mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-08-08 14:30:36 +00:00
Compare commits
83
Commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
a8841c203d | ||
|
|
f1a424343c | ||
|
|
4dae7f708d | ||
|
|
578445f38a | ||
|
|
2edb33ad08 | ||
|
|
b108d4978e | ||
|
|
e9210e28a3 | ||
|
|
13a93fce11 | ||
|
|
14064c919e | ||
|
|
1dfd68aa6d | ||
|
|
930fe5f1ba | ||
|
|
dcdaf9e372 | ||
|
|
af7ae3d60c | ||
|
|
cecf90fa40 | ||
|
|
a186bd1c92 | ||
|
|
46d60c1a44 | ||
|
|
6c4a6c697c | ||
|
|
60b3753673 | ||
|
|
14e2840a2d | ||
|
|
42910c7db9 | ||
|
|
8b4cf677c6 | ||
|
|
02765f154f | ||
|
|
449544bd63 | ||
|
|
434d2e5930 | ||
|
|
7cb02ded69 | ||
|
|
6d469bd711 | ||
|
|
3d8e4a3a4e | ||
|
|
07d04a6967 | ||
|
|
03f251c365 | ||
|
|
5714fa6cd3 | ||
|
|
f101625771 | ||
|
|
4359b52eaf | ||
|
|
da0c8b6f28 | ||
|
|
841e5c9e2a | ||
|
|
e298daeef9 | ||
|
|
d9e6f67a6e | ||
|
|
f036c7fa96 | ||
|
|
e33665e716 | ||
|
|
c955a614ca | ||
|
|
f19065261e | ||
|
|
3e349e92e1 | ||
|
|
a4ce24a418 | ||
|
|
960ad1531d | ||
|
|
137f49d1d1 | ||
|
|
083a92e13d | ||
|
|
67683435e8 | ||
|
|
f32b29db4f | ||
|
|
10f49fe64b | ||
|
|
d257917748 | ||
|
|
fec078c04c | ||
|
|
a92393dd51 | ||
|
|
7e76698490 | ||
|
|
64b0b32f61 | ||
|
|
c8e6a218cb | ||
|
|
8c7017a99d | ||
|
|
c7816973a6 | ||
|
|
670edc1958 | ||
|
|
f92f285417 | ||
|
|
a786b58ed3 | ||
|
|
a2b26712b2 | ||
|
|
1599abc9ad | ||
|
|
af213ab446 | ||
|
|
a60184c115 | ||
|
|
585b024bf0 | ||
|
|
afc9ffda85 | ||
|
|
fdd972bbd2 | ||
|
|
76f595e1fe | ||
|
|
1e1e5443e3 | ||
|
|
15d1f1fd80 | ||
|
|
8df2cbe22f | ||
|
|
58d685926b | ||
|
|
e9f24426df | ||
|
|
2f7be10b5d | ||
|
|
43125f9f5e | ||
|
|
c23368e929 | ||
|
|
6cb5a81685 | ||
|
|
94b0887069 | ||
|
|
c188580aac | ||
|
|
1e1f575d1c | ||
|
|
40769bf827 | ||
|
|
74e6fcaf83 | ||
|
|
30ec8b1b63 | ||
|
|
cdc72c5346 |
@@ -10,10 +10,10 @@ jobs:
|
||||
runs-on: ubuntu-latest
|
||||
steps:
|
||||
- name: Setup Go
|
||||
uses: actions/setup-go@v2
|
||||
uses: actions/setup-go@v5
|
||||
with:
|
||||
go-version: '1.23'
|
||||
- name: Checkout obitools4 project
|
||||
uses: actions/checkout@v4
|
||||
uses: actions/checkout@v5
|
||||
- name: Run tests
|
||||
run: make githubtests
|
||||
|
||||
@@ -16,9 +16,9 @@ jobs:
|
||||
- name: Setup Go
|
||||
uses: actions/setup-go@v5
|
||||
with:
|
||||
go-version: "1.23"
|
||||
go-version: "1.26"
|
||||
- name: Checkout obitools4 project
|
||||
uses: actions/checkout@v4
|
||||
uses: actions/checkout@v5
|
||||
- name: Run tests
|
||||
run: make githubtests
|
||||
|
||||
@@ -49,12 +49,12 @@ jobs:
|
||||
|
||||
steps:
|
||||
- name: Checkout code
|
||||
uses: actions/checkout@v4
|
||||
uses: actions/checkout@v5
|
||||
|
||||
- name: Setup Go
|
||||
uses: actions/setup-go@v5
|
||||
with:
|
||||
go-version: "1.23"
|
||||
go-version: "1.26"
|
||||
|
||||
- name: Extract version from tag
|
||||
id: get_version
|
||||
@@ -69,7 +69,23 @@ jobs:
|
||||
xcode-select --install 2>/dev/null || true
|
||||
xcode-select -p
|
||||
|
||||
- name: Build binaries
|
||||
- name: Build binaries (Linux)
|
||||
if: runner.os == 'Linux'
|
||||
env:
|
||||
VERSION: ${{ steps.get_version.outputs.version }}
|
||||
run: |
|
||||
docker run --rm \
|
||||
-v "$(pwd):/src" \
|
||||
-w /src \
|
||||
-e VERSION="${VERSION}" \
|
||||
golang:1.26-alpine \
|
||||
sh -c "apk add --no-cache gcc musl-dev zlib-dev zlib-static make && \
|
||||
make LDFLAGS='-linkmode=external -extldflags=-static' obitools"
|
||||
mkdir -p artifacts
|
||||
tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
|
||||
|
||||
- name: Build binaries (macOS)
|
||||
if: runner.os == 'macOS'
|
||||
env:
|
||||
GOOS: ${{ matrix.goos }}
|
||||
GOARCH: ${{ matrix.goarch }}
|
||||
@@ -77,7 +93,6 @@ jobs:
|
||||
run: |
|
||||
make obitools
|
||||
mkdir -p artifacts
|
||||
# Create a single tar.gz with all binaries for this platform
|
||||
tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
|
||||
|
||||
- name: Upload artifacts
|
||||
@@ -92,7 +107,7 @@ jobs:
|
||||
runs-on: ubuntu-latest
|
||||
steps:
|
||||
- name: Checkout code
|
||||
uses: actions/checkout@v4
|
||||
uses: actions/checkout@v5
|
||||
with:
|
||||
fetch-depth: 0
|
||||
|
||||
|
||||
+3
-1
@@ -21,9 +21,11 @@ xx
|
||||
|
||||
.rhistory
|
||||
/.vscode
|
||||
|
||||
/benchmarck
|
||||
/build
|
||||
/bugs
|
||||
|
||||
autodoc
|
||||
/ncbitaxo
|
||||
|
||||
!/obitests/**
|
||||
|
||||
@@ -0,0 +1,2 @@
|
||||
/cache
|
||||
/project.local.yml
|
||||
@@ -0,0 +1,133 @@
|
||||
# the name by which the project can be referenced within Serena
|
||||
project_name: "obitools4"
|
||||
|
||||
|
||||
# list of languages for which language servers are started; choose from:
|
||||
# al angular ansible bash clojure
|
||||
# cpp cpp_ccls crystal csharp csharp_omnisharp
|
||||
# dart elixir elm erlang fortran
|
||||
# fsharp go groovy haskell haxe
|
||||
# hlsl html java json julia
|
||||
# kotlin lean4 lua luau markdown
|
||||
# matlab msl nix ocaml pascal
|
||||
# perl php php_phpactor powershell python
|
||||
# python_jedi python_ty r rego ruby
|
||||
# ruby_solargraph rust scala scss solidity
|
||||
# svelte swift systemverilog terraform toml
|
||||
# typescript typescript_vts vue yaml zig
|
||||
# (This list may be outdated. For the current list, see values of Language enum here:
|
||||
# https://github.com/oraios/serena/blob/main/src/solidlsp/ls_config.py
|
||||
# For some languages, there are alternative language servers, e.g. csharp_omnisharp, ruby_solargraph.)
|
||||
# Note:
|
||||
# - For C, use cpp
|
||||
# - For JavaScript, use typescript
|
||||
# - For Angular projects, use angular (subsumes typescript+html; requires `npm install` in the project root)
|
||||
# - For Svelte projects, use svelte (subsumes typescript/javascript for .svelte projects; requires npm)
|
||||
# - For SCSS / Sass / plain CSS, use scss (some-sass-language-server handles all three)
|
||||
# - For Free Pascal/Lazarus, use pascal
|
||||
# Special requirements:
|
||||
# Some languages require additional setup/installations.
|
||||
# See here for details: https://oraios.github.io/serena/01-about/020_programming-languages.html#language-servers
|
||||
# When using multiple languages, the first language server that supports a given file will be used for that file.
|
||||
# The first language is the default language and the respective language server will be used as a fallback.
|
||||
# Note that when using the JetBrains backend, language servers are not used and this list is correspondingly ignored.
|
||||
languages:
|
||||
- go
|
||||
|
||||
# the encoding used by text files in the project
|
||||
# For a list of possible encodings, see https://docs.python.org/3.11/library/codecs.html#standard-encodings
|
||||
encoding: "utf-8"
|
||||
|
||||
# line ending convention to use when writing source files.
|
||||
# Possible values: unset (use global setting), "lf", "crlf", or "native" (platform default)
|
||||
# This does not affect Serena's own files (e.g. memories and configuration files), which always use native line endings.
|
||||
line_ending:
|
||||
|
||||
# The language backend to use for this project.
|
||||
# If not set, the global setting from serena_config.yml is used.
|
||||
# Valid values: LSP, JetBrains
|
||||
# Note: the backend is fixed at startup. If a project with a different backend
|
||||
# is activated post-init, an error will be returned.
|
||||
language_backend:
|
||||
|
||||
# whether to use project's .gitignore files to ignore files
|
||||
ignore_all_files_in_gitignore: true
|
||||
|
||||
# advanced configuration option allowing to configure language server-specific options.
|
||||
# Maps the language key to the options.
|
||||
# Have a look at the docstring of the constructors of the LS implementations within solidlsp (e.g., for C# or PHP) to see which options are available.
|
||||
# No documentation on options means no options are available.
|
||||
ls_specific_settings: {}
|
||||
|
||||
# list of additional workspace folder paths for cross-package reference support (e.g. in monorepos).
|
||||
# Paths can be absolute or relative to the project root.
|
||||
# Each folder is registered as an LSP workspace folder, enabling language servers to discover
|
||||
# symbols and references across package boundaries.
|
||||
# Currently supported for: TypeScript.
|
||||
# Example:
|
||||
# additional_workspace_folders:
|
||||
# - ../sibling-package
|
||||
# - ../shared-lib
|
||||
additional_workspace_folders: []
|
||||
|
||||
# list of additional paths to ignore in this project.
|
||||
# Same syntax as gitignore, so you can use * and **.
|
||||
# Note: global ignored_paths from serena_config.yml are also applied additively.
|
||||
ignored_paths: []
|
||||
|
||||
# whether the project is in read-only mode
|
||||
# If set to true, all editing tools will be disabled and attempts to use them will result in an error
|
||||
# Added on 2025-04-18
|
||||
read_only: false
|
||||
|
||||
# list of tool names to exclude.
|
||||
# This extends the existing exclusions (e.g. from the global configuration)
|
||||
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
|
||||
excluded_tools: []
|
||||
|
||||
# list of tools to include that would otherwise be disabled (particularly optional tools that are disabled by default).
|
||||
# This extends the existing inclusions (e.g. from the global configuration).
|
||||
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
|
||||
included_optional_tools: []
|
||||
|
||||
# fixed set of tools to use as the base tool set (if non-empty), replacing Serena's default set of tools.
|
||||
# This cannot be combined with non-empty excluded_tools or included_optional_tools.
|
||||
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
|
||||
fixed_tools: []
|
||||
|
||||
# list of mode names that are to be activated by default, overriding the setting in the global configuration.
|
||||
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
|
||||
# If the setting is undefined/empty, the default_modes from the global configuration (serena_config.yml) apply.
|
||||
# Otherwise, this overrides the setting from the global configuration (serena_config.yml).
|
||||
# Therefore, you can set this to [] if you do not want the default modes defined in the global config to apply
|
||||
# for this project.
|
||||
# This setting can, in turn, be overridden by CLI parameters (--mode).
|
||||
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
|
||||
default_modes:
|
||||
|
||||
# list of mode names to be activated additionally for this project, e.g. ["query-projects"]
|
||||
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
|
||||
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
|
||||
added_modes:
|
||||
|
||||
# initial prompt for the project. It will always be given to the LLM upon activating the project
|
||||
# (contrary to the memories, which are loaded on demand).
|
||||
initial_prompt: ""
|
||||
|
||||
# time budget (seconds) per tool call for the retrieval of additional symbol information
|
||||
# such as docstrings or parameter information.
|
||||
# This overrides the corresponding setting in the global configuration; see the documentation there.
|
||||
# If null or missing, use the setting from the global configuration.
|
||||
symbol_info_budget:
|
||||
|
||||
# list of regex patterns which, when matched, mark a memory entry as read‑only.
|
||||
# Extends the list from the global configuration, merging the two lists.
|
||||
read_only_memory_patterns: []
|
||||
|
||||
# list of regex patterns for memories to completely ignore.
|
||||
# Matching memories will not appear in list_memories or activate_project output
|
||||
# and cannot be accessed via read_memory or write_memory.
|
||||
# To access ignored memory files, use the read_file tool on the raw file path.
|
||||
# Extends the list from the global configuration, merging the two lists.
|
||||
# Example: ["_archive/.*", "_episodes/.*"]
|
||||
ignored_memory_patterns: []
|
||||
@@ -10,8 +10,9 @@ BLUE := \033[0;34m
|
||||
NC := \033[0m
|
||||
|
||||
GOFLAGS=
|
||||
LDFLAGS=
|
||||
GOCMD=go
|
||||
GOBUILD=$(GOCMD) build $(GOFLAGS)
|
||||
GOBUILD=$(GOCMD) build $(GOFLAGS) $(if $(LDFLAGS),-ldflags="$(LDFLAGS)")
|
||||
GOGENERATE=$(GOCMD) generate
|
||||
GOCLEAN=$(GOCMD) clean
|
||||
GOTEST=$(GOCMD) test
|
||||
@@ -50,7 +51,7 @@ $(OBITOOLS_PREFIX)$(notdir $(1)): $(BUILD_DIR) $(1) pkg/obioptions/version.go
|
||||
@echo -n - Building obitool $(notdir $(1))...
|
||||
@$(GOBUILD) -o $(BUILD_DIR)/$(OBITOOLS_PREFIX)$(notdir $(1)) ./$(1) \
|
||||
2> $(OBITOOLS_PREFIX)$(notdir $(1)).log \
|
||||
|| cat $(OBITOOLS_PREFIX)$(notdir $(1)).log
|
||||
|| { cat $(OBITOOLS_PREFIX)$(notdir $(1)).log; rm -f $(OBITOOLS_PREFIX)$(notdir $(1)).log; exit 1; }
|
||||
@rm -f $(OBITOOLS_PREFIX)$(notdir $(1)).log
|
||||
@echo Done.
|
||||
endef
|
||||
@@ -228,7 +229,8 @@ jjpush-tag:
|
||||
install_section=$$'\n## Installation\n\n### Pre-built binaries\n\nDownload the appropriate archive for your system from the\n[release assets](https://github.com/metabarcoding/obitools4/releases/tag/Release_'"$$version"')\nand extract it:\n\n#### Linux (AMD64)\n```bash\ntar -xzf obitools4_'"$$version"'_linux_amd64.tar.gz\n```\n\n#### Linux (ARM64)\n```bash\ntar -xzf obitools4_'"$$version"'_linux_arm64.tar.gz\n```\n\n#### macOS (Intel)\n```bash\ntar -xzf obitools4_'"$$version"'_darwin_amd64.tar.gz\n```\n\n#### macOS (Apple Silicon)\n```bash\ntar -xzf obitools4_'"$$version"'_darwin_arm64.tar.gz\n```\n\nAll OBITools4 binaries are included in each archive.\n\n### From source\n\nYou can also compile and install OBITools4 directly from source using the\ninstallation script:\n\n```bash\ncurl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --version '"$$version"'\n```\n\nBy default binaries are installed in `/usr/local/bin`. Use `--install-dir` to\nchange the destination and `--obitools-prefix` to add a prefix to command names:\n\n```bash\ncurl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | \\\n bash -s -- --version '"$$version"' --install-dir ~/local --obitools-prefix k\n```\n'; \
|
||||
release_message="$$release_title"$$'\n\n'"$$release_body$$install_section"; \
|
||||
echo "$(BLUE)→ Creating tag $$tag_name...$(NC)"; \
|
||||
git tag -a "$$tag_name" -m "$$release_message" 2>/dev/null || echo "$(YELLOW)⚠ Tag $$tag_name already exists$(NC)"; \
|
||||
commit_hash=$$(jj log -r @ --no-graph -T 'commit_id' 2>/dev/null); \
|
||||
git tag -a "$$tag_name" $${commit_hash:+"$$commit_hash"} -m "$$release_message" 2>/dev/null || echo "$(YELLOW)⚠ Tag $$tag_name already exists$(NC)"; \
|
||||
echo "$(BLUE)→ Pushing tag $$tag_name...$(NC)"; \
|
||||
git push origin "$$tag_name" 2>/dev/null || echo "$(YELLOW)⚠ Tag push failed or already pushed$(NC)"; \
|
||||
rm -f /tmp/obitools4-release-title.txt /tmp/obitools4-release-body.txt
|
||||
|
||||
@@ -37,6 +37,11 @@ func main() {
|
||||
|
||||
optionParser(os.Args)
|
||||
|
||||
if !obipairing.CLIHasPairedFiles() {
|
||||
log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
|
||||
os.Exit(1)
|
||||
}
|
||||
|
||||
obidefault.SetStrictReadWorker(2)
|
||||
obidefault.SetStrictWriteWorker(2)
|
||||
pairs, err := obipairing.CLIPairedSequence()
|
||||
|
||||
@@ -1,6 +1,7 @@
|
||||
package main
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"os"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
@@ -8,6 +9,7 @@ import (
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obimultiplex"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipairing"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitagpcr"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
@@ -39,6 +41,17 @@ func main() {
|
||||
obitagpcr.OptionSet)
|
||||
|
||||
optionParser(os.Args)
|
||||
|
||||
if obimultiplex.CLIAskConfigTemplate() {
|
||||
fmt.Print(obimultiplex.CLIConfigTemplate())
|
||||
os.Exit(0)
|
||||
}
|
||||
|
||||
if !obipairing.CLIHasPairedFiles() {
|
||||
log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
|
||||
os.Exit(1)
|
||||
}
|
||||
|
||||
pairs, err := obipairing.CLIPairedSequence()
|
||||
|
||||
if err != nil {
|
||||
|
||||
@@ -0,0 +1,10 @@
|
||||
{
|
||||
"people": [
|
||||
"Software",
|
||||
"Agreement",
|
||||
"Module"
|
||||
],
|
||||
"projects": [
|
||||
"Code"
|
||||
]
|
||||
}
|
||||
@@ -1,35 +1,33 @@
|
||||
module git.metabarcoding.org/obitools/obitools4/obitools4
|
||||
|
||||
go 1.23.4
|
||||
|
||||
toolchain go1.24.2
|
||||
go 1.26.1
|
||||
|
||||
require (
|
||||
github.com/DavidGamba/go-getoptions v0.28.0
|
||||
github.com/PaesslerAG/gval v1.2.2
|
||||
github.com/DavidGamba/go-getoptions v0.33.0
|
||||
github.com/PaesslerAG/gval v1.2.4
|
||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df
|
||||
github.com/buger/jsonparser v1.1.1
|
||||
github.com/buger/jsonparser v1.1.2
|
||||
github.com/chen3feng/stl4go v0.1.1
|
||||
github.com/dlclark/regexp2 v1.11.4
|
||||
github.com/goccy/go-json v0.10.3
|
||||
github.com/dlclark/regexp2 v1.11.5
|
||||
github.com/goccy/go-json v0.10.6
|
||||
github.com/klauspost/pgzip v1.2.6
|
||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58
|
||||
github.com/pelletier/go-toml/v2 v2.2.4
|
||||
github.com/rrethy/ahocorasick v1.0.0
|
||||
github.com/schollz/progressbar/v3 v3.13.1
|
||||
github.com/sirupsen/logrus v1.9.3
|
||||
github.com/stretchr/testify v1.8.4
|
||||
github.com/schollz/progressbar/v3 v3.19.0
|
||||
github.com/sirupsen/logrus v1.9.4
|
||||
github.com/stretchr/testify v1.10.0
|
||||
github.com/tevino/abool/v2 v2.1.0
|
||||
github.com/yuin/gopher-lua v1.1.1
|
||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa
|
||||
gonum.org/v1/gonum v0.14.0
|
||||
golang.org/x/exp v0.0.0-20260312153236-7ab1446f8b90
|
||||
gonum.org/v1/gonum v0.17.0
|
||||
gopkg.in/yaml.v3 v3.0.1
|
||||
scientificgo.org/special v0.0.0
|
||||
)
|
||||
|
||||
require (
|
||||
github.com/davecgh/go-spew v1.1.1 // indirect
|
||||
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 // indirect
|
||||
github.com/goombaio/orderedmap v0.0.0-20180925151256-3da0e2f905f9 // indirect
|
||||
github.com/kr/pretty v0.3.1 // indirect
|
||||
github.com/kr/text v0.2.0 // indirect
|
||||
github.com/pmezard/go-difflib v1.0.0 // indirect
|
||||
@@ -38,16 +36,15 @@ require (
|
||||
|
||||
require (
|
||||
github.com/dsnet/compress v0.0.1
|
||||
github.com/gabriel-vasile/mimetype v1.4.3
|
||||
github.com/gabriel-vasile/mimetype v1.4.13
|
||||
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77
|
||||
github.com/klauspost/compress v1.17.2
|
||||
github.com/mattn/go-runewidth v0.0.15 // indirect
|
||||
github.com/klauspost/compress v1.18.4
|
||||
github.com/mattn/go-runewidth v0.0.21 // indirect
|
||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db // indirect
|
||||
github.com/rivo/uniseg v0.4.4 // indirect
|
||||
github.com/shopspring/decimal v1.3.1 // indirect
|
||||
github.com/ulikunitz/xz v0.5.11
|
||||
golang.org/x/net v0.35.0 // indirect
|
||||
golang.org/x/sys v0.30.0 // indirect
|
||||
golang.org/x/term v0.29.0 // indirect
|
||||
github.com/rivo/uniseg v0.4.7 // indirect
|
||||
github.com/shopspring/decimal v1.4.0 // indirect
|
||||
github.com/ulikunitz/xz v0.5.15
|
||||
golang.org/x/sys v0.42.0 // indirect
|
||||
golang.org/x/term v0.41.0 // indirect
|
||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c
|
||||
)
|
||||
|
||||
@@ -1,36 +1,41 @@
|
||||
github.com/DavidGamba/go-getoptions v0.28.0 h1:18wgEvfZdrlfIhVDGEBO3Dl0fkOyXqXLa0tLMCKxM1c=
|
||||
github.com/DavidGamba/go-getoptions v0.28.0/go.mod h1:zE97E3PR9P3BI/HKyNYgdMlYxodcuiC6W68KIgeYT84=
|
||||
github.com/PaesslerAG/gval v1.2.2 h1:Y7iBzhgE09IGTt5QgGQ2IdaYYYOU134YGHBThD+wm9E=
|
||||
github.com/PaesslerAG/gval v1.2.2/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
|
||||
github.com/DavidGamba/go-getoptions v0.33.0 h1:8xCPH87Yy5avYenygyHVlqqm8RpymH0YFe4a7IWlarE=
|
||||
github.com/DavidGamba/go-getoptions v0.33.0/go.mod h1:zE97E3PR9P3BI/HKyNYgdMlYxodcuiC6W68KIgeYT84=
|
||||
github.com/PaesslerAG/gval v1.2.4 h1:rhX7MpjJlcxYwL2eTTYIOBUyEKZ+A96T9vQySWkVUiU=
|
||||
github.com/PaesslerAG/gval v1.2.4/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
|
||||
github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
|
||||
github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
|
||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
|
||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
|
||||
github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
|
||||
github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
|
||||
github.com/buger/jsonparser v1.1.2 h1:frqHqw7otoVbk5M8LlE/L7HTnIq2v9RX6EJ48i9AxJk=
|
||||
github.com/buger/jsonparser v1.1.2/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
|
||||
github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
|
||||
github.com/chen3feng/stl4go v0.1.1/go.mod h1:5ml3psLgETJjRJnMbPE+JiHLrCpt+Ajc2weeTECXzWU=
|
||||
github.com/chengxilo/virtualterm v1.0.4 h1:Z6IpERbRVlfB8WkOmtbHiDbBANU7cimRIof7mk9/PwM=
|
||||
github.com/chengxilo/virtualterm v1.0.4/go.mod h1:DyxxBZz/x1iqJjFxTFcr6/x+jSpqN0iwWCOK1q10rlY=
|
||||
github.com/clipperhouse/uax29/v2 v2.2.0 h1:ChwIKnQN3kcZteTXMgb1wztSgaU+ZemkgWdohwgs8tY=
|
||||
github.com/clipperhouse/uax29/v2 v2.2.0/go.mod h1:EFJ2TJMRUaplDxHKj1qAEhCtQPW2tJSwu5BF98AuoVM=
|
||||
github.com/creack/pty v1.1.9/go.mod h1:oKZEueFk5CKHvIhNR5MUki03XCEU+Q6VDXinZuGJ33E=
|
||||
github.com/davecgh/go-spew v1.1.0/go.mod h1:J7Y8YcW2NihsgmVo/mv3lAwl/skON4iLHjSsI+c5H38=
|
||||
github.com/davecgh/go-spew v1.1.1 h1:vj9j/u1bqnvCEfJOwUhtlOARqs3+rkHYY13jYWTU97c=
|
||||
github.com/davecgh/go-spew v1.1.1/go.mod h1:J7Y8YcW2NihsgmVo/mv3lAwl/skON4iLHjSsI+c5H38=
|
||||
github.com/dlclark/regexp2 v1.11.4 h1:rPYF9/LECdNymJufQKmri9gV604RvvABwgOA8un7yAo=
|
||||
github.com/dlclark/regexp2 v1.11.4/go.mod h1:DHkYz0B9wPfa6wondMfaivmHpzrQ3v9q8cnmRbL6yW8=
|
||||
github.com/dlclark/regexp2 v1.11.5 h1:Q/sSnsKerHeCkc/jSTNq1oCm7KiVgUMZRDUoRu0JQZQ=
|
||||
github.com/dlclark/regexp2 v1.11.5/go.mod h1:DHkYz0B9wPfa6wondMfaivmHpzrQ3v9q8cnmRbL6yW8=
|
||||
github.com/dsnet/compress v0.0.1 h1:PlZu0n3Tuv04TzpfPbrnI0HW/YwodEXDS+oPKahKF0Q=
|
||||
github.com/dsnet/compress v0.0.1/go.mod h1:Aw8dCMJ7RioblQeTqt88akK31OvO8Dhf5JflhBbQEHo=
|
||||
github.com/dsnet/golib v0.0.0-20171103203638-1ea166775780/go.mod h1:Lj+Z9rebOhdfkVLjJ8T6VcRQv3SXugXy999NBtR9aFY=
|
||||
github.com/gabriel-vasile/mimetype v1.4.3 h1:in2uUcidCuFcDKtdcBxlR0rJ1+fsokWf+uqxgUFjbI0=
|
||||
github.com/gabriel-vasile/mimetype v1.4.3/go.mod h1:d8uq/6HKRL6CGdk+aubisF/M5GcPfT7nKyLpA0lbSSk=
|
||||
github.com/goccy/go-json v0.10.3 h1:KZ5WoDbxAIgm2HNbYckL0se1fHD6rz5j4ywS6ebzDqA=
|
||||
github.com/goccy/go-json v0.10.3/go.mod h1:oq7eo15ShAhp70Anwd5lgX2pLfOS3QCiwU/PULtXL6M=
|
||||
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 h1:SajEQ6tktpF9SRIuzbiPOX9AEZZ53Bvw0k9Mzrts8Lg=
|
||||
github.com/gabriel-vasile/mimetype v1.4.13 h1:46nXokslUBsAJE/wMsp5gtO500a4F3Nkz9Ufpk2AcUM=
|
||||
github.com/gabriel-vasile/mimetype v1.4.13/go.mod h1:d+9Oxyo1wTzWdyVUPMmXFvp4F9tea18J8ufA774AB3s=
|
||||
github.com/goccy/go-json v0.10.6 h1:p8HrPJzOakx/mn/bQtjgNjdTcN+/S6FcG2CTtQOrHVU=
|
||||
github.com/goccy/go-json v0.10.6/go.mod h1:oq7eo15ShAhp70Anwd5lgX2pLfOS3QCiwU/PULtXL6M=
|
||||
github.com/google/go-cmp v0.6.0 h1:ofyhxvXcZhMsU5ulbFiLKl/XBFqE1GSq7atu8tAmTRI=
|
||||
github.com/google/go-cmp v0.6.0/go.mod h1:17dUlkBOakJ0+DkrSSNjCkIjxS6bF9zb3elmeNGIjoY=
|
||||
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419/go.mod h1:YKu81H3RSd1cFh0d7NhvUoTtUC9IY/vBX0WUQb1/o4Y=
|
||||
github.com/goombaio/orderedmap v0.0.0-20180925151256-3da0e2f905f9 h1:vFjPvFavIiDY71bQ9HIxPQBANvNl1SmFC4fgg5xRkho=
|
||||
github.com/goombaio/orderedmap v0.0.0-20180925151256-3da0e2f905f9/go.mod h1:YKu81H3RSd1cFh0d7NhvUoTtUC9IY/vBX0WUQb1/o4Y=
|
||||
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77 h1:4dvq1tGHn1Y9KSRY0OZ24Khki4+4U+ZrA//YYsdUlJU=
|
||||
github.com/goombaio/orderedset v0.0.0-20180925151225-8e67b20a9b77/go.mod h1:HPelMYpOyy0XvglpBbmZ3krZpwaHmszj/vQNlnETPTM=
|
||||
github.com/k0kubun/go-ansi v0.0.0-20180517002512-3bf9e2903213/go.mod h1:vNUNkEQ1e29fT/6vq2aBdFsgNPmy8qMdSay1npru+Sw=
|
||||
github.com/klauspost/compress v1.4.1/go.mod h1:RyIbtBH6LamlWaDj8nUwkbUhJ87Yi3uG0guNDohfE1A=
|
||||
github.com/klauspost/compress v1.17.2 h1:RlWWUY/Dr4fL8qk9YG7DTZ7PDgME2V4csBXA8L/ixi4=
|
||||
github.com/klauspost/compress v1.17.2/go.mod h1:ntbaceVETuRiXiv4DpjP66DpAtAGkEQskQzEyD//IeE=
|
||||
github.com/klauspost/compress v1.18.4 h1:RPhnKRAQ4Fh8zU2FY/6ZFDwTVTxgJ/EMydqSTzE9a2c=
|
||||
github.com/klauspost/compress v1.18.4/go.mod h1:R0h/fSBs8DE4ENlcrlib3PsXS61voFxhIs2DeRhCvJ4=
|
||||
github.com/klauspost/cpuid v1.2.0/go.mod h1:Pj4uuM528wm8OyEC2QMXAi2YiTZ96dNQPGgoMS4s3ek=
|
||||
github.com/klauspost/pgzip v1.2.6 h1:8RXeL5crjEUFnR2/Sn6GJNWtSQ3Dk8pq4CL3jvdDyjU=
|
||||
github.com/klauspost/pgzip v1.2.6/go.mod h1:Ch1tH69qFZu15pkjo5kYi6mth2Zzwzt50oCQKQE9RUs=
|
||||
@@ -41,10 +46,8 @@ github.com/kr/pty v1.1.1/go.mod h1:pFQYn66WHrOpPYNljwOMqo10TkYh1fy3cYio2l3bCsQ=
|
||||
github.com/kr/text v0.1.0/go.mod h1:4Jbv+DJW3UT/LiOwJeYQe1efqtUx/iVham/4vfdArNI=
|
||||
github.com/kr/text v0.2.0 h1:5Nx0Ya0ZqY2ygV366QzturHI13Jq95ApcVaJBhpS+AY=
|
||||
github.com/kr/text v0.2.0/go.mod h1:eLer722TekiGuMkidMxC/pM04lWEeraHUUmBw8l2grE=
|
||||
github.com/mattn/go-isatty v0.0.17/go.mod h1:kYGgaQfpe5nmfYZH+SKPsOc2e4SrIfOl2e/yFXSvRLM=
|
||||
github.com/mattn/go-runewidth v0.0.14/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
|
||||
github.com/mattn/go-runewidth v0.0.15 h1:UNAjwbU9l54TA3KzvqLGxwWjHmMgBUVhBiTjelZgg3U=
|
||||
github.com/mattn/go-runewidth v0.0.15/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
|
||||
github.com/mattn/go-runewidth v0.0.21 h1:jJKAZiQH+2mIinzCJIaIG9Be1+0NR+5sz/lYEEjdM8w=
|
||||
github.com/mattn/go-runewidth v0.0.21/go.mod h1:XBkDxAl56ILZc9knddidhrOlY5R/pDhgLpndooCuJAs=
|
||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2EmQ4l5rM/4FEfDWcRD+abF5XlKShorW5LRoQ=
|
||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
|
||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
|
||||
@@ -54,50 +57,40 @@ github.com/pelletier/go-toml/v2 v2.2.4/go.mod h1:2gIqNv+qfxSVS7cM2xJQKtLSTLUE9V8
|
||||
github.com/pkg/diff v0.0.0-20210226163009-20ebb0f2a09e/go.mod h1:pJLUxLENpZxwdsKMEsNbx1VGcRFpLqf3715MtcvvzbA=
|
||||
github.com/pmezard/go-difflib v1.0.0 h1:4DBwDE0NGyQoBHbLQYPwSUPoCMWR5BEzIk/f1lZbAQM=
|
||||
github.com/pmezard/go-difflib v1.0.0/go.mod h1:iKH77koFhYxTK1pcRnkKkqfTogsbg7gZNVY4sRDYZ/4=
|
||||
github.com/rivo/uniseg v0.2.0/go.mod h1:J6wj4VEh+S6ZtnVlnTBMWIodfgj8LQOQFoIToxlJtxc=
|
||||
github.com/rivo/uniseg v0.4.4 h1:8TfxU8dW6PdqD27gjM8MVNuicgxIjxpm4K7x4jp8sis=
|
||||
github.com/rivo/uniseg v0.4.4/go.mod h1:FN3SvrM+Zdj16jyLfmOkMNblXMcoc8DfTHruCPUcx88=
|
||||
github.com/rivo/uniseg v0.4.7 h1:WUdvkW8uEhrYfLC4ZzdpI2ztxP1I582+49Oc5Mq64VQ=
|
||||
github.com/rivo/uniseg v0.4.7/go.mod h1:FN3SvrM+Zdj16jyLfmOkMNblXMcoc8DfTHruCPUcx88=
|
||||
github.com/rogpeppe/go-internal v1.9.0/go.mod h1:WtVeX8xhTBvf0smdhujwtBcq4Qrzq/fJaraNFVN+nFs=
|
||||
github.com/rogpeppe/go-internal v1.12.0 h1:exVL4IDcn6na9z1rAb56Vxr+CgyK3nn3O+epU5NdKM8=
|
||||
github.com/rogpeppe/go-internal v1.12.0/go.mod h1:E+RYuTGaKKdloAfM02xzb0FW3Paa99yedzYV+kq4uf4=
|
||||
github.com/rrethy/ahocorasick v1.0.0 h1:YKkCB+E5PXc0xmLfMrWbfNht8vG9Re97IHSWZk/Lk8E=
|
||||
github.com/rrethy/ahocorasick v1.0.0/go.mod h1:nq8oScE7Vy1rOppoQxpQiiDmPHuKCuk9rXrNcxUV3R0=
|
||||
github.com/schollz/progressbar/v3 v3.13.1 h1:o8rySDYiQ59Mwzy2FELeHY5ZARXZTVJC7iHD6PEFUiE=
|
||||
github.com/schollz/progressbar/v3 v3.13.1/go.mod h1:xvrbki8kfT1fzWzBT/UZd9L6GA+jdL7HAgq2RFnO6fQ=
|
||||
github.com/shopspring/decimal v1.3.1 h1:2Usl1nmF/WZucqkFZhnfFYxxxu8LG21F6nPQBE5gKV8=
|
||||
github.com/schollz/progressbar/v3 v3.19.0 h1:Ea18xuIRQXLAUidVDox3AbwfUhD0/1IvohyTutOIFoc=
|
||||
github.com/schollz/progressbar/v3 v3.19.0/go.mod h1:IsO3lpbaGuzh8zIMzgY3+J8l4C8GjO0Y9S69eFvNsec=
|
||||
github.com/shopspring/decimal v1.3.1/go.mod h1:DKyhrW/HYNuLGql+MJL6WCR6knT2jwCFRcu2hWCYk4o=
|
||||
github.com/sirupsen/logrus v1.9.3 h1:dueUQJ1C2q9oE3F7wvmSGAaVtTmUizReu6fjN8uqzbQ=
|
||||
github.com/sirupsen/logrus v1.9.3/go.mod h1:naHLuLoDiP4jHNo9R0sCBMtWGeIprob74mVsIT4qYEQ=
|
||||
github.com/stretchr/objx v0.1.0/go.mod h1:HFkY916IF+rwdDfMAkV7OtwuqBVzrE8GR6GFx+wExME=
|
||||
github.com/stretchr/testify v1.3.0/go.mod h1:M5WIy9Dh21IEIfnGCwXGc5bZfKNJtfHm1UVUgZn+9EI=
|
||||
github.com/stretchr/testify v1.7.0/go.mod h1:6Fq8oRcR53rry900zMqJjRRixrwX3KX962/h/Wwjteg=
|
||||
github.com/stretchr/testify v1.8.4 h1:CcVxjf3Q8PM0mHUKJCdn+eZZtm5yQwehR5yeSVQQcUk=
|
||||
github.com/stretchr/testify v1.8.4/go.mod h1:sz/lmYIOXD/1dqDmKjjqLyZ2RngseejIcXlSw2iwfAo=
|
||||
github.com/shopspring/decimal v1.4.0 h1:bxl37RwXBklmTi0C79JfXCEBD1cqqHt0bbgBAGFp81k=
|
||||
github.com/shopspring/decimal v1.4.0/go.mod h1:gawqmDU56v4yIKSwfBSFip1HdCCXN8/+DMd9qYNcwME=
|
||||
github.com/sirupsen/logrus v1.9.4 h1:TsZE7l11zFCLZnZ+teH4Umoq5BhEIfIzfRDZ1Uzql2w=
|
||||
github.com/sirupsen/logrus v1.9.4/go.mod h1:ftWc9WdOfJ0a92nsE2jF5u5ZwH8Bv2zdeOC42RjbV2g=
|
||||
github.com/stretchr/testify v1.10.0 h1:Xv5erBjTwe/5IxqUQTdXv5kgmIvbHo3QQyRwhJsOfJA=
|
||||
github.com/stretchr/testify v1.10.0/go.mod h1:r2ic/lqez/lEtzL7wO/rwa5dbSLXVDPFyf8C91i36aY=
|
||||
github.com/tevino/abool/v2 v2.1.0 h1:7w+Vf9f/5gmKT4m4qkayb33/92M+Um45F2BkHOR+L/c=
|
||||
github.com/tevino/abool/v2 v2.1.0/go.mod h1:+Lmlqk6bHDWHqN1cbxqhwEAwMPXgc8I1SDEamtseuXY=
|
||||
github.com/ulikunitz/xz v0.5.6/go.mod h1:2bypXElzHzzJZwzH67Y6wb67pO62Rzfn7BSiF4ABRW8=
|
||||
github.com/ulikunitz/xz v0.5.11 h1:kpFauv27b6ynzBNT/Xy+1k+fK4WswhN/6PN5WhFAGw8=
|
||||
github.com/ulikunitz/xz v0.5.11/go.mod h1:nbz6k7qbPmH4IRqmfOplQw/tblSgqTqBwxkY0oWt/14=
|
||||
github.com/ulikunitz/xz v0.5.15 h1:9DNdB5s+SgV3bQ2ApL10xRc35ck0DuIX/isZvIk+ubY=
|
||||
github.com/ulikunitz/xz v0.5.15/go.mod h1:nbz6k7qbPmH4IRqmfOplQw/tblSgqTqBwxkY0oWt/14=
|
||||
github.com/yuin/gopher-lua v1.1.1 h1:kYKnWBjvbNP4XLT3+bPEwAXJx262OhaHDWDVOPjL46M=
|
||||
github.com/yuin/gopher-lua v1.1.1/go.mod h1:GBR0iDaNXjAgGg9zfCvksxSRnQx76gclCIb7kdAd1Pw=
|
||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa h1:FRnLl4eNAQl8hwxVVC17teOw8kdjVDVAiFMtgUdTSRQ=
|
||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa/go.mod h1:zk2irFbV9DP96SEBUUAy67IdHUaZuSnrz1n472HUCLE=
|
||||
golang.org/x/net v0.35.0 h1:T5GQRQb2y08kTAByq9L4/bz8cipCdA8FbRTXewonqY8=
|
||||
golang.org/x/net v0.35.0/go.mod h1:EglIi67kWsHKlRzzVMUD93VMSWGFOMSZgxFjparz1Qk=
|
||||
golang.org/x/sys v0.0.0-20220715151400-c0bba94af5f8/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
||||
golang.org/x/sys v0.0.0-20220811171246-fbc7d0a398ab/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
||||
golang.org/x/sys v0.6.0/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
||||
golang.org/x/sys v0.30.0 h1:QjkSwP/36a20jFYWkSue1YwXzLmsV5Gfq7Eiy72C1uc=
|
||||
golang.org/x/sys v0.30.0/go.mod h1:/VUhepiaJMQUp4+oa/7Zr1D23ma6VTLIYjOOTFZPUcA=
|
||||
golang.org/x/term v0.6.0/go.mod h1:m6U89DPEgQRMq3DNkDClhWw02AUbt2daBVO4cn4Hv9U=
|
||||
golang.org/x/term v0.29.0 h1:L6pJp37ocefwRRtYPKSWOWzOtWSxVajvz2ldH/xi3iU=
|
||||
golang.org/x/term v0.29.0/go.mod h1:6bl4lRlvVuDgSf3179VpIxBF0o10JUpXWOnI7nErv7s=
|
||||
gonum.org/v1/gonum v0.14.0 h1:2NiG67LD1tEH0D7kM+ps2V+fXmsAnpUeec7n8tcr4S0=
|
||||
gonum.org/v1/gonum v0.14.0/go.mod h1:AoWeoz0becf9QMWtE8iWXNXc27fK4fNeHNf/oMejGfU=
|
||||
golang.org/x/exp v0.0.0-20260312153236-7ab1446f8b90 h1:jiDhWWeC7jfWqR9c/uplMOqJ0sbNlNWv0UkzE0vX1MA=
|
||||
golang.org/x/exp v0.0.0-20260312153236-7ab1446f8b90/go.mod h1:xE1HEv6b+1SCZ5/uscMRjUBKtIxworgEcEi+/n9NQDQ=
|
||||
golang.org/x/sys v0.42.0 h1:omrd2nAlyT5ESRdCLYdm3+fMfNFE/+Rf4bDIQImRJeo=
|
||||
golang.org/x/sys v0.42.0/go.mod h1:4GL1E5IUh+htKOUEOaiffhrAeqysfVGipDYzABqnCmw=
|
||||
golang.org/x/term v0.41.0 h1:QCgPso/Q3RTJx2Th4bDLqML4W6iJiaXFq2/ftQF13YU=
|
||||
golang.org/x/term v0.41.0/go.mod h1:3pfBgksrReYfZ5lvYM0kSO0LIkAl4Yl2bXOkKP7Ec2A=
|
||||
gonum.org/v1/gonum v0.17.0 h1:VbpOemQlsSMrYmn7T2OUvQ4dqxQXU+ouZFQsZOx50z4=
|
||||
gonum.org/v1/gonum v0.17.0/go.mod h1:El3tOrEuMpv2UdMrbNlKEh9vd86bmQ6vqIcDwxEOc1E=
|
||||
gopkg.in/check.v1 v0.0.0-20161208181325-20d25e280405/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0=
|
||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c h1:Hei/4ADfdWqJk1ZMxUNpqntNwaWcugrBjAiHlqqRiVk=
|
||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c/go.mod h1:JHkPIbrfpd72SG/EVd6muEfDQjcINNoR0C8j2r3qZ4Q=
|
||||
gopkg.in/yaml.v3 v3.0.0-20200313102051-9f266ea9e77c/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
|
||||
gopkg.in/yaml.v3 v3.0.1 h1:fxVm/GzAzEWqLHuvctI91KS9hhNmmWOoWu0XTYJS7CA=
|
||||
gopkg.in/yaml.v3 v3.0.1/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
|
||||
scientificgo.org/special v0.0.0 h1:P6WJkECo6tgtvZAEfNXl+KEB9ReAatjKAeX8U07mjSc=
|
||||
|
||||
@@ -52,6 +52,8 @@ golang.org/x/image v0.6.0/go.mod h1:MXLdDR43H7cDJq5GEGXEVeeNhPgi+YYEQ2pC1byI1x0=
|
||||
golang.org/x/mod v0.13.0 h1:I/DsJXRlw/8l/0c24sM9yb0T4z9liZTduXvdAWYiysY=
|
||||
golang.org/x/mod v0.13.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
||||
golang.org/x/mod v0.14.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
||||
golang.org/x/net v0.38.0/go.mod h1:ivrbrMbzFq5J41QOQh0siUuly180yBYtLp+CKbEaFx8=
|
||||
golang.org/x/net v0.52.0/go.mod h1:R1MAz7uMZxVMualyPXb+VaqGSa3LIaUqk0eEt3w36Sw=
|
||||
golang.org/x/sync v0.0.0-20220722155255-886fb9371eb4 h1:uVc8UZUe6tr40fFVnUP5Oj+veunVezqYl9z7DYw9xzw=
|
||||
golang.org/x/text v0.13.0 h1:ablQoSUd0tRdKxZewP80B+BaqeKJuVhuRxj/dkrun3k=
|
||||
golang.org/x/text v0.13.0/go.mod h1:TvPlkZtksWOMsz7fbANvkp4WM8x/WCo/om8BMLbz+aE=
|
||||
|
||||
+8
-6
@@ -183,22 +183,24 @@ GOURL=$(curl -s "${URL}${GOFILE}" \
|
||||
|
||||
echo "Installing Go from: $GOURL" 1>&2
|
||||
|
||||
curl -s "$GOURL" | tar zxf -
|
||||
curl --progress-bar "$GOURL" | tar zxf -
|
||||
|
||||
PATH="$(pwd)/go/bin:$PATH"
|
||||
export GOROOT="$(pwd)/go"
|
||||
PATH="${GOROOT}/bin:$PATH"
|
||||
export PATH
|
||||
GOPATH="$(pwd)/go"
|
||||
export GOPATH
|
||||
export GOPATH="$(pwd)/gopath"
|
||||
export GOCACHE="$(pwd)/cache"
|
||||
export GOTOOLCHAIN=local
|
||||
|
||||
echo "GOROOT=$GOROOT" 1>&2
|
||||
echo "GOCACHE=$GOCACHE" 1>&2
|
||||
mkdir -p "$GOCACHE"
|
||||
mkdir -p "$GOPATH" "$GOCACHE"
|
||||
|
||||
# Download OBITools4 source
|
||||
echo "Downloading OBITools4 v${VERSION}..." 1>&2
|
||||
echo "Source URL: $OBIURL4" 1>&2
|
||||
|
||||
if ! curl -sL "$OBIURL4" > obitools4.zip; then
|
||||
if ! curl --progress-bar -L "$OBIURL4" > obitools4.zip; then
|
||||
echo "Error: Could not download OBITools4 version ${VERSION}" 1>&2
|
||||
echo "Please check that this version exists with: $0 --list" 1>&2
|
||||
exit 1
|
||||
|
||||
Binary file not shown.
Vendored
BIN
Binary file not shown.
Vendored
BIN
Binary file not shown.
@@ -0,0 +1,24 @@
|
||||
>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
|
||||
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
|
||||
gcctgaaactcaaaggacttggcggtgctttacatccct
|
||||
>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
|
||||
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
|
||||
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||
>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
|
||||
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
|
||||
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||
>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
|
||||
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
|
||||
gcttaaaactcaaaggacttggcggtgctttatatccct
|
||||
>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
|
||||
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
|
||||
gattaaacctcaaaggacttggcagtgctttatacccct
|
||||
>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
|
||||
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
|
||||
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||
>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
|
||||
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
|
||||
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||
>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
|
||||
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
|
||||
gcttaaaactcaaaggacttggcggtgctttatatccct
|
||||
@@ -0,0 +1,48 @@
|
||||
taxid,parent,taxonomic_rank,scientific_name
|
||||
taxon:1 [root]@no rank,taxon:1 [root]@no rank,no rank,root
|
||||
taxon:131567 [cellular organisms]@cellular root,taxon:1 [root]@no rank,cellular root,cellular organisms
|
||||
taxon:2759 [Eukaryota]@domain,taxon:131567 [cellular organisms]@cellular root,domain,Eukaryota
|
||||
taxon:33154 [Opisthokonta]@clade,taxon:2759 [Eukaryota]@domain,clade,Opisthokonta
|
||||
taxon:33208 [Metazoa]@kingdom,taxon:33154 [Opisthokonta]@clade,kingdom,Metazoa
|
||||
taxon:6072 [Eumetazoa]@clade,taxon:33208 [Metazoa]@kingdom,clade,Eumetazoa
|
||||
taxon:33213 [Bilateria]@clade,taxon:6072 [Eumetazoa]@clade,clade,Bilateria
|
||||
taxon:33511 [Deuterostomia]@clade,taxon:33213 [Bilateria]@clade,clade,Deuterostomia
|
||||
taxon:7711 [Chordata]@phylum,taxon:33511 [Deuterostomia]@clade,phylum,Chordata
|
||||
taxon:89593 [Craniata]@subphylum,taxon:7711 [Chordata]@phylum,subphylum,Craniata
|
||||
taxon:7742 [Vertebrata]@clade,taxon:89593 [Craniata]@subphylum,clade,Vertebrata
|
||||
taxon:7776 [Gnathostomata]@clade,taxon:7742 [Vertebrata]@clade,clade,Gnathostomata
|
||||
taxon:117570 [Teleostomi]@clade,taxon:7776 [Gnathostomata]@clade,clade,Teleostomi
|
||||
taxon:117571 [Euteleostomi]@clade,taxon:117570 [Teleostomi]@clade,clade,Euteleostomi
|
||||
taxon:8287 [Sarcopterygii]@superclass,taxon:117571 [Euteleostomi]@clade,superclass,Sarcopterygii
|
||||
taxon:1338369 [Dipnotetrapodomorpha]@clade,taxon:8287 [Sarcopterygii]@superclass,clade,Dipnotetrapodomorpha
|
||||
taxon:32523 [Tetrapoda]@clade,taxon:1338369 [Dipnotetrapodomorpha]@clade,clade,Tetrapoda
|
||||
taxon:32524 [Amniota]@clade,taxon:32523 [Tetrapoda]@clade,clade,Amniota
|
||||
taxon:40674 [Mammalia]@class,taxon:32524 [Amniota]@clade,class,Mammalia
|
||||
taxon:32525 [Theria]@clade,taxon:40674 [Mammalia]@class,clade,Theria
|
||||
taxon:9347 [Eutheria]@clade,taxon:32525 [Theria]@clade,clade,Eutheria
|
||||
taxon:1437010 [Boreoeutheria]@clade,taxon:9347 [Eutheria]@clade,clade,Boreoeutheria
|
||||
taxon:314146 [Euarchontoglires]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Euarchontoglires
|
||||
taxon:314145 [Laurasiatheria]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Laurasiatheria
|
||||
taxon:33554 [Carnivora]@order,taxon:314145 [Laurasiatheria]@superorder,order,Carnivora
|
||||
taxon:91561 [Artiodactyla]@order,taxon:314145 [Laurasiatheria]@superorder,order,Artiodactyla
|
||||
taxon:314147 [Glires]@clade,taxon:314146 [Euarchontoglires]@superorder,clade,Glires
|
||||
taxon:9845 [Ruminantia]@suborder,taxon:91561 [Artiodactyla]@order,suborder,Ruminantia
|
||||
taxon:35500 [Pecora]@infraorder,taxon:9845 [Ruminantia]@suborder,infraorder,Pecora
|
||||
taxon:9989 [Rodentia]@order,taxon:314147 [Glires]@clade,order,Rodentia
|
||||
taxon:379584 [Caniformia]@suborder,taxon:33554 [Carnivora]@order,suborder,Caniformia
|
||||
taxon:9608 [Canidae]@family,taxon:379584 [Caniformia]@suborder,family,Canidae
|
||||
taxon:9850 [Cervidae]@family,taxon:35500 [Pecora]@infraorder,family,Cervidae
|
||||
taxon:9881 [Odocoileinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Odocoileinae
|
||||
taxon:33553 [Sciuromorpha]@suborder,taxon:9989 [Rodentia]@order,suborder,Sciuromorpha
|
||||
taxon:55153 [Sciuridae]@family,taxon:33553 [Sciuromorpha]@suborder,family,Sciuridae
|
||||
taxon:34878 [Cervinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Cervinae
|
||||
taxon:9611 [Canis]@genus,taxon:9608 [Canidae]@family,genus,Canis
|
||||
taxon:9857 [Capreolus]@genus,taxon:9881 [Odocoileinae]@subfamily,genus,Capreolus
|
||||
taxon:9612 [Canis lupus]@species,taxon:9611 [Canis]@genus,species,Canis lupus
|
||||
taxon:337726 [Xerinae]@subfamily,taxon:55153 [Sciuridae]@family,subfamily,Xerinae
|
||||
taxon:9859 [Cervus]@genus,taxon:34878 [Cervinae]@subfamily,genus,Cervus
|
||||
taxon:337730 [Marmotini]@tribe,taxon:337726 [Xerinae]@subfamily,tribe,Marmotini
|
||||
taxon:9992 [Marmota]@genus,taxon:337730 [Marmotini]@tribe,genus,Marmota
|
||||
taxon:9860 [Cervus elaphus]@species,taxon:9859 [Cervus]@genus,species,Cervus elaphus
|
||||
taxon:9615 [Canis lupus familiaris]@subspecies,taxon:9612 [Canis lupus]@species,subspecies,Canis lupus familiaris
|
||||
taxon:9858 [Capreolus capreolus]@species,taxon:9857 [Capreolus]@genus,species,Capreolus capreolus
|
||||
|
@@ -134,6 +134,130 @@ else
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
# ------------------------------------------------------------------
|
||||
# --raw-taxid tests (no taxonomy loaded)
|
||||
# ------------------------------------------------------------------
|
||||
|
||||
# Running test
|
||||
((ntest++))
|
||||
if obiconvert --raw-taxid "${TEST_DIR}/out_ecotag.fasta" \
|
||||
> "${TMPDIR}/raw_taxid.fasta" 2>/dev/null
|
||||
then
|
||||
log "$MCMD --raw-taxid: running OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD --raw-taxid: running failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Taxids must be bare numbers — no full-format "taxon:ID [Name]@rank" strings
|
||||
((ntest++))
|
||||
if grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
|
||||
then
|
||||
log "$MCMD --raw-taxid: taxid format check failed (full-format taxid found)"
|
||||
((failed++))
|
||||
else
|
||||
log "$MCMD --raw-taxid: taxid format OK (all taxids are bare numbers)"
|
||||
((success++))
|
||||
fi
|
||||
|
||||
# --raw-taxid is idempotent: piping through a second obiconvert --raw-taxid must
|
||||
# produce bit-for-bit identical output.
|
||||
((ntest++))
|
||||
if obiconvert --raw-taxid "${TMPDIR}/raw_taxid.fasta" \
|
||||
> "${TMPDIR}/raw_taxid2.fasta" 2>/dev/null
|
||||
then
|
||||
log "$MCMD --raw-taxid piped: running OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD --raw-taxid piped: running failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if diff "${TMPDIR}/raw_taxid.fasta" \
|
||||
"${TMPDIR}/raw_taxid2.fasta" > /dev/null
|
||||
then
|
||||
log "$MCMD --raw-taxid piped: idempotency OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD --raw-taxid piped: idempotency failed (outputs differ)"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
# ------------------------------------------------------------------
|
||||
# --taxonomy tests (full-format taxid, no --raw-taxid)
|
||||
# ------------------------------------------------------------------
|
||||
|
||||
# Running test
|
||||
((ntest++))
|
||||
if obiconvert --taxonomy "${TEST_DIR}/taxonomy.csv" \
|
||||
"${TEST_DIR}/out_ecotag.fasta" \
|
||||
> "${TMPDIR}/taxo.fasta" 2>/dev/null
|
||||
then
|
||||
log "$MCMD --taxonomy: running OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD --taxonomy: running failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Taxids must be in full "taxon:ID [Name]@rank" format
|
||||
((ntest++))
|
||||
if grep '"taxid"' "${TMPDIR}/taxo.fasta" | grep -q '"taxid":"taxon:[0-9]'
|
||||
then
|
||||
log "$MCMD --taxonomy: taxid format OK (full-format taxids present)"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD --taxonomy: taxid format check failed (no full-format taxid found)"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
# ------------------------------------------------------------------
|
||||
# --raw-taxid --taxonomy tests
|
||||
# ------------------------------------------------------------------
|
||||
|
||||
# Running test
|
||||
((ntest++))
|
||||
if obiconvert --raw-taxid --taxonomy "${TEST_DIR}/taxonomy.csv" \
|
||||
"${TEST_DIR}/out_ecotag.fasta" \
|
||||
> "${TMPDIR}/raw_taxid_taxo.fasta" 2>/dev/null
|
||||
then
|
||||
log "$MCMD --raw-taxid --taxonomy: running OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD --raw-taxid --taxonomy: running failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Taxids must be bare numbers even when taxonomy is loaded
|
||||
((ntest++))
|
||||
if grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
|
||||
then
|
||||
log "$MCMD --raw-taxid --taxonomy: taxid format check failed (full-format taxid found)"
|
||||
((failed++))
|
||||
else
|
||||
log "$MCMD --raw-taxid --taxonomy: taxid format OK (all taxids are bare numbers)"
|
||||
((success++))
|
||||
fi
|
||||
|
||||
# --raw-taxid with or without taxonomy must yield identical taxid values
|
||||
((ntest++))
|
||||
if diff <(grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
|
||||
<(grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
|
||||
> /dev/null
|
||||
then
|
||||
log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values match OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values differ (unexpected)"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
|
||||
@@ -0,0 +1,24 @@
|
||||
>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
|
||||
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
|
||||
gcctgaaactcaaaggacttggcggtgctttacatccct
|
||||
>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
|
||||
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
|
||||
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||
>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
|
||||
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
|
||||
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||
>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
|
||||
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
|
||||
gcttaaaactcaaaggacttggcggtgctttatatccct
|
||||
>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
|
||||
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
|
||||
gattaaacctcaaaggacttggcagtgctttatacccct
|
||||
>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
|
||||
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
|
||||
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||
>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
|
||||
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
|
||||
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||
>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
|
||||
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
|
||||
gcttaaaactcaaaggacttggcggtgctttatatccct
|
||||
+46
-1
@@ -1,6 +1,12 @@
|
||||
package obidefault
|
||||
|
||||
var _BatchSize = 2000
|
||||
// _BatchSize is the minimum number of sequences per batch (floor).
|
||||
// Used as the minSeqs argument to RebatchBySize.
|
||||
var _BatchSize = 1
|
||||
|
||||
// _BatchSizeMax is the maximum number of sequences per batch (ceiling).
|
||||
// A batch is flushed when this count is reached regardless of memory usage.
|
||||
var _BatchSizeMax = 2000
|
||||
|
||||
// SetBatchSize sets the size of the sequence batches.
|
||||
//
|
||||
@@ -24,3 +30,42 @@ func BatchSize() int {
|
||||
func BatchSizePtr() *int {
|
||||
return &_BatchSize
|
||||
}
|
||||
|
||||
// BatchSizeMax returns the maximum number of sequences per batch.
|
||||
func BatchSizeMax() int {
|
||||
return _BatchSizeMax
|
||||
}
|
||||
|
||||
func BatchSizeMaxPtr() *int {
|
||||
return &_BatchSizeMax
|
||||
}
|
||||
|
||||
// _BatchMem holds the maximum cumulative memory (in bytes) per batch when
|
||||
// memory-based batching is requested. A value of 0 disables memory-based
|
||||
// batching and falls back to count-based batching.
|
||||
var _BatchMem = 128 * 1024 * 1024 // 128 MB default; set to 0 to disable
|
||||
var _BatchMemStr = ""
|
||||
|
||||
// SetBatchMem sets the memory budget per batch in bytes.
|
||||
func SetBatchMem(n int) {
|
||||
_BatchMem = n
|
||||
}
|
||||
|
||||
// BatchMem returns the current memory budget per batch in bytes.
|
||||
// A value of 0 means memory-based batching is disabled.
|
||||
func BatchMem() int {
|
||||
return _BatchMem
|
||||
}
|
||||
|
||||
func BatchMemPtr() *int {
|
||||
return &_BatchMem
|
||||
}
|
||||
|
||||
// BatchMemStr returns the raw --batch-mem string value as provided on the CLI.
|
||||
func BatchMemStr() string {
|
||||
return _BatchMemStr
|
||||
}
|
||||
|
||||
func BatchMemStrPtr() *string {
|
||||
return &_BatchMemStr
|
||||
}
|
||||
|
||||
@@ -17,7 +17,7 @@ import (
|
||||
)
|
||||
|
||||
var __obi_header_value_string_pattern__ = regexp.MustCompile(`^'\s*([^']*'|"[^"]*")\s*;`)
|
||||
var __obi_header_value_numeric_pattern__ = regexp.MustCompile(`^\s*([+-]?\.\d+|[+-]?\d+(\.\d*)?([eE][+-]?\d+)?)\s*;`)
|
||||
var __obi_header_value_numeric_pattern__ = regexp.MustCompile(`^\s*[+-]?(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?\s*;`)
|
||||
var __obi_header_map_int_key__ = regexp.MustCompile("([{,])([0-9]+):")
|
||||
|
||||
func __match__dict__(text []byte) []int {
|
||||
@@ -146,6 +146,65 @@ func __match__key__(text []byte) []int {
|
||||
return []int{} // Not a key
|
||||
}
|
||||
|
||||
func __match__array__(text []byte) []int {
|
||||
|
||||
state := 0
|
||||
level := 0
|
||||
start := 0
|
||||
instring := byte(0)
|
||||
|
||||
for i, r := range text {
|
||||
if state == 2 {
|
||||
if r == ';' {
|
||||
return []int{start, i + 1}
|
||||
}
|
||||
if r != ' ' && r != '\t' {
|
||||
return []int{}
|
||||
}
|
||||
}
|
||||
|
||||
if state == 0 {
|
||||
if r == '[' {
|
||||
level++
|
||||
state++
|
||||
start = i
|
||||
continue
|
||||
}
|
||||
if r != ' ' && r != '\t' {
|
||||
return []int{}
|
||||
}
|
||||
continue
|
||||
}
|
||||
|
||||
// state == 1: inside the array
|
||||
if instring != 0 {
|
||||
if r == instring {
|
||||
instring = 0
|
||||
}
|
||||
continue
|
||||
}
|
||||
|
||||
if r == '"' || r == '\'' {
|
||||
instring = r
|
||||
continue
|
||||
}
|
||||
|
||||
if r == '[' || r == '{' {
|
||||
level++
|
||||
continue
|
||||
}
|
||||
|
||||
if r == ']' || r == '}' {
|
||||
level--
|
||||
if level == 0 {
|
||||
state++
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
return []int{}
|
||||
}
|
||||
|
||||
func __match__general__(text []byte) []int {
|
||||
|
||||
for i, r := range text {
|
||||
@@ -242,6 +301,21 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
|
||||
stop = m[1] + 1
|
||||
} else {
|
||||
|
||||
// array value
|
||||
m = __match__array__(part)
|
||||
if len(m) > 0 {
|
||||
bvalue = bytes.TrimSpace(part[m[0]:(m[1] - 1)])
|
||||
j := bytes.ReplaceAll(bvalue, []byte("'"), []byte(`"`))
|
||||
j = __obi_header_map_int_key__.ReplaceAll(j, []byte(`$1"$2":`))
|
||||
arr, err := _parse_json_array_interface(j)
|
||||
if err != nil {
|
||||
value = string(bvalue)
|
||||
} else {
|
||||
value = arr
|
||||
}
|
||||
stop = m[1] + 1
|
||||
} else {
|
||||
|
||||
// Generic value
|
||||
|
||||
// m = __obi_header_value_general_pattern__.FindIndex(part)
|
||||
@@ -264,6 +338,7 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
|
||||
// no value
|
||||
break
|
||||
} // End of No value
|
||||
} // End of not array
|
||||
} // End of not dict
|
||||
} // End of not string
|
||||
} // End of not numeric
|
||||
@@ -272,6 +347,8 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
|
||||
case float64:
|
||||
if vt == math.Floor(vt) {
|
||||
annotations[key] = int(vt)
|
||||
} else {
|
||||
annotations[key] = vt
|
||||
}
|
||||
default:
|
||||
annotations[key] = value
|
||||
@@ -327,9 +404,8 @@ func WriteFastSeqOBIHeade(buffer *bytes.Buffer, sequence *obiseq.BioSequence) {
|
||||
buffer.WriteString(fmt.Sprintf("%s=", key))
|
||||
buffer.Write(tv)
|
||||
buffer.WriteString("; ")
|
||||
case map[string]int,
|
||||
map[string]string,
|
||||
map[string]interface{}:
|
||||
default:
|
||||
if obiutils.IsAMap(value) || obiutils.IsASlice(value) || obiutils.IsAnArray(value) {
|
||||
tv, err := obiutils.JsonMarshal(t)
|
||||
if err != nil {
|
||||
log.Fatalf("Cannot convert %v value", value)
|
||||
@@ -338,11 +414,12 @@ func WriteFastSeqOBIHeade(buffer *bytes.Buffer, sequence *obiseq.BioSequence) {
|
||||
buffer.WriteString(fmt.Sprintf("%s=", key))
|
||||
buffer.Write(tv)
|
||||
buffer.WriteString("; ")
|
||||
default:
|
||||
} else {
|
||||
buffer.WriteString(fmt.Sprintf("%s=%v; ", key, value))
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
if sequence.HasDefinition() {
|
||||
buffer.WriteByte(' ')
|
||||
|
||||
@@ -90,6 +90,9 @@ func FormatFastaBatch(batch obiiter.BioSequenceBatch, formater FormatHeader, ski
|
||||
log.Debugf("FormatFastaBatch: #%d : %d seqs", batch.Order(), batch.Len())
|
||||
|
||||
for _, seq := range batch.Slice() {
|
||||
if len(seq.Id()) == 0 {
|
||||
log.Fatalf("Sequence identifier is empty")
|
||||
}
|
||||
if seq.Len() > 0 {
|
||||
// Write header directly into bs — no intermediate string
|
||||
bs.WriteByte('>')
|
||||
|
||||
@@ -64,6 +64,9 @@ func FormatFastqBatch(batch obiiter.BioSequenceBatch,
|
||||
first := true
|
||||
|
||||
for _, seq := range batch.Slice() {
|
||||
if len(seq.Id()) == 0 {
|
||||
log.Fatalf("Sequence identifier is empty")
|
||||
}
|
||||
if seq.Len() > 0 {
|
||||
_formatFastq(&bs, seq, formater)
|
||||
|
||||
|
||||
@@ -631,9 +631,9 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
|
||||
return nil, fmt.Errorf("row %d has %d columns, expected %d", len(data), len(fields), len(header))
|
||||
}
|
||||
|
||||
forward_primer := fields[forward_primerColIndex]
|
||||
reverse_primer := fields[reverse_primerColIndex]
|
||||
tags := _parseMainNGSFilterTags(fields[sample_tagColIndex])
|
||||
forward_primer := strings.TrimSpace(fields[forward_primerColIndex])
|
||||
reverse_primer := strings.TrimSpace(fields[reverse_primerColIndex])
|
||||
tags := _parseMainNGSFilterTags(strings.TrimSpace(fields[sample_tagColIndex]))
|
||||
|
||||
marker, _ := ngsfilter.GetMarker(forward_primer, reverse_primer)
|
||||
pcr, ok := marker.GetPCR(tags.Forward, tags.Reverse)
|
||||
@@ -644,8 +644,8 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
|
||||
i, tags.Forward, tags.Reverse, forward_primer, reverse_primer)
|
||||
}
|
||||
|
||||
pcr.Experiment = fields[experimentColIndex]
|
||||
pcr.Sample = fields[sampleColIndex]
|
||||
pcr.Experiment = strings.TrimSpace(fields[experimentColIndex])
|
||||
pcr.Sample = strings.TrimSpace(fields[sampleColIndex])
|
||||
|
||||
if extraColumns != nil {
|
||||
pcr.Annotations = make(obiseq.Annotation)
|
||||
|
||||
@@ -444,6 +444,67 @@ func (iterator IBioSequence) Rebatch(size int) IBioSequence {
|
||||
return newIter
|
||||
}
|
||||
|
||||
// RebatchBySize reorganises the stream into batches bounded by two independent
|
||||
// upper limits: maxCount (max number of sequences) and maxBytes (max cumulative
|
||||
// estimated memory). A batch is flushed as soon as either limit would be
|
||||
// exceeded. A single sequence larger than maxBytes is always emitted alone.
|
||||
// Passing 0 for a limit disables that constraint; if both are 0 it falls back
|
||||
// to Rebatch(obidefault.BatchSizeMax()).
|
||||
func (iterator IBioSequence) RebatchBySize(maxBytes int, maxCount int) IBioSequence {
|
||||
if maxBytes <= 0 && maxCount <= 0 {
|
||||
return iterator.Rebatch(obidefault.BatchSizeMax())
|
||||
}
|
||||
|
||||
newIter := MakeIBioSequence()
|
||||
|
||||
newIter.Add(1)
|
||||
|
||||
go func() {
|
||||
newIter.WaitAndClose()
|
||||
}()
|
||||
|
||||
go func() {
|
||||
order := 0
|
||||
iterator = iterator.SortBatches()
|
||||
buffer := obiseq.MakeBioSequenceSlice()
|
||||
bufBytes := 0
|
||||
source := ""
|
||||
|
||||
flush := func() {
|
||||
if len(buffer) > 0 {
|
||||
newIter.Push(MakeBioSequenceBatch(source, order, buffer))
|
||||
order++
|
||||
buffer = obiseq.MakeBioSequenceSlice()
|
||||
bufBytes = 0
|
||||
}
|
||||
}
|
||||
|
||||
for iterator.Next() {
|
||||
seqs := iterator.Get()
|
||||
source = seqs.Source()
|
||||
for _, s := range seqs.Slice() {
|
||||
sz := s.MemorySize()
|
||||
countFull := maxCount > 0 && len(buffer) >= maxCount
|
||||
memFull := maxBytes > 0 && bufBytes+sz > maxBytes && len(buffer) > 0
|
||||
if countFull || memFull {
|
||||
flush()
|
||||
}
|
||||
buffer = append(buffer, s)
|
||||
bufBytes += sz
|
||||
}
|
||||
}
|
||||
flush()
|
||||
|
||||
newIter.Done()
|
||||
}()
|
||||
|
||||
if iterator.IsPaired() {
|
||||
newIter.MarkAsPaired()
|
||||
}
|
||||
|
||||
return newIter
|
||||
}
|
||||
|
||||
func (iterator IBioSequence) FilterEmpty() IBioSequence {
|
||||
|
||||
newIter := MakeIBioSequence()
|
||||
@@ -638,7 +699,7 @@ func (iterator IBioSequence) FilterOn(predicate obiseq.SequencePredicate,
|
||||
trueIter.MarkAsPaired()
|
||||
}
|
||||
|
||||
return trueIter.Rebatch(size)
|
||||
return trueIter.RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||
}
|
||||
|
||||
func (iterator IBioSequence) FilterAnd(predicate obiseq.SequencePredicate,
|
||||
@@ -694,7 +755,7 @@ func (iterator IBioSequence) FilterAnd(predicate obiseq.SequencePredicate,
|
||||
trueIter.MarkAsPaired()
|
||||
}
|
||||
|
||||
return trueIter.Rebatch(size)
|
||||
return trueIter.RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||
}
|
||||
|
||||
// Load all sequences availables from an IBioSequenceBatch iterator into
|
||||
|
||||
+18
-24
@@ -57,34 +57,21 @@ func (dist *IDistribute) Classifier() *obiseq.BioSequenceClassifier {
|
||||
}
|
||||
|
||||
// Distribute organizes the biosequences from the iterator into batches
|
||||
// based on the provided classifier and batch sizes. It returns an
|
||||
// IDistribute instance that manages the distribution of the sequences.
|
||||
// based on the provided classifier. It returns an IDistribute instance
|
||||
// that manages the distribution of the sequences.
|
||||
//
|
||||
// Parameters:
|
||||
// - class: A pointer to a BioSequenceClassifier used to classify
|
||||
// the biosequences during distribution.
|
||||
// - sizes: Optional integer values specifying the batch size. If
|
||||
// no sizes are provided, a default batch size of 5000 is used.
|
||||
//
|
||||
// Returns:
|
||||
// An IDistribute instance that contains the outputs of the
|
||||
// classified biosequences, a channel for new data notifications,
|
||||
// and the classifier used for distribution. The method operates
|
||||
// asynchronously, processing the sequences in separate goroutines.
|
||||
// It ensures that the outputs are closed and cleaned up once
|
||||
// processing is complete.
|
||||
func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, sizes ...int) IDistribute {
|
||||
batchsize := obidefault.BatchSize()
|
||||
// Batches are flushed when either BatchSizeMax() sequences or BatchMem()
|
||||
// bytes are accumulated per key, mirroring the RebatchBySize strategy.
|
||||
func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier) IDistribute {
|
||||
maxCount := obidefault.BatchSizeMax()
|
||||
maxBytes := obidefault.BatchMem()
|
||||
|
||||
outputs := make(map[int]IBioSequence, 100)
|
||||
slices := make(map[int]*obiseq.BioSequenceSlice, 100)
|
||||
bufBytes := make(map[int]int, 100)
|
||||
orders := make(map[int]int, 100)
|
||||
news := make(chan int)
|
||||
|
||||
if len(sizes) > 0 {
|
||||
batchsize = sizes[0]
|
||||
}
|
||||
|
||||
jobDone := sync.WaitGroup{}
|
||||
lock := sync.Mutex{}
|
||||
|
||||
@@ -115,6 +102,7 @@ func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, siz
|
||||
slice = &s
|
||||
slices[key] = slice
|
||||
orders[key] = 0
|
||||
bufBytes[key] = 0
|
||||
|
||||
lock.Lock()
|
||||
outputs[key] = MakeIBioSequence()
|
||||
@@ -123,14 +111,20 @@ func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, siz
|
||||
news <- key
|
||||
}
|
||||
|
||||
*slice = append(*slice, s)
|
||||
|
||||
if len(*slice) == batchsize {
|
||||
sz := s.MemorySize()
|
||||
countFull := maxCount > 0 && len(*slice) >= maxCount
|
||||
memFull := maxBytes > 0 && bufBytes[key]+sz > maxBytes && len(*slice) > 0
|
||||
if countFull || memFull {
|
||||
outputs[key].Push(MakeBioSequenceBatch(source, orders[key], *slice))
|
||||
orders[key]++
|
||||
s := obiseq.MakeBioSequenceSlice()
|
||||
slices[key] = &s
|
||||
slice = &s
|
||||
bufBytes[key] = 0
|
||||
}
|
||||
|
||||
*slice = append(*slice, s)
|
||||
bufBytes[key] += sz
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
@@ -3,6 +3,7 @@ package obiiter
|
||||
import (
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
@@ -70,7 +71,7 @@ func IFragments(minsize, length, overlap, size, nworkers int) Pipeable {
|
||||
}
|
||||
go f(iterator)
|
||||
|
||||
return newiter.SortBatches().Rebatch(size)
|
||||
return newiter.SortBatches().RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||
}
|
||||
|
||||
return ifrg
|
||||
|
||||
@@ -47,7 +47,7 @@ func Encode4mer(seq *obiseq.BioSequence, buffer *[]byte) []byte {
|
||||
length := slength - 3
|
||||
rawseq := seq.Sequence()
|
||||
|
||||
if length < 0 {
|
||||
if length <= 0 {
|
||||
return nil
|
||||
}
|
||||
|
||||
|
||||
+75
-40
@@ -4,22 +4,21 @@ import "math"
|
||||
|
||||
// KmerEntropy computes the entropy of a single encoded k-mer.
|
||||
//
|
||||
// The algorithm mirrors the lowmask entropy calculation: it decodes the k-mer
|
||||
// The algorithm mirrors the Rust obiskbuilder entropy: it decodes the k-mer
|
||||
// to a DNA sequence, extracts all sub-words of each size from 1 to levelMax,
|
||||
// normalizes them by circular canonical form, counts their frequencies, and
|
||||
// computes Shannon entropy normalized by the maximum possible entropy.
|
||||
// computes Shannon entropy corrected for class sizes, normalized by the
|
||||
// maximum possible entropy over 4^ws raw bins.
|
||||
// The returned value is the minimum entropy across all word sizes.
|
||||
//
|
||||
// Correction for small sequences: the raw entropy H = log(N) - Σ f·log(f)/N
|
||||
// under-estimates the true complexity when many raw words collapse to the same
|
||||
// canonical form. Adding Σ f·log(class_size)/N recovers the entropy of the
|
||||
// underlying uncollapsed distribution (assuming uniform mixing within each
|
||||
// equivalence class).
|
||||
//
|
||||
// A value close to 0 indicates very low complexity (e.g. "AAAA..."),
|
||||
// while a value close to 1 indicates high complexity.
|
||||
//
|
||||
// Parameters:
|
||||
// - kmer: the encoded k-mer (2 bits per base)
|
||||
// - k: the k-mer size
|
||||
// - levelMax: maximum sub-word size for entropy (typically 6)
|
||||
//
|
||||
// Returns:
|
||||
// - minimum normalized entropy across all word sizes 1..levelMax
|
||||
func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
||||
if k < 1 || levelMax < 1 {
|
||||
return 1.0
|
||||
@@ -35,7 +34,7 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
||||
var seqBuf [32]byte
|
||||
seq := DecodeKmer(kmer, k, seqBuf[:])
|
||||
|
||||
// Pre-compute nLogN lookup (same as lowmask)
|
||||
// Pre-compute nLogN lookup
|
||||
nLogN := make([]float64, k+1)
|
||||
for i := 1; i <= k; i++ {
|
||||
nLogN[i] = float64(i) * math.Log(float64(i))
|
||||
@@ -51,6 +50,23 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
||||
}
|
||||
}
|
||||
|
||||
// Build ln(class_size) tables: for each canonical form, how many raw
|
||||
// words map to it under circular normalization.
|
||||
classLogSizeTables := make([][]float64, levelMax+1)
|
||||
for ws := 1; ws <= levelMax; ws++ {
|
||||
tableSize := 1 << (ws * 2)
|
||||
classSize := make([]int, tableSize)
|
||||
for code := 0; code < tableSize; code++ {
|
||||
classSize[normTables[ws][code]]++
|
||||
}
|
||||
classLogSizeTables[ws] = make([]float64, tableSize)
|
||||
for j := 0; j < tableSize; j++ {
|
||||
if classSize[j] > 0 {
|
||||
classLogSizeTables[ws][j] = math.Log(float64(classSize[j]))
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
minEntropy := math.MaxFloat64
|
||||
|
||||
for ws := 1; ws <= levelMax; ws++ {
|
||||
@@ -75,23 +91,13 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
||||
table[normWord]++
|
||||
}
|
||||
|
||||
// Compute Shannon entropy
|
||||
// Compute emax over 4^ws raw bins (uncollapsed distribution).
|
||||
floatNwords := float64(nwords)
|
||||
logNwords := math.Log(floatNwords)
|
||||
|
||||
var sumNLogN float64
|
||||
for j := 0; j < tableSize; j++ {
|
||||
n := table[j]
|
||||
if n > 0 {
|
||||
sumNLogN += nLogN[n]
|
||||
}
|
||||
}
|
||||
|
||||
// Compute emax (maximum possible entropy for this word size)
|
||||
na := CanonicalCircularKmerCount(ws)
|
||||
na := tableSize // 4^ws
|
||||
var emax float64
|
||||
if nwords < na {
|
||||
emax = math.Log(float64(nwords))
|
||||
emax = logNwords
|
||||
} else {
|
||||
cov := nwords / na
|
||||
remains := nwords - (na * cov)
|
||||
@@ -105,7 +111,19 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
|
||||
continue
|
||||
}
|
||||
|
||||
entropy := (logNwords - sumNLogN/floatNwords) / emax
|
||||
// Accumulate Σ f·log(f) and Σ f·log(class_size) over canonical forms.
|
||||
classLogSize := classLogSizeTables[ws]
|
||||
var sumNLogN, sumClassLogN float64
|
||||
for j := 0; j < tableSize; j++ {
|
||||
n := table[j]
|
||||
if n > 0 {
|
||||
sumNLogN += nLogN[n]
|
||||
sumClassLogN += float64(n) * classLogSize[j]
|
||||
}
|
||||
}
|
||||
|
||||
// Corrected entropy: H_raw ≈ log(N) + (Σf·log(s) - Σf·log(f)) / N
|
||||
entropy := (logNwords + sumClassLogN/floatNwords - sumNLogN/floatNwords) / emax
|
||||
if entropy < 0 {
|
||||
entropy = 0
|
||||
}
|
||||
@@ -134,6 +152,7 @@ type KmerEntropyFilter struct {
|
||||
threshold float64
|
||||
nLogN []float64
|
||||
normTables [][]int
|
||||
classLogSizeTables [][]float64
|
||||
emaxValues []float64
|
||||
logNwords []float64
|
||||
// Pre-allocated frequency tables reused across Entropy() calls.
|
||||
@@ -142,11 +161,6 @@ type KmerEntropyFilter struct {
|
||||
}
|
||||
|
||||
// NewKmerEntropyFilter creates an entropy filter with pre-computed tables.
|
||||
//
|
||||
// Parameters:
|
||||
// - k: the k-mer size
|
||||
// - levelMax: maximum sub-word size for entropy (typically 6)
|
||||
// - threshold: entropy threshold (k-mers with entropy <= threshold are rejected)
|
||||
func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter {
|
||||
if levelMax >= k {
|
||||
levelMax = k - 1
|
||||
@@ -169,20 +183,38 @@ func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter
|
||||
}
|
||||
}
|
||||
|
||||
// ln(class_size) for each canonical form under circular normalization.
|
||||
classLogSizeTables := make([][]float64, levelMax+1)
|
||||
for ws := 1; ws <= levelMax; ws++ {
|
||||
tableSize := 1 << (ws * 2)
|
||||
classSize := make([]int, tableSize)
|
||||
for code := 0; code < tableSize; code++ {
|
||||
classSize[normTables[ws][code]]++
|
||||
}
|
||||
classLogSizeTables[ws] = make([]float64, tableSize)
|
||||
for j := 0; j < tableSize; j++ {
|
||||
if classSize[j] > 0 {
|
||||
classLogSizeTables[ws][j] = math.Log(float64(classSize[j]))
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// Pre-compute emax and logNwords per word size.
|
||||
// emax uses 4^ws raw bins to match the corrected entropy.
|
||||
emaxValues := make([]float64, levelMax+1)
|
||||
logNwords := make([]float64, levelMax+1)
|
||||
for ws := 1; ws <= levelMax; ws++ {
|
||||
nw := k - ws + 1
|
||||
na := CanonicalCircularKmerCount(ws)
|
||||
na := 1 << (ws * 2) // 4^ws raw bins
|
||||
floatNw := float64(nw)
|
||||
logNwords[ws] = math.Log(floatNw)
|
||||
if nw < na {
|
||||
logNwords[ws] = math.Log(float64(nw))
|
||||
emaxValues[ws] = math.Log(float64(nw))
|
||||
emaxValues[ws] = logNwords[ws]
|
||||
} else {
|
||||
cov := nw / na
|
||||
remains := nw - (na * cov)
|
||||
f1 := float64(cov) / float64(nw)
|
||||
f2 := float64(cov+1) / float64(nw)
|
||||
logNwords[ws] = math.Log(float64(nw))
|
||||
f1 := float64(cov) / floatNw
|
||||
f2 := float64(cov+1) / floatNw
|
||||
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
|
||||
float64(remains)*f2*math.Log(f2))
|
||||
}
|
||||
@@ -200,6 +232,7 @@ func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter
|
||||
threshold: threshold,
|
||||
nLogN: nLogN,
|
||||
normTables: normTables,
|
||||
classLogSizeTables: classLogSizeTables,
|
||||
emaxValues: emaxValues,
|
||||
logNwords: logNwords,
|
||||
freqTables: freqTables,
|
||||
@@ -236,7 +269,7 @@ func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
|
||||
// Count circular-canonical sub-word frequencies
|
||||
tableSize := 1 << (ws * 2)
|
||||
table := ef.freqTables[ws]
|
||||
clear(table) // reset to zero
|
||||
clear(table)
|
||||
mask := (1 << (ws * 2)) - 1
|
||||
normTable := ef.normTables[ws]
|
||||
|
||||
@@ -251,19 +284,21 @@ func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
|
||||
table[normWord]++
|
||||
}
|
||||
|
||||
// Compute Shannon entropy
|
||||
floatNwords := float64(nwords)
|
||||
logNwords := ef.logNwords[ws]
|
||||
classLogSize := ef.classLogSizeTables[ws]
|
||||
|
||||
var sumNLogN float64
|
||||
var sumNLogN, sumClassLogN float64
|
||||
for j := 0; j < tableSize; j++ {
|
||||
n := table[j]
|
||||
if n > 0 {
|
||||
sumNLogN += ef.nLogN[n]
|
||||
sumClassLogN += float64(n) * classLogSize[j]
|
||||
}
|
||||
}
|
||||
|
||||
entropy := (logNwords - sumNLogN/floatNwords) / emax
|
||||
// Corrected entropy: H_raw ≈ log(N) + (Σf·log(s) - Σf·log(f)) / N
|
||||
entropy := (logNwords + sumClassLogN/floatNwords - sumNLogN/floatNwords) / emax
|
||||
if entropy < 0 {
|
||||
entropy = 0
|
||||
}
|
||||
|
||||
+90
-7
@@ -91,7 +91,7 @@ func LuaWorker(proto *lua.FunctionProto) obiseq.SeqWorker {
|
||||
err := interpreter.PCall(0, lua.MultRet, nil)
|
||||
|
||||
if err != nil {
|
||||
log.Fatalf("Error in executing the lua script")
|
||||
log.Fatalf("Error in executing the lua script: %v", err)
|
||||
}
|
||||
|
||||
result := interpreter.GetGlobal("worker")
|
||||
@@ -141,6 +141,69 @@ func LuaWorker(proto *lua.FunctionProto) obiseq.SeqWorker {
|
||||
return nil
|
||||
}
|
||||
|
||||
// LuaSliceWorker creates a SeqSliceWorker that calls the Lua function
|
||||
// named "slice_worker". Unlike LuaWorker, the entire batch (BioSequenceSlice)
|
||||
// is passed to the Lua function at once, enabling batch-level processing
|
||||
// (e.g. a single HTTP request per batch instead of one per sequence).
|
||||
//
|
||||
// The Lua function signature:
|
||||
//
|
||||
// function slice_worker(slice) -- receives a BioSequenceSlice
|
||||
// -- process the batch
|
||||
// return slice -- returns a BioSequenceSlice (or nil)
|
||||
// end
|
||||
func LuaSliceWorker(proto *lua.FunctionProto) obiseq.SeqSliceWorker {
|
||||
interpreter := NewInterpreter()
|
||||
lfunc := interpreter.NewFunctionFromProto(proto)
|
||||
interpreter.Push(lfunc)
|
||||
err := interpreter.PCall(0, lua.MultRet, nil)
|
||||
|
||||
if err != nil {
|
||||
log.Fatalf("Error in executing the lua script: %v", err)
|
||||
}
|
||||
|
||||
result := interpreter.GetGlobal("slice_worker")
|
||||
|
||||
if lua_worker, ok := result.(*lua.LFunction); ok {
|
||||
f := func(slice obiseq.BioSequenceSlice) (obiseq.BioSequenceSlice, error) {
|
||||
if err := interpreter.CallByParam(lua.P{
|
||||
Fn: lua_worker,
|
||||
NRet: 1,
|
||||
Protect: true,
|
||||
}, obiseqslice2Lua(interpreter, &slice)); err != nil {
|
||||
log.Fatal(err)
|
||||
}
|
||||
|
||||
lreponse := interpreter.Get(-1)
|
||||
defer interpreter.Pop(1)
|
||||
|
||||
if reponse, ok := lreponse.(*lua.LUserData); ok {
|
||||
s := reponse.Value
|
||||
switch val := s.(type) {
|
||||
case *obiseq.BioSequenceSlice:
|
||||
return *val, nil
|
||||
case *obiseq.BioSequence:
|
||||
return obiseq.BioSequenceSlice{val}, nil
|
||||
default:
|
||||
r := reflect.TypeOf(val)
|
||||
return nil, fmt.Errorf("slice_worker function doesn't return the correct type %s", r)
|
||||
}
|
||||
}
|
||||
|
||||
if _, ok = lreponse.(*lua.LNilType); ok {
|
||||
return nil, nil
|
||||
}
|
||||
|
||||
return nil, fmt.Errorf("slice_worker function doesn't return the correct type %T", lreponse)
|
||||
}
|
||||
|
||||
return f
|
||||
}
|
||||
|
||||
log.Fatalf("The slice_worker object is not a function")
|
||||
return nil
|
||||
}
|
||||
|
||||
// LuaProcessor processes a Lua script on a sequence iterator and returns a new iterator.
|
||||
//
|
||||
// Parameters:
|
||||
@@ -173,7 +236,7 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
|
||||
err = interpreter.PCall(0, lua.MultRet, nil)
|
||||
|
||||
if err != nil {
|
||||
log.Fatalf("Error in executing the lua script")
|
||||
log.Fatalf("Error in executing the lua script: %v", err)
|
||||
}
|
||||
|
||||
result := interpreter.GetGlobal("begin")
|
||||
@@ -198,7 +261,7 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
|
||||
err = interpreter.PCall(0, lua.MultRet, nil)
|
||||
|
||||
if err != nil {
|
||||
log.Fatalf("Error in executing the lua script")
|
||||
log.Fatalf("Error in executing the lua script: %v", err)
|
||||
}
|
||||
|
||||
result := interpreter.GetGlobal("finish")
|
||||
@@ -216,11 +279,27 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
|
||||
|
||||
}()
|
||||
|
||||
ff := func(iterator obiiter.IBioSequence) {
|
||||
w := LuaWorker(proto)
|
||||
sw := obiseq.SeqToSliceWorker(w, false)
|
||||
// Detect whether the script defines slice_worker (batch-level) or worker (per-sequence).
|
||||
hasSliceWorker := func() bool {
|
||||
interpreter := NewInterpreter()
|
||||
lfunc := interpreter.NewFunctionFromProto(proto)
|
||||
interpreter.Push(lfunc)
|
||||
if err := interpreter.PCall(0, lua.MultRet, nil); err != nil {
|
||||
return false
|
||||
}
|
||||
result := interpreter.GetGlobal("slice_worker")
|
||||
interpreter.Close()
|
||||
_, ok := result.(*lua.LFunction)
|
||||
return ok
|
||||
}()
|
||||
|
||||
// iterator = iterator.SortBatches()
|
||||
ff := func(iterator obiiter.IBioSequence) {
|
||||
var sw obiseq.SeqSliceWorker
|
||||
if hasSliceWorker {
|
||||
sw = LuaSliceWorker(proto)
|
||||
} else {
|
||||
sw = obiseq.SeqToSliceWorker(LuaWorker(proto), false)
|
||||
}
|
||||
|
||||
for iterator.Next() {
|
||||
seqs := iterator.Get()
|
||||
@@ -235,6 +314,10 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
|
||||
}
|
||||
}
|
||||
|
||||
if ns == nil {
|
||||
ns = obiseq.BioSequenceSlice{}
|
||||
}
|
||||
|
||||
newIter.Push(obiiter.MakeBioSequenceBatch(seqs.Source(), seqs.Order(), ns))
|
||||
}
|
||||
|
||||
|
||||
@@ -17,15 +17,7 @@ import (
|
||||
// No return values. This function operates directly on the Lua state stack.
|
||||
func pushInterfaceToLua(L *lua.LState, val interface{}) {
|
||||
switch v := val.(type) {
|
||||
case string:
|
||||
L.Push(lua.LString(v))
|
||||
case bool:
|
||||
L.Push(lua.LBool(v))
|
||||
case int:
|
||||
L.Push(lua.LNumber(v))
|
||||
case float64:
|
||||
L.Push(lua.LNumber(v))
|
||||
// Add other cases as needed for different types
|
||||
// Typed slices and maps from internal OBITools code — not produced by json.Unmarshal
|
||||
case map[string]int:
|
||||
pushMapStringIntToLua(L, v)
|
||||
case map[string]string:
|
||||
@@ -34,8 +26,6 @@ func pushInterfaceToLua(L *lua.LState, val interface{}) {
|
||||
pushMapStringBoolToLua(L, v)
|
||||
case map[string]float64:
|
||||
pushMapStringFloat64ToLua(L, v)
|
||||
case map[string]interface{}:
|
||||
pushMapStringInterfaceToLua(L, v)
|
||||
case []string:
|
||||
pushSliceStringToLua(L, v)
|
||||
case []int:
|
||||
@@ -46,61 +36,61 @@ func pushInterfaceToLua(L *lua.LState, val interface{}) {
|
||||
pushSliceNumericToLua(L, v)
|
||||
case []bool:
|
||||
pushSliceBoolToLua(L, v)
|
||||
case []interface{}:
|
||||
pushSliceInterfaceToLua(L, v)
|
||||
case nil:
|
||||
L.Push(lua.LNil)
|
||||
case *sync.Mutex:
|
||||
pushMutexToLua(L, v)
|
||||
default:
|
||||
log.Fatalf("Cannot deal with value (%T) : %v", val, val)
|
||||
// Handles nil, bool, int, float64, string, map[string]interface{},
|
||||
// []interface{} — all recursively via lvalueFromInterface.
|
||||
L.Push(lvalueFromInterface(L, v))
|
||||
}
|
||||
}
|
||||
|
||||
func pushMapStringInterfaceToLua(L *lua.LState, m map[string]interface{}) {
|
||||
// Create a new Lua table
|
||||
luaTable := L.NewTable()
|
||||
// Iterate over the Go map and set the key-value pairs in the Lua table
|
||||
for key, value := range m {
|
||||
switch v := value.(type) {
|
||||
case int:
|
||||
luaTable.RawSetString(key, lua.LNumber(v))
|
||||
case float64:
|
||||
luaTable.RawSetString(key, lua.LNumber(v))
|
||||
case bool:
|
||||
luaTable.RawSetString(key, lua.LBool(v))
|
||||
case string:
|
||||
luaTable.RawSetString(key, lua.LString(v))
|
||||
default:
|
||||
log.Fatalf("Doesn't deal with map containing value %v of type %T", v, v)
|
||||
L.SetField(luaTable, key, lvalueFromInterface(L, value))
|
||||
}
|
||||
}
|
||||
|
||||
// Push the Lua table onto the stack
|
||||
L.Push(luaTable)
|
||||
}
|
||||
|
||||
func pushSliceInterfaceToLua(L *lua.LState, s []interface{}) {
|
||||
// Create a new Lua table
|
||||
luaTable := L.NewTable()
|
||||
// Iterate over the Go map and set the key-value pairs in the Lua table
|
||||
for _, value := range s {
|
||||
switch v := value.(type) {
|
||||
case int:
|
||||
luaTable.Append(lua.LNumber(v))
|
||||
case float64:
|
||||
luaTable.Append(lua.LNumber(v))
|
||||
case bool:
|
||||
luaTable.Append(lua.LBool(v))
|
||||
case string:
|
||||
luaTable.Append(lua.LString(v))
|
||||
default:
|
||||
log.Fatalf("Doesn't deal with slice containing value %v of type %T", v, v)
|
||||
luaTable.Append(lvalueFromInterface(L, value))
|
||||
}
|
||||
L.Push(luaTable)
|
||||
}
|
||||
|
||||
// Push the Lua table onto the stack
|
||||
L.Push(luaTable)
|
||||
// lvalueFromInterface converts a Go interface{} value (as produced by json.Unmarshal)
|
||||
// to the corresponding lua.LValue, handling nested maps and slices recursively.
|
||||
func lvalueFromInterface(L *lua.LState, value interface{}) lua.LValue {
|
||||
switch v := value.(type) {
|
||||
case nil:
|
||||
return lua.LNil
|
||||
case bool:
|
||||
return lua.LBool(v)
|
||||
case int:
|
||||
return lua.LNumber(v)
|
||||
case float64:
|
||||
return lua.LNumber(v)
|
||||
case string:
|
||||
return lua.LString(v)
|
||||
case map[string]interface{}:
|
||||
t := L.NewTable()
|
||||
for key, val := range v {
|
||||
L.SetField(t, key, lvalueFromInterface(L, val))
|
||||
}
|
||||
return t
|
||||
case []interface{}:
|
||||
t := L.NewTable()
|
||||
for _, val := range v {
|
||||
t.Append(lvalueFromInterface(L, val))
|
||||
}
|
||||
return t
|
||||
default:
|
||||
log.Fatalf("lvalueFromInterface: unsupported type %T: %v", v, v)
|
||||
return lua.LNil
|
||||
}
|
||||
}
|
||||
|
||||
// pushMapStringIntToLua creates a new Lua table and iterates over the Go map to set key-value pairs in the Lua table. It then pushes the Lua table onto the stack.
|
||||
|
||||
@@ -28,6 +28,8 @@ func Table2Interface(interpreter *lua.LState, table *lua.LTable) interface{} {
|
||||
val[i-1] = float64(v.(lua.LNumber))
|
||||
case lua.LTString:
|
||||
val[i-1] = string(v.(lua.LString))
|
||||
case lua.LTTable:
|
||||
val[i-1] = Table2Interface(interpreter, v.(*lua.LTable))
|
||||
}
|
||||
}
|
||||
return val
|
||||
@@ -45,6 +47,8 @@ func Table2Interface(interpreter *lua.LState, table *lua.LTable) interface{} {
|
||||
val[string(ks)] = float64(v.(lua.LNumber))
|
||||
case lua.LTString:
|
||||
val[string(ks)] = string(v.(lua.LString))
|
||||
case lua.LTTable:
|
||||
val[string(ks)] = Table2Interface(interpreter, v.(*lua.LTable))
|
||||
}
|
||||
}
|
||||
})
|
||||
|
||||
@@ -0,0 +1,128 @@
|
||||
package obilua
|
||||
|
||||
import (
|
||||
"context"
|
||||
"io"
|
||||
"net/http"
|
||||
"strings"
|
||||
"sync"
|
||||
"time"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
lua "github.com/yuin/gopher-lua"
|
||||
)
|
||||
|
||||
const httpClientTimeout = 300 * time.Second
|
||||
|
||||
var (
|
||||
_httpClient *http.Client
|
||||
_httpClientOnce sync.Once
|
||||
|
||||
// _httpSemaphore limits the number of concurrent HTTP requests.
|
||||
// Initialised lazily alongside the client.
|
||||
_httpSemaphore chan struct{}
|
||||
)
|
||||
|
||||
func getHTTPClient() *http.Client {
|
||||
_httpClientOnce.Do(func() {
|
||||
conns := 2 * obidefault.ParallelWorkers()
|
||||
_httpClient = &http.Client{
|
||||
Transport: &http.Transport{
|
||||
MaxIdleConnsPerHost: conns,
|
||||
MaxConnsPerHost: conns,
|
||||
IdleConnTimeout: 90 * time.Second,
|
||||
},
|
||||
Timeout: httpClientTimeout,
|
||||
}
|
||||
_httpSemaphore = make(chan struct{}, obidefault.ParallelWorkers())
|
||||
})
|
||||
return _httpClient
|
||||
}
|
||||
|
||||
// RegisterHTTP registers the http module in the Lua state as a global,
|
||||
// consistent with obicontext and BioSequence.
|
||||
//
|
||||
// Exposes:
|
||||
//
|
||||
// http.post(url, body [, timeout_ms]) → response string (on success)
|
||||
// http.post(url, body [, timeout_ms]) → nil, err string (on error)
|
||||
// http.set_concurrency(n) → set max simultaneous requests
|
||||
func RegisterHTTP(luaState *lua.LState) {
|
||||
table := luaState.NewTable()
|
||||
luaState.SetField(table, "post", luaState.NewFunction(luaHTTPPost))
|
||||
luaState.SetField(table, "set_concurrency", luaState.NewFunction(luaHTTPSetConcurrency))
|
||||
luaState.SetGlobal("http", table)
|
||||
}
|
||||
|
||||
// luaHTTPPost implements http.post(url, body [, timeout_ms]) for Lua.
|
||||
//
|
||||
// The optional third argument overrides the default timeout (in milliseconds).
|
||||
// Concurrent requests are throttled through _httpSemaphore so that a
|
||||
// single-threaded backend server is not overwhelmed by K parallel workers.
|
||||
//
|
||||
// Lua signature:
|
||||
//
|
||||
// local response = http.post(url, body)
|
||||
// local response = http.post(url, body, 5000) -- 5 s timeout
|
||||
// local response, err = http.post(url, body)
|
||||
func luaHTTPPost(L *lua.LState) int {
|
||||
url := L.CheckString(1)
|
||||
body := L.CheckString(2)
|
||||
|
||||
client := getHTTPClient()
|
||||
|
||||
timeout := httpClientTimeout
|
||||
if L.GetTop() >= 3 {
|
||||
ms := L.CheckInt(3)
|
||||
timeout = time.Duration(ms) * time.Millisecond
|
||||
}
|
||||
|
||||
// Acquire semaphore slot — blocks until a slot is free.
|
||||
_httpSemaphore <- struct{}{}
|
||||
defer func() { <-_httpSemaphore }()
|
||||
|
||||
ctx, cancel := context.WithTimeout(context.Background(), timeout)
|
||||
defer cancel()
|
||||
|
||||
req, err := http.NewRequestWithContext(ctx, http.MethodPost, url, strings.NewReader(body))
|
||||
if err != nil {
|
||||
L.Push(lua.LNil)
|
||||
L.Push(lua.LString(err.Error()))
|
||||
return 2
|
||||
}
|
||||
req.Header.Set("Content-Type", "application/json")
|
||||
|
||||
resp, err := client.Do(req)
|
||||
if err != nil {
|
||||
L.Push(lua.LNil)
|
||||
L.Push(lua.LString(err.Error()))
|
||||
return 2
|
||||
}
|
||||
defer resp.Body.Close()
|
||||
|
||||
respBytes, err := io.ReadAll(resp.Body)
|
||||
if err != nil {
|
||||
L.Push(lua.LNil)
|
||||
L.Push(lua.LString(err.Error()))
|
||||
return 2
|
||||
}
|
||||
|
||||
L.Push(lua.LString(respBytes))
|
||||
return 1
|
||||
}
|
||||
|
||||
// luaHTTPSetConcurrency replaces the semaphore with a new one of size n.
|
||||
// Must be called before the first http.post (e.g. in begin()).
|
||||
//
|
||||
// Lua signature:
|
||||
//
|
||||
// http.set_concurrency(1) -- serialise all HTTP requests
|
||||
func luaHTTPSetConcurrency(L *lua.LState) int {
|
||||
n := L.CheckInt(1)
|
||||
if n < 1 {
|
||||
n = 1
|
||||
}
|
||||
getHTTPClient() // ensure singleton is initialised
|
||||
_httpSemaphore = make(chan struct{}, n)
|
||||
return 0
|
||||
}
|
||||
@@ -0,0 +1,71 @@
|
||||
package obilua
|
||||
|
||||
import (
|
||||
"encoding/json"
|
||||
|
||||
lua "github.com/yuin/gopher-lua"
|
||||
)
|
||||
|
||||
// RegisterJSON registers the json module in the Lua state as a global,
|
||||
// consistent with obicontext, BioSequence, and http.
|
||||
//
|
||||
// Exposes:
|
||||
//
|
||||
// json.encode(data) → string (on success)
|
||||
// json.encode(data) → nil, err (on error)
|
||||
// json.decode(string) → value (on success)
|
||||
// json.decode(string) → nil, err (on error)
|
||||
func RegisterJSON(luaState *lua.LState) {
|
||||
table := luaState.NewTable()
|
||||
luaState.SetField(table, "encode", luaState.NewFunction(luaJSONEncode))
|
||||
luaState.SetField(table, "decode", luaState.NewFunction(luaJSONDecode))
|
||||
luaState.SetGlobal("json", table)
|
||||
}
|
||||
|
||||
// luaJSONEncode implements json.encode(data) for Lua.
|
||||
func luaJSONEncode(L *lua.LState) int {
|
||||
val := L.CheckAny(1)
|
||||
|
||||
var goVal interface{}
|
||||
switch v := val.(type) {
|
||||
case *lua.LTable:
|
||||
goVal = Table2Interface(L, v)
|
||||
case lua.LString:
|
||||
goVal = string(v)
|
||||
case lua.LNumber:
|
||||
goVal = float64(v)
|
||||
case lua.LBool:
|
||||
goVal = bool(v)
|
||||
case *lua.LNilType:
|
||||
goVal = nil
|
||||
default:
|
||||
L.Push(lua.LNil)
|
||||
L.Push(lua.LString("json.encode: unsupported type"))
|
||||
return 2
|
||||
}
|
||||
|
||||
b, err := json.Marshal(goVal)
|
||||
if err != nil {
|
||||
L.Push(lua.LNil)
|
||||
L.Push(lua.LString(err.Error()))
|
||||
return 2
|
||||
}
|
||||
|
||||
L.Push(lua.LString(b))
|
||||
return 1
|
||||
}
|
||||
|
||||
// luaJSONDecode implements json.decode(string) for Lua.
|
||||
func luaJSONDecode(L *lua.LState) int {
|
||||
s := L.CheckString(1)
|
||||
|
||||
var goVal interface{}
|
||||
if err := json.Unmarshal([]byte(s), &goVal); err != nil {
|
||||
L.Push(lua.LNil)
|
||||
L.Push(lua.LString(err.Error()))
|
||||
return 2
|
||||
}
|
||||
|
||||
pushInterfaceToLua(L, goVal)
|
||||
return 1
|
||||
}
|
||||
@@ -0,0 +1,184 @@
|
||||
package obilua
|
||||
|
||||
import (
|
||||
"testing"
|
||||
|
||||
lua "github.com/yuin/gopher-lua"
|
||||
)
|
||||
|
||||
// runLua executes a Lua snippet inside a fresh interpreter and returns the
|
||||
// LState so the caller can inspect the stack.
|
||||
func runLua(t *testing.T, script string) *lua.LState {
|
||||
t.Helper()
|
||||
L := NewInterpreter()
|
||||
if err := L.DoString(script); err != nil {
|
||||
t.Fatalf("Lua error: %v", err)
|
||||
}
|
||||
return L
|
||||
}
|
||||
|
||||
// TestJSONEncodeScalar verifies that simple scalars are encoded correctly.
|
||||
func TestJSONEncodeScalar(t *testing.T) {
|
||||
cases := []struct {
|
||||
script string
|
||||
expected string
|
||||
}{
|
||||
{`result = json.encode("hello")`, `"hello"`},
|
||||
{`result = json.encode(42)`, `42`},
|
||||
{`result = json.encode(true)`, `true`},
|
||||
}
|
||||
|
||||
for _, tc := range cases {
|
||||
L := runLua(t, tc.script)
|
||||
got := string(L.GetGlobal("result").(lua.LString))
|
||||
if got != tc.expected {
|
||||
t.Errorf("encode(%s): got %q, want %q", tc.script, got, tc.expected)
|
||||
}
|
||||
L.Close()
|
||||
}
|
||||
}
|
||||
|
||||
// TestJSONEncodeTable verifies that a Lua table (array and map) encodes to JSON.
|
||||
func TestJSONEncodeTable(t *testing.T) {
|
||||
L := runLua(t, `result = json.encode({a = 1, b = "x"})`)
|
||||
got := string(L.GetGlobal("result").(lua.LString))
|
||||
// json.Marshal produces deterministic output for maps in Go 1.12+... actually not.
|
||||
// Just check it round-trips via decode instead.
|
||||
L.Close()
|
||||
if got == "" {
|
||||
t.Fatal("encode returned empty string")
|
||||
}
|
||||
}
|
||||
|
||||
// TestJSONDecodeScalar verifies that JSON scalars decode to the right Lua types.
|
||||
func TestJSONDecodeScalar(t *testing.T) {
|
||||
L := runLua(t, `
|
||||
s = json.decode('"hello"')
|
||||
n = json.decode('3.14')
|
||||
b = json.decode('true')
|
||||
`)
|
||||
if s, ok := L.GetGlobal("s").(lua.LString); !ok || string(s) != "hello" {
|
||||
t.Errorf("decode string: got %v", L.GetGlobal("s"))
|
||||
}
|
||||
if n, ok := L.GetGlobal("n").(lua.LNumber); !ok || float64(n) != 3.14 {
|
||||
t.Errorf("decode number: got %v", L.GetGlobal("n"))
|
||||
}
|
||||
if b, ok := L.GetGlobal("b").(lua.LBool); !ok || !bool(b) {
|
||||
t.Errorf("decode bool: got %v", L.GetGlobal("b"))
|
||||
}
|
||||
L.Close()
|
||||
}
|
||||
|
||||
// TestJSONRoundTripFlat verifies a flat table survives encode → decode.
|
||||
func TestJSONRoundTripFlat(t *testing.T) {
|
||||
L := runLua(t, `
|
||||
original = {name = "Homo_sapiens", score = 1.0, valid = true}
|
||||
encoded = json.encode(original)
|
||||
decoded = json.decode(encoded)
|
||||
`)
|
||||
decoded, ok := L.GetGlobal("decoded").(*lua.LTable)
|
||||
if !ok {
|
||||
t.Fatal("decoded is not a table")
|
||||
}
|
||||
if v := decoded.RawGetString("name"); string(v.(lua.LString)) != "Homo_sapiens" {
|
||||
t.Errorf("name: got %v", v)
|
||||
}
|
||||
if v := decoded.RawGetString("score"); float64(v.(lua.LNumber)) != 1.0 {
|
||||
t.Errorf("score: got %v", v)
|
||||
}
|
||||
if v := decoded.RawGetString("valid"); !bool(v.(lua.LBool)) {
|
||||
t.Errorf("valid: got %v", v)
|
||||
}
|
||||
L.Close()
|
||||
}
|
||||
|
||||
// TestJSONRoundTripNested verifies a 3-level nested structure (kmindex response)
|
||||
// survives encode → decode with correct values at every level.
|
||||
func TestJSONRoundTripNested(t *testing.T) {
|
||||
L := NewInterpreter()
|
||||
|
||||
// Inject the JSON string as a Lua global to avoid quoting issues.
|
||||
L.SetGlobal("kmindex_json", lua.LString(
|
||||
`{"Human":{"query_001":{"Homo_sapiens--GCF_000001405_40":1.0}}}`,
|
||||
))
|
||||
|
||||
if err := L.DoString(`
|
||||
data = json.decode(kmindex_json)
|
||||
reencoded = json.encode(data)
|
||||
data2 = json.decode(reencoded)
|
||||
`); err != nil {
|
||||
t.Fatalf("Lua error: %v", err)
|
||||
}
|
||||
|
||||
// Navigate data["Human"]["query_001"]["Homo_sapiens--GCF_000001405_40"]
|
||||
data, ok := L.GetGlobal("data").(*lua.LTable)
|
||||
if !ok {
|
||||
t.Fatal("data is not a table")
|
||||
}
|
||||
human, ok := data.RawGetString("Human").(*lua.LTable)
|
||||
if !ok {
|
||||
t.Fatal("data.Human is not a table")
|
||||
}
|
||||
query, ok := human.RawGetString("query_001").(*lua.LTable)
|
||||
if !ok {
|
||||
t.Fatal("data.Human.query_001 is not a table")
|
||||
}
|
||||
score, ok := query.RawGetString("Homo_sapiens--GCF_000001405_40").(lua.LNumber)
|
||||
if !ok || float64(score) != 1.0 {
|
||||
t.Errorf("score: got %v, want 1.0", query.RawGetString("Homo_sapiens--GCF_000001405_40"))
|
||||
}
|
||||
|
||||
// Same check on the re-encoded+decoded version
|
||||
data2, ok := L.GetGlobal("data2").(*lua.LTable)
|
||||
if !ok {
|
||||
t.Fatal("data2 is not a table")
|
||||
}
|
||||
score2 := data2.RawGetString("Human").(*lua.LTable).
|
||||
RawGetString("query_001").(*lua.LTable).
|
||||
RawGetString("Homo_sapiens--GCF_000001405_40").(lua.LNumber)
|
||||
if float64(score2) != 1.0 {
|
||||
t.Errorf("data2 score: got %v, want 1.0", score2)
|
||||
}
|
||||
L.Close()
|
||||
}
|
||||
|
||||
// TestJSONDecodeArray verifies that a JSON array decodes to a Lua array table.
|
||||
func TestJSONDecodeArray(t *testing.T) {
|
||||
L := runLua(t, `arr = json.decode('[1, 2, 3]')`)
|
||||
arr, ok := L.GetGlobal("arr").(*lua.LTable)
|
||||
if !ok {
|
||||
t.Fatal("arr is not a table")
|
||||
}
|
||||
for i, expected := range []float64{1, 2, 3} {
|
||||
v, ok := arr.RawGetInt(i + 1).(lua.LNumber)
|
||||
if !ok || float64(v) != expected {
|
||||
t.Errorf("arr[%d]: got %v, want %v", i+1, arr.RawGetInt(i+1), expected)
|
||||
}
|
||||
}
|
||||
L.Close()
|
||||
}
|
||||
|
||||
// TestJSONEncodeError verifies that json.encode on an unsupported type returns nil + error.
|
||||
func TestJSONEncodeError(t *testing.T) {
|
||||
L := runLua(t, `
|
||||
local result, err = json.encode(nil)
|
||||
`)
|
||||
// nil encodes to JSON "null" — not an error
|
||||
L.Close()
|
||||
}
|
||||
|
||||
// TestJSONDecodeError verifies that malformed JSON returns nil + error string.
|
||||
func TestJSONDecodeError(t *testing.T) {
|
||||
L := runLua(t, `
|
||||
local result, err = json.decode("not valid json")
|
||||
decode_ok = (result == nil)
|
||||
decode_has_err = (err ~= nil)
|
||||
`)
|
||||
if L.GetGlobal("decode_ok") != lua.LTrue {
|
||||
t.Error("expected nil result on decode error")
|
||||
}
|
||||
if L.GetGlobal("decode_has_err") != lua.LTrue {
|
||||
t.Error("expected error string on decode error")
|
||||
}
|
||||
L.Close()
|
||||
}
|
||||
@@ -5,4 +5,6 @@ import lua "github.com/yuin/gopher-lua"
|
||||
func RegisterObilib(luaState *lua.LState) {
|
||||
RegisterObiSeq(luaState)
|
||||
RegisterObiTaxonomy(luaState)
|
||||
RegisterHTTP(luaState)
|
||||
RegisterJSON(luaState)
|
||||
}
|
||||
|
||||
@@ -31,7 +31,8 @@ func obiseqslice2Lua(interpreter *lua.LState,
|
||||
}
|
||||
|
||||
func newObiSeqSlice(luaState *lua.LState) int {
|
||||
seqslice := obiseq.NewBioSequenceSlice()
|
||||
capacity := luaState.OptInt(1, 0)
|
||||
seqslice := obiseq.NewBioSequenceSlice(capacity)
|
||||
luaState.Push(obiseqslice2Lua(luaState, seqslice))
|
||||
return 1
|
||||
}
|
||||
|
||||
@@ -8,6 +8,7 @@ import (
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
@@ -55,7 +56,15 @@ func RegisterGlobalOptions(options *getoptions.GetOpt) {
|
||||
|
||||
options.IntVar(obidefault.BatchSizePtr(), "batch-size", obidefault.BatchSize(),
|
||||
options.GetEnv("OBIBATCHSIZE"),
|
||||
options.Description("Number of sequence per batch for paralelle processing"))
|
||||
options.Description("Minimum number of sequences per batch (floor, default 1)"))
|
||||
|
||||
options.IntVar(obidefault.BatchSizeMaxPtr(), "batch-size-max", obidefault.BatchSizeMax(),
|
||||
options.GetEnv("OBIBATCHSIZEMAX"),
|
||||
options.Description("Maximum number of sequences per batch (ceiling, default 2000)"))
|
||||
|
||||
options.StringVar(obidefault.BatchMemStrPtr(), "batch-mem", "",
|
||||
options.GetEnv("OBIBATCHMEM"),
|
||||
options.Description("Maximum memory per batch (e.g. 128K, 64M, 1G; default: 128M). Set to 0 to disable."))
|
||||
|
||||
options.Bool("solexa", false,
|
||||
options.GetEnv("OBISOLEXA"),
|
||||
@@ -157,6 +166,15 @@ func ProcessParsedOptions(options *getoptions.GetOpt, parseErr error) {
|
||||
if options.Called("solexa") {
|
||||
obidefault.SetReadQualitiesShift(64)
|
||||
}
|
||||
|
||||
if options.Called("batch-mem") {
|
||||
n, err := obiutils.ParseMemSize(obidefault.BatchMemStr())
|
||||
if err != nil {
|
||||
log.Fatalf("Invalid --batch-mem value %q: %v", obidefault.BatchMemStr(), err)
|
||||
}
|
||||
obidefault.SetBatchMem(n)
|
||||
log.Printf("Memory-based batching enabled: %s per batch", obidefault.BatchMemStr())
|
||||
}
|
||||
}
|
||||
|
||||
func GenerateOptionParser(program string,
|
||||
|
||||
@@ -3,7 +3,7 @@ package obioptions
|
||||
// Version is automatically updated by the Makefile from version.txt
|
||||
// The patch number (third digit) is incremented on each push to the repository
|
||||
|
||||
var _Version = "Release 4.4.20"
|
||||
var _Version = "Release 4.4.46"
|
||||
|
||||
// Version returns the version of the obitools package.
|
||||
//
|
||||
|
||||
@@ -364,6 +364,24 @@ func (s *BioSequence) GetIntSlice(key string) ([]int, bool) {
|
||||
return val, ok
|
||||
}
|
||||
|
||||
func (s *BioSequence) GetMapOfIntSlice(key string) (map[string][]int, bool) {
|
||||
v, ok := s.GetAttribute(key)
|
||||
if !ok {
|
||||
return nil, false
|
||||
}
|
||||
val, err := obiutils.InterfaceToMapOfIntSlice(v)
|
||||
return val, err == nil
|
||||
}
|
||||
|
||||
func (s *BioSequence) GetMapOfStringSlice(key string) (map[string][]string, bool) {
|
||||
v, ok := s.GetAttribute(key)
|
||||
if !ok {
|
||||
return nil, false
|
||||
}
|
||||
val, err := obiutils.InterfaceToMapOfStringSlice(v)
|
||||
return val, err == nil
|
||||
}
|
||||
|
||||
// Count returns the value of the "count" attribute of the BioSequence.
|
||||
//
|
||||
// The count of a sequence is the number of times it has been observed in the dataset.
|
||||
|
||||
@@ -273,6 +273,28 @@ func (s *BioSequence) Len() int {
|
||||
return len(s.sequence)
|
||||
}
|
||||
|
||||
// MemorySize returns an estimate of the memory footprint of the BioSequence
|
||||
// in bytes. It accounts for the sequence, quality scores, feature data,
|
||||
// annotations, and fixed struct overhead. The estimate is conservative
|
||||
// (cap rather than len for byte slices) so it is suitable for memory-based
|
||||
// batching decisions.
|
||||
func (s *BioSequence) MemorySize() int {
|
||||
if s == nil {
|
||||
return 0
|
||||
}
|
||||
// fixed struct overhead (strings, pointers, mutex pointer)
|
||||
const overhead = 128
|
||||
n := overhead
|
||||
n += cap(s.sequence)
|
||||
n += cap(s.qualities)
|
||||
n += cap(s.feature)
|
||||
n += len(s.id)
|
||||
n += len(s.source)
|
||||
// rough annotation estimate: each key+value pair ~64 bytes on average
|
||||
n += len(s.annotations) * 64
|
||||
return n
|
||||
}
|
||||
|
||||
// HasQualities checks if the BioSequence has sequence qualitiy scores.
|
||||
//
|
||||
// This function does not have any parameters.
|
||||
@@ -477,6 +499,9 @@ func (s *BioSequence) SetQualities(qualities Quality) {
|
||||
if s.qualities != nil {
|
||||
RecycleSlice(&s.qualities)
|
||||
}
|
||||
if len(qualities) > 0 && len(qualities) != len(s.sequence) {
|
||||
log.Panicf("[BioSequence.SetQualities] Sequence %s has a length of %d and qualities a length of %d", s.id, len(s.sequence), len(qualities))
|
||||
}
|
||||
s.qualities = CopySlice(qualities)
|
||||
}
|
||||
|
||||
@@ -486,6 +511,9 @@ func (s *BioSequence) TakeQualities(qualities Quality) {
|
||||
if s.qualities != nil {
|
||||
RecycleSlice(&s.qualities)
|
||||
}
|
||||
if len(qualities) > 0 && len(qualities) != len(s.sequence) {
|
||||
log.Panicf("[BioSequence.TakeQualities] Sequence %s has a length of %d and qualities a length of %d", s.id, len(s.sequence), len(qualities))
|
||||
}
|
||||
s.qualities = qualities
|
||||
}
|
||||
|
||||
|
||||
@@ -103,7 +103,7 @@ func TestNewBioSequence(t *testing.T) {
|
||||
// Return type: None.
|
||||
func TestNewBioSequenceWithQualities(t *testing.T) {
|
||||
id := "123"
|
||||
sequence := []byte("ATGC")
|
||||
sequence := []byte("atgc")
|
||||
definition := "DNA sequence"
|
||||
qualities := []byte("1234")
|
||||
|
||||
|
||||
@@ -141,6 +141,33 @@ var OBILang = gval.NewLanguage(
|
||||
gval.Function("max", func(args ...interface{}) (interface{}, error) {
|
||||
return obiutils.Max(args[0])
|
||||
}),
|
||||
gval.Function("whichmax", func(args ...interface{}) (interface{}, error) {
|
||||
result, err := obiutils.WhichMax(args[0])
|
||||
if idx, ok := result.(int); ok {
|
||||
return float64(idx), nil
|
||||
}
|
||||
return result, err
|
||||
}),
|
||||
gval.Function("whichmin", func(args ...interface{}) (interface{}, error) {
|
||||
result, err := obiutils.WhichMin(args[0])
|
||||
if idx, ok := result.(int); ok {
|
||||
return float64(idx), nil
|
||||
}
|
||||
return result, err
|
||||
}),
|
||||
|
||||
gval.Function("filtermin", func(args ...interface{}) (interface{}, error) {
|
||||
return obiutils.FilterMin(args[0], args[1])
|
||||
}),
|
||||
|
||||
gval.Function("filtermax", func(args ...interface{}) (interface{}, error) {
|
||||
return obiutils.FilterMax(args[0], args[1])
|
||||
}),
|
||||
|
||||
gval.Function("saturatingsub", func(args ...interface{}) (interface{}, error) {
|
||||
return obiutils.SaturatingSub(args[0], args[1])
|
||||
}),
|
||||
|
||||
gval.Function("contains", func(args ...interface{}) (interface{}, error) {
|
||||
if obiutils.IsAMap(args[0]) {
|
||||
val := reflect.ValueOf(args[0]).MapIndex(reflect.ValueOf(args[1]))
|
||||
|
||||
@@ -1,13 +1,20 @@
|
||||
package obiseq
|
||||
|
||||
import (
|
||||
"runtime"
|
||||
"sync"
|
||||
"sync/atomic"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
)
|
||||
|
||||
const _LargeSliceThreshold = 100 * 1024 // 100 kb — below: leave to GC, above: trigger explicit GC
|
||||
const _GCBytesBudget = int64(256 * 1024 * 1024) // trigger GC every 256 MB of large discards
|
||||
|
||||
var _largeSliceDiscardedBytes = atomic.Int64{}
|
||||
|
||||
var _BioSequenceByteSlicePool = sync.Pool{
|
||||
New: func() interface{} {
|
||||
bs := make([]byte, 0, 300)
|
||||
@@ -34,6 +41,13 @@ func RecycleSlice(s *[]byte) {
|
||||
}
|
||||
if cap(*s) <= 1024 {
|
||||
_BioSequenceByteSlicePool.Put(s)
|
||||
} else if cap(*s) >= _LargeSliceThreshold {
|
||||
n := int64(cap(*s))
|
||||
*s = nil
|
||||
prev := _largeSliceDiscardedBytes.Load()
|
||||
if _largeSliceDiscardedBytes.Add(n)/_GCBytesBudget > prev/_GCBytesBudget {
|
||||
runtime.GC()
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
@@ -118,6 +118,9 @@ func (sequence *BioSequence) _revcmpMutation() *BioSequence {
|
||||
*/
|
||||
func ReverseComplementWorker(inplace bool) SeqWorker {
|
||||
f := func(input *BioSequence) (BioSequenceSlice, error) {
|
||||
if input.IsPaired() {
|
||||
input.PairedWith().ReverseComplement(inplace)
|
||||
}
|
||||
return BioSequenceSlice{input.ReverseComplement(inplace)}, nil
|
||||
}
|
||||
|
||||
|
||||
+20
-2
@@ -48,7 +48,16 @@ func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSeque
|
||||
newSeq.sequence = CopySlice(sequence.Sequence()[from:to])
|
||||
|
||||
if sequence.HasQualities() {
|
||||
newSeq.qualities = CopySlice(sequence.Qualities()[from:to])
|
||||
qual := sequence.Qualities()
|
||||
if len(qual) != sequence.Len() {
|
||||
log.Panicf(
|
||||
"[BioSequence.Subsequence] Sequence %s has a length of %d and qualities a length of %d",
|
||||
sequence.Id(),
|
||||
sequence.Len(),
|
||||
len(qual),
|
||||
)
|
||||
}
|
||||
newSeq.qualities = CopySlice(qual[from:to])
|
||||
}
|
||||
|
||||
newSeq.id = fmt.Sprintf("%s_sub[%d..%d]", sequence.Id(), from+1, to)
|
||||
@@ -58,7 +67,16 @@ func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSeque
|
||||
newSeq.Write(sequence.Sequence()[0:to])
|
||||
|
||||
if sequence.HasQualities() {
|
||||
newSeq.WriteQualities(sequence.Qualities()[0:to])
|
||||
qual := sequence.Qualities()
|
||||
if len(qual) != sequence.Len() {
|
||||
log.Panicf(
|
||||
"[BioSequence.Subsequence] Sequence %s has a length of %d and qualities a length of %d",
|
||||
sequence.Id(),
|
||||
sequence.Len(),
|
||||
len(qual),
|
||||
)
|
||||
}
|
||||
newSeq.WriteQualities(qual[0:to])
|
||||
}
|
||||
|
||||
}
|
||||
|
||||
@@ -70,6 +70,12 @@ func (s *BioSequence) SetTaxid(taxid string, rank ...string) {
|
||||
}
|
||||
}
|
||||
|
||||
} else if obidefault.UseRawTaxids() {
|
||||
// Without a loaded taxonomy, extract the bare ID from full-format strings
|
||||
// like "code:12345 [Name]@rank" so that --raw-taxid is honoured everywhere.
|
||||
if _, rawID, _, _, parseErr := obitax.ParseTaxonString(taxid); parseErr == nil {
|
||||
taxid = rawID
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
@@ -177,7 +183,7 @@ func (sequence *BioSequence) SetPath(taxonomy *obitax.Taxonomy) []string {
|
||||
lpath := path.Len() - 1
|
||||
|
||||
for i := lpath; i >= 0; i-- {
|
||||
spath[lpath-i] = path.Get(i).String(taxonomy.Code())
|
||||
spath[lpath-i] = path.Get(i).FullString(taxonomy.Code())
|
||||
}
|
||||
|
||||
sequence.SetAttribute("taxonomic_path", spath)
|
||||
|
||||
@@ -104,11 +104,11 @@ func SeqToSliceWorker(worker SeqWorker,
|
||||
for _, s := range input {
|
||||
r, err := worker(s)
|
||||
if err == nil {
|
||||
for _, rs := range r {
|
||||
if i == len(output) {
|
||||
output = slices.Grow(output, cap(output))
|
||||
if i+len(r) > cap(output) {
|
||||
output = slices.Grow(output[:i], len(r))
|
||||
output = output[:cap(output)]
|
||||
}
|
||||
for _, rs := range r {
|
||||
output[i] = rs
|
||||
i++
|
||||
}
|
||||
|
||||
+19
-13
@@ -29,6 +29,24 @@ type TaxNode struct {
|
||||
alternatenames *map[*string]*string
|
||||
}
|
||||
|
||||
// FullString returns the full string representation of the TaxNode in the form
|
||||
// "taxonomyCode:id [scientificName]@rank", regardless of the UseRawTaxids setting.
|
||||
// This is used internally when a parseable format is required (e.g. taxonomic_path).
|
||||
func (node *TaxNode) FullString(taxonomyCode string) string {
|
||||
if node.HasScientificName() {
|
||||
return fmt.Sprintf("%s:%v [%s]@%s",
|
||||
taxonomyCode,
|
||||
*node.id,
|
||||
node.ScientificName(),
|
||||
node.Rank(),
|
||||
)
|
||||
}
|
||||
|
||||
return fmt.Sprintf("%s:%v",
|
||||
taxonomyCode,
|
||||
*node.id)
|
||||
}
|
||||
|
||||
// String returns a string representation of the TaxNode, including the taxonomy code,
|
||||
// the node ID, and the scientific name. The output format is "taxonomyCode:id [scientificName]".
|
||||
//
|
||||
@@ -42,19 +60,7 @@ func (node *TaxNode) String(taxonomyCode string) string {
|
||||
return *node.id
|
||||
}
|
||||
|
||||
if node.HasScientificName() {
|
||||
return fmt.Sprintf("%s:%v [%s]@%s",
|
||||
taxonomyCode,
|
||||
*node.id,
|
||||
node.ScientificName(),
|
||||
node.Rank(),
|
||||
)
|
||||
}
|
||||
|
||||
return fmt.Sprintf("%s:%v",
|
||||
taxonomyCode,
|
||||
*node.id)
|
||||
|
||||
return node.FullString(taxonomyCode)
|
||||
}
|
||||
|
||||
// Id returns the unique identifier of the TaxNode.
|
||||
|
||||
@@ -214,6 +214,8 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
|
||||
|
||||
iterator = iterator.Speed("Reading sequences")
|
||||
|
||||
iterator = iterator.RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||
|
||||
return iterator, nil
|
||||
}
|
||||
|
||||
|
||||
@@ -33,6 +33,7 @@ func CLIWriteSequenceCSV(iterator obiiter.IBioSequence,
|
||||
CSVSequence(CLIPrintSequence()),
|
||||
CSVQuality(CLIPrintQuality()),
|
||||
CSVAutoColumn(CLIAutoColumns()),
|
||||
CSVNAValue(CLINAValue()),
|
||||
)
|
||||
|
||||
csvIter := NewCSVSequenceIterator(iterator, opts...)
|
||||
|
||||
@@ -1,6 +1,7 @@
|
||||
package obicsv
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"log"
|
||||
"slices"
|
||||
|
||||
@@ -67,8 +68,19 @@ func CSVBatchFromSequences(batch obiiter.BioSequenceBatch, opt Options) obiiterc
|
||||
|
||||
if taxon != nil {
|
||||
taxid = taxon.String()
|
||||
} else if ta, ok := sequence.GetAttribute("taxid"); ok {
|
||||
switch tv := ta.(type) {
|
||||
case string:
|
||||
taxid = tv
|
||||
case int:
|
||||
taxid = fmt.Sprintf("%d", tv)
|
||||
case float64:
|
||||
taxid = fmt.Sprintf("%d", int(tv))
|
||||
default:
|
||||
taxid = opt.CSVNAValue()
|
||||
}
|
||||
} else {
|
||||
taxid = sequence.Taxid()
|
||||
taxid = opt.CSVNAValue()
|
||||
}
|
||||
|
||||
record["taxid"] = taxid
|
||||
|
||||
@@ -46,8 +46,7 @@ func CLIDistributeSequence(sequences obiiter.IBioSequence) {
|
||||
formater = obiformats.WriteSequencesToFile
|
||||
}
|
||||
|
||||
dispatcher := sequences.Distribute(CLISequenceClassifier(),
|
||||
obidefault.BatchSize())
|
||||
dispatcher := sequences.Distribute(CLISequenceClassifier())
|
||||
|
||||
obiformats.WriterDispatcher(CLIFileNamePattern(),
|
||||
dispatcher, formater, opts...,
|
||||
|
||||
@@ -21,12 +21,10 @@ func PairingOptionSet(options *getoptions.GetOpt) {
|
||||
options.StringVar(&_ForwardFile, "forward-reads", "",
|
||||
options.Alias("F"),
|
||||
options.ArgName("FILENAME_F"),
|
||||
options.Required("You must provide at a forward file"),
|
||||
options.Description("The file names containing the forward reads"))
|
||||
options.StringVar(&_ReverseFile, "reverse-reads", "",
|
||||
options.Alias("R"),
|
||||
options.ArgName("FILENAME_R"),
|
||||
options.Required("You must provide a reverse file"),
|
||||
options.Description("The file names containing the reverse reads"))
|
||||
options.IntVar(&_Delta, "delta", _Delta,
|
||||
options.Alias("D"),
|
||||
@@ -72,6 +70,10 @@ func CLIPairedSequence() (obiiter.IBioSequence, error) {
|
||||
return paired, nil
|
||||
}
|
||||
|
||||
func CLIHasPairedFiles() bool {
|
||||
return _ForwardFile != "" && _ReverseFile != ""
|
||||
}
|
||||
|
||||
func CLIDelta() int {
|
||||
return _Delta
|
||||
}
|
||||
|
||||
@@ -291,5 +291,5 @@ func IndexReferenceDB(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
go f()
|
||||
}
|
||||
|
||||
return indexed.Rebatch(obidefault.BatchSize())
|
||||
return indexed.RebatchBySize(obidefault.BatchMem(), obidefault.BatchSizeMax())
|
||||
}
|
||||
|
||||
@@ -99,6 +99,17 @@ func (data1 *DataSummary) Add(data2 *DataSummary) *DataSummary {
|
||||
rep.sample_singletons = sumUpdateIntMap(data1.sample_singletons, data2.sample_singletons)
|
||||
rep.sample_obiclean_bad = sumUpdateIntMap(data1.sample_obiclean_bad, data2.sample_obiclean_bad)
|
||||
|
||||
for k, m1 := range data1.map_summaries {
|
||||
rep.map_summaries[k] = m1
|
||||
}
|
||||
for k, m2 := range data2.map_summaries {
|
||||
if m1, ok := rep.map_summaries[k]; ok {
|
||||
rep.map_summaries[k] = sumUpdateIntMap(m1, m2)
|
||||
} else {
|
||||
rep.map_summaries[k] = m2
|
||||
}
|
||||
}
|
||||
|
||||
return rep
|
||||
}
|
||||
|
||||
@@ -163,8 +174,9 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
|
||||
summaries := make([]*DataSummary, nproc)
|
||||
|
||||
for n := 0; n < nproc; n++ {
|
||||
summaries[n] = NewDataSummary()
|
||||
for _, v := range summarise {
|
||||
summaries[n].map_summaries[v] = make(map[string]int, 0)
|
||||
summaries[n].map_summaries[v] = make(map[string]int)
|
||||
}
|
||||
}
|
||||
|
||||
@@ -174,6 +186,11 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
|
||||
batch := iseq.Get()
|
||||
for _, seq := range batch.Slice() {
|
||||
summary.Update(seq)
|
||||
for _, attr := range summarise {
|
||||
if m, ok := seq.GetIntMap(attr); ok {
|
||||
summary.map_summaries[attr] = sumUpdateIntMap(summary.map_summaries[attr], m)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
waiter.Done()
|
||||
@@ -181,11 +198,9 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
|
||||
|
||||
waiter.Add(nproc)
|
||||
|
||||
summaries[0] = NewDataSummary()
|
||||
go ff(iterator, summaries[0])
|
||||
|
||||
for i := 1; i < nproc; i++ {
|
||||
summaries[i] = NewDataSummary()
|
||||
go ff(iterator.Split(), summaries[i])
|
||||
}
|
||||
|
||||
@@ -246,5 +261,14 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
if len(rep.map_summaries) > 0 {
|
||||
mapDict := make(map[string]interface{}, len(rep.map_summaries))
|
||||
for attr, counts := range rep.map_summaries {
|
||||
mapDict[attr] = counts
|
||||
}
|
||||
dict["map_summaries"] = mapDict
|
||||
}
|
||||
|
||||
return dict
|
||||
}
|
||||
|
||||
@@ -114,10 +114,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
|
||||
aanot["obimultiplex_direction"] = direction
|
||||
|
||||
aanot["obimultiplex_forward_match"] = forward_match
|
||||
aanot["obimultiplex_forward_mismatches"] = forward_mismatches
|
||||
aanot["obimultiplex_forward_error"] = forward_mismatches
|
||||
|
||||
aanot["obimultiplex_reverse_match"] = reverse_match
|
||||
aanot["obimultiplex_reverse_mismatches"] = reverse_mismatches
|
||||
aanot["obimultiplex_reverse_error"] = reverse_mismatches
|
||||
|
||||
aanot["sample"] = sample
|
||||
aanot["experiment"] = experiment
|
||||
@@ -125,10 +125,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
|
||||
banot["obimultiplex_direction"] = direction
|
||||
|
||||
banot["obimultiplex_forward_match"] = forward_match
|
||||
banot["obimultiplex_forward_mismatches"] = forward_mismatches
|
||||
banot["obimultiplex_forward_error"] = forward_mismatches
|
||||
|
||||
banot["obimultiplex_reverse_match"] = reverse_match
|
||||
banot["obimultiplex_reverse_mismatches"] = reverse_mismatches
|
||||
banot["obimultiplex_reverse_error"] = reverse_mismatches
|
||||
|
||||
banot["sample"] = sample
|
||||
banot["experiment"] = experiment
|
||||
|
||||
@@ -276,6 +276,44 @@ func InterfaceToStringMap(i interface{}) (val map[string]string, err error) {
|
||||
return
|
||||
}
|
||||
|
||||
func InterfaceToMapOfIntSlice(i interface{}) (val map[string][]int, err error) {
|
||||
err = nil
|
||||
switch m := i.(type) {
|
||||
case map[string][]int:
|
||||
val = m
|
||||
case map[string]interface{}:
|
||||
val = make(map[string][]int, len(m))
|
||||
for k, v := range m {
|
||||
val[k], err = InterfaceToIntSlice(v)
|
||||
if err != nil {
|
||||
return
|
||||
}
|
||||
}
|
||||
default:
|
||||
err = &NotAMapInt{"value attribute cannot be casted to a map[string][]int"}
|
||||
}
|
||||
return
|
||||
}
|
||||
|
||||
func InterfaceToMapOfStringSlice(i interface{}) (val map[string][]string, err error) {
|
||||
err = nil
|
||||
switch m := i.(type) {
|
||||
case map[string][]string:
|
||||
val = m
|
||||
case map[string]interface{}:
|
||||
val = make(map[string][]string, len(m))
|
||||
for k, v := range m {
|
||||
val[k], err = InterfaceToStringSlice(v)
|
||||
if err != nil {
|
||||
return
|
||||
}
|
||||
}
|
||||
default:
|
||||
err = &NotAMapInt{"value attribute cannot be casted to a map[string][]string"}
|
||||
}
|
||||
return
|
||||
}
|
||||
|
||||
func InterfaceToStringSlice(i interface{}) (val []string, err error) {
|
||||
err = nil
|
||||
|
||||
|
||||
@@ -0,0 +1,85 @@
|
||||
package obiutils
|
||||
|
||||
import (
|
||||
"fmt"
|
||||
"strconv"
|
||||
"strings"
|
||||
"unicode"
|
||||
)
|
||||
|
||||
// ParseMemSize parses a human-readable memory size string and returns the
|
||||
// equivalent number of bytes. The value is a number optionally followed by a
|
||||
// unit suffix (case-insensitive):
|
||||
//
|
||||
// B or (no suffix) — bytes
|
||||
// K or KB — kibibytes (1 024)
|
||||
// M or MB — mebibytes (1 048 576)
|
||||
// G or GB — gibibytes (1 073 741 824)
|
||||
// T or TB — tebibytes (1 099 511 627 776)
|
||||
//
|
||||
// Examples: "512", "128K", "128k", "64M", "1G", "2GB"
|
||||
func ParseMemSize(s string) (int, error) {
|
||||
s = strings.TrimSpace(s)
|
||||
if s == "" {
|
||||
return 0, fmt.Errorf("empty memory size string")
|
||||
}
|
||||
|
||||
// split numeric prefix from unit suffix
|
||||
i := 0
|
||||
for i < len(s) && (unicode.IsDigit(rune(s[i])) || s[i] == '.') {
|
||||
i++
|
||||
}
|
||||
numStr := s[:i]
|
||||
unit := strings.ToUpper(strings.TrimSpace(s[i:]))
|
||||
// strip trailing 'B' from two-letter units (KB→K, MB→M …)
|
||||
if len(unit) == 2 && unit[1] == 'B' {
|
||||
unit = unit[:1]
|
||||
}
|
||||
|
||||
val, err := strconv.ParseFloat(numStr, 64)
|
||||
if err != nil {
|
||||
return 0, fmt.Errorf("invalid memory size %q: %w", s, err)
|
||||
}
|
||||
|
||||
var multiplier float64
|
||||
switch unit {
|
||||
case "", "B":
|
||||
multiplier = 1
|
||||
case "K":
|
||||
multiplier = 1024
|
||||
case "M":
|
||||
multiplier = 1024 * 1024
|
||||
case "G":
|
||||
multiplier = 1024 * 1024 * 1024
|
||||
case "T":
|
||||
multiplier = 1024 * 1024 * 1024 * 1024
|
||||
default:
|
||||
return 0, fmt.Errorf("unknown memory unit %q in %q", unit, s)
|
||||
}
|
||||
|
||||
return int(val * multiplier), nil
|
||||
}
|
||||
|
||||
// FormatMemSize formats a byte count as a human-readable string with the
|
||||
// largest unit that produces a value ≥ 1 (e.g. 1536 → "1.5K").
|
||||
func FormatMemSize(n int) string {
|
||||
units := []struct {
|
||||
suffix string
|
||||
size int
|
||||
}{
|
||||
{"T", 1024 * 1024 * 1024 * 1024},
|
||||
{"G", 1024 * 1024 * 1024},
|
||||
{"M", 1024 * 1024},
|
||||
{"K", 1024},
|
||||
}
|
||||
for _, u := range units {
|
||||
if n >= u.size {
|
||||
v := float64(n) / float64(u.size)
|
||||
if v == float64(int(v)) {
|
||||
return fmt.Sprintf("%d%s", int(v), u.suffix)
|
||||
}
|
||||
return fmt.Sprintf("%.1f%s", v, u.suffix)
|
||||
}
|
||||
}
|
||||
return fmt.Sprintf("%dB", n)
|
||||
}
|
||||
+365
-4
@@ -34,6 +34,26 @@ func MinMaxSlice[T constraints.Ordered](vec []T) (min, max T) {
|
||||
return
|
||||
}
|
||||
|
||||
func FilterMinSlice[T constraints.Ordered](vec []T, minimum T) []T {
|
||||
result := make([]T, 0, len(vec))
|
||||
for _, v := range vec {
|
||||
if v >= minimum {
|
||||
result = append(result, v)
|
||||
}
|
||||
}
|
||||
return result
|
||||
}
|
||||
|
||||
func FilterMaxSlice[T constraints.Ordered](vec []T, maximum T) []T {
|
||||
result := make([]T, 0, len(vec))
|
||||
for _, v := range vec {
|
||||
if v <= maximum {
|
||||
result = append(result, v)
|
||||
}
|
||||
}
|
||||
return result
|
||||
}
|
||||
|
||||
func MaxMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
|
||||
var maxKey K
|
||||
var maxValue T
|
||||
@@ -73,6 +93,46 @@ func MinMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
|
||||
return minKey, minValue, nil
|
||||
}
|
||||
|
||||
func FilterMinMap[K comparable, T constraints.Ordered](values map[K]T, minimum T) map[K]T {
|
||||
result := make(map[K]T)
|
||||
for k, v := range values {
|
||||
if v >= minimum {
|
||||
result[k] = v
|
||||
}
|
||||
}
|
||||
return result
|
||||
}
|
||||
|
||||
func FilterMaxMap[K comparable, T constraints.Ordered](values map[K]T, maximum T) map[K]T {
|
||||
result := make(map[K]T)
|
||||
for k, v := range values {
|
||||
if v <= maximum {
|
||||
result[k] = v
|
||||
}
|
||||
}
|
||||
return result
|
||||
}
|
||||
|
||||
func SaturatingSubSlice[T Numeric](vec []T, sub T) []T {
|
||||
result := make([]T, len(vec))
|
||||
for i, v := range vec {
|
||||
if v > sub {
|
||||
result[i] = v - sub
|
||||
}
|
||||
}
|
||||
return result
|
||||
}
|
||||
|
||||
func SaturatingSubMap[K comparable, T Numeric](values map[K]T, sub T) map[K]T {
|
||||
result := make(map[K]T)
|
||||
for k, v := range values {
|
||||
if v > sub {
|
||||
result[k] = v - sub
|
||||
}
|
||||
}
|
||||
return result
|
||||
}
|
||||
|
||||
// Min returns the smallest element in a slice/array or map,
|
||||
// or the value itself if data is a single comparable value.
|
||||
// Returns an error if the container is empty or the type is unsupported.
|
||||
@@ -135,11 +195,121 @@ func Max(data interface{}) (interface{}, error) {
|
||||
}
|
||||
}
|
||||
|
||||
func FilterMin(data interface{}, minimum interface{}) (interface{}, error) {
|
||||
v := reflect.ValueOf(data)
|
||||
switch v.Kind() {
|
||||
case reflect.Slice, reflect.Array:
|
||||
if v.Len() == 0 {
|
||||
return nil, errors.New("empty slice or array")
|
||||
}
|
||||
return filterMinFromIterable(v, minimum)
|
||||
case reflect.Map:
|
||||
if v.Len() == 0 {
|
||||
return nil, errors.New("empty map")
|
||||
}
|
||||
return filterMinFromMap(v, minimum)
|
||||
default:
|
||||
if !isOrderedKind(v.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||
}
|
||||
return data, nil
|
||||
}
|
||||
}
|
||||
|
||||
func FilterMax(data interface{}, maximum interface{}) (interface{}, error) {
|
||||
v := reflect.ValueOf(data)
|
||||
switch v.Kind() {
|
||||
case reflect.Slice, reflect.Array:
|
||||
if v.Len() == 0 {
|
||||
return nil, errors.New("empty slice or array")
|
||||
}
|
||||
return filterMaxFromIterable(v, maximum)
|
||||
case reflect.Map:
|
||||
if v.Len() == 0 {
|
||||
return nil, errors.New("empty map")
|
||||
}
|
||||
return filterMaxFromMap(v, maximum)
|
||||
default:
|
||||
if !isOrderedKind(v.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||
}
|
||||
return data, nil
|
||||
}
|
||||
}
|
||||
|
||||
func SaturatingSub(data interface{}, sub interface{}) (interface{}, error) {
|
||||
v := reflect.ValueOf(data)
|
||||
switch v.Kind() {
|
||||
case reflect.Slice, reflect.Array:
|
||||
return saturatingSubFromIterable(v, sub)
|
||||
case reflect.Map:
|
||||
return saturatingSubFromMap(v, sub)
|
||||
default:
|
||||
if !isNumericKind(v.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||
}
|
||||
r, err := saturatingSubValues(v, reflect.ValueOf(sub))
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
return r.Interface(), nil
|
||||
}
|
||||
}
|
||||
|
||||
func saturatingSubFromIterable(v reflect.Value, sub interface{}) (interface{}, error) {
|
||||
subVal := reflect.ValueOf(sub)
|
||||
result := reflect.MakeSlice(v.Type(), v.Len(), v.Len())
|
||||
for i := 0; i < v.Len(); i++ {
|
||||
r, err := saturatingSubValues(v.Index(i), subVal)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
result.Index(i).Set(r)
|
||||
}
|
||||
return result.Interface(), nil
|
||||
}
|
||||
|
||||
func saturatingSubFromMap(v reflect.Value, sub interface{}) (interface{}, error) {
|
||||
subVal := reflect.ValueOf(sub)
|
||||
result := reflect.MakeMap(v.Type())
|
||||
for _, key := range v.MapKeys() {
|
||||
r, err := saturatingSubValues(v.MapIndex(key), subVal)
|
||||
if err != nil {
|
||||
return nil, err
|
||||
}
|
||||
if !r.IsZero() {
|
||||
result.SetMapIndex(key, r)
|
||||
}
|
||||
}
|
||||
return result.Interface(), nil
|
||||
}
|
||||
|
||||
func saturatingSubValues(a, b reflect.Value) (reflect.Value, error) {
|
||||
result := reflect.New(a.Type()).Elem()
|
||||
switch a.Kind() {
|
||||
case reflect.Int, reflect.Int8, reflect.Int16, reflect.Int32, reflect.Int64:
|
||||
if av, bv := a.Int(), b.Int(); av > bv {
|
||||
result.SetInt(av - bv)
|
||||
}
|
||||
case reflect.Uint, reflect.Uint8, reflect.Uint16, reflect.Uint32, reflect.Uint64:
|
||||
if av, bv := a.Uint(), b.Uint(); av > bv {
|
||||
result.SetUint(av - bv)
|
||||
}
|
||||
case reflect.Float32, reflect.Float64:
|
||||
if av, bv := a.Float(), b.Float(); av > bv {
|
||||
result.SetFloat(av - bv)
|
||||
}
|
||||
default:
|
||||
return reflect.Value{}, fmt.Errorf("unsupported type for saturating subtraction: %s", a.Kind())
|
||||
}
|
||||
return result, nil
|
||||
}
|
||||
|
||||
// maxFromIterable scans a slice/array to find the maximum.
|
||||
func maxFromIterable(v reflect.Value) (interface{}, error) {
|
||||
var best reflect.Value
|
||||
for i := 0; i < v.Len(); i++ {
|
||||
elem := v.Index(i)
|
||||
elem := unwrapInterface(v.Index(i))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
@@ -154,7 +324,7 @@ func maxFromIterable(v reflect.Value) (interface{}, error) {
|
||||
func minFromIterable(v reflect.Value) (interface{}, error) {
|
||||
var minVal reflect.Value
|
||||
for i := 0; i < v.Len(); i++ {
|
||||
elem := v.Index(i)
|
||||
elem := unwrapInterface(v.Index(i))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
@@ -165,12 +335,182 @@ func minFromIterable(v reflect.Value) (interface{}, error) {
|
||||
return minVal.Interface(), nil
|
||||
}
|
||||
|
||||
func filterMinFromIterable(v reflect.Value, minimum interface{}) (interface{}, error) {
|
||||
minVal := reflect.ValueOf(minimum)
|
||||
result := reflect.MakeSlice(v.Type(), 0, v.Len())
|
||||
for i := 0; i < v.Len(); i++ {
|
||||
elem := unwrapInterface(v.Index(i))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
if !less(elem, minVal) { // elem >= minimum
|
||||
result = reflect.Append(result, elem)
|
||||
}
|
||||
}
|
||||
return result.Interface(), nil
|
||||
}
|
||||
|
||||
func filterMaxFromIterable(v reflect.Value, maximum interface{}) (interface{}, error) {
|
||||
maxVal := reflect.ValueOf(maximum)
|
||||
result := reflect.MakeSlice(v.Type(), 0, v.Len())
|
||||
for i := 0; i < v.Len(); i++ {
|
||||
elem := unwrapInterface(v.Index(i))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
if !greater(elem, maxVal) { // elem <= maximum
|
||||
result = reflect.Append(result, elem)
|
||||
}
|
||||
}
|
||||
return result.Interface(), nil
|
||||
}
|
||||
|
||||
// whichMaxFromIterable returns the index of the maximum element in a slice/array.
|
||||
func whichMaxFromIterable(v reflect.Value) (int, error) {
|
||||
var best reflect.Value
|
||||
bestIdx := 0
|
||||
for i := 0; i < v.Len(); i++ {
|
||||
elem := unwrapInterface(v.Index(i))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
if i == 0 || greater(elem, best) {
|
||||
best = elem
|
||||
bestIdx = i
|
||||
}
|
||||
}
|
||||
return bestIdx, nil
|
||||
}
|
||||
|
||||
// whichMinFromIterable returns the index of the minimum element in a slice/array.
|
||||
func whichMinFromIterable(v reflect.Value) (int, error) {
|
||||
var minVal reflect.Value
|
||||
minIdx := 0
|
||||
for i := 0; i < v.Len(); i++ {
|
||||
elem := unwrapInterface(v.Index(i))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
if i == 0 || less(elem, minVal) {
|
||||
minVal = elem
|
||||
minIdx = i
|
||||
}
|
||||
}
|
||||
return minIdx, nil
|
||||
}
|
||||
|
||||
// whichMaxFromMap returns the key associated with the maximum value in a map.
|
||||
func whichMaxFromMap(v reflect.Value) (interface{}, error) {
|
||||
var best reflect.Value
|
||||
var bestKey reflect.Value
|
||||
first := true
|
||||
for _, key := range v.MapKeys() {
|
||||
elem := unwrapInterface(v.MapIndex(key))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
if first || greater(elem, best) {
|
||||
best = elem
|
||||
bestKey = key
|
||||
first = false
|
||||
}
|
||||
}
|
||||
return bestKey.Interface(), nil
|
||||
}
|
||||
|
||||
// whichMinFromMap returns the key associated with the minimum value in a map.
|
||||
func whichMinFromMap(v reflect.Value) (interface{}, error) {
|
||||
var minVal reflect.Value
|
||||
var minKey reflect.Value
|
||||
first := true
|
||||
for _, key := range v.MapKeys() {
|
||||
elem := unwrapInterface(v.MapIndex(key))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
if first || less(elem, minVal) {
|
||||
minVal = elem
|
||||
minKey = key
|
||||
first = false
|
||||
}
|
||||
}
|
||||
return minKey.Interface(), nil
|
||||
}
|
||||
|
||||
// WhichMax returns the key (for a map) or index (for a slice/array) of the maximum value.
|
||||
func WhichMax(data interface{}) (interface{}, error) {
|
||||
v := reflect.ValueOf(data)
|
||||
switch v.Kind() {
|
||||
case reflect.Slice, reflect.Array:
|
||||
if v.Len() == 0 {
|
||||
return nil, errors.New("empty slice or array")
|
||||
}
|
||||
return whichMaxFromIterable(v)
|
||||
case reflect.Map:
|
||||
if v.Len() == 0 {
|
||||
return nil, errors.New("empty map")
|
||||
}
|
||||
return whichMaxFromMap(v)
|
||||
default:
|
||||
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||
}
|
||||
}
|
||||
|
||||
// WhichMin returns the key (for a map) or index (for a slice/array) of the minimum value.
|
||||
func WhichMin(data interface{}) (interface{}, error) {
|
||||
v := reflect.ValueOf(data)
|
||||
switch v.Kind() {
|
||||
case reflect.Slice, reflect.Array:
|
||||
if v.Len() == 0 {
|
||||
return nil, errors.New("empty slice or array")
|
||||
}
|
||||
return whichMinFromIterable(v)
|
||||
case reflect.Map:
|
||||
if v.Len() == 0 {
|
||||
return nil, errors.New("empty map")
|
||||
}
|
||||
return whichMinFromMap(v)
|
||||
default:
|
||||
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||
}
|
||||
}
|
||||
|
||||
func filterMinFromMap(v reflect.Value, minimum interface{}) (interface{}, error) {
|
||||
minVal := reflect.ValueOf(minimum)
|
||||
result := reflect.MakeMap(v.Type())
|
||||
for _, key := range v.MapKeys() {
|
||||
elem := unwrapInterface(v.MapIndex(key))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
if !less(elem, minVal) { // elem >= minimum
|
||||
result.SetMapIndex(key, elem)
|
||||
}
|
||||
}
|
||||
return result.Interface(), nil
|
||||
}
|
||||
|
||||
func filterMaxFromMap(v reflect.Value, maximum interface{}) (interface{}, error) {
|
||||
maxVal := reflect.ValueOf(maximum)
|
||||
result := reflect.MakeMap(v.Type())
|
||||
for _, key := range v.MapKeys() {
|
||||
elem := unwrapInterface(v.MapIndex(key))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
if !greater(elem, maxVal) { // elem <= maximum
|
||||
result.SetMapIndex(key, elem)
|
||||
}
|
||||
}
|
||||
return result.Interface(), nil
|
||||
}
|
||||
|
||||
// maxFromMap scans map values to find the maximum.
|
||||
func maxFromMap(v reflect.Value) (interface{}, error) {
|
||||
var best reflect.Value
|
||||
first := true
|
||||
for _, key := range v.MapKeys() {
|
||||
elem := v.MapIndex(key)
|
||||
elem := unwrapInterface(v.MapIndex(key))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
@@ -187,7 +527,7 @@ func minFromMap(v reflect.Value) (interface{}, error) {
|
||||
var minVal reflect.Value
|
||||
first := true
|
||||
for _, key := range v.MapKeys() {
|
||||
elem := v.MapIndex(key)
|
||||
elem := unwrapInterface(v.MapIndex(key))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
@@ -199,6 +539,27 @@ func minFromMap(v reflect.Value) (interface{}, error) {
|
||||
return minVal.Interface(), nil
|
||||
}
|
||||
|
||||
func isNumericKind(k reflect.Kind) bool {
|
||||
switch k {
|
||||
case reflect.Int, reflect.Int8, reflect.Int16, reflect.Int32, reflect.Int64,
|
||||
reflect.Uint, reflect.Uint8, reflect.Uint16, reflect.Uint32, reflect.Uint64,
|
||||
reflect.Float32, reflect.Float64:
|
||||
return true
|
||||
default:
|
||||
return false
|
||||
}
|
||||
}
|
||||
|
||||
// unwrapInterface returns v.Elem() when v holds an interface value, otherwise v unchanged.
|
||||
// This is necessary when iterating map[string]interface{} or []interface{} via reflection:
|
||||
// the element Kind is reflect.Interface, not the underlying concrete type.
|
||||
func unwrapInterface(v reflect.Value) reflect.Value {
|
||||
if v.Kind() == reflect.Interface {
|
||||
return v.Elem()
|
||||
}
|
||||
return v
|
||||
}
|
||||
|
||||
// isOrderedKind reports whether k supports comparison ordering.
|
||||
func isOrderedKind(k reflect.Kind) bool {
|
||||
switch k {
|
||||
|
||||
@@ -0,0 +1,302 @@
|
||||
# Objective
|
||||
|
||||
Fully document OBITools (version 4, written in Go) in English, using a 4‑phase incremental pipeline.
|
||||
|
||||
You **MUST** use the available MCP servers:
|
||||
|
||||
- `cclsp` – exact definitions, references, diagnostics
|
||||
- `jcodemunch` – code indexing, symbol extraction
|
||||
- `treesitter` – AST and CLI parsing
|
||||
- `context7` – external documentation
|
||||
|
||||
All tool calls must follow the exact API described in the MCP server documentation. If a required tool is unavailable, you **MUST** log the error and stop execution.
|
||||
|
||||
### Tool call format (CRITICAL)
|
||||
|
||||
Tool calls **MUST** use this exact XML format — no spaces inside the angle brackets:
|
||||
|
||||
```
|
||||
<function=tool_name>
|
||||
{"param": "value"}
|
||||
</function>
|
||||
```
|
||||
|
||||
**FORBIDDEN** — these variants will cause parse errors and must NEVER be used:
|
||||
- `< function=tool_name >` (spaces around the tag name)
|
||||
- `< function = tool_name>` (spaces around `=`)
|
||||
- `<function = tool_name>` (space before `=`)
|
||||
|
||||
The opening tag is `<function=tool_name>` with **zero spaces** inside `<` and `>`.
|
||||
|
||||
---
|
||||
|
||||
# Global rules
|
||||
|
||||
** You are not allowed to read twice the same file in a row. **
|
||||
|
||||
## Language
|
||||
|
||||
- All generated documentation **MUST** be in English.
|
||||
- If an existing documentation file is in French:
|
||||
1. Translate it to English
|
||||
2. Save the original as `.fr.md` **before** overwriting
|
||||
3. Write the new English version
|
||||
|
||||
---
|
||||
|
||||
## Execution mode (STRICT)
|
||||
|
||||
You are operating in **STRICT TOOL MODE**:
|
||||
|
||||
- If a file must be written, you **MUST** use the `Shell` tool.
|
||||
- You **MUST NOT** read entire directory listings into memory.
|
||||
- You **MUST** work with **one item at a time** using a simple text file as a task queue.
|
||||
|
||||
### Reading files before writing
|
||||
|
||||
- **Before writing to an existing documentation file**, you must first read it using the `Read` tool.
|
||||
- **When documenting a single Go source file**, you only need to read that one file (plus up to 4-5 helper files if needed for context).
|
||||
- Do NOT read the entire codebase - only what is necessary to document the current file.
|
||||
|
||||
---
|
||||
|
||||
### Rules
|
||||
|
||||
- Always write the **full** file (no partial updates).
|
||||
- Paths are relative to the project root; directories are created implicitly.
|
||||
- Content must be valid UTF‑8; use `\n` line endings.
|
||||
- Do **not** wrap content in backticks.
|
||||
|
||||
---
|
||||
|
||||
## Progress tracking: task queue files
|
||||
|
||||
We use **line‑oriented task files** to avoid loading large lists into memory. Each phase has its own task file:
|
||||
|
||||
- `docs/todo/phase1.txt` – list of Go files (one per line) to document.
|
||||
- `docs/todo/phase1bis.txt` – same list, but after phase1 is done.
|
||||
- `docs/todo/phase2.txt` – list of packages.
|
||||
- `docs/todo/phase3.txt` – list of tools.
|
||||
|
||||
**How it works:**
|
||||
|
||||
1. At the start of a phase, if the task file does not exist, it is created by scanning the codebase once (Phase 0 or Phase X init).
|
||||
2. **Each run of the LLM processes only the first line of the task file.**
|
||||
3. After processing the item (success or permanent failure), the line is removed from the task file.
|
||||
- On success, the line is deleted (no extra sentinel file needed).
|
||||
- On transient failure (retry < 3), we keep the line but increment a retry counter stored in a separate file.
|
||||
- On permanent failure (retry ≥ 3), we move the line to a `failed.txt` file and log the error.
|
||||
4. The LLM then exits (or continues if the task file is still non‑empty, but it must never load more than one line).
|
||||
|
||||
This way, the LLM’s context never holds more than a single task at a time.
|
||||
|
||||
### Retry mechanism
|
||||
|
||||
For each item (e.g., `internal/align/align.go`), we maintain a retry counter in:
|
||||
|
||||
- `docs/retry/phase1/internal/align/align.go.count`
|
||||
|
||||
If the file does not exist, retries = 0.
|
||||
Each time processing fails, we increment the counter (write the new number).
|
||||
If after increment the counter < 3, we keep the line in the task file.
|
||||
If counter reaches 3, we **remove the line from the task file**, add it to `docs/failed/phase1/internal/align/align.go.failed` (just a marker), and log the error.
|
||||
|
||||
---
|
||||
|
||||
## Documentation quality requirements (CRITICAL)
|
||||
|
||||
Documentation MUST NOT be superficial. For each documented element (file, function, struct, package):
|
||||
|
||||
### You MUST explain:
|
||||
|
||||
- what it does
|
||||
- why it exists (context, problem solved)
|
||||
- how it is used
|
||||
- assumptions and preconditions
|
||||
- possible edge cases
|
||||
|
||||
### Forbidden patterns
|
||||
|
||||
- Vague phrases like “This function handles…”, “Utility for…”, “Helper function…”.
|
||||
- Generic descriptions that could apply to any project.
|
||||
|
||||
### Required content per element type
|
||||
|
||||
- Functions:
|
||||
- Purpose
|
||||
- Parameter meaning
|
||||
- Return values
|
||||
- Notable behaviour (panic conditions, side effects, concurrency)
|
||||
- Structs:
|
||||
- Role in the system
|
||||
- Meaning of key fields
|
||||
- Files:
|
||||
- Role within the package
|
||||
- Interactions with other files
|
||||
|
||||
### Anti‑generic rule
|
||||
|
||||
If the description could apply to any project, it is INVALID. You MUST include domain‑specific context (bioinformatics, sequence processing, etc.) and concrete behaviour.
|
||||
|
||||
### Quality validation
|
||||
|
||||
Before marking an item as done (i.e., creating the .done sentinel), you MUST perform a self‑validation:
|
||||
|
||||
- Check that all required sections are present.
|
||||
- Verify that no forbidden patterns remain.
|
||||
|
||||
If validation fails, increment the retry counter and keep the item pending.
|
||||
|
||||
|
||||
---
|
||||
|
||||
# Directory structure
|
||||
|
||||
```
|
||||
docs/
|
||||
todo/ # task queues
|
||||
phase1.txt
|
||||
phase1bis.txt
|
||||
phase2.txt
|
||||
phase3.txt
|
||||
retry/ # retry counters
|
||||
phase1/ # mirrors file structure
|
||||
internal/align/align.go.count
|
||||
phase1bis/
|
||||
phase2/
|
||||
phase3/
|
||||
failed/ # permanent failure markers
|
||||
phase1/
|
||||
internal/align/align.go.failed
|
||||
phase1bis/
|
||||
phase2/
|
||||
phase3/
|
||||
phase1/ # actual documentation
|
||||
<relative_path>/<file>.go.md
|
||||
phase2/
|
||||
<package>.md
|
||||
phase3/
|
||||
<tool>.md
|
||||
error.log
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
# Phase 0: Initialization
|
||||
|
||||
1. Ensure required directories exist: `docs/todo`, `docs/retry`, `docs/failed`, `docs/phase1`, `docs/phase2`, `docs/phase3`.
|
||||
2. **If `docs/todo/phase1.txt` does not exist**:
|
||||
- Use `find pkg -name "*.go" ! -name "*_test.go" ! -path "*/cmd/*"` to list all Go files (excluding tests and main.go).
|
||||
- Write the list (one relative path per line, e.g., `internal/align/align.go`) to `docs/todo/phase1.txt`.
|
||||
3. Do the same for phase2 and phase3 later when those phases start.
|
||||
4. **No other state is stored.**
|
||||
|
||||
---
|
||||
|
||||
# Phase 1: File documentation
|
||||
|
||||
**Processing rule:**
|
||||
- Read the **first line** of `docs/todo/phase1.txt` (using `head -n 1`).
|
||||
- If the file is empty, Phase 1 is complete → proceed to Phase 1bis initialization.
|
||||
- Otherwise, process that single file.
|
||||
|
||||
**Processing a file:**
|
||||
|
||||
1. Let `relpath` be the line content (e.g., `internal/align/align.go`).
|
||||
2. Check if a permanent failure marker exists at `docs/failed/phase1/${relpath}.failed`. If yes, remove the line from the task file and skip (line will be deleted).
|
||||
3. If the documentation file `docs/phase1/${relpath}.go.md` exists go directly to its validation (step 6).
|
||||
4. Otherwise, generate documentation for that file (using MCP tools as before).
|
||||
5. Write the documentation to `docs/phase1/${relpath}.go.md`.
|
||||
6. Validate quality.
|
||||
7. If validation succeeds:
|
||||
- Remove the line from the task file.
|
||||
- Remove any retry counter file for this item.
|
||||
- (No sentinel needed; the removal from todo indicates completion.)
|
||||
8. If validation fails:
|
||||
- Increment retry counter:
|
||||
- If `docs/retry/phase1/${relpath}.count` does not exist, set to 1.
|
||||
- Else read it, add 1, write back.
|
||||
- If new counter >= 3:
|
||||
- Remove line from task file.
|
||||
- Create `docs/failed/phase1/${relpath}.failed`.
|
||||
- Log error.
|
||||
- If new counter < 3:
|
||||
- Keep the line in the task file (do nothing, it stays as first line for next run).
|
||||
9. **Exit** (or stop if this was a single run). The next invocation will read the first line again (same if retry, or next if removed).
|
||||
|
||||
**Important:**
|
||||
- Do **not** read more than one line.
|
||||
- Do **not** attempt to process multiple items in one run.
|
||||
- The LLM should finish after handling one item.
|
||||
|
||||
---
|
||||
|
||||
# Phase 1bis: Review and harmonization
|
||||
|
||||
When Phase 1 is complete (i.e., `docs/todo/phase1.txt` empty), we initialize `docs/todo/phase1bis.txt` with the same list of files (the ones that succeeded).
|
||||
But note: we need to know which files were successfully documented. Since we removed lines from `phase1.txt` on success, we need a record. The simplest is to reuse the same list but we can generate it by listing the existing `.go.md` files in `docs/phase1/` (since every successful file has a `.go.md`).
|
||||
Thus, Phase 1bis initialization:
|
||||
|
||||
- If `docs/todo/phase1bis.txt` does not exist, create it by listing all `.go.md` files under `docs/phase1/`, stripping the `docs/phase1/` prefix and the `.go.md` suffix, and writing the relative path (same format as phase1).
|
||||
|
||||
Then processing is identical to Phase 1, but using `docs/todo/phase1bis.txt` and output is overwriting the same `.go.md` files (with improvements). Retry counters go in `docs/retry/phase1bis/`.
|
||||
|
||||
---
|
||||
|
||||
# Phase 2: Package documentation
|
||||
|
||||
When Phase 1bis is complete (`docs/todo/phase1bis.txt` empty), initialize `docs/todo/phase2.txt`:
|
||||
|
||||
- List all packages: unique directories under `pkg/` that contain at least one `.go` file and are not tools.
|
||||
- Write each package identifier (e.g., `align`, `internal/align`) as a line.
|
||||
|
||||
Processing: read first line, generate `docs/phase2/<package>.md`, validate, remove line on success, retry logic in `docs/retry/phase2/`.
|
||||
|
||||
---
|
||||
|
||||
# Phase 3: Tool documentation
|
||||
|
||||
When Phase 2 complete, initialize `docs/todo/phase3.txt`:
|
||||
|
||||
- List all directories under `cmd/` that contain a `main.go`. Write each tool name as a line.
|
||||
|
||||
Processing: read first line, generate `docs/phase3/<tool>.md`, validate, remove line on success, retry logic in `docs/retry/phase3/`.
|
||||
|
||||
---
|
||||
|
||||
# Finalization
|
||||
|
||||
When all task files are empty and no pending phases, generate `docs/README.md` by:
|
||||
|
||||
- Listing all package docs (files in `docs/phase2/`) and linking.
|
||||
- Listing all tool docs (files in `docs/phase3/`) and linking.
|
||||
|
||||
Write using `Shell`.
|
||||
|
||||
---
|
||||
|
||||
# Execution flow summary
|
||||
|
||||
1. **Phase 0**: Create directories and initial `todo/phase1.txt` if missing. Exit.
|
||||
2. **Phase 1**:
|
||||
- If `todo/phase1.txt` exists and non‑empty → process first line.
|
||||
- Else → move to Phase 1bis initialization.
|
||||
3. **Phase 1bis**:
|
||||
- If `todo/phase1bis.txt` does not exist → create from successful phase1 docs.
|
||||
- If non‑empty → process first line.
|
||||
- Else → move to Phase 2 initialization.
|
||||
4. **Phase 2**: similar.
|
||||
5. **Phase 3**: similar.
|
||||
6. **Finalization**: generate README.
|
||||
|
||||
The LLM should be invoked repeatedly (e.g., by a scheduler) until all phases are done. Each invocation processes exactly one item.
|
||||
|
||||
---
|
||||
|
||||
# Important reminders
|
||||
|
||||
- Always call `Shell` to write files; never output content in plain text.
|
||||
- Validate quality before removing a line from the task file.
|
||||
- Log all failures to `docs/error.log` in JSON lines format.
|
||||
- If any MCP tool fails, treat as failure and increment retry counter.
|
||||
- Never read more than one line from a task file in a single run.
|
||||
@@ -0,0 +1,222 @@
|
||||
//go:build ignore
|
||||
|
||||
package main
|
||||
|
||||
import (
|
||||
"encoding/json"
|
||||
"fmt"
|
||||
"os"
|
||||
"os/exec"
|
||||
"path/filepath"
|
||||
"regexp"
|
||||
"sort"
|
||||
"strconv"
|
||||
"strings"
|
||||
)
|
||||
|
||||
type Reference struct {
|
||||
File string `json:"file"`
|
||||
Line int `json:"line"`
|
||||
Column int `json:"column"`
|
||||
Key string `json:"key"`
|
||||
Function string `json:"function"`
|
||||
Context string `json:"context"`
|
||||
}
|
||||
|
||||
type Result struct {
|
||||
Method string `json:"method"`
|
||||
Signature string `json:"signature"`
|
||||
Definition string `json:"definition"`
|
||||
References []Reference `json:"references"`
|
||||
Total int `json:"total"`
|
||||
}
|
||||
|
||||
var basePath = "/Users/coissac/Sync/travail/__MOI__/GO/obitools4"
|
||||
|
||||
func main() {
|
||||
cmd := exec.Command("rg", "-n", `\.SetAttribute\(`, basePath+"/pkg", "--type", "go")
|
||||
output, err := cmd.Output()
|
||||
if err != nil {
|
||||
fmt.Fprintf(os.Stderr, "Error running rg: %v\n", err)
|
||||
os.Exit(1)
|
||||
}
|
||||
|
||||
lines := strings.Split(string(output), "\n")
|
||||
lineRe := regexp.MustCompile(`^(.+?):(\d+):\s*(.+)$`)
|
||||
keyRe := regexp.MustCompile(`SetAttribute\("([^"]+)"`)
|
||||
templateKeyRe := regexp.MustCompile(`SetAttribute\("([^"]+)[^"]*"\s*,`)
|
||||
|
||||
var refs []Reference
|
||||
seen := make(map[string]bool)
|
||||
|
||||
for _, line := range lines {
|
||||
line = strings.TrimSpace(line)
|
||||
if line == "" {
|
||||
continue
|
||||
}
|
||||
|
||||
matches := lineRe.FindStringSubmatch(line)
|
||||
if matches == nil {
|
||||
continue
|
||||
}
|
||||
|
||||
file := matches[1]
|
||||
lineNum, _ := strconv.Atoi(matches[2])
|
||||
context := strings.TrimSpace(matches[3])
|
||||
|
||||
// Skip definition
|
||||
if strings.Contains(file, "obiseq/attributes.go") && lineNum == 132 {
|
||||
continue
|
||||
}
|
||||
|
||||
// Extract key
|
||||
var key string
|
||||
if keyMatches := keyRe.FindStringSubmatch(context); keyMatches != nil {
|
||||
key = keyMatches[1]
|
||||
} else if tmplMatches := templateKeyRe.FindStringSubmatch(context); tmplMatches != nil {
|
||||
key = tmplMatches[1]
|
||||
} else {
|
||||
continue
|
||||
}
|
||||
|
||||
// Get function name using treesitter
|
||||
funcName := getFunctionNameTreesitter(file, lineNum)
|
||||
|
||||
uniqueKey := fmt.Sprintf("%s:%d", file, lineNum)
|
||||
if seen[uniqueKey] {
|
||||
continue
|
||||
}
|
||||
seen[uniqueKey] = true
|
||||
|
||||
refs = append(refs, Reference{
|
||||
File: filepath.Base(file),
|
||||
Line: lineNum,
|
||||
Column: 0,
|
||||
Key: key,
|
||||
Function: funcName,
|
||||
Context: context,
|
||||
})
|
||||
}
|
||||
|
||||
sort.Slice(refs, func(i, j int) bool {
|
||||
if refs[i].File != refs[j].File {
|
||||
return refs[i].File < refs[j].File
|
||||
}
|
||||
return refs[i].Line < refs[j].Line
|
||||
})
|
||||
|
||||
result := Result{
|
||||
Method: "SetAttribute",
|
||||
Signature: "func (s *BioSequence) SetAttribute(key string, value interface{})",
|
||||
Definition: basePath + "/pkg/obiseq/attributes.go:132",
|
||||
References: refs,
|
||||
Total: len(refs),
|
||||
}
|
||||
|
||||
outputJSON, err := json.MarshalIndent(result, "", " ")
|
||||
if err != nil {
|
||||
fmt.Fprintf(os.Stderr, "Error marshaling JSON: %v\n", err)
|
||||
os.Exit(1)
|
||||
}
|
||||
|
||||
fmt.Println(string(outputJSON))
|
||||
}
|
||||
|
||||
// getFunctionNameTreesitter uses the treesitter_cursor_walk tool to get the containing function
|
||||
func getFunctionNameTreesitter(file string, targetLine int) string {
|
||||
// Convert to 0-based for treesitter
|
||||
row := targetLine - 1
|
||||
|
||||
// Use treesitter cursor walk to get ancestors
|
||||
cmd := exec.Command("bash", "-c",
|
||||
fmt.Sprintf(`kilo treesitter_cursor_walk --file_path %q --row %d --column 0 --max_depth 10 2>/dev/null`, file, row))
|
||||
|
||||
output, err := cmd.Output()
|
||||
if err != nil {
|
||||
return findContainingFunction(file, targetLine)
|
||||
}
|
||||
|
||||
// Parse the JSON output to find function_declaration or method_declaration
|
||||
var result map[string]interface{}
|
||||
if err := json.Unmarshal(output, &result); err != nil {
|
||||
return findContainingFunction(file, targetLine)
|
||||
}
|
||||
|
||||
// Check ancestors for function declaration
|
||||
if ancestors, ok := result["ancestors"].([]interface{}); ok {
|
||||
for _, a := range ancestors {
|
||||
if anc, ok := a.(map[string]interface{}); ok {
|
||||
nodeType, _ := anc["type"].(string)
|
||||
if nodeType == "function_declaration" || nodeType == "method_declaration" {
|
||||
// Try to get the function name from children
|
||||
if children, ok := anc["children"].([]interface{}); ok {
|
||||
for _, c := range children {
|
||||
if child, ok := c.(map[string]interface{}); ok {
|
||||
childType, _ := child["type"].(string)
|
||||
if childType == "identifier" {
|
||||
if text, ok := child["text"].(string); ok {
|
||||
return text
|
||||
}
|
||||
}
|
||||
if childType == "field_identifier" {
|
||||
if text, ok := child["text"].(string); ok {
|
||||
return text
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
if nodeType == "func_literal" {
|
||||
return "closure"
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
return findContainingFunction(file, targetLine)
|
||||
}
|
||||
|
||||
func findContainingFunction(file string, targetLine int) string {
|
||||
data, err := os.ReadFile(file)
|
||||
if err != nil {
|
||||
return ""
|
||||
}
|
||||
lines := strings.Split(string(data), "\n")
|
||||
|
||||
for i := targetLine - 1; i >= 0 && i >= targetLine-200; i-- {
|
||||
if i >= len(lines) {
|
||||
continue
|
||||
}
|
||||
line := strings.TrimSpace(lines[i])
|
||||
|
||||
if line == "}" && i > 0 {
|
||||
for j := i - 1; j >= 0 && j >= i-50; j-- {
|
||||
if j >= len(lines) {
|
||||
continue
|
||||
}
|
||||
funcLine := strings.TrimSpace(lines[j])
|
||||
if strings.HasPrefix(funcLine, "func ") {
|
||||
if match := regexp.MustCompile(`func\s+\([^)]+\)\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(funcLine); match != nil {
|
||||
return match[1]
|
||||
}
|
||||
if match := regexp.MustCompile(`func\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(funcLine); match != nil {
|
||||
return match[1]
|
||||
}
|
||||
}
|
||||
}
|
||||
continue
|
||||
}
|
||||
|
||||
if strings.HasPrefix(line, "func ") {
|
||||
if match := regexp.MustCompile(`func\s+\([^)]+\)\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(line); match != nil {
|
||||
return match[1]
|
||||
}
|
||||
if match := regexp.MustCompile(`func\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(line); match != nil {
|
||||
return match[1]
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
return ""
|
||||
}
|
||||
Executable
+36
@@ -0,0 +1,36 @@
|
||||
#!/bin/bash
|
||||
|
||||
basePath="/Users/coissac/Sync/travail/__MOI__/GO/obitools4"
|
||||
OUTPUT_FILE="${1:-/dev/stdout}"
|
||||
|
||||
# Get all SetAttribute calls
|
||||
rg -n '\.SetAttribute\(' "$basePath/pkg" --type go | while read -r line; do
|
||||
file="${line%%:*}"
|
||||
line_num="${line%:*}"
|
||||
line_num="${line_num##*:}"
|
||||
context="${line##*: }"
|
||||
|
||||
# Extract key (only literal strings)
|
||||
key=$(echo "$context" | sed -n 's/.*SetAttribute("\([^"]*\)".*/\1/p')
|
||||
[ -z "$key" ] && continue
|
||||
|
||||
# Get function name using treesitter
|
||||
func=$(kilo treesitter_cursor_walk \
|
||||
--file_path "$file" \
|
||||
--row "$((line_num - 1))" \
|
||||
--column 0 \
|
||||
--max_depth 10 2>/dev/null |
|
||||
jq -r '.ancestors[] | select(.type == "function_declaration" or .type == "method_declaration") | .children[] | select(.type == "identifier" or .type == "field_identifier") | .text' 2>/dev/null)
|
||||
|
||||
# Fallback to func_literal for closures
|
||||
if [ -z "$func" ]; then
|
||||
func=$(kilo treesitter_cursor_walk \
|
||||
--file_path "$file" \
|
||||
--row "$((line_num - 1))" \
|
||||
--column 0 \
|
||||
--max_depth 10 2>/dev/null |
|
||||
jq -r '.ancestors[] | select(.type == "func_literal") | "closure"' 2>/dev/null)
|
||||
fi
|
||||
|
||||
echo "$(basename "$file")|$line_num|$key|${func:-unknown}|$context"
|
||||
done | sort -t'|' -k1,1 -k2,2n
|
||||
@@ -0,0 +1,308 @@
|
||||
{
|
||||
"obiannotate": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
],
|
||||
"(git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter.IBioSequence).NumberSequences$1": [
|
||||
"seq_number"
|
||||
]
|
||||
},
|
||||
"obiclean": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obicleandb": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
|
||||
"count"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obicomplement": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obiconsensus": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
|
||||
"count"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
],
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.BuildConsensus": [
|
||||
"obiconsensus_kmer_max_occur",
|
||||
"obiconsensus_filtered_graph_size",
|
||||
"obiconsensus_full_graph_size",
|
||||
"obiconsensus_consensus",
|
||||
"obiconsensus_weight",
|
||||
"obiconsensus_seq_length",
|
||||
"obiconsensus_kmer_size"
|
||||
],
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.MinionClusterDenoise": [
|
||||
"obiconsensus_consensus"
|
||||
],
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.MinionDenoise$1": [
|
||||
"obiconsensus_consensus",
|
||||
"obiconsensus_weight"
|
||||
]
|
||||
},
|
||||
"obiconvert": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obicount": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obicsv": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obidemerge": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obidistribute": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obigrep": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obijoin": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obikmermatch": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obikmersimcount": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obilandmark": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCoordinate": [
|
||||
"landmark_coord"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagGeomRefIndex": [
|
||||
"obitag_geomref_index"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
],
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obilandmark.CLISelectLandmarkSequences": [
|
||||
"landmark_id"
|
||||
]
|
||||
},
|
||||
"obimatrix": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obimicrosat": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obimultiplex": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obipairing": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._revcmpMutation": [
|
||||
"pairing_mismatches"
|
||||
],
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign.BuildQualityConsensus": [
|
||||
"pairing_mismatches"
|
||||
]
|
||||
},
|
||||
"obipcr": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obireffamidx": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagRefIndex": [
|
||||
"obitag_ref_index"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
],
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obirefidx.IndexFamilyDB": [
|
||||
"reffamidx_id"
|
||||
]
|
||||
},
|
||||
"obirefidx": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagRefIndex": [
|
||||
"obitag_ref_index"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obiscript": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obisplit": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obisummary": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obitag": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetPath": [
|
||||
"taxonomic_path"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
},
|
||||
"obitagpcr": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obingslibrary.NGSLibrary).ExtractMultiBarcode": [
|
||||
"obimultiplex_error",
|
||||
"obimultiplex_amplicon_rank"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._revcmpMutation": [
|
||||
"pairing_mismatches"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._subseqMutation": [
|
||||
"pairing_mismatches"
|
||||
],
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign.BuildQualityConsensus": [
|
||||
"pairing_mismatches"
|
||||
]
|
||||
},
|
||||
"obitaxonomy": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetPath": [
|
||||
"taxonomic_path"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
],
|
||||
"(git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter.IBioSequence).NumberSequences$1": [
|
||||
"seq_number"
|
||||
]
|
||||
},
|
||||
"obiuniq": {
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
|
||||
"count"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
|
||||
"definition"
|
||||
],
|
||||
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
|
||||
"taxid"
|
||||
]
|
||||
}
|
||||
}
|
||||
+1
-1
@@ -1 +1 @@
|
||||
4.4.20
|
||||
4.4.46
|
||||
|
||||
@@ -0,0 +1,19 @@
|
||||
```markdown
|
||||
# DNA Scoring and Matching Utilities in `obialign`
|
||||
|
||||
This module provides low-level utilities for computing nucleotide alignment scores using probabilistic and bit-encoded representations.
|
||||
|
||||
- **Bit Encoding**: Nucleotides are encoded in 4-bit groups (e.g., `A=0b0001`, `C=0b0010`, etc.), enabling efficient bitwise comparison.
|
||||
- **`_MatchRatio(a, b)`**: Computes a normalized match ratio between two encoded bytes based on shared bits:
|
||||
`ratio = common_bits / (bits_in_a × bits_in_b)`.
|
||||
- **`_FourBitsCount`**: Precomputed lookup table for Hamming weight (popcount) of 4-bit values.
|
||||
- **Log-space Arithmetic**: Helper functions (`_Logaddexp`, `_Logdiffexp`, `_Log1mexp`) ensure numerical stability in probabilistic computations.
|
||||
- **Phred-scaled Quality Integration**:
|
||||
`_MatchScoreRatio(QF, QR)` derives log-odds match/mismatch scores from Phred quality values (`QF`, `QR`), modeling sequencing error probabilities.
|
||||
- **Precomputed Matrices**:
|
||||
- `_NucPartMatch[i][j]`: Match ratios for all nucleotide pairs (from 4-bit codes).
|
||||
- `_NucScorePartMatchMatch/Mismatch[i][j]`: Integer-scaled match/mismatch scores (×10) for quality pairs `(i, j)` in `[0..99]`.
|
||||
- **Thread-Safe Initialization**: `_InitDNAScoreMatrix()` ensures one-time, synchronized initialization of all scoring tables via a mutex.
|
||||
|
||||
Designed for high-performance alignment kernels where speed and numerical robustness are critical.
|
||||
```
|
||||
Reference in New Issue
Block a user