mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-09-23 18:10:39 +00:00
Compare commits
17
Commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
f727ae930f | ||
|
|
90cf780f23 | ||
|
|
620646d412 | ||
|
|
438893d910 | ||
|
|
eae41ac81c | ||
|
|
d735ac6188 | ||
|
|
9de463ef1e | ||
|
|
a8841c203d | ||
|
|
f1a424343c | ||
|
|
4dae7f708d | ||
|
|
578445f38a | ||
|
|
2edb33ad08 | ||
|
|
b108d4978e | ||
|
|
e9210e28a3 | ||
|
|
13a93fce11 | ||
|
|
14064c919e | ||
|
|
1dfd68aa6d |
@@ -21,6 +21,8 @@ xx
|
||||
|
||||
.rhistory
|
||||
/.vscode
|
||||
|
||||
/benchmarck
|
||||
/build
|
||||
/bugs
|
||||
autodoc
|
||||
|
||||
@@ -0,0 +1,2 @@
|
||||
/cache
|
||||
/project.local.yml
|
||||
@@ -0,0 +1,133 @@
|
||||
# the name by which the project can be referenced within Serena
|
||||
project_name: "obitools4"
|
||||
|
||||
|
||||
# list of languages for which language servers are started; choose from:
|
||||
# al angular ansible bash clojure
|
||||
# cpp cpp_ccls crystal csharp csharp_omnisharp
|
||||
# dart elixir elm erlang fortran
|
||||
# fsharp go groovy haskell haxe
|
||||
# hlsl html java json julia
|
||||
# kotlin lean4 lua luau markdown
|
||||
# matlab msl nix ocaml pascal
|
||||
# perl php php_phpactor powershell python
|
||||
# python_jedi python_ty r rego ruby
|
||||
# ruby_solargraph rust scala scss solidity
|
||||
# svelte swift systemverilog terraform toml
|
||||
# typescript typescript_vts vue yaml zig
|
||||
# (This list may be outdated. For the current list, see values of Language enum here:
|
||||
# https://github.com/oraios/serena/blob/main/src/solidlsp/ls_config.py
|
||||
# For some languages, there are alternative language servers, e.g. csharp_omnisharp, ruby_solargraph.)
|
||||
# Note:
|
||||
# - For C, use cpp
|
||||
# - For JavaScript, use typescript
|
||||
# - For Angular projects, use angular (subsumes typescript+html; requires `npm install` in the project root)
|
||||
# - For Svelte projects, use svelte (subsumes typescript/javascript for .svelte projects; requires npm)
|
||||
# - For SCSS / Sass / plain CSS, use scss (some-sass-language-server handles all three)
|
||||
# - For Free Pascal/Lazarus, use pascal
|
||||
# Special requirements:
|
||||
# Some languages require additional setup/installations.
|
||||
# See here for details: https://oraios.github.io/serena/01-about/020_programming-languages.html#language-servers
|
||||
# When using multiple languages, the first language server that supports a given file will be used for that file.
|
||||
# The first language is the default language and the respective language server will be used as a fallback.
|
||||
# Note that when using the JetBrains backend, language servers are not used and this list is correspondingly ignored.
|
||||
languages:
|
||||
- go
|
||||
|
||||
# the encoding used by text files in the project
|
||||
# For a list of possible encodings, see https://docs.python.org/3.11/library/codecs.html#standard-encodings
|
||||
encoding: "utf-8"
|
||||
|
||||
# line ending convention to use when writing source files.
|
||||
# Possible values: unset (use global setting), "lf", "crlf", or "native" (platform default)
|
||||
# This does not affect Serena's own files (e.g. memories and configuration files), which always use native line endings.
|
||||
line_ending:
|
||||
|
||||
# The language backend to use for this project.
|
||||
# If not set, the global setting from serena_config.yml is used.
|
||||
# Valid values: LSP, JetBrains
|
||||
# Note: the backend is fixed at startup. If a project with a different backend
|
||||
# is activated post-init, an error will be returned.
|
||||
language_backend:
|
||||
|
||||
# whether to use project's .gitignore files to ignore files
|
||||
ignore_all_files_in_gitignore: true
|
||||
|
||||
# advanced configuration option allowing to configure language server-specific options.
|
||||
# Maps the language key to the options.
|
||||
# Have a look at the docstring of the constructors of the LS implementations within solidlsp (e.g., for C# or PHP) to see which options are available.
|
||||
# No documentation on options means no options are available.
|
||||
ls_specific_settings: {}
|
||||
|
||||
# list of additional workspace folder paths for cross-package reference support (e.g. in monorepos).
|
||||
# Paths can be absolute or relative to the project root.
|
||||
# Each folder is registered as an LSP workspace folder, enabling language servers to discover
|
||||
# symbols and references across package boundaries.
|
||||
# Currently supported for: TypeScript.
|
||||
# Example:
|
||||
# additional_workspace_folders:
|
||||
# - ../sibling-package
|
||||
# - ../shared-lib
|
||||
additional_workspace_folders: []
|
||||
|
||||
# list of additional paths to ignore in this project.
|
||||
# Same syntax as gitignore, so you can use * and **.
|
||||
# Note: global ignored_paths from serena_config.yml are also applied additively.
|
||||
ignored_paths: []
|
||||
|
||||
# whether the project is in read-only mode
|
||||
# If set to true, all editing tools will be disabled and attempts to use them will result in an error
|
||||
# Added on 2025-04-18
|
||||
read_only: false
|
||||
|
||||
# list of tool names to exclude.
|
||||
# This extends the existing exclusions (e.g. from the global configuration)
|
||||
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
|
||||
excluded_tools: []
|
||||
|
||||
# list of tools to include that would otherwise be disabled (particularly optional tools that are disabled by default).
|
||||
# This extends the existing inclusions (e.g. from the global configuration).
|
||||
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
|
||||
included_optional_tools: []
|
||||
|
||||
# fixed set of tools to use as the base tool set (if non-empty), replacing Serena's default set of tools.
|
||||
# This cannot be combined with non-empty excluded_tools or included_optional_tools.
|
||||
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
|
||||
fixed_tools: []
|
||||
|
||||
# list of mode names that are to be activated by default, overriding the setting in the global configuration.
|
||||
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
|
||||
# If the setting is undefined/empty, the default_modes from the global configuration (serena_config.yml) apply.
|
||||
# Otherwise, this overrides the setting from the global configuration (serena_config.yml).
|
||||
# Therefore, you can set this to [] if you do not want the default modes defined in the global config to apply
|
||||
# for this project.
|
||||
# This setting can, in turn, be overridden by CLI parameters (--mode).
|
||||
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
|
||||
default_modes:
|
||||
|
||||
# list of mode names to be activated additionally for this project, e.g. ["query-projects"]
|
||||
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
|
||||
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
|
||||
added_modes:
|
||||
|
||||
# initial prompt for the project. It will always be given to the LLM upon activating the project
|
||||
# (contrary to the memories, which are loaded on demand).
|
||||
initial_prompt: ""
|
||||
|
||||
# time budget (seconds) per tool call for the retrieval of additional symbol information
|
||||
# such as docstrings or parameter information.
|
||||
# This overrides the corresponding setting in the global configuration; see the documentation there.
|
||||
# If null or missing, use the setting from the global configuration.
|
||||
symbol_info_budget:
|
||||
|
||||
# list of regex patterns which, when matched, mark a memory entry as read‑only.
|
||||
# Extends the list from the global configuration, merging the two lists.
|
||||
read_only_memory_patterns: []
|
||||
|
||||
# list of regex patterns for memories to completely ignore.
|
||||
# Matching memories will not appear in list_memories or activate_project output
|
||||
# and cannot be accessed via read_memory or write_memory.
|
||||
# To access ignored memory files, use the read_file tool on the raw file path.
|
||||
# Extends the list from the global configuration, merging the two lists.
|
||||
# Example: ["_archive/.*", "_episodes/.*"]
|
||||
ignored_memory_patterns: []
|
||||
@@ -156,8 +156,8 @@ bump-version:
|
||||
|
||||
jjnew:
|
||||
@echo "$(YELLOW)→ Creating a new commit...$(NC)"
|
||||
@echo "$(BLUE)→ Documenting current commit...$(NC)"
|
||||
@jj auto-describe
|
||||
@echo "$(BLUE)→ Documenting undocumented commits...$(NC)"
|
||||
@jj auto-doc
|
||||
@echo "$(BLUE)→ Done.$(NC)"
|
||||
@jj new
|
||||
@echo "$(GREEN)✓ New commit created$(NC)"
|
||||
@@ -171,8 +171,8 @@ jjpush:
|
||||
@echo "$(GREEN)✓ Release complete$(NC)"
|
||||
|
||||
jjpush-describe:
|
||||
@echo "$(BLUE)→ Documenting current commit...$(NC)"
|
||||
@jj auto-describe
|
||||
@echo "$(BLUE)→ Documenting undocumented commits...$(NC)"
|
||||
@jj auto-doc
|
||||
|
||||
jjpush-bump:
|
||||
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
|
||||
|
||||
@@ -28,10 +28,18 @@ func buffIndex(i, j, width int) int {
|
||||
//
|
||||
// The function returns the start and end positions of the best
|
||||
// match, as well as the number of errors in the best match.
|
||||
//
|
||||
// When the sequence is too short relative to the pattern for the
|
||||
// backtracking to reconstruct a valid alignment (e.g. the pattern
|
||||
// is longer than the sequence, or the match sits too close to a
|
||||
// sequence boundary), no reliable position can be computed. In that
|
||||
// case the function returns the sentinel (-1, -1, -1) instead of a
|
||||
// guessed, potentially wrong, position: callers must treat this as
|
||||
// "no match" rather than use the returned coordinates.
|
||||
func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
|
||||
|
||||
if len(pattern) >= len(sequence) {
|
||||
log.Panicf("Sequence %s:Pattern %s must be shorter than sequence %s", id, pattern, sequence)
|
||||
if len(sequence) == 0 {
|
||||
log.Panicf("Sequence %s:Pattern %s must not be empty", id, pattern)
|
||||
}
|
||||
|
||||
// Pattern spreads over the columns
|
||||
@@ -158,5 +166,18 @@ func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
|
||||
// obilog.Warnf("from : %d to: %d error: %d match: %v",
|
||||
// i, end+1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)],
|
||||
// string(sequence[i:(end+1)]))
|
||||
|
||||
if i < 0 || end == -1 {
|
||||
// i < 0: the backtracking ran off the start of the sequence
|
||||
// without fully consuming the pattern.
|
||||
// end == -1: the backtracking loop never ran at all (e.g. a
|
||||
// single-base pattern, jmax == 0), so no alignment boundary
|
||||
// was ever established.
|
||||
// Either way, no valid alignment exists for this (pattern,
|
||||
// sequence) pair: signal it explicitly instead of returning
|
||||
// an out-of-bounds or uncomputed position.
|
||||
return -1, -1, -1
|
||||
}
|
||||
|
||||
return i, end + 1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)]
|
||||
}
|
||||
|
||||
@@ -0,0 +1,123 @@
|
||||
package obialign
|
||||
|
||||
import (
|
||||
"math/rand"
|
||||
"testing"
|
||||
)
|
||||
|
||||
func TestLocatePatternNormal(t *testing.T) {
|
||||
// Pattern fully and exactly present in the middle of a longer sequence.
|
||||
start, end, nerr := LocatePattern("id", []byte("ACGT"), []byte("TTTTACGTTTTT"))
|
||||
if start != 4 || end != 8 || nerr != 0 {
|
||||
t.Errorf("got start=%d end=%d nerr=%d, want start=4 end=8 nerr=0", start, end, nerr)
|
||||
}
|
||||
}
|
||||
|
||||
func TestLocatePatternOneMismatch(t *testing.T) {
|
||||
start, end, nerr := LocatePattern("id", []byte("ACGT"), []byte("TTTTACTTTTTT"))
|
||||
if nerr != 1 {
|
||||
t.Errorf("got nerr=%d, want 1 (start=%d end=%d)", nerr, start, end)
|
||||
}
|
||||
}
|
||||
|
||||
// The real-world case that used to panic: pattern longer than the sequence
|
||||
// fragment extracted for indel relocation.
|
||||
func TestLocatePatternPatternLongerThanSequence(t *testing.T) {
|
||||
start, end, nerr := LocatePattern("id",
|
||||
[]byte("GGGCAATCCTGAGCCAAATC"),
|
||||
[]byte("tcctgagccaaatcacgtt"))
|
||||
|
||||
if start != -1 || end != -1 || nerr != -1 {
|
||||
t.Errorf("got start=%d end=%d nerr=%d, want the (-1,-1,-1) sentinel", start, end, nerr)
|
||||
}
|
||||
}
|
||||
|
||||
func TestLocatePatternSequenceLengthOne(t *testing.T) {
|
||||
start, end, nerr := LocatePattern("id", []byte("AB"), []byte("A"))
|
||||
|
||||
if start < 0 || end < 0 || nerr < 0 {
|
||||
t.Fatalf("got start=%d end=%d nerr=%d, expected a valid (non-sentinel) result", start, end, nerr)
|
||||
}
|
||||
if start != 0 || end != 1 || nerr != 1 {
|
||||
t.Errorf("got start=%d end=%d nerr=%d, want start=0 end=1 nerr=1", start, end, nerr)
|
||||
}
|
||||
}
|
||||
|
||||
// A pattern much longer than the sequence can still yield a mathematically
|
||||
// valid (in-bounds) alignment: the extra pattern length is absorbed as gaps,
|
||||
// driving the error count high enough that the caller's maxerr threshold
|
||||
// rejects it. The function itself must still return consistent bounds.
|
||||
func TestLocatePatternPatternMuchLongerThanSequence(t *testing.T) {
|
||||
start, end, nerr := LocatePattern("id", []byte("ACGTACGTACGTACGTACGT"), []byte("ACG"))
|
||||
|
||||
isSentinel := start == -1 && end == -1 && nerr == -1
|
||||
isValid := start >= 0 && end > start && end <= 3 && nerr >= 0
|
||||
|
||||
if !isSentinel && !isValid {
|
||||
t.Errorf("got start=%d end=%d nerr=%d, want either the sentinel or consistent in-bounds values", start, end, nerr)
|
||||
}
|
||||
}
|
||||
|
||||
func TestLocatePatternNeverReturnsOutOfBounds(t *testing.T) {
|
||||
patterns := []string{"A", "AC", "ACG", "ACGT", "ACGTA", "ACGTAC", "ACGTACG", "ACGTACGT"}
|
||||
sequences := []string{"A", "AC", "ACG", "ACGT", "ACGTA", "ACGTAC", "ACGTACG", "ACGTACGT"}
|
||||
|
||||
for _, p := range patterns {
|
||||
for _, s := range sequences {
|
||||
start, end, nerr := LocatePattern("id", []byte(p), []byte(s))
|
||||
|
||||
if start == -1 && end == -1 && nerr == -1 {
|
||||
// Explicit "no reliable match" sentinel: always acceptable.
|
||||
continue
|
||||
}
|
||||
|
||||
if start < 0 || end < 0 || start >= end || end > len(s) || nerr < 0 {
|
||||
t.Errorf("pattern=%q sequence=%q -> start=%d end=%d nerr=%d is out of bounds / inconsistent",
|
||||
p, s, start, end, nerr)
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
// Randomized property test over a wide range of pattern/sequence length
|
||||
// combinations, including pattern >= sequence, to make sure the function
|
||||
// never panics and never returns anything but the sentinel or fully
|
||||
// consistent, in-bounds coordinates.
|
||||
func TestLocatePatternRandomizedNeverInvalid(t *testing.T) {
|
||||
const bases = "ACGT"
|
||||
rng := rand.New(rand.NewSource(42))
|
||||
|
||||
randSeq := func(n int) []byte {
|
||||
b := make([]byte, n)
|
||||
for i := range b {
|
||||
b[i] = bases[rng.Intn(len(bases))]
|
||||
}
|
||||
return b
|
||||
}
|
||||
|
||||
for trial := 0; trial < 5000; trial++ {
|
||||
patLen := 1 + rng.Intn(15)
|
||||
seqLen := 1 + rng.Intn(15)
|
||||
|
||||
pattern := randSeq(patLen)
|
||||
sequence := randSeq(seqLen)
|
||||
|
||||
func() {
|
||||
defer func() {
|
||||
if r := recover(); r != nil {
|
||||
t.Fatalf("panic for pattern=%q sequence=%q: %v", pattern, sequence, r)
|
||||
}
|
||||
}()
|
||||
|
||||
start, end, nerr := LocatePattern("id", pattern, sequence)
|
||||
|
||||
isSentinel := start == -1 && end == -1 && nerr == -1
|
||||
isValid := start >= 0 && end > start && end <= len(sequence) && nerr >= 0
|
||||
|
||||
if !isSentinel && !isValid {
|
||||
t.Errorf("pattern=%q sequence=%q -> start=%d end=%d nerr=%d is neither the sentinel nor consistent",
|
||||
pattern, sequence, start, end, nerr)
|
||||
}
|
||||
}()
|
||||
}
|
||||
}
|
||||
+25
-4
@@ -373,6 +373,7 @@ func (pattern ApatPattern) BestMatch(sequence ApatSequence, begin, length int) (
|
||||
|
||||
cpattern := (*[1 << 30]byte)(unsafe.Pointer(pattern.pointer.pointer.cpat))
|
||||
frg := sequence.pointer.reference.Sequence()[start:end]
|
||||
fragStart := start
|
||||
|
||||
log.Debugln(
|
||||
string(frg),
|
||||
@@ -384,11 +385,20 @@ func (pattern ApatPattern) BestMatch(sequence ApatSequence, begin, length int) (
|
||||
(*cpattern)[0:int(pattern.pointer.pointer.patlen)],
|
||||
frg)
|
||||
|
||||
// olderr := m[2]
|
||||
if from < 0 {
|
||||
// obialign.LocatePattern could not reconstruct a reliable
|
||||
// alignment (e.g. the fragment is too short relative to the
|
||||
// pattern). Reporting a guessed position would risk placing
|
||||
// the primer boundary incorrectly, so treat it as no match
|
||||
// at all rather than falling back to an unrefined position.
|
||||
matched = false
|
||||
log.Debugln("No reliable indel relocation, discarding match", sequence.pointer.reference.Id())
|
||||
return
|
||||
}
|
||||
|
||||
nerr = score
|
||||
start = start + from
|
||||
end = start + to
|
||||
start = fragStart + from
|
||||
end = fragStart + to
|
||||
log.Debugf("BestMatch on %s : score=%d [%d..%d]", sequence.pointer.reference.Id(), score, start, nerr)
|
||||
return
|
||||
}
|
||||
@@ -467,6 +477,7 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
|
||||
for _, m := range res {
|
||||
// Recompute the start and end position of the match
|
||||
// when the pattern allows for indels
|
||||
valid := true
|
||||
if m[2] > 0 && pattern.pointer.pointer.hasIndel {
|
||||
// obilog.Warnf("Locating indel on sequence %s[%s]", sequence.pointer.reference.Id(), pattern.String())
|
||||
start := m[0] - m[2]*2
|
||||
@@ -485,6 +496,15 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
|
||||
(*cpattern)[0:int(pattern.pointer.pointer.patlen)],
|
||||
frg)
|
||||
|
||||
if pb < 0 {
|
||||
// obialign.LocatePattern could not reconstruct a
|
||||
// reliable alignment (e.g. the match sits too close
|
||||
// to a sequence end for the fragment to be usable).
|
||||
// Reporting a guessed position risks placing the
|
||||
// primer boundary incorrectly, so drop the match
|
||||
// entirely instead of keeping an unrefined guess.
|
||||
valid = false
|
||||
} else {
|
||||
// olderr := m[2]
|
||||
m[2] = score
|
||||
m[0] = start + pb
|
||||
@@ -493,8 +513,9 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
|
||||
// obilog.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score,
|
||||
// frg, (*cpattern)[0:int(pattern.pointer.pointer.patlen)], sequence.pointer.reference.Sequence()[m[0]:m[1]])
|
||||
}
|
||||
}
|
||||
|
||||
if int(pattern.pointer.pointer.maxerr) >= m[2] {
|
||||
if valid && int(pattern.pointer.pointer.maxerr) >= m[2] {
|
||||
res[j] = m
|
||||
j++
|
||||
}
|
||||
|
||||
@@ -131,7 +131,7 @@ func _storeSequenceQuality(bytes *bytes.Buffer, out *obiseq.BioSequence, quality
|
||||
out.SetQualities(q)
|
||||
}
|
||||
|
||||
func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(string, io.Reader) (obiseq.BioSequenceSlice, error) {
|
||||
func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool, fileName string) func(string, io.Reader) (obiseq.BioSequenceSlice, error) {
|
||||
parser := func(source string, input io.Reader) (obiseq.BioSequenceSlice, error) {
|
||||
|
||||
var identifier string
|
||||
@@ -160,12 +160,12 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
|
||||
// Beginning of sequence
|
||||
state = 1
|
||||
} else {
|
||||
log.Fatalf("%s : sequence entry is not starting with @", source)
|
||||
log.Fatalf("file %s: sequence entry is not starting with @", fileName)
|
||||
}
|
||||
case 1: // Beginning of identifier (Mandatory)
|
||||
if is_sep {
|
||||
// No identifier -> ERROR
|
||||
log.Fatalf("%s : sequence identifier is empty", source)
|
||||
log.Fatalf("file %s: sequence identifier is empty", fileName)
|
||||
} else {
|
||||
// Beginning of identifier
|
||||
state = 2
|
||||
@@ -221,7 +221,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
|
||||
// End of sequence
|
||||
rawseq := seqBytes.Bytes()
|
||||
if len(rawseq) == 0 {
|
||||
log.Fatalf("@%s[%s] : sequence is empty", identifier, source)
|
||||
log.Fatalf("file %s: record @%s has an empty sequence line", fileName, identifier)
|
||||
}
|
||||
s := obiseq.NewBioSequence(identifier, rawseq, definition)
|
||||
s.SetSource(source)
|
||||
@@ -241,8 +241,8 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
|
||||
context = append(
|
||||
append([]byte{previous}, C),
|
||||
context...)
|
||||
log.Fatalf("%s [%s]: sequence contains invalid character %c (%s)",
|
||||
source, identifier, C, string(context))
|
||||
log.Fatalf("file %s: record @%s contains invalid character %c (%s)",
|
||||
fileName, identifier, C, string(context))
|
||||
}
|
||||
}
|
||||
case 7:
|
||||
@@ -251,7 +251,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
|
||||
} else if C == '+' {
|
||||
state = 8
|
||||
} else {
|
||||
log.Fatalf("@%s[%s] : sequence data not followed by a line starting with + but a %c", identifier, source, C)
|
||||
log.Fatalf("file %s: record @%s: sequence data not followed by a line starting with + but a %c", fileName, identifier, C)
|
||||
}
|
||||
case 8:
|
||||
// State consuming the + internal header line
|
||||
@@ -282,7 +282,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
|
||||
} else if C == '@' {
|
||||
state = 1
|
||||
} else {
|
||||
log.Fatalf("%s[%s] : sequence record not followed by a line starting with @", identifier, source)
|
||||
log.Fatalf("file %s: record @%s not followed by a line starting with @", fileName, identifier)
|
||||
}
|
||||
|
||||
}
|
||||
@@ -304,7 +304,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
|
||||
}
|
||||
|
||||
// FastqChunkParserRope parses a FASTQ chunk directly from a rope without Pack().
|
||||
func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte, with_quality, UtoT bool) (obiseq.BioSequenceSlice, error) {
|
||||
func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte, with_quality, UtoT bool, fileName string) (obiseq.BioSequenceSlice, error) {
|
||||
scanner := newRopeScanner(rope)
|
||||
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
|
||||
|
||||
@@ -334,7 +334,7 @@ func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte,
|
||||
// Line 2: sequence
|
||||
sline := scanner.ReadLine()
|
||||
if sline == nil {
|
||||
log.Fatalf("@%s[%s]: unexpected EOF after header", id, source)
|
||||
log.Fatalf("file %s: record @%s is truncated (header line with no sequence line following) — the FASTQ file appears incomplete", fileName, id)
|
||||
}
|
||||
seqDest := make([]byte, len(sline))
|
||||
w := 0
|
||||
@@ -350,7 +350,7 @@ func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte,
|
||||
}
|
||||
seqDest = seqDest[:w]
|
||||
if len(seqDest) == 0 {
|
||||
log.Fatalf("@%s[%s]: sequence is empty", id, source)
|
||||
log.Fatalf("file %s: record @%s has an empty sequence line", fileName, id)
|
||||
}
|
||||
|
||||
// Line 3: + (skip)
|
||||
@@ -382,16 +382,17 @@ func _ParseFastqFile(
|
||||
out obiiter.IBioSequence,
|
||||
quality_shift byte,
|
||||
with_quality, UtoT bool,
|
||||
fileName string,
|
||||
) {
|
||||
|
||||
parser := FastqChunkParser(quality_shift, with_quality, UtoT)
|
||||
parser := FastqChunkParser(quality_shift, with_quality, UtoT, fileName)
|
||||
|
||||
for chunks := range input {
|
||||
var sequences obiseq.BioSequenceSlice
|
||||
var err error
|
||||
|
||||
if chunks.Rope != nil {
|
||||
sequences, err = FastqChunkParserRope(chunks.Source, chunks.Rope, quality_shift, with_quality, UtoT)
|
||||
sequences, err = FastqChunkParserRope(chunks.Source, chunks.Rope, quality_shift, with_quality, UtoT, fileName)
|
||||
} else {
|
||||
sequences, err = parser(chunks.Source, chunks.Raw)
|
||||
}
|
||||
@@ -423,6 +424,8 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
|
||||
false,
|
||||
)
|
||||
|
||||
fileName := opt.FileName()
|
||||
|
||||
for i := 0; i < nworker; i++ {
|
||||
out.Add(1)
|
||||
go _ParseFastqFile(
|
||||
@@ -431,6 +434,7 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
|
||||
obidefault.ReadQualitiesShift(),
|
||||
opt.ReadQualities(),
|
||||
opt.UtoT(),
|
||||
fileName,
|
||||
)
|
||||
}
|
||||
|
||||
@@ -456,7 +460,9 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
|
||||
}
|
||||
|
||||
func ReadFastqFromFile(filename string, options ...WithOption) (obiiter.IBioSequence, error) {
|
||||
options = append(options, OptionsSource(obiutils.RemoveAllExt((path.Base(filename)))))
|
||||
options = append(options,
|
||||
OptionsSource(obiutils.RemoveAllExt((path.Base(filename)))),
|
||||
OptionsFileName(filename))
|
||||
|
||||
file, err := obiutils.Ropen(filename)
|
||||
|
||||
|
||||
@@ -199,47 +199,13 @@ func _parse_json_array_interface(str []byte) ([]interface{}, error) {
|
||||
return values, nil
|
||||
}
|
||||
|
||||
func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
|
||||
// _parse_json_annotation_field parses a single key/value pair coming from a
|
||||
// JSON object (either a FASTA/FASTQ inline JSON header, or the "annotations"
|
||||
// field of a JSON sequence record) and applies it to the sequence, special
|
||||
// casing the well-known OBITools attributes (id, definition, count, taxid,
|
||||
// obiclean_*, merged_*).
|
||||
func _parse_json_annotation_field(key []byte, value []byte, dataType jsonparser.ValueType, sequence *obiseq.BioSequence) error {
|
||||
annotations := sequence.Annotations()
|
||||
start := -1
|
||||
stop := -1
|
||||
level := 0
|
||||
lh := len(header)
|
||||
inquote := false
|
||||
|
||||
for i := 0; (i < lh) && (stop < 0); i++ {
|
||||
// fmt.Printf("[%d,%d-%d] : %d (%c) (%d,%c)\n", i, start, stop, header[i], header[i], '{', '{')
|
||||
if level == 0 && header[i] == '{' && !inquote {
|
||||
start = i
|
||||
}
|
||||
|
||||
// TODO: escaped double quotes are not considered
|
||||
if start > -1 && header[i] == '"' {
|
||||
inquote = !inquote
|
||||
}
|
||||
|
||||
if header[i] == '{' && !inquote {
|
||||
level++
|
||||
}
|
||||
|
||||
if header[i] == '}' && !inquote {
|
||||
level--
|
||||
}
|
||||
|
||||
if start >= 0 && level == 0 {
|
||||
stop = i
|
||||
}
|
||||
|
||||
}
|
||||
|
||||
if start < 0 || stop < 0 {
|
||||
return header
|
||||
}
|
||||
|
||||
stop++
|
||||
|
||||
jsonparser.ObjectEach(obiutils.UnsafeBytes(header[start:stop]),
|
||||
func(key []byte, value []byte, dataType jsonparser.ValueType, offset int) error {
|
||||
var err error
|
||||
|
||||
skey := obiutils.UnsafeString(key)
|
||||
@@ -335,6 +301,49 @@ func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
|
||||
}
|
||||
|
||||
return err
|
||||
}
|
||||
|
||||
func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
|
||||
start := -1
|
||||
stop := -1
|
||||
level := 0
|
||||
lh := len(header)
|
||||
inquote := false
|
||||
|
||||
for i := 0; (i < lh) && (stop < 0); i++ {
|
||||
// fmt.Printf("[%d,%d-%d] : %d (%c) (%d,%c)\n", i, start, stop, header[i], header[i], '{', '{')
|
||||
if level == 0 && header[i] == '{' && !inquote {
|
||||
start = i
|
||||
}
|
||||
|
||||
// TODO: escaped double quotes are not considered
|
||||
if start > -1 && header[i] == '"' {
|
||||
inquote = !inquote
|
||||
}
|
||||
|
||||
if header[i] == '{' && !inquote {
|
||||
level++
|
||||
}
|
||||
|
||||
if header[i] == '}' && !inquote {
|
||||
level--
|
||||
}
|
||||
|
||||
if start >= 0 && level == 0 {
|
||||
stop = i
|
||||
}
|
||||
|
||||
}
|
||||
|
||||
if start < 0 || stop < 0 {
|
||||
return header
|
||||
}
|
||||
|
||||
stop++
|
||||
|
||||
jsonparser.ObjectEach(obiutils.UnsafeBytes(header[start:stop]),
|
||||
func(key []byte, value []byte, dataType jsonparser.ValueType, offset int) error {
|
||||
return _parse_json_annotation_field(key, value, dataType, sequence)
|
||||
},
|
||||
)
|
||||
|
||||
|
||||
@@ -17,7 +17,7 @@ import (
|
||||
)
|
||||
|
||||
var __obi_header_value_string_pattern__ = regexp.MustCompile(`^'\s*([^']*'|"[^"]*")\s*;`)
|
||||
var __obi_header_value_numeric_pattern__ = regexp.MustCompile(`^\s*([+-]?\.\d+|[+-]?\d+(\.\d*)?([eE][+-]?\d+)?)\s*;`)
|
||||
var __obi_header_value_numeric_pattern__ = regexp.MustCompile(`^\s*[+-]?(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?\s*;`)
|
||||
var __obi_header_map_int_key__ = regexp.MustCompile("([{,])([0-9]+):")
|
||||
|
||||
func __match__dict__(text []byte) []int {
|
||||
@@ -347,6 +347,8 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
|
||||
case float64:
|
||||
if vt == math.Floor(vt) {
|
||||
annotations[key] = int(vt)
|
||||
} else {
|
||||
annotations[key] = vt
|
||||
}
|
||||
default:
|
||||
annotations[key] = value
|
||||
|
||||
@@ -0,0 +1,147 @@
|
||||
package obiformats
|
||||
|
||||
import (
|
||||
"io"
|
||||
"os"
|
||||
"path"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
"github.com/buger/jsonparser"
|
||||
"github.com/goccy/go-json"
|
||||
log "github.com/sirupsen/logrus"
|
||||
)
|
||||
|
||||
// _parse_json_record parses a single JSON object describing a sequence
|
||||
// (as produced by JSONRecord in json_writer.go) into a *obiseq.BioSequence.
|
||||
func _parse_json_record(raw []byte, shift byte) *obiseq.BioSequence {
|
||||
sequence := obiseq.NewEmptyBioSequence(0)
|
||||
|
||||
if id, err := jsonparser.GetString(raw, "id"); err == nil {
|
||||
sequence.SetId(id)
|
||||
}
|
||||
|
||||
if seq, err := jsonparser.GetString(raw, "sequence"); err == nil {
|
||||
sequence.SetSequence([]byte(seq))
|
||||
}
|
||||
|
||||
if qual, err := jsonparser.GetString(raw, "qualities"); err == nil {
|
||||
q := []byte(qual)
|
||||
for i := 0; i < len(q); i++ {
|
||||
q[i] -= shift
|
||||
}
|
||||
sequence.SetQualities(q)
|
||||
}
|
||||
|
||||
if annot, dataType, _, err := jsonparser.Get(raw, "annotations"); err == nil && dataType == jsonparser.Object {
|
||||
jsonparser.ObjectEach(annot,
|
||||
func(key []byte, value []byte, valType jsonparser.ValueType, offset int) error {
|
||||
return _parse_json_annotation_field(key, value, valType, sequence)
|
||||
},
|
||||
)
|
||||
}
|
||||
|
||||
return sequence
|
||||
}
|
||||
|
||||
// _ParseJsonFile streams the top-level JSON array, decoding and pushing one
|
||||
// batch of sequences at a time, without ever loading the whole document in
|
||||
// memory. Only one raw record at a time is buffered by the decoder.
|
||||
func _ParseJsonFile(source string,
|
||||
reader io.Reader,
|
||||
out obiiter.IBioSequence,
|
||||
shift byte,
|
||||
batchSize int) {
|
||||
|
||||
dec := json.NewDecoder(reader)
|
||||
|
||||
if _, err := dec.Token(); err != nil {
|
||||
if err == io.EOF {
|
||||
out.Done()
|
||||
return
|
||||
}
|
||||
log.Fatalf("cannot parse JSON data: %v", err)
|
||||
}
|
||||
|
||||
slice := obiseq.MakeBioSequenceSlice()
|
||||
o := 0
|
||||
|
||||
for dec.More() {
|
||||
var raw json.RawMessage
|
||||
|
||||
if err := dec.Decode(&raw); err != nil {
|
||||
log.Fatalf("cannot parse JSON data: %v", err)
|
||||
}
|
||||
|
||||
sequence := _parse_json_record(raw, shift)
|
||||
|
||||
slice = append(slice, sequence)
|
||||
if len(slice) >= batchSize {
|
||||
out.Push(obiiter.MakeBioSequenceBatch(source, o, slice))
|
||||
o++
|
||||
slice = obiseq.MakeBioSequenceSlice()
|
||||
}
|
||||
}
|
||||
|
||||
if len(slice) > 0 {
|
||||
out.Push(obiiter.MakeBioSequenceBatch(source, o, slice))
|
||||
}
|
||||
|
||||
out.Done()
|
||||
}
|
||||
|
||||
func ReadJSON(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
|
||||
|
||||
opt := MakeOptions(options)
|
||||
out := obiiter.MakeIBioSequence()
|
||||
|
||||
out.Add(1)
|
||||
go _ParseJsonFile(opt.Source(),
|
||||
reader,
|
||||
out,
|
||||
obidefault.ReadQualitiesShift(),
|
||||
opt.BatchSize())
|
||||
|
||||
go func() {
|
||||
out.WaitAndClose()
|
||||
}()
|
||||
|
||||
return out, nil
|
||||
|
||||
}
|
||||
|
||||
func ReadJSONFromFile(filename string, options ...WithOption) (obiiter.IBioSequence, error) {
|
||||
|
||||
options = append(options, OptionsSource(obiutils.RemoveAllExt((path.Base(filename)))))
|
||||
file, err := obiutils.Ropen(filename)
|
||||
|
||||
if err == obiutils.ErrNoContent {
|
||||
log.Infof("file %s is empty", filename)
|
||||
return ReadEmptyFile(options...)
|
||||
}
|
||||
|
||||
if err != nil {
|
||||
return obiiter.NilIBioSequence, err
|
||||
}
|
||||
|
||||
return ReadJSON(file, options...)
|
||||
}
|
||||
|
||||
func ReadJSONFromStdin(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
|
||||
options = append(options, OptionsSource(obiutils.RemoveAllExt("stdin")))
|
||||
input, err := obiutils.Buf(os.Stdin)
|
||||
|
||||
if err == obiutils.ErrNoContent {
|
||||
log.Infof("stdin is empty")
|
||||
return ReadEmptyFile(options...)
|
||||
}
|
||||
|
||||
if err != nil {
|
||||
log.Fatalf("open file error: %v", err)
|
||||
return obiiter.NilIBioSequence, err
|
||||
}
|
||||
|
||||
return ReadJSON(input, options...)
|
||||
}
|
||||
@@ -35,6 +35,7 @@ type __options__ struct {
|
||||
csv_auto bool
|
||||
paired_filename string
|
||||
source string
|
||||
filename string
|
||||
with_feature_table bool
|
||||
with_pattern bool
|
||||
with_parent bool
|
||||
@@ -216,6 +217,16 @@ func (opt Options) Source() string {
|
||||
return opt.pointer.source
|
||||
}
|
||||
|
||||
// FileName returns the full path of the file being read, for use in
|
||||
// diagnostic messages. It falls back to Source() when no explicit
|
||||
// file name has been set (e.g. reading from stdin or a raw reader).
|
||||
func (opt Options) FileName() string {
|
||||
if opt.pointer.filename == "" {
|
||||
return opt.pointer.source
|
||||
}
|
||||
return opt.pointer.filename
|
||||
}
|
||||
|
||||
func (opt Options) WithFeatureTable() bool {
|
||||
return opt.pointer.with_feature_table
|
||||
}
|
||||
@@ -421,6 +432,14 @@ func OptionsSource(source string) WithOption {
|
||||
return f
|
||||
}
|
||||
|
||||
func OptionsFileName(filename string) WithOption {
|
||||
f := WithOption(func(opt Options) {
|
||||
opt.pointer.filename = filename
|
||||
})
|
||||
|
||||
return f
|
||||
}
|
||||
|
||||
func OptionsWithProgressBar() WithOption {
|
||||
f := WithOption(func(opt Options) {
|
||||
opt.pointer.with_progress_bar = true
|
||||
|
||||
@@ -145,6 +145,8 @@ func ReadSequencesFromFile(filename string,
|
||||
return ReadGenbank(reader, options...)
|
||||
case "text/csv":
|
||||
return ReadCSV(reader, options...)
|
||||
case "application/json":
|
||||
return ReadJSON(reader, options...)
|
||||
default:
|
||||
log.Fatalf("File %s has guessed format %s which is not yet implemented",
|
||||
filename, mime.String())
|
||||
|
||||
@@ -134,7 +134,7 @@ func TestUint128_QuoRem(t *testing.T) {
|
||||
u := Uint128{w1: 3, w0: 8}
|
||||
v := Uint128{w1: 0, w0: 4}
|
||||
q, r := u.QuoRem(v)
|
||||
assert.Equal(t, Uint128{w1: 0, w0: 2}, q)
|
||||
assert.Equal(t, Uint128{w1: 0, w0: 13835058055282163714}, q)
|
||||
assert.Equal(t, Uint128{w1: 0, w0: 0}, r)
|
||||
}
|
||||
|
||||
@@ -150,7 +150,7 @@ func TestUint128_Div(t *testing.T) {
|
||||
u := Uint128{w1: 3, w0: 8}
|
||||
v := Uint128{w1: 0, w0: 4}
|
||||
q := u.Div(v)
|
||||
assert.Equal(t, Uint128{w1: 0, w0: 2}, q)
|
||||
assert.Equal(t, Uint128{w1: 0, w0: 13835058055282163714}, q)
|
||||
}
|
||||
|
||||
func TestUint128_Div64(t *testing.T) {
|
||||
@@ -183,7 +183,7 @@ func TestUint128_Cmp(t *testing.T) {
|
||||
func TestUint128_Cmp64(t *testing.T) {
|
||||
u := Uint128{w1: 1, w0: 2}
|
||||
v := uint64(3)
|
||||
assert.Equal(t, -1, u.Cmp64(v))
|
||||
assert.Equal(t, 1, u.Cmp64(v))
|
||||
}
|
||||
|
||||
func TestUint128_Equals(t *testing.T) {
|
||||
|
||||
@@ -777,7 +777,7 @@ func (library *NGSLibrary) ExtractMultiBarcodeSliceWorker(options ...WithOption)
|
||||
library.SetAllowsIndels(true)
|
||||
}
|
||||
|
||||
if opt.AllowedMismatches() > 0 {
|
||||
if opt.AllowedMismatchesIsSet() {
|
||||
library.SetAllowedMismatches(opt.AllowedMismatches())
|
||||
}
|
||||
|
||||
|
||||
@@ -9,6 +9,7 @@ type _Options struct {
|
||||
discardErrors bool
|
||||
unidentified string
|
||||
allowedMismatch int
|
||||
allowedMismatchSet bool
|
||||
allowsIndel bool
|
||||
withProgressBar bool
|
||||
parallelWorkers int
|
||||
@@ -52,6 +53,7 @@ func OptionWithProgressBar(yes bool) WithOption {
|
||||
func OptionAllowedMismatches(count int) WithOption {
|
||||
f := WithOption(func(opt Options) {
|
||||
opt.pointer.allowedMismatch = count
|
||||
opt.pointer.allowedMismatchSet = true
|
||||
})
|
||||
|
||||
return f
|
||||
@@ -97,6 +99,12 @@ func (options Options) AllowedMismatches() int {
|
||||
return options.pointer.allowedMismatch
|
||||
}
|
||||
|
||||
// AllowedMismatchesIsSet returns true if OptionAllowedMismatches
|
||||
// was explicitly applied to these options.
|
||||
func (options Options) AllowedMismatchesIsSet() bool {
|
||||
return options.pointer.allowedMismatchSet
|
||||
}
|
||||
|
||||
func (options Options) AllowsIndels() bool {
|
||||
return options.pointer.allowsIndel
|
||||
}
|
||||
|
||||
@@ -3,7 +3,7 @@ package obioptions
|
||||
// Version is automatically updated by the Makefile from version.txt
|
||||
// The patch number (third digit) is incremented on each push to the repository
|
||||
|
||||
var _Version = "Release 4.4.43"
|
||||
var _Version = "Release 4.5.0"
|
||||
|
||||
// Version returns the version of the obitools package.
|
||||
//
|
||||
|
||||
@@ -141,6 +141,20 @@ var OBILang = gval.NewLanguage(
|
||||
gval.Function("max", func(args ...interface{}) (interface{}, error) {
|
||||
return obiutils.Max(args[0])
|
||||
}),
|
||||
gval.Function("whichmax", func(args ...interface{}) (interface{}, error) {
|
||||
result, err := obiutils.WhichMax(args[0])
|
||||
if idx, ok := result.(int); ok {
|
||||
return float64(idx), nil
|
||||
}
|
||||
return result, err
|
||||
}),
|
||||
gval.Function("whichmin", func(args ...interface{}) (interface{}, error) {
|
||||
result, err := obiutils.WhichMin(args[0])
|
||||
if idx, ok := result.(int); ok {
|
||||
return float64(idx), nil
|
||||
}
|
||||
return result, err
|
||||
}),
|
||||
|
||||
gval.Function("filtermin", func(args ...interface{}) (interface{}, error) {
|
||||
return obiutils.FilterMin(args[0], args[1])
|
||||
|
||||
@@ -24,6 +24,7 @@ var __input_genbank_format__ = false
|
||||
var __input_fastq_format__ = false
|
||||
var __input_fasta_format__ = false
|
||||
var __input_csv_format__ = false
|
||||
var __input_json_format__ = false
|
||||
|
||||
var __output_in_fasta__ = false
|
||||
var __output_in_fastq__ = false
|
||||
@@ -71,6 +72,9 @@ func InputOptionSet(options *getoptions.GetOpt) {
|
||||
options.BoolVar(&__input_csv_format__, "csv", __input_csv_format__,
|
||||
options.Description("Read data following the CSV format."))
|
||||
|
||||
options.BoolVar(&__input_json_format__, "json", __input_json_format__,
|
||||
options.Description("Read data following the JSON format."))
|
||||
|
||||
options.BoolVar(&__no_ordered_input__, "no-order", __no_ordered_input__,
|
||||
options.Description("When several input files are provided, "+
|
||||
"indicates that there is no order among them."))
|
||||
@@ -158,6 +162,8 @@ func CLIInputFormat() string {
|
||||
return "genbank"
|
||||
case __input_csv_format__:
|
||||
return "csv"
|
||||
case __input_json_format__:
|
||||
return "json"
|
||||
default:
|
||||
return "guessed"
|
||||
}
|
||||
|
||||
@@ -73,7 +73,9 @@ func ExpandListOfFiles(check_ext bool, filenames ...string) ([]string, error) {
|
||||
strings.HasSuffix(path, "dat") ||
|
||||
strings.HasSuffix(path, "dat.gz") ||
|
||||
strings.HasSuffix(path, "ecopcr") ||
|
||||
strings.HasSuffix(path, "ecopcr.gz") {
|
||||
strings.HasSuffix(path, "ecopcr.gz") ||
|
||||
strings.HasSuffix(path, "json") ||
|
||||
strings.HasSuffix(path, "json.gz") {
|
||||
log.Debugf("Appending %s file\n", path)
|
||||
list_of_files.Add(path)
|
||||
}
|
||||
@@ -142,6 +144,8 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
|
||||
iterator, err = obiformats.ReadFastq(os.Stdin, opts...)
|
||||
case "csv":
|
||||
iterator, err = obiformats.ReadCSV(os.Stdin, opts...)
|
||||
case "json":
|
||||
iterator, err = obiformats.ReadJSON(os.Stdin, opts...)
|
||||
default:
|
||||
iterator, err = obiformats.ReadSequencesFromStdin(opts...)
|
||||
}
|
||||
@@ -163,6 +167,8 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
|
||||
reader = obiformats.ReadFastaFromFile
|
||||
case "csv":
|
||||
reader = obiformats.ReadCSVFromFile
|
||||
case "json":
|
||||
reader = obiformats.ReadJSONFromFile
|
||||
case "ecopcr":
|
||||
reader = obiformats.ReadEcoPCRFromFile
|
||||
case "embl":
|
||||
|
||||
@@ -170,7 +170,7 @@ func CLISelectLandmarkSequences(iterator obiiter.IBioSequence) obiiter.IBioSeque
|
||||
for i, seq := range library {
|
||||
taxon := seq.Taxon(taxo)
|
||||
if taxon == nil {
|
||||
log.Fatal("%s: Cannot identify taxid %s in %s", seq.Id(), seq.Taxid(), taxo.Name())
|
||||
log.Fatalf("%s: Cannot identify taxid %s in %s", seq.Id(), seq.Taxid(), taxo.Name())
|
||||
}
|
||||
taxa.Set(i, taxon)
|
||||
}
|
||||
|
||||
@@ -15,7 +15,6 @@ func IExtractBarcode(iterator obiiter.IBioSequence) (obiiter.IBioSequence, error
|
||||
opts := make([]obingslibrary.WithOption, 0, 10)
|
||||
|
||||
opts = append(opts,
|
||||
obingslibrary.OptionAllowedMismatches(CLIAllowedMismatch()),
|
||||
obingslibrary.OptionAllowedIndel(CLIAllowsIndel()),
|
||||
obingslibrary.OptionUnidentified(CLIUnidentifiedFileName()),
|
||||
obingslibrary.OptionDiscardErrors(!CLIConservedErrors()),
|
||||
@@ -23,6 +22,14 @@ func IExtractBarcode(iterator obiiter.IBioSequence) (obiiter.IBioSequence, error
|
||||
obingslibrary.OptionBatchSize(obidefault.BatchSize()),
|
||||
)
|
||||
|
||||
// Only propagate the CLI --allowed-mismatches value if the user
|
||||
// explicitly set it: otherwise the per-primer values defined in
|
||||
// the NGSFilter config file (@primer_mismatches, @forward_mismatches,
|
||||
// @reverse_mismatches) must be preserved.
|
||||
if CLIAllowedMismatchIsSet() {
|
||||
opts = append(opts, obingslibrary.OptionAllowedMismatches(CLIAllowedMismatch()))
|
||||
}
|
||||
|
||||
ngsfilter, err := CLINGSFIlter()
|
||||
if err != nil {
|
||||
log.Fatalf("%v", err)
|
||||
|
||||
@@ -18,6 +18,7 @@ var _UnidentifiedFile = ""
|
||||
var _AllowedMismatch = 2
|
||||
var _AllowsIndel = false
|
||||
var _ConservedError = false
|
||||
var _optionsParser *getoptions.GetOpt
|
||||
|
||||
// PCROptionSet defines every options related to a simulated PCR.
|
||||
//
|
||||
@@ -29,6 +30,8 @@ var _ConservedError = false
|
||||
// - option : is a pointer to a getoptions.GetOpt instance normaly
|
||||
// produced by the
|
||||
func MultiplexOptionSet(options *getoptions.GetOpt) {
|
||||
_optionsParser = options
|
||||
|
||||
options.StringVar(&_NGSFilterFile, "tag-list", _NGSFilterFile,
|
||||
options.Alias("s"),
|
||||
options.Description("File name of the NGSFilter file describing PCRs."))
|
||||
@@ -62,6 +65,15 @@ func CLIAllowedMismatch() int {
|
||||
return _AllowedMismatch
|
||||
}
|
||||
|
||||
// CLIAllowedMismatchIsSet returns true if the user explicitly
|
||||
// specified --allowed-mismatches on the command line, as opposed
|
||||
// to relying on its default value. This allows per-primer mismatch
|
||||
// settings from the NGSFilter config file to take precedence unless
|
||||
// the user explicitly overrides them from the CLI.
|
||||
func CLIAllowedMismatchIsSet() bool {
|
||||
return _optionsParser != nil && _optionsParser.Called("allowed-mismatches")
|
||||
}
|
||||
|
||||
func CLIAllowsIndel() bool {
|
||||
return _AllowsIndel
|
||||
}
|
||||
|
||||
@@ -55,7 +55,7 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
|
||||
ngsfilter.SetAllowsIndels(true)
|
||||
}
|
||||
|
||||
if obimultiplex.CLIAllowedMismatch() > 0 {
|
||||
if obimultiplex.CLIAllowedMismatchIsSet() {
|
||||
ngsfilter.SetAllowedMismatches(obimultiplex.CLIAllowedMismatch())
|
||||
}
|
||||
|
||||
|
||||
@@ -102,6 +102,11 @@ func RegisterOBIMimeType() {
|
||||
return ok
|
||||
}
|
||||
|
||||
jsonDetector := func(raw []byte, limit uint32) bool {
|
||||
raw = bytes.TrimLeft(raw, " \t\r\n")
|
||||
return len(raw) > 0 && (raw[0] == '[' || raw[0] == '{')
|
||||
}
|
||||
|
||||
mimetype.Lookup("text/plain").Extend(fastaDetector, "text/fasta", ".fasta")
|
||||
mimetype.Lookup("text/plain").Extend(fastqDetector, "text/fastq", ".fastq")
|
||||
mimetype.Lookup("text/plain").Extend(ecoPCR2Detector, "text/ecopcr2", ".ecopcr")
|
||||
@@ -115,6 +120,7 @@ func RegisterOBIMimeType() {
|
||||
mimetype.Lookup("application/octet-stream").Extend(genbankDetector, "text/genbank", ".seq")
|
||||
mimetype.Lookup("application/octet-stream").Extend(emblDetector, "text/embl", ".dat")
|
||||
mimetype.Lookup("application/octet-stream").Extend(csv, "text/csv", ".csv")
|
||||
mimetype.Lookup("application/octet-stream").Extend(jsonDetector, "application/json", ".json")
|
||||
}
|
||||
__obimimetype_registred__ = true
|
||||
}
|
||||
|
||||
+128
-8
@@ -309,7 +309,7 @@ func saturatingSubValues(a, b reflect.Value) (reflect.Value, error) {
|
||||
func maxFromIterable(v reflect.Value) (interface{}, error) {
|
||||
var best reflect.Value
|
||||
for i := 0; i < v.Len(); i++ {
|
||||
elem := v.Index(i)
|
||||
elem := unwrapInterface(v.Index(i))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
@@ -324,7 +324,7 @@ func maxFromIterable(v reflect.Value) (interface{}, error) {
|
||||
func minFromIterable(v reflect.Value) (interface{}, error) {
|
||||
var minVal reflect.Value
|
||||
for i := 0; i < v.Len(); i++ {
|
||||
elem := v.Index(i)
|
||||
elem := unwrapInterface(v.Index(i))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
@@ -339,7 +339,7 @@ func filterMinFromIterable(v reflect.Value, minimum interface{}) (interface{}, e
|
||||
minVal := reflect.ValueOf(minimum)
|
||||
result := reflect.MakeSlice(v.Type(), 0, v.Len())
|
||||
for i := 0; i < v.Len(); i++ {
|
||||
elem := v.Index(i)
|
||||
elem := unwrapInterface(v.Index(i))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
@@ -354,7 +354,7 @@ func filterMaxFromIterable(v reflect.Value, maximum interface{}) (interface{}, e
|
||||
maxVal := reflect.ValueOf(maximum)
|
||||
result := reflect.MakeSlice(v.Type(), 0, v.Len())
|
||||
for i := 0; i < v.Len(); i++ {
|
||||
elem := v.Index(i)
|
||||
elem := unwrapInterface(v.Index(i))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
@@ -365,11 +365,121 @@ func filterMaxFromIterable(v reflect.Value, maximum interface{}) (interface{}, e
|
||||
return result.Interface(), nil
|
||||
}
|
||||
|
||||
// whichMaxFromIterable returns the index of the maximum element in a slice/array.
|
||||
func whichMaxFromIterable(v reflect.Value) (int, error) {
|
||||
var best reflect.Value
|
||||
bestIdx := 0
|
||||
for i := 0; i < v.Len(); i++ {
|
||||
elem := unwrapInterface(v.Index(i))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
if i == 0 || greater(elem, best) {
|
||||
best = elem
|
||||
bestIdx = i
|
||||
}
|
||||
}
|
||||
return bestIdx, nil
|
||||
}
|
||||
|
||||
// whichMinFromIterable returns the index of the minimum element in a slice/array.
|
||||
func whichMinFromIterable(v reflect.Value) (int, error) {
|
||||
var minVal reflect.Value
|
||||
minIdx := 0
|
||||
for i := 0; i < v.Len(); i++ {
|
||||
elem := unwrapInterface(v.Index(i))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return 0, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
if i == 0 || less(elem, minVal) {
|
||||
minVal = elem
|
||||
minIdx = i
|
||||
}
|
||||
}
|
||||
return minIdx, nil
|
||||
}
|
||||
|
||||
// whichMaxFromMap returns the key associated with the maximum value in a map.
|
||||
func whichMaxFromMap(v reflect.Value) (interface{}, error) {
|
||||
var best reflect.Value
|
||||
var bestKey reflect.Value
|
||||
first := true
|
||||
for _, key := range v.MapKeys() {
|
||||
elem := unwrapInterface(v.MapIndex(key))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
if first || greater(elem, best) {
|
||||
best = elem
|
||||
bestKey = key
|
||||
first = false
|
||||
}
|
||||
}
|
||||
return bestKey.Interface(), nil
|
||||
}
|
||||
|
||||
// whichMinFromMap returns the key associated with the minimum value in a map.
|
||||
func whichMinFromMap(v reflect.Value) (interface{}, error) {
|
||||
var minVal reflect.Value
|
||||
var minKey reflect.Value
|
||||
first := true
|
||||
for _, key := range v.MapKeys() {
|
||||
elem := unwrapInterface(v.MapIndex(key))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
if first || less(elem, minVal) {
|
||||
minVal = elem
|
||||
minKey = key
|
||||
first = false
|
||||
}
|
||||
}
|
||||
return minKey.Interface(), nil
|
||||
}
|
||||
|
||||
// WhichMax returns the key (for a map) or index (for a slice/array) of the maximum value.
|
||||
func WhichMax(data interface{}) (interface{}, error) {
|
||||
v := reflect.ValueOf(data)
|
||||
switch v.Kind() {
|
||||
case reflect.Slice, reflect.Array:
|
||||
if v.Len() == 0 {
|
||||
return nil, errors.New("empty slice or array")
|
||||
}
|
||||
return whichMaxFromIterable(v)
|
||||
case reflect.Map:
|
||||
if v.Len() == 0 {
|
||||
return nil, errors.New("empty map")
|
||||
}
|
||||
return whichMaxFromMap(v)
|
||||
default:
|
||||
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||
}
|
||||
}
|
||||
|
||||
// WhichMin returns the key (for a map) or index (for a slice/array) of the minimum value.
|
||||
func WhichMin(data interface{}) (interface{}, error) {
|
||||
v := reflect.ValueOf(data)
|
||||
switch v.Kind() {
|
||||
case reflect.Slice, reflect.Array:
|
||||
if v.Len() == 0 {
|
||||
return nil, errors.New("empty slice or array")
|
||||
}
|
||||
return whichMinFromIterable(v)
|
||||
case reflect.Map:
|
||||
if v.Len() == 0 {
|
||||
return nil, errors.New("empty map")
|
||||
}
|
||||
return whichMinFromMap(v)
|
||||
default:
|
||||
return nil, fmt.Errorf("unsupported type: %s", v.Kind())
|
||||
}
|
||||
}
|
||||
|
||||
func filterMinFromMap(v reflect.Value, minimum interface{}) (interface{}, error) {
|
||||
minVal := reflect.ValueOf(minimum)
|
||||
result := reflect.MakeMap(v.Type())
|
||||
for _, key := range v.MapKeys() {
|
||||
elem := v.MapIndex(key)
|
||||
elem := unwrapInterface(v.MapIndex(key))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
@@ -384,7 +494,7 @@ func filterMaxFromMap(v reflect.Value, maximum interface{}) (interface{}, error)
|
||||
maxVal := reflect.ValueOf(maximum)
|
||||
result := reflect.MakeMap(v.Type())
|
||||
for _, key := range v.MapKeys() {
|
||||
elem := v.MapIndex(key)
|
||||
elem := unwrapInterface(v.MapIndex(key))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
@@ -400,7 +510,7 @@ func maxFromMap(v reflect.Value) (interface{}, error) {
|
||||
var best reflect.Value
|
||||
first := true
|
||||
for _, key := range v.MapKeys() {
|
||||
elem := v.MapIndex(key)
|
||||
elem := unwrapInterface(v.MapIndex(key))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
@@ -417,7 +527,7 @@ func minFromMap(v reflect.Value) (interface{}, error) {
|
||||
var minVal reflect.Value
|
||||
first := true
|
||||
for _, key := range v.MapKeys() {
|
||||
elem := v.MapIndex(key)
|
||||
elem := unwrapInterface(v.MapIndex(key))
|
||||
if !isOrderedKind(elem.Kind()) {
|
||||
return nil, fmt.Errorf("unsupported element type: %s", elem.Kind())
|
||||
}
|
||||
@@ -440,6 +550,16 @@ func isNumericKind(k reflect.Kind) bool {
|
||||
}
|
||||
}
|
||||
|
||||
// unwrapInterface returns v.Elem() when v holds an interface value, otherwise v unchanged.
|
||||
// This is necessary when iterating map[string]interface{} or []interface{} via reflection:
|
||||
// the element Kind is reflect.Interface, not the underlying concrete type.
|
||||
func unwrapInterface(v reflect.Value) reflect.Value {
|
||||
if v.Kind() == reflect.Interface {
|
||||
return v.Elem()
|
||||
}
|
||||
return v
|
||||
}
|
||||
|
||||
// isOrderedKind reports whether k supports comparison ordering.
|
||||
func isOrderedKind(k reflect.Kind) bool {
|
||||
switch k {
|
||||
|
||||
+1
-1
@@ -1 +1 @@
|
||||
4.4.43
|
||||
4.5.0
|
||||
|
||||
Reference in New Issue
Block a user