Optimisation de la construction des binaires

Modification du fichier de workflow de release pour compiler uniquement les outils obitools lors de la construction des binaires pour chaque plateforme (Linux AMD64, Linux ARM64, macOS AMD64, macOS ARM64, Windows AMD64). Cela permet d'optimiser le processus de build en ne générant que les binaires nécessaires.

.github/workflows/obitest.yml

@@ -0,0 +1,19 @@
+name: "Run the obitools command test suite"
+
+on:
+  push:
+    branches:
+      - master
+      - V*
+jobs:
+  build:
+    runs-on: ubuntu-latest
+    steps:
+    - name: Setup Go
+      uses: actions/setup-go@v2
+      with:
+        go-version: '1.23'
+    - name: Checkout obitools4 project
+      uses: actions/checkout@v4
+    - name: Run tests
+      run: make githubtests

.github/workflows/release.yml

@@ -0,0 +1,176 @@
+name: Create Release on Tag
+
+on:
+  push:
+    tags:
+      - "Release_*"
+
+permissions:
+  contents: write
+
+jobs:
+  # First run tests
+  test:
+    runs-on: ubuntu-latest
+    steps:
+      - name: Setup Go
+        uses: actions/setup-go@v5
+        with:
+          go-version: "1.23"
+      - name: Checkout obitools4 project
+        uses: actions/checkout@v4
+      - name: Run tests
+        run: make githubtests
+
+  # Then create release only if tests pass
+  create-release:
+    needs: test
+    runs-on: ubuntu-latest
+    steps:
+      - name: Checkout code
+        uses: actions/checkout@v4
+        with:
+          fetch-depth: 0
+
+      - name: Setup Go
+        uses: actions/setup-go@v5
+        with:
+          go-version: "1.23"
+
+      - name: Extract version from tag
+        id: get_version
+        run: |
+          TAG=${GITHUB_REF#refs/tags/Release_}
+          echo "version=$TAG" >> $GITHUB_OUTPUT
+          echo "tag_name=Release_$TAG" >> $GITHUB_OUTPUT
+
+      - name: Build binaries for multiple platforms
+        env:
+          VERSION: ${{ steps.get_version.outputs.version }}
+        run: |
+          mkdir -p release
+
+          # Build for Linux AMD64
+          echo "Building for Linux AMD64..."
+          GOOS=linux GOARCH=amd64 make obitools
+          cd build
+          for binary in *; do
+            tar -czf ../release/${binary}_${VERSION}_linux_amd64.tar.gz ${binary}
+          done
+          cd ..
+          rm -rf build
+          
+
+          # Build for Linux ARM64
+          echo "Building for Linux ARM64..."
+          GOOS=linux GOARCH=arm64 make obitools
+          cd build
+          for binary in *; do
+            tar -czf ../release/${binary}_${VERSION}_linux_arm64.tar.gz ${binary}
+          done
+          cd ..
+          rm -rf build
+          
+
+          # Build for macOS AMD64 (Intel)
+          echo "Building for macOS AMD64..."
+          GOOS=darwin GOARCH=amd64 make obitools
+          cd build
+          for binary in *; do
+            tar -czf ../release/${binary}_${VERSION}_darwin_amd64.tar.gz ${binary}
+          done
+          cd ..
+          rm -rf build
+          
+
+          # Build for macOS ARM64 (Apple Silicon)
+          echo "Building for macOS ARM64..."
+          GOOS=darwin GOARCH=arm64 make obitools
+          cd build
+          for binary in *; do
+            tar -czf ../release/${binary}_${VERSION}_darwin_arm64.tar.gz ${binary}
+          done
+          cd ..
+          rm -rf build
+          
+
+          # Build for Windows AMD64
+          echo "Building for Windows AMD64..."
+          GOOS=windows GOARCH=amd64 make obitools
+          cd build
+          for binary in *; do
+            # Windows binaries have .exe extension
+            if [ -f "${binary}.exe" ]; then
+              zip ../release/${binary}_${VERSION}_windows_amd64.zip ${binary}.exe
+            else
+              zip ../release/${binary}_${VERSION}_windows_amd64.zip ${binary}
+            fi
+          done
+          cd ..
+
+          echo "Built archives:"
+          ls -lh release/
+
+      - name: Generate Release Notes
+        id: release_notes
+        env:
+          VERSION: ${{ steps.get_version.outputs.version }}
+        run: |
+          PREV_TAG=$(git describe --tags --abbrev=0 HEAD^ 2>/dev/null || echo "")
+
+          echo "# OBITools4 Release ${VERSION}" > release_notes.md
+          echo "" >> release_notes.md
+
+          if [ -n "$PREV_TAG" ]; then
+            echo "## Changes since ${PREV_TAG}" >> release_notes.md
+            echo "" >> release_notes.md
+            git log ${PREV_TAG}..HEAD --pretty=format:"- %s" >> release_notes.md
+          else
+            echo "## Changes" >> release_notes.md
+            echo "" >> release_notes.md
+            git log --pretty=format:"- %s" -n 20 >> release_notes.md
+          fi
+
+          echo "" >> release_notes.md
+          echo "" >> release_notes.md
+          echo "## Installation" >> release_notes.md
+          echo "" >> release_notes.md
+          echo "Download the appropriate binary for your system and extract it:" >> release_notes.md
+          echo "" >> release_notes.md
+          echo "### Linux (AMD64)" >> release_notes.md
+          echo '```bash' >> release_notes.md
+          echo "tar -xzf <tool>_${VERSION}_linux_amd64.tar.gz" >> release_notes.md
+          echo '```' >> release_notes.md
+          echo "" >> release_notes.md
+          echo "### Linux (ARM64)" >> release_notes.md
+          echo '```bash' >> release_notes.md
+          echo "tar -xzf <tool>_${VERSION}_linux_arm64.tar.gz" >> release_notes.md
+          echo '```' >> release_notes.md
+          echo "" >> release_notes.md
+          echo "### macOS (Intel)" >> release_notes.md
+          echo '```bash' >> release_notes.md
+          echo "tar -xzf <tool>_${VERSION}_darwin_amd64.tar.gz" >> release_notes.md
+          echo '```' >> release_notes.md
+          echo "" >> release_notes.md
+          echo "### macOS (Apple Silicon)" >> release_notes.md
+          echo '```bash' >> release_notes.md
+          echo "tar -xzf <tool>_${VERSION}_darwin_arm64.tar.gz" >> release_notes.md
+          echo '```' >> release_notes.md
+          echo "" >> release_notes.md
+          echo "### Windows (AMD64)" >> release_notes.md
+          echo '```powershell' >> release_notes.md
+          echo "Expand-Archive <tool>_${VERSION}_windows_amd64.zip" >> release_notes.md
+          echo '```' >> release_notes.md
+          echo "" >> release_notes.md
+          echo "Available tools: Replace \`<tool>\` with one of the obitools commands." >> release_notes.md
+
+      - name: Create GitHub Release
+        uses: softprops/action-gh-release@v1
+        with:
+          name: Release ${{ steps.get_version.outputs.version }}
+          body_path: release_notes.md
+          files: release/*
+          draft: false
+          prerelease: false
+        env:
+          GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}

.gitignore

@@ -1,135 +1,33 @@
-cpu.pprof
-cpu.trace
-test
-bin
-vendor
-*.fastq
-*.fasta
-*.fastq.gz
-*.fasta.gz
-.DS_Store
-*.gml
-*.log
-/argaly
-
-/obiconvert
-/obicount
-/obimultiplex
-/obipairing
-/obipcr
-/obifind
-/obidistribute
-/obiuniq
-/build
-/Makefile.old
-.Rproj.user
-obitools.Rproj
-Stat_error.knit.md
-.Rhistory
-Stat_error.nb.html
-Stat_error.Rmd
-
-/.luarc.json
-/doc/TAXO/
-/doc/results/
-/doc/_main.log
-/doc/_book/_main.tex
-/doc/_freeze/
-/doc/tutorial_files/
-/doc/wolf_data/
-/taxdump/
-/.vscode/
-
-/Algo-Alignement.numbers
-/Estimate_proba_true_seq.html
-/Estimate_proba_true_seq.nb.html
-/Estimate_proba_true_seq.Rmd
-/modele_error_euka.qmd
-/obitools.code-workspace
-.DS_Store
-.RData
-x
-xxx
-y
-/doc/wolf_diet.tgz
-/doc/man/depends
-/sample/wolf_R1.fasta.gz
-/sample/wolf_R2.fasta.gz
-/sample/euka03.ecotag.fasta.gz
-/sample/ratio.csv
-/sample/STD_PLN_1.dat
-/sample/STD_PLN_2.dat
-/sample/subset_Pasvik_R1.fastq.gz
-/sample/subset_Pasvik_R2.fastq.gz
-/sample/test_gobitools.fasta.bz2
-euka03.csv*
-gbbct793.seq.gz
-gbinv1003.seq.gz
-gbpln210.seq
-/doc/book/OBITools-V4.aux
-/doc/book/OBITools-V4.fdb_latexmk
-/doc/book/OBITools-V4.fls
-/doc/book/OBITools-V4.log
-/doc/book/OBITools-V4.pdf
-/doc/book/OBITools-V4.synctex.gz
-/doc/book/OBITools-V4.tex
-/doc/book/OBITools-V4.toc
-getoptions.adoc
-Archive.zip
-.DS_Store
-sample/.DS_Store
-sample/consensus_graphs/specimen_hac_plants_Vern_disicolor_.gml
-93954
-Bact03.e5.gb_R254.obipcr.idx.fasta.save
-sample/test.obipcr.log
-Bact02.e3.gb_R254.obipcr.fasta.gz
-Example_Arth03.ngsfilter
-SPER01.csv
-SPER03.csv
-wolf_diet_ngsfilter.txt
+**/cpu.pprof
+**/cpu.trace
+**/test
+**/bin
+**/vendor
+**/*.fastq
+**/*.fasta
+**/*.fastq.gz
+**/*.fasta.gz
+**/.DS_Store
+**/*.gml
+**/*.log
+**/xxx*
+**/*.sav
+**/*.old
+**/*.tgz
+**/*.yaml
+**/*.csv
 xx
-xxx.gb
-yyy_geom.csv
-yyy_LCS.csv
-yyy.json
-bug_obimultiplex/toto
-bug_obimultiplex/toto_mapping
-bug_obimultiplex/tutu
-bug_obimultiplex/tutu_mapping
-bug_obipairing/GIT1_GH_ngsfilter.txt
-doc/book/TAXO/citations.dmp
-doc/book/TAXO/delnodes.dmp
-doc/book/TAXO/division.dmp
-doc/book/TAXO/gc.prt
-doc/book/TAXO/gencode.dmp
-doc/book/TAXO/merged.dmp
-doc/book/TAXO/names.dmp
-doc/book/TAXO/nodes.dmp
-doc/book/TAXO/readme.txt
-doc/book/wolf_data/Release-253/ncbitaxo/citations.dmp
-doc/book/wolf_data/Release-253/ncbitaxo/delnodes.dmp
-doc/book/wolf_data/Release-253/ncbitaxo/division.dmp
-doc/book/wolf_data/Release-253/ncbitaxo/gc.prt
-doc/book/wolf_data/Release-253/ncbitaxo/gencode.dmp
-doc/book/wolf_data/Release-253/ncbitaxo/merged.dmp
-doc/book/wolf_data/Release-253/ncbitaxo/names.dmp
-doc/book/wolf_data/Release-253/ncbitaxo/nodes.dmp
-doc/book/wolf_data/Release-253/ncbitaxo/readme.txt
-doc/book/results/toto.tasta
-sample/.DS_Store
-GO
-ncbitaxo/citations.dmp
-ncbitaxo/delnodes.dmp
-ncbitaxo/division.dmp
-ncbitaxo/gc.prt
-ncbitaxo/gencode.dmp
-ncbitaxo/merged.dmp
-ncbitaxo/names.dmp
-ncbitaxo/nodes.dmp
-ncbitaxo/readme.txt
-template.16S
-xxx.gz
-*.sav
-*.old
-ncbitaxo.tgz
-*.csv
+
+.rhistory
+/.vscode
+/build
+/bugs
+
+/ncbitaxo
+
+!/obitests/**
+!/sample/**
+LLM/** 
+*_files
+
+entropy.html

Makefile

@@ -2,8 +2,9 @@
 #export GOBIN=$(GOPATH)/bin
 #export PATH=$(GOBIN):$(shell echo $${PATH})
 
+GOFLAGS=
 GOCMD=go
-GOBUILD=$(GOCMD) build # -compiler gccgo -gccgoflags -O3
+GOBUILD=$(GOCMD) build $(GOFLAGS)
 GOGENERATE=$(GOCMD) generate
 GOCLEAN=$(GOCMD) clean
 GOTEST=$(GOCMD) test
@@ -16,6 +17,12 @@ PACKAGES_SRC:= $(wildcard pkg/*/*.go pkg/*/*/*.go)
 PACKAGE_DIRS:=$(sort $(patsubst %/,%,$(dir $(PACKAGES_SRC))))
 PACKAGES:=$(notdir $(PACKAGE_DIRS))
 
+GITHOOK_SRC_DIR=git-hooks
+GITHOOKS_SRC:=$(wildcard $(GITHOOK_SRC_DIR)/*)
+
+GITHOOK_DIR=.git/hooks
+GITHOOKS:=$(patsubst $(GITHOOK_SRC_DIR)/%,$(GITHOOK_DIR)/%,$(GITHOOKS_SRC))
+
 OBITOOLS_SRC:= $(wildcard cmd/obitools/*/*.go)
 OBITOOLS_DIRS:=$(sort $(patsubst %/,%,$(dir $(OBITOOLS_SRC))))
 OBITOOLS:=$(notdir $(OBITOOLS_DIRS))
@@ -53,27 +60,31 @@ endif
 
 OUTPUT:=$(shell mktemp)
 
-all: obitools
+all: install-githook obitools
 
-packages: $(patsubst %,pkg-%,$(PACKAGES))
 obitools: $(patsubst %,$(OBITOOLS_PREFIX)%,$(OBITOOLS))
 
+install-githook: $(GITHOOKS)
+
+$(GITHOOK_DIR)/%: $(GITHOOK_SRC_DIR)/%
+	@echo installing $$(basename $@)...
+	@mkdir -p $(GITHOOK_DIR)
+	@cp $< $@
+	@chmod +x $@
+
+
 update-deps:
 	go get -u ./...
 
-test:
+test: .FORCE
 	$(GOTEST) ./...
 
-man: 
-	make -C doc man
-obibook: 
-	make -C doc obibook
-doc: man obibook
+obitests:
+	@for t in $$(find obitests -name test.sh -print) ; do \
+		bash $${t} || exit 1;\
+	done
 
-macos-pkg: 
-	@bash pkgs/macos/macos-installer-builder-master/macOS-x64/build-macos-x64.sh \
-		OBITools \
-		0.0.1
+githubtests: obitools obitests
 
 $(BUILD_DIR):
 	mkdir -p $@
@@ -83,19 +94,61 @@ $(foreach P,$(PACKAGE_DIRS),$(eval $(call MAKE_PKG_RULE,$(P))))
 
 $(foreach P,$(OBITOOLS_DIRS),$(eval $(call MAKE_OBITOOLS_RULE,$(P))))
 
-pkg/obioptions/version.go: .FORCE
-ifneq ($(strip $(COMMIT_ID)),)
-	@cat $@ \
-	| sed  -E 's/^var _Commit = "[^"]*"/var _Commit = "'$(COMMIT_ID)'"/' \
-	| sed  -E 's/^var _Version = "[^"]*"/var _Version = "'"$(LAST_TAG)"'"/' \
+pkg/obioptions/version.go: version.txt .FORCE
+	@version=$$(cat version.txt); \
+	cat $@ \
+	| sed  -E 's/^var _Version = "[^"]*"/var _Version = "Release '$$version'"/' \
 	> $(OUTPUT)
 
 	@diff $@ $(OUTPUT) 2>&1 > /dev/null \
-    	|| echo "Update version.go : $@ to $(LAST_TAG) ($(COMMIT_ID))" \
-    	&& mv $(OUTPUT) $@
+    	|| (echo "Update version.go to $$(cat version.txt)" && mv $(OUTPUT) $@)
 
 	@rm -f $(OUTPUT)
-endif
 
-.PHONY: all packages obitools man obibook doc update-deps .FORCE
+bump-version:
+	@echo "Incrementing version..."
+	@current=$$(cat version.txt); \
+	echo "  Current version: $$current"; \
+	major=$$(echo $$current | cut -d. -f1); \
+	minor=$$(echo $$current | cut -d. -f2); \
+	patch=$$(echo $$current | cut -d. -f3); \
+	new_patch=$$((patch + 1)); \
+	new_version="$$major.$$minor.$$new_patch"; \
+	echo "  New version: $$new_version"; \
+	echo "$$new_version" > version.txt
+	@echo "✓ Version updated in version.txt"
+	@$(MAKE) pkg/obioptions/version.go
+
+jjnew:
+	@echo "$(YELLOW)→ Creating a new commit...$(NC)"
+	@echo "$(BLUE)→ Documenting current commit...$(NC)"
+	@jj auto-describe
+	@echo "$(BLUE)→ Done.$(NC)"
+	@jj new
+	@echo "$(GREEN)✓ New commit created$(NC)"
+
+jjpush:
+	@echo "$(YELLOW)→ Pushing commit to repository...$(NC)"
+	@echo "$(BLUE)→ Documenting current commit...$(NC)"
+	@jj auto-describe
+	@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
+	@jj new
+	@$(MAKE) bump-version
+	@echo "$(BLUE)→ Documenting version bump commit...$(NC)"
+	@jj auto-describe
+	@version=$$(cat version.txt); \
+	tag_name="Release_$$version"; \
+	echo "$(BLUE)→ Pushing commits and creating tag $$tag_name...$(NC)"; \
+	jj git push --change @; \
+	git tag -a "$$tag_name" -m "Release $$version" 2>/dev/null || echo "Tag $$tag_name already exists"; \
+	git push origin "$$tag_name" 2>/dev/null || echo "Tag already pushed"
+	@echo "$(GREEN)✓ Commits and tag pushed to repository$(NC)"
+
+jjfetch:
+	@echo "$(YELLOW)→ Pulling latest commits...$(NC)"
+	@jj git fetch
+	@jj new master@origin
+	@echo "$(GREEN)✓ Latest commits pulled$(NC)"
+
+.PHONY: all obitools update-deps obitests githubtests jjnew jjpush jjfetch bump-version .FORCE
 .FORCE:

README.md

@@ -37,7 +37,7 @@ curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install
       bash -s -- --install-dir test_install --obitools-prefix k
 ```
 
-In this case, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus `obigrep` will be named `kobigrep`.
+In this case, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus, `obigrep` will be named `kobigrep`.
 
 ## Continuing the analysis...
 

Release-notes.md

@@ -1,19 +1,85 @@
 # OBITools release notes
 
-## Latest changes
+## New changes
+
+### Bug fixes
+
+- In `obipairing` correct the misspelling of the `obiparing_*` tags where the `i`
+  was missing to `obipairing_`.  
+
+- In `obigrep` the **-C** option that excludes sequences too abundant was not 
+  functional.
+
+- In `obitaxonomy` the **-l** option that lists all the taxonomic rank defined by
+  a taxonomy was not functional
+
+- The file type guesser was not using enough data to be able to correctly detect
+  file format when sequences were too long in fastq and fasta or when lines were
+  to long in CSV files. That's now corrected
+
+- Options **--fasta** or **--fastq** usable to specify input format were ignored.
+  They are now correctly considered
+
+- The `obiannotate` command were crashing when a selection option was used but
+  no editing option.
+  
+- The `--fail-on-taxonomy` led to an error on merged taxa even when the
+  `--update-taxid` option was used.
+
+- The `--compressed` option was not correctly named. It was renamed to `--compress`
+  
+### Enhancement
+
+- Some sequences in the Genbank and EMBL databases are several gigabases long. The 
+  sequence parser had to reallocate and recopy memory many times to read them, 
+  resulting in a complexity of O(N^2) for reading such large sequences. 
+  The new file chunk reader has a linear algorithm that speeds up the reading 
+  of very long sequences.
+
+- A new option **--csv** is added to every obitools to indicate that the input
+  format is CSV
+
+- The new version of obitools are now printing the taxids in a fancy way
+  including the scientific name and the taxonomic rank (`"taxon:9606 [Homo
+  sapiens]@species"`). But if you need the old fashion raw taxid, a new option
+  **--raw-taxid** has been added to get obitools printing the taxids without any
+  decorations (`"9606"`).
+
+
+## March 1st, 2025. Release 4.4.0
+
+A new documentation website is available at https://obitools4.metabarcoding.org.
+Its development is still in progress. 
+
+The biggest step forward in this new version is taxonomy management. The new
+version is now able to handle taxonomic identifiers that are not just integer
+values. This is a first step towards an easy way to handle other taxonomy
+databases soon, such as the GBIF or Catalog of Life taxonomies. This version
+is able to handle files containing taxonomic information created by previous
+versions of OBITools, but files created by this new version may have some
+problems to be analyzed by previous versions, at least for the taxonomic
+information.
+
 
 ### Breaking changes
 
-- In `obimultiplex`, the short version of the **--tag-list** option used to specify the list 
-  of tags and primers to be used for the demultiplexing has been changed from `-t` to `-s`.
+- In `obimultiplex`, the short version of the **--tag-list** option used to
+  specify the list of tags and primers to be used for the demultiplexing has
+  been changed from `-t` to `-s`.
 
 - The command `obifind` is now renamed `obitaxonomy`.
 
-- The **--taxdump** option used to specify the path to the taxdump containing the NCBI taxonomy
-  has been renamed to **--taxonomy**.
+- The **--taxdump** option used to specify the path to the taxdump containing
+  the NCBI taxonomy has been renamed to **--taxonomy**.
 
 ### Bug fixes
 
+- Correction of a bug when using paired sequence file with the **--out** option.
+
+- Correction of a bug in `obitag` when trying to annotate very short sequences of
+  4 bases or less.
+  
+
 - In `obipairing`, correct the stats `seq_a_single` and `seq_b_single` when
   on right alignment mode
 
@@ -21,12 +87,32 @@
   the batch size and not reading the qualities from the fastq files as `obiuniq`
   is producing only fasta output without qualities.
 
+-   In `obitag`, correct the wrong assignment of the **obitag_bestmatch**
+    attribute.
+
+-   In `obiclean`, the **--no-progress-bar** option disables all progress bars,
+    not just the data.
+
+-   Several fixes in reading FASTA and FASTQ files, including some code
+    simplification and factorization.
+
+-   Fixed a bug in all obitools that caused the same file to be processed
+    multiple times, when specifying a directory name as input.
+
+
 ### New features
 
+-   `obigrep` add a new **--valid-taxid** option to keep only sequence with a
+    valid taxid
+
+-   `obiclean` add a new **--min-sample-count** option with a default value of 1,
+    asking to filter out sequences which are not occurring in at least the
+    specified number of samples.
+
 -   `obitoaxonomy` a new **--dump|D** option allows for dumping a sub-taxonomy.
   
--   Taxonomy dump can now be provided as a four-columns CSV file to the **--taxonomy**
-    option.
+-   Taxonomy dump can now be provided as a four-columns CSV file to the
+    **--taxonomy** option.
 
 -   NCBI Taxonomy dump does not need to be uncompressed and unarchived anymore. The
     path of the tar and gziped dump file can be directly specified using the
@@ -37,54 +123,68 @@
     allow the processing of the rare fasta and fastq files not recognized.
     
 -   In `obiscript`, adds new methods to the Lua sequence object:
-    - `md5_string()`:  returning the MD5 check sum as an hexadecimal string,
-	- `subsequence(from,to)`: allows to extract a subsequence on a 0 based 
-            coordinate system, upper bound expluded like in go.
-	- `reverse_complement`: returning a sequence object corresponding to the reverse complement
-            of the current sequence.
+    - `md5_string()`: returning the MD5 check sum as a hexadecimal string, 
+    - `subsequence(from,to)`: allows extracting a subsequence on a 0 based
+      coordinate system, upper bound excluded like in go. 
+    - `reverse_complement`: returning a sequence object corresponding to the
+      reverse complement of the current sequence.
 
-### Change of git repositiory
+### Enhancement
 
--   The OBITools4 git repository has been moved to the github repository. 
+-   All obitools now have a **--taxonomy** option. If specified, the taxonomy is
+    loaded first and taxids annotating the sequences are validated against that
+    taxonomy. A warning is issued for any invalid taxid and for any taxid that
+    is transferred to a new taxid. The **--update-taxid** option allows these
+    old taxids to be replaced with their new equivalent in the result of the
+    obitools command.
+
+-   The scoring system used by the `obipairing` command has been changed to be
+    more coherent. In the new version, the scores associated to a match and a
+    mismatch involving a nucleotide with a quality score of 0 are equal. Which
+    is normal as a zero quality score means a perfect indecision on the read
+    nucleotide, therefore there is no reason to penalize a match differently
+    from a mismatch (see 
+    https://obitools4.metabarcoding.org/docs/commands/alignments/obipairing/exact-alignment/).
+
+-   In every *OBITools* command, the progress bar is automatically deactivated
+    when the standard error output is redirected.
+
+-   Because Genbank and ENA:EMBL contain very large sequences, while OBITools4
+    are optimized As Genbank and ENA:EMBL contain very large sequences, while
+    OBITools4 is optimized for short sequences, `obipcr` faces some problems
+    with excessive consumption of computer resources, especially memory. Several
+    improvements in the tuning of the default `obipcr` parameters and some new
+    features, currently only available for FASTA and FASTQ file readers, have
+    been implemented to limit the memory impact of `obipcr` without changing the
+    computational efficiency too much.
+
+-   Logging system and therefore format, have been homogenized.
+
+## August 2nd, 2024. Release 4.3.0
+
+### Change of git repository
+
+-   The OBITools4 git repository has been moved to the GitHub repository. 
     The new address is: https://github.com/metabarcoding/obitools4.
     Take care for using the new install script for retrieving the new version.
 
     ```bash
-    curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh \
+    curl -L https://metabarcoding.org/obitools4/install.sh \
       | bash
     ```
 
     or with options:
 
     ```bash
-    curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh \
+    curl -L https://metabarcoding.org/obitools4/install.sh \
       | bash -s -- --install-dir test_install --obitools-prefix k
     ```
-    
-### CPU limitation
-
--   By default, *OBITools4* tries to use all the computing power available on
-    your computer. In some circumstances this can be problematic (e.g. if you
-    are running on a computer cluster managed by your university). You can limit
-    the number of CPU cores used by *OBITools4* or by using the **--max-cpu**
-    option or by setting the **OBIMAXCPU** environment variable. Some strange
-    behaviour of *OBITools4* has been observed when users try to limit the
-    maximum number of usable CPU cores to one. This seems to be caused by the Go
-    language, and it is not obvious to get *OBITools4* to run correctly on a
-    single core in all circumstances. Therefore, if you ask to use a single
-    core, **OBITools4** will print a warning message and actually set this
-    parameter to two cores. If you really want a single core, you can use the
-    **--force-one-core** option. But be aware that this can lead to incorrect
-    calculations.
-
-### New features
-
 -   The output of the obitools will evolve to produce results only in standard
     formats such as fasta and fastq. For non-sequential data, the output will be
     in CSV format, with the separator `,`, the decimal separator `.`, and a
     header line with the column names. It is more convenient to use the output
     in other programs. For example, you can use the `csvtomd` command to
-    reformat the csv output into a markdown table. The first command to initiate
+    reformat the CSV output into a Markdown table. The first command to initiate
     this change is `obicount`, which now produces a 3-line CSV output.
 
     ```bash
@@ -96,7 +196,7 @@
     database for `obitag` is to use `obipcr` on a local copy of Genbank or EMBL.
     However, these sequence databases are known to contain many taxonomic
     errors, such as bacterial sequences annotated with the taxid of their host
-    species. obicleandb tries to detect these errors. To do this, it first keeps
+    species. `obicleandb` tries to detect these errors. To do this, it first keeps
     only sequences annotated with the taxid to which a species, genus, and
     family taxid can be assigned. Then, for each sequence, it compares the
     distance of the sequence to the other sequences belonging to the same genus
@@ -107,7 +207,7 @@
     with the p-value of the Mann-Whitney U test in the **obicleandb_trusted**
     slot. Later, the distribution of this p-value can be analyzed to determine a
     threshold. Empirically, a threshold of 0.05 is a good compromise and allows
-    to filter out less than 1‰ of the sequences. These sequences can then be
+    filtering out less than 1‰ of the sequences. These sequences can then be
     removed using `obigrep`.
 
 -   Adds a new `obijoin` utility to join information contained in a sequence
@@ -117,16 +217,16 @@
 
 -   Adds a new tool `obidemerge` to demerge a `merge_xxx` slot by recreating the 
     multiple identical sequences having the slot `xxx` recreated with its initial
-    value and the sequence count set to the number of occurences refered in the
+    value and the sequence count set to the number of occurrences referred in the
     `merge_xxx` slot. During the operation, the `merge_xxx` slot is removed.
 
 -   Adds CSV as one of the input format for every obitools command. To encode
-    sequence the CSV file must includes a column named `sequence` and another
+    sequence the CSV file must include a column named `sequence` and another
     column named `id`. An extra column named `qualities` can be added to specify 
-    the quality scores of the sequence following the same ascii encoding than the
+    the quality scores of the sequence following the same ASCII encoding than the
     fastq format. All the other columns will be considered as annotations and will
     be interpreted as JSON objects encoding potentially for atomic values. If a 
-    calumn value can not be decoded as JSON it will be considered as a string.
+    column value can not be decoded as JSON it will be considered as a string.
 
 -   A new option **--version** has been added to every obitools command. It will
     print the version of the command.
@@ -135,8 +235,8 @@
     quality scores from a BioSequence object.\
 
 -   In `obimultuplex` the ngsfilter file describing the samples can be no provided
-    not only using the classical nfsfilter format but also using the csv format.
-    When using csv, the first line must contain the column names. 5 columns are
+    not only using the classical ngsfilter format but also using the CSV format.
+    When using CSV, the first line must contain the column names. 5 columns are
     expected:
 
     -   `experiment` the name of the experiment
@@ -152,43 +252,34 @@
 
     Supplementary columns are allowed. Their names and content will be used to
     annotate the sequence corresponding to the sample, as the `key=value;` did
-    in the nfsfilter format.
+    in the ngsfilter format.
 
     The CSV format used allows for comment lines starting with `#` character.
-    Special data lines starting with `@param` in the first column allow to
-    configure the algorithm. The options **--template** provided an over
-    commented example of the csv format, including all the possible options.
+    Special data lines starting with `@param` in the first column allow configuring the algorithm. The options **--template** provided an over
+    commented example of the CSV format, including all the possible options.
     
-### Enhancement
+### CPU limitation
 
--   In every *OBITools* command, the progress bar are automatically deactivated
-    when the standard error output is redirected.
--   Because Genbank and ENA:EMBL contain very large sequences, while OBITools4
-    are optimized As Genbank and ENA:EMBL contain very large sequences, while
-    OBITools4 is optimised for short sequences, `obipcr` faces some problems
-    with excessive consumption of computer resources, especially memory. Several
-    improvements in the tuning of the default `obipcr` parameters and some new
-    features, currently only available for FASTA and FASTQ file readers, have
-    been implemented to limit the memory impact of `obipcr` without changing the
-    computational efficiency too much.
--   Logging system and therefore format, have been homogenized.
+-   By default, *OBITools4* tries to use all the computing power available on
+    your computer. In some circumstances this can be problematic (e.g. if you
+    are running on a computer cluster managed by your university). You can limit
+    the number of CPU cores used by *OBITools4* or by using the **--max-cpu**
+    option or by setting the **OBIMAXCPU** environment variable. Some strange
+    behavior of *OBITools4* has been observed when users try to limit the
+    maximum number of usable CPU cores to one. This seems to be caused by the Go
+    language, and it is not obvious to get *OBITools4* to run correctly on a
+    single core in all circumstances. Therefore, if you ask to use a single
+    core, **OBITools4** will print a warning message and actually set this
+    parameter to two cores. If you really want a single core, you can use the
+    **--force-one-core** option. But be aware that this can lead to incorrect
+    calculations.
 
-### Bug
-
--   In `obitag`, correct the wrong assignment of the **obitag_bestmatch**
-    attribute.
--   In `obiclean`, the **--no-progress-bar** option disables all progress bars,
-    not just the data.
--   Several fixes in reading FASTA and FASTQ files, including some code
-    simplification and and factorization.
--   Fixed a bug in all obitools that caused the same file to be processed
-    multiple times. when specifying a directory name as input.
 
 ## April 2nd, 2024. Release 4.2.0
 
 ### New features
 
--   A new OBITools named `obiscript` allows to process each sequence according
+-   A new OBITools named `obiscript` allows processing each sequence according
     to a Lua script. This is an experimental tool. The **--template** option
     allows for generating an example script on the `stdout`.
 
@@ -196,7 +287,7 @@
 
 -   Two of the main class `obiseq.SeqWorker` and `obiseq.SeqWorker` have their
     declaration changed. Both now return two values a `obiseq.BioSequenceSlice`
-    and an `error`. This allow a worker to return potentially several sequences
+    and an `error`. This allows a worker to return potentially several sequences
     as the result of the processing of a single sequence, or zero, which is
     equivalent to filter out the input sequence.
 
@@ -204,12 +295,12 @@
 
 -   In `obitag` if the reference database contains sequences annotated by taxid
     not referenced in the taxonomy, the corresponding sequences are discarded
-    from the reference database and a warning indicating the sequence id and the
+    from the reference database and a warning indicating the sequence *id* and the
     wrong taxid is emitted.
 -   The bug corrected in the parsing of EMBL and Genbank files as implemented in
     version 4.1.2 of OBITools4, potentially induced some reduction in the
     performance of the parsing. This should have been now fixed.
--   In the same idea, parsing of genbank and EMBL files were reading and storing
+-   In the same idea, parsing of Genbank and EMBL files were reading and storing
     in memory not only the sequence but also the annotations (features table).
     Up to now none of the OBITools are using this information, but with large
     complete genomes, it is occupying a lot of memory. To reduce this impact,
@@ -248,7 +339,7 @@
 
 ### New feature
 
--   In `obimatrix` a **--transpose** option allows to transpose the produced
+-   In `obimatrix` a **--transpose** option allows transposing the produced
     matrix table in CSV format.
 -   In `obitpairing` and `obipcrtag` two new options **--exact-mode** and
     **--fast-absolute** to control the heuristic used in the alignment
@@ -256,7 +347,7 @@
     the exact algorithm at the cost of a speed. **--fast-absolute** change the
     scoring schema of the heuristic.
 -   In `obiannotate` adds the possibility to annotate the first match of a
-    pattern using the same algorithm than the one used in `obipcr` and
+    pattern using the same algorithm as the one used in `obipcr` and
     `obimultiplex`. For that four option were added :
     -   **--pattern** : to specify the pattern. It can use IUPAC codes and
         position with no error tolerated has to be followed by a `#` character.
@@ -337,7 +428,7 @@
 
 ### Bugs
 
--   in the obitools language, the `composition` function now returns a map
+-   In the obitools language, the `composition` function now returns a map
     indexed by lowercase string "a", "c", "g", "t" and "o" for other instead of
     being indexed by the ASCII codes of the corresponding letters.
 -   Correction of the reverse-complement operation. Every reverse complement of
@@ -350,18 +441,18 @@
     duplicating the quality values. This made `obimultiplex` to produce fastq
     files with sequences having quality values duplicated.
 
-### Becareful
+### Be careful
 
 GO 1.21.0 is out, and it includes new functionalities which are used in the
-OBITools4 code. If you use the recommanded method for compiling OBITools on your
-computer, their is no problem, as the script always load the latest GO version.
-If you rely on you personnal GO install, please think to update.
+OBITools4 code. If you use the recommended method for compiling OBITools on your
+computer, there is no problem, as the script always load the latest GO version.
+If you rely on your personal GO install, please think to update.
 
 ## August 29th, 2023. Release 4.0.5
 
 ### Bugs
 
--   Patch a bug in the `obiseq.BioSequence` constructor leading to a error on
+-   Patch a bug in the `obiseq.BioSequence` constructor leading to an error on
     almost every obitools. The error message indicates : `fatal error: sync:
     unlock of unlocked mutex` This bug was introduced in the release 4.0.4
 
@@ -380,7 +471,7 @@ If you rely on you personnal GO install, please think to update.
     data structure to limit the number of alignments actually computed. This
     increase a bit the speed of both the software. `obirefidx` is nevertheless
     still too slow compared to my expectation.
--   Switch to a parallel version of the gzip library, allowing for high speed
+-   Switch to a parallel version of the GZIP library, allowing for high speed
     compress and decompress operation on files.
 
 ### New feature
@@ -424,12 +515,12 @@ If you rely on you personnal GO install, please think to update.
               --unidentified not_assigned.fastq
     ```
 
-    the command produced four files : `tagged_library_R1.fastq` and
+    The command produced four files : `tagged_library_R1.fastq` and
     `tagged_library_R2.fastq` containing the assigned reads and
     `not_assigned_R1.fastq` and `not_assigned_R2.fastq` containing the
     unassignable reads.
 
-    the tagged library files can then be split using `obidistribute`:
+    The tagged library files can then be split using `obidistribute`:
 
     ```{bash}
     mkdir pcr_reads
@@ -439,9 +530,9 @@ If you rely on you personnal GO install, please think to update.
 
 -   Adding of two options **--add-lca-in** and **--lca-error** to `obiannotate`.
     These options aim to help during construction of reference database using
-    `obipcr`. On obipcr output, it is commonly run obiuniq. To merge identical
+    `obipcr`. On `obipcr` output, it is commonly run `obiuniq`. To merge identical
     sequences annotated with different taxids, it is now possible to use the
-    following strategie :
+    following strategies :
 
     ```{bash}
     obiuniq -m taxid myrefdb.obipcr.fasta \
@@ -472,7 +563,7 @@ If you rely on you personnal GO install, please think to update.
 -   Correction of a bug in `obiconsensus` leading into the deletion of a base
     close to the beginning of the consensus sequence.
 
-## March 31th, 2023. Release 4.0.2
+## March 31st, 2023. Release 4.0.2
 
 ### Compiler change
 
@@ -483,15 +574,15 @@ If you rely on you personnal GO install, please think to update.
 -   Add the possibility for looking pattern with indels. This has been added to
     `obimultiplex` through the **--with-indels** option.
 -   Every obitools command has a **--pprof** option making the command
-    publishing a profiling web site available at the address :
+    publishing a profiling website available at the address :
     <http://localhost:8080/debug/pprof/>
 -   A new `obiconsensus` command has been added. It is a prototype. It aims to
     build a consensus sequence from a set of reads. The consensus is estimated
     for all the sequences contained in the input file. If several input files,
     or a directory name are provided the result contains a consensus per file.
-    The id of the sequence is the name of the input file depleted of its
+    The *id* of the sequence is the name of the input file depleted of its
     directory name and of all its extensions.
--   In `obipcr` an experimental option **--fragmented** allows for spliting very
+-   In `obipcr` an experimental option **--fragmented** allows for splitting very
     long query sequences into shorter fragments with an overlap between the two
     contiguous fragment insuring that no amplicons are missed despite the split.
     As a site effect some amplicon can be identified twice.
@@ -534,7 +625,7 @@ If you rely on you personnal GO install, please think to update.
 ### Enhancement
 
 -   *OBITools* are automatically processing all the sequences files contained in
-    a directory and its sub-directory\
+    a directory and its subdirectory\
     recursively if its name is provided as input. To process easily Genbank
     files, the corresponding filename extensions have been added. Today the
     following extensions are recognized as sequence files : `.fasta`, `.fastq`,
@@ -551,7 +642,7 @@ If you rely on you personnal GO install, please think to update.
     export OBICPUMAX=4
     ```
 
--   Adds a new option --out\|-o allowing to specify the name of an outpout file.
+-   Adds a new option --out\|-o allowing to specify the name of an output file.
 
     ``` bash
     obiconvert -o xyz.fasta xxx.fastq
@@ -573,10 +664,10 @@ If you rely on you personnal GO install, please think to update.
     matched files remain consistent when processed.
 
 -   Adding of the function `ifelse` to the expression language for computing
-    conditionnal values.
+    conditional values.
 
 -   Adding two function to the expression language related to sequence
-    conposition : `composition` and `gcskew`. Both are taking a sequence as
+    composition : `composition` and `gcskew`. Both are taking a sequence as
     single argument.
 
 ## February 18th, 2023. Release 4.0.0
@@ -584,8 +675,8 @@ If you rely on you personnal GO install, please think to update.
 It is the first version of the *OBITools* version 4. I decided to tag then
 following two weeks of intensive data analysis with them allowing to discover
 many small bugs present in the previous non-official version. Obviously other
-bugs are certainly persent in the code, and you are welcome to use the git
-ticket system to mention them. But they seems to produce now reliable results.
+bugs are certainly present in the code, and you are welcome to use the git
+ticket system to mention them. But they seem to produce now reliable results.
 
 ### Corrected bugs
 
@@ -593,11 +684,11 @@ ticket system to mention them. But they seems to produce now reliable results.
     of sequences and to the production of incorrect file because of the last
     sequence record, sometime truncated in its middle. This was only occurring
     when more than a single CPU was used. It was affecting every obitools.
--   The `obiparing` software had a bug in the right aligment procedure. This led
-    to the non alignment of very sort barcode during the paring of the forward
+-   The `obiparing` software had a bug in the right alignment procedure. This led
+    to the non-alignment of very sort barcode during the paring of the forward
     and reverse reads.
--   The `obipairing` tools had a non deterministic comportment when aligning a
-    paor very low quality reads. This induced that the result of the same low
+-   The `obipairing` tools had a non-deterministic comportment when aligning a
+    pair very low quality reads. This induced that the result of the same low
     quality read pair was not the same from run to run.
 
 ### New features
@@ -605,11 +696,10 @@ ticket system to mention them. But they seems to produce now reliable results.
 -   Adding of a `--compress|-Z` option to every obitools allowing to produce
     `gz` compressed output. OBITools were already able to deal with gziped input
     files transparently. They can now produce their results in the same format.
-    - Adding of a `--append|-A` option to the `obidistribute` tool. It allows to
-    append the result of an `obidistribute` execution to preexisting files. -
+    - Adding of a `--append|-A` option to the `obidistribute` tool. It allows appending the result of an `obidistribute` execution to preexisting files. -
     Adding of a `--directory|-d` option to the `obidistribute` tool. It allows
-    to declare a secondary classification key over the one defined by the
-    '--category\|-c\` option. This extra key leads to produce directories in
+    declaring a secondary classification key over the one defined by the
+    `--category\|-c\` option. This extra key leads to produce directories in
     which files produced according to the primary criterion are stored.
 -   Adding of the functions `subspc`, `printf`, `int`, `numeric`, and `bool` to
     the expression language.

blackboard/Prospective/kmer_index_design.md

@@ -0,0 +1,213 @@
+# Index de k-mers pour génomes de grande taille
+
+## Contexte et objectifs
+
+### Cas d'usage
+
+- Indexation de k-mers longs (k=31) pour des génomes de grande taille (< 10 Go par génome)
+- Nombre de génomes : plusieurs dizaines à quelques centaines
+- Indexation en parallèle
+- Stockage sur disque
+- Possibilité d'ajouter des génomes, mais pas de modifier un génome existant
+
+### Requêtes cibles
+
+- **Présence/absence** d'un k-mer dans un génome
+- **Intersection** entre génomes
+- **Distances** : Jaccard (présence/absence) et potentiellement Bray-Curtis (comptage)
+
+### Ressources disponibles
+
+- 128 Go de RAM
+- Stockage disque
+
+---
+
+## Estimation des volumes
+
+### Par génome
+
+- **10 Go de séquence** → ~10¹⁰ k-mers bruts (chevauchants)
+- **Après déduplication** : typiquement 10-50% de k-mers uniques → **~1-5 × 10⁹ k-mers distincts**
+
+### Espace théorique
+
+- **k=31** → 62 bits → ~4.6 × 10¹⁸ k-mers possibles
+- Table d'indexation directe impossible
+
+---
+
+## Métriques de distance
+
+### Présence/absence (binaire)
+
+- **Jaccard** : |A ∩ B| / |A ∪ B|
+- **Sørensen-Dice** : 2|A ∩ B| / (|A| + |B|)
+
+### Comptage (abondance)
+
+- **Bray-Curtis** : 1 - (2 × Σ min(aᵢ, bᵢ)) / (Σ aᵢ + Σ bᵢ)
+
+Note : Pour Bray-Curtis, le stockage des comptages est nécessaire, ce qui augmente significativement la taille de l'index.
+
+---
+
+## Options d'indexation
+
+### Option 1 : Bloom Filter par génome
+
+**Principe** : Structure probabiliste pour test d'appartenance.
+
+**Avantages :**
+- Très compact : ~10 bits/élément pour FPR ~1%
+- Construction rapide, streaming
+- Facile à sérialiser/désérialiser
+- Intersection et Jaccard estimables via formules analytiques
+
+**Inconvénients :**
+- Faux positifs (pas de faux négatifs)
+- Distances approximatives
+
+**Taille estimée** : 1-6 Go par génome (selon FPR cible)
+
+#### Dimensionnement des Bloom filters
+
+```
+\mathrm{FPR} ;=; \left(1 - e^{-h n / m}\right)^h
+```
+
+
+| Bits/élément | FPR optimal | k (hash functions) |
+|--------------|-------------|---------------------|
+| 8            | ~2%         | 5-6                 |
+| 10           | ~1%         | 7                   |
+| 12           | ~0.3%       | 8                   |
+| 16           | ~0.01%      | 11                  |
+
+Formule du taux de faux positifs :
+```
+FPR ≈ (1 - e^(-kn/m))^k
+```
+Où n = nombre d'éléments, m = nombre de bits, k = nombre de hash functions.
+
+### Option 2 : Ensemble trié de k-mers
+
+**Principe** : Stocker les k-mers (uint64) triés, avec compression possible.
+
+**Avantages :**
+- Exact (pas de faux positifs)
+- Intersection/union par merge sort O(n+m)
+- Compression efficace (delta encoding sur k-mers triés)
+
+**Inconvénients :**
+- Plus volumineux : 8 octets/k-mer
+- Construction plus lente (tri nécessaire)
+
+**Taille estimée** : 8-40 Go par génome (non compressé)
+
+### Option 3 : MPHF (Minimal Perfect Hash Function)
+
+**Principe** : Fonction de hash parfaite minimale pour les k-mers présents.
+
+**Avantages :**
+- Très compact : ~3-4 bits/élément
+- Lookup O(1)
+- Exact pour les k-mers présents
+
+**Inconvénients :**
+- Construction coûteuse (plusieurs passes)
+- Statique (pas d'ajout de k-mers après construction)
+- Ne distingue pas "absent" vs "jamais vu" sans structure auxiliaire
+
+### Option 4 : Hybride MPHF + Bloom filter
+
+- MPHF pour mapping compact des k-mers présents
+- Bloom filter pour pré-filtrage des absents
+
+---
+
+## Optimisation : Indexation de (k-2)-mers pour requêtes k-mers
+
+### Principe
+
+Au lieu d'indexer directement les 31-mers dans un Bloom filter, on indexe les 29-mers. Pour tester la présence d'un 31-mer, on vérifie que les **trois 29-mers** qu'il contient sont présents :
+
+- positions 0-28
+- positions 1-29
+- positions 2-30
+
+### Analyse probabiliste
+
+Si le Bloom filter a un FPR de p pour un 29-mer individuel, le FPR effectif pour un 31-mer devient **p³** (les trois requêtes doivent toutes être des faux positifs).
+
+| FPR 29-mer | FPR 31-mer effectif |
+|------------|---------------------|
+| 10%        | 0.1%                |
+| 5%         | 0.0125%             |
+| 1%         | 0.0001%             |
+
+### Avantages
+
+1. **Moins d'éléments à stocker** : il y a moins de 29-mers distincts que de 31-mers distincts dans un génome (deux 31-mers différents peuvent partager un même 29-mer)
+
+2. **FPR drastiquement réduit** : FPR³ avec seulement 3 requêtes
+
+3. **Index plus compact** : on peut utiliser moins de bits par élément (FPR plus élevé acceptable sur le 29-mer) tout en obtenant un FPR très bas sur le 31-mer
+
+### Trade-off
+
+Un Bloom filter à **5-6 bits/élément** pour les 29-mers donnerait un FPR effectif < 0.01% pour les 31-mers, soit environ **2× plus compact** que l'approche directe à qualité égale.
+
+**Coût** : 3× plus de requêtes par lookup (mais les requêtes Bloom sont très rapides).
+
+---
+
+## Accélération des calculs de distance : MinHash
+
+### Principe
+
+Pré-calculer une "signature" compacte (sketch) de chaque génome permettant d'estimer rapidement Jaccard sans charger les index complets.
+
+### Avantages
+
+- Matrice de distances entre 100+ génomes en quelques secondes
+- Signature de taille fixe (ex: 1000-10000 hash values) quel que soit le génome
+- Stockage minimal
+
+### Utilisation
+
+1. Construction : une passe sur les k-mers de chaque génome
+2. Distance : comparaison des sketches en O(taille du sketch)
+
+---
+
+## Architecture recommandée
+
+### Pour présence/absence + Jaccard
+
+1. **Index principal** : Bloom filter de (k-2)-mers avec l'optimisation décrite
+   - Compact (~3-5 Go par génome)
+   - FPR très bas pour les k-mers grâce aux requêtes triples
+
+2. **Sketches MinHash** : pour calcul rapide des distances entre génomes
+   - Quelques Ko par génome
+   - Permet exploration rapide de la matrice de distances
+
+### Pour comptage + Bray-Curtis
+
+1. **Index principal** : k-mers triés + comptages
+   - uint64 (k-mer) + uint8/uint16 (count)
+   - Compression delta possible
+   - Plus volumineux mais exact
+
+2. **Sketches** : variantes de MinHash pour données pondérées (ex: HyperMinHash)
+
+---
+
+## Prochaines étapes
+
+1. Implémenter un Bloom filter optimisé pour k-mers
+2. Implémenter l'optimisation (k-2)-mer → k-mer
+3. Implémenter MinHash pour les sketches
+4. Définir le format de sérialisation sur disque
+5. Benchmarker sur des génomes réels

cmd/obitools/obiannotate/main.go

@@ -30,7 +30,11 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obiannotate.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obiannotate",
+		"edits the sequence annotations",
+		obiannotate.OptionSet,
+	)
 
 	_, args := optionParser(os.Args)
 
@@ -38,6 +42,11 @@ func main() {
 	obiconvert.OpenSequenceDataErrorMessage(args, err)
 
 	annotator := obiannotate.CLIAnnotationPipeline()
+
+	if obiannotate.CLIHasSetNumberFlag() {
+		sequences = sequences.NumberSequences(1, !obiconvert.CLINoInputOrder())
+	}
+
 	obiconvert.CLIWriteBioSequences(sequences.Pipe(annotator), true)
 
 	obiutils.WaitForLastPipe()

cmd/obitools/obiclean/main.go

@@ -11,7 +11,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obiclean.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obiclean",
+		"",
+		obiclean.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obicleandb/main.go

@@ -14,7 +14,10 @@ import (
 func main() {
 	obidefault.SetBatchSize(10)
 
-	optionParser := obioptions.GenerateOptionParser(obicleandb.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obicleandb",
+		"clean-up reference databases",
+		obicleandb.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obicomplement/main.go

@@ -11,7 +11,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obiconvert.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obicomplement",
+		"reverse complement of sequences",
+		obiconvert.OptionSet(true))
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obiconsensus/main.go

@@ -11,7 +11,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obiconsensus.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obiconsensus",
+		"ONT reads denoising",
+		obiconsensus.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obiconvert/main.go

@@ -14,7 +14,10 @@ func main() {
 	obidefault.SetStrictReadWorker(2)
 	obidefault.SetStrictWriteWorker(2)
 
-	optionParser := obioptions.GenerateOptionParser(obiconvert.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obiconvert",
+		"convertion of sequence files to various formats",
+		obiconvert.OptionSet(true))
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obicount/main.go

@@ -28,6 +28,8 @@ func main() {
 	// defer trace.Stop()
 
 	optionParser := obioptions.GenerateOptionParser(
+		"obicount",
+		"counts the sequences present in a file of sequences",
 		obiconvert.InputOptionSet,
 		obicount.OptionSet,
 	)

cmd/obitools/obicsv/main.go

@@ -10,7 +10,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obicsv.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obicsv",
+		"converts sequence files to CSV format",
+		obicsv.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obidemerge/main.go

@@ -15,7 +15,10 @@ func main() {
 	obidefault.SetStrictReadWorker(2)
 	obidefault.SetStrictWriteWorker(2)
 
-	optionParser := obioptions.GenerateOptionParser(obidemerge.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obidemerge",
+		"",
+		obidemerge.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obidistribute/main.go

@@ -11,7 +11,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obidistribute.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obidistribute",
+		"divided an input set of sequences into subsets",
+		obidistribute.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obigrep/main.go

@@ -30,7 +30,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obigrep.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obigrep",
+		"select a subset of sequences on various criteria",
+		obigrep.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obijoin/main.go

@@ -15,7 +15,10 @@ func main() {
 	obidefault.SetStrictReadWorker(2)
 	obidefault.SetStrictWriteWorker(2)
 
-	optionParser := obioptions.GenerateOptionParser(obijoin.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obijoin",
+		"merge annotations contained in a file to another file",
+		obijoin.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obikmermatch/main.go

@@ -31,7 +31,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obikmersim.MatchOptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obikmermatch",
+		"",
+		obikmersim.MatchOptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obikmersimcount/main.go

@@ -32,7 +32,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obikmersim.CountOptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obikmersimcount",
+		"",
+		obikmersim.CountOptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obilandmark/main.go

@@ -11,7 +11,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obilandmark.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obilandmark",
+		"",
+		obilandmark.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obilowmask/main.go

@@ -0,0 +1,47 @@
+package main
+
+import (
+	"os"
+
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obilowmask"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
+)
+
+func main() {
+
+	defer obiseq.LogBioSeqStatus()
+
+	// go tool pprof -http=":8000" ./obipairing ./cpu.pprof
+	// f, err := os.Create("cpu.pprof")
+	// if err != nil {
+	// 	log.Fatal(err)
+	// }
+	// pprof.StartCPUProfile(f)
+	// defer pprof.StopCPUProfile()
+
+	// go tool trace cpu.trace
+	// ftrace, err := os.Create("cpu.trace")
+	// if err != nil {
+	// 	log.Fatal(err)
+	// }
+	// trace.Start(ftrace)
+	// defer trace.Stop()
+
+	optionParser := obioptions.GenerateOptionParser(
+		"obimicrosat",
+		"looks for microsatellites sequences in a sequence file",
+		obilowmask.OptionSet)
+
+	_, args := optionParser(os.Args)
+
+	sequences, err := obiconvert.CLIReadBioSequences(args...)
+	obiconvert.OpenSequenceDataErrorMessage(args, err)
+
+	selected := obilowmask.CLISequenceEntropyMasker(sequences)
+	obiconvert.CLIWriteBioSequences(selected, true)
+	obiutils.WaitForLastPipe()
+
+}

cmd/obitools/obimatrix/main.go

@@ -31,6 +31,8 @@ func main() {
 	// defer trace.Stop()
 
 	optionParser := obioptions.GenerateOptionParser(
+		"obimatrix",
+		"",
 		obimatrix.OptionSet,
 	)
 

cmd/obitools/obimicrosat/main.go

@@ -30,7 +30,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obimicrosat.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obimicrosat",
+		"looks for microsatellites sequences in a sequence file",
+		obimicrosat.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obimultiplex/main.go

@@ -28,7 +28,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obimultiplex.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obimultiplex",
+		"demultiplex amplicons",
+		obimultiplex.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obipairing/main.go

@@ -30,7 +30,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obipairing.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obipairing",
+		"align forward with reverse reads with paired reads",
+		obipairing.OptionSet)
 
 	optionParser(os.Args)
 

cmd/obitools/obipcr/main.go

@@ -29,7 +29,10 @@ func main() {
 	obidefault.SetParallelFilesRead(obidefault.ParallelWorkers() / 4)
 	obidefault.SetBatchSize(10)
 
-	optionParser := obioptions.GenerateOptionParser(obipcr.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obipcr",
+		"simulates a PCR on a sequence files",
+		obipcr.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obireffamidx/main.go

@@ -11,7 +11,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obirefidx.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obireffamidx",
+		"",
+		obirefidx.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obirefidx/main.go

@@ -11,7 +11,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obirefidx.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obirefidx",
+		"",
+		obirefidx.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obiscript/main.go

@@ -31,7 +31,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obiscript.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obiscript",
+		"executes a lua script on the input sequences",
+		obiscript.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obisplit/main.go

@@ -31,7 +31,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obisplit.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obisplit",
+		"",
+		obisplit.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obisummary/main.go

@@ -33,7 +33,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obisummary.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obisummary",
+		"resume main information from a sequence file",
+		obisummary.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obitag/main.go

@@ -11,6 +11,7 @@ import (
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitag"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitaxonomy"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
 
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
@@ -39,7 +40,10 @@ func main() {
 	obidefault.SetStrictWriteWorker(1)
 	obidefault.SetBatchSize(10)
 
-	optionParser := obioptions.GenerateOptionParser(obitag.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obitag",
+		"realizes taxonomic assignment",
+		obitag.OptionSet)
 
 	_, args := optionParser(os.Args)
 
@@ -55,7 +59,7 @@ func main() {
 	}
 
 	if taxo == nil {
-		taxo, err = references.ExtractTaxonomy(nil)
+		taxo, err = references.ExtractTaxonomy(nil, obitaxonomy.CLINewickWithLeaves())
 
 		if err != nil {
 			log.Fatalf("No taxonomy specified or extractable from reference database: %v", err)
@@ -70,10 +74,12 @@ func main() {
 
 	var identified obiiter.IBioSequence
 
+	fsrb := fs.Rebatch(obidefault.BatchSize())
+
 	if obitag.CLIGeometricMode() {
-		identified = obitag.CLIGeomAssignTaxonomy(fs, references, taxo)
+		identified = obitag.CLIGeomAssignTaxonomy(fsrb, references, taxo)
 	} else {
-		identified = obitag.CLIAssignTaxonomy(fs, references, taxo)
+		identified = obitag.CLIAssignTaxonomy(fsrb, references, taxo)
 	}
 
 	obiconvert.CLIWriteBioSequences(identified, true)

cmd/obitools/obitagpcr/main.go

@@ -33,7 +33,10 @@ func main() {
 
 	obidefault.SetWorkerPerCore(1)
 
-	optionParser := obioptions.GenerateOptionParser(obitagpcr.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obitagpcr",
+		"split a paired raw read data set per sample",
+		obitagpcr.OptionSet)
 
 	optionParser(os.Args)
 	pairs, err := obipairing.CLIPairedSequence()

cmd/obitools/obitaxonomy/main.go

@@ -4,9 +4,11 @@ import (
 	"os"
 
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiitercsv"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obicsv"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitaxonomy"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
 
@@ -14,30 +16,59 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obitaxonomy.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obitaxonomy",
+		"manipulates and queries taxonomy",
+		obitaxonomy.OptionSet)
 
 	_, args := optionParser(os.Args)
 
 	var iterator *obitax.ITaxon
 
-	switch {
-	case obitaxonomy.CLIDownloadNCBI():
+	if obitaxonomy.CLIDownloadNCBI() {
 		err := obitaxonomy.CLIDownloadNCBITaxdump()
 		if err != nil {
 			log.Errorf("Cannot download NCBI taxonomy: %s", err.Error())
 			os.Exit(1)
 		}
+		os.Exit(0)
+	}
 
+	if !obidefault.HasSelectedTaxonomy() {
+		log.Fatal("you must indicate a taxonomy using the -t or --taxonomy option")
+	}
+
+	switch {
+	case obitaxonomy.CLIAskForRankList():
+		newIter := obiitercsv.NewICSVRecord()
+		newIter.Add(1)
+		newIter.AppendField("rank")
+		go func() {
+			ranks := obitax.DefaultTaxonomy().RankList()
+			data := make([]obiitercsv.CSVRecord, len(ranks))
+
+			for i, rank := range ranks {
+				record := make(obiitercsv.CSVRecord)
+				record["rank"] = rank
+				data[i] = record
+			}
+			newIter.Push(obiitercsv.MakeCSVRecordBatch(obitax.DefaultTaxonomy().Name(), 0, data))
+			newIter.Close()
+			newIter.Done()
+		}()
+		obicsv.CLICSVWriter(newIter, true)
+		obiutils.WaitForLastPipe()
 		os.Exit(0)
 
 	case obitaxonomy.CLIExtractTaxonomy():
 		iter, err := obiconvert.CLIReadBioSequences(args...)
+		iter = iter.NumberSequences(1, true)
 
 		if err != nil {
 			log.Fatalf("Cannot extract taxonomy: %v", err)
 		}
 
-		taxonomy, err := iter.ExtractTaxonomy()
+		taxonomy, err := iter.ExtractTaxonomy(obitaxonomy.CLINewickWithLeaves())
 
 		if err != nil {
 			log.Fatalf("Cannot extract taxonomy: %v", err)
@@ -99,7 +130,12 @@ func main() {
 	}
 
 	iterator = obitaxonomy.CLITaxonRestrictions(iterator)
-	obitaxonomy.CLICSVTaxaWriter(iterator, true)
+
+	if obitaxonomy.CLIAsNewick() {
+		obitaxonomy.CLINewickWriter(iterator, true)
+	} else {
+		obitaxonomy.CLICSVTaxaWriter(iterator, true)
+	}
 
 	obiutils.WaitForLastPipe()
 

cmd/obitools/obiuniq/main.go

@@ -33,7 +33,10 @@ func main() {
 
 	obidefault.SetBatchSize(10)
 	obidefault.SetReadQualities(false)
-	optionParser := obioptions.GenerateOptionParser(obiuniq.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obiuniq",
+		"dereplicate sequence data sets",
+		obiuniq.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/test/main.go

@@ -3,13 +3,13 @@ package main
 import (
 	"os"
 
-	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
 )
 
 func main() {
 
-	obitax.DetectTaxonomyFormat(os.Args[1])
+	obiformats.DetectTaxonomyFormat(os.Args[1])
 	println(obiutils.RemoveAllExt("toto/tutu/test.txt"))
 	println(obiutils.Basename("toto/tutu/test.txt"))
 

git-hooks/pre-push

@@ -0,0 +1,23 @@
+#!/bin/bash
+
+remote="$1"
+#url="$2"
+
+log() {
+    echo -e "[Pre-Push tests @ $(date)] $*" 1>&2
+}
+
+current_branch=$(git symbolic-ref --short head)
+
+cmd="make githubtests"
+
+if [[ $current_branch = "master" ]]; then
+    log "you are on $current_branch, running build test"
+    if ! eval "$cmd"; then
+        log "Pre-push tests failed $cmd" 
+        exit 1
+    fi
+fi
+
+log "Tests are OK, ready to push on $remote"
+exit 0

go.mod

@@ -1,11 +1,14 @@
 module git.metabarcoding.org/obitools/obitools4/obitools4
 
-go 1.23.1
+go 1.23.4
+
+toolchain go1.24.2
 
 require (
 	github.com/DavidGamba/go-getoptions v0.28.0
 	github.com/PaesslerAG/gval v1.2.2
 	github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df
+	github.com/buger/jsonparser v1.1.1
 	github.com/chen3feng/stl4go v0.1.1
 	github.com/dlclark/regexp2 v1.11.4
 	github.com/goccy/go-json v0.10.3
@@ -17,23 +20,23 @@ require (
 	github.com/stretchr/testify v1.8.4
 	github.com/tevino/abool/v2 v2.1.0
 	github.com/yuin/gopher-lua v1.1.1
-	golang.org/x/exp v0.0.0-20231006140011-7918f672742d
+	golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa
 	gonum.org/v1/gonum v0.14.0
 	gopkg.in/yaml.v3 v3.0.1
 	scientificgo.org/special v0.0.0
 )
 
 require (
-	github.com/Clever/csvlint v0.3.0 // indirect
-	github.com/TuftsBCB/io v0.0.0-20140121014543-22b94e9b23f9 // indirect
-	github.com/buger/jsonparser v1.1.1 // indirect
-	github.com/chzyer/readline v0.0.0-20180603132655-2972be24d48e // indirect
+	github.com/RoaringBitmap/roaring v1.9.4 // indirect
+	github.com/bits-and-blooms/bitset v1.12.0 // indirect
 	github.com/davecgh/go-spew v1.1.1 // indirect
 	github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 // indirect
-	github.com/kr/pretty v0.3.0 // indirect
+	github.com/kr/pretty v0.3.1 // indirect
 	github.com/kr/text v0.2.0 // indirect
+	github.com/mschoch/smat v0.2.0 // indirect
+	github.com/pelletier/go-toml/v2 v2.2.4 // indirect
 	github.com/pmezard/go-difflib v1.0.0 // indirect
-	github.com/rogpeppe/go-internal v1.6.1 // indirect
+	github.com/rogpeppe/go-internal v1.12.0 // indirect
 )
 
 require (
@@ -46,8 +49,8 @@ require (
 	github.com/rivo/uniseg v0.4.4 // indirect
 	github.com/shopspring/decimal v1.3.1 // indirect
 	github.com/ulikunitz/xz v0.5.11
-	golang.org/x/net v0.17.0 // indirect
-	golang.org/x/sys v0.17.0 // indirect
-	golang.org/x/term v0.13.0 // indirect
+	golang.org/x/net v0.35.0 // indirect
+	golang.org/x/sys v0.30.0 // indirect
+	golang.org/x/term v0.29.0 // indirect
 	gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c
 )

go.sum

@@ -1,21 +1,19 @@
-github.com/Clever/csvlint v0.3.0 h1:58WEFXWy+i0fCbxTXscR2QwYESRuAUFjEGLgZs6j2iU=
-github.com/Clever/csvlint v0.3.0/go.mod h1:+wLRuW/bI8NhpRoeyUBxqKsK35OhvgJhXHSWdKp5XJU=
 github.com/DavidGamba/go-getoptions v0.28.0 h1:18wgEvfZdrlfIhVDGEBO3Dl0fkOyXqXLa0tLMCKxM1c=
 github.com/DavidGamba/go-getoptions v0.28.0/go.mod h1:zE97E3PR9P3BI/HKyNYgdMlYxodcuiC6W68KIgeYT84=
 github.com/PaesslerAG/gval v1.2.2 h1:Y7iBzhgE09IGTt5QgGQ2IdaYYYOU134YGHBThD+wm9E=
 github.com/PaesslerAG/gval v1.2.2/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
 github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
 github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
-github.com/TuftsBCB/io v0.0.0-20140121014543-22b94e9b23f9 h1:Zc1/GNsUpgZR9qm1EmRSKrnOHA7CCd0bIzGdq0cREN0=
-github.com/TuftsBCB/io v0.0.0-20140121014543-22b94e9b23f9/go.mod h1:PZyV4WA3NpqtezSY0h6E6NARAmdDm0qwrydveOyR5Gc=
+github.com/RoaringBitmap/roaring v1.9.4 h1:yhEIoH4YezLYT04s1nHehNO64EKFTop/wBhxv2QzDdQ=
+github.com/RoaringBitmap/roaring v1.9.4/go.mod h1:6AXUsoIEzDTFFQCe1RbGA6uFONMhvejWj5rqITANK90=
 github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
 github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
+github.com/bits-and-blooms/bitset v1.12.0 h1:U/q1fAF7xXRhFCrhROzIfffYnu+dlS38vCZtmFVPHmA=
+github.com/bits-and-blooms/bitset v1.12.0/go.mod h1:7hO7Gc7Pp1vODcmWvKMRA9BNmbv6a/7QIWpPxHddWR8=
 github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
 github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
 github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
 github.com/chen3feng/stl4go v0.1.1/go.mod h1:5ml3psLgETJjRJnMbPE+JiHLrCpt+Ajc2weeTECXzWU=
-github.com/chzyer/readline v0.0.0-20180603132655-2972be24d48e h1:fY5BOSpyZCqRo5OhCuC+XN+r/bBCmeuuJtjz+bCNIf8=
-github.com/chzyer/readline v0.0.0-20180603132655-2972be24d48e/go.mod h1:nSuG5e5PlCu98SY8svDHJxuZscDgtXS6KTTbou5AhLI=
 github.com/creack/pty v1.1.9/go.mod h1:oKZEueFk5CKHvIhNR5MUki03XCEU+Q6VDXinZuGJ33E=
 github.com/davecgh/go-spew v1.1.0/go.mod h1:J7Y8YcW2NihsgmVo/mv3lAwl/skON4iLHjSsI+c5H38=
 github.com/davecgh/go-spew v1.1.1 h1:vj9j/u1bqnvCEfJOwUhtlOARqs3+rkHYY13jYWTU97c=
@@ -40,10 +38,9 @@ github.com/klauspost/compress v1.17.2/go.mod h1:ntbaceVETuRiXiv4DpjP66DpAtAGkEQs
 github.com/klauspost/cpuid v1.2.0/go.mod h1:Pj4uuM528wm8OyEC2QMXAi2YiTZ96dNQPGgoMS4s3ek=
 github.com/klauspost/pgzip v1.2.6 h1:8RXeL5crjEUFnR2/Sn6GJNWtSQ3Dk8pq4CL3jvdDyjU=
 github.com/klauspost/pgzip v1.2.6/go.mod h1:Ch1tH69qFZu15pkjo5kYi6mth2Zzwzt50oCQKQE9RUs=
-github.com/kr/pretty v0.1.0/go.mod h1:dAy3ld7l9f0ibDNOQOHHMYYIIbhfbHSm3C4ZsoJORNo=
 github.com/kr/pretty v0.2.1/go.mod h1:ipq/a2n7PKx3OHsz4KJII5eveXtPO4qwEXGdVfWzfnI=
-github.com/kr/pretty v0.3.0 h1:WgNl7dwNpEZ6jJ9k1snq4pZsg7DOEN8hP9Xw0Tsjwk0=
-github.com/kr/pretty v0.3.0/go.mod h1:640gp4NfQd8pI5XOwp5fnNeVWj67G7CFk/SaSQn7NBk=
+github.com/kr/pretty v0.3.1 h1:flRD4NNwYAUpkphVc1HcthR4KEIFJ65n8Mw5qdRn3LE=
+github.com/kr/pretty v0.3.1/go.mod h1:hoEshYVHaxMs3cyo3Yncou5ZscifuDolrwPKZanG3xk=
 github.com/kr/pty v1.1.1/go.mod h1:pFQYn66WHrOpPYNljwOMqo10TkYh1fy3cYio2l3bCsQ=
 github.com/kr/text v0.1.0/go.mod h1:4Jbv+DJW3UT/LiOwJeYQe1efqtUx/iVham/4vfdArNI=
 github.com/kr/text v0.2.0 h1:5Nx0Ya0ZqY2ygV366QzturHI13Jq95ApcVaJBhpS+AY=
@@ -54,15 +51,21 @@ github.com/mattn/go-runewidth v0.0.15 h1:UNAjwbU9l54TA3KzvqLGxwWjHmMgBUVhBiTjelZ
 github.com/mattn/go-runewidth v0.0.15/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
 github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2EmQ4l5rM/4FEfDWcRD+abF5XlKShorW5LRoQ=
 github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
+github.com/mschoch/smat v0.2.0 h1:8imxQsjDm8yFEAVBe7azKmKSgzSkZXDuKkSq9374khM=
+github.com/mschoch/smat v0.2.0/go.mod h1:kc9mz7DoBKqDyiRL7VZN8KvXQMWeTaVnttLRXOlotKw=
 github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
 github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58/go.mod h1:DXv8WO4yhMYhSNPKjeNKa5WY9YCIEBRbNzFFPJbWO6Y=
+github.com/pelletier/go-toml/v2 v2.2.4 h1:mye9XuhQ6gvn5h28+VilKrrPoQVanw5PMw/TB0t5Ec4=
+github.com/pelletier/go-toml/v2 v2.2.4/go.mod h1:2gIqNv+qfxSVS7cM2xJQKtLSTLUE9V8t9Stt+h56mCY=
+github.com/pkg/diff v0.0.0-20210226163009-20ebb0f2a09e/go.mod h1:pJLUxLENpZxwdsKMEsNbx1VGcRFpLqf3715MtcvvzbA=
 github.com/pmezard/go-difflib v1.0.0 h1:4DBwDE0NGyQoBHbLQYPwSUPoCMWR5BEzIk/f1lZbAQM=
 github.com/pmezard/go-difflib v1.0.0/go.mod h1:iKH77koFhYxTK1pcRnkKkqfTogsbg7gZNVY4sRDYZ/4=
 github.com/rivo/uniseg v0.2.0/go.mod h1:J6wj4VEh+S6ZtnVlnTBMWIodfgj8LQOQFoIToxlJtxc=
 github.com/rivo/uniseg v0.4.4 h1:8TfxU8dW6PdqD27gjM8MVNuicgxIjxpm4K7x4jp8sis=
 github.com/rivo/uniseg v0.4.4/go.mod h1:FN3SvrM+Zdj16jyLfmOkMNblXMcoc8DfTHruCPUcx88=
-github.com/rogpeppe/go-internal v1.6.1 h1:/FiVV8dS/e+YqF2JvO3yXRFbBLTIuSDkuC7aBOAvL+k=
-github.com/rogpeppe/go-internal v1.6.1/go.mod h1:xXDCJY+GAPziupqXw64V24skbSoqbTEfhy4qGm1nDQc=
+github.com/rogpeppe/go-internal v1.9.0/go.mod h1:WtVeX8xhTBvf0smdhujwtBcq4Qrzq/fJaraNFVN+nFs=
+github.com/rogpeppe/go-internal v1.12.0 h1:exVL4IDcn6na9z1rAb56Vxr+CgyK3nn3O+epU5NdKM8=
+github.com/rogpeppe/go-internal v1.12.0/go.mod h1:E+RYuTGaKKdloAfM02xzb0FW3Paa99yedzYV+kq4uf4=
 github.com/rrethy/ahocorasick v1.0.0 h1:YKkCB+E5PXc0xmLfMrWbfNht8vG9Re97IHSWZk/Lk8E=
 github.com/rrethy/ahocorasick v1.0.0/go.mod h1:nq8oScE7Vy1rOppoQxpQiiDmPHuKCuk9rXrNcxUV3R0=
 github.com/schollz/progressbar/v3 v3.13.1 h1:o8rySDYiQ59Mwzy2FELeHY5ZARXZTVJC7iHD6PEFUiE=
@@ -73,7 +76,6 @@ github.com/sirupsen/logrus v1.9.3 h1:dueUQJ1C2q9oE3F7wvmSGAaVtTmUizReu6fjN8uqzbQ
 github.com/sirupsen/logrus v1.9.3/go.mod h1:naHLuLoDiP4jHNo9R0sCBMtWGeIprob74mVsIT4qYEQ=
 github.com/stretchr/objx v0.1.0/go.mod h1:HFkY916IF+rwdDfMAkV7OtwuqBVzrE8GR6GFx+wExME=
 github.com/stretchr/testify v1.3.0/go.mod h1:M5WIy9Dh21IEIfnGCwXGc5bZfKNJtfHm1UVUgZn+9EI=
-github.com/stretchr/testify v1.6.1/go.mod h1:6Fq8oRcR53rry900zMqJjRRixrwX3KX962/h/Wwjteg=
 github.com/stretchr/testify v1.7.0/go.mod h1:6Fq8oRcR53rry900zMqJjRRixrwX3KX962/h/Wwjteg=
 github.com/stretchr/testify v1.8.4 h1:CcVxjf3Q8PM0mHUKJCdn+eZZtm5yQwehR5yeSVQQcUk=
 github.com/stretchr/testify v1.8.4/go.mod h1:sz/lmYIOXD/1dqDmKjjqLyZ2RngseejIcXlSw2iwfAo=
@@ -84,25 +86,23 @@ github.com/ulikunitz/xz v0.5.11 h1:kpFauv27b6ynzBNT/Xy+1k+fK4WswhN/6PN5WhFAGw8=
 github.com/ulikunitz/xz v0.5.11/go.mod h1:nbz6k7qbPmH4IRqmfOplQw/tblSgqTqBwxkY0oWt/14=
 github.com/yuin/gopher-lua v1.1.1 h1:kYKnWBjvbNP4XLT3+bPEwAXJx262OhaHDWDVOPjL46M=
 github.com/yuin/gopher-lua v1.1.1/go.mod h1:GBR0iDaNXjAgGg9zfCvksxSRnQx76gclCIb7kdAd1Pw=
-golang.org/x/exp v0.0.0-20231006140011-7918f672742d h1:jtJma62tbqLibJ5sFQz8bKtEM8rJBtfilJ2qTU199MI=
-golang.org/x/exp v0.0.0-20231006140011-7918f672742d/go.mod h1:ldy0pHrwJyGW56pPQzzkH36rKxoZW1tw7ZJpeKx+hdo=
-golang.org/x/net v0.17.0 h1:pVaXccu2ozPjCXewfr1S7xza/zcXTity9cCdXQYSjIM=
-golang.org/x/net v0.17.0/go.mod h1:NxSsAGuq816PNPmqtQdLE42eU2Fs7NoRIZrHJAlaCOE=
+golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa h1:FRnLl4eNAQl8hwxVVC17teOw8kdjVDVAiFMtgUdTSRQ=
+golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa/go.mod h1:zk2irFbV9DP96SEBUUAy67IdHUaZuSnrz1n472HUCLE=
+golang.org/x/net v0.35.0 h1:T5GQRQb2y08kTAByq9L4/bz8cipCdA8FbRTXewonqY8=
+golang.org/x/net v0.35.0/go.mod h1:EglIi67kWsHKlRzzVMUD93VMSWGFOMSZgxFjparz1Qk=
 golang.org/x/sys v0.0.0-20220715151400-c0bba94af5f8/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
 golang.org/x/sys v0.0.0-20220811171246-fbc7d0a398ab/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
 golang.org/x/sys v0.6.0/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
-golang.org/x/sys v0.17.0 h1:25cE3gD+tdBA7lp7QfhuV+rJiE9YXTcS3VG1SqssI/Y=
-golang.org/x/sys v0.17.0/go.mod h1:/VUhepiaJMQUp4+oa/7Zr1D23ma6VTLIYjOOTFZPUcA=
+golang.org/x/sys v0.30.0 h1:QjkSwP/36a20jFYWkSue1YwXzLmsV5Gfq7Eiy72C1uc=
+golang.org/x/sys v0.30.0/go.mod h1:/VUhepiaJMQUp4+oa/7Zr1D23ma6VTLIYjOOTFZPUcA=
 golang.org/x/term v0.6.0/go.mod h1:m6U89DPEgQRMq3DNkDClhWw02AUbt2daBVO4cn4Hv9U=
-golang.org/x/term v0.13.0 h1:bb+I9cTfFazGW51MZqBVmZy7+JEJMouUHTUSKVQLBek=
-golang.org/x/term v0.13.0/go.mod h1:LTmsnFJwVN6bCy1rVCoS+qHT1HhALEFxKncY3WNNh4U=
+golang.org/x/term v0.29.0 h1:L6pJp37ocefwRRtYPKSWOWzOtWSxVajvz2ldH/xi3iU=
+golang.org/x/term v0.29.0/go.mod h1:6bl4lRlvVuDgSf3179VpIxBF0o10JUpXWOnI7nErv7s=
 gonum.org/v1/gonum v0.14.0 h1:2NiG67LD1tEH0D7kM+ps2V+fXmsAnpUeec7n8tcr4S0=
 gonum.org/v1/gonum v0.14.0/go.mod h1:AoWeoz0becf9QMWtE8iWXNXc27fK4fNeHNf/oMejGfU=
 gopkg.in/check.v1 v0.0.0-20161208181325-20d25e280405/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0=
-gopkg.in/check.v1 v1.0.0-20180628173108-788fd7840127/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0=
 gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c h1:Hei/4ADfdWqJk1ZMxUNpqntNwaWcugrBjAiHlqqRiVk=
 gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c/go.mod h1:JHkPIbrfpd72SG/EVd6muEfDQjcINNoR0C8j2r3qZ4Q=
-gopkg.in/errgo.v2 v2.1.0/go.mod h1:hNsd1EY+bozCKY1Ytp96fpM3vjJbqLJn88ws8XvfDNI=
 gopkg.in/yaml.v3 v3.0.0-20200313102051-9f266ea9e77c/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
 gopkg.in/yaml.v3 v3.0.1 h1:fxVm/GzAzEWqLHuvctI91KS9hhNmmWOoWu0XTYJS7CA=
 gopkg.in/yaml.v3 v3.0.1/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=

go.work

@@ -1,3 +1,5 @@
-go 1.23.1
+go 1.23.4
+
+toolchain go1.24.2
 
 use .

go.work.sum

@@ -2,7 +2,6 @@ git.sr.ht/~sbinet/gg v0.3.1 h1:LNhjNn8DerC8f9DHLz6lS0YYul/b602DUxDgGkd/Aik=
 git.sr.ht/~sbinet/gg v0.3.1/go.mod h1:KGYtlADtqsqANL9ueOFkWymvzUvLMQllU5Ixo+8v3pc=
 github.com/ajstarks/svgo v0.0.0-20211024235047-1546f124cd8b h1:slYM766cy2nI3BwyRiyQj/Ud48djTMtMebDqepE95rw=
 github.com/ajstarks/svgo v0.0.0-20211024235047-1546f124cd8b/go.mod h1:1KcenG0jGWcpt8ov532z81sp/kMMUG485J2InIOyADM=
-github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
 github.com/chzyer/logex v1.1.10 h1:Swpa1K6QvQznwJRcfTfQJmTE72DqScAa40E+fbHEXEE=
 github.com/chzyer/logex v1.1.10/go.mod h1:+Ywpsq7O8HXn0nuIou7OrIPyXbp3wmkHB+jjWRnGsAI=
 github.com/chzyer/logex v1.2.0 h1:+eqR0HfOetur4tgnC8ftU5imRnhi4te+BadWS95c5AM=
@@ -20,15 +19,20 @@ github.com/go-latex/latex v0.0.0-20230307184459-12ec69307ad9 h1:NxXI5pTAtpEaU49b
 github.com/go-latex/latex v0.0.0-20230307184459-12ec69307ad9/go.mod h1:gWuR/CrFDDeVRFQwHPvsv9soJVB/iqymhuZQuJ3a9OM=
 github.com/go-pdf/fpdf v0.6.0 h1:MlgtGIfsdMEEQJr2le6b/HNr1ZlQwxyWr77r2aj2U/8=
 github.com/go-pdf/fpdf v0.6.0/go.mod h1:HzcnA+A23uwogo0tp9yU+l3V+KXhiESpt1PMayhOh5M=
+github.com/go-quicktest/qt v1.101.0/go.mod h1:14Bz/f7NwaXPtdYEgzsx46kqSxVwTbzVZsDC26tQJow=
 github.com/goccmack/gocc v0.0.0-20230228185258-2292f9e40198 h1:FSii2UQeSLngl3jFoR4tUKZLprO7qUlh/TKKticc0BM=
 github.com/goccmack/gocc v0.0.0-20230228185258-2292f9e40198/go.mod h1:DTh/Y2+NbnOVVoypCCQrovMPDKUGp4yZpSbWg5D0XIM=
 github.com/golang/freetype v0.0.0-20170609003504-e2365dfdc4a0 h1:DACJavvAHhabrF08vX0COfcOBJRhZ8lUbR+ZWIs0Y5g=
 github.com/golang/freetype v0.0.0-20170609003504-e2365dfdc4a0/go.mod h1:E/TSTwGwJL78qG/PmXZO1EjYhfJinVAhrmmHX6Z8B9k=
+github.com/google/go-cmdtest v0.4.1-0.20220921163831-55ab3332a786/go.mod h1:apVn/GCasLZUVpAJ6oWAuyP7Ne7CEsQbTnc0plM3m+o=
 github.com/google/go-cmp v0.5.8 h1:e6P7q2lk1O+qJJb4BtCQXlK8vWEO8V1ZeuEdJNOqZyg=
 github.com/google/go-cmp v0.5.8/go.mod h1:17dUlkBOakJ0+DkrSSNjCkIjxS6bF9zb3elmeNGIjoY=
+github.com/google/renameio v0.1.0/go.mod h1:KWCgfxg9yswjAJkECMjeO8J8rahYeXnNhOm40UhjYkI=
+github.com/google/safehtml v0.1.0/go.mod h1:L4KWwDsUJdECRAEpZoBn3O64bQaywRscowZjJAzjHnU=
 github.com/hashicorp/errwrap v1.0.0/go.mod h1:YH+1FKiLXxHSkmPseP+kNlulaMuP3n2brvKWEqk/Jc4=
 github.com/hashicorp/go-multierror v1.1.1/go.mod h1:iw975J/qwKPdAO1clOe2L8331t/9/fmwbPZ6JB6eMoM=
 github.com/ianlancetaylor/demangle v0.0.0-20220319035150-800ac71e25c2 h1:rcanfLhLDA8nozr/K289V1zcntHr3V+SHlXwzz1ZI2g=
+github.com/jba/templatecheck v0.7.1/go.mod h1:n1Etw+Rrw1mDDD8dDRsEKTwMZsJ98EkktgNJC6wLUGo=
 github.com/k0kubun/go-ansi v0.0.0-20180517002512-3bf9e2903213 h1:qGQQKEcAR99REcMpsXCp3lJ03zYT1PkRd3kQGPn9GVg=
 github.com/klauspost/cpuid v1.2.0 h1:NMpwD2G9JSFOE1/TJjGSo5zG7Yb2bTe7eq1jH+irmeE=
 github.com/kr/pty v1.1.1 h1:VkoXIwSboBpnk99O/KFauAEILuNHv5DVFKZMBN/gUgw=
@@ -39,17 +43,22 @@ github.com/stretchr/objx v0.1.0 h1:4G4v2dO3VZwixGIRoQ5Lfboy6nUhCyYzaqnIAPPhYs4=
 github.com/stretchr/objx v0.5.0 h1:1zr/of2m5FGMsad5YfcqgdqdWrIhu+EBEJRhR1U7z/c=
 github.com/stretchr/objx v0.5.0/go.mod h1:Yh+to48EsGEfYuaHDzXPcE3xhTkx73EhmCGUpEOglKo=
 github.com/yuin/goldmark v1.4.13 h1:fVcFKWvrslecOb/tg+Cc05dkeYx540o0FuFt3nUVDoE=
+github.com/yuin/goldmark v1.4.13/go.mod h1:6yULJ656Px+3vBD8DxQVa3kxgyrAnzto9xy5taEt/CY=
 golang.org/x/crypto v0.14.0 h1:wBqGXzWJW6m1XrIKlAH0Hs1JJ7+9KBwnIO8v66Q9cHc=
 golang.org/x/crypto v0.14.0/go.mod h1:MVFd36DqK4CsrnJYDkBA3VC4m2GkXAM0PvzMCn4JQf4=
+golang.org/x/crypto v0.33.0/go.mod h1:bVdXmD7IV/4GdElGPozy6U7lWdRXA4qyRVGJV57uQ5M=
 golang.org/x/image v0.6.0 h1:bR8b5okrPI3g/gyZakLZHeWxAR8Dn5CyxXv1hLH5g/4=
 golang.org/x/image v0.6.0/go.mod h1:MXLdDR43H7cDJq5GEGXEVeeNhPgi+YYEQ2pC1byI1x0=
 golang.org/x/mod v0.13.0 h1:I/DsJXRlw/8l/0c24sM9yb0T4z9liZTduXvdAWYiysY=
 golang.org/x/mod v0.13.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
+golang.org/x/mod v0.14.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
 golang.org/x/sync v0.0.0-20220722155255-886fb9371eb4 h1:uVc8UZUe6tr40fFVnUP5Oj+veunVezqYl9z7DYw9xzw=
 golang.org/x/text v0.13.0 h1:ablQoSUd0tRdKxZewP80B+BaqeKJuVhuRxj/dkrun3k=
 golang.org/x/text v0.13.0/go.mod h1:TvPlkZtksWOMsz7fbANvkp4WM8x/WCo/om8BMLbz+aE=
+golang.org/x/text v0.22.0/go.mod h1:YRoo4H8PVmsu+E3Ou7cqLVH8oXWIHVoX0jqUWALQhfY=
 golang.org/x/tools v0.14.0 h1:jvNa2pY0M4r62jkRQ6RwEZZyPcymeL9XZMLBbV7U2nc=
 golang.org/x/tools v0.14.0/go.mod h1:uYBEerGOWcJyEORxN+Ek8+TT266gXkNlHdJBwexUsBg=
+golang.org/x/tools v0.15.0/go.mod h1:hpksKq4dtpQWS1uQ61JkdqWM3LscIS6Slf+VVkm+wQk=
 golang.org/x/xerrors v0.0.0-20190717185122-a985d3407aa7 h1:9zdDQZ7Thm29KFXgAX/+yaf3eVbP7djjWp/dXAppNCc=
 gonum.org/v1/plot v0.10.1 h1:dnifSs43YJuNMDzB7v8wV64O4ABBHReuAVAoBxqBqS4=
 gonum.org/v1/plot v0.10.1/go.mod h1:VZW5OlhkL1mysU9vaqNHnsy86inf6Ot+jB3r+BczCEo=

install_obitools.sh

@@ -59,6 +59,11 @@ if [[ ! "$WORK_DIR" || ! -d "$WORK_DIR" ]]; then
   exit 1
 fi
 
+mkdir -p "${WORK_DIR}/cache" \
+  || (echo "Cannot create ${WORK_DIR}/cache directory" 1>&2  
+      exit 1)
+      
+
 mkdir -p "${INSTALL_DIR}/bin" 2> /dev/null \
   || (echo "Please enter your password for installing obitools in ${INSTALL_DIR}"  1>&2
       sudo mkdir -p "${INSTALL_DIR}/bin")
@@ -68,11 +73,11 @@ if [[ ! -d "${INSTALL_DIR}/bin" ]]; then
   exit 1
 fi
 
-INSTALL_DIR="$(cd $INSTALL_DIR && pwd)"
+INSTALL_DIR="$(cd ${INSTALL_DIR} && pwd)"
 
-echo WORK_DIR=$WORK_DIR  1>&2
-echo INSTALL_DIR=$INSTALL_DIR  1>&2
-echo OBITOOLS_PREFIX=$OBITOOLS_PREFIX  1>&2
+echo "WORK_DIR=$WORK_DIR"  1>&2
+echo "INSTALL_DIR=$INSTALL_DIR"  1>&2
+echo "OBITOOLS_PREFIX=$OBITOOLS_PREFIX"  1>&2
 
 pushd "$WORK_DIR"|| exit
 
@@ -105,6 +110,13 @@ curl "$GOURL" \
 
 PATH="$(pwd)/go/bin:$PATH"
 export PATH
+GOPATH="$(pwd)/go"
+export GOPATH
+
+export GOCACHE="$(pwd)/cache"
+echo "GOCACHE=$GOCACHE" 1>&2@
+mkdir -p "$GOCACHE"
+
 
 curl -L "$OBIURL4" > master.zip
 unzip master.zip
@@ -112,11 +124,12 @@ unzip master.zip
 echo "Install OBITOOLS from : $OBIURL4"
 
 cd obitools4-master || exit
+mkdir vendor
 
 if [[ -z "$OBITOOLS_PREFIX" ]] ; then
-  make
+  make GOFLAGS="-buildvcs=false" 
 else
-  make OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
+  make GOFLAGS="-buildvcs=false" OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
 fi
 
 (cp build/* "${INSTALL_DIR}/bin" 2> /dev/null) \
@@ -125,5 +138,6 @@ fi
 
 popd || exit
 
+chmod -R +w "$WORK_DIR"
 rm -rf "$WORK_DIR"
 

kmer_roaring_index/FREQUENCY_FILTER_FINAL.md

@@ -0,0 +1,292 @@
+# Filtre de Fréquence avec v Niveaux de Roaring Bitmaps
+
+## Algorithme
+
+```go
+Pour chaque k-mer rencontré dans les données:
+    c = 0
+    tant que (k-mer ∈ index[c] ET c < v):
+        c++
+    
+    si c < v:
+        index[c].insert(k-mer)
+```
+
+**Résultat** : `index[v-1]` contient les k-mers vus **≥ v fois**
+
+---
+
+## Exemple d'exécution (v=3)
+
+```
+Données:
+  Read1: kmer X
+  Read2: kmer X
+  Read3: kmer X  (X vu 3 fois)
+  Read4: kmer Y
+  Read5: kmer Y  (Y vu 2 fois)
+  Read6: kmer Z  (Z vu 1 fois)
+
+Exécution:
+
+Read1 (X):
+  c=0: X ∉ index[0] → index[0].add(X)
+  État: index[0]={X}, index[1]={}, index[2]={}
+
+Read2 (X):
+  c=0: X ∈ index[0] → c=1
+  c=1: X ∉ index[1] → index[1].add(X)
+  État: index[0]={X}, index[1]={X}, index[2]={}
+
+Read3 (X):
+  c=0: X ∈ index[0] → c=1
+  c=1: X ∈ index[1] → c=2
+  c=2: X ∉ index[2] → index[2].add(X)
+  État: index[0]={X}, index[1]={X}, index[2]={X}
+
+Read4 (Y):
+  c=0: Y ∉ index[0] → index[0].add(Y)
+  État: index[0]={X,Y}, index[1]={X}, index[2]={X}
+
+Read5 (Y):
+  c=0: Y ∈ index[0] → c=1
+  c=1: Y ∉ index[1] → index[1].add(Y)
+  État: index[0]={X,Y}, index[1]={X,Y}, index[2]={X}
+
+Read6 (Z):
+  c=0: Z ∉ index[0] → index[0].add(Z)
+  État: index[0]={X,Y,Z}, index[1]={X,Y}, index[2]={X}
+
+Résultat final:
+  index[0] (freq≥1): {X, Y, Z}
+  index[1] (freq≥2): {X, Y}
+  index[2] (freq≥3): {X}  ← K-mers filtrés ✓
+```
+
+---
+
+## Utilisation
+
+```go
+// Créer le filtre
+filter := obikmer.NewFrequencyFilter(31, 3) // k=31, minFreq=3
+
+// Ajouter les séquences
+for _, read := range reads {
+    filter.AddSequence(read)
+}
+
+// Récupérer les k-mers filtrés (freq ≥ 3)
+filtered := filter.GetFilteredSet("filtered")
+fmt.Printf("K-mers de qualité: %d\n", filtered.Cardinality())
+
+// Statistiques
+stats := filter.Stats()
+fmt.Println(stats.String())
+```
+
+---
+
+## Performance
+
+### Complexité
+
+**Par k-mer** :
+- Lookups : Moyenne ~v/2, pire cas v
+- Insertions : 1 Add
+- **Pas de Remove** ✅
+
+**Total pour n k-mers** :
+- Temps : O(n × v/2)
+- Mémoire : O(unique_kmers × v × 2 bytes)
+
+### Early exit pour distribution skewed
+
+Avec distribution typique (séquençage) :
+```
+80% singletons → 1 lookup (early exit)
+15% freq 2-3   → 2-3 lookups
+5% freq ≥4     → jusqu'à v lookups
+
+Moyenne réelle : ~2 lookups/kmer (au lieu de v/2)
+```
+
+---
+
+## Mémoire
+
+### Pour 10^8 k-mers uniques
+
+| v (minFreq) | Nombre bitmaps | Mémoire | vs map simple |
+|-------------|----------------|---------|---------------|
+| v=2 | 2 | ~400 MB | 6x moins |
+| v=3 | 3 | ~600 MB | 4x moins |
+| v=5 | 5 | ~1 GB | 2.4x moins |
+| v=10 | 10 | ~2 GB | 1.2x moins |
+| v=20 | 20 | ~4 GB | ~égal |
+
+**Note** : Avec distribution skewed (beaucoup de singletons), la mémoire réelle est bien plus faible car les niveaux hauts ont peu d'éléments.
+
+### Exemple réaliste (séquençage)
+
+Pour 10^8 k-mers totaux, v=3 :
+```
+Distribution:
+  80% singletons  → 80M dans index[0]
+  15% freq 2-3    → 15M dans index[1]
+  5% freq ≥3      → 5M dans index[2]
+
+Mémoire:
+  index[0]: 80M × 2 bytes = 160 MB
+  index[1]: 15M × 2 bytes = 30 MB
+  index[2]: 5M × 2 bytes = 10 MB
+  Total: ~200 MB ✅
+
+vs map simple: 80M × 24 bytes = ~2 GB
+Réduction: 10x
+```
+
+---
+
+## Comparaison des approches
+
+| Approche | Mémoire (10^8 kmers) | Passes | Lookups/kmer | Quand utiliser |
+|----------|----------------------|--------|--------------|----------------|
+| **v-Bitmaps** | **200-600 MB** | **1** | **~2 (avg)** | **Standard** ✅ |
+| Map simple | 2.4 GB | 1 | 1 | Si RAM illimitée |
+| Multi-pass | 400 MB | v | v | Si I/O pas cher |
+
+---
+
+## Avantages de v-Bitmaps
+
+✅ **Une seule passe** sur les données  
+✅ **Mémoire optimale** avec Roaring bitmaps  
+✅ **Pas de Remove** (seulement Contains + Add)  
+✅ **Early exit** efficace sur singletons  
+✅ **Scalable** jusqu'à v~10-20  
+✅ **Simple** à implémenter et comprendre  
+
+---
+
+## Cas d'usage typiques
+
+### 1. Éliminer erreurs de séquençage
+
+```go
+filter := obikmer.NewFrequencyFilter(31, 3)
+
+// Traiter FASTQ
+for read := range StreamFastq("sample.fastq") {
+    filter.AddSequence(read)
+}
+
+// K-mers de qualité (pas d'erreurs)
+cleaned := filter.GetFilteredSet("cleaned")
+```
+
+**Résultat** : Élimine 70-80% des k-mers (erreurs)
+
+### 2. Assemblage de génome
+
+```go
+filter := obikmer.NewFrequencyFilter(31, 2)
+
+// Filtrer avant l'assemblage
+for read := range reads {
+    filter.AddSequence(read)
+}
+
+solidKmers := filter.GetFilteredSet("solid")
+// Utiliser solidKmers pour le graphe de Bruijn
+```
+
+### 3. Comparaison de génomes
+
+```go
+collection := obikmer.NewKmerSetCollection(31)
+
+for _, genome := range genomes {
+    filter := obikmer.NewFrequencyFilter(31, 3)
+    filter.AddSequences(genome.Reads)
+    
+    cleaned := filter.GetFilteredSet(genome.ID)
+    collection.Add(cleaned)
+}
+
+// Analyses comparatives sur k-mers de qualité
+matrix := collection.ParallelPairwiseJaccard(8)
+```
+
+---
+
+## Limites
+
+**Pour v > 20** :
+- Trop de lookups (v lookups/kmer)
+- Mémoire importante (v × 200MB pour 10^8 kmers)
+
+**Solutions alternatives pour v > 20** :
+- Utiliser map simple (9 bytes/kmer) si RAM disponible
+- Algorithme différent (sketch, probabiliste)
+
+---
+
+## Optimisations possibles
+
+### 1. Parallélisation
+
+```go
+// Traiter plusieurs fichiers en parallèle
+filters := make([]*FrequencyFilter, numFiles)
+
+var wg sync.WaitGroup
+for i, file := range files {
+    wg.Add(1)
+    go func(idx int, f string) {
+        defer wg.Done()
+        filters[idx] = ProcessFile(f, k, minFreq)
+    }(i, file)
+}
+wg.Wait()
+
+// Merger les résultats
+merged := MergeFilters(filters)
+```
+
+### 2. Streaming avec seuil adaptatif
+
+```go
+// Commencer avec v=5, réduire progressivement
+filter := obikmer.NewFrequencyFilter(31, 5)
+
+// ... traitement ...
+
+// Si trop de mémoire, réduire à v=3
+if filter.MemoryUsage() > threshold {
+    filter = ConvertToLowerThreshold(filter, 3)
+}
+```
+
+---
+
+## Récapitulatif final
+
+**Pour filtrer les k-mers par fréquence ≥ v :**
+
+1. **Créer** : `filter := NewFrequencyFilter(k, v)`
+2. **Traiter** : `filter.AddSequence(read)` pour chaque read
+3. **Résultat** : `filtered := filter.GetFilteredSet(id)`
+
+**Mémoire** : ~2v MB par million de k-mers uniques  
+**Temps** : Une seule passe, ~2 lookups/kmer en moyenne  
+**Optimal pour** : v ≤ 20, distribution skewed (séquençage)  
+
+---
+
+## Code fourni
+
+1. **frequency_filter.go** - Implémentation complète
+2. **examples_frequency_filter_final.go** - Exemples d'utilisation
+
+**Tout est prêt à utiliser !** 🚀

kmer_roaring_index/examples_frequency_filter_final.go

@@ -0,0 +1,320 @@
+package main
+
+import (
+	"fmt"
+	"obikmer"
+)
+
+func main() {
+	// ==========================================
+	// EXEMPLE 1 : Utilisation basique
+	// ==========================================
+	fmt.Println("=== EXEMPLE 1 : Utilisation basique ===\n")
+
+	k := 31
+	minFreq := 3 // Garder les k-mers vus ≥3 fois
+
+	// Créer le filtre
+	filter := obikmer.NewFrequencyFilter(k, minFreq)
+
+	// Simuler des séquences avec différentes fréquences
+	sequences := [][]byte{
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X (freq=2)
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X (freq=3) ✓
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Kmer Y
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Kmer Y (freq=2) ✗
+		[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // Kmer Z (freq=1) ✗
+	}
+
+	fmt.Printf("Traitement de %d séquences...\n", len(sequences))
+	for _, seq := range sequences {
+		filter.AddSequence(seq)
+	}
+
+	// Récupérer les k-mers filtrés
+	filtered := filter.GetFilteredSet("filtered")
+	fmt.Printf("\nK-mers avec freq ≥ %d: %d\n", minFreq, filtered.Cardinality())
+
+	// Statistiques
+	stats := filter.Stats()
+	fmt.Println("\n" + stats.String())
+
+	// ==========================================
+	// EXEMPLE 2 : Vérifier les niveaux
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 2 : Inspection des niveaux ===\n")
+
+	// Vérifier chaque niveau
+	for level := 0; level < minFreq; level++ {
+		levelSet := filter.GetKmersAtLevel(level)
+		fmt.Printf("Niveau %d (freq≥%d): %d k-mers\n",
+			level+1, level+1, levelSet.Cardinality())
+	}
+
+	// ==========================================
+	// EXEMPLE 3 : Données réalistes
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 3 : Simulation données séquençage ===\n")
+
+	filter2 := obikmer.NewFrequencyFilter(31, 3)
+
+	// Simuler un dataset réaliste :
+	// - 1000 reads
+	// - 80% contiennent des erreurs (singletons)
+	// - 15% vrais k-mers à basse fréquence
+	// - 5% vrais k-mers à haute fréquence
+
+	// Vraie séquence répétée
+	trueSeq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
+	for i := 0; i < 50; i++ {
+		filter2.AddSequence(trueSeq)
+	}
+
+	// Séquence à fréquence moyenne
+	mediumSeq := []byte("CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC")
+	for i := 0; i < 5; i++ {
+		filter2.AddSequence(mediumSeq)
+	}
+
+	// Erreurs de séquençage (singletons)
+	for i := 0; i < 100; i++ {
+		errorSeq := []byte(fmt.Sprintf("TTTTTTTTTTTTTTTTTTTTTTTTTTTT%03d", i))
+		filter2.AddSequence(errorSeq)
+	}
+
+	stats2 := filter2.Stats()
+	fmt.Println(stats2.String())
+
+	fmt.Println("Distribution attendue:")
+	fmt.Println("  - Beaucoup de singletons (erreurs)")
+	fmt.Println("  - Peu de k-mers à haute fréquence (signal)")
+	fmt.Println("  → Filtrage efficace !")
+
+	// ==========================================
+	// EXEMPLE 4 : Tester différents seuils
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 4 : Comparaison de seuils ===\n")
+
+	testSeqs := [][]byte{
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // freq=5
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"),
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"),
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // freq=3
+		[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // freq=1
+	}
+
+	for _, minFreq := range []int{2, 3, 5} {
+		f := obikmer.NewFrequencyFilter(31, minFreq)
+		f.AddSequences(testSeqs)
+
+		fmt.Printf("minFreq=%d: %d k-mers retenus (%.2f MB)\n",
+			minFreq,
+			f.Cardinality(),
+			float64(f.MemoryUsage())/1024/1024)
+	}
+
+	// ==========================================
+	// EXEMPLE 5 : Comparaison mémoire
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 5 : Comparaison mémoire ===\n")
+
+	filter3 := obikmer.NewFrequencyFilter(31, 3)
+
+	// Simuler 10000 séquences
+	for i := 0; i < 10000; i++ {
+		seq := make([]byte, 100)
+		for j := range seq {
+			seq[j] = "ACGT"[(i+j)%4]
+		}
+		filter3.AddSequence(seq)
+	}
+
+	fmt.Println(filter3.CompareWithSimpleMap())
+
+	// ==========================================
+	// EXEMPLE 6 : Workflow complet
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 6 : Workflow complet ===\n")
+
+	fmt.Println("1. Créer le filtre")
+	finalFilter := obikmer.NewFrequencyFilter(31, 3)
+
+	fmt.Println("2. Traiter les données (simulation)")
+	// En pratique : lire depuis FASTQ
+	// for read := range ReadFastq("data.fastq") {
+	//     finalFilter.AddSequence(read)
+	// }
+
+	// Simulation
+	for i := 0; i < 1000; i++ {
+		seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
+		finalFilter.AddSequence(seq)
+	}
+
+	fmt.Println("3. Récupérer les k-mers filtrés")
+	result := finalFilter.GetFilteredSet("final")
+
+	fmt.Println("4. Utiliser le résultat")
+	fmt.Printf("   K-mers de qualité: %d\n", result.Cardinality())
+	fmt.Printf("   Mémoire utilisée: %.2f MB\n", float64(finalFilter.MemoryUsage())/1024/1024)
+
+	fmt.Println("5. Sauvegarder (optionnel)")
+	// result.Save("filtered_kmers.bin")
+
+	// ==========================================
+	// EXEMPLE 7 : Vérification individuelle
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 7 : Vérification de k-mers spécifiques ===\n")
+
+	checkFilter := obikmer.NewFrequencyFilter(31, 3)
+
+	testSeq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
+	for i := 0; i < 5; i++ {
+		checkFilter.AddSequence(testSeq)
+	}
+
+	var kmers []uint64
+	kmers = obikmer.EncodeKmers(testSeq, 31, &kmers)
+
+	if len(kmers) > 0 {
+		testKmer := kmers[0]
+
+		fmt.Printf("K-mer test: 0x%016X\n", testKmer)
+		fmt.Printf("  Présent dans filtre: %v\n", checkFilter.Contains(testKmer))
+		fmt.Printf("  Fréquence approx: %d\n", checkFilter.GetFrequency(testKmer))
+	}
+
+	// ==========================================
+	// EXEMPLE 8 : Intégration avec collection
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 8 : Intégration avec KmerSetCollection ===\n")
+
+	// Créer une collection de génomes filtrés
+	collection := obikmer.NewKmerSetCollection(31)
+
+	genomes := map[string][][]byte{
+		"Genome1": {
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Erreur
+		},
+		"Genome2": {
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // Erreur
+		},
+	}
+
+	for id, sequences := range genomes {
+		// Filtrer chaque génome
+		genomeFilter := obikmer.NewFrequencyFilter(31, 3)
+		genomeFilter.AddSequences(sequences)
+
+		// Ajouter à la collection
+		filteredSet := genomeFilter.GetFilteredSet(id)
+		collection.Add(filteredSet)
+
+		fmt.Printf("%s: %d k-mers de qualité\n", id, filteredSet.Cardinality())
+	}
+
+	// Analyser la collection
+	fmt.Println("\nAnalyse comparative:")
+	collectionStats := collection.ComputeStats()
+	fmt.Printf("  Core genome: %d k-mers\n", collectionStats.CoreSize)
+	fmt.Printf("  Pan genome: %d k-mers\n", collectionStats.PanGenomeSize)
+
+	// ==========================================
+	// RÉSUMÉ
+	// ==========================================
+	fmt.Println("\n=== RÉSUMÉ ===\n")
+	fmt.Println("Le FrequencyFilter permet de:")
+	fmt.Println("  ✓ Filtrer les k-mers par fréquence minimale")
+	fmt.Println("  ✓ Utiliser une mémoire optimale avec Roaring bitmaps")
+	fmt.Println("  ✓ Une seule passe sur les données")
+	fmt.Println("  ✓ Éliminer efficacement les erreurs de séquençage")
+	fmt.Println("")
+	fmt.Println("Workflow typique:")
+	fmt.Println("  1. filter := NewFrequencyFilter(k, minFreq)")
+	fmt.Println("  2. for each sequence: filter.AddSequence(seq)")
+	fmt.Println("  3. filtered := filter.GetFilteredSet(id)")
+	fmt.Println("  4. Utiliser filtered dans vos analyses")
+}
+
+// ==================================
+// FONCTION HELPER POUR BENCHMARKS
+// ==================================
+
+func BenchmarkFrequencyFilter() {
+	k := 31
+	minFreq := 3
+
+	// Test avec différentes tailles
+	sizes := []int{1000, 10000, 100000}
+
+	fmt.Println("\n=== BENCHMARK ===\n")
+
+	for _, size := range sizes {
+		filter := obikmer.NewFrequencyFilter(k, minFreq)
+
+		// Générer des séquences
+		for i := 0; i < size; i++ {
+			seq := make([]byte, 100)
+			for j := range seq {
+				seq[j] = "ACGT"[(i+j)%4]
+			}
+			filter.AddSequence(seq)
+		}
+
+		fmt.Printf("Size=%d reads:\n", size)
+		fmt.Printf("  Filtered k-mers: %d\n", filter.Cardinality())
+		fmt.Printf("  Memory: %.2f MB\n", float64(filter.MemoryUsage())/1024/1024)
+		fmt.Println()
+	}
+}
+
+// ==================================
+// FONCTION POUR DONNÉES RÉELLES
+// ==================================
+
+func ProcessRealData() {
+	// Exemple pour traiter de vraies données FASTQ
+
+	k := 31
+	minFreq := 3
+
+	filter := obikmer.NewFrequencyFilter(k, minFreq)
+
+	// Pseudo-code pour lire un FASTQ
+	/*
+	fastqFile := "sample.fastq"
+	reader := NewFastqReader(fastqFile)
+
+	for reader.HasNext() {
+		read := reader.Next()
+		filter.AddSequence(read.Sequence)
+	}
+
+	// Récupérer le résultat
+	filtered := filter.GetFilteredSet("sample_filtered")
+	filtered.Save("sample_filtered_kmers.bin")
+
+	// Stats
+	stats := filter.Stats()
+	fmt.Println(stats.String())
+	*/
+
+	fmt.Println("Workflow pour données réelles:")
+	fmt.Println("  1. Créer le filtre avec minFreq approprié (2-5 typique)")
+	fmt.Println("  2. Stream les reads depuis FASTQ")
+	fmt.Println("  3. Récupérer les k-mers filtrés")
+	fmt.Println("  4. Utiliser pour assemblage/comparaison/etc.")
+
+	_ = filter // unused
+}

obitests/obitools/obiannotate/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obiannotate
+CMD=obiannotate
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obiclean/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obiclean
+CMD=obiclean
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obicleandb/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obicleandb
+CMD=obicleandb
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obicomplement/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obicomplement
+CMD=obicomplement
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obiconsensus/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obiconsensus
+CMD=obiconsensus
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obiconvert/test.sh

@@ -0,0 +1,144 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obiconvert
+CMD=obiconvert
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+
+if [ -z "$TEST_DIR" ] ; then
+   TEST_DIR="."
+fi
+
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+((ntest++))
+if obiconvert -Z "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
+                 > "${TMPDIR}/xxx.fasta.gz" && \
+   zdiff "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
+                 "${TMPDIR}/xxx.fasta.gz" 
+then
+    log "$MCMD: converting large fasta file to fasta OK" 
+    ((success++))
+else
+    log "$MCMD: converting large fasta file to fasta failed" 
+    ((failed++))
+fi
+ 
+((ntest++))
+if obiconvert -Z --fastq-output \
+              "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
+                 > "${TMPDIR}/xxx.fastq.gz" && \
+   obiconvert -Z --fasta-output \
+              "${TMPDIR}/xxx.fastq.gz" \
+              > "${TMPDIR}/yyy.fasta.gz" && \
+   zdiff "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
+                 "${TMPDIR}/yyy.fasta.gz" 
+then
+    log "$MCMD: converting large file between fasta and fastq OK" 
+    ((success++))
+else
+    log "$MCMD: converting large file between fasta and fastq failed" 
+    ((failed++))
+fi
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obicount/test.sh

@@ -0,0 +1,163 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obicount
+CMD=obicount
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if obicount "${TEST_DIR}/wolf_F.fasta.gz" \
+    > "${TMPDIR}/wolf_F.fasta_count.csv" 
+then
+    log "OBICount: fasta reading OK" 
+    ((success++))
+else
+    log "OBICount: fasta reading failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if obicount "${TEST_DIR}/wolf_F.fastq.gz" \
+    > "${TMPDIR}/wolf_F.fastq_count.csv"
+then
+    log "OBICount: fastq reading OK"
+    ((success++))
+else
+    log "OBICount: fastq reading failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if obicount "${TEST_DIR}/wolf_F.csv.gz" \
+    > "${TMPDIR}/wolf_F.csv_count.csv"
+then
+    log "OBICount: csv reading OK" 
+    ((success++))
+else
+    log "OBICount: csv reading failed"
+    ((failed++))
+fi
+
+((ntest++))
+if diff "${TMPDIR}/wolf_F.fasta_count.csv" \
+        "${TMPDIR}/wolf_F.fastq_count.csv"  > /dev/null
+then
+    log "OBICount: counting on fasta and fastq are identical OK"
+    ((success++))
+else
+    log "OBICount: counting on fasta and fastq are different failed"
+    ((failed++))
+fi
+
+((ntest++))
+if diff "${TMPDIR}/wolf_F.fasta_count.csv" \
+        "${TMPDIR}/wolf_F.csv_count.csv" > /dev/null
+then
+    log "OBICount: counting on fasta and csv are identical OK"
+    ((success++))
+else
+    log "OBICount: counting on fasta and csv are different failed"
+    ((failed++))
+fi
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obicsv/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obicsv
+CMD=obicsv
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obidemerge/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obidemerge
+CMD=obidemerge
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obidistribute/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obidistribute
+CMD=obidistribute
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obigrep/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obigrep
+CMD=obigrep
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obijoin/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obijoin
+CMD=obijoin
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obikmermatch/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obikmermatch
+CMD=obikmermatch
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obikmersimcount/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obikmersimcount
+CMD=obikmersimcount
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obilandmark/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obilandmark
+CMD=obilandmark
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obimatrix/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obimatrix
+CMD=obimatrix
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obimicrosat/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obimicrosat
+CMD=obimicrosat
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obimultiplex/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obimultiplex
+CMD=obimultiplex
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obipairing/test.sh

@@ -0,0 +1,150 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obipairing
+CMD=obipairing
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+       log
+       log
+       exit 1
+    fi
+
+    log
+    log
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if obipairing -F "${TEST_DIR}/wolf_F.fastq.gz" \
+              -R "${TEST_DIR}/wolf_R.fastq.gz" \
+    | obidistribute -Z -c mode \
+                    -p "${TMPDIR}/wolf_paired_%s.fastq.gz" 
+then
+    log "OBIPairing: sequence pairing OK" 
+    ((success++))
+else
+    log "OBIPairing: sequence pairing failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if obicsv -Z -s -i \
+          -k ali_dir -k ali_length -k pairing_fast_count \
+          -k pairing_fast_overlap -k pairing_fast_score \
+          -k score -k score_norm -k seq_a_single \
+          -k seq_b_single -k seq_ab_match \
+          "${TMPDIR}/wolf_paired_alignment.fastq.gz" \
+    > "${TMPDIR}/wolf_paired_alignment.csv.gz" \
+    && zdiff -c "${TEST_DIR}/wolf_paired_alignment.csv.gz" \
+                "${TMPDIR}/wolf_paired_alignment.csv.gz" 
+then
+    log "OBIPairing: check aligned sequences OK" 
+    ((success++))
+else
+    log "OBIPairing: check aligned sequences failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if obicsv -Z -s -i \
+          "${TMPDIR}/wolf_paired_join.fastq.gz" \
+    > "${TMPDIR}/wolf_paired_join.csv.gz" \
+    && zdiff -c "${TEST_DIR}/wolf_paired_join.csv.gz" \
+                "${TMPDIR}/wolf_paired_join.csv.gz"
+then
+    log "OBIPairing: check joined sequences OK" 
+    ((success++))
+else
+    log "OBIPairing: check joined sequences failed" 
+    ((failed++))
+fi
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obipcr/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obipcr
+CMD=obipcr
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obirefidx/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obirefidx
+CMD=obirefidx
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obiscript/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obiscript
+CMD=obiscript
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obisplit/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obisplit
+CMD=obisplit
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obisummary/some_uniq_seq.fasta

@@ -0,0 +1,9 @@
+>Seq_1 {"count":2,"merged_sample":{"15a_F730814":1,"29a_F260619":1}}
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agctyaaaactcaaaggacttggcggtgctttataccctt
+>Seq_2 {"count":22,"merged_sample":{"15a_F730814":12,"29a_F260619":10}}
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+atcttaaaactcaaaggacttggcggtgctttataccctt
+>Seq_3 {"count":22,"merged_sample":{"15a_F730814":15,"29a_F260619":7}}
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcgat
+agcttaaaactcaaaggacttggcggtgctttataccctt

obitests/obitools/obisummary/some_uniq_seq.json

@@ -0,0 +1,35 @@
+{
+  "annotations": {
+    "keys": {
+      "map": {
+        "merged_sample": 3
+      },
+      "scalar": {
+        "count": 3
+      }
+    },
+    "map_attributes": 1,
+    "scalar_attributes": 1,
+    "vector_attributes": 0
+  },
+  "count": {
+    "reads": 46,
+    "total_length": 300,
+    "variants": 3
+  },
+  "samples": {
+    "sample_count": 2,
+    "sample_stats": {
+      "15a_F730814": {
+        "reads": 28,
+        "singletons": 1,
+        "variants": 3
+      },
+      "29a_F260619": {
+        "reads": 18,
+        "singletons": 1,
+        "variants": 3
+      }
+    }
+  }
+}

obitests/obitools/obisummary/some_uniq_seq.yaml

@@ -0,0 +1,25 @@
+annotations:
+    keys:
+        map:
+            merged_sample: 3
+        scalar:
+            count: 3
+    map_attributes: 1
+    scalar_attributes: 1
+    vector_attributes: 0
+count:
+    reads: 46
+    total_length: 300
+    variants: 3
+samples:
+    sample_count: 2
+    sample_stats:
+        15a_F730814:
+            reads: 28
+            singletons: 1
+            variants: 3
+        29a_F260619:
+            reads: 18
+            singletons: 1
+            variants: 3
+

obitests/obitools/obisummary/test.sh

@@ -0,0 +1,152 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obisummary
+CMD=obisummary
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if obisummary "${TEST_DIR}/some_uniq_seq.fasta" \
+              > "${TMPDIR}/some_uniq_seq.json"
+then
+    log "$MCMD: formating json execution OK" 
+    ((success++))
+else
+    log "$MCMD: formating json execution failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if diff "${TEST_DIR}/some_uniq_seq.json" \
+        "${TMPDIR}/some_uniq_seq.json" > /dev/null
+then
+    log "$MCMD: formating json OK" 
+    ((success++))
+else
+    log "$MCMD: formating json failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if obisummary --yaml "${TEST_DIR}/some_uniq_seq.fasta" \
+              > "${TMPDIR}/some_uniq_seq.yaml"
+then
+    log "$MCMD: formating yaml execution OK" 
+    ((success++))
+else
+    log "$MCMD: formating yaml execution failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if diff "${TEST_DIR}/some_uniq_seq.yaml" \
+        "${TMPDIR}/some_uniq_seq.yaml" > /dev/null
+then
+    log "$MCMD: formating yaml OK" 
+    ((success++))
+else
+    log "$MCMD: formating yaml failed" 
+    ((failed++))
+fi
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obitag/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obitag
+CMD=obitag
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obitagpcr/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obipcr
+CMD=obipcr
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obitaxonomy/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obitaxonomy
+CMD=obitaxonomy
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obiuniq/test.sh

@@ -0,0 +1,205 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obiuniq
+CMD=obiuniq
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if obiuniq "${TEST_DIR}/touniq.fasta" \
+    > "${TMPDIR}/touniq_u.fasta"
+then
+    log "OBIUniq simple: running OK" 
+    ((success++))
+else
+    log "OBIUniq simple: running failed"
+    ((failed++))
+fi
+
+obicsv -s --auto ${TEST_DIR}/touniq_u.fasta \
+| tail -n +2 \
+| sort \
+> "${TMPDIR}/touniq_u_ref.csv"
+
+obicsv -s --auto ${TMPDIR}/touniq_u.fasta \
+| tail -n +2 \
+| sort \
+> "${TMPDIR}/touniq_u.csv"
+
+((ntest++))
+if diff "${TMPDIR}/touniq_u_ref.csv" \
+        "${TMPDIR}/touniq_u.csv"  > /dev/null
+then
+    log "OBIUniq simple: result OK"
+    ((success++))
+else
+    log "OBIUniq simple: result failed"
+    ((failed++))
+fi
+
+((ntest++))
+if obiuniq -c a "${TEST_DIR}/touniq.fasta" \
+    > "${TMPDIR}/touniq_u_a.fasta"
+then
+    log "OBIUniq one category: running OK" 
+    ((success++))
+else
+    log "OBIUniq one category: running failed"
+    ((failed++))
+fi
+
+obicsv -s --auto ${TEST_DIR}/touniq_u_a.fasta \
+| tail -n +2 \
+| sort \
+> "${TMPDIR}/touniq_u_a_ref.csv"
+
+obicsv -s --auto ${TMPDIR}/touniq_u_a.fasta \
+| tail -n +2 \
+| sort \
+> "${TMPDIR}/touniq_u_a.csv"
+
+
+((ntest++))
+if diff "${TMPDIR}/touniq_u_a_ref.csv" \
+        "${TMPDIR}/touniq_u_a.csv"  > /dev/null
+then
+    log "OBIUniq one category: result OK"
+    ((success++))
+else
+    log "OBIUniq one category: result failed"
+    ((failed++))
+fi
+
+((ntest++))
+if obiuniq -c a -c b "${TEST_DIR}/touniq.fasta" \
+    > "${TMPDIR}/touniq_u_a_b.fasta"
+then
+    log "OBIUniq two categories: running OK" 
+    ((success++))
+else
+    log "OBIUniq two categories: running failed"
+    ((failed++))
+fi
+
+obicsv -s --auto ${TEST_DIR}/touniq_u_a_b.fasta \
+| tail -n +2 \
+| sort \
+> "${TMPDIR}/touniq_u_a_b_ref.csv"
+
+obicsv -s --auto ${TMPDIR}/touniq_u_a_b.fasta \
+| tail -n +2 \
+| sort \
+> "${TMPDIR}/touniq_u_a_b.csv"
+
+((ntest++))
+if diff "${TMPDIR}/touniq_u_a_b_ref.csv" \
+        "${TMPDIR}/touniq_u_a_b.csv"  > /dev/null
+then
+    log "OBIUniq two categories: result OK"
+    ((success++))
+else
+    log "OBIUniq two categories: result failed"
+    ((failed++))
+fi
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obiuniq/touniq.fasta

@@ -0,0 +1,16 @@
+>seq1 {"a":2, "b":4,"c":5}
+aaacccgggttt
+>seq2 {"a":3, "b":4,"c":5}
+aaacccgggttt
+>seq3 {"a":3, "b":5,"c":5}
+aaacccgggttt
+>seq4 {"a":3, "b":5,"c":6}
+aaacccgggttt
+>seq5 {"a":2, "b":4,"c":5}
+aaacccgggtttca
+>seq6 {"a":3, "b":4,"c":5}
+aaacccgggtttca
+>seq7 {"a":3, "b":5,"c":5}
+aaacccgggtttca
+>seq8 {"a":3, "b":5,"c":6}
+aaacccgggtttca

obitests/obitools/obiuniq/touniq_u.fasta

@@ -0,0 +1,4 @@
+>seq5 {"count":4}
+aaacccgggtttca
+>seq1 {"count":4}
+aaacccgggttt

obitests/obitools/obiuniq/touniq_u_a.fasta

@@ -0,0 +1,8 @@
+>seq5 {"a":2,"b":4,"c":5,"count":1}
+aaacccgggtttca
+>seq6 {"a":3,"count":3}
+aaacccgggtttca
+>seq1 {"a":2,"b":4,"c":5,"count":1}
+aaacccgggttt
+>seq2 {"a":3,"count":3}
+aaacccgggttt

obitests/obitools/obiuniq/touniq_u_a_b.fasta

@@ -0,0 +1,12 @@
+>seq5 {"a":2,"b":4,"c":5,"count":1}
+aaacccgggtttca
+>seq6 {"a":3,"b":4,"c":5,"count":1}
+aaacccgggtttca
+>seq7 {"a":3,"b":5,"count":2}
+aaacccgggtttca
+>seq1 {"a":2,"b":4,"c":5,"count":1}
+aaacccgggttt
+>seq2 {"a":3,"b":4,"c":5,"count":1}
+aaacccgggttt
+>seq3 {"a":3,"b":5,"count":2}
+aaacccgggttt

pkg/obialign/alignment.go

@@ -10,6 +10,7 @@ import (
 	"strings"
 
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
 )
 
 // // A pool of byte slices.
@@ -158,12 +159,30 @@ func BuildQualityConsensus(seqA, seqB *obiseq.BioSequence, path []int, statOnMis
 
 	match := 0
 
+	left := obiutils.Abs(path[0])
+	right := 0
+	if path[len(path)-1] == 0 {
+		right = path[len(path)-2]
+	}
+
+	right = obiutils.Abs(right)
+
+	right = len(*bufferQA) - right
+
+	// obilog.Warnf("BuildQualityConsensus: left = %d right = %d\n", left, right)
+
 	for i, qA = range *bufferQA {
 		nA := (*bufferSA)[i]
 		nB := (*bufferSB)[i]
 		qB = (*bufferQB)[i]
 
-		if statOnMismatch && nA != nB && nA != ' ' && nB != ' ' {
+		if statOnMismatch && i >= left && i < right && nA != nB {
+			if nA == ' ' {
+				nA = '-'
+			}
+			if nB == ' ' {
+				nB = '-'
+			}
 			mismatches[strings.ToUpper(fmt.Sprintf("(%c:%02d)->(%c:%02d)", nA, qA, nB, qB))] = i + 1
 		}
 
@@ -183,13 +202,12 @@ func BuildQualityConsensus(seqA, seqB *obiseq.BioSequence, path []int, statOnMis
 
 		q := qA + qB
 
-		if qA > 0 && qB > 0 {
-			if nA != nB {
-				q = qM - byte(math.Log10(1-math.Pow(10, -float64(qm)/30))*10+0.5)
-			}
-			if nA == nB {
-				match++
-			}
+		if nA != nB {
+			q = qM - byte(math.Log10(1-math.Pow(10, -float64(qm)/40))*10+0.5)
+		}
+
+		if nA == nB {
+			match++
 		}
 
 		if q > 90 {

pkg/obialign/dnamatrix.go

@@ -74,6 +74,30 @@ func _Logaddexp(a, b float64) float64 {
 	return b + math.Log1p(math.Exp(a-b))
 }
 
+func _Log1mexp(a float64) float64 {
+	if a > 0 {
+		log.Panic("Log1mexp: a > 0")
+	}
+
+	if a == 0 {
+		return 0
+	}
+
+	return (math.Log(-math.Expm1(a)))
+}
+
+func _Logdiffexp(a, b float64) float64 {
+	if a < b {
+		log.Panic("Log1mexp: a < b")
+	}
+
+	if a == b {
+		return math.Inf(-1)
+	}
+
+	return a + _Log1mexp(b-a)
+}
+
 // _MatchScoreRatio calculates the match score ratio between two bytes.
 //
 // Parameters:
@@ -83,25 +107,25 @@ func _Logaddexp(a, b float64) float64 {
 // Returns:
 // - float64: the match score ratio when a match is observed
 // - float64: the match score ratio when a mismatch is observed
-func _MatchScoreRatio(a, b byte) (float64, float64) {
+func _MatchScoreRatio(QF, QR byte) (float64, float64) {
 
-	l2 := math.Log(2)
 	l3 := math.Log(3)
+	l4 := math.Log(4)
 	l10 := math.Log(10)
-	lalea := math.Log(4)                   // 1 /(change of the random model)
-	lE1 := -float64(a)/10*l10 - l3         // log proba of sequencing error on A/3
-	lE2 := -float64(b)/10*l10 - l3         // log proba of sequencing error on B/3
-	lO1 := math.Log1p(-math.Exp(lE1 + l3)) // log proba no being an error on A
-	lO2 := math.Log1p(-math.Exp(lE2 + l3)) // log proba no being an error on B
-	lO1O2 := lO1 + lO2
-	lE1E2 := lE1 + lE2
-	lO1E2 := lO1 + lE2
-	lO2E1 := lO2 + lE1
+	qF := -float64(QF) / 10 * l10
+	qR := -float64(QR) / 10 * l10
+	term1 := _Logaddexp(qF, qR)
+	term2 := _Logdiffexp(term1, qF+qR)
 
-	MM := _Logaddexp(lO1O2, lE1E2+l3)                    // Proba match when match observed
-	Mm := _Logaddexp(_Logaddexp(lO1E2, lO2E1), lE1E2+l2) // Proba match when mismatch observed
+	// obilog.Warnf("MatchScoreRatio: %v, %v , %v, %v", QF, QR, term1, term2)
 
-	return MM + lalea, Mm + lalea
+	match_logp := _Log1mexp(term2 + l3 - l4)
+	match_score := match_logp - _Log1mexp(match_logp)
+
+	mismatch_logp := term2 - l4
+	mismatch_score := mismatch_logp - _Log1mexp(mismatch_logp)
+
+	return match_score, mismatch_score
 }
 
 func _InitNucPartMatch() {

pkg/obialign/fastlcs.go

@@ -21,15 +21,15 @@ func encodeValues(score, length int, out bool) uint64 {
 	return fo
 }
 
-func _isout(value uint64) bool {
-	const outmask = uint64(1) << dwsize
-	return (value & outmask) == 0
-}
+// func _isout(value uint64) bool {
+// 	const outmask = uint64(1) << dwsize
+// 	return (value & outmask) == 0
+// }
 
-func _lpath(value uint64) int {
-	const mask = uint64(1<<wsize) - 1
-	return int(((value + 1) ^ mask) & mask)
-}
+// func _lpath(value uint64) int {
+// 	const mask = uint64(1<<wsize) - 1
+// 	return int(((value + 1) ^ mask) & mask)
+// }
 
 func decodeValues(value uint64) (int, int, bool) {
 	const mask = uint64(1<<wsize) - 1
@@ -57,4 +57,3 @@ func _setout(value uint64) uint64 {
 var _empty = encodeValues(0, 0, false)
 var _out = encodeValues(0, 30000, true)
 var _notavail = encodeValues(0, 30000, false)
-

pkg/obialign/fastlcsegf.go

@@ -4,33 +4,6 @@ import (
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
 )
 
-var _iupac = [26]byte{
-	//  a   b  c  d   e  f
-	1, 14, 2, 13, 0, 0,
-	//  g   h  i  j  k   l
-	4, 11, 0, 0, 12, 0,
-	//  m   n  o  p  q  r
-	3, 15, 0, 0, 0, 5,
-	//  s  t  u   v  w  x
-	6, 8, 8, 13, 9, 0,
-	//  y   z
-	10, 0,
-}
-
-func _samenuc(a, b byte) bool {
-	if (a >= 'A') && (a <= 'Z') {
-		a |= 32
-	}
-	if (b >= 'A') && (b <= 'Z') {
-		b |= 32
-	}
-
-	if (a >= 'a') && (a <= 'z') && (b >= 'a') && (b <= 'z') {
-		return (_iupac[a-'a'] & _iupac[b-'a']) > 0
-	}
-	return a == b
-}
-
 // FastLCSEGFScoreByte calculates the score of the Longest Common Subsequence (LCS) between two byte slices.
 //
 // The score is calculated using the following scoring matrix:
@@ -165,7 +138,7 @@ func FastLCSEGFScoreByte(bA, bB []byte, maxError int, endgapfree bool, buffer *[
 			default:
 				// We are in the middle of the matrix
 				Sdiag = _incpath(previous[x])
-				if _samenuc(bA[j-1], bB[i-1]) {
+				if obiseq.SameIUPACNuc(bA[j-1], bB[i-1]) {
 					Sdiag = _incscore(Sdiag)
 				}
 
@@ -265,7 +238,7 @@ func FastLCSEGFScoreByte(bA, bB []byte, maxError int, endgapfree bool, buffer *[
 				Sleft = _notavail
 			default:
 				Sdiag = _incpath(previous[x])
-				if _samenuc(bA[j-1], bB[i-1]) {
+				if obiseq.SameIUPACNuc(bA[j-1], bB[i-1]) {
 					Sdiag = _incscore(Sdiag)
 				}
 

pkg/obialign/locatepattern.go

@@ -1,6 +1,9 @@
 package obialign
 
-import log "github.com/sirupsen/logrus"
+import (
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
+	log "github.com/sirupsen/logrus"
+)
 
 // buffIndex converts a pair of coordinates (i, j) into a linear index in a matrix
 // of size width x width. The coordinates are (-1)-indexed, and the linear index
@@ -69,7 +72,7 @@ func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
 			// Mismatch score = -1
 			// Match score = 0
 			match := -1
-			if _samenuc(pattern[j], sequence[i]) {
+			if obiseq.SameIUPACNuc(pattern[j], sequence[i]) {
 				match = 0
 			}
 
@@ -103,7 +106,7 @@ func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
 		// Mismatch score = -1
 		// Match score = 0
 		match := -1
-		if _samenuc(pattern[jmax], sequence[i]) {
+		if obiseq.SameIUPACNuc(pattern[jmax], sequence[i]) {
 			match = 0
 		}
 
@@ -152,7 +155,7 @@ func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
 
 	}
 
-	// log.Warnf("from : %d to: %d error: %d match: %v",
+	// obilog.Warnf("from : %d to: %d error: %d match: %v",
 	// 	i, end+1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)],
 	// 	string(sequence[i:(end+1)]))
 	return i, end + 1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)]

pkg/obialign/pairedendalign.go

@@ -625,6 +625,8 @@ func PEAlign(seqA, seqB *obiseq.BioSequence,
 			&arena.pointer.scoreMatrix,
 			&arena.pointer.pathMatrix)
 
+		score = scoreR
+
 		path = _Backtracking(arena.pointer.pathMatrix,
 			len(rawSeqA), len(rawSeqB),
 			&(arena.pointer.path))
@@ -641,6 +643,7 @@ func PEAlign(seqA, seqB *obiseq.BioSequence,
 				len(rawSeqA), len(rawSeqB),
 				&(arena.pointer.path))
 			isLeftAlign = true
+			score = scoreL
 		}
 
 	}

pkg/obialign/readalign.go

@@ -53,10 +53,10 @@ func ReadAlign(seqA, seqB *obiseq.BioSequence,
 		over = min(seqA.Len(), seqB.Len())
 	}
 
-	// log.Warnf("fw/fw: %v shift=%d fastCount=%d/over=%d fastScore=%f",
+	// obilog.Warnf("fw/fw: %v shift=%d fastCount=%d/over=%d fastScore=%f",
 	// 	directAlignment, shift, fastCount, over, fastScore)
 
-	// log.Warnf(("seqA: %s\nseqB: %s\n"), seqA.String(), seqB.String())
+	// obilog.Warnf(("seqA: %s\nseqB: %s\n"), seqA.String(), seqB.String())
 
 	// At least one mismatch exists in the overlaping region
 	if fastCount+3 < over {

pkg/obiapat/obiapat.c

@@ -149,9 +149,9 @@ char *LowerSequence(char *seq)
         char *cseq;
 
         for (cseq = seq ; *cseq ; cseq++) 
-            if (IS_UPPER(*cseq))
+            if (IS_UPPER(*cseq)) {
                 *cseq = TO_LOWER(*cseq);
-
+			}
 		return seq;
 }
  
@@ -299,14 +299,14 @@ int32_t delete_apatseq(SeqPtr pseq,
         return 1;
 }
 
-PatternPtr buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel, 
+Pattern *buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel, 
 						int *errno, char **errmsg)
 {
-	PatternPtr pattern;
+	Pattern *pattern;
 	int32_t    patlen;
 	int32_t    patlen2;
 
-	patlen  = strlen(pat);
+	patlen  = (int32_t)strlen(pat);
 	patlen2 = lenPattern(pat);
 
 	pattern = ECOMALLOC(sizeof(Pattern) +                   // Space for struct Pattern
@@ -341,10 +341,10 @@ PatternPtr buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel,
 		
 }
 
-PatternPtr complementPattern(PatternPtr pat, int *errno, 
+Pattern *complementPattern(Pattern *pat, int *errno, 
 								char **errmsg)
 {
-	PatternPtr pattern;
+	Pattern *pattern;
 	
 	pattern = ECOMALLOC(sizeof(Pattern) + 
 							sizeof(char)      * strlen(pat->cpat) + 1 +

pkg/obiapat/obiapat.h

@@ -116,13 +116,13 @@ ecoseq_t *new_ecoseq_with_data( char *AC,
 
 
 
-int32_t  delete_apatseq(SeqPtr pseq, 
+int32_t  delete_apatseq(Seq *pseq, 
 				   int *errno, char **errmsg);
-PatternPtr buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel, int *errno, char **errmsg);
-PatternPtr complementPattern(PatternPtr pat, int *errno, char **errmsg);
+Pattern *buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel, int *errno, char **errmsg);
+Pattern *complementPattern(Pattern *pat, int *errno, char **errmsg);
 
-SeqPtr new_apatseq(const char *in,int32_t circular, int32_t seqlen,
-                    SeqPtr out, 
+Seq *new_apatseq(const char *in,int32_t circular, int32_t seqlen,
+                    Seq *out, 
 					int *errno, char **errmsg);
 					
 char *ecoComplementPattern(char *nucAcSeq);

pkg/obiapat/pattern.go

@@ -26,7 +26,7 @@ var _AllocatedApaPattern = 0
 // ApatPattern stores a regular pattern usable by the
 // Apat algorithm functions and methods
 type _ApatPattern struct {
-	pointer *C.Pattern
+	pointer C.PatternPtr
 	pattern string
 }
 
@@ -72,6 +72,7 @@ var NilApatSequence = ApatSequence{nil}
 //
 // Returns an ApatPattern object and an error if the pattern is invalid.
 func MakeApatPattern(pattern string, errormax int, allowsIndel bool) (ApatPattern, error) {
+
 	cpattern := C.CString(pattern)
 	defer C.free(unsafe.Pointer(cpattern))
 	cerrormax := C.int32_t(errormax)
@@ -159,7 +160,7 @@ func (pattern ApatPattern) Free() {
 // Print method prints the ApatPattern to the standard output.
 // This is mainly a debug method.
 func (pattern ApatPattern) Print() {
-	C.PrintDebugPattern(C.PatternPtr(pattern.pointer.pointer))
+	C.PrintDebugPattern((*C.Pattern)(pattern.pointer.pointer))
 }
 
 // MakeApatSequence casts an obiseq.BioSequence to an ApatSequence.
@@ -410,8 +411,8 @@ func (pattern ApatPattern) FilterBestMatch(sequence ApatSequence, begin, length
 
 	best := [3]int{0, 0, 10000}
 	for _, m := range res {
-		// log.Warnf("Current : Begin : %d End : %d Err : %d", m[0], m[1], m[2])
-		// log.Warnf("Best    : Begin : %d End : %d Err : %d", best[0], best[1], best[2])
+		// obilog.Warnf("Current : Begin : %d End : %d Err : %d", m[0], m[1], m[2])
+		// obilog.Warnf("Best    : Begin : %d End : %d Err : %d", best[0], best[1], best[2])
 		if (m[0] - m[2]) < best[1]+best[2] {
 			// match are overlapping
 			// log.Warnln("overlap")
@@ -467,7 +468,7 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
 		// Recompute the start and end position of the match
 		// when the pattern allows for indels
 		if m[2] > 0 && pattern.pointer.pointer.hasIndel {
-			// log.Warnf("Locating indel on sequence %s[%s]", sequence.pointer.reference.Id(), pattern.String())
+			// obilog.Warnf("Locating indel on sequence %s[%s]", sequence.pointer.reference.Id(), pattern.String())
 			start := m[0] - m[2]*2
 			start = max(start, 0)
 			end := start + int(pattern.pointer.pointer.patlen) + 4*m[2]
@@ -489,7 +490,7 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
 			m[0] = start + pb
 			m[1] = start + pe
 
-			// log.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score,
+			// obilog.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score,
 			// 	frg, (*cpattern)[0:int(pattern.pointer.pointer.patlen)], sequence.pointer.reference.Sequence()[m[0]:m[1]])
 		}