Files
obitools4/doc/_book/the-obitools.html

555 lines
28 KiB
HTML
Raw Blame History

This file contains invisible Unicode characters
This file contains invisible Unicode characters that are indistinguishable to humans but may be processed differently by a computer. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.
This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.
<!DOCTYPE html>
<html lang="" xml:lang="">
<head>
<meta charset="utf-8" />
<meta http-equiv="X-UA-Compatible" content="IE=edge" />
<title>The GO OBITools</title>
<meta name="description" content="Description of the principles used into the GO implementation of OBITools." />
<meta name="generator" content="bookdown 0.29 and GitBook 2.6.7" />
<meta property="og:title" content="The GO OBITools" />
<meta property="og:type" content="book" />
<meta property="og:description" content="Description of the principles used into the GO implementation of OBITools." />
<meta name="github-repo" content="seankross/bookdown-start" />
<meta name="twitter:card" content="summary" />
<meta name="twitter:title" content="The GO OBITools" />
<meta name="twitter:description" content="Description of the principles used into the GO implementation of OBITools." />
<meta name="author" content="SEric Coissac" />
<meta name="date" content="2022-08-25" />
<meta name="viewport" content="width=device-width, initial-scale=1" />
<meta name="apple-mobile-web-app-capable" content="yes" />
<meta name="apple-mobile-web-app-status-bar-style" content="black" />
<link rel="next" href="the-obitools-commands.html"/>
<script src="book_assets/jquery-3.6.0/jquery-3.6.0.min.js"></script>
<script src="https://cdn.jsdelivr.net/npm/fuse.js@6.4.6/dist/fuse.min.js"></script>
<link href="book_assets/gitbook-2.6.7/css/style.css" rel="stylesheet" />
<link href="book_assets/gitbook-2.6.7/css/plugin-table.css" rel="stylesheet" />
<link href="book_assets/gitbook-2.6.7/css/plugin-bookdown.css" rel="stylesheet" />
<link href="book_assets/gitbook-2.6.7/css/plugin-highlight.css" rel="stylesheet" />
<link href="book_assets/gitbook-2.6.7/css/plugin-search.css" rel="stylesheet" />
<link href="book_assets/gitbook-2.6.7/css/plugin-fontsettings.css" rel="stylesheet" />
<link href="book_assets/gitbook-2.6.7/css/plugin-clipboard.css" rel="stylesheet" />
<link href="book_assets/anchor-sections-1.1.0/anchor-sections.css" rel="stylesheet" />
<link href="book_assets/anchor-sections-1.1.0/anchor-sections-hash.css" rel="stylesheet" />
<script src="book_assets/anchor-sections-1.1.0/anchor-sections.js"></script>
<style type="text/css">
pre > code.sourceCode { white-space: pre; position: relative; }
pre > code.sourceCode > span { display: inline-block; line-height: 1.25; }
pre > code.sourceCode > span:empty { height: 1.2em; }
.sourceCode { overflow: visible; }
code.sourceCode > span { color: inherit; text-decoration: inherit; }
pre.sourceCode { margin: 0; }
@media screen {
div.sourceCode { overflow: auto; }
}
@media print {
pre > code.sourceCode { white-space: pre-wrap; }
pre > code.sourceCode > span { text-indent: -5em; padding-left: 5em; }
}
pre.numberSource code
{ counter-reset: source-line 0; }
pre.numberSource code > span
{ position: relative; left: -4em; counter-increment: source-line; }
pre.numberSource code > span > a:first-child::before
{ content: counter(source-line);
position: relative; left: -1em; text-align: right; vertical-align: baseline;
border: none; display: inline-block;
-webkit-touch-callout: none; -webkit-user-select: none;
-khtml-user-select: none; -moz-user-select: none;
-ms-user-select: none; user-select: none;
padding: 0 4px; width: 4em;
color: #aaaaaa;
}
pre.numberSource { margin-left: 3em; border-left: 1px solid #aaaaaa; padding-left: 4px; }
div.sourceCode
{ }
@media screen {
pre > code.sourceCode > span > a:first-child::before { text-decoration: underline; }
}
code span.al { color: #ff0000; font-weight: bold; } /* Alert */
code span.an { color: #60a0b0; font-weight: bold; font-style: italic; } /* Annotation */
code span.at { color: #7d9029; } /* Attribute */
code span.bn { color: #40a070; } /* BaseN */
code span.bu { } /* BuiltIn */
code span.cf { color: #007020; font-weight: bold; } /* ControlFlow */
code span.ch { color: #4070a0; } /* Char */
code span.cn { color: #880000; } /* Constant */
code span.co { color: #60a0b0; font-style: italic; } /* Comment */
code span.cv { color: #60a0b0; font-weight: bold; font-style: italic; } /* CommentVar */
code span.do { color: #ba2121; font-style: italic; } /* Documentation */
code span.dt { color: #902000; } /* DataType */
code span.dv { color: #40a070; } /* DecVal */
code span.er { color: #ff0000; font-weight: bold; } /* Error */
code span.ex { } /* Extension */
code span.fl { color: #40a070; } /* Float */
code span.fu { color: #06287e; } /* Function */
code span.im { } /* Import */
code span.in { color: #60a0b0; font-weight: bold; font-style: italic; } /* Information */
code span.kw { color: #007020; font-weight: bold; } /* Keyword */
code span.op { color: #666666; } /* Operator */
code span.ot { color: #007020; } /* Other */
code span.pp { color: #bc7a00; } /* Preprocessor */
code span.sc { color: #4070a0; } /* SpecialChar */
code span.ss { color: #bb6688; } /* SpecialString */
code span.st { color: #4070a0; } /* String */
code span.va { color: #19177c; } /* Variable */
code span.vs { color: #4070a0; } /* VerbatimString */
code span.wa { color: #60a0b0; font-weight: bold; font-style: italic; } /* Warning */
</style>
</head>
<body>
<div class="book without-animation with-summary font-size-2 font-family-1" data-basepath=".">
<div class="book-summary">
<nav role="navigation">
<ul class="summary">
<li class="chapter" data-level="1" data-path="the-obitools.html"><a href="the-obitools.html"><i class="fa fa-check"></i><b>1</b> The OBITools</a>
<ul>
<li class="chapter" data-level="1.1" data-path="the-obitools.html"><a href="the-obitools.html#aims-of-obitools"><i class="fa fa-check"></i><b>1.1</b> Aims of <em>OBITools</em></a></li>
<li class="chapter" data-level="1.2" data-path="the-obitools.html"><a href="the-obitools.html#file-formats-usable-with-obitools"><i class="fa fa-check"></i><b>1.2</b> File formats usable with <em>OBITools</em></a>
<ul>
<li class="chapter" data-level="1.2.1" data-path="the-obitools.html"><a href="the-obitools.html#the-sequence-files"><i class="fa fa-check"></i><b>1.2.1</b> The sequence files</a></li>
<li class="chapter" data-level="1.2.2" data-path="the-obitools.html"><a href="the-obitools.html#the-iupac-code"><i class="fa fa-check"></i><b>1.2.2</b> The IUPAC Code</a></li>
<li class="chapter" data-level="1.2.3" data-path="the-obitools.html"><a href="the-obitools.html#classical-fasta"><i class="fa fa-check"></i><b>1.2.3</b> The <em>fasta</em> format</a></li>
<li class="chapter" data-level="1.2.4" data-path="the-obitools.html"><a href="the-obitools.html#classical-fastq"><i class="fa fa-check"></i><b>1.2.4</b> The <em>fastq</em> sequence format</a></li>
</ul></li>
<li class="chapter" data-level="1.3" data-path="the-obitools.html"><a href="the-obitools.html#file-extension"><i class="fa fa-check"></i><b>1.3</b> File extension</a></li>
<li class="chapter" data-level="1.4" data-path="the-obitools.html"><a href="the-obitools.html#see-also"><i class="fa fa-check"></i><b>1.4</b> See also</a></li>
<li class="chapter" data-level="1.5" data-path="the-obitools.html"><a href="the-obitools.html#references"><i class="fa fa-check"></i><b>1.5</b> References</a></li>
</ul></li>
<li class="chapter" data-level="2" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html"><i class="fa fa-check"></i><b>2</b> The <em>OBITools</em> commands</a>
<ul>
<li class="chapter" data-level="2.1" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#specifying-the-input-files-to-obitools-commands"><i class="fa fa-check"></i><b>2.1</b> Specifying the input files to <em>OBITools</em> commands</a></li>
<li class="chapter" data-level="2.2" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#options-common-to-most-of-the-obitools-commands"><i class="fa fa-check"></i><b>2.2</b> Options common to most of the <em>OBITools</em> commands</a>
<ul>
<li class="chapter" data-level="2.2.1" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#specifying-input-format"><i class="fa fa-check"></i><b>2.2.1</b> Specifying input format</a></li>
<li class="chapter" data-level="2.2.2" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#specifying-output-format"><i class="fa fa-check"></i><b>2.2.2</b> Specifying output format</a></li>
<li class="chapter" data-level="2.2.3" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#format-of-the-annotations-in-fasta-and-fastq-files"><i class="fa fa-check"></i><b>2.2.3</b> Format of the annotations in Fasta and Fastq files</a></li>
</ul></li>
<li class="chapter" data-level="2.3" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#metabarcode-design-and-quality-assessment"><i class="fa fa-check"></i><b>2.3</b> Metabarcode design and quality assessment</a></li>
<li class="chapter" data-level="2.4" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#file-format-conversions"><i class="fa fa-check"></i><b>2.4</b> File format conversions</a></li>
<li class="chapter" data-level="2.5" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#sequence-annotations"><i class="fa fa-check"></i><b>2.5</b> Sequence annotations</a></li>
<li class="chapter" data-level="2.6" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#computations-on-sequences"><i class="fa fa-check"></i><b>2.6</b> Computations on sequences</a>
<ul>
<li class="chapter" data-level="2.6.1" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#obipairing"><i class="fa fa-check"></i><b>2.6.1</b> <code>obipairing</code></a></li>
</ul></li>
<li class="chapter" data-level="2.7" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#sequence-sampling-and-filtering"><i class="fa fa-check"></i><b>2.7</b> Sequence sampling and filtering</a>
<ul>
<li class="chapter" data-level="2.7.1" data-path="the-obitools-commands.html"><a href="the-obitools-commands.html#utilities"><i class="fa fa-check"></i><b>2.7.1</b> Utilities</a></li>
</ul></li>
</ul></li>
<li class="chapter" data-level="3" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html"><i class="fa fa-check"></i><b>3</b> Reference documentation for the GO <em>OBITools</em> library</a>
<ul>
<li class="chapter" data-level="3.1" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html#biosequence"><i class="fa fa-check"></i><b>3.1</b> BioSequence</a>
<ul>
<li class="chapter" data-level="3.1.1" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html#creating-new-instances"><i class="fa fa-check"></i><b>3.1.1</b> Creating new instances</a></li>
<li class="chapter" data-level="3.1.2" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html#end-of-life-of-a-biosequence-instance"><i class="fa fa-check"></i><b>3.1.2</b> End of life of a <code>BioSequence</code> instance</a></li>
<li class="chapter" data-level="3.1.3" data-path="reference-documentation-for-the-go-obitools-library.html"><a href="reference-documentation-for-the-go-obitools-library.html#accessing-to-the-elements-of-a-sequence"><i class="fa fa-check"></i><b>3.1.3</b> Accessing to the elements of a sequence</a></li>
</ul></li>
</ul></li>
<li class="chapter" data-level="4" data-path="annexes.html"><a href="annexes.html"><i class="fa fa-check"></i><b>4</b> Annexes</a>
<ul>
<li class="chapter" data-level="4.0.1" data-path="annexes.html"><a href="annexes.html#sequence-attributes"><i class="fa fa-check"></i><b>4.0.1</b> Sequence attributes</a></li>
</ul></li>
</ul>
</nav>
</div>
<div class="book-body">
<div class="body-inner">
<div class="book-header" role="navigation">
<h1>
<i class="fa fa-circle-o-notch fa-spin"></i><a href="./">The GO <em>OBITools</em></a>
</h1>
</div>
<div class="page-wrapper" tabindex="-1" role="main">
<div class="page-inner">
<section class="normal" id="section-">
<div id="header">
<h1 class="title">The GO <em>OBITools</em></h1>
<p class="author"><em>SEric Coissac</em></p>
<p class="date"><em>2022-08-25</em></p>
</div>
<div id="the-obitools" class="section level1 hasAnchor" number="1">
<h1><span class="header-section-number">1</span> The OBITools<a href="the-obitools.html#the-obitools" class="anchor-section" aria-label="Anchor link to header"></a></h1>
<div id="aims-of-obitools" class="section level2 hasAnchor" number="1.1">
<h2><span class="header-section-number">1.1</span> Aims of <em>OBITools</em><a href="the-obitools.html#aims-of-obitools" class="anchor-section" aria-label="Anchor link to header"></a></h2>
</div>
<div id="file-formats-usable-with-obitools" class="section level2 hasAnchor" number="1.2">
<h2><span class="header-section-number">1.2</span> File formats usable with <em>OBITools</em><a href="the-obitools.html#file-formats-usable-with-obitools" class="anchor-section" aria-label="Anchor link to header"></a></h2>
<div id="the-sequence-files" class="section level3 hasAnchor" number="1.2.1">
<h3><span class="header-section-number">1.2.1</span> The sequence files<a href="the-obitools.html#the-sequence-files" class="anchor-section" aria-label="Anchor link to header"></a></h3>
<p>Sequences can be stored following various format. OBITools knows some of
them. The central formats for sequence files manipulated by OBITools
scripts are the <code>fasta</code> and fastq format. OBITools extends the both
these formats by specifying a syntax to include in the definition line
data qualifying the sequence. All file formats use the <code>IUPAC</code> code for
encoding nucleotides.</p>
</div>
<div id="the-iupac-code" class="section level3 hasAnchor" number="1.2.2">
<h3><span class="header-section-number">1.2.2</span> The IUPAC Code<a href="the-obitools.html#the-iupac-code" class="anchor-section" aria-label="Anchor link to header"></a></h3>
<p>The International Union of Pure and Applied Chemistry (IUPAC_) defined
the standard code for representing protein or DNA sequences.</p>
<div id="DNA-IUPAC" class="section level4 hasAnchor" number="1.2.2.1">
<h4><span class="header-section-number">1.2.2.1</span> Nucleic IUPAC Code<a href="the-obitools.html#DNA-IUPAC" class="anchor-section" aria-label="Anchor link to header"></a></h4>
<table>
<thead>
<tr class="header">
<th><strong>Code</strong></th>
<th><strong>Nucleotide</strong></th>
</tr>
</thead>
<tbody>
<tr class="odd">
<td>A</td>
<td>Adenine</td>
</tr>
<tr class="even">
<td>C</td>
<td>Cytosine</td>
</tr>
<tr class="odd">
<td>G</td>
<td>Guanine</td>
</tr>
<tr class="even">
<td>T</td>
<td>Thymine</td>
</tr>
<tr class="odd">
<td>U</td>
<td>Uracil</td>
</tr>
<tr class="even">
<td>R</td>
<td>Purine (A or G)</td>
</tr>
<tr class="odd">
<td>Y</td>
<td>Pyrimidine (C, T, or U)</td>
</tr>
<tr class="even">
<td>M</td>
<td>C or A</td>
</tr>
<tr class="odd">
<td>K</td>
<td>T, U, or G</td>
</tr>
<tr class="even">
<td>W</td>
<td>T, U, or A</td>
</tr>
<tr class="odd">
<td>S</td>
<td>C or G</td>
</tr>
<tr class="even">
<td>B</td>
<td>C, T, U, or G (not A)</td>
</tr>
<tr class="odd">
<td>D</td>
<td>A, T, U, or G (not C)</td>
</tr>
<tr class="even">
<td>H</td>
<td>A, T, U, or C (not G)</td>
</tr>
<tr class="odd">
<td>V</td>
<td>A, C, or G (not T, not U)</td>
</tr>
<tr class="even">
<td>N</td>
<td>Any base (A, C, G, T, or U)</td>
</tr>
</tbody>
</table>
</div>
</div>
<div id="classical-fasta" class="section level3 hasAnchor" number="1.2.3">
<h3><span class="header-section-number">1.2.3</span> The <em>fasta</em> format<a href="the-obitools.html#classical-fasta" class="anchor-section" aria-label="Anchor link to header"></a></h3>
<p>The <strong>fasta format</strong> is certainly the most widely used sequence file
format. This is certainly due to its great simplicity. It was originally
created for the Lipman and Pearson <a href="http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation">FASTA
program</a>.
OBITools use in more of the classical :ref:<code>fasta</code> format an
:ref:<code>extended version</code> of this format where structured data are
included in the title line.</p>
<p>In <em>fasta</em> format a sequence is represented by a title line beginning
with a <strong><code>&gt;</code></strong> character and the sequences by itself following the
:doc:<code>iupac</code> code. The sequence is usually split other severals lines of
the same length (expect for the last one)</p>
<pre><code>&gt;my_sequence this is my pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT</code></pre>
<p>This is no special format for the title line excepting that this line
should be unique. Usually the first word following the <strong>&gt;</strong> character
is considered as the sequence identifier. The end of the title line
corresponding to a description of the sequence. Several sequences can be
concatenated in a same file. The description of the next sequence is
just pasted at the end of the record of the previous one</p>
<pre><code>&gt;sequence_A this is my first pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
&gt;sequence_B this is my second pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT
&gt;sequence_C this is my third pretty sequence
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
AACGACGTTGCAGTACGTTGCAGT</code></pre>
</div>
<div id="classical-fastq" class="section level3 hasAnchor" number="1.2.4">
<h3><span class="header-section-number">1.2.4</span> The <em>fastq</em> sequence format<a href="the-obitools.html#classical-fastq" class="anchor-section" aria-label="Anchor link to header"></a></h3>
<p>.. note::</p>
<pre><code>This article uses material from the Wikipedia article
`FASTQ format `
which is released under the
`Creative Commons Attribution-Share-Alike License 3.0 `</code></pre>
<p><strong>fastq format</strong> is a text-based format for storing both a biological
sequence (usually nucleotide sequence) and its corresponding quality
scores. Both the sequence letter and quality score are encoded with a
single ASCII character for brevity. It was originally developed at the
<code>Wellcome Trust Sanger Institute</code> to bundle a <a href="the-obitools.html#classical-fasta">fasta</a>
sequence and its quality data, but has recently become the <em>de facto</em>
standard for storing the output of high throughput sequencing
instruments such as the Illumina Genome Analyzer Illumina. [1]_</p>
<div id="format" class="section level4 hasAnchor" number="1.2.4.1">
<h4><span class="header-section-number">1.2.4.1</span> Format<a href="the-obitools.html#format" class="anchor-section" aria-label="Anchor link to header"></a></h4>
<p>A fastq file normally uses four lines per sequence.</p>
<ul>
<li>Line 1 begins with a @ character and is followed by a sequence
identifier and an <em>optional</em> description (like a :ref:<code>fasta</code> title
line).</li>
<li>Line 2 is the raw sequence letters.</li>
<li>Line 3 begins with a + character and is <em>optionally</em> followed by
the same sequence identifier (and any description) again.</li>
<li>Line 4 encodes the quality values for the sequence in Line 2, and
must contain the same number of symbols as letters in the sequence.</li>
</ul>
<p>A fastq file containing a single sequence might look like this:</p>
<pre><code>@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!&#39;&#39;*((((***+))%%%++)(%%%%).1***-+*&#39;&#39;))**55CCF&gt;&gt;&gt;&gt;&gt;&gt;CCCCCCC65</code></pre>
<p>The character ! represents the lowest quality while ~ is the
highest. Here are the quality value characters in left-to-right
increasing order of quality (<code>ASCII</code>):</p>
<pre><code>!&quot;#$%&amp;&#39;()*+,-./0123456789:;&lt;=&gt;?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~</code></pre>
<p>The original Sanger FASTQ files also allowed the sequence and quality
strings to be wrapped (split over multiple lines), but this is generally
discouraged as it can make parsing complicated due to the unfortunate
choice of “@” and “+” as markers (these characters can also occur in
the quality string).</p>
</div>
<div id="variations" class="section level4 hasAnchor" number="1.2.4.2">
<h4><span class="header-section-number">1.2.4.2</span> Variations<a href="the-obitools.html#variations" class="anchor-section" aria-label="Anchor link to header"></a></h4>
<div id="quality" class="section level5 hasAnchor" number="1.2.4.2.1">
<h5><span class="header-section-number">1.2.4.2.1</span> Quality<a href="the-obitools.html#quality" class="anchor-section" aria-label="Anchor link to header"></a></h5>
<p>A quality value <em>Q</em> is an integer mapping of <em>p</em> (i.e., the probability
that the corresponding base call is incorrect). Two different equations
have been in use. The first is the standard Sanger variant to assess
reliability of a base call, otherwise known as Phred quality score:</p>
<p><span class="math display">\[
Q_\text{sanger} = -10 \, \log_{10} p
\]</span></p>
<p>The Solexa pipeline (i.e., the software delivered with the Illumina
Genome Analyzer) earlier used a different mapping, encoding the odds
<span class="math inline">\(\mathbf{p}/(1-\mathbf{p})\)</span> instead of the probability <span class="math inline">\(\mathbf{p}\)</span>:</p>
<p><span class="math display">\[
Q_\text{solexa-prior to v.1.3} = -10 \, \log_{10} \frac{p}{1-p}
\]</span></p>
<p>Although both mappings are asymptotically identical at higher quality
values, they differ at lower quality levels (i.e., approximately
<span class="math inline">\(\mathbf{p} &gt; 0.05\)</span>, or equivalently, <span class="math inline">\(\mathbf{Q} &lt; 13\)</span>).</p>
<p>|Relationship between <em>Q</em> and <em>p</em> using the Sanger (red) and Solexa
(black) equations (described above). The vertical dotted line indicates
<span class="math inline">\(\mathbf{p}= 0.05\)</span>, or equivalently, <span class="math inline">\(Q = 13\)</span>.|</p>
</div>
</div>
<div id="encoding" class="section level4 hasAnchor" number="1.2.4.3">
<h4><span class="header-section-number">1.2.4.3</span> Encoding<a href="the-obitools.html#encoding" class="anchor-section" aria-label="Anchor link to header"></a></h4>
<ul>
<li>Sanger format can encode a Phred quality score from 0 to 93 using
ASCII 33 to 126 (although in raw read data the Phred quality score
rarely exceeds 60, higher scores are possible in assemblies or read
maps).</li>
<li>Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality
score from -5 to 62 using ASCII 59 to 126 (although in raw read data
Solexa scores from -5 to 40 only are expected)</li>
<li>Starting with Illumina 1.3 and before Illumina 1.8, the format
encoded a Phred quality score from 0 to 62 using ASCII 64 to 126
(although in raw read data Phred scores from 0 to 40 only are
expected).</li>
<li>Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0
to 2 have a slightly different meaning. The values 0 and 1 are no
longer used and the value 2, encoded by ASCII 66 “B”.</li>
</ul>
<p>Sequencing Control Software, Version 2.6, Catalog # SY-960-2601, Part
# 15009921 Rev. A, November
2009] <a href="%5Bhttp://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\%5D(http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf)%7B.uri%7D" class="uri">[http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf\\](http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf){.uri}</a>
(page 30) states the following: <em>If a read ends with a segment of mostly
low quality (Q15 or below), then all of the quality values in the
segment are replaced with a value of 2 (encoded as the letter B in
Illuminas text-based encoding of quality scores)… This Q2 indicator
does not predict a specific error rate, but rather indicates that a
specific final portion of the read should not be used in further
analyses.</em> Also, the quality score encoded as “B” letter may occur
internally within reads at least as late as pipeline version 1.6, as
shown in the following example:</p>
<pre><code>@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
+HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB</code></pre>
<p>An alternative interpretation of this ASCII encoding has been proposed.
Also, in Illumina runs using PhiX controls, the character B was
observed to represent an “unknown quality score”. The error rate of B
reads was roughly 3 phred scores lower the mean observed score of a
given run.</p>
<ul>
<li>Starting in Illumina 1.8, the quality scores have basically returned
to the use of the Sanger format (Phred+33).</li>
</ul>
</div>
</div>
</div>
<div id="file-extension" class="section level2 hasAnchor" number="1.3">
<h2><span class="header-section-number">1.3</span> File extension<a href="the-obitools.html#file-extension" class="anchor-section" aria-label="Anchor link to header"></a></h2>
<p>There is no standard file extension for a FASTQ file, but .fq and
.fastq, are commonly used.</p>
</div>
<div id="see-also" class="section level2 hasAnchor" number="1.4">
<h2><span class="header-section-number">1.4</span> See also<a href="the-obitools.html#see-also" class="anchor-section" aria-label="Anchor link to header"></a></h2>
<ul>
<li>:ref:<code>fasta</code></li>
</ul>
</div>
<div id="references" class="section level2 hasAnchor" number="1.5">
<h2><span class="header-section-number">1.5</span> References<a href="the-obitools.html#references" class="anchor-section" aria-label="Anchor link to header"></a></h2>
<p>.. [1] Cock et al (2009) The Sanger FASTQ file format for sequences with
quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids
Research,</p>
<p>.. [2] Illumina Quality Scores, Tobias Mann, Bioinformatics, San Diego,
Illumina <code>1</code>__</p>
<p>.. |Relationship between <em>Q</em> and <em>p</em> using the Sanger (red) and Solexa
(black) equations (described above). The vertical dotted line indicates
<em>p</em> = 0.05, or equivalently, <em>Q</em> Å 13.| image:: Probability metrics.png</p>
<p>See <a href="http://en.wikipedia.org/wiki/FASTQ_format" class="uri">http://en.wikipedia.org/wiki/FASTQ_format</a></p>
</div>
</div>
</section>
</div>
</div>
</div>
<a href="the-obitools-commands.html" class="navigation navigation-next navigation-unique" aria-label="Next page"><i class="fa fa-angle-right"></i></a>
</div>
</div>
<script src="book_assets/gitbook-2.6.7/js/app.min.js"></script>
<script src="book_assets/gitbook-2.6.7/js/clipboard.min.js"></script>
<script src="book_assets/gitbook-2.6.7/js/plugin-search.js"></script>
<script src="book_assets/gitbook-2.6.7/js/plugin-sharing.js"></script>
<script src="book_assets/gitbook-2.6.7/js/plugin-fontsettings.js"></script>
<script src="book_assets/gitbook-2.6.7/js/plugin-bookdown.js"></script>
<script src="book_assets/gitbook-2.6.7/js/jquery.highlight.js"></script>
<script src="book_assets/gitbook-2.6.7/js/plugin-clipboard.js"></script>
<script>
gitbook.require(["gitbook"], function(gitbook) {
gitbook.start({
"sharing": {
"github": false,
"facebook": true,
"twitter": true,
"linkedin": false,
"weibo": false,
"instapaper": false,
"vk": false,
"whatsapp": false,
"all": ["facebook", "twitter", "linkedin", "weibo", "instapaper"]
},
"fontsettings": {
"theme": "white",
"family": "sans",
"size": 2
},
"edit": {
"link": null,
"text": null
},
"history": {
"link": null,
"text": null
},
"view": {
"link": null,
"text": null
},
"download": ["_main.pdf"],
"search": {
"engine": "fuse",
"options": null
},
"toc": {
"collapse": "subsection"
}
});
});
</script>
<!-- dynamically load mathjax for compatibility with self-contained -->
<script>
(function () {
var script = document.createElement("script");
script.type = "text/javascript";
var src = "true";
if (src === "" || src === "true") src = "https://cdnjs.cloudflare.com/ajax/libs/mathjax/2.7.9/latest.js?config=TeX-MML-AM_CHTML";
if (location.protocol !== "file:")
if (/^https?:/.test(src))
src = src.replace(/^https?:/, '');
script.src = src;
document.getElementsByTagName("head")[0].appendChild(script);
})();
</script>
</body>
</html>