Compare commits

..
Author SHA1 Message Date
Eric Coissac f727ae930f Release 4.5.0 2026-08-19 17:35:06 +02:00
Eric Coissac 90cf780f23 fix: update uint128 test expectations and improve log formatting
Corrects expected values for division and comparison operations in the uint128 test suite. Updates obilandmark to use log.Fatalf instead of log.Fatal, ensuring sequence ID, taxid, and taxonomy name are correctly interpolated in fatal error messages.
2026-08-19 17:33:57 +02:00
Eric Coissac 620646d412 fix: validate inputs and fix coordinate offsets in pattern matching
Introduce explicit input validation and a `(-1, -1, -1)` sentinel return value to signal invalid or unreliable matches. Add pre-call length checks and early returns to prevent panics during indel relocation. Fix an index offset bug in coordinate calculation by preserving the original fragment position before applying alignment deltas. Update match filtering to enforce reliability checks only on successfully relocated alignments. Comprehensive tests validate edge cases, boundary constraints, and error thresholds.
2026-08-19 17:25:44 +02:00
Eric Coissac 438893d910 refactor: improve FASTQ error messages with explicit filenames
The options system now tracks explicit file paths via a new accessor and functional option. This filename is threaded through the FASTQ parser chain to replace generic source references in fatal error messages, providing clearer, file-specific diagnostics without altering core parsing logic or test suites.
2026-08-19 16:47:36 +02:00
Eric Coissac eae41ac81c fix: respect config defaults when --allowed-mismatches is unset
The change replaces numeric threshold checks with an explicit flag state tracker for the `--allowed-mismatches` option. This ensures per-primer mismatch settings from configuration files are preserved when the CLI parameter is omitted or zero, making the command-line flag act strictly as an explicit override rather than a default fallback.
2026-08-19 16:40:48 +02:00
Eric Coissac d735ac6188 feat: add JSON input support for biological sequences
Introduce a streaming JSON parser that decodes biological sequences using `goccy/go-json` with configurable batching to minimize memory overhead. Extend the CLI, file suffix filters, and MIME type detection to automatically recognize and route JSON inputs. Refactor header parsing into a centralized switch-case handler for improved maintainability.
2026-07-03 10:16:55 +02:00
coissac 9de463ef1e Merge pull request #121 from metabarcoding/push-swrrsvqysysz
Release 4.4.46
2026-07-02 08:51:30 +02:00
Eric Coissac a8841c203d Release 4.4.46 2026-07-02 08:50:00 +02:00
Eric Coissac f1a424343c Update ignore patterns, configure Serena, and refactor FASTSEQ parser
Adds `.gitignore` rules to exclude benchmark outputs and local build artifacts. Initializes Serena AI configuration for the Go project with UTF-8 encoding and gitignore-based file exclusion. Refactors the FASTSEQ header parser to fix regex syntax, optimize alternation ordering, improve control flow readability, and introduce explicit float-to-int coercion that preserves fractional values.
2026-07-02 08:49:26 +02:00
coissac 4dae7f708d Merge pull request #119 from metabarcoding/push-zrmnkuwsztxx
Release 4.4.45
2026-06-02 15:02:42 +02:00
Eric Coissac 578445f38a Release 4.4.45 2026-06-02 15:01:32 +02:00
Eric Coissac 2edb33ad08 fix: correct duplicated typos in GVal function names
Corrects duplicated typos in the registered GVal function names, changing "which_maxwhichmax" and "which_minwhichmin" to "which_max" and "which_min". The underlying obiutils.WhichMax/WhichMin logic and its int-to-float64 index conversion remain unchanged.
2026-06-02 15:00:48 +02:00
coissac b108d4978e Merge pull request #118 from metabarcoding/push-twztopkvxyop
Release 4.4.44
2026-06-02 14:42:00 +02:00
Eric Coissac e9210e28a3 Release 4.4.44 2026-06-02 14:40:09 +02:00
Eric Coissac 13a93fce11 feat: add which_max and which_min to retrieve extreme element indices
Implement reflection-based WhichMax and WhichMin to dynamically find the index or key of the maximum/minimum element in slices, arrays, or maps. Functions validate orderability, handle empty collections, and dispatch via reflect.Kind. Expose as which_max and which_min GVal functions, with float64 type assertions for compatibility and preserved error handling.
2026-06-02 14:39:31 +02:00
Eric Coissac 14064c919e fix(obiutils): correctly unwrap interface values in min/max
Introduces an `unwrapInterface` reflection helper to dereference `interface{}`-wrapped values before type validation. Updates slice and map iteration loops in min/max functions to apply this helper, ensuring `isOrderedKind` accurately identifies underlying concrete types instead of incorrectly rejecting `reflect.Interface` elements.
2026-06-02 14:34:00 +02:00
coissac 1dfd68aa6d Merge pull request #117 from metabarcoding/push-wvlmzvomslzv
Release 4.4.43
2026-06-01 14:14:40 +02:00
Eric Coissac 930fe5f1ba Release 4.4.43 2026-06-01 13:22:58 +02:00
Eric Coissac dcdaf9e372 feat: support map and slice types in OBI attributes
Extends OBI header parsing to recognize and deserialize JSON-like arrays and objects. Introduces safe conversion utilities in `obiutils` to cast generic interface values into typed maps, and exposes them via new `BioSequence` methods. Header values are now marshaled, quote-normalized, and formatted for map and slice types.
2026-06-01 13:21:11 +02:00
Eric Coissac af7ae3d60c Correct Shannon entropy bias for canonical k-mers
Multiple raw k-mers collapsing into identical circular canonical forms introduce bias into complexity estimates. This change pre-computes `log(class_size)` tables and per-word-size maximum entropy bounds. The `KmerEntropy` function and `KmerEntropyFilter` are updated to apply the corrected formula `(log(N) + Σf·log(s) - Σf·log(f))/N / emax`, ensuring accurate sequence complexity estimation.
2026-05-17 14:54:57 +08:00
Eric Coissac cecf90fa40 feat: add min/max filtering and saturating subtraction utilities
Introduce generic and reflection-based utilities for filtering slices and maps by minimum/maximum thresholds, along with saturating subtraction. The `obiutils` package provides type-safe generic implementations alongside dynamic reflection dispatchers to handle arbitrary ordered and numeric types. These are exposed as GVAL expression functions in `obiseq`, extending the language's built-in filtering and numeric capabilities.
2026-05-14 20:58:24 +08:00
Eric Coissac a186bd1c92 fix: validate non-empty sequence IDs in FASTA and FASTQ writers
Adds a pre-processing guard that checks for empty sequence identifiers before formatting. This prevents malformed FASTA output and stops downstream processing of invalid FASTQ data by terminating early. The check is placed before existing sequence-length validations to enforce non-empty IDs during batch processing.
2026-05-05 18:07:58 +02:00
coissac 46d60c1a44 Merge pull request #115 from metabarcoding/push-lkzqoskvyqtr
[4.4.2] Enhanced taxonomy handling, input robustness & PCR tag validation
2026-04-30 16:59:49 +02:00
Eric Coissac 6c4a6c697c [4.4.2] Enhanced taxonomy handling, input robustness & PCR tag validation
- **obiconvert**: Added `--raw-taxid` mode to output numeric taxIDs without formatting (e.g., "12345" instead of ":tax:NCBI_0987@species"). Introduced `TaxNode.FullString()` to reliably return full formatted strings regardless of global settings, and improved fallback behavior when taxonomy DB is unavailable.
- **ngsfilter**: Input fields (primers, sample tags/IDs) are now automatically trimmed of leading/trailing whitespace to prevent parsing failures from inconsistent formatting.
- **obitools (pcrtag)**: Mismatch-related fields (`forward_mismatches`, `reverse_mishaps`) renamed to "error" for consistency across annotation dictionaries.
- **obipairing & obtagpcr**: Enforced mandatory paired-end file input (`--forward` and `reverse`) in obipairing; added CLI support for generating config templates via AskConfigTemplate(); removed redundant `Required()` constraints and introduced helper function CLIHasPairedFiles().
2026-04-30 16:57:45 +02:00
Eric Coissac 60b3753673 feat(obiconvert): add --raw-taxid option and refactor taxID formatting
- Add new `--tax-id` mode (`obiconvert --raw-taxid`) to output bare numeric taxIDs instead of full-format strings.
- Introduce `TaxNode.FullString()` to always return the complete "code:id [name]@rank" format, regardless of global `UseRawTaxids()` setting.
- Update `.String(taxonomyCode)` to respect the global flag, returning bare ID when `--raw-taxid` is active.
- Extract raw taxID from full-format strings in taxonomy methods when needed (e.g., fallback without loaded DB).
- Add comprehensive test suite covering:
a) `--raw-taxid` execution and idempotency
b) full-format taxID output with `--taxonomy`
c interaction of both flags
d format validation
- Add test data: new reference files `out_ecotag.fasta`, taxonomy.csv, and updated shell script.
2026-04-30 16:57:38 +02:00
Eric Coissac 14e2840a2d [ngsfilter] Trim whitespace from primer and sample fields
Trim leading/trailing whitespaces in forward/reverse primers, tags (via sample_tag), experiment andsample fields to prevent parsing errors due to formatting inconsistencies in input data.
2026-04-30 08:14:39 +02:00
Eric Coissac 42910c7db9 🔧 Rename mismatch fields to error in pcrtag.go
- Renamed `obimultiplex_forward_mismatches` to "error" for consistency
- Similarly renamed 
  `obimultiplex_reverse_mismatches` to "error"
- Applied changes in both annotation dictionaries (aanot, banot)
2026-04-29 15:29:25 +02:00
Eric Coissac 8b4cf677c6 [obitools] Add validation for paired files and config template support
- Enforce requirement of both forward (-F) and reverse files in obipairing/main.go
- Add config template support to obtagpcr via CLIAskConfigTemplate()
- Remove redundant Required() constraints in options.go
- Introduce new helper CLIHasPairedFiles()
2026-04-29 15:01:37 +02:00
coissac 02765f154f Merge pull request #113 from metabarcoding/push-oxowomxlnlnx
Push oxowomxlnlnx
2026-04-16 15:04:55 +02:00
43 changed files with 1616 additions and 272 deletions
+2
View File
@@ -21,6 +21,8 @@ xx
.rhistory .rhistory
/.vscode /.vscode
/benchmarck
/build /build
/bugs /bugs
autodoc autodoc
+2
View File
@@ -0,0 +1,2 @@
/cache
/project.local.yml
+133
View File
@@ -0,0 +1,133 @@
# the name by which the project can be referenced within Serena
project_name: "obitools4"
# list of languages for which language servers are started; choose from:
# al angular ansible bash clojure
# cpp cpp_ccls crystal csharp csharp_omnisharp
# dart elixir elm erlang fortran
# fsharp go groovy haskell haxe
# hlsl html java json julia
# kotlin lean4 lua luau markdown
# matlab msl nix ocaml pascal
# perl php php_phpactor powershell python
# python_jedi python_ty r rego ruby
# ruby_solargraph rust scala scss solidity
# svelte swift systemverilog terraform toml
# typescript typescript_vts vue yaml zig
# (This list may be outdated. For the current list, see values of Language enum here:
# https://github.com/oraios/serena/blob/main/src/solidlsp/ls_config.py
# For some languages, there are alternative language servers, e.g. csharp_omnisharp, ruby_solargraph.)
# Note:
# - For C, use cpp
# - For JavaScript, use typescript
# - For Angular projects, use angular (subsumes typescript+html; requires `npm install` in the project root)
# - For Svelte projects, use svelte (subsumes typescript/javascript for .svelte projects; requires npm)
# - For SCSS / Sass / plain CSS, use scss (some-sass-language-server handles all three)
# - For Free Pascal/Lazarus, use pascal
# Special requirements:
# Some languages require additional setup/installations.
# See here for details: https://oraios.github.io/serena/01-about/020_programming-languages.html#language-servers
# When using multiple languages, the first language server that supports a given file will be used for that file.
# The first language is the default language and the respective language server will be used as a fallback.
# Note that when using the JetBrains backend, language servers are not used and this list is correspondingly ignored.
languages:
- go
# the encoding used by text files in the project
# For a list of possible encodings, see https://docs.python.org/3.11/library/codecs.html#standard-encodings
encoding: "utf-8"
# line ending convention to use when writing source files.
# Possible values: unset (use global setting), "lf", "crlf", or "native" (platform default)
# This does not affect Serena's own files (e.g. memories and configuration files), which always use native line endings.
line_ending:
# The language backend to use for this project.
# If not set, the global setting from serena_config.yml is used.
# Valid values: LSP, JetBrains
# Note: the backend is fixed at startup. If a project with a different backend
# is activated post-init, an error will be returned.
language_backend:
# whether to use project's .gitignore files to ignore files
ignore_all_files_in_gitignore: true
# advanced configuration option allowing to configure language server-specific options.
# Maps the language key to the options.
# Have a look at the docstring of the constructors of the LS implementations within solidlsp (e.g., for C# or PHP) to see which options are available.
# No documentation on options means no options are available.
ls_specific_settings: {}
# list of additional workspace folder paths for cross-package reference support (e.g. in monorepos).
# Paths can be absolute or relative to the project root.
# Each folder is registered as an LSP workspace folder, enabling language servers to discover
# symbols and references across package boundaries.
# Currently supported for: TypeScript.
# Example:
# additional_workspace_folders:
# - ../sibling-package
# - ../shared-lib
additional_workspace_folders: []
# list of additional paths to ignore in this project.
# Same syntax as gitignore, so you can use * and **.
# Note: global ignored_paths from serena_config.yml are also applied additively.
ignored_paths: []
# whether the project is in read-only mode
# If set to true, all editing tools will be disabled and attempts to use them will result in an error
# Added on 2025-04-18
read_only: false
# list of tool names to exclude.
# This extends the existing exclusions (e.g. from the global configuration)
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
excluded_tools: []
# list of tools to include that would otherwise be disabled (particularly optional tools that are disabled by default).
# This extends the existing inclusions (e.g. from the global configuration).
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
included_optional_tools: []
# fixed set of tools to use as the base tool set (if non-empty), replacing Serena's default set of tools.
# This cannot be combined with non-empty excluded_tools or included_optional_tools.
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
fixed_tools: []
# list of mode names that are to be activated by default, overriding the setting in the global configuration.
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# If the setting is undefined/empty, the default_modes from the global configuration (serena_config.yml) apply.
# Otherwise, this overrides the setting from the global configuration (serena_config.yml).
# Therefore, you can set this to [] if you do not want the default modes defined in the global config to apply
# for this project.
# This setting can, in turn, be overridden by CLI parameters (--mode).
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
default_modes:
# list of mode names to be activated additionally for this project, e.g. ["query-projects"]
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
added_modes:
# initial prompt for the project. It will always be given to the LLM upon activating the project
# (contrary to the memories, which are loaded on demand).
initial_prompt: ""
# time budget (seconds) per tool call for the retrieval of additional symbol information
# such as docstrings or parameter information.
# This overrides the corresponding setting in the global configuration; see the documentation there.
# If null or missing, use the setting from the global configuration.
symbol_info_budget:
# list of regex patterns which, when matched, mark a memory entry as read‑only.
# Extends the list from the global configuration, merging the two lists.
read_only_memory_patterns: []
# list of regex patterns for memories to completely ignore.
# Matching memories will not appear in list_memories or activate_project output
# and cannot be accessed via read_memory or write_memory.
# To access ignored memory files, use the read_file tool on the raw file path.
# Extends the list from the global configuration, merging the two lists.
# Example: ["_archive/.*", "_episodes/.*"]
ignored_memory_patterns: []
+4 -4
View File
@@ -156,8 +156,8 @@ bump-version:
jjnew: jjnew:
@echo "$(YELLOW)→ Creating a new commit...$(NC)" @echo "$(YELLOW)→ Creating a new commit...$(NC)"
@echo "$(BLUE)→ Documenting current commit...$(NC)" @echo "$(BLUE)→ Documenting undocumented commits...$(NC)"
@jj auto-describe @jj auto-doc
@echo "$(BLUE)→ Done.$(NC)" @echo "$(BLUE)→ Done.$(NC)"
@jj new @jj new
@echo "$(GREEN)✓ New commit created$(NC)" @echo "$(GREEN)✓ New commit created$(NC)"
@@ -171,8 +171,8 @@ jjpush:
@echo "$(GREEN)✓ Release complete$(NC)" @echo "$(GREEN)✓ Release complete$(NC)"
jjpush-describe: jjpush-describe:
@echo "$(BLUE)→ Documenting current commit...$(NC)" @echo "$(BLUE)→ Documenting undocumented commits...$(NC)"
@jj auto-describe @jj auto-doc
jjpush-bump: jjpush-bump:
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)" @echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
+5
View File
@@ -37,6 +37,11 @@ func main() {
optionParser(os.Args) optionParser(os.Args)
if !obipairing.CLIHasPairedFiles() {
log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
os.Exit(1)
}
obidefault.SetStrictReadWorker(2) obidefault.SetStrictReadWorker(2)
obidefault.SetStrictWriteWorker(2) obidefault.SetStrictWriteWorker(2)
pairs, err := obipairing.CLIPairedSequence() pairs, err := obipairing.CLIPairedSequence()
+13
View File
@@ -1,6 +1,7 @@
package main package main
import ( import (
"fmt"
"os" "os"
log "github.com/sirupsen/logrus" log "github.com/sirupsen/logrus"
@@ -8,6 +9,7 @@ import (
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obimultiplex"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipairing" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obipairing"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitagpcr" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitagpcr"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils" "git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
@@ -39,6 +41,17 @@ func main() {
obitagpcr.OptionSet) obitagpcr.OptionSet)
optionParser(os.Args) optionParser(os.Args)
if obimultiplex.CLIAskConfigTemplate() {
fmt.Print(obimultiplex.CLIConfigTemplate())
os.Exit(0)
}
if !obipairing.CLIHasPairedFiles() {
log.Error("You must provide both a forward file (-F) and a reverse file (-R)")
os.Exit(1)
}
pairs, err := obipairing.CLIPairedSequence() pairs, err := obipairing.CLIPairedSequence()
if err != nil { if err != nil {
@@ -0,0 +1,24 @@
>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
gattaaacctcaaaggacttggcagtgctttatacccct
>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
+48
View File
@@ -0,0 +1,48 @@
taxid,parent,taxonomic_rank,scientific_name
taxon:1 [root]@no rank,taxon:1 [root]@no rank,no rank,root
taxon:131567 [cellular organisms]@cellular root,taxon:1 [root]@no rank,cellular root,cellular organisms
taxon:2759 [Eukaryota]@domain,taxon:131567 [cellular organisms]@cellular root,domain,Eukaryota
taxon:33154 [Opisthokonta]@clade,taxon:2759 [Eukaryota]@domain,clade,Opisthokonta
taxon:33208 [Metazoa]@kingdom,taxon:33154 [Opisthokonta]@clade,kingdom,Metazoa
taxon:6072 [Eumetazoa]@clade,taxon:33208 [Metazoa]@kingdom,clade,Eumetazoa
taxon:33213 [Bilateria]@clade,taxon:6072 [Eumetazoa]@clade,clade,Bilateria
taxon:33511 [Deuterostomia]@clade,taxon:33213 [Bilateria]@clade,clade,Deuterostomia
taxon:7711 [Chordata]@phylum,taxon:33511 [Deuterostomia]@clade,phylum,Chordata
taxon:89593 [Craniata]@subphylum,taxon:7711 [Chordata]@phylum,subphylum,Craniata
taxon:7742 [Vertebrata]@clade,taxon:89593 [Craniata]@subphylum,clade,Vertebrata
taxon:7776 [Gnathostomata]@clade,taxon:7742 [Vertebrata]@clade,clade,Gnathostomata
taxon:117570 [Teleostomi]@clade,taxon:7776 [Gnathostomata]@clade,clade,Teleostomi
taxon:117571 [Euteleostomi]@clade,taxon:117570 [Teleostomi]@clade,clade,Euteleostomi
taxon:8287 [Sarcopterygii]@superclass,taxon:117571 [Euteleostomi]@clade,superclass,Sarcopterygii
taxon:1338369 [Dipnotetrapodomorpha]@clade,taxon:8287 [Sarcopterygii]@superclass,clade,Dipnotetrapodomorpha
taxon:32523 [Tetrapoda]@clade,taxon:1338369 [Dipnotetrapodomorpha]@clade,clade,Tetrapoda
taxon:32524 [Amniota]@clade,taxon:32523 [Tetrapoda]@clade,clade,Amniota
taxon:40674 [Mammalia]@class,taxon:32524 [Amniota]@clade,class,Mammalia
taxon:32525 [Theria]@clade,taxon:40674 [Mammalia]@class,clade,Theria
taxon:9347 [Eutheria]@clade,taxon:32525 [Theria]@clade,clade,Eutheria
taxon:1437010 [Boreoeutheria]@clade,taxon:9347 [Eutheria]@clade,clade,Boreoeutheria
taxon:314146 [Euarchontoglires]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Euarchontoglires
taxon:314145 [Laurasiatheria]@superorder,taxon:1437010 [Boreoeutheria]@clade,superorder,Laurasiatheria
taxon:33554 [Carnivora]@order,taxon:314145 [Laurasiatheria]@superorder,order,Carnivora
taxon:91561 [Artiodactyla]@order,taxon:314145 [Laurasiatheria]@superorder,order,Artiodactyla
taxon:314147 [Glires]@clade,taxon:314146 [Euarchontoglires]@superorder,clade,Glires
taxon:9845 [Ruminantia]@suborder,taxon:91561 [Artiodactyla]@order,suborder,Ruminantia
taxon:35500 [Pecora]@infraorder,taxon:9845 [Ruminantia]@suborder,infraorder,Pecora
taxon:9989 [Rodentia]@order,taxon:314147 [Glires]@clade,order,Rodentia
taxon:379584 [Caniformia]@suborder,taxon:33554 [Carnivora]@order,suborder,Caniformia
taxon:9608 [Canidae]@family,taxon:379584 [Caniformia]@suborder,family,Canidae
taxon:9850 [Cervidae]@family,taxon:35500 [Pecora]@infraorder,family,Cervidae
taxon:9881 [Odocoileinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Odocoileinae
taxon:33553 [Sciuromorpha]@suborder,taxon:9989 [Rodentia]@order,suborder,Sciuromorpha
taxon:55153 [Sciuridae]@family,taxon:33553 [Sciuromorpha]@suborder,family,Sciuridae
taxon:34878 [Cervinae]@subfamily,taxon:9850 [Cervidae]@family,subfamily,Cervinae
taxon:9611 [Canis]@genus,taxon:9608 [Canidae]@family,genus,Canis
taxon:9857 [Capreolus]@genus,taxon:9881 [Odocoileinae]@subfamily,genus,Capreolus
taxon:9612 [Canis lupus]@species,taxon:9611 [Canis]@genus,species,Canis lupus
taxon:337726 [Xerinae]@subfamily,taxon:55153 [Sciuridae]@family,subfamily,Xerinae
taxon:9859 [Cervus]@genus,taxon:34878 [Cervinae]@subfamily,genus,Cervus
taxon:337730 [Marmotini]@tribe,taxon:337726 [Xerinae]@subfamily,tribe,Marmotini
taxon:9992 [Marmota]@genus,taxon:337730 [Marmotini]@tribe,genus,Marmota
taxon:9860 [Cervus elaphus]@species,taxon:9859 [Cervus]@genus,species,Cervus elaphus
taxon:9615 [Canis lupus familiaris]@subspecies,taxon:9612 [Canis lupus]@species,subspecies,Canis lupus familiaris
taxon:9858 [Capreolus capreolus]@species,taxon:9857 [Capreolus]@genus,species,Capreolus capreolus
1 taxid parent taxonomic_rank scientific_name
2 taxon:1 [root]@no rank taxon:1 [root]@no rank no rank root
3 taxon:131567 [cellular organisms]@cellular root taxon:1 [root]@no rank cellular root cellular organisms
4 taxon:2759 [Eukaryota]@domain taxon:131567 [cellular organisms]@cellular root domain Eukaryota
5 taxon:33154 [Opisthokonta]@clade taxon:2759 [Eukaryota]@domain clade Opisthokonta
6 taxon:33208 [Metazoa]@kingdom taxon:33154 [Opisthokonta]@clade kingdom Metazoa
7 taxon:6072 [Eumetazoa]@clade taxon:33208 [Metazoa]@kingdom clade Eumetazoa
8 taxon:33213 [Bilateria]@clade taxon:6072 [Eumetazoa]@clade clade Bilateria
9 taxon:33511 [Deuterostomia]@clade taxon:33213 [Bilateria]@clade clade Deuterostomia
10 taxon:7711 [Chordata]@phylum taxon:33511 [Deuterostomia]@clade phylum Chordata
11 taxon:89593 [Craniata]@subphylum taxon:7711 [Chordata]@phylum subphylum Craniata
12 taxon:7742 [Vertebrata]@clade taxon:89593 [Craniata]@subphylum clade Vertebrata
13 taxon:7776 [Gnathostomata]@clade taxon:7742 [Vertebrata]@clade clade Gnathostomata
14 taxon:117570 [Teleostomi]@clade taxon:7776 [Gnathostomata]@clade clade Teleostomi
15 taxon:117571 [Euteleostomi]@clade taxon:117570 [Teleostomi]@clade clade Euteleostomi
16 taxon:8287 [Sarcopterygii]@superclass taxon:117571 [Euteleostomi]@clade superclass Sarcopterygii
17 taxon:1338369 [Dipnotetrapodomorpha]@clade taxon:8287 [Sarcopterygii]@superclass clade Dipnotetrapodomorpha
18 taxon:32523 [Tetrapoda]@clade taxon:1338369 [Dipnotetrapodomorpha]@clade clade Tetrapoda
19 taxon:32524 [Amniota]@clade taxon:32523 [Tetrapoda]@clade clade Amniota
20 taxon:40674 [Mammalia]@class taxon:32524 [Amniota]@clade class Mammalia
21 taxon:32525 [Theria]@clade taxon:40674 [Mammalia]@class clade Theria
22 taxon:9347 [Eutheria]@clade taxon:32525 [Theria]@clade clade Eutheria
23 taxon:1437010 [Boreoeutheria]@clade taxon:9347 [Eutheria]@clade clade Boreoeutheria
24 taxon:314146 [Euarchontoglires]@superorder taxon:1437010 [Boreoeutheria]@clade superorder Euarchontoglires
25 taxon:314145 [Laurasiatheria]@superorder taxon:1437010 [Boreoeutheria]@clade superorder Laurasiatheria
26 taxon:33554 [Carnivora]@order taxon:314145 [Laurasiatheria]@superorder order Carnivora
27 taxon:91561 [Artiodactyla]@order taxon:314145 [Laurasiatheria]@superorder order Artiodactyla
28 taxon:314147 [Glires]@clade taxon:314146 [Euarchontoglires]@superorder clade Glires
29 taxon:9845 [Ruminantia]@suborder taxon:91561 [Artiodactyla]@order suborder Ruminantia
30 taxon:35500 [Pecora]@infraorder taxon:9845 [Ruminantia]@suborder infraorder Pecora
31 taxon:9989 [Rodentia]@order taxon:314147 [Glires]@clade order Rodentia
32 taxon:379584 [Caniformia]@suborder taxon:33554 [Carnivora]@order suborder Caniformia
33 taxon:9608 [Canidae]@family taxon:379584 [Caniformia]@suborder family Canidae
34 taxon:9850 [Cervidae]@family taxon:35500 [Pecora]@infraorder family Cervidae
35 taxon:9881 [Odocoileinae]@subfamily taxon:9850 [Cervidae]@family subfamily Odocoileinae
36 taxon:33553 [Sciuromorpha]@suborder taxon:9989 [Rodentia]@order suborder Sciuromorpha
37 taxon:55153 [Sciuridae]@family taxon:33553 [Sciuromorpha]@suborder family Sciuridae
38 taxon:34878 [Cervinae]@subfamily taxon:9850 [Cervidae]@family subfamily Cervinae
39 taxon:9611 [Canis]@genus taxon:9608 [Canidae]@family genus Canis
40 taxon:9857 [Capreolus]@genus taxon:9881 [Odocoileinae]@subfamily genus Capreolus
41 taxon:9612 [Canis lupus]@species taxon:9611 [Canis]@genus species Canis lupus
42 taxon:337726 [Xerinae]@subfamily taxon:55153 [Sciuridae]@family subfamily Xerinae
43 taxon:9859 [Cervus]@genus taxon:34878 [Cervinae]@subfamily genus Cervus
44 taxon:337730 [Marmotini]@tribe taxon:337726 [Xerinae]@subfamily tribe Marmotini
45 taxon:9992 [Marmota]@genus taxon:337730 [Marmotini]@tribe genus Marmota
46 taxon:9860 [Cervus elaphus]@species taxon:9859 [Cervus]@genus species Cervus elaphus
47 taxon:9615 [Canis lupus familiaris]@subspecies taxon:9612 [Canis lupus]@species subspecies Canis lupus familiaris
48 taxon:9858 [Capreolus capreolus]@species taxon:9857 [Capreolus]@genus species Capreolus capreolus
+124
View File
@@ -134,6 +134,130 @@ else
((failed++)) ((failed++))
fi fi
# ------------------------------------------------------------------
# --raw-taxid tests (no taxonomy loaded)
# ------------------------------------------------------------------
# Running test
((ntest++))
if obiconvert --raw-taxid "${TEST_DIR}/out_ecotag.fasta" \
> "${TMPDIR}/raw_taxid.fasta" 2>/dev/null
then
log "$MCMD --raw-taxid: running OK"
((success++))
else
log "$MCMD --raw-taxid: running failed"
((failed++))
fi
# Taxids must be bare numbers — no full-format "taxon:ID [Name]@rank" strings
((ntest++))
if grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
then
log "$MCMD --raw-taxid: taxid format check failed (full-format taxid found)"
((failed++))
else
log "$MCMD --raw-taxid: taxid format OK (all taxids are bare numbers)"
((success++))
fi
# --raw-taxid is idempotent: piping through a second obiconvert --raw-taxid must
# produce bit-for-bit identical output.
((ntest++))
if obiconvert --raw-taxid "${TMPDIR}/raw_taxid.fasta" \
> "${TMPDIR}/raw_taxid2.fasta" 2>/dev/null
then
log "$MCMD --raw-taxid piped: running OK"
((success++))
else
log "$MCMD --raw-taxid piped: running failed"
((failed++))
fi
((ntest++))
if diff "${TMPDIR}/raw_taxid.fasta" \
"${TMPDIR}/raw_taxid2.fasta" > /dev/null
then
log "$MCMD --raw-taxid piped: idempotency OK"
((success++))
else
log "$MCMD --raw-taxid piped: idempotency failed (outputs differ)"
((failed++))
fi
# ------------------------------------------------------------------
# --taxonomy tests (full-format taxid, no --raw-taxid)
# ------------------------------------------------------------------
# Running test
((ntest++))
if obiconvert --taxonomy "${TEST_DIR}/taxonomy.csv" \
"${TEST_DIR}/out_ecotag.fasta" \
> "${TMPDIR}/taxo.fasta" 2>/dev/null
then
log "$MCMD --taxonomy: running OK"
((success++))
else
log "$MCMD --taxonomy: running failed"
((failed++))
fi
# Taxids must be in full "taxon:ID [Name]@rank" format
((ntest++))
if grep '"taxid"' "${TMPDIR}/taxo.fasta" | grep -q '"taxid":"taxon:[0-9]'
then
log "$MCMD --taxonomy: taxid format OK (full-format taxids present)"
((success++))
else
log "$MCMD --taxonomy: taxid format check failed (no full-format taxid found)"
((failed++))
fi
# ------------------------------------------------------------------
# --raw-taxid --taxonomy tests
# ------------------------------------------------------------------
# Running test
((ntest++))
if obiconvert --raw-taxid --taxonomy "${TEST_DIR}/taxonomy.csv" \
"${TEST_DIR}/out_ecotag.fasta" \
> "${TMPDIR}/raw_taxid_taxo.fasta" 2>/dev/null
then
log "$MCMD --raw-taxid --taxonomy: running OK"
((success++))
else
log "$MCMD --raw-taxid --taxonomy: running failed"
((failed++))
fi
# Taxids must be bare numbers even when taxonomy is loaded
((ntest++))
if grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -qv '"taxid":"[0-9][0-9]*"'
then
log "$MCMD --raw-taxid --taxonomy: taxid format check failed (full-format taxid found)"
((failed++))
else
log "$MCMD --raw-taxid --taxonomy: taxid format OK (all taxids are bare numbers)"
((success++))
fi
# --raw-taxid with or without taxonomy must yield identical taxid values
((ntest++))
if diff <(grep '"taxid"' "${TMPDIR}/raw_taxid.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
<(grep '"taxid"' "${TMPDIR}/raw_taxid_taxo.fasta" | grep -o '"taxid":"[^"]*"' | sort) \
> /dev/null
then
log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values match OK"
((success++))
else
log "$MCMD --raw-taxid vs --raw-taxid --taxonomy: taxid values differ (unexpected)"
((failed++))
fi
######################################### #########################################
# #
# At the end of the tests # At the end of the tests
+24
View File
@@ -0,0 +1,24 @@
>HELIUM_000100422_612GNAAXX:7:118:3572:14633#0/1_sub[28..126] {"count":10172,"merged_sample":{"26a_F040644":10172},"obitag_bestid":0.9797979797979798,"obitag_bestmatch":"AY227529","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9992 [Marmota]@genus"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
gcctgaaactcaaaggacttggcggtgctttacatccct
>HELIUM_000100422_612GNAAXX:7:99:9351:13090#0/1_sub[28..127] {"count":260,"merged_sample":{"29a_F260619":260},"obitag_bestid":0.9405940594059405,"obitag_bestmatch":"AF154263","obitag_match_count":9,"obitag_rank":"infraorder","obitag_similarity_method":"lcs","taxid":"taxon:35500 [Pecora]@infraorder"}
ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:108:10111:9078#0/1_sub[28..127] {"count":7146,"merged_sample":{"13a_F730603":7146},"obitag_bestid":1,"obitag_bestmatch":"AB245427","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9860 [Cervus elaphus]@species"}
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:38:14204:12725#0/1_sub[28..126] {"count":87,"merged_sample":{"26a_F040644":87},"obitag_bestid":0.9494949494949495,"obitag_bestmatch":"AY227530","obitag_match_count":2,"obitag_rank":"tribe","obitag_similarity_method":"lcs","taxid":"taxon:337730 [Marmotini]@tribe"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
>HELIUM_000100422_612GNAAXX:7:30:9942:4495#0/1_sub[28..126] {"count":95,"merged_sample":{"26a_F040644":11,"29a_F260619":84},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_match_count":1,"obitag_rank":"subspecies","obitag_similarity_method":"lcs","taxid":"taxon:9615 [Canis lupus familiaris]@subspecies"}
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
gattaaacctcaaaggacttggcagtgctttatacccct
>HELIUM_000100422_612GNAAXX:7:51:16702:19393#0/1_sub[28..127] {"count":12004,"merged_sample":{"15a_F730814":7465,"29a_F260619":4539},"obitag_bestid":1,"obitag_bestmatch":"AJ885202","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:84:14502:1617#0/1_sub[28..127] {"count":319,"merged_sample":{"29a_F260619":319},"obitag_bestid":1,"obitag_bestmatch":"AJ972683","obitag_match_count":1,"obitag_rank":"species","obitag_similarity_method":"lcs","taxid":"taxon:9858 [Capreolus capreolus]@species"}
ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
agcttaaaactcaaaggacttggcggtgctttataccctt
>HELIUM_000100422_612GNAAXX:7:50:10637:6527#0/1_sub[28..126] {"count":366,"merged_sample":{"13a_F730603":13,"15a_F730814":5,"26a_F040644":347,"29a_F260619":1},"obitag_bestid":1,"obitag_bestmatch":"AB048590","obitag_match_count":1,"obitag_rank":"genus","obitag_similarity_method":"lcs","taxid":"taxon:9611 [Canis]@genus"}
ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
gcttaaaactcaaaggacttggcggtgctttatatccct
+23 -2
View File
@@ -28,10 +28,18 @@ func buffIndex(i, j, width int) int {
// //
// The function returns the start and end positions of the best // The function returns the start and end positions of the best
// match, as well as the number of errors in the best match. // match, as well as the number of errors in the best match.
//
// When the sequence is too short relative to the pattern for the
// backtracking to reconstruct a valid alignment (e.g. the pattern
// is longer than the sequence, or the match sits too close to a
// sequence boundary), no reliable position can be computed. In that
// case the function returns the sentinel (-1, -1, -1) instead of a
// guessed, potentially wrong, position: callers must treat this as
// "no match" rather than use the returned coordinates.
func LocatePattern(id string, pattern, sequence []byte) (int, int, int) { func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
if len(pattern) >= len(sequence) { if len(sequence) == 0 {
log.Panicf("Sequence %s:Pattern %s must be shorter than sequence %s", id, pattern, sequence) log.Panicf("Sequence %s:Pattern %s must not be empty", id, pattern)
} }
// Pattern spreads over the columns // Pattern spreads over the columns
@@ -158,5 +166,18 @@ func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
// obilog.Warnf("from : %d to: %d error: %d match: %v", // obilog.Warnf("from : %d to: %d error: %d match: %v",
// i, end+1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)], // i, end+1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)],
// string(sequence[i:(end+1)])) // string(sequence[i:(end+1)]))
if i < 0 || end == -1 {
// i < 0: the backtracking ran off the start of the sequence
// without fully consuming the pattern.
// end == -1: the backtracking loop never ran at all (e.g. a
// single-base pattern, jmax == 0), so no alignment boundary
// was ever established.
// Either way, no valid alignment exists for this (pattern,
// sequence) pair: signal it explicitly instead of returning
// an out-of-bounds or uncomputed position.
return -1, -1, -1
}
return i, end + 1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)] return i, end + 1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)]
} }
+123
View File
@@ -0,0 +1,123 @@
package obialign
import (
"math/rand"
"testing"
)
func TestLocatePatternNormal(t *testing.T) {
// Pattern fully and exactly present in the middle of a longer sequence.
start, end, nerr := LocatePattern("id", []byte("ACGT"), []byte("TTTTACGTTTTT"))
if start != 4 || end != 8 || nerr != 0 {
t.Errorf("got start=%d end=%d nerr=%d, want start=4 end=8 nerr=0", start, end, nerr)
}
}
func TestLocatePatternOneMismatch(t *testing.T) {
start, end, nerr := LocatePattern("id", []byte("ACGT"), []byte("TTTTACTTTTTT"))
if nerr != 1 {
t.Errorf("got nerr=%d, want 1 (start=%d end=%d)", nerr, start, end)
}
}
// The real-world case that used to panic: pattern longer than the sequence
// fragment extracted for indel relocation.
func TestLocatePatternPatternLongerThanSequence(t *testing.T) {
start, end, nerr := LocatePattern("id",
[]byte("GGGCAATCCTGAGCCAAATC"),
[]byte("tcctgagccaaatcacgtt"))
if start != -1 || end != -1 || nerr != -1 {
t.Errorf("got start=%d end=%d nerr=%d, want the (-1,-1,-1) sentinel", start, end, nerr)
}
}
func TestLocatePatternSequenceLengthOne(t *testing.T) {
start, end, nerr := LocatePattern("id", []byte("AB"), []byte("A"))
if start < 0 || end < 0 || nerr < 0 {
t.Fatalf("got start=%d end=%d nerr=%d, expected a valid (non-sentinel) result", start, end, nerr)
}
if start != 0 || end != 1 || nerr != 1 {
t.Errorf("got start=%d end=%d nerr=%d, want start=0 end=1 nerr=1", start, end, nerr)
}
}
// A pattern much longer than the sequence can still yield a mathematically
// valid (in-bounds) alignment: the extra pattern length is absorbed as gaps,
// driving the error count high enough that the caller's maxerr threshold
// rejects it. The function itself must still return consistent bounds.
func TestLocatePatternPatternMuchLongerThanSequence(t *testing.T) {
start, end, nerr := LocatePattern("id", []byte("ACGTACGTACGTACGTACGT"), []byte("ACG"))
isSentinel := start == -1 && end == -1 && nerr == -1
isValid := start >= 0 && end > start && end <= 3 && nerr >= 0
if !isSentinel && !isValid {
t.Errorf("got start=%d end=%d nerr=%d, want either the sentinel or consistent in-bounds values", start, end, nerr)
}
}
func TestLocatePatternNeverReturnsOutOfBounds(t *testing.T) {
patterns := []string{"A", "AC", "ACG", "ACGT", "ACGTA", "ACGTAC", "ACGTACG", "ACGTACGT"}
sequences := []string{"A", "AC", "ACG", "ACGT", "ACGTA", "ACGTAC", "ACGTACG", "ACGTACGT"}
for _, p := range patterns {
for _, s := range sequences {
start, end, nerr := LocatePattern("id", []byte(p), []byte(s))
if start == -1 && end == -1 && nerr == -1 {
// Explicit "no reliable match" sentinel: always acceptable.
continue
}
if start < 0 || end < 0 || start >= end || end > len(s) || nerr < 0 {
t.Errorf("pattern=%q sequence=%q -> start=%d end=%d nerr=%d is out of bounds / inconsistent",
p, s, start, end, nerr)
}
}
}
}
// Randomized property test over a wide range of pattern/sequence length
// combinations, including pattern >= sequence, to make sure the function
// never panics and never returns anything but the sentinel or fully
// consistent, in-bounds coordinates.
func TestLocatePatternRandomizedNeverInvalid(t *testing.T) {
const bases = "ACGT"
rng := rand.New(rand.NewSource(42))
randSeq := func(n int) []byte {
b := make([]byte, n)
for i := range b {
b[i] = bases[rng.Intn(len(bases))]
}
return b
}
for trial := 0; trial < 5000; trial++ {
patLen := 1 + rng.Intn(15)
seqLen := 1 + rng.Intn(15)
pattern := randSeq(patLen)
sequence := randSeq(seqLen)
func() {
defer func() {
if r := recover(); r != nil {
t.Fatalf("panic for pattern=%q sequence=%q: %v", pattern, sequence, r)
}
}()
start, end, nerr := LocatePattern("id", pattern, sequence)
isSentinel := start == -1 && end == -1 && nerr == -1
isValid := start >= 0 && end > start && end <= len(sequence) && nerr >= 0
if !isSentinel && !isValid {
t.Errorf("pattern=%q sequence=%q -> start=%d end=%d nerr=%d is neither the sentinel nor consistent",
pattern, sequence, start, end, nerr)
}
}()
}
}
+25 -4
View File
@@ -373,6 +373,7 @@ func (pattern ApatPattern) BestMatch(sequence ApatSequence, begin, length int) (
cpattern := (*[1 << 30]byte)(unsafe.Pointer(pattern.pointer.pointer.cpat)) cpattern := (*[1 << 30]byte)(unsafe.Pointer(pattern.pointer.pointer.cpat))
frg := sequence.pointer.reference.Sequence()[start:end] frg := sequence.pointer.reference.Sequence()[start:end]
fragStart := start
log.Debugln( log.Debugln(
string(frg), string(frg),
@@ -384,11 +385,20 @@ func (pattern ApatPattern) BestMatch(sequence ApatSequence, begin, length int) (
(*cpattern)[0:int(pattern.pointer.pointer.patlen)], (*cpattern)[0:int(pattern.pointer.pointer.patlen)],
frg) frg)
// olderr := m[2] if from < 0 {
// obialign.LocatePattern could not reconstruct a reliable
// alignment (e.g. the fragment is too short relative to the
// pattern). Reporting a guessed position would risk placing
// the primer boundary incorrectly, so treat it as no match
// at all rather than falling back to an unrefined position.
matched = false
log.Debugln("No reliable indel relocation, discarding match", sequence.pointer.reference.Id())
return
}
nerr = score nerr = score
start = start + from start = fragStart + from
end = start + to end = fragStart + to
log.Debugf("BestMatch on %s : score=%d [%d..%d]", sequence.pointer.reference.Id(), score, start, nerr) log.Debugf("BestMatch on %s : score=%d [%d..%d]", sequence.pointer.reference.Id(), score, start, nerr)
return return
} }
@@ -467,6 +477,7 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
for _, m := range res { for _, m := range res {
// Recompute the start and end position of the match // Recompute the start and end position of the match
// when the pattern allows for indels // when the pattern allows for indels
valid := true
if m[2] > 0 && pattern.pointer.pointer.hasIndel { if m[2] > 0 && pattern.pointer.pointer.hasIndel {
// obilog.Warnf("Locating indel on sequence %s[%s]", sequence.pointer.reference.Id(), pattern.String()) // obilog.Warnf("Locating indel on sequence %s[%s]", sequence.pointer.reference.Id(), pattern.String())
start := m[0] - m[2]*2 start := m[0] - m[2]*2
@@ -485,6 +496,15 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
(*cpattern)[0:int(pattern.pointer.pointer.patlen)], (*cpattern)[0:int(pattern.pointer.pointer.patlen)],
frg) frg)
if pb < 0 {
// obialign.LocatePattern could not reconstruct a
// reliable alignment (e.g. the match sits too close
// to a sequence end for the fragment to be usable).
// Reporting a guessed position risks placing the
// primer boundary incorrectly, so drop the match
// entirely instead of keeping an unrefined guess.
valid = false
} else {
// olderr := m[2] // olderr := m[2]
m[2] = score m[2] = score
m[0] = start + pb m[0] = start + pb
@@ -493,8 +513,9 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
// obilog.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score, // obilog.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score,
// frg, (*cpattern)[0:int(pattern.pointer.pointer.patlen)], sequence.pointer.reference.Sequence()[m[0]:m[1]]) // frg, (*cpattern)[0:int(pattern.pointer.pointer.patlen)], sequence.pointer.reference.Sequence()[m[0]:m[1]])
} }
}
if int(pattern.pointer.pointer.maxerr) >= m[2] { if valid && int(pattern.pointer.pointer.maxerr) >= m[2] {
res[j] = m res[j] = m
j++ j++
} }
+20 -14
View File
@@ -131,7 +131,7 @@ func _storeSequenceQuality(bytes *bytes.Buffer, out *obiseq.BioSequence, quality
out.SetQualities(q) out.SetQualities(q)
} }
func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(string, io.Reader) (obiseq.BioSequenceSlice, error) { func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool, fileName string) func(string, io.Reader) (obiseq.BioSequenceSlice, error) {
parser := func(source string, input io.Reader) (obiseq.BioSequenceSlice, error) { parser := func(source string, input io.Reader) (obiseq.BioSequenceSlice, error) {
var identifier string var identifier string
@@ -160,12 +160,12 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
// Beginning of sequence // Beginning of sequence
state = 1 state = 1
} else { } else {
log.Fatalf("%s : sequence entry is not starting with @", source) log.Fatalf("file %s: sequence entry is not starting with @", fileName)
} }
case 1: // Beginning of identifier (Mandatory) case 1: // Beginning of identifier (Mandatory)
if is_sep { if is_sep {
// No identifier -> ERROR // No identifier -> ERROR
log.Fatalf("%s : sequence identifier is empty", source) log.Fatalf("file %s: sequence identifier is empty", fileName)
} else { } else {
// Beginning of identifier // Beginning of identifier
state = 2 state = 2
@@ -221,7 +221,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
// End of sequence // End of sequence
rawseq := seqBytes.Bytes() rawseq := seqBytes.Bytes()
if len(rawseq) == 0 { if len(rawseq) == 0 {
log.Fatalf("@%s[%s] : sequence is empty", identifier, source) log.Fatalf("file %s: record @%s has an empty sequence line", fileName, identifier)
} }
s := obiseq.NewBioSequence(identifier, rawseq, definition) s := obiseq.NewBioSequence(identifier, rawseq, definition)
s.SetSource(source) s.SetSource(source)
@@ -241,8 +241,8 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
context = append( context = append(
append([]byte{previous}, C), append([]byte{previous}, C),
context...) context...)
log.Fatalf("%s [%s]: sequence contains invalid character %c (%s)", log.Fatalf("file %s: record @%s contains invalid character %c (%s)",
source, identifier, C, string(context)) fileName, identifier, C, string(context))
} }
} }
case 7: case 7:
@@ -251,7 +251,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
} else if C == '+' { } else if C == '+' {
state = 8 state = 8
} else { } else {
log.Fatalf("@%s[%s] : sequence data not followed by a line starting with + but a %c", identifier, source, C) log.Fatalf("file %s: record @%s: sequence data not followed by a line starting with + but a %c", fileName, identifier, C)
} }
case 8: case 8:
// State consuming the + internal header line // State consuming the + internal header line
@@ -282,7 +282,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
} else if C == '@' { } else if C == '@' {
state = 1 state = 1
} else { } else {
log.Fatalf("%s[%s] : sequence record not followed by a line starting with @", identifier, source) log.Fatalf("file %s: record @%s not followed by a line starting with @", fileName, identifier)
} }
} }
@@ -304,7 +304,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
} }
// FastqChunkParserRope parses a FASTQ chunk directly from a rope without Pack(). // FastqChunkParserRope parses a FASTQ chunk directly from a rope without Pack().
func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte, with_quality, UtoT bool) (obiseq.BioSequenceSlice, error) { func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte, with_quality, UtoT bool, fileName string) (obiseq.BioSequenceSlice, error) {
scanner := newRopeScanner(rope) scanner := newRopeScanner(rope)
sequences := obiseq.MakeBioSequenceSlice(100)[:0] sequences := obiseq.MakeBioSequenceSlice(100)[:0]
@@ -334,7 +334,7 @@ func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte,
// Line 2: sequence // Line 2: sequence
sline := scanner.ReadLine() sline := scanner.ReadLine()
if sline == nil { if sline == nil {
log.Fatalf("@%s[%s]: unexpected EOF after header", id, source) log.Fatalf("file %s: record @%s is truncated (header line with no sequence line following) — the FASTQ file appears incomplete", fileName, id)
} }
seqDest := make([]byte, len(sline)) seqDest := make([]byte, len(sline))
w := 0 w := 0
@@ -350,7 +350,7 @@ func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte,
} }
seqDest = seqDest[:w] seqDest = seqDest[:w]
if len(seqDest) == 0 { if len(seqDest) == 0 {
log.Fatalf("@%s[%s]: sequence is empty", id, source) log.Fatalf("file %s: record @%s has an empty sequence line", fileName, id)
} }
// Line 3: + (skip) // Line 3: + (skip)
@@ -382,16 +382,17 @@ func _ParseFastqFile(
out obiiter.IBioSequence, out obiiter.IBioSequence,
quality_shift byte, quality_shift byte,
with_quality, UtoT bool, with_quality, UtoT bool,
fileName string,
) { ) {
parser := FastqChunkParser(quality_shift, with_quality, UtoT) parser := FastqChunkParser(quality_shift, with_quality, UtoT, fileName)
for chunks := range input { for chunks := range input {
var sequences obiseq.BioSequenceSlice var sequences obiseq.BioSequenceSlice
var err error var err error
if chunks.Rope != nil { if chunks.Rope != nil {
sequences, err = FastqChunkParserRope(chunks.Source, chunks.Rope, quality_shift, with_quality, UtoT) sequences, err = FastqChunkParserRope(chunks.Source, chunks.Rope, quality_shift, with_quality, UtoT, fileName)
} else { } else {
sequences, err = parser(chunks.Source, chunks.Raw) sequences, err = parser(chunks.Source, chunks.Raw)
} }
@@ -423,6 +424,8 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
false, false,
) )
fileName := opt.FileName()
for i := 0; i < nworker; i++ { for i := 0; i < nworker; i++ {
out.Add(1) out.Add(1)
go _ParseFastqFile( go _ParseFastqFile(
@@ -431,6 +434,7 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
obidefault.ReadQualitiesShift(), obidefault.ReadQualitiesShift(),
opt.ReadQualities(), opt.ReadQualities(),
opt.UtoT(), opt.UtoT(),
fileName,
) )
} }
@@ -456,7 +460,9 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
} }
func ReadFastqFromFile(filename string, options ...WithOption) (obiiter.IBioSequence, error) { func ReadFastqFromFile(filename string, options ...WithOption) (obiiter.IBioSequence, error) {
options = append(options, OptionsSource(obiutils.RemoveAllExt((path.Base(filename))))) options = append(options,
OptionsSource(obiutils.RemoveAllExt((path.Base(filename)))),
OptionsFileName(filename))
file, err := obiutils.Ropen(filename) file, err := obiutils.Ropen(filename)
+49 -40
View File
@@ -199,47 +199,13 @@ func _parse_json_array_interface(str []byte) ([]interface{}, error) {
return values, nil return values, nil
} }
func _parse_json_header_(header string, sequence *obiseq.BioSequence) string { // _parse_json_annotation_field parses a single key/value pair coming from a
// JSON object (either a FASTA/FASTQ inline JSON header, or the "annotations"
// field of a JSON sequence record) and applies it to the sequence, special
// casing the well-known OBITools attributes (id, definition, count, taxid,
// obiclean_*, merged_*).
func _parse_json_annotation_field(key []byte, value []byte, dataType jsonparser.ValueType, sequence *obiseq.BioSequence) error {
annotations := sequence.Annotations() annotations := sequence.Annotations()
start := -1
stop := -1
level := 0
lh := len(header)
inquote := false
for i := 0; (i < lh) && (stop < 0); i++ {
// fmt.Printf("[%d,%d-%d] : %d (%c) (%d,%c)\n", i, start, stop, header[i], header[i], '{', '{')
if level == 0 && header[i] == '{' && !inquote {
start = i
}
// TODO: escaped double quotes are not considered
if start > -1 && header[i] == '"' {
inquote = !inquote
}
if header[i] == '{' && !inquote {
level++
}
if header[i] == '}' && !inquote {
level--
}
if start >= 0 && level == 0 {
stop = i
}
}
if start < 0 || stop < 0 {
return header
}
stop++
jsonparser.ObjectEach(obiutils.UnsafeBytes(header[start:stop]),
func(key []byte, value []byte, dataType jsonparser.ValueType, offset int) error {
var err error var err error
skey := obiutils.UnsafeString(key) skey := obiutils.UnsafeString(key)
@@ -335,6 +301,49 @@ func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
} }
return err return err
}
func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
start := -1
stop := -1
level := 0
lh := len(header)
inquote := false
for i := 0; (i < lh) && (stop < 0); i++ {
// fmt.Printf("[%d,%d-%d] : %d (%c) (%d,%c)\n", i, start, stop, header[i], header[i], '{', '{')
if level == 0 && header[i] == '{' && !inquote {
start = i
}
// TODO: escaped double quotes are not considered
if start > -1 && header[i] == '"' {
inquote = !inquote
}
if header[i] == '{' && !inquote {
level++
}
if header[i] == '}' && !inquote {
level--
}
if start >= 0 && level == 0 {
stop = i
}
}
if start < 0 || stop < 0 {
return header
}
stop++
jsonparser.ObjectEach(obiutils.UnsafeBytes(header[start:stop]),
func(key []byte, value []byte, dataType jsonparser.ValueType, offset int) error {
return _parse_json_annotation_field(key, value, dataType, sequence)
}, },
) )
+82 -5
View File
@@ -17,7 +17,7 @@ import (
) )
var __obi_header_value_string_pattern__ = regexp.MustCompile(`^'\s*([^']*'|"[^"]*")\s*;`) var __obi_header_value_string_pattern__ = regexp.MustCompile(`^'\s*([^']*'|"[^"]*")\s*;`)
var __obi_header_value_numeric_pattern__ = regexp.MustCompile(`^\s*([+-]?\.\d+|[+-]?\d+(\.\d*)?([eE][+-]?\d+)?)\s*;`) var __obi_header_value_numeric_pattern__ = regexp.MustCompile(`^\s*[+-]?(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?\s*;`)
var __obi_header_map_int_key__ = regexp.MustCompile("([{,])([0-9]+):") var __obi_header_map_int_key__ = regexp.MustCompile("([{,])([0-9]+):")
func __match__dict__(text []byte) []int { func __match__dict__(text []byte) []int {
@@ -146,6 +146,65 @@ func __match__key__(text []byte) []int {
return []int{} // Not a key return []int{} // Not a key
} }
func __match__array__(text []byte) []int {
state := 0
level := 0
start := 0
instring := byte(0)
for i, r := range text {
if state == 2 {
if r == ';' {
return []int{start, i + 1}
}
if r != ' ' && r != '\t' {
return []int{}
}
}
if state == 0 {
if r == '[' {
level++
state++
start = i
continue
}
if r != ' ' && r != '\t' {
return []int{}
}
continue
}
// state == 1: inside the array
if instring != 0 {
if r == instring {
instring = 0
}
continue
}
if r == '"' || r == '\'' {
instring = r
continue
}
if r == '[' || r == '{' {
level++
continue
}
if r == ']' || r == '}' {
level--
if level == 0 {
state++
}
}
}
return []int{}
}
func __match__general__(text []byte) []int { func __match__general__(text []byte) []int {
for i, r := range text { for i, r := range text {
@@ -242,6 +301,21 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
stop = m[1] + 1 stop = m[1] + 1
} else { } else {
// array value
m = __match__array__(part)
if len(m) > 0 {
bvalue = bytes.TrimSpace(part[m[0]:(m[1] - 1)])
j := bytes.ReplaceAll(bvalue, []byte("'"), []byte(`"`))
j = __obi_header_map_int_key__.ReplaceAll(j, []byte(`$1"$2":`))
arr, err := _parse_json_array_interface(j)
if err != nil {
value = string(bvalue)
} else {
value = arr
}
stop = m[1] + 1
} else {
// Generic value // Generic value
// m = __obi_header_value_general_pattern__.FindIndex(part) // m = __obi_header_value_general_pattern__.FindIndex(part)
@@ -264,6 +338,7 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
// no value // no value
break break
} // End of No value } // End of No value
} // End of not array
} // End of not dict } // End of not dict
} // End of not string } // End of not string
} // End of not numeric } // End of not numeric
@@ -272,6 +347,8 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
case float64: case float64:
if vt == math.Floor(vt) { if vt == math.Floor(vt) {
annotations[key] = int(vt) annotations[key] = int(vt)
} else {
annotations[key] = vt
} }
default: default:
annotations[key] = value annotations[key] = value
@@ -327,9 +404,8 @@ func WriteFastSeqOBIHeade(buffer *bytes.Buffer, sequence *obiseq.BioSequence) {
buffer.WriteString(fmt.Sprintf("%s=", key)) buffer.WriteString(fmt.Sprintf("%s=", key))
buffer.Write(tv) buffer.Write(tv)
buffer.WriteString("; ") buffer.WriteString("; ")
case map[string]int, default:
map[string]string, if obiutils.IsAMap(value) || obiutils.IsASlice(value) || obiutils.IsAnArray(value) {
map[string]interface{}:
tv, err := obiutils.JsonMarshal(t) tv, err := obiutils.JsonMarshal(t)
if err != nil { if err != nil {
log.Fatalf("Cannot convert %v value", value) log.Fatalf("Cannot convert %v value", value)
@@ -338,11 +414,12 @@ func WriteFastSeqOBIHeade(buffer *bytes.Buffer, sequence *obiseq.BioSequence) {
buffer.WriteString(fmt.Sprintf("%s=", key)) buffer.WriteString(fmt.Sprintf("%s=", key))
buffer.Write(tv) buffer.Write(tv)
buffer.WriteString("; ") buffer.WriteString("; ")
default: } else {
buffer.WriteString(fmt.Sprintf("%s=%v; ", key, value)) buffer.WriteString(fmt.Sprintf("%s=%v; ", key, value))
} }
} }
} }
}
if sequence.HasDefinition() { if sequence.HasDefinition() {
buffer.WriteByte(' ') buffer.WriteByte(' ')
+3
View File
@@ -90,6 +90,9 @@ func FormatFastaBatch(batch obiiter.BioSequenceBatch, formater FormatHeader, ski
log.Debugf("FormatFastaBatch: #%d : %d seqs", batch.Order(), batch.Len()) log.Debugf("FormatFastaBatch: #%d : %d seqs", batch.Order(), batch.Len())
for _, seq := range batch.Slice() { for _, seq := range batch.Slice() {
if len(seq.Id()) == 0 {
log.Fatalf("Sequence identifier is empty")
}
if seq.Len() > 0 { if seq.Len() > 0 {
// Write header directly into bs — no intermediate string // Write header directly into bs — no intermediate string
bs.WriteByte('>') bs.WriteByte('>')
+3
View File
@@ -64,6 +64,9 @@ func FormatFastqBatch(batch obiiter.BioSequenceBatch,
first := true first := true
for _, seq := range batch.Slice() { for _, seq := range batch.Slice() {
if len(seq.Id()) == 0 {
log.Fatalf("Sequence identifier is empty")
}
if seq.Len() > 0 { if seq.Len() > 0 {
_formatFastq(&bs, seq, formater) _formatFastq(&bs, seq, formater)
+147
View File
@@ -0,0 +1,147 @@
package obiformats
import (
"io"
"os"
"path"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
"github.com/buger/jsonparser"
"github.com/goccy/go-json"
log "github.com/sirupsen/logrus"
)
// _parse_json_record parses a single JSON object describing a sequence
// (as produced by JSONRecord in json_writer.go) into a *obiseq.BioSequence.
func _parse_json_record(raw []byte, shift byte) *obiseq.BioSequence {
sequence := obiseq.NewEmptyBioSequence(0)
if id, err := jsonparser.GetString(raw, "id"); err == nil {
sequence.SetId(id)
}
if seq, err := jsonparser.GetString(raw, "sequence"); err == nil {
sequence.SetSequence([]byte(seq))
}
if qual, err := jsonparser.GetString(raw, "qualities"); err == nil {
q := []byte(qual)
for i := 0; i < len(q); i++ {
q[i] -= shift
}
sequence.SetQualities(q)
}
if annot, dataType, _, err := jsonparser.Get(raw, "annotations"); err == nil && dataType == jsonparser.Object {
jsonparser.ObjectEach(annot,
func(key []byte, value []byte, valType jsonparser.ValueType, offset int) error {
return _parse_json_annotation_field(key, value, valType, sequence)
},
)
}
return sequence
}
// _ParseJsonFile streams the top-level JSON array, decoding and pushing one
// batch of sequences at a time, without ever loading the whole document in
// memory. Only one raw record at a time is buffered by the decoder.
func _ParseJsonFile(source string,
reader io.Reader,
out obiiter.IBioSequence,
shift byte,
batchSize int) {
dec := json.NewDecoder(reader)
if _, err := dec.Token(); err != nil {
if err == io.EOF {
out.Done()
return
}
log.Fatalf("cannot parse JSON data: %v", err)
}
slice := obiseq.MakeBioSequenceSlice()
o := 0
for dec.More() {
var raw json.RawMessage
if err := dec.Decode(&raw); err != nil {
log.Fatalf("cannot parse JSON data: %v", err)
}
sequence := _parse_json_record(raw, shift)
slice = append(slice, sequence)
if len(slice) >= batchSize {
out.Push(obiiter.MakeBioSequenceBatch(source, o, slice))
o++
slice = obiseq.MakeBioSequenceSlice()
}
}
if len(slice) > 0 {
out.Push(obiiter.MakeBioSequenceBatch(source, o, slice))
}
out.Done()
}
func ReadJSON(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
opt := MakeOptions(options)
out := obiiter.MakeIBioSequence()
out.Add(1)
go _ParseJsonFile(opt.Source(),
reader,
out,
obidefault.ReadQualitiesShift(),
opt.BatchSize())
go func() {
out.WaitAndClose()
}()
return out, nil
}
func ReadJSONFromFile(filename string, options ...WithOption) (obiiter.IBioSequence, error) {
options = append(options, OptionsSource(obiutils.RemoveAllExt((path.Base(filename)))))
file, err := obiutils.Ropen(filename)
if err == obiutils.ErrNoContent {
log.Infof("file %s is empty", filename)
return ReadEmptyFile(options...)
}
if err != nil {
return obiiter.NilIBioSequence, err
}
return ReadJSON(file, options...)
}
func ReadJSONFromStdin(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
options = append(options, OptionsSource(obiutils.RemoveAllExt("stdin")))
input, err := obiutils.Buf(os.Stdin)
if err == obiutils.ErrNoContent {
log.Infof("stdin is empty")
return ReadEmptyFile(options...)
}
if err != nil {
log.Fatalf("open file error: %v", err)
return obiiter.NilIBioSequence, err
}
return ReadJSON(input, options...)
}
+5 -5
View File
@@ -631,9 +631,9 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
return nil, fmt.Errorf("row %d has %d columns, expected %d", len(data), len(fields), len(header)) return nil, fmt.Errorf("row %d has %d columns, expected %d", len(data), len(fields), len(header))
} }
forward_primer := fields[forward_primerColIndex] forward_primer := strings.TrimSpace(fields[forward_primerColIndex])
reverse_primer := fields[reverse_primerColIndex] reverse_primer := strings.TrimSpace(fields[reverse_primerColIndex])
tags := _parseMainNGSFilterTags(fields[sample_tagColIndex]) tags := _parseMainNGSFilterTags(strings.TrimSpace(fields[sample_tagColIndex]))
marker, _ := ngsfilter.GetMarker(forward_primer, reverse_primer) marker, _ := ngsfilter.GetMarker(forward_primer, reverse_primer)
pcr, ok := marker.GetPCR(tags.Forward, tags.Reverse) pcr, ok := marker.GetPCR(tags.Forward, tags.Reverse)
@@ -644,8 +644,8 @@ func ReadCSVNGSFilter(reader io.Reader) (*obingslibrary.NGSLibrary, error) {
i, tags.Forward, tags.Reverse, forward_primer, reverse_primer) i, tags.Forward, tags.Reverse, forward_primer, reverse_primer)
} }
pcr.Experiment = fields[experimentColIndex] pcr.Experiment = strings.TrimSpace(fields[experimentColIndex])
pcr.Sample = fields[sampleColIndex] pcr.Sample = strings.TrimSpace(fields[sampleColIndex])
if extraColumns != nil { if extraColumns != nil {
pcr.Annotations = make(obiseq.Annotation) pcr.Annotations = make(obiseq.Annotation)
+19
View File
@@ -35,6 +35,7 @@ type __options__ struct {
csv_auto bool csv_auto bool
paired_filename string paired_filename string
source string source string
filename string
with_feature_table bool with_feature_table bool
with_pattern bool with_pattern bool
with_parent bool with_parent bool
@@ -216,6 +217,16 @@ func (opt Options) Source() string {
return opt.pointer.source return opt.pointer.source
} }
// FileName returns the full path of the file being read, for use in
// diagnostic messages. It falls back to Source() when no explicit
// file name has been set (e.g. reading from stdin or a raw reader).
func (opt Options) FileName() string {
if opt.pointer.filename == "" {
return opt.pointer.source
}
return opt.pointer.filename
}
func (opt Options) WithFeatureTable() bool { func (opt Options) WithFeatureTable() bool {
return opt.pointer.with_feature_table return opt.pointer.with_feature_table
} }
@@ -421,6 +432,14 @@ func OptionsSource(source string) WithOption {
return f return f
} }
func OptionsFileName(filename string) WithOption {
f := WithOption(func(opt Options) {
opt.pointer.filename = filename
})
return f
}
func OptionsWithProgressBar() WithOption { func OptionsWithProgressBar() WithOption {
f := WithOption(func(opt Options) { f := WithOption(func(opt Options) {
opt.pointer.with_progress_bar = true opt.pointer.with_progress_bar = true
+2
View File
@@ -145,6 +145,8 @@ func ReadSequencesFromFile(filename string,
return ReadGenbank(reader, options...) return ReadGenbank(reader, options...)
case "text/csv": case "text/csv":
return ReadCSV(reader, options...) return ReadCSV(reader, options...)
case "application/json":
return ReadJSON(reader, options...)
default: default:
log.Fatalf("File %s has guessed format %s which is not yet implemented", log.Fatalf("File %s has guessed format %s which is not yet implemented",
filename, mime.String()) filename, mime.String())
+3 -3
View File
@@ -134,7 +134,7 @@ func TestUint128_QuoRem(t *testing.T) {
u := Uint128{w1: 3, w0: 8} u := Uint128{w1: 3, w0: 8}
v := Uint128{w1: 0, w0: 4} v := Uint128{w1: 0, w0: 4}
q, r := u.QuoRem(v) q, r := u.QuoRem(v)
assert.Equal(t, Uint128{w1: 0, w0: 2}, q) assert.Equal(t, Uint128{w1: 0, w0: 13835058055282163714}, q)
assert.Equal(t, Uint128{w1: 0, w0: 0}, r) assert.Equal(t, Uint128{w1: 0, w0: 0}, r)
} }
@@ -150,7 +150,7 @@ func TestUint128_Div(t *testing.T) {
u := Uint128{w1: 3, w0: 8} u := Uint128{w1: 3, w0: 8}
v := Uint128{w1: 0, w0: 4} v := Uint128{w1: 0, w0: 4}
q := u.Div(v) q := u.Div(v)
assert.Equal(t, Uint128{w1: 0, w0: 2}, q) assert.Equal(t, Uint128{w1: 0, w0: 13835058055282163714}, q)
} }
func TestUint128_Div64(t *testing.T) { func TestUint128_Div64(t *testing.T) {
@@ -183,7 +183,7 @@ func TestUint128_Cmp(t *testing.T) {
func TestUint128_Cmp64(t *testing.T) { func TestUint128_Cmp64(t *testing.T) {
u := Uint128{w1: 1, w0: 2} u := Uint128{w1: 1, w0: 2}
v := uint64(3) v := uint64(3)
assert.Equal(t, -1, u.Cmp64(v)) assert.Equal(t, 1, u.Cmp64(v))
} }
func TestUint128_Equals(t *testing.T) { func TestUint128_Equals(t *testing.T) {
+75 -40
View File
@@ -4,22 +4,21 @@ import "math"
// KmerEntropy computes the entropy of a single encoded k-mer. // KmerEntropy computes the entropy of a single encoded k-mer.
// //
// The algorithm mirrors the lowmask entropy calculation: it decodes the k-mer // The algorithm mirrors the Rust obiskbuilder entropy: it decodes the k-mer
// to a DNA sequence, extracts all sub-words of each size from 1 to levelMax, // to a DNA sequence, extracts all sub-words of each size from 1 to levelMax,
// normalizes them by circular canonical form, counts their frequencies, and // normalizes them by circular canonical form, counts their frequencies, and
// computes Shannon entropy normalized by the maximum possible entropy. // computes Shannon entropy corrected for class sizes, normalized by the
// maximum possible entropy over 4^ws raw bins.
// The returned value is the minimum entropy across all word sizes. // The returned value is the minimum entropy across all word sizes.
// //
// Correction for small sequences: the raw entropy H = log(N) - Σ f·log(f)/N
// under-estimates the true complexity when many raw words collapse to the same
// canonical form. Adding Σ f·log(class_size)/N recovers the entropy of the
// underlying uncollapsed distribution (assuming uniform mixing within each
// equivalence class).
//
// A value close to 0 indicates very low complexity (e.g. "AAAA..."), // A value close to 0 indicates very low complexity (e.g. "AAAA..."),
// while a value close to 1 indicates high complexity. // while a value close to 1 indicates high complexity.
//
// Parameters:
// - kmer: the encoded k-mer (2 bits per base)
// - k: the k-mer size
// - levelMax: maximum sub-word size for entropy (typically 6)
//
// Returns:
// - minimum normalized entropy across all word sizes 1..levelMax
func KmerEntropy(kmer uint64, k int, levelMax int) float64 { func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
if k < 1 || levelMax < 1 { if k < 1 || levelMax < 1 {
return 1.0 return 1.0
@@ -35,7 +34,7 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
var seqBuf [32]byte var seqBuf [32]byte
seq := DecodeKmer(kmer, k, seqBuf[:]) seq := DecodeKmer(kmer, k, seqBuf[:])
// Pre-compute nLogN lookup (same as lowmask) // Pre-compute nLogN lookup
nLogN := make([]float64, k+1) nLogN := make([]float64, k+1)
for i := 1; i <= k; i++ { for i := 1; i <= k; i++ {
nLogN[i] = float64(i) * math.Log(float64(i)) nLogN[i] = float64(i) * math.Log(float64(i))
@@ -51,6 +50,23 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
} }
} }
// Build ln(class_size) tables: for each canonical form, how many raw
// words map to it under circular normalization.
classLogSizeTables := make([][]float64, levelMax+1)
for ws := 1; ws <= levelMax; ws++ {
tableSize := 1 << (ws * 2)
classSize := make([]int, tableSize)
for code := 0; code < tableSize; code++ {
classSize[normTables[ws][code]]++
}
classLogSizeTables[ws] = make([]float64, tableSize)
for j := 0; j < tableSize; j++ {
if classSize[j] > 0 {
classLogSizeTables[ws][j] = math.Log(float64(classSize[j]))
}
}
}
minEntropy := math.MaxFloat64 minEntropy := math.MaxFloat64
for ws := 1; ws <= levelMax; ws++ { for ws := 1; ws <= levelMax; ws++ {
@@ -75,23 +91,13 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
table[normWord]++ table[normWord]++
} }
// Compute Shannon entropy // Compute emax over 4^ws raw bins (uncollapsed distribution).
floatNwords := float64(nwords) floatNwords := float64(nwords)
logNwords := math.Log(floatNwords) logNwords := math.Log(floatNwords)
na := tableSize // 4^ws
var sumNLogN float64
for j := 0; j < tableSize; j++ {
n := table[j]
if n > 0 {
sumNLogN += nLogN[n]
}
}
// Compute emax (maximum possible entropy for this word size)
na := CanonicalCircularKmerCount(ws)
var emax float64 var emax float64
if nwords < na { if nwords < na {
emax = math.Log(float64(nwords)) emax = logNwords
} else { } else {
cov := nwords / na cov := nwords / na
remains := nwords - (na * cov) remains := nwords - (na * cov)
@@ -105,7 +111,19 @@ func KmerEntropy(kmer uint64, k int, levelMax int) float64 {
continue continue
} }
entropy := (logNwords - sumNLogN/floatNwords) / emax // Accumulate Σ f·log(f) and Σ f·log(class_size) over canonical forms.
classLogSize := classLogSizeTables[ws]
var sumNLogN, sumClassLogN float64
for j := 0; j < tableSize; j++ {
n := table[j]
if n > 0 {
sumNLogN += nLogN[n]
sumClassLogN += float64(n) * classLogSize[j]
}
}
// Corrected entropy: H_raw ≈ log(N) + (Σf·log(s) - Σf·log(f)) / N
entropy := (logNwords + sumClassLogN/floatNwords - sumNLogN/floatNwords) / emax
if entropy < 0 { if entropy < 0 {
entropy = 0 entropy = 0
} }
@@ -134,6 +152,7 @@ type KmerEntropyFilter struct {
threshold float64 threshold float64
nLogN []float64 nLogN []float64
normTables [][]int normTables [][]int
classLogSizeTables [][]float64
emaxValues []float64 emaxValues []float64
logNwords []float64 logNwords []float64
// Pre-allocated frequency tables reused across Entropy() calls. // Pre-allocated frequency tables reused across Entropy() calls.
@@ -142,11 +161,6 @@ type KmerEntropyFilter struct {
} }
// NewKmerEntropyFilter creates an entropy filter with pre-computed tables. // NewKmerEntropyFilter creates an entropy filter with pre-computed tables.
//
// Parameters:
// - k: the k-mer size
// - levelMax: maximum sub-word size for entropy (typically 6)
// - threshold: entropy threshold (k-mers with entropy <= threshold are rejected)
func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter { func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter {
if levelMax >= k { if levelMax >= k {
levelMax = k - 1 levelMax = k - 1
@@ -169,20 +183,38 @@ func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter
} }
} }
// ln(class_size) for each canonical form under circular normalization.
classLogSizeTables := make([][]float64, levelMax+1)
for ws := 1; ws <= levelMax; ws++ {
tableSize := 1 << (ws * 2)
classSize := make([]int, tableSize)
for code := 0; code < tableSize; code++ {
classSize[normTables[ws][code]]++
}
classLogSizeTables[ws] = make([]float64, tableSize)
for j := 0; j < tableSize; j++ {
if classSize[j] > 0 {
classLogSizeTables[ws][j] = math.Log(float64(classSize[j]))
}
}
}
// Pre-compute emax and logNwords per word size.
// emax uses 4^ws raw bins to match the corrected entropy.
emaxValues := make([]float64, levelMax+1) emaxValues := make([]float64, levelMax+1)
logNwords := make([]float64, levelMax+1) logNwords := make([]float64, levelMax+1)
for ws := 1; ws <= levelMax; ws++ { for ws := 1; ws <= levelMax; ws++ {
nw := k - ws + 1 nw := k - ws + 1
na := CanonicalCircularKmerCount(ws) na := 1 << (ws * 2) // 4^ws raw bins
floatNw := float64(nw)
logNwords[ws] = math.Log(floatNw)
if nw < na { if nw < na {
logNwords[ws] = math.Log(float64(nw)) emaxValues[ws] = logNwords[ws]
emaxValues[ws] = math.Log(float64(nw))
} else { } else {
cov := nw / na cov := nw / na
remains := nw - (na * cov) remains := nw - (na * cov)
f1 := float64(cov) / float64(nw) f1 := float64(cov) / floatNw
f2 := float64(cov+1) / float64(nw) f2 := float64(cov+1) / floatNw
logNwords[ws] = math.Log(float64(nw))
emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) + emaxValues[ws] = -(float64(na-remains)*f1*math.Log(f1) +
float64(remains)*f2*math.Log(f2)) float64(remains)*f2*math.Log(f2))
} }
@@ -200,6 +232,7 @@ func NewKmerEntropyFilter(k, levelMax int, threshold float64) *KmerEntropyFilter
threshold: threshold, threshold: threshold,
nLogN: nLogN, nLogN: nLogN,
normTables: normTables, normTables: normTables,
classLogSizeTables: classLogSizeTables,
emaxValues: emaxValues, emaxValues: emaxValues,
logNwords: logNwords, logNwords: logNwords,
freqTables: freqTables, freqTables: freqTables,
@@ -236,7 +269,7 @@ func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
// Count circular-canonical sub-word frequencies // Count circular-canonical sub-word frequencies
tableSize := 1 << (ws * 2) tableSize := 1 << (ws * 2)
table := ef.freqTables[ws] table := ef.freqTables[ws]
clear(table) // reset to zero clear(table)
mask := (1 << (ws * 2)) - 1 mask := (1 << (ws * 2)) - 1
normTable := ef.normTables[ws] normTable := ef.normTables[ws]
@@ -251,19 +284,21 @@ func (ef *KmerEntropyFilter) Entropy(kmer uint64) float64 {
table[normWord]++ table[normWord]++
} }
// Compute Shannon entropy
floatNwords := float64(nwords) floatNwords := float64(nwords)
logNwords := ef.logNwords[ws] logNwords := ef.logNwords[ws]
classLogSize := ef.classLogSizeTables[ws]
var sumNLogN float64 var sumNLogN, sumClassLogN float64
for j := 0; j < tableSize; j++ { for j := 0; j < tableSize; j++ {
n := table[j] n := table[j]
if n > 0 { if n > 0 {
sumNLogN += ef.nLogN[n] sumNLogN += ef.nLogN[n]
sumClassLogN += float64(n) * classLogSize[j]
} }
} }
entropy := (logNwords - sumNLogN/floatNwords) / emax // Corrected entropy: H_raw ≈ log(N) + (Σf·log(s) - Σf·log(f)) / N
entropy := (logNwords + sumClassLogN/floatNwords - sumNLogN/floatNwords) / emax
if entropy < 0 { if entropy < 0 {
entropy = 0 entropy = 0
} }
+1 -1
View File
@@ -777,7 +777,7 @@ func (library *NGSLibrary) ExtractMultiBarcodeSliceWorker(options ...WithOption)
library.SetAllowsIndels(true) library.SetAllowsIndels(true)
} }
if opt.AllowedMismatches() > 0 { if opt.AllowedMismatchesIsSet() {
library.SetAllowedMismatches(opt.AllowedMismatches()) library.SetAllowedMismatches(opt.AllowedMismatches())
} }
+8
View File
@@ -9,6 +9,7 @@ type _Options struct {
discardErrors bool discardErrors bool
unidentified string unidentified string
allowedMismatch int allowedMismatch int
allowedMismatchSet bool
allowsIndel bool allowsIndel bool
withProgressBar bool withProgressBar bool
parallelWorkers int parallelWorkers int
@@ -52,6 +53,7 @@ func OptionWithProgressBar(yes bool) WithOption {
func OptionAllowedMismatches(count int) WithOption { func OptionAllowedMismatches(count int) WithOption {
f := WithOption(func(opt Options) { f := WithOption(func(opt Options) {
opt.pointer.allowedMismatch = count opt.pointer.allowedMismatch = count
opt.pointer.allowedMismatchSet = true
}) })
return f return f
@@ -97,6 +99,12 @@ func (options Options) AllowedMismatches() int {
return options.pointer.allowedMismatch return options.pointer.allowedMismatch
} }
// AllowedMismatchesIsSet returns true if OptionAllowedMismatches
// was explicitly applied to these options.
func (options Options) AllowedMismatchesIsSet() bool {
return options.pointer.allowedMismatchSet
}
func (options Options) AllowsIndels() bool { func (options Options) AllowsIndels() bool {
return options.pointer.allowsIndel return options.pointer.allowsIndel
} }
+1 -1
View File
@@ -3,7 +3,7 @@ package obioptions
// Version is automatically updated by the Makefile from version.txt // Version is automatically updated by the Makefile from version.txt
// The patch number (third digit) is incremented on each push to the repository // The patch number (third digit) is incremented on each push to the repository
var _Version = "Release 4.4.41" var _Version = "Release 4.5.0"
// Version returns the version of the obitools package. // Version returns the version of the obitools package.
// //
+18
View File
@@ -364,6 +364,24 @@ func (s *BioSequence) GetIntSlice(key string) ([]int, bool) {
return val, ok return val, ok
} }
func (s *BioSequence) GetMapOfIntSlice(key string) (map[string][]int, bool) {
v, ok := s.GetAttribute(key)
if !ok {
return nil, false
}
val, err := obiutils.InterfaceToMapOfIntSlice(v)
return val, err == nil
}
func (s *BioSequence) GetMapOfStringSlice(key string) (map[string][]string, bool) {
v, ok := s.GetAttribute(key)
if !ok {
return nil, false
}
val, err := obiutils.InterfaceToMapOfStringSlice(v)
return val, err == nil
}
// Count returns the value of the "count" attribute of the BioSequence. // Count returns the value of the "count" attribute of the BioSequence.
// //
// The count of a sequence is the number of times it has been observed in the dataset. // The count of a sequence is the number of times it has been observed in the dataset.
+1 -1
View File
@@ -103,7 +103,7 @@ func TestNewBioSequence(t *testing.T) {
// Return type: None. // Return type: None.
func TestNewBioSequenceWithQualities(t *testing.T) { func TestNewBioSequenceWithQualities(t *testing.T) {
id := "123" id := "123"
sequence := []byte("ATGC") sequence := []byte("atgc")
definition := "DNA sequence" definition := "DNA sequence"
qualities := []byte("1234") qualities := []byte("1234")
+27
View File
@@ -141,6 +141,33 @@ var OBILang = gval.NewLanguage(
gval.Function("max", func(args ...interface{}) (interface{}, error) { gval.Function("max", func(args ...interface{}) (interface{}, error) {
return obiutils.Max(args[0]) return obiutils.Max(args[0])
}), }),
gval.Function("whichmax", func(args ...interface{}) (interface{}, error) {
result, err := obiutils.WhichMax(args[0])
if idx, ok := result.(int); ok {
return float64(idx), nil
}
return result, err
}),
gval.Function("whichmin", func(args ...interface{}) (interface{}, error) {
result, err := obiutils.WhichMin(args[0])
if idx, ok := result.(int); ok {
return float64(idx), nil
}
return result, err
}),
gval.Function("filtermin", func(args ...interface{}) (interface{}, error) {
return obiutils.FilterMin(args[0], args[1])
}),
gval.Function("filtermax", func(args ...interface{}) (interface{}, error) {
return obiutils.FilterMax(args[0], args[1])
}),
gval.Function("saturatingsub", func(args ...interface{}) (interface{}, error) {
return obiutils.SaturatingSub(args[0], args[1])
}),
gval.Function("contains", func(args ...interface{}) (interface{}, error) { gval.Function("contains", func(args ...interface{}) (interface{}, error) {
if obiutils.IsAMap(args[0]) { if obiutils.IsAMap(args[0]) {
val := reflect.ValueOf(args[0]).MapIndex(reflect.ValueOf(args[1])) val := reflect.ValueOf(args[0]).MapIndex(reflect.ValueOf(args[1]))
+7 -1
View File
@@ -70,6 +70,12 @@ func (s *BioSequence) SetTaxid(taxid string, rank ...string) {
} }
} }
} else if obidefault.UseRawTaxids() {
// Without a loaded taxonomy, extract the bare ID from full-format strings
// like "code:12345 [Name]@rank" so that --raw-taxid is honoured everywhere.
if _, rawID, _, _, parseErr := obitax.ParseTaxonString(taxid); parseErr == nil {
taxid = rawID
}
} }
} }
@@ -177,7 +183,7 @@ func (sequence *BioSequence) SetPath(taxonomy *obitax.Taxonomy) []string {
lpath := path.Len() - 1 lpath := path.Len() - 1
for i := lpath; i >= 0; i-- { for i := lpath; i >= 0; i-- {
spath[lpath-i] = path.Get(i).String(taxonomy.Code()) spath[lpath-i] = path.Get(i).FullString(taxonomy.Code())
} }
sequence.SetAttribute("taxonomic_path", spath) sequence.SetAttribute("taxonomic_path", spath)
+19 -13
View File
@@ -29,6 +29,24 @@ type TaxNode struct {
alternatenames *map[*string]*string alternatenames *map[*string]*string
} }
// FullString returns the full string representation of the TaxNode in the form
// "taxonomyCode:id [scientificName]@rank", regardless of the UseRawTaxids setting.
// This is used internally when a parseable format is required (e.g. taxonomic_path).
func (node *TaxNode) FullString(taxonomyCode string) string {
if node.HasScientificName() {
return fmt.Sprintf("%s:%v [%s]@%s",
taxonomyCode,
*node.id,
node.ScientificName(),
node.Rank(),
)
}
return fmt.Sprintf("%s:%v",
taxonomyCode,
*node.id)
}
// String returns a string representation of the TaxNode, including the taxonomy code, // String returns a string representation of the TaxNode, including the taxonomy code,
// the node ID, and the scientific name. The output format is "taxonomyCode:id [scientificName]". // the node ID, and the scientific name. The output format is "taxonomyCode:id [scientificName]".
// //
@@ -42,19 +60,7 @@ func (node *TaxNode) String(taxonomyCode string) string {
return *node.id return *node.id
} }
if node.HasScientificName() { return node.FullString(taxonomyCode)
return fmt.Sprintf("%s:%v [%s]@%s",
taxonomyCode,
*node.id,
node.ScientificName(),
node.Rank(),
)
}
return fmt.Sprintf("%s:%v",
taxonomyCode,
*node.id)
} }
// Id returns the unique identifier of the TaxNode. // Id returns the unique identifier of the TaxNode.
+6
View File
@@ -24,6 +24,7 @@ var __input_genbank_format__ = false
var __input_fastq_format__ = false var __input_fastq_format__ = false
var __input_fasta_format__ = false var __input_fasta_format__ = false
var __input_csv_format__ = false var __input_csv_format__ = false
var __input_json_format__ = false
var __output_in_fasta__ = false var __output_in_fasta__ = false
var __output_in_fastq__ = false var __output_in_fastq__ = false
@@ -71,6 +72,9 @@ func InputOptionSet(options *getoptions.GetOpt) {
options.BoolVar(&__input_csv_format__, "csv", __input_csv_format__, options.BoolVar(&__input_csv_format__, "csv", __input_csv_format__,
options.Description("Read data following the CSV format.")) options.Description("Read data following the CSV format."))
options.BoolVar(&__input_json_format__, "json", __input_json_format__,
options.Description("Read data following the JSON format."))
options.BoolVar(&__no_ordered_input__, "no-order", __no_ordered_input__, options.BoolVar(&__no_ordered_input__, "no-order", __no_ordered_input__,
options.Description("When several input files are provided, "+ options.Description("When several input files are provided, "+
"indicates that there is no order among them.")) "indicates that there is no order among them."))
@@ -158,6 +162,8 @@ func CLIInputFormat() string {
return "genbank" return "genbank"
case __input_csv_format__: case __input_csv_format__:
return "csv" return "csv"
case __input_json_format__:
return "json"
default: default:
return "guessed" return "guessed"
} }
+7 -1
View File
@@ -73,7 +73,9 @@ func ExpandListOfFiles(check_ext bool, filenames ...string) ([]string, error) {
strings.HasSuffix(path, "dat") || strings.HasSuffix(path, "dat") ||
strings.HasSuffix(path, "dat.gz") || strings.HasSuffix(path, "dat.gz") ||
strings.HasSuffix(path, "ecopcr") || strings.HasSuffix(path, "ecopcr") ||
strings.HasSuffix(path, "ecopcr.gz") { strings.HasSuffix(path, "ecopcr.gz") ||
strings.HasSuffix(path, "json") ||
strings.HasSuffix(path, "json.gz") {
log.Debugf("Appending %s file\n", path) log.Debugf("Appending %s file\n", path)
list_of_files.Add(path) list_of_files.Add(path)
} }
@@ -142,6 +144,8 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
iterator, err = obiformats.ReadFastq(os.Stdin, opts...) iterator, err = obiformats.ReadFastq(os.Stdin, opts...)
case "csv": case "csv":
iterator, err = obiformats.ReadCSV(os.Stdin, opts...) iterator, err = obiformats.ReadCSV(os.Stdin, opts...)
case "json":
iterator, err = obiformats.ReadJSON(os.Stdin, opts...)
default: default:
iterator, err = obiformats.ReadSequencesFromStdin(opts...) iterator, err = obiformats.ReadSequencesFromStdin(opts...)
} }
@@ -163,6 +167,8 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
reader = obiformats.ReadFastaFromFile reader = obiformats.ReadFastaFromFile
case "csv": case "csv":
reader = obiformats.ReadCSVFromFile reader = obiformats.ReadCSVFromFile
case "json":
reader = obiformats.ReadJSONFromFile
case "ecopcr": case "ecopcr":
reader = obiformats.ReadEcoPCRFromFile reader = obiformats.ReadEcoPCRFromFile
case "embl": case "embl":
+1 -1
View File
@@ -170,7 +170,7 @@ func CLISelectLandmarkSequences(iterator obiiter.IBioSequence) obiiter.IBioSeque
for i, seq := range library { for i, seq := range library {
taxon := seq.Taxon(taxo) taxon := seq.Taxon(taxo)
if taxon == nil { if taxon == nil {
log.Fatal("%s: Cannot identify taxid %s in %s", seq.Id(), seq.Taxid(), taxo.Name()) log.Fatalf("%s: Cannot identify taxid %s in %s", seq.Id(), seq.Taxid(), taxo.Name())
} }
taxa.Set(i, taxon) taxa.Set(i, taxon)
} }
+8 -1
View File
@@ -15,7 +15,6 @@ func IExtractBarcode(iterator obiiter.IBioSequence) (obiiter.IBioSequence, error
opts := make([]obingslibrary.WithOption, 0, 10) opts := make([]obingslibrary.WithOption, 0, 10)
opts = append(opts, opts = append(opts,
obingslibrary.OptionAllowedMismatches(CLIAllowedMismatch()),
obingslibrary.OptionAllowedIndel(CLIAllowsIndel()), obingslibrary.OptionAllowedIndel(CLIAllowsIndel()),
obingslibrary.OptionUnidentified(CLIUnidentifiedFileName()), obingslibrary.OptionUnidentified(CLIUnidentifiedFileName()),
obingslibrary.OptionDiscardErrors(!CLIConservedErrors()), obingslibrary.OptionDiscardErrors(!CLIConservedErrors()),
@@ -23,6 +22,14 @@ func IExtractBarcode(iterator obiiter.IBioSequence) (obiiter.IBioSequence, error
obingslibrary.OptionBatchSize(obidefault.BatchSize()), obingslibrary.OptionBatchSize(obidefault.BatchSize()),
) )
// Only propagate the CLI --allowed-mismatches value if the user
// explicitly set it: otherwise the per-primer values defined in
// the NGSFilter config file (@primer_mismatches, @forward_mismatches,
// @reverse_mismatches) must be preserved.
if CLIAllowedMismatchIsSet() {
opts = append(opts, obingslibrary.OptionAllowedMismatches(CLIAllowedMismatch()))
}
ngsfilter, err := CLINGSFIlter() ngsfilter, err := CLINGSFIlter()
if err != nil { if err != nil {
log.Fatalf("%v", err) log.Fatalf("%v", err)
+12
View File
@@ -18,6 +18,7 @@ var _UnidentifiedFile = ""
var _AllowedMismatch = 2 var _AllowedMismatch = 2
var _AllowsIndel = false var _AllowsIndel = false
var _ConservedError = false var _ConservedError = false
var _optionsParser *getoptions.GetOpt
// PCROptionSet defines every options related to a simulated PCR. // PCROptionSet defines every options related to a simulated PCR.
// //
@@ -29,6 +30,8 @@ var _ConservedError = false
// - option : is a pointer to a getoptions.GetOpt instance normaly // - option : is a pointer to a getoptions.GetOpt instance normaly
// produced by the // produced by the
func MultiplexOptionSet(options *getoptions.GetOpt) { func MultiplexOptionSet(options *getoptions.GetOpt) {
_optionsParser = options
options.StringVar(&_NGSFilterFile, "tag-list", _NGSFilterFile, options.StringVar(&_NGSFilterFile, "tag-list", _NGSFilterFile,
options.Alias("s"), options.Alias("s"),
options.Description("File name of the NGSFilter file describing PCRs.")) options.Description("File name of the NGSFilter file describing PCRs."))
@@ -62,6 +65,15 @@ func CLIAllowedMismatch() int {
return _AllowedMismatch return _AllowedMismatch
} }
// CLIAllowedMismatchIsSet returns true if the user explicitly
// specified --allowed-mismatches on the command line, as opposed
// to relying on its default value. This allows per-primer mismatch
// settings from the NGSFilter config file to take precedence unless
// the user explicitly overrides them from the CLI.
func CLIAllowedMismatchIsSet() bool {
return _optionsParser != nil && _optionsParser.Called("allowed-mismatches")
}
func CLIAllowsIndel() bool { func CLIAllowsIndel() bool {
return _AllowsIndel return _AllowsIndel
} }
+4 -2
View File
@@ -21,12 +21,10 @@ func PairingOptionSet(options *getoptions.GetOpt) {
options.StringVar(&_ForwardFile, "forward-reads", "", options.StringVar(&_ForwardFile, "forward-reads", "",
options.Alias("F"), options.Alias("F"),
options.ArgName("FILENAME_F"), options.ArgName("FILENAME_F"),
options.Required("You must provide at a forward file"),
options.Description("The file names containing the forward reads")) options.Description("The file names containing the forward reads"))
options.StringVar(&_ReverseFile, "reverse-reads", "", options.StringVar(&_ReverseFile, "reverse-reads", "",
options.Alias("R"), options.Alias("R"),
options.ArgName("FILENAME_R"), options.ArgName("FILENAME_R"),
options.Required("You must provide a reverse file"),
options.Description("The file names containing the reverse reads")) options.Description("The file names containing the reverse reads"))
options.IntVar(&_Delta, "delta", _Delta, options.IntVar(&_Delta, "delta", _Delta,
options.Alias("D"), options.Alias("D"),
@@ -72,6 +70,10 @@ func CLIPairedSequence() (obiiter.IBioSequence, error) {
return paired, nil return paired, nil
} }
func CLIHasPairedFiles() bool {
return _ForwardFile != "" && _ReverseFile != ""
}
func CLIDelta() int { func CLIDelta() int {
return _Delta return _Delta
} }
+5 -5
View File
@@ -55,7 +55,7 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
ngsfilter.SetAllowsIndels(true) ngsfilter.SetAllowsIndels(true)
} }
if obimultiplex.CLIAllowedMismatch() > 0 { if obimultiplex.CLIAllowedMismatchIsSet() {
ngsfilter.SetAllowedMismatches(obimultiplex.CLIAllowedMismatch()) ngsfilter.SetAllowedMismatches(obimultiplex.CLIAllowedMismatch())
} }
@@ -114,10 +114,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
aanot["obimultiplex_direction"] = direction aanot["obimultiplex_direction"] = direction
aanot["obimultiplex_forward_match"] = forward_match aanot["obimultiplex_forward_match"] = forward_match
aanot["obimultiplex_forward_mismatches"] = forward_mismatches aanot["obimultiplex_forward_error"] = forward_mismatches
aanot["obimultiplex_reverse_match"] = reverse_match aanot["obimultiplex_reverse_match"] = reverse_match
aanot["obimultiplex_reverse_mismatches"] = reverse_mismatches aanot["obimultiplex_reverse_error"] = reverse_mismatches
aanot["sample"] = sample aanot["sample"] = sample
aanot["experiment"] = experiment aanot["experiment"] = experiment
@@ -125,10 +125,10 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
banot["obimultiplex_direction"] = direction banot["obimultiplex_direction"] = direction
banot["obimultiplex_forward_match"] = forward_match banot["obimultiplex_forward_match"] = forward_match
banot["obimultiplex_forward_mismatches"] = forward_mismatches banot["obimultiplex_forward_error"] = forward_mismatches
banot["obimultiplex_reverse_match"] = reverse_match banot["obimultiplex_reverse_match"] = reverse_match
banot["obimultiplex_reverse_mismatches"] = reverse_mismatches banot["obimultiplex_reverse_error"] = reverse_mismatches
banot["sample"] = sample banot["sample"] = sample
banot["experiment"] = experiment banot["experiment"] = experiment
+38
View File
@@ -276,6 +276,44 @@ func InterfaceToStringMap(i interface{}) (val map[string]string, err error) {
return return
} }
func InterfaceToMapOfIntSlice(i interface{}) (val map[string][]int, err error) {
err = nil
switch m := i.(type) {
case map[string][]int:
val = m
case map[string]interface{}:
val = make(map[string][]int, len(m))
for k, v := range m {
val[k], err = InterfaceToIntSlice(v)
if err != nil {
return
}
}
default:
err = &NotAMapInt{"value attribute cannot be casted to a map[string][]int"}
}
return
}
func InterfaceToMapOfStringSlice(i interface{}) (val map[string][]string, err error) {
err = nil
switch m := i.(type) {
case map[string][]string:
val = m
case map[string]interface{}:
val = make(map[string][]string, len(m))
for k, v := range m {
val[k], err = InterfaceToStringSlice(v)
if err != nil {
return
}
}
default:
err = &NotAMapInt{"value attribute cannot be casted to a map[string][]string"}
}
return
}
func InterfaceToStringSlice(i interface{}) (val []string, err error) { func InterfaceToStringSlice(i interface{}) (val []string, err error) {
err = nil err = nil
+6
View File
@@ -102,6 +102,11 @@ func RegisterOBIMimeType() {
return ok return ok
} }
jsonDetector := func(raw []byte, limit uint32) bool {
raw = bytes.TrimLeft(raw, " \t\r\n")
return len(raw) > 0 && (raw[0] == '[' || raw[0] == '{')
}
mimetype.Lookup("text/plain").Extend(fastaDetector, "text/fasta", ".fasta") mimetype.Lookup("text/plain").Extend(fastaDetector, "text/fasta", ".fasta")
mimetype.Lookup("text/plain").Extend(fastqDetector, "text/fastq", ".fastq") mimetype.Lookup("text/plain").Extend(fastqDetector, "text/fastq", ".fastq")
mimetype.Lookup("text/plain").Extend(ecoPCR2Detector, "text/ecopcr2", ".ecopcr") mimetype.Lookup("text/plain").Extend(ecoPCR2Detector, "text/ecopcr2", ".ecopcr")
@@ -115,6 +120,7 @@ func RegisterOBIMimeType() {
mimetype.Lookup("application/octet-stream").Extend(genbankDetector, "text/genbank", ".seq") mimetype.Lookup("application/octet-stream").Extend(genbankDetector, "text/genbank", ".seq")
mimetype.Lookup("application/octet-stream").Extend(emblDetector, "text/embl", ".dat") mimetype.Lookup("application/octet-stream").Extend(emblDetector, "text/embl", ".dat")
mimetype.Lookup("application/octet-stream").Extend(csv, "text/csv", ".csv") mimetype.Lookup("application/octet-stream").Extend(csv, "text/csv", ".csv")
mimetype.Lookup("application/octet-stream").Extend(jsonDetector, "application/json", ".json")
} }
__obimimetype_registred__ = true __obimimetype_registred__ = true
} }
+365 -4
View File
@@ -34,6 +34,26 @@ func MinMaxSlice[T constraints.Ordered](vec []T) (min, max T) {
return return
} }
func FilterMinSlice[T constraints.Ordered](vec []T, minimum T) []T {
result := make([]T, 0, len(vec))
for _, v := range vec {
if v >= minimum {
result = append(result, v)
}
}
return result
}
func FilterMaxSlice[T constraints.Ordered](vec []T, maximum T) []T {
result := make([]T, 0, len(vec))
for _, v := range vec {
if v <= maximum {
result = append(result, v)
}
}
return result
}
func MaxMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) { func MaxMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
var maxKey K var maxKey K
var maxValue T var maxValue T
@@ -73,6 +93,46 @@ func MinMap[K comparable, T constraints.Ordered](values map[K]T) (K, T, error) {
return minKey, minValue, nil return minKey, minValue, nil
} }
func FilterMinMap[K comparable, T constraints.Ordered](values map[K]T, minimum T) map[K]T {
result := make(map[K]T)
for k, v := range values {
if v >= minimum {
result[k] = v
}
}
return result
}
func FilterMaxMap[K comparable, T constraints.Ordered](values map[K]T, maximum T) map[K]T {
result := make(map[K]T)
for k, v := range values {
if v <= maximum {
result[k] = v
}
}
return result
}
func SaturatingSubSlice[T Numeric](vec []T, sub T) []T {
result := make([]T, len(vec))
for i, v := range vec {
if v > sub {
result[i] = v - sub
}
}
return result
}
func SaturatingSubMap[K comparable, T Numeric](values map[K]T, sub T) map[K]T {
result := make(map[K]T)
for k, v := range values {
if v > sub {
result[k] = v - sub
}
}
return result
}
// Min returns the smallest element in a slice/array or map, // Min returns the smallest element in a slice/array or map,
// or the value itself if data is a single comparable value. // or the value itself if data is a single comparable value.
// Returns an error if the container is empty or the type is unsupported. // Returns an error if the container is empty or the type is unsupported.
@@ -135,11 +195,121 @@ func Max(data interface{}) (interface{}, error) {
} }
} }
func FilterMin(data interface{}, minimum interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return filterMinFromIterable(v, minimum)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return filterMinFromMap(v, minimum)
default:
if !isOrderedKind(v.Kind()) {
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
return data, nil
}
}
func FilterMax(data interface{}, maximum interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return filterMaxFromIterable(v, maximum)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return filterMaxFromMap(v, maximum)
default:
if !isOrderedKind(v.Kind()) {
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
return data, nil
}
}
func SaturatingSub(data interface{}, sub interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
return saturatingSubFromIterable(v, sub)
case reflect.Map:
return saturatingSubFromMap(v, sub)
default:
if !isNumericKind(v.Kind()) {
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
r, err := saturatingSubValues(v, reflect.ValueOf(sub))
if err != nil {
return nil, err
}
return r.Interface(), nil
}
}
func saturatingSubFromIterable(v reflect.Value, sub interface{}) (interface{}, error) {
subVal := reflect.ValueOf(sub)
result := reflect.MakeSlice(v.Type(), v.Len(), v.Len())
for i := 0; i < v.Len(); i++ {
r, err := saturatingSubValues(v.Index(i), subVal)
if err != nil {
return nil, err
}
result.Index(i).Set(r)
}
return result.Interface(), nil
}
func saturatingSubFromMap(v reflect.Value, sub interface{}) (interface{}, error) {
subVal := reflect.ValueOf(sub)
result := reflect.MakeMap(v.Type())
for _, key := range v.MapKeys() {
r, err := saturatingSubValues(v.MapIndex(key), subVal)
if err != nil {
return nil, err
}
if !r.IsZero() {
result.SetMapIndex(key, r)
}
}
return result.Interface(), nil
}
func saturatingSubValues(a, b reflect.Value) (reflect.Value, error) {
result := reflect.New(a.Type()).Elem()
switch a.Kind() {
case reflect.Int, reflect.Int8, reflect.Int16, reflect.Int32, reflect.Int64:
if av, bv := a.Int(), b.Int(); av > bv {
result.SetInt(av - bv)
}
case reflect.Uint, reflect.Uint8, reflect.Uint16, reflect.Uint32, reflect.Uint64:
if av, bv := a.Uint(), b.Uint(); av > bv {
result.SetUint(av - bv)
}
case reflect.Float32, reflect.Float64:
if av, bv := a.Float(), b.Float(); av > bv {
result.SetFloat(av - bv)
}
default:
return reflect.Value{}, fmt.Errorf("unsupported type for saturating subtraction: %s", a.Kind())
}
return result, nil
}
// maxFromIterable scans a slice/array to find the maximum. // maxFromIterable scans a slice/array to find the maximum.
func maxFromIterable(v reflect.Value) (interface{}, error) { func maxFromIterable(v reflect.Value) (interface{}, error) {
var best reflect.Value var best reflect.Value
for i := 0; i < v.Len(); i++ { for i := 0; i < v.Len(); i++ {
elem := v.Index(i) elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) { if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind()) return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
} }
@@ -154,7 +324,7 @@ func maxFromIterable(v reflect.Value) (interface{}, error) {
func minFromIterable(v reflect.Value) (interface{}, error) { func minFromIterable(v reflect.Value) (interface{}, error) {
var minVal reflect.Value var minVal reflect.Value
for i := 0; i < v.Len(); i++ { for i := 0; i < v.Len(); i++ {
elem := v.Index(i) elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) { if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind()) return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
} }
@@ -165,12 +335,182 @@ func minFromIterable(v reflect.Value) (interface{}, error) {
return minVal.Interface(), nil return minVal.Interface(), nil
} }
func filterMinFromIterable(v reflect.Value, minimum interface{}) (interface{}, error) {
minVal := reflect.ValueOf(minimum)
result := reflect.MakeSlice(v.Type(), 0, v.Len())
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !less(elem, minVal) { // elem >= minimum
result = reflect.Append(result, elem)
}
}
return result.Interface(), nil
}
func filterMaxFromIterable(v reflect.Value, maximum interface{}) (interface{}, error) {
maxVal := reflect.ValueOf(maximum)
result := reflect.MakeSlice(v.Type(), 0, v.Len())
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !greater(elem, maxVal) { // elem <= maximum
result = reflect.Append(result, elem)
}
}
return result.Interface(), nil
}
// whichMaxFromIterable returns the index of the maximum element in a slice/array.
func whichMaxFromIterable(v reflect.Value) (int, error) {
var best reflect.Value
bestIdx := 0
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if i == 0 || greater(elem, best) {
best = elem
bestIdx = i
}
}
return bestIdx, nil
}
// whichMinFromIterable returns the index of the minimum element in a slice/array.
func whichMinFromIterable(v reflect.Value) (int, error) {
var minVal reflect.Value
minIdx := 0
for i := 0; i < v.Len(); i++ {
elem := unwrapInterface(v.Index(i))
if !isOrderedKind(elem.Kind()) {
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if i == 0 || less(elem, minVal) {
minVal = elem
minIdx = i
}
}
return minIdx, nil
}
// whichMaxFromMap returns the key associated with the maximum value in a map.
func whichMaxFromMap(v reflect.Value) (interface{}, error) {
var best reflect.Value
var bestKey reflect.Value
first := true
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if first || greater(elem, best) {
best = elem
bestKey = key
first = false
}
}
return bestKey.Interface(), nil
}
// whichMinFromMap returns the key associated with the minimum value in a map.
func whichMinFromMap(v reflect.Value) (interface{}, error) {
var minVal reflect.Value
var minKey reflect.Value
first := true
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if first || less(elem, minVal) {
minVal = elem
minKey = key
first = false
}
}
return minKey.Interface(), nil
}
// WhichMax returns the key (for a map) or index (for a slice/array) of the maximum value.
func WhichMax(data interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return whichMaxFromIterable(v)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return whichMaxFromMap(v)
default:
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
}
// WhichMin returns the key (for a map) or index (for a slice/array) of the minimum value.
func WhichMin(data interface{}) (interface{}, error) {
v := reflect.ValueOf(data)
switch v.Kind() {
case reflect.Slice, reflect.Array:
if v.Len() == 0 {
return nil, errors.New("empty slice or array")
}
return whichMinFromIterable(v)
case reflect.Map:
if v.Len() == 0 {
return nil, errors.New("empty map")
}
return whichMinFromMap(v)
default:
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
}
}
func filterMinFromMap(v reflect.Value, minimum interface{}) (interface{}, error) {
minVal := reflect.ValueOf(minimum)
result := reflect.MakeMap(v.Type())
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !less(elem, minVal) { // elem >= minimum
result.SetMapIndex(key, elem)
}
}
return result.Interface(), nil
}
func filterMaxFromMap(v reflect.Value, maximum interface{}) (interface{}, error) {
maxVal := reflect.ValueOf(maximum)
result := reflect.MakeMap(v.Type())
for _, key := range v.MapKeys() {
elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
}
if !greater(elem, maxVal) { // elem <= maximum
result.SetMapIndex(key, elem)
}
}
return result.Interface(), nil
}
// maxFromMap scans map values to find the maximum. // maxFromMap scans map values to find the maximum.
func maxFromMap(v reflect.Value) (interface{}, error) { func maxFromMap(v reflect.Value) (interface{}, error) {
var best reflect.Value var best reflect.Value
first := true first := true
for _, key := range v.MapKeys() { for _, key := range v.MapKeys() {
elem := v.MapIndex(key) elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) { if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind()) return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
} }
@@ -187,7 +527,7 @@ func minFromMap(v reflect.Value) (interface{}, error) {
var minVal reflect.Value var minVal reflect.Value
first := true first := true
for _, key := range v.MapKeys() { for _, key := range v.MapKeys() {
elem := v.MapIndex(key) elem := unwrapInterface(v.MapIndex(key))
if !isOrderedKind(elem.Kind()) { if !isOrderedKind(elem.Kind()) {
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind()) return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
} }
@@ -199,6 +539,27 @@ func minFromMap(v reflect.Value) (interface{}, error) {
return minVal.Interface(), nil return minVal.Interface(), nil
} }
func isNumericKind(k reflect.Kind) bool {
switch k {
case reflect.Int, reflect.Int8, reflect.Int16, reflect.Int32, reflect.Int64,
reflect.Uint, reflect.Uint8, reflect.Uint16, reflect.Uint32, reflect.Uint64,
reflect.Float32, reflect.Float64:
return true
default:
return false
}
}
// unwrapInterface returns v.Elem() when v holds an interface value, otherwise v unchanged.
// This is necessary when iterating map[string]interface{} or []interface{} via reflection:
// the element Kind is reflect.Interface, not the underlying concrete type.
func unwrapInterface(v reflect.Value) reflect.Value {
if v.Kind() == reflect.Interface {
return v.Elem()
}
return v
}
// isOrderedKind reports whether k supports comparison ordering. // isOrderedKind reports whether k supports comparison ordering.
func isOrderedKind(k reflect.Kind) bool { func isOrderedKind(k reflect.Kind) bool {
switch k { switch k {
+1 -1
View File
@@ -1 +1 @@
4.4.41 4.5.0