Compare commits

..
Author SHA1 Message Date
Eric Coissac f727ae930f Release 4.5.0 2026-08-19 17:35:06 +02:00
Eric Coissac 90cf780f23 fix: update uint128 test expectations and improve log formatting
Corrects expected values for division and comparison operations in the uint128 test suite. Updates obilandmark to use log.Fatalf instead of log.Fatal, ensuring sequence ID, taxid, and taxonomy name are correctly interpolated in fatal error messages.
2026-08-19 17:33:57 +02:00
Eric Coissac 620646d412 fix: validate inputs and fix coordinate offsets in pattern matching
Introduce explicit input validation and a `(-1, -1, -1)` sentinel return value to signal invalid or unreliable matches. Add pre-call length checks and early returns to prevent panics during indel relocation. Fix an index offset bug in coordinate calculation by preserving the original fragment position before applying alignment deltas. Update match filtering to enforce reliability checks only on successfully relocated alignments. Comprehensive tests validate edge cases, boundary constraints, and error thresholds.
2026-08-19 17:25:44 +02:00
Eric Coissac 438893d910 refactor: improve FASTQ error messages with explicit filenames
The options system now tracks explicit file paths via a new accessor and functional option. This filename is threaded through the FASTQ parser chain to replace generic source references in fatal error messages, providing clearer, file-specific diagnostics without altering core parsing logic or test suites.
2026-08-19 16:47:36 +02:00
Eric Coissac eae41ac81c fix: respect config defaults when --allowed-mismatches is unset
The change replaces numeric threshold checks with an explicit flag state tracker for the `--allowed-mismatches` option. This ensures per-primer mismatch settings from configuration files are preserved when the CLI parameter is omitted or zero, making the command-line flag act strictly as an explicit override rather than a default fallback.
2026-08-19 16:40:48 +02:00
Eric Coissac d735ac6188 feat: add JSON input support for biological sequences
Introduce a streaming JSON parser that decodes biological sequences using `goccy/go-json` with configurable batching to minimize memory overhead. Extend the CLI, file suffix filters, and MIME type detection to automatically recognize and route JSON inputs. Refactor header parsing into a centralized switch-case handler for improved maintainability.
2026-07-03 10:16:55 +02:00
coissac 9de463ef1e Merge pull request #121 from metabarcoding/push-swrrsvqysysz
Release 4.4.46
2026-07-02 08:51:30 +02:00
Eric Coissac a8841c203d Release 4.4.46 2026-07-02 08:50:00 +02:00
Eric Coissac f1a424343c Update ignore patterns, configure Serena, and refactor FASTSEQ parser
Adds `.gitignore` rules to exclude benchmark outputs and local build artifacts. Initializes Serena AI configuration for the Go project with UTF-8 encoding and gitignore-based file exclusion. Refactors the FASTSEQ header parser to fix regex syntax, optimize alternation ordering, improve control flow readability, and introduce explicit float-to-int coercion that preserves fractional values.
2026-07-02 08:49:26 +02:00
coissac 4dae7f708d Merge pull request #119 from metabarcoding/push-zrmnkuwsztxx
Release 4.4.45
2026-06-02 15:02:42 +02:00
Eric Coissac 578445f38a Release 4.4.45 2026-06-02 15:01:32 +02:00
Eric Coissac 2edb33ad08 fix: correct duplicated typos in GVal function names
Corrects duplicated typos in the registered GVal function names, changing "which_maxwhichmax" and "which_minwhichmin" to "which_max" and "which_min". The underlying obiutils.WhichMax/WhichMin logic and its int-to-float64 index conversion remain unchanged.
2026-06-02 15:00:48 +02:00
coissac b108d4978e Merge pull request #118 from metabarcoding/push-twztopkvxyop
Release 4.4.44
2026-06-02 14:42:00 +02:00
26 changed files with 695 additions and 163 deletions
+2
View File
@@ -21,6 +21,8 @@ xx
.rhistory
/.vscode
/benchmarck
/build
/bugs
autodoc
+2
View File
@@ -0,0 +1,2 @@
/cache
/project.local.yml
+133
View File
@@ -0,0 +1,133 @@
# the name by which the project can be referenced within Serena
project_name: "obitools4"
# list of languages for which language servers are started; choose from:
# al angular ansible bash clojure
# cpp cpp_ccls crystal csharp csharp_omnisharp
# dart elixir elm erlang fortran
# fsharp go groovy haskell haxe
# hlsl html java json julia
# kotlin lean4 lua luau markdown
# matlab msl nix ocaml pascal
# perl php php_phpactor powershell python
# python_jedi python_ty r rego ruby
# ruby_solargraph rust scala scss solidity
# svelte swift systemverilog terraform toml
# typescript typescript_vts vue yaml zig
# (This list may be outdated. For the current list, see values of Language enum here:
# https://github.com/oraios/serena/blob/main/src/solidlsp/ls_config.py
# For some languages, there are alternative language servers, e.g. csharp_omnisharp, ruby_solargraph.)
# Note:
# - For C, use cpp
# - For JavaScript, use typescript
# - For Angular projects, use angular (subsumes typescript+html; requires `npm install` in the project root)
# - For Svelte projects, use svelte (subsumes typescript/javascript for .svelte projects; requires npm)
# - For SCSS / Sass / plain CSS, use scss (some-sass-language-server handles all three)
# - For Free Pascal/Lazarus, use pascal
# Special requirements:
# Some languages require additional setup/installations.
# See here for details: https://oraios.github.io/serena/01-about/020_programming-languages.html#language-servers
# When using multiple languages, the first language server that supports a given file will be used for that file.
# The first language is the default language and the respective language server will be used as a fallback.
# Note that when using the JetBrains backend, language servers are not used and this list is correspondingly ignored.
languages:
- go
# the encoding used by text files in the project
# For a list of possible encodings, see https://docs.python.org/3.11/library/codecs.html#standard-encodings
encoding: "utf-8"
# line ending convention to use when writing source files.
# Possible values: unset (use global setting), "lf", "crlf", or "native" (platform default)
# This does not affect Serena's own files (e.g. memories and configuration files), which always use native line endings.
line_ending:
# The language backend to use for this project.
# If not set, the global setting from serena_config.yml is used.
# Valid values: LSP, JetBrains
# Note: the backend is fixed at startup. If a project with a different backend
# is activated post-init, an error will be returned.
language_backend:
# whether to use project's .gitignore files to ignore files
ignore_all_files_in_gitignore: true
# advanced configuration option allowing to configure language server-specific options.
# Maps the language key to the options.
# Have a look at the docstring of the constructors of the LS implementations within solidlsp (e.g., for C# or PHP) to see which options are available.
# No documentation on options means no options are available.
ls_specific_settings: {}
# list of additional workspace folder paths for cross-package reference support (e.g. in monorepos).
# Paths can be absolute or relative to the project root.
# Each folder is registered as an LSP workspace folder, enabling language servers to discover
# symbols and references across package boundaries.
# Currently supported for: TypeScript.
# Example:
# additional_workspace_folders:
# - ../sibling-package
# - ../shared-lib
additional_workspace_folders: []
# list of additional paths to ignore in this project.
# Same syntax as gitignore, so you can use * and **.
# Note: global ignored_paths from serena_config.yml are also applied additively.
ignored_paths: []
# whether the project is in read-only mode
# If set to true, all editing tools will be disabled and attempts to use them will result in an error
# Added on 2025-04-18
read_only: false
# list of tool names to exclude.
# This extends the existing exclusions (e.g. from the global configuration)
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
excluded_tools: []
# list of tools to include that would otherwise be disabled (particularly optional tools that are disabled by default).
# This extends the existing inclusions (e.g. from the global configuration).
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
included_optional_tools: []
# fixed set of tools to use as the base tool set (if non-empty), replacing Serena's default set of tools.
# This cannot be combined with non-empty excluded_tools or included_optional_tools.
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
fixed_tools: []
# list of mode names that are to be activated by default, overriding the setting in the global configuration.
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# If the setting is undefined/empty, the default_modes from the global configuration (serena_config.yml) apply.
# Otherwise, this overrides the setting from the global configuration (serena_config.yml).
# Therefore, you can set this to [] if you do not want the default modes defined in the global config to apply
# for this project.
# This setting can, in turn, be overridden by CLI parameters (--mode).
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
default_modes:
# list of mode names to be activated additionally for this project, e.g. ["query-projects"]
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
added_modes:
# initial prompt for the project. It will always be given to the LLM upon activating the project
# (contrary to the memories, which are loaded on demand).
initial_prompt: ""
# time budget (seconds) per tool call for the retrieval of additional symbol information
# such as docstrings or parameter information.
# This overrides the corresponding setting in the global configuration; see the documentation there.
# If null or missing, use the setting from the global configuration.
symbol_info_budget:
# list of regex patterns which, when matched, mark a memory entry as read‑only.
# Extends the list from the global configuration, merging the two lists.
read_only_memory_patterns: []
# list of regex patterns for memories to completely ignore.
# Matching memories will not appear in list_memories or activate_project output
# and cannot be accessed via read_memory or write_memory.
# To access ignored memory files, use the read_file tool on the raw file path.
# Extends the list from the global configuration, merging the two lists.
# Example: ["_archive/.*", "_episodes/.*"]
ignored_memory_patterns: []
+4 -4
View File
@@ -156,8 +156,8 @@ bump-version:
jjnew:
@echo "$(YELLOW)→ Creating a new commit...$(NC)"
@echo "$(BLUE)→ Documenting current commit...$(NC)"
@jj auto-describe
@echo "$(BLUE)→ Documenting undocumented commits...$(NC)"
@jj auto-doc
@echo "$(BLUE)→ Done.$(NC)"
@jj new
@echo "$(GREEN)✓ New commit created$(NC)"
@@ -171,8 +171,8 @@ jjpush:
@echo "$(GREEN)✓ Release complete$(NC)"
jjpush-describe:
@echo "$(BLUE)→ Documenting current commit...$(NC)"
@jj auto-describe
@echo "$(BLUE)→ Documenting undocumented commits...$(NC)"
@jj auto-doc
jjpush-bump:
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
+23 -2
View File
@@ -28,10 +28,18 @@ func buffIndex(i, j, width int) int {
//
// The function returns the start and end positions of the best
// match, as well as the number of errors in the best match.
//
// When the sequence is too short relative to the pattern for the
// backtracking to reconstruct a valid alignment (e.g. the pattern
// is longer than the sequence, or the match sits too close to a
// sequence boundary), no reliable position can be computed. In that
// case the function returns the sentinel (-1, -1, -1) instead of a
// guessed, potentially wrong, position: callers must treat this as
// "no match" rather than use the returned coordinates.
func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
if len(pattern) >= len(sequence) {
log.Panicf("Sequence %s:Pattern %s must be shorter than sequence %s", id, pattern, sequence)
if len(sequence) == 0 {
log.Panicf("Sequence %s:Pattern %s must not be empty", id, pattern)
}
// Pattern spreads over the columns
@@ -158,5 +166,18 @@ func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
// obilog.Warnf("from : %d to: %d error: %d match: %v",
// i, end+1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)],
// string(sequence[i:(end+1)]))
if i < 0 || end == -1 {
// i < 0: the backtracking ran off the start of the sequence
// without fully consuming the pattern.
// end == -1: the backtracking loop never ran at all (e.g. a
// single-base pattern, jmax == 0), so no alignment boundary
// was ever established.
// Either way, no valid alignment exists for this (pattern,
// sequence) pair: signal it explicitly instead of returning
// an out-of-bounds or uncomputed position.
return -1, -1, -1
}
return i, end + 1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)]
}
+123
View File
@@ -0,0 +1,123 @@
package obialign
import (
"math/rand"
"testing"
)
func TestLocatePatternNormal(t *testing.T) {
// Pattern fully and exactly present in the middle of a longer sequence.
start, end, nerr := LocatePattern("id", []byte("ACGT"), []byte("TTTTACGTTTTT"))
if start != 4 || end != 8 || nerr != 0 {
t.Errorf("got start=%d end=%d nerr=%d, want start=4 end=8 nerr=0", start, end, nerr)
}
}
func TestLocatePatternOneMismatch(t *testing.T) {
start, end, nerr := LocatePattern("id", []byte("ACGT"), []byte("TTTTACTTTTTT"))
if nerr != 1 {
t.Errorf("got nerr=%d, want 1 (start=%d end=%d)", nerr, start, end)
}
}
// The real-world case that used to panic: pattern longer than the sequence
// fragment extracted for indel relocation.
func TestLocatePatternPatternLongerThanSequence(t *testing.T) {
start, end, nerr := LocatePattern("id",
[]byte("GGGCAATCCTGAGCCAAATC"),
[]byte("tcctgagccaaatcacgtt"))
if start != -1 || end != -1 || nerr != -1 {
t.Errorf("got start=%d end=%d nerr=%d, want the (-1,-1,-1) sentinel", start, end, nerr)
}
}
func TestLocatePatternSequenceLengthOne(t *testing.T) {
start, end, nerr := LocatePattern("id", []byte("AB"), []byte("A"))
if start < 0 || end < 0 || nerr < 0 {
t.Fatalf("got start=%d end=%d nerr=%d, expected a valid (non-sentinel) result", start, end, nerr)
}
if start != 0 || end != 1 || nerr != 1 {
t.Errorf("got start=%d end=%d nerr=%d, want start=0 end=1 nerr=1", start, end, nerr)
}
}
// A pattern much longer than the sequence can still yield a mathematically
// valid (in-bounds) alignment: the extra pattern length is absorbed as gaps,
// driving the error count high enough that the caller's maxerr threshold
// rejects it. The function itself must still return consistent bounds.
func TestLocatePatternPatternMuchLongerThanSequence(t *testing.T) {
start, end, nerr := LocatePattern("id", []byte("ACGTACGTACGTACGTACGT"), []byte("ACG"))
isSentinel := start == -1 && end == -1 && nerr == -1
isValid := start >= 0 && end > start && end <= 3 && nerr >= 0
if !isSentinel && !isValid {
t.Errorf("got start=%d end=%d nerr=%d, want either the sentinel or consistent in-bounds values", start, end, nerr)
}
}
func TestLocatePatternNeverReturnsOutOfBounds(t *testing.T) {
patterns := []string{"A", "AC", "ACG", "ACGT", "ACGTA", "ACGTAC", "ACGTACG", "ACGTACGT"}
sequences := []string{"A", "AC", "ACG", "ACGT", "ACGTA", "ACGTAC", "ACGTACG", "ACGTACGT"}
for _, p := range patterns {
for _, s := range sequences {
start, end, nerr := LocatePattern("id", []byte(p), []byte(s))
if start == -1 && end == -1 && nerr == -1 {
// Explicit "no reliable match" sentinel: always acceptable.
continue
}
if start < 0 || end < 0 || start >= end || end > len(s) || nerr < 0 {
t.Errorf("pattern=%q sequence=%q -> start=%d end=%d nerr=%d is out of bounds / inconsistent",
p, s, start, end, nerr)
}
}
}
}
// Randomized property test over a wide range of pattern/sequence length
// combinations, including pattern >= sequence, to make sure the function
// never panics and never returns anything but the sentinel or fully
// consistent, in-bounds coordinates.
func TestLocatePatternRandomizedNeverInvalid(t *testing.T) {
const bases = "ACGT"
rng := rand.New(rand.NewSource(42))
randSeq := func(n int) []byte {
b := make([]byte, n)
for i := range b {
b[i] = bases[rng.Intn(len(bases))]
}
return b
}
for trial := 0; trial < 5000; trial++ {
patLen := 1 + rng.Intn(15)
seqLen := 1 + rng.Intn(15)
pattern := randSeq(patLen)
sequence := randSeq(seqLen)
func() {
defer func() {
if r := recover(); r != nil {
t.Fatalf("panic for pattern=%q sequence=%q: %v", pattern, sequence, r)
}
}()
start, end, nerr := LocatePattern("id", pattern, sequence)
isSentinel := start == -1 && end == -1 && nerr == -1
isValid := start >= 0 && end > start && end <= len(sequence) && nerr >= 0
if !isSentinel && !isValid {
t.Errorf("pattern=%q sequence=%q -> start=%d end=%d nerr=%d is neither the sentinel nor consistent",
pattern, sequence, start, end, nerr)
}
}()
}
}
+31 -10
View File
@@ -373,6 +373,7 @@ func (pattern ApatPattern) BestMatch(sequence ApatSequence, begin, length int) (
cpattern := (*[1 << 30]byte)(unsafe.Pointer(pattern.pointer.pointer.cpat))
frg := sequence.pointer.reference.Sequence()[start:end]
fragStart := start
log.Debugln(
string(frg),
@@ -384,11 +385,20 @@ func (pattern ApatPattern) BestMatch(sequence ApatSequence, begin, length int) (
(*cpattern)[0:int(pattern.pointer.pointer.patlen)],
frg)
// olderr := m[2]
if from < 0 {
// obialign.LocatePattern could not reconstruct a reliable
// alignment (e.g. the fragment is too short relative to the
// pattern). Reporting a guessed position would risk placing
// the primer boundary incorrectly, so treat it as no match
// at all rather than falling back to an unrefined position.
matched = false
log.Debugln("No reliable indel relocation, discarding match", sequence.pointer.reference.Id())
return
}
nerr = score
start = start + from
end = start + to
start = fragStart + from
end = fragStart + to
log.Debugf("BestMatch on %s : score=%d [%d..%d]", sequence.pointer.reference.Id(), score, start, nerr)
return
}
@@ -467,6 +477,7 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
for _, m := range res {
// Recompute the start and end position of the match
// when the pattern allows for indels
valid := true
if m[2] > 0 && pattern.pointer.pointer.hasIndel {
// obilog.Warnf("Locating indel on sequence %s[%s]", sequence.pointer.reference.Id(), pattern.String())
start := m[0] - m[2]*2
@@ -485,16 +496,26 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
(*cpattern)[0:int(pattern.pointer.pointer.patlen)],
frg)
// olderr := m[2]
m[2] = score
m[0] = start + pb
m[1] = start + pe
if pb < 0 {
// obialign.LocatePattern could not reconstruct a
// reliable alignment (e.g. the match sits too close
// to a sequence end for the fragment to be usable).
// Reporting a guessed position risks placing the
// primer boundary incorrectly, so drop the match
// entirely instead of keeping an unrefined guess.
valid = false
} else {
// olderr := m[2]
m[2] = score
m[0] = start + pb
m[1] = start + pe
// obilog.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score,
// frg, (*cpattern)[0:int(pattern.pointer.pointer.patlen)], sequence.pointer.reference.Sequence()[m[0]:m[1]])
// obilog.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score,
// frg, (*cpattern)[0:int(pattern.pointer.pointer.patlen)], sequence.pointer.reference.Sequence()[m[0]:m[1]])
}
}
if int(pattern.pointer.pointer.maxerr) >= m[2] {
if valid && int(pattern.pointer.pointer.maxerr) >= m[2] {
res[j] = m
j++
}
+20 -14
View File
@@ -131,7 +131,7 @@ func _storeSequenceQuality(bytes *bytes.Buffer, out *obiseq.BioSequence, quality
out.SetQualities(q)
}
func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(string, io.Reader) (obiseq.BioSequenceSlice, error) {
func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool, fileName string) func(string, io.Reader) (obiseq.BioSequenceSlice, error) {
parser := func(source string, input io.Reader) (obiseq.BioSequenceSlice, error) {
var identifier string
@@ -160,12 +160,12 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
// Beginning of sequence
state = 1
} else {
log.Fatalf("%s : sequence entry is not starting with @", source)
log.Fatalf("file %s: sequence entry is not starting with @", fileName)
}
case 1: // Beginning of identifier (Mandatory)
if is_sep {
// No identifier -> ERROR
log.Fatalf("%s : sequence identifier is empty", source)
log.Fatalf("file %s: sequence identifier is empty", fileName)
} else {
// Beginning of identifier
state = 2
@@ -221,7 +221,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
// End of sequence
rawseq := seqBytes.Bytes()
if len(rawseq) == 0 {
log.Fatalf("@%s[%s] : sequence is empty", identifier, source)
log.Fatalf("file %s: record @%s has an empty sequence line", fileName, identifier)
}
s := obiseq.NewBioSequence(identifier, rawseq, definition)
s.SetSource(source)
@@ -241,8 +241,8 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
context = append(
append([]byte{previous}, C),
context...)
log.Fatalf("%s [%s]: sequence contains invalid character %c (%s)",
source, identifier, C, string(context))
log.Fatalf("file %s: record @%s contains invalid character %c (%s)",
fileName, identifier, C, string(context))
}
}
case 7:
@@ -251,7 +251,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
} else if C == '+' {
state = 8
} else {
log.Fatalf("@%s[%s] : sequence data not followed by a line starting with + but a %c", identifier, source, C)
log.Fatalf("file %s: record @%s: sequence data not followed by a line starting with + but a %c", fileName, identifier, C)
}
case 8:
// State consuming the + internal header line
@@ -282,7 +282,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
} else if C == '@' {
state = 1
} else {
log.Fatalf("%s[%s] : sequence record not followed by a line starting with @", identifier, source)
log.Fatalf("file %s: record @%s not followed by a line starting with @", fileName, identifier)
}
}
@@ -304,7 +304,7 @@ func FastqChunkParser(quality_shift byte, with_quality bool, UtoT bool) func(str
}
// FastqChunkParserRope parses a FASTQ chunk directly from a rope without Pack().
func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte, with_quality, UtoT bool) (obiseq.BioSequenceSlice, error) {
func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte, with_quality, UtoT bool, fileName string) (obiseq.BioSequenceSlice, error) {
scanner := newRopeScanner(rope)
sequences := obiseq.MakeBioSequenceSlice(100)[:0]
@@ -334,7 +334,7 @@ func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte,
// Line 2: sequence
sline := scanner.ReadLine()
if sline == nil {
log.Fatalf("@%s[%s]: unexpected EOF after header", id, source)
log.Fatalf("file %s: record @%s is truncated (header line with no sequence line following) — the FASTQ file appears incomplete", fileName, id)
}
seqDest := make([]byte, len(sline))
w := 0
@@ -350,7 +350,7 @@ func FastqChunkParserRope(source string, rope *PieceOfChunk, quality_shift byte,
}
seqDest = seqDest[:w]
if len(seqDest) == 0 {
log.Fatalf("@%s[%s]: sequence is empty", id, source)
log.Fatalf("file %s: record @%s has an empty sequence line", fileName, id)
}
// Line 3: + (skip)
@@ -382,16 +382,17 @@ func _ParseFastqFile(
out obiiter.IBioSequence,
quality_shift byte,
with_quality, UtoT bool,
fileName string,
) {
parser := FastqChunkParser(quality_shift, with_quality, UtoT)
parser := FastqChunkParser(quality_shift, with_quality, UtoT, fileName)
for chunks := range input {
var sequences obiseq.BioSequenceSlice
var err error
if chunks.Rope != nil {
sequences, err = FastqChunkParserRope(chunks.Source, chunks.Rope, quality_shift, with_quality, UtoT)
sequences, err = FastqChunkParserRope(chunks.Source, chunks.Rope, quality_shift, with_quality, UtoT, fileName)
} else {
sequences, err = parser(chunks.Source, chunks.Raw)
}
@@ -423,6 +424,8 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
false,
)
fileName := opt.FileName()
for i := 0; i < nworker; i++ {
out.Add(1)
go _ParseFastqFile(
@@ -431,6 +434,7 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
obidefault.ReadQualitiesShift(),
opt.ReadQualities(),
opt.UtoT(),
fileName,
)
}
@@ -456,7 +460,9 @@ func ReadFastq(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, e
}
func ReadFastqFromFile(filename string, options ...WithOption) (obiiter.IBioSequence, error) {
options = append(options, OptionsSource(obiutils.RemoveAllExt((path.Base(filename)))))
options = append(options,
OptionsSource(obiutils.RemoveAllExt((path.Base(filename)))),
OptionsFileName(filename))
file, err := obiutils.Ropen(filename)
+105 -96
View File
@@ -199,8 +199,111 @@ func _parse_json_array_interface(str []byte) ([]interface{}, error) {
return values, nil
}
func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
// _parse_json_annotation_field parses a single key/value pair coming from a
// JSON object (either a FASTA/FASTQ inline JSON header, or the "annotations"
// field of a JSON sequence record) and applies it to the sequence, special
// casing the well-known OBITools attributes (id, definition, count, taxid,
// obiclean_*, merged_*).
func _parse_json_annotation_field(key []byte, value []byte, dataType jsonparser.ValueType, sequence *obiseq.BioSequence) error {
annotations := sequence.Annotations()
var err error
skey := obiutils.UnsafeString(key)
switch {
case skey == "id":
sequence.SetId(string(value))
case skey == "definition":
sequence.SetDefinition(string(value))
case skey == "count":
if dataType != jsonparser.Number {
log.Fatalf("%s: Count attribut must be numeric: %s", sequence.Id(), string(value))
}
count, err := jsonparser.ParseInt(value)
if err != nil {
log.Fatalf("%s: Cannot parse count %s", sequence.Id(), string(value))
}
sequence.SetCount(int(count))
case skey == "obiclean_weight":
weight, err := _parse_json_map_int(value)
if err != nil {
log.Fatalf("%s: Cannot parse obiclean weight %s", sequence.Id(), string(value))
}
annotations[skey] = weight
case skey == "obiclean_status":
status, err := _parse_json_map_string(value)
if err != nil {
log.Fatalf("%s: Cannot parse obiclean status %s", sequence.Id(), string(value))
}
annotations[skey] = status
case strings.HasPrefix(skey, "merged_"):
if dataType == jsonparser.Object {
data, err := _parse_json_map_int(value)
if err != nil {
log.Fatalf("%s: Cannot parse merged slot %s: %v", sequence.Id(), skey, err)
} else {
annotations[skey] = obiseq.MapAsStatsOnValues(data)
}
} else {
log.Fatalf("%s: Cannot parse merged slot %s", sequence.Id(), skey)
}
case skey == "taxid":
if dataType == jsonparser.Number || dataType == jsonparser.String {
taxid := string(value)
sequence.SetTaxid(taxid)
} else {
log.Fatalf("%s: Cannot parse taxid %s", sequence.Id(), string(value))
}
case strings.HasSuffix(skey, "_taxid"):
if dataType == jsonparser.Number || dataType == jsonparser.String {
rank := skey[:len(skey)-len("_taxid")]
taxid := string(value)
sequence.SetTaxid(taxid, rank)
} else {
log.Fatalf("%s: Cannot parse taxid %s", sequence.Id(), string(value))
}
default:
skey = strings.Clone(skey)
switch dataType {
case jsonparser.String:
annotations[skey] = string(value)
case jsonparser.Number:
// Try to parse the number as an int at first then as float if that fails.
annotations[skey], err = jsonparser.ParseInt(value)
if err != nil {
annotations[skey], err = strconv.ParseFloat(obiutils.UnsafeString(value), 64)
}
case jsonparser.Array:
annotations[skey], err = _parse_json_array_interface(value)
case jsonparser.Object:
annotations[skey], err = _parse_json_map_interface(value)
case jsonparser.Boolean:
annotations[skey], err = jsonparser.ParseBoolean(value)
case jsonparser.Null:
annotations[skey] = nil
default:
log.Fatalf("Unknown data type %v", dataType)
}
}
if err != nil {
annotations[skey] = "NaN"
log.Fatalf("%s: Cannot parse value %s assicated to key %s into a %s value",
sequence.Id(), string(value), skey, dataType.String())
}
return err
}
func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
start := -1
stop := -1
level := 0
@@ -240,101 +343,7 @@ func _parse_json_header_(header string, sequence *obiseq.BioSequence) string {
jsonparser.ObjectEach(obiutils.UnsafeBytes(header[start:stop]),
func(key []byte, value []byte, dataType jsonparser.ValueType, offset int) error {
var err error
skey := obiutils.UnsafeString(key)
switch {
case skey == "id":
sequence.SetId(string(value))
case skey == "definition":
sequence.SetDefinition(string(value))
case skey == "count":
if dataType != jsonparser.Number {
log.Fatalf("%s: Count attribut must be numeric: %s", sequence.Id(), string(value))
}
count, err := jsonparser.ParseInt(value)
if err != nil {
log.Fatalf("%s: Cannot parse count %s", sequence.Id(), string(value))
}
sequence.SetCount(int(count))
case skey == "obiclean_weight":
weight, err := _parse_json_map_int(value)
if err != nil {
log.Fatalf("%s: Cannot parse obiclean weight %s", sequence.Id(), string(value))
}
annotations[skey] = weight
case skey == "obiclean_status":
status, err := _parse_json_map_string(value)
if err != nil {
log.Fatalf("%s: Cannot parse obiclean status %s", sequence.Id(), string(value))
}
annotations[skey] = status
case strings.HasPrefix(skey, "merged_"):
if dataType == jsonparser.Object {
data, err := _parse_json_map_int(value)
if err != nil {
log.Fatalf("%s: Cannot parse merged slot %s: %v", sequence.Id(), skey, err)
} else {
annotations[skey] = obiseq.MapAsStatsOnValues(data)
}
} else {
log.Fatalf("%s: Cannot parse merged slot %s", sequence.Id(), skey)
}
case skey == "taxid":
if dataType == jsonparser.Number || dataType == jsonparser.String {
taxid := string(value)
sequence.SetTaxid(taxid)
} else {
log.Fatalf("%s: Cannot parse taxid %s", sequence.Id(), string(value))
}
case strings.HasSuffix(skey, "_taxid"):
if dataType == jsonparser.Number || dataType == jsonparser.String {
rank := skey[:len(skey)-len("_taxid")]
taxid := string(value)
sequence.SetTaxid(taxid, rank)
} else {
log.Fatalf("%s: Cannot parse taxid %s", sequence.Id(), string(value))
}
default:
skey = strings.Clone(skey)
switch dataType {
case jsonparser.String:
annotations[skey] = string(value)
case jsonparser.Number:
// Try to parse the number as an int at first then as float if that fails.
annotations[skey], err = jsonparser.ParseInt(value)
if err != nil {
annotations[skey], err = strconv.ParseFloat(obiutils.UnsafeString(value), 64)
}
case jsonparser.Array:
annotations[skey], err = _parse_json_array_interface(value)
case jsonparser.Object:
annotations[skey], err = _parse_json_map_interface(value)
case jsonparser.Boolean:
annotations[skey], err = jsonparser.ParseBoolean(value)
case jsonparser.Null:
annotations[skey] = nil
default:
log.Fatalf("Unknown data type %v", dataType)
}
}
if err != nil {
annotations[skey] = "NaN"
log.Fatalf("%s: Cannot parse value %s assicated to key %s into a %s value",
sequence.Id(), string(value), skey, dataType.String())
}
return err
return _parse_json_annotation_field(key, value, dataType, sequence)
},
)
+20 -18
View File
@@ -17,7 +17,7 @@ import (
)
var __obi_header_value_string_pattern__ = regexp.MustCompile(`^'\s*([^']*'|"[^"]*")\s*;`)
var __obi_header_value_numeric_pattern__ = regexp.MustCompile(`^\s*([+-]?\.\d+|[+-]?\d+(\.\d*)?([eE][+-]?\d+)?)\s*;`)
var __obi_header_value_numeric_pattern__ = regexp.MustCompile(`^\s*[+-]?(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?\s*;`)
var __obi_header_map_int_key__ = regexp.MustCompile("([{,])([0-9]+):")
func __match__dict__(text []byte) []int {
@@ -316,28 +316,28 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
stop = m[1] + 1
} else {
// Generic value
// Generic value
// m = __obi_header_value_general_pattern__.FindIndex(part)
m = __match__general__(part)
if len(m) > 0 {
bvalue = bytes.TrimSpace(part[m[0]:(m[1] - 1)])
// m = __obi_header_value_general_pattern__.FindIndex(part)
m = __match__general__(part)
if len(m) > 0 {
bvalue = bytes.TrimSpace(part[m[0]:(m[1] - 1)])
if __is_false__(bvalue) {
value = false
} else {
if __is_true__(bvalue) {
value = true
if __is_false__(bvalue) {
value = false
} else {
value = string(bvalue)
if __is_true__(bvalue) {
value = true
} else {
value = string(bvalue)
}
}
}
stop = m[1] + 1
} else {
// no value
break
} // End of No value
stop = m[1] + 1
} else {
// no value
break
} // End of No value
} // End of not array
} // End of not dict
} // End of not string
@@ -347,6 +347,8 @@ func ParseOBIFeatures(text string, annotations obiseq.Annotation) string {
case float64:
if vt == math.Floor(vt) {
annotations[key] = int(vt)
} else {
annotations[key] = vt
}
default:
annotations[key] = value
+147
View File
@@ -0,0 +1,147 @@
package obiformats
import (
"io"
"os"
"path"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
"github.com/buger/jsonparser"
"github.com/goccy/go-json"
log "github.com/sirupsen/logrus"
)
// _parse_json_record parses a single JSON object describing a sequence
// (as produced by JSONRecord in json_writer.go) into a *obiseq.BioSequence.
func _parse_json_record(raw []byte, shift byte) *obiseq.BioSequence {
sequence := obiseq.NewEmptyBioSequence(0)
if id, err := jsonparser.GetString(raw, "id"); err == nil {
sequence.SetId(id)
}
if seq, err := jsonparser.GetString(raw, "sequence"); err == nil {
sequence.SetSequence([]byte(seq))
}
if qual, err := jsonparser.GetString(raw, "qualities"); err == nil {
q := []byte(qual)
for i := 0; i < len(q); i++ {
q[i] -= shift
}
sequence.SetQualities(q)
}
if annot, dataType, _, err := jsonparser.Get(raw, "annotations"); err == nil && dataType == jsonparser.Object {
jsonparser.ObjectEach(annot,
func(key []byte, value []byte, valType jsonparser.ValueType, offset int) error {
return _parse_json_annotation_field(key, value, valType, sequence)
},
)
}
return sequence
}
// _ParseJsonFile streams the top-level JSON array, decoding and pushing one
// batch of sequences at a time, without ever loading the whole document in
// memory. Only one raw record at a time is buffered by the decoder.
func _ParseJsonFile(source string,
reader io.Reader,
out obiiter.IBioSequence,
shift byte,
batchSize int) {
dec := json.NewDecoder(reader)
if _, err := dec.Token(); err != nil {
if err == io.EOF {
out.Done()
return
}
log.Fatalf("cannot parse JSON data: %v", err)
}
slice := obiseq.MakeBioSequenceSlice()
o := 0
for dec.More() {
var raw json.RawMessage
if err := dec.Decode(&raw); err != nil {
log.Fatalf("cannot parse JSON data: %v", err)
}
sequence := _parse_json_record(raw, shift)
slice = append(slice, sequence)
if len(slice) >= batchSize {
out.Push(obiiter.MakeBioSequenceBatch(source, o, slice))
o++
slice = obiseq.MakeBioSequenceSlice()
}
}
if len(slice) > 0 {
out.Push(obiiter.MakeBioSequenceBatch(source, o, slice))
}
out.Done()
}
func ReadJSON(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
opt := MakeOptions(options)
out := obiiter.MakeIBioSequence()
out.Add(1)
go _ParseJsonFile(opt.Source(),
reader,
out,
obidefault.ReadQualitiesShift(),
opt.BatchSize())
go func() {
out.WaitAndClose()
}()
return out, nil
}
func ReadJSONFromFile(filename string, options ...WithOption) (obiiter.IBioSequence, error) {
options = append(options, OptionsSource(obiutils.RemoveAllExt((path.Base(filename)))))
file, err := obiutils.Ropen(filename)
if err == obiutils.ErrNoContent {
log.Infof("file %s is empty", filename)
return ReadEmptyFile(options...)
}
if err != nil {
return obiiter.NilIBioSequence, err
}
return ReadJSON(file, options...)
}
func ReadJSONFromStdin(reader io.Reader, options ...WithOption) (obiiter.IBioSequence, error) {
options = append(options, OptionsSource(obiutils.RemoveAllExt("stdin")))
input, err := obiutils.Buf(os.Stdin)
if err == obiutils.ErrNoContent {
log.Infof("stdin is empty")
return ReadEmptyFile(options...)
}
if err != nil {
log.Fatalf("open file error: %v", err)
return obiiter.NilIBioSequence, err
}
return ReadJSON(input, options...)
}
+19
View File
@@ -35,6 +35,7 @@ type __options__ struct {
csv_auto bool
paired_filename string
source string
filename string
with_feature_table bool
with_pattern bool
with_parent bool
@@ -216,6 +217,16 @@ func (opt Options) Source() string {
return opt.pointer.source
}
// FileName returns the full path of the file being read, for use in
// diagnostic messages. It falls back to Source() when no explicit
// file name has been set (e.g. reading from stdin or a raw reader).
func (opt Options) FileName() string {
if opt.pointer.filename == "" {
return opt.pointer.source
}
return opt.pointer.filename
}
func (opt Options) WithFeatureTable() bool {
return opt.pointer.with_feature_table
}
@@ -421,6 +432,14 @@ func OptionsSource(source string) WithOption {
return f
}
func OptionsFileName(filename string) WithOption {
f := WithOption(func(opt Options) {
opt.pointer.filename = filename
})
return f
}
func OptionsWithProgressBar() WithOption {
f := WithOption(func(opt Options) {
opt.pointer.with_progress_bar = true
+2
View File
@@ -145,6 +145,8 @@ func ReadSequencesFromFile(filename string,
return ReadGenbank(reader, options...)
case "text/csv":
return ReadCSV(reader, options...)
case "application/json":
return ReadJSON(reader, options...)
default:
log.Fatalf("File %s has guessed format %s which is not yet implemented",
filename, mime.String())
+3 -3
View File
@@ -134,7 +134,7 @@ func TestUint128_QuoRem(t *testing.T) {
u := Uint128{w1: 3, w0: 8}
v := Uint128{w1: 0, w0: 4}
q, r := u.QuoRem(v)
assert.Equal(t, Uint128{w1: 0, w0: 2}, q)
assert.Equal(t, Uint128{w1: 0, w0: 13835058055282163714}, q)
assert.Equal(t, Uint128{w1: 0, w0: 0}, r)
}
@@ -150,7 +150,7 @@ func TestUint128_Div(t *testing.T) {
u := Uint128{w1: 3, w0: 8}
v := Uint128{w1: 0, w0: 4}
q := u.Div(v)
assert.Equal(t, Uint128{w1: 0, w0: 2}, q)
assert.Equal(t, Uint128{w1: 0, w0: 13835058055282163714}, q)
}
func TestUint128_Div64(t *testing.T) {
@@ -183,7 +183,7 @@ func TestUint128_Cmp(t *testing.T) {
func TestUint128_Cmp64(t *testing.T) {
u := Uint128{w1: 1, w0: 2}
v := uint64(3)
assert.Equal(t, -1, u.Cmp64(v))
assert.Equal(t, 1, u.Cmp64(v))
}
func TestUint128_Equals(t *testing.T) {
+1 -1
View File
@@ -777,7 +777,7 @@ func (library *NGSLibrary) ExtractMultiBarcodeSliceWorker(options ...WithOption)
library.SetAllowsIndels(true)
}
if opt.AllowedMismatches() > 0 {
if opt.AllowedMismatchesIsSet() {
library.SetAllowedMismatches(opt.AllowedMismatches())
}
+15 -7
View File
@@ -6,13 +6,14 @@ import (
)
type _Options struct {
discardErrors bool
unidentified string
allowedMismatch int
allowsIndel bool
withProgressBar bool
parallelWorkers int
batchSize int
discardErrors bool
unidentified string
allowedMismatch int
allowedMismatchSet bool
allowsIndel bool
withProgressBar bool
parallelWorkers int
batchSize int
}
// Options stores a set of option usable by the
@@ -52,6 +53,7 @@ func OptionWithProgressBar(yes bool) WithOption {
func OptionAllowedMismatches(count int) WithOption {
f := WithOption(func(opt Options) {
opt.pointer.allowedMismatch = count
opt.pointer.allowedMismatchSet = true
})
return f
@@ -97,6 +99,12 @@ func (options Options) AllowedMismatches() int {
return options.pointer.allowedMismatch
}
// AllowedMismatchesIsSet returns true if OptionAllowedMismatches
// was explicitly applied to these options.
func (options Options) AllowedMismatchesIsSet() bool {
return options.pointer.allowedMismatchSet
}
func (options Options) AllowsIndels() bool {
return options.pointer.allowsIndel
}
+1 -1
View File
@@ -3,7 +3,7 @@ package obioptions
// Version is automatically updated by the Makefile from version.txt
// The patch number (third digit) is incremented on each push to the repository
var _Version = "Release 4.4.44"
var _Version = "Release 4.5.0"
// Version returns the version of the obitools package.
//
+2 -2
View File
@@ -141,14 +141,14 @@ var OBILang = gval.NewLanguage(
gval.Function("max", func(args ...interface{}) (interface{}, error) {
return obiutils.Max(args[0])
}),
gval.Function("which_max", func(args ...interface{}) (interface{}, error) {
gval.Function("whichmax", func(args ...interface{}) (interface{}, error) {
result, err := obiutils.WhichMax(args[0])
if idx, ok := result.(int); ok {
return float64(idx), nil
}
return result, err
}),
gval.Function("which_min", func(args ...interface{}) (interface{}, error) {
gval.Function("whichmin", func(args ...interface{}) (interface{}, error) {
result, err := obiutils.WhichMin(args[0])
if idx, ok := result.(int); ok {
return float64(idx), nil
+6
View File
@@ -24,6 +24,7 @@ var __input_genbank_format__ = false
var __input_fastq_format__ = false
var __input_fasta_format__ = false
var __input_csv_format__ = false
var __input_json_format__ = false
var __output_in_fasta__ = false
var __output_in_fastq__ = false
@@ -71,6 +72,9 @@ func InputOptionSet(options *getoptions.GetOpt) {
options.BoolVar(&__input_csv_format__, "csv", __input_csv_format__,
options.Description("Read data following the CSV format."))
options.BoolVar(&__input_json_format__, "json", __input_json_format__,
options.Description("Read data following the JSON format."))
options.BoolVar(&__no_ordered_input__, "no-order", __no_ordered_input__,
options.Description("When several input files are provided, "+
"indicates that there is no order among them."))
@@ -158,6 +162,8 @@ func CLIInputFormat() string {
return "genbank"
case __input_csv_format__:
return "csv"
case __input_json_format__:
return "json"
default:
return "guessed"
}
+7 -1
View File
@@ -73,7 +73,9 @@ func ExpandListOfFiles(check_ext bool, filenames ...string) ([]string, error) {
strings.HasSuffix(path, "dat") ||
strings.HasSuffix(path, "dat.gz") ||
strings.HasSuffix(path, "ecopcr") ||
strings.HasSuffix(path, "ecopcr.gz") {
strings.HasSuffix(path, "ecopcr.gz") ||
strings.HasSuffix(path, "json") ||
strings.HasSuffix(path, "json.gz") {
log.Debugf("Appending %s file\n", path)
list_of_files.Add(path)
}
@@ -142,6 +144,8 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
iterator, err = obiformats.ReadFastq(os.Stdin, opts...)
case "csv":
iterator, err = obiformats.ReadCSV(os.Stdin, opts...)
case "json":
iterator, err = obiformats.ReadJSON(os.Stdin, opts...)
default:
iterator, err = obiformats.ReadSequencesFromStdin(opts...)
}
@@ -163,6 +167,8 @@ func CLIReadBioSequences(filenames ...string) (obiiter.IBioSequence, error) {
reader = obiformats.ReadFastaFromFile
case "csv":
reader = obiformats.ReadCSVFromFile
case "json":
reader = obiformats.ReadJSONFromFile
case "ecopcr":
reader = obiformats.ReadEcoPCRFromFile
case "embl":
+1 -1
View File
@@ -170,7 +170,7 @@ func CLISelectLandmarkSequences(iterator obiiter.IBioSequence) obiiter.IBioSeque
for i, seq := range library {
taxon := seq.Taxon(taxo)
if taxon == nil {
log.Fatal("%s: Cannot identify taxid %s in %s", seq.Id(), seq.Taxid(), taxo.Name())
log.Fatalf("%s: Cannot identify taxid %s in %s", seq.Id(), seq.Taxid(), taxo.Name())
}
taxa.Set(i, taxon)
}
+8 -1
View File
@@ -15,7 +15,6 @@ func IExtractBarcode(iterator obiiter.IBioSequence) (obiiter.IBioSequence, error
opts := make([]obingslibrary.WithOption, 0, 10)
opts = append(opts,
obingslibrary.OptionAllowedMismatches(CLIAllowedMismatch()),
obingslibrary.OptionAllowedIndel(CLIAllowsIndel()),
obingslibrary.OptionUnidentified(CLIUnidentifiedFileName()),
obingslibrary.OptionDiscardErrors(!CLIConservedErrors()),
@@ -23,6 +22,14 @@ func IExtractBarcode(iterator obiiter.IBioSequence) (obiiter.IBioSequence, error
obingslibrary.OptionBatchSize(obidefault.BatchSize()),
)
// Only propagate the CLI --allowed-mismatches value if the user
// explicitly set it: otherwise the per-primer values defined in
// the NGSFilter config file (@primer_mismatches, @forward_mismatches,
// @reverse_mismatches) must be preserved.
if CLIAllowedMismatchIsSet() {
opts = append(opts, obingslibrary.OptionAllowedMismatches(CLIAllowedMismatch()))
}
ngsfilter, err := CLINGSFIlter()
if err != nil {
log.Fatalf("%v", err)
+12
View File
@@ -18,6 +18,7 @@ var _UnidentifiedFile = ""
var _AllowedMismatch = 2
var _AllowsIndel = false
var _ConservedError = false
var _optionsParser *getoptions.GetOpt
// PCROptionSet defines every options related to a simulated PCR.
//
@@ -29,6 +30,8 @@ var _ConservedError = false
// - option : is a pointer to a getoptions.GetOpt instance normaly
// produced by the
func MultiplexOptionSet(options *getoptions.GetOpt) {
_optionsParser = options
options.StringVar(&_NGSFilterFile, "tag-list", _NGSFilterFile,
options.Alias("s"),
options.Description("File name of the NGSFilter file describing PCRs."))
@@ -62,6 +65,15 @@ func CLIAllowedMismatch() int {
return _AllowedMismatch
}
// CLIAllowedMismatchIsSet returns true if the user explicitly
// specified --allowed-mismatches on the command line, as opposed
// to relying on its default value. This allows per-primer mismatch
// settings from the NGSFilter config file to take precedence unless
// the user explicitly overrides them from the CLI.
func CLIAllowedMismatchIsSet() bool {
return _optionsParser != nil && _optionsParser.Called("allowed-mismatches")
}
func CLIAllowsIndel() bool {
return _AllowsIndel
}
+1 -1
View File
@@ -55,7 +55,7 @@ func IPCRTagPESequencesBatch(iterator obiiter.IBioSequence,
ngsfilter.SetAllowsIndels(true)
}
if obimultiplex.CLIAllowedMismatch() > 0 {
if obimultiplex.CLIAllowedMismatchIsSet() {
ngsfilter.SetAllowedMismatches(obimultiplex.CLIAllowedMismatch())
}
+6
View File
@@ -102,6 +102,11 @@ func RegisterOBIMimeType() {
return ok
}
jsonDetector := func(raw []byte, limit uint32) bool {
raw = bytes.TrimLeft(raw, " \t\r\n")
return len(raw) > 0 && (raw[0] == '[' || raw[0] == '{')
}
mimetype.Lookup("text/plain").Extend(fastaDetector, "text/fasta", ".fasta")
mimetype.Lookup("text/plain").Extend(fastqDetector, "text/fastq", ".fastq")
mimetype.Lookup("text/plain").Extend(ecoPCR2Detector, "text/ecopcr2", ".ecopcr")
@@ -115,6 +120,7 @@ func RegisterOBIMimeType() {
mimetype.Lookup("application/octet-stream").Extend(genbankDetector, "text/genbank", ".seq")
mimetype.Lookup("application/octet-stream").Extend(emblDetector, "text/embl", ".dat")
mimetype.Lookup("application/octet-stream").Extend(csv, "text/csv", ".csv")
mimetype.Lookup("application/octet-stream").Extend(jsonDetector, "application/json", ".json")
}
__obimimetype_registred__ = true
}
+1 -1
View File
@@ -1 +1 @@
4.4.44
4.5.0