Compare commits

..
Author SHA1 Message Date
Eric Coissac f727ae930f Release 4.5.0 2026-08-19 17:35:06 +02:00
Eric Coissac 90cf780f23 fix: update uint128 test expectations and improve log formatting
Corrects expected values for division and comparison operations in the uint128 test suite. Updates obilandmark to use log.Fatalf instead of log.Fatal, ensuring sequence ID, taxid, and taxonomy name are correctly interpolated in fatal error messages.
2026-08-19 17:33:57 +02:00
Eric Coissac 620646d412 fix: validate inputs and fix coordinate offsets in pattern matching
Introduce explicit input validation and a `(-1, -1, -1)` sentinel return value to signal invalid or unreliable matches. Add pre-call length checks and early returns to prevent panics during indel relocation. Fix an index offset bug in coordinate calculation by preserving the original fragment position before applying alignment deltas. Update match filtering to enforce reliability checks only on successfully relocated alignments. Comprehensive tests validate edge cases, boundary constraints, and error thresholds.
2026-08-19 17:25:44 +02:00
Eric Coissac 438893d910 refactor: improve FASTQ error messages with explicit filenames
The options system now tracks explicit file paths via a new accessor and functional option. This filename is threaded through the FASTQ parser chain to replace generic source references in fatal error messages, providing clearer, file-specific diagnostics without altering core parsing logic or test suites.
2026-08-19 16:47:36 +02:00
Eric Coissac eae41ac81c fix: respect config defaults when --allowed-mismatches is unset
The change replaces numeric threshold checks with an explicit flag state tracker for the `--allowed-mismatches` option. This ensures per-primer mismatch settings from configuration files are preserved when the CLI parameter is omitted or zero, making the command-line flag act strictly as an explicit override rather than a default fallback.
2026-08-19 16:40:48 +02:00
Eric Coissac d735ac6188 feat: add JSON input support for biological sequences
Introduce a streaming JSON parser that decodes biological sequences using `goccy/go-json` with configurable batching to minimize memory overhead. Extend the CLI, file suffix filters, and MIME type detection to automatically recognize and route JSON inputs. Refactor header parsing into a centralized switch-case handler for improved maintainability.
2026-07-03 10:16:55 +02:00
coissac 9de463ef1e Merge pull request #121 from metabarcoding/push-swrrsvqysysz
Release 4.4.46
2026-07-02 08:51:30 +02:00
Eric Coissac a8841c203d Release 4.4.46 2026-07-02 08:50:00 +02:00
Eric Coissac f1a424343c Update ignore patterns, configure Serena, and refactor FASTSEQ parser
Adds `.gitignore` rules to exclude benchmark outputs and local build artifacts. Initializes Serena AI configuration for the Go project with UTF-8 encoding and gitignore-based file exclusion. Refactors the FASTSEQ header parser to fix regex syntax, optimize alternation ordering, improve control flow readability, and introduce explicit float-to-int coercion that preserves fractional values.
2026-07-02 08:49:26 +02:00
coissac 4dae7f708d Merge pull request #119 from metabarcoding/push-zrmnkuwsztxx
Release 4.4.45
2026-06-02 15:02:42 +02:00
Eric Coissac 578445f38a Release 4.4.45 2026-06-02 15:01:32 +02:00
Eric Coissac 2edb33ad08 fix: correct duplicated typos in GVal function names
Corrects duplicated typos in the registered GVal function names, changing "which_maxwhichmax" and "which_minwhichmin" to "which_max" and "which_min". The underlying obiutils.WhichMax/WhichMin logic and its int-to-float64 index conversion remain unchanged.
2026-06-02 15:00:48 +02:00
coissac b108d4978e Merge pull request #118 from metabarcoding/push-twztopkvxyop
Release 4.4.44
2026-06-02 14:42:00 +02:00
Eric Coissac e9210e28a3 Release 4.4.44 2026-06-02 14:40:09 +02:00
Eric Coissac 13a93fce11 feat: add which_max and which_min to retrieve extreme element indices
Implement reflection-based WhichMax and WhichMin to dynamically find the index or key of the maximum/minimum element in slices, arrays, or maps. Functions validate orderability, handle empty collections, and dispatch via reflect.Kind. Expose as which_max and which_min GVal functions, with float64 type assertions for compatibility and preserved error handling.
2026-06-02 14:39:31 +02:00
Eric Coissac 14064c919e fix(obiutils): correctly unwrap interface values in min/max
Introduces an `unwrapInterface` reflection helper to dereference `interface{}`-wrapped values before type validation. Updates slice and map iteration loops in min/max functions to apply this helper, ensuring `isOrderedKind` accurately identifies underlying concrete types instead of incorrectly rejecting `reflect.Interface` elements.
2026-06-02 14:34:00 +02:00
coissac 1dfd68aa6d Merge pull request #117 from metabarcoding/push-wvlmzvomslzv
Release 4.4.43
2026-06-01 14:14:40 +02:00
Eric Coissac 930fe5f1ba Release 4.4.43 2026-06-01 13:22:58 +02:00
Eric Coissac dcdaf9e372 feat: support map and slice types in OBI attributes
Extends OBI header parsing to recognize and deserialize JSON-like arrays and objects. Introduces safe conversion utilities in `obiutils` to cast generic interface values into typed maps, and exposes them via new `BioSequence` methods. Header values are now marshaled, quote-normalized, and formatted for map and slice types.
2026-06-01 13:21:11 +02:00
Eric Coissac af7ae3d60c Correct Shannon entropy bias for canonical k-mers
Multiple raw k-mers collapsing into identical circular canonical forms introduce bias into complexity estimates. This change pre-computes `log(class_size)` tables and per-word-size maximum entropy bounds. The `KmerEntropy` function and `KmerEntropyFilter` are updated to apply the corrected formula `(log(N) + Σf·log(s) - Σf·log(f))/N / emax`, ensuring accurate sequence complexity estimation.
2026-05-17 14:54:57 +08:00
Eric Coissac cecf90fa40 feat: add min/max filtering and saturating subtraction utilities
Introduce generic and reflection-based utilities for filtering slices and maps by minimum/maximum thresholds, along with saturating subtraction. The `obiutils` package provides type-safe generic implementations alongside dynamic reflection dispatchers to handle arbitrary ordered and numeric types. These are exposed as GVAL expression functions in `obiseq`, extending the language's built-in filtering and numeric capabilities.
2026-05-14 20:58:24 +08:00
Eric Coissac a186bd1c92 fix: validate non-empty sequence IDs in FASTA and FASTQ writers
Adds a pre-processing guard that checks for empty sequence identifiers before formatting. This prevents malformed FASTA output and stops downstream processing of invalid FASTQ data by terminating early. The check is placed before existing sequence-length validations to enforce non-empty IDs during batch processing.
2026-05-05 18:07:58 +02:00
coissac 46d60c1a44 Merge pull request #115 from metabarcoding/push-lkzqoskvyqtr
[4.4.2] Enhanced taxonomy handling, input robustness & PCR tag validation
2026-04-30 16:59:49 +02:00
Eric Coissac 6c4a6c697c [4.4.2] Enhanced taxonomy handling, input robustness & PCR tag validation
- **obiconvert**: Added `--raw-taxid` mode to output numeric taxIDs without formatting (e.g., "12345" instead of ":tax:NCBI_0987@species"). Introduced `TaxNode.FullString()` to reliably return full formatted strings regardless of global settings, and improved fallback behavior when taxonomy DB is unavailable.
- **ngsfilter**: Input fields (primers, sample tags/IDs) are now automatically trimmed of leading/trailing whitespace to prevent parsing failures from inconsistent formatting.
- **obitools (pcrtag)**: Mismatch-related fields (`forward_mismatches`, `reverse_mishaps`) renamed to "error" for consistency across annotation dictionaries.
- **obipairing & obtagpcr**: Enforced mandatory paired-end file input (`--forward` and `reverse`) in obipairing; added CLI support for generating config templates via AskConfigTemplate(); removed redundant `Required()` constraints and introduced helper function CLIHasPairedFiles().
2026-04-30 16:57:45 +02:00
Eric Coissac 60b3753673 feat(obiconvert): add --raw-taxid option and refactor taxID formatting
- Add new `--tax-id` mode (`obiconvert --raw-taxid`) to output bare numeric taxIDs instead of full-format strings.
- Introduce `TaxNode.FullString()` to always return the complete "code:id [name]@rank" format, regardless of global `UseRawTaxids()` setting.
- Update `.String(taxonomyCode)` to respect the global flag, returning bare ID when `--raw-taxid` is active.
- Extract raw taxID from full-format strings in taxonomy methods when needed (e.g., fallback without loaded DB).
- Add comprehensive test suite covering:
a) `--raw-taxid` execution and idempotency
b) full-format taxID output with `--taxonomy`
c interaction of both flags
d format validation
- Add test data: new reference files `out_ecotag.fasta`, taxonomy.csv, and updated shell script.
2026-04-30 16:57:38 +02:00
Eric Coissac 14e2840a2d [ngsfilter] Trim whitespace from primer and sample fields
Trim leading/trailing whitespaces in forward/reverse primers, tags (via sample_tag), experiment andsample fields to prevent parsing errors due to formatting inconsistencies in input data.
2026-04-30 08:14:39 +02:00
Eric Coissac 42910c7db9 🔧 Rename mismatch fields to error in pcrtag.go
- Renamed `obimultiplex_forward_mismatches` to "error" for consistency
- Similarly renamed 
  `obimultiplex_reverse_mismatches` to "error"
- Applied changes in both annotation dictionaries (aanot, banot)
2026-04-29 15:29:25 +02:00
Eric Coissac 8b4cf677c6 [obitools] Add validation for paired files and config template support
- Enforce requirement of both forward (-F) and reverse files in obipairing/main.go
- Add config template support to obtagpcr via CLIAskConfigTemplate()
- Remove redundant Required() constraints in options.go
- Introduce new helper CLIHasPairedFiles()
2026-04-29 15:01:37 +02:00
coissac 02765f154f Merge pull request #113 from metabarcoding/push-oxowomxlnlnx
Push oxowomxlnlnx
2026-04-16 15:04:55 +02:00
Eric Coissac 449544bd63 [obiseq] Quality validation and new map_summaries aggregation
- Added strict length matching between sequences and quality scores in `SetQualities`, `Take Qualites` (note: likely intended as " TakeQuantiles" or similar, but preserved per commit), and `Subsequence` operations; an error is now raised if lengths do not match.
- Introduced a new `map_summaries` aggregation feature in obisummary to merge map summary data across datasets, supporting safe concurrent access and inclusion of non-empty results in the final output.
- Centralized string reversal logic via a new `inverser_chaine()` utility function, replacing duplicated inline implementations throughout the codebase.
2026-04-16 14:58:23 +02:00
Eric Coissac 434d2e5930 +feat: add support for map_summaries aggregation in obisummary
- Implement merging logic of `map summaries` across datasets
  - Ensure proper initialization and population in multi-threaded context
- Add `map_summaries` to final output dictionary when non-empty
2026-04-16 14:58:18 +02:00
Eric Coissac 7cb02ded69 Refactor: Extract utility function for string reversal
- Introduce `inverser_chaine()` helper to centralize logic
 - Replace inline reverse implementations across modules
2026-04-16 13:42:51 +02:00
Eric Coissac 6d469bd711 [obiseq] Add length validation for qualities in SetQualities, Take Qualites and Subsequence
[obiseq] Add length validation for qualities in SetQualities, Take Qualites and Subsequence
- Panic if sequence/qualities length mismatch when setting or taking qualities in BioSequence.
 - Add same check before slicing Qualities() for Subsequence to ensure consistency.
2026-04-15 18:20:53 +02:00
coissac 3d8e4a3a4e Merge pull request #112 from metabarcoding/push-yvqvqrxyktoz
Push yvqvqrxyktoz
2026-04-14 14:49:08 +02:00
Eric Coissac 07d04a6967 Release 4.4.40 2026-04-14 14:48:41 +02:00
Eric Coissac 03f251c365 [release] bump version to v4.4.39
- Update `version.txt` from "v" to v4.4.39
- Auto-synced `pkg/obioptions/version.go` via Makefile
2026-04-14 14:48:38 +02:00
Eric Coissac 5714fa6cd3 chore: bump version to 4.4.39
Update package and file versions from Release/Version 4.4.38 toRelease-Version /File Version
2026-04-14 14:48:29 +02:00
coissac f101625771 Merge pull request #110 from metabarcoding/push-tstsmnkomnoo
Push tstsmnkomnoo
2026-04-13 17:57:38 +02:00
Eric Coissac 4359b52eaf Release 4.4.38 2026-04-13 17:57:00 +02:00
Eric Coissac da0c8b6f28 ♻️ refactor lua_push_interface and add json module
Refactor pushInterfaceToLua to delegate unsupported types (nil, bool/int/float/string/map/slice) recursively via new lvalueFromInterface helper. Simplify typed slice and map handlers, remove explicit nil case (now handled by lvalueFromInterface), eliminate redundant type switches in pushMapStringIntToLua and similar functions. Add new luajson.go with RegisterJSON, lua.JSONEncode/Decode bindings using lvalueFromInterface and Table2 Interface for bidirectional round-trips. Include comprehensive tests covering scalars, nested structures (e.g., kmindex response), arrays and error cases.
2026-04-13 17:56:58 +02:00
coissac 841e5c9e2a Merge pull request #109 from metabarcoding/push-okvqknqnvmnl
Push okvqknqnvmnl
2026-04-13 17:19:41 +02:00
Eric Coissac e298daeef9 [v4.5] Bugfix for 3-base sequence handling and utility refactoring
- **Bug fix**: Corrected logic in 4-mer calculation to properly handle sequences of length exactly three. Previously, such cases could produce invalid or unexpected results due to an incomplete guard condition (`length < 0`) which failed for ` length == 3` (where computed step size was zero). The fix ensures all sequences shorter than four bases are safely excluded.

- **Refactor**: Introduced a new internal utility function (`inverser_chaine`) to centralize string reversal logic, improving code maintainability and test coverage without affecting user-facing behavior.
2026-04-13 17:18:53 +02:00
Eric Coissac d9e6f67a6e chore: bump version to 4.4.36
Update package and file versions from v4.4.35 to 4.4.36.
2026-04-13 17:18:48 +02:00
Eric Coissac f036c7fa96 ⬆️ version bump to v4.5
- Update `version.txt` from "v3" to v4.5
- Bump Go constant `_Version = 'Release 4.x.y'` accordingly
2026-04-13 17:18:34 +02:00
Eric Coissac e33665e716 Refactor: Extract utility function for string reversal
- Introduce `inverser_chaine()` helper to centralize logic
 - Update tests and documentation accordingly
2026-04-13 17:18:34 +02:00
Eric Coissac c955a614ca chore: bump version to 4.4.35
Update obioptions/version.go and version.txt to reflect release 4.4.35.
2026-04-13 17:18:34 +02:00
Eric Coissac f19065261e We kept 2026-04-13 17:18:34 +02:00
coissac 3e349e92e1 Merge pull request #104 from theo-krueger/master
Bugfix: result of 0 4mers not caught if sequence length == 3
2026-04-13 16:39:08 +02:00
coissac a4ce24a418 Merge pull request #108 from metabarcoding/push-qlxnulxwokxo
Push qlxnulxwokxo
2026-04-13 16:27:43 +02:00
Eric Coissac 960ad1531d [4.4.34] HTTP client thread-safety and CI infrastructure updates
- Improved concurrency safety by replacing the global HTTP client with a thread-safe, lazy-initialized instance using `sync.Once`. The new implementation enables connection pooling (`MaxIdleConnsPerHost`, connections per host) and dynamically configures pool size based on `obidefault.ParallelWorkers()`, ensuring robust behavior in multi-threaded Lua environments.
- Updated GitHub Actions workflows to the latest stable versions of `actions/setup-go` and ` actions/checkout`, improving build reliability.
- Removed outdated Go dependency checksums for buger/jsonparser v1.1.x to keep the build clean and consistent.
2026-04-13 16:27:14 +02:00
Eric Coissac 137f49d1d1 🔧 refactor(http): use thread-safe lazy-initialized HTTP client with connection pooling
- Replace global _httpClient variable by a sync.Once-based lazy initialization
- Add getHTTPClient() function to safely initialize client with connection pooling settings (MaxIdleConnsPerHost, Max Con ns/Conn per host)
- Set connection pool size based on obidefault.ParallelWorkers()

This ensures safe concurrent access and better resource management in multi-threaded Lua environments.
2026-04-13 16:27:09 +02:00
Eric Coissac 083a92e13d ⬆️ update GitHub Actions to latest versions
- Upgrade actions/setup-go from v2/v4 (depending on workflow) to latest stable version
- Update all actions/checkout from v3/v4 (depending on workflow) to latest stable version
- Clean up outdated go.sum entries for buger/jsonparser v1.1.x
2026-04-13 14:41:47 +02:00
coissac 67683435e8 Merge pull request #107 from metabarcoding/push-oyzynqqnturm
Push oyzynqqnturm
2026-04-13 14:29:44 +02:00
Eric Coissac f32b29db4f Release 4.4.33 2026-04-13 14:29:18 +02:00
Eric Coissac 10f49fe64b 📝 Clarify RegisterHTTP global registration intent
//
// Registers the http module in Lua state as a global,
// aligning with obicontext and BioSequence conventions.
The change ensures consistent module exposure across Lua environments.
2026-04-13 14:29:16 +02:00
coissac d257917748 Merge pull request #106 from metabarcoding/push-qoqotlnktvls
Push qoqotlnktvls
2026-04-13 14:08:42 +02:00
Eric Coissac fec078c04c Release 4.4.32 2026-04-13 14:08:16 +02:00
Eric Coissac a92393dd51 ⬆️ update go.mod dependencies and improve error messages
- Bump github.com/buger/jsonparser from v1.1.1 to v1.2
- Add error details in log.Fatalf calls for better debugging
2026-04-13 14:08:13 +02:00
coissac 7e76698490 Merge pull request #105 from metabarcoding/push-pnqoquxmpqpq
Push pnqoquxmpqpq
2026-04-13 13:36:13 +02:00
Eric Coissac 64b0b32f61 Release 4.4.31 2026-04-13 13:35:39 +02:00
Eric Coissac c8e6a218cb [release] bump version to v4.5
- Update obioptions/version.go and version.txt from Release v4.5 to 68302a1
- Increment patch version: from `Release v4.5` → 68302a1
- Align version.txt with current release tag
2026-04-13 13:35:33 +02:00
Eric Coissac 8c7017a99d ⬆️ version bump to v4.5
- Update obioptions.Version from "Release 4.4.29" to "/v/ Release v5"
- Update version.txt from 4.29 → .30
(automated by Makefile)
2026-04-13 13:34:53 +02:00
theo-krueger c7816973a6 Bugfix: result of 0 4mers not caught if sequence length == 3
In the 4mer calculation:
length := slength - 3

- for sequences with <4 bases, length is <=0

The check to stop did only catch <0, so sequences lengths 2 or less, leaving sequence lengths of 3 unguarded
if length < 0 {
		return nil
	}
2026-04-10 14:05:30 +02:00
Eric Coissac 670edc1958 docs: ajouter la documentation globale pour OBITools v4
- Ajout de prompt_documentation_globale.md décrivant les trois phases d'écriture de la documentation (fichier → package → outil)
- Présence de fichiers .DS_Store non significatifs (à ignorer)
2026-03-31 19:02:42 +02:00
coissac f92f285417 Merge pull request #101 from metabarcoding/push-klzowrsmmnyv
Dynamic Batch Flushing and Build Improvements
2026-03-16 22:29:29 +01:00
Eric Coissac a786b58ed3 Dynamic Batch Flushing and Build Improvements
This release introduces dynamic batch flushing in the Distribute component, replacing the previous fixed-size batching with a memory- and count-aware strategy. Batches now flush automatically when either the maximum sequence count (BatchSizeMax()) or memory threshold (BatchMem()) per key is reached, ensuring more efficient resource usage and consistent behavior with the RebatchBySize strategy. The optional sizes parameter has been removed, and related code—including the Lua wrapper and worker buffer handling—has been updated for correctness and simplicity. Unused BatchSize() references have been eliminated from obidistribute.

Additionally, this release includes improvements to static Linux builds and overall build stability, enhancing reliability across deployment environments.
2026-03-16 22:06:51 +01:00
Eric Coissac a2b26712b2 refactor: replace fixed batch size with dynamic flushing based on count and memory
Replace the old fixed batch-size mechanism in Distribute with a dynamic strategy that flushes batches when either BatchSizeMax() sequences or BatchMem() bytes are reached per key. This aligns with the RebatchBySize strategy and removes the optional sizes parameter. Also update related code: simplify Lua wrapper to accept optional capacity, and fix buffer growth logic in worker.go using slices.Grow correctly. Remove unused BatchSize() usage from obidistribute.
2026-03-16 22:06:44 +01:00
coissac 1599abc9ad Merge pull request #99 from metabarcoding/push-urlyqwkrqypt
4.4.28: Static Linux Builds, Memory-Aware Batching, and Build Stability
2026-03-14 12:21:34 +01:00
Eric Coissac af213ab446 4.4.28: Static Linux Builds, Memory-Aware Batching, and Build Stability
This release focuses on improving build reliability, memory efficiency for large datasets, and portability of Linux binaries.

### Static Linux Binaries
- Linux binaries are now built with static linking using musl, eliminating external runtime dependencies and ensuring portability across distributions.

### Memory-Aware Batching
- Users can now control memory usage during processing with the new `--batch-mem` option, specifying limits such as 128K, 64M, or 1G.
- Batching logic now respects both size and memory constraints: batches are flushed when either threshold is exceeded.
- Conservative memory estimation for sequences helps avoid over-allocation, and explicit garbage collection after large batch discards reduces memory spikes.

### Build System Improvements
- Upgraded to Go 1.26 for improved performance and toolchain stability.
- Fixed cross-compilation issues by replacing generic include paths with architecture-specific ones (x86_64-linux-gnu and aarch64-linux-gnu).
- Streamlined macOS builds by removing special flags, using standard `make` targets.
- Enhanced error reporting during build failures: logs are now shown before cleanup and exit.
- Updated install script to correctly configure GOROOT, GOPATH, and GOTOOLCHAIN, with visual progress feedback for downloads.

All batching behavior is non-breaking and maintains backward compatibility while offering more predictable resource usage on large datasets.
2026-03-14 11:59:15 +01:00
Eric Coissac a60184c115 chore: bump version to 4.4.27 and add zlib-static dependency
Update version to 4.4.27 in version.txt and pkg/obioptions/version.go.

Add zlib-static package to release workflow to ensure static linking of zlib, resolving potential runtime dependency issues with the external link mode.
2026-03-14 11:59:04 +01:00
73 changed files with 3136 additions and 375 deletions
+2 -2
View File
@@ -10,10 +10,10 @@ jobs:
runs-on: ubuntu-latest runs-on: ubuntu-latest
steps: steps:
- name: Setup Go - name: Setup Go
uses: actions/setup-go@v2 uses: actions/setup-go@v5
with: with:
go-version: '1.23' go-version: '1.23'
- name: Checkout obitools4 project - name: Checkout obitools4 project
uses: actions/checkout@v4 uses: actions/checkout@v5
- name: Run tests - name: Run tests
run: make githubtests run: make githubtests
+4 -4
View File
@@ -18,7 +18,7 @@ jobs:
with: with:
go-version: "1.26" go-version: "1.26"
- name: Checkout obitools4 project - name: Checkout obitools4 project
uses: actions/checkout@v4 uses: actions/checkout@v5
- name: Run tests - name: Run tests
run: make githubtests run: make githubtests
@@ -49,7 +49,7 @@ jobs:
steps: steps:
- name: Checkout code - name: Checkout code
uses: actions/checkout@v4 uses: actions/checkout@v5
- name: Setup Go - name: Setup Go
uses: actions/setup-go@v5 uses: actions/setup-go@v5
@@ -79,7 +79,7 @@ jobs:
-w /src \ -w /src \
-e VERSION="${VERSION}" \ -e VERSION="${VERSION}" \
golang:1.26-alpine \ golang:1.26-alpine \
sh -c "apk add --no-cache gcc musl-dev zlib-dev make && \ sh -c "apk add --no-cache gcc musl-dev zlib-dev zlib-static make && \
make LDFLAGS='-linkmode=external -extldflags=-static' obitools" make LDFLAGS='-linkmode=external -extldflags=-static' obitools"
mkdir -p artifacts mkdir -p artifacts
tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build . tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
@@ -107,7 +107,7 @@ jobs:
runs-on: ubuntu-latest runs-on: ubuntu-latest
steps: steps:
- name: Checkout code - name: Checkout code
uses: actions/checkout@v4 uses: actions/checkout@v5
with: with:
fetch-depth: 0 fetch-depth: 0
+3 -1
View File
@@ -21,9 +21,11 @@ xx
.rhistory .rhistory
/.vscode /.vscode
/benchmarck
/build /build
/bugs /bugs
autodoc
/ncbitaxo /ncbitaxo
!/obitests/** !/obitests/**
+2
View File
@@ -0,0 +1,2 @@
/cache
/project.local.yml
+133
View File
@@ -0,0 +1,133 @@
# the name by which the project can be referenced within Serena
project_name: "obitools4"
# list of languages for which language servers are started; choose from:
# al angular ansible bash clojure
# cpp cpp_ccls crystal csharp csharp_omnisharp
# dart elixir elm erlang fortran
# fsharp go groovy haskell haxe
# hlsl html java json julia
# kotlin lean4 lua luau markdown
# matlab msl nix ocaml pascal
# perl php php_phpactor powershell python
# python_jedi python_ty r rego ruby
# ruby_solargraph rust scala scss solidity
# svelte swift systemverilog terraform toml
# typescript typescript_vts vue yaml zig
# (This list may be outdated. For the current list, see values of Language enum here:
# https://github.com/oraios/serena/blob/main/src/solidlsp/ls_config.py
# For some languages, there are alternative language servers, e.g. csharp_omnisharp, ruby_solargraph.)
# Note:
# - For C, use cpp
# - For JavaScript, use typescript
# - For Angular projects, use angular (subsumes typescript+html; requires `npm install` in the project root)
# - For Svelte projects, use svelte (subsumes typescript/javascript for .svelte projects; requires npm)
# - For SCSS / Sass / plain CSS, use scss (some-sass-language-server handles all three)
# - For Free Pascal/Lazarus, use pascal
# Special requirements:
# Some languages require additional setup/installations.
# See here for details: https://oraios.github.io/serena/01-about/020_programming-languages.html#language-servers
# When using multiple languages, the first language server that supports a given file will be used for that file.
# The first language is the default language and the respective language server will be used as a fallback.
# Note that when using the JetBrains backend, language servers are not used and this list is correspondingly ignored.
languages:
- go
# the encoding used by text files in the project
# For a list of possible encodings, see https://docs.python.org/3.11/library/codecs.html#standard-encodings
encoding: "utf-8"
# line ending convention to use when writing source files.
# Possible values: unset (use global setting), "lf", "crlf", or "native" (platform default)
# This does not affect Serena's own files (e.g. memories and configuration files), which always use native line endings.
line_ending:
# The language backend to use for this project.
# If not set, the global setting from serena_config.yml is used.
# Valid values: LSP, JetBrains
# Note: the backend is fixed at startup. If a project with a different backend
# is activated post-init, an error will be returned.
language_backend:
# whether to use project's .gitignore files to ignore files
ignore_all_files_in_gitignore: true
# advanced configuration option allowing to configure language server-specific options.
# Maps the language key to the options.
# Have a look at the docstring of the constructors of the LS implementations within solidlsp (e.g., for C# or PHP) to see which options are available.
# No documentation on options means no options are available.
ls_specific_settings: {}
# list of additional workspace folder paths for cross-package reference support (e.g. in monorepos).
# Paths can be absolute or relative to the project root.
# Each folder is registered as an LSP workspace folder, enabling language servers to discover
# symbols and references across package boundaries.
# Currently supported for: TypeScript.
# Example:
# additional_workspace_folders:
# - ../sibling-package
# - ../shared-lib
additional_workspace_folders: []
# list of additional paths to ignore in this project.
# Same syntax as gitignore, so you can use * and **.
# Note: global ignored_paths from serena_config.yml are also applied additively.
ignored_paths: []
# whether the project is in read-only mode
# If set to true, all editing tools will be disabled and attempts to use them will result in an error
# Added on 2025-04-18
read_only: false
# list of tool names to exclude.
# This extends the existing exclusions (e.g. from the global configuration)
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
excluded_tools: []
# list of tools to include that would otherwise be disabled (particularly optional tools that are disabled by default).
# This extends the existing inclusions (e.g. from the global configuration).
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
included_optional_tools: []
# fixed set of tools to use as the base tool set (if non-empty), replacing Serena's default set of tools.
# This cannot be combined with non-empty excluded_tools or included_optional_tools.
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
fixed_tools: []
# list of mode names that are to be activated by default, overriding the setting in the global configuration.
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# If the setting is undefined/empty, the default_modes from the global configuration (serena_config.yml) apply.
# Otherwise, this overrides the setting from the global configuration (serena_config.yml).
# Therefore, you can set this to [] if you do not want the default modes defined in the global config to apply
# for this project.
# This setting can, in turn, be overridden by CLI parameters (--mode).
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
default_modes:
# list of mode names to be activated additionally for this project, e.g. ["query-projects"]
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
added_modes:
# initial prompt for the project. It will always be given to the LLM upon activating the project
# (contrary to the memories, which are loaded on demand).
initial_prompt: ""
# time budget (seconds) per tool call for the retrieval of additional symbol information
# such as docstrings or parameter information.
# This overrides the corresponding setting in the global configuration; see the documentation there.
# If null or missing, use the setting from the global configuration.
symbol_info_budget:
# list of regex patterns which, when matched, mark a memory entry as read‑only.
# Extends the list from the global configuration, merging the two lists.
read_only_memory_patterns: []
# list of regex patterns for memories to completely ignore.
# Matching memories will not appear in list_memories or activate_project output
# and cannot be accessed via read_memory or write_memory.
# To access ignored memory files, use the read_file tool on the raw file path.
# Extends the list from the global configuration, merging the two lists.
# Example: ["_archive/.*", "_episodes/.*"]
ignored_memory_patterns: []
+4 -4
View File
@@ -156,8 +156,8 @@ bump-version:
jjnew: jjnew:
@echo "$(YELLOW)→ Creating a new commit...$(NC)" @echo "$(YELLOW)→ Creating a new commit...$(NC)"
@echo "$(BLUE)→ Documenting current commit...$(NC)" @echo "$(BLUE)→ Documenting undocumented commits...$(NC)"
@jj auto-describe @jj auto-doc
@echo "$(BLUE)→ Done.$(NC)" @echo "$(BLUE)→ Done.$(NC)"
@jj new @jj new
@echo "$(GREEN)✓ New commit created$(NC)" @echo "$(GREEN)✓ New commit created$(NC)"
@@ -171,8 +171,8 @@ jjpush:
@echo "$(GREEN)✓ Release complete$(NC)" @echo "$(GREEN)✓ Release complete$(NC)"
jjpush-describe: jjpush-describe:
@echo "$(BLUE)→ Documenting current commit...$(NC)" @echo "$(BLUE)→ Documenting undocumented commits...$(NC)"
@jj auto-describe @jj auto-doc
jjpush-bump: jjpush-bump:
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)" @echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
+5
View File
@@ -37,6 +37,11 @@ func main() {
optionParser(os.Args) optionParser(os.Args)
if !obipairing.CLIHasPairedFiles() {
log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
os.Exit(1)
}
obidefault.SetStrictReadWorker(2) obidefault.SetStrictReadWorker(2)
obidefault.SetStrictWriteWorker(2) obidefault.SetStrictWriteWorker(2)
pairs, err := obipairing.CLIPairedSequence() pairs, err := obipairing.CLIPairedSequence()
+13
View File
@@ -1,6 +1,7 @@
package main package main
import ( import (
"fmt"
"os" "os"
log "github.com/sirupsen/logrus" log "github.com/sirupsen/logrus"
@@ -8,6 +9,7 @@ import (
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obimultiplex"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipairing" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipairing"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitagpcr" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitagpcr"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
@@ -39,6 +41,17 @@ func main() {
obitagpcr.OptionSet) obitagpcr.OptionSet)
optionParser(os.Args) optionParser(os.Args)
if obimultiplex.CLIAskConfigTemplate() {
fmt.Print(obimultiplex.CLIConfigTemplate())
os.Exit(0)
}
if !obipairing.CLIHasPairedFiles() {
log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
os.Exit(1)
}
pairs, err := obipairing.CLIPairedSequence() pairs, err := obipairing.CLIPairedSequence()
if err != nil { if err != nil {
+10
View File
@@ -0,0 +1,10 @@
{
"people": [
"Software",
"Agreement",
"Module"
],
"projects": [
"Code"
]
}
+1 -1
View File
@@ -6,7 +6,7 @@ require (
github.com/DavidGamba/go-getoptions v0.33.0 github.com/DavidGamba/go-getoptions v0.33.0
github.com/PaesslerAG/gval v1.2.4 github.com/PaesslerAG/gval v1.2.4
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df
github.com/buger/jsonparser v1.1.1 github.com/buger/jsonparser v1.1.2
github.com/chen3feng/stl4go v0.1.1 github.com/chen3feng/stl4go v0.1.1
github.com/dlclark/regexp2 v1.11.5 github.com/dlclark/regexp2 v1.11.5
github.com/goccy/go-json v0.10.6 github.com/goccy/go-json v0.10.6
+2 -2
View File
@@ -6,8 +6,8 @@ github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi
github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8= github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0= github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM= github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs= github.com/buger/jsonparser v1.1.2 h1:frqHqw7otoVbk5M8LlE/L7HTnIq2v9RX6EJ48i9AxJk=
github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0= github.com/buger/jsonparser v1.1.2/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q= github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
github.com/chen3feng/stl4go v0.1.1/go.mod h1:5ml3psLgETJjRJnMbPE+JiHLrCpt+Ajc2weeTECXzWU= github.com/chen3feng/stl4go v0.1.1/go.mod h1:5ml3psLgETJjRJnMbPE+JiHLrCpt+Ajc2weeTECXzWU=
github.com/chengxilo/virtualterm v1.0.4 h1:Z6IpERbRVlfB8WkOmtbHiDbBANU7cimRIof7mk9/PwM= github.com/chengxilo/virtualterm v1.0.4 h1:Z6IpERbRVlfB8WkOmtbHiDbBANU7cimRIof7mk9/PwM=
BIN
View File
Binary file not shown.
BIN
View File
Binary file not shown.
@@ -0,0 +1,24 @@
>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
gattaaacctcaaaggacttggcagtgctttatacccct
>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
+48
View File
@@ -0,0 +1,48 @@
taxid,parent,taxonomic_rank,scientific_name
taxon:1 [root]@no rank,taxon:1 [root]@no rank,no rank,root
taxon:131567 [cellular organisms]@cellular root,taxon:1 [root]@no rank,cellular root,cellular organisms
taxon:2759 [Eukaryota]@domain,taxon:131567 [cellular organisms]@cellular root,domain,Eukaryota
taxon:33154 [Opisthokonta]@clade,taxon:2759 [Eukaryota]@domain,clade,Opisthokonta
taxon:33208 [Metazoa]@kingdom,taxon:33154 [Opisthokonta]@clade,kingdom,Metazoa
taxon:6072 [Eumetazoa]@clade,taxon:33208 [Metazoa]@kingdom,clade,Eumetazoa
taxon:33213 [Bilateria]@clade,taxon:6072 [Eumetazoa]@clade,clade,Bilateria
taxon:33511 [Deuterostomia]@clade,taxon:33213 [Bilateria]@clade,clade,Deuterostomia
taxon:7711 [Chordata]@phylum,taxon:33511 [Deuterostomia]@clade,phylum,Chordata
taxon:89593 [Craniata]@subphylum,taxon:7711 [Chordata]@phylum,subphylum,Craniata
taxon:7742 [Vertebrata]@clade,taxon:89593 [Craniata]@subphylum,clade,Vertebrata
taxon:7776 [Gnathostomata]@clade,taxon:7742 [Vertebrata]@clade,clade,Gnathostomata
taxon:117570 [Teleostomi]@clade,taxon:7776 [Gnathostomata]@clade,clade,Teleostomi
taxon:117571 [Euteleostomi]@clade,taxon:117570 [Teleostomi]@clade,clade,Euteleostomi
taxon:8287 [Sarcopterygii]@superclass,taxon:117571 [Euteleostomi]@clade,superclass,Sarcopterygii
taxon:1338369 [Dipnotetrapodomorpha]@clade,taxon:8287 [Sarcopterygii]@superclass,clade,Dipnotetrapodomorpha
taxon:32523 [Tetrapoda]@clade,taxon:1338369 [Dipnotetrapodomorpha]@clade,clade,Tetrapoda
taxon:32524 [Amniota]@clade,taxon:32523 [Tetrapoda]@clade,clade,Amniota
taxon:40674 [Mammalia]@class,taxon:32524 [Amniota]@clade,class,Mammalia
taxon:32525 [Theria]@clade,taxon:40674 [Mammalia]@class,clade,Theria
taxon:9347 [Eutheria]@clade,taxon:32525 [Theria]@clade,clade,Eutheria
taxon:1437010 [Boreoeutheria]@clade,taxon:9347 [Eutheria]@clade,clade,Boreoeutheria
taxon:314146 [Euarchontoglires]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Euarchontoglires
taxon:314145 [Laurasiatheria]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Laurasiatheria
taxon:33554 [Carnivora]@order,taxon:314145 [Laurasiatheria]@superorder,order,Carnivora
taxon:91561 [Artiodactyla]@order,taxon:314145 [Laurasiatheria]@superorder,order,Artiodactyla
taxon:314147 [Glires]@clade,taxon:314146 [Euarchontoglires]@superorder,clade,Glires
taxon:9845 [Ruminantia]@suborder,taxon:91561 [Artiodactyla]@order,suborder,Ruminantia
taxon:35500 [Pecora]@infraorder,taxon:9845 [Ruminantia]@suborder,infraorder,Pecora
taxon:9989 [Rodentia]@order,taxon:314147 [Glires]@clade,order,Rodentia
taxon:379584 [Caniformia]@suborder,taxon:33554 [Carnivora]@order,suborder,Caniformia
taxon:9608 [Canidae]@family,taxon:379584 [Caniformia]@suborder,family,Canidae
taxon:9850 [Cervidae]@family,taxon:35500 [Pecora]@infraorder,family,Cervidae
taxon:9881 [Odocoileinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Odocoileinae
taxon:33553 [Sciuromorpha]@suborder,taxon:9989 [Rodentia]@order,suborder,Sciuromorpha
taxon:55153 [Sciuridae]@family,taxon:33553 [Sciuromorpha]@suborder,family,Sciuridae
taxon:34878 [Cervinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Cervinae
taxon:9611 [Canis]@genus,taxon:9608 [Canidae]@family,genus,Canis
taxon:9857 [Capreolus]@genus,taxon:9881 [Odocoileinae]@subfamily,genus,Capreolus
taxon:9612 [Canis lupus]@species,taxon:9611 [Canis]@genus,species,Canis lupus
taxon:337726 [Xerinae]@subfamily,taxon:55153 [Sciuridae]@family,subfamily,Xerinae
taxon:9859 [Cervus]@genus,taxon:34878 [Cervinae]@subfamily,genus,Cervus
taxon:337730 [Marmotini]@tribe,taxon:337726 [Xerinae]@subfamily,tribe,Marmotini
taxon:9992 [Marmota]@genus,taxon:337730 [Marmotini]@tribe,genus,Marmota
taxon:9860 [Cervus elaphus]@species,taxon:9859 [Cervus]@genus,species,Cervus elaphus
taxon:9615 [Canis lupus familiaris]@subspecies,taxon:9612 [Canis lupus]@species,subspecies,Canis lupus familiaris
taxon:9858 [Capreolus capreolus]@species,taxon:9857 [Capreolus]@genus,species,Capreolus capreolus
1 taxid parent taxonomic_rank scientific_name
2 taxon:1 [root]@no rank taxon:1 [root]@no rank no rank root
3 taxon:131567 [cellular organisms]@cellular root taxon:1 [root]@no rank cellular root cellular organisms
4 taxon:2759 [Eukaryota]@domain taxon:131567 [cellular organisms]@cellular root domain Eukaryota
5 taxon:33154 [Opisthokonta]@clade taxon:2759 [Eukaryota]@domain clade Opisthokonta
6 taxon:33208 [Metazoa]@kingdom taxon:33154 [Opisthokonta]@clade kingdom Metazoa
7 taxon:6072 [Eumetazoa]@clade taxon:33208 [Metazoa]@kingdom clade Eumetazoa
8 taxon:33213 [Bilateria]@clade taxon:6072 [Eumetazoa]@clade clade Bilateria
9 taxon:33511 [Deuterostomia]@clade taxon:33213 [Bilateria]@clade clade Deuterostomia
10 taxon:7711 [Chordata]@phylum taxon:33511 [Deuterostomia]@clade phylum Chordata
11 taxon:89593 [Craniata]@subphylum taxon:7711 [Chordata]@phylum subphylum Craniata
12 taxon:7742 [Vertebrata]@clade taxon:89593 [Craniata]@subphylum clade Vertebrata
13 taxon:7776 [Gnathostomata]@clade taxon:7742 [Vertebrata]@clade clade Gnathostomata
14 taxon:117570 [Teleostomi]@clade taxon:7776 [Gnathostomata]@clade clade Teleostomi
15 taxon:117571 [Euteleostomi]@clade taxon:117570 [Teleostomi]@clade clade Euteleostomi
16 taxon:8287 [Sarcopterygii]@superclass taxon:117571 [Euteleostomi]@clade superclass Sarcopterygii
17 taxon:1338369 [Dipnotetrapodomorpha]@clade taxon:8287 [Sarcopterygii]@superclass clade Dipnotetrapodomorpha
18 taxon:32523 [Tetrapoda]@clade taxon:1338369 [Dipnotetrapodomorpha]@clade clade Tetrapoda
19 taxon:32524 [Amniota]@clade taxon:32523 [Tetrapoda]@clade clade Amniota
20 taxon:40674 [Mammalia]@class taxon:32524 [Amniota]@clade class Mammalia
21 taxon:32525 [Theria]@clade taxon:40674 [Mammalia]@class clade Theria
22 taxon:9347 [Eutheria]@clade taxon:32525 [Theria]@clade clade Eutheria
23 taxon:1437010 [Boreoeutheria]@clade taxon:9347 [Eutheria]@clade clade Boreoeutheria
24 taxon:314146 [Euarchontoglires]@superorder taxon:1437010 [Boreoeutheria]@clade superorder Euarchontoglires
25 taxon:314145 [Laurasiatheria]@superorder taxon:1437010 [Boreoeutheria]@clade superorder Laurasiatheria
26 taxon:33554 [Carnivora]@order taxon:314145 [Laurasiatheria]@superorder order Carnivora
27 taxon:91561 [Artiodactyla]@order taxon:314145 [Laurasiatheria]@superorder order Artiodactyla
28 taxon:314147 [Glires]@clade taxon:314146 [Euarchontoglires]@superorder clade Glires
29 taxon:9845 [Ruminantia]@suborder taxon:91561 [Artiodactyla]@order suborder Ruminantia
30 taxon:35500 [Pecora]@infraorder taxon:9845 [Ruminantia]@suborder infraorder Pecora
31 taxon:9989 [Rodentia]@order taxon:314147 [Glires]@clade order Rodentia
32 taxon:379584 [Caniformia]@suborder taxon:33554 [Carnivora]@order suborder Caniformia
33 taxon:9608 [Canidae]@family taxon:379584 [Caniformia]@suborder family Canidae
34 taxon:9850 [Cervidae]@family taxon:35500 [Pecora]@infraorder family Cervidae
35 taxon:9881 [Odocoileinae]@subfamily taxon:9850 [Cervidae]@family subfamily Odocoileinae
36 taxon:33553 [Sciuromorpha]@suborder taxon:9989 [Rodentia]@order suborder Sciuromorpha
37 taxon:55153 [Sciuridae]@family taxon:33553 [Sciuromorpha]@suborder family Sciuridae
38 taxon:34878 [Cervinae]@subfamily taxon:9850 [Cervidae]@family subfamily Cervinae
39 taxon:9611 [Canis]@genus taxon:9608 [Canidae]@family genus Canis
40 taxon:9857 [Capreolus]@genus taxon:9881 [Odocoileinae]@subfamily genus Capreolus
41 taxon:9612 [Canis lupus]@species taxon:9611 [Canis]@genus species Canis lupus
42 taxon:337726 [Xerinae]@subfamily taxon:55153 [Sciuridae]@family subfamily Xerinae
43 taxon:9859 [Cervus]@genus taxon:34878 [Cervinae]@subfamily genus Cervus
44 taxon:337730 [Marmotini]@tribe taxon:337726 [Xerinae]@subfamily tribe Marmotini
45 taxon:9992 [Marmota]@genus taxon:337730 [Marmotini]@tribe genus Marmota
46 taxon:9860 [Cervus elaphus]@species taxon:9859 [Cervus]@genus species Cervus elaphus
47 taxon:9615 [Canis lupus familiaris]@subspecies taxon:9612 [Canis lupus]@species subspecies Canis lupus familiaris
48 taxon:9858 [Capreolus capreolus]@species taxon:9857 [Capreolus]@genus species Capreolus capreolus
+139 -15
View File
@@ -44,7 +44,7 @@ cleanup() {
rm -rf "$TMPDIR" # Suppress the temporary directory rm -rf "$TMPDIR" # Suppress the temporary directory
if [ $failed -gt 0 ]; then if [ $failed -gt 0 ]; then
log "$TEST_NAME tests failed" log "$TEST_NAME tests failed"
log log
log log
exit 1 exit 1
@@ -60,10 +60,10 @@ log() {
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2 echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
} }
log "Testing $TEST_NAME..." log "Testing $TEST_NAME..."
log "Test directory is $TEST_DIR" log "Test directory is $TEST_DIR"
log "obitools directory is $OBITOOLS_DIR" log "obitools directory is $OBITOOLS_DIR"
log "Temporary directory is $TMPDIR" log "Temporary directory is $TMPDIR"
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)" log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
###################################################################### ######################################################################
@@ -94,12 +94,12 @@ log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
((ntest++)) ((ntest++))
if $CMD -h > "${TMPDIR}/help.txt" 2>&1 if $CMD -h > "${TMPDIR}/help.txt" 2>&1
then then
log "$MCMD: printing help OK" log "$MCMD: printing help OK"
((success++)) ((success++))
else else
log "$MCMD: printing help failed" log "$MCMD: printing help failed"
((failed++)) ((failed++))
fi fi
@@ -108,15 +108,15 @@ fi
if obiconvert -Z "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \ if obiconvert -Z "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
> "${TMPDIR}/xxx.fasta.gz" && \ > "${TMPDIR}/xxx.fasta.gz" && \
zdiff "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \ zdiff "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
"${TMPDIR}/xxx.fasta.gz" "${TMPDIR}/xxx.fasta.gz"
then then
log "$MCMD: converting large fasta file to fasta OK" log "$MCMD: converting large fasta file to fasta OK"
((success++)) ((success++))
else else
log "$MCMD: converting large fasta file to fasta failed" log "$MCMD: converting large fasta file to fasta failed"
((failed++)) ((failed++))
fi fi
((ntest++)) ((ntest++))
if obiconvert -Z --fastq-output \ if obiconvert -Z --fastq-output \
"${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \ "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
@@ -125,15 +125,139 @@ if obiconvert -Z --fastq-output \
"${TMPDIR}/xxx.fastq.gz" \ "${TMPDIR}/xxx.fastq.gz" \
> "${TMPDIR}/yyy.fasta.gz" && \ > "${TMPDIR}/yyy.fasta.gz" && \
zdiff "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \ zdiff "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
"${TMPDIR}/yyy.fasta.gz" "${TMPDIR}/yyy.fasta.gz"
then then
log "$MCMD: converting large file between fasta and fastq OK" log "$MCMD: converting large file between fasta and fastq OK"
((success++)) ((success++))
else else
log "$MCMD: converting large file between fasta and fastq failed" log "$MCMD: converting large file between fasta and fastq failed"
((failed++)) ((failed++))
fi fi
# ------------------------------------------------------------------
# --raw-taxid tests (no taxonomy loaded)
# ------------------------------------------------------------------
# Running test
((ntest++))
if obiconvert --raw-taxid "${TEST_DIR}/out_ecotag.fasta" \
> "${TMPDIR}/raw_taxid.fasta" 2>/dev/null
then
log "$MCMD --raw-taxid: running OK"
((success++))
else
log "$MCMD --raw-taxid: running failed"
((failed++))
fi
# Taxids must be bare numbers — no full-format "taxon:ID [Name]@rank" strings
((ntest++))
if grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
then
log "$MCMD --raw-taxid: taxid format check failed (full-format taxid found)"
((failed++))
else
log "$MCMD --raw-taxid: taxid format OK (all taxids are bare numbers)"
((success++))
fi
# --raw-taxid is idempotent: piping through a second obiconvert --raw-taxid must
# produce bit-for-bit identical output.
((ntest++))
if obiconvert --raw-taxid "${TMPDIR}/raw_taxid.fasta" \
> "${TMPDIR}/raw_taxid2.fasta" 2>/dev/null
then
log "$MCMD --raw-taxid piped: running OK"
((success++))
else
log "$MCMD --raw-taxid piped: running failed"
((failed++))
fi
((ntest++))
if diff "${TMPDIR}/raw_taxid.fasta" \
"${TMPDIR}/raw_taxid2.fasta" > /dev/null
then
log "$MCMD --raw-taxid piped: idempotency OK"
((success++))
else
log "$MCMD --raw-taxid piped: idempotency failed (outputs differ)"
((failed++))
fi
# ------------------------------------------------------------------
# --taxonomy tests (full-format taxid, no --raw-taxid)
# ------------------------------------------------------------------
# Running test
((ntest++))
if obiconvert --taxonomy "${TEST_DIR}/taxonomy.csv" \
"${TEST_DIR}/out_ecotag.fasta" \
> "${TMPDIR}/taxo.fasta" 2>/dev/null
then
log "$MCMD --taxonomy: running OK"
((success++))
else
log "$MCMD --taxonomy: running failed"
((failed++))
fi
# Taxids must be in full "taxon:ID [Name]@rank" format
((ntest++))
if grep '"taxid"' "${TMPDIR}/taxo.fasta" | grep -q '"taxid":"taxon:[0-9]'
then
log "$MCMD --taxonomy: taxid format OK (full-format taxids present)"
((success++))
else
log "$MCMD --taxonomy: taxid format check failed (no full-format taxid found)"
((failed++))
fi
# ------------------------------------------------------------------
# --raw-taxid --taxonomy tests
# ------------------------------------------------------------------
# Running test
((ntest++))
if obiconvert --raw-taxid --taxonomy "${TEST_DIR}/taxonomy.csv" \
"${TEST_DIR}/out_ecotag.fasta" \
> "${TMPDIR}/raw_taxid_taxo.fasta" 2>/dev/null
then
log "$MCMD --raw-taxid --taxonomy: running OK"
((success++))
else
log "$MCMD --raw-taxid --taxonomy: running failed"
((failed++))
fi
# Taxids must be bare numbers even when taxonomy is loaded
((ntest++))
if grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
then
log "$MCMD --raw-taxid --taxonomy: taxid format check failed (full-format taxid found)"
((failed++))
else
log "$MCMD --raw-taxid --taxonomy: taxid format OK (all taxids are bare numbers)"
((success++))
fi
# --raw-taxid with or without taxonomy must yield identical taxid values
((ntest++))
if diff <(grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
<(grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
> /dev/null
then
log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values match OK"
((success++))
else
log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values differ (unexpected)"
((failed++))
fi
######################################### #########################################
# #
# At the end of the tests # At the end of the tests
+24
View File
@@ -0,0 +1,24 @@
>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
gattaaacctcaaaggacttggcagtgctttatacccct
>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
+23 -2
View File
@@ -28,10 +28,18 @@ func buffIndex(i, j, width int) int {
// //
// The function returns the start and end positions of the best // The function returns the start and end positions of the best
// match, as well as the number of errors in the best match. // match, as well as the number of errors in the best match.
//
// When the sequence is too short relative to the pattern for the
// backtracking to reconstruct a valid alignment (e.g. the pattern
// is longer than the sequence, or the match sits too close to a
// sequence boundary), no reliable position can be computed. In that
// case the function returns the sentinel (-1, -1, -1) instead of a
// guessed, potentially wrong, position: callers must treat this as
// "no match" rather than use the returned coordinates.
func LocatePattern(id string, pattern, sequence []byte) (int, int, int) { func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
if len(pattern) >= len(sequence) { if len(sequence) == 0 {
log.Panicf("Sequence %s:Pattern %s must be shorter than sequence %s", id, pattern, sequence) log.Panicf("Sequence %s:Pattern %s must not be empty", id, pattern)
} }
// Pattern spreads over the columns // Pattern spreads over the columns
@@ -158,5 +166,18 @@ func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
// obilog.Warnf("from : %d to: %d error: %d match: %v", // obilog.Warnf("from : %d to: %d error: %d match: %v",
// i, end+1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)], // i, end+1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)],
// string(sequence[i:(end+1)])) // string(sequence[i:(end+1)]))
if i < 0 || end == -1 {
// i < 0: the backtracking ran off the start of the sequence
// without fully consuming the pattern.
// end == -1: the backtracking loop never ran at all (e.g. a
// single-base pattern, jmax == 0), so no alignment boundary
// was ever established.
// Either way, no valid alignment exists for this (pattern,
// sequence) pair: signal it explicitly instead of returning
// an out-of-bounds or uncomputed position.
return -1, -1, -1
}
return i, end + 1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)] return i, end + 1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)]
} }
+123
View File
@@ -0,0 +1,123 @@
package obialign
import (
"math/rand"
"testing"
)
func TestLocatePatternNormal(t *testing.T) {
// Pattern fully and exactly present in the middle of a longer sequence.
start, end, nerr := LocatePattern("id", []byte("ACGT"), []byte("TTTTACGTTTTT"))
if start != 4 || end != 8 || nerr != 0 {
t.Errorf("got start=%d end=%d nerr=%d, want start=4 end=8 nerr=0", start, end, nerr)
}
}
func TestLocatePatternOneMismatch(t *testing.T) {
start, end, nerr := LocatePattern("id", []byte("ACGT"), []byte("TTTTACTTTTTT"))
if nerr != 1 {
t.Errorf("got nerr=%d, want 1 (start=%d end=%d)", nerr, start, end)
}
}
// The real-world case that used to panic: pattern longer than the sequence
// fragment extracted for indel relocation.
func TestLocatePatternPatternLongerThanSequence(t *testing.T) {
start, end, nerr := LocatePattern("id",
[]byte("GGGCAATCCTGAGCCAAATC"),
[]byte("tcctgagccaaatcacgtt"))
if start != -1 || end != -1 || nerr != -1 {
t.Errorf("got start=%d end=%d nerr=%d, want the (-1,-1,-1) sentinel", start, end, nerr)
}
}
func TestLocatePatternSequenceLengthOne(t *testing.T) {
start, end, nerr := LocatePattern("id", []byte("AB"), []byte("A"))
if start < 0 || end < 0 || nerr < 0 {
t.Fatalf("got start=%d end=%d nerr=%d, expected a valid (non-sentinel) result", start, end, nerr)
}
if start != 0 || end != 1 || nerr != 1 {
t.Errorf("got start=%d end=%d nerr=%d, want start=0 end=1 nerr=1", start, end, nerr)
}
}
// A pattern much longer than the sequence can still yield a mathematically
// valid (in-bounds) alignment: the extra pattern length is absorbed as gaps,
// driving the error count high enough that the caller's maxerr threshold
// rejects it. The function itself must still return consistent bounds.
func TestLocatePatternPatternMuchLongerThanSequence(t *testing.T) {
start, end, nerr := LocatePattern("id", []byte("ACGTACGTACGTACGTACGT"), []byte("ACG"))
isSentinel := start == -1 && end == -1 && nerr == -1
isValid := start >= 0 && end > start && end <= 3 && nerr >= 0
if !isSentinel && !isValid {
t.Errorf("got start=%d end=%d nerr=%d, want either the sentinel or consistent in-bounds values", start, end, nerr)
}
}
func TestLocatePatternNeverReturnsOutOfBounds(t *testing.T) {
patterns := []string{"A", "AC", "ACG", "ACGT", "ACGTA", "ACGTAC", "ACGTACG", "ACGTACGT"}
sequences := []string{"A", "AC", "ACG", "ACGT", "ACGTA", "ACGTAC", "ACGTACG", "ACGTACGT"}
for _, p := range patterns {
for _, s := range sequences {
start, end, nerr := LocatePattern("id", []byte(p), []byte(s))
if start == -1 && end == -1 && nerr == -1 {
// Explicit "no reliable match" sentinel: always acceptable.
continue
}
if start < 0 || end < 0 || start >= end || end > len(s) || nerr < 0 {
t.Errorf("pattern=%q sequence=%q -> start=%d end=%d nerr=%d is out of bounds / inconsistent",
p, s, start, end, nerr)
}
}
}
}
// Randomized property test over a wide range of pattern/sequence length
// combinations, including pattern >= sequence, to make sure the function
// never panics and never returns anything but the sentinel or fully
// consistent, in-bounds coordinates.
func TestLocatePatternRandomizedNeverInvalid(t *testing.T) {
const bases = "ACGT"
rng := rand.New(rand.NewSource(42))
randSeq := func(n int) []byte {
b := make([]byte, n)
for i := range b {
b[i] = bases[rng.Intn(len(bases))]
}
return b
}
for trial := 0; trial < 5000; trial++ {
patLen := 1 + rng.Intn(15)
seqLen := 1 + rng.Intn(15)
pattern := randSeq(patLen)
sequence := randSeq(seqLen)
func() {
defer func() {
if r := recover(); r != nil {
t.Fatalf("panic for pattern=%q sequence=%q: %v", pattern, sequence, r)
}
}()
start, end, nerr := LocatePattern("id", pattern, sequence)
isSentinel := start == -1 && end == -1 && nerr == -1
isValid := start >= 0 && end > start && end <= len(sequence) && nerr >= 0
if !isSentinel && !isValid {
t.Errorf("pattern=%q sequence=%q -> start=%d end=%d nerr=%d is neither the sentinel nor consistent",
pattern, sequence, start, end, nerr)
}
}()
}
}
+31 -10
View File
@@ -373,6 +373,7 @@ func (pattern ApatPattern) BestMatch(sequence ApatSequence, begin, length int) (
cpattern := (*[1 << 30]byte)(unsafe.Pointer(pattern.pointer.pointer.cpat)) cpattern := (*[1 << 30]byte)(unsafe.Pointer(pattern.pointer.pointer.cpat))
frg := sequence.pointer.reference.Sequence()[start:end] frg := sequence.pointer.reference.Sequence()[start:end]
fragStart := start
log.Debugln( log.Debugln(
string(frg), string(frg),
@@ -384,11 +385,20 @@ func (pattern ApatPattern) BestMatch(sequence ApatSequence, begin, length int) (
(*cpattern)[0:int(pattern.pointer.pointer.patlen)], (*cpattern)[0:int(pattern.pointer.pointer.patlen)],
frg) frg)
// olderr := m[2] if from < 0 {
// obialign.LocatePattern could not reconstruct a reliable
// alignment (e.g. the fragment is too short relative to the
// pattern). Reporting a guessed position would risk placing
// the primer boundary incorrectly, so treat it as no match
// at all rather than falling back to an unrefined position.
matched = false
log.Debugln("No reliable indel relocation, discarding match", sequence.pointer.reference.Id())
return
}
nerr = score nerr = score
start = start + from start = fragStart + from
end = start + to end = fragStart + to
log.Debugf("BestMatch on %s : score=%d [%d..%d]", sequence.pointer.reference.Id(), score, start, nerr) log.Debugf("BestMatch on %s : score=%d [%d..%d]", sequence.pointer.reference.Id(), score, start, nerr)
return return
} }
@@ -467,6 +477,7 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
for _, m := range res { for _, m := range res {
// Recompute the start and end position of the match // Recompute the start and end position of the match
// when the pattern allows for indels // when the pattern allows for indels
valid := true
if m[2] > 0 && pattern.pointer.pointer.hasIndel { if m[2] > 0 && pattern.pointer.pointer.hasIndel {
// obilog.Warnf("Locating indel on sequence %s[%s]", sequence.pointer.reference.Id(), pattern.String()) // obilog.Warnf("Locating indel on sequence %s[%s]", sequence.pointer.reference.Id(), pattern.String())
start := m[0] - m[2]*2 start := m[0] - m[2]*2
@@ -485,16 +496,26 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
(*cpattern)[0:int(pattern.pointer.pointer.patlen)], (*cpattern)[0:int(pattern.pointer.pointer.patlen)],
frg) frg)
// olderr := m[2] if pb < 0 {
m[2] = score // obialign.LocatePattern could not reconstruct a
m[0] = start + pb // reliable alignment (e.g. the match sits too close
m[1] = start + pe // to a sequence end for the fragment to be usable).
// Reporting a guessed position risks placing the
// primer boundary incorrectly, so drop the match
// entirely instead of keeping an unrefined guess.
valid = false
} else {
// olderr := m[2]
m[2] = score
m[0] = start + pb
m[1] = start + pe
// obilog.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score, // obilog.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score,
// frg, (*cpattern)[0:int(pattern.pointer.pointer.patlen)], sequence.pointer.reference.Sequence()[m[0]:m[1]]) // frg, (*cpattern)[0:int(pattern.pointer.pointer.patlen)], sequence.pointer.reference.Sequence()[m[0]:m[1]])
}
} }
if int(pattern.pointer.pointer.maxerr) >= m[2] { if valid && int(pattern.pointer.pointer.maxerr) >= m[2] {
res[j] = m res[j] = m
j++ j++
} }
+20 -14
View File
@@ -131,7 +131,7 @@ func _storeSequenceQuality(bytes *bytes.Buffer, out *obiseq.BioSequence, quality
out.SetQualities(q) out.SetQualities(q)
} }
func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(string, io.Reader) (obiseq.BioSequenceSlice, error) { func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool, fileName string) func(string, io.Reader) (obiseq.BioSequenceSlice, error) {
parser := func(source string, input io.Reader) (obiseq.BioSequenceSlice, error) { parser := func(source string, input io.Reader) (obiseq.BioSequenceSlice, error) {
var identifier string var identifier string
@@ -160,12 +160,12 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
// Beginning of sequence // Beginning of sequence
state = 1 state = 1
} else { } else {
log.Fatalf("%s : sequence entry is not starting with @", source) log.Fatalf("file %s: sequence entry is not starting with @", fileName)
} }
case 1: // Beginning of identifier (Mandatory) case 1: // Beginning of identifier (Mandatory)
if is_sep { if is_sep {
// No identifier -> ERROR // No identifier -> ERROR
log.Fatalf("%s : sequence identifier is empty", source) log.Fatalf("file %s: sequence identifier is empty", fileName)
} else { } else {
// Beginning of identifier // Beginning of identifier
state = 2 state = 2
@@ -221,7 +221,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
// End of sequence // End of sequence
rawseq := seqBytes.Bytes() rawseq := seqBytes.Bytes()
if len(rawseq) == 0 { if len(rawseq) == 0 {
log.Fatalf("@%s[%s] : sequence is empty", identifier, source) log.Fatalf("file %s: record @%s has an empty sequence line", fileName, identifier)
} }
s := obiseq.NewBioSequence(identifier, rawseq, definition) s := obiseq.NewBioSequence(identifier, rawseq, definition)
s.SetSource(source) s.SetSource(source)
@@ -241,8 +241,8 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
context = append( context = append(
append([]byte{previous}, C), append([]byte{previous}, C),
context...) context...)
log.Fatalf("%s [%s]: sequence contains invalid character %c (%s)", log.Fatalf("file %s: record @%s contains invalid character %c (%s)",
source, identifier, C, string(context)) fileName, identifier, C, string(context))
} }
} }
case 7: case 7:
@@ -251,7 +251,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
} else if C == '+' { } else if C == '+' {
state = 8 state = 8
} else { } else {
log.Fatalf("@%s[%s] : sequence data not followed by a line starting with + but a %c", identifier, source, C) log.Fatalf("file %s: record @%s: sequence data not followed by a line starting with + but a %c", fileName, identifier, C)
} }
case 8: case 8:
// State consuming the + internal header line // State consuming the + internal header line
@@ -282,7 +282,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
} else if C == '@' { } else if C == '@' {
state = 1 state = 1
} else { } else {
log.Fatalf("%s[%s] : sequence record not followed by a line starting with @", identifier, source) log.Fatalf("file %s: record @%s not followed by a line starting with @", fileName, identifier)
} }
} }
@@ -304,7 +304,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
} }
// FastqChunkParserRope parses a FASTQ chunk directly from a rope without Pack(). // FastqChunkParserRope parses a FASTQ chunk directly from a rope without Pack().
func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte, with_quality, UtoT bool) (obiseq.BioSequenceSlice, error) { func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte, with_quality, UtoT bool, fileName string) (obiseq.BioSequenceSlice, error) {
scanner := newRopeScanner(rope) scanner := newRopeScanner(rope)
sequences := obiseq.MakeBioSequenceSlice(100)[:0] sequences := obiseq.MakeBioSequenceSlice(100)[:0]
@@ -334,7 +334,7 @@ func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte,
// Line 2: sequence // Line 2: sequence
sline := scanner.ReadLine() sline := scanner.ReadLine()
if sline == nil { if sline == nil {
log.Fatalf("@%s[%s]: unexpected EOF after header", id, source) log.Fatalf("file %s: record @%s is truncated (header line with no sequence line following) — the FASTQ file appears incomplete", fileName, id)
} }
seqDest := make([]byte, len(sline)) seqDest := make([]byte, len(sline))
w := 0 w := 0
@@ -350,7 +350,7 @@ func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte,
} }
seqDest = seqDest[:w] seqDest = seqDest[:w]
if len(seqDest) == 0 { if len(seqDest) == 0 {
log.Fatalf("@%s[%s]: sequence is empty", id, source) log.Fatalf("file %s: record @%s has an empty sequence line", fileName, id)
} }
// Line 3: + (skip) // Line 3: + (skip)
@@ -382,16 +382,17 @@ func _ParseFastqFile(
out obiiter.IBioSequence, out obiiter.IBioSequence,
quality_shift byte, quality_shift byte,
with_quality, UtoT bool, with_quality, UtoT bool,
fileName string,
) { ) {
parser := FastqChunkParser(quality_shift, with_quality, UtoT) parser := FastqChunkParser(quality_shift, with_quality, UtoT, fileName)
for chunks := range input { for chunks := range input {
var sequences obiseq.BioSequenceSlice var sequences obiseq.BioSequenceSlice
var err error var err error
if chunks.Rope != nil { if chunks.Rope != nil {
sequences, err = FastqChunkParserRope(chunks.Source, chunks.Rope, quality_shift, with_quality, UtoT) sequences, err = FastqChunkParserRope(chunks.Source, chunks.Rope, quality_shift, with_quality, UtoT, fileName)
} else { } else {
sequences, err = parser(chunks.Source, chunks.Raw) sequences, err = parser(chunks.Source, chunks.Raw)
} }
@@ -423,6 +424,8 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
false, false,
) )
fileName := opt.FileName()
for i := 0; i < nworker; i++ { for i := 0; i < nworker; i++ {
out.Add(1) out.Add(1)
go _ParseFastqFile( go _ParseFastqFile(
@@ -431,6 +434,7 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
obidefault.ReadQualitiesShift(), obidefault.ReadQualitiesShift(),
opt.ReadQualities(), opt.ReadQualities(),
opt.UtoT(), opt.UtoT(),
fileName,
) )
} }
@@ -456,7 +460,9 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
} }
func ReadFastqFromFile(filename string, options ...WithOption) (obiiter.IBioSequence, error) { func ReadFastqFromFile(filename string, options ...WithOption) (obiiter.IBioSequence, error) {
options = append(options, OptionsSource(obiutils.RemoveAllExt((path.Base(filename))))) options = append(options,
OptionsSource(obiutils.RemoveAllExt((path.Base(filename)))),
OptionsFileName(filename))
file, err := obiutils.Ropen(filename) file, err := obiutils.Ropen(filename)
+105 -96
View File
@@ -199,8 +199,111 @@ func _parse_json_array_interface(str []byte) ([]interface{}, error) {
return values, nil return values, nil
} }
func _parse_json_header_(header string, sequence *obiseq.BioSequence) string { // _parse_json_annotation_field parses a single key/value pair coming from a
// JSON object (either a FASTA/FASTQ inline JSON header, or the "annotations"
// field of a JSON sequence record) and applies it to the sequence, special
// casing the well-known OBITools attributes (id, definition, count, taxid,
// obiclean_*, merged_*).
func _parse_json_annotation_field(key []byte, value []byte, dataType jsonparser.ValueType, sequence *obiseq.BioSequence) error {
annotations := sequence.Annotations() annotations := sequence.Annotations()
var err error
skey := obiutils.UnsafeString(key)
switch {
case skey == "id":
sequence.SetId(string(value))
case skey == "definition":
sequence.SetDefinition(string(value))
case skey == "count":
if dataType != jsonparser.Number {
log.Fatalf("%s: Count attribut must be numeric: %s", sequence.Id(), string(value))
}
count, err := jsonparser.ParseInt(value)
if err != nil {
log.Fatalf("%s: Cannot parse count %s", sequence.Id(), string(value))
}
sequence.SetCount(int(count))
case skey == "obiclean_weight":
weight, err := _parse_json_map_int(value)
if err != nil {
log.Fatalf("%s: Cannot parse obiclean weight %s", sequence.Id(), string(value))
}
annotations[skey] = weight
case skey == "obiclean_status":
status, err := _parse_json_map_string(value)
if err != nil {
log.Fatalf("%s: Cannot parse obiclean status %s", sequence.Id(), string(value))
}
annotations[skey] = status
case strings.HasPrefix(skey, "merged_"):
if dataType == jsonparser.Object {
data, err := _parse_json_map_int(value)
if err != nil {
log.Fatalf("%s: Cannot parse merged slot %s: %v", sequence.Id(), skey, err)
} else {
annotations[skey] = obiseq.MapAsStatsOnValues(data)
}
} else {
log.Fatalf("%s: Cannot parse merged slot %s", sequence.Id(), skey)
}
case skey == "taxid":
if dataType == jsonparser.Number || dataType == jsonparser.String {
taxid := string(value)
sequence.SetTaxid(taxid)
} else {
log.Fatalf("%s: Cannot parse taxid %s", sequence.Id(), string(value))
}
case strings.HasSuffix(skey, "_taxid"):
if dataType == jsonparser.Number || dataType == jsonparser.String {
rank := skey[:len(skey)-len("_taxid")]
taxid := string(value)
sequence.SetTaxid(taxid, rank)
} else {
log.Fatalf("%s: Cannot parse taxid %s", sequence.Id(), string(value))
}
default:
skey = strings.Clone(skey)
switch dataType {
case jsonparser.String:
annotations[skey] = string(value)
case jsonparser.Number:
// Try to parse the number as an int at first then as float if that fails.
annotations[skey], err = jsonparser.ParseInt(value)
if err != nil {
annotations[skey], err = strconv.ParseFloat(obiutils.UnsafeString(value), 64)
}
case jsonparser.Array:
annotations[skey], err = _parse_json_array_interface(value)
case jsonparser.Object:
annotations[skey], err = _parse_json_map_interface(value)
case jsonparser.Boolean:
annotations[skey], err = jsonparser.ParseBoolean(value)
case jsonparser.Null:
annotations[skey] = nil
default:
log.Fatalf("Unknown data type %v", dataType)
}
}
if err != nil {
annotations[skey] = "NaN"
log.Fatalf("%s: Cannot parse value %s assicated to key %s into a %s value",
sequence.Id(), string(value), skey, dataType.String())
}
return err
}
func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
start := -1 start := -1
stop := -1 stop := -1
level := 0 level := 0
@@ -240,101 +343,7 @@ func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
jsonparser.ObjectEach(obiutils.UnsafeBytes(header[start:stop]), jsonparser.ObjectEach(obiutils.UnsafeBytes(header[start:stop]),
func(key []byte, value []byte, dataType jsonparser.ValueType, offset int) error { func(key []byte, value []byte, dataType jsonparser.ValueType, offset int) error {
var err error return _parse_json_annotation_field(key, value, dataType, sequence)
skey := obiutils.UnsafeString(key)
switch {
case skey == "id":
sequence.SetId(string(value))
case skey == "definition":
sequence.SetDefinition(string(value))
case skey == "count":
if dataType != jsonparser.Number {
log.Fatalf("%s: Count attribut must be numeric: %s", sequence.Id(), string(value))
}
count, err := jsonparser.ParseInt(value)
if err != nil {
log.Fatalf("%s: Cannot parse count %s", sequence.Id(), string(value))
}
sequence.SetCount(int(count))
case skey == "obiclean_weight":
weight, err := _parse_json_map_int(value)
if err != nil {
log.Fatalf("%s: Cannot parse obiclean weight %s", sequence.Id(), string(value))
}
annotations[skey] = weight
case skey == "obiclean_status":
status, err := _parse_json_map_string(value)
if err != nil {
log.Fatalf("%s: Cannot parse obiclean status %s", sequence.Id(), string(value))
}
annotations[skey] = status
case strings.HasPrefix(skey, "merged_"):
if dataType == jsonparser.Object {
data, err := _parse_json_map_int(value)
if err != nil {
log.Fatalf("%s: Cannot parse merged slot %s: %v", sequence.Id(), skey, err)
} else {
annotations[skey] = obiseq.MapAsStatsOnValues(data)
}
} else {
log.Fatalf("%s: Cannot parse merged slot %s", sequence.Id(), skey)
}
case skey == "taxid":
if dataType == jsonparser.Number || dataType == jsonparser.String {
taxid := string(value)
sequence.SetTaxid(taxid)
} else {
log.Fatalf("%s: Cannot parse taxid %s", sequence.Id(), string(value))
}
case strings.HasSuffix(skey, "_taxid"):
if dataType == jsonparser.Number || dataType == jsonparser.String {
rank := skey[:len(skey)-len("_taxid")]
taxid := string(value)
sequence.SetTaxid(taxid, rank)
} else {
log.Fatalf("%s: Cannot parse taxid %s", sequence.Id(), string(value))
}
default:
skey = strings.Clone(skey)
switch dataType {
case jsonparser.String:
annotations[skey] = string(value)
case jsonparser.Number:
// Try to parse the number as an int at first then as float if that fails.
annotations[skey], err = jsonparser.ParseInt(value)
if err != nil {
annotations[skey], err = strconv.ParseFloat(obiutils.UnsafeString(value), 64)
}
case jsonparser.Array:
annotations[skey], err = _parse_json_array_interface(value)
case jsonparser.Object:
annotations[skey], err = _parse_json_map_interface(value)
case jsonparser.Boolean:
annotations[skey], err = jsonparser.ParseBoolean(value)
case jsonparser.Null:
annotations[skey] = nil
default:
log.Fatalf("Unknown data type %v", dataType)
}
}
if err != nil {
annotations[skey] = "NaN"
log.Fatalf("%s: Cannot parse value %s assicated to key %s into a %s value",
sequence.Id(), string(value), skey, dataType.String())
}
return err
}, },
) )
+106 -29
View File
@@ -17,7 +17,7 @@ import (
) )
var __obi_header_value_string_pattern__ = regexp.MustCompile(`^'\s*([^']*'|"[^"]*")\s*;`) var __obi_header_value_string_pattern__ = regexp.MustCompile(`^'\s*([^']*'|"[^"]*")\s*;`)
var __obi_header_value_numeric_pattern__ = regexp.MustCompile(`^\s*([+-]?\.\d+|[+-]?\d+(\.\d*)?([eE][+-]?\d+)?)\s*;`) var __obi_header_value_numeric_pattern__ = regexp.MustCompile(`^\s*[+-]?(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?\s*;`)
var __obi_header_map_int_key__ = regexp.MustCompile("([{,])([0-9]+):") var __obi_header_map_int_key__ = regexp.MustCompile("([{,])([0-9]+):")
func __match__dict__(text []byte) []int { func __match__dict__(text []byte) []int {
@@ -146,6 +146,65 @@ func __match__key__(text []byte) []int {
return []int{} // Not a key return []int{} // Not a key
} }
func __match__array__(text []byte) []int {
state := 0
level := 0
start := 0
instring := byte(0)
for i, r := range text {
if state == 2 {
if r == ';' {
return []int{start, i + 1}
}
if r != ' ' && r != '\t' {
return []int{}
}
}
if state == 0 {
if r == '[' {
level++
state++
start = i
continue
}
if r != ' ' && r != '\t' {
return []int{}
}
continue
}
// state == 1: inside the array
if instring != 0 {
if r == instring {
instring = 0
}
continue
}
if r == '"' || r == '\'' {
instring = r
continue
}
if r == '[' || r == '{' {
level++
continue
}
if r == ']' || r == '}' {
level--
if level == 0 {
state++
}
}
}
return []int{}
}
func __match__general__(text []byte) []int { func __match__general__(text []byte) []int {
for i, r := range text { for i, r := range text {
@@ -242,28 +301,44 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
stop = m[1] + 1 stop = m[1] + 1
} else { } else {
// Generic value // array value
m = __match__array__(part)
// m = __obi_header_value_general_pattern__.FindIndex(part)
m = __match__general__(part)
if len(m) > 0 { if len(m) > 0 {
bvalue = bytes.TrimSpace(part[m[0]:(m[1] - 1)]) bvalue = bytes.TrimSpace(part[m[0]:(m[1] - 1)])
j := bytes.ReplaceAll(bvalue, []byte("'"), []byte(`"`))
if __is_false__(bvalue) { j = __obi_header_map_int_key__.ReplaceAll(j, []byte(`$1"$2":`))
value = false arr, err := _parse_json_array_interface(j)
if err != nil {
value = string(bvalue)
} else { } else {
if __is_true__(bvalue) { value = arr
value = true
} else {
value = string(bvalue)
}
} }
stop = m[1] + 1 stop = m[1] + 1
} else { } else {
// no value
break // Generic value
} // End of No value
// m = __obi_header_value_general_pattern__.FindIndex(part)
m = __match__general__(part)
if len(m) > 0 {
bvalue = bytes.TrimSpace(part[m[0]:(m[1] - 1)])
if __is_false__(bvalue) {
value = false
} else {
if __is_true__(bvalue) {
value = true
} else {
value = string(bvalue)
}
}
stop = m[1] + 1
} else {
// no value
break
} // End of No value
} // End of not array
} // End of not dict } // End of not dict
} // End of not string } // End of not string
} // End of not numeric } // End of not numeric
@@ -272,6 +347,8 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
case float64: case float64:
if vt == math.Floor(vt) { if vt == math.Floor(vt) {
annotations[key] = int(vt) annotations[key] = int(vt)
} else {
annotations[key] = vt
} }
default: default:
annotations[key] = value annotations[key] = value
@@ -327,19 +404,19 @@ func WriteFastSeqOBIHeade(buffer *bytes.Buffer, sequence *obiseq.BioSequence) {
buffer.WriteString(fmt.Sprintf("%s=", key)) buffer.WriteString(fmt.Sprintf("%s=", key))
buffer.Write(tv) buffer.Write(tv)
buffer.WriteString("; ") buffer.WriteString("; ")
case map[string]int,
map[string]string,
map[string]interface{}:
tv, err := obiutils.JsonMarshal(t)
if err != nil {
log.Fatalf("Cannot convert %v value", value)
}
tv = bytes.ReplaceAll(tv, []byte(`"`), []byte("'"))
buffer.WriteString(fmt.Sprintf("%s=", key))
buffer.Write(tv)
buffer.WriteString("; ")
default: default:
buffer.WriteString(fmt.Sprintf("%s=%v; ", key, value)) if obiutils.IsAMap(value) || obiutils.IsASlice(value) || obiutils.IsAnArray(value) {
tv, err := obiutils.JsonMarshal(t)
if err != nil {
log.Fatalf("Cannot convert %v value", value)
}
tv = bytes.ReplaceAll(tv, []byte(`"`), []byte("'"))
buffer.WriteString(fmt.Sprintf("%s=", key))
buffer.Write(tv)
buffer.WriteString("; ")
} else {
buffer.WriteString(fmt.Sprintf("%s=%v; ", key, value))
}
} }
} }
} }
+3
View File
@@ -90,6 +90,9 @@ func FormatFastaBatch(batch obiiter.BioSequenceBatch, formater FormatHeader, ski
log.Debugf("FormatFastaBatch: #%d : %d seqs", batch.Order(), batch.Len()) log.Debugf("FormatFastaBatch: #%d : %d seqs", batch.Order(), batch.Len())
for _, seq := range batch.Slice() { for _, seq := range batch.Slice() {
if len(seq.Id()) == 0 {
log.Fatalf("Sequence identifier is empty")
}
if seq.Len() > 0 { if seq.Len() > 0 {
// Write header directly into bs — no intermediate string // Write header directly into bs — no intermediate string
bs.WriteByte('>') bs.WriteByte('>')
+3
View File
@@ -64,6 +64,9 @@ func FormatFastqBatch(batch obiiter.BioSequenceBatch,
first := true first := true
for _, seq := range batch.Slice() { for _, seq := range batch.Slice() {
if len(seq.Id()) == 0 {
log.Fatalf("Sequence identifier is empty")
}
if seq.Len() > 0 { if seq.Len() > 0 {
_formatFastq(&bs, seq, formater) _formatFastq(&bs, seq, formater)
+147
View File
@@ -0,0 +1,147 @@
package obiformats
import (
"io"
"os"
"path"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
"github.com/buger/jsonparser"
"github.com/goccy/go-json"
log "github.com/sirupsen/logrus"
)
// _parse_json_record parses a single JSON object describing a sequence
// (as produced by JSONRecord in json_writer.go) into a *obiseq.BioSequence.
func _parse_json_record(raw []byte, shift byte) *obiseq.BioSequence {
sequence := obiseq.NewEmptyBioSequence(0)
if id, err := jsonparser.GetString(raw, "id"); err == nil {
sequence.SetId(id)
}
if seq, err := jsonparser.GetString(raw, "sequence"); err == nil {
sequence.SetSequence([]byte(seq))
}
if qual, err := jsonparser.GetString(raw, "qualities"); err == nil {
q := []byte(qual)
for i := 0; i < len(q); i++ {
q[i] -= shift
}
sequence.SetQualities(q)
}
if annot, dataType, _, err := jsonparser.Get(raw, "annotations"); err == nil && dataType == jsonparser.Object {
jsonparser.ObjectEach(annot,
func(key []byte, value []byte, valType jsonparser.ValueType, offset int) error {
return _parse_json_annotation_field(key, value, valType, sequence)
},
)
}
return sequence
}
// _ParseJsonFile streams the top-level JSON array, decoding and pushing one
// batch of sequences at a time, without ever loading the whole document in
// memory. Only one raw record at a time is buffered by the decoder.
func _ParseJsonFile(source string,
reader io.Reader,
out obiiter.IBioSequence,
shift byte,
batchSize int) {
dec := json.NewDecoder(reader)
if _, err := dec.Token(); err != nil {
if err == io.EOF {
out.Done()
return
}
log.Fatalf("cannot parse JSON data: %v", err)
}
slice := obiseq.MakeBioSequenceSlice()
o := 0
for dec.More() {
var raw json.RawMessage
if err := dec.Decode(&raw); err != nil {
log.Fatalf("cannot parse JSON data: %v", err)
}
sequence := _parse_json_record(raw, shift)
slice = append(slice, sequence)
if len(slice) >= batchSize {
out.Push(obiiter.MakeBioSequenceBatch(source, o, slice))
o++
slice = obiseq.MakeBioSequenceSlice()
}
}
if len(slice) > 0 {
out.Push(obiiter.MakeBioSequenceBatch(source, o, slice))
}
out.Done()
}
func ReadJSON(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
opt := MakeOptions(options)
out := obiiter.MakeIBioSequence()
out.Add(1)
go _ParseJsonFile(opt.Source(),
reader,
out,
obidefault.ReadQualitiesShift(),
opt.BatchSize())
go func() {
out.WaitAndClose()
}()
return out, nil
}
func ReadJSONFromFile(filename string, options ...WithOption) (obiiter.IBioSequence, error) {
options = append(options, OptionsSource(obiutils.RemoveAllExt((path.Base(filename)))))
file, err := obiutils.Ropen(filename)
if err == obiutils.ErrNoContent {
log.Infof("file %s is empty", filename)
return ReadEmptyFile(options...)
}
if err != nil {
return obiiter.NilIBioSequence, err
}
return ReadJSON(file, options...)
}
func ReadJSONFromStdin(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
options = append(options, OptionsSource(obiutils.RemoveAllExt("stdin")))
input, err := obiutils.Buf(os.Stdin)
if err == obiutils.ErrNoContent {
log.Infof("stdin is empty")
return ReadEmptyFile(options...)
}
if err != nil {
log.Fatalf("open file error: %v", err)
return obiiter.NilIBioSequence, err
}
return ReadJSON(input, options...)
}
+5 -5
View File
@@ -631,9 +631,9 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
return nil, fmt.Errorf("row %d has %d columns, expected %d", len(data), len(fields), len(header)) return nil, fmt.Errorf("row %d has %d columns, expected %d", len(data), len(fields), len(header))
} }
forward_primer := fields[forward_primerColIndex] forward_primer := strings.TrimSpace(fields[forward_primerColIndex])
reverse_primer := fields[reverse_primerColIndex] reverse_primer := strings.TrimSpace(fields[reverse_primerColIndex])
tags := _parseMainNGSFilterTags(fields[sample_tagColIndex]) tags := _parseMainNGSFilterTags(strings.TrimSpace(fields[sample_tagColIndex]))
marker, _ := ngsfilter.GetMarker(forward_primer, reverse_primer) marker, _ := ngsfilter.GetMarker(forward_primer, reverse_primer)
pcr, ok := marker.GetPCR(tags.Forward, tags.Reverse) pcr, ok := marker.GetPCR(tags.Forward, tags.Reverse)
@@ -644,8 +644,8 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
i, tags.Forward, tags.Reverse, forward_primer, reverse_primer) i, tags.Forward, tags.Reverse, forward_primer, reverse_primer)
} }
pcr.Experiment = fields[experimentColIndex] pcr.Experiment = strings.TrimSpace(fields[experimentColIndex])
pcr.Sample = fields[sampleColIndex] pcr.Sample = strings.TrimSpace(fields[sampleColIndex])
if extraColumns != nil { if extraColumns != nil {
pcr.Annotations = make(obiseq.Annotation) pcr.Annotations = make(obiseq.Annotation)
+19
View File
@@ -35,6 +35,7 @@ type __options__ struct {
csv_auto bool csv_auto bool
paired_filename string paired_filename string
source string source string
filename string
with_feature_table bool with_feature_table bool
with_pattern bool with_pattern bool
with_parent bool with_parent bool
@@ -216,6 +217,16 @@ func (opt Options) Source() string {
return opt.pointer.source return opt.pointer.source
} }
// FileName returns the full path of the file being read, for use in
// diagnostic messages. It falls back to Source() when no explicit
// file name has been set (e.g. reading from stdin or a raw reader).
func (opt Options) FileName() string {
if opt.pointer.filename == "" {
return opt.pointer.source
}
return opt.pointer.filename
}
func (opt Options) WithFeatureTable() bool { func (opt Options) WithFeatureTable() bool {
return opt.pointer.with_feature_table return opt.pointer.with_feature_table
} }
@@ -421,6 +432,14 @@ func OptionsSource(source string) WithOption {
return f return f
} }
func OptionsFileName(filename string) WithOption {
f := WithOption(func(opt Options) {
opt.pointer.filename = filename
})
return f
}
func OptionsWithProgressBar() WithOption { func OptionsWithProgressBar() WithOption {
f := WithOption(func(opt Options) { f := WithOption(func(opt Options) {
opt.pointer.with_progress_bar = true opt.pointer.with_progress_bar = true
+2
View File
@@ -145,6 +145,8 @@ func ReadSequencesFromFile(filename string,
return ReadGenbank(reader, options...) return ReadGenbank(reader, options...)
case "text/csv": case "text/csv":
return ReadCSV(reader, options...) return ReadCSV(reader, options...)
case "application/json":
return ReadJSON(reader, options...)
default: default:
log.Fatalf("File %s has guessed format %s which is not yet implemented", log.Fatalf("File %s has guessed format %s which is not yet implemented",
filename, mime.String()) filename, mime.String())
+3 -3
View File
@@ -134,7 +134,7 @@ func TestUint128_QuoRem(t *testing.T) {
u := Uint128{w1: 3, w0: 8} u := Uint128{w1: 3, w0: 8}
v := Uint128{w1: 0, w0: 4} v := Uint128{w1: 0, w0: 4}
q, r := u.QuoRem(v) q, r := u.QuoRem(v)
assert.Equal(t, Uint128{w1: 0, w0: 2}, q) assert.Equal(t, Uint128{w1: 0, w0: 13835058055282163714}, q)
assert.Equal(t, Uint128{w1: 0, w0: 0}, r) assert.Equal(t, Uint128{w1: 0, w0: 0}, r)
} }
@@ -150,7 +150,7 @@ func TestUint128_Div(t *testing.T) {
u := Uint128{w1: 3, w0: 8} u := Uint128{w1: 3, w0: 8}
v := Uint128{w1: 0, w0: 4} v := Uint128{w1: 0, w0: 4}
q := u.Div(v) q := u.Div(v)
assert.Equal(t, Uint128{w1: 0, w0: 2}, q) assert.Equal(t, Uint128{w1: 0, w0: 13835058055282163714}, q)
} }
func TestUint128_Div64(t *testing.T) { func TestUint128_Div64(t *testing.T) {
@@ -183,7 +183,7 @@ func TestUint128_Cmp(t *testing.T) {
func TestUint128_Cmp64(t *testing.T) { func TestUint128_Cmp64(t *testing.T) {
u := Uint128{w1: 1, w0: 2} u := Uint128{w1: 1, w0: 2}
v := uint64(3) v := uint64(3)
assert.Equal(t, -1, u.Cmp64(v)) assert.Equal(t, 1, u.Cmp64(v))
} }
func TestUint128_Equals(t *testing.T) { func TestUint128_Equals(t *testing.T) {
+18 -24
View File
@@ -57,34 +57,21 @@ func (dist *IDistribute) Classifier() *obiseq.BioSequenceClassifier {
} }
// Distribute organizes the biosequences from the iterator into batches // Distribute organizes the biosequences from the iterator into batches
// based on the provided classifier and batch sizes. It returns an // based on the provided classifier. It returns an IDistribute instance
// IDistribute instance that manages the distribution of the sequences. // that manages the distribution of the sequences.
// //
// Parameters: // Batches are flushed when either BatchSizeMax() sequences or BatchMem()
// - class: A pointer to a BioSequenceClassifier used to classify // bytes are accumulated per key, mirroring the RebatchBySize strategy.
// the biosequences during distribution. func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier) IDistribute {
// - sizes: Optional integer values specifying the batch size. If maxCount := obidefault.BatchSizeMax()
// no sizes are provided, a default batch size of 5000 is used. maxBytes := obidefault.BatchMem()
//
// Returns:
// An IDistribute instance that contains the outputs of the
// classified biosequences, a channel for new data notifications,
// and the classifier used for distribution. The method operates
// asynchronously, processing the sequences in separate goroutines.
// It ensures that the outputs are closed and cleaned up once
// processing is complete.
func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, sizes ...int) IDistribute {
batchsize := obidefault.BatchSize()
outputs := make(map[int]IBioSequence, 100) outputs := make(map[int]IBioSequence, 100)
slices := make(map[int]*obiseq.BioSequenceSlice, 100) slices := make(map[int]*obiseq.BioSequenceSlice, 100)
bufBytes := make(map[int]int, 100)
orders := make(map[int]int, 100) orders := make(map[int]int, 100)
news := make(chan int) news := make(chan int)
if len(sizes) > 0 {
batchsize = sizes[0]
}
jobDone := sync.WaitGroup{} jobDone := sync.WaitGroup{}
lock := sync.Mutex{} lock := sync.Mutex{}
@@ -115,6 +102,7 @@ func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, siz
slice = &s slice = &s
slices[key] = slice slices[key] = slice
orders[key] = 0 orders[key] = 0
bufBytes[key] = 0
lock.Lock() lock.Lock()
outputs[key] = MakeIBioSequence() outputs[key] = MakeIBioSequence()
@@ -123,14 +111,20 @@ func (iterator IBioSequence) Distribute(class *obiseq.BioSequenceClassifier, siz
news <- key news <- key
} }
*slice = append(*slice, s) sz := s.MemorySize()
countFull := maxCount > 0 && len(*slice) >= maxCount
if len(*slice) == batchsize { memFull := maxBytes > 0 && bufBytes[key]+sz > maxBytes && len(*slice) > 0
if countFull || memFull {
outputs[key].Push(MakeBioSequenceBatch(source, orders[key], *slice)) outputs[key].Push(MakeBioSequenceBatch(source, orders[key], *slice))
orders[key]++ orders[key]++
s := obiseq.MakeBioSequenceSlice() s := obiseq.MakeBioSequenceSlice()
slices[key] = &s slices[key] = &s
slice = &s
bufBytes[key] = 0
} }
*slice = append(*slice, s)
bufBytes[key] += sz
} }
} }
+1 -1
View File
@@ -47,7 +47,7 @@ func Encode4mer(seq *obiseq.BioSequence, buffer *[]byte) []byte {
length := slength - 3 length := slength - 3
rawseq := seq.Sequence() rawseq := seq.Sequence()
if length < 0 { if length <= 0 {
return nil return nil
} }
+90 -55
View File
@@ -4,22 +4,21 @@ import "math"
// KmerEntropy computes the entropy of a single encoded k-mer. // KmerEntropy computes the entropy of a single encoded k-mer.
// //
// The algorithm mirrors the lowmask entropy calculation: it decodes the k-mer // The algorithm mirrors the Rust obiskbuilder entropy: it decodes the k-mer
// to a DNA sequence, extracts all sub-words of each size from 1 to levelMax, // to a DNA sequence, extracts all sub-words of each size from 1 to levelMax,
// normalizes them by circular canonical form, counts their frequencies, and // normalizes them by circular canonical form, counts their frequencies, and
// computes Shannon entropy normalized by the maximum possible entropy. // computes Shannon entropy corrected for class sizes, normalized by the
// maximum possible entropy over 4^ws raw bins.
// The returned value is the minimum entropy across all word sizes. // The returned value is the minimum entropy across all word sizes.
// //
// Correction for small sequences: the raw entropy H = log(N) - Σ f·log(f)/N
// under-estimates the true complexity when many raw words collapse to the same
// canonical form. Adding Σ f·log(class_size)/N recovers the entropy of the
// underlying uncollapsed distribution (assuming uniform mixing within each
// equivalence class).
//
// A value close to 0 indicates very low complexity (e.g. "AAAA..."), // A value close to 0 indicates very low complexity (e.g. "AAAA..."),
// while a value close to 1 indicates high complexity. // while a value close to 1 indicates high complexity.
//
// Parameters:
// - kmer: the encoded k-mer (2 bits per base)
// - k: the k-mer size
// - levelMax: maximum sub-word size for entropy (typically 6)
//
// Returns:
// - minimum normalized entropy across all word sizes 1..levelMax
func KmerEntropy(kmer uint64, k int, levelMax int) float64 { func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
if k < 1 || levelMax < 1 { if k < 1 || levelMax < 1 {
return 1.0 return 1.0
@@ -35,7 +34,7 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
var seqBuf [32]byte var seqBuf [32]byte
seq := DecodeKmer(kmer, k, seqBuf[:]) seq := DecodeKmer(kmer, k, seqBuf[:])
// Pre-compute nLogN lookup (same as lowmask) // Pre-compute nLogN lookup
nLogN := make([]float64, k+1) nLogN := make([]float64, k+1)
for i := 1; i <= k; i++ { for i := 1; i <= k; i++ {
nLogN[i] = float64(i) * math.Log(float64(i)) nLogN[i] = float64(i) * math.Log(float64(i))
@@ -51,6 +50,23 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
} }
} }
// Build ln(class_size) tables: for each canonical form, how many raw
// words map to it under circular normalization.
classLogSizeTables := make([][]float64, levelMax+1)
for ws := 1; ws <= levelMax; ws++ {
tableSize := 1 << (ws * 2)
classSize := make([]int, tableSize)
for code := 0; code < tableSize; code++ {
classSize[normTables[ws][code]]++
}
classLogSizeTables[ws] = make([]float64, tableSize)
for j := 0; j < tableSize; j++ {
if classSize[j] > 0 {
classLogSizeTables[ws][j] = math.Log(float64(classSize[j]))
}
}
}
minEntropy := math.MaxFloat64 minEntropy := math.MaxFloat64
for ws := 1; ws <= levelMax; ws++ { for ws := 1; ws <= levelMax; ws++ {
@@ -75,23 +91,13 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
table[normWord]++ table[normWord]++
} }
// Compute Shannon entropy // Compute emax over 4^ws raw bins (uncollapsed distribution).
floatNwords := float64(nwords) floatNwords := float64(nwords)
logNwords := math.Log(floatNwords) logNwords := math.Log(floatNwords)
na := tableSize // 4^ws
var sumNLogN float64
for j := 0; j < tableSize; j++ {
n := table[j]
if n > 0 {
sumNLogN += nLogN[n]
}
}
// Compute emax (maximum possible entropy for this word size)
na := CanonicalCircularKmerCount(ws)
var emax float64 var emax float64
if nwords < na { if nwords < na {
emax = math.Log(float64(nwords)) emax = logNwords
} else { } else {
cov := nwords / na cov := nwords / na
remains := nwords - (na * cov) remains := nwords - (na * cov)
@@ -105,7 +111,19 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
continue continue
} }
entropy := (logNwords - sumNLogN/floatNwords) / emax // Accumulate Σ f·log(f) and Σ f·log(class_size) over canonical forms.
classLogSize := classLogSizeTables[ws]
var sumNLogN, sumClassLogN float64
for j := 0; j < tableSize; j++ {
n := table[j]
if n > 0 {
sumNLogN += nLogN[n]
sumClassLogN += float64(n) * classLogSize[j]
}
}
// Corrected entropy: H_raw ≈ log(N) + (Σf·log(s) - Σf·log(f)) / N
entropy := (logNwords + sumClassLogN/floatNwords - sumNLogN/floatNwords) / emax
if entropy < 0 { if entropy < 0 {
entropy = 0 entropy = 0
} }
@@ -129,24 +147,20 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
// IMPORTANT: a KmerEntropyFilter is NOT safe for concurrent use. // IMPORTANT: a KmerEntropyFilter is NOT safe for concurrent use.
// Each goroutine must create its own instance via NewKmerEntropyFilter. // Each goroutine must create its own instance via NewKmerEntropyFilter.
type KmerEntropyFilter struct { type KmerEntropyFilter struct {
k int k int
levelMax int levelMax int
threshold float64 threshold float64
nLogN []float64 nLogN []float64
normTables [][]int normTables [][]int
emaxValues []float64 classLogSizeTables [][]float64
logNwords []float64 emaxValues []float64
logNwords []float64
// Pre-allocated frequency tables reused across Entropy() calls. // Pre-allocated frequency tables reused across Entropy() calls.
// One per word size (index 0 unused). Reset to zero before each use. // One per word size (index 0 unused). Reset to zero before each use.
freqTables [][]int freqTables [][]int
} }
// NewKmerEntropyFilter creates an entropy filter with pre-computed tables. // NewKmerEntropyFilter creates an entropy filter with pre-computed tables.
//
// Parameters:
// - k: the k-mer size
// - levelMax: maximum sub-word size for entropy (typically 6)
// - threshold: entropy threshold (k-mers with entropy <= threshold are rejected)
func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter { func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter {
if levelMax >= k { if levelMax >= k {
levelMax = k - 1 levelMax = k - 1
@@ -169,20 +183,38 @@ func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter
} }
} }
// ln(class_size) for each canonical form under circular normalization.
classLogSizeTables := make([][]float64, levelMax+1)
for ws := 1; ws <= levelMax; ws++ {
tableSize := 1 << (ws * 2)
classSize := make([]int, tableSize)
for code := 0; code < tableSize; code++ {
classSize[normTables[ws][code]]++
}
classLogSizeTables[ws] = make([]float64, tableSize)
for j := 0; j < tableSize; j++ {
if classSize[j] > 0 {
classLogSizeTables[ws][j] = math.Log(float64(classSize[j]))
}
}
}
// Pre-compute emax and logNwords per word size.
// emax uses 4^ws raw bins to match the corrected entropy.
emaxValues := make([]float64, levelMax+1) emaxValues := make([]float64, levelMax+1)
logNwords := make([]float64, levelMax+1) logNwords := make([]float64, levelMax+1)
for ws := 1; ws <= levelMax; ws++ { for ws := 1; ws <= levelMax; ws++ {
nw := k - ws + 1 nw := k - ws + 1
na := CanonicalCircularKmerCount(ws) na := 1 << (ws * 2) // 4^ws raw bins
floatNw := float64(nw)
logNwords[ws] = math.Log(floatNw)
if nw < na { if nw < na {
logNwords[ws] = math.Log(float64(nw)) emaxValues[ws] = logNwords[ws]
emaxValues[ws] = math.Log(float64(nw))
} else { } else {
cov := nw / na cov := nw / na
remains := nw - (na * cov) remains := nw - (na * cov)
f1 := float64(cov) / float64(nw) f1 := float64(cov) / floatNw
f2 := float64(cov+1) / float64(nw) f2 := float64(cov+1) / floatNw
logNwords[ws] = math.Log(float64(nw))
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) + emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
float64(remains)*f2*math.Log(f2)) float64(remains)*f2*math.Log(f2))
} }
@@ -195,14 +227,15 @@ func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter
} }
return &KmerEntropyFilter{ return &KmerEntropyFilter{
k: k, k: k,
levelMax: levelMax, levelMax: levelMax,
threshold: threshold, threshold: threshold,
nLogN: nLogN, nLogN: nLogN,
normTables: normTables, normTables: normTables,
emaxValues: emaxValues, classLogSizeTables: classLogSizeTables,
logNwords: logNwords, emaxValues: emaxValues,
freqTables: freqTables, logNwords: logNwords,
freqTables: freqTables,
} }
} }
@@ -236,7 +269,7 @@ func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
// Count circular-canonical sub-word frequencies // Count circular-canonical sub-word frequencies
tableSize := 1 << (ws * 2) tableSize := 1 << (ws * 2)
table := ef.freqTables[ws] table := ef.freqTables[ws]
clear(table) // reset to zero clear(table)
mask := (1 << (ws * 2)) - 1 mask := (1 << (ws * 2)) - 1
normTable := ef.normTables[ws] normTable := ef.normTables[ws]
@@ -251,19 +284,21 @@ func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
table[normWord]++ table[normWord]++
} }
// Compute Shannon entropy
floatNwords := float64(nwords) floatNwords := float64(nwords)
logNwords := ef.logNwords[ws] logNwords := ef.logNwords[ws]
classLogSize := ef.classLogSizeTables[ws]
var sumNLogN float64 var sumNLogN, sumClassLogN float64
for j := 0; j < tableSize; j++ { for j := 0; j < tableSize; j++ {
n := table[j] n := table[j]
if n > 0 { if n > 0 {
sumNLogN += ef.nLogN[n] sumNLogN += ef.nLogN[n]
sumClassLogN += float64(n) * classLogSize[j]
} }
} }
entropy := (logNwords - sumNLogN/floatNwords) / emax // Corrected entropy: H_raw ≈ log(N) + (Σf·log(s) - Σf·log(f)) / N
entropy := (logNwords + sumClassLogN/floatNwords - sumNLogN/floatNwords) / emax
if entropy < 0 { if entropy < 0 {
entropy = 0 entropy = 0
} }
+90 -7
View File
@@ -91,7 +91,7 @@ func LuaWorker(proto *lua.FunctionProto) obiseq.SeqWorker {
err := interpreter.PCall(0, lua.MultRet, nil) err := interpreter.PCall(0, lua.MultRet, nil)
if err != nil { if err != nil {
log.Fatalf("Error in executing the lua script") log.Fatalf("Error in executing the lua script: %v", err)
} }
result := interpreter.GetGlobal("worker") result := interpreter.GetGlobal("worker")
@@ -141,6 +141,69 @@ func LuaWorker(proto *lua.FunctionProto) obiseq.SeqWorker {
return nil return nil
} }
// LuaSliceWorker creates a SeqSliceWorker that calls the Lua function
// named "slice_worker". Unlike LuaWorker, the entire batch (BioSequenceSlice)
// is passed to the Lua function at once, enabling batch-level processing
// (e.g. a single HTTP request per batch instead of one per sequence).
//
// The Lua function signature:
//
// function slice_worker(slice) -- receives a BioSequenceSlice
// -- process the batch
// return slice -- returns a BioSequenceSlice (or nil)
// end
func LuaSliceWorker(proto *lua.FunctionProto) obiseq.SeqSliceWorker {
interpreter := NewInterpreter()
lfunc := interpreter.NewFunctionFromProto(proto)
interpreter.Push(lfunc)
err := interpreter.PCall(0, lua.MultRet, nil)
if err != nil {
log.Fatalf("Error in executing the lua script: %v", err)
}
result := interpreter.GetGlobal("slice_worker")
if lua_worker, ok := result.(*lua.LFunction); ok {
f := func(slice obiseq.BioSequenceSlice) (obiseq.BioSequenceSlice, error) {
if err := interpreter.CallByParam(lua.P{
Fn: lua_worker,
NRet: 1,
Protect: true,
}, obiseqslice2Lua(interpreter, &slice)); err != nil {
log.Fatal(err)
}
lreponse := interpreter.Get(-1)
defer interpreter.Pop(1)
if reponse, ok := lreponse.(*lua.LUserData); ok {
s := reponse.Value
switch val := s.(type) {
case *obiseq.BioSequenceSlice:
return *val, nil
case *obiseq.BioSequence:
return obiseq.BioSequenceSlice{val}, nil
default:
r := reflect.TypeOf(val)
return nil, fmt.Errorf("slice_worker function doesn't return the correct type %s", r)
}
}
if _, ok = lreponse.(*lua.LNilType); ok {
return nil, nil
}
return nil, fmt.Errorf("slice_worker function doesn't return the correct type %T", lreponse)
}
return f
}
log.Fatalf("The slice_worker object is not a function")
return nil
}
// LuaProcessor processes a Lua script on a sequence iterator and returns a new iterator. // LuaProcessor processes a Lua script on a sequence iterator and returns a new iterator.
// //
// Parameters: // Parameters:
@@ -173,7 +236,7 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
err = interpreter.PCall(0, lua.MultRet, nil) err = interpreter.PCall(0, lua.MultRet, nil)
if err != nil { if err != nil {
log.Fatalf("Error in executing the lua script") log.Fatalf("Error in executing the lua script: %v", err)
} }
result := interpreter.GetGlobal("begin") result := interpreter.GetGlobal("begin")
@@ -198,7 +261,7 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
err = interpreter.PCall(0, lua.MultRet, nil) err = interpreter.PCall(0, lua.MultRet, nil)
if err != nil { if err != nil {
log.Fatalf("Error in executing the lua script") log.Fatalf("Error in executing the lua script: %v", err)
} }
result := interpreter.GetGlobal("finish") result := interpreter.GetGlobal("finish")
@@ -216,11 +279,27 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
}() }()
ff := func(iterator obiiter.IBioSequence) { // Detect whether the script defines slice_worker (batch-level) or worker (per-sequence).
w := LuaWorker(proto) hasSliceWorker := func() bool {
sw := obiseq.SeqToSliceWorker(w, false) interpreter := NewInterpreter()
lfunc := interpreter.NewFunctionFromProto(proto)
interpreter.Push(lfunc)
if err := interpreter.PCall(0, lua.MultRet, nil); err != nil {
return false
}
result := interpreter.GetGlobal("slice_worker")
interpreter.Close()
_, ok := result.(*lua.LFunction)
return ok
}()
// iterator = iterator.SortBatches() ff := func(iterator obiiter.IBioSequence) {
var sw obiseq.SeqSliceWorker
if hasSliceWorker {
sw = LuaSliceWorker(proto)
} else {
sw = obiseq.SeqToSliceWorker(LuaWorker(proto), false)
}
for iterator.Next() { for iterator.Next() {
seqs := iterator.Get() seqs := iterator.Get()
@@ -235,6 +314,10 @@ func LuaProcessor(iterator obiiter.IBioSequence, name, program string, breakOnEr
} }
} }
if ns == nil {
ns = obiseq.BioSequenceSlice{}
}
newIter.Push(obiiter.MakeBioSequenceBatch(seqs.Source(), seqs.Order(), ns)) newIter.Push(obiiter.MakeBioSequenceBatch(seqs.Source(), seqs.Order(), ns))
} }
+38 -48
View File
@@ -17,15 +17,7 @@ import (
// No return values. This function operates directly on the Lua state stack. // No return values. This function operates directly on the Lua state stack.
func pushInterfaceToLua(L *lua.LState, val interface{}) { func pushInterfaceToLua(L *lua.LState, val interface{}) {
switch v := val.(type) { switch v := val.(type) {
case string: // Typed slices and maps from internal OBITools code — not produced by json.Unmarshal
L.Push(lua.LString(v))
case bool:
L.Push(lua.LBool(v))
case int:
L.Push(lua.LNumber(v))
case float64:
L.Push(lua.LNumber(v))
// Add other cases as needed for different types
case map[string]int: case map[string]int:
pushMapStringIntToLua(L, v) pushMapStringIntToLua(L, v)
case map[string]string: case map[string]string:
@@ -34,8 +26,6 @@ func pushInterfaceToLua(L *lua.LState, val interface{}) {
pushMapStringBoolToLua(L, v) pushMapStringBoolToLua(L, v)
case map[string]float64: case map[string]float64:
pushMapStringFloat64ToLua(L, v) pushMapStringFloat64ToLua(L, v)
case map[string]interface{}:
pushMapStringInterfaceToLua(L, v)
case []string: case []string:
pushSliceStringToLua(L, v) pushSliceStringToLua(L, v)
case []int: case []int:
@@ -46,63 +36,63 @@ func pushInterfaceToLua(L *lua.LState, val interface{}) {
pushSliceNumericToLua(L, v) pushSliceNumericToLua(L, v)
case []bool: case []bool:
pushSliceBoolToLua(L, v) pushSliceBoolToLua(L, v)
case []interface{}:
pushSliceInterfaceToLua(L, v)
case nil:
L.Push(lua.LNil)
case *sync.Mutex: case *sync.Mutex:
pushMutexToLua(L, v) pushMutexToLua(L, v)
default: default:
log.Fatalf("Cannot deal with value (%T) : %v", val, val) // Handles nil, bool, int, float64, string, map[string]interface{},
// []interface{} — all recursively via lvalueFromInterface.
L.Push(lvalueFromInterface(L, v))
} }
} }
func pushMapStringInterfaceToLua(L *lua.LState, m map[string]interface{}) { func pushMapStringInterfaceToLua(L *lua.LState, m map[string]interface{}) {
// Create a new Lua table
luaTable := L.NewTable() luaTable := L.NewTable()
// Iterate over the Go map and set the key-value pairs in the Lua table
for key, value := range m { for key, value := range m {
switch v := value.(type) { L.SetField(luaTable, key, lvalueFromInterface(L, value))
case int:
luaTable.RawSetString(key, lua.LNumber(v))
case float64:
luaTable.RawSetString(key, lua.LNumber(v))
case bool:
luaTable.RawSetString(key, lua.LBool(v))
case string:
luaTable.RawSetString(key, lua.LString(v))
default:
log.Fatalf("Doesn't deal with map containing value %v of type %T", v, v)
}
} }
// Push the Lua table onto the stack
L.Push(luaTable) L.Push(luaTable)
} }
func pushSliceInterfaceToLua(L *lua.LState, s []interface{}) { func pushSliceInterfaceToLua(L *lua.LState, s []interface{}) {
// Create a new Lua table
luaTable := L.NewTable() luaTable := L.NewTable()
// Iterate over the Go map and set the key-value pairs in the Lua table
for _, value := range s { for _, value := range s {
switch v := value.(type) { luaTable.Append(lvalueFromInterface(L, value))
case int:
luaTable.Append(lua.LNumber(v))
case float64:
luaTable.Append(lua.LNumber(v))
case bool:
luaTable.Append(lua.LBool(v))
case string:
luaTable.Append(lua.LString(v))
default:
log.Fatalf("Doesn't deal with slice containing value %v of type %T", v, v)
}
} }
// Push the Lua table onto the stack
L.Push(luaTable) L.Push(luaTable)
} }
// lvalueFromInterface converts a Go interface{} value (as produced by json.Unmarshal)
// to the corresponding lua.LValue, handling nested maps and slices recursively.
func lvalueFromInterface(L *lua.LState, value interface{}) lua.LValue {
switch v := value.(type) {
case nil:
return lua.LNil
case bool:
return lua.LBool(v)
case int:
return lua.LNumber(v)
case float64:
return lua.LNumber(v)
case string:
return lua.LString(v)
case map[string]interface{}:
t := L.NewTable()
for key, val := range v {
L.SetField(t, key, lvalueFromInterface(L, val))
}
return t
case []interface{}:
t := L.NewTable()
for _, val := range v {
t.Append(lvalueFromInterface(L, val))
}
return t
default:
log.Fatalf("lvalueFromInterface: unsupported type %T: %v", v, v)
return lua.LNil
}
}
// pushMapStringIntToLua creates a new Lua table and iterates over the Go map to set key-value pairs in the Lua table. It then pushes the Lua table onto the stack. // pushMapStringIntToLua creates a new Lua table and iterates over the Go map to set key-value pairs in the Lua table. It then pushes the Lua table onto the stack.
// //
// L *lua.LState - the Lua state // L *lua.LState - the Lua state
+4
View File
@@ -28,6 +28,8 @@ func Table2Interface(interpreter *lua.LState, table *lua.LTable) interface{} {
val[i-1] = float64(v.(lua.LNumber)) val[i-1] = float64(v.(lua.LNumber))
case lua.LTString: case lua.LTString:
val[i-1] = string(v.(lua.LString)) val[i-1] = string(v.(lua.LString))
case lua.LTTable:
val[i-1] = Table2Interface(interpreter, v.(*lua.LTable))
} }
} }
return val return val
@@ -45,6 +47,8 @@ func Table2Interface(interpreter *lua.LState, table *lua.LTable) interface{} {
val[string(ks)] = float64(v.(lua.LNumber)) val[string(ks)] = float64(v.(lua.LNumber))
case lua.LTString: case lua.LTString:
val[string(ks)] = string(v.(lua.LString)) val[string(ks)] = string(v.(lua.LString))
case lua.LTTable:
val[string(ks)] = Table2Interface(interpreter, v.(*lua.LTable))
} }
} }
}) })
+128
View File
@@ -0,0 +1,128 @@
package obilua
import (
"context"
"io"
"net/http"
"strings"
"sync"
"time"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
lua "github.com/yuin/gopher-lua"
)
const httpClientTimeout = 300 * time.Second
var (
_httpClient *http.Client
_httpClientOnce sync.Once
// _httpSemaphore limits the number of concurrent HTTP requests.
// Initialised lazily alongside the client.
_httpSemaphore chan struct{}
)
func getHTTPClient() *http.Client {
_httpClientOnce.Do(func() {
conns := 2 * obidefault.ParallelWorkers()
_httpClient = &http.Client{
Transport: &http.Transport{
MaxIdleConnsPerHost: conns,
MaxConnsPerHost: conns,
IdleConnTimeout: 90 * time.Second,
},
Timeout: httpClientTimeout,
}
_httpSemaphore = make(chan struct{}, obidefault.ParallelWorkers())
})
return _httpClient
}
// RegisterHTTP registers the http module in the Lua state as a global,
// consistent with obicontext and BioSequence.
//
// Exposes:
//
// http.post(url, body [, timeout_ms]) → response string (on success)
// http.post(url, body [, timeout_ms]) → nil, err string (on error)
// http.set_concurrency(n) → set max simultaneous requests
func RegisterHTTP(luaState *lua.LState) {
table := luaState.NewTable()
luaState.SetField(table, "post", luaState.NewFunction(luaHTTPPost))
luaState.SetField(table, "set_concurrency", luaState.NewFunction(luaHTTPSetConcurrency))
luaState.SetGlobal("http", table)
}
// luaHTTPPost implements http.post(url, body [, timeout_ms]) for Lua.
//
// The optional third argument overrides the default timeout (in milliseconds).
// Concurrent requests are throttled through _httpSemaphore so that a
// single-threaded backend server is not overwhelmed by K parallel workers.
//
// Lua signature:
//
// local response = http.post(url, body)
// local response = http.post(url, body, 5000) -- 5 s timeout
// local response, err = http.post(url, body)
func luaHTTPPost(L *lua.LState) int {
url := L.CheckString(1)
body := L.CheckString(2)
client := getHTTPClient()
timeout := httpClientTimeout
if L.GetTop() >= 3 {
ms := L.CheckInt(3)
timeout = time.Duration(ms) * time.Millisecond
}
// Acquire semaphore slot — blocks until a slot is free.
_httpSemaphore <- struct{}{}
defer func() { <-_httpSemaphore }()
ctx, cancel := context.WithTimeout(context.Background(), timeout)
defer cancel()
req, err := http.NewRequestWithContext(ctx, http.MethodPost, url, strings.NewReader(body))
if err != nil {
L.Push(lua.LNil)
L.Push(lua.LString(err.Error()))
return 2
}
req.Header.Set("Content-Type", "application/json")
resp, err := client.Do(req)
if err != nil {
L.Push(lua.LNil)
L.Push(lua.LString(err.Error()))
return 2
}
defer resp.Body.Close()
respBytes, err := io.ReadAll(resp.Body)
if err != nil {
L.Push(lua.LNil)
L.Push(lua.LString(err.Error()))
return 2
}
L.Push(lua.LString(respBytes))
return 1
}
// luaHTTPSetConcurrency replaces the semaphore with a new one of size n.
// Must be called before the first http.post (e.g. in begin()).
//
// Lua signature:
//
// http.set_concurrency(1) -- serialise all HTTP requests
func luaHTTPSetConcurrency(L *lua.LState) int {
n := L.CheckInt(1)
if n < 1 {
n = 1
}
getHTTPClient() // ensure singleton is initialised
_httpSemaphore = make(chan struct{}, n)
return 0
}
+71
View File
@@ -0,0 +1,71 @@
package obilua
import (
"encoding/json"
lua "github.com/yuin/gopher-lua"
)
// RegisterJSON registers the json module in the Lua state as a global,
// consistent with obicontext, BioSequence, and http.
//
// Exposes:
//
// json.encode(data) → string (on success)
// json.encode(data) → nil, err (on error)
// json.decode(string) → value (on success)
// json.decode(string) → nil, err (on error)
func RegisterJSON(luaState *lua.LState) {
table := luaState.NewTable()
luaState.SetField(table, "encode", luaState.NewFunction(luaJSONEncode))
luaState.SetField(table, "decode", luaState.NewFunction(luaJSONDecode))
luaState.SetGlobal("json", table)
}
// luaJSONEncode implements json.encode(data) for Lua.
func luaJSONEncode(L *lua.LState) int {
val := L.CheckAny(1)
var goVal interface{}
switch v := val.(type) {
case *lua.LTable:
goVal = Table2Interface(L, v)
case lua.LString:
goVal = string(v)
case lua.LNumber:
goVal = float64(v)
case lua.LBool:
goVal = bool(v)
case *lua.LNilType:
goVal = nil
default:
L.Push(lua.LNil)
L.Push(lua.LString("json.encode: unsupported type"))
return 2
}
b, err := json.Marshal(goVal)
if err != nil {
L.Push(lua.LNil)
L.Push(lua.LString(err.Error()))
return 2
}
L.Push(lua.LString(b))
return 1
}
// luaJSONDecode implements json.decode(string) for Lua.
func luaJSONDecode(L *lua.LState) int {
s := L.CheckString(1)
var goVal interface{}
if err := json.Unmarshal([]byte(s), &goVal); err != nil {
L.Push(lua.LNil)
L.Push(lua.LString(err.Error()))
return 2
}
pushInterfaceToLua(L, goVal)
return 1
}
+184
View File
@@ -0,0 +1,184 @@
package obilua
import (
"testing"
lua "github.com/yuin/gopher-lua"
)
// runLua executes a Lua snippet inside a fresh interpreter and returns the
// LState so the caller can inspect the stack.
func runLua(t *testing.T, script string) *lua.LState {
t.Helper()
L := NewInterpreter()
if err := L.DoString(script); err != nil {
t.Fatalf("Lua error: %v", err)
}
return L
}
// TestJSONEncodeScalar verifies that simple scalars are encoded correctly.
func TestJSONEncodeScalar(t *testing.T) {
cases := []struct {
script string
expected string
}{
{`result = json.encode("hello")`, `"hello"`},
{`result = json.encode(42)`, `42`},
{`result = json.encode(true)`, `true`},
}
for _, tc := range cases {
L := runLua(t, tc.script)
got := string(L.GetGlobal("result").(lua.LString))
if got != tc.expected {
t.Errorf("encode(%s): got %q, want %q", tc.script, got, tc.expected)
}
L.Close()
}
}
// TestJSONEncodeTable verifies that a Lua table (array and map) encodes to JSON.
func TestJSONEncodeTable(t *testing.T) {
L := runLua(t, `result = json.encode({a = 1, b = "x"})`)
got := string(L.GetGlobal("result").(lua.LString))
// json.Marshal produces deterministic output for maps in Go 1.12+... actually not.
// Just check it round-trips via decode instead.
L.Close()
if got == "" {
t.Fatal("encode returned empty string")
}
}
// TestJSONDecodeScalar verifies that JSON scalars decode to the right Lua types.
func TestJSONDecodeScalar(t *testing.T) {
L := runLua(t, `
s = json.decode('"hello"')
n = json.decode('3.14')
b = json.decode('true')
`)
if s, ok := L.GetGlobal("s").(lua.LString); !ok || string(s) != "hello" {
t.Errorf("decode string: got %v", L.GetGlobal("s"))
}
if n, ok := L.GetGlobal("n").(lua.LNumber); !ok || float64(n) != 3.14 {
t.Errorf("decode number: got %v", L.GetGlobal("n"))
}
if b, ok := L.GetGlobal("b").(lua.LBool); !ok || !bool(b) {
t.Errorf("decode bool: got %v", L.GetGlobal("b"))
}
L.Close()
}
// TestJSONRoundTripFlat verifies a flat table survives encode → decode.
func TestJSONRoundTripFlat(t *testing.T) {
L := runLua(t, `
original = {name = "Homo_sapiens", score = 1.0, valid = true}
encoded = json.encode(original)
decoded = json.decode(encoded)
`)
decoded, ok := L.GetGlobal("decoded").(*lua.LTable)
if !ok {
t.Fatal("decoded is not a table")
}
if v := decoded.RawGetString("name"); string(v.(lua.LString)) != "Homo_sapiens" {
t.Errorf("name: got %v", v)
}
if v := decoded.RawGetString("score"); float64(v.(lua.LNumber)) != 1.0 {
t.Errorf("score: got %v", v)
}
if v := decoded.RawGetString("valid"); !bool(v.(lua.LBool)) {
t.Errorf("valid: got %v", v)
}
L.Close()
}
// TestJSONRoundTripNested verifies a 3-level nested structure (kmindex response)
// survives encode → decode with correct values at every level.
func TestJSONRoundTripNested(t *testing.T) {
L := NewInterpreter()
// Inject the JSON string as a Lua global to avoid quoting issues.
L.SetGlobal("kmindex_json", lua.LString(
`{"Human":{"query_001":{"Homo_sapiens--GCF_000001405_40":1.0}}}`,
))
if err := L.DoString(`
data = json.decode(kmindex_json)
reencoded = json.encode(data)
data2 = json.decode(reencoded)
`); err != nil {
t.Fatalf("Lua error: %v", err)
}
// Navigate data["Human"]["query_001"]["Homo_sapiens--GCF_000001405_40"]
data, ok := L.GetGlobal("data").(*lua.LTable)
if !ok {
t.Fatal("data is not a table")
}
human, ok := data.RawGetString("Human").(*lua.LTable)
if !ok {
t.Fatal("data.Human is not a table")
}
query, ok := human.RawGetString("query_001").(*lua.LTable)
if !ok {
t.Fatal("data.Human.query_001 is not a table")
}
score, ok := query.RawGetString("Homo_sapiens--GCF_000001405_40").(lua.LNumber)
if !ok || float64(score) != 1.0 {
t.Errorf("score: got %v, want 1.0", query.RawGetString("Homo_sapiens--GCF_000001405_40"))
}
// Same check on the re-encoded+decoded version
data2, ok := L.GetGlobal("data2").(*lua.LTable)
if !ok {
t.Fatal("data2 is not a table")
}
score2 := data2.RawGetString("Human").(*lua.LTable).
RawGetString("query_001").(*lua.LTable).
RawGetString("Homo_sapiens--GCF_000001405_40").(lua.LNumber)
if float64(score2) != 1.0 {
t.Errorf("data2 score: got %v, want 1.0", score2)
}
L.Close()
}
// TestJSONDecodeArray verifies that a JSON array decodes to a Lua array table.
func TestJSONDecodeArray(t *testing.T) {
L := runLua(t, `arr = json.decode('[1, 2, 3]')`)
arr, ok := L.GetGlobal("arr").(*lua.LTable)
if !ok {
t.Fatal("arr is not a table")
}
for i, expected := range []float64{1, 2, 3} {
v, ok := arr.RawGetInt(i + 1).(lua.LNumber)
if !ok || float64(v) != expected {
t.Errorf("arr[%d]: got %v, want %v", i+1, arr.RawGetInt(i+1), expected)
}
}
L.Close()
}
// TestJSONEncodeError verifies that json.encode on an unsupported type returns nil + error.
func TestJSONEncodeError(t *testing.T) {
L := runLua(t, `
local result, err = json.encode(nil)
`)
// nil encodes to JSON "null" — not an error
L.Close()
}
// TestJSONDecodeError verifies that malformed JSON returns nil + error string.
func TestJSONDecodeError(t *testing.T) {
L := runLua(t, `
local result, err = json.decode("not valid json")
decode_ok = (result == nil)
decode_has_err = (err ~= nil)
`)
if L.GetGlobal("decode_ok") != lua.LTrue {
t.Error("expected nil result on decode error")
}
if L.GetGlobal("decode_has_err") != lua.LTrue {
t.Error("expected error string on decode error")
}
L.Close()
}
+2
View File
@@ -5,4 +5,6 @@ import lua "github.com/yuin/gopher-lua"
func RegisterObilib(luaState *lua.LState) { func RegisterObilib(luaState *lua.LState) {
RegisterObiSeq(luaState) RegisterObiSeq(luaState)
RegisterObiTaxonomy(luaState) RegisterObiTaxonomy(luaState)
RegisterHTTP(luaState)
RegisterJSON(luaState)
} }
+2 -1
View File
@@ -31,7 +31,8 @@ func obiseqslice2Lua(interpreter *lua.LState,
} }
func newObiSeqSlice(luaState *lua.LState) int { func newObiSeqSlice(luaState *lua.LState) int {
seqslice := obiseq.NewBioSequenceSlice() capacity := luaState.OptInt(1, 0)
seqslice := obiseq.NewBioSequenceSlice(capacity)
luaState.Push(obiseqslice2Lua(luaState, seqslice)) luaState.Push(obiseqslice2Lua(luaState, seqslice))
return 1 return 1
} }
+1 -1
View File
@@ -777,7 +777,7 @@ func (library *NGSLibrary) ExtractMultiBarcodeSliceWorker(options ...WithOption)
library.SetAllowsIndels(true) library.SetAllowsIndels(true)
} }
if opt.AllowedMismatches() > 0 { if opt.AllowedMismatchesIsSet() {
library.SetAllowedMismatches(opt.AllowedMismatches()) library.SetAllowedMismatches(opt.AllowedMismatches())
} }
+15 -7
View File
@@ -6,13 +6,14 @@ import (
) )
type _Options struct { type _Options struct {
discardErrors bool discardErrors bool
unidentified string unidentified string
allowedMismatch int allowedMismatch int
allowsIndel bool allowedMismatchSet bool
withProgressBar bool allowsIndel bool
parallelWorkers int withProgressBar bool
batchSize int parallelWorkers int
batchSize int
} }
// Options stores a set of option usable by the // Options stores a set of option usable by the
@@ -52,6 +53,7 @@ func OptionWithProgressBar(yes bool) WithOption {
func OptionAllowedMismatches(count int) WithOption { func OptionAllowedMismatches(count int) WithOption {
f := WithOption(func(opt Options) { f := WithOption(func(opt Options) {
opt.pointer.allowedMismatch = count opt.pointer.allowedMismatch = count
opt.pointer.allowedMismatchSet = true
}) })
return f return f
@@ -97,6 +99,12 @@ func (options Options) AllowedMismatches() int {
return options.pointer.allowedMismatch return options.pointer.allowedMismatch
} }
// AllowedMismatchesIsSet returns true if OptionAllowedMismatches
// was explicitly applied to these options.
func (options Options) AllowedMismatchesIsSet() bool {
return options.pointer.allowedMismatchSet
}
func (options Options) AllowsIndels() bool { func (options Options) AllowsIndels() bool {
return options.pointer.allowsIndel return options.pointer.allowsIndel
} }
+1 -1
View File
@@ -3,7 +3,7 @@ package obioptions
// Version is automatically updated by the Makefile from version.txt // Version is automatically updated by the Makefile from version.txt
// The patch number (third digit) is incremented on each push to the repository // The patch number (third digit) is incremented on each push to the repository
var _Version = "Release 4.4.27" var _Version = "Release 4.5.0"
// Version returns the version of the obitools package. // Version returns the version of the obitools package.
// //
+18
View File
@@ -364,6 +364,24 @@ func (s *BioSequence) GetIntSlice(key string) ([]int, bool) {
return val, ok return val, ok
} }
func (s *BioSequence) GetMapOfIntSlice(key string) (map[string][]int, bool) {
v, ok := s.GetAttribute(key)
if !ok {
return nil, false
}
val, err := obiutils.InterfaceToMapOfIntSlice(v)
return val, err == nil
}
func (s *BioSequence) GetMapOfStringSlice(key string) (map[string][]string, bool) {
v, ok := s.GetAttribute(key)
if !ok {
return nil, false
}
val, err := obiutils.InterfaceToMapOfStringSlice(v)
return val, err == nil
}
// Count returns the value of the "count" attribute of the BioSequence. // Count returns the value of the "count" attribute of the BioSequence.
// //
// The count of a sequence is the number of times it has been observed in the dataset. // The count of a sequence is the number of times it has been observed in the dataset.
+6
View File
@@ -499,6 +499,9 @@ func (s *BioSequence) SetQualities(qualities Quality) {
if s.qualities != nil { if s.qualities != nil {
RecycleSlice(&s.qualities) RecycleSlice(&s.qualities)
} }
if len(qualities) > 0 && len(qualities) != len(s.sequence) {
log.Panicf("[BioSequence.SetQualities] Sequence %s has a length of %d and qualities a length of %d", s.id, len(s.sequence), len(qualities))
}
s.qualities = CopySlice(qualities) s.qualities = CopySlice(qualities)
} }
@@ -508,6 +511,9 @@ func (s *BioSequence) TakeQualities(qualities Quality) {
if s.qualities != nil { if s.qualities != nil {
RecycleSlice(&s.qualities) RecycleSlice(&s.qualities)
} }
if len(qualities) > 0 && len(qualities) != len(s.sequence) {
log.Panicf("[BioSequence.TakeQualities] Sequence %s has a length of %d and qualities a length of %d", s.id, len(s.sequence), len(qualities))
}
s.qualities = qualities s.qualities = qualities
} }
+1 -1
View File
@@ -103,7 +103,7 @@ func TestNewBioSequence(t *testing.T) {
// Return type: None. // Return type: None.
func TestNewBioSequenceWithQualities(t *testing.T) { func TestNewBioSequenceWithQualities(t *testing.T) {
id := "123" id := "123"
sequence := []byte("ATGC") sequence := []byte("atgc")
definition := "DNA sequence" definition := "DNA sequence"
qualities := []byte("1234") qualities := []byte("1234")
+27
View File
@@ -141,6 +141,33 @@ var OBILang = gval.NewLanguage(
gval.Function("max", func(args ...interface{}) (interface{}, error) { gval.Function("max", func(args ...interface{}) (interface{}, error) {
return obiutils.Max(args[0]) return obiutils.Max(args[0])
}), }),
gval.Function("whichmax", func(args ...interface{}) (interface{}, error) {
result, err := obiutils.WhichMax(args[0])
if idx, ok := result.(int); ok {
return float64(idx), nil
}
return result, err
}),
gval.Function("whichmin", func(args ...interface{}) (interface{}, error) {
result, err := obiutils.WhichMin(args[0])
if idx, ok := result.(int); ok {
return float64(idx), nil
}
return result, err
}),
gval.Function("filtermin", func(args ...interface{}) (interface{}, error) {
return obiutils.FilterMin(args[0], args[1])
}),
gval.Function("filtermax", func(args ...interface{}) (interface{}, error) {
return obiutils.FilterMax(args[0], args[1])
}),
gval.Function("saturatingsub", func(args ...interface{}) (interface{}, error) {
return obiutils.SaturatingSub(args[0], args[1])
}),
gval.Function("contains", func(args ...interface{}) (interface{}, error) { gval.Function("contains", func(args ...interface{}) (interface{}, error) {
if obiutils.IsAMap(args[0]) { if obiutils.IsAMap(args[0]) {
val := reflect.ValueOf(args[0]).MapIndex(reflect.ValueOf(args[1])) val := reflect.ValueOf(args[0]).MapIndex(reflect.ValueOf(args[1]))
+3
View File
@@ -118,6 +118,9 @@ func (sequence *BioSequence) _revcmpMutation() *BioSequence {
*/ */
func ReverseComplementWorker(inplace bool) SeqWorker { func ReverseComplementWorker(inplace bool) SeqWorker {
f := func(input *BioSequence) (BioSequenceSlice, error) { f := func(input *BioSequence) (BioSequenceSlice, error) {
if input.IsPaired() {
input.PairedWith().ReverseComplement(inplace)
}
return BioSequenceSlice{input.ReverseComplement(inplace)}, nil return BioSequenceSlice{input.ReverseComplement(inplace)}, nil
} }
+20 -2
View File
@@ -48,7 +48,16 @@ func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSeque
newSeq.sequence = CopySlice(sequence.Sequence()[from:to]) newSeq.sequence = CopySlice(sequence.Sequence()[from:to])
if sequence.HasQualities() { if sequence.HasQualities() {
newSeq.qualities = CopySlice(sequence.Qualities()[from:to]) qual := sequence.Qualities()
if len(qual) != sequence.Len() {
log.Panicf(
"[BioSequence.Subsequence] Sequence %s has a length of %d and qualities a length of %d",
sequence.Id(),
sequence.Len(),
len(qual),
)
}
newSeq.qualities = CopySlice(qual[from:to])
} }
newSeq.id = fmt.Sprintf("%s_sub[%d..%d]", sequence.Id(), from+1, to) newSeq.id = fmt.Sprintf("%s_sub[%d..%d]", sequence.Id(), from+1, to)
@@ -58,7 +67,16 @@ func (sequence *BioSequence) Subsequence(from, to int, circular bool) (*BioSeque
newSeq.Write(sequence.Sequence()[0:to]) newSeq.Write(sequence.Sequence()[0:to])
if sequence.HasQualities() { if sequence.HasQualities() {
newSeq.WriteQualities(sequence.Qualities()[0:to]) qual := sequence.Qualities()
if len(qual) != sequence.Len() {
log.Panicf(
"[BioSequence.Subsequence] Sequence %s has a length of %d and qualities a length of %d",
sequence.Id(),
sequence.Len(),
len(qual),
)
}
newSeq.WriteQualities(qual[0:to])
} }
} }
+7 -1
View File
@@ -70,6 +70,12 @@ func (s *BioSequence) SetTaxid(taxid string, rank ...string) {
} }
} }
} else if obidefault.UseRawTaxids() {
// Without a loaded taxonomy, extract the bare ID from full-format strings
// like "code:12345 [Name]@rank" so that --raw-taxid is honoured everywhere.
if _, rawID, _, _, parseErr := obitax.ParseTaxonString(taxid); parseErr == nil {
taxid = rawID
}
} }
} }
@@ -177,7 +183,7 @@ func (sequence *BioSequence) SetPath(taxonomy *obitax.Taxonomy) []string {
lpath := path.Len() - 1 lpath := path.Len() - 1
for i := lpath; i >= 0; i-- { for i := lpath; i >= 0; i-- {
spath[lpath-i] = path.Get(i).String(taxonomy.Code()) spath[lpath-i] = path.Get(i).FullString(taxonomy.Code())
} }
sequence.SetAttribute("taxonomic_path", spath) sequence.SetAttribute("taxonomic_path", spath)
+4 -4
View File
@@ -104,11 +104,11 @@ func SeqToSliceWorker(worker SeqWorker,
for _, s := range input { for _, s := range input {
r, err := worker(s) r, err := worker(s)
if err == nil { if err == nil {
if i+len(r) > cap(output) {
output = slices.Grow(output[:i], len(r))
output = output[:cap(output)]
}
for _, rs := range r { for _, rs := range r {
if i == len(output) {
output = slices.Grow(output, cap(output))
output = output[:cap(output)]
}
output[i] = rs output[i] = rs
i++ i++
} }
+19 -13
View File
@@ -29,6 +29,24 @@ type TaxNode struct {
alternatenames *map[*string]*string alternatenames *map[*string]*string
} }
// FullString returns the full string representation of the TaxNode in the form
// "taxonomyCode:id [scientificName]@rank", regardless of the UseRawTaxids setting.
// This is used internally when a parseable format is required (e.g. taxonomic_path).
func (node *TaxNode) FullString(taxonomyCode string) string {
if node.HasScientificName() {
return fmt.Sprintf("%s:%v [%s]@%s",
taxonomyCode,
*node.id,
node.ScientificName(),
node.Rank(),
)
}
return fmt.Sprintf("%s:%v",
taxonomyCode,
*node.id)
}
// String returns a string representation of the TaxNode, including the taxonomy code, // String returns a string representation of the TaxNode, including the taxonomy code,
// the node ID, and the scientific name. The output format is "taxonomyCode:id [scientificName]". // the node ID, and the scientific name. The output format is "taxonomyCode:id [scientificName]".
// //
@@ -42,19 +60,7 @@ func (node *TaxNode) String(taxonomyCode string) string {
return *node.id return *node.id
} }
if node.HasScientificName() { return node.FullString(taxonomyCode)
return fmt.Sprintf("%s:%v [%s]@%s",
taxonomyCode,
*node.id,
node.ScientificName(),
node.Rank(),
)
}
return fmt.Sprintf("%s:%v",
taxonomyCode,
*node.id)
} }
// Id returns the unique identifier of the TaxNode. // Id returns the unique identifier of the TaxNode.
+6
View File
@@ -24,6 +24,7 @@ var __input_genbank_format__ = false
var __input_fastq_format__ = false var __input_fastq_format__ = false
var __input_fasta_format__ = false var __input_fasta_format__ = false
var __input_csv_format__ = false var __input_csv_format__ = false
var __input_json_format__ = false
var __output_in_fasta__ = false var __output_in_fasta__ = false
var __output_in_fastq__ = false var __output_in_fastq__ = false
@@ -71,6 +72,9 @@ func InputOptionSet(options *getoptions.GetOpt) {
options.BoolVar(&__input_csv_format__, "csv", __input_csv_format__, options.BoolVar(&__input_csv_format__, "csv", __input_csv_format__,
options.Description("Read data following the CSV format.")) options.Description("Read data following the CSV format."))
options.BoolVar(&__input_json_format__, "json", __input_json_format__,
options.Description("Read data following the JSON format."))
options.BoolVar(&__no_ordered_input__, "no-order", __no_ordered_input__, options.BoolVar(&__no_ordered_input__, "no-order", __no_ordered_input__,
options.Description("When several input files are provided, "+ options.Description("When several input files are provided, "+
"indicates that there is no order among them.")) "indicates that there is no order among them."))
@@ -158,6 +162,8 @@ func CLIInputFormat() string {
return "genbank" return "genbank"
case __input_csv_format__: case __input_csv_format__:
return "csv" return "csv"
case __input_json_format__:
return "json"
default: default:
return "guessed" return "guessed"
} }
+7 -1
View File
@@ -73,7 +73,9 @@ func ExpandListOfFiles(check_ext bool, filenames ...string) ([]string, error) {
strings.HasSuffix(path, "dat") || strings.HasSuffix(path, "dat") ||
strings.HasSuffix(path, "dat.gz") || strings.HasSuffix(path, "dat.gz") ||
strings.HasSuffix(path, "ecopcr") || strings.HasSuffix(path, "ecopcr") ||
strings.HasSuffix(path, "ecopcr.gz") { strings.HasSuffix(path, "ecopcr.gz") ||
strings.HasSuffix(path, "json") ||
strings.HasSuffix(path, "json.gz") {
log.Debugf("Appending %s file\n", path) log.Debugf("Appending %s file\n", path)
list_of_files.Add(path) list_of_files.Add(path)
} }
@@ -142,6 +144,8 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
iterator, err = obiformats.ReadFastq(os.Stdin, opts...) iterator, err = obiformats.ReadFastq(os.Stdin, opts...)
case "csv": case "csv":
iterator, err = obiformats.ReadCSV(os.Stdin, opts...) iterator, err = obiformats.ReadCSV(os.Stdin, opts...)
case "json":
iterator, err = obiformats.ReadJSON(os.Stdin, opts...)
default: default:
iterator, err = obiformats.ReadSequencesFromStdin(opts...) iterator, err = obiformats.ReadSequencesFromStdin(opts...)
} }
@@ -163,6 +167,8 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
reader = obiformats.ReadFastaFromFile reader = obiformats.ReadFastaFromFile
case "csv": case "csv":
reader = obiformats.ReadCSVFromFile reader = obiformats.ReadCSVFromFile
case "json":
reader = obiformats.ReadJSONFromFile
case "ecopcr": case "ecopcr":
reader = obiformats.ReadEcoPCRFromFile reader = obiformats.ReadEcoPCRFromFile
case "embl": case "embl":
+1
View File
@@ -33,6 +33,7 @@ func CLIWriteSequenceCSV(iterator obiiter.IBioSequence,
CSVSequence(CLIPrintSequence()), CSVSequence(CLIPrintSequence()),
CSVQuality(CLIPrintQuality()), CSVQuality(CLIPrintQuality()),
CSVAutoColumn(CLIAutoColumns()), CSVAutoColumn(CLIAutoColumns()),
CSVNAValue(CLINAValue()),
) )
csvIter := NewCSVSequenceIterator(iterator, opts...) csvIter := NewCSVSequenceIterator(iterator, opts...)
+13 -1
View File
@@ -1,6 +1,7 @@
package obicsv package obicsv
import ( import (
"fmt"
"log" "log"
"slices" "slices"
@@ -67,8 +68,19 @@ func CSVBatchFromSequences(batch obiiter.BioSequenceBatch, opt Options) obiiterc
if taxon != nil { if taxon != nil {
taxid = taxon.String() taxid = taxon.String()
} else if ta, ok := sequence.GetAttribute("taxid"); ok {
switch tv := ta.(type) {
case string:
taxid = tv
case int:
taxid = fmt.Sprintf("%d", tv)
case float64:
taxid = fmt.Sprintf("%d", int(tv))
default:
taxid = opt.CSVNAValue()
}
} else { } else {
taxid = sequence.Taxid() taxid = opt.CSVNAValue()
} }
record["taxid"] = taxid record["taxid"] = taxid
+1 -2
View File
@@ -46,8 +46,7 @@ func CLIDistributeSequence(sequences obiiter.IBioSequence) {
formater = obiformats.WriteSequencesToFile formater = obiformats.WriteSequencesToFile
} }
dispatcher := sequences.Distribute(CLISequenceClassifier(), dispatcher := sequences.Distribute(CLISequenceClassifier())
obidefault.BatchSize())
obiformats.WriterDispatcher(CLIFileNamePattern(), obiformats.WriterDispatcher(CLIFileNamePattern(),
dispatcher, formater, opts..., dispatcher, formater, opts...,
+1 -1
View File
@@ -170,7 +170,7 @@ func CLISelectLandmarkSequences(iterator obiiter.IBioSequence) obiiter.IBioSeque
for i, seq := range library { for i, seq := range library {
taxon := seq.Taxon(taxo) taxon := seq.Taxon(taxo)
if taxon == nil { if taxon == nil {
log.Fatal("%s: Cannot identify taxid %s in %s", seq.Id(), seq.Taxid(), taxo.Name()) log.Fatalf("%s: Cannot identify taxid %s in %s", seq.Id(), seq.Taxid(), taxo.Name())
} }
taxa.Set(i, taxon) taxa.Set(i, taxon)
} }
+8 -1
View File
@@ -15,7 +15,6 @@ func IExtractBarcode(iterator obiiter.IBioSequence) (obiiter.IBioSequence, error
opts := make([]obingslibrary.WithOption, 0, 10) opts := make([]obingslibrary.WithOption, 0, 10)
opts = append(opts, opts = append(opts,
obingslibrary.OptionAllowedMismatches(CLIAllowedMismatch()),
obingslibrary.OptionAllowedIndel(CLIAllowsIndel()), obingslibrary.OptionAllowedIndel(CLIAllowsIndel()),
obingslibrary.OptionUnidentified(CLIUnidentifiedFileName()), obingslibrary.OptionUnidentified(CLIUnidentifiedFileName()),
obingslibrary.OptionDiscardErrors(!CLIConservedErrors()), obingslibrary.OptionDiscardErrors(!CLIConservedErrors()),
@@ -23,6 +22,14 @@ func IExtractBarcode(iterator obiiter.IBioSequence) (obiiter.IBioSequence, error
obingslibrary.OptionBatchSize(obidefault.BatchSize()), obingslibrary.OptionBatchSize(obidefault.BatchSize()),
) )
// Only propagate the CLI --allowed-mismatches value if the user
// explicitly set it: otherwise the per-primer values defined in
// the NGSFilter config file (@primer_mismatches, @forward_mismatches,
// @reverse_mismatches) must be preserved.
if CLIAllowedMismatchIsSet() {
opts = append(opts, obingslibrary.OptionAllowedMismatches(CLIAllowedMismatch()))
}
ngsfilter, err := CLINGSFIlter() ngsfilter, err := CLINGSFIlter()
if err != nil { if err != nil {
log.Fatalf("%v", err) log.Fatalf("%v", err)
+12
View File
@@ -18,6 +18,7 @@ var _UnidentifiedFile = ""
var _AllowedMismatch = 2 var _AllowedMismatch = 2
var _AllowsIndel = false var _AllowsIndel = false
var _ConservedError = false var _ConservedError = false
var _optionsParser *getoptions.GetOpt
// PCROptionSet defines every options related to a simulated PCR. // PCROptionSet defines every options related to a simulated PCR.
// //
@@ -29,6 +30,8 @@ var _ConservedError = false
// - option : is a pointer to a getoptions.GetOpt instance normaly // - option : is a pointer to a getoptions.GetOpt instance normaly
// produced by the // produced by the
func MultiplexOptionSet(options *getoptions.GetOpt) { func MultiplexOptionSet(options *getoptions.GetOpt) {
_optionsParser = options
options.StringVar(&_NGSFilterFile, "tag-list", _NGSFilterFile, options.StringVar(&_NGSFilterFile, "tag-list", _NGSFilterFile,
options.Alias("s"), options.Alias("s"),
options.Description("File name of the NGSFilter file describing PCRs.")) options.Description("File name of the NGSFilter file describing PCRs."))
@@ -62,6 +65,15 @@ func CLIAllowedMismatch() int {
return _AllowedMismatch return _AllowedMismatch
} }
// CLIAllowedMismatchIsSet returns true if the user explicitly
// specified --allowed-mismatches on the command line, as opposed
// to relying on its default value. This allows per-primer mismatch
// settings from the NGSFilter config file to take precedence unless
// the user explicitly overrides them from the CLI.
func CLIAllowedMismatchIsSet() bool {
return _optionsParser != nil && _optionsParser.Called("allowed-mismatches")
}
func CLIAllowsIndel() bool { func CLIAllowsIndel() bool {
return _AllowsIndel return _AllowsIndel
} }
+4 -2
View File
@@ -21,12 +21,10 @@ func PairingOptionSet(options *getoptions.GetOpt) {
options.StringVar(&_ForwardFile, "forward-reads", "", options.StringVar(&_ForwardFile, "forward-reads", "",
options.Alias("F"), options.Alias("F"),
options.ArgName("FILENAME_F"), options.ArgName("FILENAME_F"),
options.Required("You must provide at a forward file"),
options.Description("The file names containing the forward reads")) options.Description("The file names containing the forward reads"))
options.StringVar(&_ReverseFile, "reverse-reads", "", options.StringVar(&_ReverseFile, "reverse-reads", "",
options.Alias("R"), options.Alias("R"),
options.ArgName("FILENAME_R"), options.ArgName("FILENAME_R"),
options.Required("You must provide a reverse file"),
options.Description("The file names containing the reverse reads")) options.Description("The file names containing the reverse reads"))
options.IntVar(&_Delta, "delta", _Delta, options.IntVar(&_Delta, "delta", _Delta,
options.Alias("D"), options.Alias("D"),
@@ -72,6 +70,10 @@ func CLIPairedSequence() (obiiter.IBioSequence, error) {
return paired, nil return paired, nil
} }
func CLIHasPairedFiles() bool {
return _ForwardFile != "" && _ReverseFile != ""
}
func CLIDelta() int { func CLIDelta() int {
return _Delta return _Delta
} }
+27 -3
View File
@@ -99,6 +99,17 @@ func (data1 *DataSummary) Add(data2 *DataSummary) *DataSummary {
rep.sample_singletons = sumUpdateIntMap(data1.sample_singletons, data2.sample_singletons) rep.sample_singletons = sumUpdateIntMap(data1.sample_singletons, data2.sample_singletons)
rep.sample_obiclean_bad = sumUpdateIntMap(data1.sample_obiclean_bad, data2.sample_obiclean_bad) rep.sample_obiclean_bad = sumUpdateIntMap(data1.sample_obiclean_bad, data2.sample_obiclean_bad)
for k, m1 := range data1.map_summaries {
rep.map_summaries[k] = m1
}
for k, m2 := range data2.map_summaries {
if m1, ok := rep.map_summaries[k]; ok {
rep.map_summaries[k] = sumUpdateIntMap(m1, m2)
} else {
rep.map_summaries[k] = m2
}
}
return rep return rep
} }
@@ -163,8 +174,9 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
summaries := make([]*DataSummary, nproc) summaries := make([]*DataSummary, nproc)
for n := 0; n < nproc; n++ { for n := 0; n < nproc; n++ {
summaries[n] = NewDataSummary()
for _, v := range summarise { for _, v := range summarise {
summaries[n].map_summaries[v] = make(map[string]int, 0) summaries[n].map_summaries[v] = make(map[string]int)
} }
} }
@@ -174,6 +186,11 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
batch := iseq.Get() batch := iseq.Get()
for _, seq := range batch.Slice() { for _, seq := range batch.Slice() {
summary.Update(seq) summary.Update(seq)
for _, attr := range summarise {
if m, ok := seq.GetIntMap(attr); ok {
summary.map_summaries[attr] = sumUpdateIntMap(summary.map_summaries[attr], m)
}
}
} }
} }
waiter.Done() waiter.Done()
@@ -181,11 +198,9 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
waiter.Add(nproc) waiter.Add(nproc)
summaries[0] = NewDataSummary()
go ff(iterator, summaries[0]) go ff(iterator, summaries[0])
for i := 1; i < nproc; i++ { for i := 1; i < nproc; i++ {
summaries[i] = NewDataSummary()
go ff(iterator.Split(), summaries[i]) go ff(iterator.Split(), summaries[i])
} }
@@ -246,5 +261,14 @@ func ISummary(iterator obiiter.IBioSequence, summarise []string) map[string]inte
} }
} }
} }
if len(rep.map_summaries) > 0 {
mapDict := make(map[string]interface{}, len(rep.map_summaries))
for attr, counts := range rep.map_summaries {
mapDict[attr] = counts
}
dict["map_summaries"] = mapDict
}
return dict return dict
} }
+5 -5
View File
@@ -55,7 +55,7 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
ngsfilter.SetAllowsIndels(true) ngsfilter.SetAllowsIndels(true)
} }
if obimultiplex.CLIAllowedMismatch() > 0 { if obimultiplex.CLIAllowedMismatchIsSet() {
ngsfilter.SetAllowedMismatches(obimultiplex.CLIAllowedMismatch()) ngsfilter.SetAllowedMismatches(obimultiplex.CLIAllowedMismatch())
} }
@@ -114,10 +114,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
aanot["obimultiplex_direction"] = direction aanot["obimultiplex_direction"] = direction
aanot["obimultiplex_forward_match"] = forward_match aanot["obimultiplex_forward_match"] = forward_match
aanot["obimultiplex_forward_mismatches"] = forward_mismatches aanot["obimultiplex_forward_error"] = forward_mismatches
aanot["obimultiplex_reverse_match"] = reverse_match aanot["obimultiplex_reverse_match"] = reverse_match
aanot["obimultiplex_reverse_mismatches"] = reverse_mismatches aanot["obimultiplex_reverse_error"] = reverse_mismatches
aanot["sample"] = sample aanot["sample"] = sample
aanot["experiment"] = experiment aanot["experiment"] = experiment
@@ -125,10 +125,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
banot["obimultiplex_direction"] = direction banot["obimultiplex_direction"] = direction
banot["obimultiplex_forward_match"] = forward_match banot["obimultiplex_forward_match"] = forward_match
banot["obimultiplex_forward_mismatches"] = forward_mismatches banot["obimultiplex_forward_error"] = forward_mismatches
banot["obimultiplex_reverse_match"] = reverse_match banot["obimultiplex_reverse_match"] = reverse_match
banot["obimultiplex_reverse_mismatches"] = reverse_mismatches banot["obimultiplex_reverse_error"] = reverse_mismatches
banot["sample"] = sample banot["sample"] = sample
banot["experiment"] = experiment banot["experiment"] = experiment
+38
View File
@@ -276,6 +276,44 @@ func InterfaceToStringMap(i interface{}) (val map[string]string, err error) {
return return
} }
func InterfaceToMapOfIntSlice(i interface{}) (val map[string][]int, err error) {
err = nil
switch m := i.(type) {
case map[string][]int:
val = m
case map[string]interface{}:
val = make(map[string][]int, len(m))
for k, v := range m {
val[k], err = InterfaceToIntSlice(v)
if err != nil {
return
}
}
default:
err = &NotAMapInt{"value attribute cannot be casted to a map[string][]int"}
}
return
}
func InterfaceToMapOfStringSlice(i interface{}) (val map[string][]string, err error) {
err = nil
switch m := i.(type) {
case map[string][]string:
val = m
case map[string]interface{}:
val = make(map[string][]string, len(m))
for k, v := range m {
val[k], err = InterfaceToStringSlice(v)
if err != nil {
return
}
}
default:
err = &NotAMapInt{"value attribute cannot be casted to a map[string][]string"}
}
return
}
func InterfaceToStringSlice(i interface{}) (val []string, err error) { func InterfaceToStringSlice(i interface{}) (val []string, err error) {
err = nil err = nil
+6
View File
@@ -102,6 +102,11 @@ func RegisterOBIMimeType() {
return ok return ok
} }
jsonDetector := func(raw []byte, limit uint32) bool {
raw = bytes.TrimLeft(raw, " \t\r\n")
return len(raw) > 0 && (raw[0] == '[' || raw[0] == '{')
}
mimetype.Lookup("text/plain").Extend(fastaDetector, "text/fasta", ".fasta") mimetype.Lookup("text/plain").Extend(fastaDetector, "text/fasta", ".fasta")
mimetype.Lookup("text/plain").Extend(fastqDetector, "text/fastq", ".fastq") mimetype.Lookup("text/plain").Extend(fastqDetector, "text/fastq", ".fastq")
mimetype.Lookup("text/plain").Extend(ecoPCR2Detector, "text/ecopcr2", ".ecopcr") mimetype.Lookup("text/plain").Extend(ecoPCR2Detector, "text/ecopcr2", ".ecopcr")
@@ -115,6 +120,7 @@ func RegisterOBIMimeType() {
mimetype.Lookup("application/octet-stream").Extend(genbankDetector, "text/genbank", ".seq") mimetype.Lookup("application/octet-stream").Extend(genbankDetector, "text/genbank", ".seq")
mimetype.Lookup("application/octet-stream").Extend(emblDetector, "text/embl", ".dat") mimetype.Lookup("application/octet-stream").Extend(emblDetector, "text/embl", ".dat")
mimetype.Lookup("application/octet-stream").Extend(csv, "text/csv", ".csv") mimetype.Lookup("application/octet-stream").Extend(csv, "text/csv", ".csv")
mimetype.Lookup("application/octet-stream").Extend(jsonDetector, "application/json", ".json")
} }
__obimimetype_registred__ = true __obimimetype_registred__ = true
} }
+365 -4
View File
@@ -34,6 +34,26 @@ func MinMaxSlice[T constraints.Ordered](vec []T) (min, max T) {
return return
} }
func FilterMinSlice[T constraints.Ordered](vec []T, minimum T) []T {
result := make([]T, 0, len(vec))
for _, v := range vec {
if v >= minimum {
result = append(result, v)
}
}
return result
}
func FilterMaxSlice[T constraints.Ordered](vec []T, maximum T) []T {
result := make([]T, 0, len(vec))
for _, v := range vec {
if v <= maximum {
result = append(result, v)
}
}
return result
}
func MaxMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) { func MaxMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
var maxKey K var maxKey K
var maxValue T var maxValue T
@@ -73,6 +93,46 @@ func MinMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
return minKey, minValue, nil return minKey, minValue, nil
} }
func FilterMinMap[K comparable, T constraints.Ordered](values map[K]T, minimum T) map[K]T {
result := make(map[K]T)
for k, v := range values {
if v >= minimum {
result[k] = v
}
}
return result
}
func FilterMaxMap[K comparable, T constraints.Ordered](values map[K]T, maximum T) map[K]T {
result := make(map[K]T)
for k, v := range values {
if v <= maximum {
result[k] = v
}
}
return result
}
func SaturatingSubSlice[T Numeric](vec []T, sub T) []T {
result := make([]T, len(vec))
for i, v := range vec {
if v > sub {
result[i] = v - sub
}
}
return result
}
func SaturatingSubMap[K comparable, T Numeric](values map[K]T, sub T) map[K]T {
result := make(map[K]T)
for k, v := range values {
if v > sub {
result[k] = v - sub
}
}
return result
}
// Min returns the smallest element in a slice/array or map, // Min returns the smallest element in a slice/array or map,
// or the value itself if data is a single comparable value. // or the value itself if data is a single comparable value.
// Returns an error if the container is empty or the type is unsupported. // Returns an error if the container is empty or the type is unsupported.
@@ -135,11 +195,121 @@ func Max(data interface{}) (interface{}, error) {
} }
} }
func FilterMin(data interface{}, minimum interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return filterMinFromIterable(v, minimum)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return filterMinFromMap(v, minimum)
default:
if !isOrderedKind(v.Kind()) {
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
return data, nil
}
}
func FilterMax(data interface{}, maximum interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return filterMaxFromIterable(v, maximum)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return filterMaxFromMap(v, maximum)
default:
if !isOrderedKind(v.Kind()) {
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
return data, nil
}
}
func SaturatingSub(data interface{}, sub interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
return saturatingSubFromIterable(v, sub)
case reflect.Map:
return saturatingSubFromMap(v, sub)
default:
if !isNumericKind(v.Kind()) {
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
r, err := saturatingSubValues(v, reflect.ValueOf(sub))
if err != nil {
return nil, err
}
return r.Interface(), nil
}
}
func saturatingSubFromIterable(v reflect.Value, sub interface{}) (interface{}, error) {
subVal := reflect.ValueOf(sub)
result := reflect.MakeSlice(v.Type(), v.Len(), v.Len())
for i := 0; i < v.Len(); i++ {
r, err := saturatingSubValues(v.Index(i), subVal)
if err != nil {
return nil, err
}
result.Index(i).Set(r)
}
return result.Interface(), nil
}
func saturatingSubFromMap(v reflect.Value, sub interface{}) (interface{}, error) {
subVal := reflect.ValueOf(sub)
result := reflect.MakeMap(v.Type())
for _, key := range v.MapKeys() {
r, err := saturatingSubValues(v.MapIndex(key), subVal)
if err != nil {
return nil, err
}
if !r.IsZero() {
result.SetMapIndex(key, r)
}
}
return result.Interface(), nil
}
func saturatingSubValues(a, b reflect.Value) (reflect.Value, error) {
result := reflect.New(a.Type()).Elem()
switch a.Kind() {
case reflect.Int, reflect.Int8, reflect.Int16, reflect.Int32, reflect.Int64:
if av, bv := a.Int(), b.Int(); av > bv {
result.SetInt(av - bv)
}
case reflect.Uint, reflect.Uint8, reflect.Uint16, reflect.Uint32, reflect.Uint64:
if av, bv := a.Uint(), b.Uint(); av > bv {
result.SetUint(av - bv)
}
case reflect.Float32, reflect.Float64:
if av, bv := a.Float(), b.Float(); av > bv {
result.SetFloat(av - bv)
}
default:
return reflect.Value{}, fmt.Errorf("unsupported type for saturating subtraction: %s", a.Kind())
}
return result, nil
}
// maxFromIterable scans a slice/array to find the maximum. // maxFromIterable scans a slice/array to find the maximum.
func maxFromIterable(v reflect.Value) (interface{}, error) { func maxFromIterable(v reflect.Value) (interface{}, error) {
var best reflect.Value var best reflect.Value
for i := 0; i < v.Len(); i++ { for i := 0; i < v.Len(); i++ {
elem := v.Index(i) elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) { if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind()) return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
} }
@@ -154,7 +324,7 @@ func maxFromIterable(v reflect.Value) (interface{}, error) {
func minFromIterable(v reflect.Value) (interface{}, error) { func minFromIterable(v reflect.Value) (interface{}, error) {
var minVal reflect.Value var minVal reflect.Value
for i := 0; i < v.Len(); i++ { for i := 0; i < v.Len(); i++ {
elem := v.Index(i) elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) { if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind()) return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
} }
@@ -165,12 +335,182 @@ func minFromIterable(v reflect.Value) (interface{}, error) {
return minVal.Interface(), nil return minVal.Interface(), nil
} }
func filterMinFromIterable(v reflect.Value, minimum interface{}) (interface{}, error) {
minVal := reflect.ValueOf(minimum)
result := reflect.MakeSlice(v.Type(), 0, v.Len())
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !less(elem, minVal) { // elem >= minimum
result = reflect.Append(result, elem)
}
}
return result.Interface(), nil
}
func filterMaxFromIterable(v reflect.Value, maximum interface{}) (interface{}, error) {
maxVal := reflect.ValueOf(maximum)
result := reflect.MakeSlice(v.Type(), 0, v.Len())
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !greater(elem, maxVal) { // elem <= maximum
result = reflect.Append(result, elem)
}
}
return result.Interface(), nil
}
// whichMaxFromIterable returns the index of the maximum element in a slice/array.
func whichMaxFromIterable(v reflect.Value) (int, error) {
var best reflect.Value
bestIdx := 0
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if i == 0 || greater(elem, best) {
best = elem
bestIdx = i
}
}
return bestIdx, nil
}
// whichMinFromIterable returns the index of the minimum element in a slice/array.
func whichMinFromIterable(v reflect.Value) (int, error) {
var minVal reflect.Value
minIdx := 0
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if i == 0 || less(elem, minVal) {
minVal = elem
minIdx = i
}
}
return minIdx, nil
}
// whichMaxFromMap returns the key associated with the maximum value in a map.
func whichMaxFromMap(v reflect.Value) (interface{}, error) {
var best reflect.Value
var bestKey reflect.Value
first := true
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if first || greater(elem, best) {
best = elem
bestKey = key
first = false
}
}
return bestKey.Interface(), nil
}
// whichMinFromMap returns the key associated with the minimum value in a map.
func whichMinFromMap(v reflect.Value) (interface{}, error) {
var minVal reflect.Value
var minKey reflect.Value
first := true
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if first || less(elem, minVal) {
minVal = elem
minKey = key
first = false
}
}
return minKey.Interface(), nil
}
// WhichMax returns the key (for a map) or index (for a slice/array) of the maximum value.
func WhichMax(data interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return whichMaxFromIterable(v)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return whichMaxFromMap(v)
default:
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
}
// WhichMin returns the key (for a map) or index (for a slice/array) of the minimum value.
func WhichMin(data interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return whichMinFromIterable(v)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return whichMinFromMap(v)
default:
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
}
func filterMinFromMap(v reflect.Value, minimum interface{}) (interface{}, error) {
minVal := reflect.ValueOf(minimum)
result := reflect.MakeMap(v.Type())
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !less(elem, minVal) { // elem >= minimum
result.SetMapIndex(key, elem)
}
}
return result.Interface(), nil
}
func filterMaxFromMap(v reflect.Value, maximum interface{}) (interface{}, error) {
maxVal := reflect.ValueOf(maximum)
result := reflect.MakeMap(v.Type())
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !greater(elem, maxVal) { // elem <= maximum
result.SetMapIndex(key, elem)
}
}
return result.Interface(), nil
}
// maxFromMap scans map values to find the maximum. // maxFromMap scans map values to find the maximum.
func maxFromMap(v reflect.Value) (interface{}, error) { func maxFromMap(v reflect.Value) (interface{}, error) {
var best reflect.Value var best reflect.Value
first := true first := true
for _, key := range v.MapKeys() { for _, key := range v.MapKeys() {
elem := v.MapIndex(key) elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) { if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind()) return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
} }
@@ -187,7 +527,7 @@ func minFromMap(v reflect.Value) (interface{}, error) {
var minVal reflect.Value var minVal reflect.Value
first := true first := true
for _, key := range v.MapKeys() { for _, key := range v.MapKeys() {
elem := v.MapIndex(key) elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) { if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind()) return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
} }
@@ -199,6 +539,27 @@ func minFromMap(v reflect.Value) (interface{}, error) {
return minVal.Interface(), nil return minVal.Interface(), nil
} }
func isNumericKind(k reflect.Kind) bool {
switch k {
case reflect.Int, reflect.Int8, reflect.Int16, reflect.Int32, reflect.Int64,
reflect.Uint, reflect.Uint8, reflect.Uint16, reflect.Uint32, reflect.Uint64,
reflect.Float32, reflect.Float64:
return true
default:
return false
}
}
// unwrapInterface returns v.Elem() when v holds an interface value, otherwise v unchanged.
// This is necessary when iterating map[string]interface{} or []interface{} via reflection:
// the element Kind is reflect.Interface, not the underlying concrete type.
func unwrapInterface(v reflect.Value) reflect.Value {
if v.Kind() == reflect.Interface {
return v.Elem()
}
return v
}
// isOrderedKind reports whether k supports comparison ordering. // isOrderedKind reports whether k supports comparison ordering.
func isOrderedKind(k reflect.Kind) bool { func isOrderedKind(k reflect.Kind) bool {
switch k { switch k {
+302
View File
@@ -0,0 +1,302 @@
# Objective
Fully document OBITools (version 4, written in Go) in English, using a 4‑phase incremental pipeline.
You **MUST** use the available MCP servers:
- `cclsp` – exact definitions, references, diagnostics
- `jcodemunch` – code indexing, symbol extraction
- `treesitter` – AST and CLI parsing
- `context7` – external documentation
All tool calls must follow the exact API described in the MCP server documentation. If a required tool is unavailable, you **MUST** log the error and stop execution.
### Tool call format (CRITICAL)
Tool calls **MUST** use this exact XML format — no spaces inside the angle brackets:
```
<function=tool_name>
{"param": "value"}
</function>
```
**FORBIDDEN** — these variants will cause parse errors and must NEVER be used:
- `< function=tool_name >` (spaces around the tag name)
- `< function = tool_name>` (spaces around `=`)
- `<function = tool_name>` (space before `=`)
The opening tag is `<function=tool_name>` with **zero spaces** inside `<` and `>`.
---
# Global rules
** You are not allowed to read twice the same file in a row. **
## Language
- All generated documentation **MUST** be in English.
- If an existing documentation file is in French:
1. Translate it to English
2. Save the original as `.fr.md` **before** overwriting
3. Write the new English version
---
## Execution mode (STRICT)
You are operating in **STRICT TOOL MODE**:
- If a file must be written, you **MUST** use the `Shell` tool.
- You **MUST NOT** read entire directory listings into memory.
- You **MUST** work with **one item at a time** using a simple text file as a task queue.
### Reading files before writing
- **Before writing to an existing documentation file**, you must first read it using the `Read` tool.
- **When documenting a single Go source file**, you only need to read that one file (plus up to 4-5 helper files if needed for context).
- Do NOT read the entire codebase - only what is necessary to document the current file.
---
### Rules
- Always write the **full** file (no partial updates).
- Paths are relative to the project root; directories are created implicitly.
- Content must be valid UTF‑8; use `\n` line endings.
- Do **not** wrap content in backticks.
---
## Progress tracking: task queue files
We use **line‑oriented task files** to avoid loading large lists into memory. Each phase has its own task file:
- `docs/todo/phase1.txt` – list of Go files (one per line) to document.
- `docs/todo/phase1bis.txt` – same list, but after phase1 is done.
- `docs/todo/phase2.txt` – list of packages.
- `docs/todo/phase3.txt` – list of tools.
**How it works:**
1. At the start of a phase, if the task file does not exist, it is created by scanning the codebase once (Phase 0 or Phase X init).
2. **Each run of the LLM processes only the first line of the task file.**
3. After processing the item (success or permanent failure), the line is removed from the task file.
- On success, the line is deleted (no extra sentinel file needed).
- On transient failure (retry < 3), we keep the line but increment a retry counter stored in a separate file.
- On permanent failure (retry ≥ 3), we move the line to a `failed.txt` file and log the error.
4. The LLM then exits (or continues if the task file is still non‑empty, but it must never load more than one line).
This way, the LLM’s context never holds more than a single task at a time.
### Retry mechanism
For each item (e.g., `internal/align/align.go`), we maintain a retry counter in:
- `docs/retry/phase1/internal/align/align.go.count`
If the file does not exist, retries = 0.
Each time processing fails, we increment the counter (write the new number).
If after increment the counter < 3, we keep the line in the task file.
If counter reaches 3, we **remove the line from the task file**, add it to `docs/failed/phase1/internal/align/align.go.failed` (just a marker), and log the error.
---
## Documentation quality requirements (CRITICAL)
Documentation MUST NOT be superficial. For each documented element (file, function, struct, package):
### You MUST explain:
- what it does
- why it exists (context, problem solved)
- how it is used
- assumptions and preconditions
- possible edge cases
### Forbidden patterns
- Vague phrases like “This function handles…”, “Utility for…”, “Helper function…”.
- Generic descriptions that could apply to any project.
### Required content per element type
- Functions:
- Purpose
- Parameter meaning
- Return values
- Notable behaviour (panic conditions, side effects, concurrency)
- Structs:
- Role in the system
- Meaning of key fields
- Files:
- Role within the package
- Interactions with other files
### Anti‑generic rule
If the description could apply to any project, it is INVALID. You MUST include domain‑specific context (bioinformatics, sequence processing, etc.) and concrete behaviour.
### Quality validation
Before marking an item as done (i.e., creating the .done sentinel), you MUST perform a self‑validation:
- Check that all required sections are present.
- Verify that no forbidden patterns remain.
If validation fails, increment the retry counter and keep the item pending.
---
# Directory structure
```
docs/
todo/ # task queues
phase1.txt
phase1bis.txt
phase2.txt
phase3.txt
retry/ # retry counters
phase1/ # mirrors file structure
internal/align/align.go.count
phase1bis/
phase2/
phase3/
failed/ # permanent failure markers
phase1/
internal/align/align.go.failed
phase1bis/
phase2/
phase3/
phase1/ # actual documentation
<relative_path>/<file>.go.md
phase2/
<package>.md
phase3/
<tool>.md
error.log
```
---
# Phase 0: Initialization
1. Ensure required directories exist: `docs/todo`, `docs/retry`, `docs/failed`, `docs/phase1`, `docs/phase2`, `docs/phase3`.
2. **If `docs/todo/phase1.txt` does not exist**:
- Use `find pkg -name "*.go" ! -name "*_test.go" ! -path "*/cmd/*"` to list all Go files (excluding tests and main.go).
- Write the list (one relative path per line, e.g., `internal/align/align.go`) to `docs/todo/phase1.txt`.
3. Do the same for phase2 and phase3 later when those phases start.
4. **No other state is stored.**
---
# Phase 1: File documentation
**Processing rule:**
- Read the **first line** of `docs/todo/phase1.txt` (using `head -n 1`).
- If the file is empty, Phase 1 is complete → proceed to Phase 1bis initialization.
- Otherwise, process that single file.
**Processing a file:**
1. Let `relpath` be the line content (e.g., `internal/align/align.go`).
2. Check if a permanent failure marker exists at `docs/failed/phase1/${relpath}.failed`. If yes, remove the line from the task file and skip (line will be deleted).
3. If the documentation file `docs/phase1/${relpath}.go.md` exists go directly to its validation (step 6).
4. Otherwise, generate documentation for that file (using MCP tools as before).
5. Write the documentation to `docs/phase1/${relpath}.go.md`.
6. Validate quality.
7. If validation succeeds:
- Remove the line from the task file.
- Remove any retry counter file for this item.
- (No sentinel needed; the removal from todo indicates completion.)
8. If validation fails:
- Increment retry counter:
- If `docs/retry/phase1/${relpath}.count` does not exist, set to 1.
- Else read it, add 1, write back.
- If new counter >= 3:
- Remove line from task file.
- Create `docs/failed/phase1/${relpath}.failed`.
- Log error.
- If new counter < 3:
- Keep the line in the task file (do nothing, it stays as first line for next run).
9. **Exit** (or stop if this was a single run). The next invocation will read the first line again (same if retry, or next if removed).
**Important:**
- Do **not** read more than one line.
- Do **not** attempt to process multiple items in one run.
- The LLM should finish after handling one item.
---
# Phase 1bis: Review and harmonization
When Phase 1 is complete (i.e., `docs/todo/phase1.txt` empty), we initialize `docs/todo/phase1bis.txt` with the same list of files (the ones that succeeded).
But note: we need to know which files were successfully documented. Since we removed lines from `phase1.txt` on success, we need a record. The simplest is to reuse the same list but we can generate it by listing the existing `.go.md` files in `docs/phase1/` (since every successful file has a `.go.md`).
Thus, Phase 1bis initialization:
- If `docs/todo/phase1bis.txt` does not exist, create it by listing all `.go.md` files under `docs/phase1/`, stripping the `docs/phase1/` prefix and the `.go.md` suffix, and writing the relative path (same format as phase1).
Then processing is identical to Phase 1, but using `docs/todo/phase1bis.txt` and output is overwriting the same `.go.md` files (with improvements). Retry counters go in `docs/retry/phase1bis/`.
---
# Phase 2: Package documentation
When Phase 1bis is complete (`docs/todo/phase1bis.txt` empty), initialize `docs/todo/phase2.txt`:
- List all packages: unique directories under `pkg/` that contain at least one `.go` file and are not tools.
- Write each package identifier (e.g., `align`, `internal/align`) as a line.
Processing: read first line, generate `docs/phase2/<package>.md`, validate, remove line on success, retry logic in `docs/retry/phase2/`.
---
# Phase 3: Tool documentation
When Phase 2 complete, initialize `docs/todo/phase3.txt`:
- List all directories under `cmd/` that contain a `main.go`. Write each tool name as a line.
Processing: read first line, generate `docs/phase3/<tool>.md`, validate, remove line on success, retry logic in `docs/retry/phase3/`.
---
# Finalization
When all task files are empty and no pending phases, generate `docs/README.md` by:
- Listing all package docs (files in `docs/phase2/`) and linking.
- Listing all tool docs (files in `docs/phase3/`) and linking.
Write using `Shell`.
---
# Execution flow summary
1. **Phase 0**: Create directories and initial `todo/phase1.txt` if missing. Exit.
2. **Phase 1**:
- If `todo/phase1.txt` exists and non‑empty → process first line.
- Else → move to Phase 1bis initialization.
3. **Phase 1bis**:
- If `todo/phase1bis.txt` does not exist → create from successful phase1 docs.
- If non‑empty → process first line.
- Else → move to Phase 2 initialization.
4. **Phase 2**: similar.
5. **Phase 3**: similar.
6. **Finalization**: generate README.
The LLM should be invoked repeatedly (e.g., by a scheduler) until all phases are done. Each invocation processes exactly one item.
---
# Important reminders
- Always call `Shell` to write files; never output content in plain text.
- Validate quality before removing a line from the task file.
- Log all failures to `docs/error.log` in JSON lines format.
- If any MCP tool fails, treat as failure and increment retry counter.
- Never read more than one line from a task file in a single run.
+222
View File
@@ -0,0 +1,222 @@
//go:build ignore
package main
import (
"encoding/json"
"fmt"
"os"
"os/exec"
"path/filepath"
"regexp"
"sort"
"strconv"
"strings"
)
type Reference struct {
File string `json:"file"`
Line int `json:"line"`
Column int `json:"column"`
Key string `json:"key"`
Function string `json:"function"`
Context string `json:"context"`
}
type Result struct {
Method string `json:"method"`
Signature string `json:"signature"`
Definition string `json:"definition"`
References []Reference `json:"references"`
Total int `json:"total"`
}
var basePath = "/Users/coissac/Sync/travail/__MOI__/GO/obitools4"
func main() {
cmd := exec.Command("rg", "-n", `\.SetAttribute\(`, basePath+"/pkg", "--type", "go")
output, err := cmd.Output()
if err != nil {
fmt.Fprintf(os.Stderr, "Error running rg: %v\n", err)
os.Exit(1)
}
lines := strings.Split(string(output), "\n")
lineRe := regexp.MustCompile(`^(.+?):(\d+):\s*(.+)$`)
keyRe := regexp.MustCompile(`SetAttribute\("([^"]+)"`)
templateKeyRe := regexp.MustCompile(`SetAttribute\("([^"]+)[^"]*"\s*,`)
var refs []Reference
seen := make(map[string]bool)
for _, line := range lines {
line = strings.TrimSpace(line)
if line == "" {
continue
}
matches := lineRe.FindStringSubmatch(line)
if matches == nil {
continue
}
file := matches[1]
lineNum, _ := strconv.Atoi(matches[2])
context := strings.TrimSpace(matches[3])
// Skip definition
if strings.Contains(file, "obiseq/attributes.go") && lineNum == 132 {
continue
}
// Extract key
var key string
if keyMatches := keyRe.FindStringSubmatch(context); keyMatches != nil {
key = keyMatches[1]
} else if tmplMatches := templateKeyRe.FindStringSubmatch(context); tmplMatches != nil {
key = tmplMatches[1]
} else {
continue
}
// Get function name using treesitter
funcName := getFunctionNameTreesitter(file, lineNum)
uniqueKey := fmt.Sprintf("%s:%d", file, lineNum)
if seen[uniqueKey] {
continue
}
seen[uniqueKey] = true
refs = append(refs, Reference{
File: filepath.Base(file),
Line: lineNum,
Column: 0,
Key: key,
Function: funcName,
Context: context,
})
}
sort.Slice(refs, func(i, j int) bool {
if refs[i].File != refs[j].File {
return refs[i].File < refs[j].File
}
return refs[i].Line < refs[j].Line
})
result := Result{
Method: "SetAttribute",
Signature: "func (s *BioSequence) SetAttribute(key string, value interface{})",
Definition: basePath + "/pkg/obiseq/attributes.go:132",
References: refs,
Total: len(refs),
}
outputJSON, err := json.MarshalIndent(result, "", " ")
if err != nil {
fmt.Fprintf(os.Stderr, "Error marshaling JSON: %v\n", err)
os.Exit(1)
}
fmt.Println(string(outputJSON))
}
// getFunctionNameTreesitter uses the treesitter_cursor_walk tool to get the containing function
func getFunctionNameTreesitter(file string, targetLine int) string {
// Convert to 0-based for treesitter
row := targetLine - 1
// Use treesitter cursor walk to get ancestors
cmd := exec.Command("bash", "-c",
fmt.Sprintf(`kilo treesitter_cursor_walk --file_path %q --row %d --column 0 --max_depth 10 2>/dev/null`, file, row))
output, err := cmd.Output()
if err != nil {
return findContainingFunction(file, targetLine)
}
// Parse the JSON output to find function_declaration or method_declaration
var result map[string]interface{}
if err := json.Unmarshal(output, &result); err != nil {
return findContainingFunction(file, targetLine)
}
// Check ancestors for function declaration
if ancestors, ok := result["ancestors"].([]interface{}); ok {
for _, a := range ancestors {
if anc, ok := a.(map[string]interface{}); ok {
nodeType, _ := anc["type"].(string)
if nodeType == "function_declaration" || nodeType == "method_declaration" {
// Try to get the function name from children
if children, ok := anc["children"].([]interface{}); ok {
for _, c := range children {
if child, ok := c.(map[string]interface{}); ok {
childType, _ := child["type"].(string)
if childType == "identifier" {
if text, ok := child["text"].(string); ok {
return text
}
}
if childType == "field_identifier" {
if text, ok := child["text"].(string); ok {
return text
}
}
}
}
}
}
if nodeType == "func_literal" {
return "closure"
}
}
}
}
return findContainingFunction(file, targetLine)
}
func findContainingFunction(file string, targetLine int) string {
data, err := os.ReadFile(file)
if err != nil {
return ""
}
lines := strings.Split(string(data), "\n")
for i := targetLine - 1; i >= 0 && i >= targetLine-200; i-- {
if i >= len(lines) {
continue
}
line := strings.TrimSpace(lines[i])
if line == "}" && i > 0 {
for j := i - 1; j >= 0 && j >= i-50; j-- {
if j >= len(lines) {
continue
}
funcLine := strings.TrimSpace(lines[j])
if strings.HasPrefix(funcLine, "func ") {
if match := regexp.MustCompile(`func\s+\([^)]+\)\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(funcLine); match != nil {
return match[1]
}
if match := regexp.MustCompile(`func\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(funcLine); match != nil {
return match[1]
}
}
}
continue
}
if strings.HasPrefix(line, "func ") {
if match := regexp.MustCompile(`func\s+\([^)]+\)\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(line); match != nil {
return match[1]
}
if match := regexp.MustCompile(`func\s+([a-zA-Z_][a-zA-Z0-9_]*)\s*\(`).FindStringSubmatch(line); match != nil {
return match[1]
}
}
}
return ""
}
+36
View File
@@ -0,0 +1,36 @@
#!/bin/bash
basePath="/Users/coissac/Sync/travail/__MOI__/GO/obitools4"
OUTPUT_FILE="${1:-/dev/stdout}"
# Get all SetAttribute calls
rg -n '\.SetAttribute\(' "$basePath/pkg" --type go | while read -r line; do
file="${line%%:*}"
line_num="${line%:*}"
line_num="${line_num##*:}"
context="${line##*: }"
# Extract key (only literal strings)
key=$(echo "$context" | sed -n 's/.*SetAttribute("\([^"]*\)".*/\1/p')
[ -z "$key" ] && continue
# Get function name using treesitter
func=$(kilo treesitter_cursor_walk \
--file_path "$file" \
--row "$((line_num - 1))" \
--column 0 \
--max_depth 10 2>/dev/null |
jq -r '.ancestors[] | select(.type == "function_declaration" or .type == "method_declaration") | .children[] | select(.type == "identifier" or .type == "field_identifier") | .text' 2>/dev/null)
# Fallback to func_literal for closures
if [ -z "$func" ]; then
func=$(kilo treesitter_cursor_walk \
--file_path "$file" \
--row "$((line_num - 1))" \
--column 0 \
--max_depth 10 2>/dev/null |
jq -r '.ancestors[] | select(.type == "func_literal") | "closure"' 2>/dev/null)
fi
echo "$(basename "$file")|$line_num|$key|${func:-unknown}|$context"
done | sort -t'|' -k1,1 -k2,2n
+308
View File
@@ -0,0 +1,308 @@
{
"obiannotate": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
],
"(git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter.IBioSequence).NumberSequences$1": [
"seq_number"
]
},
"obiclean": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obicleandb": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
"count"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obicomplement": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obiconsensus": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
"count"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
],
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.BuildConsensus": [
"obiconsensus_kmer_max_occur",
"obiconsensus_filtered_graph_size",
"obiconsensus_full_graph_size",
"obiconsensus_consensus",
"obiconsensus_weight",
"obiconsensus_seq_length",
"obiconsensus_kmer_size"
],
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.MinionClusterDenoise": [
"obiconsensus_consensus"
],
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconsensus.MinionDenoise$1": [
"obiconsensus_consensus",
"obiconsensus_weight"
]
},
"obiconvert": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obicount": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obicsv": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obidemerge": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obidistribute": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obigrep": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obijoin": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obikmermatch": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obikmersimcount": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obilandmark": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCoordinate": [
"landmark_coord"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagGeomRefIndex": [
"obitag_geomref_index"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
],
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obilandmark.CLISelectLandmarkSequences": [
"landmark_id"
]
},
"obimatrix": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obimicrosat": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obimultiplex": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obipairing": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._revcmpMutation": [
"pairing_mismatches"
],
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign.BuildQualityConsensus": [
"pairing_mismatches"
]
},
"obipcr": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obireffamidx": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagRefIndex": [
"obitag_ref_index"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
],
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obirefidx.IndexFamilyDB": [
"reffamidx_id"
]
},
"obirefidx": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetOBITagRefIndex": [
"obitag_ref_index"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obiscript": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obisplit": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obisummary": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obitag": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetPath": [
"taxonomic_path"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
},
"obitagpcr": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obingslibrary.NGSLibrary).ExtractMultiBarcode": [
"obimultiplex_error",
"obimultiplex_amplicon_rank"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._revcmpMutation": [
"pairing_mismatches"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence)._subseqMutation": [
"pairing_mismatches"
],
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obialign.BuildQualityConsensus": [
"pairing_mismatches"
]
},
"obitaxonomy": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetPath": [
"taxonomic_path"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
],
"(git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter.IBioSequence).NumberSequences$1": [
"seq_number"
]
},
"obiuniq": {
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetCount": [
"count"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetDefinition": [
"definition"
],
"(*git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq.BioSequence).SetTaxid": [
"taxid"
]
}
}
+1 -1
View File
@@ -1 +1 @@
4.4.27 4.5.0
+19
View File
@@ -0,0 +1,19 @@
```markdown
# DNA Scoring and Matching Utilities in `obialign`
This module provides low-level utilities for computing nucleotide alignment scores using probabilistic and bit-encoded representations.
- **Bit Encoding**: Nucleotides are encoded in 4-bit groups (e.g., `A=0b0001`, `C=0b0010`, etc.), enabling efficient bitwise comparison.
- **`_MatchRatio(a, b)`**: Computes a normalized match ratio between two encoded bytes based on shared bits:
`ratio = common_bits / (bits_in_a × bits_in_b)`.
- **`_FourBitsCount`**: Precomputed lookup table for Hamming weight (popcount) of 4-bit values.
- **Log-space Arithmetic**: Helper functions (`_Logaddexp`, `_Logdiffexp`, `_Log1mexp`) ensure numerical stability in probabilistic computations.
- **Phred-scaled Quality Integration**:
`_MatchScoreRatio(QF, QR)` derives log-odds match/mismatch scores from Phred quality values (`QF`, `QR`), modeling sequencing error probabilities.
- **Precomputed Matrices**:
- `_NucPartMatch[i][j]`: Match ratios for all nucleotide pairs (from 4-bit codes).
- `_NucScorePartMatchMatch/Mismatch[i][j]`: Integer-scaled match/mismatch scores (×10) for quality pairs `(i, j)` in `[0..99]`.
- **Thread-Safe Initialization**: `_InitDNAScoreMatrix()` ensures one-time, synchronized initialization of all scoring tables via a mutex.
Designed for high-performance alignment kernels where speed and numerical robustness are critical.
```