mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-06-24 17:51:00 +00:00
Compare commits
103 Commits
| Author | SHA1 | Date | |
|---|---|---|---|
| 578445f38a | |||
| 2edb33ad08 | |||
| b108d4978e | |||
| e9210e28a3 | |||
| 13a93fce11 | |||
| 14064c919e | |||
| 1dfd68aa6d | |||
| 930fe5f1ba | |||
| dcdaf9e372 | |||
| af7ae3d60c | |||
| cecf90fa40 | |||
| a186bd1c92 | |||
| 46d60c1a44 | |||
| 6c4a6c697c | |||
| 60b3753673 | |||
| 14e2840a2d | |||
| 42910c7db9 | |||
| 8b4cf677c6 | |||
| 02765f154f | |||
| 449544bd63 | |||
| 434d2e5930 | |||
| 7cb02ded69 | |||
| 6d469bd711 | |||
| 3d8e4a3a4e | |||
| 07d04a6967 | |||
| 03f251c365 | |||
| 5714fa6cd3 | |||
| f101625771 | |||
| 4359b52eaf | |||
| da0c8b6f28 | |||
| 841e5c9e2a | |||
| e298daeef9 | |||
| d9e6f67a6e | |||
| f036c7fa96 | |||
| e33665e716 | |||
| c955a614ca | |||
| f19065261e | |||
| 3e349e92e1 | |||
| a4ce24a418 | |||
| 960ad1531d | |||
| 137f49d1d1 | |||
| 083a92e13d | |||
| 67683435e8 | |||
| f32b29db4f | |||
| 10f49fe64b | |||
| d257917748 | |||
| fec078c04c | |||
| a92393dd51 | |||
| 7e76698490 | |||
| 64b0b32f61 | |||
| c8e6a218cb | |||
| 8c7017a99d | |||
| c7816973a6 | |||
| 670edc1958 | |||
| f92f285417 | |||
| a786b58ed3 | |||
| a2b26712b2 | |||
| 1599abc9ad | |||
| af213ab446 | |||
| a60184c115 | |||
| 585b024bf0 | |||
| afc9ffda85 | |||
| fdd972bbd2 | |||
| 76f595e1fe | |||
| 1e1e5443e3 | |||
| 15d1f1fd80 | |||
| 8df2cbe22f | |||
| 58d685926b | |||
| e9f24426df | |||
| 2f7be10b5d | |||
| 43125f9f5e | |||
| c23368e929 | |||
| 6cb5a81685 | |||
| 94b0887069 | |||
| c188580aac | |||
| 1e1f575d1c | |||
| 40769bf827 | |||
| 74e6fcaf83 | |||
| 30ec8b1b63 | |||
| cdc72c5346 | |||
| 82a9972be7 | |||
| ff6e515b2a | |||
| cd0c525f50 | |||
| abe935aa18 | |||
| 8dd32dc1bf | |||
| 6ee8750635 | |||
| 8c318c480e | |||
| 09fbc217d3 | |||
| 3d2e205722 | |||
| 623116ab13 | |||
| 1e4509cb63 | |||
| b33d7705a8 | |||
| 1342c83db6 | |||
| b246025907 | |||
| 761e0dbed3 | |||
| a7ea47624b | |||
| 61e346658e | |||
| 1ba1294b11 | |||
| b2476fffcb | |||
| b05404721e | |||
| c57e788459 | |||
| 1cecf23978 | |||
| 4c824ef9b7 |
@@ -9,11 +9,11 @@ jobs:
|
|||||||
build:
|
build:
|
||||||
runs-on: ubuntu-latest
|
runs-on: ubuntu-latest
|
||||||
steps:
|
steps:
|
||||||
- name: Checkout obitools4 project
|
|
||||||
uses: actions/checkout@v4
|
|
||||||
- name: Setup Go
|
- name: Setup Go
|
||||||
uses: actions/setup-go@v5
|
uses: actions/setup-go@v5
|
||||||
with:
|
with:
|
||||||
go-version: "1.23"
|
go-version: '1.23'
|
||||||
|
- name: Checkout obitools4 project
|
||||||
|
uses: actions/checkout@v5
|
||||||
- name: Run tests
|
- name: Run tests
|
||||||
run: make githubtests
|
run: make githubtests
|
||||||
|
|||||||
@@ -16,9 +16,9 @@ jobs:
|
|||||||
- name: Setup Go
|
- name: Setup Go
|
||||||
uses: actions/setup-go@v5
|
uses: actions/setup-go@v5
|
||||||
with:
|
with:
|
||||||
go-version: "1.23"
|
go-version: "1.26"
|
||||||
- name: Checkout obitools4 project
|
- name: Checkout obitools4 project
|
||||||
uses: actions/checkout@v4
|
uses: actions/checkout@v5
|
||||||
- name: Run tests
|
- name: Run tests
|
||||||
run: make githubtests
|
run: make githubtests
|
||||||
|
|
||||||
@@ -49,12 +49,12 @@ jobs:
|
|||||||
|
|
||||||
steps:
|
steps:
|
||||||
- name: Checkout code
|
- name: Checkout code
|
||||||
uses: actions/checkout@v4
|
uses: actions/checkout@v5
|
||||||
|
|
||||||
- name: Setup Go
|
- name: Setup Go
|
||||||
uses: actions/setup-go@v5
|
uses: actions/setup-go@v5
|
||||||
with:
|
with:
|
||||||
go-version: "1.23"
|
go-version: "1.26"
|
||||||
|
|
||||||
- name: Extract version from tag
|
- name: Extract version from tag
|
||||||
id: get_version
|
id: get_version
|
||||||
@@ -69,7 +69,23 @@ jobs:
|
|||||||
xcode-select --install 2>/dev/null || true
|
xcode-select --install 2>/dev/null || true
|
||||||
xcode-select -p
|
xcode-select -p
|
||||||
|
|
||||||
- name: Build binaries
|
- name: Build binaries (Linux)
|
||||||
|
if: runner.os == 'Linux'
|
||||||
|
env:
|
||||||
|
VERSION: ${{ steps.get_version.outputs.version }}
|
||||||
|
run: |
|
||||||
|
docker run --rm \
|
||||||
|
-v "$(pwd):/src" \
|
||||||
|
-w /src \
|
||||||
|
-e VERSION="${VERSION}" \
|
||||||
|
golang:1.26-alpine \
|
||||||
|
sh -c "apk add --no-cache gcc musl-dev zlib-dev zlib-static make && \
|
||||||
|
make LDFLAGS='-linkmode=external -extldflags=-static' obitools"
|
||||||
|
mkdir -p artifacts
|
||||||
|
tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
|
||||||
|
|
||||||
|
- name: Build binaries (macOS)
|
||||||
|
if: runner.os == 'macOS'
|
||||||
env:
|
env:
|
||||||
GOOS: ${{ matrix.goos }}
|
GOOS: ${{ matrix.goos }}
|
||||||
GOARCH: ${{ matrix.goarch }}
|
GOARCH: ${{ matrix.goarch }}
|
||||||
@@ -77,7 +93,6 @@ jobs:
|
|||||||
run: |
|
run: |
|
||||||
make obitools
|
make obitools
|
||||||
mkdir -p artifacts
|
mkdir -p artifacts
|
||||||
# Create a single tar.gz with all binaries for this platform
|
|
||||||
tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
|
tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
|
||||||
|
|
||||||
- name: Upload artifacts
|
- name: Upload artifacts
|
||||||
@@ -92,7 +107,7 @@ jobs:
|
|||||||
runs-on: ubuntu-latest
|
runs-on: ubuntu-latest
|
||||||
steps:
|
steps:
|
||||||
- name: Checkout code
|
- name: Checkout code
|
||||||
uses: actions/checkout@v4
|
uses: actions/checkout@v5
|
||||||
with:
|
with:
|
||||||
fetch-depth: 0
|
fetch-depth: 0
|
||||||
|
|
||||||
|
|||||||
+2
-1
@@ -16,13 +16,14 @@
|
|||||||
**/*.tgz
|
**/*.tgz
|
||||||
**/*.yaml
|
**/*.yaml
|
||||||
**/*.csv
|
**/*.csv
|
||||||
|
**/*.pb.gz
|
||||||
xx
|
xx
|
||||||
|
|
||||||
.rhistory
|
.rhistory
|
||||||
/.vscode
|
/.vscode
|
||||||
/build
|
/build
|
||||||
/bugs
|
/bugs
|
||||||
|
autodoc
|
||||||
/ncbitaxo
|
/ncbitaxo
|
||||||
|
|
||||||
!/obitests/**
|
!/obitests/**
|
||||||
|
|||||||
@@ -2,9 +2,17 @@
|
|||||||
#export GOBIN=$(GOPATH)/bin
|
#export GOBIN=$(GOPATH)/bin
|
||||||
#export PATH=$(GOBIN):$(shell echo $${PATH})
|
#export PATH=$(GOBIN):$(shell echo $${PATH})
|
||||||
|
|
||||||
|
.DEFAULT_GOAL := all
|
||||||
|
|
||||||
|
GREEN := \033[0;32m
|
||||||
|
YELLOW := \033[0;33m
|
||||||
|
BLUE := \033[0;34m
|
||||||
|
NC := \033[0m
|
||||||
|
|
||||||
GOFLAGS=
|
GOFLAGS=
|
||||||
|
LDFLAGS=
|
||||||
GOCMD=go
|
GOCMD=go
|
||||||
GOBUILD=$(GOCMD) build $(GOFLAGS)
|
GOBUILD=$(GOCMD) build $(GOFLAGS) $(if $(LDFLAGS),-ldflags="$(LDFLAGS)")
|
||||||
GOGENERATE=$(GOCMD) generate
|
GOGENERATE=$(GOCMD) generate
|
||||||
GOCLEAN=$(GOCMD) clean
|
GOCLEAN=$(GOCMD) clean
|
||||||
GOTEST=$(GOCMD) test
|
GOTEST=$(GOCMD) test
|
||||||
@@ -43,7 +51,7 @@ $(OBITOOLS_PREFIX)$(notdir $(1)): $(BUILD_DIR) $(1) pkg/obioptions/version.go
|
|||||||
@echo -n - Building obitool $(notdir $(1))...
|
@echo -n - Building obitool $(notdir $(1))...
|
||||||
@$(GOBUILD) -o $(BUILD_DIR)/$(OBITOOLS_PREFIX)$(notdir $(1)) ./$(1) \
|
@$(GOBUILD) -o $(BUILD_DIR)/$(OBITOOLS_PREFIX)$(notdir $(1)) ./$(1) \
|
||||||
2> $(OBITOOLS_PREFIX)$(notdir $(1)).log \
|
2> $(OBITOOLS_PREFIX)$(notdir $(1)).log \
|
||||||
|| cat $(OBITOOLS_PREFIX)$(notdir $(1)).log
|
|| { cat $(OBITOOLS_PREFIX)$(notdir $(1)).log; rm -f $(OBITOOLS_PREFIX)$(notdir $(1)).log; exit 1; }
|
||||||
@rm -f $(OBITOOLS_PREFIX)$(notdir $(1)).log
|
@rm -f $(OBITOOLS_PREFIX)$(notdir $(1)).log
|
||||||
@echo Done.
|
@echo Done.
|
||||||
endef
|
endef
|
||||||
@@ -60,6 +68,28 @@ endif
|
|||||||
|
|
||||||
OUTPUT:=$(shell mktemp)
|
OUTPUT:=$(shell mktemp)
|
||||||
|
|
||||||
|
help:
|
||||||
|
@printf "$(GREEN)OBITools4 Makefile$(NC)\n\n"
|
||||||
|
@printf "$(BLUE)Main targets:$(NC)\n"
|
||||||
|
@printf " %-20s %s\n" "all" "Build all obitools (default)"
|
||||||
|
@printf " %-20s %s\n" "obitools" "Build all obitools binaries to build/"
|
||||||
|
@printf " %-20s %s\n" "test" "Run Go unit tests"
|
||||||
|
@printf " %-20s %s\n" "obitests" "Run integration tests (obitests/)"
|
||||||
|
@printf " %-20s %s\n" "bump-version" "Increment patch version (or set with VERSION=x.y.z)"
|
||||||
|
@printf " %-20s %s\n" "update-deps" "Update all Go dependencies"
|
||||||
|
@printf "\n$(BLUE)Jujutsu workflow:$(NC)\n"
|
||||||
|
@printf " %-20s %s\n" "jjnew" "Document current commit and start a new one"
|
||||||
|
@printf " %-20s %s\n" "jjpush" "Release: describe, bump, generate notes, push PR, tag (VERSION=x.y.z optional)"
|
||||||
|
@printf " %-20s %s\n" "jjfetch" "Fetch latest commits from origin"
|
||||||
|
@printf "\n$(BLUE)Required tools:$(NC)\n"
|
||||||
|
@printf " %-20s " "go"; command -v go >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(go version)" || printf "$(YELLOW)✗ not found$(NC)\n"
|
||||||
|
@printf " %-20s " "git"; command -v git >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(git --version)" || printf "$(YELLOW)✗ not found$(NC)\n"
|
||||||
|
@printf " %-20s " "jj"; command -v jj >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(jj --version)" || printf "$(YELLOW)✗ not found$(NC)\n"
|
||||||
|
@printf " %-20s " "gh"; command -v gh >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(gh --version | head -1)" || printf "$(YELLOW)✗ not found$(NC) (brew install gh)\n"
|
||||||
|
@printf "\n$(BLUE)Optional tools (release notes generation):$(NC)\n"
|
||||||
|
@printf " %-20s " "aichat"; command -v aichat >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(aichat --version)" || printf "$(YELLOW)✗ not found$(NC) (https://github.com/sigoden/aichat)\n"
|
||||||
|
@printf " %-20s " "jq"; command -v jq >/dev/null 2>&1 && printf "$(GREEN)✓$(NC) %s\n" "$$(jq --version)" || printf "$(YELLOW)✗ not found$(NC) (brew install jq)\n"
|
||||||
|
|
||||||
all: install-githook obitools
|
all: install-githook obitools
|
||||||
|
|
||||||
obitools: $(patsubst %,$(OBITOOLS_PREFIX)%,$(OBITOOLS))
|
obitools: $(patsubst %,$(OBITOOLS_PREFIX)%,$(OBITOOLS))
|
||||||
@@ -106,8 +136,12 @@ pkg/obioptions/version.go: version.txt .FORCE
|
|||||||
@rm -f $(OUTPUT)
|
@rm -f $(OUTPUT)
|
||||||
|
|
||||||
bump-version:
|
bump-version:
|
||||||
@echo "Incrementing version..."
|
|
||||||
@current=$$(cat version.txt); \
|
@current=$$(cat version.txt); \
|
||||||
|
if [ -n "$(VERSION)" ]; then \
|
||||||
|
new_version="$(VERSION)"; \
|
||||||
|
echo "Setting version to $$new_version (was $$current)"; \
|
||||||
|
else \
|
||||||
|
echo "Incrementing version..."; \
|
||||||
echo " Current version: $$current"; \
|
echo " Current version: $$current"; \
|
||||||
major=$$(echo $$current | cut -d. -f1); \
|
major=$$(echo $$current | cut -d. -f1); \
|
||||||
minor=$$(echo $$current | cut -d. -f2); \
|
minor=$$(echo $$current | cut -d. -f2); \
|
||||||
@@ -115,6 +149,7 @@ bump-version:
|
|||||||
new_patch=$$((patch + 1)); \
|
new_patch=$$((patch + 1)); \
|
||||||
new_version="$$major.$$minor.$$new_patch"; \
|
new_version="$$major.$$minor.$$new_patch"; \
|
||||||
echo " New version: $$new_version"; \
|
echo " New version: $$new_version"; \
|
||||||
|
fi; \
|
||||||
echo "$$new_version" > version.txt
|
echo "$$new_version" > version.txt
|
||||||
@echo "✓ Version updated in version.txt"
|
@echo "✓ Version updated in version.txt"
|
||||||
@$(MAKE) pkg/obioptions/version.go
|
@$(MAKE) pkg/obioptions/version.go
|
||||||
@@ -128,40 +163,77 @@ jjnew:
|
|||||||
@echo "$(GREEN)✓ New commit created$(NC)"
|
@echo "$(GREEN)✓ New commit created$(NC)"
|
||||||
|
|
||||||
jjpush:
|
jjpush:
|
||||||
@echo "$(YELLOW)→ Pushing commit to repository...$(NC)"
|
@$(MAKE) jjpush-describe
|
||||||
|
@$(MAKE) jjpush-bump
|
||||||
|
@$(MAKE) jjpush-notes
|
||||||
|
@$(MAKE) jjpush-push
|
||||||
|
@$(MAKE) jjpush-tag
|
||||||
|
@echo "$(GREEN)✓ Release complete$(NC)"
|
||||||
|
|
||||||
|
jjpush-describe:
|
||||||
@echo "$(BLUE)→ Documenting current commit...$(NC)"
|
@echo "$(BLUE)→ Documenting current commit...$(NC)"
|
||||||
@jj auto-describe
|
@jj auto-describe
|
||||||
|
|
||||||
|
jjpush-bump:
|
||||||
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
|
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
|
||||||
@jj new
|
@jj new
|
||||||
@previous_version=$$(cat version.txt); \
|
@$(MAKE) bump-version
|
||||||
$(MAKE) bump-version; \
|
|
||||||
version=$$(cat version.txt); \
|
jjpush-notes:
|
||||||
|
@version=$$(cat version.txt); \
|
||||||
|
echo "$(BLUE)→ Generating release notes for version $$version...$(NC)"; \
|
||||||
|
release_title="Release $$version"; \
|
||||||
|
release_body=""; \
|
||||||
|
if command -v aichat >/dev/null 2>&1; then \
|
||||||
|
previous_tag=$$(git describe --tags --abbrev=0 --match 'Release_*' 2>/dev/null); \
|
||||||
|
if [ -z "$$previous_tag" ]; then \
|
||||||
|
echo "$(YELLOW)⚠ No previous Release tag found, skipping release notes$(NC)"; \
|
||||||
|
else \
|
||||||
|
raw_output=$$(git log --format="%h %B" "$$previous_tag..HEAD" | \
|
||||||
|
aichat \
|
||||||
|
"Summarize the following commits into a GitHub release note for version $$version. Ignore commits related to version bumps, .gitignore changes, or any internal housekeeping that is irrelevant to end users. Describe each user-facing change precisely without exposing code. Eliminate redundancy. Output strictly valid JSON with no surrounding text, using this exact schema: {\"title\": \"<short release title>\", \"body\": \"<detailed markdown release notes>\"}" 2>/dev/null) || true; \
|
||||||
|
if [ -n "$$raw_output" ]; then \
|
||||||
|
notes=$$(printf '%s\n' "$$raw_output" | python3 tools/json2md.py 2>/dev/null); \
|
||||||
|
if [ -n "$$notes" ]; then \
|
||||||
|
release_title=$$(echo "$$notes" | head -1); \
|
||||||
|
release_body=$$(echo "$$notes" | tail -n +3); \
|
||||||
|
else \
|
||||||
|
echo "$(YELLOW)⚠ JSON parsing failed, using default release message$(NC)"; \
|
||||||
|
fi; \
|
||||||
|
fi; \
|
||||||
|
fi; \
|
||||||
|
fi; \
|
||||||
|
printf '%s' "$$release_title" > /tmp/obitools4-release-title.txt; \
|
||||||
|
printf '%s' "$$release_body" > /tmp/obitools4-release-body.txt; \
|
||||||
|
echo "$(BLUE)→ Setting release notes as commit description...$(NC)"; \
|
||||||
|
jj desc -m "$$release_title"$$'\n\n'"$$release_body"
|
||||||
|
|
||||||
|
jjpush-push:
|
||||||
|
@echo "$(BLUE)→ Pushing commits...$(NC)"
|
||||||
|
@jj git push --change @
|
||||||
|
@echo "$(BLUE)→ Creating/updating PR...$(NC)"
|
||||||
|
@release_title=$$(cat /tmp/obitools4-release-title.txt 2>/dev/null || echo "Release $$(cat version.txt)"); \
|
||||||
|
release_body=$$(cat /tmp/obitools4-release-body.txt 2>/dev/null || echo ""); \
|
||||||
|
branch=$$(jj log -r @ --no-graph -T 'bookmarks.map(|b| b.name()).join("\n")' 2>/dev/null | head -1); \
|
||||||
|
if [ -n "$$branch" ] && command -v gh >/dev/null 2>&1; then \
|
||||||
|
gh pr create --title "$$release_title" --body "$$release_body" --base master --head "$$branch" 2>/dev/null \
|
||||||
|
|| gh pr edit "$$branch" --title "$$release_title" --body "$$release_body" 2>/dev/null \
|
||||||
|
|| echo "$(YELLOW)⚠ Could not create/update PR$(NC)"; \
|
||||||
|
fi
|
||||||
|
|
||||||
|
jjpush-tag:
|
||||||
|
@version=$$(cat version.txt); \
|
||||||
tag_name="Release_$$version"; \
|
tag_name="Release_$$version"; \
|
||||||
previous_tag="Release_$$previous_version"; \
|
release_title=$$(cat /tmp/obitools4-release-title.txt 2>/dev/null || echo "Release $$version"); \
|
||||||
echo "$(BLUE)→ Documenting version bump commit...$(NC)"; \
|
release_body=$$(cat /tmp/obitools4-release-body.txt 2>/dev/null || echo ""); \
|
||||||
jj auto-describe; \
|
install_section=$$'\n## Installation\n\n### Pre-built binaries\n\nDownload the appropriate archive for your system from the\n[release assets](https://github.com/metabarcoding/obitools4/releases/tag/Release_'"$$version"')\nand extract it:\n\n#### Linux (AMD64)\n```bash\ntar -xzf obitools4_'"$$version"'_linux_amd64.tar.gz\n```\n\n#### Linux (ARM64)\n```bash\ntar -xzf obitools4_'"$$version"'_linux_arm64.tar.gz\n```\n\n#### macOS (Intel)\n```bash\ntar -xzf obitools4_'"$$version"'_darwin_amd64.tar.gz\n```\n\n#### macOS (Apple Silicon)\n```bash\ntar -xzf obitools4_'"$$version"'_darwin_arm64.tar.gz\n```\n\nAll OBITools4 binaries are included in each archive.\n\n### From source\n\nYou can also compile and install OBITools4 directly from source using the\ninstallation script:\n\n```bash\ncurl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --version '"$$version"'\n```\n\nBy default binaries are installed in `/usr/local/bin`. Use `--install-dir` to\nchange the destination and `--obitools-prefix` to add a prefix to command names:\n\n```bash\ncurl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | \\\n bash -s -- --version '"$$version"' --install-dir ~/local --obitools-prefix k\n```\n'; \
|
||||||
echo "$(BLUE)→ Generating release notes from $$previous_tag to current commit...$(NC)"; \
|
release_message="$$release_title"$$'\n\n'"$$release_body$$install_section"; \
|
||||||
if command -v orla >/dev/null 2>&1 && command -v jq >/dev/null 2>&1; then \
|
echo "$(BLUE)→ Creating tag $$tag_name...$(NC)"; \
|
||||||
release_json=$$(jj log -r "$$previous_tag::@" -T 'commit_id.short() ++ " " ++ description' | \
|
commit_hash=$$(jj log -r @ --no-graph -T 'commit_id' 2>/dev/null); \
|
||||||
ORLA_MAX_TOOL_CALLS=50 orla agent -m ollama:qwen3-coder-next:latest \
|
git tag -a "$$tag_name" $${commit_hash:+"$$commit_hash"} -m "$$release_message" 2>/dev/null || echo "$(YELLOW)⚠ Tag $$tag_name already exists$(NC)"; \
|
||||||
"Summarize the following commits into a GitHub release note for version $$version. Ignore commits related to version bumps, .gitignore changes, or any internal housekeeping that is irrelevant to end users. Describe each user-facing change precisely without exposing code. Eliminate redundancy. Output strictly valid JSON with no surrounding text, using this exact schema: {\"title\": \"<short release title>\", \"body\": \"<detailed markdown release notes>\"}"); \
|
echo "$(BLUE)→ Pushing tag $$tag_name...$(NC)"; \
|
||||||
release_json=$$(echo "$$release_json" | sed -n '/^{/,/^}/p'); \
|
git push origin "$$tag_name" 2>/dev/null || echo "$(YELLOW)⚠ Tag push failed or already pushed$(NC)"; \
|
||||||
release_title=$$(echo "$$release_json" | jq -r '.title // empty') ; \
|
rm -f /tmp/obitools4-release-title.txt /tmp/obitools4-release-body.txt
|
||||||
release_body=$$(echo "$$release_json" | jq -r '.body // empty') ; \
|
|
||||||
if [ -n "$$release_title" ] && [ -n "$$release_body" ]; then \
|
|
||||||
release_message="$$release_title"$$'\n\n'"$$release_body"; \
|
|
||||||
else \
|
|
||||||
echo "$(YELLOW)⚠ JSON parsing failed, falling back to raw output$(NC)"; \
|
|
||||||
release_message="Release $$version"$$'\n\n'"$$release_json"; \
|
|
||||||
fi; \
|
|
||||||
else \
|
|
||||||
release_message="Release $$version"; \
|
|
||||||
fi; \
|
|
||||||
echo "$(BLUE)→ Pushing commits and creating tag $$tag_name...$(NC)"; \
|
|
||||||
jj git push --change @; \
|
|
||||||
git tag -a "$$tag_name" -m "$$release_message" 2>/dev/null || echo "Tag $$tag_name already exists"; \
|
|
||||||
git push origin "$$tag_name" 2>/dev/null || echo "Tag already pushed"
|
|
||||||
@echo "$(GREEN)✓ Commits and tag pushed to repository$(NC)"
|
|
||||||
|
|
||||||
jjfetch:
|
jjfetch:
|
||||||
@echo "$(YELLOW)→ Pulling latest commits...$(NC)"
|
@echo "$(YELLOW)→ Pulling latest commits...$(NC)"
|
||||||
@@ -169,5 +241,5 @@ jjfetch:
|
|||||||
@jj new master@origin
|
@jj new master@origin
|
||||||
@echo "$(GREEN)✓ Latest commits pulled$(NC)"
|
@echo "$(GREEN)✓ Latest commits pulled$(NC)"
|
||||||
|
|
||||||
.PHONY: all obitools update-deps obitests githubtests jjnew jjpush jjfetch bump-version .FORCE
|
.PHONY: all obitools update-deps obitests githubtests help jjnew jjpush jjpush-describe jjpush-bump jjpush-notes jjpush-push jjpush-tag jjfetch bump-version .FORCE
|
||||||
.FORCE:
|
.FORCE:
|
||||||
|
|||||||
@@ -34,6 +34,10 @@ The installation script offers several options:
|
|||||||
> want to have several versions of obitools at the
|
> want to have several versions of obitools at the
|
||||||
> same time on your system (as example `-p g` will produce
|
> same time on your system (as example `-p g` will produce
|
||||||
> `gobigrep` command instead of `obigrep`).
|
> `gobigrep` command instead of `obigrep`).
|
||||||
|
>
|
||||||
|
> -j, --jobs Number of parallel jobs used for compilation
|
||||||
|
> (default: 1). Increase this value to speed up
|
||||||
|
> compilation on multi-core systems (e.g., `-j 4`).
|
||||||
|
|
||||||
### Examples
|
### Examples
|
||||||
|
|
||||||
|
|||||||
@@ -1,755 +0,0 @@
|
|||||||
# Prospective : Index k-mer v3 — Super-kmers canoniques, unitigs, et Aho-Corasick
|
|
||||||
|
|
||||||
## 1. Constat sur l'index v1
|
|
||||||
|
|
||||||
L'index actuel (`.kdi` delta-varint) stocke 18.6 milliards de k-mers (k=31, m=13, P=4096, 2 sets) en 85 Go, soit 4.8-5.6 bytes/k-mer. Les causes :
|
|
||||||
|
|
||||||
- Le canonical standard `min(fwd, rc)` disperse les k-mers sur 62 bits → deltas ~2^40 → 5-6 bytes varint
|
|
||||||
- Les k-mers partagés entre sets sont stockés N fois (une fois par set)
|
|
||||||
- Le matching nécessite N×P ouvertures de fichier (N passes)
|
|
||||||
|
|
||||||
## 2. Observations expérimentales
|
|
||||||
|
|
||||||
### 2.1 Déréplication brute
|
|
||||||
|
|
||||||
Sur un génome de *Betula exilis* 15× couvert, le pipeline `obik lowmask | obik super | obiuniq` réduit **80 Go de fastq.gz en 5.6 Go de fasta.gz** — un facteur 14×. Cela montre que la déréplication au niveau super-kmer est extrêmement efficace et que les super-kmers forment une représentation naturellement compacte.
|
|
||||||
|
|
||||||
### 2.2 Après filtre de fréquence (count > 1)
|
|
||||||
|
|
||||||
En éliminant les super-kmers observés une seule fois (erreurs de séquençage), le fichier passe de 5.6 Go à **2.7 Go de fasta.gz**. Les statistiques détaillées (obicount) :
|
|
||||||
|
|
||||||
| Métrique | Valeur |
|
|
||||||
|----------|--------|
|
|
||||||
| Variants (super-kmers uniques) | 37,294,271 |
|
|
||||||
| Reads (somme des counts) | 148,828,167 |
|
|
||||||
| Symboles (bases totales variants) | 1,415,018,593 |
|
|
||||||
| Longueur moyenne super-kmer | **37.9 bases** |
|
|
||||||
| K-mers/super-kmer moyen (k=31) | **7.9** |
|
|
||||||
| K-mers totaux estimés | **~295M** |
|
|
||||||
| Count moyen par super-kmer | **4.0×** |
|
|
||||||
|
|
||||||
### 2.3 Comparaison avec l'index v1
|
|
||||||
|
|
||||||
| Format | Taille | K-mers | Bytes/k-mer |
|
|
||||||
|--------|--------|--------|-------------|
|
|
||||||
| Index .kdi v1 (set Human dans Contaminent_idx) | 12.8 Go | ~3B | 4.3 |
|
|
||||||
| Delta-varint hypothétique (295M k-mers) | ~1.5 Go | 295M | 5.0 |
|
|
||||||
| Super-kmers 2-bit packed (*Betula* count>1) | ~354 Mo | 295M | **1.2** |
|
|
||||||
| Super-kmers fasta.gz (*Betula* count>1) | 2.7 Go | 295M | 9.2* |
|
|
||||||
|
|
||||||
\* Le fasta.gz inclut les headers, les counts, et la compression gzip — pas directement comparable au format binaire.
|
|
||||||
|
|
||||||
**Le format super-kmer 2-bit est ~4× plus compact que le delta-varint** à nombre égal de k-mers. Cette efficacité vient du fait qu'un super-kmer de 38 bases encode 8 k-mers en ~10 bytes au lieu de 8 × 5 = 40 bytes en delta-varint.
|
|
||||||
|
|
||||||
Note : la comparaison n'est pas directe (Contaminent_idx = génomes assemblés, *Betula* = reads bruts filtrés), mais le ratio bytes/k-mer est comparable car il dépend de la longueur des super-kmers, pas de la source des données.
|
|
||||||
|
|
||||||
## 3. Stratégie proposée : pipeline de construction v3
|
|
||||||
|
|
||||||
### 3.1 Définition du k-mer minimizer-canonique
|
|
||||||
|
|
||||||
On redéfinit la forme canonique d'un k-mer en fonction de son minimiseur :
|
|
||||||
|
|
||||||
```
|
|
||||||
CanonicalKmer(kmer, k, m) :
|
|
||||||
minimizer = plus petit m-mer canonique dans le k-mer
|
|
||||||
si minimizer == forward_mmer(minimizer_pos)
|
|
||||||
→ garder le k-mer tel quel
|
|
||||||
sinon
|
|
||||||
→ prendre le reverse-complement du k-mer
|
|
||||||
```
|
|
||||||
|
|
||||||
Propriétés :
|
|
||||||
- **m impair** → aucun m-mer ne peut être palindromique (`m_mer != RC(m_mer)` toujours) → la canonisation par le minimiseur est toujours non-ambiguë. C'est m, pas k, qui doit être impair : l'ambiguïté viendrait d'un minimiseur palindrome (`min == RC(min)`), auquel cas on ne saurait pas dans quel sens orienter le k-mer/super-kmer.
|
|
||||||
- Tous les k-mers d'un super-kmer partagent le même minimiseur
|
|
||||||
- **La canonisation peut se faire au niveau du super-kmer entier** : si `minimizer != canonical(minimizer)`, on RC le super-kmer complet. Tous les k-mers qu'il contient deviennent automatiquement minimizer-canoniques.
|
|
||||||
|
|
||||||
### 3.2 Pipeline de construction
|
|
||||||
|
|
||||||
```
|
|
||||||
Séquences brutes ([]byte, 1 byte/base)
|
|
||||||
│
|
|
||||||
▼
|
|
||||||
[0] Encodage 2-bit + nettoyage
|
|
||||||
│ - Encoder chaque séquence en 2 bits/base ([]byte packed)
|
|
||||||
│ - Couper aux bases ambiguës (N, R, Y, W, S, K, M, B, D, H, V)
|
|
||||||
│ - Retirer les fragments de longueur < k
|
|
||||||
│ - Résultat : fragments 2-bit clean, prêts pour toutes les opérations
|
|
||||||
▼
|
|
||||||
[1] Filtre de complexité (lowmask sur vecteurs 2-bit)
|
|
||||||
│ Supprime/masque les régions de faible entropie
|
|
||||||
▼
|
|
||||||
[2] Extraction des super-kmers (sur vecteurs 2-bit, non canonisé)
|
|
||||||
│ Chaque super-kmer a un minimiseur et une séquence 2-bit packed
|
|
||||||
▼
|
|
||||||
[3] Canonisation au niveau super-kmer
|
|
||||||
│ Si minimizer != CanonicalKmer(minimizer) → RC le super-kmer (op bit)
|
|
||||||
│ Résultat : super-kmers canoniques 2-bit packed
|
|
||||||
▼
|
|
||||||
[4] Écriture dans les partitions .skm (partition = minimizer % P)
|
|
||||||
│ Format natif 2-bit → écriture directe, pas de conversion
|
|
||||||
▼
|
|
||||||
[5] Déréplication des super-kmers par partition
|
|
||||||
│ Trier les super-kmers (comparaison uint64 sur données packed → très rapide)
|
|
||||||
│ Compter les occurrences identiques
|
|
||||||
│ Résultat : super-kmers uniques avec count
|
|
||||||
▼
|
|
||||||
[6] Construction des unitigs canoniques par partition
|
|
||||||
│ Assembler les super-kmers qui se chevauchent de (k-1) bases
|
|
||||||
│ en chaînes linéaires non-branchantes (tout en 2-bit)
|
|
||||||
│ Propager les counts : vecteur de poids par unitig
|
|
||||||
▼
|
|
||||||
[7] Filtre de fréquence sur le graphe pondéré (voir section 4)
|
|
||||||
│ Supprimer les k-mers (positions) avec poids < seuil
|
|
||||||
│ Re-calculer les unitigs après filtrage
|
|
||||||
▼
|
|
||||||
[8] Stockage des unitigs avec bitmask multiset
|
|
||||||
│ Format compact sur disque (déjà en 2-bit, écriture directe)
|
|
||||||
▼
|
|
||||||
Index v3
|
|
||||||
```
|
|
||||||
|
|
||||||
### 3.2bis Pourquoi encoder en 2-bit dès le début ?
|
|
||||||
|
|
||||||
**Alternative rejetée** : travailler en `[]byte` (1 byte/base) puis encoder en 2-bit seulement pour le stockage final.
|
|
||||||
|
|
||||||
| Aspect | `[]byte` (1 byte/base) | 2-bit packed |
|
|
||||||
|--------|----------------------|--------------|
|
|
||||||
| Programmation | Simple (slicing natif, pas de bit-shift) | Plus complexe (masques, shifts) |
|
|
||||||
| Mémoire par super-kmer (38 bases) | 38 bytes | 10 bytes (**3.8×** moins) |
|
|
||||||
| 37M super-kmers en RAM | ~1.4 Go | ~370 Mo |
|
|
||||||
| Tri (comparaison) | `bytes.Compare` sur slices | Comparaison uint64 (**beaucoup** plus rapide) |
|
|
||||||
| Format .skm | Conversion encode/decode à chaque I/O | Écriture/lecture directe |
|
|
||||||
| RC d'un super-kmer | Boucle sur bytes + lookup | Opérations bit (une instruction pour complement) |
|
|
||||||
|
|
||||||
L'opération la plus coûteuse du pipeline est le **tri des super-kmers** pour la déréplication (étape 5). En 2-bit packed, un super-kmer de ≤32 bases tient dans un `uint64` → tri par comparaison entière (une instruction CPU). Un super-kmer de 33-64 bases tient dans deux `uint64` → tri en deux comparaisons.
|
|
||||||
|
|
||||||
Le code de manipulation 2-bit est plus complexe à écrire mais **s'écrit une seule fois** (bibliothèque de primitives) et bénéficie à toute la chaîne. Le gain en mémoire (4×) et en temps de tri est significatif sur des dizaines de millions de super-kmers.
|
|
||||||
|
|
||||||
### 3.3 Canonisation des super-kmers : pourquoi ça marche
|
|
||||||
|
|
||||||
**Point crucial** : les super-kmers doivent être construits en utilisant le minimiseur **non-canonique** (le m-mer brut tel qu'il apparaît dans la séquence), et non le minimiseur canonique `min(fwd, rc)`.
|
|
||||||
|
|
||||||
**Pourquoi ?** Si on utilise le minimiseur canonique comme critère de regroupement, un même super-kmer pourrait contenir le minimiseur dans ses **deux orientations** à des positions différentes (le m-mer forward à une position, et sa forme RC à une autre position, ayant la même valeur canonique). Dans ce cas, le RC du super-kmer ne résoudrait pas l'ambiguïté.
|
|
||||||
|
|
||||||
**Algorithme correct** :
|
|
||||||
|
|
||||||
1. **Extraction** : construire les super-kmers en regroupant les k-mers consécutifs qui partagent le même m-mer minimal **non-canonique** (le m-mer brut). Au sein d'un tel super-kmer, le minimiseur apparaît toujours dans **une seule orientation**.
|
|
||||||
|
|
||||||
2. **Canonisation** : pour chaque super-kmer, comparer son minimiseur brut à `canonical(minimizer) = min(minimizer, RC(minimizer))` :
|
|
||||||
- Si `minimizer == canonical(minimizer)` → le minimiseur est déjà en forward → garder le super-kmer tel quel
|
|
||||||
- Si `minimizer != canonical(minimizer)` → le minimiseur est en RC → RC le super-kmer entier → le minimiseur apparaît maintenant en forward
|
|
||||||
|
|
||||||
Après cette étape, **chaque k-mer du super-kmer** contient le minimiseur canonique en position forward, ce qui correspond exactement à notre définition de k-mer minimizer-canonique.
|
|
||||||
|
|
||||||
**Note** : cela signifie que l'algorithme `IterSuperKmers` actuel (qui utilise le minimiseur canonique pour le regroupement) doit être modifié pour utiliser le minimiseur brut. C'est un changement dans le critère de rupture des super-kmers : on casse quand le **m-mer minimal brut** change, pas quand le **m-mer minimal canonique** change. Les super-kmers résultants seront potentiellement plus courts (un changement d'orientation du minimiseur force une coupure), mais c'est le prix de la canonicité absolue.
|
|
||||||
|
|
||||||
### 3.4 Déréplication des super-kmers
|
|
||||||
|
|
||||||
Deux super-kmers identiques (même séquence, même minimiseur) correspondent aux mêmes k-mers. On peut les dérépliquer en triant :
|
|
||||||
|
|
||||||
1. Par minimiseur (déjà partitionné)
|
|
||||||
2. Par séquence (tri lexicographique des séquences 2-bit packed)
|
|
||||||
|
|
||||||
Les super-kmers identiques deviennent consécutifs dans le tri → comptage linéaire.
|
|
||||||
|
|
||||||
Le tri peut se faire sur les fichiers .skm d'une partition, en mémoire si la partition tient en RAM, ou par merge-sort externe sinon.
|
|
||||||
|
|
||||||
## 4. Filtre de fréquence
|
|
||||||
|
|
||||||
### 4.1 Problème
|
|
||||||
|
|
||||||
Le filtre de fréquence (`--min-occurrence N`) élimine les k-mers vus moins de N fois. Avec la déréplication des super-kmers, on a un count par super-kmer, pas par k-mer. Un k-mer peut apparaître dans plusieurs super-kmers différents (aux jonctions, ou quand le minimiseur change), donc le count exact d'un k-mer n'est connu qu'après fusion.
|
|
||||||
|
|
||||||
### 4.2 Solution : filtrage sur le graphe de De Bruijn pondéré
|
|
||||||
|
|
||||||
Le filtre de fréquence doit être appliqué **après** la construction des unitigs canoniques (section 5), et non avant. Le pipeline devient :
|
|
||||||
|
|
||||||
```
|
|
||||||
Super-kmers canoniques dérepliqués (avec counts)
|
|
||||||
│
|
|
||||||
▼
|
|
||||||
Construction des unitigs canoniques (section 5)
|
|
||||||
│ Chaque position dans un unitig porte un poids
|
|
||||||
│ = somme des counts des super-kmers couvrant ce k-mer
|
|
||||||
▼
|
|
||||||
Graphe de De Bruijn pondéré (implicite dans les unitigs)
|
|
||||||
│
|
|
||||||
▼
|
|
||||||
Filtrage : supprimer les k-mers (positions) avec poids < seuil
|
|
||||||
│ Cela casse certains unitigs en fragments
|
|
||||||
▼
|
|
||||||
Recalcul des unitigs sur le graphe filtré
|
|
||||||
│
|
|
||||||
▼
|
|
||||||
Unitigs filtrés finaux
|
|
||||||
```
|
|
||||||
|
|
||||||
**Avantages** :
|
|
||||||
- Le filtre opère sur les **k-mers exacts** avec leurs **counts exacts** (pas une approximation par super-kmer)
|
|
||||||
- Le graphe de De Bruijn est implicitement contenu dans les unitigs — pas besoin de le construire explicitement avec une `map[uint64]uint`
|
|
||||||
- Les k-mers aux jonctions de super-kmers ont leurs counts correctement agrégés
|
|
||||||
|
|
||||||
### 4.3 Calcul du poids de chaque position dans un unitig
|
|
||||||
|
|
||||||
Un unitig est construit par chaînage de super-kmers. Chaque super-kmer S de longueur L et count C contribue (L-k+1) k-mers, chacun avec poids C. Quand deux super-kmers se chevauchent de (k-1) bases dans l'unitig, les k-mers de la zone de chevauchement reçoivent la **somme** des counts des deux super-kmers.
|
|
||||||
|
|
||||||
En pratique, lors de la construction de l'unitig par chaînage, on construit un vecteur de poids `weights[0..nkmers-1]` :
|
|
||||||
```
|
|
||||||
Pour chaque super-kmer S (count=C) ajouté à l'unitig:
|
|
||||||
Pour chaque position i couverte par S dans l'unitig:
|
|
||||||
weights[i] += C
|
|
||||||
```
|
|
||||||
|
|
||||||
### 4.4 Filtrage et re-construction
|
|
||||||
|
|
||||||
Après filtrage (`weights[i] < seuil` → supprimer position i), l'unitig est potentiellement coupé en fragments. Chaque fragment continu de positions conservées forme un nouvel unitig (ou super-kmer si court).
|
|
||||||
|
|
||||||
Le recalcul des unitigs après filtrage est trivial : les fragments sont déjà des chemins linéaires, il suffit de vérifier les conditions de non-branchement aux nouvelles extrémités.
|
|
||||||
|
|
||||||
### 4.5 Spectre de fréquence
|
|
||||||
|
|
||||||
Le spectre de fréquence exact peut être calculé directement depuis les vecteurs de poids des unitigs : `weights[i]` donne le count exact du k-mer à la position i. C'est un histogramme sur toutes les positions de tous les unitigs.
|
|
||||||
|
|
||||||
### 4.6 Faisabilité mémoire : graphe pondéré par partition
|
|
||||||
|
|
||||||
Données mesurées sur un index *Betula* (k=31, P=4096 partitions, 1 set, génome assemblé) — distribution des tailles de fichiers .kdi :
|
|
||||||
|
|
||||||
| Métrique | Taille fichier .kdi | K-mers estimés (~5 B/kmer) | Super-kmers (~8 kmer/skm) |
|
|
||||||
|----------|--------------------|-----------------------------|---------------------------|
|
|
||||||
| Mode | 100-200 Ko | 20 000 – 40 000 | 2 500 – 5 000 |
|
|
||||||
| Médiane | ~350-400 Ko | ~70 000 – 80 000 | ~9 000 – 10 000 |
|
|
||||||
| Max | ~2.3 Mo | ~460 000 | ~57 000 |
|
|
||||||
|
|
||||||
Le graphe de De Bruijn pondéré pour une partition nécessite d'extraire tous les k-mers (arêtes) et (k-1)-mers (nœuds) des super-kmers :
|
|
||||||
|
|
||||||
| Partition | K-mers (arêtes) | RAM arêtes (~20 B) | RAM nœuds (~16 B) | Total |
|
|
||||||
|-----------|-----------------|--------------------|--------------------|-------|
|
|
||||||
| Typique (~10K skm, 38 bases avg) | ~80K | ~1.6 Mo | ~1.3 Mo | **~3 Mo** |
|
|
||||||
| Maximale (~57K skm) | ~460K | ~9.2 Mo | ~7.4 Mo | **~17 Mo** |
|
|
||||||
|
|
||||||
C'est **largement en mémoire**. Les partitions étant indépendantes, elles peuvent être traitées en parallèle par un pool de goroutines. Avec 8 goroutines : **~136 Mo** au pic — négligeable. Les tableaux sont réutilisables entre partitions (allocation unique).
|
|
||||||
|
|
||||||
**Conclusion** : la construction du graphe de De Bruijn pondéré partition par partition est non seulement faisable mais triviale en termes de mémoire. C'est un argument fort en faveur de l'approche « filtre après unitigs » plutôt que « filtre sur super-kmers ».
|
|
||||||
|
|
||||||
### 4.7 Invariance de la distribution par rapport à la canonisation
|
|
||||||
|
|
||||||
La redéfinition du k-mer canonique (par le minimiseur au lieu de `min(fwd, rc)`) ne change **rien** à l'ensemble des k-mers ni à leur répartition par partition :
|
|
||||||
|
|
||||||
- C'est une **bijection** : chaque k-mer a toujours exactement un représentant canonique, on change juste lequel des deux brins on choisit
|
|
||||||
- Le partitionnement se fait sur `canonical(minimizer) % P` — la valeur du minimiseur canonique est la même dans les deux conventions
|
|
||||||
- **Même nombre de k-mers par partition, même distribution de tailles**
|
|
||||||
- **Même topologie du graphe de De Bruijn** (mêmes nœuds, mêmes arêtes)
|
|
||||||
|
|
||||||
Ce qui change, c'est **l'orientation** : avec la canonicité par minimiseur, les unitigs canoniques ne suivent que les arêtes « forward » (`suffix(S1) == prefix(S2)`, identité exacte). Certaines arêtes traversables en RC dans BCALM2 deviennent des points de cassure. Le graphe n'est pas plus gros — il suffit de ne construire que des unitigs canoniques, ce qui **simplifie** l'algorithme (pas de gestion des traversées de brin).
|
|
||||||
|
|
||||||
## 5. Construction des unitigs canoniques
|
|
||||||
|
|
||||||
### 5.1 Définition : unitig canonique absolu
|
|
||||||
|
|
||||||
Un **unitig canonique** est un chemin linéaire non-branchant dans le graphe de De Bruijn où :
|
|
||||||
1. Chaque k-mer est **minimizer-canonique** (le minimiseur y apparaît en forward)
|
|
||||||
2. Chaque super-kmer constituant est **canonique** (même convention)
|
|
||||||
3. Le chaînage se fait **sans traversée de brin** : `suffix(k-1, S1) == prefix(k-1, S2)` dans le même sens (pas en RC)
|
|
||||||
|
|
||||||
C'est plus restrictif que les unitigs BCALM2 (qui autorisent `suffix(S1) == RC(prefix(S2))`), mais cela garantit que **tout k-mer extrait par fenêtre glissante est directement dans sa forme canonique**, sans re-canonisation.
|
|
||||||
|
|
||||||
### 5.2 Pourquoi la canonicité absolue est essentielle
|
|
||||||
|
|
||||||
**Matching** : les k-mers requête sont canonisés une fois (par le minimiseur), puis comparés directement aux k-mers de l'unitig par scan. Pas de re-canonisation à la volée → plus rapide, plus simple.
|
|
||||||
|
|
||||||
**Opérations ensemblistes** : deux index utilisant la même convention produisent les mêmes unitigs canoniques pour les mêmes k-mers. L'intersect/union peut opérer par comparaison directe de séquences triées.
|
|
||||||
|
|
||||||
**Bitmask multiset** : la fusion de N sets est triviale — merger des listes de super-kmers/unitigs canoniques triés par séquence.
|
|
||||||
|
|
||||||
**Déterminisme** : un ensemble de k-mers produit toujours les mêmes unitigs canoniques, quel que soit l'ordre d'insertion ou la source des données.
|
|
||||||
|
|
||||||
### 5.3 Impact sur la compaction
|
|
||||||
|
|
||||||
La contrainte canonique interdit les traversées de brin aux jonctions → les unitigs canoniques sont **plus courts** que les unitigs BCALM2. Estimation :
|
|
||||||
- BCALM2 (unitigs libres) : 63 bases moyennes (mesuré sur *Betula*)
|
|
||||||
- Unitigs canoniques : probablement ~45-55 bases moyennes
|
|
||||||
- Super-kmers dérepliqués : 38 bases moyennes
|
|
||||||
|
|
||||||
Le facteur de compaction est légèrement réduit mais le gain en simplicité opérationnelle compense largement.
|
|
||||||
|
|
||||||
### 5.4 Construction par partition — le vrai graphe de De Bruijn
|
|
||||||
|
|
||||||
Les super-kmers canoniques dérepliqués sont des **chemins** dans le graphe de De Bruijn, pas des nœuds. On ne peut pas les chaîner directement comme des nœuds car :
|
|
||||||
- Deux super-kmers peuvent **se chevaucher** (partager des k-mers aux jonctions)
|
|
||||||
- Un super-kmer court peut avoir ses k-mers **inclus** dans un super-kmer plus long
|
|
||||||
|
|
||||||
Un super-kmer de longueur L contient (L-k+1) k-mers, soit (L-k+1) arêtes et (L-k+2) nœuds ((k-1)-mers) dans le graphe de De Bruijn.
|
|
||||||
|
|
||||||
#### 5.4.1 Nœuds = (k-1)-mers, Arêtes = k-mers
|
|
||||||
|
|
||||||
Le graphe de De Bruijn par partition a :
|
|
||||||
- **Nœuds** : les (k-1)-mers uniques (extraits de toutes les positions dans les super-kmers)
|
|
||||||
- **Arêtes** : les k-mers (chaque position dans un super-kmer = une arête entre deux (k-1)-mers consécutifs)
|
|
||||||
- **Poids** : chaque arête (k-mer) porte le count du super-kmer qui la contient
|
|
||||||
|
|
||||||
Les branchements (nœud avec degré entrant > 1 ou degré sortant > 1) peuvent être :
|
|
||||||
- Aux **bords** des super-kmers (jonctions entre super-kmers)
|
|
||||||
- Aux **positions internes** si un k-mer d'un autre super-kmer rejoint un (k-1)-mer interne
|
|
||||||
|
|
||||||
#### 5.4.2 Graphe complet nécessaire
|
|
||||||
|
|
||||||
Construire le graphe avec **tous** les (k-1)-mers (internes et bords) est nécessaire pour détecter correctement les branchements. Se limiter aux seuls bords de super-kmers serait incorrect car un (k-1)-mer de bord d'un super-kmer peut correspondre à un nœud interne d'un autre super-kmer.
|
|
||||||
|
|
||||||
Pour une partition typique de 10K super-kmers de longueur moyenne 38 bases → ~80K k-mers → ~80K arêtes et ~80K nœuds. Voir section 4.6 pour la faisabilité mémoire (~3 Mo par partition typique, ~17 Mo max).
|
|
||||||
|
|
||||||
#### 5.4.3 Structure de données : tableau trié d'arêtes
|
|
||||||
|
|
||||||
Plutôt que des hash maps, on utilise un **tableau trié** pour le graphe :
|
|
||||||
|
|
||||||
```go
|
|
||||||
type Edge struct {
|
|
||||||
srcKmer uint64 // (k-1)-mer source (prefix du k-mer)
|
|
||||||
dstKmer uint64 // (k-1)-mer destination (suffix du k-mer)
|
|
||||||
weight int32 // count du super-kmer contenant ce k-mer
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
Pour chaque super-kmer S de longueur L et count C, on émet (L-k+1) arêtes. Tableau total pour une partition typique : ~80K × 20 bytes = **~1.6 Mo**.
|
|
||||||
|
|
||||||
On trie par `srcKmer` pour obtenir la liste d'adjacence sortante, ou on construit deux vues triées (par src et par dst) pour avoir adjacence entrante et sortante.
|
|
||||||
|
|
||||||
#### 5.4.4 Détection des unitigs canoniques
|
|
||||||
|
|
||||||
Un unitig canonique est un chemin maximal non-branchant. L'algorithme :
|
|
||||||
|
|
||||||
```
|
|
||||||
1. Extraire toutes les arêtes des super-kmers → tableau edges[]
|
|
||||||
2. Trier edges[] par srcKmer → vue sortante
|
|
||||||
Trier une copie par dstKmer → vue entrante
|
|
||||||
3. Pour chaque (k-1)-mer unique :
|
|
||||||
- degré_sortant = nombre d'arêtes avec ce srcKmer
|
|
||||||
- degré_entrant = nombre d'arêtes avec ce dstKmer
|
|
||||||
- Si degré_sortant == 1 ET degré_entrant == 1 → nœud interne d'unitig
|
|
||||||
- Sinon → nœud de branchement (début ou fin d'unitig)
|
|
||||||
4. Parcourir les chemins non-branchants pour construire les unitigs
|
|
||||||
- Chaque unitig est une séquence de (k-1)-mers chaînés
|
|
||||||
- Le vecteur de poids est la séquence des weight des arêtes traversées
|
|
||||||
```
|
|
||||||
|
|
||||||
Les (k-1)-mers ne sont **pas canonisés** — on respecte l'orientation des super-kmers canoniques. Le chaînage est strictement orienté.
|
|
||||||
|
|
||||||
#### 5.4.5 Estimation mémoire
|
|
||||||
|
|
||||||
| Partition | K-mers (arêtes) | RAM arêtes | RAM nœuds | Total |
|
|
||||||
|-----------|-----------------|------------|-----------|-------|
|
|
||||||
| Typique (~10K skm, 38 bases avg) | ~80K | ~1.6 Mo | ~1.3 Mo | **~3 Mo** |
|
|
||||||
| Maximale (~57K skm) | ~460K | ~9.2 Mo | ~7.4 Mo | **~17 Mo** |
|
|
||||||
|
|
||||||
Avec traitement parallèle par un pool de G goroutines : RAM max = G × 17 Mo. Avec G=8 : **~136 Mo** au pic. Le tableau d'arêtes est réutilisable entre partitions (allocation unique, remise à zéro).
|
|
||||||
|
|
||||||
Complexité : O(E log E) par partition, avec E = nombre total de k-mers. Dominé par les deux tris.
|
|
||||||
|
|
||||||
### 5.5 Graphe par minimiseur, pas par partition
|
|
||||||
|
|
||||||
Les k-mers (arêtes) sont partitionnés par minimiseur. Deux k-mers adjacents dans le graphe de De Bruijn peuvent avoir des minimiseurs différents — c'est exactement ce qui définit les frontières de super-kmers. Si on construit le graphe par partition (qui regroupe plusieurs minimiseurs), des (k-1)-mers de jonction entre minimiseurs différents apparaîtraient comme nœuds partagés entre partitions → le graphe par partition n'est pas autonome.
|
|
||||||
|
|
||||||
**Solution : construire un graphe par minimiseur.**
|
|
||||||
|
|
||||||
Un super-kmer est par définition un chemin dont **tous les k-mers partagent le même minimiseur**. Donc :
|
|
||||||
- Toutes les arêtes d'un super-kmer appartiennent à un seul minimiseur
|
|
||||||
- Chaque graphe par minimiseur est **100% autonome** : toutes ses arêtes et nœuds internes sont auto-contenus
|
|
||||||
- Les (k-1)-mers aux bords des super-kmers qui touchent un autre minimiseur sont des extrémités (degré 0 dans ce graphe) → bouts d'unitig naturels
|
|
||||||
- Aucune jonction inter-graphe → pas de cassure artificielle d'unitig
|
|
||||||
|
|
||||||
**Taille des graphes** : avec ~16K minimiseurs théoriques par partition (P=4096, m=13), le calcul naïf donne ~5 arêtes/minimiseur. Mais en pratique, beaucoup de minimiseurs ne sont pas représentés (séquences biologiques, pas aléatoires) et la distribution est très inégale. Si seuls ~500-1000 minimiseurs sont effectivement présents dans une partition typique de 80K arêtes, on a plutôt **80-160 arêtes en moyenne** par minimiseur, avec une queue de distribution vers les centaines ou milliers pour les minimiseurs les plus fréquents. Même dans ce cas, les graphes restent petits (quelques Ko à quelques dizaines de Ko).
|
|
||||||
|
|
||||||
*À mesurer* : nombre de minimiseurs distincts par partition et distribution du nombre de k-mers par minimiseur sur un index existant.
|
|
||||||
|
|
||||||
**Algorithme** : les super-kmers étant déjà triés par minimiseur dans la partition, on itère séquentiellement et on construit/détruit un petit graphe à chaque changement de minimiseur. C'est plus simple que le graphe par partition — pas de tri global de toutes les arêtes, juste un buffer local réutilisé.
|
|
||||||
|
|
||||||
**Les unitigs résultants** sont les chemins maximaux non-branchants au sein d'un minimiseur. Un unitig ne traverse jamais une frontière de minimiseur, ce qui est correct : tous les k-mers d'un unitig partagent le même minimiseur canonique, ce qui renforce la propriété de canonicité absolue.
|
|
||||||
|
|
||||||
### 5.6 Quand les unitigs canoniques n'aident pas
|
|
||||||
|
|
||||||
- Si les super-kmers sont courts (peu de chevauchement entre super-kmers adjacents)
|
|
||||||
- Si le graphe est très branché (zones de divergence entre génomes)
|
|
||||||
- Si beaucoup de jonctions se font par traversée de brin (la contrainte canonique empêche la fusion)
|
|
||||||
- Données metabarcoding avec grande diversité taxonomique → courts unitigs
|
|
||||||
|
|
||||||
Dans ces cas, stocker les super-kmers dérepliqués directement est suffisant — ils sont déjà canoniques par construction.
|
|
||||||
|
|
||||||
## 6. Construction multiset : super-kmers par set, graphe commun
|
|
||||||
|
|
||||||
### 6.1 Pipeline en deux phases
|
|
||||||
|
|
||||||
La construction d'un index multiset (N sets) se fait en deux phases distinctes :
|
|
||||||
|
|
||||||
**Phase 1 — Par set (indépendant, parallélisable)** :
|
|
||||||
|
|
||||||
Chaque set i (i = 0..N-1) produit indépendamment ses super-kmers canoniques :
|
|
||||||
```
|
|
||||||
Set i : séquences → [0] 2-bit → [1] lowmask → [2] super-kmers → [3] canonisation → [4] partition .skm_i
|
|
||||||
```
|
|
||||||
Puis déréplication par partition : super-kmers triés avec counts, écrits dans des fichiers `.skm` distincts par set.
|
|
||||||
|
|
||||||
**Phase 2 — Par partition, tous sets confondus** :
|
|
||||||
|
|
||||||
Pour chaque partition P (parallélisable par goroutine) :
|
|
||||||
```
|
|
||||||
.skm_0[P], .skm_1[P], ..., .skm_{N-1}[P] (super-kmers triés de chaque set)
|
|
||||||
│
|
|
||||||
▼
|
|
||||||
[a] N-way merge des super-kmers triés
|
|
||||||
│ Même super-kmer dans sets i et j → fusionner en vecteur de counts [c_0, ..., c_{N-1}]
|
|
||||||
│ Super-kmer uniquement dans set i → counts = [0, ..., c_i, ..., 0]
|
|
||||||
▼
|
|
||||||
[b] Extraction des arêtes du graphe de De Bruijn
|
|
||||||
│ Chaque k-mer (arête) porte un vecteur de poids [w_0, ..., w_{N-1}]
|
|
||||||
│ w_i = count du super-kmer contenant ce k-mer dans le set i
|
|
||||||
▼
|
|
||||||
[c] Construction d'un SEUL graphe de De Bruijn par partition
|
|
||||||
│ Les branchements sont définis par l'UNION de tous les sets :
|
|
||||||
│ si un (k-1)-mer a degré > 1 dans n'importe quel set, c'est un branchement
|
|
||||||
▼
|
|
||||||
[d] Extraction des unitigs canoniques communs
|
|
||||||
│ Même séquence pour tous les sets
|
|
||||||
│ Chaque position porte un vecteur de poids (un count par set)
|
|
||||||
▼
|
|
||||||
[e] Filtre de fréquence (optionnel, par set ou global)
|
|
||||||
▼
|
|
||||||
[f] Encodage du bitmask par runs le long de chaque unitig
|
|
||||||
▼
|
|
||||||
Écriture dans le .sku de la partition
|
|
||||||
```
|
|
||||||
|
|
||||||
### 6.2 Le graphe est défini par l'union
|
|
||||||
|
|
||||||
Point crucial : les unitigs sont déterminés par la **topologie de l'union** de tous les sets. Un branchement dans un seul set force une coupure d'unitig pour tous les sets. Cela garantit que :
|
|
||||||
- Les unitigs sont les mêmes quelle que soit l'ordre des sets
|
|
||||||
- Un k-mer donné se trouve toujours au même endroit (même unitig, même position)
|
|
||||||
- Les opérations ensemblistes (intersect, union, difference) opèrent sur les mêmes unitigs
|
|
||||||
|
|
||||||
### 6.3 Arêtes à vecteur de poids
|
|
||||||
|
|
||||||
La structure Edge (section 5.4.3) est étendue pour le multiset :
|
|
||||||
|
|
||||||
```go
|
|
||||||
type Edge struct {
|
|
||||||
srcKmer uint64 // (k-1)-mer source
|
|
||||||
dstKmer uint64 // (k-1)-mer destination
|
|
||||||
weights []int32 // weights[i] = count dans le set i (0 si absent)
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
Pour la détection des branchements, le degré d'un nœud est le nombre d'arêtes distinctes (par dstKmer pour le degré sortant), **indépendamment** des sets. Une arête présente dans le set 0 mais pas le set 1 compte quand même.
|
|
||||||
|
|
||||||
### 6.4 Bitmask par runs le long des unitigs
|
|
||||||
|
|
||||||
Le long d'un unitig, le bitmask (quels sets contiennent ce k-mer) change rarement — les régions conservées entre génomes sont longues. On encode :
|
|
||||||
|
|
||||||
```
|
|
||||||
unitig_bitmask = [(bitmask_1, run_length_1), (bitmask_2, run_length_2), ...]
|
|
||||||
```
|
|
||||||
|
|
||||||
Où `bitmask_i` a un bit par set (bit j = 1 si `weights[j] > 0` à cette position).
|
|
||||||
|
|
||||||
Pour un unitig de 70 k-mers avec 2 sets :
|
|
||||||
- Si complètement partagé : 1 run `(0b11, 70)` → 2 bytes
|
|
||||||
- Si divergent au milieu : 2-3 runs → 4-6 bytes
|
|
||||||
- Pire cas : 70 runs → 140 bytes (très rare)
|
|
||||||
|
|
||||||
### 6.5 Impact mémoire du multiset
|
|
||||||
|
|
||||||
Le vecteur de poids par arête augmente la taille du graphe :
|
|
||||||
- 1 set : `weight int32` → 4 bytes/arête
|
|
||||||
- N sets : `weights [N]int32` → 4N bytes/arête
|
|
||||||
|
|
||||||
Pour la partition typique (~80K arêtes) avec N=2 sets : overhead = 80K × 4 = **320 Ko** supplémentaires. Négligeable.
|
|
||||||
|
|
||||||
Pour N=64 sets (cas extrême) : 80K × 256 = **~20 Mo** par partition. Reste faisable mais les sets très nombreux pourraient nécessiter un encodage plus compact (sparse vector si beaucoup de zéros).
|
|
||||||
|
|
||||||
### 6.6 Merge des super-kmers : N-way sur séquences triées
|
|
||||||
|
|
||||||
Le merge des N listes de super-kmers triés (par séquence 2-bit) est un N-way merge classique avec min-heap :
|
|
||||||
- Chaque .skm est déjà trié par séquence (étape de déréplication)
|
|
||||||
- On compare les séquences 2-bit packed (comparaison uint64, très rapide)
|
|
||||||
- Quand le même super-kmer apparaît dans plusieurs sets, on fusionne les counts
|
|
||||||
- Quand un super-kmer est unique à un set, les autres counts sont 0
|
|
||||||
|
|
||||||
C'est analogue au `KWayMerge` existant sur les k-mers triés, étendu aux super-kmers.
|
|
||||||
|
|
||||||
## 7. Format de stockage v3 : fichiers parallèles
|
|
||||||
|
|
||||||
### 7.1 Architecture : 3 fichiers par partition
|
|
||||||
|
|
||||||
Pour chaque partition, trois fichiers alignés :
|
|
||||||
|
|
||||||
```
|
|
||||||
index_v3/
|
|
||||||
metadata.toml
|
|
||||||
parts/
|
|
||||||
part_PPPP.sku # séquences 2-bit des unitigs concaténés
|
|
||||||
part_PPPP.skx # index par minimiseur (offsets dans .sku)
|
|
||||||
part_PPPP.skb # bitmask multiset (1 entrée par k-mer)
|
|
||||||
...
|
|
||||||
set_N/spectrum.bin # spectre de fréquence par set
|
|
||||||
```
|
|
||||||
|
|
||||||
### 7.2 Fichier .sku — séquences d'unitigs concaténées
|
|
||||||
|
|
||||||
Tous les unitigs d'une partition sont concaténés bout à bout en 2-bit packed, **ordonnés par minimiseur**. Entre deux unitigs, pas de séparateur dans le flux 2-bit.
|
|
||||||
|
|
||||||
Un **tableau de longueurs** stocké en en-tête ou dans le .skx donne la longueur (en bases) de chaque unitig dans l'ordre. Ce tableau permet :
|
|
||||||
- De retrouver les frontières d'unitigs
|
|
||||||
- De savoir si un match AC chevauche une jonction (à filtrer)
|
|
||||||
- D'indexer directement un unitig par son numéro
|
|
||||||
|
|
||||||
```
|
|
||||||
Format .sku :
|
|
||||||
Magic: "SKU\x01" (4 bytes)
|
|
||||||
TotalBases: uint64 LE (nombre total de bases dans la partition)
|
|
||||||
NUnitigs: uint64 LE (nombre d'unitigs)
|
|
||||||
Lengths: [NUnitigs]varint (longueur en bases de chaque unitig)
|
|
||||||
Sequence: ceil(TotalBases/4) bytes (flux 2-bit continu)
|
|
||||||
```
|
|
||||||
|
|
||||||
### 7.3 Fichier .skx — index par minimiseur
|
|
||||||
|
|
||||||
Pour chaque minimiseur présent dans la partition, l'index donne l'offset (en bases) dans le flux .sku et le nombre d'unitigs :
|
|
||||||
|
|
||||||
```
|
|
||||||
Format .skx :
|
|
||||||
Magic: "SKX\x01" (4 bytes)
|
|
||||||
NMinimizers: uint32 LE (nombre de minimiseurs présents)
|
|
||||||
Entries: [NMinimizers] {
|
|
||||||
Minimizer: uint64 LE (valeur du minimiseur canonique)
|
|
||||||
BaseOffset: uint64 LE (offset en bases dans le flux .sku)
|
|
||||||
UnitigOffset: uint32 LE (index du premier unitig de ce minimiseur dans le tableau de longueurs)
|
|
||||||
NUnitigs: uint32 LE (nombre d'unitigs pour ce minimiseur)
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
Les entrées sont triées par `Minimizer` → recherche binaire en O(log N).
|
|
||||||
|
|
||||||
Pour accéder aux unitigs d'un minimiseur donné :
|
|
||||||
1. Recherche binaire dans le .skx → `BaseOffset`, `UnitigOffset`, `NUnitigs`
|
|
||||||
2. Seek dans le .sku au bit `BaseOffset × 2`
|
|
||||||
3. Lecture de `NUnitigs` unitigs (longueurs dans le tableau à partir de `UnitigOffset`)
|
|
||||||
|
|
||||||
### 7.4 Fichier .skb — bitmask multiset parallèle
|
|
||||||
|
|
||||||
Le fichier bitmask est **aligné position par position** avec le flux de k-mers des unitigs. Chaque k-mer (position dans un unitig) a exactement une entrée dans le .skb, dans le même ordre que les k-mers apparaissent en lisant les unitigs séquentiellement.
|
|
||||||
|
|
||||||
```
|
|
||||||
Format .skb :
|
|
||||||
Magic: "SKB\x01" (4 bytes)
|
|
||||||
TotalKmers: uint64 LE (nombre total de k-mers)
|
|
||||||
NSets: uint8 (nombre de sets)
|
|
||||||
BitmaskSize: uint8 (ceil(NSets/8) bytes par entrée)
|
|
||||||
Bitmasks: [TotalKmers × BitmaskSize] bytes
|
|
||||||
```
|
|
||||||
|
|
||||||
**Accès direct** : la position absolue d'un k-mer dans le flux d'unitigs (offset en k-mers depuis le début de la partition) donne directement l'index dans le fichier .skb :
|
|
||||||
```
|
|
||||||
bitmask_offset = header_size + kmer_position × BitmaskSize
|
|
||||||
```
|
|
||||||
|
|
||||||
Pour 2 sets : 1 byte par k-mer (6 bits inutilisés).
|
|
||||||
Pour ≤8 sets : 1 byte par k-mer.
|
|
||||||
Pour ≤16 sets : 2 bytes par k-mer.
|
|
||||||
|
|
||||||
**Coût** : pour 295M k-mers (*Betula*, 2 sets) : 295 Mo. Pour l'index Contaminent_idx (18.6B k-mers, 2 sets) : ~18.6 Go. C'est significatif — voir section 7.5 pour la compression.
|
|
||||||
|
|
||||||
### 7.5 Compression du bitmask : RLE ou non ?
|
|
||||||
|
|
||||||
| Approche | Taille (2 sets, 295M k-mers) | Accès |
|
|
||||||
|----------|------------------------------|-------|
|
|
||||||
| Non compressé (1 byte/k-mer) | 295 Mo | O(1) direct |
|
|
||||||
| RLE par unitig | ~10-50 Mo (estimé) | O(decode) par unitig |
|
|
||||||
| Bitset par set (1 bit/k-mer/set) | 74 Mo | O(1) direct |
|
|
||||||
|
|
||||||
L'approche **bitset par set** (1 bit par k-mer par set, packed en bytes) est un bon compromis :
|
|
||||||
- 2 sets : 2 bits/k-mer → ~74 Mo (vs 295 Mo non compressé)
|
|
||||||
- Accès O(1) : `bit = (data[kmer_pos / 4] >> ((kmer_pos % 4) × 2)) & 0x3`
|
|
||||||
- Pas besoin de décompression séquentielle
|
|
||||||
|
|
||||||
Pour les très grands index (18.6B k-mers), même le bitset fait ~4.6 Go. Le RLE par minimiseur (ou par unitig) pourrait réduire à ~1-2 Go mais perd l'accès O(1).
|
|
||||||
|
|
||||||
**Recommandation** : bitset packed pour ≤8 sets (accès O(1)), RLE pour >8 sets ou très grands index.
|
|
||||||
|
|
||||||
## 8. Matching avec Aho-Corasick sur le flux d'unitigs
|
|
||||||
|
|
||||||
### 8.1 Principe
|
|
||||||
|
|
||||||
Pour chaque partition dont les k-mers requête partagent le minimiseur :
|
|
||||||
1. Seek dans le .sku au bloc du minimiseur (via .skx)
|
|
||||||
2. Construire un automate AC avec les k-mers requête canoniques de ce minimiseur
|
|
||||||
3. Scanner le flux 2-bit des unitigs de ce minimiseur
|
|
||||||
4. Pour chaque match : vérifier qu'il ne chevauche pas une frontière d'unitig
|
|
||||||
5. Pour chaque match valide : lookup dans le .skb à la position correspondante → bitmask
|
|
||||||
|
|
||||||
### 8.2 Le problème des faux matches aux jonctions
|
|
||||||
|
|
||||||
En 2-bit, pas de 5e lettre pour séparer les unitigs. Le scan AC sur le flux continu peut produire des matches à cheval sur deux unitigs adjacents.
|
|
||||||
|
|
||||||
**Solution : post-filtrage par le tableau de longueurs.**
|
|
||||||
|
|
||||||
Pendant le scan, on maintient un compteur de position et un index dans le tableau de longueurs (préfixe cumulé). Quand un match est trouvé à la position `p` :
|
|
||||||
- Le match couvre les bases `[p, p+k-1]`
|
|
||||||
- Si ces bases chevauchent une frontière d'unitig → faux positif, ignorer
|
|
||||||
- Sinon → match valide
|
|
||||||
|
|
||||||
Le coût du post-filtrage est O(1) par match (le compteur de frontière avance séquentiellement).
|
|
||||||
|
|
||||||
**Estimation du taux de faux positifs** : avec des unitigs de ~50 bases en moyenne, une jonction tous les ~50 bases, et k=31 : ~31/50 = ~62% des positions de jonction peuvent produire un faux match. Mais seule une infime fraction de ces positions correspond à un pattern dans l'automate AC. En pratique, le nombre de faux positifs est négligeable.
|
|
||||||
|
|
||||||
### 8.3 Du match à la position absolue dans le .skb
|
|
||||||
|
|
||||||
Un match AC à la position `p` dans le flux du minimiseur se traduit en position k-mer dans le .skb :
|
|
||||||
|
|
||||||
```
|
|
||||||
kmer_position_in_partition = base_offset_of_minimizer_in_partition
|
|
||||||
+ p
|
|
||||||
- (nombre de bases de padding/frontières avant p)
|
|
||||||
```
|
|
||||||
|
|
||||||
En fait, si le tableau de longueurs donne les longueurs d'unitigs en bases, la position k-mer cumulative est :
|
|
||||||
```
|
|
||||||
Pour l'unitig i contenant le match :
|
|
||||||
kmer_base = somme des longueurs des unitigs 0..i-1
|
|
||||||
kmer_offset_in_unitig = p - kmer_base
|
|
||||||
kmer_index = somme des (len_j - k + 1) pour j=0..i-1 + kmer_offset_in_unitig
|
|
||||||
```
|
|
||||||
|
|
||||||
Ce `kmer_index` est l'index direct dans le fichier .skb.
|
|
||||||
|
|
||||||
### 8.4 Comparaison avec le merge-scan v1
|
|
||||||
|
|
||||||
| Aspect | Merge-scan (v1) | AC sur unitigs (v3) |
|
|
||||||
|--------|----------------|---------------------|
|
|
||||||
| Pré-requis | Tri des requêtes O(Q log Q) | Construction automate AC O(Q×k) |
|
|
||||||
| Seek | .kdx sparse index | .skx index par minimiseur |
|
|
||||||
| Scan | O(Q + K) merge linéaire par set | O(bases_du_minimiseur + matches) |
|
|
||||||
| Multi-set | **N passes** (une par set) | **1 seule passe** (bitmask .skb) |
|
|
||||||
| I/O | N×P ouvertures de fichier | 1 seek + lecture séquentielle + lookup .skb |
|
|
||||||
| Accès bitmask | implicite (chaque .kdi = 1 set) | O(1) dans .skb |
|
|
||||||
|
|
||||||
Le gain principal du v3 est l'**élimination des N passes** : au lieu de scanner N fois (une par set), on scanne une seule fois et on consulte le bitmask. Pour N=2 sets et P=4096 partitions, cela réduit les ouvertures de fichier de 2×4096 = 8192 à 4096.
|
|
||||||
|
|
||||||
## 9. Estimations de taille et validation expérimentale
|
|
||||||
|
|
||||||
### 9.1 Cas mesuré : *Betula exilis* 15× (reads bruts, count > 1)
|
|
||||||
|
|
||||||
| Métrique | Valeur |
|
|
||||||
|----------|--------|
|
|
||||||
| Super-kmers uniques (count > 1) | 37.3M |
|
|
||||||
| Longueur moyenne | 37.9 bases |
|
|
||||||
| Bases totales | 1.415G |
|
|
||||||
|
|
||||||
**Stockage binaire 2-bit packed** :
|
|
||||||
- Séquences : 1.415G / 4 = **354 Mo**
|
|
||||||
- Headers (longueur varint + minimiseur) : 37.3M × ~4 bytes = **150 Mo**
|
|
||||||
- Bitmask (1 set → 0 bytes, ou 2 sets → 1 byte/entrée = 37 Mo)
|
|
||||||
- **Total estimé : ~500-550 Mo** pour un set
|
|
||||||
|
|
||||||
### 9.2 Extrapolation pour l'index Plants+Human (2 sets)
|
|
||||||
|
|
||||||
L'index v1 actuel contient 18.6B k-mers en 85 Go. Avec le pipeline v3 :
|
|
||||||
|
|
||||||
**Scénario reads bruts 15× par génome** (extrapolé depuis *Betula exilis*) :
|
|
||||||
- *Betula exilis* mesuré : ~37M super-kmers, ~1.4G bases → ~500 Mo
|
|
||||||
- Proportionnellement pour l'index Contaminent_idx (18.6B k-mers) : **~2-5 Go**
|
|
||||||
|
|
||||||
**Scénario génome assemblé (pas de filtre de fréquence)** :
|
|
||||||
- Un génome assemblé de 3 Gbases → estimation ~80M super-kmers × 38 bases → **760 Mo**
|
|
||||||
- Un génome assemblé de 10 Gbases → estimation ~350M super-kmers × 38 bases → **3.3 Go**
|
|
||||||
- Avec overlap multiset : super-kmers partagés fusionnés (bitmask) → **~4 Go**
|
|
||||||
|
|
||||||
**Le gain est spectaculaire dans les deux scénarios** :
|
|
||||||
- Reads bruts : facteur **~30-40×** grâce à la déréplication + filtre de fréquence
|
|
||||||
- Génomes assemblés : facteur **~20×** grâce au format super-kmer seul
|
|
||||||
|
|
||||||
Le format super-kmer est intrinsèquement plus efficace que le delta-varint car il exploite la structure locale du graphe de De Bruijn : des k-mers consécutifs partagent (k-1) bases, encodées une seule fois dans le super-kmer.
|
|
||||||
|
|
||||||
### 9.3 Validation expérimentale : unitigs BCALM2
|
|
||||||
|
|
||||||
*Betula exilis* 15×, après lowmask + super-kmers canoniques + déréplication + filtre count>1, passé dans BCALM2 (`-kmer-size 31 -abundance-min 1`) :
|
|
||||||
|
|
||||||
| Métrique | Super-kmers (count>1) | Unitigs (BCALM2) | Ratio |
|
|
||||||
|----------|----------------------|-------------------|-------|
|
|
||||||
| Variants | 37,294,271 | 6,473,171 | **5.8×** |
|
|
||||||
| Bases totales | 1,415,018,593 | 408,070,894 | **3.5×** |
|
|
||||||
| Longueur moyenne | 37.9 bases | 63.0 bases | 1.7× |
|
|
||||||
| K-mers estimés | ~295M | ~213M | — |
|
|
||||||
|
|
||||||
### Stockage estimé
|
|
||||||
|
|
||||||
| Format | Taille estimée | Bytes/k-mer | Facteur vs v1 |
|
|
||||||
|--------|---------------|-------------|---------------|
|
|
||||||
| .kdi v1 (delta-varint, assemblé) | 12.8 Go | 4.3 | 1× |
|
|
||||||
| Super-kmers 2-bit (count>1) | ~500 Mo | 1.7 | 25× |
|
|
||||||
| **Unitigs 2-bit (BCALM2)** | **~130 Mo** | **0.6** | **98×** |
|
|
||||||
|
|
||||||
### Extrapolation pour l'index Contaminent_idx (Plants+Human, 2 sets)
|
|
||||||
|
|
||||||
Le facteur ~100× mesuré sur *Betula exilis* 15× se décompose :
|
|
||||||
- Déréplication des reads redondants : facteur ~15× (couverture 15×)
|
|
||||||
- Compaction super-kmer/unitig vs delta-varint : facteur ~100/15 ≈ **6.7×**
|
|
||||||
|
|
||||||
L'index Contaminent_idx est construit à partir de **génomes assemblés** (sans redondance de séquençage). Seul le facteur de compaction unitig s'applique :
|
|
||||||
- Index v1 actuel : 85 Go (Plants 72 Go + Human 12.8 Go)
|
|
||||||
- **Estimation unitigs : ~85 / 6.7 ≈ 12-13 Go** (facteur **~6.7×**)
|
|
||||||
|
|
||||||
C'est un gain significatif mais bien moins spectaculaire que sur des reads bruts. Le facteur pourrait être meilleur si les unitigs des génomes assemblés sont plus longs que ceux des reads (moins de fragmentation par les erreurs de séquençage).
|
|
||||||
|
|
||||||
### Observation sur le nombre de k-mers
|
|
||||||
|
|
||||||
Les unitigs contiennent ~213M k-mers vs ~295M estimés dans les super-kmers. La différence (~80M) provient probablement de k-mers qui étaient comptés dans plusieurs super-kmers (aux jonctions) et qui ne sont comptés qu'une fois dans les unitigs (déduplication exacte par le graphe de De Bruijn).
|
|
||||||
|
|
||||||
### Conclusion
|
|
||||||
|
|
||||||
L'approche unitig est massivement plus compacte que toutes les alternatives. Le format de stockage final devrait être basé sur les unitigs (ou au minimum sur les super-kmers dérepliqués) plutôt que sur des k-mers individuels en delta-varint.
|
|
||||||
|
|
||||||
## 10. Questions ouvertes
|
|
||||||
|
|
||||||
### 10.1 Le format super-kmer est-il toujours meilleur que delta-varint ?
|
|
||||||
|
|
||||||
D'après les estimations révisées (section 8.3), le format super-kmer 2-bit est **toujours plus compact** que le delta-varint, même pour des génomes assemblés :
|
|
||||||
- Reads bruts 15× : ~500 Mo vs ~1.5 Go (facteur 3×, à k-mers égaux) + déréplication massive
|
|
||||||
- Génomes assemblés : ~1.2 bytes/k-mer vs ~5 bytes/k-mer (facteur 4×)
|
|
||||||
|
|
||||||
La raison fondamentale : le delta-varint encode chaque k-mer indépendamment (même avec deltas), tandis que le super-kmer exploite le chevauchement de (k-1) bases entre k-mers consécutifs. C'est un avantage structurel irrattrapable par le delta-varint.
|
|
||||||
|
|
||||||
**Le format super-kmer semble donc préférable dans tous les cas.**
|
|
||||||
|
|
||||||
### 10.2 L'index doit-il stocker les super-kmers ou les k-mers ?
|
|
||||||
|
|
||||||
Stocker les super-kmers/unitigs comme format d'index final a des avantages (compacité, scan naturel) mais des inconvénients :
|
|
||||||
- Pas de seek rapide vers un k-mer spécifique (vs .kdx sparse index)
|
|
||||||
- Le matching par scan complet est O(total_bases) vs O(Q + K) pour le merge-scan
|
|
||||||
- Les opérations ensemblistes (Union, Intersect) deviennent plus complexes
|
|
||||||
|
|
||||||
**Approche hybride possible** :
|
|
||||||
1. Phase de construction : lowmask → super-kmers canoniques → déréplication → filtre de fréquence
|
|
||||||
2. Phase de finalisation : extraire les k-mers uniques des super-kmers filtrés → delta-varint .kdi (v1 ou v2)
|
|
||||||
3. Les super-kmers servent de **format intermédiaire efficace**, pas de format d'index final
|
|
||||||
|
|
||||||
Cela combine le meilleur des deux mondes :
|
|
||||||
- Déréplication ultra-efficace au niveau super-kmer (facteur 16× sur reads bruts)
|
|
||||||
- Index final compact et query-efficient en delta-varint
|
|
||||||
|
|
||||||
### 10.3 Le filtre de fréquence simple (niveau super-kmer) est-il suffisant ?
|
|
||||||
|
|
||||||
À valider expérimentalement :
|
|
||||||
- Comparer le nombre de k-mers retenus par filtre super-kmer vs filtre k-mer exact
|
|
||||||
- Mesurer l'impact sur les métriques biologiques (Jaccard, match positions)
|
|
||||||
- Si la différence est <1%, le filtre simple suffit
|
|
||||||
|
|
||||||
### 10.4 Aho-Corasick vs merge-scan pour le matching final ?
|
|
||||||
|
|
||||||
Si le format d'index final reste delta-varint (question 9.2), le merge-scan reste la méthode naturelle de matching. L'AC/hash-set n'a d'intérêt que si le format de stockage est basé sur des séquences (unitigs/super-kmers).
|
|
||||||
|
|
||||||
## 11. Prochaine étape : validation expérimentale
|
|
||||||
|
|
||||||
Avant de modifier l'architecture, valider sur des données réelles :
|
|
||||||
|
|
||||||
1. **Taux de compaction super-kmer** : sur un génome assemblé vs reads bruts, mesurer le nombre de super-kmers uniques et leur longueur moyenne
|
|
||||||
2. **Impact du filtre super-kmer** : comparer filtre au niveau super-kmer vs filtre au niveau k-mer exact sur un jeu de données de référence
|
|
||||||
3. **Taux d'assembly en unitigs** : mesurer la longueur des unitigs obtenus à partir des super-kmers dérepliqués
|
|
||||||
4. **Benchmark stockage** : comparer taille index super-kmer vs delta-varint vs unitig sur les mêmes données
|
|
||||||
5. **Benchmark matching** : comparer temps de matching AC/hash vs merge-scan sur différentes densités de requêtes
|
|
||||||
@@ -0,0 +1,264 @@
|
|||||||
|
# Optimisation du parsing des grandes séquences
|
||||||
|
|
||||||
|
## Contexte
|
||||||
|
|
||||||
|
OBITools4 doit pouvoir traiter des séquences de taille chromosomique (plusieurs Gbp), notamment
|
||||||
|
issues de fichiers GenBank/EMBL (assemblages de génomes) ou de fichiers FASTA convertis depuis
|
||||||
|
ces formats.
|
||||||
|
|
||||||
|
## Architecture actuelle
|
||||||
|
|
||||||
|
### Pipeline de lecture (`pkg/obiformats/`)
|
||||||
|
|
||||||
|
```
|
||||||
|
ReadFileChunk (goroutine)
|
||||||
|
→ ChannelFileChunk
|
||||||
|
→ N × _ParseGenbankFile / _ParseFastaFile (goroutines)
|
||||||
|
→ IBioSequence
|
||||||
|
```
|
||||||
|
|
||||||
|
`ReadFileChunk` (`file_chunk_read.go`) lit le fichier par morceaux via une chaîne de
|
||||||
|
`PieceOfChunk` (rope). Chaque nœud fait `fileChunkSize` bytes :
|
||||||
|
|
||||||
|
- GenBank/EMBL : 128 MB (`1024*1024*128`)
|
||||||
|
- FASTA/FASTQ : 1 MB (`1024*1024`)
|
||||||
|
|
||||||
|
La chaîne est accumulée jusqu'à trouver la fin du dernier enregistrement complet (splitter),
|
||||||
|
puis `Pack()` est appelé pour fusionner tous les nœuds en un seul buffer contigu. Ce buffer
|
||||||
|
est transmis au parseur via `FileChunk.Raw *bytes.Buffer`.
|
||||||
|
|
||||||
|
### Parseur GenBank (`genbank_read.go`)
|
||||||
|
|
||||||
|
`GenbankChunkParser` reçoit un `io.Reader` sur le buffer packé, lit ligne par ligne via
|
||||||
|
`bufio.NewReader` (buffer 4096 bytes), et pour chaque ligne de la section `ORIGIN` :
|
||||||
|
|
||||||
|
```go
|
||||||
|
line = string(bline) // allocation par ligne
|
||||||
|
cleanline := strings.TrimSpace(line) // allocation
|
||||||
|
parts := strings.SplitN(cleanline, " ", 7) // allocation []string + substrings
|
||||||
|
for i := 1; i < lparts; i++ {
|
||||||
|
seqBytes.WriteString(parts[i])
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
Point positif : `seqBytes` est pré-alloué grâce à `lseq` extrait de la ligne `LOCUS`.
|
||||||
|
|
||||||
|
### Parseur FASTA (`fastaseq_read.go`)
|
||||||
|
|
||||||
|
`FastaChunkParser` lit **octet par octet** via `scanner.ReadByte()`. Pour 3 Gbp :
|
||||||
|
3 milliards d'appels. `seqBytes` est un `bytes.Buffer{}` sans pré-allocation.
|
||||||
|
|
||||||
|
## Problème principal
|
||||||
|
|
||||||
|
Pour une séquence de plusieurs Gbp, `Pack()` fusionne une chaîne de ~N nœuds de 128 MB en
|
||||||
|
un seul buffer contigu. C'est une allocation de N × 128 MB suivie d'une copie de toutes les
|
||||||
|
données. Bien que l'implémentation de `Pack()` soit efficace (libère les nœuds au fur et à
|
||||||
|
mesure via `slices.Grow`), la copie est inévitable avec l'architecture actuelle.
|
||||||
|
|
||||||
|
De plus, le parseur GenBank produit des dizaines de millions d'allocations temporaires pour
|
||||||
|
parser la section `ORIGIN` (une par ligne).
|
||||||
|
|
||||||
|
## Invariant clé découvert
|
||||||
|
|
||||||
|
**Si la rope a plus d'un nœud, le premier nœud seul ne se termine pas sur une frontière
|
||||||
|
d'enregistrement** (pas de `//\n` en fin de `piece1`).
|
||||||
|
|
||||||
|
Preuve par construction dans `ReadFileChunk` :
|
||||||
|
- `splitter` est appelé dès le premier nœud (ligne 157)
|
||||||
|
- Si `end >= 0` → frontière trouvée dans 128 MB → boucle interne sautée → rope à 1 nœud
|
||||||
|
- Si `end < 0` → boucle interne ajoute des nœuds → rope à ≥ 2 nœuds
|
||||||
|
|
||||||
|
Corollaire : si rope à 1 nœud, `Pack()` ne fait rien (aucun nœud suivant).
|
||||||
|
|
||||||
|
**Attention** : rope à ≥ 2 nœuds ne signifie pas qu'il n'y a qu'une seule séquence dans
|
||||||
|
la rope. La rope packée peut contenir plusieurs enregistrements complets. Exemple : records
|
||||||
|
de 80 MB → `nextpieces` (48 MB de reste) + nouveau nœud (128 MB) = rope à 2 nœuds
|
||||||
|
contenant 2 records complets + début d'un troisième.
|
||||||
|
|
||||||
|
L'invariant dit seulement que `piece1` seul est incomplet — pas que la rope entière
|
||||||
|
ne contient qu'un seul record.
|
||||||
|
|
||||||
|
**Invariant : le dernier FileChunk envoyé finit sur une frontière d'enregistrement.**
|
||||||
|
|
||||||
|
Deux chemins dans `ReadFileChunk` :
|
||||||
|
|
||||||
|
1. **Chemin normal** (`end >= 0` via `splitter`) : le buffer est explicitement tronqué à
|
||||||
|
`end` (ligne 200 : `pieces.data = pieces.data[:end]`). Frontière garantie par construction
|
||||||
|
pour tous les formats. ✓
|
||||||
|
|
||||||
|
2. **Chemin EOF** (`end < 0`, `end = pieces.Len()`) : tout le reste du fichier est envoyé.
|
||||||
|
- **GenBank/EMBL** : présuppose fichier bien formé (se termine par `//\n`). Le parseur
|
||||||
|
lève un `log.Fatalf` sur tout état inattendu — filet de sécurité suffisant. ✓
|
||||||
|
- **FASTQ** : présupposé, vérifié par le parseur. ✓
|
||||||
|
- **FASTA** : garanti par le format lui-même (fin d'enregistrement = EOF ou `>`). ✓
|
||||||
|
|
||||||
|
**Hypothèse de travail adoptée** : les fichiers d'entrée sont bien formés. Dans le pire cas,
|
||||||
|
le parseur lèvera une erreur explicite. Il n'y a pas de risque de corruption silencieuse.
|
||||||
|
|
||||||
|
## Piste d'optimisation : se dispenser de Pack()
|
||||||
|
|
||||||
|
### Idée centrale
|
||||||
|
|
||||||
|
Au lieu de fusionner la rope avant de la passer au parseur, **parser directement la rope
|
||||||
|
nœud par nœud**, et **écrire la séquence compactée in-place dans le premier nœud**.
|
||||||
|
|
||||||
|
Pourquoi c'est sûr :
|
||||||
|
- Le header (LOCUS, DEFINITION, SOURCE, FEATURES) est **petit** et traité en premier
|
||||||
|
- La séquence (ORIGIN) est **à la fin** du record
|
||||||
|
- Au moment d'écrire la séquence depuis l'offset 0 de `piece1`, le pointeur de lecture
|
||||||
|
est profond dans la rope (offset >> 0) → jamais de collision
|
||||||
|
- La séquence compactée est toujours plus courte que les données brutes
|
||||||
|
|
||||||
|
### Pré-allocation
|
||||||
|
|
||||||
|
Pour GenBank/EMBL : `lseq` est connu dès la ligne `LOCUS`/`ID` (première ligne, dans
|
||||||
|
`piece1`). On peut faire `slices.Grow(piece1.data, lseq)` dès ce moment.
|
||||||
|
|
||||||
|
Pour FASTA : pas de taille garantie dans le header, mais `rope.Len()` donne un majorant.
|
||||||
|
On peut utiliser `rope.Len() / 2` comme estimation initiale.
|
||||||
|
|
||||||
|
### Gestion des jonctions entre nœuds
|
||||||
|
|
||||||
|
Une ligne peut chevaucher deux nœuds (rare avec 128 MB, mais possible). Solution : carry
|
||||||
|
buffer de ~128 bytes pour les quelques bytes en fin de nœud.
|
||||||
|
|
||||||
|
### Cas FASTA/FASTQ multi-séquences
|
||||||
|
|
||||||
|
Un FileChunk peut contenir N séquences (notamment FASTA/FASTQ courts). Dans ce cas
|
||||||
|
l'écriture in-place dans `piece1` n'est pas applicable directement — on écrase des données
|
||||||
|
nécessaires aux séquences suivantes.
|
||||||
|
|
||||||
|
Stratégie par cas :
|
||||||
|
- **Rope à 1 nœud** (record ≤ 128 MB) : `Pack()` est trivial (no-op), parseur actuel OK
|
||||||
|
- **Rope à ≥ 2 nœuds** : par l'invariant, `piece1` ne contient pas de record complet →
|
||||||
|
une seule grande séquence → in-place applicable
|
||||||
|
|
||||||
|
### Format d'une ligne séquence GenBank (Après ORIGIN)
|
||||||
|
|
||||||
|
```
|
||||||
|
/^ *[0-9]+( [nuc]{10}){0,5} [nuc]{1,10}/
|
||||||
|
```
|
||||||
|
|
||||||
|
### Format d'une ligne séquence GenBank (Après SQ)
|
||||||
|
|
||||||
|
La ligne SQ contient aussi la taille de la séquence
|
||||||
|
|
||||||
|
```
|
||||||
|
/^ *( [nuc]{10}){0,5} [nuc]{1,10} *[0-9]+/
|
||||||
|
```
|
||||||
|
|
||||||
|
Compactage in-place sur `bline` ([]byte brut, sans conversion `string`) :
|
||||||
|
|
||||||
|
```go
|
||||||
|
w := 0
|
||||||
|
i := 0
|
||||||
|
for i < len(bline) && bline[i] == ' ' { i++ } // skip indentation
|
||||||
|
for i < len(bline) && bline[i] <= '9' { i++ } // skip position number
|
||||||
|
for ; i < len(bline); i++ {
|
||||||
|
if bline[i] != ' ' {
|
||||||
|
bline[w] = bline[i]
|
||||||
|
w++
|
||||||
|
}
|
||||||
|
}
|
||||||
|
// écrire bline[:w] directement dans piece1.data[seqOffset:]
|
||||||
|
```
|
||||||
|
|
||||||
|
## Changements nécessaires
|
||||||
|
|
||||||
|
1. **`FileChunk`** : exposer la rope `*PieceOfChunk` non-packée en plus (ou à la place)
|
||||||
|
de `Raw *bytes.Buffer`
|
||||||
|
2. **`GenbankChunkParser` / `EmblChunkParser`** : accepter `*PieceOfChunk`, parser la
|
||||||
|
rope séquentiellement avec carry buffer pour les jonctions
|
||||||
|
3. **`FastaChunkParser`** : idem, avec in-place conditionnel selon taille de la rope
|
||||||
|
4. **`ReadFileChunk`** : ne pas appeler `Pack()` avant envoi sur le channel (ou version
|
||||||
|
alternative `ReadFileChunkRope`)
|
||||||
|
|
||||||
|
## Fichiers concernés
|
||||||
|
|
||||||
|
- `pkg/obiformats/file_chunk_read.go` — structure rope, `ReadFileChunk`
|
||||||
|
- `pkg/obiformats/genbank_read.go` — `GenbankChunkParser`, `_ParseGenbankFile`
|
||||||
|
- `pkg/obiformats/embl_read.go` — `EmblChunkParser`, `ReadEMBL`
|
||||||
|
- `pkg/obiformats/fastaseq_read.go` — `FastaChunkParser`, `_ParseFastaFile`
|
||||||
|
- `pkg/obiformats/fastqseq_read.go` — parseur FASTQ (même structure)
|
||||||
|
|
||||||
|
## Plan d'implémentation : parseur GenBank sur rope
|
||||||
|
|
||||||
|
### Contexte
|
||||||
|
|
||||||
|
Baseline mesurée : `obiconvert gbpln640.seq.gz` → 49s real, 42s user, 29s sys, **57 GB RSS**.
|
||||||
|
Le sys élevé indique des allocations massives. Deux causes :
|
||||||
|
1. `Pack()` : fusionne toute la rope (N × 128 MB) en un buffer contigu avant de parser
|
||||||
|
2. Parser ORIGIN : `string(bline)` + `TrimSpace` + `SplitN` × millions de lignes
|
||||||
|
|
||||||
|
### 1. `gbRopeScanner`
|
||||||
|
|
||||||
|
Struct de lecture ligne par ligne sur la rope, sans allocation heap :
|
||||||
|
|
||||||
|
```go
|
||||||
|
type gbRopeScanner struct {
|
||||||
|
current *PieceOfChunk
|
||||||
|
pos int
|
||||||
|
carry [256]byte // stack-allocated, max GenBank line = 80 chars
|
||||||
|
carryN int
|
||||||
|
}
|
||||||
|
```
|
||||||
|
|
||||||
|
`ReadLine()` :
|
||||||
|
- Cherche `\n` dans `current.data[pos:]` via `bytes.IndexByte`
|
||||||
|
- Si trouvé sans carry : retourne slice direct du node (zéro alloc)
|
||||||
|
- Si trouvé avec carry : copie dans carry buffer, retourne `carry[:n]`
|
||||||
|
- Si non trouvé : copie le reste dans carry, avance au node suivant, recommence
|
||||||
|
- EOF : retourne `carry[:carryN]` puis nil
|
||||||
|
|
||||||
|
`extractSequence(dest []byte, UtoT bool) int` :
|
||||||
|
- Scan direct des bytes pour section ORIGIN, sans passer par ReadLine
|
||||||
|
- Machine d'états : lineStart → skip espaces/digits → copier nucléotides dans dest
|
||||||
|
- Stop sur `//` en début de ligne
|
||||||
|
- Zéro allocation, UtoT inline
|
||||||
|
|
||||||
|
### 2. `GenbankChunkParserRope`
|
||||||
|
|
||||||
|
```go
|
||||||
|
func GenbankChunkParserRope(source string, rope *PieceOfChunk,
|
||||||
|
withFeatureTable, UtoT bool) (obiseq.BioSequenceSlice, error)
|
||||||
|
```
|
||||||
|
|
||||||
|
- Même machine d'états que `GenbankChunkParser`, sur `[]byte` (`bytes.HasPrefix`)
|
||||||
|
- LOCUS : extrait `id` et `lseq` par scan direct (remplace `_seqlenght_rx`)
|
||||||
|
- FEATURES / default inFeature : taxid extrait par scan de `/db_xref="taxon:`
|
||||||
|
dans la source feature ; `featBytes` rempli seulement si `withFeatureTable=true`
|
||||||
|
- DEFINITION : toujours conservée
|
||||||
|
- ORIGIN : `dest = make([]byte, 0, lseq+20)` puis `s.extractSequence(dest, UtoT)`
|
||||||
|
|
||||||
|
### 3. Modifications `_ParseGenbankFile` et `ReadGenbank`
|
||||||
|
|
||||||
|
`_ParseGenbankFile` utilise `chunk.Rope` :
|
||||||
|
```go
|
||||||
|
sequences, err := GenbankChunkParserRope(chunk.Source, chunk.Rope, ...)
|
||||||
|
```
|
||||||
|
|
||||||
|
`ReadGenbank` passe `pack=false` :
|
||||||
|
```go
|
||||||
|
entry_channel := ReadFileChunk(..., false)
|
||||||
|
```
|
||||||
|
|
||||||
|
### 4. Ce qui NE change pas
|
||||||
|
|
||||||
|
- `GenbankChunkParser` reste (référence, tests)
|
||||||
|
- `ReadFileChunk`, `Pack()`, autres parseurs (EMBL, FASTA, FASTQ) : inchangés
|
||||||
|
|
||||||
|
### 5. Gains attendus
|
||||||
|
|
||||||
|
- **RSS** : pic ≈ 128 MB × workers (au lieu de N × 128 MB)
|
||||||
|
- **Temps sys** : élimination des mmap/munmap pour les gros buffers
|
||||||
|
- **Temps user** : ~50M allocations éliminées
|
||||||
|
|
||||||
|
### 6. Vérification
|
||||||
|
|
||||||
|
```bash
|
||||||
|
/usr/local/go/bin/go build ./...
|
||||||
|
diff <(obiconvert gbpln640.seq.gz) gbpln640.reference.fasta
|
||||||
|
cd bugs/genbank && ./benchmark.sh gbpln640.seq.gz
|
||||||
|
```
|
||||||
|
|
||||||
|
Cible : RSS < 1 GB, temps comparable ou meilleur.
|
||||||
@@ -1,3 +0,0 @@
|
|||||||
lit le ficier [@canonical-super-kmer-strategy.md](file:///Users/coissac/Sync/travail/__MOI__/GO/obitools4/blackboard/Prospective/canonical-super-kmer-strategy.md).
|
|
||||||
|
|
||||||
Dans le fichier [@superkmer_iter.go](file:///Users/coissac/Sync/travail/__MOI__/GO/obitools4/pkg/obikmer/superkmer_iter.go) implemente une nouvelle fonction IterCanonicalSuperKmers sur le modèle de IterSuperKmers, qui implémente la notion de SuperKmers canonique présenté dans le document d'architecture.
|
|
||||||
@@ -37,6 +37,11 @@ func main() {
|
|||||||
|
|
||||||
optionParser(os.Args)
|
optionParser(os.Args)
|
||||||
|
|
||||||
|
if !obipairing.CLIHasPairedFiles() {
|
||||||
|
log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
|
||||||
|
os.Exit(1)
|
||||||
|
}
|
||||||
|
|
||||||
obidefault.SetStrictReadWorker(2)
|
obidefault.SetStrictReadWorker(2)
|
||||||
obidefault.SetStrictWriteWorker(2)
|
obidefault.SetStrictWriteWorker(2)
|
||||||
pairs, err := obipairing.CLIPairedSequence()
|
pairs, err := obipairing.CLIPairedSequence()
|
||||||
|
|||||||
@@ -1,6 +1,7 @@
|
|||||||
package main
|
package main
|
||||||
|
|
||||||
import (
|
import (
|
||||||
|
"fmt"
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
@@ -8,6 +9,7 @@ import (
|
|||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obimultiplex"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipairing"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipairing"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitagpcr"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitagpcr"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
@@ -39,6 +41,17 @@ func main() {
|
|||||||
obitagpcr.OptionSet)
|
obitagpcr.OptionSet)
|
||||||
|
|
||||||
optionParser(os.Args)
|
optionParser(os.Args)
|
||||||
|
|
||||||
|
if obimultiplex.CLIAskConfigTemplate() {
|
||||||
|
fmt.Print(obimultiplex.CLIConfigTemplate())
|
||||||
|
os.Exit(0)
|
||||||
|
}
|
||||||
|
|
||||||
|
if !obipairing.CLIHasPairedFiles() {
|
||||||
|
log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
|
||||||
|
os.Exit(1)
|
||||||
|
}
|
||||||
|
|
||||||
pairs, err := obipairing.CLIPairedSequence()
|
pairs, err := obipairing.CLIPairedSequence()
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
|
|||||||
@@ -0,0 +1,10 @@
|
|||||||
|
{
|
||||||
|
"people": [
|
||||||
|
"Software",
|
||||||
|
"Agreement",
|
||||||
|
"Module"
|
||||||
|
],
|
||||||
|
"projects": [
|
||||||
|
"Code"
|
||||||
|
]
|
||||||
|
}
|
||||||
@@ -1,35 +1,33 @@
|
|||||||
module git.metabarcoding.org/obitools/obitools4/obitools4
|
module git.metabarcoding.org/obitools/obitools4/obitools4
|
||||||
|
|
||||||
go 1.23.4
|
go 1.26.1
|
||||||
|
|
||||||
toolchain go1.24.2
|
|
||||||
|
|
||||||
require (
|
require (
|
||||||
github.com/DavidGamba/go-getoptions v0.28.0
|
github.com/DavidGamba/go-getoptions v0.33.0
|
||||||
github.com/PaesslerAG/gval v1.2.2
|
github.com/PaesslerAG/gval v1.2.4
|
||||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df
|
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df
|
||||||
github.com/buger/jsonparser v1.1.1
|
github.com/buger/jsonparser v1.1.2
|
||||||
github.com/chen3feng/stl4go v0.1.1
|
github.com/chen3feng/stl4go v0.1.1
|
||||||
github.com/dlclark/regexp2 v1.11.4
|
github.com/dlclark/regexp2 v1.11.5
|
||||||
github.com/goccy/go-json v0.10.3
|
github.com/goccy/go-json v0.10.6
|
||||||
github.com/klauspost/pgzip v1.2.6
|
github.com/klauspost/pgzip v1.2.6
|
||||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58
|
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58
|
||||||
github.com/pelletier/go-toml/v2 v2.2.4
|
github.com/pelletier/go-toml/v2 v2.2.4
|
||||||
github.com/rrethy/ahocorasick v1.0.0
|
github.com/rrethy/ahocorasick v1.0.0
|
||||||
github.com/schollz/progressbar/v3 v3.13.1
|
github.com/schollz/progressbar/v3 v3.19.0
|
||||||
github.com/sirupsen/logrus v1.9.3
|
github.com/sirupsen/logrus v1.9.4
|
||||||
github.com/stretchr/testify v1.8.4
|
github.com/stretchr/testify v1.10.0
|
||||||
github.com/tevino/abool/v2 v2.1.0
|
github.com/tevino/abool/v2 v2.1.0
|
||||||
github.com/yuin/gopher-lua v1.1.1
|
github.com/yuin/gopher-lua v1.1.1
|
||||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa
|
golang.org/x/exp v0.0.0-20260312153236-7ab1446f8b90
|
||||||
gonum.org/v1/gonum v0.14.0
|
gonum.org/v1/gonum v0.17.0
|
||||||
gopkg.in/yaml.v3 v3.0.1
|
gopkg.in/yaml.v3 v3.0.1
|
||||||
scientificgo.org/special v0.0.0
|
scientificgo.org/special v0.0.0
|
||||||
)
|
)
|
||||||
|
|
||||||
require (
|
require (
|
||||||
github.com/davecgh/go-spew v1.1.1 // indirect
|
github.com/davecgh/go-spew v1.1.1 // indirect
|
||||||
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 // indirect
|
github.com/goombaio/orderedmap v0.0.0-20180925151256-3da0e2f905f9 // indirect
|
||||||
github.com/kr/pretty v0.3.1 // indirect
|
github.com/kr/pretty v0.3.1 // indirect
|
||||||
github.com/kr/text v0.2.0 // indirect
|
github.com/kr/text v0.2.0 // indirect
|
||||||
github.com/pmezard/go-difflib v1.0.0 // indirect
|
github.com/pmezard/go-difflib v1.0.0 // indirect
|
||||||
@@ -38,16 +36,15 @@ require (
|
|||||||
|
|
||||||
require (
|
require (
|
||||||
github.com/dsnet/compress v0.0.1
|
github.com/dsnet/compress v0.0.1
|
||||||
github.com/gabriel-vasile/mimetype v1.4.3
|
github.com/gabriel-vasile/mimetype v1.4.13
|
||||||
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77
|
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77
|
||||||
github.com/klauspost/compress v1.17.2
|
github.com/klauspost/compress v1.18.4
|
||||||
github.com/mattn/go-runewidth v0.0.15 // indirect
|
github.com/mattn/go-runewidth v0.0.21 // indirect
|
||||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db // indirect
|
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db // indirect
|
||||||
github.com/rivo/uniseg v0.4.4 // indirect
|
github.com/rivo/uniseg v0.4.7 // indirect
|
||||||
github.com/shopspring/decimal v1.3.1 // indirect
|
github.com/shopspring/decimal v1.4.0 // indirect
|
||||||
github.com/ulikunitz/xz v0.5.11
|
github.com/ulikunitz/xz v0.5.15
|
||||||
golang.org/x/net v0.35.0 // indirect
|
golang.org/x/sys v0.42.0 // indirect
|
||||||
golang.org/x/sys v0.30.0 // indirect
|
golang.org/x/term v0.41.0 // indirect
|
||||||
golang.org/x/term v0.29.0 // indirect
|
|
||||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c
|
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c
|
||||||
)
|
)
|
||||||
|
|||||||
@@ -1,36 +1,41 @@
|
|||||||
github.com/DavidGamba/go-getoptions v0.28.0 h1:18wgEvfZdrlfIhVDGEBO3Dl0fkOyXqXLa0tLMCKxM1c=
|
github.com/DavidGamba/go-getoptions v0.33.0 h1:8xCPH87Yy5avYenygyHVlqqm8RpymH0YFe4a7IWlarE=
|
||||||
github.com/DavidGamba/go-getoptions v0.28.0/go.mod h1:zE97E3PR9P3BI/HKyNYgdMlYxodcuiC6W68KIgeYT84=
|
github.com/DavidGamba/go-getoptions v0.33.0/go.mod h1:zE97E3PR9P3BI/HKyNYgdMlYxodcuiC6W68KIgeYT84=
|
||||||
github.com/PaesslerAG/gval v1.2.2 h1:Y7iBzhgE09IGTt5QgGQ2IdaYYYOU134YGHBThD+wm9E=
|
github.com/PaesslerAG/gval v1.2.4 h1:rhX7MpjJlcxYwL2eTTYIOBUyEKZ+A96T9vQySWkVUiU=
|
||||||
github.com/PaesslerAG/gval v1.2.2/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
|
github.com/PaesslerAG/gval v1.2.4/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
|
||||||
github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
|
github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
|
||||||
github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
|
github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
|
||||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
|
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
|
||||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
|
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
|
||||||
github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
|
github.com/buger/jsonparser v1.1.2 h1:frqHqw7otoVbk5M8LlE/L7HTnIq2v9RX6EJ48i9AxJk=
|
||||||
github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
|
github.com/buger/jsonparser v1.1.2/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
|
||||||
github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
|
github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
|
||||||
github.com/chen3feng/stl4go v0.1.1/go.mod h1:5ml3psLgETJjRJnMbPE+JiHLrCpt+Ajc2weeTECXzWU=
|
github.com/chen3feng/stl4go v0.1.1/go.mod h1:5ml3psLgETJjRJnMbPE+JiHLrCpt+Ajc2weeTECXzWU=
|
||||||
|
github.com/chengxilo/virtualterm v1.0.4 h1:Z6IpERbRVlfB8WkOmtbHiDbBANU7cimRIof7mk9/PwM=
|
||||||
|
github.com/chengxilo/virtualterm v1.0.4/go.mod h1:DyxxBZz/x1iqJjFxTFcr6/x+jSpqN0iwWCOK1q10rlY=
|
||||||
|
github.com/clipperhouse/uax29/v2 v2.2.0 h1:ChwIKnQN3kcZteTXMgb1wztSgaU+ZemkgWdohwgs8tY=
|
||||||
|
github.com/clipperhouse/uax29/v2 v2.2.0/go.mod h1:EFJ2TJMRUaplDxHKj1qAEhCtQPW2tJSwu5BF98AuoVM=
|
||||||
github.com/creack/pty v1.1.9/go.mod h1:oKZEueFk5CKHvIhNR5MUki03XCEU+Q6VDXinZuGJ33E=
|
github.com/creack/pty v1.1.9/go.mod h1:oKZEueFk5CKHvIhNR5MUki03XCEU+Q6VDXinZuGJ33E=
|
||||||
github.com/davecgh/go-spew v1.1.0/go.mod h1:J7Y8YcW2NihsgmVo/mv3lAwl/skON4iLHjSsI+c5H38=
|
|
||||||
github.com/davecgh/go-spew v1.1.1 h1:vj9j/u1bqnvCEfJOwUhtlOARqs3+rkHYY13jYWTU97c=
|
github.com/davecgh/go-spew v1.1.1 h1:vj9j/u1bqnvCEfJOwUhtlOARqs3+rkHYY13jYWTU97c=
|
||||||
github.com/davecgh/go-spew v1.1.1/go.mod h1:J7Y8YcW2NihsgmVo/mv3lAwl/skON4iLHjSsI+c5H38=
|
github.com/davecgh/go-spew v1.1.1/go.mod h1:J7Y8YcW2NihsgmVo/mv3lAwl/skON4iLHjSsI+c5H38=
|
||||||
github.com/dlclark/regexp2 v1.11.4 h1:rPYF9/LECdNymJufQKmri9gV604RvvABwgOA8un7yAo=
|
github.com/dlclark/regexp2 v1.11.5 h1:Q/sSnsKerHeCkc/jSTNq1oCm7KiVgUMZRDUoRu0JQZQ=
|
||||||
github.com/dlclark/regexp2 v1.11.4/go.mod h1:DHkYz0B9wPfa6wondMfaivmHpzrQ3v9q8cnmRbL6yW8=
|
github.com/dlclark/regexp2 v1.11.5/go.mod h1:DHkYz0B9wPfa6wondMfaivmHpzrQ3v9q8cnmRbL6yW8=
|
||||||
github.com/dsnet/compress v0.0.1 h1:PlZu0n3Tuv04TzpfPbrnI0HW/YwodEXDS+oPKahKF0Q=
|
github.com/dsnet/compress v0.0.1 h1:PlZu0n3Tuv04TzpfPbrnI0HW/YwodEXDS+oPKahKF0Q=
|
||||||
github.com/dsnet/compress v0.0.1/go.mod h1:Aw8dCMJ7RioblQeTqt88akK31OvO8Dhf5JflhBbQEHo=
|
github.com/dsnet/compress v0.0.1/go.mod h1:Aw8dCMJ7RioblQeTqt88akK31OvO8Dhf5JflhBbQEHo=
|
||||||
github.com/dsnet/golib v0.0.0-20171103203638-1ea166775780/go.mod h1:Lj+Z9rebOhdfkVLjJ8T6VcRQv3SXugXy999NBtR9aFY=
|
github.com/dsnet/golib v0.0.0-20171103203638-1ea166775780/go.mod h1:Lj+Z9rebOhdfkVLjJ8T6VcRQv3SXugXy999NBtR9aFY=
|
||||||
github.com/gabriel-vasile/mimetype v1.4.3 h1:in2uUcidCuFcDKtdcBxlR0rJ1+fsokWf+uqxgUFjbI0=
|
github.com/gabriel-vasile/mimetype v1.4.13 h1:46nXokslUBsAJE/wMsp5gtO500a4F3Nkz9Ufpk2AcUM=
|
||||||
github.com/gabriel-vasile/mimetype v1.4.3/go.mod h1:d8uq/6HKRL6CGdk+aubisF/M5GcPfT7nKyLpA0lbSSk=
|
github.com/gabriel-vasile/mimetype v1.4.13/go.mod h1:d+9Oxyo1wTzWdyVUPMmXFvp4F9tea18J8ufA774AB3s=
|
||||||
github.com/goccy/go-json v0.10.3 h1:KZ5WoDbxAIgm2HNbYckL0se1fHD6rz5j4ywS6ebzDqA=
|
github.com/goccy/go-json v0.10.6 h1:p8HrPJzOakx/mn/bQtjgNjdTcN+/S6FcG2CTtQOrHVU=
|
||||||
github.com/goccy/go-json v0.10.3/go.mod h1:oq7eo15ShAhp70Anwd5lgX2pLfOS3QCiwU/PULtXL6M=
|
github.com/goccy/go-json v0.10.6/go.mod h1:oq7eo15ShAhp70Anwd5lgX2pLfOS3QCiwU/PULtXL6M=
|
||||||
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 h1:SajEQ6tktpF9SRIuzbiPOX9AEZZ53Bvw0k9Mzrts8Lg=
|
github.com/google/go-cmp v0.6.0 h1:ofyhxvXcZhMsU5ulbFiLKl/XBFqE1GSq7atu8tAmTRI=
|
||||||
|
github.com/google/go-cmp v0.6.0/go.mod h1:17dUlkBOakJ0+DkrSSNjCkIjxS6bF9zb3elmeNGIjoY=
|
||||||
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419/go.mod h1:YKu81H3RSd1cFh0d7NhvUoTtUC9IY/vBX0WUQb1/o4Y=
|
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419/go.mod h1:YKu81H3RSd1cFh0d7NhvUoTtUC9IY/vBX0WUQb1/o4Y=
|
||||||
|
github.com/goombaio/orderedmap v0.0.0-20180925151256-3da0e2f905f9 h1:vFjPvFavIiDY71bQ9HIxPQBANvNl1SmFC4fgg5xRkho=
|
||||||
|
github.com/goombaio/orderedmap v0.0.0-20180925151256-3da0e2f905f9/go.mod h1:YKu81H3RSd1cFh0d7NhvUoTtUC9IY/vBX0WUQb1/o4Y=
|
||||||
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77 h1:4dvq1tGHn1Y9KSRY0OZ24Khki4+4U+ZrA//YYsdUlJU=
|
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77 h1:4dvq1tGHn1Y9KSRY0OZ24Khki4+4U+ZrA//YYsdUlJU=
|
||||||
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77/go.mod h1:HPelMYpOyy0XvglpBbmZ3krZpwaHmszj/vQNlnETPTM=
|
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77/go.mod h1:HPelMYpOyy0XvglpBbmZ3krZpwaHmszj/vQNlnETPTM=
|
||||||
github.com/k0kubun/go-ansi v0.0.0-20180517002512-3bf9e2903213/go.mod h1:vNUNkEQ1e29fT/6vq2aBdFsgNPmy8qMdSay1npru+Sw=
|
|
||||||
github.com/klauspost/compress v1.4.1/go.mod h1:RyIbtBH6LamlWaDj8nUwkbUhJ87Yi3uG0guNDohfE1A=
|
github.com/klauspost/compress v1.4.1/go.mod h1:RyIbtBH6LamlWaDj8nUwkbUhJ87Yi3uG0guNDohfE1A=
|
||||||
github.com/klauspost/compress v1.17.2 h1:RlWWUY/Dr4fL8qk9YG7DTZ7PDgME2V4csBXA8L/ixi4=
|
github.com/klauspost/compress v1.18.4 h1:RPhnKRAQ4Fh8zU2FY/6ZFDwTVTxgJ/EMydqSTzE9a2c=
|
||||||
github.com/klauspost/compress v1.17.2/go.mod h1:ntbaceVETuRiXiv4DpjP66DpAtAGkEQskQzEyD//IeE=
|
github.com/klauspost/compress v1.18.4/go.mod h1:R0h/fSBs8DE4ENlcrlib3PsXS61voFxhIs2DeRhCvJ4=
|
||||||
github.com/klauspost/cpuid v1.2.0/go.mod h1:Pj4uuM528wm8OyEC2QMXAi2YiTZ96dNQPGgoMS4s3ek=
|
github.com/klauspost/cpuid v1.2.0/go.mod h1:Pj4uuM528wm8OyEC2QMXAi2YiTZ96dNQPGgoMS4s3ek=
|
||||||
github.com/klauspost/pgzip v1.2.6 h1:8RXeL5crjEUFnR2/Sn6GJNWtSQ3Dk8pq4CL3jvdDyjU=
|
github.com/klauspost/pgzip v1.2.6 h1:8RXeL5crjEUFnR2/Sn6GJNWtSQ3Dk8pq4CL3jvdDyjU=
|
||||||
github.com/klauspost/pgzip v1.2.6/go.mod h1:Ch1tH69qFZu15pkjo5kYi6mth2Zzwzt50oCQKQE9RUs=
|
github.com/klauspost/pgzip v1.2.6/go.mod h1:Ch1tH69qFZu15pkjo5kYi6mth2Zzwzt50oCQKQE9RUs=
|
||||||
@@ -41,10 +46,8 @@ github.com/kr/pty v1.1.1/go.mod h1:pFQYn66WHrOpPYNljwOMqo10TkYh1fy3cYio2l3bCsQ=
|
|||||||
github.com/kr/text v0.1.0/go.mod h1:4Jbv+DJW3UT/LiOwJeYQe1efqtUx/iVham/4vfdArNI=
|
github.com/kr/text v0.1.0/go.mod h1:4Jbv+DJW3UT/LiOwJeYQe1efqtUx/iVham/4vfdArNI=
|
||||||
github.com/kr/text v0.2.0 h1:5Nx0Ya0ZqY2ygV366QzturHI13Jq95ApcVaJBhpS+AY=
|
github.com/kr/text v0.2.0 h1:5Nx0Ya0ZqY2ygV366QzturHI13Jq95ApcVaJBhpS+AY=
|
||||||
github.com/kr/text v0.2.0/go.mod h1:eLer722TekiGuMkidMxC/pM04lWEeraHUUmBw8l2grE=
|
github.com/kr/text v0.2.0/go.mod h1:eLer722TekiGuMkidMxC/pM04lWEeraHUUmBw8l2grE=
|
||||||
github.com/mattn/go-isatty v0.0.17/go.mod h1:kYGgaQfpe5nmfYZH+SKPsOc2e4SrIfOl2e/yFXSvRLM=
|
github.com/mattn/go-runewidth v0.0.21 h1:jJKAZiQH+2mIinzCJIaIG9Be1+0NR+5sz/lYEEjdM8w=
|
||||||
github.com/mattn/go-runewidth v0.0.14/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
|
github.com/mattn/go-runewidth v0.0.21/go.mod h1:XBkDxAl56ILZc9knddidhrOlY5R/pDhgLpndooCuJAs=
|
||||||
github.com/mattn/go-runewidth v0.0.15 h1:UNAjwbU9l54TA3KzvqLGxwWjHmMgBUVhBiTjelZgg3U=
|
|
||||||
github.com/mattn/go-runewidth v0.0.15/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
|
|
||||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2EmQ4l5rM/4FEfDWcRD+abF5XlKShorW5LRoQ=
|
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2EmQ4l5rM/4FEfDWcRD+abF5XlKShorW5LRoQ=
|
||||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
|
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
|
||||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
|
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
|
||||||
@@ -54,50 +57,40 @@ github.com/pelletier/go-toml/v2 v2.2.4/go.mod h1:2gIqNv+qfxSVS7cM2xJQKtLSTLUE9V8
|
|||||||
github.com/pkg/diff v0.0.0-20210226163009-20ebb0f2a09e/go.mod h1:pJLUxLENpZxwdsKMEsNbx1VGcRFpLqf3715MtcvvzbA=
|
github.com/pkg/diff v0.0.0-20210226163009-20ebb0f2a09e/go.mod h1:pJLUxLENpZxwdsKMEsNbx1VGcRFpLqf3715MtcvvzbA=
|
||||||
github.com/pmezard/go-difflib v1.0.0 h1:4DBwDE0NGyQoBHbLQYPwSUPoCMWR5BEzIk/f1lZbAQM=
|
github.com/pmezard/go-difflib v1.0.0 h1:4DBwDE0NGyQoBHbLQYPwSUPoCMWR5BEzIk/f1lZbAQM=
|
||||||
github.com/pmezard/go-difflib v1.0.0/go.mod h1:iKH77koFhYxTK1pcRnkKkqfTogsbg7gZNVY4sRDYZ/4=
|
github.com/pmezard/go-difflib v1.0.0/go.mod h1:iKH77koFhYxTK1pcRnkKkqfTogsbg7gZNVY4sRDYZ/4=
|
||||||
github.com/rivo/uniseg v0.2.0/go.mod h1:J6wj4VEh+S6ZtnVlnTBMWIodfgj8LQOQFoIToxlJtxc=
|
github.com/rivo/uniseg v0.4.7 h1:WUdvkW8uEhrYfLC4ZzdpI2ztxP1I582+49Oc5Mq64VQ=
|
||||||
github.com/rivo/uniseg v0.4.4 h1:8TfxU8dW6PdqD27gjM8MVNuicgxIjxpm4K7x4jp8sis=
|
github.com/rivo/uniseg v0.4.7/go.mod h1:FN3SvrM+Zdj16jyLfmOkMNblXMcoc8DfTHruCPUcx88=
|
||||||
github.com/rivo/uniseg v0.4.4/go.mod h1:FN3SvrM+Zdj16jyLfmOkMNblXMcoc8DfTHruCPUcx88=
|
|
||||||
github.com/rogpeppe/go-internal v1.9.0/go.mod h1:WtVeX8xhTBvf0smdhujwtBcq4Qrzq/fJaraNFVN+nFs=
|
github.com/rogpeppe/go-internal v1.9.0/go.mod h1:WtVeX8xhTBvf0smdhujwtBcq4Qrzq/fJaraNFVN+nFs=
|
||||||
github.com/rogpeppe/go-internal v1.12.0 h1:exVL4IDcn6na9z1rAb56Vxr+CgyK3nn3O+epU5NdKM8=
|
github.com/rogpeppe/go-internal v1.12.0 h1:exVL4IDcn6na9z1rAb56Vxr+CgyK3nn3O+epU5NdKM8=
|
||||||
github.com/rogpeppe/go-internal v1.12.0/go.mod h1:E+RYuTGaKKdloAfM02xzb0FW3Paa99yedzYV+kq4uf4=
|
github.com/rogpeppe/go-internal v1.12.0/go.mod h1:E+RYuTGaKKdloAfM02xzb0FW3Paa99yedzYV+kq4uf4=
|
||||||
github.com/rrethy/ahocorasick v1.0.0 h1:YKkCB+E5PXc0xmLfMrWbfNht8vG9Re97IHSWZk/Lk8E=
|
github.com/rrethy/ahocorasick v1.0.0 h1:YKkCB+E5PXc0xmLfMrWbfNht8vG9Re97IHSWZk/Lk8E=
|
||||||
github.com/rrethy/ahocorasick v1.0.0/go.mod h1:nq8oScE7Vy1rOppoQxpQiiDmPHuKCuk9rXrNcxUV3R0=
|
github.com/rrethy/ahocorasick v1.0.0/go.mod h1:nq8oScE7Vy1rOppoQxpQiiDmPHuKCuk9rXrNcxUV3R0=
|
||||||
github.com/schollz/progressbar/v3 v3.13.1 h1:o8rySDYiQ59Mwzy2FELeHY5ZARXZTVJC7iHD6PEFUiE=
|
github.com/schollz/progressbar/v3 v3.19.0 h1:Ea18xuIRQXLAUidVDox3AbwfUhD0/1IvohyTutOIFoc=
|
||||||
github.com/schollz/progressbar/v3 v3.13.1/go.mod h1:xvrbki8kfT1fzWzBT/UZd9L6GA+jdL7HAgq2RFnO6fQ=
|
github.com/schollz/progressbar/v3 v3.19.0/go.mod h1:IsO3lpbaGuzh8zIMzgY3+J8l4C8GjO0Y9S69eFvNsec=
|
||||||
github.com/shopspring/decimal v1.3.1 h1:2Usl1nmF/WZucqkFZhnfFYxxxu8LG21F6nPQBE5gKV8=
|
|
||||||
github.com/shopspring/decimal v1.3.1/go.mod h1:DKyhrW/HYNuLGql+MJL6WCR6knT2jwCFRcu2hWCYk4o=
|
github.com/shopspring/decimal v1.3.1/go.mod h1:DKyhrW/HYNuLGql+MJL6WCR6knT2jwCFRcu2hWCYk4o=
|
||||||
github.com/sirupsen/logrus v1.9.3 h1:dueUQJ1C2q9oE3F7wvmSGAaVtTmUizReu6fjN8uqzbQ=
|
github.com/shopspring/decimal v1.4.0 h1:bxl37RwXBklmTi0C79JfXCEBD1cqqHt0bbgBAGFp81k=
|
||||||
github.com/sirupsen/logrus v1.9.3/go.mod h1:naHLuLoDiP4jHNo9R0sCBMtWGeIprob74mVsIT4qYEQ=
|
github.com/shopspring/decimal v1.4.0/go.mod h1:gawqmDU56v4yIKSwfBSFip1HdCCXN8/+DMd9qYNcwME=
|
||||||
github.com/stretchr/objx v0.1.0/go.mod h1:HFkY916IF+rwdDfMAkV7OtwuqBVzrE8GR6GFx+wExME=
|
github.com/sirupsen/logrus v1.9.4 h1:TsZE7l11zFCLZnZ+teH4Umoq5BhEIfIzfRDZ1Uzql2w=
|
||||||
github.com/stretchr/testify v1.3.0/go.mod h1:M5WIy9Dh21IEIfnGCwXGc5bZfKNJtfHm1UVUgZn+9EI=
|
github.com/sirupsen/logrus v1.9.4/go.mod h1:ftWc9WdOfJ0a92nsE2jF5u5ZwH8Bv2zdeOC42RjbV2g=
|
||||||
github.com/stretchr/testify v1.7.0/go.mod h1:6Fq8oRcR53rry900zMqJjRRixrwX3KX962/h/Wwjteg=
|
github.com/stretchr/testify v1.10.0 h1:Xv5erBjTwe/5IxqUQTdXv5kgmIvbHo3QQyRwhJsOfJA=
|
||||||
github.com/stretchr/testify v1.8.4 h1:CcVxjf3Q8PM0mHUKJCdn+eZZtm5yQwehR5yeSVQQcUk=
|
github.com/stretchr/testify v1.10.0/go.mod h1:r2ic/lqez/lEtzL7wO/rwa5dbSLXVDPFyf8C91i36aY=
|
||||||
github.com/stretchr/testify v1.8.4/go.mod h1:sz/lmYIOXD/1dqDmKjjqLyZ2RngseejIcXlSw2iwfAo=
|
|
||||||
github.com/tevino/abool/v2 v2.1.0 h1:7w+Vf9f/5gmKT4m4qkayb33/92M+Um45F2BkHOR+L/c=
|
github.com/tevino/abool/v2 v2.1.0 h1:7w+Vf9f/5gmKT4m4qkayb33/92M+Um45F2BkHOR+L/c=
|
||||||
github.com/tevino/abool/v2 v2.1.0/go.mod h1:+Lmlqk6bHDWHqN1cbxqhwEAwMPXgc8I1SDEamtseuXY=
|
github.com/tevino/abool/v2 v2.1.0/go.mod h1:+Lmlqk6bHDWHqN1cbxqhwEAwMPXgc8I1SDEamtseuXY=
|
||||||
github.com/ulikunitz/xz v0.5.6/go.mod h1:2bypXElzHzzJZwzH67Y6wb67pO62Rzfn7BSiF4ABRW8=
|
github.com/ulikunitz/xz v0.5.6/go.mod h1:2bypXElzHzzJZwzH67Y6wb67pO62Rzfn7BSiF4ABRW8=
|
||||||
github.com/ulikunitz/xz v0.5.11 h1:kpFauv27b6ynzBNT/Xy+1k+fK4WswhN/6PN5WhFAGw8=
|
github.com/ulikunitz/xz v0.5.15 h1:9DNdB5s+SgV3bQ2ApL10xRc35ck0DuIX/isZvIk+ubY=
|
||||||
github.com/ulikunitz/xz v0.5.11/go.mod h1:nbz6k7qbPmH4IRqmfOplQw/tblSgqTqBwxkY0oWt/14=
|
github.com/ulikunitz/xz v0.5.15/go.mod h1:nbz6k7qbPmH4IRqmfOplQw/tblSgqTqBwxkY0oWt/14=
|
||||||
github.com/yuin/gopher-lua v1.1.1 h1:kYKnWBjvbNP4XLT3+bPEwAXJx262OhaHDWDVOPjL46M=
|
github.com/yuin/gopher-lua v1.1.1 h1:kYKnWBjvbNP4XLT3+bPEwAXJx262OhaHDWDVOPjL46M=
|
||||||
github.com/yuin/gopher-lua v1.1.1/go.mod h1:GBR0iDaNXjAgGg9zfCvksxSRnQx76gclCIb7kdAd1Pw=
|
github.com/yuin/gopher-lua v1.1.1/go.mod h1:GBR0iDaNXjAgGg9zfCvksxSRnQx76gclCIb7kdAd1Pw=
|
||||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa h1:FRnLl4eNAQl8hwxVVC17teOw8kdjVDVAiFMtgUdTSRQ=
|
golang.org/x/exp v0.0.0-20260312153236-7ab1446f8b90 h1:jiDhWWeC7jfWqR9c/uplMOqJ0sbNlNWv0UkzE0vX1MA=
|
||||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa/go.mod h1:zk2irFbV9DP96SEBUUAy67IdHUaZuSnrz1n472HUCLE=
|
golang.org/x/exp v0.0.0-20260312153236-7ab1446f8b90/go.mod h1:xE1HEv6b+1SCZ5/uscMRjUBKtIxworgEcEi+/n9NQDQ=
|
||||||
golang.org/x/net v0.35.0 h1:T5GQRQb2y08kTAByq9L4/bz8cipCdA8FbRTXewonqY8=
|
golang.org/x/sys v0.42.0 h1:omrd2nAlyT5ESRdCLYdm3+fMfNFE/+Rf4bDIQImRJeo=
|
||||||
golang.org/x/net v0.35.0/go.mod h1:EglIi67kWsHKlRzzVMUD93VMSWGFOMSZgxFjparz1Qk=
|
golang.org/x/sys v0.42.0/go.mod h1:4GL1E5IUh+htKOUEOaiffhrAeqysfVGipDYzABqnCmw=
|
||||||
golang.org/x/sys v0.0.0-20220715151400-c0bba94af5f8/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
golang.org/x/term v0.41.0 h1:QCgPso/Q3RTJx2Th4bDLqML4W6iJiaXFq2/ftQF13YU=
|
||||||
golang.org/x/sys v0.0.0-20220811171246-fbc7d0a398ab/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
golang.org/x/term v0.41.0/go.mod h1:3pfBgksrReYfZ5lvYM0kSO0LIkAl4Yl2bXOkKP7Ec2A=
|
||||||
golang.org/x/sys v0.6.0/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
gonum.org/v1/gonum v0.17.0 h1:VbpOemQlsSMrYmn7T2OUvQ4dqxQXU+ouZFQsZOx50z4=
|
||||||
golang.org/x/sys v0.30.0 h1:QjkSwP/36a20jFYWkSue1YwXzLmsV5Gfq7Eiy72C1uc=
|
gonum.org/v1/gonum v0.17.0/go.mod h1:El3tOrEuMpv2UdMrbNlKEh9vd86bmQ6vqIcDwxEOc1E=
|
||||||
golang.org/x/sys v0.30.0/go.mod h1:/VUhepiaJMQUp4+oa/7Zr1D23ma6VTLIYjOOTFZPUcA=
|
|
||||||
golang.org/x/term v0.6.0/go.mod h1:m6U89DPEgQRMq3DNkDClhWw02AUbt2daBVO4cn4Hv9U=
|
|
||||||
golang.org/x/term v0.29.0 h1:L6pJp37ocefwRRtYPKSWOWzOtWSxVajvz2ldH/xi3iU=
|
|
||||||
golang.org/x/term v0.29.0/go.mod h1:6bl4lRlvVuDgSf3179VpIxBF0o10JUpXWOnI7nErv7s=
|
|
||||||
gonum.org/v1/gonum v0.14.0 h1:2NiG67LD1tEH0D7kM+ps2V+fXmsAnpUeec7n8tcr4S0=
|
|
||||||
gonum.org/v1/gonum v0.14.0/go.mod h1:AoWeoz0becf9QMWtE8iWXNXc27fK4fNeHNf/oMejGfU=
|
|
||||||
gopkg.in/check.v1 v0.0.0-20161208181325-20d25e280405/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0=
|
gopkg.in/check.v1 v0.0.0-20161208181325-20d25e280405/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0=
|
||||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c h1:Hei/4ADfdWqJk1ZMxUNpqntNwaWcugrBjAiHlqqRiVk=
|
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c h1:Hei/4ADfdWqJk1ZMxUNpqntNwaWcugrBjAiHlqqRiVk=
|
||||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c/go.mod h1:JHkPIbrfpd72SG/EVd6muEfDQjcINNoR0C8j2r3qZ4Q=
|
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c/go.mod h1:JHkPIbrfpd72SG/EVd6muEfDQjcINNoR0C8j2r3qZ4Q=
|
||||||
gopkg.in/yaml.v3 v3.0.0-20200313102051-9f266ea9e77c/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
|
|
||||||
gopkg.in/yaml.v3 v3.0.1 h1:fxVm/GzAzEWqLHuvctI91KS9hhNmmWOoWu0XTYJS7CA=
|
gopkg.in/yaml.v3 v3.0.1 h1:fxVm/GzAzEWqLHuvctI91KS9hhNmmWOoWu0XTYJS7CA=
|
||||||
gopkg.in/yaml.v3 v3.0.1/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
|
gopkg.in/yaml.v3 v3.0.1/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
|
||||||
scientificgo.org/special v0.0.0 h1:P6WJkECo6tgtvZAEfNXl+KEB9ReAatjKAeX8U07mjSc=
|
scientificgo.org/special v0.0.0 h1:P6WJkECo6tgtvZAEfNXl+KEB9ReAatjKAeX8U07mjSc=
|
||||||
|
|||||||
@@ -52,6 +52,8 @@ golang.org/x/image v0.6.0/go.mod h1:MXLdDR43H7cDJq5GEGXEVeeNhPgi+YYEQ2pC1byI1x0=
|
|||||||
golang.org/x/mod v0.13.0 h1:I/DsJXRlw/8l/0c24sM9yb0T4z9liZTduXvdAWYiysY=
|
golang.org/x/mod v0.13.0 h1:I/DsJXRlw/8l/0c24sM9yb0T4z9liZTduXvdAWYiysY=
|
||||||
golang.org/x/mod v0.13.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
golang.org/x/mod v0.13.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
||||||
golang.org/x/mod v0.14.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
golang.org/x/mod v0.14.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
||||||
|
golang.org/x/net v0.38.0/go.mod h1:ivrbrMbzFq5J41QOQh0siUuly180yBYtLp+CKbEaFx8=
|
||||||
|
golang.org/x/net v0.52.0/go.mod h1:R1MAz7uMZxVMualyPXb+VaqGSa3LIaUqk0eEt3w36Sw=
|
||||||
golang.org/x/sync v0.0.0-20220722155255-886fb9371eb4 h1:uVc8UZUe6tr40fFVnUP5Oj+veunVezqYl9z7DYw9xzw=
|
golang.org/x/sync v0.0.0-20220722155255-886fb9371eb4 h1:uVc8UZUe6tr40fFVnUP5Oj+veunVezqYl9z7DYw9xzw=
|
||||||
golang.org/x/text v0.13.0 h1:ablQoSUd0tRdKxZewP80B+BaqeKJuVhuRxj/dkrun3k=
|
golang.org/x/text v0.13.0 h1:ablQoSUd0tRdKxZewP80B+BaqeKJuVhuRxj/dkrun3k=
|
||||||
golang.org/x/text v0.13.0/go.mod h1:TvPlkZtksWOMsz7fbANvkp4WM8x/WCo/om8BMLbz+aE=
|
golang.org/x/text v0.13.0/go.mod h1:TvPlkZtksWOMsz7fbANvkp4WM8x/WCo/om8BMLbz+aE=
|
||||||
|
|||||||
+41
-14
@@ -7,6 +7,7 @@ INSTALL_DIR="/usr/local"
|
|||||||
OBITOOLS_PREFIX=""
|
OBITOOLS_PREFIX=""
|
||||||
VERSION=""
|
VERSION=""
|
||||||
LIST_VERSIONS=false
|
LIST_VERSIONS=false
|
||||||
|
JOBS=1
|
||||||
|
|
||||||
# Help message
|
# Help message
|
||||||
function display_help {
|
function display_help {
|
||||||
@@ -21,6 +22,7 @@ function display_help {
|
|||||||
echo " gobigrep command instead of obigrep)."
|
echo " gobigrep command instead of obigrep)."
|
||||||
echo " -v, --version Install a specific version (e.g., 4.4.8)."
|
echo " -v, --version Install a specific version (e.g., 4.4.8)."
|
||||||
echo " If not specified, installs the latest version."
|
echo " If not specified, installs the latest version."
|
||||||
|
echo " -j, --jobs Number of parallel jobs for compilation (default: 1)."
|
||||||
echo " -l, --list List all available versions and exit."
|
echo " -l, --list List all available versions and exit."
|
||||||
echo " -h, --help Display this help message."
|
echo " -h, --help Display this help message."
|
||||||
echo ""
|
echo ""
|
||||||
@@ -65,6 +67,10 @@ while [ "$#" -gt 0 ]; do
|
|||||||
VERSION="$2"
|
VERSION="$2"
|
||||||
shift 2
|
shift 2
|
||||||
;;
|
;;
|
||||||
|
-j|--jobs)
|
||||||
|
JOBS="$2"
|
||||||
|
shift 2
|
||||||
|
;;
|
||||||
-l|--list)
|
-l|--list)
|
||||||
LIST_VERSIONS=true
|
LIST_VERSIONS=true
|
||||||
shift
|
shift
|
||||||
@@ -122,9 +128,15 @@ mkdir -p "${WORK_DIR}/cache" \
|
|||||||
exit 1)
|
exit 1)
|
||||||
|
|
||||||
# Create installation directory
|
# Create installation directory
|
||||||
mkdir -p "${INSTALL_DIR}/bin" 2> /dev/null \
|
if ! mkdir -p "${INSTALL_DIR}/bin" 2>/dev/null; then
|
||||||
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
if [ ! -w "$(dirname "${INSTALL_DIR}")" ] && [ ! -w "${INSTALL_DIR}" ]; then
|
||||||
sudo mkdir -p "${INSTALL_DIR}/bin")
|
echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
||||||
|
sudo mkdir -p "${INSTALL_DIR}/bin"
|
||||||
|
else
|
||||||
|
echo "Error: Could not create ${INSTALL_DIR}/bin (check path or disk space)" 1>&2
|
||||||
|
exit 1
|
||||||
|
fi
|
||||||
|
fi
|
||||||
|
|
||||||
if [[ ! -d "${INSTALL_DIR}/bin" ]]; then
|
if [[ ! -d "${INSTALL_DIR}/bin" ]]; then
|
||||||
echo "Could not create ${INSTALL_DIR}/bin directory for installing obitools" 1>&2
|
echo "Could not create ${INSTALL_DIR}/bin directory for installing obitools" 1>&2
|
||||||
@@ -171,22 +183,24 @@ GOURL=$(curl -s "${URL}${GOFILE}" \
|
|||||||
|
|
||||||
echo "Installing Go from: $GOURL" 1>&2
|
echo "Installing Go from: $GOURL" 1>&2
|
||||||
|
|
||||||
curl -s "$GOURL" | tar zxf -
|
curl --progress-bar "$GOURL" | tar zxf -
|
||||||
|
|
||||||
PATH="$(pwd)/go/bin:$PATH"
|
export GOROOT="$(pwd)/go"
|
||||||
|
PATH="${GOROOT}/bin:$PATH"
|
||||||
export PATH
|
export PATH
|
||||||
GOPATH="$(pwd)/go"
|
export GOPATH="$(pwd)/gopath"
|
||||||
export GOPATH
|
|
||||||
export GOCACHE="$(pwd)/cache"
|
export GOCACHE="$(pwd)/cache"
|
||||||
|
export GOTOOLCHAIN=local
|
||||||
|
|
||||||
|
echo "GOROOT=$GOROOT" 1>&2
|
||||||
echo "GOCACHE=$GOCACHE" 1>&2
|
echo "GOCACHE=$GOCACHE" 1>&2
|
||||||
mkdir -p "$GOCACHE"
|
mkdir -p "$GOPATH" "$GOCACHE"
|
||||||
|
|
||||||
# Download OBITools4 source
|
# Download OBITools4 source
|
||||||
echo "Downloading OBITools4 v${VERSION}..." 1>&2
|
echo "Downloading OBITools4 v${VERSION}..." 1>&2
|
||||||
echo "Source URL: $OBIURL4" 1>&2
|
echo "Source URL: $OBIURL4" 1>&2
|
||||||
|
|
||||||
if ! curl -sL "$OBIURL4" > obitools4.zip; then
|
if ! curl --progress-bar -L "$OBIURL4" > obitools4.zip; then
|
||||||
echo "Error: Could not download OBITools4 version ${VERSION}" 1>&2
|
echo "Error: Could not download OBITools4 version ${VERSION}" 1>&2
|
||||||
echo "Please check that this version exists with: $0 --list" 1>&2
|
echo "Please check that this version exists with: $0 --list" 1>&2
|
||||||
exit 1
|
exit 1
|
||||||
@@ -208,16 +222,29 @@ mkdir -p vendor
|
|||||||
|
|
||||||
# Build with or without prefix
|
# Build with or without prefix
|
||||||
if [[ -z "$OBITOOLS_PREFIX" ]] ; then
|
if [[ -z "$OBITOOLS_PREFIX" ]] ; then
|
||||||
make GOFLAGS="-buildvcs=false"
|
make -j"${JOBS}" obitools GOFLAGS="-buildvcs=false"
|
||||||
else
|
else
|
||||||
make GOFLAGS="-buildvcs=false" OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
|
make -j"${JOBS}" obitools GOFLAGS="-buildvcs=false" OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
|
||||||
fi
|
fi
|
||||||
|
|
||||||
# Install binaries
|
# Install binaries
|
||||||
echo "Installing binaries to ${INSTALL_DIR}/bin..." 1>&2
|
echo "Installing binaries to ${INSTALL_DIR}/bin..." 1>&2
|
||||||
(cp build/* "${INSTALL_DIR}/bin" 2> /dev/null) \
|
if ! cp build/* "${INSTALL_DIR}/bin" 2>/dev/null; then
|
||||||
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
if [ ! -w "${INSTALL_DIR}/bin" ]; then
|
||||||
sudo cp build/* "${INSTALL_DIR}/bin")
|
echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
||||||
|
sudo cp build/* "${INSTALL_DIR}/bin"
|
||||||
|
else
|
||||||
|
echo "Error: Could not copy binaries to ${INSTALL_DIR}/bin" 1>&2
|
||||||
|
echo " Source files: $(ls build/ 2>/dev/null || echo 'none found')" 1>&2
|
||||||
|
echo "" 1>&2
|
||||||
|
echo "The build directory has been preserved for manual recovery:" 1>&2
|
||||||
|
echo " $(pwd)/build/" 1>&2
|
||||||
|
echo "You can install manually with:" 1>&2
|
||||||
|
echo " cp $(pwd)/build/* ${INSTALL_DIR}/bin/" 1>&2
|
||||||
|
popd > /dev/null || true
|
||||||
|
exit 1
|
||||||
|
fi
|
||||||
|
fi
|
||||||
|
|
||||||
popd > /dev/null || exit
|
popd > /dev/null || exit
|
||||||
|
|
||||||
|
|||||||
Binary file not shown.
Vendored
BIN
Binary file not shown.
Vendored
BIN
Binary file not shown.
@@ -0,0 +1,24 @@
|
|||||||
|
>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
|
||||||
|
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
|
||||||
|
gcctgaaactcaaaggacttggcggtgctttacatccct
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
|
||||||
|
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
|
||||||
|
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
|
||||||
|
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
|
||||||
|
gcttaaaactcaaaggacttggcggtgctttatatccct
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
|
||||||
|
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
|
||||||
|
gattaaacctcaaaggacttggcagtgctttatacccct
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
|
||||||
|
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
|
||||||
|
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
|
||||||
|
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
|
||||||
|
gcttaaaactcaaaggacttggcggtgctttatatccct
|
||||||
@@ -0,0 +1,48 @@
|
|||||||
|
taxid,parent,taxonomic_rank,scientific_name
|
||||||
|
taxon:1 [root]@no rank,taxon:1 [root]@no rank,no rank,root
|
||||||
|
taxon:131567 [cellular organisms]@cellular root,taxon:1 [root]@no rank,cellular root,cellular organisms
|
||||||
|
taxon:2759 [Eukaryota]@domain,taxon:131567 [cellular organisms]@cellular root,domain,Eukaryota
|
||||||
|
taxon:33154 [Opisthokonta]@clade,taxon:2759 [Eukaryota]@domain,clade,Opisthokonta
|
||||||
|
taxon:33208 [Metazoa]@kingdom,taxon:33154 [Opisthokonta]@clade,kingdom,Metazoa
|
||||||
|
taxon:6072 [Eumetazoa]@clade,taxon:33208 [Metazoa]@kingdom,clade,Eumetazoa
|
||||||
|
taxon:33213 [Bilateria]@clade,taxon:6072 [Eumetazoa]@clade,clade,Bilateria
|
||||||
|
taxon:33511 [Deuterostomia]@clade,taxon:33213 [Bilateria]@clade,clade,Deuterostomia
|
||||||
|
taxon:7711 [Chordata]@phylum,taxon:33511 [Deuterostomia]@clade,phylum,Chordata
|
||||||
|
taxon:89593 [Craniata]@subphylum,taxon:7711 [Chordata]@phylum,subphylum,Craniata
|
||||||
|
taxon:7742 [Vertebrata]@clade,taxon:89593 [Craniata]@subphylum,clade,Vertebrata
|
||||||
|
taxon:7776 [Gnathostomata]@clade,taxon:7742 [Vertebrata]@clade,clade,Gnathostomata
|
||||||
|
taxon:117570 [Teleostomi]@clade,taxon:7776 [Gnathostomata]@clade,clade,Teleostomi
|
||||||
|
taxon:117571 [Euteleostomi]@clade,taxon:117570 [Teleostomi]@clade,clade,Euteleostomi
|
||||||
|
taxon:8287 [Sarcopterygii]@superclass,taxon:117571 [Euteleostomi]@clade,superclass,Sarcopterygii
|
||||||
|
taxon:1338369 [Dipnotetrapodomorpha]@clade,taxon:8287 [Sarcopterygii]@superclass,clade,Dipnotetrapodomorpha
|
||||||
|
taxon:32523 [Tetrapoda]@clade,taxon:1338369 [Dipnotetrapodomorpha]@clade,clade,Tetrapoda
|
||||||
|
taxon:32524 [Amniota]@clade,taxon:32523 [Tetrapoda]@clade,clade,Amniota
|
||||||
|
taxon:40674 [Mammalia]@class,taxon:32524 [Amniota]@clade,class,Mammalia
|
||||||
|
taxon:32525 [Theria]@clade,taxon:40674 [Mammalia]@class,clade,Theria
|
||||||
|
taxon:9347 [Eutheria]@clade,taxon:32525 [Theria]@clade,clade,Eutheria
|
||||||
|
taxon:1437010 [Boreoeutheria]@clade,taxon:9347 [Eutheria]@clade,clade,Boreoeutheria
|
||||||
|
taxon:314146 [Euarchontoglires]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Euarchontoglires
|
||||||
|
taxon:314145 [Laurasiatheria]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Laurasiatheria
|
||||||
|
taxon:33554 [Carnivora]@order,taxon:314145 [Laurasiatheria]@superorder,order,Carnivora
|
||||||
|
taxon:91561 [Artiodactyla]@order,taxon:314145 [Laurasiatheria]@superorder,order,Artiodactyla
|
||||||
|
taxon:314147 [Glires]@clade,taxon:314146 [Euarchontoglires]@superorder,clade,Glires
|
||||||
|
taxon:9845 [Ruminantia]@suborder,taxon:91561 [Artiodactyla]@order,suborder,Ruminantia
|
||||||
|
taxon:35500 [Pecora]@infraorder,taxon:9845 [Ruminantia]@suborder,infraorder,Pecora
|
||||||
|
taxon:9989 [Rodentia]@order,taxon:314147 [Glires]@clade,order,Rodentia
|
||||||
|
taxon:379584 [Caniformia]@suborder,taxon:33554 [Carnivora]@order,suborder,Caniformia
|
||||||
|
taxon:9608 [Canidae]@family,taxon:379584 [Caniformia]@suborder,family,Canidae
|
||||||
|
taxon:9850 [Cervidae]@family,taxon:35500 [Pecora]@infraorder,family,Cervidae
|
||||||
|
taxon:9881 [Odocoileinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Odocoileinae
|
||||||
|
taxon:33553 [Sciuromorpha]@suborder,taxon:9989 [Rodentia]@order,suborder,Sciuromorpha
|
||||||
|
taxon:55153 [Sciuridae]@family,taxon:33553 [Sciuromorpha]@suborder,family,Sciuridae
|
||||||
|
taxon:34878 [Cervinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Cervinae
|
||||||
|
taxon:9611 [Canis]@genus,taxon:9608 [Canidae]@family,genus,Canis
|
||||||
|
taxon:9857 [Capreolus]@genus,taxon:9881 [Odocoileinae]@subfamily,genus,Capreolus
|
||||||
|
taxon:9612 [Canis lupus]@species,taxon:9611 [Canis]@genus,species,Canis lupus
|
||||||
|
taxon:337726 [Xerinae]@subfamily,taxon:55153 [Sciuridae]@family,subfamily,Xerinae
|
||||||
|
taxon:9859 [Cervus]@genus,taxon:34878 [Cervinae]@subfamily,genus,Cervus
|
||||||
|
taxon:337730 [Marmotini]@tribe,taxon:337726 [Xerinae]@subfamily,tribe,Marmotini
|
||||||
|
taxon:9992 [Marmota]@genus,taxon:337730 [Marmotini]@tribe,genus,Marmota
|
||||||
|
taxon:9860 [Cervus elaphus]@species,taxon:9859 [Cervus]@genus,species,Cervus elaphus
|
||||||
|
taxon:9615 [Canis lupus familiaris]@subspecies,taxon:9612 [Canis lupus]@species,subspecies,Canis lupus familiaris
|
||||||
|
taxon:9858 [Capreolus capreolus]@species,taxon:9857 [Capreolus]@genus,species,Capreolus capreolus
|
||||||
|
@@ -134,6 +134,130 @@ else
|
|||||||
((failed++))
|
((failed++))
|
||||||
fi
|
fi
|
||||||
|
|
||||||
|
|
||||||
|
# ------------------------------------------------------------------
|
||||||
|
# --raw-taxid tests (no taxonomy loaded)
|
||||||
|
# ------------------------------------------------------------------
|
||||||
|
|
||||||
|
# Running test
|
||||||
|
((ntest++))
|
||||||
|
if obiconvert --raw-taxid "${TEST_DIR}/out_ecotag.fasta" \
|
||||||
|
> "${TMPDIR}/raw_taxid.fasta" 2>/dev/null
|
||||||
|
then
|
||||||
|
log "$MCMD --raw-taxid: running OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD --raw-taxid: running failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Taxids must be bare numbers — no full-format "taxon:ID [Name]@rank" strings
|
||||||
|
((ntest++))
|
||||||
|
if grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
|
||||||
|
then
|
||||||
|
log "$MCMD --raw-taxid: taxid format check failed (full-format taxid found)"
|
||||||
|
((failed++))
|
||||||
|
else
|
||||||
|
log "$MCMD --raw-taxid: taxid format OK (all taxids are bare numbers)"
|
||||||
|
((success++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# --raw-taxid is idempotent: piping through a second obiconvert --raw-taxid must
|
||||||
|
# produce bit-for-bit identical output.
|
||||||
|
((ntest++))
|
||||||
|
if obiconvert --raw-taxid "${TMPDIR}/raw_taxid.fasta" \
|
||||||
|
> "${TMPDIR}/raw_taxid2.fasta" 2>/dev/null
|
||||||
|
then
|
||||||
|
log "$MCMD --raw-taxid piped: running OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD --raw-taxid piped: running failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
((ntest++))
|
||||||
|
if diff "${TMPDIR}/raw_taxid.fasta" \
|
||||||
|
"${TMPDIR}/raw_taxid2.fasta" > /dev/null
|
||||||
|
then
|
||||||
|
log "$MCMD --raw-taxid piped: idempotency OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD --raw-taxid piped: idempotency failed (outputs differ)"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
|
||||||
|
# ------------------------------------------------------------------
|
||||||
|
# --taxonomy tests (full-format taxid, no --raw-taxid)
|
||||||
|
# ------------------------------------------------------------------
|
||||||
|
|
||||||
|
# Running test
|
||||||
|
((ntest++))
|
||||||
|
if obiconvert --taxonomy "${TEST_DIR}/taxonomy.csv" \
|
||||||
|
"${TEST_DIR}/out_ecotag.fasta" \
|
||||||
|
> "${TMPDIR}/taxo.fasta" 2>/dev/null
|
||||||
|
then
|
||||||
|
log "$MCMD --taxonomy: running OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD --taxonomy: running failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Taxids must be in full "taxon:ID [Name]@rank" format
|
||||||
|
((ntest++))
|
||||||
|
if grep '"taxid"' "${TMPDIR}/taxo.fasta" | grep -q '"taxid":"taxon:[0-9]'
|
||||||
|
then
|
||||||
|
log "$MCMD --taxonomy: taxid format OK (full-format taxids present)"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD --taxonomy: taxid format check failed (no full-format taxid found)"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
|
||||||
|
# ------------------------------------------------------------------
|
||||||
|
# --raw-taxid --taxonomy tests
|
||||||
|
# ------------------------------------------------------------------
|
||||||
|
|
||||||
|
# Running test
|
||||||
|
((ntest++))
|
||||||
|
if obiconvert --raw-taxid --taxonomy "${TEST_DIR}/taxonomy.csv" \
|
||||||
|
"${TEST_DIR}/out_ecotag.fasta" \
|
||||||
|
> "${TMPDIR}/raw_taxid_taxo.fasta" 2>/dev/null
|
||||||
|
then
|
||||||
|
log "$MCMD --raw-taxid --taxonomy: running OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD --raw-taxid --taxonomy: running failed"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Taxids must be bare numbers even when taxonomy is loaded
|
||||||
|
((ntest++))
|
||||||
|
if grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
|
||||||
|
then
|
||||||
|
log "$MCMD --raw-taxid --taxonomy: taxid format check failed (full-format taxid found)"
|
||||||
|
((failed++))
|
||||||
|
else
|
||||||
|
log "$MCMD --raw-taxid --taxonomy: taxid format OK (all taxids are bare numbers)"
|
||||||
|
((success++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
# --raw-taxid with or without taxonomy must yield identical taxid values
|
||||||
|
((ntest++))
|
||||||
|
if diff <(grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
|
||||||
|
<(grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
|
||||||
|
> /dev/null
|
||||||
|
then
|
||||||
|
log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values match OK"
|
||||||
|
((success++))
|
||||||
|
else
|
||||||
|
log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values differ (unexpected)"
|
||||||
|
((failed++))
|
||||||
|
fi
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
#########################################
|
||||||
#
|
#
|
||||||
# At the end of the tests
|
# At the end of the tests
|
||||||
|
|||||||
@@ -0,0 +1,24 @@
|
|||||||
|
>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
|
||||||
|
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
|
||||||
|
gcctgaaactcaaaggacttggcggtgctttacatccct
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
|
||||||
|
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
|
||||||
|
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
|
||||||
|
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
|
||||||
|
gcttaaaactcaaaggacttggcggtgctttatatccct
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
|
||||||
|
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
|
||||||
|
gattaaacctcaaaggacttggcagtgctttatacccct
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
|
||||||
|
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
|
||||||
|
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
|
||||||
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||||
|
>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
|
||||||
|
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
|
||||||
|
gcttaaaactcaaaggacttggcggtgctttatatccct
|
||||||
+46
-1
@@ -1,6 +1,12 @@
|
|||||||
package obidefault
|
package obidefault
|
||||||
|
|
||||||
var _BatchSize = 2000
|
// _BatchSize is the minimum number of sequences per batch (floor).
|
||||||
|
// Used as the minSeqs argument to RebatchBySize.
|
||||||
|
var _BatchSize = 1
|
||||||
|
|
||||||
|
// _BatchSizeMax is the maximum number of sequences per batch (ceiling).
|
||||||
|
// A batch is flushed when this count is reached regardless of memory usage.
|
||||||
|
var _BatchSizeMax = 2000
|
||||||
|
|
||||||
// SetBatchSize sets the size of the sequence batches.
|
// SetBatchSize sets the size of the sequence batches.
|
||||||
//
|
//
|
||||||
@@ -24,3 +30,42 @@ func BatchSize() int {
|
|||||||
func BatchSizePtr() *int {
|
func BatchSizePtr() *int {
|
||||||
return &_BatchSize
|
return &_BatchSize
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// BatchSizeMax returns the maximum number of sequences per batch.
|
||||||
|
func BatchSizeMax() int {
|
||||||
|
return _BatchSizeMax
|
||||||
|
}
|
||||||
|
|
||||||
|
func BatchSizeMaxPtr() *int {
|
||||||
|
return &_BatchSizeMax
|
||||||
|
}
|
||||||
|
|
||||||
|
// _BatchMem holds the maximum cumulative memory (in bytes) per batch when
|
||||||
|
// memory-based batching is requested. A value of 0 disables memory-based
|
||||||
|
// batching and falls back to count-based batching.
|
||||||
|
var _BatchMem = 128 * 1024 * 1024 // 128 MB default; set to 0 to disable
|
||||||
|
var _BatchMemStr = ""
|
||||||
|
|
||||||
|
// SetBatchMem sets the memory budget per batch in bytes.
|
||||||
|
func SetBatchMem(n int) {
|
||||||
|
_BatchMem = n
|
||||||
|
}
|
||||||
|
|
||||||
|
// BatchMem returns the current memory budget per batch in bytes.
|
||||||
|
// A value of 0 means memory-based batching is disabled.
|
||||||
|
func BatchMem() int {
|
||||||
|
return _BatchMem
|
||||||
|
}
|
||||||
|
|
||||||
|
func BatchMemPtr() *int {
|
||||||
|
return &_BatchMem
|
||||||
|
}
|
||||||
|
|
||||||
|
// BatchMemStr returns the raw --batch-mem string value as provided on the CLI.
|
||||||
|
func BatchMemStr() string {
|
||||||
|
return _BatchMemStr
|
||||||
|
}
|
||||||
|
|
||||||
|
func BatchMemStrPtr() *string {
|
||||||
|
return &_BatchMemStr
|
||||||
|
}
|
||||||
|
|||||||
+152
-1
@@ -161,6 +161,149 @@ func EmblChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (obise
|
|||||||
return parser
|
return parser
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// extractEmblSeq scans the sequence section of an EMBL record directly on the
|
||||||
|
// rope. EMBL sequence lines start with 5 spaces followed by bases in groups of
|
||||||
|
// 10, separated by spaces, with a position number at the end. The section ends
|
||||||
|
// with "//".
|
||||||
|
func (s *ropeScanner) extractEmblSeq(dest []byte, UtoT bool) []byte {
|
||||||
|
// We use ReadLine and scan each line for bases (skip digits, spaces, newlines).
|
||||||
|
for {
|
||||||
|
line := s.ReadLine()
|
||||||
|
if line == nil {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
if len(line) >= 2 && line[0] == '/' && line[1] == '/' {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
// Lines start with 5 spaces; bases follow separated by single spaces.
|
||||||
|
// Digits at the end are the position counter — skip them.
|
||||||
|
// Simplest: take every byte that is a letter.
|
||||||
|
for _, b := range line {
|
||||||
|
if b >= 'A' && b <= 'Z' {
|
||||||
|
b += 'a' - 'A'
|
||||||
|
}
|
||||||
|
if UtoT && b == 'u' {
|
||||||
|
b = 't'
|
||||||
|
}
|
||||||
|
if b >= 'a' && b <= 'z' {
|
||||||
|
dest = append(dest, b)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return dest
|
||||||
|
}
|
||||||
|
|
||||||
|
// EmblChunkParserRope parses an EMBL chunk directly from a rope without Pack().
|
||||||
|
func EmblChunkParserRope(source string, rope *PieceOfChunk, withFeatureTable, UtoT bool) (obiseq.BioSequenceSlice, error) {
|
||||||
|
scanner := newRopeScanner(rope)
|
||||||
|
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
|
||||||
|
|
||||||
|
var id string
|
||||||
|
var scientificName string
|
||||||
|
defBytes := make([]byte, 0, 256)
|
||||||
|
featBytes := make([]byte, 0, 1024)
|
||||||
|
var taxid int
|
||||||
|
inSeq := false
|
||||||
|
|
||||||
|
for {
|
||||||
|
line := scanner.ReadLine()
|
||||||
|
if line == nil {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
|
||||||
|
if inSeq {
|
||||||
|
// Should not happen — extractEmblSeq consumed up to "//"
|
||||||
|
inSeq = false
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
switch {
|
||||||
|
case bytes.HasPrefix(line, []byte("ID ")):
|
||||||
|
id = string(bytes.SplitN(line[5:], []byte(";"), 2)[0])
|
||||||
|
case bytes.HasPrefix(line, []byte("OS ")):
|
||||||
|
scientificName = string(bytes.TrimSpace(line[5:]))
|
||||||
|
case bytes.HasPrefix(line, []byte("DE ")):
|
||||||
|
if len(defBytes) > 0 {
|
||||||
|
defBytes = append(defBytes, ' ')
|
||||||
|
}
|
||||||
|
defBytes = append(defBytes, bytes.TrimSpace(line[5:])...)
|
||||||
|
case withFeatureTable && bytes.HasPrefix(line, []byte("FH ")):
|
||||||
|
featBytes = append(featBytes, line...)
|
||||||
|
case withFeatureTable && bytes.Equal(line, []byte("FH")):
|
||||||
|
featBytes = append(featBytes, '\n')
|
||||||
|
featBytes = append(featBytes, line...)
|
||||||
|
case bytes.HasPrefix(line, []byte("FT ")):
|
||||||
|
if withFeatureTable {
|
||||||
|
featBytes = append(featBytes, '\n')
|
||||||
|
featBytes = append(featBytes, line...)
|
||||||
|
}
|
||||||
|
if bytes.HasPrefix(line, []byte(`FT /db_xref="taxon:`)) {
|
||||||
|
rest := line[37:]
|
||||||
|
end := bytes.IndexByte(rest, '"')
|
||||||
|
if end > 0 {
|
||||||
|
taxid, _ = strconv.Atoi(string(rest[:end]))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
case bytes.HasPrefix(line, []byte(" ")):
|
||||||
|
// First sequence line: extract all bases via extractEmblSeq,
|
||||||
|
// which also consumes this line's remaining content.
|
||||||
|
// But ReadLine already consumed this line — we need to process it
|
||||||
|
// plus subsequent lines. Process this line inline then call helper.
|
||||||
|
seqDest := make([]byte, 0, 4096)
|
||||||
|
for _, b := range line {
|
||||||
|
if b >= 'A' && b <= 'Z' {
|
||||||
|
b += 'a' - 'A'
|
||||||
|
}
|
||||||
|
if UtoT && b == 'u' {
|
||||||
|
b = 't'
|
||||||
|
}
|
||||||
|
if b >= 'a' && b <= 'z' {
|
||||||
|
seqDest = append(seqDest, b)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
seqDest = scanner.extractEmblSeq(seqDest, UtoT)
|
||||||
|
|
||||||
|
seq := obiseq.NewBioSequenceOwning(id, seqDest, string(defBytes))
|
||||||
|
seq.SetSource(source)
|
||||||
|
if withFeatureTable {
|
||||||
|
seq.SetFeatures(featBytes)
|
||||||
|
}
|
||||||
|
annot := seq.Annotations()
|
||||||
|
annot["scientific_name"] = scientificName
|
||||||
|
annot["taxid"] = taxid
|
||||||
|
sequences = append(sequences, seq)
|
||||||
|
|
||||||
|
// Reset state
|
||||||
|
id = ""
|
||||||
|
scientificName = ""
|
||||||
|
defBytes = defBytes[:0]
|
||||||
|
featBytes = featBytes[:0]
|
||||||
|
taxid = 1
|
||||||
|
|
||||||
|
case bytes.Equal(line, []byte("//")):
|
||||||
|
// record ended without SQ/sequence section (e.g. WGS entries)
|
||||||
|
if id != "" {
|
||||||
|
seq := obiseq.NewBioSequenceOwning(id, []byte{}, string(defBytes))
|
||||||
|
seq.SetSource(source)
|
||||||
|
if withFeatureTable {
|
||||||
|
seq.SetFeatures(featBytes)
|
||||||
|
}
|
||||||
|
annot := seq.Annotations()
|
||||||
|
annot["scientific_name"] = scientificName
|
||||||
|
annot["taxid"] = taxid
|
||||||
|
sequences = append(sequences, seq)
|
||||||
|
}
|
||||||
|
id = ""
|
||||||
|
scientificName = ""
|
||||||
|
defBytes = defBytes[:0]
|
||||||
|
featBytes = featBytes[:0]
|
||||||
|
taxid = 1
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return sequences, nil
|
||||||
|
}
|
||||||
|
|
||||||
func _ParseEmblFile(
|
func _ParseEmblFile(
|
||||||
input ChannelFileChunk,
|
input ChannelFileChunk,
|
||||||
out obiiter.IBioSequence,
|
out obiiter.IBioSequence,
|
||||||
@@ -171,7 +314,14 @@ func _ParseEmblFile(
|
|||||||
|
|
||||||
for chunks := range input {
|
for chunks := range input {
|
||||||
order := chunks.Order
|
order := chunks.Order
|
||||||
sequences, err := parser(chunks.Source, chunks.Raw)
|
var sequences obiseq.BioSequenceSlice
|
||||||
|
var err error
|
||||||
|
|
||||||
|
if chunks.Rope != nil {
|
||||||
|
sequences, err = EmblChunkParserRope(chunks.Source, chunks.Rope, withFeatureTable, UtoT)
|
||||||
|
} else {
|
||||||
|
sequences, err = parser(chunks.Source, chunks.Raw)
|
||||||
|
}
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("%s : Cannot parse the embl file : %v", chunks.Source, err)
|
log.Fatalf("%s : Cannot parse the embl file : %v", chunks.Source, err)
|
||||||
@@ -196,6 +346,7 @@ func ReadEMBL(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, er
|
|||||||
1024*1024*128,
|
1024*1024*128,
|
||||||
EndOfLastFlatFileEntry,
|
EndOfLastFlatFileEntry,
|
||||||
"\nID ",
|
"\nID ",
|
||||||
|
false,
|
||||||
)
|
)
|
||||||
|
|
||||||
newIter := obiiter.MakeIBioSequence()
|
newIter := obiiter.MakeIBioSequence()
|
||||||
|
|||||||
@@ -209,28 +209,121 @@ func FastaChunkParser(UtoT bool) func(string, io.Reader) (obiseq.BioSequenceSlic
|
|||||||
return parser
|
return parser
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// extractFastaSeq scans sequence bytes from the rope directly into dest,
|
||||||
|
// appending valid nucleotide characters and skipping whitespace.
|
||||||
|
// Stops when '>' is found at the start of a line (next record) or at EOF.
|
||||||
|
// Returns (dest with appended bases, hasMore).
|
||||||
|
// hasMore=true means scanner is now positioned at '>' of the next record.
|
||||||
|
func (s *ropeScanner) extractFastaSeq(dest []byte, UtoT bool) ([]byte, bool) {
|
||||||
|
lineStart := true
|
||||||
|
|
||||||
|
for s.current != nil {
|
||||||
|
data := s.current.data[s.pos:]
|
||||||
|
for i, b := range data {
|
||||||
|
if lineStart && b == '>' {
|
||||||
|
s.pos += i
|
||||||
|
if s.pos >= len(s.current.data) {
|
||||||
|
s.current = s.current.Next()
|
||||||
|
s.pos = 0
|
||||||
|
}
|
||||||
|
return dest, true
|
||||||
|
}
|
||||||
|
if b == '\n' || b == '\r' {
|
||||||
|
lineStart = true
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
lineStart = false
|
||||||
|
if b == ' ' || b == '\t' {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
if b >= 'A' && b <= 'Z' {
|
||||||
|
b += 'a' - 'A'
|
||||||
|
}
|
||||||
|
if UtoT && b == 'u' {
|
||||||
|
b = 't'
|
||||||
|
}
|
||||||
|
dest = append(dest, b)
|
||||||
|
}
|
||||||
|
s.current = s.current.Next()
|
||||||
|
s.pos = 0
|
||||||
|
}
|
||||||
|
return dest, false
|
||||||
|
}
|
||||||
|
|
||||||
|
// FastaChunkParserRope parses a FASTA chunk directly from the rope without Pack().
|
||||||
|
func FastaChunkParserRope(source string, rope *PieceOfChunk, UtoT bool) (obiseq.BioSequenceSlice, error) {
|
||||||
|
scanner := newRopeScanner(rope)
|
||||||
|
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
|
||||||
|
|
||||||
|
for {
|
||||||
|
bline := scanner.ReadLine()
|
||||||
|
if bline == nil {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
if len(bline) == 0 || bline[0] != '>' {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
// Parse header: ">id definition"
|
||||||
|
header := bline[1:]
|
||||||
|
var id string
|
||||||
|
var definition string
|
||||||
|
sp := bytes.IndexByte(header, ' ')
|
||||||
|
if sp < 0 {
|
||||||
|
sp = bytes.IndexByte(header, '\t')
|
||||||
|
}
|
||||||
|
if sp < 0 {
|
||||||
|
id = string(header)
|
||||||
|
} else {
|
||||||
|
id = string(header[:sp])
|
||||||
|
definition = string(bytes.TrimSpace(header[sp+1:]))
|
||||||
|
}
|
||||||
|
|
||||||
|
seqDest := make([]byte, 0, 4096)
|
||||||
|
var hasMore bool
|
||||||
|
seqDest, hasMore = scanner.extractFastaSeq(seqDest, UtoT)
|
||||||
|
|
||||||
|
if len(seqDest) == 0 {
|
||||||
|
log.Fatalf("%s [%s]: sequence is empty", source, id)
|
||||||
|
}
|
||||||
|
|
||||||
|
seq := obiseq.NewBioSequenceOwning(id, seqDest, definition)
|
||||||
|
seq.SetSource(source)
|
||||||
|
sequences = append(sequences, seq)
|
||||||
|
|
||||||
|
if !hasMore {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return sequences, nil
|
||||||
|
}
|
||||||
|
|
||||||
func _ParseFastaFile(
|
func _ParseFastaFile(
|
||||||
input ChannelFileChunk,
|
input ChannelFileChunk,
|
||||||
out obiiter.IBioSequence,
|
out obiiter.IBioSequence,
|
||||||
UtoT bool,
|
UtoT bool,
|
||||||
) {
|
) {
|
||||||
|
|
||||||
parser := FastaChunkParser(UtoT)
|
parser := FastaChunkParser(UtoT)
|
||||||
|
|
||||||
for chunks := range input {
|
for chunks := range input {
|
||||||
sequences, err := parser(chunks.Source, chunks.Raw)
|
var sequences obiseq.BioSequenceSlice
|
||||||
// obilog.Warnf("Chunck(%d:%d) -%d- ", chunks.Order, l, sequences.Len())
|
var err error
|
||||||
|
|
||||||
|
if chunks.Rope != nil {
|
||||||
|
sequences, err = FastaChunkParserRope(chunks.Source, chunks.Rope, UtoT)
|
||||||
|
} else {
|
||||||
|
sequences, err = parser(chunks.Source, chunks.Raw)
|
||||||
|
}
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("File %s : Cannot parse the fasta file : %v", chunks.Source, err)
|
log.Fatalf("File %s : Cannot parse the fasta file : %v", chunks.Source, err)
|
||||||
}
|
}
|
||||||
|
|
||||||
out.Push(obiiter.MakeBioSequenceBatch(chunks.Source, chunks.Order, sequences))
|
out.Push(obiiter.MakeBioSequenceBatch(chunks.Source, chunks.Order, sequences))
|
||||||
|
|
||||||
}
|
}
|
||||||
|
|
||||||
out.Done()
|
out.Done()
|
||||||
|
|
||||||
}
|
}
|
||||||
|
|
||||||
func ReadFasta(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
|
func ReadFasta(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
|
||||||
@@ -245,6 +338,7 @@ func ReadFasta(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
|
|||||||
1024*1024,
|
1024*1024,
|
||||||
EndOfLastFastaEntry,
|
EndOfLastFastaEntry,
|
||||||
"\n>",
|
"\n>",
|
||||||
|
false,
|
||||||
)
|
)
|
||||||
|
|
||||||
for i := 0; i < nworker; i++ {
|
for i := 0; i < nworker; i++ {
|
||||||
|
|||||||
@@ -303,6 +303,80 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
|
|||||||
return parser
|
return parser
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// FastqChunkParserRope parses a FASTQ chunk directly from a rope without Pack().
|
||||||
|
func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte, with_quality, UtoT bool) (obiseq.BioSequenceSlice, error) {
|
||||||
|
scanner := newRopeScanner(rope)
|
||||||
|
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
|
||||||
|
|
||||||
|
for {
|
||||||
|
// Line 1: @id [definition]
|
||||||
|
hline := scanner.ReadLine()
|
||||||
|
if hline == nil {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
if len(hline) == 0 || hline[0] != '@' {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
header := hline[1:]
|
||||||
|
var id string
|
||||||
|
var definition string
|
||||||
|
sp := bytes.IndexByte(header, ' ')
|
||||||
|
if sp < 0 {
|
||||||
|
sp = bytes.IndexByte(header, '\t')
|
||||||
|
}
|
||||||
|
if sp < 0 {
|
||||||
|
id = string(header)
|
||||||
|
} else {
|
||||||
|
id = string(header[:sp])
|
||||||
|
definition = string(bytes.TrimSpace(header[sp+1:]))
|
||||||
|
}
|
||||||
|
|
||||||
|
// Line 2: sequence
|
||||||
|
sline := scanner.ReadLine()
|
||||||
|
if sline == nil {
|
||||||
|
log.Fatalf("@%s[%s]: unexpected EOF after header", id, source)
|
||||||
|
}
|
||||||
|
seqDest := make([]byte, len(sline))
|
||||||
|
w := 0
|
||||||
|
for _, b := range sline {
|
||||||
|
if b >= 'A' && b <= 'Z' {
|
||||||
|
b += 'a' - 'A'
|
||||||
|
}
|
||||||
|
if UtoT && b == 'u' {
|
||||||
|
b = 't'
|
||||||
|
}
|
||||||
|
seqDest[w] = b
|
||||||
|
w++
|
||||||
|
}
|
||||||
|
seqDest = seqDest[:w]
|
||||||
|
if len(seqDest) == 0 {
|
||||||
|
log.Fatalf("@%s[%s]: sequence is empty", id, source)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Line 3: + (skip)
|
||||||
|
scanner.ReadLine()
|
||||||
|
|
||||||
|
// Line 4: quality
|
||||||
|
qline := scanner.ReadLine()
|
||||||
|
|
||||||
|
seq := obiseq.NewBioSequenceOwning(id, seqDest, definition)
|
||||||
|
seq.SetSource(source)
|
||||||
|
|
||||||
|
if with_quality && qline != nil {
|
||||||
|
qDest := make([]byte, len(qline))
|
||||||
|
copy(qDest, qline)
|
||||||
|
for i := range qDest {
|
||||||
|
qDest[i] -= quality_shift
|
||||||
|
}
|
||||||
|
seq.TakeQualities(qDest)
|
||||||
|
}
|
||||||
|
|
||||||
|
sequences = append(sequences, seq)
|
||||||
|
}
|
||||||
|
|
||||||
|
return sequences, nil
|
||||||
|
}
|
||||||
|
|
||||||
func _ParseFastqFile(
|
func _ParseFastqFile(
|
||||||
input ChannelFileChunk,
|
input ChannelFileChunk,
|
||||||
out obiiter.IBioSequence,
|
out obiiter.IBioSequence,
|
||||||
@@ -313,7 +387,14 @@ func _ParseFastqFile(
|
|||||||
parser := FastqChunkParser(quality_shift, with_quality, UtoT)
|
parser := FastqChunkParser(quality_shift, with_quality, UtoT)
|
||||||
|
|
||||||
for chunks := range input {
|
for chunks := range input {
|
||||||
sequences, err := parser(chunks.Source, chunks.Raw)
|
var sequences obiseq.BioSequenceSlice
|
||||||
|
var err error
|
||||||
|
|
||||||
|
if chunks.Rope != nil {
|
||||||
|
sequences, err = FastqChunkParserRope(chunks.Source, chunks.Rope, quality_shift, with_quality, UtoT)
|
||||||
|
} else {
|
||||||
|
sequences, err = parser(chunks.Source, chunks.Raw)
|
||||||
|
}
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("File %s : Cannot parse the fastq file : %v", chunks.Source, err)
|
log.Fatalf("File %s : Cannot parse the fastq file : %v", chunks.Source, err)
|
||||||
@@ -339,6 +420,7 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
|
|||||||
1024*1024,
|
1024*1024,
|
||||||
EndOfLastFastqEntry,
|
EndOfLastFastqEntry,
|
||||||
"\n@",
|
"\n@",
|
||||||
|
false,
|
||||||
)
|
)
|
||||||
|
|
||||||
for i := 0; i < nworker; i++ {
|
for i := 0; i < nworker; i++ {
|
||||||
|
|||||||
@@ -296,7 +296,7 @@ func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
|
|||||||
|
|
||||||
case strings.HasSuffix(skey, "_taxid"):
|
case strings.HasSuffix(skey, "_taxid"):
|
||||||
if dataType == jsonparser.Number || dataType == jsonparser.String {
|
if dataType == jsonparser.Number || dataType == jsonparser.String {
|
||||||
rank, _ := obiutils.SplitInTwo(skey, '_')
|
rank := skey[:len(skey)-len("_taxid")]
|
||||||
|
|
||||||
taxid := string(value)
|
taxid := string(value)
|
||||||
sequence.SetTaxid(taxid, rank)
|
sequence.SetTaxid(taxid, rank)
|
||||||
|
|||||||
@@ -146,6 +146,65 @@ func __match__key__(text []byte) []int {
|
|||||||
return []int{} // Not a key
|
return []int{} // Not a key
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func __match__array__(text []byte) []int {
|
||||||
|
|
||||||
|
state := 0
|
||||||
|
level := 0
|
||||||
|
start := 0
|
||||||
|
instring := byte(0)
|
||||||
|
|
||||||
|
for i, r := range text {
|
||||||
|
if state == 2 {
|
||||||
|
if r == ';' {
|
||||||
|
return []int{start, i + 1}
|
||||||
|
}
|
||||||
|
if r != ' ' && r != '\t' {
|
||||||
|
return []int{}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if state == 0 {
|
||||||
|
if r == '[' {
|
||||||
|
level++
|
||||||
|
state++
|
||||||
|
start = i
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
if r != ' ' && r != '\t' {
|
||||||
|
return []int{}
|
||||||
|
}
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
// state == 1: inside the array
|
||||||
|
if instring != 0 {
|
||||||
|
if r == instring {
|
||||||
|
instring = 0
|
||||||
|
}
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
if r == '"' || r == '\'' {
|
||||||
|
instring = r
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
if r == '[' || r == '{' {
|
||||||
|
level++
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
if r == ']' || r == '}' {
|
||||||
|
level--
|
||||||
|
if level == 0 {
|
||||||
|
state++
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return []int{}
|
||||||
|
}
|
||||||
|
|
||||||
func __match__general__(text []byte) []int {
|
func __match__general__(text []byte) []int {
|
||||||
|
|
||||||
for i, r := range text {
|
for i, r := range text {
|
||||||
@@ -242,6 +301,21 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
|
|||||||
stop = m[1] + 1
|
stop = m[1] + 1
|
||||||
} else {
|
} else {
|
||||||
|
|
||||||
|
// array value
|
||||||
|
m = __match__array__(part)
|
||||||
|
if len(m) > 0 {
|
||||||
|
bvalue = bytes.TrimSpace(part[m[0]:(m[1] - 1)])
|
||||||
|
j := bytes.ReplaceAll(bvalue, []byte("'"), []byte(`"`))
|
||||||
|
j = __obi_header_map_int_key__.ReplaceAll(j, []byte(`$1"$2":`))
|
||||||
|
arr, err := _parse_json_array_interface(j)
|
||||||
|
if err != nil {
|
||||||
|
value = string(bvalue)
|
||||||
|
} else {
|
||||||
|
value = arr
|
||||||
|
}
|
||||||
|
stop = m[1] + 1
|
||||||
|
} else {
|
||||||
|
|
||||||
// Generic value
|
// Generic value
|
||||||
|
|
||||||
// m = __obi_header_value_general_pattern__.FindIndex(part)
|
// m = __obi_header_value_general_pattern__.FindIndex(part)
|
||||||
@@ -264,6 +338,7 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
|
|||||||
// no value
|
// no value
|
||||||
break
|
break
|
||||||
} // End of No value
|
} // End of No value
|
||||||
|
} // End of not array
|
||||||
} // End of not dict
|
} // End of not dict
|
||||||
} // End of not string
|
} // End of not string
|
||||||
} // End of not numeric
|
} // End of not numeric
|
||||||
@@ -327,9 +402,8 @@ func WriteFastSeqOBIHeade(buffer *bytes.Buffer, sequence *obiseq.BioSequence) {
|
|||||||
buffer.WriteString(fmt.Sprintf("%s=", key))
|
buffer.WriteString(fmt.Sprintf("%s=", key))
|
||||||
buffer.Write(tv)
|
buffer.Write(tv)
|
||||||
buffer.WriteString("; ")
|
buffer.WriteString("; ")
|
||||||
case map[string]int,
|
default:
|
||||||
map[string]string,
|
if obiutils.IsAMap(value) || obiutils.IsASlice(value) || obiutils.IsAnArray(value) {
|
||||||
map[string]interface{}:
|
|
||||||
tv, err := obiutils.JsonMarshal(t)
|
tv, err := obiutils.JsonMarshal(t)
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("Cannot convert %v value", value)
|
log.Fatalf("Cannot convert %v value", value)
|
||||||
@@ -338,11 +412,12 @@ func WriteFastSeqOBIHeade(buffer *bytes.Buffer, sequence *obiseq.BioSequence) {
|
|||||||
buffer.WriteString(fmt.Sprintf("%s=", key))
|
buffer.WriteString(fmt.Sprintf("%s=", key))
|
||||||
buffer.Write(tv)
|
buffer.Write(tv)
|
||||||
buffer.WriteString("; ")
|
buffer.WriteString("; ")
|
||||||
default:
|
} else {
|
||||||
buffer.WriteString(fmt.Sprintf("%s=%v; ", key, value))
|
buffer.WriteString(fmt.Sprintf("%s=%v; ", key, value))
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
}
|
||||||
|
|
||||||
if sequence.HasDefinition() {
|
if sequence.HasDefinition() {
|
||||||
buffer.WriteByte(' ')
|
buffer.WriteByte(' ')
|
||||||
|
|||||||
@@ -77,45 +77,50 @@ func FormatFasta(seq *obiseq.BioSequence, formater FormatHeader) string {
|
|||||||
//
|
//
|
||||||
// It returns a byte array containing the formatted sequences.
|
// It returns a byte array containing the formatted sequences.
|
||||||
func FormatFastaBatch(batch obiiter.BioSequenceBatch, formater FormatHeader, skipEmpty bool) *bytes.Buffer {
|
func FormatFastaBatch(batch obiiter.BioSequenceBatch, formater FormatHeader, skipEmpty bool) *bytes.Buffer {
|
||||||
// Create a buffer to store the formatted sequences
|
|
||||||
var bs bytes.Buffer
|
var bs bytes.Buffer
|
||||||
|
|
||||||
lt := 0
|
lt := 0
|
||||||
|
|
||||||
for _, seq := range batch.Slice() {
|
for _, seq := range batch.Slice() {
|
||||||
lt += seq.Len()
|
lt += seq.Len()
|
||||||
}
|
}
|
||||||
|
|
||||||
// Iterate over each sequence in the batch
|
// Pre-allocate: sequence data + newlines every 60 chars + ~100 bytes header per sequence
|
||||||
|
bs.Grow(lt + lt/60 + 100*batch.Len() + 1)
|
||||||
|
|
||||||
log.Debugf("FormatFastaBatch: #%d : %d seqs", batch.Order(), batch.Len())
|
log.Debugf("FormatFastaBatch: #%d : %d seqs", batch.Order(), batch.Len())
|
||||||
first := true
|
|
||||||
for _, seq := range batch.Slice() {
|
for _, seq := range batch.Slice() {
|
||||||
// Check if the sequence is empty
|
if len(seq.Id()) == 0 {
|
||||||
if seq.Len() > 0 {
|
log.Fatalf("Sequence identifier is empty")
|
||||||
// Format the sequence using the provided formater function
|
|
||||||
formattedSeq := FormatFasta(seq, formater)
|
|
||||||
|
|
||||||
if first {
|
|
||||||
bs.Grow(lt + (len(formattedSeq)-seq.Len())*batch.Len()*5/4)
|
|
||||||
first = false
|
|
||||||
}
|
}
|
||||||
|
if seq.Len() > 0 {
|
||||||
// Append the formatted sequence to the buffer
|
// Write header directly into bs — no intermediate string
|
||||||
bs.WriteString(formattedSeq)
|
bs.WriteByte('>')
|
||||||
|
bs.WriteString(seq.Id())
|
||||||
|
bs.WriteByte(' ')
|
||||||
|
bs.WriteString(formater(seq))
|
||||||
bs.WriteByte('\n')
|
bs.WriteByte('\n')
|
||||||
|
|
||||||
|
// Write folded sequence directly into bs — no copies
|
||||||
|
s := seq.Sequence()
|
||||||
|
l := len(s)
|
||||||
|
for i := 0; i < l; i += 60 {
|
||||||
|
to := i + 60
|
||||||
|
if to > l {
|
||||||
|
to = l
|
||||||
|
}
|
||||||
|
bs.Write(s[i:to])
|
||||||
|
bs.WriteByte('\n')
|
||||||
|
}
|
||||||
} else {
|
} else {
|
||||||
// Handle empty sequences
|
|
||||||
if skipEmpty {
|
if skipEmpty {
|
||||||
// Skip empty sequences if skipEmpty is true
|
|
||||||
obilog.Warnf("Sequence %s is empty and skipped in output", seq.Id())
|
obilog.Warnf("Sequence %s is empty and skipped in output", seq.Id())
|
||||||
} else {
|
} else {
|
||||||
// Terminate the program if skipEmpty is false
|
|
||||||
log.Fatalf("Sequence %s is empty", seq.Id())
|
log.Fatalf("Sequence %s is empty", seq.Id())
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// Return the byte array representation of the buffer
|
|
||||||
return &bs
|
return &bs
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -64,6 +64,9 @@ func FormatFastqBatch(batch obiiter.BioSequenceBatch,
|
|||||||
first := true
|
first := true
|
||||||
|
|
||||||
for _, seq := range batch.Slice() {
|
for _, seq := range batch.Slice() {
|
||||||
|
if len(seq.Id()) == 0 {
|
||||||
|
log.Fatalf("Sequence identifier is empty")
|
||||||
|
}
|
||||||
if seq.Len() > 0 {
|
if seq.Len() > 0 {
|
||||||
_formatFastq(&bs, seq, formater)
|
_formatFastq(&bs, seq, formater)
|
||||||
|
|
||||||
|
|||||||
@@ -16,6 +16,7 @@ type SeqFileChunkParser func(string, io.Reader) (obiseq.BioSequenceSlice, error)
|
|||||||
type FileChunk struct {
|
type FileChunk struct {
|
||||||
Source string
|
Source string
|
||||||
Raw *bytes.Buffer
|
Raw *bytes.Buffer
|
||||||
|
Rope *PieceOfChunk
|
||||||
Order int
|
Order int
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -97,11 +98,17 @@ func (piece *PieceOfChunk) IsLast() bool {
|
|||||||
return piece.next == nil
|
return piece.next == nil
|
||||||
}
|
}
|
||||||
|
|
||||||
func (piece *PieceOfChunk) FileChunk(source string, order int) FileChunk {
|
func (piece *PieceOfChunk) FileChunk(source string, order int, pack bool) FileChunk {
|
||||||
|
piece = piece.Head()
|
||||||
|
var raw *bytes.Buffer
|
||||||
|
if pack {
|
||||||
piece.Pack()
|
piece.Pack()
|
||||||
|
raw = bytes.NewBuffer(piece.data)
|
||||||
|
}
|
||||||
return FileChunk{
|
return FileChunk{
|
||||||
Source: source,
|
Source: source,
|
||||||
Raw: bytes.NewBuffer(piece.data),
|
Raw: raw,
|
||||||
|
Rope: piece,
|
||||||
Order: order,
|
Order: order,
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -133,7 +140,8 @@ func ReadFileChunk(
|
|||||||
reader io.Reader,
|
reader io.Reader,
|
||||||
fileChunkSize int,
|
fileChunkSize int,
|
||||||
splitter LastSeqRecord,
|
splitter LastSeqRecord,
|
||||||
probe string) ChannelFileChunk {
|
probe string,
|
||||||
|
pack bool) ChannelFileChunk {
|
||||||
|
|
||||||
chunk_channel := make(ChannelFileChunk)
|
chunk_channel := make(ChannelFileChunk)
|
||||||
|
|
||||||
@@ -205,7 +213,7 @@ func ReadFileChunk(
|
|||||||
|
|
||||||
if len(pieces.data) > 0 {
|
if len(pieces.data) > 0 {
|
||||||
// obilog.Warnf("chuck %d :Read %d bytes from file %s", i, io.Len(), source)
|
// obilog.Warnf("chuck %d :Read %d bytes from file %s", i, io.Len(), source)
|
||||||
chunk_channel <- pieces.FileChunk(source, i)
|
chunk_channel <- pieces.FileChunk(source, i, pack)
|
||||||
i++
|
i++
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -222,7 +230,7 @@ func ReadFileChunk(
|
|||||||
|
|
||||||
// Send the last chunk to the channel
|
// Send the last chunk to the channel
|
||||||
if pieces.Len() > 0 {
|
if pieces.Len() > 0 {
|
||||||
chunk_channel <- pieces.FileChunk(source, i)
|
chunk_channel <- pieces.FileChunk(source, i, pack)
|
||||||
}
|
}
|
||||||
|
|
||||||
// Close the readers channel when the end of the file is reached
|
// Close the readers channel when the end of the file is reached
|
||||||
|
|||||||
+270
-15
@@ -29,6 +29,265 @@ const (
|
|||||||
|
|
||||||
var _seqlenght_rx = regexp.MustCompile(" +([0-9]+) bp")
|
var _seqlenght_rx = regexp.MustCompile(" +([0-9]+) bp")
|
||||||
|
|
||||||
|
// extractSequence scans the ORIGIN section byte-by-byte directly on the rope,
|
||||||
|
// appending compacted bases to dest. Returns the extended slice.
|
||||||
|
// Stops and returns when "//" is found at the start of a line.
|
||||||
|
// The scanner is left positioned after the "//" line.
|
||||||
|
func (s *ropeScanner) extractSequence(dest []byte, UtoT bool) []byte {
|
||||||
|
lineStart := true
|
||||||
|
skipDigits := true
|
||||||
|
|
||||||
|
for s.current != nil {
|
||||||
|
data := s.current.data[s.pos:]
|
||||||
|
for i, b := range data {
|
||||||
|
if lineStart {
|
||||||
|
if b == '/' {
|
||||||
|
// End-of-record marker "//"
|
||||||
|
s.pos += i + 1
|
||||||
|
if s.pos >= len(s.current.data) {
|
||||||
|
s.current = s.current.Next()
|
||||||
|
s.pos = 0
|
||||||
|
}
|
||||||
|
s.skipToNewline()
|
||||||
|
return dest
|
||||||
|
}
|
||||||
|
lineStart = false
|
||||||
|
skipDigits = true
|
||||||
|
}
|
||||||
|
switch {
|
||||||
|
case b == '\n':
|
||||||
|
lineStart = true
|
||||||
|
case b == '\r':
|
||||||
|
// skip
|
||||||
|
case skipDigits:
|
||||||
|
if b != ' ' && (b < '0' || b > '9') {
|
||||||
|
skipDigits = false
|
||||||
|
if UtoT && b == 'u' {
|
||||||
|
b = 't'
|
||||||
|
}
|
||||||
|
dest = append(dest, b)
|
||||||
|
}
|
||||||
|
case b != ' ':
|
||||||
|
if UtoT && b == 'u' {
|
||||||
|
b = 't'
|
||||||
|
}
|
||||||
|
dest = append(dest, b)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
s.current = s.current.Next()
|
||||||
|
s.pos = 0
|
||||||
|
}
|
||||||
|
return dest
|
||||||
|
}
|
||||||
|
|
||||||
|
// parseLseqFromLocus extracts the declared sequence length from a LOCUS line.
|
||||||
|
// Format: "LOCUS <id> <length> bp ..."
|
||||||
|
// Returns -1 if not found or parse error.
|
||||||
|
func parseLseqFromLocus(line []byte) int {
|
||||||
|
if len(line) < 13 {
|
||||||
|
return -1
|
||||||
|
}
|
||||||
|
i := 12
|
||||||
|
for i < len(line) && line[i] != ' ' {
|
||||||
|
i++
|
||||||
|
}
|
||||||
|
for i < len(line) && line[i] == ' ' {
|
||||||
|
i++
|
||||||
|
}
|
||||||
|
start := i
|
||||||
|
for i < len(line) && line[i] >= '0' && line[i] <= '9' {
|
||||||
|
i++
|
||||||
|
}
|
||||||
|
if i == start {
|
||||||
|
return -1
|
||||||
|
}
|
||||||
|
n, err := strconv.Atoi(string(line[start:i]))
|
||||||
|
if err != nil {
|
||||||
|
return -1
|
||||||
|
}
|
||||||
|
return n
|
||||||
|
}
|
||||||
|
|
||||||
|
// Prefix constants for GenBank section headers (byte slices for zero-alloc comparison).
|
||||||
|
var (
|
||||||
|
gbPfxLocus = []byte("LOCUS ")
|
||||||
|
gbPfxDefinition = []byte("DEFINITION ")
|
||||||
|
gbPfxContinue = []byte(" ")
|
||||||
|
gbPfxSource = []byte("SOURCE ")
|
||||||
|
gbPfxFeatures = []byte("FEATURES ")
|
||||||
|
gbPfxOrigin = []byte("ORIGIN")
|
||||||
|
gbPfxContig = []byte("CONTIG")
|
||||||
|
gbPfxEnd = []byte("//")
|
||||||
|
gbPfxDbXref = []byte(` /db_xref="taxon:`)
|
||||||
|
)
|
||||||
|
|
||||||
|
// GenbankChunkParserRope parses a GenBank FileChunk directly from the rope
|
||||||
|
// (PieceOfChunk linked list) without calling Pack(). This eliminates the large
|
||||||
|
// contiguous allocation required for chromosomal-scale sequences.
|
||||||
|
func GenbankChunkParserRope(source string, rope *PieceOfChunk,
|
||||||
|
withFeatureTable, UtoT bool) (obiseq.BioSequenceSlice, error) {
|
||||||
|
|
||||||
|
state := inHeader
|
||||||
|
scanner := newRopeScanner(rope)
|
||||||
|
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
|
||||||
|
|
||||||
|
id := ""
|
||||||
|
lseq := -1
|
||||||
|
scientificName := ""
|
||||||
|
defBytes := new(bytes.Buffer)
|
||||||
|
featBytes := new(bytes.Buffer)
|
||||||
|
var seqDest []byte
|
||||||
|
taxid := 1
|
||||||
|
nl := 0
|
||||||
|
|
||||||
|
for bline := scanner.ReadLine(); bline != nil; bline = scanner.ReadLine() {
|
||||||
|
nl++
|
||||||
|
processed := false
|
||||||
|
for !processed {
|
||||||
|
switch {
|
||||||
|
|
||||||
|
case bytes.HasPrefix(bline, gbPfxLocus):
|
||||||
|
if state != inHeader {
|
||||||
|
log.Fatalf("Line %d - Unexpected state %d while reading LOCUS: %s", nl, state, bline)
|
||||||
|
}
|
||||||
|
rest := bline[12:]
|
||||||
|
sp := bytes.IndexByte(rest, ' ')
|
||||||
|
if sp < 0 {
|
||||||
|
id = string(rest)
|
||||||
|
} else {
|
||||||
|
id = string(rest[:sp])
|
||||||
|
}
|
||||||
|
lseq = parseLseqFromLocus(bline)
|
||||||
|
cap0 := lseq + 20
|
||||||
|
if cap0 < 1024 {
|
||||||
|
cap0 = 1024
|
||||||
|
}
|
||||||
|
seqDest = make([]byte, 0, cap0)
|
||||||
|
state = inEntry
|
||||||
|
processed = true
|
||||||
|
|
||||||
|
case bytes.HasPrefix(bline, gbPfxDefinition):
|
||||||
|
if state != inEntry {
|
||||||
|
log.Fatalf("Line %d - Unexpected state %d while reading DEFINITION: %s", nl, state, bline)
|
||||||
|
}
|
||||||
|
defBytes.Write(bytes.TrimSpace(bline[12:]))
|
||||||
|
state = inDefinition
|
||||||
|
processed = true
|
||||||
|
|
||||||
|
case state == inDefinition:
|
||||||
|
if bytes.HasPrefix(bline, gbPfxContinue) {
|
||||||
|
defBytes.WriteByte(' ')
|
||||||
|
defBytes.Write(bytes.TrimSpace(bline[12:]))
|
||||||
|
processed = true
|
||||||
|
} else {
|
||||||
|
state = inEntry
|
||||||
|
}
|
||||||
|
|
||||||
|
case bytes.HasPrefix(bline, gbPfxSource):
|
||||||
|
if state != inEntry {
|
||||||
|
log.Fatalf("Line %d - Unexpected state %d while reading SOURCE: %s", nl, state, bline)
|
||||||
|
}
|
||||||
|
scientificName = string(bytes.TrimSpace(bline[12:]))
|
||||||
|
processed = true
|
||||||
|
|
||||||
|
case bytes.HasPrefix(bline, gbPfxFeatures):
|
||||||
|
if state != inEntry {
|
||||||
|
log.Fatalf("Line %d - Unexpected state %d while reading FEATURES: %s", nl, state, bline)
|
||||||
|
}
|
||||||
|
if withFeatureTable {
|
||||||
|
featBytes.Write(bline)
|
||||||
|
}
|
||||||
|
state = inFeature
|
||||||
|
processed = true
|
||||||
|
|
||||||
|
case bytes.HasPrefix(bline, gbPfxOrigin):
|
||||||
|
if state != inFeature && state != inContig {
|
||||||
|
log.Fatalf("Line %d - Unexpected state %d while reading ORIGIN: %s", nl, state, bline)
|
||||||
|
}
|
||||||
|
// Use fast byte-scan to extract sequence and consume through "//"
|
||||||
|
seqDest = scanner.extractSequence(seqDest, UtoT)
|
||||||
|
// Emit record
|
||||||
|
if id == "" {
|
||||||
|
log.Warn("Empty id when parsing genbank file")
|
||||||
|
}
|
||||||
|
sequence := obiseq.NewBioSequenceOwning(id, seqDest, defBytes.String())
|
||||||
|
sequence.SetSource(source)
|
||||||
|
if withFeatureTable {
|
||||||
|
sequence.SetFeatures(featBytes.Bytes())
|
||||||
|
}
|
||||||
|
annot := sequence.Annotations()
|
||||||
|
annot["scientific_name"] = scientificName
|
||||||
|
annot["taxid"] = taxid
|
||||||
|
sequences = append(sequences, sequence)
|
||||||
|
|
||||||
|
defBytes = bytes.NewBuffer(obiseq.GetSlice(200))
|
||||||
|
featBytes = new(bytes.Buffer)
|
||||||
|
nl = 0
|
||||||
|
taxid = 1
|
||||||
|
seqDest = nil
|
||||||
|
state = inHeader
|
||||||
|
processed = true
|
||||||
|
|
||||||
|
case bytes.HasPrefix(bline, gbPfxContig):
|
||||||
|
if state != inFeature && state != inContig {
|
||||||
|
log.Fatalf("Line %d - Unexpected state %d while reading CONTIG: %s", nl, state, bline)
|
||||||
|
}
|
||||||
|
state = inContig
|
||||||
|
processed = true
|
||||||
|
|
||||||
|
case bytes.Equal(bline, gbPfxEnd):
|
||||||
|
// Reached for CONTIG records (no ORIGIN section)
|
||||||
|
if state != inContig {
|
||||||
|
log.Fatalf("Line %d - Unexpected state %d while reading end of record %s", nl, state, id)
|
||||||
|
}
|
||||||
|
if id == "" {
|
||||||
|
log.Warn("Empty id when parsing genbank file")
|
||||||
|
}
|
||||||
|
sequence := obiseq.NewBioSequenceOwning(id, seqDest, defBytes.String())
|
||||||
|
sequence.SetSource(source)
|
||||||
|
if withFeatureTable {
|
||||||
|
sequence.SetFeatures(featBytes.Bytes())
|
||||||
|
}
|
||||||
|
annot := sequence.Annotations()
|
||||||
|
annot["scientific_name"] = scientificName
|
||||||
|
annot["taxid"] = taxid
|
||||||
|
sequences = append(sequences, sequence)
|
||||||
|
|
||||||
|
defBytes = bytes.NewBuffer(obiseq.GetSlice(200))
|
||||||
|
featBytes = new(bytes.Buffer)
|
||||||
|
nl = 0
|
||||||
|
taxid = 1
|
||||||
|
seqDest = nil
|
||||||
|
state = inHeader
|
||||||
|
processed = true
|
||||||
|
|
||||||
|
default:
|
||||||
|
switch state {
|
||||||
|
case inFeature:
|
||||||
|
if withFeatureTable {
|
||||||
|
featBytes.WriteByte('\n')
|
||||||
|
featBytes.Write(bline)
|
||||||
|
}
|
||||||
|
if bytes.HasPrefix(bline, gbPfxDbXref) {
|
||||||
|
rest := bline[len(gbPfxDbXref):]
|
||||||
|
q := bytes.IndexByte(rest, '"')
|
||||||
|
if q >= 0 {
|
||||||
|
taxid, _ = strconv.Atoi(string(rest[:q]))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
processed = true
|
||||||
|
case inHeader, inEntry, inContig:
|
||||||
|
processed = true
|
||||||
|
default:
|
||||||
|
log.Fatalf("Unexpected state %d while reading: %s", state, bline)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return sequences, nil
|
||||||
|
}
|
||||||
|
|
||||||
func GenbankChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (obiseq.BioSequenceSlice, error) {
|
func GenbankChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (obiseq.BioSequenceSlice, error) {
|
||||||
return func(source string, input io.Reader) (obiseq.BioSequenceSlice, error) {
|
return func(source string, input io.Reader) (obiseq.BioSequenceSlice, error) {
|
||||||
state := inHeader
|
state := inHeader
|
||||||
@@ -125,13 +384,10 @@ func GenbankChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (ob
|
|||||||
if state != inSequence && state != inContig {
|
if state != inSequence && state != inContig {
|
||||||
log.Fatalf("Line %d - Unexpected state %d while reading end of record %s", nl, state, id)
|
log.Fatalf("Line %d - Unexpected state %d while reading end of record %s", nl, state, id)
|
||||||
}
|
}
|
||||||
// log.Debugln("Total lines := ", nl)
|
|
||||||
if id == "" {
|
if id == "" {
|
||||||
log.Warn("Empty id when parsing genbank file")
|
log.Warn("Empty id when parsing genbank file")
|
||||||
}
|
}
|
||||||
|
|
||||||
// log.Debugf("End of sequence %s: %dbp ", id, seqBytes.Len())
|
|
||||||
|
|
||||||
sequence := obiseq.NewBioSequence(id,
|
sequence := obiseq.NewBioSequence(id,
|
||||||
seqBytes.Bytes(),
|
seqBytes.Bytes(),
|
||||||
defBytes.String())
|
defBytes.String())
|
||||||
@@ -144,9 +400,6 @@ func GenbankChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (ob
|
|||||||
annot := sequence.Annotations()
|
annot := sequence.Annotations()
|
||||||
annot["scientific_name"] = scientificName
|
annot["scientific_name"] = scientificName
|
||||||
annot["taxid"] = taxid
|
annot["taxid"] = taxid
|
||||||
// log.Println(FormatFasta(sequence, FormatFastSeqJsonHeader))
|
|
||||||
// log.Debugf("Read sequences %s: %dbp (%d)", sequence.Id(),
|
|
||||||
// sequence.Len(), seqBytes.Len())
|
|
||||||
|
|
||||||
sequences = append(sequences, sequence)
|
sequences = append(sequences, sequence)
|
||||||
|
|
||||||
@@ -159,8 +412,6 @@ func GenbankChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (ob
|
|||||||
processed = true
|
processed = true
|
||||||
|
|
||||||
case state == inSequence:
|
case state == inSequence:
|
||||||
// log.Debugf("Chunk %d : Genbank: line %d, state = %d : %s", chunks.order, nl, state, line)
|
|
||||||
|
|
||||||
sl++
|
sl++
|
||||||
cleanline := strings.TrimSpace(line)
|
cleanline := strings.TrimSpace(line)
|
||||||
parts := strings.SplitN(cleanline, " ", 7)
|
parts := strings.SplitN(cleanline, " ", 7)
|
||||||
@@ -198,6 +449,7 @@ func GenbankChunkParser(withFeatureTable, UtoT bool) func(string, io.Reader) (ob
|
|||||||
|
|
||||||
}
|
}
|
||||||
|
|
||||||
|
_ = sl
|
||||||
return sequences, nil
|
return sequences, nil
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -206,10 +458,16 @@ func _ParseGenbankFile(input ChannelFileChunk,
|
|||||||
out obiiter.IBioSequence,
|
out obiiter.IBioSequence,
|
||||||
withFeatureTable, UtoT bool) {
|
withFeatureTable, UtoT bool) {
|
||||||
|
|
||||||
parser := GenbankChunkParser(withFeatureTable, UtoT)
|
|
||||||
|
|
||||||
for chunks := range input {
|
for chunks := range input {
|
||||||
sequences, err := parser(chunks.Source, chunks.Raw)
|
var sequences obiseq.BioSequenceSlice
|
||||||
|
var err error
|
||||||
|
|
||||||
|
if chunks.Rope != nil {
|
||||||
|
sequences, err = GenbankChunkParserRope(chunks.Source, chunks.Rope, withFeatureTable, UtoT)
|
||||||
|
} else {
|
||||||
|
parser := GenbankChunkParser(withFeatureTable, UtoT)
|
||||||
|
sequences, err = parser(chunks.Source, chunks.Raw)
|
||||||
|
}
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("File %s : Cannot parse the genbank file : %v", chunks.Source, err)
|
log.Fatalf("File %s : Cannot parse the genbank file : %v", chunks.Source, err)
|
||||||
@@ -225,7 +483,6 @@ func _ParseGenbankFile(input ChannelFileChunk,
|
|||||||
|
|
||||||
func ReadGenbank(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
|
func ReadGenbank(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
|
||||||
opt := MakeOptions(options)
|
opt := MakeOptions(options)
|
||||||
// entry_channel := make(chan _FileChunk)
|
|
||||||
|
|
||||||
entry_channel := ReadFileChunk(
|
entry_channel := ReadFileChunk(
|
||||||
opt.Source(),
|
opt.Source(),
|
||||||
@@ -233,13 +490,13 @@ func ReadGenbank(reader io.Reader, options ...WithOption) (obiiter.IBioSequence,
|
|||||||
1024*1024*128,
|
1024*1024*128,
|
||||||
EndOfLastFlatFileEntry,
|
EndOfLastFlatFileEntry,
|
||||||
"\nLOCUS ",
|
"\nLOCUS ",
|
||||||
|
false, // do not pack: rope-based parser avoids contiguous allocation
|
||||||
)
|
)
|
||||||
|
|
||||||
newIter := obiiter.MakeIBioSequence()
|
newIter := obiiter.MakeIBioSequence()
|
||||||
|
|
||||||
nworkers := opt.ParallelWorkers()
|
nworkers := opt.ParallelWorkers()
|
||||||
|
|
||||||
// for j := 0; j < opt.ParallelWorkers(); j++ {
|
|
||||||
for j := 0; j < nworkers; j++ {
|
for j := 0; j < nworkers; j++ {
|
||||||
newIter.Add(1)
|
newIter.Add(1)
|
||||||
go _ParseGenbankFile(
|
go _ParseGenbankFile(
|
||||||
@@ -250,8 +507,6 @@ func ReadGenbank(reader io.Reader, options ...WithOption) (obiiter.IBioSequence,
|
|||||||
)
|
)
|
||||||
}
|
}
|
||||||
|
|
||||||
// go _ReadFlatFileChunk(reader, entry_channel)
|
|
||||||
|
|
||||||
go func() {
|
go func() {
|
||||||
newIter.WaitAndClose()
|
newIter.WaitAndClose()
|
||||||
log.Debug("End of the genbank file ", opt.Source())
|
log.Debug("End of the genbank file ", opt.Source())
|
||||||
|
|||||||
@@ -631,9 +631,9 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
|
|||||||
return nil, fmt.Errorf("row %d has %d columns, expected %d", len(data), len(fields), len(header))
|
return nil, fmt.Errorf("row %d has %d columns, expected %d", len(data), len(fields), len(header))
|
||||||
}
|
}
|
||||||
|
|
||||||
forward_primer := fields[forward_primerColIndex]
|
forward_primer := strings.TrimSpace(fields[forward_primerColIndex])
|
||||||
reverse_primer := fields[reverse_primerColIndex]
|
reverse_primer := strings.TrimSpace(fields[reverse_primerColIndex])
|
||||||
tags := _parseMainNGSFilterTags(fields[sample_tagColIndex])
|
tags := _parseMainNGSFilterTags(strings.TrimSpace(fields[sample_tagColIndex]))
|
||||||
|
|
||||||
marker, _ := ngsfilter.GetMarker(forward_primer, reverse_primer)
|
marker, _ := ngsfilter.GetMarker(forward_primer, reverse_primer)
|
||||||
pcr, ok := marker.GetPCR(tags.Forward, tags.Reverse)
|
pcr, ok := marker.GetPCR(tags.Forward, tags.Reverse)
|
||||||
@@ -644,8 +644,8 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
|
|||||||
i, tags.Forward, tags.Reverse, forward_primer, reverse_primer)
|
i, tags.Forward, tags.Reverse, forward_primer, reverse_primer)
|
||||||
}
|
}
|
||||||
|
|
||||||
pcr.Experiment = fields[experimentColIndex]
|
pcr.Experiment = strings.TrimSpace(fields[experimentColIndex])
|
||||||
pcr.Sample = fields[sampleColIndex]
|
pcr.Sample = strings.TrimSpace(fields[sampleColIndex])
|
||||||
|
|
||||||
if extraColumns != nil {
|
if extraColumns != nil {
|
||||||
pcr.Annotations = make(obiseq.Annotation)
|
pcr.Annotations = make(obiseq.Annotation)
|
||||||
|
|||||||
@@ -0,0 +1,77 @@
|
|||||||
|
package obiformats
|
||||||
|
|
||||||
|
import "bytes"
|
||||||
|
|
||||||
|
// ropeScanner reads lines from a PieceOfChunk rope.
|
||||||
|
// The carry buffer handles lines that span two rope nodes; it grows as needed.
|
||||||
|
type ropeScanner struct {
|
||||||
|
current *PieceOfChunk
|
||||||
|
pos int
|
||||||
|
carry []byte
|
||||||
|
}
|
||||||
|
|
||||||
|
func newRopeScanner(rope *PieceOfChunk) *ropeScanner {
|
||||||
|
return &ropeScanner{current: rope}
|
||||||
|
}
|
||||||
|
|
||||||
|
// ReadLine returns the next line without the trailing \n (or \r\n).
|
||||||
|
// Returns nil at end of rope. The returned slice aliases carry[] or the node
|
||||||
|
// data and is valid only until the next ReadLine call.
|
||||||
|
func (s *ropeScanner) ReadLine() []byte {
|
||||||
|
for {
|
||||||
|
if s.current == nil {
|
||||||
|
if len(s.carry) > 0 {
|
||||||
|
line := s.carry
|
||||||
|
s.carry = s.carry[:0]
|
||||||
|
return line
|
||||||
|
}
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
|
data := s.current.data[s.pos:]
|
||||||
|
idx := bytes.IndexByte(data, '\n')
|
||||||
|
|
||||||
|
if idx >= 0 {
|
||||||
|
var line []byte
|
||||||
|
if len(s.carry) == 0 {
|
||||||
|
line = data[:idx]
|
||||||
|
} else {
|
||||||
|
s.carry = append(s.carry, data[:idx]...)
|
||||||
|
line = s.carry
|
||||||
|
s.carry = s.carry[:0]
|
||||||
|
}
|
||||||
|
s.pos += idx + 1
|
||||||
|
if s.pos >= len(s.current.data) {
|
||||||
|
s.current = s.current.Next()
|
||||||
|
s.pos = 0
|
||||||
|
}
|
||||||
|
if len(line) > 0 && line[len(line)-1] == '\r' {
|
||||||
|
line = line[:len(line)-1]
|
||||||
|
}
|
||||||
|
return line
|
||||||
|
}
|
||||||
|
|
||||||
|
// No \n in this node: accumulate into carry and advance
|
||||||
|
s.carry = append(s.carry, data...)
|
||||||
|
s.current = s.current.Next()
|
||||||
|
s.pos = 0
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// skipToNewline advances the scanner past the next '\n'.
|
||||||
|
func (s *ropeScanner) skipToNewline() {
|
||||||
|
for s.current != nil {
|
||||||
|
data := s.current.data[s.pos:]
|
||||||
|
idx := bytes.IndexByte(data, '\n')
|
||||||
|
if idx >= 0 {
|
||||||
|
s.pos += idx + 1
|
||||||
|
if s.pos >= len(s.current.data) {
|
||||||
|
s.current = s.current.Next()
|
||||||
|
s.pos = 0
|
||||||
|
}
|
||||||
|
return
|
||||||
|
}
|
||||||
|
s.current = s.current.Next()
|
||||||
|
s.pos = 0
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -444,6 +444,67 @@ func (iterator IBioSequence) Rebatch(size int) IBioSequence {
|
|||||||
return newIter
|
return newIter
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// RebatchBySize reorganises the stream into batches bounded by two independent
|
||||||
|
// upper limits: maxCount (max number of sequences) and maxBytes (max cumulative
|
||||||
|
// estimated memory). A batch is flushed as soon as either limit would be
|
||||||
|
// exceeded. A single sequence larger than maxBytes is always emitted alone.
|
||||||
|
// Passing 0 for a limit disables that constraint; if both are 0 it falls back
|
||||||
|
// to Rebatch(obidefault.BatchSizeMax()).
|
||||||
|
func (iterator IBioSequence) RebatchBySize(maxBytes int, maxCount int) IBioSequence {
|
||||||
|
if maxBytes <= 0 && maxCount <= 0 {
|
||||||
|
return iterator.Rebatch(obidefault.BatchSizeMax())
|
||||||
|
}
|
||||||
|
|
||||||
|
newIter := MakeIBioSequence()
|
||||||
|
|
||||||
|
newIter.Add(1)
|
||||||
|
|
||||||
|
go func() {
|
||||||
|
newIter.WaitAndClose()
|
||||||
|
}()
|
||||||
|
|
||||||
|
go func() {
|
||||||
|
order := 0
|
||||||
|
iterator = iterator.SortBatches()
|
||||||
|
buffer := obiseq.MakeBioSequenceSlice()
|
||||||
|
bufBytes := 0
|
||||||
|
source := ""
|
||||||
|
|
||||||
|
flush := func() {
|
||||||
|
if len(buffer) > 0 {
|
||||||
|
newIter.Push(MakeBioSequenceBatch(source, order, buffer))
|
||||||
|
order++
|
||||||
|
buffer = obiseq.MakeBioSequenceSlice()
|
||||||
|
bufBytes = 0
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
for iterator.Next() {
|
||||||
|
seqs := iterator.Get()
|
||||||
|
source = seqs.Source()
|
||||||
|
for _, s := range seqs.Slice() {
|
||||||
|
sz := s.MemorySize()
|
||||||
|
countFull := maxCount > 0 && len(buffer) >= maxCount
|
||||||
|
memFull := maxBytes > 0 && bufBytes+sz > maxBytes && len(buffer) > 0
|
||||||
|
if countFull || memFull {
|
||||||
|
flush()
|
||||||
|
}
|
||||||
|
buffer = append(buffer, s)
|
||||||
|
bufBytes += sz
|
||||||
|
}
|
||||||
|
}
|
||||||
|
flush()
|
||||||
|
|
||||||
|
newIter.Done()
|
||||||
|
}()
|
||||||
|
|
||||||
|
if iterator.IsPaired() {
|
||||||
|
newIter.MarkAsPaired()
|
||||||
|
}
|
||||||
|
|
||||||
|
return newIter
|
||||||
|
}
|
||||||
|
|
||||||
func (iterator IBioSequence) FilterEmpty() IBioSequence {
|
func (iterator IBioSequence) FilterEmpty() IBioSequence {
|
||||||
|
|
||||||
newIter := MakeIBioSequence()
|
newIter := MakeIBioSequence()
|
||||||
@@ -638,7 +699,7 @@ func (iterator IBioSequence) FilterOn(predicate obiseq.SequencePredicate,
|
|||||||
trueIter.MarkAsPaired()
|
trueIter.MarkAsPaired()
|
||||||
}
|
}
|
||||||
|
|
||||||
return trueIter.Rebatch(size)
|
return trueIter.RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||||
}
|
}
|
||||||
|
|
||||||
func (iterator IBioSequence) FilterAnd(predicate obiseq.SequencePredicate,
|
func (iterator IBioSequence) FilterAnd(predicate obiseq.SequencePredicate,
|
||||||
@@ -694,7 +755,7 @@ func (iterator IBioSequence) FilterAnd(predicate obiseq.SequencePredicate,
|
|||||||
trueIter.MarkAsPaired()
|
trueIter.MarkAsPaired()
|
||||||
}
|
}
|
||||||
|
|
||||||
return trueIter.Rebatch(size)
|
return trueIter.RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||||
}
|
}
|
||||||
|
|
||||||
// Load all sequences availables from an IBioSequenceBatch iterator into
|
// Load all sequences availables from an IBioSequenceBatch iterator into
|
||||||
|
|||||||
+18
-24
@@ -57,34 +57,21 @@ func (dist *IDistribute) Classifier() *obiseq.BioSequenceClassifier {
|
|||||||
}
|
}
|
||||||
|
|
||||||
// Distribute organizes the biosequences from the iterator into batches
|
// Distribute organizes the biosequences from the iterator into batches
|
||||||
// based on the provided classifier and batch sizes. It returns an
|
// based on the provided classifier. It returns an IDistribute instance
|
||||||
// IDistribute instance that manages the distribution of the sequences.
|
// that manages the distribution of the sequences.
|
||||||
//
|
//
|
||||||
// Parameters:
|
// Batches are flushed when either BatchSizeMax() sequences or BatchMem()
|
||||||
// - class: A pointer to a BioSequenceClassifier used to classify
|
// bytes are accumulated per key, mirroring the RebatchBySize strategy.
|
||||||
// the biosequences during distribution.
|
func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier) IDistribute {
|
||||||
// - sizes: Optional integer values specifying the batch size. If
|
maxCount := obidefault.BatchSizeMax()
|
||||||
// no sizes are provided, a default batch size of 5000 is used.
|
maxBytes := obidefault.BatchMem()
|
||||||
//
|
|
||||||
// Returns:
|
|
||||||
// An IDistribute instance that contains the outputs of the
|
|
||||||
// classified biosequences, a channel for new data notifications,
|
|
||||||
// and the classifier used for distribution. The method operates
|
|
||||||
// asynchronously, processing the sequences in separate goroutines.
|
|
||||||
// It ensures that the outputs are closed and cleaned up once
|
|
||||||
// processing is complete.
|
|
||||||
func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, sizes ...int) IDistribute {
|
|
||||||
batchsize := obidefault.BatchSize()
|
|
||||||
|
|
||||||
outputs := make(map[int]IBioSequence, 100)
|
outputs := make(map[int]IBioSequence, 100)
|
||||||
slices := make(map[int]*obiseq.BioSequenceSlice, 100)
|
slices := make(map[int]*obiseq.BioSequenceSlice, 100)
|
||||||
|
bufBytes := make(map[int]int, 100)
|
||||||
orders := make(map[int]int, 100)
|
orders := make(map[int]int, 100)
|
||||||
news := make(chan int)
|
news := make(chan int)
|
||||||
|
|
||||||
if len(sizes) > 0 {
|
|
||||||
batchsize = sizes[0]
|
|
||||||
}
|
|
||||||
|
|
||||||
jobDone := sync.WaitGroup{}
|
jobDone := sync.WaitGroup{}
|
||||||
lock := sync.Mutex{}
|
lock := sync.Mutex{}
|
||||||
|
|
||||||
@@ -115,6 +102,7 @@ func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, siz
|
|||||||
slice = &s
|
slice = &s
|
||||||
slices[key] = slice
|
slices[key] = slice
|
||||||
orders[key] = 0
|
orders[key] = 0
|
||||||
|
bufBytes[key] = 0
|
||||||
|
|
||||||
lock.Lock()
|
lock.Lock()
|
||||||
outputs[key] = MakeIBioSequence()
|
outputs[key] = MakeIBioSequence()
|
||||||
@@ -123,14 +111,20 @@ func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, siz
|
|||||||
news <- key
|
news <- key
|
||||||
}
|
}
|
||||||
|
|
||||||
*slice = append(*slice, s)
|
sz := s.MemorySize()
|
||||||
|
countFull := maxCount > 0 && len(*slice) >= maxCount
|
||||||
if len(*slice) == batchsize {
|
memFull := maxBytes > 0 && bufBytes[key]+sz > maxBytes && len(*slice) > 0
|
||||||
|
if countFull || memFull {
|
||||||
outputs[key].Push(MakeBioSequenceBatch(source, orders[key], *slice))
|
outputs[key].Push(MakeBioSequenceBatch(source, orders[key], *slice))
|
||||||
orders[key]++
|
orders[key]++
|
||||||
s := obiseq.MakeBioSequenceSlice()
|
s := obiseq.MakeBioSequenceSlice()
|
||||||
slices[key] = &s
|
slices[key] = &s
|
||||||
|
slice = &s
|
||||||
|
bufBytes[key] = 0
|
||||||
}
|
}
|
||||||
|
|
||||||
|
*slice = append(*slice, s)
|
||||||
|
bufBytes[key] += sz
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -3,6 +3,7 @@ package obiiter
|
|||||||
import (
|
import (
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
@@ -70,7 +71,7 @@ func IFragments(minsize, length, overlap, size, nworkers int) Pipeable {
|
|||||||
}
|
}
|
||||||
go f(iterator)
|
go f(iterator)
|
||||||
|
|
||||||
return newiter.SortBatches().Rebatch(size)
|
return newiter.SortBatches().RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||||
}
|
}
|
||||||
|
|
||||||
return ifrg
|
return ifrg
|
||||||
|
|||||||
@@ -47,7 +47,7 @@ func Encode4mer(seq *obiseq.BioSequence, buffer *[]byte) []byte {
|
|||||||
length := slength - 3
|
length := slength - 3
|
||||||
rawseq := seq.Sequence()
|
rawseq := seq.Sequence()
|
||||||
|
|
||||||
if length < 0 {
|
if length <= 0 {
|
||||||
return nil
|
return nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
+75
-40
@@ -4,22 +4,21 @@ import "math"
|
|||||||
|
|
||||||
// KmerEntropy computes the entropy of a single encoded k-mer.
|
// KmerEntropy computes the entropy of a single encoded k-mer.
|
||||||
//
|
//
|
||||||
// The algorithm mirrors the lowmask entropy calculation: it decodes the k-mer
|
// The algorithm mirrors the Rust obiskbuilder entropy: it decodes the k-mer
|
||||||
// to a DNA sequence, extracts all sub-words of each size from 1 to levelMax,
|
// to a DNA sequence, extracts all sub-words of each size from 1 to levelMax,
|
||||||
// normalizes them by circular canonical form, counts their frequencies, and
|
// normalizes them by circular canonical form, counts their frequencies, and
|
||||||
// computes Shannon entropy normalized by the maximum possible entropy.
|
// computes Shannon entropy corrected for class sizes, normalized by the
|
||||||
|
// maximum possible entropy over 4^ws raw bins.
|
||||||
// The returned value is the minimum entropy across all word sizes.
|
// The returned value is the minimum entropy across all word sizes.
|
||||||
//
|
//
|
||||||
|
// Correction for small sequences: the raw entropy H = log(N) - Σ f·log(f)/N
|
||||||
|
// under-estimates the true complexity when many raw words collapse to the same
|
||||||
|
// canonical form. Adding Σ f·log(class_size)/N recovers the entropy of the
|
||||||
|
// underlying uncollapsed distribution (assuming uniform mixing within each
|
||||||
|
// equivalence class).
|
||||||
|
//
|
||||||
// A value close to 0 indicates very low complexity (e.g. "AAAA..."),
|
// A value close to 0 indicates very low complexity (e.g. "AAAA..."),
|
||||||
// while a value close to 1 indicates high complexity.
|
// while a value close to 1 indicates high complexity.
|
||||||
//
|
|
||||||
// Parameters:
|
|
||||||
// - kmer: the encoded k-mer (2 bits per base)
|
|
||||||
// - k: the k-mer size
|
|
||||||
// - levelMax: maximum sub-word size for entropy (typically 6)
|
|
||||||
//
|
|
||||||
// Returns:
|
|
||||||
// - minimum normalized entropy across all word sizes 1..levelMax
|
|
||||||
func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
||||||
if k < 1 || levelMax < 1 {
|
if k < 1 || levelMax < 1 {
|
||||||
return 1.0
|
return 1.0
|
||||||
@@ -35,7 +34,7 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
|||||||
var seqBuf [32]byte
|
var seqBuf [32]byte
|
||||||
seq := DecodeKmer(kmer, k, seqBuf[:])
|
seq := DecodeKmer(kmer, k, seqBuf[:])
|
||||||
|
|
||||||
// Pre-compute nLogN lookup (same as lowmask)
|
// Pre-compute nLogN lookup
|
||||||
nLogN := make([]float64, k+1)
|
nLogN := make([]float64, k+1)
|
||||||
for i := 1; i <= k; i++ {
|
for i := 1; i <= k; i++ {
|
||||||
nLogN[i] = float64(i) * math.Log(float64(i))
|
nLogN[i] = float64(i) * math.Log(float64(i))
|
||||||
@@ -51,6 +50,23 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// Build ln(class_size) tables: for each canonical form, how many raw
|
||||||
|
// words map to it under circular normalization.
|
||||||
|
classLogSizeTables := make([][]float64, levelMax+1)
|
||||||
|
for ws := 1; ws <= levelMax; ws++ {
|
||||||
|
tableSize := 1 << (ws * 2)
|
||||||
|
classSize := make([]int, tableSize)
|
||||||
|
for code := 0; code < tableSize; code++ {
|
||||||
|
classSize[normTables[ws][code]]++
|
||||||
|
}
|
||||||
|
classLogSizeTables[ws] = make([]float64, tableSize)
|
||||||
|
for j := 0; j < tableSize; j++ {
|
||||||
|
if classSize[j] > 0 {
|
||||||
|
classLogSizeTables[ws][j] = math.Log(float64(classSize[j]))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
minEntropy := math.MaxFloat64
|
minEntropy := math.MaxFloat64
|
||||||
|
|
||||||
for ws := 1; ws <= levelMax; ws++ {
|
for ws := 1; ws <= levelMax; ws++ {
|
||||||
@@ -75,23 +91,13 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
|||||||
table[normWord]++
|
table[normWord]++
|
||||||
}
|
}
|
||||||
|
|
||||||
// Compute Shannon entropy
|
// Compute emax over 4^ws raw bins (uncollapsed distribution).
|
||||||
floatNwords := float64(nwords)
|
floatNwords := float64(nwords)
|
||||||
logNwords := math.Log(floatNwords)
|
logNwords := math.Log(floatNwords)
|
||||||
|
na := tableSize // 4^ws
|
||||||
var sumNLogN float64
|
|
||||||
for j := 0; j < tableSize; j++ {
|
|
||||||
n := table[j]
|
|
||||||
if n > 0 {
|
|
||||||
sumNLogN += nLogN[n]
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// Compute emax (maximum possible entropy for this word size)
|
|
||||||
na := CanonicalCircularKmerCount(ws)
|
|
||||||
var emax float64
|
var emax float64
|
||||||
if nwords < na {
|
if nwords < na {
|
||||||
emax = math.Log(float64(nwords))
|
emax = logNwords
|
||||||
} else {
|
} else {
|
||||||
cov := nwords / na
|
cov := nwords / na
|
||||||
remains := nwords - (na * cov)
|
remains := nwords - (na * cov)
|
||||||
@@ -105,7 +111,19 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
|||||||
continue
|
continue
|
||||||
}
|
}
|
||||||
|
|
||||||
entropy := (logNwords - sumNLogN/floatNwords) / emax
|
// Accumulate Σ f·log(f) and Σ f·log(class_size) over canonical forms.
|
||||||
|
classLogSize := classLogSizeTables[ws]
|
||||||
|
var sumNLogN, sumClassLogN float64
|
||||||
|
for j := 0; j < tableSize; j++ {
|
||||||
|
n := table[j]
|
||||||
|
if n > 0 {
|
||||||
|
sumNLogN += nLogN[n]
|
||||||
|
sumClassLogN += float64(n) * classLogSize[j]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Corrected entropy: H_raw ≈ log(N) + (Σf·log(s) - Σf·log(f)) / N
|
||||||
|
entropy := (logNwords + sumClassLogN/floatNwords - sumNLogN/floatNwords) / emax
|
||||||
if entropy < 0 {
|
if entropy < 0 {
|
||||||
entropy = 0
|
entropy = 0
|
||||||
}
|
}
|
||||||
@@ -134,6 +152,7 @@ type KmerEntropyFilter struct {
|
|||||||
threshold float64
|
threshold float64
|
||||||
nLogN []float64
|
nLogN []float64
|
||||||
normTables [][]int
|
normTables [][]int
|
||||||
|
classLogSizeTables [][]float64
|
||||||
emaxValues []float64
|
emaxValues []float64
|
||||||
logNwords []float64
|
logNwords []float64
|
||||||
// Pre-allocated frequency tables reused across Entropy() calls.
|
// Pre-allocated frequency tables reused across Entropy() calls.
|
||||||
@@ -142,11 +161,6 @@ type KmerEntropyFilter struct {
|
|||||||
}
|
}
|
||||||
|
|
||||||
// NewKmerEntropyFilter creates an entropy filter with pre-computed tables.
|
// NewKmerEntropyFilter creates an entropy filter with pre-computed tables.
|
||||||
//
|
|
||||||
// Parameters:
|
|
||||||
// - k: the k-mer size
|
|
||||||
// - levelMax: maximum sub-word size for entropy (typically 6)
|
|
||||||
// - threshold: entropy threshold (k-mers with entropy <= threshold are rejected)
|
|
||||||
func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter {
|
func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter {
|
||||||
if levelMax >= k {
|
if levelMax >= k {
|
||||||
levelMax = k - 1
|
levelMax = k - 1
|
||||||
@@ -169,20 +183,38 @@ func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ln(class_size) for each canonical form under circular normalization.
|
||||||
|
classLogSizeTables := make([][]float64, levelMax+1)
|
||||||
|
for ws := 1; ws <= levelMax; ws++ {
|
||||||
|
tableSize := 1 << (ws * 2)
|
||||||
|
classSize := make([]int, tableSize)
|
||||||
|
for code := 0; code < tableSize; code++ {
|
||||||
|
classSize[normTables[ws][code]]++
|
||||||
|
}
|
||||||
|
classLogSizeTables[ws] = make([]float64, tableSize)
|
||||||
|
for j := 0; j < tableSize; j++ {
|
||||||
|
if classSize[j] > 0 {
|
||||||
|
classLogSizeTables[ws][j] = math.Log(float64(classSize[j]))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// Pre-compute emax and logNwords per word size.
|
||||||
|
// emax uses 4^ws raw bins to match the corrected entropy.
|
||||||
emaxValues := make([]float64, levelMax+1)
|
emaxValues := make([]float64, levelMax+1)
|
||||||
logNwords := make([]float64, levelMax+1)
|
logNwords := make([]float64, levelMax+1)
|
||||||
for ws := 1; ws <= levelMax; ws++ {
|
for ws := 1; ws <= levelMax; ws++ {
|
||||||
nw := k - ws + 1
|
nw := k - ws + 1
|
||||||
na := CanonicalCircularKmerCount(ws)
|
na := 1 << (ws * 2) // 4^ws raw bins
|
||||||
|
floatNw := float64(nw)
|
||||||
|
logNwords[ws] = math.Log(floatNw)
|
||||||
if nw < na {
|
if nw < na {
|
||||||
logNwords[ws] = math.Log(float64(nw))
|
emaxValues[ws] = logNwords[ws]
|
||||||
emaxValues[ws] = math.Log(float64(nw))
|
|
||||||
} else {
|
} else {
|
||||||
cov := nw / na
|
cov := nw / na
|
||||||
remains := nw - (na * cov)
|
remains := nw - (na * cov)
|
||||||
f1 := float64(cov) / float64(nw)
|
f1 := float64(cov) / floatNw
|
||||||
f2 := float64(cov+1) / float64(nw)
|
f2 := float64(cov+1) / floatNw
|
||||||
logNwords[ws] = math.Log(float64(nw))
|
|
||||||
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
|
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
|
||||||
float64(remains)*f2*math.Log(f2))
|
float64(remains)*f2*math.Log(f2))
|
||||||
}
|
}
|
||||||
@@ -200,6 +232,7 @@ func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter
|
|||||||
threshold: threshold,
|
threshold: threshold,
|
||||||
nLogN: nLogN,
|
nLogN: nLogN,
|
||||||
normTables: normTables,
|
normTables: normTables,
|
||||||
|
classLogSizeTables: classLogSizeTables,
|
||||||
emaxValues: emaxValues,
|
emaxValues: emaxValues,
|
||||||
logNwords: logNwords,
|
logNwords: logNwords,
|
||||||
freqTables: freqTables,
|
freqTables: freqTables,
|
||||||
@@ -236,7 +269,7 @@ func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
|
|||||||
// Count circular-canonical sub-word frequencies
|
// Count circular-canonical sub-word frequencies
|
||||||
tableSize := 1 << (ws * 2)
|
tableSize := 1 << (ws * 2)
|
||||||
table := ef.freqTables[ws]
|
table := ef.freqTables[ws]
|
||||||
clear(table) // reset to zero
|
clear(table)
|
||||||
mask := (1 << (ws * 2)) - 1
|
mask := (1 << (ws * 2)) - 1
|
||||||
normTable := ef.normTables[ws]
|
normTable := ef.normTables[ws]
|
||||||
|
|
||||||
@@ -251,19 +284,21 @@ func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
|
|||||||
table[normWord]++
|
table[normWord]++
|
||||||
}
|
}
|
||||||
|
|
||||||
// Compute Shannon entropy
|
|
||||||
floatNwords := float64(nwords)
|
floatNwords := float64(nwords)
|
||||||
logNwords := ef.logNwords[ws]
|
logNwords := ef.logNwords[ws]
|
||||||
|
classLogSize := ef.classLogSizeTables[ws]
|
||||||
|
|
||||||
var sumNLogN float64
|
var sumNLogN, sumClassLogN float64
|
||||||
for j := 0; j < tableSize; j++ {
|
for j := 0; j < tableSize; j++ {
|
||||||
n := table[j]
|
n := table[j]
|
||||||
if n > 0 {
|
if n > 0 {
|
||||||
sumNLogN += ef.nLogN[n]
|
sumNLogN += ef.nLogN[n]
|
||||||
|
sumClassLogN += float64(n) * classLogSize[j]
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
entropy := (logNwords - sumNLogN/floatNwords) / emax
|
// Corrected entropy: H_raw ≈ log(N) + (Σf·log(s) - Σf·log(f)) / N
|
||||||
|
entropy := (logNwords + sumClassLogN/floatNwords - sumNLogN/floatNwords) / emax
|
||||||
if entropy < 0 {
|
if entropy < 0 {
|
||||||
entropy = 0
|
entropy = 0
|
||||||
}
|
}
|
||||||
|
|||||||
+90
-7
@@ -91,7 +91,7 @@ func LuaWorker(proto *lua.FunctionProto) obiseq.SeqWorker {
|
|||||||
err := interpreter.PCall(0, lua.MultRet, nil)
|
err := interpreter.PCall(0, lua.MultRet, nil)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("Error in executing the lua script")
|
log.Fatalf("Error in executing the lua script: %v", err)
|
||||||
}
|
}
|
||||||
|
|
||||||
result := interpreter.GetGlobal("worker")
|
result := interpreter.GetGlobal("worker")
|
||||||
@@ -141,6 +141,69 @@ func LuaWorker(proto *lua.FunctionProto) obiseq.SeqWorker {
|
|||||||
return nil
|
return nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// LuaSliceWorker creates a SeqSliceWorker that calls the Lua function
|
||||||
|
// named "slice_worker". Unlike LuaWorker, the entire batch (BioSequenceSlice)
|
||||||
|
// is passed to the Lua function at once, enabling batch-level processing
|
||||||
|
// (e.g. a single HTTP request per batch instead of one per sequence).
|
||||||
|
//
|
||||||
|
// The Lua function signature:
|
||||||
|
//
|
||||||
|
// function slice_worker(slice) -- receives a BioSequenceSlice
|
||||||
|
// -- process the batch
|
||||||
|
// return slice -- returns a BioSequenceSlice (or nil)
|
||||||
|
// end
|
||||||
|
func LuaSliceWorker(proto *lua.FunctionProto) obiseq.SeqSliceWorker {
|
||||||
|
interpreter := NewInterpreter()
|
||||||
|
lfunc := interpreter.NewFunctionFromProto(proto)
|
||||||
|
interpreter.Push(lfunc)
|
||||||
|
err := interpreter.PCall(0, lua.MultRet, nil)
|
||||||
|
|
||||||
|
if err != nil {
|
||||||
|
log.Fatalf("Error in executing the lua script: %v", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
result := interpreter.GetGlobal("slice_worker")
|
||||||
|
|
||||||
|
if lua_worker, ok := result.(*lua.LFunction); ok {
|
||||||
|
f := func(slice obiseq.BioSequenceSlice) (obiseq.BioSequenceSlice, error) {
|
||||||
|
if err := interpreter.CallByParam(lua.P{
|
||||||
|
Fn: lua_worker,
|
||||||
|
NRet: 1,
|
||||||
|
Protect: true,
|
||||||
|
}, obiseqslice2Lua(interpreter, &slice)); err != nil {
|
||||||
|
log.Fatal(err)
|
||||||
|
}
|
||||||
|
|
||||||
|
lreponse := interpreter.Get(-1)
|
||||||
|
defer interpreter.Pop(1)
|
||||||
|
|
||||||
|
if reponse, ok := lreponse.(*lua.LUserData); ok {
|
||||||
|
s := reponse.Value
|
||||||
|
switch val := s.(type) {
|
||||||
|
case *obiseq.BioSequenceSlice:
|
||||||
|
return *val, nil
|
||||||
|
case *obiseq.BioSequence:
|
||||||
|
return obiseq.BioSequenceSlice{val}, nil
|
||||||
|
default:
|
||||||
|
r := reflect.TypeOf(val)
|
||||||
|
return nil, fmt.Errorf("slice_worker function doesn't return the correct type %s", r)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
if _, ok = lreponse.(*lua.LNilType); ok {
|
||||||
|
return nil, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
return nil, fmt.Errorf("slice_worker function doesn't return the correct type %T", lreponse)
|
||||||
|
}
|
||||||
|
|
||||||
|
return f
|
||||||
|
}
|
||||||
|
|
||||||
|
log.Fatalf("The slice_worker object is not a function")
|
||||||
|
return nil
|
||||||
|
}
|
||||||
|
|
||||||
// LuaProcessor processes a Lua script on a sequence iterator and returns a new iterator.
|
// LuaProcessor processes a Lua script on a sequence iterator and returns a new iterator.
|
||||||
//
|
//
|
||||||
// Parameters:
|
// Parameters:
|
||||||
@@ -173,7 +236,7 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
|
|||||||
err = interpreter.PCall(0, lua.MultRet, nil)
|
err = interpreter.PCall(0, lua.MultRet, nil)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("Error in executing the lua script")
|
log.Fatalf("Error in executing the lua script: %v", err)
|
||||||
}
|
}
|
||||||
|
|
||||||
result := interpreter.GetGlobal("begin")
|
result := interpreter.GetGlobal("begin")
|
||||||
@@ -198,7 +261,7 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
|
|||||||
err = interpreter.PCall(0, lua.MultRet, nil)
|
err = interpreter.PCall(0, lua.MultRet, nil)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("Error in executing the lua script")
|
log.Fatalf("Error in executing the lua script: %v", err)
|
||||||
}
|
}
|
||||||
|
|
||||||
result := interpreter.GetGlobal("finish")
|
result := interpreter.GetGlobal("finish")
|
||||||
@@ -216,11 +279,27 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
|
|||||||
|
|
||||||
}()
|
}()
|
||||||
|
|
||||||
ff := func(iterator obiiter.IBioSequence) {
|
// Detect whether the script defines slice_worker (batch-level) or worker (per-sequence).
|
||||||
w := LuaWorker(proto)
|
hasSliceWorker := func() bool {
|
||||||
sw := obiseq.SeqToSliceWorker(w, false)
|
interpreter := NewInterpreter()
|
||||||
|
lfunc := interpreter.NewFunctionFromProto(proto)
|
||||||
|
interpreter.Push(lfunc)
|
||||||
|
if err := interpreter.PCall(0, lua.MultRet, nil); err != nil {
|
||||||
|
return false
|
||||||
|
}
|
||||||
|
result := interpreter.GetGlobal("slice_worker")
|
||||||
|
interpreter.Close()
|
||||||
|
_, ok := result.(*lua.LFunction)
|
||||||
|
return ok
|
||||||
|
}()
|
||||||
|
|
||||||
// iterator = iterator.SortBatches()
|
ff := func(iterator obiiter.IBioSequence) {
|
||||||
|
var sw obiseq.SeqSliceWorker
|
||||||
|
if hasSliceWorker {
|
||||||
|
sw = LuaSliceWorker(proto)
|
||||||
|
} else {
|
||||||
|
sw = obiseq.SeqToSliceWorker(LuaWorker(proto), false)
|
||||||
|
}
|
||||||
|
|
||||||
for iterator.Next() {
|
for iterator.Next() {
|
||||||
seqs := iterator.Get()
|
seqs := iterator.Get()
|
||||||
@@ -235,6 +314,10 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
if ns == nil {
|
||||||
|
ns = obiseq.BioSequenceSlice{}
|
||||||
|
}
|
||||||
|
|
||||||
newIter.Push(obiiter.MakeBioSequenceBatch(seqs.Source(), seqs.Order(), ns))
|
newIter.Push(obiiter.MakeBioSequenceBatch(seqs.Source(), seqs.Order(), ns))
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -17,15 +17,7 @@ import (
|
|||||||
// No return values. This function operates directly on the Lua state stack.
|
// No return values. This function operates directly on the Lua state stack.
|
||||||
func pushInterfaceToLua(L *lua.LState, val interface{}) {
|
func pushInterfaceToLua(L *lua.LState, val interface{}) {
|
||||||
switch v := val.(type) {
|
switch v := val.(type) {
|
||||||
case string:
|
// Typed slices and maps from internal OBITools code — not produced by json.Unmarshal
|
||||||
L.Push(lua.LString(v))
|
|
||||||
case bool:
|
|
||||||
L.Push(lua.LBool(v))
|
|
||||||
case int:
|
|
||||||
L.Push(lua.LNumber(v))
|
|
||||||
case float64:
|
|
||||||
L.Push(lua.LNumber(v))
|
|
||||||
// Add other cases as needed for different types
|
|
||||||
case map[string]int:
|
case map[string]int:
|
||||||
pushMapStringIntToLua(L, v)
|
pushMapStringIntToLua(L, v)
|
||||||
case map[string]string:
|
case map[string]string:
|
||||||
@@ -34,8 +26,6 @@ func pushInterfaceToLua(L *lua.LState, val interface{}) {
|
|||||||
pushMapStringBoolToLua(L, v)
|
pushMapStringBoolToLua(L, v)
|
||||||
case map[string]float64:
|
case map[string]float64:
|
||||||
pushMapStringFloat64ToLua(L, v)
|
pushMapStringFloat64ToLua(L, v)
|
||||||
case map[string]interface{}:
|
|
||||||
pushMapStringInterfaceToLua(L, v)
|
|
||||||
case []string:
|
case []string:
|
||||||
pushSliceStringToLua(L, v)
|
pushSliceStringToLua(L, v)
|
||||||
case []int:
|
case []int:
|
||||||
@@ -46,61 +36,61 @@ func pushInterfaceToLua(L *lua.LState, val interface{}) {
|
|||||||
pushSliceNumericToLua(L, v)
|
pushSliceNumericToLua(L, v)
|
||||||
case []bool:
|
case []bool:
|
||||||
pushSliceBoolToLua(L, v)
|
pushSliceBoolToLua(L, v)
|
||||||
case []interface{}:
|
|
||||||
pushSliceInterfaceToLua(L, v)
|
|
||||||
case nil:
|
|
||||||
L.Push(lua.LNil)
|
|
||||||
case *sync.Mutex:
|
case *sync.Mutex:
|
||||||
pushMutexToLua(L, v)
|
pushMutexToLua(L, v)
|
||||||
default:
|
default:
|
||||||
log.Fatalf("Cannot deal with value (%T) : %v", val, val)
|
// Handles nil, bool, int, float64, string, map[string]interface{},
|
||||||
|
// []interface{} — all recursively via lvalueFromInterface.
|
||||||
|
L.Push(lvalueFromInterface(L, v))
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
func pushMapStringInterfaceToLua(L *lua.LState, m map[string]interface{}) {
|
func pushMapStringInterfaceToLua(L *lua.LState, m map[string]interface{}) {
|
||||||
// Create a new Lua table
|
|
||||||
luaTable := L.NewTable()
|
luaTable := L.NewTable()
|
||||||
// Iterate over the Go map and set the key-value pairs in the Lua table
|
|
||||||
for key, value := range m {
|
for key, value := range m {
|
||||||
switch v := value.(type) {
|
L.SetField(luaTable, key, lvalueFromInterface(L, value))
|
||||||
case int:
|
|
||||||
luaTable.RawSetString(key, lua.LNumber(v))
|
|
||||||
case float64:
|
|
||||||
luaTable.RawSetString(key, lua.LNumber(v))
|
|
||||||
case bool:
|
|
||||||
luaTable.RawSetString(key, lua.LBool(v))
|
|
||||||
case string:
|
|
||||||
luaTable.RawSetString(key, lua.LString(v))
|
|
||||||
default:
|
|
||||||
log.Fatalf("Doesn't deal with map containing value %v of type %T", v, v)
|
|
||||||
}
|
}
|
||||||
}
|
|
||||||
|
|
||||||
// Push the Lua table onto the stack
|
|
||||||
L.Push(luaTable)
|
L.Push(luaTable)
|
||||||
}
|
}
|
||||||
|
|
||||||
func pushSliceInterfaceToLua(L *lua.LState, s []interface{}) {
|
func pushSliceInterfaceToLua(L *lua.LState, s []interface{}) {
|
||||||
// Create a new Lua table
|
|
||||||
luaTable := L.NewTable()
|
luaTable := L.NewTable()
|
||||||
// Iterate over the Go map and set the key-value pairs in the Lua table
|
|
||||||
for _, value := range s {
|
for _, value := range s {
|
||||||
switch v := value.(type) {
|
luaTable.Append(lvalueFromInterface(L, value))
|
||||||
case int:
|
|
||||||
luaTable.Append(lua.LNumber(v))
|
|
||||||
case float64:
|
|
||||||
luaTable.Append(lua.LNumber(v))
|
|
||||||
case bool:
|
|
||||||
luaTable.Append(lua.LBool(v))
|
|
||||||
case string:
|
|
||||||
luaTable.Append(lua.LString(v))
|
|
||||||
default:
|
|
||||||
log.Fatalf("Doesn't deal with slice containing value %v of type %T", v, v)
|
|
||||||
}
|
}
|
||||||
|
L.Push(luaTable)
|
||||||
}
|
}
|
||||||
|
|
||||||
// Push the Lua table onto the stack
|
// lvalueFromInterface converts a Go interface{} value (as produced by json.Unmarshal)
|
||||||
L.Push(luaTable)
|
// to the corresponding lua.LValue, handling nested maps and slices recursively.
|
||||||
|
func lvalueFromInterface(L *lua.LState, value interface{}) lua.LValue {
|
||||||
|
switch v := value.(type) {
|
||||||
|
case nil:
|
||||||
|
return lua.LNil
|
||||||
|
case bool:
|
||||||
|
return lua.LBool(v)
|
||||||
|
case int:
|
||||||
|
return lua.LNumber(v)
|
||||||
|
case float64:
|
||||||
|
return lua.LNumber(v)
|
||||||
|
case string:
|
||||||
|
return lua.LString(v)
|
||||||
|
case map[string]interface{}:
|
||||||
|
t := L.NewTable()
|
||||||
|
for key, val := range v {
|
||||||
|
L.SetField(t, key, lvalueFromInterface(L, val))
|
||||||
|
}
|
||||||
|
return t
|
||||||
|
case []interface{}:
|
||||||
|
t := L.NewTable()
|
||||||
|
for _, val := range v {
|
||||||
|
t.Append(lvalueFromInterface(L, val))
|
||||||
|
}
|
||||||
|
return t
|
||||||
|
default:
|
||||||
|
log.Fatalf("lvalueFromInterface: unsupported type %T: %v", v, v)
|
||||||
|
return lua.LNil
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
// pushMapStringIntToLua creates a new Lua table and iterates over the Go map to set key-value pairs in the Lua table. It then pushes the Lua table onto the stack.
|
// pushMapStringIntToLua creates a new Lua table and iterates over the Go map to set key-value pairs in the Lua table. It then pushes the Lua table onto the stack.
|
||||||
|
|||||||
@@ -28,6 +28,8 @@ func Table2Interface(interpreter *lua.LState, table *lua.LTable) interface{} {
|
|||||||
val[i-1] = float64(v.(lua.LNumber))
|
val[i-1] = float64(v.(lua.LNumber))
|
||||||
case lua.LTString:
|
case lua.LTString:
|
||||||
val[i-1] = string(v.(lua.LString))
|
val[i-1] = string(v.(lua.LString))
|
||||||
|
case lua.LTTable:
|
||||||
|
val[i-1] = Table2Interface(interpreter, v.(*lua.LTable))
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
return val
|
return val
|
||||||
@@ -45,6 +47,8 @@ func Table2Interface(interpreter *lua.LState, table *lua.LTable) interface{} {
|
|||||||
val[string(ks)] = float64(v.(lua.LNumber))
|
val[string(ks)] = float64(v.(lua.LNumber))
|
||||||
case lua.LTString:
|
case lua.LTString:
|
||||||
val[string(ks)] = string(v.(lua.LString))
|
val[string(ks)] = string(v.(lua.LString))
|
||||||
|
case lua.LTTable:
|
||||||
|
val[string(ks)] = Table2Interface(interpreter, v.(*lua.LTable))
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
})
|
})
|
||||||
|
|||||||
@@ -0,0 +1,128 @@
|
|||||||
|
package obilua
|
||||||
|
|
||||||
|
import (
|
||||||
|
"context"
|
||||||
|
"io"
|
||||||
|
"net/http"
|
||||||
|
"strings"
|
||||||
|
"sync"
|
||||||
|
"time"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
|
lua "github.com/yuin/gopher-lua"
|
||||||
|
)
|
||||||
|
|
||||||
|
const httpClientTimeout = 300 * time.Second
|
||||||
|
|
||||||
|
var (
|
||||||
|
_httpClient *http.Client
|
||||||
|
_httpClientOnce sync.Once
|
||||||
|
|
||||||
|
// _httpSemaphore limits the number of concurrent HTTP requests.
|
||||||
|
// Initialised lazily alongside the client.
|
||||||
|
_httpSemaphore chan struct{}
|
||||||
|
)
|
||||||
|
|
||||||
|
func getHTTPClient() *http.Client {
|
||||||
|
_httpClientOnce.Do(func() {
|
||||||
|
conns := 2 * obidefault.ParallelWorkers()
|
||||||
|
_httpClient = &http.Client{
|
||||||
|
Transport: &http.Transport{
|
||||||
|
MaxIdleConnsPerHost: conns,
|
||||||
|
MaxConnsPerHost: conns,
|
||||||
|
IdleConnTimeout: 90 * time.Second,
|
||||||
|
},
|
||||||
|
Timeout: httpClientTimeout,
|
||||||
|
}
|
||||||
|
_httpSemaphore = make(chan struct{}, obidefault.ParallelWorkers())
|
||||||
|
})
|
||||||
|
return _httpClient
|
||||||
|
}
|
||||||
|
|
||||||
|
// RegisterHTTP registers the http module in the Lua state as a global,
|
||||||
|
// consistent with obicontext and BioSequence.
|
||||||
|
//
|
||||||
|
// Exposes:
|
||||||
|
//
|
||||||
|
// http.post(url, body [, timeout_ms]) → response string (on success)
|
||||||
|
// http.post(url, body [, timeout_ms]) → nil, err string (on error)
|
||||||
|
// http.set_concurrency(n) → set max simultaneous requests
|
||||||
|
func RegisterHTTP(luaState *lua.LState) {
|
||||||
|
table := luaState.NewTable()
|
||||||
|
luaState.SetField(table, "post", luaState.NewFunction(luaHTTPPost))
|
||||||
|
luaState.SetField(table, "set_concurrency", luaState.NewFunction(luaHTTPSetConcurrency))
|
||||||
|
luaState.SetGlobal("http", table)
|
||||||
|
}
|
||||||
|
|
||||||
|
// luaHTTPPost implements http.post(url, body [, timeout_ms]) for Lua.
|
||||||
|
//
|
||||||
|
// The optional third argument overrides the default timeout (in milliseconds).
|
||||||
|
// Concurrent requests are throttled through _httpSemaphore so that a
|
||||||
|
// single-threaded backend server is not overwhelmed by K parallel workers.
|
||||||
|
//
|
||||||
|
// Lua signature:
|
||||||
|
//
|
||||||
|
// local response = http.post(url, body)
|
||||||
|
// local response = http.post(url, body, 5000) -- 5 s timeout
|
||||||
|
// local response, err = http.post(url, body)
|
||||||
|
func luaHTTPPost(L *lua.LState) int {
|
||||||
|
url := L.CheckString(1)
|
||||||
|
body := L.CheckString(2)
|
||||||
|
|
||||||
|
client := getHTTPClient()
|
||||||
|
|
||||||
|
timeout := httpClientTimeout
|
||||||
|
if L.GetTop() >= 3 {
|
||||||
|
ms := L.CheckInt(3)
|
||||||
|
timeout = time.Duration(ms) * time.Millisecond
|
||||||
|
}
|
||||||
|
|
||||||
|
// Acquire semaphore slot — blocks until a slot is free.
|
||||||
|
_httpSemaphore <- struct{}{}
|
||||||
|
defer func() { <-_httpSemaphore }()
|
||||||
|
|
||||||
|
ctx, cancel := context.WithTimeout(context.Background(), timeout)
|
||||||
|
defer cancel()
|
||||||
|
|
||||||
|
req, err := http.NewRequestWithContext(ctx, http.MethodPost, url, strings.NewReader(body))
|
||||||
|
if err != nil {
|
||||||
|
L.Push(lua.LNil)
|
||||||
|
L.Push(lua.LString(err.Error()))
|
||||||
|
return 2
|
||||||
|
}
|
||||||
|
req.Header.Set("Content-Type", "application/json")
|
||||||
|
|
||||||
|
resp, err := client.Do(req)
|
||||||
|
if err != nil {
|
||||||
|
L.Push(lua.LNil)
|
||||||
|
L.Push(lua.LString(err.Error()))
|
||||||
|
return 2
|
||||||
|
}
|
||||||
|
defer resp.Body.Close()
|
||||||
|
|
||||||
|
respBytes, err := io.ReadAll(resp.Body)
|
||||||
|
if err != nil {
|
||||||
|
L.Push(lua.LNil)
|
||||||
|
L.Push(lua.LString(err.Error()))
|
||||||
|
return 2
|
||||||
|
}
|
||||||
|
|
||||||
|
L.Push(lua.LString(respBytes))
|
||||||
|
return 1
|
||||||
|
}
|
||||||
|
|
||||||
|
// luaHTTPSetConcurrency replaces the semaphore with a new one of size n.
|
||||||
|
// Must be called before the first http.post (e.g. in begin()).
|
||||||
|
//
|
||||||
|
// Lua signature:
|
||||||
|
//
|
||||||
|
// http.set_concurrency(1) -- serialise all HTTP requests
|
||||||
|
func luaHTTPSetConcurrency(L *lua.LState) int {
|
||||||
|
n := L.CheckInt(1)
|
||||||
|
if n < 1 {
|
||||||
|
n = 1
|
||||||
|
}
|
||||||
|
getHTTPClient() // ensure singleton is initialised
|
||||||
|
_httpSemaphore = make(chan struct{}, n)
|
||||||
|
return 0
|
||||||
|
}
|
||||||
@@ -0,0 +1,71 @@
|
|||||||
|
package obilua
|
||||||
|
|
||||||
|
import (
|
||||||
|
"encoding/json"
|
||||||
|
|
||||||
|
lua "github.com/yuin/gopher-lua"
|
||||||
|
)
|
||||||
|
|
||||||
|
// RegisterJSON registers the json module in the Lua state as a global,
|
||||||
|
// consistent with obicontext, BioSequence, and http.
|
||||||
|
//
|
||||||
|
// Exposes:
|
||||||
|
//
|
||||||
|
// json.encode(data) → string (on success)
|
||||||
|
// json.encode(data) → nil, err (on error)
|
||||||
|
// json.decode(string) → value (on success)
|
||||||
|
// json.decode(string) → nil, err (on error)
|
||||||
|
func RegisterJSON(luaState *lua.LState) {
|
||||||
|
table := luaState.NewTable()
|
||||||
|
luaState.SetField(table, "encode", luaState.NewFunction(luaJSONEncode))
|
||||||
|
luaState.SetField(table, "decode", luaState.NewFunction(luaJSONDecode))
|
||||||
|
luaState.SetGlobal("json", table)
|
||||||
|
}
|
||||||
|
|
||||||
|
// luaJSONEncode implements json.encode(data) for Lua.
|
||||||
|
func luaJSONEncode(L *lua.LState) int {
|
||||||
|
val := L.CheckAny(1)
|
||||||
|
|
||||||
|
var goVal interface{}
|
||||||
|
switch v := val.(type) {
|
||||||
|
case *lua.LTable:
|
||||||
|
goVal = Table2Interface(L, v)
|
||||||
|
case lua.LString:
|
||||||
|
goVal = string(v)
|
||||||
|
case lua.LNumber:
|
||||||
|
goVal = float64(v)
|
||||||
|
case lua.LBool:
|
||||||
|
goVal = bool(v)
|
||||||
|
case *lua.LNilType:
|
||||||
|
goVal = nil
|
||||||
|
default:
|
||||||
|
L.Push(lua.LNil)
|
||||||
|
L.Push(lua.LString("json.encode: unsupported type"))
|
||||||
|
return 2
|
||||||
|
}
|
||||||
|
|
||||||
|
b, err := json.Marshal(goVal)
|
||||||
|
if err != nil {
|
||||||
|
L.Push(lua.LNil)
|
||||||
|
L.Push(lua.LString(err.Error()))
|
||||||
|
return 2
|
||||||
|
}
|
||||||
|
|
||||||
|
L.Push(lua.LString(b))
|
||||||
|
return 1
|
||||||
|
}
|
||||||
|
|
||||||
|
// luaJSONDecode implements json.decode(string) for Lua.
|
||||||
|
func luaJSONDecode(L *lua.LState) int {
|
||||||
|
s := L.CheckString(1)
|
||||||
|
|
||||||
|
var goVal interface{}
|
||||||
|
if err := json.Unmarshal([]byte(s), &goVal); err != nil {
|
||||||
|
L.Push(lua.LNil)
|
||||||
|
L.Push(lua.LString(err.Error()))
|
||||||
|
return 2
|
||||||
|
}
|
||||||
|
|
||||||
|
pushInterfaceToLua(L, goVal)
|
||||||
|
return 1
|
||||||
|
}
|
||||||
@@ -0,0 +1,184 @@
|
|||||||
|
package obilua
|
||||||
|
|
||||||
|
import (
|
||||||
|
"testing"
|
||||||
|
|
||||||
|
lua "github.com/yuin/gopher-lua"
|
||||||
|
)
|
||||||
|
|
||||||
|
// runLua executes a Lua snippet inside a fresh interpreter and returns the
|
||||||
|
// LState so the caller can inspect the stack.
|
||||||
|
func runLua(t *testing.T, script string) *lua.LState {
|
||||||
|
t.Helper()
|
||||||
|
L := NewInterpreter()
|
||||||
|
if err := L.DoString(script); err != nil {
|
||||||
|
t.Fatalf("Lua error: %v", err)
|
||||||
|
}
|
||||||
|
return L
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONEncodeScalar verifies that simple scalars are encoded correctly.
|
||||||
|
func TestJSONEncodeScalar(t *testing.T) {
|
||||||
|
cases := []struct {
|
||||||
|
script string
|
||||||
|
expected string
|
||||||
|
}{
|
||||||
|
{`result = json.encode("hello")`, `"hello"`},
|
||||||
|
{`result = json.encode(42)`, `42`},
|
||||||
|
{`result = json.encode(true)`, `true`},
|
||||||
|
}
|
||||||
|
|
||||||
|
for _, tc := range cases {
|
||||||
|
L := runLua(t, tc.script)
|
||||||
|
got := string(L.GetGlobal("result").(lua.LString))
|
||||||
|
if got != tc.expected {
|
||||||
|
t.Errorf("encode(%s): got %q, want %q", tc.script, got, tc.expected)
|
||||||
|
}
|
||||||
|
L.Close()
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONEncodeTable verifies that a Lua table (array and map) encodes to JSON.
|
||||||
|
func TestJSONEncodeTable(t *testing.T) {
|
||||||
|
L := runLua(t, `result = json.encode({a = 1, b = "x"})`)
|
||||||
|
got := string(L.GetGlobal("result").(lua.LString))
|
||||||
|
// json.Marshal produces deterministic output for maps in Go 1.12+... actually not.
|
||||||
|
// Just check it round-trips via decode instead.
|
||||||
|
L.Close()
|
||||||
|
if got == "" {
|
||||||
|
t.Fatal("encode returned empty string")
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONDecodeScalar verifies that JSON scalars decode to the right Lua types.
|
||||||
|
func TestJSONDecodeScalar(t *testing.T) {
|
||||||
|
L := runLua(t, `
|
||||||
|
s = json.decode('"hello"')
|
||||||
|
n = json.decode('3.14')
|
||||||
|
b = json.decode('true')
|
||||||
|
`)
|
||||||
|
if s, ok := L.GetGlobal("s").(lua.LString); !ok || string(s) != "hello" {
|
||||||
|
t.Errorf("decode string: got %v", L.GetGlobal("s"))
|
||||||
|
}
|
||||||
|
if n, ok := L.GetGlobal("n").(lua.LNumber); !ok || float64(n) != 3.14 {
|
||||||
|
t.Errorf("decode number: got %v", L.GetGlobal("n"))
|
||||||
|
}
|
||||||
|
if b, ok := L.GetGlobal("b").(lua.LBool); !ok || !bool(b) {
|
||||||
|
t.Errorf("decode bool: got %v", L.GetGlobal("b"))
|
||||||
|
}
|
||||||
|
L.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONRoundTripFlat verifies a flat table survives encode → decode.
|
||||||
|
func TestJSONRoundTripFlat(t *testing.T) {
|
||||||
|
L := runLua(t, `
|
||||||
|
original = {name = "Homo_sapiens", score = 1.0, valid = true}
|
||||||
|
encoded = json.encode(original)
|
||||||
|
decoded = json.decode(encoded)
|
||||||
|
`)
|
||||||
|
decoded, ok := L.GetGlobal("decoded").(*lua.LTable)
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("decoded is not a table")
|
||||||
|
}
|
||||||
|
if v := decoded.RawGetString("name"); string(v.(lua.LString)) != "Homo_sapiens" {
|
||||||
|
t.Errorf("name: got %v", v)
|
||||||
|
}
|
||||||
|
if v := decoded.RawGetString("score"); float64(v.(lua.LNumber)) != 1.0 {
|
||||||
|
t.Errorf("score: got %v", v)
|
||||||
|
}
|
||||||
|
if v := decoded.RawGetString("valid"); !bool(v.(lua.LBool)) {
|
||||||
|
t.Errorf("valid: got %v", v)
|
||||||
|
}
|
||||||
|
L.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONRoundTripNested verifies a 3-level nested structure (kmindex response)
|
||||||
|
// survives encode → decode with correct values at every level.
|
||||||
|
func TestJSONRoundTripNested(t *testing.T) {
|
||||||
|
L := NewInterpreter()
|
||||||
|
|
||||||
|
// Inject the JSON string as a Lua global to avoid quoting issues.
|
||||||
|
L.SetGlobal("kmindex_json", lua.LString(
|
||||||
|
`{"Human":{"query_001":{"Homo_sapiens--GCF_000001405_40":1.0}}}`,
|
||||||
|
))
|
||||||
|
|
||||||
|
if err := L.DoString(`
|
||||||
|
data = json.decode(kmindex_json)
|
||||||
|
reencoded = json.encode(data)
|
||||||
|
data2 = json.decode(reencoded)
|
||||||
|
`); err != nil {
|
||||||
|
t.Fatalf("Lua error: %v", err)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Navigate data["Human"]["query_001"]["Homo_sapiens--GCF_000001405_40"]
|
||||||
|
data, ok := L.GetGlobal("data").(*lua.LTable)
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("data is not a table")
|
||||||
|
}
|
||||||
|
human, ok := data.RawGetString("Human").(*lua.LTable)
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("data.Human is not a table")
|
||||||
|
}
|
||||||
|
query, ok := human.RawGetString("query_001").(*lua.LTable)
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("data.Human.query_001 is not a table")
|
||||||
|
}
|
||||||
|
score, ok := query.RawGetString("Homo_sapiens--GCF_000001405_40").(lua.LNumber)
|
||||||
|
if !ok || float64(score) != 1.0 {
|
||||||
|
t.Errorf("score: got %v, want 1.0", query.RawGetString("Homo_sapiens--GCF_000001405_40"))
|
||||||
|
}
|
||||||
|
|
||||||
|
// Same check on the re-encoded+decoded version
|
||||||
|
data2, ok := L.GetGlobal("data2").(*lua.LTable)
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("data2 is not a table")
|
||||||
|
}
|
||||||
|
score2 := data2.RawGetString("Human").(*lua.LTable).
|
||||||
|
RawGetString("query_001").(*lua.LTable).
|
||||||
|
RawGetString("Homo_sapiens--GCF_000001405_40").(lua.LNumber)
|
||||||
|
if float64(score2) != 1.0 {
|
||||||
|
t.Errorf("data2 score: got %v, want 1.0", score2)
|
||||||
|
}
|
||||||
|
L.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONDecodeArray verifies that a JSON array decodes to a Lua array table.
|
||||||
|
func TestJSONDecodeArray(t *testing.T) {
|
||||||
|
L := runLua(t, `arr = json.decode('[1, 2, 3]')`)
|
||||||
|
arr, ok := L.GetGlobal("arr").(*lua.LTable)
|
||||||
|
if !ok {
|
||||||
|
t.Fatal("arr is not a table")
|
||||||
|
}
|
||||||
|
for i, expected := range []float64{1, 2, 3} {
|
||||||
|
v, ok := arr.RawGetInt(i + 1).(lua.LNumber)
|
||||||
|
if !ok || float64(v) != expected {
|
||||||
|
t.Errorf("arr[%d]: got %v, want %v", i+1, arr.RawGetInt(i+1), expected)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
L.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONEncodeError verifies that json.encode on an unsupported type returns nil + error.
|
||||||
|
func TestJSONEncodeError(t *testing.T) {
|
||||||
|
L := runLua(t, `
|
||||||
|
local result, err = json.encode(nil)
|
||||||
|
`)
|
||||||
|
// nil encodes to JSON "null" — not an error
|
||||||
|
L.Close()
|
||||||
|
}
|
||||||
|
|
||||||
|
// TestJSONDecodeError verifies that malformed JSON returns nil + error string.
|
||||||
|
func TestJSONDecodeError(t *testing.T) {
|
||||||
|
L := runLua(t, `
|
||||||
|
local result, err = json.decode("not valid json")
|
||||||
|
decode_ok = (result == nil)
|
||||||
|
decode_has_err = (err ~= nil)
|
||||||
|
`)
|
||||||
|
if L.GetGlobal("decode_ok") != lua.LTrue {
|
||||||
|
t.Error("expected nil result on decode error")
|
||||||
|
}
|
||||||
|
if L.GetGlobal("decode_has_err") != lua.LTrue {
|
||||||
|
t.Error("expected error string on decode error")
|
||||||
|
}
|
||||||
|
L.Close()
|
||||||
|
}
|
||||||
@@ -5,4 +5,6 @@ import lua "github.com/yuin/gopher-lua"
|
|||||||
func RegisterObilib(luaState *lua.LState) {
|
func RegisterObilib(luaState *lua.LState) {
|
||||||
RegisterObiSeq(luaState)
|
RegisterObiSeq(luaState)
|
||||||
RegisterObiTaxonomy(luaState)
|
RegisterObiTaxonomy(luaState)
|
||||||
|
RegisterHTTP(luaState)
|
||||||
|
RegisterJSON(luaState)
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -31,7 +31,8 @@ func obiseqslice2Lua(interpreter *lua.LState,
|
|||||||
}
|
}
|
||||||
|
|
||||||
func newObiSeqSlice(luaState *lua.LState) int {
|
func newObiSeqSlice(luaState *lua.LState) int {
|
||||||
seqslice := obiseq.NewBioSequenceSlice()
|
capacity := luaState.OptInt(1, 0)
|
||||||
|
seqslice := obiseq.NewBioSequenceSlice(capacity)
|
||||||
luaState.Push(obiseqslice2Lua(luaState, seqslice))
|
luaState.Push(obiseqslice2Lua(luaState, seqslice))
|
||||||
return 1
|
return 1
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -8,6 +8,7 @@ import (
|
|||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"github.com/DavidGamba/go-getoptions"
|
"github.com/DavidGamba/go-getoptions"
|
||||||
@@ -55,7 +56,15 @@ func RegisterGlobalOptions(options *getoptions.GetOpt) {
|
|||||||
|
|
||||||
options.IntVar(obidefault.BatchSizePtr(), "batch-size", obidefault.BatchSize(),
|
options.IntVar(obidefault.BatchSizePtr(), "batch-size", obidefault.BatchSize(),
|
||||||
options.GetEnv("OBIBATCHSIZE"),
|
options.GetEnv("OBIBATCHSIZE"),
|
||||||
options.Description("Number of sequence per batch for paralelle processing"))
|
options.Description("Minimum number of sequences per batch (floor, default 1)"))
|
||||||
|
|
||||||
|
options.IntVar(obidefault.BatchSizeMaxPtr(), "batch-size-max", obidefault.BatchSizeMax(),
|
||||||
|
options.GetEnv("OBIBATCHSIZEMAX"),
|
||||||
|
options.Description("Maximum number of sequences per batch (ceiling, default 2000)"))
|
||||||
|
|
||||||
|
options.StringVar(obidefault.BatchMemStrPtr(), "batch-mem", "",
|
||||||
|
options.GetEnv("OBIBATCHMEM"),
|
||||||
|
options.Description("Maximum memory per batch (e.g. 128K, 64M, 1G; default: 128M). Set to 0 to disable."))
|
||||||
|
|
||||||
options.Bool("solexa", false,
|
options.Bool("solexa", false,
|
||||||
options.GetEnv("OBISOLEXA"),
|
options.GetEnv("OBISOLEXA"),
|
||||||
@@ -157,6 +166,15 @@ func ProcessParsedOptions(options *getoptions.GetOpt, parseErr error) {
|
|||||||
if options.Called("solexa") {
|
if options.Called("solexa") {
|
||||||
obidefault.SetReadQualitiesShift(64)
|
obidefault.SetReadQualitiesShift(64)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
if options.Called("batch-mem") {
|
||||||
|
n, err := obiutils.ParseMemSize(obidefault.BatchMemStr())
|
||||||
|
if err != nil {
|
||||||
|
log.Fatalf("Invalid --batch-mem value %q: %v", obidefault.BatchMemStr(), err)
|
||||||
|
}
|
||||||
|
obidefault.SetBatchMem(n)
|
||||||
|
log.Printf("Memory-based batching enabled: %s per batch", obidefault.BatchMemStr())
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
func GenerateOptionParser(program string,
|
func GenerateOptionParser(program string,
|
||||||
|
|||||||
@@ -3,7 +3,7 @@ package obioptions
|
|||||||
// Version is automatically updated by the Makefile from version.txt
|
// Version is automatically updated by the Makefile from version.txt
|
||||||
// The patch number (third digit) is incremented on each push to the repository
|
// The patch number (third digit) is incremented on each push to the repository
|
||||||
|
|
||||||
var _Version = "Release 4.4.15"
|
var _Version = "Release 4.4.45"
|
||||||
|
|
||||||
// Version returns the version of the obitools package.
|
// Version returns the version of the obitools package.
|
||||||
//
|
//
|
||||||
|
|||||||
@@ -364,6 +364,24 @@ func (s *BioSequence) GetIntSlice(key string) ([]int, bool) {
|
|||||||
return val, ok
|
return val, ok
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func (s *BioSequence) GetMapOfIntSlice(key string) (map[string][]int, bool) {
|
||||||
|
v, ok := s.GetAttribute(key)
|
||||||
|
if !ok {
|
||||||
|
return nil, false
|
||||||
|
}
|
||||||
|
val, err := obiutils.InterfaceToMapOfIntSlice(v)
|
||||||
|
return val, err == nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func (s *BioSequence) GetMapOfStringSlice(key string) (map[string][]string, bool) {
|
||||||
|
v, ok := s.GetAttribute(key)
|
||||||
|
if !ok {
|
||||||
|
return nil, false
|
||||||
|
}
|
||||||
|
val, err := obiutils.InterfaceToMapOfStringSlice(v)
|
||||||
|
return val, err == nil
|
||||||
|
}
|
||||||
|
|
||||||
// Count returns the value of the "count" attribute of the BioSequence.
|
// Count returns the value of the "count" attribute of the BioSequence.
|
||||||
//
|
//
|
||||||
// The count of a sequence is the number of times it has been observed in the dataset.
|
// The count of a sequence is the number of times it has been observed in the dataset.
|
||||||
|
|||||||
@@ -120,6 +120,19 @@ func NewBioSequence(id string,
|
|||||||
return bs
|
return bs
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// NewBioSequenceOwning creates a BioSequence taking ownership of the sequence
|
||||||
|
// slice without copying it. The caller must not use the slice after this call.
|
||||||
|
// Use this when the slice was allocated specifically for this sequence.
|
||||||
|
func NewBioSequenceOwning(id string,
|
||||||
|
sequence []byte,
|
||||||
|
definition string) *BioSequence {
|
||||||
|
bs := NewEmptyBioSequence(0)
|
||||||
|
bs.SetId(id)
|
||||||
|
bs.TakeSequence(sequence)
|
||||||
|
bs.SetDefinition(definition)
|
||||||
|
return bs
|
||||||
|
}
|
||||||
|
|
||||||
// NewBioSequenceWithQualities creates a new BioSequence object with the given id, sequence, definition, and qualities.
|
// NewBioSequenceWithQualities creates a new BioSequence object with the given id, sequence, definition, and qualities.
|
||||||
//
|
//
|
||||||
// Parameters:
|
// Parameters:
|
||||||
@@ -260,6 +273,28 @@ func (s *BioSequence) Len() int {
|
|||||||
return len(s.sequence)
|
return len(s.sequence)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// MemorySize returns an estimate of the memory footprint of the BioSequence
|
||||||
|
// in bytes. It accounts for the sequence, quality scores, feature data,
|
||||||
|
// annotations, and fixed struct overhead. The estimate is conservative
|
||||||
|
// (cap rather than len for byte slices) so it is suitable for memory-based
|
||||||
|
// batching decisions.
|
||||||
|
func (s *BioSequence) MemorySize() int {
|
||||||
|
if s == nil {
|
||||||
|
return 0
|
||||||
|
}
|
||||||
|
// fixed struct overhead (strings, pointers, mutex pointer)
|
||||||
|
const overhead = 128
|
||||||
|
n := overhead
|
||||||
|
n += cap(s.sequence)
|
||||||
|
n += cap(s.qualities)
|
||||||
|
n += cap(s.feature)
|
||||||
|
n += len(s.id)
|
||||||
|
n += len(s.source)
|
||||||
|
// rough annotation estimate: each key+value pair ~64 bytes on average
|
||||||
|
n += len(s.annotations) * 64
|
||||||
|
return n
|
||||||
|
}
|
||||||
|
|
||||||
// HasQualities checks if the BioSequence has sequence qualitiy scores.
|
// HasQualities checks if the BioSequence has sequence qualitiy scores.
|
||||||
//
|
//
|
||||||
// This function does not have any parameters.
|
// This function does not have any parameters.
|
||||||
@@ -444,6 +479,12 @@ func (s *BioSequence) SetSequence(sequence []byte) {
|
|||||||
s.sequence = obiutils.InPlaceToLower(CopySlice(sequence))
|
s.sequence = obiutils.InPlaceToLower(CopySlice(sequence))
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// TakeSequence stores the slice directly without copying, then lowercases in-place.
|
||||||
|
// The caller must not use the slice after this call.
|
||||||
|
func (s *BioSequence) TakeSequence(sequence []byte) {
|
||||||
|
s.sequence = obiutils.InPlaceToLower(sequence)
|
||||||
|
}
|
||||||
|
|
||||||
func (s *BioSequence) HasValidSequence() bool {
|
func (s *BioSequence) HasValidSequence() bool {
|
||||||
for _, c := range s.sequence {
|
for _, c := range s.sequence {
|
||||||
if !((c >= 'a' && c <= 'z') || c == '-' || c == '.' || c == '[' || c == ']') {
|
if !((c >= 'a' && c <= 'z') || c == '-' || c == '.' || c == '[' || c == ']') {
|
||||||
@@ -458,9 +499,24 @@ func (s *BioSequence) SetQualities(qualities Quality) {
|
|||||||
if s.qualities != nil {
|
if s.qualities != nil {
|
||||||
RecycleSlice(&s.qualities)
|
RecycleSlice(&s.qualities)
|
||||||
}
|
}
|
||||||
|
if len(qualities) > 0 && len(qualities) != len(s.sequence) {
|
||||||
|
log.Panicf("[BioSequence.SetQualities] Sequence %s has a length of %d and qualities a length of %d", s.id, len(s.sequence), len(qualities))
|
||||||
|
}
|
||||||
s.qualities = CopySlice(qualities)
|
s.qualities = CopySlice(qualities)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// TakeQualities stores the slice directly without copying.
|
||||||
|
// The caller must not use the slice after this call.
|
||||||
|
func (s *BioSequence) TakeQualities(qualities Quality) {
|
||||||
|
if s.qualities != nil {
|
||||||
|
RecycleSlice(&s.qualities)
|
||||||
|
}
|
||||||
|
if len(qualities) > 0 && len(qualities) != len(s.sequence) {
|
||||||
|
log.Panicf("[BioSequence.TakeQualities] Sequence %s has a length of %d and qualities a length of %d", s.id, len(s.sequence), len(qualities))
|
||||||
|
}
|
||||||
|
s.qualities = qualities
|
||||||
|
}
|
||||||
|
|
||||||
// A method that appends a byte slice to the qualities of the BioSequence.
|
// A method that appends a byte slice to the qualities of the BioSequence.
|
||||||
func (s *BioSequence) WriteQualities(data []byte) (int, error) {
|
func (s *BioSequence) WriteQualities(data []byte) (int, error) {
|
||||||
s.qualities = append(s.qualities, data...)
|
s.qualities = append(s.qualities, data...)
|
||||||
|
|||||||
@@ -103,7 +103,7 @@ func TestNewBioSequence(t *testing.T) {
|
|||||||
// Return type: None.
|
// Return type: None.
|
||||||
func TestNewBioSequenceWithQualities(t *testing.T) {
|
func TestNewBioSequenceWithQualities(t *testing.T) {
|
||||||
id := "123"
|
id := "123"
|
||||||
sequence := []byte("ATGC")
|
sequence := []byte("atgc")
|
||||||
definition := "DNA sequence"
|
definition := "DNA sequence"
|
||||||
qualities := []byte("1234")
|
qualities := []byte("1234")
|
||||||
|
|
||||||
|
|||||||
@@ -195,7 +195,7 @@ func (s *BioSequenceSlice) ExtractTaxonomy(taxonomy *obitax.Taxonomy, seqAsTaxa
|
|||||||
return nil, fmt.Errorf("sequence %v has no path", s.Id())
|
return nil, fmt.Errorf("sequence %v has no path", s.Id())
|
||||||
}
|
}
|
||||||
last := path[len(path)-1]
|
last := path[len(path)-1]
|
||||||
taxname, _ := obiutils.SplitInTwo(last, ':')
|
taxname, _ := obiutils.LeftSplitInTwo(last, ':')
|
||||||
if idx, ok := s.GetIntAttribute("seq_number"); !ok {
|
if idx, ok := s.GetIntAttribute("seq_number"); !ok {
|
||||||
return nil, errors.New("sequences are not numbered")
|
return nil, errors.New("sequences are not numbered")
|
||||||
} else {
|
} else {
|
||||||
|
|||||||
@@ -141,6 +141,33 @@ var OBILang = gval.NewLanguage(
|
|||||||
gval.Function("max", func(args ...interface{}) (interface{}, error) {
|
gval.Function("max", func(args ...interface{}) (interface{}, error) {
|
||||||
return obiutils.Max(args[0])
|
return obiutils.Max(args[0])
|
||||||
}),
|
}),
|
||||||
|
gval.Function("whichmax", func(args ...interface{}) (interface{}, error) {
|
||||||
|
result, err := obiutils.WhichMax(args[0])
|
||||||
|
if idx, ok := result.(int); ok {
|
||||||
|
return float64(idx), nil
|
||||||
|
}
|
||||||
|
return result, err
|
||||||
|
}),
|
||||||
|
gval.Function("whichmin", func(args ...interface{}) (interface{}, error) {
|
||||||
|
result, err := obiutils.WhichMin(args[0])
|
||||||
|
if idx, ok := result.(int); ok {
|
||||||
|
return float64(idx), nil
|
||||||
|
}
|
||||||
|
return result, err
|
||||||
|
}),
|
||||||
|
|
||||||
|
gval.Function("filtermin", func(args ...interface{}) (interface{}, error) {
|
||||||
|
return obiutils.FilterMin(args[0], args[1])
|
||||||
|
}),
|
||||||
|
|
||||||
|
gval.Function("filtermax", func(args ...interface{}) (interface{}, error) {
|
||||||
|
return obiutils.FilterMax(args[0], args[1])
|
||||||
|
}),
|
||||||
|
|
||||||
|
gval.Function("saturatingsub", func(args ...interface{}) (interface{}, error) {
|
||||||
|
return obiutils.SaturatingSub(args[0], args[1])
|
||||||
|
}),
|
||||||
|
|
||||||
gval.Function("contains", func(args ...interface{}) (interface{}, error) {
|
gval.Function("contains", func(args ...interface{}) (interface{}, error) {
|
||||||
if obiutils.IsAMap(args[0]) {
|
if obiutils.IsAMap(args[0]) {
|
||||||
val := reflect.ValueOf(args[0]).MapIndex(reflect.ValueOf(args[1]))
|
val := reflect.ValueOf(args[0]).MapIndex(reflect.ValueOf(args[1]))
|
||||||
|
|||||||
@@ -1,13 +1,20 @@
|
|||||||
package obiseq
|
package obiseq
|
||||||
|
|
||||||
import (
|
import (
|
||||||
|
"runtime"
|
||||||
"sync"
|
"sync"
|
||||||
|
"sync/atomic"
|
||||||
|
|
||||||
log "github.com/sirupsen/logrus"
|
log "github.com/sirupsen/logrus"
|
||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
const _LargeSliceThreshold = 100 * 1024 // 100 kb — below: leave to GC, above: trigger explicit GC
|
||||||
|
const _GCBytesBudget = int64(256 * 1024 * 1024) // trigger GC every 256 MB of large discards
|
||||||
|
|
||||||
|
var _largeSliceDiscardedBytes = atomic.Int64{}
|
||||||
|
|
||||||
var _BioSequenceByteSlicePool = sync.Pool{
|
var _BioSequenceByteSlicePool = sync.Pool{
|
||||||
New: func() interface{} {
|
New: func() interface{} {
|
||||||
bs := make([]byte, 0, 300)
|
bs := make([]byte, 0, 300)
|
||||||
@@ -34,6 +41,13 @@ func RecycleSlice(s *[]byte) {
|
|||||||
}
|
}
|
||||||
if cap(*s) <= 1024 {
|
if cap(*s) <= 1024 {
|
||||||
_BioSequenceByteSlicePool.Put(s)
|
_BioSequenceByteSlicePool.Put(s)
|
||||||
|
} else if cap(*s) >= _LargeSliceThreshold {
|
||||||
|
n := int64(cap(*s))
|
||||||
|
*s = nil
|
||||||
|
prev := _largeSliceDiscardedBytes.Load()
|
||||||
|
if _largeSliceDiscardedBytes.Add(n)/_GCBytesBudget > prev/_GCBytesBudget {
|
||||||
|
runtime.GC()
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -118,6 +118,9 @@ func (sequence *BioSequence) _revcmpMutation() *BioSequence {
|
|||||||
*/
|
*/
|
||||||
func ReverseComplementWorker(inplace bool) SeqWorker {
|
func ReverseComplementWorker(inplace bool) SeqWorker {
|
||||||
f := func(input *BioSequence) (BioSequenceSlice, error) {
|
f := func(input *BioSequence) (BioSequenceSlice, error) {
|
||||||
|
if input.IsPaired() {
|
||||||
|
input.PairedWith().ReverseComplement(inplace)
|
||||||
|
}
|
||||||
return BioSequenceSlice{input.ReverseComplement(inplace)}, nil
|
return BioSequenceSlice{input.ReverseComplement(inplace)}, nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
+20
-2
@@ -48,7 +48,16 @@ func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSeque
|
|||||||
newSeq.sequence = CopySlice(sequence.Sequence()[from:to])
|
newSeq.sequence = CopySlice(sequence.Sequence()[from:to])
|
||||||
|
|
||||||
if sequence.HasQualities() {
|
if sequence.HasQualities() {
|
||||||
newSeq.qualities = CopySlice(sequence.Qualities()[from:to])
|
qual := sequence.Qualities()
|
||||||
|
if len(qual) != sequence.Len() {
|
||||||
|
log.Panicf(
|
||||||
|
"[BioSequence.Subsequence] Sequence %s has a length of %d and qualities a length of %d",
|
||||||
|
sequence.Id(),
|
||||||
|
sequence.Len(),
|
||||||
|
len(qual),
|
||||||
|
)
|
||||||
|
}
|
||||||
|
newSeq.qualities = CopySlice(qual[from:to])
|
||||||
}
|
}
|
||||||
|
|
||||||
newSeq.id = fmt.Sprintf("%s_sub[%d..%d]", sequence.Id(), from+1, to)
|
newSeq.id = fmt.Sprintf("%s_sub[%d..%d]", sequence.Id(), from+1, to)
|
||||||
@@ -58,7 +67,16 @@ func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSeque
|
|||||||
newSeq.Write(sequence.Sequence()[0:to])
|
newSeq.Write(sequence.Sequence()[0:to])
|
||||||
|
|
||||||
if sequence.HasQualities() {
|
if sequence.HasQualities() {
|
||||||
newSeq.WriteQualities(sequence.Qualities()[0:to])
|
qual := sequence.Qualities()
|
||||||
|
if len(qual) != sequence.Len() {
|
||||||
|
log.Panicf(
|
||||||
|
"[BioSequence.Subsequence] Sequence %s has a length of %d and qualities a length of %d",
|
||||||
|
sequence.Id(),
|
||||||
|
sequence.Len(),
|
||||||
|
len(qual),
|
||||||
|
)
|
||||||
|
}
|
||||||
|
newSeq.WriteQualities(qual[0:to])
|
||||||
}
|
}
|
||||||
|
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -70,6 +70,12 @@ func (s *BioSequence) SetTaxid(taxid string, rank ...string) {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
} else if obidefault.UseRawTaxids() {
|
||||||
|
// Without a loaded taxonomy, extract the bare ID from full-format strings
|
||||||
|
// like "code:12345 [Name]@rank" so that --raw-taxid is honoured everywhere.
|
||||||
|
if _, rawID, _, _, parseErr := obitax.ParseTaxonString(taxid); parseErr == nil {
|
||||||
|
taxid = rawID
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -177,7 +183,7 @@ func (sequence *BioSequence) SetPath(taxonomy *obitax.Taxonomy) []string {
|
|||||||
lpath := path.Len() - 1
|
lpath := path.Len() - 1
|
||||||
|
|
||||||
for i := lpath; i >= 0; i-- {
|
for i := lpath; i >= 0; i-- {
|
||||||
spath[lpath-i] = path.Get(i).String(taxonomy.Code())
|
spath[lpath-i] = path.Get(i).FullString(taxonomy.Code())
|
||||||
}
|
}
|
||||||
|
|
||||||
sequence.SetAttribute("taxonomic_path", spath)
|
sequence.SetAttribute("taxonomic_path", spath)
|
||||||
|
|||||||
@@ -104,11 +104,11 @@ func SeqToSliceWorker(worker SeqWorker,
|
|||||||
for _, s := range input {
|
for _, s := range input {
|
||||||
r, err := worker(s)
|
r, err := worker(s)
|
||||||
if err == nil {
|
if err == nil {
|
||||||
for _, rs := range r {
|
if i+len(r) > cap(output) {
|
||||||
if i == len(output) {
|
output = slices.Grow(output[:i], len(r))
|
||||||
output = slices.Grow(output, cap(output))
|
|
||||||
output = output[:cap(output)]
|
output = output[:cap(output)]
|
||||||
}
|
}
|
||||||
|
for _, rs := range r {
|
||||||
output[i] = rs
|
output[i] = rs
|
||||||
i++
|
i++
|
||||||
}
|
}
|
||||||
|
|||||||
+1
-1
@@ -31,7 +31,7 @@ func NewTaxidFactory(code string, alphabet obiutils.AsciiSet) *TaxidFactory {
|
|||||||
// It extracts the relevant part of the string after the first colon (':') if present.
|
// It extracts the relevant part of the string after the first colon (':') if present.
|
||||||
func (f *TaxidFactory) FromString(taxid string) (Taxid, error) {
|
func (f *TaxidFactory) FromString(taxid string) (Taxid, error) {
|
||||||
taxid = obiutils.AsciiSpaceSet.TrimLeft(taxid)
|
taxid = obiutils.AsciiSpaceSet.TrimLeft(taxid)
|
||||||
part1, part2 := obiutils.SplitInTwo(taxid, ':')
|
part1, part2 := obiutils.LeftSplitInTwo(taxid, ':')
|
||||||
if len(part2) == 0 {
|
if len(part2) == 0 {
|
||||||
taxid = part1
|
taxid = part1
|
||||||
} else {
|
} else {
|
||||||
|
|||||||
+19
-13
@@ -29,6 +29,24 @@ type TaxNode struct {
|
|||||||
alternatenames *map[*string]*string
|
alternatenames *map[*string]*string
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// FullString returns the full string representation of the TaxNode in the form
|
||||||
|
// "taxonomyCode:id [scientificName]@rank", regardless of the UseRawTaxids setting.
|
||||||
|
// This is used internally when a parseable format is required (e.g. taxonomic_path).
|
||||||
|
func (node *TaxNode) FullString(taxonomyCode string) string {
|
||||||
|
if node.HasScientificName() {
|
||||||
|
return fmt.Sprintf("%s:%v [%s]@%s",
|
||||||
|
taxonomyCode,
|
||||||
|
*node.id,
|
||||||
|
node.ScientificName(),
|
||||||
|
node.Rank(),
|
||||||
|
)
|
||||||
|
}
|
||||||
|
|
||||||
|
return fmt.Sprintf("%s:%v",
|
||||||
|
taxonomyCode,
|
||||||
|
*node.id)
|
||||||
|
}
|
||||||
|
|
||||||
// String returns a string representation of the TaxNode, including the taxonomy code,
|
// String returns a string representation of the TaxNode, including the taxonomy code,
|
||||||
// the node ID, and the scientific name. The output format is "taxonomyCode:id [scientificName]".
|
// the node ID, and the scientific name. The output format is "taxonomyCode:id [scientificName]".
|
||||||
//
|
//
|
||||||
@@ -42,19 +60,7 @@ func (node *TaxNode) String(taxonomyCode string) string {
|
|||||||
return *node.id
|
return *node.id
|
||||||
}
|
}
|
||||||
|
|
||||||
if node.HasScientificName() {
|
return node.FullString(taxonomyCode)
|
||||||
return fmt.Sprintf("%s:%v [%s]@%s",
|
|
||||||
taxonomyCode,
|
|
||||||
*node.id,
|
|
||||||
node.ScientificName(),
|
|
||||||
node.Rank(),
|
|
||||||
)
|
|
||||||
}
|
|
||||||
|
|
||||||
return fmt.Sprintf("%s:%v",
|
|
||||||
taxonomyCode,
|
|
||||||
*node.id)
|
|
||||||
|
|
||||||
}
|
}
|
||||||
|
|
||||||
// Id returns the unique identifier of the TaxNode.
|
// Id returns the unique identifier of the TaxNode.
|
||||||
|
|||||||
@@ -64,7 +64,7 @@ func EmpiricalDistCsv(filename string, data [][]Ratio, compressed bool) {
|
|||||||
fmt.Println(err)
|
fmt.Println(err)
|
||||||
}
|
}
|
||||||
|
|
||||||
destfile, err := obiutils.CompressStream(file, true, true)
|
destfile, err := obiutils.CompressStream(file, compressed, true)
|
||||||
if err != nil {
|
if err != nil {
|
||||||
fmt.Println(err)
|
fmt.Println(err)
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -214,6 +214,8 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
|
|||||||
|
|
||||||
iterator = iterator.Speed("Reading sequences")
|
iterator = iterator.Speed("Reading sequences")
|
||||||
|
|
||||||
|
iterator = iterator.RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||||
|
|
||||||
return iterator, nil
|
return iterator, nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -33,6 +33,7 @@ func CLIWriteSequenceCSV(iterator obiiter.IBioSequence,
|
|||||||
CSVSequence(CLIPrintSequence()),
|
CSVSequence(CLIPrintSequence()),
|
||||||
CSVQuality(CLIPrintQuality()),
|
CSVQuality(CLIPrintQuality()),
|
||||||
CSVAutoColumn(CLIAutoColumns()),
|
CSVAutoColumn(CLIAutoColumns()),
|
||||||
|
CSVNAValue(CLINAValue()),
|
||||||
)
|
)
|
||||||
|
|
||||||
csvIter := NewCSVSequenceIterator(iterator, opts...)
|
csvIter := NewCSVSequenceIterator(iterator, opts...)
|
||||||
|
|||||||
@@ -1,6 +1,7 @@
|
|||||||
package obicsv
|
package obicsv
|
||||||
|
|
||||||
import (
|
import (
|
||||||
|
"fmt"
|
||||||
"log"
|
"log"
|
||||||
"slices"
|
"slices"
|
||||||
|
|
||||||
@@ -67,8 +68,19 @@ func CSVBatchFromSequences(batch obiiter.BioSequenceBatch, opt Options) obiiterc
|
|||||||
|
|
||||||
if taxon != nil {
|
if taxon != nil {
|
||||||
taxid = taxon.String()
|
taxid = taxon.String()
|
||||||
|
} else if ta, ok := sequence.GetAttribute("taxid"); ok {
|
||||||
|
switch tv := ta.(type) {
|
||||||
|
case string:
|
||||||
|
taxid = tv
|
||||||
|
case int:
|
||||||
|
taxid = fmt.Sprintf("%d", tv)
|
||||||
|
case float64:
|
||||||
|
taxid = fmt.Sprintf("%d", int(tv))
|
||||||
|
default:
|
||||||
|
taxid = opt.CSVNAValue()
|
||||||
|
}
|
||||||
} else {
|
} else {
|
||||||
taxid = sequence.Taxid()
|
taxid = opt.CSVNAValue()
|
||||||
}
|
}
|
||||||
|
|
||||||
record["taxid"] = taxid
|
record["taxid"] = taxid
|
||||||
|
|||||||
@@ -46,8 +46,7 @@ func CLIDistributeSequence(sequences obiiter.IBioSequence) {
|
|||||||
formater = obiformats.WriteSequencesToFile
|
formater = obiformats.WriteSequencesToFile
|
||||||
}
|
}
|
||||||
|
|
||||||
dispatcher := sequences.Distribute(CLISequenceClassifier(),
|
dispatcher := sequences.Distribute(CLISequenceClassifier())
|
||||||
obidefault.BatchSize())
|
|
||||||
|
|
||||||
obiformats.WriterDispatcher(CLIFileNamePattern(),
|
obiformats.WriterDispatcher(CLIFileNamePattern(),
|
||||||
dispatcher, formater, opts...,
|
dispatcher, formater, opts...,
|
||||||
|
|||||||
@@ -21,12 +21,10 @@ func PairingOptionSet(options *getoptions.GetOpt) {
|
|||||||
options.StringVar(&_ForwardFile, "forward-reads", "",
|
options.StringVar(&_ForwardFile, "forward-reads", "",
|
||||||
options.Alias("F"),
|
options.Alias("F"),
|
||||||
options.ArgName("FILENAME_F"),
|
options.ArgName("FILENAME_F"),
|
||||||
options.Required("You must provide at a forward file"),
|
|
||||||
options.Description("The file names containing the forward reads"))
|
options.Description("The file names containing the forward reads"))
|
||||||
options.StringVar(&_ReverseFile, "reverse-reads", "",
|
options.StringVar(&_ReverseFile, "reverse-reads", "",
|
||||||
options.Alias("R"),
|
options.Alias("R"),
|
||||||
options.ArgName("FILENAME_R"),
|
options.ArgName("FILENAME_R"),
|
||||||
options.Required("You must provide a reverse file"),
|
|
||||||
options.Description("The file names containing the reverse reads"))
|
options.Description("The file names containing the reverse reads"))
|
||||||
options.IntVar(&_Delta, "delta", _Delta,
|
options.IntVar(&_Delta, "delta", _Delta,
|
||||||
options.Alias("D"),
|
options.Alias("D"),
|
||||||
@@ -72,6 +70,10 @@ func CLIPairedSequence() (obiiter.IBioSequence, error) {
|
|||||||
return paired, nil
|
return paired, nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func CLIHasPairedFiles() bool {
|
||||||
|
return _ForwardFile != "" && _ReverseFile != ""
|
||||||
|
}
|
||||||
|
|
||||||
func CLIDelta() int {
|
func CLIDelta() int {
|
||||||
return _Delta
|
return _Delta
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -291,5 +291,5 @@ func IndexReferenceDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
|||||||
go f()
|
go f()
|
||||||
}
|
}
|
||||||
|
|
||||||
return indexed.Rebatch(obidefault.BatchSize())
|
return indexed.RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -99,6 +99,17 @@ func (data1 *DataSummary) Add(data2 *DataSummary) *DataSummary {
|
|||||||
rep.sample_singletons = sumUpdateIntMap(data1.sample_singletons, data2.sample_singletons)
|
rep.sample_singletons = sumUpdateIntMap(data1.sample_singletons, data2.sample_singletons)
|
||||||
rep.sample_obiclean_bad = sumUpdateIntMap(data1.sample_obiclean_bad, data2.sample_obiclean_bad)
|
rep.sample_obiclean_bad = sumUpdateIntMap(data1.sample_obiclean_bad, data2.sample_obiclean_bad)
|
||||||
|
|
||||||
|
for k, m1 := range data1.map_summaries {
|
||||||
|
rep.map_summaries[k] = m1
|
||||||
|
}
|
||||||
|
for k, m2 := range data2.map_summaries {
|
||||||
|
if m1, ok := rep.map_summaries[k]; ok {
|
||||||
|
rep.map_summaries[k] = sumUpdateIntMap(m1, m2)
|
||||||
|
} else {
|
||||||
|
rep.map_summaries[k] = m2
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
return rep
|
return rep
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -163,8 +174,9 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
|
|||||||
summaries := make([]*DataSummary, nproc)
|
summaries := make([]*DataSummary, nproc)
|
||||||
|
|
||||||
for n := 0; n < nproc; n++ {
|
for n := 0; n < nproc; n++ {
|
||||||
|
summaries[n] = NewDataSummary()
|
||||||
for _, v := range summarise {
|
for _, v := range summarise {
|
||||||
summaries[n].map_summaries[v] = make(map[string]int, 0)
|
summaries[n].map_summaries[v] = make(map[string]int)
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -174,6 +186,11 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
|
|||||||
batch := iseq.Get()
|
batch := iseq.Get()
|
||||||
for _, seq := range batch.Slice() {
|
for _, seq := range batch.Slice() {
|
||||||
summary.Update(seq)
|
summary.Update(seq)
|
||||||
|
for _, attr := range summarise {
|
||||||
|
if m, ok := seq.GetIntMap(attr); ok {
|
||||||
|
summary.map_summaries[attr] = sumUpdateIntMap(summary.map_summaries[attr], m)
|
||||||
|
}
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
waiter.Done()
|
waiter.Done()
|
||||||
@@ -181,11 +198,9 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
|
|||||||
|
|
||||||
waiter.Add(nproc)
|
waiter.Add(nproc)
|
||||||
|
|
||||||
summaries[0] = NewDataSummary()
|
|
||||||
go ff(iterator, summaries[0])
|
go ff(iterator, summaries[0])
|
||||||
|
|
||||||
for i := 1; i < nproc; i++ {
|
for i := 1; i < nproc; i++ {
|
||||||
summaries[i] = NewDataSummary()
|
|
||||||
go ff(iterator.Split(), summaries[i])
|
go ff(iterator.Split(), summaries[i])
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -246,5 +261,14 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
if len(rep.map_summaries) > 0 {
|
||||||
|
mapDict := make(map[string]interface{}, len(rep.map_summaries))
|
||||||
|
for attr, counts := range rep.map_summaries {
|
||||||
|
mapDict[attr] = counts
|
||||||
|
}
|
||||||
|
dict["map_summaries"] = mapDict
|
||||||
|
}
|
||||||
|
|
||||||
return dict
|
return dict
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -114,10 +114,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
|
|||||||
aanot["obimultiplex_direction"] = direction
|
aanot["obimultiplex_direction"] = direction
|
||||||
|
|
||||||
aanot["obimultiplex_forward_match"] = forward_match
|
aanot["obimultiplex_forward_match"] = forward_match
|
||||||
aanot["obimultiplex_forward_mismatches"] = forward_mismatches
|
aanot["obimultiplex_forward_error"] = forward_mismatches
|
||||||
|
|
||||||
aanot["obimultiplex_reverse_match"] = reverse_match
|
aanot["obimultiplex_reverse_match"] = reverse_match
|
||||||
aanot["obimultiplex_reverse_mismatches"] = reverse_mismatches
|
aanot["obimultiplex_reverse_error"] = reverse_mismatches
|
||||||
|
|
||||||
aanot["sample"] = sample
|
aanot["sample"] = sample
|
||||||
aanot["experiment"] = experiment
|
aanot["experiment"] = experiment
|
||||||
@@ -125,10 +125,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
|
|||||||
banot["obimultiplex_direction"] = direction
|
banot["obimultiplex_direction"] = direction
|
||||||
|
|
||||||
banot["obimultiplex_forward_match"] = forward_match
|
banot["obimultiplex_forward_match"] = forward_match
|
||||||
banot["obimultiplex_forward_mismatches"] = forward_mismatches
|
banot["obimultiplex_forward_error"] = forward_mismatches
|
||||||
|
|
||||||
banot["obimultiplex_reverse_match"] = reverse_match
|
banot["obimultiplex_reverse_match"] = reverse_match
|
||||||
banot["obimultiplex_reverse_mismatches"] = reverse_mismatches
|
banot["obimultiplex_reverse_error"] = reverse_mismatches
|
||||||
|
|
||||||
banot["sample"] = sample
|
banot["sample"] = sample
|
||||||
banot["experiment"] = experiment
|
banot["experiment"] = experiment
|
||||||
|
|||||||
@@ -276,6 +276,44 @@ func InterfaceToStringMap(i interface{}) (val map[string]string, err error) {
|
|||||||
return
|
return
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func InterfaceToMapOfIntSlice(i interface{}) (val map[string][]int, err error) {
|
||||||
|
err = nil
|
||||||
|
switch m := i.(type) {
|
||||||
|
case map[string][]int:
|
||||||
|
val = m
|
||||||
|
case map[string]interface{}:
|
||||||
|
val = make(map[string][]int, len(m))
|
||||||
|
for k, v := range m {
|
||||||
|
val[k], err = InterfaceToIntSlice(v)
|
||||||
|
if err != nil {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
}
|
||||||
|
default:
|
||||||
|
err = &NotAMapInt{"value attribute cannot be casted to a map[string][]int"}
|
||||||
|
}
|
||||||
|
return
|
||||||
|
}
|
||||||
|
|
||||||
|
func InterfaceToMapOfStringSlice(i interface{}) (val map[string][]string, err error) {
|
||||||
|
err = nil
|
||||||
|
switch m := i.(type) {
|
||||||
|
case map[string][]string:
|
||||||
|
val = m
|
||||||
|
case map[string]interface{}:
|
||||||
|
val = make(map[string][]string, len(m))
|
||||||
|
for k, v := range m {
|
||||||
|
val[k], err = InterfaceToStringSlice(v)
|
||||||
|
if err != nil {
|
||||||
|
return
|
||||||
|
}
|
||||||
|
}
|
||||||
|
default:
|
||||||
|
err = &NotAMapInt{"value attribute cannot be casted to a map[string][]string"}
|
||||||
|
}
|
||||||
|
return
|
||||||
|
}
|
||||||
|
|
||||||
func InterfaceToStringSlice(i interface{}) (val []string, err error) {
|
func InterfaceToStringSlice(i interface{}) (val []string, err error) {
|
||||||
err = nil
|
err = nil
|
||||||
|
|
||||||
|
|||||||
@@ -0,0 +1,85 @@
|
|||||||
|
package obiutils
|
||||||
|
|
||||||
|
import (
|
||||||
|
"fmt"
|
||||||
|
"strconv"
|
||||||
|
"strings"
|
||||||
|
"unicode"
|
||||||
|
)
|
||||||
|
|
||||||
|
// ParseMemSize parses a human-readable memory size string and returns the
|
||||||
|
// equivalent number of bytes. The value is a number optionally followed by a
|
||||||
|
// unit suffix (case-insensitive):
|
||||||
|
//
|
||||||
|
// B or (no suffix) — bytes
|
||||||
|
// K or KB — kibibytes (1 024)
|
||||||
|
// M or MB — mebibytes (1 048 576)
|
||||||
|
// G or GB — gibibytes (1 073 741 824)
|
||||||
|
// T or TB — tebibytes (1 099 511 627 776)
|
||||||
|
//
|
||||||
|
// Examples: "512", "128K", "128k", "64M", "1G", "2GB"
|
||||||
|
func ParseMemSize(s string) (int, error) {
|
||||||
|
s = strings.TrimSpace(s)
|
||||||
|
if s == "" {
|
||||||
|
return 0, fmt.Errorf("empty memory size string")
|
||||||
|
}
|
||||||
|
|
||||||
|
// split numeric prefix from unit suffix
|
||||||
|
i := 0
|
||||||
|
for i < len(s) && (unicode.IsDigit(rune(s[i])) || s[i] == '.') {
|
||||||
|
i++
|
||||||
|
}
|
||||||
|
numStr := s[:i]
|
||||||
|
unit := strings.ToUpper(strings.TrimSpace(s[i:]))
|
||||||
|
// strip trailing 'B' from two-letter units (KB→K, MB→M …)
|
||||||
|
if len(unit) == 2 && unit[1] == 'B' {
|
||||||
|
unit = unit[:1]
|
||||||
|
}
|
||||||
|
|
||||||
|
val, err := strconv.ParseFloat(numStr, 64)
|
||||||
|
if err != nil {
|
||||||
|
return 0, fmt.Errorf("invalid memory size %q: %w", s, err)
|
||||||
|
}
|
||||||
|
|
||||||
|
var multiplier float64
|
||||||
|
switch unit {
|
||||||
|
case "", "B":
|
||||||
|
multiplier = 1
|
||||||
|
case "K":
|
||||||
|
multiplier = 1024
|
||||||
|
case "M":
|
||||||
|
multiplier = 1024 * 1024
|
||||||
|
case "G":
|
||||||
|
multiplier = 1024 * 1024 * 1024
|
||||||
|
case "T":
|
||||||
|
multiplier = 1024 * 1024 * 1024 * 1024
|
||||||
|
default:
|
||||||
|
return 0, fmt.Errorf("unknown memory unit %q in %q", unit, s)
|
||||||
|
}
|
||||||
|
|
||||||
|
return int(val * multiplier), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// FormatMemSize formats a byte count as a human-readable string with the
|
||||||
|
// largest unit that produces a value ≥ 1 (e.g. 1536 → "1.5K").
|
||||||
|
func FormatMemSize(n int) string {
|
||||||
|
units := []struct {
|
||||||
|
suffix string
|
||||||
|
size int
|
||||||
|
}{
|
||||||
|
{"T", 1024 * 1024 * 1024 * 1024},
|
||||||
|
{"G", 1024 * 1024 * 1024},
|
||||||
|
{"M", 1024 * 1024},
|
||||||
|
{"K", 1024},
|
||||||
|
}
|
||||||
|
for _, u := range units {
|
||||||
|
if n >= u.size {
|
||||||
|
v := float64(n) / float64(u.size)
|
||||||
|
if v == float64(int(v)) {
|
||||||
|
return fmt.Sprintf("%d%s", int(v), u.suffix)
|
||||||
|
}
|
||||||
|
return fmt.Sprintf("%.1f%s", v, u.suffix)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return fmt.Sprintf("%dB", n)
|
||||||
|
}
|
||||||
+365
-4
@@ -34,6 +34,26 @@ func MinMaxSlice[T constraints.Ordered](vec []T) (min, max T) {
|
|||||||
return
|
return
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func FilterMinSlice[T constraints.Ordered](vec []T, minimum T) []T {
|
||||||
|
result := make([]T, 0, len(vec))
|
||||||
|
for _, v := range vec {
|
||||||
|
if v >= minimum {
|
||||||
|
result = append(result, v)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
|
func FilterMaxSlice[T constraints.Ordered](vec []T, maximum T) []T {
|
||||||
|
result := make([]T, 0, len(vec))
|
||||||
|
for _, v := range vec {
|
||||||
|
if v <= maximum {
|
||||||
|
result = append(result, v)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
func MaxMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
|
func MaxMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
|
||||||
var maxKey K
|
var maxKey K
|
||||||
var maxValue T
|
var maxValue T
|
||||||
@@ -73,6 +93,46 @@ func MinMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
|
|||||||
return minKey, minValue, nil
|
return minKey, minValue, nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func FilterMinMap[K comparable, T constraints.Ordered](values map[K]T, minimum T) map[K]T {
|
||||||
|
result := make(map[K]T)
|
||||||
|
for k, v := range values {
|
||||||
|
if v >= minimum {
|
||||||
|
result[k] = v
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
|
func FilterMaxMap[K comparable, T constraints.Ordered](values map[K]T, maximum T) map[K]T {
|
||||||
|
result := make(map[K]T)
|
||||||
|
for k, v := range values {
|
||||||
|
if v <= maximum {
|
||||||
|
result[k] = v
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
|
func SaturatingSubSlice[T Numeric](vec []T, sub T) []T {
|
||||||
|
result := make([]T, len(vec))
|
||||||
|
for i, v := range vec {
|
||||||
|
if v > sub {
|
||||||
|
result[i] = v - sub
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
|
func SaturatingSubMap[K comparable, T Numeric](values map[K]T, sub T) map[K]T {
|
||||||
|
result := make(map[K]T)
|
||||||
|
for k, v := range values {
|
||||||
|
if v > sub {
|
||||||
|
result[k] = v - sub
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result
|
||||||
|
}
|
||||||
|
|
||||||
// Min returns the smallest element in a slice/array or map,
|
// Min returns the smallest element in a slice/array or map,
|
||||||
// or the value itself if data is a single comparable value.
|
// or the value itself if data is a single comparable value.
|
||||||
// Returns an error if the container is empty or the type is unsupported.
|
// Returns an error if the container is empty or the type is unsupported.
|
||||||
@@ -135,11 +195,121 @@ func Max(data interface{}) (interface{}, error) {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func FilterMin(data interface{}, minimum interface{}) (interface{}, error) {
|
||||||
|
v := reflect.ValueOf(data)
|
||||||
|
switch v.Kind() {
|
||||||
|
case reflect.Slice, reflect.Array:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty slice or array")
|
||||||
|
}
|
||||||
|
return filterMinFromIterable(v, minimum)
|
||||||
|
case reflect.Map:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty map")
|
||||||
|
}
|
||||||
|
return filterMinFromMap(v, minimum)
|
||||||
|
default:
|
||||||
|
if !isOrderedKind(v.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||||
|
}
|
||||||
|
return data, nil
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func FilterMax(data interface{}, maximum interface{}) (interface{}, error) {
|
||||||
|
v := reflect.ValueOf(data)
|
||||||
|
switch v.Kind() {
|
||||||
|
case reflect.Slice, reflect.Array:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty slice or array")
|
||||||
|
}
|
||||||
|
return filterMaxFromIterable(v, maximum)
|
||||||
|
case reflect.Map:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty map")
|
||||||
|
}
|
||||||
|
return filterMaxFromMap(v, maximum)
|
||||||
|
default:
|
||||||
|
if !isOrderedKind(v.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||||
|
}
|
||||||
|
return data, nil
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func SaturatingSub(data interface{}, sub interface{}) (interface{}, error) {
|
||||||
|
v := reflect.ValueOf(data)
|
||||||
|
switch v.Kind() {
|
||||||
|
case reflect.Slice, reflect.Array:
|
||||||
|
return saturatingSubFromIterable(v, sub)
|
||||||
|
case reflect.Map:
|
||||||
|
return saturatingSubFromMap(v, sub)
|
||||||
|
default:
|
||||||
|
if !isNumericKind(v.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||||
|
}
|
||||||
|
r, err := saturatingSubValues(v, reflect.ValueOf(sub))
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
return r.Interface(), nil
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func saturatingSubFromIterable(v reflect.Value, sub interface{}) (interface{}, error) {
|
||||||
|
subVal := reflect.ValueOf(sub)
|
||||||
|
result := reflect.MakeSlice(v.Type(), v.Len(), v.Len())
|
||||||
|
for i := 0; i < v.Len(); i++ {
|
||||||
|
r, err := saturatingSubValues(v.Index(i), subVal)
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
result.Index(i).Set(r)
|
||||||
|
}
|
||||||
|
return result.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func saturatingSubFromMap(v reflect.Value, sub interface{}) (interface{}, error) {
|
||||||
|
subVal := reflect.ValueOf(sub)
|
||||||
|
result := reflect.MakeMap(v.Type())
|
||||||
|
for _, key := range v.MapKeys() {
|
||||||
|
r, err := saturatingSubValues(v.MapIndex(key), subVal)
|
||||||
|
if err != nil {
|
||||||
|
return nil, err
|
||||||
|
}
|
||||||
|
if !r.IsZero() {
|
||||||
|
result.SetMapIndex(key, r)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func saturatingSubValues(a, b reflect.Value) (reflect.Value, error) {
|
||||||
|
result := reflect.New(a.Type()).Elem()
|
||||||
|
switch a.Kind() {
|
||||||
|
case reflect.Int, reflect.Int8, reflect.Int16, reflect.Int32, reflect.Int64:
|
||||||
|
if av, bv := a.Int(), b.Int(); av > bv {
|
||||||
|
result.SetInt(av - bv)
|
||||||
|
}
|
||||||
|
case reflect.Uint, reflect.Uint8, reflect.Uint16, reflect.Uint32, reflect.Uint64:
|
||||||
|
if av, bv := a.Uint(), b.Uint(); av > bv {
|
||||||
|
result.SetUint(av - bv)
|
||||||
|
}
|
||||||
|
case reflect.Float32, reflect.Float64:
|
||||||
|
if av, bv := a.Float(), b.Float(); av > bv {
|
||||||
|
result.SetFloat(av - bv)
|
||||||
|
}
|
||||||
|
default:
|
||||||
|
return reflect.Value{}, fmt.Errorf("unsupported type for saturating subtraction: %s", a.Kind())
|
||||||
|
}
|
||||||
|
return result, nil
|
||||||
|
}
|
||||||
|
|
||||||
// maxFromIterable scans a slice/array to find the maximum.
|
// maxFromIterable scans a slice/array to find the maximum.
|
||||||
func maxFromIterable(v reflect.Value) (interface{}, error) {
|
func maxFromIterable(v reflect.Value) (interface{}, error) {
|
||||||
var best reflect.Value
|
var best reflect.Value
|
||||||
for i := 0; i < v.Len(); i++ {
|
for i := 0; i < v.Len(); i++ {
|
||||||
elem := v.Index(i)
|
elem := unwrapInterface(v.Index(i))
|
||||||
if !isOrderedKind(elem.Kind()) {
|
if !isOrderedKind(elem.Kind()) {
|
||||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
}
|
}
|
||||||
@@ -154,7 +324,7 @@ func maxFromIterable(v reflect.Value) (interface{}, error) {
|
|||||||
func minFromIterable(v reflect.Value) (interface{}, error) {
|
func minFromIterable(v reflect.Value) (interface{}, error) {
|
||||||
var minVal reflect.Value
|
var minVal reflect.Value
|
||||||
for i := 0; i < v.Len(); i++ {
|
for i := 0; i < v.Len(); i++ {
|
||||||
elem := v.Index(i)
|
elem := unwrapInterface(v.Index(i))
|
||||||
if !isOrderedKind(elem.Kind()) {
|
if !isOrderedKind(elem.Kind()) {
|
||||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
}
|
}
|
||||||
@@ -165,12 +335,182 @@ func minFromIterable(v reflect.Value) (interface{}, error) {
|
|||||||
return minVal.Interface(), nil
|
return minVal.Interface(), nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func filterMinFromIterable(v reflect.Value, minimum interface{}) (interface{}, error) {
|
||||||
|
minVal := reflect.ValueOf(minimum)
|
||||||
|
result := reflect.MakeSlice(v.Type(), 0, v.Len())
|
||||||
|
for i := 0; i < v.Len(); i++ {
|
||||||
|
elem := unwrapInterface(v.Index(i))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if !less(elem, minVal) { // elem >= minimum
|
||||||
|
result = reflect.Append(result, elem)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func filterMaxFromIterable(v reflect.Value, maximum interface{}) (interface{}, error) {
|
||||||
|
maxVal := reflect.ValueOf(maximum)
|
||||||
|
result := reflect.MakeSlice(v.Type(), 0, v.Len())
|
||||||
|
for i := 0; i < v.Len(); i++ {
|
||||||
|
elem := unwrapInterface(v.Index(i))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if !greater(elem, maxVal) { // elem <= maximum
|
||||||
|
result = reflect.Append(result, elem)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// whichMaxFromIterable returns the index of the maximum element in a slice/array.
|
||||||
|
func whichMaxFromIterable(v reflect.Value) (int, error) {
|
||||||
|
var best reflect.Value
|
||||||
|
bestIdx := 0
|
||||||
|
for i := 0; i < v.Len(); i++ {
|
||||||
|
elem := unwrapInterface(v.Index(i))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if i == 0 || greater(elem, best) {
|
||||||
|
best = elem
|
||||||
|
bestIdx = i
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return bestIdx, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// whichMinFromIterable returns the index of the minimum element in a slice/array.
|
||||||
|
func whichMinFromIterable(v reflect.Value) (int, error) {
|
||||||
|
var minVal reflect.Value
|
||||||
|
minIdx := 0
|
||||||
|
for i := 0; i < v.Len(); i++ {
|
||||||
|
elem := unwrapInterface(v.Index(i))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if i == 0 || less(elem, minVal) {
|
||||||
|
minVal = elem
|
||||||
|
minIdx = i
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return minIdx, nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// whichMaxFromMap returns the key associated with the maximum value in a map.
|
||||||
|
func whichMaxFromMap(v reflect.Value) (interface{}, error) {
|
||||||
|
var best reflect.Value
|
||||||
|
var bestKey reflect.Value
|
||||||
|
first := true
|
||||||
|
for _, key := range v.MapKeys() {
|
||||||
|
elem := unwrapInterface(v.MapIndex(key))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if first || greater(elem, best) {
|
||||||
|
best = elem
|
||||||
|
bestKey = key
|
||||||
|
first = false
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return bestKey.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// whichMinFromMap returns the key associated with the minimum value in a map.
|
||||||
|
func whichMinFromMap(v reflect.Value) (interface{}, error) {
|
||||||
|
var minVal reflect.Value
|
||||||
|
var minKey reflect.Value
|
||||||
|
first := true
|
||||||
|
for _, key := range v.MapKeys() {
|
||||||
|
elem := unwrapInterface(v.MapIndex(key))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if first || less(elem, minVal) {
|
||||||
|
minVal = elem
|
||||||
|
minKey = key
|
||||||
|
first = false
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return minKey.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
// WhichMax returns the key (for a map) or index (for a slice/array) of the maximum value.
|
||||||
|
func WhichMax(data interface{}) (interface{}, error) {
|
||||||
|
v := reflect.ValueOf(data)
|
||||||
|
switch v.Kind() {
|
||||||
|
case reflect.Slice, reflect.Array:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty slice or array")
|
||||||
|
}
|
||||||
|
return whichMaxFromIterable(v)
|
||||||
|
case reflect.Map:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty map")
|
||||||
|
}
|
||||||
|
return whichMaxFromMap(v)
|
||||||
|
default:
|
||||||
|
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// WhichMin returns the key (for a map) or index (for a slice/array) of the minimum value.
|
||||||
|
func WhichMin(data interface{}) (interface{}, error) {
|
||||||
|
v := reflect.ValueOf(data)
|
||||||
|
switch v.Kind() {
|
||||||
|
case reflect.Slice, reflect.Array:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty slice or array")
|
||||||
|
}
|
||||||
|
return whichMinFromIterable(v)
|
||||||
|
case reflect.Map:
|
||||||
|
if v.Len() == 0 {
|
||||||
|
return nil, errors.New("empty map")
|
||||||
|
}
|
||||||
|
return whichMinFromMap(v)
|
||||||
|
default:
|
||||||
|
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
func filterMinFromMap(v reflect.Value, minimum interface{}) (interface{}, error) {
|
||||||
|
minVal := reflect.ValueOf(minimum)
|
||||||
|
result := reflect.MakeMap(v.Type())
|
||||||
|
for _, key := range v.MapKeys() {
|
||||||
|
elem := unwrapInterface(v.MapIndex(key))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if !less(elem, minVal) { // elem >= minimum
|
||||||
|
result.SetMapIndex(key, elem)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
|
func filterMaxFromMap(v reflect.Value, maximum interface{}) (interface{}, error) {
|
||||||
|
maxVal := reflect.ValueOf(maximum)
|
||||||
|
result := reflect.MakeMap(v.Type())
|
||||||
|
for _, key := range v.MapKeys() {
|
||||||
|
elem := unwrapInterface(v.MapIndex(key))
|
||||||
|
if !isOrderedKind(elem.Kind()) {
|
||||||
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
|
}
|
||||||
|
if !greater(elem, maxVal) { // elem <= maximum
|
||||||
|
result.SetMapIndex(key, elem)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return result.Interface(), nil
|
||||||
|
}
|
||||||
|
|
||||||
// maxFromMap scans map values to find the maximum.
|
// maxFromMap scans map values to find the maximum.
|
||||||
func maxFromMap(v reflect.Value) (interface{}, error) {
|
func maxFromMap(v reflect.Value) (interface{}, error) {
|
||||||
var best reflect.Value
|
var best reflect.Value
|
||||||
first := true
|
first := true
|
||||||
for _, key := range v.MapKeys() {
|
for _, key := range v.MapKeys() {
|
||||||
elem := v.MapIndex(key)
|
elem := unwrapInterface(v.MapIndex(key))
|
||||||
if !isOrderedKind(elem.Kind()) {
|
if !isOrderedKind(elem.Kind()) {
|
||||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
}
|
}
|
||||||
@@ -187,7 +527,7 @@ func minFromMap(v reflect.Value) (interface{}, error) {
|
|||||||
var minVal reflect.Value
|
var minVal reflect.Value
|
||||||
first := true
|
first := true
|
||||||
for _, key := range v.MapKeys() {
|
for _, key := range v.MapKeys() {
|
||||||
elem := v.MapIndex(key)
|
elem := unwrapInterface(v.MapIndex(key))
|
||||||
if !isOrderedKind(elem.Kind()) {
|
if !isOrderedKind(elem.Kind()) {
|
||||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||||
}
|
}
|
||||||
@@ -199,6 +539,27 @@ func minFromMap(v reflect.Value) (interface{}, error) {
|
|||||||
return minVal.Interface(), nil
|
return minVal.Interface(), nil
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func isNumericKind(k reflect.Kind) bool {
|
||||||
|
switch k {
|
||||||
|
case reflect.Int, reflect.Int8, reflect.Int16, reflect.Int32, reflect.Int64,
|
||||||
|
reflect.Uint, reflect.Uint8, reflect.Uint16, reflect.Uint32, reflect.Uint64,
|
||||||
|
reflect.Float32, reflect.Float64:
|
||||||
|
return true
|
||||||
|
default:
|
||||||
|
return false
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// unwrapInterface returns v.Elem() when v holds an interface value, otherwise v unchanged.
|
||||||
|
// This is necessary when iterating map[string]interface{} or []interface{} via reflection:
|
||||||
|
// the element Kind is reflect.Interface, not the underlying concrete type.
|
||||||
|
func unwrapInterface(v reflect.Value) reflect.Value {
|
||||||
|
if v.Kind() == reflect.Interface {
|
||||||
|
return v.Elem()
|
||||||
|
}
|
||||||
|
return v
|
||||||
|
}
|
||||||
|
|
||||||
// isOrderedKind reports whether k supports comparison ordering.
|
// isOrderedKind reports whether k supports comparison ordering.
|
||||||
func isOrderedKind(k reflect.Kind) bool {
|
func isOrderedKind(k reflect.Kind) bool {
|
||||||
switch k {
|
switch k {
|
||||||
|
|||||||
+15
-1
@@ -144,7 +144,7 @@ func (r *AsciiSet) TrimLeft(s string) string {
|
|||||||
return s[i:]
|
return s[i:]
|
||||||
}
|
}
|
||||||
|
|
||||||
func SplitInTwo(s string, sep byte) (string, string) {
|
func LeftSplitInTwo(s string, sep byte) (string, string) {
|
||||||
i := 0
|
i := 0
|
||||||
for ; i < len(s); i++ {
|
for ; i < len(s); i++ {
|
||||||
c := s[i]
|
c := s[i]
|
||||||
@@ -157,3 +157,17 @@ func SplitInTwo(s string, sep byte) (string, string) {
|
|||||||
}
|
}
|
||||||
return s[:i], s[i+1:]
|
return s[:i], s[i+1:]
|
||||||
}
|
}
|
||||||
|
|
||||||
|
func RightSplitInTwo(s string, sep byte) (string, string) {
|
||||||
|
i := len(s) - 1
|
||||||
|
for ; i >= 0; i-- {
|
||||||
|
c := s[i]
|
||||||
|
if c == sep {
|
||||||
|
break
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if i == len(s) {
|
||||||
|
return s, ""
|
||||||
|
}
|
||||||
|
return s[:i], s[i+1:]
|
||||||
|
}
|
||||||
|
|||||||
@@ -0,0 +1,302 @@
|
|||||||
|
# Objective
|
||||||
|
|
||||||
|
Fully document OBITools (version 4, written in Go) in English, using a 4‑phase incremental pipeline.
|
||||||
|
|
||||||
|
You **MUST** use the available MCP servers:
|
||||||
|
|
||||||
|
- `cclsp` – exact definitions, references, diagnostics
|
||||||
|
- `jcodemunch` – code indexing, symbol extraction
|
||||||
|
- `treesitter` – AST and CLI parsing
|
||||||
|
- `context7` – external documentation
|
||||||
|
|
||||||
|
All tool calls must follow the exact API described in the MCP server documentation. If a required tool is unavailable, you **MUST** log the error and stop execution.
|
||||||
|
|
||||||
|
### Tool call format (CRITICAL)
|
||||||
|
|
||||||
|
Tool calls **MUST** use this exact XML format — no spaces inside the angle brackets:
|
||||||
|
|
||||||
|
```
|
||||||
|
<function=tool_name>
|
||||||
|
{"param": "value"}
|
||||||
|
</function>
|
||||||
|
```
|
||||||
|
|
||||||
|
**FORBIDDEN** — these variants will cause parse errors and must NEVER be used:
|
||||||
|
- `< function=tool_name >` (spaces around the tag name)
|
||||||
|
- `< function = tool_name>` (spaces around `=`)
|
||||||
|
- `<function = tool_name>` (space before `=`)
|
||||||
|
|
||||||
|
The opening tag is `<function=tool_name>` with **zero spaces** inside `<` and `>`.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Global rules
|
||||||
|
|
||||||
|
** You are not allowed to read twice the same file in a row. **
|
||||||
|
|
||||||
|
## Language
|
||||||
|
|
||||||
|
- All generated documentation **MUST** be in English.
|
||||||
|
- If an existing documentation file is in French:
|
||||||
|
1. Translate it to English
|
||||||
|
2. Save the original as `.fr.md` **before** overwriting
|
||||||
|
3. Write the new English version
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Execution mode (STRICT)
|
||||||
|
|
||||||
|
You are operating in **STRICT TOOL MODE**:
|
||||||
|
|
||||||
|
- If a file must be written, you **MUST** use the `Shell` tool.
|
||||||
|
- You **MUST NOT** read entire directory listings into memory.
|
||||||
|
- You **MUST** work with **one item at a time** using a simple text file as a task queue.
|
||||||
|
|
||||||
|
### Reading files before writing
|
||||||
|
|
||||||
|
- **Before writing to an existing documentation file**, you must first read it using the `Read` tool.
|
||||||
|
- **When documenting a single Go source file**, you only need to read that one file (plus up to 4-5 helper files if needed for context).
|
||||||
|
- Do NOT read the entire codebase - only what is necessary to document the current file.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
### Rules
|
||||||
|
|
||||||
|
- Always write the **full** file (no partial updates).
|
||||||
|
- Paths are relative to the project root; directories are created implicitly.
|
||||||
|
- Content must be valid UTF‑8; use `\n` line endings.
|
||||||
|
- Do **not** wrap content in backticks.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Progress tracking: task queue files
|
||||||
|
|
||||||
|
We use **line‑oriented task files** to avoid loading large lists into memory. Each phase has its own task file:
|
||||||
|
|
||||||
|
- `docs/todo/phase1.txt` – list of Go files (one per line) to document.
|
||||||
|
- `docs/todo/phase1bis.txt` – same list, but after phase1 is done.
|
||||||
|
- `docs/todo/phase2.txt` – list of packages.
|
||||||
|
- `docs/todo/phase3.txt` – list of tools.
|
||||||
|
|
||||||
|
**How it works:**
|
||||||
|
|
||||||
|
1. At the start of a phase, if the task file does not exist, it is created by scanning the codebase once (Phase 0 or Phase X init).
|
||||||
|
2. **Each run of the LLM processes only the first line of the task file.**
|
||||||
|
3. After processing the item (success or permanent failure), the line is removed from the task file.
|
||||||
|
- On success, the line is deleted (no extra sentinel file needed).
|
||||||
|
- On transient failure (retry < 3), we keep the line but increment a retry counter stored in a separate file.
|
||||||
|
- On permanent failure (retry ≥ 3), we move the line to a `failed.txt` file and log the error.
|
||||||
|
4. The LLM then exits (or continues if the task file is still non‑empty, but it must never load more than one line).
|
||||||
|
|
||||||
|
This way, the LLM’s context never holds more than a single task at a time.
|
||||||
|
|
||||||
|
### Retry mechanism
|
||||||
|
|
||||||
|
For each item (e.g., `internal/align/align.go`), we maintain a retry counter in:
|
||||||
|
|
||||||
|
- `docs/retry/phase1/internal/align/align.go.count`
|
||||||
|
|
||||||
|
If the file does not exist, retries = 0.
|
||||||
|
Each time processing fails, we increment the counter (write the new number).
|
||||||
|
If after increment the counter < 3, we keep the line in the task file.
|
||||||
|
If counter reaches 3, we **remove the line from the task file**, add it to `docs/failed/phase1/internal/align/align.go.failed` (just a marker), and log the error.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
## Documentation quality requirements (CRITICAL)
|
||||||
|
|
||||||
|
Documentation MUST NOT be superficial. For each documented element (file, function, struct, package):
|
||||||
|
|
||||||
|
### You MUST explain:
|
||||||
|
|
||||||
|
- what it does
|
||||||
|
- why it exists (context, problem solved)
|
||||||
|
- how it is used
|
||||||
|
- assumptions and preconditions
|
||||||
|
- possible edge cases
|
||||||
|
|
||||||
|
### Forbidden patterns
|
||||||
|
|
||||||
|
- Vague phrases like “This function handles…”, “Utility for…”, “Helper function…”.
|
||||||
|
- Generic descriptions that could apply to any project.
|
||||||
|
|
||||||
|
### Required content per element type
|
||||||
|
|
||||||
|
- Functions:
|
||||||
|
- Purpose
|
||||||
|
- Parameter meaning
|
||||||
|
- Return values
|
||||||
|
- Notable behaviour (panic conditions, side effects, concurrency)
|
||||||
|
- Structs:
|
||||||
|
- Role in the system
|
||||||
|
- Meaning of key fields
|
||||||
|
- Files:
|
||||||
|
- Role within the package
|
||||||
|
- Interactions with other files
|
||||||
|
|
||||||
|
### Anti‑generic rule
|
||||||
|
|
||||||
|
If the description could apply to any project, it is INVALID. You MUST include domain‑specific context (bioinformatics, sequence processing, etc.) and concrete behaviour.
|
||||||
|
|
||||||
|
### Quality validation
|
||||||
|
|
||||||
|
Before marking an item as done (i.e., creating the .done sentinel), you MUST perform a self‑validation:
|
||||||
|
|
||||||
|
- Check that all required sections are present.
|
||||||
|
- Verify that no forbidden patterns remain.
|
||||||
|
|
||||||
|
If validation fails, increment the retry counter and keep the item pending.
|
||||||
|
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Directory structure
|
||||||
|
|
||||||
|
```
|
||||||
|
docs/
|
||||||
|
todo/ # task queues
|
||||||
|
phase1.txt
|
||||||
|
phase1bis.txt
|
||||||
|
phase2.txt
|
||||||
|
phase3.txt
|
||||||
|
retry/ # retry counters
|
||||||
|
phase1/ # mirrors file structure
|
||||||
|
internal/align/align.go.count
|
||||||
|
phase1bis/
|
||||||
|
phase2/
|
||||||
|
phase3/
|
||||||
|
failed/ # permanent failure markers
|
||||||
|
phase1/
|
||||||
|
internal/align/align.go.failed
|
||||||
|
phase1bis/
|
||||||
|
phase2/
|
||||||
|
phase3/
|
||||||
|
phase1/ # actual documentation
|
||||||
|
<relative_path>/<file>.go.md
|
||||||
|
phase2/
|
||||||
|
<package>.md
|
||||||
|
phase3/
|
||||||
|
<tool>.md
|
||||||
|
error.log
|
||||||
|
```
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Phase 0: Initialization
|
||||||
|
|
||||||
|
1. Ensure required directories exist: `docs/todo`, `docs/retry`, `docs/failed`, `docs/phase1`, `docs/phase2`, `docs/phase3`.
|
||||||
|
2. **If `docs/todo/phase1.txt` does not exist**:
|
||||||
|
- Use `find pkg -name "*.go" ! -name "*_test.go" ! -path "*/cmd/*"` to list all Go files (excluding tests and main.go).
|
||||||
|
- Write the list (one relative path per line, e.g., `internal/align/align.go`) to `docs/todo/phase1.txt`.
|
||||||
|
3. Do the same for phase2 and phase3 later when those phases start.
|
||||||
|
4. **No other state is stored.**
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Phase 1: File documentation
|
||||||
|
|
||||||
|
**Processing rule:**
|
||||||
|
- Read the **first line** of `docs/todo/phase1.txt` (using `head -n 1`).
|
||||||
|
- If the file is empty, Phase 1 is complete → proceed to Phase 1bis initialization.
|
||||||
|
- Otherwise, process that single file.
|
||||||
|
|
||||||
|
**Processing a file:**
|
||||||
|
|
||||||
|
1. Let `relpath` be the line content (e.g., `internal/align/align.go`).
|
||||||
|
2. Check if a permanent failure marker exists at `docs/failed/phase1/${relpath}.failed`. If yes, remove the line from the task file and skip (line will be deleted).
|
||||||
|
3. If the documentation file `docs/phase1/${relpath}.go.md` exists go directly to its validation (step 6).
|
||||||
|
4. Otherwise, generate documentation for that file (using MCP tools as before).
|
||||||
|
5. Write the documentation to `docs/phase1/${relpath}.go.md`.
|
||||||
|
6. Validate quality.
|
||||||
|
7. If validation succeeds:
|
||||||
|
- Remove the line from the task file.
|
||||||
|
- Remove any retry counter file for this item.
|
||||||
|
- (No sentinel needed; the removal from todo indicates completion.)
|
||||||
|
8. If validation fails:
|
||||||
|
- Increment retry counter:
|
||||||
|
- If `docs/retry/phase1/${relpath}.count` does not exist, set to 1.
|
||||||
|
- Else read it, add 1, write back.
|
||||||
|
- If new counter >= 3:
|
||||||
|
- Remove line from task file.
|
||||||
|
- Create `docs/failed/phase1/${relpath}.failed`.
|
||||||
|
- Log error.
|
||||||
|
- If new counter < 3:
|
||||||
|
- Keep the line in the task file (do nothing, it stays as first line for next run).
|
||||||
|
9. **Exit** (or stop if this was a single run). The next invocation will read the first line again (same if retry, or next if removed).
|
||||||
|
|
||||||
|
**Important:**
|
||||||
|
- Do **not** read more than one line.
|
||||||
|
- Do **not** attempt to process multiple items in one run.
|
||||||
|
- The LLM should finish after handling one item.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Phase 1bis: Review and harmonization
|
||||||
|
|
||||||
|
When Phase 1 is complete (i.e., `docs/todo/phase1.txt` empty), we initialize `docs/todo/phase1bis.txt` with the same list of files (the ones that succeeded).
|
||||||
|
But note: we need to know which files were successfully documented. Since we removed lines from `phase1.txt` on success, we need a record. The simplest is to reuse the same list but we can generate it by listing the existing `.go.md` files in `docs/phase1/` (since every successful file has a `.go.md`).
|
||||||
|
Thus, Phase 1bis initialization:
|
||||||
|
|
||||||
|
- If `docs/todo/phase1bis.txt` does not exist, create it by listing all `.go.md` files under `docs/phase1/`, stripping the `docs/phase1/` prefix and the `.go.md` suffix, and writing the relative path (same format as phase1).
|
||||||
|
|
||||||
|
Then processing is identical to Phase 1, but using `docs/todo/phase1bis.txt` and output is overwriting the same `.go.md` files (with improvements). Retry counters go in `docs/retry/phase1bis/`.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Phase 2: Package documentation
|
||||||
|
|
||||||
|
When Phase 1bis is complete (`docs/todo/phase1bis.txt` empty), initialize `docs/todo/phase2.txt`:
|
||||||
|
|
||||||
|
- List all packages: unique directories under `pkg/` that contain at least one `.go` file and are not tools.
|
||||||
|
- Write each package identifier (e.g., `align`, `internal/align`) as a line.
|
||||||
|
|
||||||
|
Processing: read first line, generate `docs/phase2/<package>.md`, validate, remove line on success, retry logic in `docs/retry/phase2/`.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Phase 3: Tool documentation
|
||||||
|
|
||||||
|
When Phase 2 complete, initialize `docs/todo/phase3.txt`:
|
||||||
|
|
||||||
|
- List all directories under `cmd/` that contain a `main.go`. Write each tool name as a line.
|
||||||
|
|
||||||
|
Processing: read first line, generate `docs/phase3/<tool>.md`, validate, remove line on success, retry logic in `docs/retry/phase3/`.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Finalization
|
||||||
|
|
||||||
|
When all task files are empty and no pending phases, generate `docs/README.md` by:
|
||||||
|
|
||||||
|
- Listing all package docs (files in `docs/phase2/`) and linking.
|
||||||
|
- Listing all tool docs (files in `docs/phase3/`) and linking.
|
||||||
|
|
||||||
|
Write using `Shell`.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Execution flow summary
|
||||||
|
|
||||||
|
1. **Phase 0**: Create directories and initial `todo/phase1.txt` if missing. Exit.
|
||||||
|
2. **Phase 1**:
|
||||||
|
- If `todo/phase1.txt` exists and non‑empty → process first line.
|
||||||
|
- Else → move to Phase 1bis initialization.
|
||||||
|
3. **Phase 1bis**:
|
||||||
|
- If `todo/phase1bis.txt` does not exist → create from successful phase1 docs.
|
||||||
|
- If non‑empty → process first line.
|
||||||
|
- Else → move to Phase 2 initialization.
|
||||||
|
4. **Phase 2**: similar.
|
||||||
|
5. **Phase 3**: similar.
|
||||||
|
6. **Finalization**: generate README.
|
||||||
|
|
||||||
|
The LLM should be invoked repeatedly (e.g., by a scheduler) until all phases are done. Each invocation processes exactly one item.
|
||||||
|
|
||||||
|
---
|
||||||
|
|
||||||
|
# Important reminders
|
||||||
|
|
||||||
|
- Always call `Shell` to write files; never output content in plain text.
|
||||||
|
- Validate quality before removing a line from the task file.
|
||||||
|
- Log all failures to `docs/error.log` in JSON lines format.
|
||||||
|
- If any MCP tool fails, treat as failure and increment retry counter.
|
||||||
|
- Never read more than one line from a task file in a single run.
|
||||||
Executable
+294
@@ -0,0 +1,294 @@
|
|||||||
|
#!/bin/bash
|
||||||
|
|
||||||
|
# Generate GitHub-compatible release notes for an OBITools4 version.
|
||||||
|
#
|
||||||
|
# Usage:
|
||||||
|
# ./release_notes.sh # latest version
|
||||||
|
# ./release_notes.sh -v 4.4.15 # specific version
|
||||||
|
# ./release_notes.sh -l # list available versions
|
||||||
|
# ./release_notes.sh -r # raw commit list (no LLM)
|
||||||
|
# ./release_notes.sh -c -v 4.4.16 # show LLM context for a version
|
||||||
|
|
||||||
|
GITHUB_REPO="metabarcoding/obitools4"
|
||||||
|
GITHUB_API="https://api.github.com/repos/${GITHUB_REPO}"
|
||||||
|
VERSION=""
|
||||||
|
LIST_VERSIONS=false
|
||||||
|
RAW_MODE=false
|
||||||
|
CONTEXT_MODE=false
|
||||||
|
LLM_MODEL="ollama:qwen3-coder-next:latest"
|
||||||
|
|
||||||
|
# ── Helpers ──────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
die() { echo "Error: $*" >&2; exit 1; }
|
||||||
|
|
||||||
|
next_patch() {
|
||||||
|
local v="$1"
|
||||||
|
local major minor patch
|
||||||
|
major=$(echo "$v" | cut -d. -f1)
|
||||||
|
minor=$(echo "$v" | cut -d. -f2)
|
||||||
|
patch=$(echo "$v" | cut -d. -f3)
|
||||||
|
echo "${major}.${minor}.$(( patch + 1 ))"
|
||||||
|
}
|
||||||
|
|
||||||
|
# Strip "pre-" prefix to get the bare version number for installation section
|
||||||
|
bare_version() {
|
||||||
|
echo "$1" | sed 's/^pre-//'
|
||||||
|
}
|
||||||
|
|
||||||
|
installation_section() {
|
||||||
|
local v
|
||||||
|
v=$(bare_version "$1")
|
||||||
|
cat <<INSTALL_EOF
|
||||||
|
|
||||||
|
## Installation
|
||||||
|
|
||||||
|
### Pre-built binaries
|
||||||
|
|
||||||
|
Download the appropriate archive for your system from the
|
||||||
|
[release assets](https://github.com/metabarcoding/obitools4/releases/tag/Release_${v})
|
||||||
|
and extract it:
|
||||||
|
|
||||||
|
#### Linux (AMD64)
|
||||||
|
\`\`\`bash
|
||||||
|
tar -xzf obitools4_${v}_linux_amd64.tar.gz
|
||||||
|
\`\`\`
|
||||||
|
|
||||||
|
#### Linux (ARM64)
|
||||||
|
\`\`\`bash
|
||||||
|
tar -xzf obitools4_${v}_linux_arm64.tar.gz
|
||||||
|
\`\`\`
|
||||||
|
|
||||||
|
#### macOS (Intel)
|
||||||
|
\`\`\`bash
|
||||||
|
tar -xzf obitools4_${v}_darwin_amd64.tar.gz
|
||||||
|
\`\`\`
|
||||||
|
|
||||||
|
#### macOS (Apple Silicon)
|
||||||
|
\`\`\`bash
|
||||||
|
tar -xzf obitools4_${v}_darwin_arm64.tar.gz
|
||||||
|
\`\`\`
|
||||||
|
|
||||||
|
All OBITools4 binaries are included in each archive.
|
||||||
|
|
||||||
|
### From source
|
||||||
|
|
||||||
|
You can also compile and install OBITools4 directly from source using the
|
||||||
|
installation script:
|
||||||
|
|
||||||
|
\`\`\`bash
|
||||||
|
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --version ${v}
|
||||||
|
\`\`\`
|
||||||
|
|
||||||
|
By default binaries are installed in \`/usr/local/bin\`. Use \`--install-dir\` to
|
||||||
|
change the destination and \`--obitools-prefix\` to add a prefix to command names:
|
||||||
|
|
||||||
|
\`\`\`bash
|
||||||
|
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | \\
|
||||||
|
bash -s -- --version ${v} --install-dir ~/local --obitools-prefix k
|
||||||
|
\`\`\`
|
||||||
|
INSTALL_EOF
|
||||||
|
}
|
||||||
|
|
||||||
|
display_help() {
|
||||||
|
cat <<EOF
|
||||||
|
Usage: $(basename "$0") [OPTIONS]
|
||||||
|
|
||||||
|
Generate GitHub-compatible Markdown release notes for an OBITools4 version.
|
||||||
|
|
||||||
|
Options:
|
||||||
|
-v, --version VERSION Target version (e.g., 4.4.15). Default: latest.
|
||||||
|
-l, --list List all available versions and exit.
|
||||||
|
-r, --raw Output raw commit list without LLM summarization.
|
||||||
|
-c, --context Show the exact context (commits + prompt) sent to the LLM.
|
||||||
|
-m, --model MODEL LLM model for orla (default: $LLM_MODEL).
|
||||||
|
-h, --help Display this help message.
|
||||||
|
|
||||||
|
Examples:
|
||||||
|
$(basename "$0") # release notes for the latest version
|
||||||
|
$(basename "$0") -v 4.4.15 # release notes for a specific version
|
||||||
|
$(basename "$0") -l # list versions
|
||||||
|
$(basename "$0") -r -v 4.4.15 # raw commit log for a version
|
||||||
|
$(basename "$0") -c -v 4.4.16 # show LLM context for a version
|
||||||
|
EOF
|
||||||
|
}
|
||||||
|
|
||||||
|
# Fetch all Release tags from GitHub API (sorted newest first)
|
||||||
|
fetch_versions() {
|
||||||
|
curl -sf "${GITHUB_API}/releases" \
|
||||||
|
| grep '"tag_name":' \
|
||||||
|
| sed -E 's/.*"tag_name": "Release_([0-9.]+)".*/\1/' \
|
||||||
|
| sort -V -r
|
||||||
|
}
|
||||||
|
|
||||||
|
# ── Parse arguments ──────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
while [ "$#" -gt 0 ]; do
|
||||||
|
case "$1" in
|
||||||
|
-v|--version) VERSION="$2"; shift 2 ;;
|
||||||
|
-l|--list) LIST_VERSIONS=true; shift ;;
|
||||||
|
-r|--raw) RAW_MODE=true; shift ;;
|
||||||
|
-c|--context) CONTEXT_MODE=true; shift ;;
|
||||||
|
-m|--model) LLM_MODEL="$2"; shift 2 ;;
|
||||||
|
-h|--help) display_help; exit 0 ;;
|
||||||
|
*) die "Unsupported option: $1" ;;
|
||||||
|
esac
|
||||||
|
done
|
||||||
|
|
||||||
|
# ── List mode ────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
if [ "$LIST_VERSIONS" = true ]; then
|
||||||
|
echo "Available OBITools4 versions:" >&2
|
||||||
|
echo "==============================" >&2
|
||||||
|
fetch_versions
|
||||||
|
exit 0
|
||||||
|
fi
|
||||||
|
|
||||||
|
# ── Resolve versions ─────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
all_versions=$(fetch_versions)
|
||||||
|
[ -z "$all_versions" ] && die "Could not fetch versions from GitHub"
|
||||||
|
|
||||||
|
if [ -z "$VERSION" ]; then
|
||||||
|
# ── Pre-release mode: local HEAD vs latest GitHub tag ──────────────────
|
||||||
|
PRE_RELEASE=true
|
||||||
|
previous_tag="Release_${latest_version}"
|
||||||
|
VERSION="pre-$(next_patch "$latest_version")"
|
||||||
|
|
||||||
|
echo "Pre-release mode: $previous_tag -> HEAD (as $VERSION)" >&2
|
||||||
|
|
||||||
|
# Need to be in a git repo
|
||||||
|
if ! git rev-parse --is-inside-work-tree >/dev/null 2>&1; then
|
||||||
|
die "Not inside a git repository. Pre-release mode requires a local git repo."
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Check that the previous tag exists locally
|
||||||
|
if ! git rev-parse "$previous_tag" >/dev/null 2>&1; then
|
||||||
|
echo "Tag $previous_tag not found locally, fetching..." >&2
|
||||||
|
git fetch --tags 2>/dev/null || true
|
||||||
|
if ! git rev-parse "$previous_tag" >/dev/null 2>&1; then
|
||||||
|
die "Tag $previous_tag not found locally or remotely"
|
||||||
|
fi
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Get local commits from the tag to HEAD (full messages)
|
||||||
|
commit_list=$(git log --format="%h %B" "${previous_tag}..HEAD" 2>/dev/null)
|
||||||
|
|
||||||
|
if [ -z "$commit_list" ]; then
|
||||||
|
die "No local commits found since $previous_tag"
|
||||||
|
fi
|
||||||
|
else
|
||||||
|
# ── Published release mode: between two GitHub tags ────────────────────
|
||||||
|
PRE_RELEASE=false
|
||||||
|
tag_name="Release_${VERSION}"
|
||||||
|
|
||||||
|
# Verify the requested version exists
|
||||||
|
if ! echo "$all_versions" | grep -qx "$VERSION"; then
|
||||||
|
die "Version $VERSION not found. Use -l to list available versions."
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Find the previous version
|
||||||
|
previous_version=$(echo "$all_versions" | grep -A1 -x "$VERSION" | tail -1)
|
||||||
|
|
||||||
|
if [ "$previous_version" = "$VERSION" ] || [ -z "$previous_version" ]; then
|
||||||
|
previous_tag=""
|
||||||
|
echo "No previous version found -- will include all commits for $tag_name" >&2
|
||||||
|
else
|
||||||
|
previous_tag="Release_${previous_version}"
|
||||||
|
echo "Generating notes: $previous_tag -> $tag_name" >&2
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Fetch commit messages between tags via GitHub compare API
|
||||||
|
if [ -n "$previous_tag" ]; then
|
||||||
|
commits_json=$(curl -sf "${GITHUB_API}/compare/${previous_tag}...${tag_name}")
|
||||||
|
if [ -z "$commits_json" ]; then
|
||||||
|
die "Could not fetch commit comparison from GitHub"
|
||||||
|
fi
|
||||||
|
commit_list=$(echo "$commits_json" \
|
||||||
|
| jq -r '.commits[] | (.sha[:8] + " " + .commit.message)' 2>/dev/null)
|
||||||
|
else
|
||||||
|
commits_json=$(curl -sf "${GITHUB_API}/commits?sha=${tag_name}&per_page=50")
|
||||||
|
if [ -z "$commits_json" ]; then
|
||||||
|
die "Could not fetch commits from GitHub"
|
||||||
|
fi
|
||||||
|
commit_list=$(echo "$commits_json" \
|
||||||
|
| jq -r '.[] | (.sha[:8] + " " + .commit.message)' 2>/dev/null)
|
||||||
|
fi
|
||||||
|
|
||||||
|
if [ -z "$commit_list" ]; then
|
||||||
|
die "No commits found between $previous_tag and $tag_name"
|
||||||
|
fi
|
||||||
|
fi
|
||||||
|
|
||||||
|
# ── LLM prompt (shared by context mode and summarization) ────────────────
|
||||||
|
|
||||||
|
LLM_PROMPT="Summarize the following commits into a GitHub release note for version ${VERSION}. \
|
||||||
|
Ignore commits related to version bumps, .gitignore changes, or any internal housekeeping \
|
||||||
|
that is irrelevant to end users. Describe each user-facing change precisely without exposing \
|
||||||
|
code. Eliminate redundancy. Output strictly valid JSON with no surrounding text, using this \
|
||||||
|
exact schema: {\"title\": \"<short release title>\", \"body\": \"<detailed markdown release notes>\"}"
|
||||||
|
|
||||||
|
# ── Raw mode: just output the commit list ────────────────────────────────
|
||||||
|
|
||||||
|
if [ "$RAW_MODE" = true ]; then
|
||||||
|
echo "# Release ${VERSION}"
|
||||||
|
echo ""
|
||||||
|
echo "## Commits"
|
||||||
|
echo ""
|
||||||
|
echo "$commit_list" | while IFS= read -r line; do
|
||||||
|
echo "- ${line}"
|
||||||
|
done
|
||||||
|
installation_section "$VERSION"
|
||||||
|
exit 0
|
||||||
|
fi
|
||||||
|
|
||||||
|
# ── Context mode: show what would be sent to the LLM ────────────────────
|
||||||
|
|
||||||
|
if [ "$CONTEXT_MODE" = true ]; then
|
||||||
|
echo "=== LLM Model ==="
|
||||||
|
echo "$LLM_MODEL"
|
||||||
|
echo ""
|
||||||
|
echo "=== Prompt ==="
|
||||||
|
echo "$LLM_PROMPT"
|
||||||
|
echo ""
|
||||||
|
echo "=== Stdin (commit list) ==="
|
||||||
|
echo "$commit_list"
|
||||||
|
exit 0
|
||||||
|
fi
|
||||||
|
|
||||||
|
# ── LLM summarization ───────────────────────────────────────────────────
|
||||||
|
|
||||||
|
if ! command -v orla >/dev/null 2>&1; then
|
||||||
|
die "orla is required for LLM summarization. Use -r for raw output."
|
||||||
|
fi
|
||||||
|
|
||||||
|
if ! command -v jq >/dev/null 2>&1; then
|
||||||
|
die "jq is required for JSON parsing. Use -r for raw output."
|
||||||
|
fi
|
||||||
|
|
||||||
|
echo "Summarizing with LLM ($LLM_MODEL)..." >&2
|
||||||
|
|
||||||
|
raw_output=$(echo "$commit_list" | \
|
||||||
|
ORLA_MAX_TOOL_CALLS=50 orla agent -m "$LLM_MODEL" \
|
||||||
|
"$LLM_PROMPT" \
|
||||||
|
2>/dev/null) || true
|
||||||
|
|
||||||
|
if [ -z "$raw_output" ]; then
|
||||||
|
echo "Warning: LLM returned empty output, falling back to raw mode" >&2
|
||||||
|
exec "$0" -r -v "$VERSION"
|
||||||
|
fi
|
||||||
|
|
||||||
|
# Sanitize: extract JSON object, strip control characters
|
||||||
|
sanitized=$(echo "$raw_output" | sed -n '/^{/,/^}/p' | tr -d '\000-\011\013-\014\016-\037')
|
||||||
|
|
||||||
|
release_title=$(echo "$sanitized" | jq -r '.title // empty' 2>/dev/null)
|
||||||
|
release_body=$(echo "$sanitized" | jq -r '.body // empty' 2>/dev/null)
|
||||||
|
|
||||||
|
if [ -n "$release_title" ] && [ -n "$release_body" ]; then
|
||||||
|
echo "# ${release_title}"
|
||||||
|
echo ""
|
||||||
|
echo "$release_body"
|
||||||
|
installation_section "$VERSION"
|
||||||
|
else
|
||||||
|
echo "Warning: JSON parsing failed, falling back to raw mode" >&2
|
||||||
|
exec "$0" -r -v "$VERSION"
|
||||||
|
fi
|
||||||
@@ -0,0 +1,222 @@
|
|||||||
|
//go:build ignore
|
||||||
|
|
||||||
|
package main
|
||||||
|
|
||||||
|
import (
|
||||||
|
"encoding/json"
|
||||||
|
"fmt"
|
||||||
|
"os"
|
||||||
|
"os/exec"
|
||||||
|
"path/filepath"
|
||||||
|
"regexp"
|
||||||
|
"sort"
|
||||||
|
"strconv"
|
||||||
|
"strings"
|
||||||
|
)
|
||||||
|
|
||||||
|
type Reference struct {
|
||||||
|
File string `json:"file"`
|
||||||
|
Line int `json:"line"`
|
||||||
|
Column int `json:"column"`
|
||||||
|
Key string `json:"key"`
|
||||||
|
Function string `json:"function"`
|
||||||
|
Context string `json:"context"`
|
||||||
|
}
|
||||||
|
|
||||||
|
type Result struct {
|
||||||
|
Method string `json:"method"`
|
||||||
|
Signature string `json:"signature"`
|
||||||
|
Definition string `json:"definition"`
|
||||||
|
References []Reference `json:"references"`
|
||||||
|
Total int `json:"total"`
|
||||||
|
}
|
||||||
|
|
||||||
|
var basePath = "/Users/coissac/Sync/travail/__MOI__/GO/obitools4"
|
||||||
|
|
||||||
|
func main() {
|
||||||
|
cmd := exec.Command("rg", "-n", `\.SetAttribute\(`, basePath+"/pkg", "--type", "go")
|
||||||
|
output, err := cmd.Output()
|
||||||
|
if err != nil {
|
||||||
|
fmt.Fprintf(os.Stderr, "Error running rg: %v\n", err)
|
||||||
|
os.Exit(1)
|
||||||
|
}
|
||||||
|
|
||||||
|
lines := strings.Split(string(output), "\n")
|
||||||
|
lineRe := regexp.MustCompile(`^(.+?):(\d+):\s*(.+)$`)
|
||||||
|
keyRe := regexp.MustCompile(`SetAttribute\("([^"]+)"`)
|
||||||
|
templateKeyRe := regexp.MustCompile(`SetAttribute\("([^"]+)[^"]*"\s*,`)
|
||||||
|
|
||||||
|
var refs []Reference
|
||||||
|
seen := make(map[string]bool)
|
||||||
|
|
||||||
|
for _, line := range lines {
|
||||||
|
line = strings.TrimSpace(line)
|
||||||
|
if line == "" {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
matches := lineRe.FindStringSubmatch(line)
|
||||||
|
if matches == nil {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
file := matches[1]
|
||||||
|
lineNum, _ := strconv.Atoi(matches[2])
|
||||||
|
context := strings.TrimSpace(matches[3])
|
||||||
|
|
||||||
|
// Skip definition
|
||||||
|
if strings.Contains(file, "obiseq/attributes.go") && lineNum == 132 {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
// Extract key
|
||||||
|
var key string
|
||||||
|
if keyMatches := keyRe.FindStringSubmatch(context); keyMatches != nil {
|
||||||
|
key = keyMatches[1]
|
||||||
|
} else if tmplMatches := templateKeyRe.FindStringSubmatch(context); tmplMatches != nil {
|
||||||
|
key = tmplMatches[1]
|
||||||
|
} else {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
// Get function name using treesitter
|
||||||
|
funcName := getFunctionNameTreesitter(file, lineNum)
|
||||||
|
|
||||||
|
uniqueKey := fmt.Sprintf("%s:%d", file, lineNum)
|
||||||
|
if seen[uniqueKey] {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
seen[uniqueKey] = true
|
||||||
|
|
||||||
|
refs = append(refs, Reference{
|
||||||
|
File: filepath.Base(file),
|
||||||
|
Line: lineNum,
|
||||||
|
Column: 0,
|
||||||
|
Key: key,
|
||||||
|
Function: funcName,
|
||||||
|
Context: context,
|
||||||
|
})
|
||||||
|
}
|
||||||
|
|
||||||
|
sort.Slice(refs, func(i, j int) bool {
|
||||||
|
if refs[i].File != refs[j].File {
|
||||||
|
return refs[i].File < refs[j].File
|
||||||
|
}
|
||||||
|
return refs[i].Line < refs[j].Line
|
||||||
|
})
|
||||||
|
|
||||||
|
result := Result{
|
||||||
|
Method: "SetAttribute",
|
||||||
|
Signature: "func (s *BioSequence) SetAttribute(key string, value interface{})",
|
||||||
|
Definition: basePath + "/pkg/obiseq/attributes.go:132",
|
||||||
|
References: refs,
|
||||||
|
Total: len(refs),
|
||||||
|
}
|
||||||
|
|
||||||
|
outputJSON, err := json.MarshalIndent(result, "", " ")
|
||||||
|
if err != nil {
|
||||||
|
fmt.Fprintf(os.Stderr, "Error marshaling JSON: %v\n", err)
|
||||||
|
os.Exit(1)
|
||||||
|
}
|
||||||
|
|
||||||
|
fmt.Println(string(outputJSON))
|
||||||
|
}
|
||||||
|
|
||||||
|
// getFunctionNameTreesitter uses the treesitter_cursor_walk tool to get the containing function
|
||||||
|
func getFunctionNameTreesitter(file string, targetLine int) string {
|
||||||
|
// Convert to 0-based for treesitter
|
||||||
|
row := targetLine - 1
|
||||||
|
|
||||||
|
// Use treesitter cursor walk to get ancestors
|
||||||
|
cmd := exec.Command("bash", "-c",
|
||||||
|
fmt.Sprintf(`kilo treesitter_cursor_walk --file_path %q --row %d --column 0 --max_depth 10 2>/dev/null`, file, row))
|
||||||
|
|
||||||
|
output, err := cmd.Output()
|
||||||
|
if err != nil {
|
||||||
|
return findContainingFunction(file, targetLine)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Parse the JSON output to find function_declaration or method_declaration
|
||||||
|
var result map[string]interface{}
|
||||||
|
if err := json.Unmarshal(output, &result); err != nil {
|
||||||
|
return findContainingFunction(file, targetLine)
|
||||||
|
}
|
||||||
|
|
||||||
|
// Check ancestors for function declaration
|
||||||
|
if ancestors, ok := result["ancestors"].([]interface{}); ok {
|
||||||
|
for _, a := range ancestors {
|
||||||
|
if anc, ok := a.(map[string]interface{}); ok {
|
||||||
|
nodeType, _ := anc["type"].(string)
|
||||||
|
if nodeType == "function_declaration" || nodeType == "method_declaration" {
|
||||||
|
// Try to get the function name from children
|
||||||
|
if children, ok := anc["children"].([]interface{}); ok {
|
||||||
|
for _, c := range children {
|
||||||
|
if child, ok := c.(map[string]interface{}); ok {
|
||||||
|
childType, _ := child["type"].(string)
|
||||||
|
if childType == "identifier" {
|
||||||
|
if text, ok := child["text"].(string); ok {
|
||||||
|
return text
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if childType == "field_identifier" {
|
||||||
|
if text, ok := child["text"].(string); ok {
|
||||||
|
return text
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if nodeType == "func_literal" {
|
||||||
|
return "closure"
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return findContainingFunction(file, targetLine)
|
||||||
|
}
|
||||||
|
|
||||||
|
func findContainingFunction(file string, targetLine int) string {
|
||||||
|
data, err := os.ReadFile(file)
|
||||||
|
if err != nil {
|
||||||
|
return ""
|
||||||
|
}
|
||||||
|
lines := strings.Split(string(data), "\n")
|
||||||
|
|
||||||
|
for i := targetLine - 1; i >= 0 && i >= targetLine-200; i-- {
|
||||||
|
if i >= len(lines) {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
line := strings.TrimSpace(lines[i])
|
||||||
|
|
||||||
|
if line == "}" && i > 0 {
|
||||||
|
for j := i - 1; j >= 0 && j >= i-50; j-- {
|
||||||
|
if j >= len(lines) {
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
funcLine := strings.TrimSpace(lines[j])
|
||||||
|
if strings.HasPrefix(funcLine, "func ") {
|
||||||
|
if match := regexp.MustCompile(`func\s+\([^)]+\)\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(funcLine); match != nil {
|
||||||
|
return match[1]
|
||||||
|
}
|
||||||
|
if match := regexp.MustCompile(`func\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(funcLine); match != nil {
|
||||||
|
return match[1]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
continue
|
||||||
|
}
|
||||||
|
|
||||||
|
if strings.HasPrefix(line, "func ") {
|
||||||
|
if match := regexp.MustCompile(`func\s+\([^)]+\)\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(line); match != nil {
|
||||||
|
return match[1]
|
||||||
|
}
|
||||||
|
if match := regexp.MustCompile(`func\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(line); match != nil {
|
||||||
|
return match[1]
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
return ""
|
||||||
|
}
|
||||||
Executable
+36
@@ -0,0 +1,36 @@
|
|||||||
|
#!/bin/bash
|
||||||
|
|
||||||
|
basePath="/Users/coissac/Sync/travail/__MOI__/GO/obitools4"
|
||||||
|
OUTPUT_FILE="${1:-/dev/stdout}"
|
||||||
|
|
||||||
|
# Get all SetAttribute calls
|
||||||
|
rg -n '\.SetAttribute\(' "$basePath/pkg" --type go | while read -r line; do
|
||||||
|
file="${line%%:*}"
|
||||||
|
line_num="${line%:*}"
|
||||||
|
line_num="${line_num##*:}"
|
||||||
|
context="${line##*: }"
|
||||||
|
|
||||||
|
# Extract key (only literal strings)
|
||||||
|
key=$(echo "$context" | sed -n 's/.*SetAttribute("\([^"]*\)".*/\1/p')
|
||||||
|
[ -z "$key" ] && continue
|
||||||
|
|
||||||
|
# Get function name using treesitter
|
||||||
|
func=$(kilo treesitter_cursor_walk \
|
||||||
|
--file_path "$file" \
|
||||||
|
--row "$((line_num - 1))" \
|
||||||
|
--column 0 \
|
||||||
|
--max_depth 10 2>/dev/null |
|
||||||
|
jq -r '.ancestors[] | select(.type == "function_declaration" or .type == "method_declaration") | .children[] | select(.type == "identifier" or .type == "field_identifier") | .text' 2>/dev/null)
|
||||||
|
|
||||||
|
# Fallback to func_literal for closures
|
||||||
|
if [ -z "$func" ]; then
|
||||||
|
func=$(kilo treesitter_cursor_walk \
|
||||||
|
--file_path "$file" \
|
||||||
|
--row "$((line_num - 1))" \
|
||||||
|
--column 0 \
|
||||||
|
--max_depth 10 2>/dev/null |
|
||||||
|
jq -r '.ancestors[] | select(.type == "func_literal") | "closure"' 2>/dev/null)
|
||||||
|
fi
|
||||||
|
|
||||||
|
echo "$(basename "$file")|$line_num|$key|${func:-unknown}|$context"
|
||||||
|
done | sort -t'|' -k1,1 -k2,2n
|
||||||
@@ -0,0 +1,308 @@
|
|||||||
|
{
|
||||||
|
"obiannotate": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
],
|
||||||
|
"(git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter.IBioSequence).NumberSequences$1": [
|
||||||
|
"seq_number"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obiclean": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obicleandb": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
|
||||||
|
"count"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obicomplement": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obiconsensus": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
|
||||||
|
"count"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
],
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.BuildConsensus": [
|
||||||
|
"obiconsensus_kmer_max_occur",
|
||||||
|
"obiconsensus_filtered_graph_size",
|
||||||
|
"obiconsensus_full_graph_size",
|
||||||
|
"obiconsensus_consensus",
|
||||||
|
"obiconsensus_weight",
|
||||||
|
"obiconsensus_seq_length",
|
||||||
|
"obiconsensus_kmer_size"
|
||||||
|
],
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.MinionClusterDenoise": [
|
||||||
|
"obiconsensus_consensus"
|
||||||
|
],
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.MinionDenoise$1": [
|
||||||
|
"obiconsensus_consensus",
|
||||||
|
"obiconsensus_weight"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obiconvert": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obicount": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obicsv": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obidemerge": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obidistribute": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obigrep": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obijoin": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obikmermatch": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obikmersimcount": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obilandmark": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCoordinate": [
|
||||||
|
"landmark_coord"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagGeomRefIndex": [
|
||||||
|
"obitag_geomref_index"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
],
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obilandmark.CLISelectLandmarkSequences": [
|
||||||
|
"landmark_id"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obimatrix": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obimicrosat": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obimultiplex": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obipairing": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._revcmpMutation": [
|
||||||
|
"pairing_mismatches"
|
||||||
|
],
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign.BuildQualityConsensus": [
|
||||||
|
"pairing_mismatches"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obipcr": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obireffamidx": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagRefIndex": [
|
||||||
|
"obitag_ref_index"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
],
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obirefidx.IndexFamilyDB": [
|
||||||
|
"reffamidx_id"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obirefidx": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagRefIndex": [
|
||||||
|
"obitag_ref_index"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obiscript": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obisplit": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obisummary": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obitag": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetPath": [
|
||||||
|
"taxonomic_path"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obitagpcr": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obingslibrary.NGSLibrary).ExtractMultiBarcode": [
|
||||||
|
"obimultiplex_error",
|
||||||
|
"obimultiplex_amplicon_rank"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._revcmpMutation": [
|
||||||
|
"pairing_mismatches"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._subseqMutation": [
|
||||||
|
"pairing_mismatches"
|
||||||
|
],
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign.BuildQualityConsensus": [
|
||||||
|
"pairing_mismatches"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obitaxonomy": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetPath": [
|
||||||
|
"taxonomic_path"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
],
|
||||||
|
"(git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter.IBioSequence).NumberSequences$1": [
|
||||||
|
"seq_number"
|
||||||
|
]
|
||||||
|
},
|
||||||
|
"obiuniq": {
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
|
||||||
|
"count"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||||
|
"definition"
|
||||||
|
],
|
||||||
|
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||||
|
"taxid"
|
||||||
|
]
|
||||||
|
}
|
||||||
|
}
|
||||||
Executable
+36
@@ -0,0 +1,36 @@
|
|||||||
|
#!/usr/bin/env python3
|
||||||
|
"""
|
||||||
|
Read potentially malformed JSON from stdin (aichat output), extract title and
|
||||||
|
body, and print them as plain text: title on first line, blank line, then body.
|
||||||
|
Exits with 1 on failure (no output).
|
||||||
|
"""
|
||||||
|
|
||||||
|
import sys
|
||||||
|
import json
|
||||||
|
import re
|
||||||
|
|
||||||
|
text = sys.stdin.read()
|
||||||
|
|
||||||
|
m = re.search(r'\{.*\}', text, re.DOTALL)
|
||||||
|
if not m:
|
||||||
|
sys.exit(1)
|
||||||
|
|
||||||
|
s = m.group()
|
||||||
|
obj = None
|
||||||
|
|
||||||
|
try:
|
||||||
|
obj = json.loads(s)
|
||||||
|
except Exception:
|
||||||
|
s2 = re.sub(r'(?<!\\)\n', r'\\n', s)
|
||||||
|
try:
|
||||||
|
obj = json.loads(s2)
|
||||||
|
except Exception:
|
||||||
|
sys.exit(1)
|
||||||
|
|
||||||
|
title = obj.get('title', '').strip()
|
||||||
|
body = obj.get('body', '').strip()
|
||||||
|
|
||||||
|
if not title or not body:
|
||||||
|
sys.exit(1)
|
||||||
|
|
||||||
|
print(f"{title}\n\n{body}")
|
||||||
+1
-1
@@ -1 +1 @@
|
|||||||
4.4.15
|
4.4.45
|
||||||
|
|||||||
@@ -0,0 +1,19 @@
|
|||||||
|
```markdown
|
||||||
|
# DNA Scoring and Matching Utilities in `obialign`
|
||||||
|
|
||||||
|
This module provides low-level utilities for computing nucleotide alignment scores using probabilistic and bit-encoded representations.
|
||||||
|
|
||||||
|
- **Bit Encoding**: Nucleotides are encoded in 4-bit groups (e.g., `A=0b0001`, `C=0b0010`, etc.), enabling efficient bitwise comparison.
|
||||||
|
- **`_MatchRatio(a, b)`**: Computes a normalized match ratio between two encoded bytes based on shared bits:
|
||||||
|
`ratio = common_bits / (bits_in_a × bits_in_b)`.
|
||||||
|
- **`_FourBitsCount`**: Precomputed lookup table for Hamming weight (popcount) of 4-bit values.
|
||||||
|
- **Log-space Arithmetic**: Helper functions (`_Logaddexp`, `_Logdiffexp`, `_Log1mexp`) ensure numerical stability in probabilistic computations.
|
||||||
|
- **Phred-scaled Quality Integration**:
|
||||||
|
`_MatchScoreRatio(QF, QR)` derives log-odds match/mismatch scores from Phred quality values (`QF`, `QR`), modeling sequencing error probabilities.
|
||||||
|
- **Precomputed Matrices**:
|
||||||
|
- `_NucPartMatch[i][j]`: Match ratios for all nucleotide pairs (from 4-bit codes).
|
||||||
|
- `_NucScorePartMatchMatch/Mismatch[i][j]`: Integer-scaled match/mismatch scores (×10) for quality pairs `(i, j)` in `[0..99]`.
|
||||||
|
- **Thread-Safe Initialization**: `_InitDNAScoreMatrix()` ensures one-time, synchronized initialization of all scoring tables via a mutex.
|
||||||
|
|
||||||
|
Designed for high-performance alignment kernels where speed and numerical robustness are critical.
|
||||||
|
```
|
||||||
Reference in New Issue
Block a user