||
|
||||
// Pseudo-code pour lire un FASTQ
|
||||
/*
|
||||
fastqFile := "sample.fastq"
|
||||
reader := NewFastqReader(fastqFile)
|
||||
|
||||
for reader.HasNext() {
|
||||
read := reader.Next()
|
||||
filter.AddSequence(read.Sequence)
|
||||
}
|
||||
|
||||
// Récupérer le résultat
|
||||
filtered := filter.GetFilteredSet("sample_filtered")
|
||||
filtered.Save("sample_filtered_kmers.bin")
|
||||
|
||||
// Stats
|
||||
stats := filter.Stats()
|
||||
fmt.Println(stats.String())
|
||||
*/
|
||||
|
||||
fmt.Println("Workflow pour données réelles:")
|
||||
fmt.Println(" 1. Créer le filtre avec minFreq approprié (2-5 typique)")
|
||||
fmt.Println(" 2. Stream les reads depuis FASTQ")
|
||||
fmt.Println(" 3. Récupérer les k-mers filtrés")
|
||||
fmt.Println(" 4. Utiliser pour assemblage/comparaison/etc.")
|
||||
|
||||
_ = filter // unused
|
||||
}
|
||||
@@ -4,8 +4,8 @@
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obisuperkmer
|
||||
CMD=obisuperkmer
|
||||
TEST_NAME=obik-super
|
||||
CMD=obik
|
||||
|
||||
######
|
||||
#
|
||||
@@ -16,7 +16,7 @@ TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
MCMD="OBIk-super"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
@@ -65,31 +65,10 @@ log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
if $CMD super -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
@@ -100,7 +79,7 @@ fi
|
||||
|
||||
# Test 1: Basic super k-mer extraction with default parameters
|
||||
((ntest++))
|
||||
if obisuperkmer "${TEST_DIR}/test_sequences.fasta" \
|
||||
if $CMD super "${TEST_DIR}/test_sequences.fasta" \
|
||||
> "${TMPDIR}/output_default.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: basic extraction with default parameters OK"
|
||||
@@ -148,7 +127,7 @@ fi
|
||||
|
||||
# Test 5: Extract super k-mers with custom k and m parameters
|
||||
((ntest++))
|
||||
if obisuperkmer -k 15 -m 7 "${TEST_DIR}/test_sequences.fasta" \
|
||||
if $CMD super -k 15 -m 7 "${TEST_DIR}/test_sequences.fasta" \
|
||||
> "${TMPDIR}/output_k15_m7.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: extraction with custom k=15, m=7 OK"
|
||||
@@ -172,7 +151,7 @@ fi
|
||||
|
||||
# Test 7: Test with different output format (FASTA output explicitly)
|
||||
((ntest++))
|
||||
if obisuperkmer --fasta-output -k 21 -m 11 \
|
||||
if $CMD super --fasta-output -k 21 -m 11 \
|
||||
"${TEST_DIR}/test_sequences.fasta" \
|
||||
> "${TMPDIR}/output_fasta.fasta" 2>&1
|
||||
then
|
||||
@@ -209,7 +188,7 @@ fi
|
||||
|
||||
# Test 10: Test with output file option
|
||||
((ntest++))
|
||||
if obisuperkmer -o "${TMPDIR}/output_file.fasta" \
|
||||
if $CMD super -o "${TMPDIR}/output_file.fasta" \
|
||||
"${TEST_DIR}/test_sequences.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: output to file with -o option OK"
|
||||
|
||||
+152
-1
@@ -161,6 +161,149 @@ func EmblChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (obise
|
||||
return parser
|
||||
}
|
||||
|
||||
// extractEmblSeq scans the sequence section of an EMBL record directly on the
|
||||
// rope. EMBL sequence lines start with 5 spaces followed by bases in groups of
|
||||
// 10, separated by spaces, with a position number at the end. The section ends
|
||||
// with "//".
|
||||
func (s *ropeScanner) extractEmblSeq(dest []byte, UtoT bool) []byte {
|
||||
// We use ReadLine and scan each line for bases (skip digits, spaces, newlines).
|
||||
for {
|
||||
line := s.ReadLine()
|
||||
if line == nil {
|
||||
break
|
||||
}
|
||||
if len(line) >= 2 && line[0] == '/' && line[1] == '/' {
|
||||
break
|
||||
}
|
||||
// Lines start with 5 spaces; bases follow separated by single spaces.
|
||||
// Digits at the end are the position counter — skip them.
|
||||
// Simplest: take every byte that is a letter.
|
||||
for _, b := range line {
|
||||
if b >= 'A' && b <= 'Z' {
|
||||
b += 'a' - 'A'
|
||||
}
|
||||
if UtoT && b == 'u' {
|
||||
b = 't'
|
||||
}
|
||||
if b >= 'a' && b <= 'z' {
|
||||
dest = append(dest, b)
|
||||
}
|
||||
}
|
||||
}
|
||||
return dest
|
||||
}
|
||||
|
||||
// EmblChunkParserRope parses an EMBL chunk directly from a rope without Pack().
|
||||
func EmblChunkParserRope(source string, rope *PieceOfChunk, withFeatureTable, UtoT bool) (obiseq.BioSequenceSlice, error) {
|
||||
scanner := newRopeScanner(rope)
|
||||
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
|
||||
|
||||
var id string
|
||||
var scientificName string
|
||||
defBytes := make([]byte, 0, 256)
|
||||
featBytes := make([]byte, 0, 1024)
|
||||
var taxid int
|
||||
inSeq := false
|
||||
|
||||
for {
|
||||
line := scanner.ReadLine()
|
||||
if line == nil {
|
||||
break
|
||||
}
|
||||
|
||||
if inSeq {
|
||||
// Should not happen — extractEmblSeq consumed up to "//"
|
||||
inSeq = false
|
||||
continue
|
||||
}
|
||||
|
||||
switch {
|
||||
case bytes.HasPrefix(line, []byte("ID ")):
|
||||
id = string(bytes.SplitN(line[5:], []byte(";"), 2)[0])
|
||||
case bytes.HasPrefix(line, []byte("OS ")):
|
||||
scientificName = string(bytes.TrimSpace(line[5:]))
|
||||
case bytes.HasPrefix(line, []byte("DE ")):
|
||||
if len(defBytes) > 0 {
|
||||
defBytes = append(defBytes, ' ')
|
||||
}
|
||||
defBytes = append(defBytes, bytes.TrimSpace(line[5:])...)
|
||||
case withFeatureTable && bytes.HasPrefix(line, []byte("FH ")):
|
||||
featBytes = append(featBytes, line...)
|
||||
case withFeatureTable && bytes.Equal(line, []byte("FH")):
|
||||
featBytes = append(featBytes, '\n')
|
||||
featBytes = append(featBytes, line...)
|
||||
case bytes.HasPrefix(line, []byte("FT ")):
|
||||
if withFeatureTable {
|
||||
featBytes = append(featBytes, '\n')
|
||||
featBytes = append(featBytes, line...)
|
||||
}
|
||||
if bytes.HasPrefix(line, []byte(`FT /db_xref="taxon:`)) {
|
||||
rest := line[37:]
|
||||
end := bytes.IndexByte(rest, '"')
|
||||
if end > 0 {
|
||||
taxid, _ = strconv.Atoi(string(rest[:end]))
|
||||
}
|
||||
}
|
||||
case bytes.HasPrefix(line, []byte(" ")):
|
||||
// First sequence line: extract all bases via extractEmblSeq,
|
||||
// which also consumes this line's remaining content.
|
||||
// But ReadLine already consumed this line — we need to process it
|
||||
// plus subsequent lines. Process this line inline then call helper.
|
||||
seqDest := make([]byte, 0, 4096)
|
||||
for _, b := range line {
|
||||
if b >= 'A' && b <= 'Z' {
|
||||
b += 'a' - 'A'
|
||||
}
|
||||
if UtoT && b == 'u' {
|
||||
b = 't'
|
||||
}
|
||||
if b >= 'a' && b <= 'z' {
|
||||
seqDest = append(seqDest, b)
|
||||
}
|
||||
}
|
||||
seqDest = scanner.extractEmblSeq(seqDest, UtoT)
|
||||
|
||||
seq := obiseq.NewBioSequenceOwning(id, seqDest, string(defBytes))
|
||||
seq.SetSource(source)
|
||||
if withFeatureTable {
|
||||
seq.SetFeatures(featBytes)
|
||||
}
|
||||
annot := seq.Annotations()
|
||||
annot["scientific_name"] = scientificName
|
||||
annot["taxid"] = taxid
|
||||
sequences = append(sequences, seq)
|
||||
|
||||
// Reset state
|
||||
id = ""
|
||||
scientificName = ""
|
||||
defBytes = defBytes[:0]
|
||||
featBytes = featBytes[:0]
|
||||
taxid = 1
|
||||
|
||||
case bytes.Equal(line, []byte("//")):
|
||||
// record ended without SQ/sequence section (e.g. WGS entries)
|
||||
if id != "" {
|
||||
seq := obiseq.NewBioSequenceOwning(id, []byte{}, string(defBytes))
|
||||
seq.SetSource(source)
|
||||
if withFeatureTable {
|
||||
seq.SetFeatures(featBytes)
|
||||
}
|
||||
annot := seq.Annotations()
|
||||
annot["scientific_name"] = scientificName
|
||||
annot["taxid"] = taxid
|
||||
sequences = append(sequences, seq)
|
||||
}
|
||||
id = ""
|
||||
scientificName = ""
|
||||
defBytes = defBytes[:0]
|
||||
featBytes = featBytes[:0]
|
||||
taxid = 1
|
||||
}
|
||||
}
|
||||
|
||||
return sequences, nil
|
||||
}
|
||||
|
||||
func _ParseEmblFile(
|
||||
input ChannelFileChunk,
|
||||
out obiiter.IBioSequence,
|
||||
@@ -171,7 +314,14 @@ func _ParseEmblFile(
|
||||
|
||||
for chunks := range input {
|
||||
order := chunks.Order
|
||||
sequences, err := parser(chunks.Source, chunks.Raw)
|
||||
var sequences obiseq.BioSequenceSlice
|
||||
var err error
|
||||
|
||||
if chunks.Rope != nil {
|
||||
sequences, err = EmblChunkParserRope(chunks.Source, chunks.Rope, withFeatureTable, UtoT)
|
||||
} else {
|
||||
sequences, err = parser(chunks.Source, chunks.Raw)
|
||||
}
|
||||
|
||||
if err != nil {
|
||||
log.Fatalf("%s : Cannot parse the embl file : %v", chunks.Source, err)
|
||||
@@ -196,6 +346,7 @@ func ReadEMBL(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, er
|
||||
1024*1024*128,
|
||||
EndOfLastFlatFileEntry,
|
||||
"\nID ",
|
||||
false,
|
||||
)
|
||||
|
||||
newIter := obiiter.MakeIBioSequence()
|
||||
|
||||
@@ -209,28 +209,121 @@ func FastaChunkParser(UtoT bool) func(string, io.Reader) (obiseq.BioSequenceSlic
|
||||
return parser
|
||||
}
|
||||
|
||||
// extractFastaSeq scans sequence bytes from the rope directly into dest,
|
||||
// appending valid nucleotide characters and skipping whitespace.
|
||||
// Stops when '>' is found at the start of a line (next record) or at EOF.
|
||||
// Returns (dest with appended bases, hasMore).
|
||||
// hasMore=true means scanner is now positioned at '>' of the next record.
|
||||
func (s *ropeScanner) extractFastaSeq(dest []byte, UtoT bool) ([]byte, bool) {
|
||||
lineStart := true
|
||||
|
||||
for s.current != nil {
|
||||
data := s.current.data[s.pos:]
|
||||
for i, b := range data {
|
||||
if lineStart && b == '>' {
|
||||
s.pos += i
|
||||
if s.pos >= len(s.current.data) {
|
||||
s.current = s.current.Next()
|
||||
s.pos = 0
|
||||
}
|
||||
return dest, true
|
||||
}
|
||||
if b == '\n' || b == '\r' {
|
||||
lineStart = true
|
||||
continue
|
||||
}
|
||||
lineStart = false
|
||||
if b == ' ' || b == '\t' {
|
||||
continue
|
||||
}
|
||||
if b >= 'A' && b <= 'Z' {
|
||||
b += 'a' - 'A'
|
||||
}
|
||||
if UtoT && b == 'u' {
|
||||
b = 't'
|
||||
}
|
||||
dest = append(dest, b)
|
||||
}
|
||||
s.current = s.current.Next()
|
||||
s.pos = 0
|
||||
}
|
||||
return dest, false
|
||||
}
|
||||
|
||||
// FastaChunkParserRope parses a FASTA chunk directly from the rope without Pack().
|
||||
func FastaChunkParserRope(source string, rope *PieceOfChunk, UtoT bool) (obiseq.BioSequenceSlice, error) {
|
||||
scanner := newRopeScanner(rope)
|
||||
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
|
||||
|
||||
for {
|
||||
bline := scanner.ReadLine()
|
||||
if bline == nil {
|
||||
break
|
||||
}
|
||||
if len(bline) == 0 || bline[0] != '>' {
|
||||
continue
|
||||
}
|
||||
|
||||
// Parse header: ">id definition"
|
||||
header := bline[1:]
|
||||
var id string
|
||||
var definition string
|
||||
sp := bytes.IndexByte(header, ' ')
|
||||
if sp < 0 {
|
||||
sp = bytes.IndexByte(header, '\t')
|
||||
}
|
||||
if sp < 0 {
|
||||
id = string(header)
|
||||
} else {
|
||||
id = string(header[:sp])
|
||||
definition = string(bytes.TrimSpace(header[sp+1:]))
|
||||
}
|
||||
|
||||
seqDest := make([]byte, 0, 4096)
|
||||
var hasMore bool
|
||||
seqDest, hasMore = scanner.extractFastaSeq(seqDest, UtoT)
|
||||
|
||||
if len(seqDest) == 0 {
|
||||
log.Fatalf("%s [%s]: sequence is empty", source, id)
|
||||
}
|
||||
|
||||
seq := obiseq.NewBioSequenceOwning(id, seqDest, definition)
|
||||
seq.SetSource(source)
|
||||
sequences = append(sequences, seq)
|
||||
|
||||
if !hasMore {
|
||||
break
|
||||
}
|
||||
}
|
||||
|
||||
return sequences, nil
|
||||
}
|
||||
|
||||
func _ParseFastaFile(
|
||||
input ChannelFileChunk,
|
||||
out obiiter.IBioSequence,
|
||||
UtoT bool,
|
||||
) {
|
||||
|
||||
parser := FastaChunkParser(UtoT)
|
||||
|
||||
for chunks := range input {
|
||||
sequences, err := parser(chunks.Source, chunks.Raw)
|
||||
// obilog.Warnf("Chunck(%d:%d) -%d- ", chunks.Order, l, sequences.Len())
|
||||
var sequences obiseq.BioSequenceSlice
|
||||
var err error
|
||||
|
||||
if chunks.Rope != nil {
|
||||
sequences, err = FastaChunkParserRope(chunks.Source, chunks.Rope, UtoT)
|
||||
} else {
|
||||
sequences, err = parser(chunks.Source, chunks.Raw)
|
||||
}
|
||||
|
||||
if err != nil {
|
||||
log.Fatalf("File %s : Cannot parse the fasta file : %v", chunks.Source, err)
|
||||
}
|
||||
|
||||
out.Push(obiiter.MakeBioSequenceBatch(chunks.Source, chunks.Order, sequences))
|
||||
|
||||
}
|
||||
|
||||
out.Done()
|
||||
|
||||
}
|
||||
|
||||
func ReadFasta(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
|
||||
@@ -245,6 +338,7 @@ func ReadFasta(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
|
||||
1024*1024,
|
||||
EndOfLastFastaEntry,
|
||||
"\n>",
|
||||
false,
|
||||
)
|
||||
|
||||
for i := 0; i < nworker; i++ {
|
||||
|
||||
@@ -303,6 +303,80 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
|
||||
return parser
|
||||
}
|
||||
|
||||
// FastqChunkParserRope parses a FASTQ chunk directly from a rope without Pack().
|
||||
func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte, with_quality, UtoT bool) (obiseq.BioSequenceSlice, error) {
|
||||
scanner := newRopeScanner(rope)
|
||||
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
|
||||
|
||||
for {
|
||||
// Line 1: @id [definition]
|
||||
hline := scanner.ReadLine()
|
||||
if hline == nil {
|
||||
break
|
||||
}
|
||||
if len(hline) == 0 || hline[0] != '@' {
|
||||
continue
|
||||
}
|
||||
header := hline[1:]
|
||||
var id string
|
||||
var definition string
|
||||
sp := bytes.IndexByte(header, ' ')
|
||||
if sp < 0 {
|
||||
sp = bytes.IndexByte(header, '\t')
|
||||
}
|
||||
if sp < 0 {
|
||||
id = string(header)
|
||||
} else {
|
||||
id = string(header[:sp])
|
||||
definition = string(bytes.TrimSpace(header[sp+1:]))
|
||||
}
|
||||
|
||||
// Line 2: sequence
|
||||
sline := scanner.ReadLine()
|
||||
if sline == nil {
|
||||
log.Fatalf("@%s[%s]: unexpected EOF after header", id, source)
|
||||
}
|
||||
seqDest := make([]byte, len(sline))
|
||||
w := 0
|
||||
for _, b := range sline {
|
||||
if b >= 'A' && b <= 'Z' {
|
||||
b += 'a' - 'A'
|
||||
}
|
||||
if UtoT && b == 'u' {
|
||||
b = 't'
|
||||
}
|
||||
seqDest[w] = b
|
||||
w++
|
||||
}
|
||||
seqDest = seqDest[:w]
|
||||
if len(seqDest) == 0 {
|
||||
log.Fatalf("@%s[%s]: sequence is empty", id, source)
|
||||
}
|
||||
|
||||
// Line 3: + (skip)
|
||||
scanner.ReadLine()
|
||||
|
||||
// Line 4: quality
|
||||
qline := scanner.ReadLine()
|
||||
|
||||
seq := obiseq.NewBioSequenceOwning(id, seqDest, definition)
|
||||
seq.SetSource(source)
|
||||
|
||||
if with_quality && qline != nil {
|
||||
qDest := make([]byte, len(qline))
|
||||
copy(qDest, qline)
|
||||
for i := range qDest {
|
||||
qDest[i] -= quality_shift
|
||||
}
|
||||
seq.TakeQualities(qDest)
|
||||
}
|
||||
|
||||
sequences = append(sequences, seq)
|
||||
}
|
||||
|
||||
return sequences, nil
|
||||
}
|
||||
|
||||
func _ParseFastqFile(
|
||||
input ChannelFileChunk,
|
||||
out obiiter.IBioSequence,
|
||||
@@ -313,7 +387,14 @@ func _ParseFastqFile(
|
||||
parser := FastqChunkParser(quality_shift, with_quality, UtoT)
|
||||
|
||||
for chunks := range input {
|
||||
sequences, err := parser(chunks.Source, chunks.Raw)
|
||||
var sequences obiseq.BioSequenceSlice
|
||||
var err error
|
||||
|
||||
if chunks.Rope != nil {
|
||||
sequences, err = FastqChunkParserRope(chunks.Source, chunks.Rope, quality_shift, with_quality, UtoT)
|
||||
} else {
|
||||
sequences, err = parser(chunks.Source, chunks.Raw)
|
||||
}
|
||||
|
||||
if err != nil {
|
||||
log.Fatalf("File %s : Cannot parse the fastq file : %v", chunks.Source, err)
|
||||
@@ -339,6 +420,7 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
|
||||
1024*1024,
|
||||
EndOfLastFastqEntry,
|
||||
"\n@",
|
||||
false,
|
||||
)
|
||||
|
||||
for i := 0; i < nworker; i++ {
|
||||
|
||||
@@ -296,7 +296,7 @@ func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
|
||||
|
||||
case strings.HasSuffix(skey, "_taxid"):
|
||||
if dataType == jsonparser.Number || dataType == jsonparser.String {
|
||||
rank, _ := obiutils.SplitInTwo(skey, '_')
|
||||
rank := skey[:len(skey)-len("_taxid")]
|
||||
|
||||
taxid := string(value)
|
||||
sequence.SetTaxid(taxid, rank)
|
||||
|
||||
@@ -77,45 +77,47 @@ func FormatFasta(seq *obiseq.BioSequence, formater FormatHeader) string {
|
||||
//
|
||||
// It returns a byte array containing the formatted sequences.
|
||||
func FormatFastaBatch(batch obiiter.BioSequenceBatch, formater FormatHeader, skipEmpty bool) *bytes.Buffer {
|
||||
// Create a buffer to store the formatted sequences
|
||||
var bs bytes.Buffer
|
||||
|
||||
lt := 0
|
||||
|
||||
for _, seq := range batch.Slice() {
|
||||
lt += seq.Len()
|
||||
}
|
||||
|
||||
// Iterate over each sequence in the batch
|
||||
// Pre-allocate: sequence data + newlines every 60 chars + ~100 bytes header per sequence
|
||||
bs.Grow(lt + lt/60 + 100*batch.Len() + 1)
|
||||
|
||||
log.Debugf("FormatFastaBatch: #%d : %d seqs", batch.Order(), batch.Len())
|
||||
first := true
|
||||
|
||||
for _, seq := range batch.Slice() {
|
||||
// Check if the sequence is empty
|
||||
if seq.Len() > 0 {
|
||||
// Format the sequence using the provided formater function
|
||||
formattedSeq := FormatFasta(seq, formater)
|
||||
|
||||
if first {
|
||||
bs.Grow(lt + (len(formattedSeq)-seq.Len())*batch.Len()*5/4)
|
||||
first = false
|
||||
}
|
||||
|
||||
// Append the formatted sequence to the buffer
|
||||
bs.WriteString(formattedSeq)
|
||||
// Write header directly into bs — no intermediate string
|
||||
bs.WriteByte('>')
|
||||
bs.WriteString(seq.Id())
|
||||
bs.WriteByte(' ')
|
||||
bs.WriteString(formater(seq))
|
||||
bs.WriteByte('\n')
|
||||
|
||||
// Write folded sequence directly into bs — no copies
|
||||
s := seq.Sequence()
|
||||
l := len(s)
|
||||
for i := 0; i < l; i += 60 {
|
||||
to := i + 60
|
||||
if to > l {
|
||||
to = l
|
||||
}
|
||||
bs.Write(s[i:to])
|
||||
bs.WriteByte('\n')
|
||||
}
|
||||
} else {
|
||||
// Handle empty sequences
|
||||
if skipEmpty {
|
||||
// Skip empty sequences if skipEmpty is true
|
||||
obilog.Warnf("Sequence %s is empty and skipped in output", seq.Id())
|
||||
} else {
|
||||
// Terminate the program if skipEmpty is false
|
||||
log.Fatalf("Sequence %s is empty", seq.Id())
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// Return the byte array representation of the buffer
|
||||
return &bs
|
||||
}
|
||||
|
||||
|
||||
@@ -16,6 +16,7 @@ type SeqFileChunkParser func(string, io.Reader) (obiseq.BioSequenceSlice, error)
|
||||
type FileChunk struct {
|
||||
Source string
|
||||
Raw *bytes.Buffer
|
||||
Rope *PieceOfChunk
|
||||
Order int
|
||||
}
|
||||
|
||||
@@ -97,11 +98,17 @@ func (piece *PieceOfChunk) IsLast() bool {
|
||||
return piece.next == nil
|
||||
}
|
||||
|
||||
func (piece *PieceOfChunk) FileChunk(source string, order int) FileChunk {
|
||||
func (piece *PieceOfChunk) FileChunk(source string, order int, pack bool) FileChunk {
|
||||
piece = piece.Head()
|
||||
var raw *bytes.Buffer
|
||||
if pack {
|
||||
piece.Pack()
|
||||
raw = bytes.NewBuffer(piece.data)
|
||||
}
|
||||
return FileChunk{
|
||||
Source: source,
|
||||
Raw: bytes.NewBuffer(piece.data),
|
||||
Raw: raw,
|
||||
Rope: piece,
|
||||
Order: order,
|
||||
}
|
||||
}
|
||||
@@ -133,7 +140,8 @@ func ReadFileChunk(
|
||||
reader io.Reader,
|
||||
fileChunkSize int,
|
||||
splitter LastSeqRecord,
|
||||
probe string) ChannelFileChunk {
|
||||
probe string,
|
||||
pack bool) ChannelFileChunk {
|
||||
|
||||
chunk_channel := make(ChannelFileChunk)
|
||||
|
||||
@@ -205,7 +213,7 @@ func ReadFileChunk(
|
||||
|
||||
if len(pieces.data) > 0 {
|
||||
// obilog.Warnf("chuck %d :Read %d bytes from file %s", i, io.Len(), source)
|
||||
chunk_channel <- pieces.FileChunk(source, i)
|
||||
chunk_channel <- pieces.FileChunk(source, i, pack)
|
||||
i++
|
||||
}
|
||||
|
||||
@@ -222,7 +230,7 @@ func ReadFileChunk(
|
||||
|
||||
// Send the last chunk to the channel
|
||||
if pieces.Len() > 0 {
|
||||
chunk_channel <- pieces.FileChunk(source, i)
|
||||
chunk_channel <- pieces.FileChunk(source, i, pack)
|
||||
}
|
||||
|
||||
// Close the readers channel when the end of the file is reached
|
||||
|
||||
+273
-17
@@ -29,6 +29,265 @@ const (
|
||||
|
||||
var _seqlenght_rx = regexp.MustCompile(" +([0-9]+) bp")
|
||||
|
||||
// extractSequence scans the ORIGIN section byte-by-byte directly on the rope,
|
||||
// appending compacted bases to dest. Returns the extended slice.
|
||||
// Stops and returns when "//" is found at the start of a line.
|
||||
// The scanner is left positioned after the "//" line.
|
||||
func (s *ropeScanner) extractSequence(dest []byte, UtoT bool) []byte {
|
||||
lineStart := true
|
||||
skipDigits := true
|
||||
|
||||
for s.current != nil {
|
||||
data := s.current.data[s.pos:]
|
||||
for i, b := range data {
|
||||
if lineStart {
|
||||
if b == '/' {
|
||||
// End-of-record marker "//"
|
||||
s.pos += i + 1
|
||||
if s.pos >= len(s.current.data) {
|
||||
s.current = s.current.Next()
|
||||
s.pos = 0
|
||||
}
|
||||
s.skipToNewline()
|
||||
return dest
|
||||
}
|
||||
lineStart = false
|
||||
skipDigits = true
|
||||
}
|
||||
switch {
|
||||
case b == '\n':
|
||||
lineStart = true
|
||||
case b == '\r':
|
||||
// skip
|
||||
case skipDigits:
|
||||
if b != ' ' && (b < '0' || b > '9') {
|
||||
skipDigits = false
|
||||
if UtoT && b == 'u' {
|
||||
b = 't'
|
||||
}
|
||||
dest = append(dest, b)
|
||||
}
|
||||
case b != ' ':
|
||||
if UtoT && b == 'u' {
|
||||
b = 't'
|
||||
}
|
||||
dest = append(dest, b)
|
||||
}
|
||||
}
|
||||
s.current = s.current.Next()
|
||||
s.pos = 0
|
||||
}
|
||||
return dest
|
||||
}
|
||||
|
||||
// parseLseqFromLocus extracts the declared sequence length from a LOCUS line.
|
||||
// Format: "LOCUS <id> <length> bp ..."
|
||||
// Returns -1 if not found or parse error.
|
||||
func parseLseqFromLocus(line []byte) int {
|
||||
if len(line) < 13 {
|
||||
return -1
|
||||
}
|
||||
i := 12
|
||||
for i < len(line) && line[i] != ' ' {
|
||||
i++
|
||||
}
|
||||
for i < len(line) && line[i] == ' ' {
|
||||
i++
|
||||
}
|
||||
start := i
|
||||
for i < len(line) && line[i] >= '0' && line[i] <= '9' {
|
||||
i++
|
||||
}
|
||||
if i == start {
|
||||
return -1
|
||||
}
|
||||
n, err := strconv.Atoi(string(line[start:i]))
|
||||
if err != nil {
|
||||
return -1
|
||||
}
|
||||
return n
|
||||
}
|
||||
|
||||
// Prefix constants for GenBank section headers (byte slices for zero-alloc comparison).
|
||||
var (
|
||||
gbPfxLocus = []byte("LOCUS ")
|
||||
gbPfxDefinition = []byte("DEFINITION ")
|
||||
gbPfxContinue = []byte(" ")
|
||||
gbPfxSource = []byte("SOURCE ")
|
||||
gbPfxFeatures = []byte("FEATURES ")
|
||||
gbPfxOrigin = []byte("ORIGIN")
|
||||
gbPfxContig = []byte("CONTIG")
|
||||
gbPfxEnd = []byte("//")
|
||||
gbPfxDbXref = []byte(` /db_xref="taxon:`)
|
||||
)
|
||||
|
||||
// GenbankChunkParserRope parses a GenBank FileChunk directly from the rope
|
||||
// (PieceOfChunk linked list) without calling Pack(). This eliminates the large
|
||||
// contiguous allocation required for chromosomal-scale sequences.
|
||||
func GenbankChunkParserRope(source string, rope *PieceOfChunk,
|
||||
withFeatureTable, UtoT bool) (obiseq.BioSequenceSlice, error) {
|
||||
|
||||
state := inHeader
|
||||
scanner := newRopeScanner(rope)
|
||||
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
|
||||
|
||||
id := ""
|
||||
lseq := -1
|
||||
scientificName := ""
|
||||
defBytes := new(bytes.Buffer)
|
||||
featBytes := new(bytes.Buffer)
|
||||
var seqDest []byte
|
||||
taxid := 1
|
||||
nl := 0
|
||||
|
||||
for bline := scanner.ReadLine(); bline != nil; bline = scanner.ReadLine() {
|
||||
nl++
|
||||
processed := false
|
||||
for !processed {
|
||||
switch {
|
||||
|
||||
case bytes.HasPrefix(bline, gbPfxLocus):
|
||||
if state != inHeader {
|
||||
log.Fatalf("Line %d - Unexpected state %d while reading LOCUS: %s", nl, state, bline)
|
||||
}
|
||||
rest := bline[12:]
|
||||
sp := bytes.IndexByte(rest, ' ')
|
||||
if sp < 0 {
|
||||
id = string(rest)
|
||||
} else {
|
||||
id = string(rest[:sp])
|
||||
}
|
||||
lseq = parseLseqFromLocus(bline)
|
||||
cap0 := lseq + 20
|
||||
if cap0 < 1024 {
|
||||
cap0 = 1024
|
||||
}
|
||||
seqDest = make([]byte, 0, cap0)
|
||||
state = inEntry
|
||||
processed = true
|
||||
|
||||
case bytes.HasPrefix(bline, gbPfxDefinition):
|
||||
if state != inEntry {
|
||||
log.Fatalf("Line %d - Unexpected state %d while reading DEFINITION: %s", nl, state, bline)
|
||||
}
|
||||
defBytes.Write(bytes.TrimSpace(bline[12:]))
|
||||
state = inDefinition
|
||||
processed = true
|
||||
|
||||
case state == inDefinition:
|
||||
if bytes.HasPrefix(bline, gbPfxContinue) {
|
||||
defBytes.WriteByte(' ')
|
||||
defBytes.Write(bytes.TrimSpace(bline[12:]))
|
||||
processed = true
|
||||
} else {
|
||||
state = inEntry
|
||||
}
|
||||
|
||||
case bytes.HasPrefix(bline, gbPfxSource):
|
||||
if state != inEntry {
|
||||
log.Fatalf("Line %d - Unexpected state %d while reading SOURCE: %s", nl, state, bline)
|
||||
}
|
||||
scientificName = string(bytes.TrimSpace(bline[12:]))
|
||||
processed = true
|
||||
|
||||
case bytes.HasPrefix(bline, gbPfxFeatures):
|
||||
if state != inEntry {
|
||||
log.Fatalf("Line %d - Unexpected state %d while reading FEATURES: %s", nl, state, bline)
|
||||
}
|
||||
if withFeatureTable {
|
||||
featBytes.Write(bline)
|
||||
}
|
||||
state = inFeature
|
||||
processed = true
|
||||
|
||||
case bytes.HasPrefix(bline, gbPfxOrigin):
|
||||
if state != inFeature && state != inContig {
|
||||
log.Fatalf("Line %d - Unexpected state %d while reading ORIGIN: %s", nl, state, bline)
|
||||
}
|
||||
// Use fast byte-scan to extract sequence and consume through "//"
|
||||
seqDest = scanner.extractSequence(seqDest, UtoT)
|
||||
// Emit record
|
||||
if id == "" {
|
||||
log.Warn("Empty id when parsing genbank file")
|
||||
}
|
||||
sequence := obiseq.NewBioSequenceOwning(id, seqDest, defBytes.String())
|
||||
sequence.SetSource(source)
|
||||
if withFeatureTable {
|
||||
sequence.SetFeatures(featBytes.Bytes())
|
||||
}
|
||||
annot := sequence.Annotations()
|
||||
annot["scientific_name"] = scientificName
|
||||
annot["taxid"] = taxid
|
||||
sequences = append(sequences, sequence)
|
||||
|
||||
defBytes = bytes.NewBuffer(obiseq.GetSlice(200))
|
||||
featBytes = new(bytes.Buffer)
|
||||
nl = 0
|
||||
taxid = 1
|
||||
seqDest = nil
|
||||
state = inHeader
|
||||
processed = true
|
||||
|
||||
case bytes.HasPrefix(bline, gbPfxContig):
|
||||
if state != inFeature && state != inContig {
|
||||
log.Fatalf("Line %d - Unexpected state %d while reading CONTIG: %s", nl, state, bline)
|
||||
}
|
||||
state = inContig
|
||||
processed = true
|
||||
|
||||
case bytes.Equal(bline, gbPfxEnd):
|
||||
// Reached for CONTIG records (no ORIGIN section)
|
||||
if state != inContig {
|
||||
log.Fatalf("Line %d - Unexpected state %d while reading end of record %s", nl, state, id)
|
||||
}
|
||||
if id == "" {
|
||||
log.Warn("Empty id when parsing genbank file")
|
||||
}
|
||||
sequence := obiseq.NewBioSequenceOwning(id, seqDest, defBytes.String())
|
||||
sequence.SetSource(source)
|
||||
if withFeatureTable {
|
||||
sequence.SetFeatures(featBytes.Bytes())
|
||||
}
|
||||
annot := sequence.Annotations()
|
||||
annot["scientific_name"] = scientificName
|
||||
annot["taxid"] = taxid
|
||||
sequences = append(sequences, sequence)
|
||||
|
||||
defBytes = bytes.NewBuffer(obiseq.GetSlice(200))
|
||||
featBytes = new(bytes.Buffer)
|
||||
nl = 0
|
||||
taxid = 1
|
||||
seqDest = nil
|
||||
state = inHeader
|
||||
processed = true
|
||||
|
||||
default:
|
||||
switch state {
|
||||
case inFeature:
|
||||
if withFeatureTable {
|
||||
featBytes.WriteByte('\n')
|
||||
featBytes.Write(bline)
|
||||
}
|
||||
if bytes.HasPrefix(bline, gbPfxDbXref) {
|
||||
rest := bline[len(gbPfxDbXref):]
|
||||
q := bytes.IndexByte(rest, '"')
|
||||
if q >= 0 {
|
||||
taxid, _ = strconv.Atoi(string(rest[:q]))
|
||||
}
|
||||
}
|
||||
processed = true
|
||||
case inHeader, inEntry, inContig:
|
||||
processed = true
|
||||
default:
|
||||
log.Fatalf("Unexpected state %d while reading: %s", state, bline)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
return sequences, nil
|
||||
}
|
||||
|
||||
func GenbankChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (obiseq.BioSequenceSlice, error) {
|
||||
return func(source string, input io.Reader) (obiseq.BioSequenceSlice, error) {
|
||||
state := inHeader
|
||||
@@ -125,13 +384,10 @@ func GenbankChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (ob
|
||||
if state != inSequence && state != inContig {
|
||||
log.Fatalf("Line %d - Unexpected state %d while reading end of record %s", nl, state, id)
|
||||
}
|
||||
// log.Debugln("Total lines := ", nl)
|
||||
if id == "" {
|
||||
log.Warn("Empty id when parsing genbank file")
|
||||
}
|
||||
|
||||
// log.Debugf("End of sequence %s: %dbp ", id, seqBytes.Len())
|
||||
|
||||
sequence := obiseq.NewBioSequence(id,
|
||||
seqBytes.Bytes(),
|
||||
defBytes.String())
|
||||
@@ -144,9 +400,6 @@ func GenbankChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (ob
|
||||
annot := sequence.Annotations()
|
||||
annot["scientific_name"] = scientificName
|
||||
annot["taxid"] = taxid
|
||||
// log.Println(FormatFasta(sequence, FormatFastSeqJsonHeader))
|
||||
// log.Debugf("Read sequences %s: %dbp (%d)", sequence.Id(),
|
||||
// sequence.Len(), seqBytes.Len())
|
||||
|
||||
sequences = append(sequences, sequence)
|
||||
|
||||
@@ -159,12 +412,11 @@ func GenbankChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (ob
|
||||
processed = true
|
||||
|
||||
case state == inSequence:
|
||||
// log.Debugf("Chunk %d : Genbank: line %d, state = %d : %s", chunks.order, nl, state, line)
|
||||
|
||||
sl++
|
||||
parts := strings.SplitN(line[10:], " ", 6)
|
||||
cleanline := strings.TrimSpace(line)
|
||||
parts := strings.SplitN(cleanline, " ", 7)
|
||||
lparts := len(parts)
|
||||
for i := 0; i < lparts; i++ {
|
||||
for i := 1; i < lparts; i++ {
|
||||
if UtoT {
|
||||
parts[i] = strings.ReplaceAll(parts[i], "u", "t")
|
||||
}
|
||||
@@ -197,6 +449,7 @@ func GenbankChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (ob
|
||||
|
||||
}
|
||||
|
||||
_ = sl
|
||||
return sequences, nil
|
||||
}
|
||||
}
|
||||
@@ -205,10 +458,16 @@ func _ParseGenbankFile(input ChannelFileChunk,
|
||||
out obiiter.IBioSequence,
|
||||
withFeatureTable, UtoT bool) {
|
||||
|
||||
parser := GenbankChunkParser(withFeatureTable, UtoT)
|
||||
|
||||
for chunks := range input {
|
||||
sequences, err := parser(chunks.Source, chunks.Raw)
|
||||
var sequences obiseq.BioSequenceSlice
|
||||
var err error
|
||||
|
||||
if chunks.Rope != nil {
|
||||
sequences, err = GenbankChunkParserRope(chunks.Source, chunks.Rope, withFeatureTable, UtoT)
|
||||
} else {
|
||||
parser := GenbankChunkParser(withFeatureTable, UtoT)
|
||||
sequences, err = parser(chunks.Source, chunks.Raw)
|
||||
}
|
||||
|
||||
if err != nil {
|
||||
log.Fatalf("File %s : Cannot parse the genbank file : %v", chunks.Source, err)
|
||||
@@ -224,7 +483,6 @@ func _ParseGenbankFile(input ChannelFileChunk,
|
||||
|
||||
func ReadGenbank(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
|
||||
opt := MakeOptions(options)
|
||||
// entry_channel := make(chan _FileChunk)
|
||||
|
||||
entry_channel := ReadFileChunk(
|
||||
opt.Source(),
|
||||
@@ -232,13 +490,13 @@ func ReadGenbank(reader io.Reader, options ...WithOption) (obiiter.IBioSequence,
|
||||
1024*1024*128,
|
||||
EndOfLastFlatFileEntry,
|
||||
"\nLOCUS ",
|
||||
false, // do not pack: rope-based parser avoids contiguous allocation
|
||||
)
|
||||
|
||||
newIter := obiiter.MakeIBioSequence()
|
||||
|
||||
nworkers := opt.ParallelWorkers()
|
||||
|
||||
// for j := 0; j < opt.ParallelWorkers(); j++ {
|
||||
for j := 0; j < nworkers; j++ {
|
||||
newIter.Add(1)
|
||||
go _ParseGenbankFile(
|
||||
@@ -249,8 +507,6 @@ func ReadGenbank(reader io.Reader, options ...WithOption) (obiiter.IBioSequence,
|
||||
)
|
||||
}
|
||||
|
||||
// go _ReadFlatFileChunk(reader, entry_channel)
|
||||
|
||||
go func() {
|
||||
newIter.WaitAndClose()
|
||||
log.Debug("End of the genbank file ", opt.Source())
|
||||
|
||||
@@ -0,0 +1,77 @@
|
||||
package obiformats
|
||||
|
||||
import "bytes"
|
||||
|
||||
// ropeScanner reads lines from a PieceOfChunk rope.
|
||||
// The carry buffer handles lines that span two rope nodes; it grows as needed.
|
||||
type ropeScanner struct {
|
||||
current *PieceOfChunk
|
||||
pos int
|
||||
carry []byte
|
||||
}
|
||||
|
||||
func newRopeScanner(rope *PieceOfChunk) *ropeScanner {
|
||||
return &ropeScanner{current: rope}
|
||||
}
|
||||
|
||||
// ReadLine returns the next line without the trailing \n (or \r\n).
|
||||
// Returns nil at end of rope. The returned slice aliases carry[] or the node
|
||||
// data and is valid only until the next ReadLine call.
|
||||
func (s *ropeScanner) ReadLine() []byte {
|
||||
for {
|
||||
if s.current == nil {
|
||||
if len(s.carry) > 0 {
|
||||
line := s.carry
|
||||
s.carry = s.carry[:0]
|
||||
return line
|
||||
}
|
||||
return nil
|
||||
}
|
||||
|
||||
data := s.current.data[s.pos:]
|
||||
idx := bytes.IndexByte(data, '\n')
|
||||
|
||||
if idx >= 0 {
|
||||
var line []byte
|
||||
if len(s.carry) == 0 {
|
||||
line = data[:idx]
|
||||
} else {
|
||||
s.carry = append(s.carry, data[:idx]...)
|
||||
line = s.carry
|
||||
s.carry = s.carry[:0]
|
||||
}
|
||||
s.pos += idx + 1
|
||||
if s.pos >= len(s.current.data) {
|
||||
s.current = s.current.Next()
|
||||
s.pos = 0
|
||||
}
|
||||
if len(line) > 0 && line[len(line)-1] == '\r' {
|
||||
line = line[:len(line)-1]
|
||||
}
|
||||
return line
|
||||
}
|
||||
|
||||
// No \n in this node: accumulate into carry and advance
|
||||
s.carry = append(s.carry, data...)
|
||||
s.current = s.current.Next()
|
||||
s.pos = 0
|
||||
}
|
||||
}
|
||||
|
||||
// skipToNewline advances the scanner past the next '\n'.
|
||||
func (s *ropeScanner) skipToNewline() {
|
||||
for s.current != nil {
|
||||
data := s.current.data[s.pos:]
|
||||
idx := bytes.IndexByte(data, '\n')
|
||||
if idx >= 0 {
|
||||
s.pos += idx + 1
|
||||
if s.pos >= len(s.current.data) {
|
||||
s.current = s.current.Next()
|
||||
s.pos = 0
|
||||
}
|
||||
return
|
||||
}
|
||||
s.current = s.current.Next()
|
||||
s.pos = 0
|
||||
}
|
||||
}
|
||||
@@ -0,0 +1,281 @@
|
||||
package obikmer
|
||||
|
||||
import "math"
|
||||
|
||||
// KmerEntropy computes the entropy of a single encoded k-mer.
|
||||
//
|
||||
// The algorithm mirrors the lowmask entropy calculation: it decodes the k-mer
|
||||
// to a DNA sequence, extracts all sub-words of each size from 1 to levelMax,
|
||||
// normalizes them by circular canonical form, counts their frequencies, and
|
||||
// computes Shannon entropy normalized by the maximum possible entropy.
|
||||
// The returned value is the minimum entropy across all word sizes.
|
||||
//
|
||||
// A value close to 0 indicates very low complexity (e.g. "AAAA..."),
|
||||
// while a value close to 1 indicates high complexity.
|
||||
//
|
||||
// Parameters:
|
||||
// - kmer: the encoded k-mer (2 bits per base)
|
||||
// - k: the k-mer size
|
||||
// - levelMax: maximum sub-word size for entropy (typically 6)
|
||||
//
|
||||
// Returns:
|
||||
// - minimum normalized entropy across all word sizes 1..levelMax
|
||||
func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
||||
if k < 1 || levelMax < 1 {
|
||||
return 1.0
|
||||
}
|
||||
if levelMax >= k {
|
||||
levelMax = k - 1
|
||||
}
|
||||
if levelMax < 1 {
|
||||
return 1.0
|
||||
}
|
||||
|
||||
// Decode k-mer to DNA sequence
|
||||
var seqBuf [32]byte
|
||||
seq := DecodeKmer(kmer, k, seqBuf[:])
|
||||
|
||||
// Pre-compute nLogN lookup (same as lowmask)
|
||||
nLogN := make([]float64, k+1)
|
||||
for i := 1; i <= k; i++ {
|
||||
nLogN[i] = float64(i) * math.Log(float64(i))
|
||||
}
|
||||
|
||||
// Build circular-canonical normalization tables per word size
|
||||
normTables := make([][]int, levelMax+1)
|
||||
for ws := 1; ws <= levelMax; ws++ {
|
||||
size := 1 << (ws * 2)
|
||||
normTables[ws] = make([]int, size)
|
||||
for code := 0; code < size; code++ {
|
||||
normTables[ws][code] = int(NormalizeCircular(uint64(code), ws))
|
||||
}
|
||||
}
|
||||
|
||||
minEntropy := math.MaxFloat64
|
||||
|
||||
for ws := 1; ws <= levelMax; ws++ {
|
||||
nwords := k - ws + 1
|
||||
if nwords < 1 {
|
||||
continue
|
||||
}
|
||||
|
||||
// Count circular-canonical sub-word frequencies
|
||||
tableSize := 1 << (ws * 2)
|
||||
table := make([]int, tableSize)
|
||||
mask := (1 << (ws * 2)) - 1
|
||||
|
||||
wordIndex := 0
|
||||
for i := 0; i < ws-1; i++ {
|
||||
wordIndex = (wordIndex << 2) + int(EncodeNucleotide(seq[i]))
|
||||
}
|
||||
|
||||
for i, j := 0, ws-1; j < k; i, j = i+1, j+1 {
|
||||
wordIndex = ((wordIndex << 2) & mask) + int(EncodeNucleotide(seq[j]))
|
||||
normWord := normTables[ws][wordIndex]
|
||||
table[normWord]++
|
||||
}
|
||||
|
||||
// Compute Shannon entropy
|
||||
floatNwords := float64(nwords)
|
||||
logNwords := math.Log(floatNwords)
|
||||
|
||||
var sumNLogN float64
|
||||
for j := 0; j < tableSize; j++ {
|
||||
n := table[j]
|
||||
if n > 0 {
|
||||
sumNLogN += nLogN[n]
|
||||
}
|
||||
}
|
||||
|
||||
// Compute emax (maximum possible entropy for this word size)
|
||||
na := CanonicalCircularKmerCount(ws)
|
||||
var emax float64
|
||||
if nwords < na {
|
||||
emax = math.Log(float64(nwords))
|
||||
} else {
|
||||
cov := nwords / na
|
||||
remains := nwords - (na * cov)
|
||||
f1 := float64(cov) / floatNwords
|
||||
f2 := float64(cov+1) / floatNwords
|
||||
emax = -(float64(na-remains)*f1*math.Log(f1) +
|
||||
float64(remains)*f2*math.Log(f2))
|
||||
}
|
||||
|
||||
if emax <= 0 {
|
||||
continue
|
||||
}
|
||||
|
||||
entropy := (logNwords - sumNLogN/floatNwords) / emax
|
||||
if entropy < 0 {
|
||||
entropy = 0
|
||||
}
|
||||
|
||||
if entropy < minEntropy {
|
||||
minEntropy = entropy
|
||||
}
|
||||
}
|
||||
|
||||
if minEntropy == math.MaxFloat64 {
|
||||
return 1.0
|
||||
}
|
||||
|
||||
return math.Round(minEntropy*10000) / 10000
|
||||
}
|
||||
|
||||
// KmerEntropyFilter is a reusable entropy filter for batch processing.
|
||||
// It pre-computes normalization tables and lookup values to avoid repeated
|
||||
// allocation across millions of k-mers.
|
||||
//
|
||||
// IMPORTANT: a KmerEntropyFilter is NOT safe for concurrent use.
|
||||
// Each goroutine must create its own instance via NewKmerEntropyFilter.
|
||||
type KmerEntropyFilter struct {
|
||||
k int
|
||||
levelMax int
|
||||
threshold float64
|
||||
nLogN []float64
|
||||
normTables [][]int
|
||||
emaxValues []float64
|
||||
logNwords []float64
|
||||
// Pre-allocated frequency tables reused across Entropy() calls.
|
||||
// One per word size (index 0 unused). Reset to zero before each use.
|
||||
freqTables [][]int
|
||||
}
|
||||
|
||||
// NewKmerEntropyFilter creates an entropy filter with pre-computed tables.
|
||||
//
|
||||
// Parameters:
|
||||
// - k: the k-mer size
|
||||
// - levelMax: maximum sub-word size for entropy (typically 6)
|
||||
// - threshold: entropy threshold (k-mers with entropy <= threshold are rejected)
|
||||
func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter {
|
||||
if levelMax >= k {
|
||||
levelMax = k - 1
|
||||
}
|
||||
if levelMax < 1 {
|
||||
levelMax = 1
|
||||
}
|
||||
|
||||
nLogN := make([]float64, k+1)
|
||||
for i := 1; i <= k; i++ {
|
||||
nLogN[i] = float64(i) * math.Log(float64(i))
|
||||
}
|
||||
|
||||
normTables := make([][]int, levelMax+1)
|
||||
for ws := 1; ws <= levelMax; ws++ {
|
||||
size := 1 << (ws * 2)
|
||||
normTables[ws] = make([]int, size)
|
||||
for code := 0; code < size; code++ {
|
||||
normTables[ws][code] = int(NormalizeCircular(uint64(code), ws))
|
||||
}
|
||||
}
|
||||
|
||||
emaxValues := make([]float64, levelMax+1)
|
||||
logNwords := make([]float64, levelMax+1)
|
||||
for ws := 1; ws <= levelMax; ws++ {
|
||||
nw := k - ws + 1
|
||||
na := CanonicalCircularKmerCount(ws)
|
||||
if nw < na {
|
||||
logNwords[ws] = math.Log(float64(nw))
|
||||
emaxValues[ws] = math.Log(float64(nw))
|
||||
} else {
|
||||
cov := nw / na
|
||||
remains := nw - (na * cov)
|
||||
f1 := float64(cov) / float64(nw)
|
||||
f2 := float64(cov+1) / float64(nw)
|
||||
logNwords[ws] = math.Log(float64(nw))
|
||||
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
|
||||
float64(remains)*f2*math.Log(f2))
|
||||
}
|
||||
}
|
||||
|
||||
// Pre-allocate frequency tables per word size
|
||||
freqTables := make([][]int, levelMax+1)
|
||||
for ws := 1; ws <= levelMax; ws++ {
|
||||
freqTables[ws] = make([]int, 1<<(ws*2))
|
||||
}
|
||||
|
||||
return &KmerEntropyFilter{
|
||||
k: k,
|
||||
levelMax: levelMax,
|
||||
threshold: threshold,
|
||||
nLogN: nLogN,
|
||||
normTables: normTables,
|
||||
emaxValues: emaxValues,
|
||||
logNwords: logNwords,
|
||||
freqTables: freqTables,
|
||||
}
|
||||
}
|
||||
|
||||
// Accept returns true if the k-mer has entropy strictly above the threshold.
|
||||
// Low-complexity k-mers (entropy <= threshold) are rejected.
|
||||
func (ef *KmerEntropyFilter) Accept(kmer uint64) bool {
|
||||
return ef.Entropy(kmer) > ef.threshold
|
||||
}
|
||||
|
||||
// Entropy computes the entropy for a single k-mer using pre-computed tables.
|
||||
func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
|
||||
k := ef.k
|
||||
|
||||
// Decode k-mer to DNA sequence
|
||||
var seqBuf [32]byte
|
||||
seq := DecodeKmer(kmer, k, seqBuf[:])
|
||||
|
||||
minEntropy := math.MaxFloat64
|
||||
|
||||
for ws := 1; ws <= ef.levelMax; ws++ {
|
||||
nwords := k - ws + 1
|
||||
if nwords < 1 {
|
||||
continue
|
||||
}
|
||||
|
||||
emax := ef.emaxValues[ws]
|
||||
if emax <= 0 {
|
||||
continue
|
||||
}
|
||||
|
||||
// Count circular-canonical sub-word frequencies
|
||||
tableSize := 1 << (ws * 2)
|
||||
table := ef.freqTables[ws]
|
||||
clear(table) // reset to zero
|
||||
mask := (1 << (ws * 2)) - 1
|
||||
normTable := ef.normTables[ws]
|
||||
|
||||
wordIndex := 0
|
||||
for i := 0; i < ws-1; i++ {
|
||||
wordIndex = (wordIndex << 2) + int(EncodeNucleotide(seq[i]))
|
||||
}
|
||||
|
||||
for i, j := 0, ws-1; j < k; i, j = i+1, j+1 {
|
||||
wordIndex = ((wordIndex << 2) & mask) + int(EncodeNucleotide(seq[j]))
|
||||
normWord := normTable[wordIndex]
|
||||
table[normWord]++
|
||||
}
|
||||
|
||||
// Compute Shannon entropy
|
||||
floatNwords := float64(nwords)
|
||||
logNwords := ef.logNwords[ws]
|
||||
|
||||
var sumNLogN float64
|
||||
for j := 0; j < tableSize; j++ {
|
||||
n := table[j]
|
||||
if n > 0 {
|
||||
sumNLogN += ef.nLogN[n]
|
||||
}
|
||||
}
|
||||
|
||||
entropy := (logNwords - sumNLogN/floatNwords) / emax
|
||||
if entropy < 0 {
|
||||
entropy = 0
|
||||
}
|
||||
|
||||
if entropy < minEntropy {
|
||||
minEntropy = entropy
|
||||
}
|
||||
}
|
||||
|
||||
if minEntropy == math.MaxFloat64 {
|
||||
return 1.0
|
||||
}
|
||||
|
||||
return math.Round(minEntropy*10000) / 10000
|
||||
}
|
||||
@@ -1,310 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
// FrequencyFilter filters k-mers by minimum frequency
|
||||
// Specialization of KmerSetGroup where index[i] contains k-mers seen at least i+1 times
|
||||
type FrequencyFilter struct {
|
||||
*KmerSetGroup // Group of KmerSet (one per frequency level)
|
||||
MinFreq int // v - minimum required frequency
|
||||
}
|
||||
|
||||
// NewFrequencyFilter creates a new frequency filter
|
||||
// minFreq: minimum number d'occurrences required (v)
|
||||
func NewFrequencyFilter(k, minFreq int) *FrequencyFilter {
|
||||
ff := &FrequencyFilter{
|
||||
KmerSetGroup: NewKmerSetGroup(k, minFreq),
|
||||
MinFreq: minFreq,
|
||||
}
|
||||
|
||||
// Initialize group metadata
|
||||
ff.SetAttribute("type", "FrequencyFilter")
|
||||
ff.SetAttribute("min_freq", minFreq)
|
||||
|
||||
// Initialize metadata for each level
|
||||
for i := 0; i < minFreq; i++ {
|
||||
level := ff.Get(i)
|
||||
level.SetAttribute("level", i)
|
||||
level.SetAttribute("min_occurrences", i+1)
|
||||
level.SetId(fmt.Sprintf("level_%d", i))
|
||||
}
|
||||
|
||||
return ff
|
||||
}
|
||||
|
||||
// AddSequence adds all k-mers from a sequence to the filter
|
||||
// Uses an iterator to avoid allocating an intermediate vector
|
||||
func (ff *FrequencyFilter) AddSequence(seq *obiseq.BioSequence) {
|
||||
rawSeq := seq.Sequence()
|
||||
for canonical := range IterCanonicalKmers(rawSeq, ff.K()) {
|
||||
ff.AddKmerCode(canonical)
|
||||
}
|
||||
}
|
||||
|
||||
// AddKmerCode adds an encoded k-mer to the filter (main algorithm)
|
||||
func (ff *FrequencyFilter) AddKmerCode(kmer uint64) {
|
||||
// Find the current level of the k-mer
|
||||
c := 0
|
||||
for c < ff.MinFreq && ff.Get(c).Contains(kmer) {
|
||||
c++
|
||||
}
|
||||
|
||||
// Add to next level (if not yet at maximum)
|
||||
if c < ff.MinFreq {
|
||||
ff.Get(c).AddKmerCode(kmer)
|
||||
}
|
||||
}
|
||||
|
||||
// AddCanonicalKmerCode adds an encoded canonical k-mer to the filter
|
||||
func (ff *FrequencyFilter) AddCanonicalKmerCode(kmer uint64) {
|
||||
canonical := CanonicalKmer(kmer, ff.K())
|
||||
ff.AddKmerCode(canonical)
|
||||
}
|
||||
|
||||
// AddKmer adds a k-mer to the filter by encoding the sequence
|
||||
// The sequence must have exactly k nucleotides
|
||||
// Zero-allocation: encodes directly without creating an intermediate slice
|
||||
func (ff *FrequencyFilter) AddKmer(seq []byte) {
|
||||
kmer := EncodeKmer(seq, ff.K())
|
||||
ff.AddKmerCode(kmer)
|
||||
}
|
||||
|
||||
// AddCanonicalKmer adds a canonical k-mer to the filter by encoding the sequence
|
||||
// The sequence must have exactly k nucleotides
|
||||
// Zero-allocation: encodes directly in canonical form without creating an intermediate slice
|
||||
func (ff *FrequencyFilter) AddCanonicalKmer(seq []byte) {
|
||||
canonical := EncodeCanonicalKmer(seq, ff.K())
|
||||
ff.AddKmerCode(canonical)
|
||||
}
|
||||
|
||||
// GetFilteredSet returns a KmerSet of k-mers with frequency ≥ minFreq
|
||||
func (ff *FrequencyFilter) GetFilteredSet() *KmerSet {
|
||||
// Filtered k-mers are in the last level
|
||||
return ff.Get(ff.MinFreq - 1).Copy()
|
||||
}
|
||||
|
||||
// GetKmersAtLevel returns a KmerSet of k-mers seen at least (level+1) times
|
||||
// level doit être dans [0, minFreq-1]
|
||||
func (ff *FrequencyFilter) GetKmersAtLevel(level int) *KmerSet {
|
||||
ks := ff.Get(level)
|
||||
if ks == nil {
|
||||
return NewKmerSet(ff.K())
|
||||
}
|
||||
return ks.Copy()
|
||||
}
|
||||
|
||||
// Stats returns statistics on frequency levels
|
||||
func (ff *FrequencyFilter) Stats() FrequencyFilterStats {
|
||||
stats := FrequencyFilterStats{
|
||||
MinFreq: ff.MinFreq,
|
||||
Levels: make([]LevelStats, ff.MinFreq),
|
||||
}
|
||||
|
||||
for i := 0; i < ff.MinFreq; i++ {
|
||||
ks := ff.Get(i)
|
||||
card := ks.Len()
|
||||
sizeBytes := ks.MemoryUsage()
|
||||
|
||||
stats.Levels[i] = LevelStats{
|
||||
Level: i + 1, // Level 1 = freq ≥ 1
|
||||
Cardinality: card,
|
||||
SizeBytes: sizeBytes,
|
||||
}
|
||||
|
||||
stats.TotalBytes += sizeBytes
|
||||
}
|
||||
|
||||
// The last level contains the result
|
||||
stats.FilteredKmers = stats.Levels[ff.MinFreq-1].Cardinality
|
||||
|
||||
return stats
|
||||
}
|
||||
|
||||
// FrequencyFilterStats contains the filter statistics
|
||||
type FrequencyFilterStats struct {
|
||||
MinFreq int
|
||||
FilteredKmers uint64 // K-mers with freq ≥ minFreq
|
||||
TotalBytes uint64 // Total memory used
|
||||
Levels []LevelStats
|
||||
}
|
||||
|
||||
// LevelStats contains the stats of a level
|
||||
type LevelStats struct {
|
||||
Level int // freq ≥ Level
|
||||
Cardinality uint64 // Number of k-mers
|
||||
SizeBytes uint64 // Size in bytes
|
||||
}
|
||||
|
||||
func (ffs FrequencyFilterStats) String() string {
|
||||
result := fmt.Sprintf(`Frequency Filter Statistics (minFreq=%d):
|
||||
Filtered k-mers (freq≥%d): %d
|
||||
Total memory: %.2f MB
|
||||
|
||||
Level breakdown:
|
||||
`, ffs.MinFreq, ffs.MinFreq, ffs.FilteredKmers, float64(ffs.TotalBytes)/1024/1024)
|
||||
|
||||
for _, level := range ffs.Levels {
|
||||
result += fmt.Sprintf(" freq≥%d: %d k-mers (%.2f MB)\n",
|
||||
level.Level,
|
||||
level.Cardinality,
|
||||
float64(level.SizeBytes)/1024/1024)
|
||||
}
|
||||
|
||||
return result
|
||||
}
|
||||
|
||||
// Clear libère la mémoire de tous les niveaux
|
||||
// (héritée de KmerSetGroup mais redéfinie pour clarté)
|
||||
func (ff *FrequencyFilter) Clear() {
|
||||
ff.KmerSetGroup.Clear()
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// BATCH PROCESSING
|
||||
// ==================================
|
||||
|
||||
// AddSequences adds multiple sequences in batch
|
||||
func (ff *FrequencyFilter) AddSequences(sequences *obiseq.BioSequenceSlice) {
|
||||
for _, seq := range *sequences {
|
||||
ff.AddSequence(seq)
|
||||
}
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// PERSISTANCE
|
||||
// ==================================
|
||||
|
||||
// Save sauvegarde le FrequencyFilter dans un répertoire
|
||||
// Utilise le format de sérialisation du KmerSetGroup sous-jacent
|
||||
// Les métadonnées incluent le type "FrequencyFilter" et min_freq
|
||||
//
|
||||
// Format:
|
||||
// - directory/metadata.{toml,yaml,json} - métadonnées du filtre
|
||||
// - directory/set_0.roaring - k-mers vus ≥1 fois
|
||||
// - directory/set_1.roaring - k-mers vus ≥2 fois
|
||||
// - ...
|
||||
// - directory/set_{minFreq-1}.roaring - k-mers vus ≥minFreq fois
|
||||
//
|
||||
// Parameters:
|
||||
// - directory: répertoire de destination
|
||||
// - format: format des métadonnées (FormatTOML, FormatYAML, FormatJSON)
|
||||
//
|
||||
// Example:
|
||||
//
|
||||
// err := ff.Save("./my_filter", obikmer.FormatTOML)
|
||||
func (ff *FrequencyFilter) Save(directory string, format MetadataFormat) error {
|
||||
// Déléguer à KmerSetGroup qui gère déjà tout
|
||||
return ff.KmerSetGroup.Save(directory, format)
|
||||
}
|
||||
|
||||
// LoadFrequencyFilter charge un FrequencyFilter depuis un répertoire
|
||||
// Vérifie que les métadonnées correspondent à un FrequencyFilter
|
||||
//
|
||||
// Parameters:
|
||||
// - directory: répertoire source
|
||||
//
|
||||
// Returns:
|
||||
// - *FrequencyFilter: le filtre chargé
|
||||
// - error: erreur si le chargement échoue ou si ce n'est pas un FrequencyFilter
|
||||
//
|
||||
// Example:
|
||||
//
|
||||
// ff, err := obikmer.LoadFrequencyFilter("./my_filter")
|
||||
func LoadFrequencyFilter(directory string) (*FrequencyFilter, error) {
|
||||
// Charger le KmerSetGroup
|
||||
ksg, err := LoadKmerSetGroup(directory)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
// Vérifier que c'est bien un FrequencyFilter
|
||||
if typeAttr, ok := ksg.GetAttribute("type"); !ok || typeAttr != "FrequencyFilter" {
|
||||
return nil, fmt.Errorf("loaded data is not a FrequencyFilter (type=%v)", typeAttr)
|
||||
}
|
||||
|
||||
// Récupérer min_freq
|
||||
minFreqAttr, ok := ksg.GetIntAttribute("min_freq")
|
||||
if !ok {
|
||||
return nil, fmt.Errorf("FrequencyFilter missing min_freq attribute")
|
||||
}
|
||||
|
||||
// Créer le FrequencyFilter
|
||||
ff := &FrequencyFilter{
|
||||
KmerSetGroup: ksg,
|
||||
MinFreq: minFreqAttr,
|
||||
}
|
||||
|
||||
return ff, nil
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// UTILITAIRES
|
||||
// ==================================
|
||||
|
||||
// Contains vérifie si un k-mer a atteint la fréquence minimale
|
||||
func (ff *FrequencyFilter) Contains(kmer uint64) bool {
|
||||
canonical := CanonicalKmer(kmer, ff.K())
|
||||
return ff.Get(ff.MinFreq - 1).Contains(canonical)
|
||||
}
|
||||
|
||||
// GetFrequency returns the approximate frequency of a k-mer
|
||||
// Retourne le niveau maximum atteint (freq ≥ niveau)
|
||||
func (ff *FrequencyFilter) GetFrequency(kmer uint64) int {
|
||||
canonical := CanonicalKmer(kmer, ff.K())
|
||||
|
||||
freq := 0
|
||||
for i := 0; i < ff.MinFreq; i++ {
|
||||
if ff.Get(i).Contains(canonical) {
|
||||
freq = i + 1
|
||||
} else {
|
||||
break
|
||||
}
|
||||
}
|
||||
|
||||
return freq
|
||||
}
|
||||
|
||||
// Len returns the number of filtered k-mers or at a specific level
|
||||
// Without argument: returns the number of k-mers with freq ≥ minFreq (last level)
|
||||
// With argument level: returns the number of k-mers with freq ≥ (level+1)
|
||||
// Exemple: Len() pour les k-mers filtrés, Len(2) pour freq ≥ 3
|
||||
// (héritée de KmerSetGroup mais redéfinie pour la documentation)
|
||||
func (ff *FrequencyFilter) Len(level ...int) uint64 {
|
||||
return ff.KmerSetGroup.Len(level...)
|
||||
}
|
||||
|
||||
// MemoryUsage returns memory usage in bytes
|
||||
// (héritée de KmerSetGroup mais redéfinie pour clarté)
|
||||
func (ff *FrequencyFilter) MemoryUsage() uint64 {
|
||||
return ff.KmerSetGroup.MemoryUsage()
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// COMPARAISON AVEC D'AUTRES APPROCHES
|
||||
// ==================================
|
||||
|
||||
// CompareWithSimpleMap compare la mémoire avec une simple map
|
||||
func (ff *FrequencyFilter) CompareWithSimpleMap() string {
|
||||
totalKmers := ff.Get(0).Len()
|
||||
|
||||
simpleMapBytes := totalKmers * 24 // ~24 bytes par entrée
|
||||
roaringBytes := ff.MemoryUsage()
|
||||
|
||||
reduction := float64(simpleMapBytes) / float64(roaringBytes)
|
||||
|
||||
return fmt.Sprintf(`Memory Comparison for %d k-mers:
|
||||
Simple map[uint64]uint32: %.2f MB
|
||||
Roaring filter (v=%d): %.2f MB
|
||||
Reduction: %.1fx
|
||||
`,
|
||||
totalKmers,
|
||||
float64(simpleMapBytes)/1024/1024,
|
||||
ff.MinFreq,
|
||||
float64(roaringBytes)/1024/1024,
|
||||
reduction,
|
||||
)
|
||||
}
|
||||
@@ -0,0 +1,86 @@
|
||||
package obikmer
|
||||
|
||||
import "container/heap"
|
||||
|
||||
// mergeItem represents an element in the min-heap for k-way merge.
|
||||
type mergeItem struct {
|
||||
value uint64
|
||||
idx int // index of the reader that produced this value
|
||||
}
|
||||
|
||||
// mergeHeap implements heap.Interface for k-way merge.
|
||||
type mergeHeap []mergeItem
|
||||
|
||||
func (h mergeHeap) Len() int { return len(h) }
|
||||
func (h mergeHeap) Less(i, j int) bool { return h[i].value < h[j].value }
|
||||
func (h mergeHeap) Swap(i, j int) { h[i], h[j] = h[j], h[i] }
|
||||
func (h *mergeHeap) Push(x interface{}) { *h = append(*h, x.(mergeItem)) }
|
||||
func (h *mergeHeap) Pop() interface{} {
|
||||
old := *h
|
||||
n := len(old)
|
||||
x := old[n-1]
|
||||
*h = old[:n-1]
|
||||
return x
|
||||
}
|
||||
|
||||
// KWayMerge performs a k-way merge of multiple sorted KdiReader streams.
|
||||
// For each unique k-mer value, it reports the value and the number of
|
||||
// input streams that contained it (count).
|
||||
type KWayMerge struct {
|
||||
h mergeHeap
|
||||
readers []*KdiReader
|
||||
}
|
||||
|
||||
// NewKWayMerge creates a k-way merge from multiple KdiReaders.
|
||||
// Each reader must produce values in sorted (ascending) order.
|
||||
func NewKWayMerge(readers []*KdiReader) *KWayMerge {
|
||||
m := &KWayMerge{
|
||||
h: make(mergeHeap, 0, len(readers)),
|
||||
readers: readers,
|
||||
}
|
||||
|
||||
// Initialize heap with first value from each reader
|
||||
for i, r := range readers {
|
||||
if v, ok := r.Next(); ok {
|
||||
m.h = append(m.h, mergeItem{value: v, idx: i})
|
||||
}
|
||||
}
|
||||
heap.Init(&m.h)
|
||||
|
||||
return m
|
||||
}
|
||||
|
||||
// Next returns the next smallest k-mer value, the number of readers
|
||||
// that contained this value (count), and true.
|
||||
// Returns (0, 0, false) when all streams are exhausted.
|
||||
func (m *KWayMerge) Next() (kmer uint64, count int, ok bool) {
|
||||
if len(m.h) == 0 {
|
||||
return 0, 0, false
|
||||
}
|
||||
|
||||
minVal := m.h[0].value
|
||||
count = 0
|
||||
|
||||
// Pop all items with the same value
|
||||
for len(m.h) > 0 && m.h[0].value == minVal {
|
||||
item := heap.Pop(&m.h).(mergeItem)
|
||||
count++
|
||||
// Advance that reader
|
||||
if v, ok := m.readers[item.idx].Next(); ok {
|
||||
heap.Push(&m.h, mergeItem{value: v, idx: item.idx})
|
||||
}
|
||||
}
|
||||
|
||||
return minVal, count, true
|
||||
}
|
||||
|
||||
// Close closes all underlying readers.
|
||||
func (m *KWayMerge) Close() error {
|
||||
var firstErr error
|
||||
for _, r := range m.readers {
|
||||
if err := r.Close(); err != nil && firstErr == nil {
|
||||
firstErr = err
|
||||
}
|
||||
}
|
||||
return firstErr
|
||||
}
|
||||
@@ -0,0 +1,159 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"path/filepath"
|
||||
"testing"
|
||||
)
|
||||
|
||||
// writeKdi is a helper that writes sorted kmers to a .kdi file.
|
||||
func writeKdi(t *testing.T, dir, name string, kmers []uint64) string {
|
||||
t.Helper()
|
||||
path := filepath.Join(dir, name)
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
for _, v := range kmers {
|
||||
if err := w.Write(v); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
return path
|
||||
}
|
||||
|
||||
func TestKWayMergeBasic(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
// Three sorted streams
|
||||
p1 := writeKdi(t, dir, "a.kdi", []uint64{1, 3, 5, 7})
|
||||
p2 := writeKdi(t, dir, "b.kdi", []uint64{2, 3, 6, 7})
|
||||
p3 := writeKdi(t, dir, "c.kdi", []uint64{3, 4, 7, 8})
|
||||
|
||||
r1, _ := NewKdiReader(p1)
|
||||
r2, _ := NewKdiReader(p2)
|
||||
r3, _ := NewKdiReader(p3)
|
||||
|
||||
m := NewKWayMerge([]*KdiReader{r1, r2, r3})
|
||||
defer m.Close()
|
||||
|
||||
type result struct {
|
||||
kmer uint64
|
||||
count int
|
||||
}
|
||||
var results []result
|
||||
for {
|
||||
kmer, count, ok := m.Next()
|
||||
if !ok {
|
||||
break
|
||||
}
|
||||
results = append(results, result{kmer, count})
|
||||
}
|
||||
|
||||
expected := []result{
|
||||
{1, 1}, {2, 1}, {3, 3}, {4, 1}, {5, 1}, {6, 1}, {7, 3}, {8, 1},
|
||||
}
|
||||
if len(results) != len(expected) {
|
||||
t.Fatalf("got %d results, want %d", len(results), len(expected))
|
||||
}
|
||||
for i, exp := range expected {
|
||||
if results[i] != exp {
|
||||
t.Errorf("result %d: got %+v, want %+v", i, results[i], exp)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestKWayMergeSingleStream(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
p := writeKdi(t, dir, "a.kdi", []uint64{10, 20, 30})
|
||||
|
||||
r, _ := NewKdiReader(p)
|
||||
m := NewKWayMerge([]*KdiReader{r})
|
||||
defer m.Close()
|
||||
|
||||
vals := []uint64{10, 20, 30}
|
||||
for _, expected := range vals {
|
||||
kmer, count, ok := m.Next()
|
||||
if !ok {
|
||||
t.Fatal("unexpected EOF")
|
||||
}
|
||||
if kmer != expected || count != 1 {
|
||||
t.Fatalf("got (%d, %d), want (%d, 1)", kmer, count, expected)
|
||||
}
|
||||
}
|
||||
_, _, ok := m.Next()
|
||||
if ok {
|
||||
t.Fatal("expected EOF")
|
||||
}
|
||||
}
|
||||
|
||||
func TestKWayMergeEmpty(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
p1 := writeKdi(t, dir, "a.kdi", nil)
|
||||
p2 := writeKdi(t, dir, "b.kdi", nil)
|
||||
|
||||
r1, _ := NewKdiReader(p1)
|
||||
r2, _ := NewKdiReader(p2)
|
||||
|
||||
m := NewKWayMerge([]*KdiReader{r1, r2})
|
||||
defer m.Close()
|
||||
|
||||
_, _, ok := m.Next()
|
||||
if ok {
|
||||
t.Fatal("expected no results from empty streams")
|
||||
}
|
||||
}
|
||||
|
||||
func TestKWayMergeDisjoint(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
p1 := writeKdi(t, dir, "a.kdi", []uint64{1, 2, 3})
|
||||
p2 := writeKdi(t, dir, "b.kdi", []uint64{10, 20, 30})
|
||||
|
||||
r1, _ := NewKdiReader(p1)
|
||||
r2, _ := NewKdiReader(p2)
|
||||
|
||||
m := NewKWayMerge([]*KdiReader{r1, r2})
|
||||
defer m.Close()
|
||||
|
||||
expected := []uint64{1, 2, 3, 10, 20, 30}
|
||||
for _, exp := range expected {
|
||||
kmer, count, ok := m.Next()
|
||||
if !ok {
|
||||
t.Fatal("unexpected EOF")
|
||||
}
|
||||
if kmer != exp || count != 1 {
|
||||
t.Fatalf("got (%d, %d), want (%d, 1)", kmer, count, exp)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestKWayMergeAllSame(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
p1 := writeKdi(t, dir, "a.kdi", []uint64{42})
|
||||
p2 := writeKdi(t, dir, "b.kdi", []uint64{42})
|
||||
p3 := writeKdi(t, dir, "c.kdi", []uint64{42})
|
||||
|
||||
r1, _ := NewKdiReader(p1)
|
||||
r2, _ := NewKdiReader(p2)
|
||||
r3, _ := NewKdiReader(p3)
|
||||
|
||||
m := NewKWayMerge([]*KdiReader{r1, r2, r3})
|
||||
defer m.Close()
|
||||
|
||||
kmer, count, ok := m.Next()
|
||||
if !ok {
|
||||
t.Fatal("expected one result")
|
||||
}
|
||||
if kmer != 42 || count != 3 {
|
||||
t.Fatalf("got (%d, %d), want (42, 3)", kmer, count)
|
||||
}
|
||||
_, _, ok = m.Next()
|
||||
if ok {
|
||||
t.Fatal("expected EOF")
|
||||
}
|
||||
}
|
||||
@@ -0,0 +1,170 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"bufio"
|
||||
"encoding/binary"
|
||||
"fmt"
|
||||
"io"
|
||||
"os"
|
||||
)
|
||||
|
||||
// KdiReader reads k-mers from a .kdi file using streaming delta-varint decoding.
|
||||
type KdiReader struct {
|
||||
r *bufio.Reader
|
||||
file *os.File
|
||||
count uint64 // total number of k-mers
|
||||
read uint64 // number of k-mers already consumed
|
||||
prev uint64 // last decoded value
|
||||
started bool // whether first value has been read
|
||||
index *KdxIndex // optional sparse index for seeking
|
||||
}
|
||||
|
||||
// NewKdiReader opens a .kdi file for streaming reading (no index).
|
||||
func NewKdiReader(path string) (*KdiReader, error) {
|
||||
return openKdiReader(path, nil)
|
||||
}
|
||||
|
||||
// NewKdiIndexedReader opens a .kdi file with its companion .kdx index
|
||||
// loaded for fast seeking. If the .kdx file does not exist, it gracefully
|
||||
// falls back to sequential reading.
|
||||
func NewKdiIndexedReader(path string) (*KdiReader, error) {
|
||||
kdxPath := KdxPathForKdi(path)
|
||||
idx, err := LoadKdxIndex(kdxPath)
|
||||
if err != nil {
|
||||
// Index load failed — fall back to non-indexed
|
||||
return openKdiReader(path, nil)
|
||||
}
|
||||
// idx may be nil if file does not exist — that's fine
|
||||
return openKdiReader(path, idx)
|
||||
}
|
||||
|
||||
func openKdiReader(path string, idx *KdxIndex) (*KdiReader, error) {
|
||||
f, err := os.Open(path)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
r := bufio.NewReaderSize(f, 65536)
|
||||
|
||||
// Read and verify magic
|
||||
var magic [4]byte
|
||||
if _, err := io.ReadFull(r, magic[:]); err != nil {
|
||||
f.Close()
|
||||
return nil, fmt.Errorf("kdi: read magic: %w", err)
|
||||
}
|
||||
if magic != kdiMagic {
|
||||
f.Close()
|
||||
return nil, fmt.Errorf("kdi: bad magic %v", magic)
|
||||
}
|
||||
|
||||
// Read count
|
||||
var countBuf [8]byte
|
||||
if _, err := io.ReadFull(r, countBuf[:]); err != nil {
|
||||
f.Close()
|
||||
return nil, fmt.Errorf("kdi: read count: %w", err)
|
||||
}
|
||||
count := binary.LittleEndian.Uint64(countBuf[:])
|
||||
|
||||
return &KdiReader{
|
||||
r: r,
|
||||
file: f,
|
||||
count: count,
|
||||
index: idx,
|
||||
}, nil
|
||||
}
|
||||
|
||||
// Next returns the next k-mer and true, or (0, false) when exhausted.
|
||||
func (kr *KdiReader) Next() (uint64, bool) {
|
||||
if kr.read >= kr.count {
|
||||
return 0, false
|
||||
}
|
||||
|
||||
if !kr.started {
|
||||
// Read first value as absolute uint64 LE
|
||||
var buf [8]byte
|
||||
if _, err := io.ReadFull(kr.r, buf[:]); err != nil {
|
||||
return 0, false
|
||||
}
|
||||
kr.prev = binary.LittleEndian.Uint64(buf[:])
|
||||
kr.started = true
|
||||
kr.read++
|
||||
return kr.prev, true
|
||||
}
|
||||
|
||||
// Read delta varint
|
||||
delta, err := DecodeVarint(kr.r)
|
||||
if err != nil {
|
||||
return 0, false
|
||||
}
|
||||
kr.prev += delta
|
||||
kr.read++
|
||||
return kr.prev, true
|
||||
}
|
||||
|
||||
// SeekTo positions the reader near the target k-mer using the sparse .kdx index.
|
||||
// After SeekTo, the reader is positioned so that the next call to Next()
|
||||
// returns the k-mer immediately after the indexed entry at or before target.
|
||||
//
|
||||
// If the reader has no index, or the target is before the current position,
|
||||
// SeekTo does nothing (linear scan continues from current position).
|
||||
func (kr *KdiReader) SeekTo(target uint64) error {
|
||||
if kr.index == nil {
|
||||
return nil
|
||||
}
|
||||
|
||||
// If we've already passed the target, we can't seek backwards
|
||||
if kr.started && kr.prev >= target {
|
||||
return nil
|
||||
}
|
||||
|
||||
offset, skipCount, ok := kr.index.FindOffset(target)
|
||||
if !ok {
|
||||
return nil
|
||||
}
|
||||
|
||||
// skipCount is the number of k-mers consumed at the indexed position.
|
||||
// The index was recorded AFTER writing the k-mer at position skipCount-1
|
||||
// (since count%stride==0 after incrementing count). So the actual number
|
||||
// of k-mers consumed is skipCount (the entry's kmer is the last one
|
||||
// before the offset).
|
||||
|
||||
// Only seek if it would skip significant work
|
||||
if kr.started && skipCount <= kr.read {
|
||||
return nil
|
||||
}
|
||||
|
||||
// The index entry stores (kmer_value, byte_offset_after_that_kmer).
|
||||
// skipCount = (entryIdx+1)*stride, so entryIdx = skipCount/stride - 1
|
||||
// We seek to that offset, set prev = indexedKmer, and the next Next()
|
||||
// call will read the delta-varint of the following k-mer.
|
||||
entryIdx := int(skipCount)/kr.index.stride - 1
|
||||
if entryIdx < 0 || entryIdx >= len(kr.index.entries) {
|
||||
return nil
|
||||
}
|
||||
indexedKmer := kr.index.entries[entryIdx].kmer
|
||||
|
||||
if _, err := kr.file.Seek(int64(offset), io.SeekStart); err != nil {
|
||||
return fmt.Errorf("kdi: seek: %w", err)
|
||||
}
|
||||
kr.r.Reset(kr.file)
|
||||
|
||||
kr.prev = indexedKmer
|
||||
kr.started = true
|
||||
kr.read = skipCount
|
||||
|
||||
return nil
|
||||
}
|
||||
|
||||
// Count returns the total number of k-mers in this partition.
|
||||
func (kr *KdiReader) Count() uint64 {
|
||||
return kr.count
|
||||
}
|
||||
|
||||
// Remaining returns how many k-mers have not been read yet.
|
||||
func (kr *KdiReader) Remaining() uint64 {
|
||||
return kr.count - kr.read
|
||||
}
|
||||
|
||||
// Close closes the underlying file.
|
||||
func (kr *KdiReader) Close() error {
|
||||
return kr.file.Close()
|
||||
}
|
||||
@@ -0,0 +1,255 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"os"
|
||||
"path/filepath"
|
||||
"sort"
|
||||
"testing"
|
||||
)
|
||||
|
||||
func TestKdiRoundTrip(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "test.kdi")
|
||||
|
||||
// Sorted k-mer values
|
||||
kmers := []uint64{10, 20, 30, 100, 200, 500, 10000, 1 << 40, 1<<62 - 1}
|
||||
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
for _, v := range kmers {
|
||||
if err := w.Write(v); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
}
|
||||
if w.Count() != uint64(len(kmers)) {
|
||||
t.Fatalf("writer count: got %d, want %d", w.Count(), len(kmers))
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Read back
|
||||
r, err := NewKdiReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
if r.Count() != uint64(len(kmers)) {
|
||||
t.Fatalf("reader count: got %d, want %d", r.Count(), len(kmers))
|
||||
}
|
||||
|
||||
for i, expected := range kmers {
|
||||
got, ok := r.Next()
|
||||
if !ok {
|
||||
t.Fatalf("unexpected EOF at index %d", i)
|
||||
}
|
||||
if got != expected {
|
||||
t.Fatalf("kmer %d: got %d, want %d", i, got, expected)
|
||||
}
|
||||
}
|
||||
|
||||
_, ok := r.Next()
|
||||
if ok {
|
||||
t.Fatal("expected EOF after all k-mers")
|
||||
}
|
||||
}
|
||||
|
||||
func TestKdiEmpty(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "empty.kdi")
|
||||
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
r, err := NewKdiReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
if r.Count() != 0 {
|
||||
t.Fatalf("expected count 0, got %d", r.Count())
|
||||
}
|
||||
|
||||
_, ok := r.Next()
|
||||
if ok {
|
||||
t.Fatal("expected no k-mers in empty file")
|
||||
}
|
||||
}
|
||||
|
||||
func TestKdiSingleValue(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "single.kdi")
|
||||
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Write(42); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
r, err := NewKdiReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
if r.Count() != 1 {
|
||||
t.Fatalf("expected count 1, got %d", r.Count())
|
||||
}
|
||||
|
||||
v, ok := r.Next()
|
||||
if !ok {
|
||||
t.Fatal("expected one k-mer")
|
||||
}
|
||||
if v != 42 {
|
||||
t.Fatalf("got %d, want 42", v)
|
||||
}
|
||||
}
|
||||
|
||||
func TestKdiFileSize(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "size.kdi")
|
||||
|
||||
// Write: magic(4) + count(8) + first(8) = 20 bytes
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Write(0); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
info, err := os.Stat(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
// magic(4) + count(8) + first(8) = 20
|
||||
if info.Size() != 20 {
|
||||
t.Fatalf("file size: got %d, want 20", info.Size())
|
||||
}
|
||||
}
|
||||
|
||||
func TestKdiDeltaCompression(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "delta.kdi")
|
||||
|
||||
// Dense consecutive values should compress well
|
||||
n := 10000
|
||||
kmers := make([]uint64, n)
|
||||
for i := range kmers {
|
||||
kmers[i] = uint64(i * 2) // even numbers
|
||||
}
|
||||
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
for _, v := range kmers {
|
||||
if err := w.Write(v); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Each delta is 2, encoded as 1 byte varint
|
||||
// Total: magic(4) + count(8) + first(8) + (n-1)*1 = 20 + 9999 bytes
|
||||
info, err := os.Stat(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
expected := int64(20 + n - 1)
|
||||
if info.Size() != expected {
|
||||
t.Fatalf("file size: got %d, want %d", info.Size(), expected)
|
||||
}
|
||||
|
||||
// Verify round-trip
|
||||
r, err := NewKdiReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
for i, expected := range kmers {
|
||||
got, ok := r.Next()
|
||||
if !ok {
|
||||
t.Fatalf("unexpected EOF at index %d", i)
|
||||
}
|
||||
if got != expected {
|
||||
t.Fatalf("kmer %d: got %d, want %d", i, got, expected)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestKdiFromRealKmers(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "real.kdi")
|
||||
|
||||
// Extract k-mers from a sequence, sort, dedup, write to KDI
|
||||
seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT")
|
||||
k := 15
|
||||
|
||||
var kmers []uint64
|
||||
for kmer := range IterCanonicalKmers(seq, k) {
|
||||
kmers = append(kmers, kmer)
|
||||
}
|
||||
sort.Slice(kmers, func(i, j int) bool { return kmers[i] < kmers[j] })
|
||||
// Dedup
|
||||
deduped := kmers[:0]
|
||||
for i, v := range kmers {
|
||||
if i == 0 || v != kmers[i-1] {
|
||||
deduped = append(deduped, v)
|
||||
}
|
||||
}
|
||||
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
for _, v := range deduped {
|
||||
if err := w.Write(v); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Read back and verify
|
||||
r, err := NewKdiReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
if r.Count() != uint64(len(deduped)) {
|
||||
t.Fatalf("count: got %d, want %d", r.Count(), len(deduped))
|
||||
}
|
||||
|
||||
for i, expected := range deduped {
|
||||
got, ok := r.Next()
|
||||
if !ok {
|
||||
t.Fatalf("unexpected EOF at index %d", i)
|
||||
}
|
||||
if got != expected {
|
||||
t.Fatalf("kmer %d: got %d, want %d", i, got, expected)
|
||||
}
|
||||
}
|
||||
}
|
||||
@@ -0,0 +1,151 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"bufio"
|
||||
"encoding/binary"
|
||||
"os"
|
||||
)
|
||||
|
||||
// KDI file magic bytes: "KDI\x01"
|
||||
var kdiMagic = [4]byte{'K', 'D', 'I', 0x01}
|
||||
|
||||
// kdiHeaderSize is the size of the KDI header: magic(4) + count(8) = 12 bytes.
|
||||
const kdiHeaderSize = 12
|
||||
|
||||
// KdiWriter writes a sorted sequence of uint64 k-mers to a .kdi file
|
||||
// using delta-varint encoding.
|
||||
//
|
||||
// Format:
|
||||
//
|
||||
// [magic: 4 bytes "KDI\x01"]
|
||||
// [count: uint64 LE] number of k-mers
|
||||
// [first: uint64 LE] first k-mer (absolute value)
|
||||
// [delta_1: varint] arr[1] - arr[0]
|
||||
// [delta_2: varint] arr[2] - arr[1]
|
||||
// ...
|
||||
//
|
||||
// The caller must write k-mers in strictly increasing order.
|
||||
//
|
||||
// On Close(), a companion .kdx sparse index file is written alongside
|
||||
// the .kdi file for fast random access.
|
||||
type KdiWriter struct {
|
||||
w *bufio.Writer
|
||||
file *os.File
|
||||
count uint64
|
||||
prev uint64
|
||||
first bool
|
||||
path string
|
||||
bytesWritten uint64 // bytes written after header (data section offset)
|
||||
indexEntries []kdxEntry // sparse index entries collected during writes
|
||||
}
|
||||
|
||||
// NewKdiWriter creates a new KdiWriter writing to the given file path.
|
||||
// The header (magic + count placeholder) is written immediately.
|
||||
// Count is patched on Close().
|
||||
func NewKdiWriter(path string) (*KdiWriter, error) {
|
||||
f, err := os.Create(path)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
w := bufio.NewWriterSize(f, 65536)
|
||||
|
||||
// Write magic
|
||||
if _, err := w.Write(kdiMagic[:]); err != nil {
|
||||
f.Close()
|
||||
return nil, err
|
||||
}
|
||||
// Write placeholder for count (will be patched on Close)
|
||||
var countBuf [8]byte
|
||||
if _, err := w.Write(countBuf[:]); err != nil {
|
||||
f.Close()
|
||||
return nil, err
|
||||
}
|
||||
|
||||
return &KdiWriter{
|
||||
w: w,
|
||||
file: f,
|
||||
first: true,
|
||||
path: path,
|
||||
bytesWritten: 0,
|
||||
indexEntries: make([]kdxEntry, 0, 256),
|
||||
}, nil
|
||||
}
|
||||
|
||||
// Write adds a k-mer to the file. K-mers must be written in strictly
|
||||
// increasing order.
|
||||
func (kw *KdiWriter) Write(kmer uint64) error {
|
||||
if kw.first {
|
||||
// Write first value as absolute uint64 LE
|
||||
var buf [8]byte
|
||||
binary.LittleEndian.PutUint64(buf[:], kmer)
|
||||
if _, err := kw.w.Write(buf[:]); err != nil {
|
||||
return err
|
||||
}
|
||||
kw.bytesWritten += 8
|
||||
kw.prev = kmer
|
||||
kw.first = false
|
||||
} else {
|
||||
delta := kmer - kw.prev
|
||||
n, err := EncodeVarint(kw.w, delta)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
kw.bytesWritten += uint64(n)
|
||||
kw.prev = kmer
|
||||
}
|
||||
kw.count++
|
||||
|
||||
// Record sparse index entry every defaultKdxStride k-mers.
|
||||
// The offset recorded is AFTER writing this k-mer, so it points to
|
||||
// where the next k-mer's data will start. SeekTo uses this: it seeks
|
||||
// to the recorded offset, sets prev = indexedKmer, and Next() reads
|
||||
// the delta of the following k-mer.
|
||||
if kw.count%defaultKdxStride == 0 {
|
||||
kw.indexEntries = append(kw.indexEntries, kdxEntry{
|
||||
kmer: kmer,
|
||||
offset: kdiHeaderSize + kw.bytesWritten,
|
||||
})
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
|
||||
// Count returns the number of k-mers written so far.
|
||||
func (kw *KdiWriter) Count() uint64 {
|
||||
return kw.count
|
||||
}
|
||||
|
||||
// Close flushes buffered data, patches the count in the header,
|
||||
// writes the companion .kdx index file, and closes the file.
|
||||
func (kw *KdiWriter) Close() error {
|
||||
if err := kw.w.Flush(); err != nil {
|
||||
kw.file.Close()
|
||||
return err
|
||||
}
|
||||
|
||||
// Patch count at offset 4 (after magic)
|
||||
if _, err := kw.file.Seek(4, 0); err != nil {
|
||||
kw.file.Close()
|
||||
return err
|
||||
}
|
||||
var countBuf [8]byte
|
||||
binary.LittleEndian.PutUint64(countBuf[:], kw.count)
|
||||
if _, err := kw.file.Write(countBuf[:]); err != nil {
|
||||
kw.file.Close()
|
||||
return err
|
||||
}
|
||||
|
||||
if err := kw.file.Close(); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Write .kdx index file if there are entries to index
|
||||
if len(kw.indexEntries) > 0 {
|
||||
kdxPath := KdxPathForKdi(kw.path)
|
||||
if err := WriteKdxIndex(kdxPath, defaultKdxStride, kw.indexEntries); err != nil {
|
||||
return err
|
||||
}
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
@@ -0,0 +1,170 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"encoding/binary"
|
||||
"fmt"
|
||||
"io"
|
||||
"os"
|
||||
"sort"
|
||||
"strings"
|
||||
)
|
||||
|
||||
// KDX file magic bytes: "KDX\x01"
|
||||
var kdxMagic = [4]byte{'K', 'D', 'X', 0x01}
|
||||
|
||||
// defaultKdxStride is the number of k-mers between consecutive index entries.
|
||||
const defaultKdxStride = 4096
|
||||
|
||||
// kdxEntry is a single entry in the sparse index: the absolute k-mer value
|
||||
// and the byte offset in the corresponding .kdi file where that k-mer is stored.
|
||||
type kdxEntry struct {
|
||||
kmer uint64
|
||||
offset uint64 // absolute byte offset in .kdi file
|
||||
}
|
||||
|
||||
// KdxIndex is a sparse, in-memory index for a .kdi file.
|
||||
// It stores one entry every `stride` k-mers, enabling O(log N / stride)
|
||||
// binary search followed by at most `stride` linear scan steps.
|
||||
type KdxIndex struct {
|
||||
stride int
|
||||
entries []kdxEntry
|
||||
}
|
||||
|
||||
// LoadKdxIndex reads a .kdx file into memory.
|
||||
// Returns (nil, nil) if the file does not exist (graceful degradation).
|
||||
func LoadKdxIndex(path string) (*KdxIndex, error) {
|
||||
f, err := os.Open(path)
|
||||
if err != nil {
|
||||
if os.IsNotExist(err) {
|
||||
return nil, nil
|
||||
}
|
||||
return nil, err
|
||||
}
|
||||
defer f.Close()
|
||||
|
||||
// Read magic
|
||||
var magic [4]byte
|
||||
if _, err := io.ReadFull(f, magic[:]); err != nil {
|
||||
return nil, fmt.Errorf("kdx: read magic: %w", err)
|
||||
}
|
||||
if magic != kdxMagic {
|
||||
return nil, fmt.Errorf("kdx: bad magic %v", magic)
|
||||
}
|
||||
|
||||
// Read stride (uint32 LE)
|
||||
var buf4 [4]byte
|
||||
if _, err := io.ReadFull(f, buf4[:]); err != nil {
|
||||
return nil, fmt.Errorf("kdx: read stride: %w", err)
|
||||
}
|
||||
stride := int(binary.LittleEndian.Uint32(buf4[:]))
|
||||
|
||||
// Read count (uint32 LE)
|
||||
if _, err := io.ReadFull(f, buf4[:]); err != nil {
|
||||
return nil, fmt.Errorf("kdx: read count: %w", err)
|
||||
}
|
||||
count := int(binary.LittleEndian.Uint32(buf4[:]))
|
||||
|
||||
// Read entries
|
||||
entries := make([]kdxEntry, count)
|
||||
var buf16 [16]byte
|
||||
for i := 0; i < count; i++ {
|
||||
if _, err := io.ReadFull(f, buf16[:]); err != nil {
|
||||
return nil, fmt.Errorf("kdx: read entry %d: %w", i, err)
|
||||
}
|
||||
entries[i] = kdxEntry{
|
||||
kmer: binary.LittleEndian.Uint64(buf16[0:8]),
|
||||
offset: binary.LittleEndian.Uint64(buf16[8:16]),
|
||||
}
|
||||
}
|
||||
|
||||
return &KdxIndex{
|
||||
stride: stride,
|
||||
entries: entries,
|
||||
}, nil
|
||||
}
|
||||
|
||||
// FindOffset locates the best starting point in the .kdi file to scan for
|
||||
// the target k-mer. It returns:
|
||||
// - offset: the byte offset in the .kdi file to seek to (positioned after
|
||||
// the indexed k-mer, ready to read the next delta)
|
||||
// - skipCount: the number of k-mers already consumed at that offset
|
||||
// (to set the reader's internal counter)
|
||||
// - ok: true if the index provides a useful starting point
|
||||
//
|
||||
// Index entries are recorded at k-mer count positions stride, 2*stride, etc.
|
||||
// Entry i corresponds to the k-mer written at count = (i+1)*stride.
|
||||
func (idx *KdxIndex) FindOffset(target uint64) (offset uint64, skipCount uint64, ok bool) {
|
||||
if idx == nil || len(idx.entries) == 0 {
|
||||
return 0, 0, false
|
||||
}
|
||||
|
||||
// Binary search: find the largest entry with kmer <= target
|
||||
i := sort.Search(len(idx.entries), func(i int) bool {
|
||||
return idx.entries[i].kmer > target
|
||||
})
|
||||
// i is the first entry with kmer > target, so i-1 is the last with kmer <= target
|
||||
if i == 0 {
|
||||
// Target is before the first index entry.
|
||||
// No useful jump point — caller should scan from the beginning.
|
||||
return 0, 0, false
|
||||
}
|
||||
|
||||
i-- // largest entry with kmer <= target
|
||||
// Entry i was recorded after writing k-mer at count = (i+1)*stride
|
||||
skipCount = uint64(i+1) * uint64(idx.stride)
|
||||
return idx.entries[i].offset, skipCount, true
|
||||
}
|
||||
|
||||
// Stride returns the stride of this index.
|
||||
func (idx *KdxIndex) Stride() int {
|
||||
return idx.stride
|
||||
}
|
||||
|
||||
// Len returns the number of entries in this index.
|
||||
func (idx *KdxIndex) Len() int {
|
||||
return len(idx.entries)
|
||||
}
|
||||
|
||||
// WriteKdxIndex writes a .kdx file from a slice of entries.
|
||||
func WriteKdxIndex(path string, stride int, entries []kdxEntry) error {
|
||||
f, err := os.Create(path)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
defer f.Close()
|
||||
|
||||
// Magic
|
||||
if _, err := f.Write(kdxMagic[:]); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Stride (uint32 LE)
|
||||
var buf4 [4]byte
|
||||
binary.LittleEndian.PutUint32(buf4[:], uint32(stride))
|
||||
if _, err := f.Write(buf4[:]); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Count (uint32 LE)
|
||||
binary.LittleEndian.PutUint32(buf4[:], uint32(len(entries)))
|
||||
if _, err := f.Write(buf4[:]); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Entries
|
||||
var buf16 [16]byte
|
||||
for _, e := range entries {
|
||||
binary.LittleEndian.PutUint64(buf16[0:8], e.kmer)
|
||||
binary.LittleEndian.PutUint64(buf16[8:16], e.offset)
|
||||
if _, err := f.Write(buf16[:]); err != nil {
|
||||
return err
|
||||
}
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
|
||||
// KdxPathForKdi returns the .kdx path corresponding to a .kdi path.
|
||||
func KdxPathForKdi(kdiPath string) string {
|
||||
return strings.TrimSuffix(kdiPath, ".kdi") + ".kdx"
|
||||
}
|
||||
@@ -0,0 +1,256 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"cmp"
|
||||
"slices"
|
||||
"sync"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
// QueryEntry represents a canonical k-mer to look up, together with
|
||||
// metadata to trace the result back to the originating sequence and position.
|
||||
type QueryEntry struct {
|
||||
Kmer uint64 // canonical k-mer value
|
||||
SeqIdx int // index within the batch
|
||||
Pos int // 1-based position in the sequence
|
||||
}
|
||||
|
||||
// MatchResult holds matched positions for each sequence in a batch.
|
||||
// results[i] contains the sorted matched positions for sequence i.
|
||||
type MatchResult [][]int
|
||||
|
||||
// PreparedQueries holds pre-computed query buckets along with the number
|
||||
// of sequences they were built from. This is used by the accumulation
|
||||
// pipeline to merge queries from multiple batches.
|
||||
type PreparedQueries struct {
|
||||
Buckets [][]QueryEntry // queries[partition], each sorted by Kmer
|
||||
NSeqs int // number of sequences that produced these queries
|
||||
NKmers int // total number of k-mer entries across all partitions
|
||||
}
|
||||
|
||||
// MergeQueries merges src into dst, offsetting all SeqIdx values in src
|
||||
// by dst.NSeqs. Both dst and src must have the same number of partitions.
|
||||
// After merging, src should not be reused.
|
||||
//
|
||||
// Each partition's entries are merged in sorted order (merge-sort of two
|
||||
// already-sorted slices).
|
||||
func MergeQueries(dst, src *PreparedQueries) {
|
||||
for p := range dst.Buckets {
|
||||
if len(src.Buckets[p]) == 0 {
|
||||
continue
|
||||
}
|
||||
|
||||
offset := dst.NSeqs
|
||||
srcB := src.Buckets[p]
|
||||
|
||||
// Offset SeqIdx in src entries
|
||||
for i := range srcB {
|
||||
srcB[i].SeqIdx += offset
|
||||
}
|
||||
|
||||
if len(dst.Buckets[p]) == 0 {
|
||||
dst.Buckets[p] = srcB
|
||||
continue
|
||||
}
|
||||
|
||||
// Merge two sorted slices
|
||||
dstB := dst.Buckets[p]
|
||||
merged := make([]QueryEntry, 0, len(dstB)+len(srcB))
|
||||
i, j := 0, 0
|
||||
for i < len(dstB) && j < len(srcB) {
|
||||
if dstB[i].Kmer <= srcB[j].Kmer {
|
||||
merged = append(merged, dstB[i])
|
||||
i++
|
||||
} else {
|
||||
merged = append(merged, srcB[j])
|
||||
j++
|
||||
}
|
||||
}
|
||||
merged = append(merged, dstB[i:]...)
|
||||
merged = append(merged, srcB[j:]...)
|
||||
dst.Buckets[p] = merged
|
||||
}
|
||||
dst.NSeqs += src.NSeqs
|
||||
dst.NKmers += src.NKmers
|
||||
}
|
||||
|
||||
// PrepareQueries extracts all canonical k-mers from a batch of sequences
|
||||
// and groups them by partition using super-kmer minimizers.
|
||||
//
|
||||
// Returns a PreparedQueries with sorted per-partition buckets.
|
||||
func (ksg *KmerSetGroup) PrepareQueries(sequences []*obiseq.BioSequence) *PreparedQueries {
|
||||
P := ksg.partitions
|
||||
k := ksg.k
|
||||
m := ksg.m
|
||||
|
||||
// Pre-allocate partition buckets
|
||||
buckets := make([][]QueryEntry, P)
|
||||
for i := range buckets {
|
||||
buckets[i] = make([]QueryEntry, 0, 64)
|
||||
}
|
||||
|
||||
totalKmers := 0
|
||||
for seqIdx, seq := range sequences {
|
||||
bseq := seq.Sequence()
|
||||
if len(bseq) < k {
|
||||
continue
|
||||
}
|
||||
|
||||
// Iterate super-kmers to get minimizer → partition mapping
|
||||
for sk := range IterSuperKmers(bseq, k, m) {
|
||||
partition := int(sk.Minimizer % uint64(P))
|
||||
|
||||
// Iterate canonical k-mers within this super-kmer
|
||||
skSeq := sk.Sequence
|
||||
if len(skSeq) < k {
|
||||
continue
|
||||
}
|
||||
|
||||
localPos := 0
|
||||
for kmer := range IterCanonicalKmers(skSeq, k) {
|
||||
buckets[partition] = append(buckets[partition], QueryEntry{
|
||||
Kmer: kmer,
|
||||
SeqIdx: seqIdx,
|
||||
Pos: sk.Start + localPos + 1,
|
||||
})
|
||||
localPos++
|
||||
totalKmers++
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// Sort each bucket by k-mer value for merge-scan
|
||||
for p := range buckets {
|
||||
slices.SortFunc(buckets[p], func(a, b QueryEntry) int {
|
||||
return cmp.Compare(a.Kmer, b.Kmer)
|
||||
})
|
||||
}
|
||||
|
||||
return &PreparedQueries{
|
||||
Buckets: buckets,
|
||||
NSeqs: len(sequences),
|
||||
NKmers: totalKmers,
|
||||
}
|
||||
}
|
||||
|
||||
// MatchBatch looks up pre-sorted queries against one set of the index.
|
||||
// Partitions are processed in parallel. For each partition, a merge-scan
|
||||
// compares the sorted queries against the sorted KDI stream.
|
||||
//
|
||||
// Returns a MatchResult where result[i] contains sorted matched positions
|
||||
// for sequence i.
|
||||
func (ksg *KmerSetGroup) MatchBatch(setIndex int, pq *PreparedQueries) MatchResult {
|
||||
P := ksg.partitions
|
||||
|
||||
// Pre-allocated per-sequence results and mutexes.
|
||||
// Each partition goroutine appends to results[seqIdx] with mus[seqIdx] held.
|
||||
// Contention is low: a sequence's k-mers span many partitions, but each
|
||||
// partition processes its queries sequentially and the critical section is tiny.
|
||||
results := make([][]int, pq.NSeqs)
|
||||
mus := make([]sync.Mutex, pq.NSeqs)
|
||||
|
||||
var wg sync.WaitGroup
|
||||
|
||||
for p := 0; p < P; p++ {
|
||||
if len(pq.Buckets[p]) == 0 {
|
||||
continue
|
||||
}
|
||||
wg.Add(1)
|
||||
go func(part int) {
|
||||
defer wg.Done()
|
||||
ksg.matchPartition(setIndex, part, pq.Buckets[part], results, mus)
|
||||
}(p)
|
||||
}
|
||||
|
||||
wg.Wait()
|
||||
|
||||
// Sort positions within each sequence
|
||||
for i := range results {
|
||||
if len(results[i]) > 1 {
|
||||
slices.Sort(results[i])
|
||||
}
|
||||
}
|
||||
|
||||
return MatchResult(results)
|
||||
}
|
||||
|
||||
// matchPartition processes one partition: opens the KDI reader (with index),
|
||||
// seeks to the first query, then merge-scans queries against the KDI stream.
|
||||
func (ksg *KmerSetGroup) matchPartition(
|
||||
setIndex int,
|
||||
partIndex int,
|
||||
queries []QueryEntry, // sorted by Kmer
|
||||
results [][]int,
|
||||
mus []sync.Mutex,
|
||||
) {
|
||||
r, err := NewKdiIndexedReader(ksg.partitionPath(setIndex, partIndex))
|
||||
if err != nil {
|
||||
return
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
if r.Count() == 0 || len(queries) == 0 {
|
||||
return
|
||||
}
|
||||
|
||||
// Seek to the first query's neighborhood
|
||||
if err := r.SeekTo(queries[0].Kmer); err != nil {
|
||||
return
|
||||
}
|
||||
|
||||
// Read first kmer from the stream after seek
|
||||
currentKmer, ok := r.Next()
|
||||
if !ok {
|
||||
return
|
||||
}
|
||||
|
||||
qi := 0 // query index
|
||||
|
||||
for qi < len(queries) {
|
||||
q := queries[qi]
|
||||
|
||||
// If the next query is far ahead, re-seek instead of linear scan.
|
||||
// Only seek if we'd skip more k-mers than the index stride,
|
||||
// otherwise linear scan through the buffer is faster than a syscall.
|
||||
if r.index != nil && q.Kmer > currentKmer && r.Remaining() > uint64(r.index.stride) {
|
||||
_, skipCount, found := r.index.FindOffset(q.Kmer)
|
||||
if found && skipCount > r.read+uint64(r.index.stride) {
|
||||
if err := r.SeekTo(q.Kmer); err == nil {
|
||||
nextKmer, nextOk := r.Next()
|
||||
if !nextOk {
|
||||
return
|
||||
}
|
||||
currentKmer = nextKmer
|
||||
ok = true
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// Advance KDI stream until >= query kmer
|
||||
for currentKmer < q.Kmer {
|
||||
currentKmer, ok = r.Next()
|
||||
if !ok {
|
||||
return // KDI exhausted
|
||||
}
|
||||
}
|
||||
|
||||
if currentKmer == q.Kmer {
|
||||
// Match! Record all queries with this same k-mer value
|
||||
matchedKmer := q.Kmer
|
||||
for qi < len(queries) && queries[qi].Kmer == matchedKmer {
|
||||
idx := queries[qi].SeqIdx
|
||||
mus[idx].Lock()
|
||||
results[idx] = append(results[idx], queries[qi].Pos)
|
||||
mus[idx].Unlock()
|
||||
qi++
|
||||
}
|
||||
} else {
|
||||
// currentKmer > q.Kmer: skip all queries with this kmer value
|
||||
skippedKmer := q.Kmer
|
||||
for qi < len(queries) && queries[qi].Kmer == skippedKmer {
|
||||
qi++
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
@@ -1,217 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"github.com/RoaringBitmap/roaring/roaring64"
|
||||
)
|
||||
|
||||
// KmerSet wraps a set of k-mers stored in a Roaring Bitmap
|
||||
// Provides utility methods for manipulating k-mer sets
|
||||
type KmerSet struct {
|
||||
id string // Unique identifier of the KmerSet
|
||||
k int // Size of k-mers (immutable)
|
||||
bitmap *roaring64.Bitmap // Bitmap containing the k-mers
|
||||
Metadata map[string]interface{} // User metadata (key=atomic value)
|
||||
}
|
||||
|
||||
// NewKmerSet creates a new empty KmerSet
|
||||
func NewKmerSet(k int) *KmerSet {
|
||||
return &KmerSet{
|
||||
k: k,
|
||||
bitmap: roaring64.New(),
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
}
|
||||
|
||||
// NewKmerSetFromBitmap creates a KmerSet from an existing bitmap
|
||||
func NewKmerSetFromBitmap(k int, bitmap *roaring64.Bitmap) *KmerSet {
|
||||
return &KmerSet{
|
||||
k: k,
|
||||
bitmap: bitmap,
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
}
|
||||
|
||||
// K returns the size of k-mers (immutable)
|
||||
func (ks *KmerSet) K() int {
|
||||
return ks.k
|
||||
}
|
||||
|
||||
// AddKmerCode adds an encoded k-mer to the set
|
||||
func (ks *KmerSet) AddKmerCode(kmer uint64) {
|
||||
ks.bitmap.Add(kmer)
|
||||
}
|
||||
|
||||
// AddCanonicalKmerCode adds an encoded canonical k-mer to the set
|
||||
func (ks *KmerSet) AddCanonicalKmerCode(kmer uint64) {
|
||||
canonical := CanonicalKmer(kmer, ks.k)
|
||||
ks.bitmap.Add(canonical)
|
||||
}
|
||||
|
||||
// AddKmer adds a k-mer to the set by encoding the sequence
|
||||
// The sequence must have exactly k nucleotides
|
||||
// Zero-allocation: encodes directly without creating an intermediate slice
|
||||
func (ks *KmerSet) AddKmer(seq []byte) {
|
||||
kmer := EncodeKmer(seq, ks.k)
|
||||
ks.bitmap.Add(kmer)
|
||||
}
|
||||
|
||||
// AddCanonicalKmer adds a canonical k-mer to the set by encoding the sequence
|
||||
// The sequence must have exactly k nucleotides
|
||||
// Zero-allocation: encodes directly in canonical form without creating an intermediate slice
|
||||
func (ks *KmerSet) AddCanonicalKmer(seq []byte) {
|
||||
canonical := EncodeCanonicalKmer(seq, ks.k)
|
||||
ks.bitmap.Add(canonical)
|
||||
}
|
||||
|
||||
// AddSequence adds all k-mers from a sequence to the set
|
||||
// Uses an iterator to avoid allocating an intermediate vector
|
||||
func (ks *KmerSet) AddSequence(seq *obiseq.BioSequence) {
|
||||
rawSeq := seq.Sequence()
|
||||
for canonical := range IterCanonicalKmers(rawSeq, ks.k) {
|
||||
ks.bitmap.Add(canonical)
|
||||
}
|
||||
}
|
||||
|
||||
// AddSequences adds all k-mers from multiple sequences in batch
|
||||
func (ks *KmerSet) AddSequences(sequences *obiseq.BioSequenceSlice) {
|
||||
for _, seq := range *sequences {
|
||||
ks.AddSequence(seq)
|
||||
}
|
||||
}
|
||||
|
||||
// Contains checks if a k-mer is in the set
|
||||
func (ks *KmerSet) Contains(kmer uint64) bool {
|
||||
return ks.bitmap.Contains(kmer)
|
||||
}
|
||||
|
||||
// Len returns the number of k-mers in the set
|
||||
func (ks *KmerSet) Len() uint64 {
|
||||
return ks.bitmap.GetCardinality()
|
||||
}
|
||||
|
||||
// MemoryUsage returns memory usage in bytes
|
||||
func (ks *KmerSet) MemoryUsage() uint64 {
|
||||
return ks.bitmap.GetSizeInBytes()
|
||||
}
|
||||
|
||||
// Clear empties the set
|
||||
func (ks *KmerSet) Clear() {
|
||||
ks.bitmap.Clear()
|
||||
}
|
||||
|
||||
// Copy creates a copy of the set (consistent with BioSequence.Copy)
|
||||
func (ks *KmerSet) Copy() *KmerSet {
|
||||
// Copy metadata
|
||||
metadata := make(map[string]interface{}, len(ks.Metadata))
|
||||
for k, v := range ks.Metadata {
|
||||
metadata[k] = v
|
||||
}
|
||||
|
||||
return &KmerSet{
|
||||
id: ks.id,
|
||||
k: ks.k,
|
||||
bitmap: ks.bitmap.Clone(),
|
||||
Metadata: metadata,
|
||||
}
|
||||
}
|
||||
|
||||
// Id returns the identifier of the KmerSet (consistent with BioSequence.Id)
|
||||
func (ks *KmerSet) Id() string {
|
||||
return ks.id
|
||||
}
|
||||
|
||||
// SetId sets the identifier of the KmerSet (consistent with BioSequence.SetId)
|
||||
func (ks *KmerSet) SetId(id string) {
|
||||
ks.id = id
|
||||
}
|
||||
|
||||
// Union returns the union of this set with another
|
||||
func (ks *KmerSet) Union(other *KmerSet) *KmerSet {
|
||||
if ks.k != other.k {
|
||||
panic(fmt.Sprintf("Cannot union KmerSets with different k values: %d vs %d", ks.k, other.k))
|
||||
}
|
||||
result := ks.bitmap.Clone()
|
||||
result.Or(other.bitmap)
|
||||
return NewKmerSetFromBitmap(ks.k, result)
|
||||
}
|
||||
|
||||
// Intersect returns the intersection of this set with another
|
||||
func (ks *KmerSet) Intersect(other *KmerSet) *KmerSet {
|
||||
if ks.k != other.k {
|
||||
panic(fmt.Sprintf("Cannot intersect KmerSets with different k values: %d vs %d", ks.k, other.k))
|
||||
}
|
||||
result := ks.bitmap.Clone()
|
||||
result.And(other.bitmap)
|
||||
return NewKmerSetFromBitmap(ks.k, result)
|
||||
}
|
||||
|
||||
// Difference returns the difference of this set with another (this - other)
|
||||
func (ks *KmerSet) Difference(other *KmerSet) *KmerSet {
|
||||
if ks.k != other.k {
|
||||
panic(fmt.Sprintf("Cannot subtract KmerSets with different k values: %d vs %d", ks.k, other.k))
|
||||
}
|
||||
result := ks.bitmap.Clone()
|
||||
result.AndNot(other.bitmap)
|
||||
return NewKmerSetFromBitmap(ks.k, result)
|
||||
}
|
||||
|
||||
// JaccardDistance computes the Jaccard distance between two KmerSets.
|
||||
// The Jaccard distance is defined as: 1 - (|A ∩ B| / |A ∪ B|)
|
||||
// where A and B are the two sets.
|
||||
//
|
||||
// Returns:
|
||||
// - 0.0 when sets are identical (distance = 0, similarity = 1)
|
||||
// - 1.0 when sets are completely disjoint (distance = 1, similarity = 0)
|
||||
// - 1.0 when both sets are empty (by convention)
|
||||
//
|
||||
// Time complexity: O(|A| + |B|) for Roaring Bitmap operations
|
||||
// Space complexity: O(1) as operations are done in-place on temporary bitmaps
|
||||
func (ks *KmerSet) JaccardDistance(other *KmerSet) float64 {
|
||||
if ks.k != other.k {
|
||||
panic(fmt.Sprintf("Cannot compute Jaccard distance between KmerSets with different k values: %d vs %d", ks.k, other.k))
|
||||
}
|
||||
|
||||
// Compute intersection cardinality
|
||||
intersectionCard := ks.bitmap.AndCardinality(other.bitmap)
|
||||
|
||||
// Compute union cardinality
|
||||
unionCard := ks.bitmap.OrCardinality(other.bitmap)
|
||||
|
||||
// If union is empty, both sets are empty - return 1.0 by convention
|
||||
if unionCard == 0 {
|
||||
return 1.0
|
||||
}
|
||||
|
||||
// Jaccard similarity = |A ∩ B| / |A ∪ B|
|
||||
similarity := float64(intersectionCard) / float64(unionCard)
|
||||
|
||||
// Jaccard distance = 1 - similarity
|
||||
return 1.0 - similarity
|
||||
}
|
||||
|
||||
// JaccardSimilarity computes the Jaccard similarity coefficient between two KmerSets.
|
||||
// The Jaccard similarity is defined as: |A ∩ B| / |A ∪ B|
|
||||
//
|
||||
// Returns:
|
||||
// - 1.0 when sets are identical (maximum similarity)
|
||||
// - 0.0 when sets are completely disjoint (no similarity)
|
||||
// - 0.0 when both sets are empty (by convention)
|
||||
//
|
||||
// Time complexity: O(|A| + |B|) for Roaring Bitmap operations
|
||||
// Space complexity: O(1) as operations are done in-place on temporary bitmaps
|
||||
func (ks *KmerSet) JaccardSimilarity(other *KmerSet) float64 {
|
||||
return 1.0 - ks.JaccardDistance(other)
|
||||
}
|
||||
|
||||
// Iterator returns an iterator over all k-mers in the set
|
||||
func (ks *KmerSet) Iterator() roaring64.IntIterable64 {
|
||||
return ks.bitmap.Iterator()
|
||||
}
|
||||
|
||||
// Bitmap returns the underlying bitmap (for compatibility)
|
||||
func (ks *KmerSet) Bitmap() *roaring64.Bitmap {
|
||||
return ks.bitmap
|
||||
}
|
||||
@@ -1,362 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"strconv"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
)
|
||||
|
||||
// ==================================
|
||||
// KMER SET ATTRIBUTE API
|
||||
// Mimic BioSequence attribute API from obiseq/attributes.go
|
||||
// ==================================
|
||||
|
||||
// HasAttribute vérifie si une clé d'attribut existe
|
||||
func (ks *KmerSet) HasAttribute(key string) bool {
|
||||
_, ok := ks.Metadata[key]
|
||||
return ok
|
||||
}
|
||||
|
||||
// GetAttribute récupère la valeur d'un attribut
|
||||
// Cas particuliers: "id" utilise Id(), "k" utilise K()
|
||||
func (ks *KmerSet) GetAttribute(key string) (interface{}, bool) {
|
||||
switch key {
|
||||
case "id":
|
||||
return ks.Id(), true
|
||||
case "k":
|
||||
return ks.K(), true
|
||||
default:
|
||||
value, ok := ks.Metadata[key]
|
||||
return value, ok
|
||||
}
|
||||
}
|
||||
|
||||
// SetAttribute sets the value of an attribute
|
||||
// Cas particuliers: "id" utilise SetId(), "k" est immutable (panique)
|
||||
func (ks *KmerSet) SetAttribute(key string, value interface{}) {
|
||||
switch key {
|
||||
case "id":
|
||||
if id, ok := value.(string); ok {
|
||||
ks.SetId(id)
|
||||
} else {
|
||||
panic(fmt.Sprintf("id must be a string, got %T", value))
|
||||
}
|
||||
case "k":
|
||||
panic("k is immutable and cannot be modified via SetAttribute")
|
||||
default:
|
||||
ks.Metadata[key] = value
|
||||
}
|
||||
}
|
||||
|
||||
// DeleteAttribute supprime un attribut
|
||||
func (ks *KmerSet) DeleteAttribute(key string) {
|
||||
delete(ks.Metadata, key)
|
||||
}
|
||||
|
||||
// RemoveAttribute supprime un attribut (alias de DeleteAttribute)
|
||||
func (ks *KmerSet) RemoveAttribute(key string) {
|
||||
ks.DeleteAttribute(key)
|
||||
}
|
||||
|
||||
// RenameAttribute renomme un attribut
|
||||
func (ks *KmerSet) RenameAttribute(newName, oldName string) {
|
||||
if value, ok := ks.Metadata[oldName]; ok {
|
||||
ks.Metadata[newName] = value
|
||||
delete(ks.Metadata, oldName)
|
||||
}
|
||||
}
|
||||
|
||||
// GetIntAttribute récupère un attribut en tant qu'entier
|
||||
func (ks *KmerSet) GetIntAttribute(key string) (int, bool) {
|
||||
value, ok := ks.Metadata[key]
|
||||
if !ok {
|
||||
return 0, false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case int:
|
||||
return v, true
|
||||
case int64:
|
||||
return int(v), true
|
||||
case float64:
|
||||
return int(v), true
|
||||
case string:
|
||||
if i, err := strconv.Atoi(v); err == nil {
|
||||
return i, true
|
||||
}
|
||||
}
|
||||
return 0, false
|
||||
}
|
||||
|
||||
// GetFloatAttribute récupère un attribut en tant que float64
|
||||
func (ks *KmerSet) GetFloatAttribute(key string) (float64, bool) {
|
||||
value, ok := ks.Metadata[key]
|
||||
if !ok {
|
||||
return 0, false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case float64:
|
||||
return v, true
|
||||
case float32:
|
||||
return float64(v), true
|
||||
case int:
|
||||
return float64(v), true
|
||||
case int64:
|
||||
return float64(v), true
|
||||
case string:
|
||||
if f, err := strconv.ParseFloat(v, 64); err == nil {
|
||||
return f, true
|
||||
}
|
||||
}
|
||||
return 0, false
|
||||
}
|
||||
|
||||
// GetNumericAttribute récupère un attribut numérique (alias de GetFloatAttribute)
|
||||
func (ks *KmerSet) GetNumericAttribute(key string) (float64, bool) {
|
||||
return ks.GetFloatAttribute(key)
|
||||
}
|
||||
|
||||
// GetStringAttribute récupère un attribut en tant que chaîne
|
||||
func (ks *KmerSet) GetStringAttribute(key string) (string, bool) {
|
||||
value, ok := ks.Metadata[key]
|
||||
if !ok {
|
||||
return "", false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case string:
|
||||
return v, true
|
||||
default:
|
||||
return fmt.Sprintf("%v", v), true
|
||||
}
|
||||
}
|
||||
|
||||
// GetBoolAttribute récupère un attribut en tant que booléen
|
||||
func (ks *KmerSet) GetBoolAttribute(key string) (bool, bool) {
|
||||
value, ok := ks.Metadata[key]
|
||||
if !ok {
|
||||
return false, false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case bool:
|
||||
return v, true
|
||||
case int:
|
||||
return v != 0, true
|
||||
case string:
|
||||
if b, err := strconv.ParseBool(v); err == nil {
|
||||
return b, true
|
||||
}
|
||||
}
|
||||
return false, false
|
||||
}
|
||||
|
||||
// AttributeKeys returns the set of attribute keys
|
||||
func (ks *KmerSet) AttributeKeys() obiutils.Set[string] {
|
||||
keys := obiutils.MakeSet[string]()
|
||||
for key := range ks.Metadata {
|
||||
keys.Add(key)
|
||||
}
|
||||
return keys
|
||||
}
|
||||
|
||||
// Keys returns the set of attribute keys (alias of AttributeKeys)
|
||||
func (ks *KmerSet) Keys() obiutils.Set[string] {
|
||||
return ks.AttributeKeys()
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// KMER SET GROUP ATTRIBUTE API
|
||||
// Métadonnées du groupe + accès via Get() pour les sets individuels
|
||||
// ==================================
|
||||
|
||||
// HasAttribute vérifie si une clé d'attribut existe pour le groupe
|
||||
func (ksg *KmerSetGroup) HasAttribute(key string) bool {
|
||||
_, ok := ksg.Metadata[key]
|
||||
return ok
|
||||
}
|
||||
|
||||
// GetAttribute récupère la valeur d'un attribut du groupe
|
||||
// Cas particuliers: "id" utilise Id(), "k" utilise K()
|
||||
func (ksg *KmerSetGroup) GetAttribute(key string) (interface{}, bool) {
|
||||
switch key {
|
||||
case "id":
|
||||
return ksg.Id(), true
|
||||
case "k":
|
||||
return ksg.K(), true
|
||||
default:
|
||||
value, ok := ksg.Metadata[key]
|
||||
return value, ok
|
||||
}
|
||||
}
|
||||
|
||||
// SetAttribute sets the value of an attribute du groupe
|
||||
// Cas particuliers: "id" utilise SetId(), "k" est immutable (panique)
|
||||
func (ksg *KmerSetGroup) SetAttribute(key string, value interface{}) {
|
||||
switch key {
|
||||
case "id":
|
||||
if id, ok := value.(string); ok {
|
||||
ksg.SetId(id)
|
||||
} else {
|
||||
panic(fmt.Sprintf("id must be a string, got %T", value))
|
||||
}
|
||||
case "k":
|
||||
panic("k is immutable and cannot be modified via SetAttribute")
|
||||
default:
|
||||
ksg.Metadata[key] = value
|
||||
}
|
||||
}
|
||||
|
||||
// DeleteAttribute supprime un attribut du groupe
|
||||
func (ksg *KmerSetGroup) DeleteAttribute(key string) {
|
||||
delete(ksg.Metadata, key)
|
||||
}
|
||||
|
||||
// RemoveAttribute supprime un attribut du groupe (alias)
|
||||
func (ksg *KmerSetGroup) RemoveAttribute(key string) {
|
||||
ksg.DeleteAttribute(key)
|
||||
}
|
||||
|
||||
// RenameAttribute renomme un attribut du groupe
|
||||
func (ksg *KmerSetGroup) RenameAttribute(newName, oldName string) {
|
||||
if value, ok := ksg.Metadata[oldName]; ok {
|
||||
ksg.Metadata[newName] = value
|
||||
delete(ksg.Metadata, oldName)
|
||||
}
|
||||
}
|
||||
|
||||
// GetIntAttribute récupère un attribut entier du groupe
|
||||
func (ksg *KmerSetGroup) GetIntAttribute(key string) (int, bool) {
|
||||
value, ok := ksg.GetAttribute(key)
|
||||
if !ok {
|
||||
return 0, false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case int:
|
||||
return v, true
|
||||
case int64:
|
||||
return int(v), true
|
||||
case float64:
|
||||
return int(v), true
|
||||
case string:
|
||||
if i, err := strconv.Atoi(v); err == nil {
|
||||
return i, true
|
||||
}
|
||||
}
|
||||
return 0, false
|
||||
}
|
||||
|
||||
// GetFloatAttribute récupère un attribut float64 du groupe
|
||||
func (ksg *KmerSetGroup) GetFloatAttribute(key string) (float64, bool) {
|
||||
value, ok := ksg.GetAttribute(key)
|
||||
if !ok {
|
||||
return 0, false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case float64:
|
||||
return v, true
|
||||
case float32:
|
||||
return float64(v), true
|
||||
case int:
|
||||
return float64(v), true
|
||||
case int64:
|
||||
return float64(v), true
|
||||
case string:
|
||||
if f, err := strconv.ParseFloat(v, 64); err == nil {
|
||||
return f, true
|
||||
}
|
||||
}
|
||||
return 0, false
|
||||
}
|
||||
|
||||
// GetNumericAttribute récupère un attribut numérique du groupe
|
||||
func (ksg *KmerSetGroup) GetNumericAttribute(key string) (float64, bool) {
|
||||
return ksg.GetFloatAttribute(key)
|
||||
}
|
||||
|
||||
// GetStringAttribute récupère un attribut chaîne du groupe
|
||||
func (ksg *KmerSetGroup) GetStringAttribute(key string) (string, bool) {
|
||||
value, ok := ksg.GetAttribute(key)
|
||||
if !ok {
|
||||
return "", false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case string:
|
||||
return v, true
|
||||
default:
|
||||
return fmt.Sprintf("%v", v), true
|
||||
}
|
||||
}
|
||||
|
||||
// GetBoolAttribute récupère un attribut booléen du groupe
|
||||
func (ksg *KmerSetGroup) GetBoolAttribute(key string) (bool, bool) {
|
||||
value, ok := ksg.GetAttribute(key)
|
||||
if !ok {
|
||||
return false, false
|
||||
}
|
||||
|
||||
switch v := value.(type) {
|
||||
case bool:
|
||||
return v, true
|
||||
case int:
|
||||
return v != 0, true
|
||||
case string:
|
||||
if b, err := strconv.ParseBool(v); err == nil {
|
||||
return b, true
|
||||
}
|
||||
}
|
||||
return false, false
|
||||
}
|
||||
|
||||
// AttributeKeys returns the set of attribute keys du groupe
|
||||
func (ksg *KmerSetGroup) AttributeKeys() obiutils.Set[string] {
|
||||
keys := obiutils.MakeSet[string]()
|
||||
for key := range ksg.Metadata {
|
||||
keys.Add(key)
|
||||
}
|
||||
return keys
|
||||
}
|
||||
|
||||
// Keys returns the set of group attribute keys (alias)
|
||||
func (ksg *KmerSetGroup) Keys() obiutils.Set[string] {
|
||||
return ksg.AttributeKeys()
|
||||
}
|
||||
|
||||
// ==================================
|
||||
// MÉTHODES POUR ACCÉDER AUX ATTRIBUTS DES SETS INDIVIDUELS VIA Get()
|
||||
// Architecture zero-copy: ksg.Get(i).SetAttribute(...)
|
||||
// ==================================
|
||||
|
||||
// Exemple d'utilisation:
|
||||
// Pour accéder aux métadonnées d'un KmerSet individuel dans un groupe:
|
||||
// ks := ksg.Get(0)
|
||||
// ks.SetAttribute("level", 1)
|
||||
// hasLevel := ks.HasAttribute("level")
|
||||
//
|
||||
// Pour les métadonnées du groupe:
|
||||
// ksg.SetAttribute("name", "FrequencyFilter")
|
||||
// name, ok := ksg.GetStringAttribute("name")
|
||||
|
||||
// AllAttributeKeys returns all unique attribute keys of the group AND all its sets
|
||||
func (ksg *KmerSetGroup) AllAttributeKeys() obiutils.Set[string] {
|
||||
keys := obiutils.MakeSet[string]()
|
||||
|
||||
// Ajouter les clés du groupe
|
||||
for key := range ksg.Metadata {
|
||||
keys.Add(key)
|
||||
}
|
||||
|
||||
// Ajouter les clés de chaque set
|
||||
for _, ks := range ksg.sets {
|
||||
for key := range ks.Metadata {
|
||||
keys.Add(key)
|
||||
}
|
||||
}
|
||||
|
||||
return keys
|
||||
}
|
||||
@@ -0,0 +1,702 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"math"
|
||||
"os"
|
||||
"path/filepath"
|
||||
"slices"
|
||||
"sync"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"github.com/schollz/progressbar/v3"
|
||||
)
|
||||
|
||||
// BuilderOption is a functional option for KmerSetGroupBuilder.
|
||||
type BuilderOption func(*builderConfig)
|
||||
|
||||
type builderConfig struct {
|
||||
minFreq int // 0 means no frequency filtering (simple dedup)
|
||||
maxFreq int // 0 means no upper bound
|
||||
saveFreqTopN int // >0 means save the N most frequent k-mers per set to CSV
|
||||
entropyThreshold float64 // >0 means filter k-mers with entropy <= threshold
|
||||
entropyLevelMax int // max sub-word size for entropy (typically 6)
|
||||
}
|
||||
|
||||
// WithMinFrequency activates frequency filtering mode.
|
||||
// Only k-mers seen >= minFreq times are kept in the final index.
|
||||
func WithMinFrequency(minFreq int) BuilderOption {
|
||||
return func(c *builderConfig) {
|
||||
c.minFreq = minFreq
|
||||
}
|
||||
}
|
||||
|
||||
// WithMaxFrequency sets the upper frequency bound.
|
||||
// Only k-mers seen <= maxFreq times are kept in the final index.
|
||||
func WithMaxFrequency(maxFreq int) BuilderOption {
|
||||
return func(c *builderConfig) {
|
||||
c.maxFreq = maxFreq
|
||||
}
|
||||
}
|
||||
|
||||
// WithSaveFreqKmers saves the N most frequent k-mers per set to a CSV file
|
||||
// (top_kmers.csv in each set directory).
|
||||
func WithSaveFreqKmers(n int) BuilderOption {
|
||||
return func(c *builderConfig) {
|
||||
c.saveFreqTopN = n
|
||||
}
|
||||
}
|
||||
|
||||
// WithEntropyFilter activates entropy-based low-complexity filtering.
|
||||
// K-mers with entropy <= threshold are discarded during finalization.
|
||||
// levelMax is the maximum sub-word size for entropy computation (typically 6).
|
||||
func WithEntropyFilter(threshold float64, levelMax int) BuilderOption {
|
||||
return func(c *builderConfig) {
|
||||
c.entropyThreshold = threshold
|
||||
c.entropyLevelMax = levelMax
|
||||
}
|
||||
}
|
||||
|
||||
// KmerSetGroupBuilder constructs a KmerSetGroup on disk.
|
||||
// During construction, super-kmers are written to temporary .skm files
|
||||
// partitioned by minimizer. On Close(), each partition is finalized
|
||||
// (sort, dedup, optional frequency filter) into .kdi files.
|
||||
type KmerSetGroupBuilder struct {
|
||||
dir string
|
||||
k int
|
||||
m int
|
||||
n int // number of NEW sets being built
|
||||
P int // number of partitions
|
||||
startIndex int // first set index (0 for new groups, existingN for appends)
|
||||
config builderConfig
|
||||
existing *KmerSetGroup // non-nil when appending to existing group
|
||||
writers [][]*SkmWriter // [setIndex][partIndex] (local index 0..n-1)
|
||||
mu [][]sync.Mutex // per-writer mutex for concurrent access
|
||||
closed bool
|
||||
}
|
||||
|
||||
// NewKmerSetGroupBuilder creates a builder for a new KmerSetGroup.
|
||||
//
|
||||
// Parameters:
|
||||
// - directory: destination directory (created if necessary)
|
||||
// - k: k-mer size (1-31)
|
||||
// - m: minimizer size (-1 for auto = ceil(k/2.5))
|
||||
// - n: number of sets in the group
|
||||
// - P: number of partitions (-1 for auto)
|
||||
// - options: optional builder options (e.g. WithMinFrequency)
|
||||
func NewKmerSetGroupBuilder(directory string, k, m, n, P int,
|
||||
options ...BuilderOption) (*KmerSetGroupBuilder, error) {
|
||||
|
||||
if k < 2 || k > 31 {
|
||||
return nil, fmt.Errorf("obikmer: k must be between 2 and 31, got %d", k)
|
||||
}
|
||||
if n < 1 {
|
||||
return nil, fmt.Errorf("obikmer: n must be >= 1, got %d", n)
|
||||
}
|
||||
|
||||
// Auto minimizer size
|
||||
if m < 0 {
|
||||
m = int(math.Ceil(float64(k) / 2.5))
|
||||
}
|
||||
if m < 1 {
|
||||
m = 1
|
||||
}
|
||||
if m >= k {
|
||||
m = k - 1
|
||||
}
|
||||
|
||||
// Auto partition count
|
||||
if P < 0 {
|
||||
// Use 4^m as the maximum, capped at a reasonable value
|
||||
maxP := 1 << (2 * m) // 4^m
|
||||
P = maxP
|
||||
if P > 4096 {
|
||||
P = 4096
|
||||
}
|
||||
if P < 64 {
|
||||
P = 64
|
||||
}
|
||||
}
|
||||
|
||||
// Apply options
|
||||
var config builderConfig
|
||||
for _, opt := range options {
|
||||
opt(&config)
|
||||
}
|
||||
|
||||
// Create build directory structure
|
||||
buildDir := filepath.Join(directory, ".build")
|
||||
for s := 0; s < n; s++ {
|
||||
setDir := filepath.Join(buildDir, fmt.Sprintf("set_%d", s))
|
||||
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: create build dir: %w", err)
|
||||
}
|
||||
}
|
||||
|
||||
// Create SKM writers
|
||||
writers := make([][]*SkmWriter, n)
|
||||
mutexes := make([][]sync.Mutex, n)
|
||||
for s := 0; s < n; s++ {
|
||||
writers[s] = make([]*SkmWriter, P)
|
||||
mutexes[s] = make([]sync.Mutex, P)
|
||||
for p := 0; p < P; p++ {
|
||||
path := filepath.Join(buildDir, fmt.Sprintf("set_%d", s),
|
||||
fmt.Sprintf("part_%04d.skm", p))
|
||||
w, err := NewSkmWriter(path)
|
||||
if err != nil {
|
||||
// Close already-created writers
|
||||
for ss := 0; ss <= s; ss++ {
|
||||
for pp := 0; pp < P; pp++ {
|
||||
if writers[ss][pp] != nil {
|
||||
writers[ss][pp].Close()
|
||||
}
|
||||
}
|
||||
}
|
||||
return nil, fmt.Errorf("obikmer: create skm writer: %w", err)
|
||||
}
|
||||
writers[s][p] = w
|
||||
}
|
||||
}
|
||||
|
||||
return &KmerSetGroupBuilder{
|
||||
dir: directory,
|
||||
k: k,
|
||||
m: m,
|
||||
n: n,
|
||||
P: P,
|
||||
startIndex: 0,
|
||||
config: config,
|
||||
writers: writers,
|
||||
mu: mutexes,
|
||||
}, nil
|
||||
}
|
||||
|
||||
// AppendKmerSetGroupBuilder opens an existing KmerSetGroup and creates
|
||||
// a builder that adds n new sets starting from the existing set count.
|
||||
// The k, m, and partitions are inherited from the existing group.
|
||||
func AppendKmerSetGroupBuilder(directory string, n int, options ...BuilderOption) (*KmerSetGroupBuilder, error) {
|
||||
existing, err := OpenKmerSetGroup(directory)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("obikmer: open existing group: %w", err)
|
||||
}
|
||||
|
||||
if n < 1 {
|
||||
return nil, fmt.Errorf("obikmer: n must be >= 1, got %d", n)
|
||||
}
|
||||
|
||||
k := existing.K()
|
||||
m := existing.M()
|
||||
P := existing.Partitions()
|
||||
startIndex := existing.Size()
|
||||
|
||||
var config builderConfig
|
||||
for _, opt := range options {
|
||||
opt(&config)
|
||||
}
|
||||
|
||||
// Create build directory structure for new sets
|
||||
buildDir := filepath.Join(directory, ".build")
|
||||
for s := 0; s < n; s++ {
|
||||
setDir := filepath.Join(buildDir, fmt.Sprintf("set_%d", s))
|
||||
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: create build dir: %w", err)
|
||||
}
|
||||
}
|
||||
|
||||
// Create SKM writers for new sets
|
||||
writers := make([][]*SkmWriter, n)
|
||||
mutexes := make([][]sync.Mutex, n)
|
||||
for s := 0; s < n; s++ {
|
||||
writers[s] = make([]*SkmWriter, P)
|
||||
mutexes[s] = make([]sync.Mutex, P)
|
||||
for p := 0; p < P; p++ {
|
||||
path := filepath.Join(buildDir, fmt.Sprintf("set_%d", s),
|
||||
fmt.Sprintf("part_%04d.skm", p))
|
||||
w, err := NewSkmWriter(path)
|
||||
if err != nil {
|
||||
for ss := 0; ss <= s; ss++ {
|
||||
for pp := 0; pp < P; pp++ {
|
||||
if writers[ss][pp] != nil {
|
||||
writers[ss][pp].Close()
|
||||
}
|
||||
}
|
||||
}
|
||||
return nil, fmt.Errorf("obikmer: create skm writer: %w", err)
|
||||
}
|
||||
writers[s][p] = w
|
||||
}
|
||||
}
|
||||
|
||||
return &KmerSetGroupBuilder{
|
||||
dir: directory,
|
||||
k: k,
|
||||
m: m,
|
||||
n: n,
|
||||
P: P,
|
||||
startIndex: startIndex,
|
||||
config: config,
|
||||
existing: existing,
|
||||
writers: writers,
|
||||
mu: mutexes,
|
||||
}, nil
|
||||
}
|
||||
|
||||
// StartIndex returns the first global set index for the new sets being built.
|
||||
// For new groups this is 0; for appends it is the existing group's Size().
|
||||
func (b *KmerSetGroupBuilder) StartIndex() int {
|
||||
return b.startIndex
|
||||
}
|
||||
|
||||
// AddSequence extracts super-kmers from a sequence and writes them
|
||||
// to the appropriate partition files for the given set.
|
||||
func (b *KmerSetGroupBuilder) AddSequence(setIndex int, seq *obiseq.BioSequence) {
|
||||
if setIndex < 0 || setIndex >= b.n {
|
||||
return
|
||||
}
|
||||
rawSeq := seq.Sequence()
|
||||
if len(rawSeq) < b.k {
|
||||
return
|
||||
}
|
||||
for sk := range IterSuperKmers(rawSeq, b.k, b.m) {
|
||||
part := int(sk.Minimizer % uint64(b.P))
|
||||
b.mu[setIndex][part].Lock()
|
||||
b.writers[setIndex][part].Write(sk)
|
||||
b.mu[setIndex][part].Unlock()
|
||||
}
|
||||
}
|
||||
|
||||
// AddSuperKmer writes a single super-kmer to the appropriate partition.
|
||||
func (b *KmerSetGroupBuilder) AddSuperKmer(setIndex int, sk SuperKmer) {
|
||||
if setIndex < 0 || setIndex >= b.n {
|
||||
return
|
||||
}
|
||||
part := int(sk.Minimizer % uint64(b.P))
|
||||
b.mu[setIndex][part].Lock()
|
||||
b.writers[setIndex][part].Write(sk)
|
||||
b.mu[setIndex][part].Unlock()
|
||||
}
|
||||
|
||||
// Close finalizes the construction:
|
||||
// 1. Flush and close all SKM writers
|
||||
// 2. For each partition of each set (in parallel):
|
||||
// - Load super-kmers from .skm
|
||||
// - Extract canonical k-mers
|
||||
// - Sort and deduplicate (count if frequency filter)
|
||||
// - Write .kdi file
|
||||
// 3. Write metadata.toml
|
||||
// 4. Remove .build/ directory
|
||||
//
|
||||
// Returns the finalized KmerSetGroup in read-only mode.
|
||||
func (b *KmerSetGroupBuilder) Close() (*KmerSetGroup, error) {
|
||||
if b.closed {
|
||||
return nil, fmt.Errorf("obikmer: builder already closed")
|
||||
}
|
||||
b.closed = true
|
||||
|
||||
// 1. Close all SKM writers
|
||||
for s := 0; s < b.n; s++ {
|
||||
for p := 0; p < b.P; p++ {
|
||||
if err := b.writers[s][p].Close(); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: close skm writer set=%d part=%d: %w", s, p, err)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// 2. Create output directory structure for new sets
|
||||
for s := 0; s < b.n; s++ {
|
||||
globalIdx := b.startIndex + s
|
||||
setDir := filepath.Join(b.dir, fmt.Sprintf("set_%d", globalIdx))
|
||||
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: create set dir: %w", err)
|
||||
}
|
||||
}
|
||||
|
||||
// =====================================================================
|
||||
// 2-stage pipeline: readers (pure I/O) → workers (CPU + write)
|
||||
//
|
||||
// - nReaders goroutines read .skm files (pure I/O, fast)
|
||||
// - nWorkers goroutines extract k-mers, sort, dedup, filter, write .kdi
|
||||
//
|
||||
// One unbuffered channel between stages. Readers are truly I/O-bound
|
||||
// (small files, buffered reads), workers are CPU-bound and stay busy.
|
||||
// =====================================================================
|
||||
totalJobs := b.n * b.P
|
||||
|
||||
counts := make([][]uint64, b.n)
|
||||
spectra := make([][]map[int]uint64, b.n)
|
||||
var topKmers [][]*TopNKmers
|
||||
for s := 0; s < b.n; s++ {
|
||||
counts[s] = make([]uint64, b.P)
|
||||
spectra[s] = make([]map[int]uint64, b.P)
|
||||
}
|
||||
if b.config.saveFreqTopN > 0 {
|
||||
topKmers = make([][]*TopNKmers, b.n)
|
||||
for s := 0; s < b.n; s++ {
|
||||
topKmers[s] = make([]*TopNKmers, b.P)
|
||||
}
|
||||
}
|
||||
|
||||
nCPU := obidefault.ParallelWorkers()
|
||||
|
||||
// Stage sizing
|
||||
nWorkers := nCPU // CPU-bound: one per core
|
||||
nReaders := nCPU / 4 // pure I/O: few goroutines suffice
|
||||
if nReaders < 2 {
|
||||
nReaders = 2
|
||||
}
|
||||
if nReaders > 4 {
|
||||
nReaders = 4
|
||||
}
|
||||
if nWorkers > totalJobs {
|
||||
nWorkers = totalJobs
|
||||
}
|
||||
if nReaders > totalJobs {
|
||||
nReaders = totalJobs
|
||||
}
|
||||
|
||||
var bar *progressbar.ProgressBar
|
||||
if obidefault.ProgressBar() {
|
||||
pbopt := []progressbar.Option{
|
||||
progressbar.OptionSetWriter(os.Stderr),
|
||||
progressbar.OptionSetWidth(15),
|
||||
progressbar.OptionShowCount(),
|
||||
progressbar.OptionShowIts(),
|
||||
progressbar.OptionSetPredictTime(true),
|
||||
progressbar.OptionSetDescription("[Finalizing partitions]"),
|
||||
}
|
||||
bar = progressbar.NewOptions(totalJobs, pbopt...)
|
||||
}
|
||||
|
||||
// --- Channel types ---
|
||||
type partitionData struct {
|
||||
setIdx int
|
||||
partIdx int
|
||||
skmers []SuperKmer // raw super-kmers from I/O stage
|
||||
}
|
||||
|
||||
type readJob struct {
|
||||
setIdx int
|
||||
partIdx int
|
||||
}
|
||||
|
||||
dataCh := make(chan *partitionData) // unbuffered
|
||||
readJobs := make(chan readJob, totalJobs)
|
||||
|
||||
var errMu sync.Mutex
|
||||
var firstErr error
|
||||
|
||||
// Fill job queue (buffered, all jobs pre-loaded)
|
||||
for s := 0; s < b.n; s++ {
|
||||
for p := 0; p < b.P; p++ {
|
||||
readJobs <- readJob{s, p}
|
||||
}
|
||||
}
|
||||
close(readJobs)
|
||||
|
||||
// --- Stage 1: Readers (pure I/O) ---
|
||||
var readWg sync.WaitGroup
|
||||
for w := 0; w < nReaders; w++ {
|
||||
readWg.Add(1)
|
||||
go func() {
|
||||
defer readWg.Done()
|
||||
for rj := range readJobs {
|
||||
skmers, err := b.loadPartitionRaw(rj.setIdx, rj.partIdx)
|
||||
if err != nil {
|
||||
errMu.Lock()
|
||||
if firstErr == nil {
|
||||
firstErr = err
|
||||
}
|
||||
errMu.Unlock()
|
||||
}
|
||||
dataCh <- &partitionData{rj.setIdx, rj.partIdx, skmers}
|
||||
}
|
||||
}()
|
||||
}
|
||||
|
||||
go func() {
|
||||
readWg.Wait()
|
||||
close(dataCh)
|
||||
}()
|
||||
|
||||
// --- Stage 2: Workers (CPU: extract k-mers + sort/filter + write .kdi) ---
|
||||
var workWg sync.WaitGroup
|
||||
for w := 0; w < nWorkers; w++ {
|
||||
workWg.Add(1)
|
||||
go func() {
|
||||
defer workWg.Done()
|
||||
for pd := range dataCh {
|
||||
// CPU: extract canonical k-mers from super-kmers
|
||||
kmers := extractCanonicalKmers(pd.skmers, b.k)
|
||||
pd.skmers = nil // allow GC of raw super-kmers
|
||||
|
||||
// CPU: sort, dedup, filter
|
||||
filtered, spectrum, topN := b.sortFilterPartition(kmers)
|
||||
kmers = nil // allow GC of unsorted data
|
||||
|
||||
// I/O: write .kdi file
|
||||
globalIdx := b.startIndex + pd.setIdx
|
||||
kdiPath := filepath.Join(b.dir,
|
||||
fmt.Sprintf("set_%d", globalIdx),
|
||||
fmt.Sprintf("part_%04d.kdi", pd.partIdx))
|
||||
|
||||
n, err := b.writePartitionKdi(kdiPath, filtered)
|
||||
if err != nil {
|
||||
errMu.Lock()
|
||||
if firstErr == nil {
|
||||
firstErr = err
|
||||
}
|
||||
errMu.Unlock()
|
||||
}
|
||||
counts[pd.setIdx][pd.partIdx] = n
|
||||
spectra[pd.setIdx][pd.partIdx] = spectrum
|
||||
if topKmers != nil {
|
||||
topKmers[pd.setIdx][pd.partIdx] = topN
|
||||
}
|
||||
if bar != nil {
|
||||
bar.Add(1)
|
||||
}
|
||||
}
|
||||
}()
|
||||
}
|
||||
|
||||
workWg.Wait()
|
||||
|
||||
if bar != nil {
|
||||
fmt.Fprintln(os.Stderr)
|
||||
}
|
||||
|
||||
if firstErr != nil {
|
||||
return nil, firstErr
|
||||
}
|
||||
|
||||
// Aggregate per-partition spectra into per-set spectra and write spectrum.bin
|
||||
for s := 0; s < b.n; s++ {
|
||||
globalIdx := b.startIndex + s
|
||||
setSpectrum := make(map[int]uint64)
|
||||
for p := 0; p < b.P; p++ {
|
||||
if spectra[s][p] != nil {
|
||||
MergeSpectraMaps(setSpectrum, spectra[s][p])
|
||||
}
|
||||
}
|
||||
if len(setSpectrum) > 0 {
|
||||
specPath := filepath.Join(b.dir, fmt.Sprintf("set_%d", globalIdx), "spectrum.bin")
|
||||
if err := WriteSpectrum(specPath, MapToSpectrum(setSpectrum)); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: write spectrum set=%d: %w", globalIdx, err)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// Aggregate per-partition top-N k-mers and write CSV
|
||||
if topKmers != nil {
|
||||
for s := 0; s < b.n; s++ {
|
||||
globalIdx := b.startIndex + s
|
||||
merged := NewTopNKmers(b.config.saveFreqTopN)
|
||||
for p := 0; p < b.P; p++ {
|
||||
merged.MergeTopN(topKmers[s][p])
|
||||
}
|
||||
results := merged.Results()
|
||||
if len(results) > 0 {
|
||||
csvPath := filepath.Join(b.dir, fmt.Sprintf("set_%d", globalIdx), "top_kmers.csv")
|
||||
if err := WriteTopKmersCSV(csvPath, results, b.k); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: write top kmers set=%d: %w", globalIdx, err)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// 3. Build KmerSetGroup and write metadata
|
||||
newCounts := make([]uint64, b.n)
|
||||
for s := 0; s < b.n; s++ {
|
||||
for p := 0; p < b.P; p++ {
|
||||
newCounts[s] += counts[s][p]
|
||||
}
|
||||
}
|
||||
|
||||
var ksg *KmerSetGroup
|
||||
|
||||
if b.existing != nil {
|
||||
// Append mode: extend existing group
|
||||
ksg = b.existing
|
||||
ksg.n += b.n
|
||||
ksg.setsIDs = append(ksg.setsIDs, make([]string, b.n)...)
|
||||
ksg.counts = append(ksg.counts, newCounts...)
|
||||
newMeta := make([]map[string]interface{}, b.n)
|
||||
for i := range newMeta {
|
||||
newMeta[i] = make(map[string]interface{})
|
||||
}
|
||||
ksg.setsMetadata = append(ksg.setsMetadata, newMeta...)
|
||||
} else {
|
||||
// New group
|
||||
setsIDs := make([]string, b.n)
|
||||
setsMetadata := make([]map[string]interface{}, b.n)
|
||||
for i := range setsMetadata {
|
||||
setsMetadata[i] = make(map[string]interface{})
|
||||
}
|
||||
ksg = &KmerSetGroup{
|
||||
path: b.dir,
|
||||
k: b.k,
|
||||
m: b.m,
|
||||
partitions: b.P,
|
||||
n: b.n,
|
||||
setsIDs: setsIDs,
|
||||
counts: newCounts,
|
||||
setsMetadata: setsMetadata,
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
}
|
||||
|
||||
if err := ksg.saveMetadata(); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: write metadata: %w", err)
|
||||
}
|
||||
|
||||
// 4. Remove .build/ directory
|
||||
buildDir := filepath.Join(b.dir, ".build")
|
||||
os.RemoveAll(buildDir)
|
||||
|
||||
return ksg, nil
|
||||
}
|
||||
|
||||
// loadPartitionRaw reads a .skm file and returns raw super-kmers.
|
||||
// This is pure I/O — no k-mer extraction is done here.
|
||||
// Returns nil (not an error) if the .skm file is empty or missing.
|
||||
func (b *KmerSetGroupBuilder) loadPartitionRaw(setIdx, partIdx int) ([]SuperKmer, error) {
|
||||
skmPath := filepath.Join(b.dir, ".build",
|
||||
fmt.Sprintf("set_%d", setIdx),
|
||||
fmt.Sprintf("part_%04d.skm", partIdx))
|
||||
|
||||
fi, err := os.Stat(skmPath)
|
||||
if err != nil {
|
||||
return nil, nil // empty partition, not an error
|
||||
}
|
||||
|
||||
reader, err := NewSkmReader(skmPath)
|
||||
if err != nil {
|
||||
return nil, nil
|
||||
}
|
||||
|
||||
// Estimate capacity from file size. Each super-kmer record is
|
||||
// 2 bytes (length) + packed bases (~k/4 bytes), so roughly
|
||||
// (2 + k/4) bytes per super-kmer on average.
|
||||
avgRecordSize := 2 + b.k/4
|
||||
if avgRecordSize < 4 {
|
||||
avgRecordSize = 4
|
||||
}
|
||||
estCount := int(fi.Size()) / avgRecordSize
|
||||
|
||||
skmers := make([]SuperKmer, 0, estCount)
|
||||
for {
|
||||
sk, ok := reader.Next()
|
||||
if !ok {
|
||||
break
|
||||
}
|
||||
skmers = append(skmers, sk)
|
||||
}
|
||||
reader.Close()
|
||||
|
||||
return skmers, nil
|
||||
}
|
||||
|
||||
// extractCanonicalKmers extracts all canonical k-mers from a slice of super-kmers.
|
||||
// This is CPU-bound work (sliding-window forward/reverse complement).
|
||||
func extractCanonicalKmers(skmers []SuperKmer, k int) []uint64 {
|
||||
// Pre-compute total capacity to avoid repeated slice growth.
|
||||
// Each super-kmer of length L yields L-k+1 canonical k-mers.
|
||||
total := 0
|
||||
for i := range skmers {
|
||||
n := len(skmers[i].Sequence) - k + 1
|
||||
if n > 0 {
|
||||
total += n
|
||||
}
|
||||
}
|
||||
|
||||
kmers := make([]uint64, 0, total)
|
||||
for _, sk := range skmers {
|
||||
for kmer := range IterCanonicalKmers(sk.Sequence, k) {
|
||||
kmers = append(kmers, kmer)
|
||||
}
|
||||
}
|
||||
return kmers
|
||||
}
|
||||
|
||||
// sortFilterPartition sorts, deduplicates, and filters k-mers in memory (CPU-bound).
|
||||
// Returns the filtered sorted slice, frequency spectrum, and optional top-N.
|
||||
func (b *KmerSetGroupBuilder) sortFilterPartition(kmers []uint64) ([]uint64, map[int]uint64, *TopNKmers) {
|
||||
if len(kmers) == 0 {
|
||||
return nil, nil, nil
|
||||
}
|
||||
|
||||
// Sort (CPU-bound) — slices.Sort avoids reflection overhead of sort.Slice
|
||||
slices.Sort(kmers)
|
||||
|
||||
minFreq := b.config.minFreq
|
||||
if minFreq <= 0 {
|
||||
minFreq = 1 // simple dedup
|
||||
}
|
||||
maxFreq := b.config.maxFreq
|
||||
|
||||
// Prepare entropy filter if requested
|
||||
var entropyFilter *KmerEntropyFilter
|
||||
if b.config.entropyThreshold > 0 && b.config.entropyLevelMax > 0 {
|
||||
entropyFilter = NewKmerEntropyFilter(b.k, b.config.entropyLevelMax, b.config.entropyThreshold)
|
||||
}
|
||||
|
||||
// Prepare top-N collector if requested
|
||||
var topN *TopNKmers
|
||||
if b.config.saveFreqTopN > 0 {
|
||||
topN = NewTopNKmers(b.config.saveFreqTopN)
|
||||
}
|
||||
|
||||
// Linear scan: count consecutive identical values, filter, accumulate spectrum
|
||||
partSpectrum := make(map[int]uint64)
|
||||
filtered := make([]uint64, 0, len(kmers)/2)
|
||||
|
||||
i := 0
|
||||
for i < len(kmers) {
|
||||
val := kmers[i]
|
||||
c := 1
|
||||
for i+c < len(kmers) && kmers[i+c] == val {
|
||||
c++
|
||||
}
|
||||
partSpectrum[c]++
|
||||
if topN != nil {
|
||||
topN.Add(val, c)
|
||||
}
|
||||
if c >= minFreq && (maxFreq <= 0 || c <= maxFreq) {
|
||||
if entropyFilter == nil || entropyFilter.Accept(val) {
|
||||
filtered = append(filtered, val)
|
||||
}
|
||||
}
|
||||
i += c
|
||||
}
|
||||
|
||||
return filtered, partSpectrum, topN
|
||||
}
|
||||
|
||||
// writePartitionKdi writes a sorted slice of k-mers to a .kdi file (I/O-bound).
|
||||
// Returns the number of k-mers written.
|
||||
func (b *KmerSetGroupBuilder) writePartitionKdi(kdiPath string, kmers []uint64) (uint64, error) {
|
||||
w, err := NewKdiWriter(kdiPath)
|
||||
if err != nil {
|
||||
return 0, err
|
||||
}
|
||||
|
||||
for _, val := range kmers {
|
||||
if err := w.Write(val); err != nil {
|
||||
w.Close()
|
||||
return 0, err
|
||||
}
|
||||
}
|
||||
|
||||
n := w.Count()
|
||||
return n, w.Close()
|
||||
}
|
||||
|
||||
func (b *KmerSetGroupBuilder) writeEmptyKdi(path string, count *uint64) error {
|
||||
w, err := NewKdiWriter(path)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
*count = 0
|
||||
return w.Close()
|
||||
}
|
||||
@@ -0,0 +1,278 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"sort"
|
||||
"testing"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
func TestBuilderBasic(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
seq := obiseq.NewBioSequence("test", []byte("ACGTACGTACGTACGTACGTACGTACGT"), "")
|
||||
builder.AddSequence(0, seq)
|
||||
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
if ksg.K() != 15 {
|
||||
t.Fatalf("K() = %d, want 15", ksg.K())
|
||||
}
|
||||
if ksg.M() != 7 {
|
||||
t.Fatalf("M() = %d, want 7", ksg.M())
|
||||
}
|
||||
if ksg.Partitions() != 64 {
|
||||
t.Fatalf("Partitions() = %d, want 64", ksg.Partitions())
|
||||
}
|
||||
if ksg.Size() != 1 {
|
||||
t.Fatalf("Size() = %d, want 1", ksg.Size())
|
||||
}
|
||||
if ksg.Len(0) == 0 {
|
||||
t.Fatal("Len(0) = 0, expected some k-mers")
|
||||
}
|
||||
|
||||
// Verify k-mers match what we'd compute directly
|
||||
var expected []uint64
|
||||
for kmer := range IterCanonicalKmers(seq.Sequence(), 15) {
|
||||
expected = append(expected, kmer)
|
||||
}
|
||||
sort.Slice(expected, func(i, j int) bool { return expected[i] < expected[j] })
|
||||
// Dedup
|
||||
deduped := expected[:0]
|
||||
for i, v := range expected {
|
||||
if i == 0 || v != expected[i-1] {
|
||||
deduped = append(deduped, v)
|
||||
}
|
||||
}
|
||||
|
||||
if ksg.Len(0) != uint64(len(deduped)) {
|
||||
t.Fatalf("Len(0) = %d, expected %d unique k-mers", ksg.Len(0), len(deduped))
|
||||
}
|
||||
|
||||
// Check iterator
|
||||
var fromIter []uint64
|
||||
for kmer := range ksg.Iterator(0) {
|
||||
fromIter = append(fromIter, kmer)
|
||||
}
|
||||
// The iterator does a k-way merge so should be sorted
|
||||
for i := 1; i < len(fromIter); i++ {
|
||||
if fromIter[i] <= fromIter[i-1] {
|
||||
t.Fatalf("iterator not sorted at %d: %d <= %d", i, fromIter[i], fromIter[i-1])
|
||||
}
|
||||
}
|
||||
if len(fromIter) != len(deduped) {
|
||||
t.Fatalf("iterator yielded %d k-mers, expected %d", len(fromIter), len(deduped))
|
||||
}
|
||||
for i, v := range fromIter {
|
||||
if v != deduped[i] {
|
||||
t.Fatalf("iterator kmer %d: got %d, want %d", i, v, deduped[i])
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestBuilderMultipleSequences(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
seqs := []string{
|
||||
"ACGTACGTACGTACGTACGTACGTACGT",
|
||||
"TTTTTTTTTTTTTTTTTTTTTTTTT",
|
||||
"GGGGGGGGGGGGGGGGGGGGGGGG",
|
||||
}
|
||||
for _, s := range seqs {
|
||||
seq := obiseq.NewBioSequence("", []byte(s), "")
|
||||
builder.AddSequence(0, seq)
|
||||
}
|
||||
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
if ksg.Len(0) == 0 {
|
||||
t.Fatal("expected k-mers after multiple sequences")
|
||||
}
|
||||
}
|
||||
|
||||
func TestBuilderFrequencyFilter(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64,
|
||||
WithMinFrequency(3))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Add same sequence 3 times — all k-mers should survive freq=3
|
||||
seq := obiseq.NewBioSequence("test", []byte("ACGTACGTACGTACGTACGTACGTACGT"), "")
|
||||
for i := 0; i < 3; i++ {
|
||||
builder.AddSequence(0, seq)
|
||||
}
|
||||
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// All k-mers appear exactly 3 times → all should survive
|
||||
var expected []uint64
|
||||
for kmer := range IterCanonicalKmers(seq.Sequence(), 15) {
|
||||
expected = append(expected, kmer)
|
||||
}
|
||||
sort.Slice(expected, func(i, j int) bool { return expected[i] < expected[j] })
|
||||
deduped := expected[:0]
|
||||
for i, v := range expected {
|
||||
if i == 0 || v != expected[i-1] {
|
||||
deduped = append(deduped, v)
|
||||
}
|
||||
}
|
||||
|
||||
if ksg.Len(0) != uint64(len(deduped)) {
|
||||
t.Fatalf("Len(0) = %d, expected %d (all k-mers at freq=3)", ksg.Len(0), len(deduped))
|
||||
}
|
||||
}
|
||||
|
||||
func TestBuilderFrequencyFilterRejects(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64,
|
||||
WithMinFrequency(5))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Use a non-repetitive sequence so each canonical k-mer appears once per pass.
|
||||
// Adding it twice gives freq=2 per kmer, which is < minFreq=5 → all rejected.
|
||||
seq := obiseq.NewBioSequence("test",
|
||||
[]byte("ACGATCGATCTAGCTAGCTGATCGATCGATCG"), "")
|
||||
builder.AddSequence(0, seq)
|
||||
builder.AddSequence(0, seq)
|
||||
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
if ksg.Len(0) != 0 {
|
||||
t.Fatalf("Len(0) = %d, expected 0 (all k-mers at freq=2 < minFreq=5)", ksg.Len(0))
|
||||
}
|
||||
}
|
||||
|
||||
func TestBuilderMultipleSets(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 3, 64)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
seqs := []string{
|
||||
"ACGTACGTACGTACGTACGTACGTACGT",
|
||||
"TTTTTTTTTTTTTTTTTTTTTTTTT",
|
||||
"GGGGGGGGGGGGGGGGGGGGGGGG",
|
||||
}
|
||||
for i, s := range seqs {
|
||||
seq := obiseq.NewBioSequence("", []byte(s), "")
|
||||
builder.AddSequence(i, seq)
|
||||
}
|
||||
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
if ksg.Size() != 3 {
|
||||
t.Fatalf("Size() = %d, want 3", ksg.Size())
|
||||
}
|
||||
for s := 0; s < 3; s++ {
|
||||
if ksg.Len(s) == 0 {
|
||||
t.Fatalf("Len(%d) = 0, expected some k-mers", s)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestBuilderOpenRoundTrip(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
seq := obiseq.NewBioSequence("test", []byte("ACGTACGTACGTACGTACGTACGTACGT"), "")
|
||||
builder.AddSequence(0, seq)
|
||||
|
||||
ksg1, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Reopen
|
||||
ksg2, err := OpenKmerSetGroup(dir)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
if ksg2.K() != ksg1.K() {
|
||||
t.Fatalf("K mismatch: %d vs %d", ksg2.K(), ksg1.K())
|
||||
}
|
||||
if ksg2.M() != ksg1.M() {
|
||||
t.Fatalf("M mismatch: %d vs %d", ksg2.M(), ksg1.M())
|
||||
}
|
||||
if ksg2.Partitions() != ksg1.Partitions() {
|
||||
t.Fatalf("Partitions mismatch: %d vs %d", ksg2.Partitions(), ksg1.Partitions())
|
||||
}
|
||||
if ksg2.Len(0) != ksg1.Len(0) {
|
||||
t.Fatalf("Len mismatch: %d vs %d", ksg2.Len(0), ksg1.Len(0))
|
||||
}
|
||||
}
|
||||
|
||||
func TestBuilderAttributes(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
|
||||
builder, err := NewKmerSetGroupBuilder(dir, 15, 7, 1, 64)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
seq := obiseq.NewBioSequence("test", []byte("ACGTACGTACGTACGTACGTACGTACGT"), "")
|
||||
builder.AddSequence(0, seq)
|
||||
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
ksg.SetId("my_index")
|
||||
ksg.SetAttribute("organism", "test")
|
||||
ksg.SaveMetadata()
|
||||
|
||||
// Reopen and check
|
||||
ksg2, err := OpenKmerSetGroup(dir)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
if ksg2.Id() != "my_index" {
|
||||
t.Fatalf("Id() = %q, want %q", ksg2.Id(), "my_index")
|
||||
}
|
||||
if !ksg2.HasAttribute("organism") {
|
||||
t.Fatal("expected 'organism' attribute")
|
||||
}
|
||||
v, _ := ksg2.GetAttribute("organism")
|
||||
if v != "test" {
|
||||
t.Fatalf("organism = %v, want 'test'", v)
|
||||
}
|
||||
}
|
||||
@@ -0,0 +1,944 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"io"
|
||||
"iter"
|
||||
"os"
|
||||
"path"
|
||||
"path/filepath"
|
||||
"sort"
|
||||
"sync"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidist"
|
||||
"github.com/pelletier/go-toml/v2"
|
||||
)
|
||||
|
||||
// MetadataFormat represents the metadata serialization format.
|
||||
// Currently only TOML is used for disk-based indices, but the type
|
||||
// is kept for backward compatibility with CLI options.
|
||||
type MetadataFormat int
|
||||
|
||||
const (
|
||||
FormatTOML MetadataFormat = iota
|
||||
FormatYAML
|
||||
FormatJSON
|
||||
)
|
||||
|
||||
// String returns the file extension for the format.
|
||||
func (f MetadataFormat) String() string {
|
||||
switch f {
|
||||
case FormatTOML:
|
||||
return "toml"
|
||||
case FormatYAML:
|
||||
return "yaml"
|
||||
case FormatJSON:
|
||||
return "json"
|
||||
default:
|
||||
return "toml"
|
||||
}
|
||||
}
|
||||
|
||||
// KmerSetGroup is a disk-based collection of N k-mer sets sharing the same
|
||||
// k, m, and partition count P. After construction (via KmerSetGroupBuilder),
|
||||
// it is immutable and all operations are streaming (partition by partition).
|
||||
//
|
||||
// A KmerSetGroup with Size()==1 is effectively a KmerSet (singleton).
|
||||
type KmerSetGroup struct {
|
||||
path string // root directory
|
||||
id string // user-assigned identifier
|
||||
k int // k-mer size
|
||||
m int // minimizer size
|
||||
partitions int // number of partitions P
|
||||
n int // number of sets N
|
||||
setsIDs []string // IDs of individual sets
|
||||
counts []uint64 // total k-mer count per set (sum over partitions)
|
||||
setsMetadata []map[string]interface{} // per-set user metadata
|
||||
Metadata map[string]interface{} // group-level user metadata
|
||||
}
|
||||
|
||||
// diskMetadata is the TOML-serializable structure for metadata.toml.
|
||||
type diskMetadata struct {
|
||||
ID string `toml:"id,omitempty"`
|
||||
K int `toml:"k"`
|
||||
M int `toml:"m"`
|
||||
Partitions int `toml:"partitions"`
|
||||
Type string `toml:"type"`
|
||||
Size int `toml:"size"`
|
||||
SetsIDs []string `toml:"sets_ids,omitempty"`
|
||||
Counts []uint64 `toml:"counts,omitempty"`
|
||||
SetsMetadata []map[string]interface{} `toml:"sets_metadata,omitempty"`
|
||||
UserMetadata map[string]interface{} `toml:"user_metadata,omitempty"`
|
||||
}
|
||||
|
||||
// OpenKmerSetGroup opens a finalized index directory in read-only mode.
|
||||
func OpenKmerSetGroup(directory string) (*KmerSetGroup, error) {
|
||||
metaPath := filepath.Join(directory, "metadata.toml")
|
||||
f, err := os.Open(metaPath)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("obikmer: open metadata: %w", err)
|
||||
}
|
||||
defer f.Close()
|
||||
|
||||
var meta diskMetadata
|
||||
if err := toml.NewDecoder(f).Decode(&meta); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: decode metadata: %w", err)
|
||||
}
|
||||
|
||||
ksg := &KmerSetGroup{
|
||||
path: directory,
|
||||
id: meta.ID,
|
||||
k: meta.K,
|
||||
m: meta.M,
|
||||
partitions: meta.Partitions,
|
||||
n: meta.Size,
|
||||
setsIDs: meta.SetsIDs,
|
||||
counts: meta.Counts,
|
||||
setsMetadata: meta.SetsMetadata,
|
||||
Metadata: meta.UserMetadata,
|
||||
}
|
||||
if ksg.Metadata == nil {
|
||||
ksg.Metadata = make(map[string]interface{})
|
||||
}
|
||||
if ksg.setsIDs == nil {
|
||||
ksg.setsIDs = make([]string, ksg.n)
|
||||
}
|
||||
if ksg.setsMetadata == nil {
|
||||
ksg.setsMetadata = make([]map[string]interface{}, ksg.n)
|
||||
for i := range ksg.setsMetadata {
|
||||
ksg.setsMetadata[i] = make(map[string]interface{})
|
||||
}
|
||||
}
|
||||
if ksg.counts == nil {
|
||||
// Compute counts by scanning partitions
|
||||
ksg.counts = make([]uint64, ksg.n)
|
||||
for s := 0; s < ksg.n; s++ {
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
path := ksg.partitionPath(s, p)
|
||||
r, err := NewKdiReader(path)
|
||||
if err != nil {
|
||||
continue
|
||||
}
|
||||
ksg.counts[s] += r.Count()
|
||||
r.Close()
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
return ksg, nil
|
||||
}
|
||||
|
||||
// NewFilteredKmerSetGroup creates a KmerSetGroup from pre-computed data.
|
||||
// Used by the filter command to construct a new group after filtering partitions.
|
||||
func NewFilteredKmerSetGroup(
|
||||
directory string, k, m, partitions, n int,
|
||||
setsIDs []string, counts []uint64,
|
||||
setsMetadata []map[string]interface{},
|
||||
) (*KmerSetGroup, error) {
|
||||
ksg := &KmerSetGroup{
|
||||
path: directory,
|
||||
k: k,
|
||||
m: m,
|
||||
partitions: partitions,
|
||||
n: n,
|
||||
setsIDs: setsIDs,
|
||||
counts: counts,
|
||||
setsMetadata: setsMetadata,
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
return ksg, nil
|
||||
}
|
||||
|
||||
// SaveMetadata writes the metadata.toml file. This is useful after
|
||||
// modifying attributes or IDs on an already-finalized index.
|
||||
func (ksg *KmerSetGroup) SaveMetadata() error {
|
||||
return ksg.saveMetadata()
|
||||
}
|
||||
|
||||
// saveMetadata writes the metadata.toml file (internal).
|
||||
func (ksg *KmerSetGroup) saveMetadata() error {
|
||||
meta := diskMetadata{
|
||||
ID: ksg.id,
|
||||
K: ksg.k,
|
||||
M: ksg.m,
|
||||
Partitions: ksg.partitions,
|
||||
Type: "KmerSetGroup",
|
||||
Size: ksg.n,
|
||||
SetsIDs: ksg.setsIDs,
|
||||
Counts: ksg.counts,
|
||||
SetsMetadata: ksg.setsMetadata,
|
||||
UserMetadata: ksg.Metadata,
|
||||
}
|
||||
|
||||
metaPath := filepath.Join(ksg.path, "metadata.toml")
|
||||
f, err := os.Create(metaPath)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
defer f.Close()
|
||||
|
||||
return toml.NewEncoder(f).Encode(meta)
|
||||
}
|
||||
|
||||
// partitionPath returns the file path for partition p of set s.
|
||||
func (ksg *KmerSetGroup) partitionPath(setIndex, partIndex int) string {
|
||||
return filepath.Join(ksg.path, fmt.Sprintf("set_%d", setIndex),
|
||||
fmt.Sprintf("part_%04d.kdi", partIndex))
|
||||
}
|
||||
|
||||
// Path returns the root directory of the index.
|
||||
func (ksg *KmerSetGroup) Path() string {
|
||||
return ksg.path
|
||||
}
|
||||
|
||||
// K returns the k-mer size.
|
||||
func (ksg *KmerSetGroup) K() int {
|
||||
return ksg.k
|
||||
}
|
||||
|
||||
// M returns the minimizer size.
|
||||
func (ksg *KmerSetGroup) M() int {
|
||||
return ksg.m
|
||||
}
|
||||
|
||||
// Partitions returns the number of partitions P.
|
||||
func (ksg *KmerSetGroup) Partitions() int {
|
||||
return ksg.partitions
|
||||
}
|
||||
|
||||
// Size returns the number of sets N.
|
||||
func (ksg *KmerSetGroup) Size() int {
|
||||
return ksg.n
|
||||
}
|
||||
|
||||
// Id returns the group identifier.
|
||||
func (ksg *KmerSetGroup) Id() string {
|
||||
return ksg.id
|
||||
}
|
||||
|
||||
// SetId sets the group identifier and persists the change.
|
||||
func (ksg *KmerSetGroup) SetId(id string) {
|
||||
ksg.id = id
|
||||
}
|
||||
|
||||
// Len returns the total number of k-mers.
|
||||
// Without argument: total across all sets.
|
||||
// With argument setIndex: count for that specific set.
|
||||
func (ksg *KmerSetGroup) Len(setIndex ...int) uint64 {
|
||||
if len(setIndex) == 0 {
|
||||
var total uint64
|
||||
for _, c := range ksg.counts {
|
||||
total += c
|
||||
}
|
||||
return total
|
||||
}
|
||||
idx := setIndex[0]
|
||||
if idx < 0 || idx >= ksg.n {
|
||||
return 0
|
||||
}
|
||||
return ksg.counts[idx]
|
||||
}
|
||||
|
||||
// Contains checks if a k-mer is present in the specified set.
|
||||
// Uses the .kdx sparse index (if available) for fast seeking within
|
||||
// each partition, then a short linear scan of at most `stride` entries.
|
||||
// All partitions are searched in parallel since the k-mer's partition
|
||||
// is not known without its minimizer context.
|
||||
func (ksg *KmerSetGroup) Contains(setIndex int, kmer uint64) bool {
|
||||
if setIndex < 0 || setIndex >= ksg.n {
|
||||
return false
|
||||
}
|
||||
|
||||
type result struct {
|
||||
found bool
|
||||
}
|
||||
ch := make(chan result, ksg.partitions)
|
||||
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
go func(part int) {
|
||||
r, err := NewKdiIndexedReader(ksg.partitionPath(setIndex, part))
|
||||
if err != nil {
|
||||
ch <- result{false}
|
||||
return
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
// Use index to jump near the target
|
||||
if err := r.SeekTo(kmer); err != nil {
|
||||
ch <- result{false}
|
||||
return
|
||||
}
|
||||
|
||||
// Linear scan from the seek position
|
||||
for {
|
||||
v, ok := r.Next()
|
||||
if !ok {
|
||||
ch <- result{false}
|
||||
return
|
||||
}
|
||||
if v == kmer {
|
||||
ch <- result{true}
|
||||
return
|
||||
}
|
||||
if v > kmer {
|
||||
ch <- result{false}
|
||||
return
|
||||
}
|
||||
}
|
||||
}(p)
|
||||
}
|
||||
|
||||
for i := 0; i < ksg.partitions; i++ {
|
||||
res := <-ch
|
||||
if res.found {
|
||||
// Drain remaining goroutines
|
||||
go func() {
|
||||
for j := i + 1; j < ksg.partitions; j++ {
|
||||
<-ch
|
||||
}
|
||||
}()
|
||||
return true
|
||||
}
|
||||
}
|
||||
return false
|
||||
}
|
||||
|
||||
// Iterator returns an iterator over all k-mers in the specified set,
|
||||
// in sorted order within each partition. Since partitions are independent,
|
||||
// to get a globally sorted stream, use iteratorSorted.
|
||||
func (ksg *KmerSetGroup) Iterator(setIndex int) iter.Seq[uint64] {
|
||||
return func(yield func(uint64) bool) {
|
||||
if setIndex < 0 || setIndex >= ksg.n {
|
||||
return
|
||||
}
|
||||
|
||||
// Open all partition readers and merge them
|
||||
readers := make([]*KdiReader, 0, ksg.partitions)
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
r, err := NewKdiReader(ksg.partitionPath(setIndex, p))
|
||||
if err != nil {
|
||||
continue
|
||||
}
|
||||
if r.Count() > 0 {
|
||||
readers = append(readers, r)
|
||||
} else {
|
||||
r.Close()
|
||||
}
|
||||
}
|
||||
|
||||
if len(readers) == 0 {
|
||||
return
|
||||
}
|
||||
|
||||
m := NewKWayMerge(readers)
|
||||
defer m.Close()
|
||||
|
||||
for {
|
||||
kmer, _, ok := m.Next()
|
||||
if !ok {
|
||||
return
|
||||
}
|
||||
if !yield(kmer) {
|
||||
return
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Attribute API (compatible with old API)
|
||||
// ==============================
|
||||
|
||||
// HasAttribute checks if a metadata key exists.
|
||||
func (ksg *KmerSetGroup) HasAttribute(key string) bool {
|
||||
_, ok := ksg.Metadata[key]
|
||||
return ok
|
||||
}
|
||||
|
||||
// GetAttribute returns the value of an attribute.
|
||||
func (ksg *KmerSetGroup) GetAttribute(key string) (interface{}, bool) {
|
||||
switch key {
|
||||
case "id":
|
||||
return ksg.Id(), true
|
||||
case "k":
|
||||
return ksg.K(), true
|
||||
default:
|
||||
value, ok := ksg.Metadata[key]
|
||||
return value, ok
|
||||
}
|
||||
}
|
||||
|
||||
// SetAttribute sets a metadata attribute.
|
||||
func (ksg *KmerSetGroup) SetAttribute(key string, value interface{}) {
|
||||
switch key {
|
||||
case "id":
|
||||
if id, ok := value.(string); ok {
|
||||
ksg.SetId(id)
|
||||
} else {
|
||||
panic(fmt.Sprintf("id must be a string, got %T", value))
|
||||
}
|
||||
case "k":
|
||||
panic("k is immutable")
|
||||
default:
|
||||
ksg.Metadata[key] = value
|
||||
}
|
||||
}
|
||||
|
||||
// DeleteAttribute removes a metadata attribute.
|
||||
func (ksg *KmerSetGroup) DeleteAttribute(key string) {
|
||||
delete(ksg.Metadata, key)
|
||||
}
|
||||
|
||||
// GetIntAttribute returns an attribute as int.
|
||||
func (ksg *KmerSetGroup) GetIntAttribute(key string) (int, bool) {
|
||||
v, ok := ksg.GetAttribute(key)
|
||||
if !ok {
|
||||
return 0, false
|
||||
}
|
||||
switch val := v.(type) {
|
||||
case int:
|
||||
return val, true
|
||||
case int64:
|
||||
return int(val), true
|
||||
case float64:
|
||||
return int(val), true
|
||||
}
|
||||
return 0, false
|
||||
}
|
||||
|
||||
// GetStringAttribute returns an attribute as string.
|
||||
func (ksg *KmerSetGroup) GetStringAttribute(key string) (string, bool) {
|
||||
v, ok := ksg.GetAttribute(key)
|
||||
if !ok {
|
||||
return "", false
|
||||
}
|
||||
if s, ok := v.(string); ok {
|
||||
return s, true
|
||||
}
|
||||
return fmt.Sprintf("%v", v), true
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Jaccard metrics (streaming, disk-based)
|
||||
// ==============================
|
||||
|
||||
// JaccardDistanceMatrix computes a pairwise Jaccard distance matrix
|
||||
// for all sets in the group. Operates partition by partition in streaming.
|
||||
func (ksg *KmerSetGroup) JaccardDistanceMatrix() *obidist.DistMatrix {
|
||||
n := ksg.n
|
||||
labels := make([]string, n)
|
||||
for i := 0; i < n; i++ {
|
||||
if i < len(ksg.setsIDs) && ksg.setsIDs[i] != "" {
|
||||
labels[i] = ksg.setsIDs[i]
|
||||
} else {
|
||||
labels[i] = fmt.Sprintf("set_%d", i)
|
||||
}
|
||||
}
|
||||
|
||||
dm := obidist.NewDistMatrixWithLabels(labels)
|
||||
|
||||
// Accumulate intersection and union counts
|
||||
intersections := make([][]uint64, n)
|
||||
unions := make([][]uint64, n)
|
||||
for i := 0; i < n; i++ {
|
||||
intersections[i] = make([]uint64, n)
|
||||
unions[i] = make([]uint64, n)
|
||||
}
|
||||
|
||||
// Process partition by partition
|
||||
var mu sync.Mutex
|
||||
var wg sync.WaitGroup
|
||||
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
wg.Add(1)
|
||||
go func(part int) {
|
||||
defer wg.Done()
|
||||
|
||||
// Open all set readers for this partition
|
||||
readers := make([]*KdiReader, n)
|
||||
for s := 0; s < n; s++ {
|
||||
r, err := NewKdiReader(ksg.partitionPath(s, part))
|
||||
if err != nil {
|
||||
continue
|
||||
}
|
||||
readers[s] = r
|
||||
}
|
||||
defer func() {
|
||||
for _, r := range readers {
|
||||
if r != nil {
|
||||
r.Close()
|
||||
}
|
||||
}
|
||||
}()
|
||||
|
||||
// Merge all N readers to count intersections and unions
|
||||
activeReaders := make([]*KdiReader, 0, n)
|
||||
activeIndices := make([]int, 0, n)
|
||||
for i, r := range readers {
|
||||
if r != nil && r.Count() > 0 {
|
||||
activeReaders = append(activeReaders, r)
|
||||
activeIndices = append(activeIndices, i)
|
||||
}
|
||||
}
|
||||
if len(activeReaders) == 0 {
|
||||
return
|
||||
}
|
||||
|
||||
merge := NewKWayMerge(activeReaders)
|
||||
// Don't close merge here since readers are managed above
|
||||
// We only want to iterate
|
||||
|
||||
// We need per-set presence tracking, so we use a custom merge
|
||||
// Rebuild with a direct approach
|
||||
merge.Close() // close the merge (which closes readers)
|
||||
|
||||
// Reopen readers for custom merge
|
||||
for s := 0; s < n; s++ {
|
||||
readers[s] = nil
|
||||
r, err := NewKdiReader(ksg.partitionPath(s, part))
|
||||
if err != nil {
|
||||
continue
|
||||
}
|
||||
if r.Count() > 0 {
|
||||
readers[s] = r
|
||||
} else {
|
||||
r.Close()
|
||||
}
|
||||
}
|
||||
|
||||
// Custom k-way merge that tracks which sets contain each kmer
|
||||
type entry struct {
|
||||
val uint64
|
||||
setIdx int
|
||||
}
|
||||
|
||||
// Use a simpler approach: read all values for this partition into memory
|
||||
// for each set, then do a merge
|
||||
setKmers := make([][]uint64, n)
|
||||
for s := 0; s < n; s++ {
|
||||
if readers[s] == nil {
|
||||
continue
|
||||
}
|
||||
kmers := make([]uint64, 0, readers[s].Count())
|
||||
for {
|
||||
v, ok := readers[s].Next()
|
||||
if !ok {
|
||||
break
|
||||
}
|
||||
kmers = append(kmers, v)
|
||||
}
|
||||
setKmers[s] = kmers
|
||||
readers[s].Close()
|
||||
readers[s] = nil
|
||||
}
|
||||
|
||||
// Count pairwise intersections using sorted merge
|
||||
// For each pair (i,j), count kmers present in both
|
||||
localInter := make([][]uint64, n)
|
||||
localUnion := make([][]uint64, n)
|
||||
for i := 0; i < n; i++ {
|
||||
localInter[i] = make([]uint64, n)
|
||||
localUnion[i] = make([]uint64, n)
|
||||
}
|
||||
|
||||
for i := 0; i < n; i++ {
|
||||
localUnion[i][i] = uint64(len(setKmers[i]))
|
||||
for j := i + 1; j < n; j++ {
|
||||
a, b := setKmers[i], setKmers[j]
|
||||
var inter uint64
|
||||
ai, bi := 0, 0
|
||||
for ai < len(a) && bi < len(b) {
|
||||
if a[ai] == b[bi] {
|
||||
inter++
|
||||
ai++
|
||||
bi++
|
||||
} else if a[ai] < b[bi] {
|
||||
ai++
|
||||
} else {
|
||||
bi++
|
||||
}
|
||||
}
|
||||
localInter[i][j] = inter
|
||||
localUnion[i][j] = uint64(len(a)) + uint64(len(b)) - inter
|
||||
}
|
||||
}
|
||||
|
||||
mu.Lock()
|
||||
for i := 0; i < n; i++ {
|
||||
for j := i; j < n; j++ {
|
||||
intersections[i][j] += localInter[i][j]
|
||||
unions[i][j] += localUnion[i][j]
|
||||
}
|
||||
}
|
||||
mu.Unlock()
|
||||
}(p)
|
||||
}
|
||||
wg.Wait()
|
||||
|
||||
// Compute distances from accumulated counts
|
||||
for i := 0; i < n-1; i++ {
|
||||
for j := i + 1; j < n; j++ {
|
||||
u := unions[i][j]
|
||||
if u == 0 {
|
||||
dm.Set(i, j, 1.0)
|
||||
} else {
|
||||
dm.Set(i, j, 1.0-float64(intersections[i][j])/float64(u))
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
return dm
|
||||
}
|
||||
|
||||
// JaccardSimilarityMatrix computes a pairwise Jaccard similarity matrix.
|
||||
func (ksg *KmerSetGroup) JaccardSimilarityMatrix() *obidist.DistMatrix {
|
||||
n := ksg.n
|
||||
labels := make([]string, n)
|
||||
for i := 0; i < n; i++ {
|
||||
if i < len(ksg.setsIDs) && ksg.setsIDs[i] != "" {
|
||||
labels[i] = ksg.setsIDs[i]
|
||||
} else {
|
||||
labels[i] = fmt.Sprintf("set_%d", i)
|
||||
}
|
||||
}
|
||||
|
||||
// Reuse distance computation
|
||||
dm := ksg.JaccardDistanceMatrix()
|
||||
sm := obidist.NewSimilarityMatrixWithLabels(labels)
|
||||
|
||||
for i := 0; i < n-1; i++ {
|
||||
for j := i + 1; j < n; j++ {
|
||||
sm.Set(i, j, 1.0-dm.Get(i, j))
|
||||
}
|
||||
}
|
||||
|
||||
return sm
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Set ID accessors
|
||||
// ==============================
|
||||
|
||||
// SetsIDs returns a copy of the per-set string identifiers.
|
||||
func (ksg *KmerSetGroup) SetsIDs() []string {
|
||||
out := make([]string, len(ksg.setsIDs))
|
||||
copy(out, ksg.setsIDs)
|
||||
return out
|
||||
}
|
||||
|
||||
// SetIDOf returns the string ID of the set at the given index.
|
||||
// Returns "" if index is out of range.
|
||||
func (ksg *KmerSetGroup) SetIDOf(index int) string {
|
||||
if index < 0 || index >= ksg.n {
|
||||
return ""
|
||||
}
|
||||
return ksg.setsIDs[index]
|
||||
}
|
||||
|
||||
// SetSetID sets the string ID of the set at the given index.
|
||||
func (ksg *KmerSetGroup) SetSetID(index int, id string) {
|
||||
if index >= 0 && index < ksg.n {
|
||||
ksg.setsIDs[index] = id
|
||||
}
|
||||
}
|
||||
|
||||
// IndexOfSetID returns the numeric index for a set ID, or -1 if not found.
|
||||
func (ksg *KmerSetGroup) IndexOfSetID(id string) int {
|
||||
for i, sid := range ksg.setsIDs {
|
||||
if sid == id {
|
||||
return i
|
||||
}
|
||||
}
|
||||
return -1
|
||||
}
|
||||
|
||||
// MatchSetIDs resolves glob patterns against set IDs and returns matching
|
||||
// indices sorted in ascending order. Uses path.Match for pattern matching
|
||||
// (supports *, ?, [...] patterns). Returns error if a pattern is malformed.
|
||||
func (ksg *KmerSetGroup) MatchSetIDs(patterns []string) ([]int, error) {
|
||||
seen := make(map[int]bool)
|
||||
for _, pattern := range patterns {
|
||||
for i, sid := range ksg.setsIDs {
|
||||
matched, err := path.Match(pattern, sid)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("obikmer: invalid glob pattern %q: %w", pattern, err)
|
||||
}
|
||||
if matched {
|
||||
seen[i] = true
|
||||
}
|
||||
}
|
||||
}
|
||||
result := make([]int, 0, len(seen))
|
||||
for idx := range seen {
|
||||
result = append(result, idx)
|
||||
}
|
||||
sort.Ints(result)
|
||||
return result, nil
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Per-set metadata accessors
|
||||
// ==============================
|
||||
|
||||
// GetSetMetadata returns the value of a per-set metadata key.
|
||||
func (ksg *KmerSetGroup) GetSetMetadata(setIndex int, key string) (interface{}, bool) {
|
||||
if setIndex < 0 || setIndex >= ksg.n {
|
||||
return nil, false
|
||||
}
|
||||
v, ok := ksg.setsMetadata[setIndex][key]
|
||||
return v, ok
|
||||
}
|
||||
|
||||
// SetSetMetadata sets a per-set metadata attribute.
|
||||
func (ksg *KmerSetGroup) SetSetMetadata(setIndex int, key string, value interface{}) {
|
||||
if setIndex < 0 || setIndex >= ksg.n {
|
||||
return
|
||||
}
|
||||
if ksg.setsMetadata[setIndex] == nil {
|
||||
ksg.setsMetadata[setIndex] = make(map[string]interface{})
|
||||
}
|
||||
ksg.setsMetadata[setIndex][key] = value
|
||||
}
|
||||
|
||||
// DeleteSetMetadata removes a per-set metadata attribute.
|
||||
func (ksg *KmerSetGroup) DeleteSetMetadata(setIndex int, key string) {
|
||||
if setIndex < 0 || setIndex >= ksg.n {
|
||||
return
|
||||
}
|
||||
delete(ksg.setsMetadata[setIndex], key)
|
||||
}
|
||||
|
||||
// AllSetMetadata returns a copy of all metadata for a given set.
|
||||
func (ksg *KmerSetGroup) AllSetMetadata(setIndex int) map[string]interface{} {
|
||||
if setIndex < 0 || setIndex >= ksg.n {
|
||||
return nil
|
||||
}
|
||||
out := make(map[string]interface{}, len(ksg.setsMetadata[setIndex]))
|
||||
for k, v := range ksg.setsMetadata[setIndex] {
|
||||
out[k] = v
|
||||
}
|
||||
return out
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Exported partition path and compatibility
|
||||
// ==============================
|
||||
|
||||
// PartitionPath returns the file path for partition partIndex of set setIndex.
|
||||
func (ksg *KmerSetGroup) PartitionPath(setIndex, partIndex int) string {
|
||||
return ksg.partitionPath(setIndex, partIndex)
|
||||
}
|
||||
|
||||
// SpectrumPath returns the path to the spectrum.bin file for the given set.
|
||||
func (ksg *KmerSetGroup) SpectrumPath(setIndex int) string {
|
||||
return filepath.Join(ksg.path, fmt.Sprintf("set_%d", setIndex), "spectrum.bin")
|
||||
}
|
||||
|
||||
// Spectrum reads the k-mer frequency spectrum for the given set.
|
||||
// Returns nil, nil if no spectrum file exists.
|
||||
func (ksg *KmerSetGroup) Spectrum(setIndex int) (*KmerSpectrum, error) {
|
||||
path := ksg.SpectrumPath(setIndex)
|
||||
if _, err := os.Stat(path); os.IsNotExist(err) {
|
||||
return nil, nil
|
||||
}
|
||||
return ReadSpectrum(path)
|
||||
}
|
||||
|
||||
// IsCompatibleWith returns true if the other group has the same k, m, and partitions.
|
||||
func (ksg *KmerSetGroup) IsCompatibleWith(other *KmerSetGroup) bool {
|
||||
return ksg.k == other.k && ksg.m == other.m && ksg.partitions == other.partitions
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Set management operations
|
||||
// ==============================
|
||||
|
||||
// NewEmptyCompatible creates an empty KmerSetGroup at destDir with the same
|
||||
// k, m, and partitions as this group. The destination must not already exist.
|
||||
func (ksg *KmerSetGroup) NewEmptyCompatible(destDir string) (*KmerSetGroup, error) {
|
||||
if err := os.MkdirAll(destDir, 0755); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: create directory: %w", err)
|
||||
}
|
||||
|
||||
dest := &KmerSetGroup{
|
||||
path: destDir,
|
||||
k: ksg.k,
|
||||
m: ksg.m,
|
||||
partitions: ksg.partitions,
|
||||
n: 0,
|
||||
setsIDs: []string{},
|
||||
counts: []uint64{},
|
||||
setsMetadata: []map[string]interface{}{},
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
|
||||
if err := dest.saveMetadata(); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: write metadata: %w", err)
|
||||
}
|
||||
|
||||
return dest, nil
|
||||
}
|
||||
|
||||
// RemoveSetByID removes the set with the given ID from the group.
|
||||
// It deletes the set directory, renumbers all subsequent sets, and
|
||||
// updates the metadata on disk.
|
||||
func (ksg *KmerSetGroup) RemoveSetByID(id string) error {
|
||||
idx := ksg.IndexOfSetID(id)
|
||||
if idx < 0 {
|
||||
return fmt.Errorf("obikmer: set ID %q not found", id)
|
||||
}
|
||||
|
||||
// Delete the set directory
|
||||
setDir := filepath.Join(ksg.path, fmt.Sprintf("set_%d", idx))
|
||||
if err := os.RemoveAll(setDir); err != nil {
|
||||
return fmt.Errorf("obikmer: remove set directory: %w", err)
|
||||
}
|
||||
|
||||
// Renumber subsequent sets
|
||||
for i := idx + 1; i < ksg.n; i++ {
|
||||
oldDir := filepath.Join(ksg.path, fmt.Sprintf("set_%d", i))
|
||||
newDir := filepath.Join(ksg.path, fmt.Sprintf("set_%d", i-1))
|
||||
if err := os.Rename(oldDir, newDir); err != nil {
|
||||
return fmt.Errorf("obikmer: rename set_%d to set_%d: %w", i, i-1, err)
|
||||
}
|
||||
}
|
||||
|
||||
// Update slices
|
||||
ksg.setsIDs = append(ksg.setsIDs[:idx], ksg.setsIDs[idx+1:]...)
|
||||
ksg.counts = append(ksg.counts[:idx], ksg.counts[idx+1:]...)
|
||||
ksg.setsMetadata = append(ksg.setsMetadata[:idx], ksg.setsMetadata[idx+1:]...)
|
||||
ksg.n--
|
||||
|
||||
return ksg.saveMetadata()
|
||||
}
|
||||
|
||||
// CopySetsByIDTo copies sets identified by their IDs into a KmerSetGroup
|
||||
// at destDir. If destDir does not exist, a new compatible empty group is
|
||||
// created. If it exists, compatibility (k, m, partitions) is checked.
|
||||
// If a set ID already exists in the destination, an error is returned
|
||||
// unless force is true (in which case the existing set is replaced).
|
||||
// Per-set metadata travels with the set.
|
||||
func (ksg *KmerSetGroup) CopySetsByIDTo(ids []string, destDir string, force bool) (*KmerSetGroup, error) {
|
||||
// Resolve source IDs to indices
|
||||
srcIndices := make([]int, len(ids))
|
||||
for i, id := range ids {
|
||||
idx := ksg.IndexOfSetID(id)
|
||||
if idx < 0 {
|
||||
return nil, fmt.Errorf("obikmer: source set ID %q not found", id)
|
||||
}
|
||||
srcIndices[i] = idx
|
||||
}
|
||||
|
||||
// Open or create destination
|
||||
var dest *KmerSetGroup
|
||||
metaPath := filepath.Join(destDir, "metadata.toml")
|
||||
if _, err := os.Stat(metaPath); err == nil {
|
||||
// Destination exists
|
||||
dest, err = OpenKmerSetGroup(destDir)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("obikmer: open destination: %w", err)
|
||||
}
|
||||
if !ksg.IsCompatibleWith(dest) {
|
||||
return nil, fmt.Errorf("obikmer: incompatible groups: source (k=%d, m=%d, P=%d) vs dest (k=%d, m=%d, P=%d)",
|
||||
ksg.k, ksg.m, ksg.partitions, dest.k, dest.m, dest.partitions)
|
||||
}
|
||||
} else {
|
||||
// Create new destination
|
||||
var err error
|
||||
dest, err = ksg.NewEmptyCompatible(destDir)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
}
|
||||
|
||||
// Copy each set
|
||||
for i, srcIdx := range srcIndices {
|
||||
srcID := ids[i]
|
||||
|
||||
// Check for ID conflict in destination
|
||||
existingIdx := dest.IndexOfSetID(srcID)
|
||||
if existingIdx >= 0 {
|
||||
if !force {
|
||||
return nil, fmt.Errorf("obikmer: set ID %q already exists in destination (use force to replace)", srcID)
|
||||
}
|
||||
// Force: remove existing set in destination
|
||||
if err := dest.RemoveSetByID(srcID); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: remove existing set %q in destination: %w", srcID, err)
|
||||
}
|
||||
}
|
||||
|
||||
// Destination set index = current dest size
|
||||
destIdx := dest.n
|
||||
|
||||
// Create destination set directory
|
||||
destSetDir := filepath.Join(destDir, fmt.Sprintf("set_%d", destIdx))
|
||||
if err := os.MkdirAll(destSetDir, 0755); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: create dest set dir: %w", err)
|
||||
}
|
||||
|
||||
// Copy all partition files and their .kdx indices
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
srcPath := ksg.partitionPath(srcIdx, p)
|
||||
destPath := dest.partitionPath(destIdx, p)
|
||||
if err := copyFile(srcPath, destPath); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: copy partition %d of set %q: %w", p, srcID, err)
|
||||
}
|
||||
// Copy .kdx index if it exists
|
||||
srcKdx := KdxPathForKdi(srcPath)
|
||||
if _, err := os.Stat(srcKdx); err == nil {
|
||||
destKdx := KdxPathForKdi(destPath)
|
||||
if err := copyFile(srcKdx, destKdx); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: copy index %d of set %q: %w", p, srcID, err)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// Copy spectrum.bin if it exists
|
||||
srcSpecPath := ksg.SpectrumPath(srcIdx)
|
||||
if _, err := os.Stat(srcSpecPath); err == nil {
|
||||
destSpecPath := filepath.Join(destSetDir, "spectrum.bin")
|
||||
if err := copyFile(srcSpecPath, destSpecPath); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: copy spectrum of set %q: %w", srcID, err)
|
||||
}
|
||||
}
|
||||
|
||||
// Update destination metadata
|
||||
dest.setsIDs = append(dest.setsIDs, srcID)
|
||||
dest.counts = append(dest.counts, ksg.counts[srcIdx])
|
||||
|
||||
// Copy per-set metadata
|
||||
srcMeta := ksg.AllSetMetadata(srcIdx)
|
||||
if srcMeta == nil {
|
||||
srcMeta = make(map[string]interface{})
|
||||
}
|
||||
dest.setsMetadata = append(dest.setsMetadata, srcMeta)
|
||||
dest.n++
|
||||
}
|
||||
|
||||
if err := dest.saveMetadata(); err != nil {
|
||||
return nil, fmt.Errorf("obikmer: save destination metadata: %w", err)
|
||||
}
|
||||
|
||||
return dest, nil
|
||||
}
|
||||
|
||||
// copyFile copies a file from src to dst.
|
||||
func copyFile(src, dst string) error {
|
||||
in, err := os.Open(src)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
defer in.Close()
|
||||
|
||||
out, err := os.Create(dst)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
defer out.Close()
|
||||
|
||||
if _, err := io.Copy(out, in); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
return out.Close()
|
||||
}
|
||||
@@ -0,0 +1,568 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"os"
|
||||
"path/filepath"
|
||||
"runtime"
|
||||
"sync"
|
||||
)
|
||||
|
||||
// Union computes the union of all sets in the group, producing a new
|
||||
// singleton KmerSetGroup on disk. A k-mer is in the result if it
|
||||
// appears in any set.
|
||||
func (ksg *KmerSetGroup) Union(outputDir string) (*KmerSetGroup, error) {
|
||||
return ksg.quorumOp(outputDir, 1, ksg.n)
|
||||
}
|
||||
|
||||
// Intersect computes the intersection of all sets, producing a new
|
||||
// singleton KmerSetGroup on disk. A k-mer is in the result if it
|
||||
// appears in every set.
|
||||
func (ksg *KmerSetGroup) Intersect(outputDir string) (*KmerSetGroup, error) {
|
||||
return ksg.quorumOp(outputDir, ksg.n, ksg.n)
|
||||
}
|
||||
|
||||
// Difference computes set_0 minus the union of all other sets.
|
||||
func (ksg *KmerSetGroup) Difference(outputDir string) (*KmerSetGroup, error) {
|
||||
return ksg.differenceOp(outputDir)
|
||||
}
|
||||
|
||||
// QuorumAtLeast returns k-mers present in at least q sets.
|
||||
func (ksg *KmerSetGroup) QuorumAtLeast(q int, outputDir string) (*KmerSetGroup, error) {
|
||||
return ksg.quorumOp(outputDir, q, ksg.n)
|
||||
}
|
||||
|
||||
// QuorumExactly returns k-mers present in exactly q sets.
|
||||
func (ksg *KmerSetGroup) QuorumExactly(q int, outputDir string) (*KmerSetGroup, error) {
|
||||
return ksg.quorumOp(outputDir, q, q)
|
||||
}
|
||||
|
||||
// QuorumAtMost returns k-mers present in at most q sets.
|
||||
func (ksg *KmerSetGroup) QuorumAtMost(q int, outputDir string) (*KmerSetGroup, error) {
|
||||
return ksg.quorumOp(outputDir, 1, q)
|
||||
}
|
||||
|
||||
// UnionWith merges this group with another, producing a new KmerSetGroup
|
||||
// whose set_i is the union of this.set_i and other.set_i.
|
||||
// Both groups must have the same k, m, P, and N.
|
||||
func (ksg *KmerSetGroup) UnionWith(other *KmerSetGroup, outputDir string) (*KmerSetGroup, error) {
|
||||
if err := ksg.checkCompatible(other); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
return ksg.pairwiseOp(other, outputDir, mergeUnion)
|
||||
}
|
||||
|
||||
// IntersectWith merges this group with another, producing a new KmerSetGroup
|
||||
// whose set_i is the intersection of this.set_i and other.set_i.
|
||||
func (ksg *KmerSetGroup) IntersectWith(other *KmerSetGroup, outputDir string) (*KmerSetGroup, error) {
|
||||
if err := ksg.checkCompatible(other); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
return ksg.pairwiseOp(other, outputDir, mergeIntersect)
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Internal implementation
|
||||
// ==============================
|
||||
|
||||
func (ksg *KmerSetGroup) checkCompatible(other *KmerSetGroup) error {
|
||||
if ksg.k != other.k {
|
||||
return fmt.Errorf("obikmer: incompatible k: %d vs %d", ksg.k, other.k)
|
||||
}
|
||||
if ksg.m != other.m {
|
||||
return fmt.Errorf("obikmer: incompatible m: %d vs %d", ksg.m, other.m)
|
||||
}
|
||||
if ksg.partitions != other.partitions {
|
||||
return fmt.Errorf("obikmer: incompatible partitions: %d vs %d", ksg.partitions, other.partitions)
|
||||
}
|
||||
if ksg.n != other.n {
|
||||
return fmt.Errorf("obikmer: incompatible size: %d vs %d", ksg.n, other.n)
|
||||
}
|
||||
return nil
|
||||
}
|
||||
|
||||
// quorumOp processes all N sets partition by partition.
|
||||
// For each partition, it opens N KdiReaders and does a k-way merge.
|
||||
// A kmer is written to the result if minQ <= count <= maxQ.
|
||||
func (ksg *KmerSetGroup) quorumOp(outputDir string, minQ, maxQ int) (*KmerSetGroup, error) {
|
||||
if minQ < 1 {
|
||||
minQ = 1
|
||||
}
|
||||
if maxQ > ksg.n {
|
||||
maxQ = ksg.n
|
||||
}
|
||||
|
||||
// Create output structure
|
||||
setDir := filepath.Join(outputDir, "set_0")
|
||||
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
counts := make([]uint64, ksg.partitions)
|
||||
|
||||
nWorkers := runtime.NumCPU()
|
||||
if nWorkers > ksg.partitions {
|
||||
nWorkers = ksg.partitions
|
||||
}
|
||||
|
||||
jobs := make(chan int, ksg.partitions)
|
||||
var wg sync.WaitGroup
|
||||
var errMu sync.Mutex
|
||||
var firstErr error
|
||||
|
||||
for w := 0; w < nWorkers; w++ {
|
||||
wg.Add(1)
|
||||
go func() {
|
||||
defer wg.Done()
|
||||
for p := range jobs {
|
||||
c, err := ksg.quorumPartition(p, setDir, minQ, maxQ)
|
||||
if err != nil {
|
||||
errMu.Lock()
|
||||
if firstErr == nil {
|
||||
firstErr = err
|
||||
}
|
||||
errMu.Unlock()
|
||||
return
|
||||
}
|
||||
counts[p] = c
|
||||
}
|
||||
}()
|
||||
}
|
||||
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
jobs <- p
|
||||
}
|
||||
close(jobs)
|
||||
wg.Wait()
|
||||
|
||||
if firstErr != nil {
|
||||
return nil, firstErr
|
||||
}
|
||||
|
||||
var totalCount uint64
|
||||
for _, c := range counts {
|
||||
totalCount += c
|
||||
}
|
||||
|
||||
result := &KmerSetGroup{
|
||||
path: outputDir,
|
||||
k: ksg.k,
|
||||
m: ksg.m,
|
||||
partitions: ksg.partitions,
|
||||
n: 1,
|
||||
setsIDs: []string{""},
|
||||
counts: []uint64{totalCount},
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
|
||||
if err := result.saveMetadata(); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
return result, nil
|
||||
}
|
||||
|
||||
// quorumPartition processes a single partition for quorum filtering.
|
||||
func (ksg *KmerSetGroup) quorumPartition(partIdx int, outSetDir string, minQ, maxQ int) (uint64, error) {
|
||||
// Open readers for all sets
|
||||
readers := make([]*KdiReader, 0, ksg.n)
|
||||
for s := 0; s < ksg.n; s++ {
|
||||
r, err := NewKdiReader(ksg.partitionPath(s, partIdx))
|
||||
if err != nil {
|
||||
// Close already-opened readers
|
||||
for _, rr := range readers {
|
||||
rr.Close()
|
||||
}
|
||||
return 0, err
|
||||
}
|
||||
if r.Count() > 0 {
|
||||
readers = append(readers, r)
|
||||
} else {
|
||||
r.Close()
|
||||
}
|
||||
}
|
||||
|
||||
outPath := filepath.Join(outSetDir, fmt.Sprintf("part_%04d.kdi", partIdx))
|
||||
|
||||
if len(readers) == 0 {
|
||||
// Write empty KDI
|
||||
w, err := NewKdiWriter(outPath)
|
||||
if err != nil {
|
||||
return 0, err
|
||||
}
|
||||
return 0, w.Close()
|
||||
}
|
||||
|
||||
merge := NewKWayMerge(readers)
|
||||
// merge.Close() will close readers
|
||||
|
||||
w, err := NewKdiWriter(outPath)
|
||||
if err != nil {
|
||||
merge.Close()
|
||||
return 0, err
|
||||
}
|
||||
|
||||
for {
|
||||
kmer, count, ok := merge.Next()
|
||||
if !ok {
|
||||
break
|
||||
}
|
||||
if count >= minQ && count <= maxQ {
|
||||
if err := w.Write(kmer); err != nil {
|
||||
merge.Close()
|
||||
w.Close()
|
||||
return 0, err
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
merge.Close()
|
||||
cnt := w.Count()
|
||||
return cnt, w.Close()
|
||||
}
|
||||
|
||||
// differenceOp computes set_0 minus the union of all other sets.
|
||||
func (ksg *KmerSetGroup) differenceOp(outputDir string) (*KmerSetGroup, error) {
|
||||
if ksg.n < 1 {
|
||||
return nil, fmt.Errorf("obikmer: difference requires at least 1 set")
|
||||
}
|
||||
|
||||
setDir := filepath.Join(outputDir, "set_0")
|
||||
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
counts := make([]uint64, ksg.partitions)
|
||||
|
||||
nWorkers := runtime.NumCPU()
|
||||
if nWorkers > ksg.partitions {
|
||||
nWorkers = ksg.partitions
|
||||
}
|
||||
|
||||
jobs := make(chan int, ksg.partitions)
|
||||
var wg sync.WaitGroup
|
||||
var errMu sync.Mutex
|
||||
var firstErr error
|
||||
|
||||
for w := 0; w < nWorkers; w++ {
|
||||
wg.Add(1)
|
||||
go func() {
|
||||
defer wg.Done()
|
||||
for p := range jobs {
|
||||
c, err := ksg.differencePartition(p, setDir)
|
||||
if err != nil {
|
||||
errMu.Lock()
|
||||
if firstErr == nil {
|
||||
firstErr = err
|
||||
}
|
||||
errMu.Unlock()
|
||||
return
|
||||
}
|
||||
counts[p] = c
|
||||
}
|
||||
}()
|
||||
}
|
||||
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
jobs <- p
|
||||
}
|
||||
close(jobs)
|
||||
wg.Wait()
|
||||
|
||||
if firstErr != nil {
|
||||
return nil, firstErr
|
||||
}
|
||||
|
||||
var totalCount uint64
|
||||
for _, c := range counts {
|
||||
totalCount += c
|
||||
}
|
||||
|
||||
result := &KmerSetGroup{
|
||||
path: outputDir,
|
||||
k: ksg.k,
|
||||
m: ksg.m,
|
||||
partitions: ksg.partitions,
|
||||
n: 1,
|
||||
setsIDs: []string{""},
|
||||
counts: []uint64{totalCount},
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
|
||||
if err := result.saveMetadata(); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
return result, nil
|
||||
}
|
||||
|
||||
// differencePartition computes set_0 - union(set_1..set_{n-1}) for one partition.
|
||||
func (ksg *KmerSetGroup) differencePartition(partIdx int, outSetDir string) (uint64, error) {
|
||||
outPath := filepath.Join(outSetDir, fmt.Sprintf("part_%04d.kdi", partIdx))
|
||||
|
||||
// Open set_0 reader
|
||||
r0, err := NewKdiReader(ksg.partitionPath(0, partIdx))
|
||||
if err != nil {
|
||||
return 0, err
|
||||
}
|
||||
|
||||
if r0.Count() == 0 {
|
||||
r0.Close()
|
||||
w, err := NewKdiWriter(outPath)
|
||||
if err != nil {
|
||||
return 0, err
|
||||
}
|
||||
return 0, w.Close()
|
||||
}
|
||||
|
||||
// Open readers for the other sets and merge them
|
||||
var otherReaders []*KdiReader
|
||||
for s := 1; s < ksg.n; s++ {
|
||||
r, err := NewKdiReader(ksg.partitionPath(s, partIdx))
|
||||
if err != nil {
|
||||
r0.Close()
|
||||
for _, rr := range otherReaders {
|
||||
rr.Close()
|
||||
}
|
||||
return 0, err
|
||||
}
|
||||
if r.Count() > 0 {
|
||||
otherReaders = append(otherReaders, r)
|
||||
} else {
|
||||
r.Close()
|
||||
}
|
||||
}
|
||||
|
||||
w, err := NewKdiWriter(outPath)
|
||||
if err != nil {
|
||||
r0.Close()
|
||||
for _, rr := range otherReaders {
|
||||
rr.Close()
|
||||
}
|
||||
return 0, err
|
||||
}
|
||||
|
||||
if len(otherReaders) == 0 {
|
||||
// No other sets — copy set_0
|
||||
for {
|
||||
v, ok := r0.Next()
|
||||
if !ok {
|
||||
break
|
||||
}
|
||||
if err := w.Write(v); err != nil {
|
||||
r0.Close()
|
||||
w.Close()
|
||||
return 0, err
|
||||
}
|
||||
}
|
||||
r0.Close()
|
||||
cnt := w.Count()
|
||||
return cnt, w.Close()
|
||||
}
|
||||
|
||||
// Merge other sets to get the "subtraction" stream
|
||||
otherMerge := NewKWayMerge(otherReaders)
|
||||
|
||||
// Streaming difference: advance both streams
|
||||
v0, ok0 := r0.Next()
|
||||
vo, _, oko := otherMerge.Next()
|
||||
|
||||
for ok0 {
|
||||
if !oko || v0 < vo {
|
||||
// v0 not in others → emit
|
||||
if err := w.Write(v0); err != nil {
|
||||
r0.Close()
|
||||
otherMerge.Close()
|
||||
w.Close()
|
||||
return 0, err
|
||||
}
|
||||
v0, ok0 = r0.Next()
|
||||
} else if v0 == vo {
|
||||
// v0 in others → skip
|
||||
v0, ok0 = r0.Next()
|
||||
vo, _, oko = otherMerge.Next()
|
||||
} else {
|
||||
// vo < v0 → advance others
|
||||
vo, _, oko = otherMerge.Next()
|
||||
}
|
||||
}
|
||||
|
||||
r0.Close()
|
||||
otherMerge.Close()
|
||||
cnt := w.Count()
|
||||
return cnt, w.Close()
|
||||
}
|
||||
|
||||
// mergeMode defines how to combine two values during pairwise operations.
|
||||
type mergeMode int
|
||||
|
||||
const (
|
||||
mergeUnion mergeMode = iota // emit if in either
|
||||
mergeIntersect // emit if in both
|
||||
)
|
||||
|
||||
// pairwiseOp applies a merge operation between corresponding sets of two groups.
|
||||
func (ksg *KmerSetGroup) pairwiseOp(other *KmerSetGroup, outputDir string, mode mergeMode) (*KmerSetGroup, error) {
|
||||
for s := 0; s < ksg.n; s++ {
|
||||
setDir := filepath.Join(outputDir, fmt.Sprintf("set_%d", s))
|
||||
if err := os.MkdirAll(setDir, 0755); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
}
|
||||
|
||||
counts := make([][]uint64, ksg.n)
|
||||
for s := 0; s < ksg.n; s++ {
|
||||
counts[s] = make([]uint64, ksg.partitions)
|
||||
}
|
||||
|
||||
nWorkers := runtime.NumCPU()
|
||||
if nWorkers > ksg.partitions {
|
||||
nWorkers = ksg.partitions
|
||||
}
|
||||
|
||||
type job struct {
|
||||
setIdx int
|
||||
partIdx int
|
||||
}
|
||||
jobs := make(chan job, ksg.n*ksg.partitions)
|
||||
var wg sync.WaitGroup
|
||||
var errMu sync.Mutex
|
||||
var firstErr error
|
||||
|
||||
for w := 0; w < nWorkers; w++ {
|
||||
wg.Add(1)
|
||||
go func() {
|
||||
defer wg.Done()
|
||||
for j := range jobs {
|
||||
c, err := pairwiseMergePartition(
|
||||
ksg.partitionPath(j.setIdx, j.partIdx),
|
||||
other.partitionPath(j.setIdx, j.partIdx),
|
||||
filepath.Join(outputDir, fmt.Sprintf("set_%d", j.setIdx),
|
||||
fmt.Sprintf("part_%04d.kdi", j.partIdx)),
|
||||
mode,
|
||||
)
|
||||
if err != nil {
|
||||
errMu.Lock()
|
||||
if firstErr == nil {
|
||||
firstErr = err
|
||||
}
|
||||
errMu.Unlock()
|
||||
return
|
||||
}
|
||||
counts[j.setIdx][j.partIdx] = c
|
||||
}
|
||||
}()
|
||||
}
|
||||
|
||||
for s := 0; s < ksg.n; s++ {
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
jobs <- job{s, p}
|
||||
}
|
||||
}
|
||||
close(jobs)
|
||||
wg.Wait()
|
||||
|
||||
if firstErr != nil {
|
||||
return nil, firstErr
|
||||
}
|
||||
|
||||
totalCounts := make([]uint64, ksg.n)
|
||||
setsIDs := make([]string, ksg.n)
|
||||
for s := 0; s < ksg.n; s++ {
|
||||
for p := 0; p < ksg.partitions; p++ {
|
||||
totalCounts[s] += counts[s][p]
|
||||
}
|
||||
}
|
||||
|
||||
result := &KmerSetGroup{
|
||||
path: outputDir,
|
||||
k: ksg.k,
|
||||
m: ksg.m,
|
||||
partitions: ksg.partitions,
|
||||
n: ksg.n,
|
||||
setsIDs: setsIDs,
|
||||
counts: totalCounts,
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
|
||||
if err := result.saveMetadata(); err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
return result, nil
|
||||
}
|
||||
|
||||
// pairwiseMergePartition merges two KDI files (sorted streams) with the given mode.
|
||||
func pairwiseMergePartition(pathA, pathB, outPath string, mode mergeMode) (uint64, error) {
|
||||
rA, err := NewKdiReader(pathA)
|
||||
if err != nil {
|
||||
return 0, err
|
||||
}
|
||||
rB, err := NewKdiReader(pathB)
|
||||
if err != nil {
|
||||
rA.Close()
|
||||
return 0, err
|
||||
}
|
||||
|
||||
w, err := NewKdiWriter(outPath)
|
||||
if err != nil {
|
||||
rA.Close()
|
||||
rB.Close()
|
||||
return 0, err
|
||||
}
|
||||
|
||||
cnt, mergeErr := doPairwiseMerge(rA, rB, w, mode)
|
||||
rA.Close()
|
||||
rB.Close()
|
||||
closeErr := w.Close()
|
||||
if mergeErr != nil {
|
||||
return 0, mergeErr
|
||||
}
|
||||
return cnt, closeErr
|
||||
}
|
||||
|
||||
func doPairwiseMerge(rA, rB *KdiReader, w *KdiWriter, mode mergeMode) (uint64, error) {
|
||||
vA, okA := rA.Next()
|
||||
vB, okB := rB.Next()
|
||||
|
||||
for okA && okB {
|
||||
if vA == vB {
|
||||
if err := w.Write(vA); err != nil {
|
||||
return 0, err
|
||||
}
|
||||
vA, okA = rA.Next()
|
||||
vB, okB = rB.Next()
|
||||
} else if vA < vB {
|
||||
if mode == mergeUnion {
|
||||
if err := w.Write(vA); err != nil {
|
||||
return 0, err
|
||||
}
|
||||
}
|
||||
vA, okA = rA.Next()
|
||||
} else {
|
||||
if mode == mergeUnion {
|
||||
if err := w.Write(vB); err != nil {
|
||||
return 0, err
|
||||
}
|
||||
}
|
||||
vB, okB = rB.Next()
|
||||
}
|
||||
}
|
||||
|
||||
if mode == mergeUnion {
|
||||
for okA {
|
||||
if err := w.Write(vA); err != nil {
|
||||
return 0, err
|
||||
}
|
||||
vA, okA = rA.Next()
|
||||
}
|
||||
for okB {
|
||||
if err := w.Write(vB); err != nil {
|
||||
return 0, err
|
||||
}
|
||||
vB, okB = rB.Next()
|
||||
}
|
||||
}
|
||||
|
||||
return w.Count(), nil
|
||||
}
|
||||
@@ -0,0 +1,251 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"path/filepath"
|
||||
"testing"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
// buildGroupFromSeqs creates a KmerSetGroup with one set per sequence.
|
||||
func buildGroupFromSeqs(t *testing.T, dir string, k, m int, seqs []string) *KmerSetGroup {
|
||||
t.Helper()
|
||||
n := len(seqs)
|
||||
builder, err := NewKmerSetGroupBuilder(dir, k, m, n, 64)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
for i, s := range seqs {
|
||||
seq := obiseq.NewBioSequence("", []byte(s), "")
|
||||
builder.AddSequence(i, seq)
|
||||
}
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
return ksg
|
||||
}
|
||||
|
||||
func collectKmers(t *testing.T, ksg *KmerSetGroup, setIdx int) []uint64 {
|
||||
t.Helper()
|
||||
var result []uint64
|
||||
for kmer := range ksg.Iterator(setIdx) {
|
||||
result = append(result, kmer)
|
||||
}
|
||||
return result
|
||||
}
|
||||
|
||||
func TestDiskOpsUnion(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
indexDir := filepath.Join(dir, "index")
|
||||
outDir := filepath.Join(dir, "union")
|
||||
|
||||
// Two sequences with some overlap
|
||||
seqs := []string{
|
||||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||
}
|
||||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||
|
||||
result, err := ksg.Union(outDir)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Union should have at least as many k-mers as each individual set
|
||||
unionLen := result.Len(0)
|
||||
if unionLen == 0 {
|
||||
t.Fatal("union is empty")
|
||||
}
|
||||
if unionLen < ksg.Len(0) || unionLen < ksg.Len(1) {
|
||||
t.Fatalf("union (%d) smaller than an input set (%d, %d)", unionLen, ksg.Len(0), ksg.Len(1))
|
||||
}
|
||||
|
||||
// Union should not exceed the sum of both sets
|
||||
if unionLen > ksg.Len(0)+ksg.Len(1) {
|
||||
t.Fatalf("union (%d) larger than sum of sets (%d)", unionLen, ksg.Len(0)+ksg.Len(1))
|
||||
}
|
||||
}
|
||||
|
||||
func TestDiskOpsIntersect(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
indexDir := filepath.Join(dir, "index")
|
||||
outDir := filepath.Join(dir, "intersect")
|
||||
|
||||
// Two sequences with some shared k-mers
|
||||
seqs := []string{
|
||||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||
}
|
||||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||
|
||||
result, err := ksg.Intersect(outDir)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
interLen := result.Len(0)
|
||||
// Intersection should not be bigger than any individual set
|
||||
if interLen > ksg.Len(0) || interLen > ksg.Len(1) {
|
||||
t.Fatalf("intersection (%d) larger than input sets (%d, %d)", interLen, ksg.Len(0), ksg.Len(1))
|
||||
}
|
||||
}
|
||||
|
||||
func TestDiskOpsDifference(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
indexDir := filepath.Join(dir, "index")
|
||||
outDir := filepath.Join(dir, "diff")
|
||||
|
||||
seqs := []string{
|
||||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||
}
|
||||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||
|
||||
result, err := ksg.Difference(outDir)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
diffLen := result.Len(0)
|
||||
// Difference = set_0 - set_1, so should be <= set_0
|
||||
if diffLen > ksg.Len(0) {
|
||||
t.Fatalf("difference (%d) larger than set_0 (%d)", diffLen, ksg.Len(0))
|
||||
}
|
||||
}
|
||||
|
||||
func TestDiskOpsConsistency(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
indexDir := filepath.Join(dir, "index")
|
||||
|
||||
seqs := []string{
|
||||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||
}
|
||||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||
|
||||
unionResult, err := ksg.Union(filepath.Join(dir, "union"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
interResult, err := ksg.Intersect(filepath.Join(dir, "intersect"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
diffResult, err := ksg.Difference(filepath.Join(dir, "diff"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
unionLen := unionResult.Len(0)
|
||||
interLen := interResult.Len(0)
|
||||
diffLen := diffResult.Len(0)
|
||||
|
||||
// |A ∪ B| = |A| + |B| - |A ∩ B|
|
||||
expectedUnion := ksg.Len(0) + ksg.Len(1) - interLen
|
||||
if unionLen != expectedUnion {
|
||||
t.Fatalf("|A∪B|=%d, expected |A|+|B|-|A∩B|=%d+%d-%d=%d",
|
||||
unionLen, ksg.Len(0), ksg.Len(1), interLen, expectedUnion)
|
||||
}
|
||||
|
||||
// |A \ B| = |A| - |A ∩ B|
|
||||
expectedDiff := ksg.Len(0) - interLen
|
||||
if diffLen != expectedDiff {
|
||||
t.Fatalf("|A\\B|=%d, expected |A|-|A∩B|=%d-%d=%d",
|
||||
diffLen, ksg.Len(0), interLen, expectedDiff)
|
||||
}
|
||||
}
|
||||
|
||||
func TestDiskOpsQuorum(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
indexDir := filepath.Join(dir, "index")
|
||||
|
||||
// Three sets
|
||||
seqs := []string{
|
||||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||||
"GATCGATCGATCGAAATTTCCCGGG",
|
||||
}
|
||||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||
|
||||
// QuorumAtLeast(1) = Union
|
||||
q1, err := ksg.QuorumAtLeast(1, filepath.Join(dir, "q1"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
union, err := ksg.Union(filepath.Join(dir, "union"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if q1.Len(0) != union.Len(0) {
|
||||
t.Fatalf("QuorumAtLeast(1)=%d != Union=%d", q1.Len(0), union.Len(0))
|
||||
}
|
||||
|
||||
// QuorumAtLeast(3) = Intersect
|
||||
q3, err := ksg.QuorumAtLeast(3, filepath.Join(dir, "q3"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
inter, err := ksg.Intersect(filepath.Join(dir, "inter"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if q3.Len(0) != inter.Len(0) {
|
||||
t.Fatalf("QuorumAtLeast(3)=%d != Intersect=%d", q3.Len(0), inter.Len(0))
|
||||
}
|
||||
|
||||
// QuorumAtLeast(2) should be between Intersect and Union
|
||||
q2, err := ksg.QuorumAtLeast(2, filepath.Join(dir, "q2"))
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if q2.Len(0) < q3.Len(0) || q2.Len(0) > q1.Len(0) {
|
||||
t.Fatalf("QuorumAtLeast(2)=%d not between intersect=%d and union=%d",
|
||||
q2.Len(0), q3.Len(0), q1.Len(0))
|
||||
}
|
||||
}
|
||||
|
||||
func TestDiskOpsJaccard(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
indexDir := filepath.Join(dir, "index")
|
||||
|
||||
seqs := []string{
|
||||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG", // identical to first
|
||||
"TTTTTTTTTTTTTTTTTTTTTTTTT", // completely different
|
||||
}
|
||||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||||
|
||||
dm := ksg.JaccardDistanceMatrix()
|
||||
if dm == nil {
|
||||
t.Fatal("JaccardDistanceMatrix returned nil")
|
||||
}
|
||||
|
||||
// Identical sets should have distance 0
|
||||
d01 := dm.Get(0, 1)
|
||||
if d01 != 0.0 {
|
||||
t.Fatalf("distance(0,1) = %f, expected 0.0 for identical sets", d01)
|
||||
}
|
||||
|
||||
// Completely different sets should have distance 1.0
|
||||
d02 := dm.Get(0, 2)
|
||||
if d02 != 1.0 {
|
||||
t.Fatalf("distance(0,2) = %f, expected 1.0 for disjoint sets", d02)
|
||||
}
|
||||
|
||||
// Similarity matrix
|
||||
sm := ksg.JaccardSimilarityMatrix()
|
||||
if sm == nil {
|
||||
t.Fatal("JaccardSimilarityMatrix returned nil")
|
||||
}
|
||||
|
||||
s01 := sm.Get(0, 1)
|
||||
if s01 != 1.0 {
|
||||
t.Fatalf("similarity(0,1) = %f, expected 1.0 for identical sets", s01)
|
||||
}
|
||||
|
||||
s02 := sm.Get(0, 2)
|
||||
if s02 != 0.0 {
|
||||
t.Fatalf("similarity(0,2) = %f, expected 0.0 for disjoint sets", s02)
|
||||
}
|
||||
}
|
||||
@@ -1,339 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidist"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
// KmerSetGroup represents a vector of KmerSet
|
||||
// Used to manage multiple k-mer sets (for example, by frequency level)
|
||||
type KmerSetGroup struct {
|
||||
id string // Unique identifier of the KmerSetGroup
|
||||
k int // Size of k-mers (immutable)
|
||||
sets []*KmerSet // Vector of KmerSet
|
||||
Metadata map[string]interface{} // Group metadata (not individual sets)
|
||||
}
|
||||
|
||||
// NewKmerSetGroup creates a new group of n KmerSets
|
||||
func NewKmerSetGroup(k int, n int) *KmerSetGroup {
|
||||
if n < 1 {
|
||||
panic("KmerSetGroup size must be >= 1")
|
||||
}
|
||||
|
||||
sets := make([]*KmerSet, n)
|
||||
for i := range sets {
|
||||
sets[i] = NewKmerSet(k)
|
||||
}
|
||||
|
||||
return &KmerSetGroup{
|
||||
k: k,
|
||||
sets: sets,
|
||||
Metadata: make(map[string]interface{}),
|
||||
}
|
||||
}
|
||||
|
||||
// K returns the size of k-mers (immutable)
|
||||
func (ksg *KmerSetGroup) K() int {
|
||||
return ksg.k
|
||||
}
|
||||
|
||||
// Size returns the number of KmerSet in the group
|
||||
func (ksg *KmerSetGroup) Size() int {
|
||||
return len(ksg.sets)
|
||||
}
|
||||
|
||||
// Get returns the KmerSet at the given index
|
||||
// Returns nil if the index is invalid
|
||||
func (ksg *KmerSetGroup) Get(index int) *KmerSet {
|
||||
if index < 0 || index >= len(ksg.sets) {
|
||||
return nil
|
||||
}
|
||||
return ksg.sets[index]
|
||||
}
|
||||
|
||||
// Set replaces the KmerSet at the given index
|
||||
// Panics if the index is invalid or if k does not match
|
||||
func (ksg *KmerSetGroup) Set(index int, ks *KmerSet) {
|
||||
if index < 0 || index >= len(ksg.sets) {
|
||||
panic(fmt.Sprintf("Index out of bounds: %d (size: %d)", index, len(ksg.sets)))
|
||||
}
|
||||
if ks.k != ksg.k {
|
||||
panic(fmt.Sprintf("KmerSet k mismatch: expected %d, got %d", ksg.k, ks.k))
|
||||
}
|
||||
ksg.sets[index] = ks
|
||||
}
|
||||
|
||||
// Len returns the number of k-mers in a specific KmerSet
|
||||
// Without argument: returns the number of k-mers in the last KmerSet
|
||||
// With argument index: returns the number of k-mers in the KmerSet at this index
|
||||
func (ksg *KmerSetGroup) Len(index ...int) uint64 {
|
||||
if len(index) == 0 {
|
||||
// Without argument: last KmerSet
|
||||
return ksg.sets[len(ksg.sets)-1].Len()
|
||||
}
|
||||
|
||||
// With argument: specific KmerSet
|
||||
idx := index[0]
|
||||
if idx < 0 || idx >= len(ksg.sets) {
|
||||
return 0
|
||||
}
|
||||
return ksg.sets[idx].Len()
|
||||
}
|
||||
|
||||
// MemoryUsage returns the total memory usage in bytes
|
||||
func (ksg *KmerSetGroup) MemoryUsage() uint64 {
|
||||
total := uint64(0)
|
||||
for _, ks := range ksg.sets {
|
||||
total += ks.MemoryUsage()
|
||||
}
|
||||
return total
|
||||
}
|
||||
|
||||
// Clear empties all KmerSet in the group
|
||||
func (ksg *KmerSetGroup) Clear() {
|
||||
for _, ks := range ksg.sets {
|
||||
ks.Clear()
|
||||
}
|
||||
}
|
||||
|
||||
// Copy creates a complete copy of the group (consistent with BioSequence.Copy)
|
||||
func (ksg *KmerSetGroup) Copy() *KmerSetGroup {
|
||||
copiedSets := make([]*KmerSet, len(ksg.sets))
|
||||
for i, ks := range ksg.sets {
|
||||
copiedSets[i] = ks.Copy() // Copy each KmerSet with its metadata
|
||||
}
|
||||
|
||||
// Copy group metadata
|
||||
groupMetadata := make(map[string]interface{}, len(ksg.Metadata))
|
||||
for k, v := range ksg.Metadata {
|
||||
groupMetadata[k] = v
|
||||
}
|
||||
|
||||
return &KmerSetGroup{
|
||||
id: ksg.id,
|
||||
k: ksg.k,
|
||||
sets: copiedSets,
|
||||
Metadata: groupMetadata,
|
||||
}
|
||||
}
|
||||
|
||||
// Id returns the identifier of the KmerSetGroup (consistent with BioSequence.Id)
|
||||
func (ksg *KmerSetGroup) Id() string {
|
||||
return ksg.id
|
||||
}
|
||||
|
||||
// SetId sets the identifier of the KmerSetGroup (consistent with BioSequence.SetId)
|
||||
func (ksg *KmerSetGroup) SetId(id string) {
|
||||
ksg.id = id
|
||||
}
|
||||
|
||||
// AddSequence adds all k-mers from a sequence to a specific KmerSet
|
||||
func (ksg *KmerSetGroup) AddSequence(seq *obiseq.BioSequence, index int) {
|
||||
if index < 0 || index >= len(ksg.sets) {
|
||||
panic(fmt.Sprintf("Index out of bounds: %d (size: %d)", index, len(ksg.sets)))
|
||||
}
|
||||
ksg.sets[index].AddSequence(seq)
|
||||
}
|
||||
|
||||
// AddSequences adds all k-mers from multiple sequences to a specific KmerSet
|
||||
func (ksg *KmerSetGroup) AddSequences(sequences *obiseq.BioSequenceSlice, index int) {
|
||||
if index < 0 || index >= len(ksg.sets) {
|
||||
panic(fmt.Sprintf("Index out of bounds: %d (size: %d)", index, len(ksg.sets)))
|
||||
}
|
||||
ksg.sets[index].AddSequences(sequences)
|
||||
}
|
||||
|
||||
// Union returns the union of all KmerSet in the group
|
||||
// Optimization: starts from the largest set to minimize operations
|
||||
func (ksg *KmerSetGroup) Union() *KmerSet {
|
||||
if len(ksg.sets) == 0 {
|
||||
return NewKmerSet(ksg.k)
|
||||
}
|
||||
|
||||
if len(ksg.sets) == 1 {
|
||||
return ksg.sets[0].Copy()
|
||||
}
|
||||
|
||||
// Find the index of the largest set (the one with the most k-mers)
|
||||
maxIdx := 0
|
||||
maxCard := ksg.sets[0].Len()
|
||||
for i := 1; i < len(ksg.sets); i++ {
|
||||
card := ksg.sets[i].Len()
|
||||
if card > maxCard {
|
||||
maxCard = card
|
||||
maxIdx = i
|
||||
}
|
||||
}
|
||||
|
||||
// Copy the largest set and perform unions in-place
|
||||
result := ksg.sets[maxIdx].bitmap.Clone()
|
||||
for i := 0; i < len(ksg.sets); i++ {
|
||||
if i != maxIdx {
|
||||
result.Or(ksg.sets[i].bitmap)
|
||||
}
|
||||
}
|
||||
|
||||
return NewKmerSetFromBitmap(ksg.k, result)
|
||||
}
|
||||
|
||||
// Intersect returns the intersection of all KmerSet in the group
|
||||
// Optimization: starts from the smallest set to minimize operations
|
||||
func (ksg *KmerSetGroup) Intersect() *KmerSet {
|
||||
if len(ksg.sets) == 0 {
|
||||
return NewKmerSet(ksg.k)
|
||||
}
|
||||
|
||||
if len(ksg.sets) == 1 {
|
||||
return ksg.sets[0].Copy()
|
||||
}
|
||||
|
||||
// Find the index of the smallest set (the one with the fewest k-mers)
|
||||
minIdx := 0
|
||||
minCard := ksg.sets[0].Len()
|
||||
for i := 1; i < len(ksg.sets); i++ {
|
||||
card := ksg.sets[i].Len()
|
||||
if card < minCard {
|
||||
minCard = card
|
||||
minIdx = i
|
||||
}
|
||||
}
|
||||
|
||||
// Copy the smallest set and perform intersections in-place
|
||||
result := ksg.sets[minIdx].bitmap.Clone()
|
||||
for i := 0; i < len(ksg.sets); i++ {
|
||||
if i != minIdx {
|
||||
result.And(ksg.sets[i].bitmap)
|
||||
}
|
||||
}
|
||||
|
||||
return NewKmerSetFromBitmap(ksg.k, result)
|
||||
}
|
||||
|
||||
// Stats returns statistics for each KmerSet in the group
|
||||
type KmerSetGroupStats struct {
|
||||
K int
|
||||
Size int // Number of KmerSet
|
||||
TotalBytes uint64 // Total memory used
|
||||
Sets []KmerSetStats // Stats of each KmerSet
|
||||
}
|
||||
|
||||
type KmerSetStats struct {
|
||||
Index int // Index of the KmerSet in the group
|
||||
Len uint64 // Number of k-mers
|
||||
SizeBytes uint64 // Size in bytes
|
||||
}
|
||||
|
||||
func (ksg *KmerSetGroup) Stats() KmerSetGroupStats {
|
||||
stats := KmerSetGroupStats{
|
||||
K: ksg.k,
|
||||
Size: len(ksg.sets),
|
||||
Sets: make([]KmerSetStats, len(ksg.sets)),
|
||||
}
|
||||
|
||||
for i, ks := range ksg.sets {
|
||||
sizeBytes := ks.MemoryUsage()
|
||||
stats.Sets[i] = KmerSetStats{
|
||||
Index: i,
|
||||
Len: ks.Len(),
|
||||
SizeBytes: sizeBytes,
|
||||
}
|
||||
stats.TotalBytes += sizeBytes
|
||||
}
|
||||
|
||||
return stats
|
||||
}
|
||||
|
||||
func (ksgs KmerSetGroupStats) String() string {
|
||||
result := fmt.Sprintf(`KmerSetGroup Statistics (k=%d, size=%d):
|
||||
Total memory: %.2f MB
|
||||
|
||||
Set breakdown:
|
||||
`, ksgs.K, ksgs.Size, float64(ksgs.TotalBytes)/1024/1024)
|
||||
|
||||
for _, set := range ksgs.Sets {
|
||||
result += fmt.Sprintf(" Set[%d]: %d k-mers (%.2f MB)\n",
|
||||
set.Index,
|
||||
set.Len,
|
||||
float64(set.SizeBytes)/1024/1024)
|
||||
}
|
||||
|
||||
return result
|
||||
}
|
||||
|
||||
// JaccardDistanceMatrix computes a pairwise Jaccard distance matrix for all KmerSets in the group.
|
||||
// Returns a triangular distance matrix where element (i, j) represents the Jaccard distance
|
||||
// between set i and set j.
|
||||
//
|
||||
// The Jaccard distance is: 1 - (|A ∩ B| / |A ∪ B|)
|
||||
//
|
||||
// The matrix labels are set to the IDs of the individual KmerSets if available,
|
||||
// otherwise they are set to "set_0", "set_1", etc.
|
||||
//
|
||||
// Time complexity: O(n² × (|A| + |B|)) where n is the number of sets
|
||||
// Space complexity: O(n²) for the distance matrix
|
||||
func (ksg *KmerSetGroup) JaccardDistanceMatrix() *obidist.DistMatrix {
|
||||
n := len(ksg.sets)
|
||||
|
||||
// Create labels from set IDs
|
||||
labels := make([]string, n)
|
||||
for i, ks := range ksg.sets {
|
||||
if ks.Id() != "" {
|
||||
labels[i] = ks.Id()
|
||||
} else {
|
||||
labels[i] = fmt.Sprintf("set_%d", i)
|
||||
}
|
||||
}
|
||||
|
||||
dm := obidist.NewDistMatrixWithLabels(labels)
|
||||
|
||||
// Compute pairwise distances
|
||||
for i := 0; i < n-1; i++ {
|
||||
for j := i + 1; j < n; j++ {
|
||||
distance := ksg.sets[i].JaccardDistance(ksg.sets[j])
|
||||
dm.Set(i, j, distance)
|
||||
}
|
||||
}
|
||||
|
||||
return dm
|
||||
}
|
||||
|
||||
// JaccardSimilarityMatrix computes a pairwise Jaccard similarity matrix for all KmerSets in the group.
|
||||
// Returns a similarity matrix where element (i, j) represents the Jaccard similarity
|
||||
// between set i and set j.
|
||||
//
|
||||
// The Jaccard similarity is: |A ∩ B| / |A ∪ B|
|
||||
//
|
||||
// The diagonal is 1.0 (similarity of a set to itself).
|
||||
//
|
||||
// The matrix labels are set to the IDs of the individual KmerSets if available,
|
||||
// otherwise they are set to "set_0", "set_1", etc.
|
||||
//
|
||||
// Time complexity: O(n² × (|A| + |B|)) where n is the number of sets
|
||||
// Space complexity: O(n²) for the similarity matrix
|
||||
func (ksg *KmerSetGroup) JaccardSimilarityMatrix() *obidist.DistMatrix {
|
||||
n := len(ksg.sets)
|
||||
|
||||
// Create labels from set IDs
|
||||
labels := make([]string, n)
|
||||
for i, ks := range ksg.sets {
|
||||
if ks.Id() != "" {
|
||||
labels[i] = ks.Id()
|
||||
} else {
|
||||
labels[i] = fmt.Sprintf("set_%d", i)
|
||||
}
|
||||
}
|
||||
|
||||
sm := obidist.NewSimilarityMatrixWithLabels(labels)
|
||||
|
||||
// Compute pairwise similarities
|
||||
for i := 0; i < n-1; i++ {
|
||||
for j := i + 1; j < n; j++ {
|
||||
similarity := ksg.sets[i].JaccardSimilarity(ksg.sets[j])
|
||||
sm.Set(i, j, similarity)
|
||||
}
|
||||
}
|
||||
|
||||
return sm
|
||||
}
|
||||
@@ -1,231 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"math"
|
||||
"testing"
|
||||
)
|
||||
|
||||
func TestKmerSetGroupJaccardDistanceMatrix(t *testing.T) {
|
||||
ksg := NewKmerSetGroup(5, 3)
|
||||
|
||||
// Set 0: {1, 2, 3}
|
||||
ksg.Get(0).AddKmerCode(1)
|
||||
ksg.Get(0).AddKmerCode(2)
|
||||
ksg.Get(0).AddKmerCode(3)
|
||||
ksg.Get(0).SetId("set_A")
|
||||
|
||||
// Set 1: {2, 3, 4}
|
||||
ksg.Get(1).AddKmerCode(2)
|
||||
ksg.Get(1).AddKmerCode(3)
|
||||
ksg.Get(1).AddKmerCode(4)
|
||||
ksg.Get(1).SetId("set_B")
|
||||
|
||||
// Set 2: {5, 6, 7}
|
||||
ksg.Get(2).AddKmerCode(5)
|
||||
ksg.Get(2).AddKmerCode(6)
|
||||
ksg.Get(2).AddKmerCode(7)
|
||||
ksg.Get(2).SetId("set_C")
|
||||
|
||||
dm := ksg.JaccardDistanceMatrix()
|
||||
|
||||
// Check labels
|
||||
if dm.GetLabel(0) != "set_A" {
|
||||
t.Errorf("Expected label 'set_A' at index 0, got '%s'", dm.GetLabel(0))
|
||||
}
|
||||
if dm.GetLabel(1) != "set_B" {
|
||||
t.Errorf("Expected label 'set_B' at index 1, got '%s'", dm.GetLabel(1))
|
||||
}
|
||||
if dm.GetLabel(2) != "set_C" {
|
||||
t.Errorf("Expected label 'set_C' at index 2, got '%s'", dm.GetLabel(2))
|
||||
}
|
||||
|
||||
// Check distances
|
||||
// Distance(0, 1):
|
||||
// Intersection: {2, 3} -> 2 elements
|
||||
// Union: {1, 2, 3, 4} -> 4 elements
|
||||
// Similarity: 2/4 = 0.5
|
||||
// Distance: 1 - 0.5 = 0.5
|
||||
expectedDist01 := 0.5
|
||||
actualDist01 := dm.Get(0, 1)
|
||||
if math.Abs(actualDist01-expectedDist01) > 1e-10 {
|
||||
t.Errorf("Distance(0, 1): expected %f, got %f", expectedDist01, actualDist01)
|
||||
}
|
||||
|
||||
// Distance(0, 2):
|
||||
// Intersection: {} -> 0 elements
|
||||
// Union: {1, 2, 3, 5, 6, 7} -> 6 elements
|
||||
// Similarity: 0/6 = 0
|
||||
// Distance: 1 - 0 = 1.0
|
||||
expectedDist02 := 1.0
|
||||
actualDist02 := dm.Get(0, 2)
|
||||
if math.Abs(actualDist02-expectedDist02) > 1e-10 {
|
||||
t.Errorf("Distance(0, 2): expected %f, got %f", expectedDist02, actualDist02)
|
||||
}
|
||||
|
||||
// Distance(1, 2):
|
||||
// Intersection: {} -> 0 elements
|
||||
// Union: {2, 3, 4, 5, 6, 7} -> 6 elements
|
||||
// Similarity: 0/6 = 0
|
||||
// Distance: 1 - 0 = 1.0
|
||||
expectedDist12 := 1.0
|
||||
actualDist12 := dm.Get(1, 2)
|
||||
if math.Abs(actualDist12-expectedDist12) > 1e-10 {
|
||||
t.Errorf("Distance(1, 2): expected %f, got %f", expectedDist12, actualDist12)
|
||||
}
|
||||
|
||||
// Check symmetry
|
||||
if dm.Get(0, 1) != dm.Get(1, 0) {
|
||||
t.Errorf("Matrix not symmetric: Get(0, 1) = %f, Get(1, 0) = %f",
|
||||
dm.Get(0, 1), dm.Get(1, 0))
|
||||
}
|
||||
|
||||
// Check diagonal
|
||||
if dm.Get(0, 0) != 0.0 {
|
||||
t.Errorf("Diagonal should be 0, got %f", dm.Get(0, 0))
|
||||
}
|
||||
if dm.Get(1, 1) != 0.0 {
|
||||
t.Errorf("Diagonal should be 0, got %f", dm.Get(1, 1))
|
||||
}
|
||||
if dm.Get(2, 2) != 0.0 {
|
||||
t.Errorf("Diagonal should be 0, got %f", dm.Get(2, 2))
|
||||
}
|
||||
}
|
||||
|
||||
func TestKmerSetGroupJaccardSimilarityMatrix(t *testing.T) {
|
||||
ksg := NewKmerSetGroup(5, 3)
|
||||
|
||||
// Set 0: {1, 2, 3}
|
||||
ksg.Get(0).AddKmerCode(1)
|
||||
ksg.Get(0).AddKmerCode(2)
|
||||
ksg.Get(0).AddKmerCode(3)
|
||||
|
||||
// Set 1: {2, 3, 4}
|
||||
ksg.Get(1).AddKmerCode(2)
|
||||
ksg.Get(1).AddKmerCode(3)
|
||||
ksg.Get(1).AddKmerCode(4)
|
||||
|
||||
// Set 2: {1, 2, 3} (same as set 0)
|
||||
ksg.Get(2).AddKmerCode(1)
|
||||
ksg.Get(2).AddKmerCode(2)
|
||||
ksg.Get(2).AddKmerCode(3)
|
||||
|
||||
sm := ksg.JaccardSimilarityMatrix()
|
||||
|
||||
// Check similarities
|
||||
// Similarity(0, 1): 0.5 (as calculated above)
|
||||
expectedSim01 := 0.5
|
||||
actualSim01 := sm.Get(0, 1)
|
||||
if math.Abs(actualSim01-expectedSim01) > 1e-10 {
|
||||
t.Errorf("Similarity(0, 1): expected %f, got %f", expectedSim01, actualSim01)
|
||||
}
|
||||
|
||||
// Similarity(0, 2): 1.0 (identical sets)
|
||||
expectedSim02 := 1.0
|
||||
actualSim02 := sm.Get(0, 2)
|
||||
if math.Abs(actualSim02-expectedSim02) > 1e-10 {
|
||||
t.Errorf("Similarity(0, 2): expected %f, got %f", expectedSim02, actualSim02)
|
||||
}
|
||||
|
||||
// Similarity(1, 2): 0.5
|
||||
// Intersection: {2, 3} -> 2
|
||||
// Union: {1, 2, 3, 4} -> 4
|
||||
// Similarity: 2/4 = 0.5
|
||||
expectedSim12 := 0.5
|
||||
actualSim12 := sm.Get(1, 2)
|
||||
if math.Abs(actualSim12-expectedSim12) > 1e-10 {
|
||||
t.Errorf("Similarity(1, 2): expected %f, got %f", expectedSim12, actualSim12)
|
||||
}
|
||||
|
||||
// Check diagonal (similarity to self = 1.0)
|
||||
if sm.Get(0, 0) != 1.0 {
|
||||
t.Errorf("Diagonal should be 1.0, got %f", sm.Get(0, 0))
|
||||
}
|
||||
if sm.Get(1, 1) != 1.0 {
|
||||
t.Errorf("Diagonal should be 1.0, got %f", sm.Get(1, 1))
|
||||
}
|
||||
if sm.Get(2, 2) != 1.0 {
|
||||
t.Errorf("Diagonal should be 1.0, got %f", sm.Get(2, 2))
|
||||
}
|
||||
}
|
||||
|
||||
func TestKmerSetGroupJaccardMatricesRelation(t *testing.T) {
|
||||
ksg := NewKmerSetGroup(5, 4)
|
||||
|
||||
// Create different sets
|
||||
ksg.Get(0).AddKmerCode(1)
|
||||
ksg.Get(0).AddKmerCode(2)
|
||||
|
||||
ksg.Get(1).AddKmerCode(2)
|
||||
ksg.Get(1).AddKmerCode(3)
|
||||
|
||||
ksg.Get(2).AddKmerCode(1)
|
||||
ksg.Get(2).AddKmerCode(2)
|
||||
ksg.Get(2).AddKmerCode(3)
|
||||
|
||||
ksg.Get(3).AddKmerCode(10)
|
||||
ksg.Get(3).AddKmerCode(20)
|
||||
|
||||
dm := ksg.JaccardDistanceMatrix()
|
||||
sm := ksg.JaccardSimilarityMatrix()
|
||||
|
||||
// For all pairs (including diagonal), distance + similarity should equal 1.0
|
||||
for i := 0; i < 4; i++ {
|
||||
for j := 0; j < 4; j++ {
|
||||
distance := dm.Get(i, j)
|
||||
similarity := sm.Get(i, j)
|
||||
sum := distance + similarity
|
||||
|
||||
if math.Abs(sum-1.0) > 1e-10 {
|
||||
t.Errorf("At (%d, %d): distance %f + similarity %f = %f, expected 1.0",
|
||||
i, j, distance, similarity, sum)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestKmerSetGroupJaccardMatrixLabels(t *testing.T) {
|
||||
ksg := NewKmerSetGroup(5, 3)
|
||||
|
||||
// Don't set IDs - should use default labels
|
||||
ksg.Get(0).AddKmerCode(1)
|
||||
ksg.Get(1).AddKmerCode(2)
|
||||
ksg.Get(2).AddKmerCode(3)
|
||||
|
||||
dm := ksg.JaccardDistanceMatrix()
|
||||
|
||||
// Check default labels
|
||||
if dm.GetLabel(0) != "set_0" {
|
||||
t.Errorf("Expected default label 'set_0', got '%s'", dm.GetLabel(0))
|
||||
}
|
||||
if dm.GetLabel(1) != "set_1" {
|
||||
t.Errorf("Expected default label 'set_1', got '%s'", dm.GetLabel(1))
|
||||
}
|
||||
if dm.GetLabel(2) != "set_2" {
|
||||
t.Errorf("Expected default label 'set_2', got '%s'", dm.GetLabel(2))
|
||||
}
|
||||
}
|
||||
|
||||
func TestKmerSetGroupJaccardMatrixSize(t *testing.T) {
|
||||
ksg := NewKmerSetGroup(5, 5)
|
||||
|
||||
for i := 0; i < 5; i++ {
|
||||
ksg.Get(i).AddKmerCode(uint64(i))
|
||||
}
|
||||
|
||||
dm := ksg.JaccardDistanceMatrix()
|
||||
|
||||
if dm.Size() != 5 {
|
||||
t.Errorf("Expected matrix size 5, got %d", dm.Size())
|
||||
}
|
||||
|
||||
// All sets are disjoint, so all distances should be 1.0
|
||||
for i := 0; i < 5; i++ {
|
||||
for j := i + 1; j < 5; j++ {
|
||||
dist := dm.Get(i, j)
|
||||
if math.Abs(dist-1.0) > 1e-10 {
|
||||
t.Errorf("Expected distance 1.0 for disjoint sets (%d, %d), got %f",
|
||||
i, j, dist)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
@@ -1,235 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"container/heap"
|
||||
|
||||
"github.com/RoaringBitmap/roaring/roaring64"
|
||||
)
|
||||
|
||||
// heapItem represents an element in the min-heap for k-way merge
|
||||
type heapItem struct {
|
||||
value uint64
|
||||
idx int
|
||||
}
|
||||
|
||||
// kmerMinHeap implements heap.Interface for k-way merge algorithm
|
||||
type kmerMinHeap []heapItem
|
||||
|
||||
func (h kmerMinHeap) Len() int { return len(h) }
|
||||
func (h kmerMinHeap) Less(i, j int) bool { return h[i].value < h[j].value }
|
||||
func (h kmerMinHeap) Swap(i, j int) { h[i], h[j] = h[j], h[i] }
|
||||
|
||||
func (h *kmerMinHeap) Push(x interface{}) {
|
||||
*h = append(*h, x.(heapItem))
|
||||
}
|
||||
|
||||
func (h *kmerMinHeap) Pop() interface{} {
|
||||
old := *h
|
||||
n := len(old)
|
||||
x := old[n-1]
|
||||
*h = old[0 : n-1]
|
||||
return x
|
||||
}
|
||||
|
||||
// QuorumAtLeast returns k-mers present in at least q sets
|
||||
//
|
||||
// Algorithm: K-way merge with min-heap counting
|
||||
//
|
||||
// The algorithm processes all k-mers in sorted order using a min-heap:
|
||||
//
|
||||
// 1. Initialize one iterator per non-empty set
|
||||
// 2. Build a min-heap of (value, set_index) pairs, one per iterator
|
||||
// 3. While heap is not empty:
|
||||
// a. Extract the minimum value v from heap
|
||||
// b. Pop ALL heap items with value == v (counting occurrences)
|
||||
// c. If count >= q, add v to result
|
||||
// d. Advance each popped iterator and re-insert into heap if valid
|
||||
//
|
||||
// This ensures each unique k-mer is counted exactly once across all sets.
|
||||
//
|
||||
// Time complexity: O(M log N)
|
||||
// - M = sum of all set cardinalities (total k-mer occurrences)
|
||||
// - N = number of sets
|
||||
// - Each k-mer occurrence is inserted/extracted from heap once: O(M) operations
|
||||
// - Each heap operation costs O(log N)
|
||||
//
|
||||
// Space complexity: O(N)
|
||||
// - Heap contains at most N elements (one per set iterator)
|
||||
// - Output bitmap size depends on quorum result
|
||||
//
|
||||
// Special cases (optimized):
|
||||
// - q <= 0: returns empty set
|
||||
// - q == 1: delegates to Union() (native OR operations)
|
||||
// - q == n: delegates to Intersect() (native AND operations)
|
||||
// - q > n: returns empty set (impossible to satisfy)
|
||||
func (ksg *KmerSetGroup) QuorumAtLeast(q int) *KmerSet {
|
||||
n := len(ksg.sets)
|
||||
|
||||
// Edge cases
|
||||
if q <= 0 || n == 0 {
|
||||
return NewKmerSet(ksg.k)
|
||||
}
|
||||
if q > n {
|
||||
return NewKmerSet(ksg.k)
|
||||
}
|
||||
if q == 1 {
|
||||
return ksg.Union()
|
||||
}
|
||||
if q == n {
|
||||
return ksg.Intersect()
|
||||
}
|
||||
|
||||
// Initialize iterators for all non-empty sets
|
||||
iterators := make([]roaring64.IntIterable64, 0, n)
|
||||
iterIndices := make([]int, 0, n)
|
||||
|
||||
for i, set := range ksg.sets {
|
||||
if set.Len() > 0 {
|
||||
iter := set.bitmap.Iterator()
|
||||
if iter.HasNext() {
|
||||
iterators = append(iterators, iter)
|
||||
iterIndices = append(iterIndices, i)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
if len(iterators) == 0 {
|
||||
return NewKmerSet(ksg.k)
|
||||
}
|
||||
|
||||
// Initialize heap with first value from each iterator
|
||||
h := make(kmerMinHeap, len(iterators))
|
||||
for i, iter := range iterators {
|
||||
h[i] = heapItem{value: iter.Next(), idx: i}
|
||||
}
|
||||
heap.Init(&h)
|
||||
|
||||
// Result bitmap
|
||||
result := roaring64.New()
|
||||
|
||||
// K-way merge with counting
|
||||
for len(h) > 0 {
|
||||
minVal := h[0].value
|
||||
count := 0
|
||||
activeIndices := make([]int, 0, len(h))
|
||||
|
||||
// Pop all elements with same value (count occurrences)
|
||||
for len(h) > 0 && h[0].value == minVal {
|
||||
item := heap.Pop(&h).(heapItem)
|
||||
count++
|
||||
activeIndices = append(activeIndices, item.idx)
|
||||
}
|
||||
|
||||
// Add to result if quorum reached
|
||||
if count >= q {
|
||||
result.Add(minVal)
|
||||
}
|
||||
|
||||
// Advance iterators and re-insert into heap
|
||||
for _, iterIdx := range activeIndices {
|
||||
if iterators[iterIdx].HasNext() {
|
||||
heap.Push(&h, heapItem{
|
||||
value: iterators[iterIdx].Next(),
|
||||
idx: iterIdx,
|
||||
})
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
return NewKmerSetFromBitmap(ksg.k, result)
|
||||
}
|
||||
|
||||
// QuorumAtMost returns k-mers present in at most q sets
|
||||
//
|
||||
// Algorithm: Uses the mathematical identity
|
||||
// AtMost(q) = Union() - AtLeast(q+1)
|
||||
//
|
||||
// Proof:
|
||||
// - Union() contains all k-mers present in at least 1 set
|
||||
// - AtLeast(q+1) contains all k-mers present in q+1 or more sets
|
||||
// - Their difference contains only k-mers present in at most q sets
|
||||
//
|
||||
// Implementation:
|
||||
// 1. Compute U = Union()
|
||||
// 2. Compute A = QuorumAtLeast(q+1)
|
||||
// 3. Return U - A using bitmap AndNot operation
|
||||
//
|
||||
// Time complexity: O(M log N)
|
||||
// - Union(): O(M) with native OR operations
|
||||
// - QuorumAtLeast(q+1): O(M log N)
|
||||
// - AndNot: O(|U|) where |U| <= M
|
||||
// - Total: O(M log N)
|
||||
//
|
||||
// Space complexity: O(N)
|
||||
// - Inherited from QuorumAtLeast heap
|
||||
//
|
||||
// Special cases:
|
||||
// - q <= 0: returns empty set
|
||||
// - q >= n: returns Union() (all k-mers are in at most n sets)
|
||||
func (ksg *KmerSetGroup) QuorumAtMost(q int) *KmerSet {
|
||||
n := len(ksg.sets)
|
||||
|
||||
// Edge cases
|
||||
if q <= 0 {
|
||||
return NewKmerSet(ksg.k)
|
||||
}
|
||||
if q >= n {
|
||||
return ksg.Union()
|
||||
}
|
||||
|
||||
// Compute Union() - AtLeast(q+1)
|
||||
union := ksg.Union()
|
||||
atLeastQ1 := ksg.QuorumAtLeast(q + 1)
|
||||
|
||||
// Difference: elements in union but not in atLeastQ1
|
||||
result := union.bitmap.Clone()
|
||||
result.AndNot(atLeastQ1.bitmap)
|
||||
|
||||
return NewKmerSetFromBitmap(ksg.k, result)
|
||||
}
|
||||
|
||||
// QuorumExactly returns k-mers present in exactly q sets
|
||||
//
|
||||
// Algorithm: Uses the mathematical identity
|
||||
// Exactly(q) = AtLeast(q) - AtLeast(q+1)
|
||||
//
|
||||
// Proof:
|
||||
// - AtLeast(q) contains all k-mers present in q or more sets
|
||||
// - AtLeast(q+1) contains all k-mers present in q+1 or more sets
|
||||
// - Their difference contains only k-mers present in exactly q sets
|
||||
//
|
||||
// Implementation:
|
||||
// 1. Compute A = QuorumAtLeast(q)
|
||||
// 2. Compute B = QuorumAtLeast(q+1)
|
||||
// 3. Return A - B using bitmap AndNot operation
|
||||
//
|
||||
// Time complexity: O(M log N)
|
||||
// - Two calls to QuorumAtLeast: 2 * O(M log N)
|
||||
// - One AndNot operation: O(|A|) where |A| <= M
|
||||
// - Total: O(M log N) since AndNot is dominated by merge operations
|
||||
//
|
||||
// Space complexity: O(N)
|
||||
// - Inherited from QuorumAtLeast heap
|
||||
// - Two temporary bitmaps for intermediate results
|
||||
//
|
||||
// Special cases:
|
||||
// - q <= 0: returns empty set
|
||||
// - q > n: returns empty set (impossible to have k-mer in more than n sets)
|
||||
func (ksg *KmerSetGroup) QuorumExactly(q int) *KmerSet {
|
||||
n := len(ksg.sets)
|
||||
|
||||
// Edge cases
|
||||
if q <= 0 || q > n {
|
||||
return NewKmerSet(ksg.k)
|
||||
}
|
||||
|
||||
// Compute AtLeast(q) - AtLeast(q+1)
|
||||
aq := ksg.QuorumAtLeast(q)
|
||||
aq1 := ksg.QuorumAtLeast(q + 1)
|
||||
|
||||
// Difference: elements in aq but not in aq1
|
||||
result := aq.bitmap.Clone()
|
||||
result.AndNot(aq1.bitmap)
|
||||
|
||||
return NewKmerSetFromBitmap(ksg.k, result)
|
||||
}
|
||||
@@ -1,395 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"testing"
|
||||
)
|
||||
|
||||
// TestQuorumAtLeastEdgeCases tests edge cases for QuorumAtLeast
|
||||
func TestQuorumAtLeastEdgeCases(t *testing.T) {
|
||||
k := 5
|
||||
|
||||
// Test group with all empty sets
|
||||
emptyGroup := NewKmerSetGroup(k, 3)
|
||||
result := emptyGroup.QuorumAtLeast(1)
|
||||
if result.Len() != 0 {
|
||||
t.Errorf("Empty sets: expected 0 k-mers, got %d", result.Len())
|
||||
}
|
||||
|
||||
// Test q <= 0
|
||||
group := NewKmerSetGroup(k, 3)
|
||||
result = group.QuorumAtLeast(0)
|
||||
if result.Len() != 0 {
|
||||
t.Errorf("q=0: expected 0 k-mers, got %d", result.Len())
|
||||
}
|
||||
|
||||
result = group.QuorumAtLeast(-1)
|
||||
if result.Len() != 0 {
|
||||
t.Errorf("q=-1: expected 0 k-mers, got %d", result.Len())
|
||||
}
|
||||
|
||||
// Test q > n
|
||||
group.Get(0).AddKmerCode(1)
|
||||
result = group.QuorumAtLeast(10)
|
||||
if result.Len() != 0 {
|
||||
t.Errorf("q>n: expected 0 k-mers, got %d", result.Len())
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumAtLeastQ1 tests q=1 (should equal Union)
|
||||
func TestQuorumAtLeastQ1(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 3)
|
||||
|
||||
// Add different k-mers to each set
|
||||
group.Get(0).AddKmerCode(1)
|
||||
group.Get(0).AddKmerCode(2)
|
||||
group.Get(1).AddKmerCode(2)
|
||||
group.Get(1).AddKmerCode(3)
|
||||
group.Get(2).AddKmerCode(3)
|
||||
group.Get(2).AddKmerCode(4)
|
||||
|
||||
quorum := group.QuorumAtLeast(1)
|
||||
union := group.Union()
|
||||
|
||||
if quorum.Len() != union.Len() {
|
||||
t.Errorf("QuorumAtLeast(1) length %d != Union length %d", quorum.Len(), union.Len())
|
||||
}
|
||||
|
||||
// Check all elements match
|
||||
for kmer := uint64(1); kmer <= 4; kmer++ {
|
||||
if quorum.Contains(kmer) != union.Contains(kmer) {
|
||||
t.Errorf("Mismatch for k-mer %d", kmer)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumAtLeastQN tests q=n (should equal Intersect)
|
||||
func TestQuorumAtLeastQN(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 3)
|
||||
|
||||
// Add some common k-mers and some unique
|
||||
for i := 0; i < 3; i++ {
|
||||
group.Get(i).AddKmerCode(10) // common to all
|
||||
group.Get(i).AddKmerCode(20) // common to all
|
||||
}
|
||||
group.Get(0).AddKmerCode(1) // unique to set 0
|
||||
group.Get(1).AddKmerCode(2) // unique to set 1
|
||||
|
||||
quorum := group.QuorumAtLeast(3)
|
||||
intersect := group.Intersect()
|
||||
|
||||
if quorum.Len() != intersect.Len() {
|
||||
t.Errorf("QuorumAtLeast(n) length %d != Intersect length %d", quorum.Len(), intersect.Len())
|
||||
}
|
||||
|
||||
if quorum.Len() != 2 {
|
||||
t.Errorf("Expected 2 common k-mers, got %d", quorum.Len())
|
||||
}
|
||||
|
||||
if !quorum.Contains(10) || !quorum.Contains(20) {
|
||||
t.Error("Missing common k-mers")
|
||||
}
|
||||
|
||||
if quorum.Contains(1) || quorum.Contains(2) {
|
||||
t.Error("Unique k-mers should not be in result")
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumAtLeastGeneral tests general quorum values
|
||||
func TestQuorumAtLeastGeneral(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 5)
|
||||
|
||||
// Setup: k-mer i appears in i sets (for i=1..5)
|
||||
// k-mer 1: in set 0
|
||||
// k-mer 2: in sets 0,1
|
||||
// k-mer 3: in sets 0,1,2
|
||||
// k-mer 4: in sets 0,1,2,3
|
||||
// k-mer 5: in sets 0,1,2,3,4 (all)
|
||||
|
||||
for kmer := uint64(1); kmer <= 5; kmer++ {
|
||||
for setIdx := 0; setIdx < int(kmer); setIdx++ {
|
||||
group.Get(setIdx).AddKmerCode(kmer)
|
||||
}
|
||||
}
|
||||
|
||||
tests := []struct {
|
||||
q int
|
||||
expected map[uint64]bool
|
||||
}{
|
||||
{1, map[uint64]bool{1: true, 2: true, 3: true, 4: true, 5: true}},
|
||||
{2, map[uint64]bool{2: true, 3: true, 4: true, 5: true}},
|
||||
{3, map[uint64]bool{3: true, 4: true, 5: true}},
|
||||
{4, map[uint64]bool{4: true, 5: true}},
|
||||
{5, map[uint64]bool{5: true}},
|
||||
}
|
||||
|
||||
for _, tt := range tests {
|
||||
result := group.QuorumAtLeast(tt.q)
|
||||
|
||||
if result.Len() != uint64(len(tt.expected)) {
|
||||
t.Errorf("q=%d: expected %d k-mers, got %d", tt.q, len(tt.expected), result.Len())
|
||||
}
|
||||
|
||||
for kmer := uint64(1); kmer <= 5; kmer++ {
|
||||
shouldContain := tt.expected[kmer]
|
||||
doesContain := result.Contains(kmer)
|
||||
if shouldContain != doesContain {
|
||||
t.Errorf("q=%d, k-mer=%d: expected contains=%v, got %v", tt.q, kmer, shouldContain, doesContain)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumExactlyBasic tests QuorumExactly basic functionality
|
||||
func TestQuorumExactlyBasic(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 5)
|
||||
|
||||
// Setup: k-mer i appears in exactly i sets
|
||||
for kmer := uint64(1); kmer <= 5; kmer++ {
|
||||
for setIdx := 0; setIdx < int(kmer); setIdx++ {
|
||||
group.Get(setIdx).AddKmerCode(kmer)
|
||||
}
|
||||
}
|
||||
|
||||
tests := []struct {
|
||||
q int
|
||||
expected []uint64
|
||||
}{
|
||||
{1, []uint64{1}},
|
||||
{2, []uint64{2}},
|
||||
{3, []uint64{3}},
|
||||
{4, []uint64{4}},
|
||||
{5, []uint64{5}},
|
||||
}
|
||||
|
||||
for _, tt := range tests {
|
||||
result := group.QuorumExactly(tt.q)
|
||||
|
||||
if result.Len() != uint64(len(tt.expected)) {
|
||||
t.Errorf("q=%d: expected %d k-mers, got %d", tt.q, len(tt.expected), result.Len())
|
||||
}
|
||||
|
||||
for _, kmer := range tt.expected {
|
||||
if !result.Contains(kmer) {
|
||||
t.Errorf("q=%d: missing k-mer %d", tt.q, kmer)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumIdentity tests the mathematical identity: Exactly(q) = AtLeast(q) - AtLeast(q+1)
|
||||
func TestQuorumIdentity(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 4)
|
||||
|
||||
// Add random distribution
|
||||
group.Get(0).AddKmerCode(1)
|
||||
group.Get(0).AddKmerCode(2)
|
||||
group.Get(0).AddKmerCode(3)
|
||||
|
||||
group.Get(1).AddKmerCode(2)
|
||||
group.Get(1).AddKmerCode(3)
|
||||
group.Get(1).AddKmerCode(4)
|
||||
|
||||
group.Get(2).AddKmerCode(3)
|
||||
group.Get(2).AddKmerCode(4)
|
||||
|
||||
group.Get(3).AddKmerCode(4)
|
||||
|
||||
for q := 1; q <= 4; q++ {
|
||||
exactly := group.QuorumExactly(q)
|
||||
atLeast := group.QuorumAtLeast(q)
|
||||
atLeastPlus1 := group.QuorumAtLeast(q + 1)
|
||||
|
||||
// Verify: every element in exactly(q) is in atLeast(q)
|
||||
iter := exactly.Iterator()
|
||||
for iter.HasNext() {
|
||||
kmer := iter.Next()
|
||||
if !atLeast.Contains(kmer) {
|
||||
t.Errorf("q=%d: k-mer %d in Exactly but not in AtLeast", q, kmer)
|
||||
}
|
||||
if atLeastPlus1.Contains(kmer) {
|
||||
t.Errorf("q=%d: k-mer %d in Exactly but also in AtLeast(q+1)", q, kmer)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumDisjointSets tests quorum on completely disjoint sets
|
||||
func TestQuorumDisjointSets(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 3)
|
||||
|
||||
// Each set has unique k-mers
|
||||
group.Get(0).AddKmerCode(1)
|
||||
group.Get(1).AddKmerCode(2)
|
||||
group.Get(2).AddKmerCode(3)
|
||||
|
||||
// q=1 should give all
|
||||
result := group.QuorumAtLeast(1)
|
||||
if result.Len() != 3 {
|
||||
t.Errorf("Disjoint sets q=1: expected 3, got %d", result.Len())
|
||||
}
|
||||
|
||||
// q=2 should give none
|
||||
result = group.QuorumAtLeast(2)
|
||||
if result.Len() != 0 {
|
||||
t.Errorf("Disjoint sets q=2: expected 0, got %d", result.Len())
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumIdenticalSets tests quorum on identical sets
|
||||
func TestQuorumIdenticalSets(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 3)
|
||||
|
||||
// All sets have same k-mers
|
||||
for i := 0; i < 3; i++ {
|
||||
group.Get(i).AddKmerCode(10)
|
||||
group.Get(i).AddKmerCode(20)
|
||||
group.Get(i).AddKmerCode(30)
|
||||
}
|
||||
|
||||
// Any q <= n should give all k-mers
|
||||
for q := 1; q <= 3; q++ {
|
||||
result := group.QuorumAtLeast(q)
|
||||
if result.Len() != 3 {
|
||||
t.Errorf("Identical sets q=%d: expected 3, got %d", q, result.Len())
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumLargeNumbers tests with large k-mer values
|
||||
func TestQuorumLargeNumbers(t *testing.T) {
|
||||
k := 21
|
||||
group := NewKmerSetGroup(k, 3)
|
||||
|
||||
// Use large uint64 values (actual k-mer encodings)
|
||||
largeKmers := []uint64{
|
||||
0x1234567890ABCDEF,
|
||||
0xFEDCBA0987654321,
|
||||
0xAAAAAAAAAAAAAAAA,
|
||||
}
|
||||
|
||||
// Add to multiple sets
|
||||
for i := 0; i < 3; i++ {
|
||||
for j := 0; j <= i; j++ {
|
||||
group.Get(j).AddKmerCode(largeKmers[i])
|
||||
}
|
||||
}
|
||||
|
||||
result := group.QuorumAtLeast(2)
|
||||
if result.Len() != 2 {
|
||||
t.Errorf("Large numbers q=2: expected 2, got %d", result.Len())
|
||||
}
|
||||
|
||||
if !result.Contains(largeKmers[1]) || !result.Contains(largeKmers[2]) {
|
||||
t.Error("Large numbers: wrong k-mers in result")
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumAtMostBasic tests QuorumAtMost basic functionality
|
||||
func TestQuorumAtMostBasic(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 5)
|
||||
|
||||
// Setup: k-mer i appears in exactly i sets
|
||||
for kmer := uint64(1); kmer <= 5; kmer++ {
|
||||
for setIdx := 0; setIdx < int(kmer); setIdx++ {
|
||||
group.Get(setIdx).AddKmerCode(kmer)
|
||||
}
|
||||
}
|
||||
|
||||
tests := []struct {
|
||||
q int
|
||||
expected []uint64
|
||||
}{
|
||||
{0, []uint64{}}, // at most 0: none
|
||||
{1, []uint64{1}}, // at most 1: only k-mer 1
|
||||
{2, []uint64{1, 2}}, // at most 2: k-mers 1,2
|
||||
{3, []uint64{1, 2, 3}}, // at most 3: k-mers 1,2,3
|
||||
{4, []uint64{1, 2, 3, 4}}, // at most 4: k-mers 1,2,3,4
|
||||
{5, []uint64{1, 2, 3, 4, 5}}, // at most 5: all k-mers
|
||||
{10, []uint64{1, 2, 3, 4, 5}}, // at most 10: all k-mers
|
||||
}
|
||||
|
||||
for _, tt := range tests {
|
||||
result := group.QuorumAtMost(tt.q)
|
||||
|
||||
if result.Len() != uint64(len(tt.expected)) {
|
||||
t.Errorf("q=%d: expected %d k-mers, got %d", tt.q, len(tt.expected), result.Len())
|
||||
}
|
||||
|
||||
for _, kmer := range tt.expected {
|
||||
if !result.Contains(kmer) {
|
||||
t.Errorf("q=%d: missing k-mer %d", tt.q, kmer)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// TestQuorumComplementIdentity tests that AtLeast and AtMost are complementary
|
||||
func TestQuorumComplementIdentity(t *testing.T) {
|
||||
k := 5
|
||||
group := NewKmerSetGroup(k, 4)
|
||||
|
||||
// Add random distribution
|
||||
group.Get(0).AddKmerCode(1)
|
||||
group.Get(0).AddKmerCode(2)
|
||||
group.Get(0).AddKmerCode(3)
|
||||
|
||||
group.Get(1).AddKmerCode(2)
|
||||
group.Get(1).AddKmerCode(3)
|
||||
group.Get(1).AddKmerCode(4)
|
||||
|
||||
group.Get(2).AddKmerCode(3)
|
||||
group.Get(2).AddKmerCode(4)
|
||||
|
||||
group.Get(3).AddKmerCode(4)
|
||||
|
||||
union := group.Union()
|
||||
|
||||
for q := 1; q < 4; q++ {
|
||||
atMost := group.QuorumAtMost(q)
|
||||
atLeast := group.QuorumAtLeast(q + 1)
|
||||
|
||||
// Verify: AtMost(q) ∪ AtLeast(q+1) = Union()
|
||||
combined := atMost.Union(atLeast)
|
||||
|
||||
if combined.Len() != union.Len() {
|
||||
t.Errorf("q=%d: AtMost(q) ∪ AtLeast(q+1) has %d k-mers, Union has %d",
|
||||
q, combined.Len(), union.Len())
|
||||
}
|
||||
|
||||
// Verify: AtMost(q) ∩ AtLeast(q+1) = ∅
|
||||
overlap := atMost.Intersect(atLeast)
|
||||
if overlap.Len() != 0 {
|
||||
t.Errorf("q=%d: AtMost(q) and AtLeast(q+1) overlap with %d k-mers",
|
||||
q, overlap.Len())
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// BenchmarkQuorumAtLeast benchmarks quorum operations
|
||||
func BenchmarkQuorumAtLeast(b *testing.B) {
|
||||
k := 21
|
||||
n := 10
|
||||
group := NewKmerSetGroup(k, n)
|
||||
|
||||
// Populate with realistic data
|
||||
for i := 0; i < n; i++ {
|
||||
for j := uint64(0); j < 10000; j++ {
|
||||
if (j % uint64(n)) <= uint64(i) {
|
||||
group.Get(i).AddKmerCode(j)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
b.ResetTimer()
|
||||
for i := 0; i < b.N; i++ {
|
||||
_ = group.QuorumAtLeast(5)
|
||||
}
|
||||
}
|
||||
@@ -1,376 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"encoding/json"
|
||||
"fmt"
|
||||
"os"
|
||||
"path/filepath"
|
||||
"strings"
|
||||
|
||||
"github.com/pelletier/go-toml/v2"
|
||||
"gopkg.in/yaml.v3"
|
||||
)
|
||||
|
||||
// MetadataFormat represents the metadata serialization format
|
||||
type MetadataFormat int
|
||||
|
||||
const (
|
||||
FormatTOML MetadataFormat = iota
|
||||
FormatYAML
|
||||
FormatJSON
|
||||
)
|
||||
|
||||
// String returns the file extension for the format
|
||||
func (f MetadataFormat) String() string {
|
||||
switch f {
|
||||
case FormatTOML:
|
||||
return "toml"
|
||||
case FormatYAML:
|
||||
return "yaml"
|
||||
case FormatJSON:
|
||||
return "json"
|
||||
default:
|
||||
return "toml"
|
||||
}
|
||||
}
|
||||
|
||||
// KmerSetMetadata contient les métadonnées d'un KmerSet ou KmerSetGroup
|
||||
type KmerSetMetadata struct {
|
||||
ID string `toml:"id,omitempty" yaml:"id,omitempty" json:"id,omitempty"` // Identifiant unique
|
||||
K int `toml:"k" yaml:"k" json:"k"` // Taille des k-mers
|
||||
Type string `toml:"type" yaml:"type" json:"type"` // "KmerSet" ou "KmerSetGroup"
|
||||
Size int `toml:"size" yaml:"size" json:"size"` // 1 pour KmerSet, n pour KmerSetGroup
|
||||
Files []string `toml:"files" yaml:"files" json:"files"` // Liste des fichiers .roaring
|
||||
SetsIDs []string `toml:"sets_ids,omitempty" yaml:"sets_ids,omitempty" json:"sets_ids,omitempty"` // IDs des KmerSet individuels
|
||||
UserMetadata map[string]interface{} `toml:"user_metadata,omitempty" yaml:"user_metadata,omitempty" json:"user_metadata,omitempty"` // Métadonnées KmerSet ou KmerSetGroup
|
||||
SetsMetadata []map[string]interface{} `toml:"sets_metadata,omitempty" yaml:"sets_metadata,omitempty" json:"sets_metadata,omitempty"` // Métadonnées des KmerSet individuels dans un KmerSetGroup
|
||||
}
|
||||
|
||||
// SaveKmerSet sauvegarde un KmerSet dans un répertoire
|
||||
// Format: directory/metadata.{toml,yaml,json} + directory/set_0.roaring
|
||||
func (ks *KmerSet) Save(directory string, format MetadataFormat) error {
|
||||
// Créer le répertoire si nécessaire
|
||||
if err := os.MkdirAll(directory, 0755); err != nil {
|
||||
return fmt.Errorf("failed to create directory %s: %w", directory, err)
|
||||
}
|
||||
|
||||
// Métadonnées
|
||||
metadata := KmerSetMetadata{
|
||||
ID: ks.id,
|
||||
K: ks.k,
|
||||
Type: "KmerSet",
|
||||
Size: 1,
|
||||
Files: []string{"set_0.roaring"},
|
||||
UserMetadata: ks.Metadata, // Sauvegarder les métadonnées utilisateur
|
||||
}
|
||||
|
||||
// Sauvegarder les métadonnées
|
||||
if err := saveMetadata(filepath.Join(directory, "metadata."+format.String()), metadata, format); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Sauvegarder le bitmap
|
||||
bitmapPath := filepath.Join(directory, "set_0.roaring")
|
||||
file, err := os.Create(bitmapPath)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to create bitmap file %s: %w", bitmapPath, err)
|
||||
}
|
||||
defer file.Close()
|
||||
|
||||
if _, err := ks.bitmap.WriteTo(file); err != nil {
|
||||
return fmt.Errorf("failed to write bitmap: %w", err)
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
|
||||
// LoadKmerSet charge un KmerSet depuis un répertoire
|
||||
func LoadKmerSet(directory string) (*KmerSet, error) {
|
||||
// Lire les métadonnées (essayer tous les formats)
|
||||
metadata, err := loadMetadata(directory)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
// Vérifier le type
|
||||
if metadata.Type != "KmerSet" {
|
||||
return nil, fmt.Errorf("invalid type: expected KmerSet, got %s", metadata.Type)
|
||||
}
|
||||
|
||||
// Vérifier qu'il n'y a qu'un seul fichier
|
||||
if metadata.Size != 1 || len(metadata.Files) != 1 {
|
||||
return nil, fmt.Errorf("KmerSet must have exactly 1 bitmap file, got %d", len(metadata.Files))
|
||||
}
|
||||
|
||||
// Charger le bitmap
|
||||
bitmapPath := filepath.Join(directory, metadata.Files[0])
|
||||
file, err := os.Open(bitmapPath)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("failed to open bitmap file %s: %w", bitmapPath, err)
|
||||
}
|
||||
defer file.Close()
|
||||
|
||||
ks := NewKmerSet(metadata.K)
|
||||
|
||||
// Charger l'ID
|
||||
ks.id = metadata.ID
|
||||
|
||||
// Charger les métadonnées utilisateur
|
||||
if metadata.UserMetadata != nil {
|
||||
ks.Metadata = metadata.UserMetadata
|
||||
}
|
||||
|
||||
if _, err := ks.bitmap.ReadFrom(file); err != nil {
|
||||
return nil, fmt.Errorf("failed to read bitmap: %w", err)
|
||||
}
|
||||
|
||||
return ks, nil
|
||||
}
|
||||
|
||||
// SaveKmerSetGroup sauvegarde un KmerSetGroup dans un répertoire
|
||||
// Format: directory/metadata.{toml,yaml,json} + directory/set_0.roaring, set_1.roaring, ...
|
||||
func (ksg *KmerSetGroup) Save(directory string, format MetadataFormat) error {
|
||||
// Créer le répertoire si nécessaire
|
||||
if err := os.MkdirAll(directory, 0755); err != nil {
|
||||
return fmt.Errorf("failed to create directory %s: %w", directory, err)
|
||||
}
|
||||
|
||||
// Métadonnées
|
||||
files := make([]string, len(ksg.sets))
|
||||
for i := range ksg.sets {
|
||||
files[i] = fmt.Sprintf("set_%d.roaring", i)
|
||||
}
|
||||
|
||||
// Collecter les IDs et métadonnées de chaque KmerSet individuel
|
||||
setsIDs := make([]string, len(ksg.sets))
|
||||
setsMetadata := make([]map[string]interface{}, len(ksg.sets))
|
||||
for i, ks := range ksg.sets {
|
||||
setsIDs[i] = ks.id
|
||||
setsMetadata[i] = ks.Metadata
|
||||
}
|
||||
|
||||
metadata := KmerSetMetadata{
|
||||
ID: ksg.id,
|
||||
K: ksg.k,
|
||||
Type: "KmerSetGroup",
|
||||
Size: len(ksg.sets),
|
||||
Files: files,
|
||||
SetsIDs: setsIDs, // IDs de chaque set
|
||||
UserMetadata: ksg.Metadata, // Métadonnées du groupe
|
||||
SetsMetadata: setsMetadata, // Métadonnées de chaque set
|
||||
}
|
||||
|
||||
// Sauvegarder les métadonnées
|
||||
if err := saveMetadata(filepath.Join(directory, "metadata."+format.String()), metadata, format); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Sauvegarder chaque bitmap
|
||||
for i, ks := range ksg.sets {
|
||||
bitmapPath := filepath.Join(directory, files[i])
|
||||
file, err := os.Create(bitmapPath)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to create bitmap file %s: %w", bitmapPath, err)
|
||||
}
|
||||
|
||||
if _, err := ks.bitmap.WriteTo(file); err != nil {
|
||||
file.Close()
|
||||
return fmt.Errorf("failed to write bitmap %d: %w", i, err)
|
||||
}
|
||||
file.Close()
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
|
||||
// LoadKmerSetGroup charge un KmerSetGroup depuis un répertoire
|
||||
func LoadKmerSetGroup(directory string) (*KmerSetGroup, error) {
|
||||
// Lire les métadonnées (essayer tous les formats)
|
||||
metadata, err := loadMetadata(directory)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
|
||||
// Vérifier le type
|
||||
if metadata.Type != "KmerSetGroup" {
|
||||
return nil, fmt.Errorf("invalid type: expected KmerSetGroup, got %s", metadata.Type)
|
||||
}
|
||||
|
||||
// Vérifier la cohérence
|
||||
if metadata.Size != len(metadata.Files) {
|
||||
return nil, fmt.Errorf("size mismatch: size=%d but %d files listed", metadata.Size, len(metadata.Files))
|
||||
}
|
||||
|
||||
// Créer le groupe
|
||||
ksg := NewKmerSetGroup(metadata.K, metadata.Size)
|
||||
|
||||
// Charger l'ID du groupe
|
||||
ksg.id = metadata.ID
|
||||
|
||||
// Charger les métadonnées du groupe
|
||||
if metadata.UserMetadata != nil {
|
||||
ksg.Metadata = metadata.UserMetadata
|
||||
}
|
||||
|
||||
// Charger les IDs de chaque KmerSet
|
||||
if metadata.SetsIDs != nil && len(metadata.SetsIDs) == metadata.Size {
|
||||
for i := range ksg.sets {
|
||||
ksg.sets[i].id = metadata.SetsIDs[i]
|
||||
}
|
||||
}
|
||||
|
||||
// Charger les métadonnées de chaque KmerSet individuel
|
||||
if metadata.SetsMetadata != nil {
|
||||
if len(metadata.SetsMetadata) != metadata.Size {
|
||||
return nil, fmt.Errorf("sets metadata size mismatch: expected %d, got %d", metadata.Size, len(metadata.SetsMetadata))
|
||||
}
|
||||
for i := range ksg.sets {
|
||||
ksg.sets[i].Metadata = metadata.SetsMetadata[i]
|
||||
}
|
||||
}
|
||||
|
||||
// Charger chaque bitmap
|
||||
for i, filename := range metadata.Files {
|
||||
bitmapPath := filepath.Join(directory, filename)
|
||||
file, err := os.Open(bitmapPath)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("failed to open bitmap file %s: %w", bitmapPath, err)
|
||||
}
|
||||
|
||||
if _, err := ksg.sets[i].bitmap.ReadFrom(file); err != nil {
|
||||
file.Close()
|
||||
return nil, fmt.Errorf("failed to read bitmap %d: %w", i, err)
|
||||
}
|
||||
file.Close()
|
||||
}
|
||||
|
||||
return ksg, nil
|
||||
}
|
||||
|
||||
// saveMetadata sauvegarde les métadonnées dans le format spécifié
|
||||
func saveMetadata(path string, metadata KmerSetMetadata, format MetadataFormat) error {
|
||||
file, err := os.Create(path)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to create metadata file %s: %w", path, err)
|
||||
}
|
||||
defer file.Close()
|
||||
|
||||
var encoder interface{ Encode(interface{}) error }
|
||||
|
||||
switch format {
|
||||
case FormatTOML:
|
||||
encoder = toml.NewEncoder(file)
|
||||
case FormatYAML:
|
||||
encoder = yaml.NewEncoder(file)
|
||||
case FormatJSON:
|
||||
jsonEncoder := json.NewEncoder(file)
|
||||
jsonEncoder.SetIndent("", " ")
|
||||
encoder = jsonEncoder
|
||||
default:
|
||||
return fmt.Errorf("unsupported format: %v", format)
|
||||
}
|
||||
|
||||
if err := encoder.Encode(metadata); err != nil {
|
||||
return fmt.Errorf("failed to encode metadata: %w", err)
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
|
||||
// loadMetadata charge les métadonnées depuis un répertoire
|
||||
// Essaie tous les formats (TOML, YAML, JSON) dans l'ordre
|
||||
func loadMetadata(directory string) (*KmerSetMetadata, error) {
|
||||
formats := []MetadataFormat{FormatTOML, FormatYAML, FormatJSON}
|
||||
|
||||
var lastErr error
|
||||
for _, format := range formats {
|
||||
path := filepath.Join(directory, "metadata."+format.String())
|
||||
|
||||
// Vérifier si le fichier existe
|
||||
if _, err := os.Stat(path); os.IsNotExist(err) {
|
||||
continue
|
||||
}
|
||||
|
||||
metadata, err := loadMetadataFromFile(path, format)
|
||||
if err != nil {
|
||||
lastErr = err
|
||||
continue
|
||||
}
|
||||
return metadata, nil
|
||||
}
|
||||
|
||||
if lastErr != nil {
|
||||
return nil, fmt.Errorf("failed to load metadata: %w", lastErr)
|
||||
}
|
||||
return nil, fmt.Errorf("no metadata file found in %s (tried .toml, .yaml, .json)", directory)
|
||||
}
|
||||
|
||||
// loadMetadataFromFile charge les métadonnées depuis un fichier spécifique
|
||||
func loadMetadataFromFile(path string, format MetadataFormat) (*KmerSetMetadata, error) {
|
||||
file, err := os.Open(path)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("failed to open metadata file %s: %w", path, err)
|
||||
}
|
||||
defer file.Close()
|
||||
|
||||
var metadata KmerSetMetadata
|
||||
var decoder interface{ Decode(interface{}) error }
|
||||
|
||||
switch format {
|
||||
case FormatTOML:
|
||||
decoder = toml.NewDecoder(file)
|
||||
case FormatYAML:
|
||||
decoder = yaml.NewDecoder(file)
|
||||
case FormatJSON:
|
||||
decoder = json.NewDecoder(file)
|
||||
default:
|
||||
return nil, fmt.Errorf("unsupported format: %v", format)
|
||||
}
|
||||
|
||||
if err := decoder.Decode(&metadata); err != nil {
|
||||
return nil, fmt.Errorf("failed to decode metadata: %w", err)
|
||||
}
|
||||
|
||||
return &metadata, nil
|
||||
}
|
||||
|
||||
// DetectFormat détecte le format des métadonnées dans un répertoire
|
||||
func DetectFormat(directory string) (MetadataFormat, error) {
|
||||
formats := []MetadataFormat{FormatTOML, FormatYAML, FormatJSON}
|
||||
|
||||
for _, format := range formats {
|
||||
path := filepath.Join(directory, "metadata."+format.String())
|
||||
if _, err := os.Stat(path); err == nil {
|
||||
return format, nil
|
||||
}
|
||||
}
|
||||
|
||||
return FormatTOML, fmt.Errorf("no metadata file found in %s", directory)
|
||||
}
|
||||
|
||||
// IsKmerSetDirectory vérifie si un répertoire contient un KmerSet ou KmerSetGroup
|
||||
func IsKmerSetDirectory(directory string) (bool, string, error) {
|
||||
metadata, err := loadMetadata(directory)
|
||||
if err != nil {
|
||||
return false, "", err
|
||||
}
|
||||
|
||||
return true, metadata.Type, nil
|
||||
}
|
||||
|
||||
// ListBitmapFiles liste tous les fichiers .roaring dans un répertoire
|
||||
func ListBitmapFiles(directory string) ([]string, error) {
|
||||
entries, err := os.ReadDir(directory)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("failed to read directory %s: %w", directory, err)
|
||||
}
|
||||
|
||||
var files []string
|
||||
for _, entry := range entries {
|
||||
if !entry.IsDir() && strings.HasSuffix(entry.Name(), ".roaring") {
|
||||
files = append(files, entry.Name())
|
||||
}
|
||||
}
|
||||
|
||||
return files, nil
|
||||
}
|
||||
@@ -1,272 +0,0 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"math"
|
||||
"testing"
|
||||
)
|
||||
|
||||
func TestJaccardDistanceIdentical(t *testing.T) {
|
||||
ks1 := NewKmerSet(5)
|
||||
ks1.AddKmerCode(100)
|
||||
ks1.AddKmerCode(200)
|
||||
ks1.AddKmerCode(300)
|
||||
|
||||
ks2 := NewKmerSet(5)
|
||||
ks2.AddKmerCode(100)
|
||||
ks2.AddKmerCode(200)
|
||||
ks2.AddKmerCode(300)
|
||||
|
||||
distance := ks1.JaccardDistance(ks2)
|
||||
similarity := ks1.JaccardSimilarity(ks2)
|
||||
|
||||
if distance != 0.0 {
|
||||
t.Errorf("Expected distance 0.0 for identical sets, got %f", distance)
|
||||
}
|
||||
|
||||
if similarity != 1.0 {
|
||||
t.Errorf("Expected similarity 1.0 for identical sets, got %f", similarity)
|
||||
}
|
||||
}
|
||||
|
||||
func TestJaccardDistanceDisjoint(t *testing.T) {
|
||||
ks1 := NewKmerSet(5)
|
||||
ks1.AddKmerCode(100)
|
||||
ks1.AddKmerCode(200)
|
||||
ks1.AddKmerCode(300)
|
||||
|
||||
ks2 := NewKmerSet(5)
|
||||
ks2.AddKmerCode(400)
|
||||
ks2.AddKmerCode(500)
|
||||
ks2.AddKmerCode(600)
|
||||
|
||||
distance := ks1.JaccardDistance(ks2)
|
||||
similarity := ks1.JaccardSimilarity(ks2)
|
||||
|
||||
if distance != 1.0 {
|
||||
t.Errorf("Expected distance 1.0 for disjoint sets, got %f", distance)
|
||||
}
|
||||
|
||||
if similarity != 0.0 {
|
||||
t.Errorf("Expected similarity 0.0 for disjoint sets, got %f", similarity)
|
||||
}
|
||||
}
|
||||
|
||||
func TestJaccardDistancePartialOverlap(t *testing.T) {
|
||||
// Set 1: {1, 2, 3}
|
||||
ks1 := NewKmerSet(5)
|
||||
ks1.AddKmerCode(1)
|
||||
ks1.AddKmerCode(2)
|
||||
ks1.AddKmerCode(3)
|
||||
|
||||
// Set 2: {2, 3, 4}
|
||||
ks2 := NewKmerSet(5)
|
||||
ks2.AddKmerCode(2)
|
||||
ks2.AddKmerCode(3)
|
||||
ks2.AddKmerCode(4)
|
||||
|
||||
// Intersection: {2, 3} -> cardinality = 2
|
||||
// Union: {1, 2, 3, 4} -> cardinality = 4
|
||||
// Similarity = 2/4 = 0.5
|
||||
// Distance = 1 - 0.5 = 0.5
|
||||
|
||||
distance := ks1.JaccardDistance(ks2)
|
||||
similarity := ks1.JaccardSimilarity(ks2)
|
||||
|
||||
expectedDistance := 0.5
|
||||
expectedSimilarity := 0.5
|
||||
|
||||
if math.Abs(distance-expectedDistance) > 1e-10 {
|
||||
t.Errorf("Expected distance %f, got %f", expectedDistance, distance)
|
||||
}
|
||||
|
||||
if math.Abs(similarity-expectedSimilarity) > 1e-10 {
|
||||
t.Errorf("Expected similarity %f, got %f", expectedSimilarity, similarity)
|
||||
}
|
||||
}
|
||||
|
||||
func TestJaccardDistanceOneSubsetOfOther(t *testing.T) {
|
||||
// Set 1: {1, 2}
|
||||
ks1 := NewKmerSet(5)
|
||||
ks1.AddKmerCode(1)
|
||||
ks1.AddKmerCode(2)
|
||||
|
||||
// Set 2: {1, 2, 3, 4}
|
||||
ks2 := NewKmerSet(5)
|
||||
ks2.AddKmerCode(1)
|
||||
ks2.AddKmerCode(2)
|
||||
ks2.AddKmerCode(3)
|
||||
ks2.AddKmerCode(4)
|
||||
|
||||
// Intersection: {1, 2} -> cardinality = 2
|
||||
// Union: {1, 2, 3, 4} -> cardinality = 4
|
||||
// Similarity = 2/4 = 0.5
|
||||
// Distance = 1 - 0.5 = 0.5
|
||||
|
||||
distance := ks1.JaccardDistance(ks2)
|
||||
similarity := ks1.JaccardSimilarity(ks2)
|
||||
|
||||
expectedDistance := 0.5
|
||||
expectedSimilarity := 0.5
|
||||
|
||||
if math.Abs(distance-expectedDistance) > 1e-10 {
|
||||
t.Errorf("Expected distance %f, got %f", expectedDistance, distance)
|
||||
}
|
||||
|
||||
if math.Abs(similarity-expectedSimilarity) > 1e-10 {
|
||||
t.Errorf("Expected similarity %f, got %f", expectedSimilarity, similarity)
|
||||
}
|
||||
}
|
||||
|
||||
func TestJaccardDistanceEmptySets(t *testing.T) {
|
||||
ks1 := NewKmerSet(5)
|
||||
ks2 := NewKmerSet(5)
|
||||
|
||||
distance := ks1.JaccardDistance(ks2)
|
||||
similarity := ks1.JaccardSimilarity(ks2)
|
||||
|
||||
// By convention, distance = 1.0 for empty sets
|
||||
if distance != 1.0 {
|
||||
t.Errorf("Expected distance 1.0 for empty sets, got %f", distance)
|
||||
}
|
||||
|
||||
if similarity != 0.0 {
|
||||
t.Errorf("Expected similarity 0.0 for empty sets, got %f", similarity)
|
||||
}
|
||||
}
|
||||
|
||||
func TestJaccardDistanceOneEmpty(t *testing.T) {
|
||||
ks1 := NewKmerSet(5)
|
||||
ks1.AddKmerCode(1)
|
||||
ks1.AddKmerCode(2)
|
||||
ks1.AddKmerCode(3)
|
||||
|
||||
ks2 := NewKmerSet(5)
|
||||
|
||||
distance := ks1.JaccardDistance(ks2)
|
||||
similarity := ks1.JaccardSimilarity(ks2)
|
||||
|
||||
// Intersection: {} -> cardinality = 0
|
||||
// Union: {1, 2, 3} -> cardinality = 3
|
||||
// Similarity = 0/3 = 0.0
|
||||
// Distance = 1.0
|
||||
|
||||
if distance != 1.0 {
|
||||
t.Errorf("Expected distance 1.0 when one set is empty, got %f", distance)
|
||||
}
|
||||
|
||||
if similarity != 0.0 {
|
||||
t.Errorf("Expected similarity 0.0 when one set is empty, got %f", similarity)
|
||||
}
|
||||
}
|
||||
|
||||
func TestJaccardDistanceDifferentK(t *testing.T) {
|
||||
ks1 := NewKmerSet(5)
|
||||
ks1.AddKmerCode(1)
|
||||
|
||||
ks2 := NewKmerSet(7)
|
||||
ks2.AddKmerCode(1)
|
||||
|
||||
defer func() {
|
||||
if r := recover(); r == nil {
|
||||
t.Errorf("Expected panic when computing Jaccard distance with different k values")
|
||||
}
|
||||
}()
|
||||
|
||||
_ = ks1.JaccardDistance(ks2)
|
||||
}
|
||||
|
||||
func TestJaccardDistanceSimilarityRelation(t *testing.T) {
|
||||
// Test that distance + similarity = 1.0 for all cases
|
||||
testCases := []struct {
|
||||
name string
|
||||
ks1 *KmerSet
|
||||
ks2 *KmerSet
|
||||
}{
|
||||
{
|
||||
name: "partial overlap",
|
||||
ks1: func() *KmerSet {
|
||||
ks := NewKmerSet(5)
|
||||
ks.AddKmerCode(1)
|
||||
ks.AddKmerCode(2)
|
||||
ks.AddKmerCode(3)
|
||||
return ks
|
||||
}(),
|
||||
ks2: func() *KmerSet {
|
||||
ks := NewKmerSet(5)
|
||||
ks.AddKmerCode(2)
|
||||
ks.AddKmerCode(3)
|
||||
ks.AddKmerCode(4)
|
||||
ks.AddKmerCode(5)
|
||||
return ks
|
||||
}(),
|
||||
},
|
||||
{
|
||||
name: "identical",
|
||||
ks1: func() *KmerSet {
|
||||
ks := NewKmerSet(5)
|
||||
ks.AddKmerCode(10)
|
||||
ks.AddKmerCode(20)
|
||||
return ks
|
||||
}(),
|
||||
ks2: func() *KmerSet {
|
||||
ks := NewKmerSet(5)
|
||||
ks.AddKmerCode(10)
|
||||
ks.AddKmerCode(20)
|
||||
return ks
|
||||
}(),
|
||||
},
|
||||
{
|
||||
name: "disjoint",
|
||||
ks1: func() *KmerSet {
|
||||
ks := NewKmerSet(5)
|
||||
ks.AddKmerCode(1)
|
||||
return ks
|
||||
}(),
|
||||
ks2: func() *KmerSet {
|
||||
ks := NewKmerSet(5)
|
||||
ks.AddKmerCode(100)
|
||||
return ks
|
||||
}(),
|
||||
},
|
||||
}
|
||||
|
||||
for _, tc := range testCases {
|
||||
t.Run(tc.name, func(t *testing.T) {
|
||||
distance := tc.ks1.JaccardDistance(tc.ks2)
|
||||
similarity := tc.ks1.JaccardSimilarity(tc.ks2)
|
||||
|
||||
sum := distance + similarity
|
||||
|
||||
if math.Abs(sum-1.0) > 1e-10 {
|
||||
t.Errorf("Expected distance + similarity = 1.0, got %f + %f = %f",
|
||||
distance, similarity, sum)
|
||||
}
|
||||
})
|
||||
}
|
||||
}
|
||||
|
||||
func TestJaccardDistanceSymmetry(t *testing.T) {
|
||||
ks1 := NewKmerSet(5)
|
||||
ks1.AddKmerCode(1)
|
||||
ks1.AddKmerCode(2)
|
||||
ks1.AddKmerCode(3)
|
||||
|
||||
ks2 := NewKmerSet(5)
|
||||
ks2.AddKmerCode(2)
|
||||
ks2.AddKmerCode(3)
|
||||
ks2.AddKmerCode(4)
|
||||
|
||||
distance1 := ks1.JaccardDistance(ks2)
|
||||
distance2 := ks2.JaccardDistance(ks1)
|
||||
|
||||
similarity1 := ks1.JaccardSimilarity(ks2)
|
||||
similarity2 := ks2.JaccardSimilarity(ks1)
|
||||
|
||||
if math.Abs(distance1-distance2) > 1e-10 {
|
||||
t.Errorf("Jaccard distance not symmetric: %f vs %f", distance1, distance2)
|
||||
}
|
||||
|
||||
if math.Abs(similarity1-similarity2) > 1e-10 {
|
||||
t.Errorf("Jaccard similarity not symmetric: %f vs %f", similarity1, similarity2)
|
||||
}
|
||||
}
|
||||
@@ -0,0 +1,47 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"math"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
)
|
||||
|
||||
// DefaultMinimizerSize returns ceil(k / 2.5) as a reasonable default minimizer size.
|
||||
func DefaultMinimizerSize(k int) int {
|
||||
m := int(math.Ceil(float64(k) / 2.5))
|
||||
if m < 1 {
|
||||
m = 1
|
||||
}
|
||||
if m >= k {
|
||||
m = k - 1
|
||||
}
|
||||
return m
|
||||
}
|
||||
|
||||
// MinMinimizerSize returns the minimum m such that 4^m >= nworkers,
|
||||
// i.e. ceil(log(nworkers) / log(4)).
|
||||
func MinMinimizerSize(nworkers int) int {
|
||||
if nworkers <= 1 {
|
||||
return 1
|
||||
}
|
||||
return int(math.Ceil(math.Log(float64(nworkers)) / math.Log(4)))
|
||||
}
|
||||
|
||||
// ValidateMinimizerSize checks and adjusts the minimizer size to satisfy constraints:
|
||||
// - m >= ceil(log(nworkers)/log(4))
|
||||
// - 1 <= m < k
|
||||
func ValidateMinimizerSize(m, k, nworkers int) int {
|
||||
minM := MinMinimizerSize(nworkers)
|
||||
if m < minM {
|
||||
log.Warnf("Minimizer size %d too small for %d workers (4^%d = %d < %d), adjusting to %d",
|
||||
m, nworkers, m, 1<<(2*m), nworkers, minM)
|
||||
m = minM
|
||||
}
|
||||
if m < 1 {
|
||||
m = 1
|
||||
}
|
||||
if m >= k {
|
||||
m = k - 1
|
||||
}
|
||||
return m
|
||||
}
|
||||
@@ -0,0 +1,67 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"bufio"
|
||||
"encoding/binary"
|
||||
"io"
|
||||
"os"
|
||||
)
|
||||
|
||||
// decode2bit maps 2-bit codes back to nucleotide bytes.
|
||||
var decode2bit = [4]byte{'a', 'c', 'g', 't'}
|
||||
|
||||
// SkmReader reads super-kmers from a binary .skm file.
|
||||
type SkmReader struct {
|
||||
r *bufio.Reader
|
||||
file *os.File
|
||||
}
|
||||
|
||||
// NewSkmReader opens a .skm file for reading.
|
||||
func NewSkmReader(path string) (*SkmReader, error) {
|
||||
f, err := os.Open(path)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
return &SkmReader{
|
||||
r: bufio.NewReaderSize(f, 65536),
|
||||
file: f,
|
||||
}, nil
|
||||
}
|
||||
|
||||
// Next reads the next super-kmer from the file.
|
||||
// Returns the SuperKmer and true, or a zero SuperKmer and false at EOF.
|
||||
func (sr *SkmReader) Next() (SuperKmer, bool) {
|
||||
// Read length
|
||||
var lenbuf [2]byte
|
||||
if _, err := io.ReadFull(sr.r, lenbuf[:]); err != nil {
|
||||
return SuperKmer{}, false
|
||||
}
|
||||
seqLen := int(binary.LittleEndian.Uint16(lenbuf[:]))
|
||||
|
||||
// Read packed bytes
|
||||
nBytes := (seqLen + 3) / 4
|
||||
packed := make([]byte, nBytes)
|
||||
if _, err := io.ReadFull(sr.r, packed); err != nil {
|
||||
return SuperKmer{}, false
|
||||
}
|
||||
|
||||
// Decode to nucleotide bytes
|
||||
seq := make([]byte, seqLen)
|
||||
for i := 0; i < seqLen; i++ {
|
||||
byteIdx := i / 4
|
||||
bitPos := uint(6 - (i%4)*2)
|
||||
code := (packed[byteIdx] >> bitPos) & 0x03
|
||||
seq[i] = decode2bit[code]
|
||||
}
|
||||
|
||||
return SuperKmer{
|
||||
Sequence: seq,
|
||||
Start: 0,
|
||||
End: seqLen,
|
||||
}, true
|
||||
}
|
||||
|
||||
// Close closes the underlying file.
|
||||
func (sr *SkmReader) Close() error {
|
||||
return sr.file.Close()
|
||||
}
|
||||
@@ -0,0 +1,176 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"os"
|
||||
"path/filepath"
|
||||
"testing"
|
||||
)
|
||||
|
||||
func TestSkmRoundTrip(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "test.skm")
|
||||
|
||||
// Create super-kmers from a known sequence
|
||||
seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT")
|
||||
k := 21
|
||||
m := 9
|
||||
superKmers := ExtractSuperKmers(seq, k, m, nil)
|
||||
if len(superKmers) == 0 {
|
||||
t.Fatal("no super-kmers extracted")
|
||||
}
|
||||
|
||||
// Write
|
||||
w, err := NewSkmWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
for _, sk := range superKmers {
|
||||
if err := w.Write(sk); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Read back
|
||||
r, err := NewSkmReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
idx := 0
|
||||
for {
|
||||
sk, ok := r.Next()
|
||||
if !ok {
|
||||
break
|
||||
}
|
||||
if idx >= len(superKmers) {
|
||||
t.Fatal("read more super-kmers than written")
|
||||
}
|
||||
expected := superKmers[idx]
|
||||
if len(sk.Sequence) != len(expected.Sequence) {
|
||||
t.Fatalf("super-kmer %d: length mismatch: got %d, want %d",
|
||||
idx, len(sk.Sequence), len(expected.Sequence))
|
||||
}
|
||||
// Compare nucleotide-by-nucleotide (case insensitive since decode produces lowercase)
|
||||
for j := range sk.Sequence {
|
||||
got := sk.Sequence[j] | 0x20
|
||||
want := expected.Sequence[j] | 0x20
|
||||
if got != want {
|
||||
t.Fatalf("super-kmer %d pos %d: got %c, want %c", idx, j, got, want)
|
||||
}
|
||||
}
|
||||
idx++
|
||||
}
|
||||
if idx != len(superKmers) {
|
||||
t.Fatalf("read %d super-kmers, want %d", idx, len(superKmers))
|
||||
}
|
||||
}
|
||||
|
||||
func TestSkmEmptyFile(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "empty.skm")
|
||||
|
||||
// Write nothing
|
||||
w, err := NewSkmWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Read back
|
||||
r, err := NewSkmReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
_, ok := r.Next()
|
||||
if ok {
|
||||
t.Fatal("expected no super-kmers in empty file")
|
||||
}
|
||||
}
|
||||
|
||||
func TestSkmSingleBase(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "single.skm")
|
||||
|
||||
// Test with sequences of various lengths to check padding
|
||||
sequences := [][]byte{
|
||||
[]byte("A"),
|
||||
[]byte("AC"),
|
||||
[]byte("ACG"),
|
||||
[]byte("ACGT"),
|
||||
[]byte("ACGTA"),
|
||||
}
|
||||
|
||||
w, err := NewSkmWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
for _, seq := range sequences {
|
||||
sk := SuperKmer{Sequence: seq}
|
||||
if err := w.Write(sk); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
r, err := NewSkmReader(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
defer r.Close()
|
||||
|
||||
for i, expected := range sequences {
|
||||
sk, ok := r.Next()
|
||||
if !ok {
|
||||
t.Fatalf("expected super-kmer %d, got EOF", i)
|
||||
}
|
||||
if len(sk.Sequence) != len(expected) {
|
||||
t.Fatalf("sk %d: length %d, want %d", i, len(sk.Sequence), len(expected))
|
||||
}
|
||||
for j := range sk.Sequence {
|
||||
got := sk.Sequence[j] | 0x20
|
||||
want := expected[j] | 0x20
|
||||
if got != want {
|
||||
t.Fatalf("sk %d pos %d: got %c, want %c", i, j, got, want)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestSkmFileSize(t *testing.T) {
|
||||
dir := t.TempDir()
|
||||
path := filepath.Join(dir, "size.skm")
|
||||
|
||||
// Write a sequence of known length
|
||||
seq := []byte("ACGTACGTAC") // 10 bases
|
||||
sk := SuperKmer{Sequence: seq}
|
||||
|
||||
w, err := NewSkmWriter(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Write(sk); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if err := w.Close(); err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
|
||||
// Expected: 2 bytes (length) + ceil(10/4)=3 bytes (data) = 5 bytes
|
||||
info, err := os.Stat(path)
|
||||
if err != nil {
|
||||
t.Fatal(err)
|
||||
}
|
||||
if info.Size() != 5 {
|
||||
t.Fatalf("file size: got %d, want 5", info.Size())
|
||||
}
|
||||
}
|
||||
@@ -0,0 +1,74 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"bufio"
|
||||
"encoding/binary"
|
||||
"os"
|
||||
)
|
||||
|
||||
// SkmWriter writes super-kmers to a binary .skm file.
|
||||
//
|
||||
// Format per super-kmer:
|
||||
//
|
||||
// [len: uint16 LE] length of the super-kmer in bases
|
||||
// [data: ceil(len/4) bytes] sequence encoded 2 bits/base, packed
|
||||
//
|
||||
// Nucleotide encoding: A=00, C=01, G=10, T=11.
|
||||
// The last byte is zero-padded on the low bits if len%4 != 0.
|
||||
type SkmWriter struct {
|
||||
w *bufio.Writer
|
||||
file *os.File
|
||||
}
|
||||
|
||||
// NewSkmWriter creates a new SkmWriter writing to the given file path.
|
||||
func NewSkmWriter(path string) (*SkmWriter, error) {
|
||||
f, err := os.Create(path)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
return &SkmWriter{
|
||||
w: bufio.NewWriterSize(f, 65536),
|
||||
file: f,
|
||||
}, nil
|
||||
}
|
||||
|
||||
// Write encodes a SuperKmer to the .skm file.
|
||||
// The sequence bytes are packed 2 bits per base.
|
||||
func (sw *SkmWriter) Write(sk SuperKmer) error {
|
||||
seq := sk.Sequence
|
||||
seqLen := uint16(len(seq))
|
||||
|
||||
// Write length
|
||||
var lenbuf [2]byte
|
||||
binary.LittleEndian.PutUint16(lenbuf[:], seqLen)
|
||||
if _, err := sw.w.Write(lenbuf[:]); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Encode and write packed sequence (2 bits/base)
|
||||
nBytes := (int(seqLen) + 3) / 4
|
||||
for i := 0; i < nBytes; i++ {
|
||||
var packed byte
|
||||
for j := 0; j < 4; j++ {
|
||||
pos := i*4 + j
|
||||
packed <<= 2
|
||||
if pos < int(seqLen) {
|
||||
packed |= __single_base_code__[seq[pos]&31]
|
||||
}
|
||||
}
|
||||
if err := sw.w.WriteByte(packed); err != nil {
|
||||
return err
|
||||
}
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
|
||||
// Close flushes buffered data and closes the underlying file.
|
||||
func (sw *SkmWriter) Close() error {
|
||||
if err := sw.w.Flush(); err != nil {
|
||||
sw.file.Close()
|
||||
return err
|
||||
}
|
||||
return sw.file.Close()
|
||||
}
|
||||
@@ -0,0 +1,253 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"bufio"
|
||||
"container/heap"
|
||||
"encoding/csv"
|
||||
"fmt"
|
||||
"os"
|
||||
"sort"
|
||||
"strconv"
|
||||
)
|
||||
|
||||
// KSP file magic bytes: "KSP\x01" (K-mer SPectrum v1)
|
||||
var kspMagic = [4]byte{'K', 'S', 'P', 0x01}
|
||||
|
||||
// SpectrumEntry represents one entry in a k-mer frequency spectrum.
|
||||
type SpectrumEntry struct {
|
||||
Frequency int // how many times a k-mer was observed
|
||||
Count uint64 // how many distinct k-mers have this frequency
|
||||
}
|
||||
|
||||
// KmerSpectrum represents the frequency distribution of k-mers.
|
||||
// Entries are sorted by Frequency in ascending order and only include
|
||||
// non-zero counts.
|
||||
type KmerSpectrum struct {
|
||||
Entries []SpectrumEntry
|
||||
}
|
||||
|
||||
// MaxFrequency returns the highest frequency in the spectrum, or 0 if empty.
|
||||
func (s *KmerSpectrum) MaxFrequency() int {
|
||||
if len(s.Entries) == 0 {
|
||||
return 0
|
||||
}
|
||||
return s.Entries[len(s.Entries)-1].Frequency
|
||||
}
|
||||
|
||||
// ToMap converts a KmerSpectrum back to a map for easy lookup.
|
||||
func (s *KmerSpectrum) ToMap() map[int]uint64 {
|
||||
m := make(map[int]uint64, len(s.Entries))
|
||||
for _, e := range s.Entries {
|
||||
m[e.Frequency] = e.Count
|
||||
}
|
||||
return m
|
||||
}
|
||||
|
||||
// MapToSpectrum converts a map[int]uint64 to a sorted KmerSpectrum.
|
||||
func MapToSpectrum(m map[int]uint64) *KmerSpectrum {
|
||||
entries := make([]SpectrumEntry, 0, len(m))
|
||||
for freq, count := range m {
|
||||
if count > 0 {
|
||||
entries = append(entries, SpectrumEntry{Frequency: freq, Count: count})
|
||||
}
|
||||
}
|
||||
sort.Slice(entries, func(i, j int) bool {
|
||||
return entries[i].Frequency < entries[j].Frequency
|
||||
})
|
||||
return &KmerSpectrum{Entries: entries}
|
||||
}
|
||||
|
||||
// MergeSpectraMaps adds all entries from b into a.
|
||||
func MergeSpectraMaps(a, b map[int]uint64) {
|
||||
for freq, count := range b {
|
||||
a[freq] += count
|
||||
}
|
||||
}
|
||||
|
||||
// WriteSpectrum writes a KmerSpectrum to a binary file.
|
||||
//
|
||||
// Format:
|
||||
//
|
||||
// [magic: 4 bytes "KSP\x01"]
|
||||
// [n_entries: varint]
|
||||
// For each entry (sorted by frequency ascending):
|
||||
// [frequency: varint]
|
||||
// [count: varint]
|
||||
func WriteSpectrum(path string, spectrum *KmerSpectrum) error {
|
||||
f, err := os.Create(path)
|
||||
if err != nil {
|
||||
return fmt.Errorf("create spectrum file: %w", err)
|
||||
}
|
||||
w := bufio.NewWriterSize(f, 65536)
|
||||
|
||||
// Magic
|
||||
if _, err := w.Write(kspMagic[:]); err != nil {
|
||||
f.Close()
|
||||
return err
|
||||
}
|
||||
|
||||
// Number of entries
|
||||
if _, err := EncodeVarint(w, uint64(len(spectrum.Entries))); err != nil {
|
||||
f.Close()
|
||||
return err
|
||||
}
|
||||
|
||||
// Entries
|
||||
for _, e := range spectrum.Entries {
|
||||
if _, err := EncodeVarint(w, uint64(e.Frequency)); err != nil {
|
||||
f.Close()
|
||||
return err
|
||||
}
|
||||
if _, err := EncodeVarint(w, e.Count); err != nil {
|
||||
f.Close()
|
||||
return err
|
||||
}
|
||||
}
|
||||
|
||||
if err := w.Flush(); err != nil {
|
||||
f.Close()
|
||||
return err
|
||||
}
|
||||
return f.Close()
|
||||
}
|
||||
|
||||
// ReadSpectrum reads a KmerSpectrum from a binary file.
|
||||
func ReadSpectrum(path string) (*KmerSpectrum, error) {
|
||||
f, err := os.Open(path)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
defer f.Close()
|
||||
|
||||
r := bufio.NewReaderSize(f, 65536)
|
||||
|
||||
// Check magic
|
||||
var magic [4]byte
|
||||
if _, err := r.Read(magic[:]); err != nil {
|
||||
return nil, fmt.Errorf("read spectrum magic: %w", err)
|
||||
}
|
||||
if magic != kspMagic {
|
||||
return nil, fmt.Errorf("invalid spectrum file magic: %v", magic)
|
||||
}
|
||||
|
||||
// Number of entries
|
||||
nEntries, err := DecodeVarint(r)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("read spectrum entry count: %w", err)
|
||||
}
|
||||
|
||||
entries := make([]SpectrumEntry, nEntries)
|
||||
for i := uint64(0); i < nEntries; i++ {
|
||||
freq, err := DecodeVarint(r)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("read spectrum freq at entry %d: %w", i, err)
|
||||
}
|
||||
count, err := DecodeVarint(r)
|
||||
if err != nil {
|
||||
return nil, fmt.Errorf("read spectrum count at entry %d: %w", i, err)
|
||||
}
|
||||
entries[i] = SpectrumEntry{
|
||||
Frequency: int(freq),
|
||||
Count: count,
|
||||
}
|
||||
}
|
||||
|
||||
return &KmerSpectrum{Entries: entries}, nil
|
||||
}
|
||||
|
||||
// KmerFreq associates a k-mer (encoded as uint64) with its observed frequency.
|
||||
type KmerFreq struct {
|
||||
Kmer uint64
|
||||
Freq int
|
||||
}
|
||||
|
||||
// kmerFreqHeap is a min-heap of KmerFreq ordered by Freq (lowest first).
|
||||
// Used to maintain a top-N most frequent k-mers set.
|
||||
type kmerFreqHeap []KmerFreq
|
||||
|
||||
func (h kmerFreqHeap) Len() int { return len(h) }
|
||||
func (h kmerFreqHeap) Less(i, j int) bool { return h[i].Freq < h[j].Freq }
|
||||
func (h kmerFreqHeap) Swap(i, j int) { h[i], h[j] = h[j], h[i] }
|
||||
func (h *kmerFreqHeap) Push(x interface{}) { *h = append(*h, x.(KmerFreq)) }
|
||||
func (h *kmerFreqHeap) Pop() interface{} {
|
||||
old := *h
|
||||
n := len(old)
|
||||
x := old[n-1]
|
||||
*h = old[:n-1]
|
||||
return x
|
||||
}
|
||||
|
||||
// TopNKmers maintains a collection of the N most frequent k-mers
|
||||
// using a min-heap. Thread-safe usage requires external synchronization.
|
||||
type TopNKmers struct {
|
||||
n int
|
||||
h kmerFreqHeap
|
||||
}
|
||||
|
||||
// NewTopNKmers creates a new top-N collector.
|
||||
func NewTopNKmers(n int) *TopNKmers {
|
||||
return &TopNKmers{
|
||||
n: n,
|
||||
h: make(kmerFreqHeap, 0, n+1),
|
||||
}
|
||||
}
|
||||
|
||||
// Add considers a k-mer with the given frequency for inclusion in the top-N.
|
||||
func (t *TopNKmers) Add(kmer uint64, freq int) {
|
||||
if t.n <= 0 {
|
||||
return
|
||||
}
|
||||
if len(t.h) < t.n {
|
||||
heap.Push(&t.h, KmerFreq{Kmer: kmer, Freq: freq})
|
||||
} else if freq > t.h[0].Freq {
|
||||
t.h[0] = KmerFreq{Kmer: kmer, Freq: freq}
|
||||
heap.Fix(&t.h, 0)
|
||||
}
|
||||
}
|
||||
|
||||
// Results returns the collected k-mers sorted by frequency descending.
|
||||
func (t *TopNKmers) Results() []KmerFreq {
|
||||
result := make([]KmerFreq, len(t.h))
|
||||
copy(result, t.h)
|
||||
sort.Slice(result, func(i, j int) bool {
|
||||
return result[i].Freq > result[j].Freq
|
||||
})
|
||||
return result
|
||||
}
|
||||
|
||||
// MergeTopN merges another TopNKmers into this one.
|
||||
func (t *TopNKmers) MergeTopN(other *TopNKmers) {
|
||||
if other == nil {
|
||||
return
|
||||
}
|
||||
for _, kf := range other.h {
|
||||
t.Add(kf.Kmer, kf.Freq)
|
||||
}
|
||||
}
|
||||
|
||||
// WriteTopKmersCSV writes the top k-mers to a CSV file.
|
||||
// Columns: sequence, frequency
|
||||
func WriteTopKmersCSV(path string, topKmers []KmerFreq, k int) error {
|
||||
f, err := os.Create(path)
|
||||
if err != nil {
|
||||
return fmt.Errorf("create top-kmers file: %w", err)
|
||||
}
|
||||
defer f.Close()
|
||||
|
||||
w := csv.NewWriter(f)
|
||||
defer w.Flush()
|
||||
|
||||
if err := w.Write([]string{"sequence", "frequency"}); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
buf := make([]byte, k)
|
||||
for _, kf := range topKmers {
|
||||
seq := DecodeKmer(kf.Kmer, k, buf)
|
||||
if err := w.Write([]string{string(seq), strconv.Itoa(kf.Freq)}); err != nil {
|
||||
return err
|
||||
}
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
@@ -0,0 +1,53 @@
|
||||
package obikmer
|
||||
|
||||
import "io"
|
||||
|
||||
// EncodeVarint writes a uint64 value as a variable-length integer to w.
|
||||
// Uses 7 bits per byte with the high bit as a continuation flag
|
||||
// (identical to protobuf unsigned varint encoding).
|
||||
// Returns the number of bytes written.
|
||||
func EncodeVarint(w io.Writer, v uint64) (int, error) {
|
||||
var buf [10]byte // max 10 bytes for uint64 varint
|
||||
n := 0
|
||||
for v >= 0x80 {
|
||||
buf[n] = byte(v) | 0x80
|
||||
v >>= 7
|
||||
n++
|
||||
}
|
||||
buf[n] = byte(v)
|
||||
n++
|
||||
return w.Write(buf[:n])
|
||||
}
|
||||
|
||||
// DecodeVarint reads a variable-length encoded uint64 from r.
|
||||
// Returns the decoded value and any error encountered.
|
||||
func DecodeVarint(r io.Reader) (uint64, error) {
|
||||
var val uint64
|
||||
var shift uint
|
||||
var buf [1]byte
|
||||
|
||||
for {
|
||||
if _, err := io.ReadFull(r, buf[:]); err != nil {
|
||||
return 0, err
|
||||
}
|
||||
b := buf[0]
|
||||
val |= uint64(b&0x7F) << shift
|
||||
if b < 0x80 {
|
||||
return val, nil
|
||||
}
|
||||
shift += 7
|
||||
if shift >= 70 {
|
||||
return 0, io.ErrUnexpectedEOF
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// VarintLen returns the number of bytes needed to encode v as a varint.
|
||||
func VarintLen(v uint64) int {
|
||||
n := 1
|
||||
for v >= 0x80 {
|
||||
v >>= 7
|
||||
n++
|
||||
}
|
||||
return n
|
||||
}
|
||||
@@ -0,0 +1,82 @@
|
||||
package obikmer
|
||||
|
||||
import (
|
||||
"bytes"
|
||||
"testing"
|
||||
)
|
||||
|
||||
func TestVarintRoundTrip(t *testing.T) {
|
||||
values := []uint64{
|
||||
0, 1, 127, 128, 255, 256,
|
||||
16383, 16384,
|
||||
1<<21 - 1, 1 << 21,
|
||||
1<<28 - 1, 1 << 28,
|
||||
1<<35 - 1, 1 << 35,
|
||||
1<<42 - 1, 1 << 42,
|
||||
1<<49 - 1, 1 << 49,
|
||||
1<<56 - 1, 1 << 56,
|
||||
1<<63 - 1, 1 << 63,
|
||||
^uint64(0), // max uint64
|
||||
}
|
||||
|
||||
for _, v := range values {
|
||||
var buf bytes.Buffer
|
||||
n, err := EncodeVarint(&buf, v)
|
||||
if err != nil {
|
||||
t.Fatalf("EncodeVarint(%d): %v", v, err)
|
||||
}
|
||||
if n != VarintLen(v) {
|
||||
t.Fatalf("EncodeVarint(%d): wrote %d bytes, VarintLen says %d", v, n, VarintLen(v))
|
||||
}
|
||||
|
||||
decoded, err := DecodeVarint(&buf)
|
||||
if err != nil {
|
||||
t.Fatalf("DecodeVarint for %d: %v", v, err)
|
||||
}
|
||||
if decoded != v {
|
||||
t.Fatalf("roundtrip failed: encoded %d, decoded %d", v, decoded)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestVarintLen(t *testing.T) {
|
||||
tests := []struct {
|
||||
value uint64
|
||||
expected int
|
||||
}{
|
||||
{0, 1},
|
||||
{127, 1},
|
||||
{128, 2},
|
||||
{16383, 2},
|
||||
{16384, 3},
|
||||
{^uint64(0), 10},
|
||||
}
|
||||
|
||||
for _, tc := range tests {
|
||||
got := VarintLen(tc.value)
|
||||
if got != tc.expected {
|
||||
t.Errorf("VarintLen(%d) = %d, want %d", tc.value, got, tc.expected)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
func TestVarintSequence(t *testing.T) {
|
||||
var buf bytes.Buffer
|
||||
values := []uint64{0, 42, 1000000, ^uint64(0), 1}
|
||||
|
||||
for _, v := range values {
|
||||
if _, err := EncodeVarint(&buf, v); err != nil {
|
||||
t.Fatalf("EncodeVarint(%d): %v", v, err)
|
||||
}
|
||||
}
|
||||
|
||||
for _, expected := range values {
|
||||
got, err := DecodeVarint(&buf)
|
||||
if err != nil {
|
||||
t.Fatalf("DecodeVarint: %v", err)
|
||||
}
|
||||
if got != expected {
|
||||
t.Errorf("got %d, want %d", got, expected)
|
||||
}
|
||||
}
|
||||
}
|
||||
+37
-49
@@ -26,16 +26,11 @@ var __defaut_taxonomy_mutex__ sync.Mutex
|
||||
|
||||
type ArgumentParser func([]string) (*getoptions.GetOpt, []string)
|
||||
|
||||
func GenerateOptionParser(program string,
|
||||
documentation string,
|
||||
optionset ...func(*getoptions.GetOpt)) ArgumentParser {
|
||||
|
||||
options := getoptions.New()
|
||||
options.Self(program, documentation)
|
||||
options.SetMode(getoptions.Bundling)
|
||||
options.SetUnknownMode(getoptions.Fail)
|
||||
options.Bool("help", false, options.Alias("h", "?"))
|
||||
|
||||
// RegisterGlobalOptions registers the global options shared by all obitools
|
||||
// commands onto the given GetOpt instance. It does NOT register --help,
|
||||
// which must be handled by the caller (either as a Bool option or via
|
||||
// HelpCommand for subcommand-based parsers).
|
||||
func RegisterGlobalOptions(options *getoptions.GetOpt) {
|
||||
options.Bool("version", false,
|
||||
options.Description("Prints the version and exits."))
|
||||
|
||||
@@ -46,17 +41,10 @@ func GenerateOptionParser(program string,
|
||||
options.BoolVar(&_Pprof, "pprof", false,
|
||||
options.Description("Enable pprof server. Look at the log for details."))
|
||||
|
||||
// options.IntVar(&_ParallelWorkers, "workers", _ParallelWorkers,
|
||||
// options.Alias("w"),
|
||||
// options.Description("Number of parallele threads computing the result"))
|
||||
|
||||
options.IntVar(obidefault.MaxCPUPtr(), "max-cpu", obidefault.MaxCPU(),
|
||||
options.GetEnv("OBIMAXCPU"),
|
||||
options.Description("Number of parallele threads computing the result"))
|
||||
|
||||
// options.BoolVar(&_Pprof, "force-one-cpu", false,
|
||||
// options.Description("Force to use only one cpu core for parallel processing"))
|
||||
|
||||
options.IntVar(&_PprofMudex, "pprof-mutex", _PprofMudex,
|
||||
options.GetEnv("OBIPPROFMUTEX"),
|
||||
options.Description("Enable profiling of mutex lock."))
|
||||
@@ -77,19 +65,22 @@ func GenerateOptionParser(program string,
|
||||
options.GetEnv("OBIWARNING"),
|
||||
options.Description("Stop printing of the warning message"),
|
||||
)
|
||||
|
||||
for _, o := range optionset {
|
||||
o(options)
|
||||
}
|
||||
|
||||
return func(args []string) (*getoptions.GetOpt, []string) {
|
||||
|
||||
remaining, err := options.Parse(args[1:])
|
||||
|
||||
// ProcessParsedOptions handles the post-parse logic common to all obitools
|
||||
// commands: help, version, debug, pprof, taxonomy, cpu configuration, etc.
|
||||
// It receives the GetOpt instance and the parse error (if any).
|
||||
func ProcessParsedOptions(options *getoptions.GetOpt, parseErr error) {
|
||||
// Note: "help" may not be registered as a Bool (e.g. when using HelpCommand
|
||||
// for subcommand-based parsers). Only check if it won't panic.
|
||||
// We use a recover guard to be safe.
|
||||
func() {
|
||||
defer func() { recover() }()
|
||||
if options.Called("help") {
|
||||
fmt.Fprint(os.Stderr, options.Help())
|
||||
os.Exit(0)
|
||||
}
|
||||
}()
|
||||
|
||||
if options.Called("version") {
|
||||
fmt.Fprintf(os.Stderr, "OBITools %s\n", VersionString())
|
||||
@@ -107,7 +98,6 @@ func GenerateOptionParser(program string,
|
||||
|
||||
if err != nil {
|
||||
log.Fatalf("Cannot load default taxonomy: %v", err)
|
||||
|
||||
}
|
||||
|
||||
taxonomy.SetAsDefault()
|
||||
@@ -146,32 +136,14 @@ func GenerateOptionParser(program string,
|
||||
}
|
||||
|
||||
// Handle user errors
|
||||
if err != nil {
|
||||
fmt.Fprintf(os.Stderr, "ERROR: %s\n\n", err)
|
||||
if parseErr != nil {
|
||||
fmt.Fprintf(os.Stderr, "ERROR: %s\n\n", parseErr)
|
||||
fmt.Fprint(os.Stderr, options.Help(getoptions.HelpSynopsis))
|
||||
os.Exit(1)
|
||||
}
|
||||
|
||||
// // Setup the maximum number of CPU usable by the program
|
||||
// if obidefault.MaxCPU() == 1 {
|
||||
// log.Warn("Limitating the Maximum number of CPU to 1 is not recommanded")
|
||||
// log.Warn("The number of CPU requested has been set to 2")
|
||||
// obidefault.SetMaxCPU(2)
|
||||
// }
|
||||
|
||||
// if options.Called("force-one-cpu") {
|
||||
// log.Warn("Limitating the Maximum number of CPU to 1 is not recommanded")
|
||||
// log.Warn("The number of CPU has been forced to 1")
|
||||
// log.Warn("This can lead to unexpected behavior")
|
||||
// obidefault.SetMaxCPU(1)
|
||||
// }
|
||||
|
||||
runtime.GOMAXPROCS(obidefault.MaxCPU())
|
||||
|
||||
// if options.Called("max-cpu") || options.Called("force-one-cpu") {
|
||||
// log.Printf("CPU number limited to %d", obidefault.MaxCPU())
|
||||
// }
|
||||
|
||||
if options.Called("max-cpu") {
|
||||
log.Printf("CPU number limited to %d", obidefault.MaxCPU())
|
||||
}
|
||||
@@ -182,14 +154,30 @@ func GenerateOptionParser(program string,
|
||||
|
||||
log.Printf("Number of workers set %d", obidefault.ParallelWorkers())
|
||||
|
||||
// if options.Called("workers") {
|
||||
|
||||
// }
|
||||
|
||||
if options.Called("solexa") {
|
||||
obidefault.SetReadQualitiesShift(64)
|
||||
}
|
||||
}
|
||||
|
||||
func GenerateOptionParser(program string,
|
||||
documentation string,
|
||||
optionset ...func(*getoptions.GetOpt)) ArgumentParser {
|
||||
|
||||
options := getoptions.New()
|
||||
options.Self(program, documentation)
|
||||
options.SetMode(getoptions.Bundling)
|
||||
options.SetUnknownMode(getoptions.Fail)
|
||||
options.Bool("help", false, options.Alias("h", "?"))
|
||||
|
||||
RegisterGlobalOptions(options)
|
||||
|
||||
for _, o := range optionset {
|
||||
o(options)
|
||||
}
|
||||
|
||||
return func(args []string) (*getoptions.GetOpt, []string) {
|
||||
remaining, err := options.Parse(args[1:])
|
||||
ProcessParsedOptions(options, err)
|
||||
return options, remaining
|
||||
}
|
||||
}
|
||||
|
||||
@@ -0,0 +1,43 @@
|
||||
package obioptions
|
||||
|
||||
import (
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// GenerateSubcommandParser creates an option parser that supports subcommands
|
||||
// via go-getoptions' NewCommand/SetCommandFn/Dispatch API.
|
||||
//
|
||||
// The setup function receives the root *GetOpt and should register subcommands
|
||||
// using opt.NewCommand(). Global options (--debug, --max-cpu, etc.) are
|
||||
// registered before setup is called and are inherited by all subcommands.
|
||||
//
|
||||
// Returns the root *GetOpt (needed for Dispatch) and an ArgumentParser
|
||||
// that handles parsing and post-parse processing.
|
||||
func GenerateSubcommandParser(
|
||||
program string,
|
||||
documentation string,
|
||||
setup func(opt *getoptions.GetOpt),
|
||||
) (*getoptions.GetOpt, ArgumentParser) {
|
||||
|
||||
options := getoptions.New()
|
||||
options.Self(program, documentation)
|
||||
options.SetMode(getoptions.Bundling)
|
||||
options.SetUnknownMode(getoptions.Fail)
|
||||
|
||||
// Register global options (inherited by all subcommands)
|
||||
RegisterGlobalOptions(options)
|
||||
|
||||
// Let the caller register subcommands
|
||||
setup(options)
|
||||
|
||||
// Add automatic help subcommand (must be after all commands)
|
||||
options.HelpCommand("help", options.Description("Show help for a command"))
|
||||
|
||||
parser := func(args []string) (*getoptions.GetOpt, []string) {
|
||||
remaining, err := options.Parse(args[1:])
|
||||
ProcessParsedOptions(options, err)
|
||||
return options, remaining
|
||||
}
|
||||
|
||||
return options, parser
|
||||
}
|
||||
@@ -3,7 +3,7 @@ package obioptions
|
||||
// Version is automatically updated by the Makefile from version.txt
|
||||
// The patch number (third digit) is incremented on each push to the repository
|
||||
|
||||
var _Version = "Release 4.4.12"
|
||||
var _Version = "Release 4.4.21"
|
||||
|
||||
// Version returns the version of the obitools package.
|
||||
//
|
||||
|
||||
@@ -120,6 +120,19 @@ func NewBioSequence(id string,
|
||||
return bs
|
||||
}
|
||||
|
||||
// NewBioSequenceOwning creates a BioSequence taking ownership of the sequence
|
||||
// slice without copying it. The caller must not use the slice after this call.
|
||||
// Use this when the slice was allocated specifically for this sequence.
|
||||
func NewBioSequenceOwning(id string,
|
||||
sequence []byte,
|
||||
definition string) *BioSequence {
|
||||
bs := NewEmptyBioSequence(0)
|
||||
bs.SetId(id)
|
||||
bs.TakeSequence(sequence)
|
||||
bs.SetDefinition(definition)
|
||||
return bs
|
||||
}
|
||||
|
||||
// NewBioSequenceWithQualities creates a new BioSequence object with the given id, sequence, definition, and qualities.
|
||||
//
|
||||
// Parameters:
|
||||
@@ -444,6 +457,12 @@ func (s *BioSequence) SetSequence(sequence []byte) {
|
||||
s.sequence = obiutils.InPlaceToLower(CopySlice(sequence))
|
||||
}
|
||||
|
||||
// TakeSequence stores the slice directly without copying, then lowercases in-place.
|
||||
// The caller must not use the slice after this call.
|
||||
func (s *BioSequence) TakeSequence(sequence []byte) {
|
||||
s.sequence = obiutils.InPlaceToLower(sequence)
|
||||
}
|
||||
|
||||
func (s *BioSequence) HasValidSequence() bool {
|
||||
for _, c := range s.sequence {
|
||||
if !((c >= 'a' && c <= 'z') || c == '-' || c == '.' || c == '[' || c == ']') {
|
||||
@@ -461,6 +480,15 @@ func (s *BioSequence) SetQualities(qualities Quality) {
|
||||
s.qualities = CopySlice(qualities)
|
||||
}
|
||||
|
||||
// TakeQualities stores the slice directly without copying.
|
||||
// The caller must not use the slice after this call.
|
||||
func (s *BioSequence) TakeQualities(qualities Quality) {
|
||||
if s.qualities != nil {
|
||||
RecycleSlice(&s.qualities)
|
||||
}
|
||||
s.qualities = qualities
|
||||
}
|
||||
|
||||
// A method that appends a byte slice to the qualities of the BioSequence.
|
||||
func (s *BioSequence) WriteQualities(data []byte) (int, error) {
|
||||
s.qualities = append(s.qualities, data...)
|
||||
|
||||
@@ -195,7 +195,7 @@ func (s *BioSequenceSlice) ExtractTaxonomy(taxonomy *obitax.Taxonomy, seqAsTaxa
|
||||
return nil, fmt.Errorf("sequence %v has no path", s.Id())
|
||||
}
|
||||
last := path[len(path)-1]
|
||||
taxname, _ := obiutils.SplitInTwo(last, ':')
|
||||
taxname, _ := obiutils.LeftSplitInTwo(last, ':')
|
||||
if idx, ok := s.GetIntAttribute("seq_number"); !ok {
|
||||
return nil, errors.New("sequences are not numbered")
|
||||
} else {
|
||||
|
||||
+1
-1
@@ -31,7 +31,7 @@ func NewTaxidFactory(code string, alphabet obiutils.AsciiSet) *TaxidFactory {
|
||||
// It extracts the relevant part of the string after the first colon (':') if present.
|
||||
func (f *TaxidFactory) FromString(taxid string) (Taxid, error) {
|
||||
taxid = obiutils.AsciiSpaceSet.TrimLeft(taxid)
|
||||
part1, part2 := obiutils.SplitInTwo(taxid, ':')
|
||||
part1, part2 := obiutils.LeftSplitInTwo(taxid, ':')
|
||||
if len(part2) == 0 {
|
||||
taxid = part1
|
||||
} else {
|
||||
|
||||
@@ -64,7 +64,7 @@ func EmpiricalDistCsv(filename string, data [][]Ratio, compressed bool) {
|
||||
fmt.Println(err)
|
||||
}
|
||||
|
||||
destfile, err := obiutils.CompressStream(file, true, true)
|
||||
destfile, err := obiutils.CompressStream(file, compressed, true)
|
||||
if err != nil {
|
||||
fmt.Println(err)
|
||||
}
|
||||
|
||||
@@ -68,6 +68,8 @@ func ExpandListOfFiles(check_ext bool, filenames ...string) ([]string, error) {
|
||||
strings.HasSuffix(path, "seq.gz") ||
|
||||
strings.HasSuffix(path, "gb") ||
|
||||
strings.HasSuffix(path, "gb.gz") ||
|
||||
strings.HasSuffix(path, "gbff") ||
|
||||
strings.HasSuffix(path, "gbff.gz") ||
|
||||
strings.HasSuffix(path, "dat") ||
|
||||
strings.HasSuffix(path, "dat.gz") ||
|
||||
strings.HasSuffix(path, "ecopcr") ||
|
||||
@@ -204,7 +206,7 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
|
||||
iterator = iterator.PairTo(ip)
|
||||
}
|
||||
} else {
|
||||
iterator = obiiter.NilIBioSequence
|
||||
return obiiter.NilIBioSequence, fmt.Errorf("no sequence files found in the provided paths")
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
@@ -0,0 +1,55 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
func runCp(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
if len(args) < 2 {
|
||||
return fmt.Errorf("usage: obik cp [--set PATTERN]... [--force] <source_index> <dest_index>")
|
||||
}
|
||||
|
||||
srcDir := args[0]
|
||||
destDir := args[1]
|
||||
|
||||
ksg, err := obikmer.OpenKmerSetGroup(srcDir)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open source kmer index: %w", err)
|
||||
}
|
||||
|
||||
// Resolve set patterns
|
||||
patterns := CLISetPatterns()
|
||||
var ids []string
|
||||
if len(patterns) > 0 {
|
||||
indices, err := ksg.MatchSetIDs(patterns)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
if len(indices) == 0 {
|
||||
return fmt.Errorf("no sets match the given patterns")
|
||||
}
|
||||
ids = make([]string, len(indices))
|
||||
for i, idx := range indices {
|
||||
ids[i] = ksg.SetIDOf(idx)
|
||||
}
|
||||
} else {
|
||||
// Copy all sets
|
||||
ids = ksg.SetsIDs()
|
||||
}
|
||||
|
||||
log.Infof("Copying %d set(s) from %s to %s", len(ids), srcDir, destDir)
|
||||
|
||||
dest, err := ksg.CopySetsByIDTo(ids, destDir, CLIForce())
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
log.Infof("Destination now has %d set(s)", dest.Size())
|
||||
return nil
|
||||
}
|
||||
@@ -0,0 +1,344 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
"os"
|
||||
"path/filepath"
|
||||
"strings"
|
||||
"sync"
|
||||
"sync/atomic"
|
||||
|
||||
"github.com/schollz/progressbar/v3"
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// KmerFilter is a predicate applied to individual k-mers during filtering.
|
||||
// Returns true if the k-mer should be kept.
|
||||
type KmerFilter func(kmer uint64) bool
|
||||
|
||||
// KmerFilterFactory creates a new KmerFilter instance.
|
||||
// Each goroutine should call the factory to get its own filter,
|
||||
// since some filters (e.g. KmerEntropyFilter) are not thread-safe.
|
||||
type KmerFilterFactory func() KmerFilter
|
||||
|
||||
// chainFilterFactories combines multiple KmerFilterFactory into one.
|
||||
// The resulting factory creates a filter that accepts a k-mer only
|
||||
// if all individual filters accept it.
|
||||
func chainFilterFactories(factories []KmerFilterFactory) KmerFilterFactory {
|
||||
switch len(factories) {
|
||||
case 0:
|
||||
return func() KmerFilter { return func(uint64) bool { return true } }
|
||||
case 1:
|
||||
return factories[0]
|
||||
default:
|
||||
return func() KmerFilter {
|
||||
filters := make([]KmerFilter, len(factories))
|
||||
for i, f := range factories {
|
||||
filters[i] = f()
|
||||
}
|
||||
return func(kmer uint64) bool {
|
||||
for _, f := range filters {
|
||||
if !f(kmer) {
|
||||
return false
|
||||
}
|
||||
}
|
||||
return true
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// runFilter implements the "obik filter" subcommand.
|
||||
// It reads an existing kmer index, applies a chain of filters,
|
||||
// and writes a new filtered index.
|
||||
func runFilter(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
if len(args) < 1 {
|
||||
return fmt.Errorf("usage: obik filter [options] <source_index> --out <dest_index>")
|
||||
}
|
||||
|
||||
srcDir := args[0]
|
||||
destDir := CLIOutputDirectory()
|
||||
if destDir == "" || destDir == "-" {
|
||||
return fmt.Errorf("--out option is required and must specify a destination directory")
|
||||
}
|
||||
|
||||
// Open source index
|
||||
src, err := obikmer.OpenKmerSetGroup(srcDir)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open source index: %w", err)
|
||||
}
|
||||
|
||||
k := src.K()
|
||||
|
||||
// Build filter factory chain from CLI options.
|
||||
// Factories are used so each goroutine creates its own filter instance,
|
||||
// since some filters (e.g. KmerEntropyFilter) have mutable state.
|
||||
var factories []KmerFilterFactory
|
||||
var filterDescriptions []string
|
||||
|
||||
// Entropy filter
|
||||
entropyThreshold := CLIIndexEntropyThreshold()
|
||||
entropySize := CLIIndexEntropySize()
|
||||
if entropyThreshold > 0 {
|
||||
factories = append(factories, func() KmerFilter {
|
||||
ef := obikmer.NewKmerEntropyFilter(k, entropySize, entropyThreshold)
|
||||
return ef.Accept
|
||||
})
|
||||
filterDescriptions = append(filterDescriptions,
|
||||
fmt.Sprintf("entropy(threshold=%.4f, level-max=%d)", entropyThreshold, entropySize))
|
||||
}
|
||||
|
||||
// Future filters will be added here, e.g.:
|
||||
// quorumFilter, frequencyFilter, ...
|
||||
|
||||
if len(factories) == 0 {
|
||||
return fmt.Errorf("no filter specified; use --entropy-filter or other filter options")
|
||||
}
|
||||
|
||||
filterFactory := chainFilterFactories(factories)
|
||||
|
||||
// Resolve set selection (default: all sets)
|
||||
patterns := CLISetPatterns()
|
||||
var setIndices []int
|
||||
if len(patterns) > 0 {
|
||||
setIndices, err = src.MatchSetIDs(patterns)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to match set patterns: %w", err)
|
||||
}
|
||||
if len(setIndices) == 0 {
|
||||
return fmt.Errorf("no sets match the given patterns")
|
||||
}
|
||||
} else {
|
||||
setIndices = make([]int, src.Size())
|
||||
for i := range setIndices {
|
||||
setIndices[i] = i
|
||||
}
|
||||
}
|
||||
|
||||
log.Infof("Filtering %d set(s) from %s with: %s",
|
||||
len(setIndices), srcDir, strings.Join(filterDescriptions, " + "))
|
||||
|
||||
// Create destination directory
|
||||
if err := os.MkdirAll(destDir, 0755); err != nil {
|
||||
return fmt.Errorf("failed to create destination: %w", err)
|
||||
}
|
||||
|
||||
P := src.Partitions()
|
||||
|
||||
// Progress bar for partition filtering
|
||||
totalPartitions := len(setIndices) * P
|
||||
var bar *progressbar.ProgressBar
|
||||
if obidefault.ProgressBar() {
|
||||
pbopt := []progressbar.Option{
|
||||
progressbar.OptionSetWriter(os.Stderr),
|
||||
progressbar.OptionSetWidth(15),
|
||||
progressbar.OptionShowCount(),
|
||||
progressbar.OptionShowIts(),
|
||||
progressbar.OptionSetPredictTime(true),
|
||||
progressbar.OptionSetDescription("[Filtering partitions]"),
|
||||
}
|
||||
bar = progressbar.NewOptions(totalPartitions, pbopt...)
|
||||
}
|
||||
|
||||
// Process each selected set
|
||||
newCounts := make([]uint64, len(setIndices))
|
||||
|
||||
for si, srcIdx := range setIndices {
|
||||
setID := src.SetIDOf(srcIdx)
|
||||
if setID == "" {
|
||||
setID = fmt.Sprintf("set_%d", srcIdx)
|
||||
}
|
||||
|
||||
destSetDir := filepath.Join(destDir, fmt.Sprintf("set_%d", si))
|
||||
if err := os.MkdirAll(destSetDir, 0755); err != nil {
|
||||
return fmt.Errorf("failed to create set directory: %w", err)
|
||||
}
|
||||
|
||||
// Process partitions in parallel
|
||||
nWorkers := obidefault.ParallelWorkers()
|
||||
if nWorkers > P {
|
||||
nWorkers = P
|
||||
}
|
||||
|
||||
var totalKept atomic.Uint64
|
||||
var totalProcessed atomic.Uint64
|
||||
|
||||
type job struct {
|
||||
partIdx int
|
||||
}
|
||||
|
||||
jobs := make(chan job, P)
|
||||
var wg sync.WaitGroup
|
||||
var errMu sync.Mutex
|
||||
var firstErr error
|
||||
|
||||
for w := 0; w < nWorkers; w++ {
|
||||
wg.Add(1)
|
||||
go func() {
|
||||
defer wg.Done()
|
||||
// Each goroutine gets its own filter instance
|
||||
workerFilter := filterFactory()
|
||||
for j := range jobs {
|
||||
kept, processed, err := filterPartition(
|
||||
src.PartitionPath(srcIdx, j.partIdx),
|
||||
filepath.Join(destSetDir, fmt.Sprintf("part_%04d.kdi", j.partIdx)),
|
||||
workerFilter,
|
||||
)
|
||||
if err != nil {
|
||||
errMu.Lock()
|
||||
if firstErr == nil {
|
||||
firstErr = err
|
||||
}
|
||||
errMu.Unlock()
|
||||
return
|
||||
}
|
||||
totalKept.Add(kept)
|
||||
totalProcessed.Add(processed)
|
||||
if bar != nil {
|
||||
bar.Add(1)
|
||||
}
|
||||
}
|
||||
}()
|
||||
}
|
||||
|
||||
for p := 0; p < P; p++ {
|
||||
jobs <- job{p}
|
||||
}
|
||||
close(jobs)
|
||||
wg.Wait()
|
||||
|
||||
if firstErr != nil {
|
||||
return fmt.Errorf("failed to filter set %q: %w", setID, firstErr)
|
||||
}
|
||||
|
||||
kept := totalKept.Load()
|
||||
processed := totalProcessed.Load()
|
||||
newCounts[si] = kept
|
||||
log.Infof("Set %q: %d/%d k-mers kept (%.1f%% removed)",
|
||||
setID, kept, processed,
|
||||
100.0*float64(processed-kept)/float64(max(processed, 1)))
|
||||
|
||||
// Copy spectrum.bin if it exists
|
||||
srcSpecPath := src.SpectrumPath(srcIdx)
|
||||
if _, err := os.Stat(srcSpecPath); err == nil {
|
||||
destSpecPath := filepath.Join(destSetDir, "spectrum.bin")
|
||||
if err := copyFileHelper(srcSpecPath, destSpecPath); err != nil {
|
||||
log.Warnf("Could not copy spectrum for set %q: %v", setID, err)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
if bar != nil {
|
||||
fmt.Fprintln(os.Stderr)
|
||||
}
|
||||
|
||||
// Build destination metadata
|
||||
setsIDs := make([]string, len(setIndices))
|
||||
setsMetadata := make([]map[string]interface{}, len(setIndices))
|
||||
for i, srcIdx := range setIndices {
|
||||
setsIDs[i] = src.SetIDOf(srcIdx)
|
||||
setsMetadata[i] = src.AllSetMetadata(srcIdx)
|
||||
if setsMetadata[i] == nil {
|
||||
setsMetadata[i] = make(map[string]interface{})
|
||||
}
|
||||
}
|
||||
|
||||
// Write metadata for the filtered index
|
||||
dest, err := obikmer.NewFilteredKmerSetGroup(
|
||||
destDir, k, src.M(), P,
|
||||
len(setIndices), setsIDs, newCounts, setsMetadata,
|
||||
)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to create filtered metadata: %w", err)
|
||||
}
|
||||
|
||||
// Copy group-level metadata and record applied filters
|
||||
for key, value := range src.Metadata {
|
||||
dest.SetAttribute(key, value)
|
||||
}
|
||||
if entropyThreshold > 0 {
|
||||
dest.SetAttribute("entropy_filter", entropyThreshold)
|
||||
dest.SetAttribute("entropy_filter_size", entropySize)
|
||||
}
|
||||
dest.SetAttribute("filtered_from", srcDir)
|
||||
|
||||
if err := dest.SaveMetadata(); err != nil {
|
||||
return fmt.Errorf("failed to save metadata: %w", err)
|
||||
}
|
||||
|
||||
log.Info("Done.")
|
||||
return nil
|
||||
}
|
||||
|
||||
// filterPartition reads a single .kdi partition, applies the filter predicate,
|
||||
// and writes the accepted k-mers to a new .kdi file.
|
||||
// Returns (kept, processed, error).
|
||||
func filterPartition(srcPath, destPath string, accept KmerFilter) (uint64, uint64, error) {
|
||||
reader, err := obikmer.NewKdiReader(srcPath)
|
||||
if err != nil {
|
||||
// Empty partition — write empty KDI
|
||||
w, err2 := obikmer.NewKdiWriter(destPath)
|
||||
if err2 != nil {
|
||||
return 0, 0, err2
|
||||
}
|
||||
return 0, 0, w.Close()
|
||||
}
|
||||
defer reader.Close()
|
||||
|
||||
w, err := obikmer.NewKdiWriter(destPath)
|
||||
if err != nil {
|
||||
return 0, 0, err
|
||||
}
|
||||
|
||||
var kept, processed uint64
|
||||
for {
|
||||
kmer, ok := reader.Next()
|
||||
if !ok {
|
||||
break
|
||||
}
|
||||
processed++
|
||||
if accept(kmer) {
|
||||
if err := w.Write(kmer); err != nil {
|
||||
w.Close()
|
||||
return 0, 0, err
|
||||
}
|
||||
kept++
|
||||
}
|
||||
}
|
||||
|
||||
return kept, processed, w.Close()
|
||||
}
|
||||
|
||||
// copyFileHelper copies a file (used for spectrum.bin etc.)
|
||||
func copyFileHelper(src, dst string) error {
|
||||
in, err := os.Open(src)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
defer in.Close()
|
||||
|
||||
out, err := os.Create(dst)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
defer out.Close()
|
||||
|
||||
buf := make([]byte, 32*1024)
|
||||
for {
|
||||
n, readErr := in.Read(buf)
|
||||
if n > 0 {
|
||||
if _, writeErr := out.Write(buf[:n]); writeErr != nil {
|
||||
return writeErr
|
||||
}
|
||||
}
|
||||
if readErr != nil {
|
||||
break
|
||||
}
|
||||
}
|
||||
return out.Close()
|
||||
}
|
||||
@@ -0,0 +1,154 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
"os"
|
||||
"path/filepath"
|
||||
"sync"
|
||||
"sync/atomic"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
func runIndex(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
outDir := CLIOutputDirectory()
|
||||
if outDir == "" || outDir == "-" {
|
||||
return fmt.Errorf("--out option is required and must specify a directory path")
|
||||
}
|
||||
|
||||
k := CLIKmerSize()
|
||||
if k < 2 || k > 31 {
|
||||
return fmt.Errorf("invalid k-mer size: %d (must be between 2 and 31)", k)
|
||||
}
|
||||
|
||||
m := CLIMinimizerSize()
|
||||
|
||||
minOcc := CLIMinOccurrence()
|
||||
if minOcc < 1 {
|
||||
return fmt.Errorf("invalid min-occurrence: %d (must be >= 1)", minOcc)
|
||||
}
|
||||
|
||||
maxOcc := CLIMaxOccurrence()
|
||||
|
||||
entropyThreshold := CLIIndexEntropyThreshold()
|
||||
entropySize := CLIIndexEntropySize()
|
||||
|
||||
// Build options
|
||||
var opts []obikmer.BuilderOption
|
||||
if minOcc > 1 {
|
||||
opts = append(opts, obikmer.WithMinFrequency(minOcc))
|
||||
}
|
||||
if maxOcc > 0 {
|
||||
opts = append(opts, obikmer.WithMaxFrequency(maxOcc))
|
||||
}
|
||||
if topN := CLISaveFreqKmer(); topN > 0 {
|
||||
opts = append(opts, obikmer.WithSaveFreqKmers(topN))
|
||||
}
|
||||
if entropyThreshold > 0 {
|
||||
opts = append(opts, obikmer.WithEntropyFilter(entropyThreshold, entropySize))
|
||||
}
|
||||
|
||||
// Determine whether to append to existing group or create new
|
||||
var builder *obikmer.KmerSetGroupBuilder
|
||||
var err error
|
||||
metaPath := filepath.Join(outDir, "metadata.toml")
|
||||
if _, statErr := os.Stat(metaPath); statErr == nil {
|
||||
// Existing group: append
|
||||
log.Infof("Appending to existing kmer index at %s", outDir)
|
||||
builder, err = obikmer.AppendKmerSetGroupBuilder(outDir, 1, opts...)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open existing kmer index for appending: %w", err)
|
||||
}
|
||||
} else {
|
||||
// New group
|
||||
if maxOcc > 0 {
|
||||
log.Infof("Creating new kmer index: k=%d, m=%d, occurrence=[%d,%d]", k, m, minOcc, maxOcc)
|
||||
} else {
|
||||
log.Infof("Creating new kmer index: k=%d, m=%d, min-occurrence=%d", k, m, minOcc)
|
||||
}
|
||||
builder, err = obikmer.NewKmerSetGroupBuilder(outDir, k, m, 1, -1, opts...)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to create kmer index builder: %w", err)
|
||||
}
|
||||
}
|
||||
|
||||
// Read and process sequences in parallel
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open sequence files: %w", err)
|
||||
}
|
||||
|
||||
nworkers := obidefault.ParallelWorkers()
|
||||
var seqCount atomic.Int64
|
||||
var wg sync.WaitGroup
|
||||
|
||||
consumer := func(iter obiiter.IBioSequence) {
|
||||
defer wg.Done()
|
||||
for iter.Next() {
|
||||
batch := iter.Get()
|
||||
for _, seq := range batch.Slice() {
|
||||
builder.AddSequence(0, seq)
|
||||
seqCount.Add(1)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
for i := 1; i < nworkers; i++ {
|
||||
wg.Add(1)
|
||||
go consumer(sequences.Split())
|
||||
}
|
||||
wg.Add(1)
|
||||
go consumer(sequences)
|
||||
wg.Wait()
|
||||
|
||||
log.Infof("Processed %d sequences", seqCount.Load())
|
||||
|
||||
// Finalize
|
||||
ksg, err := builder.Close()
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to finalize kmer index: %w", err)
|
||||
}
|
||||
|
||||
// Apply index-id to the new set
|
||||
newSetIdx := builder.StartIndex()
|
||||
if id := CLIIndexId(); id != "" {
|
||||
ksg.SetSetID(newSetIdx, id)
|
||||
}
|
||||
|
||||
// Apply group-level tags (-S)
|
||||
for key, value := range CLISetTag() {
|
||||
ksg.SetAttribute(key, value)
|
||||
}
|
||||
|
||||
// Apply per-set tags (-T) to the new set
|
||||
for key, value := range _setMetaTags {
|
||||
ksg.SetSetMetadata(newSetIdx, key, value)
|
||||
}
|
||||
|
||||
if minOcc > 1 {
|
||||
ksg.SetAttribute("min_occurrence", minOcc)
|
||||
}
|
||||
if maxOcc > 0 {
|
||||
ksg.SetAttribute("max_occurrence", maxOcc)
|
||||
}
|
||||
|
||||
if entropyThreshold > 0 {
|
||||
ksg.SetAttribute("entropy_filter", entropyThreshold)
|
||||
ksg.SetAttribute("entropy_filter_size", entropySize)
|
||||
}
|
||||
|
||||
if err := ksg.SaveMetadata(); err != nil {
|
||||
return fmt.Errorf("failed to save metadata: %w", err)
|
||||
}
|
||||
|
||||
log.Infof("Index contains %d k-mers for set %d in %s", ksg.Len(newSetIdx), newSetIdx, outDir)
|
||||
log.Info("Done.")
|
||||
return nil
|
||||
}
|
||||
@@ -1,39 +1,22 @@
|
||||
package obilowmask
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
"math"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// MaskingMode defines how to handle low-complexity regions
|
||||
type MaskingMode int
|
||||
|
||||
const (
|
||||
Mask MaskingMode = iota // Mask mode: replace low-complexity regions with masked characters
|
||||
Split // Split mode: split sequence into high-complexity fragments
|
||||
Extract
|
||||
)
|
||||
|
||||
// LowMaskWorker creates a worker to mask low-complexity regions in DNA sequences.
|
||||
//
|
||||
// Algorithm principle:
|
||||
// Calculate the normalized entropy of each k-mer at different scales (wordSize = 1 to level_max).
|
||||
// K-mers with entropy below the threshold are masked.
|
||||
//
|
||||
// Parameters:
|
||||
// - kmer_size: size of the sliding window for entropy calculation
|
||||
// - level_max: maximum word size used for entropy calculation (finest scale)
|
||||
// - threshold: normalized entropy threshold below which masking occurs (between 0 and 1)
|
||||
// - mode: Mask (masking) or Split (splitting)
|
||||
// - maskChar: character used for masking (typically 'n' or 'N')
|
||||
//
|
||||
// Returns: a SeqWorker function that can be applied to each sequence
|
||||
func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode MaskingMode, maskChar byte) obiseq.SeqWorker {
|
||||
// lowMaskWorker creates a worker to mask low-complexity regions in DNA sequences.
|
||||
func lowMaskWorker(kmer_size int, level_max int, threshold float64, mode MaskingMode, maskChar byte, keepShorter bool) obiseq.SeqWorker {
|
||||
|
||||
nLogN := make([]float64, kmer_size+1)
|
||||
for i := 1; i <= kmer_size; i++ {
|
||||
@@ -87,6 +70,7 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
|
||||
data[i] = deque[0].value
|
||||
}
|
||||
}
|
||||
|
||||
emaxValues := make([]float64, level_max+1)
|
||||
logNwords := make([]float64, level_max+1)
|
||||
for ws := 1; ws <= level_max; ws++ {
|
||||
@@ -259,24 +243,30 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
|
||||
}
|
||||
if inlow && !masked {
|
||||
if fromlow >= 0 {
|
||||
frgLen := i - fromlow
|
||||
if keepShorter || frgLen >= kmer_size {
|
||||
frg, err := sequence.Subsequence(fromlow, i, false)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
rep.Push(frg)
|
||||
}
|
||||
}
|
||||
inlow = false
|
||||
fromlow = -1
|
||||
}
|
||||
}
|
||||
|
||||
if inlow && fromlow >= 0 {
|
||||
frgLen := len(maskPosition) - fromlow
|
||||
if keepShorter || frgLen >= kmer_size {
|
||||
frg, err := sequence.Subsequence(fromlow, len(maskPosition), false)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
rep.Push(frg)
|
||||
}
|
||||
}
|
||||
|
||||
return *rep, nil
|
||||
}
|
||||
@@ -293,24 +283,30 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
|
||||
}
|
||||
if inhigh && masked {
|
||||
if fromhigh >= 0 {
|
||||
frgLen := i - fromhigh
|
||||
if keepShorter || frgLen >= kmer_size {
|
||||
frg, err := sequence.Subsequence(fromhigh, i, false)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
rep.Push(frg)
|
||||
}
|
||||
}
|
||||
inhigh = false
|
||||
fromhigh = -1
|
||||
}
|
||||
}
|
||||
|
||||
if inhigh && fromhigh >= 0 {
|
||||
frgLen := len(maskPosition) - fromhigh
|
||||
if keepShorter || frgLen >= kmer_size {
|
||||
frg, err := sequence.Subsequence(fromhigh, len(maskPosition), false)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
rep.Push(frg)
|
||||
}
|
||||
}
|
||||
|
||||
return *rep, nil
|
||||
}
|
||||
@@ -322,14 +318,22 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
|
||||
for i := range remove {
|
||||
remove[i] = true
|
||||
}
|
||||
switch mode {
|
||||
case MaskMode:
|
||||
return applyMaskMode(sequence, remove, maskChar)
|
||||
case SplitMode:
|
||||
return selectunmasked(sequence, remove)
|
||||
case ExtractMode:
|
||||
return selectMasked(sequence, remove)
|
||||
}
|
||||
return nil, fmt.Errorf("unknown mode %d", mode)
|
||||
}
|
||||
|
||||
bseq := sequence.Sequence()
|
||||
|
||||
maskPositions := maskAmbiguities(bseq)
|
||||
|
||||
mask := make([]int, len(bseq))
|
||||
maskFlags := make([]int, len(bseq))
|
||||
entropies := make([]float64, len(bseq))
|
||||
for i := range entropies {
|
||||
entropies[i] = 4.0
|
||||
@@ -343,7 +347,7 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
|
||||
|
||||
for i := range bseq {
|
||||
v := level_max
|
||||
mask[i] = v
|
||||
maskFlags[i] = v
|
||||
}
|
||||
|
||||
for ws := level_max - 1; ws > 0; ws-- {
|
||||
@@ -351,7 +355,7 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
|
||||
for i, e2 := range entropies2 {
|
||||
if e2 < entropies[i] {
|
||||
entropies[i] = e2
|
||||
mask[i] = ws
|
||||
maskFlags[i] = ws
|
||||
}
|
||||
}
|
||||
}
|
||||
@@ -367,39 +371,49 @@ func LowMaskWorker(kmer_size int, level_max int, threshold float64, mode Masking
|
||||
remove[i] = e <= threshold
|
||||
}
|
||||
|
||||
sequence.SetAttribute("mask", mask)
|
||||
sequence.SetAttribute("mask", maskFlags)
|
||||
sequence.SetAttribute("Entropies", entropies)
|
||||
|
||||
switch mode {
|
||||
case Mask:
|
||||
case MaskMode:
|
||||
return applyMaskMode(sequence, remove, maskChar)
|
||||
case Split:
|
||||
case SplitMode:
|
||||
return selectunmasked(sequence, remove)
|
||||
case Extract:
|
||||
case ExtractMode:
|
||||
return selectMasked(sequence, remove)
|
||||
}
|
||||
return nil, fmt.Errorf("Unknown mode %d", mode)
|
||||
return nil, fmt.Errorf("unknown mode %d", mode)
|
||||
}
|
||||
|
||||
return masking
|
||||
}
|
||||
|
||||
// CLISequenceEntropyMasker creates an iterator that applies entropy masking
|
||||
// to all sequences in an input iterator.
|
||||
//
|
||||
// Uses command-line parameters to configure the worker.
|
||||
func CLISequenceEntropyMasker(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
var newIter obiiter.IBioSequence
|
||||
// runLowmask implements the "obik lowmask" subcommand.
|
||||
// It masks low-complexity regions in DNA sequences using entropy-based detection.
|
||||
func runLowmask(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
kmerSize := CLIKmerSize()
|
||||
levelMax := CLIEntropySize()
|
||||
threshold := CLIEntropyThreshold()
|
||||
mode := CLIMaskingMode()
|
||||
maskChar := CLIMaskingChar()
|
||||
|
||||
worker := LowMaskWorker(
|
||||
CLIKmerSize(),
|
||||
CLILevelMax(),
|
||||
CLIThreshold(),
|
||||
CLIMaskingMode(),
|
||||
CLIMaskingChar(),
|
||||
)
|
||||
log.Printf("Low-complexity masking: kmer-size=%d, entropy-size=%d, threshold=%.4f", kmerSize, levelMax, threshold)
|
||||
|
||||
newIter = iterator.MakeIWorker(worker, false, obidefault.ParallelWorkers())
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open sequence files: %w", err)
|
||||
}
|
||||
|
||||
return newIter.FilterEmpty()
|
||||
worker := lowMaskWorker(kmerSize, levelMax, threshold, mode, maskChar, CLIKeepShorter())
|
||||
|
||||
masked := sequences.MakeIWorker(
|
||||
worker,
|
||||
false,
|
||||
obidefault.ParallelWorkers(),
|
||||
).FilterEmpty()
|
||||
|
||||
obiconvert.CLIWriteBioSequences(masked, true)
|
||||
obiutils.WaitForLastPipe()
|
||||
|
||||
return nil
|
||||
}
|
||||
@@ -0,0 +1,96 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"encoding/json"
|
||||
"fmt"
|
||||
"strings"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
"gopkg.in/yaml.v3"
|
||||
)
|
||||
|
||||
type setEntry struct {
|
||||
Index int `json:"index" yaml:"index"`
|
||||
ID string `json:"id" yaml:"id"`
|
||||
Count uint64 `json:"count" yaml:"count"`
|
||||
}
|
||||
|
||||
func runLs(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
if len(args) < 1 {
|
||||
return fmt.Errorf("usage: obik ls [options] <index_directory>")
|
||||
}
|
||||
|
||||
ksg, err := obikmer.OpenKmerSetGroup(args[0])
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||
}
|
||||
|
||||
// Determine which sets to show
|
||||
patterns := CLISetPatterns()
|
||||
var indices []int
|
||||
if len(patterns) > 0 {
|
||||
indices, err = ksg.MatchSetIDs(patterns)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
} else {
|
||||
indices = make([]int, ksg.Size())
|
||||
for i := range indices {
|
||||
indices[i] = i
|
||||
}
|
||||
}
|
||||
|
||||
entries := make([]setEntry, len(indices))
|
||||
for i, idx := range indices {
|
||||
entries[i] = setEntry{
|
||||
Index: idx,
|
||||
ID: ksg.SetIDOf(idx),
|
||||
Count: ksg.Len(idx),
|
||||
}
|
||||
}
|
||||
|
||||
format := CLIOutFormat()
|
||||
switch format {
|
||||
case "json":
|
||||
return outputLsJSON(entries)
|
||||
case "yaml":
|
||||
return outputLsYAML(entries)
|
||||
case "csv":
|
||||
return outputLsCSV(entries)
|
||||
default:
|
||||
return outputLsCSV(entries)
|
||||
}
|
||||
}
|
||||
|
||||
func outputLsCSV(entries []setEntry) error {
|
||||
fmt.Println("index,id,count")
|
||||
for _, e := range entries {
|
||||
// Escape commas in ID if needed
|
||||
id := e.ID
|
||||
if strings.ContainsAny(id, ",\"") {
|
||||
id = "\"" + strings.ReplaceAll(id, "\"", "\"\"") + "\""
|
||||
}
|
||||
fmt.Printf("%d,%s,%d\n", e.Index, id, e.Count)
|
||||
}
|
||||
return nil
|
||||
}
|
||||
|
||||
func outputLsJSON(entries []setEntry) error {
|
||||
data, err := json.MarshalIndent(entries, "", " ")
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
fmt.Println(string(data))
|
||||
return nil
|
||||
}
|
||||
|
||||
func outputLsYAML(entries []setEntry) error {
|
||||
data, err := yaml.Marshal(entries)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
fmt.Print(string(data))
|
||||
return nil
|
||||
}
|
||||
@@ -0,0 +1,221 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
"sync"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// defaultMatchQueryThreshold is the minimum number of k-mer entries to
|
||||
// accumulate before launching a MatchBatch. Larger values amortize the
|
||||
// cost of opening .kdi files across more query k-mers.
|
||||
const defaultMatchQueryThreshold = 10_000_000
|
||||
|
||||
// preparedBatch pairs a batch with its pre-computed queries.
|
||||
type preparedBatch struct {
|
||||
batch obiiter.BioSequenceBatch
|
||||
seqs []*obiseq.BioSequence
|
||||
queries *obikmer.PreparedQueries
|
||||
}
|
||||
|
||||
// accumulatedWork holds multiple prepared batches whose queries have been
|
||||
// merged into a single PreparedQueries. The flat seqs slice allows
|
||||
// MatchBatch results (indexed by merged SeqIdx) to be mapped back to
|
||||
// the original sequences.
|
||||
type accumulatedWork struct {
|
||||
batches []obiiter.BioSequenceBatch // original batches in order
|
||||
seqs []*obiseq.BioSequence // flat: seqs from all batches concatenated
|
||||
queries *obikmer.PreparedQueries // merged queries with rebased SeqIdx
|
||||
}
|
||||
|
||||
// runMatch implements the "obik match" subcommand.
|
||||
//
|
||||
// Pipeline architecture (no shared mutable state between stages):
|
||||
//
|
||||
// [input batches]
|
||||
// │ Split across nCPU goroutines
|
||||
// ▼
|
||||
// PrepareQueries (CPU, parallel)
|
||||
// │ preparedCh
|
||||
// ▼
|
||||
// Accumulate & MergeQueries (1 goroutine)
|
||||
// │ matchCh — fires when totalKmers >= threshold
|
||||
// ▼
|
||||
// MatchBatch + annotate (1 goroutine, internal parallelism per partition)
|
||||
// │
|
||||
// ▼
|
||||
// [output batches]
|
||||
func runMatch(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
indexDir := CLIIndexDirectory()
|
||||
|
||||
// Open the k-mer index
|
||||
ksg, err := obikmer.OpenKmerSetGroup(indexDir)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||
}
|
||||
|
||||
log.Infof("Opened index: k=%d, m=%d, %d partitions, %d set(s)",
|
||||
ksg.K(), ksg.M(), ksg.Partitions(), ksg.Size())
|
||||
|
||||
// Resolve which sets to match against
|
||||
patterns := CLISetPatterns()
|
||||
var setIndices []int
|
||||
if len(patterns) > 0 {
|
||||
setIndices, err = ksg.MatchSetIDs(patterns)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to match set patterns: %w", err)
|
||||
}
|
||||
if len(setIndices) == 0 {
|
||||
return fmt.Errorf("no sets match the given patterns")
|
||||
}
|
||||
} else {
|
||||
setIndices = make([]int, ksg.Size())
|
||||
for i := range setIndices {
|
||||
setIndices[i] = i
|
||||
}
|
||||
}
|
||||
|
||||
for _, idx := range setIndices {
|
||||
id := ksg.SetIDOf(idx)
|
||||
if id == "" {
|
||||
id = fmt.Sprintf("set_%d", idx)
|
||||
}
|
||||
log.Infof("Matching against set %d (%s): %d k-mers", idx, id, ksg.Len(idx))
|
||||
}
|
||||
|
||||
// Read input sequences
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open sequence files: %w", err)
|
||||
}
|
||||
|
||||
nworkers := obidefault.ParallelWorkers()
|
||||
|
||||
// --- Stage 1: Prepare queries in parallel ---
|
||||
preparedCh := make(chan preparedBatch, nworkers)
|
||||
|
||||
var prepWg sync.WaitGroup
|
||||
preparer := func(iter obiiter.IBioSequence) {
|
||||
defer prepWg.Done()
|
||||
for iter.Next() {
|
||||
batch := iter.Get()
|
||||
slice := batch.Slice()
|
||||
|
||||
seqs := make([]*obiseq.BioSequence, len(slice))
|
||||
for i, s := range slice {
|
||||
seqs[i] = s
|
||||
}
|
||||
|
||||
pq := ksg.PrepareQueries(seqs)
|
||||
|
||||
preparedCh <- preparedBatch{
|
||||
batch: batch,
|
||||
seqs: seqs,
|
||||
queries: pq,
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
for i := 1; i < nworkers; i++ {
|
||||
prepWg.Add(1)
|
||||
go preparer(sequences.Split())
|
||||
}
|
||||
prepWg.Add(1)
|
||||
go preparer(sequences)
|
||||
|
||||
go func() {
|
||||
prepWg.Wait()
|
||||
close(preparedCh)
|
||||
}()
|
||||
|
||||
// --- Stage 2: Accumulate & merge queries ---
|
||||
matchCh := make(chan *accumulatedWork, 2)
|
||||
|
||||
go func() {
|
||||
defer close(matchCh)
|
||||
|
||||
var acc *accumulatedWork
|
||||
|
||||
for pb := range preparedCh {
|
||||
if acc == nil {
|
||||
acc = &accumulatedWork{
|
||||
batches: []obiiter.BioSequenceBatch{pb.batch},
|
||||
seqs: pb.seqs,
|
||||
queries: pb.queries,
|
||||
}
|
||||
} else {
|
||||
// Merge this batch's queries into the accumulator
|
||||
obikmer.MergeQueries(acc.queries, pb.queries)
|
||||
acc.batches = append(acc.batches, pb.batch)
|
||||
acc.seqs = append(acc.seqs, pb.seqs...)
|
||||
}
|
||||
|
||||
// Flush when we exceed the threshold
|
||||
if acc.queries.NKmers >= defaultMatchQueryThreshold {
|
||||
matchCh <- acc
|
||||
acc = nil
|
||||
}
|
||||
}
|
||||
|
||||
// Flush remaining
|
||||
if acc != nil {
|
||||
matchCh <- acc
|
||||
}
|
||||
}()
|
||||
|
||||
// --- Stage 3: Match & annotate ---
|
||||
output := obiiter.MakeIBioSequence()
|
||||
if sequences.IsPaired() {
|
||||
output.MarkAsPaired()
|
||||
}
|
||||
|
||||
output.Add(1)
|
||||
go func() {
|
||||
defer output.Done()
|
||||
|
||||
for work := range matchCh {
|
||||
// Match against each selected set
|
||||
for _, setIdx := range setIndices {
|
||||
result := ksg.MatchBatch(setIdx, work.queries)
|
||||
|
||||
setID := ksg.SetIDOf(setIdx)
|
||||
if setID == "" {
|
||||
setID = fmt.Sprintf("set_%d", setIdx)
|
||||
}
|
||||
attrName := "kmer_matched_" + setID
|
||||
|
||||
for seqIdx, positions := range result {
|
||||
if len(positions) > 0 {
|
||||
work.seqs[seqIdx].SetAttribute(attrName, positions)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// Push annotated batches to output
|
||||
for _, b := range work.batches {
|
||||
output.Push(b)
|
||||
}
|
||||
|
||||
// Help GC
|
||||
work.seqs = nil
|
||||
work.queries = nil
|
||||
}
|
||||
}()
|
||||
|
||||
go output.WaitAndClose()
|
||||
|
||||
obiconvert.CLIWriteBioSequences(output, true)
|
||||
obiutils.WaitForLastPipe()
|
||||
|
||||
return nil
|
||||
}
|
||||
@@ -0,0 +1,63 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
func runMv(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
if len(args) < 2 {
|
||||
return fmt.Errorf("usage: obik mv [--set PATTERN]... [--force] <source_index> <dest_index>")
|
||||
}
|
||||
|
||||
srcDir := args[0]
|
||||
destDir := args[1]
|
||||
|
||||
ksg, err := obikmer.OpenKmerSetGroup(srcDir)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open source kmer index: %w", err)
|
||||
}
|
||||
|
||||
// Resolve set patterns
|
||||
patterns := CLISetPatterns()
|
||||
var ids []string
|
||||
if len(patterns) > 0 {
|
||||
indices, err := ksg.MatchSetIDs(patterns)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
if len(indices) == 0 {
|
||||
return fmt.Errorf("no sets match the given patterns")
|
||||
}
|
||||
ids = make([]string, len(indices))
|
||||
for i, idx := range indices {
|
||||
ids[i] = ksg.SetIDOf(idx)
|
||||
}
|
||||
} else {
|
||||
// Move all sets
|
||||
ids = ksg.SetsIDs()
|
||||
}
|
||||
|
||||
log.Infof("Moving %d set(s) from %s to %s", len(ids), srcDir, destDir)
|
||||
|
||||
// Copy first
|
||||
dest, err := ksg.CopySetsByIDTo(ids, destDir, CLIForce())
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Remove from source (in reverse order to avoid renumbering issues)
|
||||
for i := len(ids) - 1; i >= 0; i-- {
|
||||
if err := ksg.RemoveSetByID(ids[i]); err != nil {
|
||||
return fmt.Errorf("failed to remove set %q from source after copy: %w", ids[i], err)
|
||||
}
|
||||
}
|
||||
|
||||
log.Infof("Destination now has %d set(s), source has %d set(s)", dest.Size(), ksg.Size())
|
||||
return nil
|
||||
}
|
||||
@@ -0,0 +1,85 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// OptionSet registers all obik subcommands on the root GetOpt.
|
||||
func OptionSet(opt *getoptions.GetOpt) {
|
||||
// index: build or extend a kmer index from sequence files
|
||||
indexCmd := opt.NewCommand("index", "Build a disk-based kmer index from sequence files")
|
||||
obiconvert.InputOptionSet(indexCmd)
|
||||
obiconvert.OutputModeOptionSet(indexCmd, false)
|
||||
KmerIndexOptionSet(indexCmd)
|
||||
indexCmd.StringMapVar(&_setMetaTags, "tag", 1, 1,
|
||||
indexCmd.Alias("T"),
|
||||
indexCmd.ArgName("KEY=VALUE"),
|
||||
indexCmd.Description("Per-set metadata tag (repeatable)."))
|
||||
indexCmd.SetCommandFn(runIndex)
|
||||
|
||||
// ls: list sets in a kmer index
|
||||
lsCmd := opt.NewCommand("ls", "List sets in a kmer index")
|
||||
OutputFormatOptionSet(lsCmd)
|
||||
SetSelectionOptionSet(lsCmd)
|
||||
lsCmd.SetCommandFn(runLs)
|
||||
|
||||
// summary: detailed statistics
|
||||
summaryCmd := opt.NewCommand("summary", "Show detailed statistics of a kmer index")
|
||||
OutputFormatOptionSet(summaryCmd)
|
||||
summaryCmd.BoolVar(&_jaccard, "jaccard", false,
|
||||
summaryCmd.Description("Compute and display pairwise Jaccard distance matrix."))
|
||||
summaryCmd.SetCommandFn(runSummary)
|
||||
|
||||
// cp: copy sets between indices
|
||||
cpCmd := opt.NewCommand("cp", "Copy sets between kmer indices")
|
||||
SetSelectionOptionSet(cpCmd)
|
||||
ForceOptionSet(cpCmd)
|
||||
cpCmd.SetCommandFn(runCp)
|
||||
|
||||
// mv: move sets between indices
|
||||
mvCmd := opt.NewCommand("mv", "Move sets between kmer indices")
|
||||
SetSelectionOptionSet(mvCmd)
|
||||
ForceOptionSet(mvCmd)
|
||||
mvCmd.SetCommandFn(runMv)
|
||||
|
||||
// rm: remove sets from an index
|
||||
rmCmd := opt.NewCommand("rm", "Remove sets from a kmer index")
|
||||
SetSelectionOptionSet(rmCmd)
|
||||
rmCmd.SetCommandFn(runRm)
|
||||
|
||||
// spectrum: output k-mer frequency spectrum as CSV
|
||||
spectrumCmd := opt.NewCommand("spectrum", "Output k-mer frequency spectrum as CSV")
|
||||
SetSelectionOptionSet(spectrumCmd)
|
||||
obiconvert.OutputModeOptionSet(spectrumCmd, false)
|
||||
spectrumCmd.SetCommandFn(runSpectrum)
|
||||
|
||||
// super: extract super k-mers from sequences
|
||||
superCmd := opt.NewCommand("super", "Extract super k-mers from sequence files")
|
||||
obiconvert.InputOptionSet(superCmd)
|
||||
obiconvert.OutputOptionSet(superCmd)
|
||||
SuperKmerOptionSet(superCmd)
|
||||
superCmd.SetCommandFn(runSuper)
|
||||
|
||||
// lowmask: mask low-complexity regions
|
||||
lowmaskCmd := opt.NewCommand("lowmask", "Mask low-complexity regions in sequences using entropy")
|
||||
obiconvert.InputOptionSet(lowmaskCmd)
|
||||
obiconvert.OutputOptionSet(lowmaskCmd)
|
||||
LowMaskOptionSet(lowmaskCmd)
|
||||
lowmaskCmd.SetCommandFn(runLowmask)
|
||||
|
||||
// match: annotate sequences with k-mer match positions from an index
|
||||
matchCmd := opt.NewCommand("match", "Annotate sequences with k-mer match positions from an index")
|
||||
IndexDirectoryOptionSet(matchCmd)
|
||||
obiconvert.InputOptionSet(matchCmd)
|
||||
obiconvert.OutputOptionSet(matchCmd)
|
||||
SetSelectionOptionSet(matchCmd)
|
||||
matchCmd.SetCommandFn(runMatch)
|
||||
|
||||
// filter: filter an index to remove low-complexity k-mers
|
||||
filterCmd := opt.NewCommand("filter", "Filter a kmer index to remove low-complexity k-mers")
|
||||
obiconvert.OutputModeOptionSet(filterCmd, false)
|
||||
EntropyFilterOptionSet(filterCmd)
|
||||
SetSelectionOptionSet(filterCmd)
|
||||
filterCmd.SetCommandFn(runFilter)
|
||||
}
|
||||
@@ -0,0 +1,360 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"strings"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// MaskingMode defines how to handle low-complexity regions
|
||||
type MaskingMode int
|
||||
|
||||
const (
|
||||
MaskMode MaskingMode = iota // Replace low-complexity regions with masked characters
|
||||
SplitMode // Split sequence into high-complexity fragments
|
||||
ExtractMode // Extract low-complexity fragments
|
||||
)
|
||||
|
||||
// Output format flags
|
||||
var _jsonOutput bool
|
||||
var _csvOutput bool
|
||||
var _yamlOutput bool
|
||||
|
||||
// Set selection flags
|
||||
var _setPatterns []string
|
||||
|
||||
// Force flag
|
||||
var _force bool
|
||||
|
||||
// Jaccard flag
|
||||
var _jaccard bool
|
||||
|
||||
// Per-set tags for index subcommand
|
||||
var _setMetaTags = make(map[string]string, 0)
|
||||
|
||||
// ==============================
|
||||
// Shared kmer options (used by index, super, lowmask)
|
||||
// ==============================
|
||||
|
||||
var _kmerSize = 31
|
||||
var _minimizerSize = -1 // -1 means auto: ceil(k / 2.5)
|
||||
|
||||
// KmerSizeOptionSet registers --kmer-size / -k.
|
||||
// Shared by index, super, and lowmask subcommands.
|
||||
func KmerSizeOptionSet(options *getoptions.GetOpt) {
|
||||
options.IntVar(&_kmerSize, "kmer-size", _kmerSize,
|
||||
options.Alias("k"),
|
||||
options.Description("Size of k-mers (must be between 2 and 31)."))
|
||||
}
|
||||
|
||||
// MinimizerOptionSet registers --minimizer-size / -m.
|
||||
// Shared by index and super subcommands.
|
||||
func MinimizerOptionSet(options *getoptions.GetOpt) {
|
||||
options.IntVar(&_minimizerSize, "minimizer-size", _minimizerSize,
|
||||
options.Alias("m"),
|
||||
options.Description("Size of minimizers for parallelization (-1 for auto = ceil(k/2.5))."))
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Lowmask-specific options
|
||||
// ==============================
|
||||
|
||||
var _entropySize = 6
|
||||
var _entropyThreshold = 0.5
|
||||
var _splitMode = false
|
||||
var _extractMode = false
|
||||
var _maskingChar = "."
|
||||
var _keepShorter = false
|
||||
|
||||
// LowMaskOptionSet registers options specific to low-complexity masking.
|
||||
func LowMaskOptionSet(options *getoptions.GetOpt) {
|
||||
KmerSizeOptionSet(options)
|
||||
|
||||
options.IntVar(&_entropySize, "entropy-size", _entropySize,
|
||||
options.Description("Maximum word size considered for entropy estimate."))
|
||||
|
||||
options.Float64Var(&_entropyThreshold, "threshold", _entropyThreshold,
|
||||
options.Description("Entropy threshold below which a kmer is masked (0 to 1)."))
|
||||
|
||||
options.BoolVar(&_splitMode, "extract-high", _splitMode,
|
||||
options.Description("Extract only high-complexity regions."))
|
||||
|
||||
options.BoolVar(&_extractMode, "extract-low", _extractMode,
|
||||
options.Description("Extract only low-complexity regions."))
|
||||
|
||||
options.StringVar(&_maskingChar, "masking-char", _maskingChar,
|
||||
options.Description("Character used to mask low complexity regions."))
|
||||
|
||||
options.BoolVar(&_keepShorter, "keep-shorter", _keepShorter,
|
||||
options.Description("Keep fragments shorter than kmer-size in split/extract mode."))
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Index-specific options
|
||||
// ==============================
|
||||
|
||||
var _indexId = ""
|
||||
var _metadataFormat = "toml"
|
||||
var _setTag = make(map[string]string, 0)
|
||||
var _minOccurrence = 1
|
||||
var _maxOccurrence = 0
|
||||
var _saveFullFilter = false
|
||||
var _saveFreqKmer = 0
|
||||
var _indexEntropyThreshold = 0.0
|
||||
var _indexEntropySize = 6
|
||||
|
||||
// KmerIndexOptionSet defines every option related to kmer index building.
|
||||
func KmerIndexOptionSet(options *getoptions.GetOpt) {
|
||||
KmerSizeOptionSet(options)
|
||||
MinimizerOptionSet(options)
|
||||
|
||||
options.StringVar(&_indexId, "index-id", _indexId,
|
||||
options.Description("Identifier for the kmer index."))
|
||||
|
||||
options.StringVar(&_metadataFormat, "metadata-format", _metadataFormat,
|
||||
options.Description("Format for metadata file (toml, yaml, json)."))
|
||||
|
||||
options.StringMapVar(&_setTag, "set-tag", 1, 1,
|
||||
options.Alias("S"),
|
||||
options.ArgName("KEY=VALUE"),
|
||||
options.Description("Adds a group-level metadata attribute KEY with value VALUE."))
|
||||
|
||||
options.IntVar(&_minOccurrence, "min-occurrence", _minOccurrence,
|
||||
options.Description("Minimum number of occurrences for a k-mer to be kept (default 1 = keep all)."))
|
||||
|
||||
options.IntVar(&_maxOccurrence, "max-occurrence", _maxOccurrence,
|
||||
options.Description("Maximum number of occurrences for a k-mer to be kept (default 0 = no upper bound)."))
|
||||
|
||||
options.BoolVar(&_saveFullFilter, "save-full-filter", _saveFullFilter,
|
||||
options.Description("When using --min-occurrence > 1, save the full frequency filter instead of just the filtered index."))
|
||||
|
||||
options.IntVar(&_saveFreqKmer, "save-freq-kmer", _saveFreqKmer,
|
||||
options.Description("Save the N most frequent k-mers per set to a CSV file (top_kmers.csv)."))
|
||||
|
||||
options.Float64Var(&_indexEntropyThreshold, "entropy-filter", _indexEntropyThreshold,
|
||||
options.Description("Filter low-complexity k-mers with entropy <= threshold (0 = disabled)."))
|
||||
|
||||
options.IntVar(&_indexEntropySize, "entropy-filter-size", _indexEntropySize,
|
||||
options.Description("Maximum word size for entropy filter computation (default 6)."))
|
||||
}
|
||||
|
||||
// EntropyFilterOptionSet registers entropy filter options for commands
|
||||
// that process existing indices (e.g. filter).
|
||||
func EntropyFilterOptionSet(options *getoptions.GetOpt) {
|
||||
options.Float64Var(&_indexEntropyThreshold, "entropy-filter", _indexEntropyThreshold,
|
||||
options.Description("Filter low-complexity k-mers with entropy <= threshold (0 = disabled)."))
|
||||
|
||||
options.IntVar(&_indexEntropySize, "entropy-filter-size", _indexEntropySize,
|
||||
options.Description("Maximum word size for entropy filter computation (default 6)."))
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Super kmer options
|
||||
// ==============================
|
||||
|
||||
// SuperKmerOptionSet registers options specific to super k-mer extraction.
|
||||
func SuperKmerOptionSet(options *getoptions.GetOpt) {
|
||||
KmerSizeOptionSet(options)
|
||||
MinimizerOptionSet(options)
|
||||
}
|
||||
|
||||
// CLIKmerSize returns the k-mer size.
|
||||
func CLIKmerSize() int {
|
||||
return _kmerSize
|
||||
}
|
||||
|
||||
// CLIMinimizerSize returns the effective minimizer size.
|
||||
func CLIMinimizerSize() int {
|
||||
m := _minimizerSize
|
||||
if m < 0 {
|
||||
m = obikmer.DefaultMinimizerSize(_kmerSize)
|
||||
}
|
||||
nworkers := obidefault.ParallelWorkers()
|
||||
m = obikmer.ValidateMinimizerSize(m, _kmerSize, nworkers)
|
||||
return m
|
||||
}
|
||||
|
||||
// CLIIndexId returns the index identifier.
|
||||
func CLIIndexId() string {
|
||||
return _indexId
|
||||
}
|
||||
|
||||
// CLIMetadataFormat returns the metadata format.
|
||||
func CLIMetadataFormat() obikmer.MetadataFormat {
|
||||
switch strings.ToLower(_metadataFormat) {
|
||||
case "toml":
|
||||
return obikmer.FormatTOML
|
||||
case "yaml":
|
||||
return obikmer.FormatYAML
|
||||
case "json":
|
||||
return obikmer.FormatJSON
|
||||
default:
|
||||
log.Warnf("Unknown metadata format %q, defaulting to TOML", _metadataFormat)
|
||||
return obikmer.FormatTOML
|
||||
}
|
||||
}
|
||||
|
||||
// CLISetTag returns the group-level metadata key=value pairs.
|
||||
func CLISetTag() map[string]string {
|
||||
return _setTag
|
||||
}
|
||||
|
||||
// CLIMinOccurrence returns the minimum occurrence threshold.
|
||||
func CLIMinOccurrence() int {
|
||||
return _minOccurrence
|
||||
}
|
||||
|
||||
// CLIMaxOccurrence returns the maximum occurrence threshold (0 = no upper bound).
|
||||
func CLIMaxOccurrence() int {
|
||||
return _maxOccurrence
|
||||
}
|
||||
|
||||
// CLISaveFullFilter returns whether to save the full frequency filter.
|
||||
func CLISaveFullFilter() bool {
|
||||
return _saveFullFilter
|
||||
}
|
||||
|
||||
// CLISaveFreqKmer returns the number of top frequent k-mers to save (0 = disabled).
|
||||
func CLISaveFreqKmer() int {
|
||||
return _saveFreqKmer
|
||||
}
|
||||
|
||||
// CLIOutputDirectory returns the output directory path.
|
||||
func CLIOutputDirectory() string {
|
||||
return obiconvert.CLIOutPutFileName()
|
||||
}
|
||||
|
||||
// SetKmerSize sets the k-mer size (for testing).
|
||||
func SetKmerSize(k int) {
|
||||
_kmerSize = k
|
||||
}
|
||||
|
||||
// SetMinimizerSize sets the minimizer size (for testing).
|
||||
func SetMinimizerSize(m int) {
|
||||
_minimizerSize = m
|
||||
}
|
||||
|
||||
// SetMinOccurrence sets the minimum occurrence (for testing).
|
||||
func SetMinOccurrence(n int) {
|
||||
_minOccurrence = n
|
||||
}
|
||||
|
||||
// CLIMaskingMode returns the masking mode from CLI flags.
|
||||
func CLIMaskingMode() MaskingMode {
|
||||
switch {
|
||||
case _extractMode:
|
||||
return ExtractMode
|
||||
case _splitMode:
|
||||
return SplitMode
|
||||
default:
|
||||
return MaskMode
|
||||
}
|
||||
}
|
||||
|
||||
// CLIMaskingChar returns the masking character, validated.
|
||||
func CLIMaskingChar() byte {
|
||||
mask := strings.TrimSpace(_maskingChar)
|
||||
if len(mask) != 1 {
|
||||
log.Fatalf("--masking-char option accepts a single character, not %s", mask)
|
||||
}
|
||||
return []byte(mask)[0]
|
||||
}
|
||||
|
||||
// CLIEntropySize returns the entropy word size.
|
||||
func CLIEntropySize() int {
|
||||
return _entropySize
|
||||
}
|
||||
|
||||
// CLIEntropyThreshold returns the entropy threshold.
|
||||
func CLIEntropyThreshold() float64 {
|
||||
return _entropyThreshold
|
||||
}
|
||||
|
||||
// CLIKeepShorter returns whether to keep short fragments.
|
||||
func CLIKeepShorter() bool {
|
||||
return _keepShorter
|
||||
}
|
||||
|
||||
// ==============================
|
||||
// Match-specific options
|
||||
// ==============================
|
||||
|
||||
var _indexDirectory = ""
|
||||
|
||||
// IndexDirectoryOptionSet registers --index / -i (mandatory directory for match).
|
||||
func IndexDirectoryOptionSet(options *getoptions.GetOpt) {
|
||||
options.StringVar(&_indexDirectory, "index", _indexDirectory,
|
||||
options.Alias("i"),
|
||||
options.Required(),
|
||||
options.ArgName("DIRECTORY"),
|
||||
options.Description("Path to the kmer index directory."))
|
||||
}
|
||||
|
||||
// CLIIndexDirectory returns the --index directory path.
|
||||
func CLIIndexDirectory() string {
|
||||
return _indexDirectory
|
||||
}
|
||||
|
||||
// CLIIndexEntropyThreshold returns the entropy filter threshold for index building (0 = disabled).
|
||||
func CLIIndexEntropyThreshold() float64 {
|
||||
return _indexEntropyThreshold
|
||||
}
|
||||
|
||||
// CLIIndexEntropySize returns the entropy filter word size for index building.
|
||||
func CLIIndexEntropySize() int {
|
||||
return _indexEntropySize
|
||||
}
|
||||
|
||||
// OutputFormatOptionSet registers --json-output, --csv-output, --yaml-output.
|
||||
func OutputFormatOptionSet(options *getoptions.GetOpt) {
|
||||
options.BoolVar(&_jsonOutput, "json-output", false,
|
||||
options.Description("Print results as JSON."))
|
||||
options.BoolVar(&_csvOutput, "csv-output", false,
|
||||
options.Description("Print results as CSV."))
|
||||
options.BoolVar(&_yamlOutput, "yaml-output", false,
|
||||
options.Description("Print results as YAML."))
|
||||
}
|
||||
|
||||
// CLIOutFormat returns the selected output format: "json", "csv", "yaml", or "text".
|
||||
func CLIOutFormat() string {
|
||||
if _jsonOutput {
|
||||
return "json"
|
||||
}
|
||||
if _csvOutput {
|
||||
return "csv"
|
||||
}
|
||||
if _yamlOutput {
|
||||
return "yaml"
|
||||
}
|
||||
return "text"
|
||||
}
|
||||
|
||||
// SetSelectionOptionSet registers --set <glob_pattern> (repeatable).
|
||||
func SetSelectionOptionSet(options *getoptions.GetOpt) {
|
||||
options.StringSliceVar(&_setPatterns, "set", 1, 1,
|
||||
options.Alias("s"),
|
||||
options.ArgName("PATTERN"),
|
||||
options.Description("Set ID or glob pattern (repeatable, supports *, ?, [...])."))
|
||||
}
|
||||
|
||||
// CLISetPatterns returns the --set patterns provided by the user.
|
||||
func CLISetPatterns() []string {
|
||||
return _setPatterns
|
||||
}
|
||||
|
||||
// ForceOptionSet registers --force / -f.
|
||||
func ForceOptionSet(options *getoptions.GetOpt) {
|
||||
options.BoolVar(&_force, "force", false,
|
||||
options.Alias("f"),
|
||||
options.Description("Force operation even if set ID already exists in destination."))
|
||||
}
|
||||
|
||||
// CLIForce returns whether --force was specified.
|
||||
func CLIForce() bool {
|
||||
return _force
|
||||
}
|
||||
@@ -0,0 +1,56 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
func runRm(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
if len(args) < 1 {
|
||||
return fmt.Errorf("usage: obik rm --set PATTERN [--set PATTERN]... <index_directory>")
|
||||
}
|
||||
|
||||
patterns := CLISetPatterns()
|
||||
if len(patterns) == 0 {
|
||||
return fmt.Errorf("--set is required (specify which sets to remove)")
|
||||
}
|
||||
|
||||
indexDir := args[0]
|
||||
|
||||
ksg, err := obikmer.OpenKmerSetGroup(indexDir)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||
}
|
||||
|
||||
indices, err := ksg.MatchSetIDs(patterns)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
if len(indices) == 0 {
|
||||
return fmt.Errorf("no sets match the given patterns")
|
||||
}
|
||||
|
||||
// Collect IDs before removal (indices shift as we remove)
|
||||
ids := make([]string, len(indices))
|
||||
for i, idx := range indices {
|
||||
ids[i] = ksg.SetIDOf(idx)
|
||||
}
|
||||
|
||||
log.Infof("Removing %d set(s) from %s", len(ids), indexDir)
|
||||
|
||||
// Remove in reverse order to avoid renumbering issues
|
||||
for i := len(ids) - 1; i >= 0; i-- {
|
||||
if err := ksg.RemoveSetByID(ids[i]); err != nil {
|
||||
return fmt.Errorf("failed to remove set %q: %w", ids[i], err)
|
||||
}
|
||||
log.Infof("Removed set %q", ids[i])
|
||||
}
|
||||
|
||||
log.Infof("Index now has %d set(s)", ksg.Size())
|
||||
return nil
|
||||
}
|
||||
@@ -0,0 +1,121 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"encoding/csv"
|
||||
"fmt"
|
||||
"os"
|
||||
"strconv"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// runSpectrum implements the "obik spectrum" subcommand.
|
||||
// It outputs k-mer frequency spectra as CSV with one column per set.
|
||||
func runSpectrum(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
if len(args) < 1 {
|
||||
return fmt.Errorf("usage: obik spectrum [options] <index_directory>")
|
||||
}
|
||||
|
||||
ksg, err := obikmer.OpenKmerSetGroup(args[0])
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||
}
|
||||
|
||||
// Determine which sets to include
|
||||
patterns := CLISetPatterns()
|
||||
var indices []int
|
||||
if len(patterns) > 0 {
|
||||
indices, err = ksg.MatchSetIDs(patterns)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to match set patterns: %w", err)
|
||||
}
|
||||
if len(indices) == 0 {
|
||||
return fmt.Errorf("no sets match the given patterns")
|
||||
}
|
||||
} else {
|
||||
// All sets
|
||||
indices = make([]int, ksg.Size())
|
||||
for i := range indices {
|
||||
indices[i] = i
|
||||
}
|
||||
}
|
||||
|
||||
// Read spectra for selected sets
|
||||
spectraMaps := make([]map[int]uint64, len(indices))
|
||||
maxFreq := 0
|
||||
for i, idx := range indices {
|
||||
spectrum, err := ksg.Spectrum(idx)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to read spectrum for set %d: %w", idx, err)
|
||||
}
|
||||
if spectrum == nil {
|
||||
log.Warnf("No spectrum data for set %d (%s)", idx, ksg.SetIDOf(idx))
|
||||
spectraMaps[i] = make(map[int]uint64)
|
||||
continue
|
||||
}
|
||||
spectraMaps[i] = spectrum.ToMap()
|
||||
if mf := spectrum.MaxFrequency(); mf > maxFreq {
|
||||
maxFreq = mf
|
||||
}
|
||||
}
|
||||
|
||||
if maxFreq == 0 {
|
||||
return fmt.Errorf("no spectrum data found in any selected set")
|
||||
}
|
||||
|
||||
// Determine output destination
|
||||
outFile := obiconvert.CLIOutPutFileName()
|
||||
var w *csv.Writer
|
||||
if outFile == "" || outFile == "-" {
|
||||
w = csv.NewWriter(os.Stdout)
|
||||
} else {
|
||||
f, err := os.Create(outFile)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to create output file: %w", err)
|
||||
}
|
||||
defer f.Close()
|
||||
w = csv.NewWriter(f)
|
||||
}
|
||||
defer w.Flush()
|
||||
|
||||
// Build header: frequency, set_id_1, set_id_2, ...
|
||||
header := make([]string, 1+len(indices))
|
||||
header[0] = "frequency"
|
||||
for i, idx := range indices {
|
||||
id := ksg.SetIDOf(idx)
|
||||
if id == "" {
|
||||
id = fmt.Sprintf("set_%d", idx)
|
||||
}
|
||||
header[i+1] = id
|
||||
}
|
||||
if err := w.Write(header); err != nil {
|
||||
return err
|
||||
}
|
||||
|
||||
// Write rows for each frequency from 1 to maxFreq
|
||||
record := make([]string, 1+len(indices))
|
||||
for freq := 1; freq <= maxFreq; freq++ {
|
||||
record[0] = strconv.Itoa(freq)
|
||||
hasData := false
|
||||
for i := range indices {
|
||||
count := spectraMaps[i][freq]
|
||||
record[i+1] = strconv.FormatUint(count, 10)
|
||||
if count > 0 {
|
||||
hasData = true
|
||||
}
|
||||
}
|
||||
// Only write rows where at least one set has a non-zero count
|
||||
if hasData {
|
||||
if err := w.Write(record); err != nil {
|
||||
return err
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
return nil
|
||||
}
|
||||
@@ -0,0 +1,148 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"encoding/json"
|
||||
"fmt"
|
||||
"os"
|
||||
"path/filepath"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
"gopkg.in/yaml.v3"
|
||||
)
|
||||
|
||||
type setSummary struct {
|
||||
Index int `json:"index" yaml:"index"`
|
||||
ID string `json:"id" yaml:"id"`
|
||||
Count uint64 `json:"count" yaml:"count"`
|
||||
DiskSize int64 `json:"disk_bytes" yaml:"disk_bytes"`
|
||||
Metadata map[string]interface{} `json:"metadata,omitempty" yaml:"metadata,omitempty"`
|
||||
}
|
||||
|
||||
type groupSummary struct {
|
||||
Path string `json:"path" yaml:"path"`
|
||||
ID string `json:"id,omitempty" yaml:"id,omitempty"`
|
||||
K int `json:"k" yaml:"k"`
|
||||
M int `json:"m" yaml:"m"`
|
||||
Partitions int `json:"partitions" yaml:"partitions"`
|
||||
TotalSets int `json:"total_sets" yaml:"total_sets"`
|
||||
TotalKmers uint64 `json:"total_kmers" yaml:"total_kmers"`
|
||||
TotalDisk int64 `json:"total_disk_bytes" yaml:"total_disk_bytes"`
|
||||
Metadata map[string]interface{} `json:"metadata,omitempty" yaml:"metadata,omitempty"`
|
||||
Sets []setSummary `json:"sets" yaml:"sets"`
|
||||
Jaccard [][]float64 `json:"jaccard,omitempty" yaml:"jaccard,omitempty"`
|
||||
}
|
||||
|
||||
func runSummary(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
if len(args) < 1 {
|
||||
return fmt.Errorf("usage: obik summary [options] <index_directory>")
|
||||
}
|
||||
|
||||
ksg, err := obikmer.OpenKmerSetGroup(args[0])
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open kmer index: %w", err)
|
||||
}
|
||||
|
||||
summary := groupSummary{
|
||||
Path: ksg.Path(),
|
||||
ID: ksg.Id(),
|
||||
K: ksg.K(),
|
||||
M: ksg.M(),
|
||||
Partitions: ksg.Partitions(),
|
||||
TotalSets: ksg.Size(),
|
||||
TotalKmers: ksg.Len(),
|
||||
Metadata: ksg.Metadata,
|
||||
Sets: make([]setSummary, ksg.Size()),
|
||||
}
|
||||
|
||||
var totalDisk int64
|
||||
for i := 0; i < ksg.Size(); i++ {
|
||||
diskSize := computeSetDiskSize(ksg, i)
|
||||
totalDisk += diskSize
|
||||
summary.Sets[i] = setSummary{
|
||||
Index: i,
|
||||
ID: ksg.SetIDOf(i),
|
||||
Count: ksg.Len(i),
|
||||
DiskSize: diskSize,
|
||||
Metadata: ksg.AllSetMetadata(i),
|
||||
}
|
||||
}
|
||||
summary.TotalDisk = totalDisk
|
||||
|
||||
// Jaccard matrix
|
||||
if _jaccard && ksg.Size() > 1 {
|
||||
dm := ksg.JaccardDistanceMatrix()
|
||||
n := ksg.Size()
|
||||
matrix := make([][]float64, n)
|
||||
for i := 0; i < n; i++ {
|
||||
matrix[i] = make([]float64, n)
|
||||
for j := 0; j < n; j++ {
|
||||
if i == j {
|
||||
matrix[i][j] = 0
|
||||
} else {
|
||||
matrix[i][j] = dm.Get(i, j)
|
||||
}
|
||||
}
|
||||
}
|
||||
summary.Jaccard = matrix
|
||||
}
|
||||
|
||||
format := CLIOutFormat()
|
||||
switch format {
|
||||
case "json":
|
||||
return outputSummaryJSON(summary)
|
||||
case "yaml":
|
||||
return outputSummaryYAML(summary)
|
||||
case "csv":
|
||||
return outputSummaryCSV(summary)
|
||||
default:
|
||||
return outputSummaryJSON(summary)
|
||||
}
|
||||
}
|
||||
|
||||
func computeSetDiskSize(ksg *obikmer.KmerSetGroup, setIndex int) int64 {
|
||||
var total int64
|
||||
for p := 0; p < ksg.Partitions(); p++ {
|
||||
path := ksg.PartitionPath(setIndex, p)
|
||||
info, err := os.Stat(path)
|
||||
if err != nil {
|
||||
continue
|
||||
}
|
||||
total += info.Size()
|
||||
}
|
||||
// Also count the set directory entry itself
|
||||
setDir := filepath.Join(ksg.Path(), fmt.Sprintf("set_%d", setIndex))
|
||||
entries, err := os.ReadDir(setDir)
|
||||
if err == nil {
|
||||
// We already counted .kdi files above; this is just for completeness
|
||||
_ = entries
|
||||
}
|
||||
return total
|
||||
}
|
||||
|
||||
func outputSummaryJSON(summary groupSummary) error {
|
||||
data, err := json.MarshalIndent(summary, "", " ")
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
fmt.Println(string(data))
|
||||
return nil
|
||||
}
|
||||
|
||||
func outputSummaryYAML(summary groupSummary) error {
|
||||
data, err := yaml.Marshal(summary)
|
||||
if err != nil {
|
||||
return err
|
||||
}
|
||||
fmt.Print(string(data))
|
||||
return nil
|
||||
}
|
||||
|
||||
func outputSummaryCSV(summary groupSummary) error {
|
||||
fmt.Println("index,id,count,disk_bytes")
|
||||
for _, s := range summary.Sets {
|
||||
fmt.Printf("%d,%s,%d,%d\n", s.Index, s.ID, s.Count, s.DiskSize)
|
||||
}
|
||||
return nil
|
||||
}
|
||||
@@ -0,0 +1,49 @@
|
||||
package obik
|
||||
|
||||
import (
|
||||
"context"
|
||||
"fmt"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// runSuper implements the "obik super" subcommand.
|
||||
// It extracts super k-mers from DNA sequences.
|
||||
func runSuper(ctx context.Context, opt *getoptions.GetOpt, args []string) error {
|
||||
k := CLIKmerSize()
|
||||
m := CLIMinimizerSize()
|
||||
|
||||
if k < 2 || k > 31 {
|
||||
return fmt.Errorf("invalid k-mer size: %d (must be between 2 and 31)", k)
|
||||
}
|
||||
|
||||
if m < 1 || m >= k {
|
||||
return fmt.Errorf("invalid parameters: minimizer size (%d) must be between 1 and k-1 (%d)", m, k-1)
|
||||
}
|
||||
|
||||
log.Printf("Extracting super k-mers with k=%d, m=%d", k, m)
|
||||
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
if err != nil {
|
||||
return fmt.Errorf("failed to open sequence files: %w", err)
|
||||
}
|
||||
|
||||
worker := obikmer.SuperKmerWorker(k, m)
|
||||
|
||||
superkmers := sequences.MakeIWorker(
|
||||
worker,
|
||||
false,
|
||||
obidefault.ParallelWorkers(),
|
||||
)
|
||||
|
||||
obiconvert.CLIWriteBioSequences(superkmers, true)
|
||||
obiutils.WaitForLastPipe()
|
||||
|
||||
return nil
|
||||
}
|
||||
@@ -1,332 +0,0 @@
|
||||
```{r}
|
||||
library(tidyverse)
|
||||
```
|
||||
|
||||
```{r}
|
||||
x <- sample(1:4096, 29, replace=TRUE)
|
||||
```
|
||||
|
||||
```{r}
|
||||
emax <- function(lseq,word_size) {
|
||||
nword = lseq - word_size + 1
|
||||
nalpha = 4^word_size
|
||||
|
||||
if (nalpha < nword) {
|
||||
cov = nword %/% nalpha
|
||||
remains = nword %% nalpha
|
||||
f1 = cov/nword
|
||||
f2 = (cov+1)/nword
|
||||
print(c(nalpha - remains,f1,remains,f2))
|
||||
e = -(nalpha - remains) * f1 * log(f1) -
|
||||
remains * f2 * log(f2)
|
||||
} else {
|
||||
e = log(nword)
|
||||
}
|
||||
|
||||
e
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
ec <- function(data,kmer_size) {
|
||||
table <- table(data)
|
||||
s <- sum(table)
|
||||
e <- sum(table * log(table))/s
|
||||
ed <- log(s) - e
|
||||
|
||||
em <- emax(s+kmer_size-1,kmer_size)
|
||||
|
||||
ed/em
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
ef <- function(data,kmer_size) {
|
||||
table <- table(data)
|
||||
s <- sum(table)
|
||||
f <- table / s
|
||||
|
||||
f <- as.numeric(f)
|
||||
f <- f[f > 0]
|
||||
|
||||
em <- emax(s+kmer_size-1,kmer_size)
|
||||
ed <- -sum(f * log(f))
|
||||
|
||||
print(c(ed,em,ed/em))
|
||||
|
||||
ed/em
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
okmer <- function(data,kmer_size) {
|
||||
str_sub(data,1:(nchar(data)-kmer_size+1)) %>%
|
||||
str_sub(1,kmer_size)
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Normalisation circulaire: retourne le plus petit k-mer par rotation circulaire
|
||||
normalize_circular <- function(kmer) {
|
||||
if (nchar(kmer) == 0) return(kmer)
|
||||
|
||||
canonical <- kmer
|
||||
n <- nchar(kmer)
|
||||
|
||||
# Tester toutes les rotations circulaires
|
||||
for (i in 2:n) {
|
||||
rotated <- paste0(str_sub(kmer, i, n), str_sub(kmer, 1, i-1))
|
||||
if (rotated < canonical) {
|
||||
canonical <- rotated
|
||||
}
|
||||
}
|
||||
|
||||
canonical
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Fonction totient d'Euler: compte le nombre d'entiers de 1 à n coprimes avec n
|
||||
euler_totient <- function(n) {
|
||||
if (n <= 0) return(0)
|
||||
|
||||
result <- n
|
||||
p <- 2
|
||||
|
||||
# Traiter tous les facteurs premiers
|
||||
while (p * p <= n) {
|
||||
if (n %% p == 0) {
|
||||
# Retirer toutes les occurrences de p
|
||||
while (n %% p == 0) {
|
||||
n <- n %/% p
|
||||
}
|
||||
# Appliquer la formule: φ(n) = n * (1 - 1/p)
|
||||
result <- result - result %/% p
|
||||
}
|
||||
p <- p + 1
|
||||
}
|
||||
|
||||
# Si n est toujours > 1, alors c'est un facteur premier
|
||||
if (n > 1) {
|
||||
result <- result - result %/% n
|
||||
}
|
||||
|
||||
result
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Retourne tous les diviseurs de n
|
||||
divisors <- function(n) {
|
||||
if (n <= 0) return(integer(0))
|
||||
|
||||
divs <- c()
|
||||
i <- 1
|
||||
while (i * i <= n) {
|
||||
if (n %% i == 0) {
|
||||
divs <- c(divs, i)
|
||||
if (i != n %/% i) {
|
||||
divs <- c(divs, n %/% i)
|
||||
}
|
||||
}
|
||||
i <- i + 1
|
||||
}
|
||||
|
||||
sort(divs)
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Compte le nombre de colliers (necklaces) distincts de longueur n
|
||||
# sur un alphabet de taille a en utilisant la formule de Moreau:
|
||||
# N(n, a) = (1/n) * Σ φ(d) * a^(n/d)
|
||||
# où la somme est sur tous les diviseurs d de n, et φ est la fonction totient d'Euler
|
||||
necklace_count <- function(n, alphabet_size) {
|
||||
if (n <= 0) return(0)
|
||||
|
||||
divs <- divisors(n)
|
||||
sum_val <- 0
|
||||
|
||||
for (d in divs) {
|
||||
# Calculer alphabet_size^(n/d)
|
||||
power <- alphabet_size^(n %/% d)
|
||||
sum_val <- sum_val + euler_totient(d) * power
|
||||
}
|
||||
|
||||
sum_val %/% n
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Nombre de classes d'équivalence pour les k-mers normalisés
|
||||
# Utilise la formule exacte de Moreau pour compter les colliers (necklaces)
|
||||
n_normalized_kmers <- function(kmer_size) {
|
||||
# Valeurs exactes pré-calculées pour k=1 à 6
|
||||
if (kmer_size == 1) return(4)
|
||||
if (kmer_size == 2) return(10)
|
||||
if (kmer_size == 3) return(24)
|
||||
if (kmer_size == 4) return(70)
|
||||
if (kmer_size == 5) return(208)
|
||||
if (kmer_size == 6) return(700)
|
||||
|
||||
# Pour k > 6, utiliser la formule de Moreau (exacte)
|
||||
# Alphabet ADN a 4 bases
|
||||
necklace_count(kmer_size, 4)
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Entropie maximale pour k-mers normalisés
|
||||
enmax <- function(lseq, word_size) {
|
||||
nword = lseq - word_size + 1
|
||||
nalpha = n_normalized_kmers(word_size)
|
||||
|
||||
if (nalpha < nword) {
|
||||
cov = nword %/% nalpha
|
||||
remains = nword %% nalpha
|
||||
f1 = cov/nword
|
||||
f2 = (cov+1)/nword
|
||||
e = -(nalpha - remains) * f1 * log(f1) -
|
||||
remains * f2 * log(f2)
|
||||
} else {
|
||||
e = log(nword)
|
||||
}
|
||||
|
||||
e
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Entropie normalisée avec normalisation circulaire des k-mers
|
||||
ecn <- function(data, kmer_size) {
|
||||
# Normaliser tous les k-mers
|
||||
normalized_data <- sapply(data, normalize_circular)
|
||||
|
||||
# Calculer la table des fréquences
|
||||
table <- table(normalized_data)
|
||||
s <- sum(table)
|
||||
e <- sum(table * log(table))/s
|
||||
ed <- log(s) - e
|
||||
|
||||
# Entropie maximale avec normalisation
|
||||
em <- enmax(s + kmer_size - 1, kmer_size)
|
||||
|
||||
ed/em
|
||||
}
|
||||
```
|
||||
|
||||
```{r}
|
||||
k<-'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa'
|
||||
ec(okmer(k,1),1)
|
||||
ec(okmer(k,2),2)
|
||||
ec(okmer(k,3),3)
|
||||
ec(okmer(k,4),4)
|
||||
```
|
||||
|
||||
```{r}
|
||||
k<-'atatatatatatatatatatatatatatata'
|
||||
ef(okmer(k,1),1)
|
||||
ef(okmer(k,2),2)
|
||||
ef(okmer(k,3),3)
|
||||
ef(okmer(k,4),4)
|
||||
```
|
||||
|
||||
```{r}
|
||||
k<-'aaaaaaaaaaaaaaaattttttttttttttt'
|
||||
ef(okmer(k,1),1)
|
||||
ef(okmer(k,2),2)
|
||||
ef(okmer(k,3),3)
|
||||
ef(okmer(k,4),4)
|
||||
```
|
||||
|
||||
```{r}
|
||||
k<-'atgatgatgatgatgatgatgatgatgatga'
|
||||
ef(okmer(k,1),1)
|
||||
ef(okmer(k,2),2)
|
||||
ef(okmer(k,3),3)
|
||||
ef(okmer(k,4),4)
|
||||
```
|
||||
|
||||
```{r}
|
||||
k<-'atcgatcgatcgatcgatcgatcgatcgact'
|
||||
ecn(okmer(k,1),1)
|
||||
ecn(okmer(k,2),2)
|
||||
ecn(okmer(k,3),3)
|
||||
ecn(okmer(k,4),4)
|
||||
```
|
||||
|
||||
```{r}
|
||||
k<-paste(sample(rep(c("a","c","g","t"),8),31),collapse="")
|
||||
k <- "actatggcaagtcgtaaccgcgcttatcagg"
|
||||
ecn(okmer(k,1),1)
|
||||
ecn(okmer(k,2),2)
|
||||
ecn(okmer(k,3),3)
|
||||
ecn(okmer(k,4),4)
|
||||
```
|
||||
|
||||
aattaaaaaaacaagataaaataatattttt
|
||||
|
||||
```{r}
|
||||
k<-'aattaaaaaaacaagataaaataatattttt'
|
||||
ecn(okmer(k,1),1)
|
||||
ecn(okmer(k,2),2)
|
||||
ecn(okmer(k,3),3)
|
||||
ecn(okmer(k,4),4)
|
||||
```
|
||||
|
||||
atg tga gat ,,,,
|
||||
|
||||
cat tca atc
|
||||
|
||||
tgatgatgatgatgatgatgatgatgatg
|
||||
|
||||
## Tests de normalisation circulaire
|
||||
|
||||
```{r}
|
||||
# Test de la fonction de normalisation
|
||||
normalize_circular("ca") # devrait donner "ac"
|
||||
normalize_circular("tgca") # devrait donner "atgc"
|
||||
normalize_circular("acgt") # devrait donner "acgt"
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Comparaison ec vs ecn sur une séquence répétitive
|
||||
# Les k-mers "atg", "tga", "gat" sont équivalents par rotation
|
||||
k <- 'atgatgatgatgatgatgatgatgatgatga'
|
||||
cat("Séquence:", k, "\n")
|
||||
cat("ec(k,3) =", ec(okmer(k,3),3), "\n")
|
||||
cat("ecn(k,3) =", ecn(okmer(k,3),3), "\n")
|
||||
```
|
||||
|
||||
```{r}
|
||||
# Comparaison sur séquence aléatoire
|
||||
k <- "actatggcaagtcgtaaccgcgcttatcagg"
|
||||
cat("Séquence:", k, "\n")
|
||||
cat("Sans normalisation:\n")
|
||||
cat(" ec(k,2) =", ec(okmer(k,2),2), "\n")
|
||||
cat(" ec(k,3) =", ec(okmer(k,3),3), "\n")
|
||||
cat(" ec(k,4) =", ec(okmer(k,4),4), "\n")
|
||||
cat("Avec normalisation circulaire:\n")
|
||||
cat(" ecn(k,2) =", ecn(okmer(k,2),2), "\n")
|
||||
cat(" ecn(k,3) =", ecn(okmer(k,3),3), "\n")
|
||||
cat(" ecn(k,4) =", ecn(okmer(k,4),4), "\n")
|
||||
```
|
||||
|
||||
```{r}
|
||||
|
||||
sequence <- "ttcatcactcagcaatcctgaatgatGAGAGCTTTTTTTTTTTATATATATATATATGTATATGTATGAAATACACTtatgctccgtttgtttcgccgtaa"
|
||||
re <- rev(c(0.8108602271901116,0.8108602271901116,0.8041354757148719,0.8041354757148719,0.8041354757148719,0.8041354757148719,0.8041354757148719,0.8041354757148719,0.7800272339058549,0.7800272339058549,0.7751610144606091,0.7751610144606091,0.7751610144606091,0.764858185548322,0.7325526601302021,0.7137620699527615,0.6789199521982864,0.6584536373623372,0.634002687184193,0.6075290415873623,0.5785545803330997,0.5785545803330997,0.5503220289212184,0.5315314387437778,0.4966893209893028,0.46077361820145696,0.42388221293245526,0.4009547969713408,0.3561142883497758,0.3561142883497758,0.3561142883497758,0.3561142883497758,0.3561142883497758,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.3418776106000334,0.35141814451677883,0.35141814451677883,0.35141814451677883,0.35141814451677883,0.35141814451677883,0.390029016052137,0.42781461756157363,0.45192285937059073,0.47238917420654,0.47238917420654,0.47238917420654,0.5092805794755417,0.5451962822633876,0.5800384000178626,0.602395141014297,0.6046146614886381,0.6046146614886381,0.6119084258128231,0.6119084258128231,0.6214217106113492,0.6424704346756562,0.6482381543085467,0.6635191587399633,0.6635191587399633,0.6635191587399633,0.6828444721058894,0.6950205907027562,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.696103322070051,0.7208976112999935))
|
||||
|
||||
di <- c(0.7208976112999935,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6961033220700509,0.6950205907027562,0.6828444721058894,0.6635191587399633,0.6635191587399633,0.6635191587399633,0.6482381543085467,0.6424704346756562,0.6214217106113492,0.6119084258128231,0.6119084258128231,0.6046146614886382,0.6046146614886382,0.6023951410142971,0.5800384000178627,0.5451962822633876,0.5092805794755418,0.47238917420654003,0.47238917420654003,0.47238917420654003,0.4519228593705908,0.4278146175615737,0.39002901605213713,0.35141814451677894,0.35141814451677894,0.35141814451677894,0.35141814451677894,0.35141814451677883,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3418776106000333,0.3561142883497762,0.3561142883497762,0.3561142883497762,0.3561142883497762,0.3561142883497762,0.40095479697134073,0.42388221293245526,0.46077361820145696,0.4966893209893028,0.5315314387437778,0.5503220289212184,0.5785545803330997,0.5785545803330997,0.6075290415873625,0.6340026871841933,0.6584536373623374,0.6789199521982866,0.7137620699527616,0.7325526601302023,0.7648581855483221,0.7751610144606093,0.7751610144606093,0.7751610144606093,0.7800272339058549,0.7800272339058549,0.8041354757148721,0.8041354757148721,0.8041354757148721,0.8041354757148721,0.8041354757148721,0.8041354757148721,0.8108602271901116,0.8108602271901116)
|
||||
|
||||
ebidir <- tibble(direct=di,reverse=re) %>%
|
||||
mutate(position = 1:length(re),
|
||||
nucleotide = str_sub(sequence,position,position))
|
||||
|
||||
ebidir %>%
|
||||
ggplot(aes(x=position,y=direct)) +
|
||||
geom_line() +
|
||||
scale_x_continuous(breaks = ebidir$position, labels = ebidir$nucleotide) +
|
||||
ylim(0,1)+
|
||||
geom_hline(yintercept=0.5, col = "red", linetype = "dashed")
|
||||
```
|
||||
@@ -1,40 +0,0 @@
|
||||
package obilowmask
|
||||
|
||||
import (
|
||||
"testing"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
func TestLowMaskWorker(t *testing.T) {
|
||||
worker := LowMaskWorker(31, 6, 0.3, Mask, 'n')
|
||||
|
||||
seq := obiseq.NewBioSequence("test", []byte("acgtacgtacgtacgtacgtacgtacgtacgt"), "test")
|
||||
result, err := worker(seq)
|
||||
if err != nil {
|
||||
t.Fatalf("Worker failed: %v", err)
|
||||
}
|
||||
|
||||
if result.Len() != 1 {
|
||||
t.Fatalf("Expected 1 sequence, got %d", result.Len())
|
||||
}
|
||||
|
||||
resultSeq := result[0]
|
||||
if resultSeq.Len() != 32 {
|
||||
t.Fatalf("Expected sequence length 32, got %d", resultSeq.Len())
|
||||
}
|
||||
}
|
||||
|
||||
func TestLowMaskWorkerWithAmbiguity(t *testing.T) {
|
||||
worker := LowMaskWorker(31, 6, 0.3, Mask, 'n')
|
||||
|
||||
seq := obiseq.NewBioSequence("test", []byte("acgtNcgtacgtacgtacgtacgtacgtacgt"), "test")
|
||||
result, err := worker(seq)
|
||||
if err != nil {
|
||||
t.Fatalf("Worker failed: %v", err)
|
||||
}
|
||||
|
||||
if result.Len() != 1 {
|
||||
t.Fatalf("Expected 1 sequence, got %d", result.Len())
|
||||
}
|
||||
}
|
||||
@@ -1,81 +0,0 @@
|
||||
package obilowmask
|
||||
|
||||
import (
|
||||
"strings"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
)
|
||||
|
||||
var __kmer_size__ = 31
|
||||
var __level_max__ = 6
|
||||
var __threshold__ = 0.5
|
||||
var __split_mode__ = false
|
||||
var __low_mode__ = false
|
||||
var __mask__ = "."
|
||||
|
||||
func LowMaskOptionSet(options *getoptions.GetOpt) {
|
||||
|
||||
options.IntVar(&__kmer_size__, "kmer-size", __kmer_size__,
|
||||
options.Description("Size of the kmer considered to estimate entropy."),
|
||||
)
|
||||
|
||||
options.IntVar(&__level_max__, "entropy_size", __level_max__,
|
||||
options.Description("Maximum word size considered for entropy estimate"),
|
||||
)
|
||||
|
||||
options.Float64Var(&__threshold__, "threshold", __threshold__,
|
||||
options.Description("entropy theshold used to mask a kmer"),
|
||||
)
|
||||
|
||||
options.BoolVar(&__split_mode__, "split-mode", __split_mode__,
|
||||
options.Description("in split mode, input sequences are splitted to remove masked regions"),
|
||||
)
|
||||
|
||||
options.BoolVar(&__low_mode__, "low-mode", __low_mode__,
|
||||
options.Description("in split mode, input sequences are splitted to remove masked regions"),
|
||||
)
|
||||
|
||||
options.StringVar(&__mask__, "masking-char", __mask__,
|
||||
options.Description("Character used to mask low complexity region"),
|
||||
)
|
||||
}
|
||||
|
||||
func OptionSet(options *getoptions.GetOpt) {
|
||||
LowMaskOptionSet(options)
|
||||
obiconvert.InputOptionSet(options)
|
||||
obiconvert.OutputOptionSet(options)
|
||||
}
|
||||
|
||||
func CLIKmerSize() int {
|
||||
return __kmer_size__
|
||||
}
|
||||
|
||||
func CLILevelMax() int {
|
||||
return __level_max__
|
||||
}
|
||||
|
||||
func CLIThreshold() float64 {
|
||||
return __threshold__
|
||||
}
|
||||
|
||||
func CLIMaskingMode() MaskingMode {
|
||||
switch {
|
||||
case __low_mode__:
|
||||
return Extract
|
||||
case __split_mode__:
|
||||
return Split
|
||||
default:
|
||||
return Mask
|
||||
}
|
||||
}
|
||||
|
||||
func CLIMaskingChar() byte {
|
||||
mask := strings.TrimSpace(__mask__)
|
||||
if len(mask) != 1 {
|
||||
log.Fatalf("--masking-char option accept a single character, not %s", mask)
|
||||
}
|
||||
return []byte(mask)[0]
|
||||
}
|
||||
@@ -1,10 +0,0 @@
|
||||
// obisuperkmer function utility package.
|
||||
//
|
||||
// The obitools/obisuperkmer package contains every
|
||||
// function specifically required by the obisuperkmer utility.
|
||||
//
|
||||
// The obisuperkmer command extracts super k-mers from DNA sequences.
|
||||
// A super k-mer is a maximal subsequence where all consecutive k-mers
|
||||
// share the same minimizer. This decomposition is useful for efficient
|
||||
// k-mer indexing and analysis in bioinformatics applications.
|
||||
package obisuperkmer
|
||||
@@ -1,69 +0,0 @@
|
||||
package obisuperkmer
|
||||
|
||||
import (
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// Private variables for storing option values
|
||||
var _KmerSize = 31
|
||||
var _MinimizerSize = 13
|
||||
|
||||
// SuperKmerOptionSet defines every option related to super k-mer extraction.
|
||||
//
|
||||
// The function adds to a CLI every option proposed to the user
|
||||
// to tune the parameters of the super k-mer extraction algorithm.
|
||||
//
|
||||
// Parameters:
|
||||
// - options: is a pointer to a getoptions.GetOpt instance normally
|
||||
// produced by the obioptions.GenerateOptionParser function.
|
||||
func SuperKmerOptionSet(options *getoptions.GetOpt) {
|
||||
options.IntVar(&_KmerSize, "kmer-size", _KmerSize,
|
||||
options.Alias("k"),
|
||||
options.Description("Size of k-mers (must be between m+1 and 31)."))
|
||||
|
||||
options.IntVar(&_MinimizerSize, "minimizer-size", _MinimizerSize,
|
||||
options.Alias("m"),
|
||||
options.Description("Size of minimizers (must be between 1 and k-1)."))
|
||||
}
|
||||
|
||||
// OptionSet adds to the basic option set every option declared for
|
||||
// the obisuperkmer command.
|
||||
//
|
||||
// It takes a pointer to a GetOpt struct as its parameter and does not return anything.
|
||||
func OptionSet(options *getoptions.GetOpt) {
|
||||
obiconvert.OptionSet(false)(options)
|
||||
SuperKmerOptionSet(options)
|
||||
}
|
||||
|
||||
// CLIKmerSize returns the k-mer size to use for super k-mer extraction.
|
||||
//
|
||||
// It does not take any parameters.
|
||||
// It returns an integer representing the k-mer size.
|
||||
func CLIKmerSize() int {
|
||||
return _KmerSize
|
||||
}
|
||||
|
||||
// SetKmerSize sets the k-mer size for super k-mer extraction.
|
||||
//
|
||||
// Parameters:
|
||||
// - k: the k-mer size (must be between m+1 and 31).
|
||||
func SetKmerSize(k int) {
|
||||
_KmerSize = k
|
||||
}
|
||||
|
||||
// CLIMinimizerSize returns the minimizer size to use for super k-mer extraction.
|
||||
//
|
||||
// It does not take any parameters.
|
||||
// It returns an integer representing the minimizer size.
|
||||
func CLIMinimizerSize() int {
|
||||
return _MinimizerSize
|
||||
}
|
||||
|
||||
// SetMinimizerSize sets the minimizer size for super k-mer extraction.
|
||||
//
|
||||
// Parameters:
|
||||
// - m: the minimizer size (must be between 1 and k-1).
|
||||
func SetMinimizerSize(m int) {
|
||||
_MinimizerSize = m
|
||||
}
|
||||
@@ -1,59 +0,0 @@
|
||||
package obisuperkmer
|
||||
|
||||
import (
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obikmer"
|
||||
)
|
||||
|
||||
// CLIExtractSuperKmers extracts super k-mers from an iterator of BioSequences.
|
||||
//
|
||||
// This function takes an iterator of BioSequence objects, extracts super k-mers
|
||||
// from each sequence using the k-mer and minimizer sizes specified by CLI options,
|
||||
// and returns a new iterator yielding the extracted super k-mers as BioSequence objects.
|
||||
//
|
||||
// Each super k-mer is a maximal subsequence where all consecutive k-mers share
|
||||
// the same minimizer. The resulting BioSequences contain metadata including:
|
||||
// - minimizer_value: the canonical minimizer value
|
||||
// - minimizer_seq: the DNA sequence of the minimizer
|
||||
// - k: the k-mer size used
|
||||
// - m: the minimizer size used
|
||||
// - start: starting position in the original sequence
|
||||
// - end: ending position in the original sequence
|
||||
// - parent_id: ID of the parent sequence
|
||||
//
|
||||
// Parameters:
|
||||
// - iterator: an iterator yielding BioSequence objects to process.
|
||||
//
|
||||
// Returns:
|
||||
// - An iterator yielding BioSequence objects representing super k-mers.
|
||||
func CLIExtractSuperKmers(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
// Get k-mer and minimizer sizes from CLI options
|
||||
k := CLIKmerSize()
|
||||
m := CLIMinimizerSize()
|
||||
|
||||
// Validate parameters
|
||||
if m < 1 || m >= k {
|
||||
log.Fatalf("Invalid parameters: minimizer size (%d) must be between 1 and k-1 (%d)", m, k-1)
|
||||
}
|
||||
|
||||
if k < 2 || k > 31 {
|
||||
log.Fatalf("Invalid k-mer size: %d (must be between 2 and 31)", k)
|
||||
}
|
||||
|
||||
log.Printf("Extracting super k-mers with k=%d, m=%d", k, m)
|
||||
|
||||
// Create the worker for super k-mer extraction
|
||||
worker := obikmer.SuperKmerWorker(k, m)
|
||||
|
||||
// Apply the worker to the iterator with parallel processing
|
||||
newIter := iterator.MakeIWorker(
|
||||
worker,
|
||||
false, // don't merge results
|
||||
obidefault.ParallelWorkers(),
|
||||
)
|
||||
|
||||
return newIter
|
||||
}
|
||||
@@ -1,149 +0,0 @@
|
||||
package obisuperkmer
|
||||
|
||||
import (
|
||||
"testing"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
func TestCLIExtractSuperKmers(t *testing.T) {
|
||||
// Create a test sequence
|
||||
testSeq := obiseq.NewBioSequence(
|
||||
"test_seq",
|
||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACGT"),
|
||||
"",
|
||||
)
|
||||
|
||||
// Create a batch with the test sequence
|
||||
batch := obiseq.NewBioSequenceBatch()
|
||||
batch.Add(testSeq)
|
||||
|
||||
// Create an iterator from the batch
|
||||
iterator := obiiter.MakeBioSequenceBatchChannel(1)
|
||||
go func() {
|
||||
iterator.Push(batch)
|
||||
iterator.Close()
|
||||
}()
|
||||
|
||||
// Set test parameters
|
||||
SetKmerSize(15)
|
||||
SetMinimizerSize(7)
|
||||
|
||||
// Extract super k-mers
|
||||
result := CLIExtractSuperKmers(iterator)
|
||||
|
||||
// Count the number of super k-mers
|
||||
count := 0
|
||||
for result.Next() {
|
||||
batch := result.Get()
|
||||
for _, sk := range batch.Slice() {
|
||||
count++
|
||||
|
||||
// Verify that the super k-mer has the expected attributes
|
||||
if !sk.HasAttribute("minimizer_value") {
|
||||
t.Error("Super k-mer missing 'minimizer_value' attribute")
|
||||
}
|
||||
if !sk.HasAttribute("minimizer_seq") {
|
||||
t.Error("Super k-mer missing 'minimizer_seq' attribute")
|
||||
}
|
||||
if !sk.HasAttribute("k") {
|
||||
t.Error("Super k-mer missing 'k' attribute")
|
||||
}
|
||||
if !sk.HasAttribute("m") {
|
||||
t.Error("Super k-mer missing 'm' attribute")
|
||||
}
|
||||
if !sk.HasAttribute("start") {
|
||||
t.Error("Super k-mer missing 'start' attribute")
|
||||
}
|
||||
if !sk.HasAttribute("end") {
|
||||
t.Error("Super k-mer missing 'end' attribute")
|
||||
}
|
||||
if !sk.HasAttribute("parent_id") {
|
||||
t.Error("Super k-mer missing 'parent_id' attribute")
|
||||
}
|
||||
|
||||
// Verify attribute values
|
||||
k, _ := sk.GetIntAttribute("k")
|
||||
m, _ := sk.GetIntAttribute("m")
|
||||
|
||||
if k != 15 {
|
||||
t.Errorf("Expected k=15, got k=%d", k)
|
||||
}
|
||||
if m != 7 {
|
||||
t.Errorf("Expected m=7, got m=%d", m)
|
||||
}
|
||||
|
||||
parentID, _ := sk.GetStringAttribute("parent_id")
|
||||
if parentID != "test_seq" {
|
||||
t.Errorf("Expected parent_id='test_seq', got '%s'", parentID)
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
if count == 0 {
|
||||
t.Error("No super k-mers were extracted")
|
||||
}
|
||||
|
||||
t.Logf("Extracted %d super k-mers from test sequence", count)
|
||||
}
|
||||
|
||||
func TestOptionGettersAndSetters(t *testing.T) {
|
||||
// Test initial values
|
||||
if CLIKmerSize() != 21 {
|
||||
t.Errorf("Expected default k-mer size 21, got %d", CLIKmerSize())
|
||||
}
|
||||
if CLIMinimizerSize() != 11 {
|
||||
t.Errorf("Expected default minimizer size 11, got %d", CLIMinimizerSize())
|
||||
}
|
||||
|
||||
// Test setters
|
||||
SetKmerSize(25)
|
||||
SetMinimizerSize(13)
|
||||
|
||||
if CLIKmerSize() != 25 {
|
||||
t.Errorf("SetKmerSize failed: expected 25, got %d", CLIKmerSize())
|
||||
}
|
||||
if CLIMinimizerSize() != 13 {
|
||||
t.Errorf("SetMinimizerSize failed: expected 13, got %d", CLIMinimizerSize())
|
||||
}
|
||||
|
||||
// Reset to defaults
|
||||
SetKmerSize(21)
|
||||
SetMinimizerSize(11)
|
||||
}
|
||||
|
||||
func BenchmarkCLIExtractSuperKmers(b *testing.B) {
|
||||
// Create a longer test sequence
|
||||
longSeq := make([]byte, 1000)
|
||||
bases := []byte{'A', 'C', 'G', 'T'}
|
||||
for i := range longSeq {
|
||||
longSeq[i] = bases[i%4]
|
||||
}
|
||||
|
||||
testSeq := obiseq.NewBioSequence("bench_seq", longSeq, "")
|
||||
|
||||
// Set parameters
|
||||
SetKmerSize(21)
|
||||
SetMinimizerSize(11)
|
||||
|
||||
b.ResetTimer()
|
||||
|
||||
for i := 0; i < b.N; i++ {
|
||||
batch := obiseq.NewBioSequenceBatch()
|
||||
batch.Add(testSeq)
|
||||
|
||||
iterator := obiiter.MakeBioSequenceBatchChannel(1)
|
||||
go func() {
|
||||
iterator.Push(batch)
|
||||
iterator.Close()
|
||||
}()
|
||||
|
||||
result := CLIExtractSuperKmers(iterator)
|
||||
|
||||
// Consume the iterator
|
||||
for result.Next() {
|
||||
result.Get()
|
||||
}
|
||||
}
|
||||
}
|
||||
+15
-1
@@ -144,7 +144,7 @@ func (r *AsciiSet) TrimLeft(s string) string {
|
||||
return s[i:]
|
||||
}
|
||||
|
||||
func SplitInTwo(s string, sep byte) (string, string) {
|
||||
func LeftSplitInTwo(s string, sep byte) (string, string) {
|
||||
i := 0
|
||||
for ; i < len(s); i++ {
|
||||
c := s[i]
|
||||
@@ -157,3 +157,17 @@ func SplitInTwo(s string, sep byte) (string, string) {
|
||||
}
|
||||
return s[:i], s[i+1:]
|
||||
}
|
||||
|
||||
func RightSplitInTwo(s string, sep byte) (string, string) {
|
||||
i := len(s) - 1
|
||||
for ; i >= 0; i-- {
|
||||
c := s[i]
|
||||
if c == sep {
|
||||
break
|
||||
}
|
||||
}
|
||||
if i == len(s) {
|
||||
return s, ""
|
||||
}
|
||||
return s[:i], s[i+1:]
|
||||
}
|
||||
|
||||
Executable
+294
@@ -0,0 +1,294 @@
|
||||
#!/bin/bash
|
||||
|
||||
# Generate GitHub-compatible release notes for an OBITools4 version.
|
||||
#
|
||||
# Usage:
|
||||
# ./release_notes.sh # latest version
|
||||
# ./release_notes.sh -v 4.4.15 # specific version
|
||||
# ./release_notes.sh -l # list available versions
|
||||
# ./release_notes.sh -r # raw commit list (no LLM)
|
||||
# ./release_notes.sh -c -v 4.4.16 # show LLM context for a version
|
||||
|
||||
GITHUB_REPO="metabarcoding/obitools4"
|
||||
GITHUB_API="https://api.github.com/repos/${GITHUB_REPO}"
|
||||
VERSION=""
|
||||
LIST_VERSIONS=false
|
||||
RAW_MODE=false
|
||||
CONTEXT_MODE=false
|
||||
LLM_MODEL="ollama:qwen3-coder-next:latest"
|
||||
|
||||
# ── Helpers ──────────────────────────────────────────────────────────────
|
||||
|
||||
die() { echo "Error: $*" >&2; exit 1; }
|
||||
|
||||
next_patch() {
|
||||
local v="$1"
|
||||
local major minor patch
|
||||
major=$(echo "$v" | cut -d. -f1)
|
||||
minor=$(echo "$v" | cut -d. -f2)
|
||||
patch=$(echo "$v" | cut -d. -f3)
|
||||
echo "${major}.${minor}.$(( patch + 1 ))"
|
||||
}
|
||||
|
||||
# Strip "pre-" prefix to get the bare version number for installation section
|
||||
bare_version() {
|
||||
echo "$1" | sed 's/^pre-//'
|
||||
}
|
||||
|
||||
installation_section() {
|
||||
local v
|
||||
v=$(bare_version "$1")
|
||||
cat <<INSTALL_EOF
|
||||
|
||||
## Installation
|
||||
|
||||
### Pre-built binaries
|
||||
|
||||
Download the appropriate archive for your system from the
|
||||
[release assets](https://github.com/metabarcoding/obitools4/releases/tag/Release_${v})
|
||||
and extract it:
|
||||
|
||||
#### Linux (AMD64)
|
||||
\`\`\`bash
|
||||
tar -xzf obitools4_${v}_linux_amd64.tar.gz
|
||||
\`\`\`
|
||||
|
||||
#### Linux (ARM64)
|
||||
\`\`\`bash
|
||||
tar -xzf obitools4_${v}_linux_arm64.tar.gz
|
||||
\`\`\`
|
||||
|
||||
#### macOS (Intel)
|
||||
\`\`\`bash
|
||||
tar -xzf obitools4_${v}_darwin_amd64.tar.gz
|
||||
\`\`\`
|
||||
|
||||
#### macOS (Apple Silicon)
|
||||
\`\`\`bash
|
||||
tar -xzf obitools4_${v}_darwin_arm64.tar.gz
|
||||
\`\`\`
|
||||
|
||||
All OBITools4 binaries are included in each archive.
|
||||
|
||||
### From source
|
||||
|
||||
You can also compile and install OBITools4 directly from source using the
|
||||
installation script:
|
||||
|
||||
\`\`\`bash
|
||||
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --version ${v}
|
||||
\`\`\`
|
||||
|
||||
By default binaries are installed in \`/usr/local/bin\`. Use \`--install-dir\` to
|
||||
change the destination and \`--obitools-prefix\` to add a prefix to command names:
|
||||
|
||||
\`\`\`bash
|
||||
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | \\
|
||||
bash -s -- --version ${v} --install-dir ~/local --obitools-prefix k
|
||||
\`\`\`
|
||||
INSTALL_EOF
|
||||
}
|
||||
|
||||
display_help() {
|
||||
cat <<EOF
|
||||
Usage: $(basename "$0") [OPTIONS]
|
||||
|
||||
Generate GitHub-compatible Markdown release notes for an OBITools4 version.
|
||||
|
||||
Options:
|
||||
-v, --version VERSION Target version (e.g., 4.4.15). Default: latest.
|
||||
-l, --list List all available versions and exit.
|
||||
-r, --raw Output raw commit list without LLM summarization.
|
||||
-c, --context Show the exact context (commits + prompt) sent to the LLM.
|
||||
-m, --model MODEL LLM model for orla (default: $LLM_MODEL).
|
||||
-h, --help Display this help message.
|
||||
|
||||
Examples:
|
||||
$(basename "$0") # release notes for the latest version
|
||||
$(basename "$0") -v 4.4.15 # release notes for a specific version
|
||||
$(basename "$0") -l # list versions
|
||||
$(basename "$0") -r -v 4.4.15 # raw commit log for a version
|
||||
$(basename "$0") -c -v 4.4.16 # show LLM context for a version
|
||||
EOF
|
||||
}
|
||||
|
||||
# Fetch all Release tags from GitHub API (sorted newest first)
|
||||
fetch_versions() {
|
||||
curl -sf "${GITHUB_API}/releases" \
|
||||
| grep '"tag_name":' \
|
||||
| sed -E 's/.*"tag_name": "Release_([0-9.]+)".*/\1/' \
|
||||
| sort -V -r
|
||||
}
|
||||
|
||||
# ── Parse arguments ──────────────────────────────────────────────────────
|
||||
|
||||
while [ "$#" -gt 0 ]; do
|
||||
case "$1" in
|
||||
-v|--version) VERSION="$2"; shift 2 ;;
|
||||
-l|--list) LIST_VERSIONS=true; shift ;;
|
||||
-r|--raw) RAW_MODE=true; shift ;;
|
||||
-c|--context) CONTEXT_MODE=true; shift ;;
|
||||
-m|--model) LLM_MODEL="$2"; shift 2 ;;
|
||||
-h|--help) display_help; exit 0 ;;
|
||||
*) die "Unsupported option: $1" ;;
|
||||
esac
|
||||
done
|
||||
|
||||
# ── List mode ────────────────────────────────────────────────────────────
|
||||
|
||||
if [ "$LIST_VERSIONS" = true ]; then
|
||||
echo "Available OBITools4 versions:" >&2
|
||||
echo "==============================" >&2
|
||||
fetch_versions
|
||||
exit 0
|
||||
fi
|
||||
|
||||
# ── Resolve versions ─────────────────────────────────────────────────────
|
||||
|
||||
all_versions=$(fetch_versions)
|
||||
[ -z "$all_versions" ] && die "Could not fetch versions from GitHub"
|
||||
|
||||
if [ -z "$VERSION" ]; then
|
||||
# ── Pre-release mode: local HEAD vs latest GitHub tag ──────────────────
|
||||
PRE_RELEASE=true
|
||||
previous_tag="Release_${latest_version}"
|
||||
VERSION="pre-$(next_patch "$latest_version")"
|
||||
|
||||
echo "Pre-release mode: $previous_tag -> HEAD (as $VERSION)" >&2
|
||||
|
||||
# Need to be in a git repo
|
||||
if ! git rev-parse --is-inside-work-tree >/dev/null 2>&1; then
|
||||
die "Not inside a git repository. Pre-release mode requires a local git repo."
|
||||
fi
|
||||
|
||||
# Check that the previous tag exists locally
|
||||
if ! git rev-parse "$previous_tag" >/dev/null 2>&1; then
|
||||
echo "Tag $previous_tag not found locally, fetching..." >&2
|
||||
git fetch --tags 2>/dev/null || true
|
||||
if ! git rev-parse "$previous_tag" >/dev/null 2>&1; then
|
||||
die "Tag $previous_tag not found locally or remotely"
|
||||
fi
|
||||
fi
|
||||
|
||||
# Get local commits from the tag to HEAD (full messages)
|
||||
commit_list=$(git log --format="%h %B" "${previous_tag}..HEAD" 2>/dev/null)
|
||||
|
||||
if [ -z "$commit_list" ]; then
|
||||
die "No local commits found since $previous_tag"
|
||||
fi
|
||||
else
|
||||
# ── Published release mode: between two GitHub tags ────────────────────
|
||||
PRE_RELEASE=false
|
||||
tag_name="Release_${VERSION}"
|
||||
|
||||
# Verify the requested version exists
|
||||
if ! echo "$all_versions" | grep -qx "$VERSION"; then
|
||||
die "Version $VERSION not found. Use -l to list available versions."
|
||||
fi
|
||||
|
||||
# Find the previous version
|
||||
previous_version=$(echo "$all_versions" | grep -A1 -x "$VERSION" | tail -1)
|
||||
|
||||
if [ "$previous_version" = "$VERSION" ] || [ -z "$previous_version" ]; then
|
||||
previous_tag=""
|
||||
echo "No previous version found -- will include all commits for $tag_name" >&2
|
||||
else
|
||||
previous_tag="Release_${previous_version}"
|
||||
echo "Generating notes: $previous_tag -> $tag_name" >&2
|
||||
fi
|
||||
|
||||
# Fetch commit messages between tags via GitHub compare API
|
||||
if [ -n "$previous_tag" ]; then
|
||||
commits_json=$(curl -sf "${GITHUB_API}/compare/${previous_tag}...${tag_name}")
|
||||
if [ -z "$commits_json" ]; then
|
||||
die "Could not fetch commit comparison from GitHub"
|
||||
fi
|
||||
commit_list=$(echo "$commits_json" \
|
||||
| jq -r '.commits[] | (.sha[:8] + " " + .commit.message)' 2>/dev/null)
|
||||
else
|
||||
commits_json=$(curl -sf "${GITHUB_API}/commits?sha=${tag_name}&per_page=50")
|
||||
if [ -z "$commits_json" ]; then
|
||||
die "Could not fetch commits from GitHub"
|
||||
fi
|
||||
commit_list=$(echo "$commits_json" \
|
||||
| jq -r '.[] | (.sha[:8] + " " + .commit.message)' 2>/dev/null)
|
||||
fi
|
||||
|
||||
if [ -z "$commit_list" ]; then
|
||||
die "No commits found between $previous_tag and $tag_name"
|
||||
fi
|
||||
fi
|
||||
|
||||
# ── LLM prompt (shared by context mode and summarization) ────────────────
|
||||
|
||||
LLM_PROMPT="Summarize the following commits into a GitHub release note for version ${VERSION}. \
|
||||
Ignore commits related to version bumps, .gitignore changes, or any internal housekeeping \
|
||||
that is irrelevant to end users. Describe each user-facing change precisely without exposing \
|
||||
code. Eliminate redundancy. Output strictly valid JSON with no surrounding text, using this \
|
||||
exact schema: {\"title\": \"<short release title>\", \"body\": \"<detailed markdown release notes>\"}"
|
||||
|
||||
# ── Raw mode: just output the commit list ────────────────────────────────
|
||||
|
||||
if [ "$RAW_MODE" = true ]; then
|
||||
echo "# Release ${VERSION}"
|
||||
echo ""
|
||||
echo "## Commits"
|
||||
echo ""
|
||||
echo "$commit_list" | while IFS= read -r line; do
|
||||
echo "- ${line}"
|
||||
done
|
||||
installation_section "$VERSION"
|
||||
exit 0
|
||||
fi
|
||||
|
||||
# ── Context mode: show what would be sent to the LLM ────────────────────
|
||||
|
||||
if [ "$CONTEXT_MODE" = true ]; then
|
||||
echo "=== LLM Model ==="
|
||||
echo "$LLM_MODEL"
|
||||
echo ""
|
||||
echo "=== Prompt ==="
|
||||
echo "$LLM_PROMPT"
|
||||
echo ""
|
||||
echo "=== Stdin (commit list) ==="
|
||||
echo "$commit_list"
|
||||
exit 0
|
||||
fi
|
||||
|
||||
# ── LLM summarization ───────────────────────────────────────────────────
|
||||
|
||||
if ! command -v orla >/dev/null 2>&1; then
|
||||
die "orla is required for LLM summarization. Use -r for raw output."
|
||||
fi
|
||||
|
||||
if ! command -v jq >/dev/null 2>&1; then
|
||||
die "jq is required for JSON parsing. Use -r for raw output."
|
||||
fi
|
||||
|
||||
echo "Summarizing with LLM ($LLM_MODEL)..." >&2
|
||||
|
||||
raw_output=$(echo "$commit_list" | \
|
||||
ORLA_MAX_TOOL_CALLS=50 orla agent -m "$LLM_MODEL" \
|
||||
"$LLM_PROMPT" \
|
||||
2>/dev/null) || true
|
||||
|
||||
if [ -z "$raw_output" ]; then
|
||||
echo "Warning: LLM returned empty output, falling back to raw mode" >&2
|
||||
exec "$0" -r -v "$VERSION"
|
||||
fi
|
||||
|
||||
# Sanitize: extract JSON object, strip control characters
|
||||
sanitized=$(echo "$raw_output" | sed -n '/^{/,/^}/p' | tr -d '\000-\011\013-\014\016-\037')
|
||||
|
||||
release_title=$(echo "$sanitized" | jq -r '.title // empty' 2>/dev/null)
|
||||
release_body=$(echo "$sanitized" | jq -r '.body // empty' 2>/dev/null)
|
||||
|
||||
if [ -n "$release_title" ] && [ -n "$release_body" ]; then
|
||||
echo "# ${release_title}"
|
||||
echo ""
|
||||
echo "$release_body"
|
||||
installation_section "$VERSION"
|
||||
else
|
||||
echo "Warning: JSON parsing failed, falling back to raw mode" >&2
|
||||
exec "$0" -r -v "$VERSION"
|
||||
fi
|
||||
Executable
+36
@@ -0,0 +1,36 @@
|
||||
#!/usr/bin/env python3
|
||||
"""
|
||||
Read potentially malformed JSON from stdin (aichat output), extract title and
|
||||
body, and print them as plain text: title on first line, blank line, then body.
|
||||
Exits with 1 on failure (no output).
|
||||
"""
|
||||
|
||||
import sys
|
||||
import json
|
||||
import re
|
||||
|
||||
text = sys.stdin.read()
|
||||
|
||||
m = re.search(r'\{.*\}', text, re.DOTALL)
|
||||
if not m:
|
||||
sys.exit(1)
|
||||
|
||||
s = m.group()
|
||||
obj = None
|
||||
|
||||
try:
|
||||
obj = json.loads(s)
|
||||
except Exception:
|
||||
s2 = re.sub(r'(?<!\\)\n', r'\\n', s)
|
||||
try:
|
||||
obj = json.loads(s2)
|
||||
except Exception:
|
||||
sys.exit(1)
|
||||
|
||||
title = obj.get('title', '').strip()
|
||||
body = obj.get('body', '').strip()
|
||||
|
||||
if not title or not body:
|
||||
sys.exit(1)
|
||||
|
||||
print(f"{title}\n\n{body}")
|
||||
+1
-1
@@ -1 +1 @@
|
||||
4.4.12
|
||||
4.4.21
|
||||
|
||||
Reference in New Issue
Block a user