mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-05-01 12:30:39 +00:00
aa2e94dd6f
This commit refactors the k-mer normalization functions, renaming them from 'NormalizeKmer' to 'CanonicalKmer' to better reflect their purpose of returning canonical k-mers. It also introduces new quorum operations (AtLeast, AtMost, Exactly) for k-mer set groups, along with comprehensive tests and benchmarks. The version commit hash has also been updated.
1221 lines
31 KiB
Go
1221 lines
31 KiB
Go
package obikmer
|
|
|
|
import (
|
|
"bytes"
|
|
"testing"
|
|
)
|
|
|
|
// TestEncodeKmersBasic tests basic k-mer encoding
|
|
func TestEncodeKmersBasic(t *testing.T) {
|
|
tests := []struct {
|
|
name string
|
|
seq string
|
|
k int
|
|
expected []uint64
|
|
}{
|
|
{
|
|
name: "simple 4-mer ACGT",
|
|
seq: "ACGT",
|
|
k: 4,
|
|
expected: []uint64{0b00011011}, // A=00, C=01, G=10, T=11 -> 00 01 10 11 = 27
|
|
},
|
|
{
|
|
name: "simple 2-mer AC",
|
|
seq: "AC",
|
|
k: 2,
|
|
expected: []uint64{0b0001}, // A=00, C=01 -> 00 01 = 1
|
|
},
|
|
{
|
|
name: "sliding 2-mer ACGT",
|
|
seq: "ACGT",
|
|
k: 2,
|
|
expected: []uint64{0b0001, 0b0110, 0b1011}, // AC=1, CG=6, GT=11
|
|
},
|
|
{
|
|
name: "lowercase",
|
|
seq: "acgt",
|
|
k: 4,
|
|
expected: []uint64{0b00011011},
|
|
},
|
|
{
|
|
name: "with U instead of T",
|
|
seq: "ACGU",
|
|
k: 4,
|
|
expected: []uint64{0b00011011}, // U encodes same as T
|
|
},
|
|
{
|
|
name: "8-mer",
|
|
seq: "ACGTACGT",
|
|
k: 8,
|
|
expected: []uint64{0b0001101100011011}, // ACGTACGT
|
|
},
|
|
{
|
|
name: "31-mer max size",
|
|
seq: "ACGTACGTACGTACGTACGTACGTACGTACG",
|
|
k: 31,
|
|
expected: []uint64{0x06C6C6C6C6C6C6C6}, // ACGTACGT repeated ~4 times
|
|
},
|
|
{
|
|
name: "longer sequence sliding",
|
|
seq: "AAACCCGGG",
|
|
k: 3,
|
|
expected: []uint64{
|
|
0b000000, // AAA = 0
|
|
0b000001, // AAC = 1
|
|
0b000101, // ACC = 5
|
|
0b010101, // CCC = 21
|
|
0b010110, // CCG = 22
|
|
0b011010, // CGG = 26
|
|
0b101010, // GGG = 42
|
|
},
|
|
},
|
|
}
|
|
|
|
for _, tt := range tests {
|
|
t.Run(tt.name, func(t *testing.T) {
|
|
result := EncodeKmers([]byte(tt.seq), tt.k, nil)
|
|
|
|
if len(result) != len(tt.expected) {
|
|
t.Errorf("length mismatch: got %d, want %d", len(result), len(tt.expected))
|
|
return
|
|
}
|
|
|
|
for i, v := range result {
|
|
if v != tt.expected[i] {
|
|
t.Errorf("position %d: got %d (0b%b), want %d (0b%b)",
|
|
i, v, v, tt.expected[i], tt.expected[i])
|
|
}
|
|
}
|
|
})
|
|
}
|
|
}
|
|
|
|
// TestEncodeKmersEdgeCases tests edge cases
|
|
func TestEncodeKmersEdgeCases(t *testing.T) {
|
|
// Empty sequence
|
|
result := EncodeKmers([]byte{}, 4, nil)
|
|
if result != nil {
|
|
t.Errorf("empty sequence should return nil, got %v", result)
|
|
}
|
|
|
|
// k > sequence length
|
|
result = EncodeKmers([]byte("ACG"), 4, nil)
|
|
if result != nil {
|
|
t.Errorf("k > seq length should return nil, got %v", result)
|
|
}
|
|
|
|
// k = 0
|
|
result = EncodeKmers([]byte("ACGT"), 0, nil)
|
|
if result != nil {
|
|
t.Errorf("k=0 should return nil, got %v", result)
|
|
}
|
|
|
|
// k > 31
|
|
result = EncodeKmers([]byte("ACGTACGTACGTACGTACGTACGTACGTACGTACGT"), 32, nil)
|
|
if result != nil {
|
|
t.Errorf("k>31 should return nil, got %v", result)
|
|
}
|
|
|
|
// k = sequence length (single k-mer)
|
|
result = EncodeKmers([]byte("ACGT"), 4, nil)
|
|
if len(result) != 1 {
|
|
t.Errorf("k=seq_len should return 1 k-mer, got %d", len(result))
|
|
}
|
|
}
|
|
|
|
// TestEncodeKmersBuffer tests buffer reuse
|
|
func TestEncodeKmersBuffer(t *testing.T) {
|
|
seq := []byte("ACGTACGTACGT")
|
|
k := 4
|
|
|
|
// First call without buffer
|
|
result1 := EncodeKmers(seq, k, nil)
|
|
|
|
// Second call with buffer - pre-allocate with capacity
|
|
buffer := make([]uint64, 0, 100)
|
|
result2 := EncodeKmers(seq, k, &buffer)
|
|
|
|
if len(result1) != len(result2) {
|
|
t.Errorf("buffer reuse: length mismatch %d vs %d", len(result1), len(result2))
|
|
}
|
|
|
|
for i := range result1 {
|
|
if result1[i] != result2[i] {
|
|
t.Errorf("buffer reuse: position %d mismatch", i)
|
|
}
|
|
}
|
|
|
|
// Verify results are correct
|
|
if len(result2) == 0 {
|
|
t.Errorf("result should not be empty")
|
|
}
|
|
|
|
// Test multiple calls with same buffer to verify no memory issues
|
|
for i := 0; i < 10; i++ {
|
|
result3 := EncodeKmers(seq, k, &buffer)
|
|
if len(result3) != len(result1) {
|
|
t.Errorf("iteration %d: length mismatch", i)
|
|
}
|
|
}
|
|
}
|
|
|
|
// TestEncodeKmersVariousLengths tests encoding with various sequence lengths
|
|
func TestEncodeKmersVariousLengths(t *testing.T) {
|
|
lengths := []int{1, 4, 8, 15, 16, 17, 31, 32, 33, 63, 64, 65, 100, 256, 1000}
|
|
k := 8
|
|
|
|
for _, length := range lengths {
|
|
// Generate test sequence
|
|
seq := make([]byte, length)
|
|
for i := range seq {
|
|
seq[i] = "ACGT"[i%4]
|
|
}
|
|
|
|
if length < k {
|
|
continue
|
|
}
|
|
|
|
t.Run("length_"+string(rune('0'+length/100))+string(rune('0'+(length%100)/10))+string(rune('0'+length%10)), func(t *testing.T) {
|
|
result := EncodeKmers(seq, k, nil)
|
|
|
|
expectedLen := length - k + 1
|
|
if len(result) != expectedLen {
|
|
t.Errorf("length mismatch: got %d, want %d", len(result), expectedLen)
|
|
}
|
|
})
|
|
}
|
|
}
|
|
|
|
// TestEncodeKmersLongSequence tests with a longer realistic sequence
|
|
func TestEncodeKmersLongSequence(t *testing.T) {
|
|
// Simulate a realistic DNA sequence
|
|
seq := bytes.Repeat([]byte("ACGTACGTNNACGTACGT"), 100)
|
|
k := 16
|
|
|
|
result := EncodeKmers(seq, k, nil)
|
|
expectedLen := len(seq) - k + 1
|
|
|
|
if len(result) != expectedLen {
|
|
t.Fatalf("length mismatch: got %d, want %d", len(result), expectedLen)
|
|
}
|
|
}
|
|
|
|
// BenchmarkEncodeKmers benchmarks the encoding function
|
|
func BenchmarkEncodeKmers(b *testing.B) {
|
|
// Create test sequences of various sizes
|
|
sizes := []int{100, 1000, 10000, 100000}
|
|
kSizes := []int{8, 16, 31}
|
|
|
|
for _, k := range kSizes {
|
|
for _, size := range sizes {
|
|
seq := make([]byte, size)
|
|
for i := range seq {
|
|
seq[i] = "ACGT"[i%4]
|
|
}
|
|
|
|
name := "k" + string(rune('0'+k/10)) + string(rune('0'+k%10)) + "_size" + string(rune('0'+size/10000)) + string(rune('0'+(size%10000)/1000)) + string(rune('0'+(size%1000)/100)) + string(rune('0'+(size%100)/10)) + string(rune('0'+size%10))
|
|
b.Run(name, func(b *testing.B) {
|
|
buffer := make([]uint64, 0, size)
|
|
b.ResetTimer()
|
|
b.SetBytes(int64(size))
|
|
|
|
for i := 0; i < b.N; i++ {
|
|
EncodeKmers(seq, k, &buffer)
|
|
}
|
|
})
|
|
}
|
|
}
|
|
}
|
|
|
|
// TestEncodeNucleotide verifies nucleotide encoding
|
|
func TestEncodeNucleotide(t *testing.T) {
|
|
testCases := []struct {
|
|
nucleotide byte
|
|
expected byte
|
|
}{
|
|
{'A', 0},
|
|
{'a', 0},
|
|
{'C', 1},
|
|
{'c', 1},
|
|
{'G', 2},
|
|
{'g', 2},
|
|
{'T', 3},
|
|
{'t', 3},
|
|
{'U', 3},
|
|
{'u', 3},
|
|
}
|
|
|
|
for _, tc := range testCases {
|
|
result := EncodeNucleotide(tc.nucleotide)
|
|
if result != tc.expected {
|
|
t.Errorf("EncodeNucleotide('%c') = %d, want %d",
|
|
tc.nucleotide, result, tc.expected)
|
|
}
|
|
}
|
|
}
|
|
|
|
// TestReverseComplement tests the reverse complement function
|
|
func TestReverseComplement(t *testing.T) {
|
|
tests := []struct {
|
|
name string
|
|
seq string
|
|
k int
|
|
expected string // expected reverse complement sequence
|
|
}{
|
|
{
|
|
name: "ACGT -> ACGT (palindrome)",
|
|
seq: "ACGT",
|
|
k: 4,
|
|
expected: "ACGT",
|
|
},
|
|
{
|
|
name: "AAAA -> TTTT",
|
|
seq: "AAAA",
|
|
k: 4,
|
|
expected: "TTTT",
|
|
},
|
|
{
|
|
name: "TTTT -> AAAA",
|
|
seq: "TTTT",
|
|
k: 4,
|
|
expected: "AAAA",
|
|
},
|
|
{
|
|
name: "CCCC -> GGGG",
|
|
seq: "CCCC",
|
|
k: 4,
|
|
expected: "GGGG",
|
|
},
|
|
{
|
|
name: "AACG -> CGTT",
|
|
seq: "AACG",
|
|
k: 4,
|
|
expected: "CGTT",
|
|
},
|
|
{
|
|
name: "AC -> GT",
|
|
seq: "AC",
|
|
k: 2,
|
|
expected: "GT",
|
|
},
|
|
{
|
|
name: "ACGTACGT -> ACGTACGT (palindrome)",
|
|
seq: "ACGTACGT",
|
|
k: 8,
|
|
expected: "ACGTACGT",
|
|
},
|
|
}
|
|
|
|
for _, tt := range tests {
|
|
t.Run(tt.name, func(t *testing.T) {
|
|
// Encode the input sequence
|
|
kmers := EncodeKmers([]byte(tt.seq), tt.k, nil)
|
|
if len(kmers) != 1 {
|
|
t.Fatalf("expected 1 k-mer, got %d", len(kmers))
|
|
}
|
|
|
|
// Compute reverse complement
|
|
rc := ReverseComplement(kmers[0], tt.k)
|
|
|
|
// Encode the expected reverse complement
|
|
expectedKmers := EncodeKmers([]byte(tt.expected), tt.k, nil)
|
|
if len(expectedKmers) != 1 {
|
|
t.Fatalf("expected 1 k-mer for expected, got %d", len(expectedKmers))
|
|
}
|
|
|
|
if rc != expectedKmers[0] {
|
|
t.Errorf("ReverseComplement(%s) = %d (0b%b), want %d (0b%b) for %s",
|
|
tt.seq, rc, rc, expectedKmers[0], expectedKmers[0], tt.expected)
|
|
}
|
|
})
|
|
}
|
|
}
|
|
|
|
// TestReverseComplementInvolution tests that RC(RC(x)) = x
|
|
func TestReverseComplementInvolution(t *testing.T) {
|
|
testSeqs := []string{"ACGT", "AAAA", "TTTT", "ACGTACGT", "AACGTTGC", "AC", "ACGTACGTACGTACGT", "ACGTACGTACGTACGTACGTACGTACGTACGT"}
|
|
|
|
for _, seq := range testSeqs {
|
|
k := len(seq)
|
|
kmers := EncodeKmers([]byte(seq), k, nil)
|
|
if len(kmers) != 1 {
|
|
continue
|
|
}
|
|
|
|
original := kmers[0]
|
|
rc := ReverseComplement(original, k)
|
|
rcrc := ReverseComplement(rc, k)
|
|
|
|
if rcrc != original {
|
|
t.Errorf("RC(RC(%s)) != %s: got %d, want %d", seq, seq, rcrc, original)
|
|
}
|
|
}
|
|
}
|
|
|
|
// TestCanonicalKmer tests the normalization function
|
|
func TestCanonicalKmer(t *testing.T) {
|
|
tests := []struct {
|
|
name string
|
|
seq string
|
|
k int
|
|
}{
|
|
{"ACGT palindrome", "ACGT", 4},
|
|
{"AAAA vs TTTT", "AAAA", 4},
|
|
{"TTTT vs AAAA", "TTTT", 4},
|
|
{"AACG vs CGTT", "AACG", 4},
|
|
}
|
|
|
|
for _, tt := range tests {
|
|
t.Run(tt.name, func(t *testing.T) {
|
|
kmers := EncodeKmers([]byte(tt.seq), tt.k, nil)
|
|
if len(kmers) != 1 {
|
|
t.Fatalf("expected 1 k-mer, got %d", len(kmers))
|
|
}
|
|
|
|
kmer := kmers[0]
|
|
rc := ReverseComplement(kmer, tt.k)
|
|
normalized := CanonicalKmer(kmer, tt.k)
|
|
|
|
// Normalized should be the minimum
|
|
expectedNorm := kmer
|
|
if rc < kmer {
|
|
expectedNorm = rc
|
|
}
|
|
|
|
if normalized != expectedNorm {
|
|
t.Errorf("CanonicalKmer(%d) = %d, want %d", kmer, normalized, expectedNorm)
|
|
}
|
|
|
|
// Normalizing the RC should give the same result
|
|
normalizedRC := CanonicalKmer(rc, tt.k)
|
|
if normalizedRC != normalized {
|
|
t.Errorf("CanonicalKmer(RC) = %d, want %d (same as CanonicalKmer(fwd))", normalizedRC, normalized)
|
|
}
|
|
})
|
|
}
|
|
}
|
|
|
|
// TestEncodeCanonicalKmersBasic tests basic normalized k-mer encoding
|
|
func TestEncodeCanonicalKmersBasic(t *testing.T) {
|
|
// Test that a sequence and its reverse complement produce the same normalized k-mers
|
|
seq := []byte("AACGTT")
|
|
revComp := []byte("AACGTT") // This is a palindrome!
|
|
|
|
k := 4
|
|
kmers1 := EncodeCanonicalKmers(seq, k, nil)
|
|
kmers2 := EncodeCanonicalKmers(revComp, k, nil)
|
|
|
|
if len(kmers1) != len(kmers2) {
|
|
t.Fatalf("length mismatch: %d vs %d", len(kmers1), len(kmers2))
|
|
}
|
|
|
|
// For a palindrome, forward and reverse should give the same k-mers
|
|
for i := range kmers1 {
|
|
if kmers1[i] != kmers2[len(kmers2)-1-i] {
|
|
t.Logf("Note: position %d differs (expected for non-palindromic sequences)", i)
|
|
}
|
|
}
|
|
}
|
|
|
|
// TestEncodeCanonicalKmersSymmetry tests that seq and its RC produce same normalized k-mers (reversed)
|
|
func TestEncodeCanonicalKmersSymmetry(t *testing.T) {
|
|
// Manually construct a sequence and its reverse complement
|
|
seq := []byte("ACGTAACCGG")
|
|
|
|
// Compute reverse complement manually
|
|
rcMap := map[byte]byte{'A': 'T', 'C': 'G', 'G': 'C', 'T': 'A'}
|
|
revComp := make([]byte, len(seq))
|
|
for i, b := range seq {
|
|
revComp[len(seq)-1-i] = rcMap[b]
|
|
}
|
|
|
|
k := 4
|
|
kmers1 := EncodeCanonicalKmers(seq, k, nil)
|
|
kmers2 := EncodeCanonicalKmers(revComp, k, nil)
|
|
|
|
if len(kmers1) != len(kmers2) {
|
|
t.Fatalf("length mismatch: %d vs %d", len(kmers1), len(kmers2))
|
|
}
|
|
|
|
// The normalized k-mers should be the same but in reverse order
|
|
for i := range kmers1 {
|
|
j := len(kmers2) - 1 - i
|
|
if kmers1[i] != kmers2[j] {
|
|
t.Errorf("position %d vs %d: %d != %d", i, j, kmers1[i], kmers2[j])
|
|
}
|
|
}
|
|
}
|
|
|
|
// TestEncodeCanonicalKmersConsistency verifies normalized k-mers match manual normalization
|
|
func TestEncodeCanonicalKmersConsistency(t *testing.T) {
|
|
seq := []byte("ACGTACGTACGTACGT")
|
|
k := 8
|
|
|
|
// Get k-mers both ways
|
|
rawKmers := EncodeKmers(seq, k, nil)
|
|
normalizedKmers := EncodeCanonicalKmers(seq, k, nil)
|
|
|
|
if len(rawKmers) != len(normalizedKmers) {
|
|
t.Fatalf("length mismatch: %d vs %d", len(rawKmers), len(normalizedKmers))
|
|
}
|
|
|
|
// Verify each normalized k-mer matches manual normalization
|
|
for i, raw := range rawKmers {
|
|
expected := CanonicalKmer(raw, k)
|
|
if normalizedKmers[i] != expected {
|
|
t.Errorf("position %d: EncodeCanonicalKmers gave %d, CanonicalKmer gave %d",
|
|
i, normalizedKmers[i], expected)
|
|
}
|
|
}
|
|
}
|
|
|
|
// BenchmarkEncodeCanonicalKmers benchmarks the normalized encoding function
|
|
func BenchmarkEncodeCanonicalKmers(b *testing.B) {
|
|
sizes := []int{100, 1000, 10000, 100000}
|
|
kSizes := []int{8, 16, 31}
|
|
|
|
for _, k := range kSizes {
|
|
for _, size := range sizes {
|
|
seq := make([]byte, size)
|
|
for i := range seq {
|
|
seq[i] = "ACGT"[i%4]
|
|
}
|
|
|
|
name := "k" + string(rune('0'+k/10)) + string(rune('0'+k%10)) + "_size" + string(rune('0'+size/10000)) + string(rune('0'+(size%10000)/1000)) + string(rune('0'+(size%1000)/100)) + string(rune('0'+(size%100)/10)) + string(rune('0'+size%10))
|
|
b.Run(name, func(b *testing.B) {
|
|
buffer := make([]uint64, 0, size)
|
|
b.ResetTimer()
|
|
b.SetBytes(int64(size))
|
|
|
|
for i := 0; i < b.N; i++ {
|
|
EncodeCanonicalKmers(seq, k, &buffer)
|
|
}
|
|
})
|
|
}
|
|
}
|
|
}
|
|
|
|
// BenchmarkReverseComplement benchmarks the reverse complement function
|
|
func BenchmarkReverseComplement(b *testing.B) {
|
|
kmer := uint64(0x06C6C6C6C6C6C6C6)
|
|
k := 31
|
|
|
|
b.ResetTimer()
|
|
for i := 0; i < b.N; i++ {
|
|
ReverseComplement(kmer, k)
|
|
}
|
|
}
|
|
|
|
// BenchmarkCanonicalKmer benchmarks the normalization function
|
|
func BenchmarkCanonicalKmer(b *testing.B) {
|
|
kmer := uint64(0x06C6C6C6C6C6C6C6)
|
|
k := 31
|
|
|
|
b.ResetTimer()
|
|
for i := 0; i < b.N; i++ {
|
|
CanonicalKmer(kmer, k)
|
|
}
|
|
}
|
|
|
|
// TestExtractSuperKmersBasic tests basic super k-mer extraction
|
|
func TestExtractSuperKmersBasic(t *testing.T) {
|
|
tests := []struct {
|
|
name string
|
|
seq string
|
|
k int
|
|
m int
|
|
validate func(*testing.T, []SuperKmer)
|
|
}{
|
|
{
|
|
name: "simple sequence",
|
|
seq: "ACGTACGTACGT",
|
|
k: 5,
|
|
m: 3,
|
|
validate: func(t *testing.T, sks []SuperKmer) {
|
|
if len(sks) == 0 {
|
|
t.Error("expected at least one super k-mer")
|
|
}
|
|
// Verify all super k-mers cover the sequence
|
|
totalLen := 0
|
|
for _, sk := range sks {
|
|
totalLen += sk.End - sk.Start
|
|
if string(sk.Sequence) != string([]byte(t.Name())[len(t.Name())-len(sk.Sequence):]) {
|
|
// Just verify Start/End matches Sequence
|
|
if string(sk.Sequence) != string([]byte("ACGTACGTACGT")[sk.Start:sk.End]) {
|
|
t.Errorf("Sequence mismatch: seq[%d:%d] != %s", sk.Start, sk.End, sk.Sequence)
|
|
}
|
|
}
|
|
}
|
|
},
|
|
},
|
|
{
|
|
name: "single k-mer sequence",
|
|
seq: "ACGTACGT",
|
|
k: 8,
|
|
m: 4,
|
|
validate: func(t *testing.T, sks []SuperKmer) {
|
|
if len(sks) != 1 {
|
|
t.Errorf("expected exactly 1 super k-mer for len(seq)==k, got %d", len(sks))
|
|
}
|
|
if len(sks) > 0 {
|
|
if sks[0].Start != 0 || sks[0].End != 8 {
|
|
t.Errorf("expected [0:8], got [%d:%d]", sks[0].Start, sks[0].End)
|
|
}
|
|
}
|
|
},
|
|
},
|
|
{
|
|
name: "repeating sequence",
|
|
seq: "AAAAAAAAAA",
|
|
k: 5,
|
|
m: 3,
|
|
validate: func(t *testing.T, sks []SuperKmer) {
|
|
// Repeating A should have same minimizer (AAA) everywhere
|
|
if len(sks) != 1 {
|
|
t.Errorf("expected 1 super k-mer for repeating sequence, got %d", len(sks))
|
|
}
|
|
if len(sks) > 0 {
|
|
if sks[0].Start != 0 || sks[0].End != 10 {
|
|
t.Errorf("expected super k-mer to cover entire sequence [0:10], got [%d:%d]",
|
|
sks[0].Start, sks[0].End)
|
|
}
|
|
}
|
|
},
|
|
},
|
|
}
|
|
|
|
for _, tt := range tests {
|
|
t.Run(tt.name, func(t *testing.T) {
|
|
result := ExtractSuperKmers([]byte(tt.seq), tt.k, tt.m, nil)
|
|
tt.validate(t, result)
|
|
})
|
|
}
|
|
}
|
|
|
|
// TestExtractSuperKmersEdgeCases tests edge cases and error handling
|
|
func TestExtractSuperKmersEdgeCases(t *testing.T) {
|
|
tests := []struct {
|
|
name string
|
|
seq string
|
|
k int
|
|
m int
|
|
expectNil bool
|
|
}{
|
|
{"empty sequence", "", 5, 3, true},
|
|
{"seq shorter than k", "ACG", 5, 3, true},
|
|
{"m < 1", "ACGTACGT", 5, 0, true},
|
|
{"m >= k", "ACGTACGT", 5, 5, true},
|
|
{"m == k-1 (valid)", "ACGTACGT", 5, 4, false},
|
|
{"k < 2", "ACGTACGT", 1, 1, true},
|
|
{"k > 31", "ACGTACGTACGTACGTACGTACGTACGTACGT", 32, 16, true},
|
|
{"k == 31 (valid)", "ACGTACGTACGTACGTACGTACGTACGTACG", 31, 16, false},
|
|
{"seq == k (valid)", "ACGTACGT", 8, 4, false},
|
|
}
|
|
|
|
for _, tt := range tests {
|
|
t.Run(tt.name, func(t *testing.T) {
|
|
result := ExtractSuperKmers([]byte(tt.seq), tt.k, tt.m, nil)
|
|
if tt.expectNil && result != nil {
|
|
t.Errorf("expected nil, got %v", result)
|
|
}
|
|
if !tt.expectNil && result == nil {
|
|
t.Errorf("expected non-nil result, got nil")
|
|
}
|
|
})
|
|
}
|
|
}
|
|
|
|
// TestExtractSuperKmersBoundaries verifies Start/End positions
|
|
func TestExtractSuperKmersBoundaries(t *testing.T) {
|
|
seq := []byte("ACGTACGTGGGGAAAA")
|
|
k := 6
|
|
m := 3
|
|
|
|
result := ExtractSuperKmers(seq, k, m, nil)
|
|
|
|
if result == nil {
|
|
t.Fatal("expected non-nil result")
|
|
}
|
|
|
|
// Verify each super k-mer
|
|
for i, sk := range result {
|
|
// Verify Start < End
|
|
if sk.Start >= sk.End {
|
|
t.Errorf("super k-mer %d: Start (%d) >= End (%d)", i, sk.Start, sk.End)
|
|
}
|
|
|
|
// Verify Sequence matches seq[Start:End]
|
|
expected := string(seq[sk.Start:sk.End])
|
|
actual := string(sk.Sequence)
|
|
if actual != expected {
|
|
t.Errorf("super k-mer %d: Sequence mismatch: got %s, want %s", i, actual, expected)
|
|
}
|
|
|
|
// Verify bounds are within sequence
|
|
if sk.Start < 0 || sk.End > len(seq) {
|
|
t.Errorf("super k-mer %d: bounds [%d:%d] outside sequence length %d",
|
|
i, sk.Start, sk.End, len(seq))
|
|
}
|
|
|
|
// Verify minimum length is k
|
|
if sk.End-sk.Start < k {
|
|
t.Errorf("super k-mer %d: length %d < k=%d", i, sk.End-sk.Start, k)
|
|
}
|
|
}
|
|
|
|
// Verify super k-mers can overlap (by up to k-1 bases) but must be ordered
|
|
// and the overlap should not exceed k-1
|
|
for i := 0; i < len(result)-1; i++ {
|
|
// Next super k-mer should start before or at the end of current one
|
|
// Overlap is allowed and expected
|
|
overlap := result[i].End - result[i+1].Start
|
|
if overlap > k-1 {
|
|
t.Errorf("super k-mers %d and %d overlap by %d bases (max allowed: %d): [%d:%d] and [%d:%d]",
|
|
i, i+1, overlap, k-1, result[i].Start, result[i].End, result[i+1].Start, result[i+1].End)
|
|
}
|
|
// But the start positions should be ordered
|
|
if result[i+1].Start < result[i].Start {
|
|
t.Errorf("super k-mers %d and %d are not ordered: [%d:%d] and [%d:%d]",
|
|
i, i+1, result[i].Start, result[i].End, result[i+1].Start, result[i+1].End)
|
|
}
|
|
}
|
|
}
|
|
|
|
// TestExtractSuperKmersBufferReuse tests buffer parameter
|
|
func TestExtractSuperKmersBufferReuse(t *testing.T) {
|
|
seq := []byte("ACGTACGTACGTACGT")
|
|
k := 6
|
|
m := 3
|
|
|
|
// First call without buffer
|
|
result1 := ExtractSuperKmers(seq, k, m, nil)
|
|
|
|
// Second call with buffer
|
|
buffer := make([]SuperKmer, 0, 100)
|
|
result2 := ExtractSuperKmers(seq, k, m, &buffer)
|
|
|
|
if len(result1) != len(result2) {
|
|
t.Errorf("buffer reuse: length mismatch %d vs %d", len(result1), len(result2))
|
|
}
|
|
|
|
for i := range result1 {
|
|
if result1[i].Minimizer != result2[i].Minimizer {
|
|
t.Errorf("position %d: minimizer mismatch", i)
|
|
}
|
|
if result1[i].Start != result2[i].Start || result1[i].End != result2[i].End {
|
|
t.Errorf("position %d: boundary mismatch", i)
|
|
}
|
|
}
|
|
|
|
// Test multiple calls with same buffer
|
|
for i := 0; i < 10; i++ {
|
|
result3 := ExtractSuperKmers(seq, k, m, &buffer)
|
|
if len(result3) != len(result1) {
|
|
t.Errorf("iteration %d: length mismatch", i)
|
|
}
|
|
}
|
|
}
|
|
|
|
// TestExtractSuperKmersCanonical verifies minimizers are canonical
|
|
func TestExtractSuperKmersCanonical(t *testing.T) {
|
|
seq := []byte("ACGTACGTACGT")
|
|
k := 6
|
|
m := 3
|
|
|
|
result := ExtractSuperKmers(seq, k, m, nil)
|
|
|
|
if result == nil {
|
|
t.Fatal("expected non-nil result")
|
|
}
|
|
|
|
for i, sk := range result {
|
|
// Verify the minimizer is indeed canonical (equal to its normalized form)
|
|
normalized := CanonicalKmer(sk.Minimizer, m)
|
|
if sk.Minimizer != normalized {
|
|
t.Errorf("super k-mer %d: minimizer %d is not canonical (normalized: %d)",
|
|
i, sk.Minimizer, normalized)
|
|
}
|
|
|
|
// The minimizer should be <= its reverse complement
|
|
rc := ReverseComplement(sk.Minimizer, m)
|
|
if sk.Minimizer > rc {
|
|
t.Errorf("super k-mer %d: minimizer %d > reverse complement %d (not canonical)",
|
|
i, sk.Minimizer, rc)
|
|
}
|
|
}
|
|
}
|
|
|
|
// TestExtractSuperKmersVariousKM tests various k and m combinations
|
|
func TestExtractSuperKmersVariousKM(t *testing.T) {
|
|
seq := []byte("ACGTACGTACGTACGTACGTACGT")
|
|
|
|
configs := []struct {
|
|
k int
|
|
m int
|
|
}{
|
|
{5, 3},
|
|
{8, 4},
|
|
{10, 5},
|
|
{16, 8},
|
|
{21, 11},
|
|
{6, 5}, // m = k-1
|
|
{4, 2},
|
|
}
|
|
|
|
for _, cfg := range configs {
|
|
t.Run("k"+string(rune('0'+cfg.k/10))+string(rune('0'+cfg.k%10))+"_m"+string(rune('0'+cfg.m/10))+string(rune('0'+cfg.m%10)), func(t *testing.T) {
|
|
if len(seq) < cfg.k {
|
|
t.Skip("sequence too short for this k")
|
|
}
|
|
|
|
result := ExtractSuperKmers(seq, cfg.k, cfg.m, nil)
|
|
|
|
if result == nil {
|
|
t.Fatal("expected non-nil result for valid parameters")
|
|
}
|
|
|
|
if len(result) == 0 {
|
|
t.Error("expected at least one super k-mer")
|
|
}
|
|
|
|
// Verify each super k-mer has minimum length k
|
|
for i, sk := range result {
|
|
length := sk.End - sk.Start
|
|
if length < cfg.k {
|
|
t.Errorf("super k-mer %d has length %d < k=%d", i, length, cfg.k)
|
|
}
|
|
}
|
|
})
|
|
}
|
|
}
|
|
|
|
// TestKmerErrorMarkers tests the error marker functionality
|
|
func TestKmerErrorMarkers(t *testing.T) {
|
|
// Test with a 31-mer (max odd k-mer that fits in 62 bits)
|
|
kmer31 := uint64(0x1FFFFFFFFFFFFFFF) // All 62 bits set (31 * 2)
|
|
|
|
tests := []struct {
|
|
name string
|
|
kmer uint64
|
|
errorCode uint64
|
|
expected uint64
|
|
}{
|
|
{
|
|
name: "no error",
|
|
kmer: kmer31,
|
|
errorCode: 0,
|
|
expected: kmer31,
|
|
},
|
|
{
|
|
name: "error type 1",
|
|
kmer: kmer31,
|
|
errorCode: 1,
|
|
expected: kmer31 | (0b01 << 62),
|
|
},
|
|
{
|
|
name: "error type 2",
|
|
kmer: kmer31,
|
|
errorCode: 2,
|
|
expected: kmer31 | (0b10 << 62),
|
|
},
|
|
{
|
|
name: "error type 3",
|
|
kmer: kmer31,
|
|
errorCode: 3,
|
|
expected: kmer31 | (0b11 << 62),
|
|
},
|
|
}
|
|
|
|
for _, tt := range tests {
|
|
t.Run(tt.name, func(t *testing.T) {
|
|
// Set error
|
|
marked := SetKmerError(tt.kmer, tt.errorCode)
|
|
if marked != tt.expected {
|
|
t.Errorf("SetKmerError: got 0x%016X, want 0x%016X", marked, tt.expected)
|
|
}
|
|
|
|
// Get error
|
|
extractedError := GetKmerError(marked)
|
|
if extractedError != tt.errorCode {
|
|
t.Errorf("GetKmerError: got 0x%016X, want 0x%016X", extractedError, tt.errorCode)
|
|
}
|
|
|
|
// Clear error
|
|
cleared := ClearKmerError(marked)
|
|
if cleared != tt.kmer {
|
|
t.Errorf("ClearKmerError: got 0x%016X, want 0x%016X", cleared, tt.kmer)
|
|
}
|
|
|
|
// Verify sequence bits are preserved
|
|
if (marked & KmerSequenceMask) != tt.kmer {
|
|
t.Errorf("Sequence bits corrupted: got 0x%016X, want 0x%016X",
|
|
marked&KmerSequenceMask, tt.kmer)
|
|
}
|
|
})
|
|
}
|
|
}
|
|
|
|
// TestKmerErrorMarkersWithRealKmers tests error markers with actual k-mer encoding
|
|
func TestKmerErrorMarkersWithRealKmers(t *testing.T) {
|
|
// Encode a real 31-mer
|
|
seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG") // 31 bases
|
|
k := 31
|
|
|
|
kmers := EncodeKmers(seq, k, nil)
|
|
if len(kmers) != 1 {
|
|
t.Fatalf("Expected 1 k-mer, got %d", len(kmers))
|
|
}
|
|
|
|
originalKmer := kmers[0]
|
|
|
|
// Test each error type
|
|
for i, errorCode := range []uint64{0, 1, 2, 3} {
|
|
t.Run("error_code_"+string(rune('0'+i)), func(t *testing.T) {
|
|
// Mark with error
|
|
marked := SetKmerError(originalKmer, errorCode)
|
|
|
|
// Verify error can be extracted
|
|
if GetKmerError(marked) != errorCode {
|
|
t.Errorf("Error code mismatch: got 0x%X, want 0x%X",
|
|
GetKmerError(marked), errorCode)
|
|
}
|
|
|
|
// Verify sequence is preserved
|
|
if ClearKmerError(marked) != originalKmer {
|
|
t.Errorf("Original k-mer not preserved after marking")
|
|
}
|
|
|
|
// Verify normalization works with error bits cleared
|
|
normalized1 := CanonicalKmer(originalKmer, k)
|
|
normalized2 := CanonicalKmer(ClearKmerError(marked), k)
|
|
if normalized1 != normalized2 {
|
|
t.Errorf("Normalization affected by error bits")
|
|
}
|
|
})
|
|
}
|
|
}
|
|
|
|
// TestKmerErrorMarkersConstants verifies the mask constant definitions
|
|
func TestKmerErrorMarkersConstants(t *testing.T) {
|
|
// Verify error mask covers exactly the top 2 bits
|
|
if KmerErrorMask != (0b11 << 62) {
|
|
t.Errorf("KmerErrorMask wrong value: 0x%016X", KmerErrorMask)
|
|
}
|
|
|
|
// Verify sequence mask is the complement
|
|
if KmerSequenceMask != ^KmerErrorMask {
|
|
t.Errorf("KmerSequenceMask should be complement of KmerErrorMask")
|
|
}
|
|
|
|
// Verify masks are mutually exclusive
|
|
if (KmerErrorMask & KmerSequenceMask) != 0 {
|
|
t.Errorf("Masks should be mutually exclusive")
|
|
}
|
|
|
|
// Verify masks cover all bits
|
|
if (KmerErrorMask | KmerSequenceMask) != ^uint64(0) {
|
|
t.Errorf("Masks should cover all 64 bits")
|
|
}
|
|
|
|
// Verify error code API
|
|
testKmer := uint64(0x06C6C6C6C6C6C6C6)
|
|
for code := uint64(0); code <= 3; code++ {
|
|
marked := SetKmerError(testKmer, code)
|
|
extracted := GetKmerError(marked)
|
|
if extracted != code {
|
|
t.Errorf("Error code %d not preserved: got %d", code, extracted)
|
|
}
|
|
}
|
|
}
|
|
|
|
// TestReverseComplementPreservesErrorBits tests that RC preserves error markers
|
|
func TestReverseComplementPreservesErrorBits(t *testing.T) {
|
|
// Test with a 31-mer
|
|
seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
|
|
k := 31
|
|
|
|
kmers := EncodeKmers(seq, k, nil)
|
|
if len(kmers) != 1 {
|
|
t.Fatalf("Expected 1 k-mer, got %d", len(kmers))
|
|
}
|
|
|
|
originalKmer := kmers[0]
|
|
|
|
// Test each error code
|
|
errorCodes := []uint64{0, 1, 2, 3}
|
|
|
|
for i, errCode := range errorCodes {
|
|
t.Run("error_code_"+string(rune('0'+i)), func(t *testing.T) {
|
|
// Mark k-mer with error
|
|
marked := SetKmerError(originalKmer, errCode)
|
|
|
|
// Compute reverse complement
|
|
rc := ReverseComplement(marked, k)
|
|
|
|
// Verify error bits are preserved
|
|
extractedError := GetKmerError(rc)
|
|
if extractedError != errCode {
|
|
t.Errorf("Error bits not preserved: got 0x%X, want 0x%X", extractedError, errCode)
|
|
}
|
|
|
|
// Verify sequence was reverse complemented correctly
|
|
// (clear error bits and check RC property)
|
|
cleanOriginal := ClearKmerError(originalKmer)
|
|
cleanRC := ClearKmerError(rc)
|
|
expectedRC := ReverseComplement(cleanOriginal, k)
|
|
|
|
if cleanRC != expectedRC {
|
|
t.Errorf("Sequence not reverse complemented correctly")
|
|
}
|
|
|
|
// Verify RC(RC(x)) = x (involution property with error bits)
|
|
rcrc := ReverseComplement(rc, k)
|
|
if rcrc != marked {
|
|
t.Errorf("RC(RC(x)) != x: got 0x%016X, want 0x%016X", rcrc, marked)
|
|
}
|
|
})
|
|
}
|
|
}
|
|
|
|
// TestCanonicalKmerWithErrorBits tests that CanonicalKmer works with error bits
|
|
func TestCanonicalKmerWithErrorBits(t *testing.T) {
|
|
seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
|
|
k := 31
|
|
|
|
kmers := EncodeKmers(seq, k, nil)
|
|
if len(kmers) != 1 {
|
|
t.Fatalf("Expected 1 k-mer, got %d", len(kmers))
|
|
}
|
|
|
|
originalKmer := kmers[0]
|
|
|
|
// Test with different error codes
|
|
for i, errCode := range []uint64{1, 2, 3} {
|
|
t.Run("error_code_"+string(rune('0'+i+1)), func(t *testing.T) {
|
|
marked := SetKmerError(originalKmer, errCode)
|
|
|
|
// Normalize should work on the sequence part
|
|
normalized := CanonicalKmer(marked, k)
|
|
|
|
// Error bits should be preserved
|
|
if GetKmerError(normalized) != errCode {
|
|
t.Errorf("Error bits lost during normalization")
|
|
}
|
|
|
|
// The sequence part should be normalized
|
|
cleanNormalized := ClearKmerError(normalized)
|
|
expectedNormalized := CanonicalKmer(ClearKmerError(marked), k)
|
|
|
|
if cleanNormalized != expectedNormalized {
|
|
t.Errorf("Normalization incorrect with error bits present")
|
|
}
|
|
})
|
|
}
|
|
}
|
|
|
|
// TestKmerErrorMarkersOddKmers tests that error markers work for all odd k ≤ 31
|
|
func TestKmerErrorMarkersOddKmers(t *testing.T) {
|
|
oddKSizes := []int{1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31}
|
|
|
|
for _, k := range oddKSizes {
|
|
t.Run("k="+string(rune('0'+k/10))+string(rune('0'+k%10)), func(t *testing.T) {
|
|
// Create a sequence of length k
|
|
seq := make([]byte, k)
|
|
for i := range seq {
|
|
seq[i] = "ACGT"[i%4]
|
|
}
|
|
|
|
kmers := EncodeKmers(seq, k, nil)
|
|
if len(kmers) != 1 {
|
|
t.Fatalf("Expected 1 k-mer, got %d", len(kmers))
|
|
}
|
|
|
|
originalKmer := kmers[0]
|
|
|
|
// Verify that k*2 bits fit in 62 bits (top 2 bits should be free)
|
|
maxValue := uint64(1)<<(k*2) - 1
|
|
if originalKmer > maxValue {
|
|
t.Errorf("k-mer exceeds expected bit range for k=%d", k)
|
|
}
|
|
|
|
// Test all error codes
|
|
for _, errCode := range []uint64{1, 2, 3} {
|
|
marked := SetKmerError(originalKmer, errCode)
|
|
|
|
// Verify error is set
|
|
if GetKmerError(marked) != errCode {
|
|
t.Errorf("Error code not preserved for k=%d", k)
|
|
}
|
|
|
|
// Verify sequence is preserved
|
|
if ClearKmerError(marked) != originalKmer {
|
|
t.Errorf("Sequence corrupted for k=%d", k)
|
|
}
|
|
}
|
|
})
|
|
}
|
|
}
|
|
|
|
// TestIterKmers tests the k-mer iterator
|
|
func TestIterKmers(t *testing.T) {
|
|
seq := []byte("ACGTACGT")
|
|
k := 4
|
|
|
|
// Collect k-mers via iterator
|
|
var iterKmers []uint64
|
|
for kmer := range IterKmers(seq, k) {
|
|
iterKmers = append(iterKmers, kmer)
|
|
}
|
|
|
|
// Compare with slice-based version
|
|
sliceKmers := EncodeKmers(seq, k, nil)
|
|
|
|
if len(iterKmers) != len(sliceKmers) {
|
|
t.Errorf("length mismatch: iter=%d, slice=%d", len(iterKmers), len(sliceKmers))
|
|
}
|
|
|
|
for i := range iterKmers {
|
|
if iterKmers[i] != sliceKmers[i] {
|
|
t.Errorf("position %d: iter=%d, slice=%d", i, iterKmers[i], sliceKmers[i])
|
|
}
|
|
}
|
|
}
|
|
|
|
// TestIterCanonicalKmers tests the normalized k-mer iterator
|
|
func TestIterCanonicalKmers(t *testing.T) {
|
|
seq := []byte("ACGTACGTACGT")
|
|
k := 6
|
|
|
|
// Collect k-mers via iterator
|
|
var iterKmers []uint64
|
|
for kmer := range IterCanonicalKmers(seq, k) {
|
|
iterKmers = append(iterKmers, kmer)
|
|
}
|
|
|
|
// Compare with slice-based version
|
|
sliceKmers := EncodeCanonicalKmers(seq, k, nil)
|
|
|
|
if len(iterKmers) != len(sliceKmers) {
|
|
t.Errorf("length mismatch: iter=%d, slice=%d", len(iterKmers), len(sliceKmers))
|
|
}
|
|
|
|
for i := range iterKmers {
|
|
if iterKmers[i] != sliceKmers[i] {
|
|
t.Errorf("position %d: iter=%d, slice=%d", i, iterKmers[i], sliceKmers[i])
|
|
}
|
|
}
|
|
}
|
|
|
|
// TestIterKmersEarlyExit tests early exit from iterator
|
|
func TestIterKmersEarlyExit(t *testing.T) {
|
|
seq := []byte("ACGTACGTACGTACGT")
|
|
k := 4
|
|
|
|
count := 0
|
|
for range IterKmers(seq, k) {
|
|
count++
|
|
if count == 5 {
|
|
break
|
|
}
|
|
}
|
|
|
|
if count != 5 {
|
|
t.Errorf("expected to process 5 k-mers, got %d", count)
|
|
}
|
|
}
|
|
|
|
// BenchmarkIterKmers benchmarks the k-mer iterator vs slice-based
|
|
func BenchmarkIterKmers(b *testing.B) {
|
|
seq := make([]byte, 10000)
|
|
for i := range seq {
|
|
seq[i] = "ACGT"[i%4]
|
|
}
|
|
k := 21
|
|
|
|
b.Run("Iterator", func(b *testing.B) {
|
|
b.ResetTimer()
|
|
for i := 0; i < b.N; i++ {
|
|
count := 0
|
|
for range IterKmers(seq, k) {
|
|
count++
|
|
}
|
|
}
|
|
})
|
|
|
|
b.Run("Slice", func(b *testing.B) {
|
|
var buffer []uint64
|
|
b.ResetTimer()
|
|
for i := 0; i < b.N; i++ {
|
|
buffer = EncodeKmers(seq, k, &buffer)
|
|
}
|
|
})
|
|
}
|
|
|
|
// BenchmarkIterCanonicalKmers benchmarks the normalized iterator
|
|
func BenchmarkIterCanonicalKmers(b *testing.B) {
|
|
seq := make([]byte, 10000)
|
|
for i := range seq {
|
|
seq[i] = "ACGT"[i%4]
|
|
}
|
|
k := 21
|
|
|
|
b.Run("Iterator", func(b *testing.B) {
|
|
b.ResetTimer()
|
|
for i := 0; i < b.N; i++ {
|
|
count := 0
|
|
for range IterCanonicalKmers(seq, k) {
|
|
count++
|
|
}
|
|
}
|
|
})
|
|
|
|
b.Run("Slice", func(b *testing.B) {
|
|
var buffer []uint64
|
|
b.ResetTimer()
|
|
for i := 0; i < b.N; i++ {
|
|
buffer = EncodeCanonicalKmers(seq, k, &buffer)
|
|
}
|
|
})
|
|
}
|
|
|
|
// BenchmarkExtractSuperKmers benchmarks the super k-mer extraction
|
|
func BenchmarkExtractSuperKmers(b *testing.B) {
|
|
sizes := []int{100, 1000, 10000, 100000}
|
|
configs := []struct {
|
|
k int
|
|
m int
|
|
}{
|
|
{21, 11},
|
|
{31, 15},
|
|
{16, 8},
|
|
{10, 5},
|
|
}
|
|
|
|
for _, cfg := range configs {
|
|
for _, size := range sizes {
|
|
seq := make([]byte, size)
|
|
for i := range seq {
|
|
seq[i] = "ACGT"[i%4]
|
|
}
|
|
|
|
name := "k" + string(rune('0'+cfg.k/10)) + string(rune('0'+cfg.k%10)) +
|
|
"_m" + string(rune('0'+cfg.m/10)) + string(rune('0'+cfg.m%10)) +
|
|
"_size" + string(rune('0'+(size/10000)%10)) +
|
|
string(rune('0'+(size/1000)%10)) +
|
|
string(rune('0'+(size/100)%10)) +
|
|
string(rune('0'+(size/10)%10)) +
|
|
string(rune('0'+size%10))
|
|
|
|
b.Run(name, func(b *testing.B) {
|
|
buffer := make([]SuperKmer, 0, size/cfg.k)
|
|
b.ResetTimer()
|
|
b.SetBytes(int64(size))
|
|
|
|
for i := 0; i < b.N; i++ {
|
|
ExtractSuperKmers(seq, cfg.k, cfg.m, &buffer)
|
|
}
|
|
})
|
|
}
|
|
}
|
|
}
|