mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-03-26 05:50:52 +00:00
Refactor k-mer index building to use the new disk-based KmerSetGroupBuilder instead of the old KmerSet and FrequencyFilter approaches. This change introduces a more efficient and scalable approach to building k-mer indices by using partitioned disk storage with streaming operations. - Replace BuildKmerIndex and BuildFrequencyFilterIndex with KmerSetGroupBuilder - Add support for frequency filtering via WithMinFrequency option - Remove deprecated k-mer set persistence methods - Update CLI to use new builder approach - Add new disk-based k-mer operations (union, intersect, difference, quorum) - Introduce KDI (K-mer Delta Index) file format for efficient storage - Add K-way merge operations for combining sorted k-mer streams - Update documentation and examples to reflect new API This refactoring provides better memory usage, faster operations on large datasets, and more flexible k-mer set operations.
252 lines
6.2 KiB
Go
252 lines
6.2 KiB
Go
package obikmer
|
||
|
||
import (
|
||
"path/filepath"
|
||
"testing"
|
||
|
||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||
)
|
||
|
||
// buildGroupFromSeqs creates a KmerSetGroup with one set per sequence.
|
||
func buildGroupFromSeqs(t *testing.T, dir string, k, m int, seqs []string) *KmerSetGroup {
|
||
t.Helper()
|
||
n := len(seqs)
|
||
builder, err := NewKmerSetGroupBuilder(dir, k, m, n, 64)
|
||
if err != nil {
|
||
t.Fatal(err)
|
||
}
|
||
for i, s := range seqs {
|
||
seq := obiseq.NewBioSequence("", []byte(s), "")
|
||
builder.AddSequence(i, seq)
|
||
}
|
||
ksg, err := builder.Close()
|
||
if err != nil {
|
||
t.Fatal(err)
|
||
}
|
||
return ksg
|
||
}
|
||
|
||
func collectKmers(t *testing.T, ksg *KmerSetGroup, setIdx int) []uint64 {
|
||
t.Helper()
|
||
var result []uint64
|
||
for kmer := range ksg.Iterator(setIdx) {
|
||
result = append(result, kmer)
|
||
}
|
||
return result
|
||
}
|
||
|
||
func TestDiskOpsUnion(t *testing.T) {
|
||
dir := t.TempDir()
|
||
indexDir := filepath.Join(dir, "index")
|
||
outDir := filepath.Join(dir, "union")
|
||
|
||
// Two sequences with some overlap
|
||
seqs := []string{
|
||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||
}
|
||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||
|
||
result, err := ksg.Union(outDir)
|
||
if err != nil {
|
||
t.Fatal(err)
|
||
}
|
||
|
||
// Union should have at least as many k-mers as each individual set
|
||
unionLen := result.Len(0)
|
||
if unionLen == 0 {
|
||
t.Fatal("union is empty")
|
||
}
|
||
if unionLen < ksg.Len(0) || unionLen < ksg.Len(1) {
|
||
t.Fatalf("union (%d) smaller than an input set (%d, %d)", unionLen, ksg.Len(0), ksg.Len(1))
|
||
}
|
||
|
||
// Union should not exceed the sum of both sets
|
||
if unionLen > ksg.Len(0)+ksg.Len(1) {
|
||
t.Fatalf("union (%d) larger than sum of sets (%d)", unionLen, ksg.Len(0)+ksg.Len(1))
|
||
}
|
||
}
|
||
|
||
func TestDiskOpsIntersect(t *testing.T) {
|
||
dir := t.TempDir()
|
||
indexDir := filepath.Join(dir, "index")
|
||
outDir := filepath.Join(dir, "intersect")
|
||
|
||
// Two sequences with some shared k-mers
|
||
seqs := []string{
|
||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||
}
|
||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||
|
||
result, err := ksg.Intersect(outDir)
|
||
if err != nil {
|
||
t.Fatal(err)
|
||
}
|
||
|
||
interLen := result.Len(0)
|
||
// Intersection should not be bigger than any individual set
|
||
if interLen > ksg.Len(0) || interLen > ksg.Len(1) {
|
||
t.Fatalf("intersection (%d) larger than input sets (%d, %d)", interLen, ksg.Len(0), ksg.Len(1))
|
||
}
|
||
}
|
||
|
||
func TestDiskOpsDifference(t *testing.T) {
|
||
dir := t.TempDir()
|
||
indexDir := filepath.Join(dir, "index")
|
||
outDir := filepath.Join(dir, "diff")
|
||
|
||
seqs := []string{
|
||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||
}
|
||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||
|
||
result, err := ksg.Difference(outDir)
|
||
if err != nil {
|
||
t.Fatal(err)
|
||
}
|
||
|
||
diffLen := result.Len(0)
|
||
// Difference = set_0 - set_1, so should be <= set_0
|
||
if diffLen > ksg.Len(0) {
|
||
t.Fatalf("difference (%d) larger than set_0 (%d)", diffLen, ksg.Len(0))
|
||
}
|
||
}
|
||
|
||
func TestDiskOpsConsistency(t *testing.T) {
|
||
dir := t.TempDir()
|
||
indexDir := filepath.Join(dir, "index")
|
||
|
||
seqs := []string{
|
||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||
}
|
||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||
|
||
unionResult, err := ksg.Union(filepath.Join(dir, "union"))
|
||
if err != nil {
|
||
t.Fatal(err)
|
||
}
|
||
interResult, err := ksg.Intersect(filepath.Join(dir, "intersect"))
|
||
if err != nil {
|
||
t.Fatal(err)
|
||
}
|
||
diffResult, err := ksg.Difference(filepath.Join(dir, "diff"))
|
||
if err != nil {
|
||
t.Fatal(err)
|
||
}
|
||
|
||
unionLen := unionResult.Len(0)
|
||
interLen := interResult.Len(0)
|
||
diffLen := diffResult.Len(0)
|
||
|
||
// |A ∪ B| = |A| + |B| - |A ∩ B|
|
||
expectedUnion := ksg.Len(0) + ksg.Len(1) - interLen
|
||
if unionLen != expectedUnion {
|
||
t.Fatalf("|A∪B|=%d, expected |A|+|B|-|A∩B|=%d+%d-%d=%d",
|
||
unionLen, ksg.Len(0), ksg.Len(1), interLen, expectedUnion)
|
||
}
|
||
|
||
// |A \ B| = |A| - |A ∩ B|
|
||
expectedDiff := ksg.Len(0) - interLen
|
||
if diffLen != expectedDiff {
|
||
t.Fatalf("|A\\B|=%d, expected |A|-|A∩B|=%d-%d=%d",
|
||
diffLen, ksg.Len(0), interLen, expectedDiff)
|
||
}
|
||
}
|
||
|
||
func TestDiskOpsQuorum(t *testing.T) {
|
||
dir := t.TempDir()
|
||
indexDir := filepath.Join(dir, "index")
|
||
|
||
// Three sets
|
||
seqs := []string{
|
||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||
"CTAGCTAGCTGATCGATCGATCGTTTAAACCC",
|
||
"GATCGATCGATCGAAATTTCCCGGG",
|
||
}
|
||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||
|
||
// QuorumAtLeast(1) = Union
|
||
q1, err := ksg.QuorumAtLeast(1, filepath.Join(dir, "q1"))
|
||
if err != nil {
|
||
t.Fatal(err)
|
||
}
|
||
union, err := ksg.Union(filepath.Join(dir, "union"))
|
||
if err != nil {
|
||
t.Fatal(err)
|
||
}
|
||
if q1.Len(0) != union.Len(0) {
|
||
t.Fatalf("QuorumAtLeast(1)=%d != Union=%d", q1.Len(0), union.Len(0))
|
||
}
|
||
|
||
// QuorumAtLeast(3) = Intersect
|
||
q3, err := ksg.QuorumAtLeast(3, filepath.Join(dir, "q3"))
|
||
if err != nil {
|
||
t.Fatal(err)
|
||
}
|
||
inter, err := ksg.Intersect(filepath.Join(dir, "inter"))
|
||
if err != nil {
|
||
t.Fatal(err)
|
||
}
|
||
if q3.Len(0) != inter.Len(0) {
|
||
t.Fatalf("QuorumAtLeast(3)=%d != Intersect=%d", q3.Len(0), inter.Len(0))
|
||
}
|
||
|
||
// QuorumAtLeast(2) should be between Intersect and Union
|
||
q2, err := ksg.QuorumAtLeast(2, filepath.Join(dir, "q2"))
|
||
if err != nil {
|
||
t.Fatal(err)
|
||
}
|
||
if q2.Len(0) < q3.Len(0) || q2.Len(0) > q1.Len(0) {
|
||
t.Fatalf("QuorumAtLeast(2)=%d not between intersect=%d and union=%d",
|
||
q2.Len(0), q3.Len(0), q1.Len(0))
|
||
}
|
||
}
|
||
|
||
func TestDiskOpsJaccard(t *testing.T) {
|
||
dir := t.TempDir()
|
||
indexDir := filepath.Join(dir, "index")
|
||
|
||
seqs := []string{
|
||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG",
|
||
"ACGATCGATCTAGCTAGCTGATCGATCGATCG", // identical to first
|
||
"TTTTTTTTTTTTTTTTTTTTTTTTT", // completely different
|
||
}
|
||
ksg := buildGroupFromSeqs(t, indexDir, 15, 7, seqs)
|
||
|
||
dm := ksg.JaccardDistanceMatrix()
|
||
if dm == nil {
|
||
t.Fatal("JaccardDistanceMatrix returned nil")
|
||
}
|
||
|
||
// Identical sets should have distance 0
|
||
d01 := dm.Get(0, 1)
|
||
if d01 != 0.0 {
|
||
t.Fatalf("distance(0,1) = %f, expected 0.0 for identical sets", d01)
|
||
}
|
||
|
||
// Completely different sets should have distance 1.0
|
||
d02 := dm.Get(0, 2)
|
||
if d02 != 1.0 {
|
||
t.Fatalf("distance(0,2) = %f, expected 1.0 for disjoint sets", d02)
|
||
}
|
||
|
||
// Similarity matrix
|
||
sm := ksg.JaccardSimilarityMatrix()
|
||
if sm == nil {
|
||
t.Fatal("JaccardSimilarityMatrix returned nil")
|
||
}
|
||
|
||
s01 := sm.Get(0, 1)
|
||
if s01 != 1.0 {
|
||
t.Fatalf("similarity(0,1) = %f, expected 1.0 for identical sets", s01)
|
||
}
|
||
|
||
s02 := sm.Get(0, 2)
|
||
if s02 != 0.0 {
|
||
t.Fatalf("similarity(0,2) = %f, expected 0.0 for disjoint sets", s02)
|
||
}
|
||
}
|