mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-08-24 13:51:18 +00:00
2995 lines
119 KiB
TeX
2995 lines
119 KiB
TeX
% Options for packages loaded elsewhere
|
|
\PassOptionsToPackage{unicode}{hyperref}
|
|
\PassOptionsToPackage{hyphens}{url}
|
|
\PassOptionsToPackage{dvipsnames,svgnames,x11names}{xcolor}
|
|
%
|
|
\documentclass[
|
|
letterpaper,
|
|
DIV=11,
|
|
numbers=noendperiod]{scrreprt}
|
|
|
|
\usepackage{amsmath,amssymb}
|
|
\usepackage{lmodern}
|
|
\usepackage{iftex}
|
|
\ifPDFTeX
|
|
\usepackage[T1]{fontenc}
|
|
\usepackage[utf8]{inputenc}
|
|
\usepackage{textcomp} % provide euro and other symbols
|
|
\else % if luatex or xetex
|
|
\usepackage{unicode-math}
|
|
\defaultfontfeatures{Scale=MatchLowercase}
|
|
\defaultfontfeatures[\rmfamily]{Ligatures=TeX,Scale=1}
|
|
\fi
|
|
% Use upquote if available, for straight quotes in verbatim environments
|
|
\IfFileExists{upquote.sty}{\usepackage{upquote}}{}
|
|
\IfFileExists{microtype.sty}{% use microtype if available
|
|
\usepackage[]{microtype}
|
|
\UseMicrotypeSet[protrusion]{basicmath} % disable protrusion for tt fonts
|
|
}{}
|
|
\makeatletter
|
|
\@ifundefined{KOMAClassName}{% if non-KOMA class
|
|
\IfFileExists{parskip.sty}{%
|
|
\usepackage{parskip}
|
|
}{% else
|
|
\setlength{\parindent}{0pt}
|
|
\setlength{\parskip}{6pt plus 2pt minus 1pt}}
|
|
}{% if KOMA class
|
|
\KOMAoptions{parskip=half}}
|
|
\makeatother
|
|
\usepackage{xcolor}
|
|
\setlength{\emergencystretch}{3em} % prevent overfull lines
|
|
\setcounter{secnumdepth}{5}
|
|
% Make \paragraph and \subparagraph free-standing
|
|
\ifx\paragraph\undefined\else
|
|
\let\oldparagraph\paragraph
|
|
\renewcommand{\paragraph}[1]{\oldparagraph{#1}\mbox{}}
|
|
\fi
|
|
\ifx\subparagraph\undefined\else
|
|
\let\oldsubparagraph\subparagraph
|
|
\renewcommand{\subparagraph}[1]{\oldsubparagraph{#1}\mbox{}}
|
|
\fi
|
|
|
|
\usepackage{color}
|
|
\usepackage{fancyvrb}
|
|
\newcommand{\VerbBar}{|}
|
|
\newcommand{\VERB}{\Verb[commandchars=\\\{\}]}
|
|
\DefineVerbatimEnvironment{Highlighting}{Verbatim}{commandchars=\\\{\}}
|
|
% Add ',fontsize=\small' for more characters per line
|
|
\usepackage{framed}
|
|
\definecolor{shadecolor}{RGB}{241,243,245}
|
|
\newenvironment{Shaded}{\begin{snugshade}}{\end{snugshade}}
|
|
\newcommand{\AlertTok}[1]{\textcolor[rgb]{0.68,0.00,0.00}{#1}}
|
|
\newcommand{\AnnotationTok}[1]{\textcolor[rgb]{0.37,0.37,0.37}{#1}}
|
|
\newcommand{\AttributeTok}[1]{\textcolor[rgb]{0.40,0.45,0.13}{#1}}
|
|
\newcommand{\BaseNTok}[1]{\textcolor[rgb]{0.68,0.00,0.00}{#1}}
|
|
\newcommand{\BuiltInTok}[1]{\textcolor[rgb]{0.00,0.23,0.31}{#1}}
|
|
\newcommand{\CharTok}[1]{\textcolor[rgb]{0.13,0.47,0.30}{#1}}
|
|
\newcommand{\CommentTok}[1]{\textcolor[rgb]{0.37,0.37,0.37}{#1}}
|
|
\newcommand{\CommentVarTok}[1]{\textcolor[rgb]{0.37,0.37,0.37}{\textit{#1}}}
|
|
\newcommand{\ConstantTok}[1]{\textcolor[rgb]{0.56,0.35,0.01}{#1}}
|
|
\newcommand{\ControlFlowTok}[1]{\textcolor[rgb]{0.00,0.23,0.31}{#1}}
|
|
\newcommand{\DataTypeTok}[1]{\textcolor[rgb]{0.68,0.00,0.00}{#1}}
|
|
\newcommand{\DecValTok}[1]{\textcolor[rgb]{0.68,0.00,0.00}{#1}}
|
|
\newcommand{\DocumentationTok}[1]{\textcolor[rgb]{0.37,0.37,0.37}{\textit{#1}}}
|
|
\newcommand{\ErrorTok}[1]{\textcolor[rgb]{0.68,0.00,0.00}{#1}}
|
|
\newcommand{\ExtensionTok}[1]{\textcolor[rgb]{0.00,0.23,0.31}{#1}}
|
|
\newcommand{\FloatTok}[1]{\textcolor[rgb]{0.68,0.00,0.00}{#1}}
|
|
\newcommand{\FunctionTok}[1]{\textcolor[rgb]{0.28,0.35,0.67}{#1}}
|
|
\newcommand{\ImportTok}[1]{\textcolor[rgb]{0.00,0.46,0.62}{#1}}
|
|
\newcommand{\InformationTok}[1]{\textcolor[rgb]{0.37,0.37,0.37}{#1}}
|
|
\newcommand{\KeywordTok}[1]{\textcolor[rgb]{0.00,0.23,0.31}{#1}}
|
|
\newcommand{\NormalTok}[1]{\textcolor[rgb]{0.00,0.23,0.31}{#1}}
|
|
\newcommand{\OperatorTok}[1]{\textcolor[rgb]{0.37,0.37,0.37}{#1}}
|
|
\newcommand{\OtherTok}[1]{\textcolor[rgb]{0.00,0.23,0.31}{#1}}
|
|
\newcommand{\PreprocessorTok}[1]{\textcolor[rgb]{0.68,0.00,0.00}{#1}}
|
|
\newcommand{\RegionMarkerTok}[1]{\textcolor[rgb]{0.00,0.23,0.31}{#1}}
|
|
\newcommand{\SpecialCharTok}[1]{\textcolor[rgb]{0.37,0.37,0.37}{#1}}
|
|
\newcommand{\SpecialStringTok}[1]{\textcolor[rgb]{0.13,0.47,0.30}{#1}}
|
|
\newcommand{\StringTok}[1]{\textcolor[rgb]{0.13,0.47,0.30}{#1}}
|
|
\newcommand{\VariableTok}[1]{\textcolor[rgb]{0.07,0.07,0.07}{#1}}
|
|
\newcommand{\VerbatimStringTok}[1]{\textcolor[rgb]{0.13,0.47,0.30}{#1}}
|
|
\newcommand{\WarningTok}[1]{\textcolor[rgb]{0.37,0.37,0.37}{\textit{#1}}}
|
|
|
|
\providecommand{\tightlist}{%
|
|
\setlength{\itemsep}{0pt}\setlength{\parskip}{0pt}}\usepackage{longtable,booktabs,array}
|
|
\usepackage{calc} % for calculating minipage widths
|
|
% Correct order of tables after \paragraph or \subparagraph
|
|
\usepackage{etoolbox}
|
|
\makeatletter
|
|
\patchcmd\longtable{\par}{\if@noskipsec\mbox{}\fi\par}{}{}
|
|
\makeatother
|
|
% Allow footnotes in longtable head/foot
|
|
\IfFileExists{footnotehyper.sty}{\usepackage{footnotehyper}}{\usepackage{footnote}}
|
|
\makesavenoteenv{longtable}
|
|
\usepackage{graphicx}
|
|
\makeatletter
|
|
\def\maxwidth{\ifdim\Gin@nat@width>\linewidth\linewidth\else\Gin@nat@width\fi}
|
|
\def\maxheight{\ifdim\Gin@nat@height>\textheight\textheight\else\Gin@nat@height\fi}
|
|
\makeatother
|
|
% Scale images if necessary, so that they will not overflow the page
|
|
% margins by default, and it is still possible to overwrite the defaults
|
|
% using explicit options in \includegraphics[width, height, ...]{}
|
|
\setkeys{Gin}{width=\maxwidth,height=\maxheight,keepaspectratio}
|
|
% Set default figure placement to htbp
|
|
\makeatletter
|
|
\def\fps@figure{htbp}
|
|
\makeatother
|
|
\newlength{\cslhangindent}
|
|
\setlength{\cslhangindent}{1.5em}
|
|
\newlength{\csllabelwidth}
|
|
\setlength{\csllabelwidth}{3em}
|
|
\newlength{\cslentryspacingunit} % times entry-spacing
|
|
\setlength{\cslentryspacingunit}{\parskip}
|
|
\newenvironment{CSLReferences}[2] % #1 hanging-ident, #2 entry spacing
|
|
{% don't indent paragraphs
|
|
\setlength{\parindent}{0pt}
|
|
% turn on hanging indent if param 1 is 1
|
|
\ifodd #1
|
|
\let\oldpar\par
|
|
\def\par{\hangindent=\cslhangindent\oldpar}
|
|
\fi
|
|
% set entry spacing
|
|
\setlength{\parskip}{#2\cslentryspacingunit}
|
|
}%
|
|
{}
|
|
\usepackage{calc}
|
|
\newcommand{\CSLBlock}[1]{#1\hfill\break}
|
|
\newcommand{\CSLLeftMargin}[1]{\parbox[t]{\csllabelwidth}{#1}}
|
|
\newcommand{\CSLRightInline}[1]{\parbox[t]{\linewidth - \csllabelwidth}{#1}\break}
|
|
\newcommand{\CSLIndent}[1]{\hspace{\cslhangindent}#1}
|
|
|
|
\KOMAoption{captions}{tableheading}
|
|
\makeatletter
|
|
\makeatother
|
|
\makeatletter
|
|
\@ifpackageloaded{bookmark}{}{\usepackage{bookmark}}
|
|
\makeatother
|
|
\makeatletter
|
|
\@ifpackageloaded{caption}{}{\usepackage{caption}}
|
|
\AtBeginDocument{%
|
|
\ifdefined\contentsname
|
|
\renewcommand*\contentsname{Table of contents}
|
|
\else
|
|
\newcommand\contentsname{Table of contents}
|
|
\fi
|
|
\ifdefined\listfigurename
|
|
\renewcommand*\listfigurename{List of Figures}
|
|
\else
|
|
\newcommand\listfigurename{List of Figures}
|
|
\fi
|
|
\ifdefined\listtablename
|
|
\renewcommand*\listtablename{List of Tables}
|
|
\else
|
|
\newcommand\listtablename{List of Tables}
|
|
\fi
|
|
\ifdefined\figurename
|
|
\renewcommand*\figurename{Figure}
|
|
\else
|
|
\newcommand\figurename{Figure}
|
|
\fi
|
|
\ifdefined\tablename
|
|
\renewcommand*\tablename{Table}
|
|
\else
|
|
\newcommand\tablename{Table}
|
|
\fi
|
|
}
|
|
\@ifpackageloaded{float}{}{\usepackage{float}}
|
|
\floatstyle{ruled}
|
|
\@ifundefined{c@chapter}{\newfloat{codelisting}{h}{lop}}{\newfloat{codelisting}{h}{lop}[chapter]}
|
|
\floatname{codelisting}{Listing}
|
|
\newcommand*\listoflistings{\listof{codelisting}{List of Listings}}
|
|
\makeatother
|
|
\makeatletter
|
|
\@ifpackageloaded{caption}{}{\usepackage{caption}}
|
|
\@ifpackageloaded{subcaption}{}{\usepackage{subcaption}}
|
|
\makeatother
|
|
\makeatletter
|
|
\@ifpackageloaded{tcolorbox}{}{\usepackage[many]{tcolorbox}}
|
|
\makeatother
|
|
\makeatletter
|
|
\@ifundefined{shadecolor}{\definecolor{shadecolor}{rgb}{.97, .97, .97}}
|
|
\makeatother
|
|
\makeatletter
|
|
\makeatother
|
|
\ifLuaTeX
|
|
\usepackage{selnolig} % disable illegal ligatures
|
|
\fi
|
|
\IfFileExists{bookmark.sty}{\usepackage{bookmark}}{\usepackage{hyperref}}
|
|
\IfFileExists{xurl.sty}{\usepackage{xurl}}{} % add URL line breaks if available
|
|
\urlstyle{same} % disable monospaced font for URLs
|
|
\hypersetup{
|
|
pdftitle={OBITools V4},
|
|
pdfauthor={Eric Coissac},
|
|
colorlinks=true,
|
|
linkcolor={blue},
|
|
filecolor={Maroon},
|
|
citecolor={Blue},
|
|
urlcolor={Blue},
|
|
pdfcreator={LaTeX via pandoc}}
|
|
|
|
\title{OBITools V4}
|
|
\author{Eric Coissac}
|
|
\date{1/17/23}
|
|
|
|
\begin{document}
|
|
\maketitle
|
|
\ifdefined\Shaded\renewenvironment{Shaded}{\begin{tcolorbox}[boxrule=0pt, breakable, enhanced, borderline west={3pt}{0pt}{shadecolor}, frame hidden, interior hidden, sharp corners]}{\end{tcolorbox}}\fi
|
|
|
|
\renewcommand*\contentsname{Table of contents}
|
|
{
|
|
\hypersetup{linkcolor=}
|
|
\setcounter{tocdepth}{2}
|
|
\tableofcontents
|
|
}
|
|
\bookmarksetup{startatroot}
|
|
|
|
\hypertarget{preface}{%
|
|
\chapter*{Preface}\label{preface}}
|
|
\addcontentsline{toc}{chapter}{Preface}
|
|
|
|
\markboth{Preface}{Preface}
|
|
|
|
The first version of \emph{OBITools} started to be developed in 2005.
|
|
This was at the beginning of the DNA metabarcoding story at the
|
|
Laboratoire d'Ecologie Alpine (LECA) in Grenoble. At that time, with
|
|
Pierre Taberlet and François Pompanon, we were thinking about the
|
|
potential of this new methodology under development. PIerre and François
|
|
developed more the laboratory methods, while I was thinking more about
|
|
the tools for analysing the sequences produced. Two ideas were behind
|
|
this development. I wanted something modular, and something easy to
|
|
extend. To achieve the first goal, I decided to implement obitools as a
|
|
suite of unix commands mimicking the classic unix commands but dedicated
|
|
to sequence files. The basic unix commands are very useful for
|
|
automatically manipulating, parsing and editing text files. They work in
|
|
flow, line by line on the input text. The result is a new text file that
|
|
can be used as input for the next command. Such a design makes it
|
|
possible to quickly develop a text processing pipeline by chaining
|
|
simple elementary operations. The \emph{OBITools} are the exact
|
|
counterpart of these basic Unix commands, but the basic information they
|
|
process is a sequence (potentially spanning several lines of text), not
|
|
a single line of text. Most \emph{OBITools} consume sequence files and
|
|
produce sequence files. Thus, the principles of chaining and modularity
|
|
are respected. In order to be able to easily extend the \emph{OBITools}
|
|
to keep up with our evolving ideas about processing DNA metabarcoding
|
|
data, it was decided to develop them using an interpreted language:
|
|
Python. Python 2, the version available at the time, allowed us to
|
|
develop the \emph{OBITools} efficiently. When parts of the algorithms
|
|
were computationally demanding, they were implemented in C and linked to
|
|
the Python code. Even though Python is not the most efficient language
|
|
available, even though computers were not as powerful as they are today,
|
|
the size of the data we could produce using 454 sequencers or early
|
|
solexa machines was small enough to be processed in a reasonable time.
|
|
|
|
The first public version of obitools was
|
|
\href{https://metabarcoding.org/obitools}{\emph{OBITools2}} (Boyer et
|
|
al. 2016), this was actually a cleaned up and documented version of
|
|
\emph{OBITools} that had been running at LECA for years and was not
|
|
really distributed except to a few collaborators. This is where
|
|
\emph{OBITools} started its public life from then on. The DNA
|
|
metabarcoding spring schools provided and still provide user training
|
|
every year. But \emph{OBITools2} soon suffered from two limitations: it
|
|
was developed in Python2, which was increasingly abandoned in favour of
|
|
Python3, and the data size kept increasing with the new illumina
|
|
machines. Python's intrinsic slowness coupled with the increasing size
|
|
of the datasets made OBITools computation times increasingly long. The
|
|
abandonment of all maintenance of Python2 by its developers also imposed
|
|
the need for a new version of OBITools.
|
|
|
|
\href{https://metabarcoding.org/obitools3}{\emph{OBITools3}} was the
|
|
first response to this crisis. Developed and maintained by
|
|
\href{https://www.celine-mercier.info}{Céline Mercier}, \emph{OBITools3}
|
|
attempted to address several limitations of \emph{OBITools2}. It is a
|
|
complete new code, mainly developed in Python3, with most of the lower
|
|
layer code written in C for efficiency. OBITools3 has also abandoned
|
|
text files for binary files for the same reason of efficiency. They have
|
|
been replaced by a database structure that keeps track of every
|
|
operation performed on the data.
|
|
|
|
Here we present \emph{OBITools4} which can be seen as a return to the
|
|
origins of OBITools. While \emph{OBITools3} offered traceability of
|
|
analyses, which is in line with the concept of open science, and faster
|
|
execution, \emph{OBITools2} was more versatile and not only usable for
|
|
the analysis of DNA metabarcoding data. \emph{OBITools4} is the third
|
|
full implementation of \emph{OBITools}. The idea behind this new version
|
|
is to go back to the original design of \emph{OBITools} which ran on
|
|
text files containing sequences, like the classic Unix commands, but
|
|
running at least as fast as \emph{OBITools3} and taking advantage of the
|
|
multicore architecture of all modern laptops. For this, the idea of
|
|
relying on an interpreted language was abandoned. The \emph{OBITools4}
|
|
are now fully implemented in the \href{https://go.dev}{GO} language with
|
|
the exception of a few small pieces of specific code already implemented
|
|
very efficiently in C. \emph{OBITools4} also implement a new format for
|
|
the annotations inserted in the header of every sequences. Rather tha
|
|
relying on a format specific to \emph{OBITools}, by default
|
|
\emph{OBITools4} use the \href{https://www.json.org}{JSON} format. This
|
|
simplifies the writing of parsers in any languages, and thus allows
|
|
obitools to easiestly interact with other software.
|
|
|
|
\part{The OBITools}
|
|
|
|
The \emph{OBITools4} are programs specifically designed for analyzing
|
|
NGS data in a DNA metabarcoding context, taking into account taxonomic
|
|
information. It is distributed as an open source software available on
|
|
the following website: http://metabarcoding.org/obitools4.
|
|
|
|
\hypertarget{aims-of-obitools}{%
|
|
\section*{\texorpdfstring{Aims of
|
|
\emph{OBITools}}{Aims of OBITools}}\label{aims-of-obitools}}
|
|
\addcontentsline{toc}{section}{Aims of \emph{OBITools}}
|
|
|
|
\markright{Aims of \emph{OBITools}}
|
|
|
|
DNA metabarcoding is an efficient approach for biodiversity studies
|
|
(Taberlet et al. 2012). Originally mainly developed by microbiologists
|
|
(\emph{e.g.} Sogin et al. 2006), it is now widely used for plants
|
|
(\emph{e.g.} Sønstebø et al. 2010; Yoccoz et al. 2012; Parducci et al.
|
|
2012) and animals from meiofauna (\emph{e.g.} Chariton et al. 2010;
|
|
Baldwin et al. 2013) to larger organisms (\emph{e.g.} Andersen et al.
|
|
2012; Thomsen et al. 2012). Interestingly, this method is not limited to
|
|
\emph{sensu stricto} biodiversity surveys, but it can also be
|
|
implemented in other ecological contexts such as for herbivore (e.g.
|
|
Valentini et al. 2009; Kowalczyk et al. 2011) or carnivore (e.g. Deagle,
|
|
Kirkwood, and Jarman 2009; Shehzad et al. 2012) diet analyses.
|
|
|
|
Whatever the biological question under consideration, the DNA
|
|
metabarcoding methodology relies heavily on next-generation sequencing
|
|
(NGS), and generates considerable numbers of DNA sequence reads
|
|
(typically million of reads). Manipulation of such large datasets
|
|
requires dedicated programs usually running on a Unix system. Unix is an
|
|
operating system, whose first version was created during the sixties.
|
|
Since its early stages, it is dedicated to scientific computing and
|
|
includes a large set of simple tools to efficiently process text files.
|
|
Most of those programs can be viewed as filters extracting information
|
|
from a text file to create a new text file. These programs process text
|
|
files as streams, line per line, therefore allowing computation on a
|
|
huge dataset without requiring a large memory. Unix programs usually
|
|
print their results to their standard output (\emph{stdout}), which by
|
|
default is the terminal, so the results can be examined on screen. The
|
|
main philosophy of the Unix environment is to allow easy redirection of
|
|
the \emph{stdout} either to a file, for saving the results, or to the
|
|
standard input (\emph{stdin}) of a second program thus allowing to
|
|
easily create complex processing from simple base commands. Access to
|
|
Unix computers is increasingly easier for scientists nowadays. Indeed,
|
|
the Linux operating system, an open source version of Unix, can be
|
|
freely installed on every PC machine and the MacOS operating system,
|
|
running on Apple computers, is also a Unix system. The \emph{OBITools}
|
|
programs imitate Unix standard programs because they usually act as
|
|
filters, reading their data from text files or the \emph{stdin} and
|
|
writing their results to the \emph{stdout}. The main difference with
|
|
classical Unix programs is that text files are not analyzed line per
|
|
line but sequence record per sequence record (see below for a detailed
|
|
description of a sequence record). Compared to packages for similar
|
|
purposes like mothur (Schloss et al. 2009) or QIIME (Caporaso et al.
|
|
2010), the \emph{OBITools} mainly rely on filtering and sorting
|
|
algorithms. This allows users to set up versatile data analysis
|
|
pipelines (Figure 1), adjustable to the broad range of DNA metabarcoding
|
|
applications. The innovation of the \emph{OBITools} is their ability to
|
|
take into account the taxonomic annotations, ultimately allowing sorting
|
|
and filtering of sequence records based on the taxonomy.
|
|
|
|
\hypertarget{installation-of-the-obitools}{%
|
|
\chapter{\texorpdfstring{Installation of the
|
|
\emph{OBITools}}{Installation of the OBITools}}\label{installation-of-the-obitools}}
|
|
|
|
\hypertarget{availability-of-the-obitools}{%
|
|
\section{\texorpdfstring{Availability of the
|
|
\emph{OBITools}}{Availability of the OBITools}}\label{availability-of-the-obitools}}
|
|
|
|
The \emph{OBITools} are open source and protected by the
|
|
\href{http://www.cecill.info/licences/Licence_CeCILL_V2.1-en.html}{CeCILL
|
|
2.1 license}.
|
|
|
|
All the sources of the
|
|
\href{http://metabarcoding.org/obitools4}{\emph{OBITools4}} can be
|
|
downloaded from the metabarcoding git server
|
|
(https://git.metabarcoding.org).
|
|
|
|
\hypertarget{prerequisites}{%
|
|
\section{Prerequisites}\label{prerequisites}}
|
|
|
|
The \emph{OBITools4} are developped using the \href{https://go.dev/}{GO
|
|
programming language}, we stick to the latest version of the language,
|
|
today the \(1.21.4\). If you want to download and compile the sources
|
|
yourself, you first need to install the corresponding compiler on your
|
|
system. Some parts of the soft are also written in C, therefore a recent
|
|
C compiler is also requested, GCC on Linux or Windows, the Developer
|
|
Tools on Mac.
|
|
|
|
Whatever the installation you decide for, you will have to ensure that a
|
|
C compiler is available on your system.
|
|
|
|
\hypertarget{installation-with-the-install-script}{%
|
|
\section{Installation with the install
|
|
script}\label{installation-with-the-install-script}}
|
|
|
|
An installation script that compiles the new \emph{OBITools} on your
|
|
Unix-like system is available online. The easiest way to run it is to
|
|
copy and paste the following command into your terminal
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{curl} \AttributeTok{{-}L}\NormalTok{ https://metabarcoding.org/obitools4/install.sh }\KeywordTok{|} \FunctionTok{bash}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
By default, the script installs the \emph{OBITools} commands and other
|
|
associated files into the \texttt{/usr/local} directory. The names of
|
|
the commands in the new \emph{OBITools4} are mostly identical to those
|
|
in \emph{OBITools2}. Therefore, installing the new \emph{OBITools} may
|
|
hide or delete the old ones. If you want both versions to be available
|
|
on your system, the installation script offers two options:
|
|
|
|
\begin{quote}
|
|
-i, --install-dir Directory where \emph{OBITools} are installed (as
|
|
example use \texttt{/usr/local} not \texttt{/usr/local/bin}).
|
|
|
|
-p, --obitools-prefix Prefix added to the \emph{OBITools} command names
|
|
if you want to have several versions of obitools at the same time on
|
|
your system (as example \texttt{-p\ g} will produce \texttt{gobigrep}
|
|
command instead of \texttt{obigrep}).
|
|
\end{quote}
|
|
|
|
You can use these options by following the installation command:
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{curl} \AttributeTok{{-}L}\NormalTok{ https://metabarcoding.org/obitools4/install.sh }\KeywordTok{|} \DataTypeTok{\textbackslash{}}
|
|
\FunctionTok{bash} \AttributeTok{{-}s} \AttributeTok{{-}{-}} \AttributeTok{{-}{-}install{-}dir}\NormalTok{ test\_install }\AttributeTok{{-}{-}obitools{-}prefix}\NormalTok{ k}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
In this case, the binaries will be installed in the
|
|
\texttt{test\_install} directory and all command names will be prefixed
|
|
with the letter \texttt{k}. Thus \texttt{obigrep} will be named
|
|
\texttt{kobigrep}.
|
|
|
|
\hypertarget{compilation-from-sources}{%
|
|
\section{Compilation from sources}\label{compilation-from-sources}}
|
|
|
|
\hypertarget{file-formats-usable-with-obitools}{%
|
|
\chapter{\texorpdfstring{File formats usable with
|
|
\emph{OBITools}}{File formats usable with OBITools}}\label{file-formats-usable-with-obitools}}
|
|
|
|
\emph{OBITools} manipulate have to manipulate DNA sequence data and
|
|
taxonomical data. They can use some supplentary metadata describing the
|
|
experiment and produce some stats about the processed DNA data. All the
|
|
manipulated data are stored in text files, following standard data
|
|
format.
|
|
|
|
\hypertarget{the-dna-sequence-data}{%
|
|
\section{The DNA sequence data}\label{the-dna-sequence-data}}
|
|
|
|
Sequences can be stored following various format. \emph{OBITools} knows
|
|
some of them. The central formats for sequence files manipulated by
|
|
\emph{OBITools} scripts are the
|
|
\protect\hyperlink{sec-fasta}{\emph{FASTA}} and
|
|
\protect\hyperlink{sec-fastq}{\emph{FASTQ}} format. \emph{OBITools}
|
|
extends the both these formats by specifying a syntax to include in the
|
|
definition line data qualifying the sequence. All file formats use the
|
|
\protect\hyperlink{sec-iupac}{\texttt{IUPAC}} code for encoding
|
|
nucleotides.
|
|
|
|
Moreover these two formats that can be used as input and output formats,
|
|
\emph{OBITools4} can read the following format :
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\href{https://ena-docs.readthedocs.io/en/latest/submit/fileprep/flat-file-example.html}{EBML
|
|
flat file} format (use by ENA)
|
|
\item
|
|
\href{https://www.ncbi.nlm.nih.gov/Sitemap/samplerecord.html}{Genbank
|
|
flat file format}
|
|
\item
|
|
\href{https://pythonhosted.org/OBITools/scripts/ecoPCR.html}{ecoPCR
|
|
output files}
|
|
\end{itemize}
|
|
|
|
\hypertarget{sec-iupac}{%
|
|
\subsection{The IUPAC Code}\label{sec-iupac}}
|
|
|
|
The International Union of Pure and Applied Chemistry (\href{}{IUPAC})
|
|
defined the standard code for representing protein or DNA sequences.
|
|
|
|
\begin{longtable}[]{@{}ll@{}}
|
|
\toprule()
|
|
\textbf{Code} & \textbf{Nucleotide} \\
|
|
\midrule()
|
|
\endhead
|
|
A & Adenine \\
|
|
C & Cytosine \\
|
|
G & Guanine \\
|
|
T & Thymine \\
|
|
U & Uracil \\
|
|
R & Purine (A or G) \\
|
|
Y & Pyrimidine (C, T, or U) \\
|
|
M & C or A \\
|
|
K & T, U, or G \\
|
|
W & T, U, or A \\
|
|
S & C or G \\
|
|
B & C, T, U, or G (not A) \\
|
|
D & A, T, U, or G (not C) \\
|
|
H & A, T, U, or C (not G) \\
|
|
V & A, C, or G (not T, not U) \\
|
|
N & Any base (A, C, G, T, or U) \\
|
|
\bottomrule()
|
|
\end{longtable}
|
|
|
|
\hypertarget{sec-fasta}{%
|
|
\subsection{\texorpdfstring{The \emph{FASTA} sequence
|
|
format}{The FASTA sequence format}}\label{sec-fasta}}
|
|
|
|
The \protect\hyperlink{sec-fasta}{\emph{FASTA}} format is certainly the
|
|
most widely used sequence file format. This is certainly due to its
|
|
great simplicity. It was originally created for the Lipman and Pearson
|
|
\href{http://www.ncbi.nlm.nih.gov/pubmed/3162770?dopt=Citation}{\texttt{FASTA}
|
|
program}. \emph{OBITools} use in more of the classical
|
|
\protect\hyperlink{sec-fasta}{\emph{FASTA}} format an
|
|
\texttt{extended\ version} of this format where structured data are
|
|
included in the title line.
|
|
|
|
In \protect\hyperlink{sec-fasta}{\emph{FASTA}} format a sequence is
|
|
represented by a title line beginning with a
|
|
\textbf{\texttt{\textgreater{}}} character and the sequences by itself
|
|
following the \protect\hyperlink{sec-iupac}{\texttt{IUPAC}} code. The
|
|
sequence is usually split other severals lines of the same length
|
|
(expect for the last one)
|
|
|
|
\begin{verbatim}
|
|
>my_sequence this is my pretty sequence
|
|
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
|
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
|
AACGACGTTGCAGTACGTTGCAGT
|
|
\end{verbatim}
|
|
|
|
This is no special format for the title line excepting that this line
|
|
should be unique. Usually the first word following the
|
|
\textbf{\textgreater{}} character is considered as the sequence
|
|
identifier. The end of the title line corresponding to a description of
|
|
the sequence. Several sequences can be concatenated in a same file. The
|
|
description of the next sequence is just pasted at the end of the record
|
|
of the previous one
|
|
|
|
\begin{verbatim}
|
|
>sequence_A this is my first pretty sequence
|
|
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
|
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
|
AACGACGTTGCAGTACGTTGCAGT
|
|
>sequence_B this is my second pretty sequence
|
|
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
|
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
|
AACGACGTTGCAGTACGTTGCAGT
|
|
>sequence_C this is my third pretty sequence
|
|
ACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGT
|
|
GTGCTGACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTACGTTGCAGTGTTT
|
|
AACGACGTTGCAGTACGTTGCAGT
|
|
\end{verbatim}
|
|
|
|
\hypertarget{file-extensions}{%
|
|
\subsubsection{File extensions}\label{file-extensions}}
|
|
|
|
There is no standard file extension for a
|
|
\protect\hyperlink{sec-fasta}{\emph{FASTA}} file, but \texttt{.fa} and
|
|
\texttt{.fasta}, are commonly used.
|
|
|
|
\hypertarget{sec-fastq}{%
|
|
\subsection[The \emph{FASTQ} sequence format]{\texorpdfstring{The
|
|
\emph{FASTQ} sequence
|
|
format\footnote{This article uses material from the Wikipedia article
|
|
\href{http://en.wikipedia.org/wiki/FASTQ_format}{\texttt{FASTQ\ format}}
|
|
which is released under the
|
|
\texttt{Creative\ Commons\ Attribution-Share-Alike\ License\ 3.0}}}{The FASTQ sequence format}}\label{sec-fastq}}
|
|
|
|
The \protect\hyperlink{sec-fastq}{\emph{FASTQ}} format is a text file
|
|
format for storing both biological sequences (only nucleic acid
|
|
sequences) and the associated sequence quality scores. Every nucleotide
|
|
of the sequence and its associated quality score are each encoded by a
|
|
single ASCII character. This format was originally developed by the
|
|
Wellcome Trust Sanger Institute to link a
|
|
\protect\hyperlink{sec-fasta}{\emph{FASTA}} sequence file to the
|
|
corresponding quality data, but is now became the \emph{de facto}
|
|
standard for storing results from high-throughput sequencers (Cock et
|
|
al. 2010).
|
|
|
|
\emph{OBITools} considers that a
|
|
\protect\hyperlink{sec-fastq}{\emph{FASTQ}} file uses four lines to
|
|
encode a sequence record.
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Line 1 begins with a `@' character and is followed by a sequence
|
|
identifier and an \emph{optional} description (like a
|
|
\protect\hyperlink{sec-fasta}{\emph{FASTA}} title line).
|
|
\item
|
|
Line 2 is the sequence letters, in upper or lower case, but
|
|
\emph{OBITools} only write sequences as lower cases.
|
|
\item
|
|
Line 3 begins with a `+' character and is \emph{optionally} followed
|
|
by the same sequence identifier (and any description) again.
|
|
\item
|
|
Line 4 encodes the quality values for the sequence in Line 2, and must
|
|
contain the same number of symbols as letters in the sequence.
|
|
\end{itemize}
|
|
|
|
A \protect\hyperlink{sec-fastq}{\emph{FASTQ}} file looks like this:
|
|
|
|
\begin{verbatim}
|
|
@SEQ_ID
|
|
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
|
|
+
|
|
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
|
|
\end{verbatim}
|
|
|
|
The character `!' represents the lowest quality while
|
|
`\textasciitilde{}' is the highest. Here are the quality value
|
|
characters in left-to-right increasing order of quality
|
|
(\texttt{ASCII}):
|
|
|
|
\begin{verbatim}
|
|
!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]
|
|
^_`abcdefghijklmnopqrstuvwxyz{|}~
|
|
\end{verbatim}
|
|
|
|
If the original Sanger \protect\hyperlink{sec-fastq}{\emph{FASTQ}} files
|
|
also allowed the sequence and quality strings to be wrapped (split over
|
|
multiple lines), it is not supported by \emph{OBITools} as it make
|
|
parsing complicated due to the unfortunate choice of ``@'' and ``+'' as
|
|
markers (these characters can also occur in the quality string).
|
|
|
|
\hypertarget{sequence-quality-scores}{%
|
|
\subsubsection*{Sequence quality scores}\label{sequence-quality-scores}}
|
|
\addcontentsline{toc}{subsubsection}{Sequence quality scores}
|
|
|
|
The Phred quality value \emph{Q} is an integer mapping of \emph{p}
|
|
(\emph{i.e.}, the probability that the corresponding base call is
|
|
incorrect). Two different equations have been in use. The first is the
|
|
standard Sanger variant to assess reliability of a base call, otherwise
|
|
known as Phred quality score:
|
|
|
|
\[
|
|
Q_\text{sanger} = -10 \, \log_{10} p
|
|
\]
|
|
|
|
The Solexa pipeline (i.e., the software delivered with the Illumina
|
|
Genome Analyzer) earlier used a different mapping, encoding the odds
|
|
\(\mathbf{p}/(1-\mathbf{p})\) instead of the probability \(\mathbf{p}\):
|
|
|
|
\[
|
|
Q_\text{solexa-prior to v.1.3} = -10 \; \log_{10} \frac{p}{1-p}
|
|
\]
|
|
|
|
Although both mappings are asymptotically identical at higher quality
|
|
values, they differ at lower quality levels (i.e., approximately
|
|
\(\mathbf{p} > 0.05\), or equivalently, \(\mathbf{Q} < 13\)).
|
|
|
|
\begin{figure}
|
|
|
|
{\centering \includegraphics{./Probabilitymetrics.png}
|
|
|
|
}
|
|
|
|
\caption{\label{fig-Probabilitymetrics}Relationship between \emph{Q} and
|
|
\emph{p} using the Sanger (red) and Solexa (black) equations (described
|
|
above). The vertical dotted line indicates \(\mathbf{p}= 0.05\), or
|
|
equivalently, \(Q = 13\).}
|
|
|
|
\end{figure}
|
|
|
|
\hypertarget{encoding}{%
|
|
\paragraph*{Encoding}\label{encoding}}
|
|
\addcontentsline{toc}{paragraph}{Encoding}
|
|
|
|
The \protect\hyperlink{sec-fastq}{\emph{FASTQ}} format had differente
|
|
way of encoding the Phred quality score along the time. Here a breif
|
|
history of these changes is presented. \emph{OBITools}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Sanger format can encode a Phred quality score from 0 to 93 using
|
|
ASCII 33 to 126 (although in raw read data the Phred quality score
|
|
rarely exceeds 60, higher scores are possible in assemblies or read
|
|
maps).
|
|
\item
|
|
Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score
|
|
from -5 to 62 using ASCII 59 to 126 (although in raw read data Solexa
|
|
scores from -5 to 40 only are expected)
|
|
\item
|
|
Starting with Illumina 1.3 and before Illumina 1.8, the format encoded
|
|
a Phred quality score from 0 to 62 using ASCII 64 to 126 (although in
|
|
raw read data Phred scores from 0 to 40 only are expected).
|
|
\item
|
|
Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0
|
|
to 2 have a slightly different meaning. The values 0 and 1 are no
|
|
longer used and the value 2, encoded by ASCII 66 ``B''.
|
|
\end{itemize}
|
|
|
|
\begin{quote}
|
|
Sequencing Control Software, Version 2.6, (Catalog \# SY-960-2601, Part
|
|
\# 15009921 Rev.~A, November 2009, page 30) states the following:
|
|
\emph{If a read ends with a segment of mostly low quality (Q15 or
|
|
below), then all of the quality values in the segment are replaced with
|
|
a value of 2 (encoded as the letter B in Illumina's text-based encoding
|
|
of quality scores)\ldots{} This Q2 indicator does not predict a specific
|
|
error rate, but rather indicates that a specific final portion of the
|
|
read should not be used in further analyses.} Also, the quality score
|
|
encoded as ``B'' letter may occur internally within reads at least as
|
|
late as pipeline version 1.6, as shown in the following example:
|
|
\end{quote}
|
|
|
|
\begin{verbatim}
|
|
@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
|
|
TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGA
|
|
TTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
|
|
+HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
|
|
efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][ dddd`
|
|
ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB
|
|
\end{verbatim}
|
|
|
|
An alternative interpretation of this ASCII encoding has been proposed.
|
|
Also, in Illumina runs using PhiX controls, the character `B' was
|
|
observed to represent an ``unknown quality score''. The error rate of
|
|
`B' reads was roughly 3 phred scores lower the mean observed score of a
|
|
given run.
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Starting in Illumina 1.8, the quality scores have basically returned
|
|
to the use of the Sanger format (Phred+33).
|
|
\end{itemize}
|
|
|
|
\emph{OBITools} follows the Sanger format. Nevertheless, It is possible
|
|
to read files encoded following the Solexa/Illumina format by applying a
|
|
shift of 62 (see the option \textbf{--solexa} of the \emph{OBITools}
|
|
commands).
|
|
|
|
\hypertarget{file-extensions-1}{%
|
|
\subsubsection{File extensions}\label{file-extensions-1}}
|
|
|
|
There is no standard file extension for a
|
|
\protect\hyperlink{sec-fastq}{\emph{FASTQ}} file, but \texttt{.fq} and
|
|
\texttt{.fastq}, are commonly used.
|
|
|
|
\hypertarget{the-taxonomy-files}{%
|
|
\section{The taxonomy files}\label{the-taxonomy-files}}
|
|
|
|
Many OBITools are able to take into account taxonomic data. This is done
|
|
by specifying a directory containing all
|
|
:doc:\texttt{NCBI\ taxonomy\ dump\ files\ \textless{}./taxdump\textgreater{}}.
|
|
|
|
\hypertarget{the-sample-description-file}{%
|
|
\section{The sample description
|
|
file}\label{the-sample-description-file}}
|
|
|
|
A key file for \emph{OBITools4} is the file describing all samples (PCR)
|
|
analyzed in the processed sequencing library file. This file, often
|
|
called the \texttt{ngsfilter} file, is a tab separated values (TSV)
|
|
file. The format of this file is exactly identical to that used in
|
|
\emph{OBITools2} and \emph{OBITools4}.
|
|
|
|
\texttt{\{tsv,\ .smaller\}\ wolf\_diet\ \ \ \ 13a\_F730603\ \ \ \ \ \ aattaac\ \ TTAGATACCCCACTATGC\ \ \ \ TAGAACAGGCTCCTCTAG\ \ \ \ \ F\ wolf\_diet\ \ \ \ 15a\_F730814\ \ \ \ \ \ gaagtag\ \ TTAGATACCCCACTATGC\ \ \ \ TAGAACAGGCTCCTCTAG\ \ \ \ \ F\ wolf\_diet\ \ \ \ 26a\_F040644\ \ \ \ \ \ gaatatc\ \ TTAGATACCCCACTATGC\ \ \ \ TAGAACAGGCTCCTCTAG\ \ \ \ \ F\ wolf\_diet\ \ \ \ 29a\_F260619\ \ \ \ \ \ gcctcct\ \ TTAGATACCCCACTATGC\ \ \ \ TAGAACAGGCTCCTCTAG\ \ \ \ \ F}
|
|
|
|
At least six columns must be present in every line of the file.
|
|
|
|
\begin{itemize}
|
|
\item
|
|
The first column contains the name of the experience:
|
|
|
|
An experiment name groups a set of sample together. Sequences
|
|
belonging to the experiment are tagged with an attribute
|
|
\texttt{experiment} containing the name of the experiment in their
|
|
annotation.
|
|
\item
|
|
The second column contains the sample identifier in the experiment
|
|
|
|
The sample identifier must be unique in the experiment. The
|
|
\texttt{obimultiplex} and \texttt{obitagpcr} commands add to all the
|
|
sequences bellonging to the same sample an attribute \texttt{sample}
|
|
containing the sample identifier
|
|
\item
|
|
The third column contains description of the tag used to identify
|
|
sequences corresponding to this sample
|
|
\item
|
|
The fourth column contains the forward primer sequence
|
|
\item
|
|
The fifth column contains the reverse primer sequence
|
|
\item
|
|
The sixth column must always contain the character \texttt{F} (full
|
|
length)
|
|
\end{itemize}
|
|
|
|
\hypertarget{obitools-v4-tutorial}{%
|
|
\chapter{OBITools V4 Tutorial}\label{obitools-v4-tutorial}}
|
|
|
|
Here is a short tutorial on how to analyze DNA metabarcoding data
|
|
produced on Illumina sequencers using:
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
the OBITools
|
|
\item
|
|
some basic Unix commands
|
|
\end{itemize}
|
|
|
|
\hypertarget{wolves-diet-based-on-dna-metabarcoding}{%
|
|
\section{Wolves' diet based on DNA
|
|
metabarcoding}\label{wolves-diet-based-on-dna-metabarcoding}}
|
|
|
|
The data used in this tutorial correspond to the analysis of four wolf
|
|
scats, using the protocol published in Shehzad et al. (2012) for
|
|
assessing carnivore diet. After extracting DNA from the faeces, the DNA
|
|
amplifications were carried out using the primers
|
|
\texttt{TTAGATACCCCACTATGC} and \texttt{TAGAACAGGCTCCTCTAG} amplifiying
|
|
the \emph{12S-V5} region (Riaz et al. 2011), together with a wolf
|
|
blocking oligonucleotide.
|
|
|
|
The complete data set can be downloaded here: \href{wolf_diet.tgz}{the
|
|
tutorial dataset}
|
|
|
|
Once the data file is downloaded, using a UNIX terminal unarchive the
|
|
data from the \texttt{tgz} file.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\FunctionTok{tar}\NormalTok{ zxvf wolf\_diet.tgz}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
That command create a new directory named \texttt{wolf\_data} containing
|
|
every required data files:
|
|
|
|
\begin{itemize}
|
|
\item
|
|
\texttt{fastq\ \textless{}fastq\textgreater{}} files resulting of aGA
|
|
IIx (Illumina) paired-end (2 x 108 bp) sequencing assay of DNA
|
|
extracted and amplified from four wolf faeces:
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{wolf\_F.fastq}
|
|
\item
|
|
\texttt{wolf\_R.fastq}
|
|
\end{itemize}
|
|
\item
|
|
the file describing the primers and tags used for all samples
|
|
sequenced:
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{wolf\_diet\_ngsfilter.txt} The tags correspond to short and
|
|
specific sequences added on the 5\textquotesingle{} end of each
|
|
primer to distinguish the different samples
|
|
\end{itemize}
|
|
\item
|
|
the file containing the reference database in a fasta format:
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{db\_v05\_r117.fasta} This reference database has been
|
|
extracted from the release 117 of EMBL using \texttt{obipcr}
|
|
\end{itemize}
|
|
\end{itemize}
|
|
|
|
To not mix raw data and processed data a new directory called
|
|
\texttt{results} is created.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\FunctionTok{mkdir}\NormalTok{ results}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\hypertarget{step-by-step-analysis}{%
|
|
\section{Step by step analysis}\label{step-by-step-analysis}}
|
|
|
|
\hypertarget{recover-full-sequence-reads-from-forward-and-reverse-partial-reads}{%
|
|
\subsection{Recover full sequence reads from forward and reverse partial
|
|
reads}\label{recover-full-sequence-reads-from-forward-and-reverse-partial-reads}}
|
|
|
|
When using the result of a paired-end sequencing assay with supposedly
|
|
overlapping forward and reverse reads, the first step is to recover the
|
|
assembled sequence.
|
|
|
|
The forward and reverse reads of the same fragment are \emph{at the same
|
|
line position} in the two fastq files obtained after sequencing. Based
|
|
on these two files, the assembly of the forward and reverse reads is
|
|
done with the \texttt{obipairing} utility that aligns the two reads and
|
|
returns the reconstructed sequence.
|
|
|
|
In our case, the command is:
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obipairing} \AttributeTok{{-}{-}min{-}identity}\OperatorTok{=}\NormalTok{0.8 }\DataTypeTok{\textbackslash{}}
|
|
\AttributeTok{{-}{-}min{-}overlap}\OperatorTok{=}\NormalTok{10 }\DataTypeTok{\textbackslash{}}
|
|
\AttributeTok{{-}F}\NormalTok{ wolf\_data/wolf\_F.fastq }\DataTypeTok{\textbackslash{}}
|
|
\AttributeTok{{-}R}\NormalTok{ wolf\_data/wolf\_R.fastq }\DataTypeTok{\textbackslash{}}
|
|
\OperatorTok{\textgreater{}}\NormalTok{ results/wolf.fastq }
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
The \texttt{-\/-min-identity} and \texttt{-\/-min-overlap} options allow
|
|
discarding sequences with low alignment quality. If after the aligment,
|
|
the overlaping parts of the reads is shorter than 10 base pairs or the
|
|
similarity over this aligned region is below 80\% of identity, in the
|
|
output file, the forward and reverse reads are not aligned but
|
|
concatenated, and the value of the \texttt{mode} attribute in the
|
|
sequence header is set to \texttt{joined} instead of \texttt{alignment}.
|
|
|
|
\hypertarget{remove-unaligned-sequence-records}{%
|
|
\subsection{Remove unaligned sequence
|
|
records}\label{remove-unaligned-sequence-records}}
|
|
|
|
Unaligned sequences (:py\texttt{mode=joined}) cannot be used. The
|
|
following command allows removing them from the dataset:
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obigrep} \AttributeTok{{-}p} \StringTok{\textquotesingle{}annotations.mode != "join"\textquotesingle{}} \DataTypeTok{\textbackslash{}}
|
|
\NormalTok{ results/wolf.fastq }\OperatorTok{\textgreater{}}\NormalTok{ results/wolf.ali.fastq}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
The \texttt{-p} requires a go like expression.
|
|
\texttt{annotations.mode\ !=\ "join"} means that if the value of the
|
|
\texttt{mode} annotation of a sequence is different from \texttt{join},
|
|
the corresponding sequence record will be kept.
|
|
|
|
The first sequence record of \texttt{wolf.ali.fastq} can be obtained
|
|
using the following command line:
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\FunctionTok{head} \AttributeTok{{-}n}\NormalTok{ 4 results/wolf.ali.fastq}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
The folling piece of code appears on thew window of tour terminal.
|
|
|
|
\begin{verbatim}
|
|
@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/1 {"ali_dir":"left","ali_length":62,"mode":"alignment","pairing_mismatches":{"(T:26)->(G:13)":62,"(T:34)->(G:18)":48},"score":484,"score_norm":0.968,"seq_a_single":46,"seq_ab_match":60,"seq_b_single":46}
|
|
ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
|
|
+
|
|
CCCCCCCBCCCCCCCCCCCCCCCCCCCCCCBCCCCCBCCCCCCC<CcCccbe[`F`accXV<TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCCCCCCACCCCCACCCCCCCCCCCCCCCC
|
|
\end{verbatim}
|
|
|
|
\hypertarget{assign-each-sequence-record-to-the-corresponding-samplemarker-combination}{%
|
|
\subsection{Assign each sequence record to the corresponding
|
|
sample/marker
|
|
combination}\label{assign-each-sequence-record-to-the-corresponding-samplemarker-combination}}
|
|
|
|
Each sequence record is assigned to its corresponding sample and marker
|
|
using the data provided in a text file (here
|
|
\texttt{wolf\_diet\_ngsfilter.txt}). This text file contains one line
|
|
per sample, with the name of the experiment (several experiments can be
|
|
included in the same file), the name of the tags (for example:
|
|
\texttt{aattaac} if the same tag has been used on each extremity of the
|
|
PCR products, or \texttt{aattaac:gaagtag} if the tags were different),
|
|
the sequence of the forward primer, the sequence of the reverse primer,
|
|
the letter \texttt{T} or \texttt{F} for sample identification using the
|
|
forward primer and tag only or using both primers and both tags,
|
|
respectively (see \texttt{obimultiplex} for details).
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obimultiplex} \AttributeTok{{-}t}\NormalTok{ wolf\_data/wolf\_diet\_ngsfilter.txt }\DataTypeTok{\textbackslash{}}
|
|
\AttributeTok{{-}u}\NormalTok{ results/unidentified.fastq }\DataTypeTok{\textbackslash{}}
|
|
\NormalTok{ results/wolf.ali.fastq }\DataTypeTok{\textbackslash{}}
|
|
\OperatorTok{\textgreater{}}\NormalTok{ results/wolf.ali.assigned.fastq}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
This command creates two files:
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{unidentified.fastq} containing all the sequence records that
|
|
were not assigned to a sample/marker combination
|
|
\item
|
|
\texttt{wolf.ali.assigned.fastq} containing all the sequence records
|
|
that were properly assigned to a sample/marker combination
|
|
\end{itemize}
|
|
|
|
Note that each sequence record of the \texttt{wolf.ali.assigned.fastq}
|
|
file contains only the barcode sequence as the sequences of primers and
|
|
tags are removed by the \texttt{obimultiplex} program. Information
|
|
concerning the experiment, sample, primers and tags is added as
|
|
attributes in the sequence header.
|
|
|
|
For instance, the first sequence record of
|
|
\texttt{wolf.ali.assigned.fastq} is:
|
|
|
|
\begin{verbatim}
|
|
@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/1_sub[28..127] {"ali_dir":"left","ali_length":62,"direction":"direct","experiment":"wolf_diet","forward_match":"ttagataccccactatgc","forward_mismatches":0,"forward_primer":"ttagataccccactatgc","forward_tag":"gcctcct","mode":"alignment","pairing_mismatches":{"(T:26)->(G:13)":35,"(T:34)->(G:18)":21},"reverse_match":"tagaacaggctcctctag","reverse_mismatches":0,"reverse_primer":"tagaacaggctcctctag","reverse_tag":"gcctcct","sample":"29a_F260619","score":484,"score_norm":0.968,"seq_a_single":46,"seq_ab_match":60,"seq_b_single":46}
|
|
ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
|
|
+
|
|
CCCBCCCCCBCCCCCCC<CcCccbe[`F`accXV<TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCC
|
|
\end{verbatim}
|
|
|
|
\hypertarget{dereplicate-reads-into-uniq-sequences}{%
|
|
\subsection{Dereplicate reads into uniq
|
|
sequences}\label{dereplicate-reads-into-uniq-sequences}}
|
|
|
|
The same DNA molecule can be sequenced several times. In order to reduce
|
|
both file size and computations time, and to get easier interpretable
|
|
results, it is convenient to work with unique \emph{sequences} instead
|
|
of \emph{reads}. To \emph{dereplicate} such \emph{reads} into unique
|
|
\emph{sequences}, we use the \texttt{obiuniq} command.
|
|
|
|
\begin{longtable}[]{@{}
|
|
>{\raggedright\arraybackslash}p{(\columnwidth - 0\tabcolsep) * \real{0.8611}}@{}}
|
|
\toprule()
|
|
\endhead
|
|
Definition: Dereplicate reads into unique sequences \\
|
|
\begin{minipage}[t]{\linewidth}\raggedright
|
|
\begin{enumerate}
|
|
\def\labelenumi{\arabic{enumi}.}
|
|
\tightlist
|
|
\item
|
|
compare all the reads in a data set to each other
|
|
\item
|
|
group strictly identical reads together
|
|
\item
|
|
output the sequence for each group and its count in the original
|
|
dataset (in this way, all duplicated reads are removed)
|
|
\end{enumerate}
|
|
|
|
Definition adapted from Seguritan and Rohwer (2001)
|
|
\end{minipage} \\
|
|
\bottomrule()
|
|
\end{longtable}
|
|
|
|
For dereplication, we use the \texttt{obiuniq} command with the
|
|
\texttt{-m\ sample}. The \texttt{-m\ sample} option is used to keep the
|
|
information of the samples of origin for each uniquesequence.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obiuniq} \AttributeTok{{-}m}\NormalTok{ sample }\DataTypeTok{\textbackslash{}}
|
|
\NormalTok{ results/wolf.ali.assigned.fastq }\DataTypeTok{\textbackslash{}}
|
|
\OperatorTok{\textgreater{}}\NormalTok{ results/wolf.ali.assigned.uniq.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
Note that \texttt{obiuniq} returns a fasta file.
|
|
|
|
The first sequence record of \texttt{wolf.ali.assigned.uniq.fasta} is:
|
|
|
|
\begin{verbatim}
|
|
>HELIUM_000100422_612GNAAXX:7:93:6991:1942#0/1_sub[28..126] {"ali_dir":"left","ali_length":63,"count":1,"direction":"reverse","experiment":"wolf_diet","forward_match":"ttagataccccactatgc","forward_mismatches":0,"forward_primer":"ttagataccccactatgc","forward_tag":"gaatatc","merged_sample":{"26a_F040644":1},"mode":"alignment","pairing_mismatches":{"(A:10)->(G:34)":76,"(C:06)->(A:34)":58},"reverse_match":"tagaacaggctcctctag","reverse_mismatches":0,"reverse_primer":"tagaacaggctcctctag","reverse_tag":"gaatatc","score":730,"score_norm":0.968,"seq_a_single":45,"seq_ab_match":61,"seq_b_single":45}
|
|
ttagccctaaacataaacattcaataaacaagaatgttcgccagagaactactagcaaca
|
|
gcctgaaactcaaaggacttggcggtgctttatatccct
|
|
\end{verbatim}
|
|
|
|
The run of \texttt{obiuniq} has added two key=values entries in the
|
|
header of the fasta sequence:
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{"merged\_sample":\{"29a\_F260619":1\}}: this sequence have
|
|
been found once in a single sample called \textbf{29a\_F260619}
|
|
\item
|
|
\texttt{"count":1} : the total count for this sequence is \(1\)
|
|
\end{itemize}
|
|
|
|
To keep only these two attributes, we can use the \texttt{obiannotate}
|
|
command:
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obiannotate} \AttributeTok{{-}k}\NormalTok{ count }\AttributeTok{{-}k}\NormalTok{ merged\_sample }\DataTypeTok{\textbackslash{}}
|
|
\NormalTok{ results/wolf.ali.assigned.uniq.fasta }\DataTypeTok{\textbackslash{}}
|
|
\OperatorTok{\textgreater{}}\NormalTok{ results/wolf.ali.assigned.simple.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
The first five sequence records of
|
|
\texttt{wolf.ali.assigned.simple.fasta} become:
|
|
|
|
\begin{verbatim}
|
|
>HELIUM_000100422_612GNAAXX:7:26:18930:11105#0/1_sub[28..127] {"count":1,"merged_sample":{"29a_F260619":1}}
|
|
ttagccctaaacacaagtaattaatataacaaaatwattcgcyagagtactacmggcaat
|
|
agctyaaarctcamagrwcttggcggtgctttataccctt
|
|
>HELIUM_000100422_612GNAAXX:7:58:5711:11399#0/1_sub[28..127] {"count":1,"merged_sample":{"29a_F260619":1}}
|
|
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtwctaccgssaat
|
|
agcttaaaactcaaaggactgggcggtgctttataccctt
|
|
>HELIUM_000100422_612GNAAXX:7:100:15836:9304#0/1_sub[28..127] {"count":1,"merged_sample":{"29a_F260619":1}}
|
|
ttagccctaaacatagataattacacaaacaaaattgttcaccagagtactagcggcaac
|
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
|
>HELIUM_000100422_612GNAAXX:7:55:13242:9085#0/1_sub[28..126] {"count":4,"merged_sample":{"26a_F040644":4}}
|
|
ttagccctaaacataaacattcaataaacaagagtgttcgccagagtactactagcaaca
|
|
gcctgaaactcaaaggacttggcggtgctttacatccct
|
|
>HELIUM_000100422_612GNAAXX:7:86:8429:13723#0/1_sub[28..127] {"count":7,"merged_sample":{"15a_F730814":5,"29a_F260619":2}}
|
|
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
|
|
agcttaaaactcaaaggactcggcggtgctttataccctt
|
|
\end{verbatim}
|
|
|
|
\hypertarget{denoise-the-sequence-dataset}{%
|
|
\subsection{Denoise the sequence
|
|
dataset}\label{denoise-the-sequence-dataset}}
|
|
|
|
To have a set of sequences assigned to their corresponding samples does
|
|
not mean that all sequences are \emph{biologically} meaningful i.e.~some
|
|
of these sequences can contains PCR and/or sequencing errors, or
|
|
chimeras.
|
|
|
|
\hypertarget{tag-the-sequences-for-pcr-errors-sequence-variants}{%
|
|
\subsubsection*{Tag the sequences for PCR errors (sequence
|
|
variants)}\label{tag-the-sequences-for-pcr-errors-sequence-variants}}
|
|
\addcontentsline{toc}{subsubsection}{Tag the sequences for PCR errors
|
|
(sequence variants)}
|
|
|
|
The \texttt{obiclean} program tags sequence variants as potential error
|
|
generated during PCR amplification. We ask it to keep the {head}
|
|
sequences (\texttt{-H} option) that are sequences which are not variants
|
|
of another sequence with a count greater than 5\% of their own count
|
|
(\texttt{-r\ 0.05} option).
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obiclean} \AttributeTok{{-}s}\NormalTok{ sample }\AttributeTok{{-}r}\NormalTok{ 0.05 }\AttributeTok{{-}H} \DataTypeTok{\textbackslash{}}
|
|
\NormalTok{ results/wolf.ali.assigned.simple.fasta }\DataTypeTok{\textbackslash{}}
|
|
\OperatorTok{\textgreater{}}\NormalTok{ results/wolf.ali.assigned.simple.clean.fasta }
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
One of the sequence records of
|
|
\texttt{wolf.ali.assigned.simple.clean.fasta} is:
|
|
|
|
\begin{verbatim}
|
|
>HELIUM_000100422_612GNAAXX:7:66:4039:8016#0/1_sub[28..127] {"count":17,"merged_sample":{"13a_F730603":17},"obiclean_head":true,"obiclean_headcount":1,"obiclean_internalcount":0,"obi
|
|
clean_samplecount":1,"obiclean_singletoncount":0,"obiclean_status":{"13a_F730603":"h"},"obiclean_weight":{"13a_F730603":25}}
|
|
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaac
|
|
agcccaaaactcaaaggacttggcggtgcttcacaccctt
|
|
\end{verbatim}
|
|
|
|
To remove such sequences as much as possible, we first discard rare
|
|
sequences and then rsequence variants that likely correspond to
|
|
artifacts.
|
|
|
|
\hypertarget{get-some-statistics-about-sequence-counts}{%
|
|
\subsubsection*{Get some statistics about sequence
|
|
counts}\label{get-some-statistics-about-sequence-counts}}
|
|
\addcontentsline{toc}{subsubsection}{Get some statistics about sequence
|
|
counts}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obicount}\NormalTok{ results/wolf.ali.assigned.simple.clean.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\begin{verbatim}
|
|
time="2023-02-23T18:43:37+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.fasta file\n"
|
|
2749 36409 273387
|
|
\end{verbatim}
|
|
|
|
The dataset contains \(4313\) sequences variant corresponding to 42452
|
|
sequence reads. Most of the variants occur only a single time in the
|
|
complete dataset and are usualy named \emph{singletons}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obigrep} \AttributeTok{{-}p} \StringTok{\textquotesingle{}sequence.Count() == 1\textquotesingle{}}\NormalTok{ results/wolf.ali.assigned.simple.clean.fasta }\DataTypeTok{\textbackslash{}}
|
|
\KeywordTok{|} \ExtensionTok{obicount}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\begin{verbatim}
|
|
time="2023-02-23T18:43:37+01:00" level=info msg="Reading sequences from stdin in guessed\n"
|
|
time="2023-02-23T18:43:37+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.fasta file\n"
|
|
time="2023-02-23T18:43:37+01:00" level=info msg="On output use JSON headers"
|
|
2623 2623 261217
|
|
\end{verbatim}
|
|
|
|
In that dataset sigletons corresponds to \(3511\) variants.
|
|
|
|
Using \emph{R} and the \texttt{ROBIFastread} package able to read
|
|
headers of the fasta files produced by \emph{OBITools}, we can get more
|
|
complete statistics on the distribution of occurrencies.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\FunctionTok{library}\NormalTok{(ROBIFastread)}
|
|
\FunctionTok{library}\NormalTok{(ggplot2)}
|
|
|
|
\NormalTok{seqs }\OtherTok{\textless{}{-}} \FunctionTok{read\_obifasta}\NormalTok{(}\StringTok{"results/wolf.ali.assigned.simple.clean.fasta"}\NormalTok{,}\AttributeTok{keys=}\StringTok{"count"}\NormalTok{)}
|
|
|
|
\FunctionTok{ggplot}\NormalTok{(}\AttributeTok{data =}\NormalTok{ seqs, }\AttributeTok{mapping=}\FunctionTok{aes}\NormalTok{(}\AttributeTok{x =}\NormalTok{ count)) }\SpecialCharTok{+}
|
|
\FunctionTok{geom\_histogram}\NormalTok{(}\AttributeTok{bins=}\DecValTok{100}\NormalTok{) }\SpecialCharTok{+}
|
|
\FunctionTok{scale\_y\_sqrt}\NormalTok{() }\SpecialCharTok{+}
|
|
\FunctionTok{scale\_x\_sqrt}\NormalTok{() }\SpecialCharTok{+}
|
|
\FunctionTok{geom\_vline}\NormalTok{(}\AttributeTok{xintercept =} \DecValTok{10}\NormalTok{, }\AttributeTok{col=}\StringTok{"red"}\NormalTok{, }\AttributeTok{lty=}\DecValTok{2}\NormalTok{) }\SpecialCharTok{+}
|
|
\FunctionTok{xlab}\NormalTok{(}\StringTok{"number of occurrencies of a variant"}\NormalTok{) }
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\begin{figure}[H]
|
|
|
|
{\centering \includegraphics{./tutorial_files/figure-pdf/unnamed-chunk-9-1.pdf}
|
|
|
|
}
|
|
|
|
\end{figure}
|
|
|
|
In a similar way it is also possible to plot the distribution of the
|
|
sequence length.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\FunctionTok{ggplot}\NormalTok{(}\AttributeTok{data =}\NormalTok{ seqs, }\AttributeTok{mapping=}\FunctionTok{aes}\NormalTok{(}\AttributeTok{x =} \FunctionTok{nchar}\NormalTok{(sequence))) }\SpecialCharTok{+}
|
|
\FunctionTok{geom\_histogram}\NormalTok{() }\SpecialCharTok{+}
|
|
\FunctionTok{scale\_y\_log10}\NormalTok{() }\SpecialCharTok{+}
|
|
\FunctionTok{geom\_vline}\NormalTok{(}\AttributeTok{xintercept =} \DecValTok{80}\NormalTok{, }\AttributeTok{col=}\StringTok{"red"}\NormalTok{, }\AttributeTok{lty=}\DecValTok{2}\NormalTok{) }\SpecialCharTok{+}
|
|
\FunctionTok{xlab}\NormalTok{(}\StringTok{"sequence lengths in base pair"}\NormalTok{)}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\begin{figure}[H]
|
|
|
|
{\centering \includegraphics{./tutorial_files/figure-pdf/unnamed-chunk-10-1.pdf}
|
|
|
|
}
|
|
|
|
\end{figure}
|
|
|
|
\hypertarget{keep-only-the-sequences-having-a-count-greater-or-equal-to-10-and-a-length-shorter-than-80-bp}{%
|
|
\subsubsection*{Keep only the sequences having a count greater or equal
|
|
to 10 and a length shorter than 80
|
|
bp}\label{keep-only-the-sequences-having-a-count-greater-or-equal-to-10-and-a-length-shorter-than-80-bp}}
|
|
\addcontentsline{toc}{subsubsection}{Keep only the sequences having a
|
|
count greater or equal to 10 and a length shorter than 80 bp}
|
|
|
|
Based on the previous observation, we set the cut-off for keeping
|
|
sequences for further analysis to a count of 10. To do this, we use the
|
|
\texttt{obigrep\ \textless{}scripts/obigrep\textgreater{}} command. The
|
|
\texttt{-p\ \textquotesingle{}count\textgreater{}=10\textquotesingle{}}
|
|
option means that the \texttt{python} expression
|
|
:py\texttt{count\textgreater{}=10} must be evaluated to :py\texttt{True}
|
|
for each sequence to be kept. Based on previous knowledge we also remove
|
|
sequences with a length shorter than 80 bp (option -l) as we know that
|
|
the amplified 12S-V5 barcode for vertebrates must have a length around
|
|
100bp.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obigrep} \AttributeTok{{-}l}\NormalTok{ 80 }\AttributeTok{{-}p} \StringTok{\textquotesingle{}sequence.Count() \textgreater{}= 10\textquotesingle{}}\NormalTok{ results/wolf.ali.assigned.simple.clean.fasta }\DataTypeTok{\textbackslash{}}
|
|
\OperatorTok{\textgreater{}}\NormalTok{ results/wolf.ali.assigned.simple.clean.c10.l80.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
The first sequence record of
|
|
\texttt{results/wolf.ali.assigned.simple.clean.c10.l80.fasta} is:
|
|
|
|
\begin{verbatim}
|
|
>HELIUM_000100422_612GNAAXX:7:22:2603:18023#0/1_sub[28..127] {"count":12182,"merged_sample":{"15a_F730814":7559,"29a_F260619":4623},"obiclean_head":true,"obiclean_headcount":2,"obiclean_internalcount":0,"obiclean_samplecount":2,"obiclean_singletoncount":0,"obiclean_status":{"15a_F730814":"h","29a_F260619":"h"},"obiclean_weight":{"15a_F730814":9165,"29a_F260619":6275}}
|
|
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
|
|
agcttaaaactcaaaggacttggcggtgctttataccctt
|
|
\end{verbatim}
|
|
|
|
At that time in the data cleanning we have conserved :
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obicount}\NormalTok{ results/wolf.ali.assigned.simple.clean.c10.l80.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\begin{verbatim}
|
|
time="2023-02-23T18:43:40+01:00" level=info msg="Appending results/wolf.ali.assigned.simple.clean.c10.l80.fasta file\n"
|
|
26 31337 2585
|
|
\end{verbatim}
|
|
|
|
\hypertarget{taxonomic-assignment-of-sequences}{%
|
|
\subsection{Taxonomic assignment of
|
|
sequences}\label{taxonomic-assignment-of-sequences}}
|
|
|
|
Once denoising has been done, the next step in diet analysis is to
|
|
assign the barcodes to the corresponding species in order to get the
|
|
complete list of species associated to each sample.
|
|
|
|
Taxonomic assignment of sequences requires a reference database
|
|
compiling all possible species to be identified in the sample.
|
|
Assignment is then done based on sequence comparison between sample
|
|
sequences and reference sequences.
|
|
|
|
\hypertarget{download-the-taxonomy}{%
|
|
\subsubsection*{Download the taxonomy}\label{download-the-taxonomy}}
|
|
\addcontentsline{toc}{subsubsection}{Download the taxonomy}
|
|
|
|
It is always possible to download the complete taxonomy from NCBI using
|
|
the following commands.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\FunctionTok{mkdir}\NormalTok{ TAXO}
|
|
\BuiltInTok{cd}\NormalTok{ TAXO}
|
|
\ExtensionTok{curl}\NormalTok{ http://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz }\DataTypeTok{\textbackslash{}}
|
|
\KeywordTok{|} \FunctionTok{tar} \AttributeTok{{-}zxvf} \AttributeTok{{-}}
|
|
\BuiltInTok{cd}\NormalTok{ ..}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
For people have a low speed internet connection, a copy of the
|
|
\texttt{taxdump.tar.gz} file is provided in the wolf\_data directory.
|
|
The NCBI taxonomy is dayly updated, but the one provided here is ok for
|
|
running this tutorial.
|
|
|
|
To build the TAXO directory from the provided \texttt{taxdump.tar.gz},
|
|
you need to execute the following commands
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\FunctionTok{mkdir}\NormalTok{ TAXO}
|
|
\BuiltInTok{cd}\NormalTok{ TAXO}
|
|
\FunctionTok{tar}\NormalTok{ zxvf wolf\_data/taxdump.tar.gz }
|
|
\BuiltInTok{cd}\NormalTok{ ..}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\hypertarget{build-a-reference-database}{%
|
|
\subsubsection*{Build a reference
|
|
database}\label{build-a-reference-database}}
|
|
\addcontentsline{toc}{subsubsection}{Build a reference database}
|
|
|
|
One way to build the reference database is to use the \texttt{obipcr}
|
|
program to simulate a PCR and extract all sequences from a general
|
|
purpose DNA database such as genbank or EMBL that can be amplified
|
|
\emph{in silico} by the two primers (here \textbf{TTAGATACCCCACTATGC}
|
|
and \textbf{TAGAACAGGCTCCTCTAG}) used for PCR amplification.
|
|
|
|
The two steps to build this reference database would then be
|
|
|
|
\begin{enumerate}
|
|
\def\labelenumi{\arabic{enumi}.}
|
|
\item
|
|
Today, the easiest database to download is \emph{Genbank}. But this
|
|
will take you more than a day and occupy more than half a terabyte on
|
|
your hard drive. In the \texttt{wolf\_data} directory, a shell script
|
|
called \texttt{download\_gb.sh} is provided to perform this task. It
|
|
requires that the programs \texttt{wget2} and \texttt{curl} are
|
|
available on your computer.
|
|
\item
|
|
Use \texttt{obipcr} to simulate amplification and build a reference
|
|
database based on the putatively amplified barcodes and their recorded
|
|
taxonomic information.
|
|
\end{enumerate}
|
|
|
|
As these steps can take a long time (about a day for the download and an
|
|
hour for the PCR), we already provide the reference database produced by
|
|
the following commands so you can skip its construction. Note that as
|
|
the Genbank and taxonomic database evolve frequently, if you run the
|
|
following commands you may get different results.
|
|
|
|
\hypertarget{download-the-sequences}{%
|
|
\paragraph*{Download the sequences}\label{download-the-sequences}}
|
|
\addcontentsline{toc}{paragraph}{Download the sequences}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\FunctionTok{mkdir}\NormalTok{ genbank}
|
|
\BuiltInTok{cd}\NormalTok{ genbank}
|
|
\ExtensionTok{../wolf\_data/install\_gb.sh}
|
|
\BuiltInTok{cd}\NormalTok{ ..}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
DO NOT RUN THIS COMMAND EXCEPT IF YOU ARE REALLY CONSIENT OF THE TIME
|
|
AND DISK SPACE REQUIRED.
|
|
|
|
\hypertarget{use-obipcr-to-simulate-an-in-silico-pcr}{%
|
|
\paragraph*{Use obipcr to simulate an in silico`
|
|
PCR}\label{use-obipcr-to-simulate-an-in-silico-pcr}}
|
|
\addcontentsline{toc}{paragraph}{Use obipcr to simulate an in silico`
|
|
PCR}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obipcr} \AttributeTok{{-}t}\NormalTok{ TAXO }\AttributeTok{{-}e}\NormalTok{ 3 }\AttributeTok{{-}l}\NormalTok{ 50 }\AttributeTok{{-}L}\NormalTok{ 150 }\DataTypeTok{\textbackslash{} }
|
|
\ExtensionTok{{-}{-}forward}\NormalTok{ TTAGATACCCCACTATGC }\DataTypeTok{\textbackslash{}}
|
|
\AttributeTok{{-}{-}reverse}\NormalTok{ TAGAACAGGCTCCTCTAG }\DataTypeTok{\textbackslash{}}
|
|
\AttributeTok{{-}{-}no{-}order} \DataTypeTok{\textbackslash{}}
|
|
\NormalTok{ genbank/Release{-}251/gb}\PreprocessorTok{*}\NormalTok{.seq.gz}
|
|
\OperatorTok{\textgreater{}}\NormalTok{ results/v05.pcr.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
Note that the primers must be in the same order both in
|
|
\texttt{wolf\_diet\_ngsfilter.txt} and in the \texttt{obipcr} command.
|
|
The part of the path indicating the \emph{Genbank} release can change.
|
|
Please check in your genbank directory the exact name of your release.
|
|
|
|
\hypertarget{clean-the-database}{%
|
|
\paragraph*{Clean the database}\label{clean-the-database}}
|
|
\addcontentsline{toc}{paragraph}{Clean the database}
|
|
|
|
\begin{enumerate}
|
|
\def\labelenumi{\arabic{enumi}.}
|
|
\tightlist
|
|
\item
|
|
filter sequences so that they have a good taxonomic description at the
|
|
species, genus, and family levels (\texttt{obigrep} command command
|
|
below).
|
|
\item
|
|
remove redundant sequences (\texttt{obiuniq} command below).
|
|
\item
|
|
ensure that the dereplicated sequences have a taxid at the family
|
|
level (\texttt{obigrep} command below).
|
|
\item
|
|
ensure that sequences each have a unique identification
|
|
(\texttt{obiannotate} command below)
|
|
\end{enumerate}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obigrep} \AttributeTok{{-}t}\NormalTok{ TAXO }\DataTypeTok{\textbackslash{}}
|
|
\AttributeTok{{-}{-}require{-}rank}\NormalTok{ species }\DataTypeTok{\textbackslash{}}
|
|
\AttributeTok{{-}{-}require{-}rank}\NormalTok{ genus }\DataTypeTok{\textbackslash{}}
|
|
\AttributeTok{{-}{-}require{-}rank}\NormalTok{ family }\DataTypeTok{\textbackslash{}}
|
|
\NormalTok{ results/v05.ecopcr }\OperatorTok{\textgreater{}}\NormalTok{ results/v05\_clean.fasta}
|
|
|
|
\ExtensionTok{obiuniq} \AttributeTok{{-}c}\NormalTok{ taxid }\DataTypeTok{\textbackslash{}}
|
|
\NormalTok{ results/v05\_clean.fasta }\DataTypeTok{\textbackslash{}}
|
|
\OperatorTok{\textgreater{}}\NormalTok{ results/v05\_clean\_uniq.fasta}
|
|
|
|
\ExtensionTok{obirefidx} \AttributeTok{{-}t}\NormalTok{ TAXO results/v05\_clean\_uniq.fasta }\DataTypeTok{\textbackslash{}}
|
|
\OperatorTok{\textgreater{}}\NormalTok{ results/v05\_clean\_uniq.indexed.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
Warning
|
|
|
|
From now on, for the sake of clarity, the following commands will use
|
|
the filenames of the files provided with the tutorial. If you decided to
|
|
run the last steps and use the files you have produced,
|
|
you\textquotesingle ll have to use
|
|
\texttt{results/v05\_clean\_uniq.indexed.fasta} instead of
|
|
\texttt{wolf\_data/db\_v05\_r117.indexed.fasta}.
|
|
|
|
\hypertarget{assign-each-sequence-to-a-taxon}{%
|
|
\subsection{Assign each sequence to a
|
|
taxon}\label{assign-each-sequence-to-a-taxon}}
|
|
|
|
Once the reference database is built, taxonomic assignment can be
|
|
carried out using the \texttt{obitag} command.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obitag} \AttributeTok{{-}t}\NormalTok{ TAXO }\AttributeTok{{-}R}\NormalTok{ wolf\_data/db\_v05\_r117.indexed.fasta }\DataTypeTok{\textbackslash{}}
|
|
\NormalTok{ results/wolf.ali.assigned.simple.clean.c10.l80.fasta }\DataTypeTok{\textbackslash{}}
|
|
\OperatorTok{\textgreater{}}\NormalTok{ results/wolf.ali.assigned.simple.clean.c10.l80.taxo.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
The \texttt{obitag} adds several attributes in the sequence record
|
|
header, among them:
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
obitag\_bestmatch=ACCESSION where ACCESSION is the id of hte sequence
|
|
in the reference database that best aligns to the query sequence;
|
|
\item
|
|
obitag\_bestid=FLOAT where FLOAT*100 is the percentage of identity
|
|
between the best match sequence and the query sequence;
|
|
\item
|
|
taxid=TAXID where TAXID is the final assignation of the sequence by
|
|
\texttt{obitag}
|
|
\item
|
|
scientific\_name=NAME where NAME is the scientific name of the
|
|
assigned taxid.
|
|
\end{itemize}
|
|
|
|
The first sequence record of
|
|
\texttt{wolf.ali.assigned.simple.clean.c10.l80.taxo.fasta} is:
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\OperatorTok{\textgreater{}}\NormalTok{HELIUM\_000100422\_612GNAAXX:7:81:18704:12346\#0/1\_sub[28..126] }\DataTypeTok{\{}\StringTok{"count"}\DataTypeTok{:88}\OperatorTok{,}\StringTok{"merged\_sample"}\DataTypeTok{:\{}\StringTok{"26a\_F040644"}\DataTypeTok{:88\}}\OperatorTok{,}\StringTok{"obiclean\_head"}\DataTypeTok{:true}\OperatorTok{,}\StringTok{"obiclean\_headcount"}\DataTypeTok{:1}\OperatorTok{,}\StringTok{"obiclean\_internalcount"}\DataTypeTok{:0}\OperatorTok{,}\StringTok{"obiclean\_samplecount"}\DataTypeTok{:1}\OperatorTok{,}\StringTok{"obiclean\_singletoncount"}\DataTypeTok{:0}\OperatorTok{,}\StringTok{"obiclean\_status"}\DataTypeTok{:\{}\StringTok{"26a\_F040644"}\DataTypeTok{:}\StringTok{"h"}\DataTypeTok{\}}\OperatorTok{,}\StringTok{"obiclean\_weight"}\DataTypeTok{:\{}\StringTok{"26a\_F040644"}\DataTypeTok{:208\}}\OperatorTok{,}\StringTok{"obitag\_bestid"}\DataTypeTok{:0.9207920792079208}\OperatorTok{,}\StringTok{"obitag\_bestmatch"}\DataTypeTok{:}\StringTok{"AY769263"}\OperatorTok{,}\StringTok{"obitag\_difference"}\DataTypeTok{:8}\OperatorTok{,}\StringTok{"obitag\_match\_count"}\DataTypeTok{:1}\OperatorTok{,}\StringTok{"obitag\_rank"}\DataTypeTok{:}\StringTok{"clade"}\OperatorTok{,}\StringTok{"scientific\_name"}\DataTypeTok{:}\StringTok{"Boreoeutheria"}\OperatorTok{,}\StringTok{"taxid"}\DataTypeTok{:1437010\}}
|
|
\ExtensionTok{ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata}
|
|
\ExtensionTok{gcttaaaactcaaaggacttggcggtgctttatatccct}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\hypertarget{generate-the-final-result-table}{%
|
|
\subsection{Generate the final result
|
|
table}\label{generate-the-final-result-table}}
|
|
|
|
Some unuseful attributes can be removed at this stage.
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
obiclean\_head
|
|
\item
|
|
obiclean\_headcount
|
|
\item
|
|
obiclean\_internalcount
|
|
\item
|
|
obiclean\_samplecount
|
|
\item
|
|
obiclean\_singletoncount
|
|
\end{itemize}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obiannotate} \AttributeTok{{-}{-}delete{-}tag}\OperatorTok{=}\NormalTok{obiclean\_head }\DataTypeTok{\textbackslash{}}
|
|
\AttributeTok{{-}{-}delete{-}tag}\OperatorTok{=}\NormalTok{obiclean\_headcount }\DataTypeTok{\textbackslash{}}
|
|
\AttributeTok{{-}{-}delete{-}tag}\OperatorTok{=}\NormalTok{obiclean\_internalcount }\DataTypeTok{\textbackslash{}}
|
|
\AttributeTok{{-}{-}delete{-}tag}\OperatorTok{=}\NormalTok{obiclean\_samplecount }\DataTypeTok{\textbackslash{}}
|
|
\AttributeTok{{-}{-}delete{-}tag}\OperatorTok{=}\NormalTok{obiclean\_singletoncount }\DataTypeTok{\textbackslash{}}
|
|
\NormalTok{ results/wolf.ali.assigned.simple.clean.c10.l80.taxo.fasta }\DataTypeTok{\textbackslash{}}
|
|
\OperatorTok{\textgreater{}}\NormalTok{ results/wolf.ali.assigned.simple.clean.c10.l80.taxo.ann.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
The first sequence record of
|
|
\texttt{wolf.ali.assigned.simple.c10.l80.clean.taxo.ann.fasta} is then:
|
|
|
|
\begin{verbatim}
|
|
>HELIUM_000100422_612GNAAXX:7:84:16335:5083#0/1_sub[28..126] {"count":96,"merged_sample":{"26a_F040644":11,"29a_F260619":85},"obiclean_status":{"26a_F040644":"s","29a_F260619":"h"},"obiclean_weight":{"26a_F040644":14,"29a_F260619":110},"obitag_bestid":0.9595959595959596,"obitag_bestmatch":"AC187326","obitag_difference":4,"obitag_match_count":1,"obitag_rank":"subspecies","scientific_name":"Canis lupus familiaris","taxid":9615}
|
|
ttagccctaaacataagctattccataacaaaataattcgccagagaactactagcaaca
|
|
gattaaacctcaaaggacttggcagtgctttatacccct
|
|
\end{verbatim}
|
|
|
|
\hypertarget{looking-at-the-data-in-r}{%
|
|
\subsection{Looking at the data in R}\label{looking-at-the-data-in-r}}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\FunctionTok{library}\NormalTok{(ROBIFastread)}
|
|
\FunctionTok{library}\NormalTok{(vegan)}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\begin{verbatim}
|
|
Le chargement a nécessité le package : permute
|
|
\end{verbatim}
|
|
|
|
\begin{verbatim}
|
|
Le chargement a nécessité le package : lattice
|
|
\end{verbatim}
|
|
|
|
\begin{verbatim}
|
|
This is vegan 2.6-4
|
|
\end{verbatim}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\FunctionTok{library}\NormalTok{(magrittr)}
|
|
|
|
|
|
\NormalTok{diet\_data }\OtherTok{\textless{}{-}} \FunctionTok{read\_obifasta}\NormalTok{(}\StringTok{"results/wolf.ali.assigned.simple.clean.c10.l80.taxo.fasta"}\NormalTok{) }
|
|
\NormalTok{diet\_data }\SpecialCharTok{\%\textless{}\textgreater{}\%} \FunctionTok{extract\_features}\NormalTok{(}\StringTok{"obitag\_bestmatch"}\NormalTok{,}\StringTok{"obitag\_rank"}\NormalTok{,}\StringTok{"scientific\_name"}\NormalTok{,}\StringTok{\textquotesingle{}taxid\textquotesingle{}}\NormalTok{)}
|
|
|
|
\NormalTok{diet\_tab }\OtherTok{\textless{}{-}} \FunctionTok{extract\_readcount}\NormalTok{(diet\_data,}\AttributeTok{key=}\StringTok{"obiclean\_weight"}\NormalTok{)}
|
|
\NormalTok{diet\_tab}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\begin{verbatim}
|
|
4 x 26 sparse Matrix of class "dgCMatrix"
|
|
\end{verbatim}
|
|
|
|
\begin{verbatim}
|
|
[[ suppressing 26 column names 'HELIUM_000100422_612GNAAXX:7:100:4828:3492#0/1_sub[28..127]', 'HELIUM_000100422_612GNAAXX:7:7:2880:4021#0/1_sub[28..127]', 'HELIUM_000100422_612GNAAXX:7:7:18108:9040#0/1_sub[28..126]' ... ]]
|
|
\end{verbatim}
|
|
|
|
\begin{verbatim}
|
|
|
|
13a_F730603 22 . 9 19 25 1 . . . . . . . . . 20 . . . .
|
|
29a_F260619 . 44 . 1 . 13 . 25 . . . 16 391 . . . . 6275 110 .
|
|
15a_F730814 . . 4 5 . . . . . . . . . . . . . 9138 . .
|
|
26a_F040644 . . . 481 . . 14 . 43 208 72 . . 52 88 . 31 . 14 18
|
|
|
|
13a_F730603 . . . . 15 8409
|
|
29a_F260619 . . . 353 . .
|
|
15a_F730814 . . . . . .
|
|
26a_F040644 12265 15 17 . . .
|
|
\end{verbatim}
|
|
|
|
\begin{description}
|
|
\item[This file contains 26 sequences. You can deduce the diet of each
|
|
sample:]
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item[]
|
|
\item
|
|
13a\_F730603: Cervus elaphus
|
|
\item
|
|
15a\_F730814: Capreolus capreolus
|
|
\item
|
|
26a\_F040644: Marmota sp. (according to the location, it is Marmota
|
|
marmota)
|
|
\item
|
|
29a\_F260619: Capreolus capreolus
|
|
\end{itemize}
|
|
\end{description}
|
|
|
|
Note that we also obtained a few wolf sequences although a wolf-blocking
|
|
oligonucleotide was used.
|
|
|
|
\part{The \emph{OBITools V4} commands}
|
|
|
|
\hypertarget{specifying-the-data-input-to-obitools-commands}{%
|
|
\chapter{\texorpdfstring{Specifying the data input to \emph{OBITools}
|
|
commands}{Specifying the data input to OBITools commands}}\label{specifying-the-data-input-to-obitools-commands}}
|
|
|
|
\hypertarget{specifying-input-format}{%
|
|
\section{Specifying input format}\label{specifying-input-format}}
|
|
|
|
Five sequence formats are accepted for input files. \emph{Fasta}
|
|
(Section~\ref{sec-fasta}) and \emph{Fastq} (Section~\ref{sec-fastq}) are
|
|
the main ones, EMBL and Genbank allow the use of flat files produced by
|
|
these two international databases. The last one, ecoPCR, is maintained
|
|
for compatibility with previous \emph{OBITools} and allows to read
|
|
\emph{ecoPCR} outputs as sequence files.
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{-\/-ecopcr} : Read data following the \emph{ecoPCR} output
|
|
format.
|
|
\item
|
|
\texttt{-\/-embl} Read data following the \emph{EMBL} flatfile format.
|
|
\item
|
|
\texttt{-\/-genbank} Read data following the \emph{Genbank} flatfile
|
|
format.
|
|
\end{itemize}
|
|
|
|
Several encoding schemes have been proposed for quality scores in
|
|
\emph{Fastq} format. Currently, \emph{OBITools} considers Sanger
|
|
encoding as the standard. For reasons of compatibility with older
|
|
datasets produced with \emph{Solexa} sequencers, it is possible, by
|
|
using the following option, to force the use of the corresponding
|
|
quality encoding scheme when reading these older files.
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{-\/-solexa} Decodes quality string according to the Solexa
|
|
specification. (default: false)
|
|
\end{itemize}
|
|
|
|
\hypertarget{controling-obitools-outputs}{%
|
|
\chapter{Controling OBITools
|
|
outputs}\label{controling-obitools-outputs}}
|
|
|
|
\hypertarget{specifying-output-format}{%
|
|
\section{Specifying output format}\label{specifying-output-format}}
|
|
|
|
Only two output sequence formats are supported by OBITools, Fasta and
|
|
Fastq. Fastq is used when output sequences are associated with quality
|
|
information. Otherwise, Fasta is the default format. However, it is
|
|
possible to force the output format by using one of the following two
|
|
options. Forcing the use of Fasta results in the loss of quality
|
|
information. Conversely, when the Fastq format is forced with sequences
|
|
that have no quality data, dummy qualities set to 40 for each nucleotide
|
|
are added.
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{-\/-fasta-output} Read data following the ecoPCR output
|
|
format.
|
|
\item
|
|
\texttt{-\/-fastq-output} Read data following the EMBL flatfile
|
|
format.
|
|
\end{itemize}
|
|
|
|
OBITools allows multiple input files to be specified for a single
|
|
command.
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{-\/-no-order} When several input files are provided, indicates
|
|
that there is no order among them. (default: false). Using such option
|
|
can increase a lot the processing of the data.
|
|
\end{itemize}
|
|
|
|
\hypertarget{the-fasta-and-fastq-annotations-format}{%
|
|
\section{The Fasta and Fastq annotations
|
|
format}\label{the-fasta-and-fastq-annotations-format}}
|
|
|
|
OBITools extend the \protect\hyperlink{the-fasta-sequence-format}{Fasta}
|
|
and \protect\hyperlink{the-fastq-sequence-format}{Fastq} formats by
|
|
introducing a format for the title lines of these formats allowing to
|
|
annotate every sequence. While the previous version of OBITools used an
|
|
\emph{ad-hoc} format for these annotation, this new version introduce
|
|
the usage of the standard JSON format to store them.
|
|
|
|
On input, OBITools automatically recognize the format of the
|
|
annotations, but two options allows to force the parsing following one
|
|
of them. You should normally not need to use these options.
|
|
|
|
\begin{itemize}
|
|
\item
|
|
\texttt{-\/-input-OBI-header} FASTA/FASTQ title line annotations
|
|
follow OBI format. (default: false)
|
|
\item
|
|
\texttt{-\/-input-json-header} FASTA/FASTQ title line annotations
|
|
follow json format. (default: false)
|
|
\end{itemize}
|
|
|
|
On output, by default annotation are formatted using the new JSON
|
|
format. For compatibility with previous version of OBITools and with
|
|
external scripts and software, it is possible to force the usage of the
|
|
previous OBITools format.
|
|
|
|
\begin{itemize}
|
|
\item
|
|
\texttt{-\/-output-OBI-header\textbar{}-O} output FASTA/FASTQ title
|
|
line annotations follow OBI format. (default: false)
|
|
\item
|
|
\texttt{-\/-output-json-header} output FASTA/FASTQ title line
|
|
annotations follow json format. (default: false)
|
|
\end{itemize}
|
|
|
|
\hypertarget{options-common-to-most-of-the-obitools-commands}{%
|
|
\chapter{\texorpdfstring{Options common to most of the \emph{OBITools}
|
|
commands}{Options common to most of the OBITools commands}}\label{options-common-to-most-of-the-obitools-commands}}
|
|
|
|
\hypertarget{helpful-options}{%
|
|
\section{Helpful options}\label{helpful-options}}
|
|
|
|
\begin{description}
|
|
\item[\textbf{-\/-help}, \textbf{-h}]
|
|
Display a friendly help message.
|
|
\end{description}
|
|
|
|
\textbf{-\/-no-progressbar}
|
|
|
|
\hypertarget{system-related-options}{%
|
|
\section{System related options}\label{system-related-options}}
|
|
|
|
\textbf{Managing parallel execution of tasks}
|
|
|
|
A new feature of \emph{OBITools} V4 is the ability to run multiple tasks
|
|
in parallel, reading files, calculating on the data, formatting and
|
|
writing the results. Each of these tasks can itself be parallelized by
|
|
dividing the data into batches and running the calculation on several
|
|
batches in parallel. This allows the overall calculation time of an
|
|
\emph{OBITools} command to be reduced considerably. The parameters
|
|
organizing the parallel calculation are determined automatically to use
|
|
the maximum capacity of your computer. But in some circumstances, it is
|
|
necessary to override these default settings either to try to optimize
|
|
the computation on a given machine, or to limit the OBITools to using
|
|
only a part of the computational capacity. There are two options for
|
|
doing this.
|
|
|
|
\begin{description}
|
|
\item[\textbf{-\/-max-cpu}]
|
|
OBITools V4 are able to run in parallel on all the CPU cores available
|
|
on the computer. It is sometime required to limit the computation to a
|
|
smaller number of cores. That option specify the maximum number of cores
|
|
that the OBITools command can use. This behaviour can also be set up
|
|
using the \texttt{OBIMAXCPU} environment variable.
|
|
\end{description}
|
|
|
|
\textbf{-\/-workers}, \textbf{-w}
|
|
|
|
If your computer has 8 cores, but you want to limit \emph{OBITools} to
|
|
use only two of them you have several solution:
|
|
|
|
\begin{itemize}
|
|
\item
|
|
If you want to set the limit for a single execution you can use the
|
|
\textbf{--max-cpu} option
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obiconvert} \AttributeTok{{-}{-}max{-}cpu}\NormalTok{ 2 }\AttributeTok{{-}{-}fasta{-}output}\NormalTok{ data.fastq }\OperatorTok{\textgreater{}}\NormalTok{ data.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
or you can precede the command by setting the environment variable
|
|
\texttt{OBIMAXCPU}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\VariableTok{OBIMAXCPU}\OperatorTok{=}\NormalTok{2 }\ExtensionTok{obiconvert} \AttributeTok{{-}{-}fasta{-}output}\NormalTok{ data.fastq }\OperatorTok{\textgreater{}}\NormalTok{ data.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
\item
|
|
If you want to set the limit to your complete session, you have to
|
|
export \texttt{OBIMAXCPU}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\BuiltInTok{export} \VariableTok{OBIMAXCPU}\OperatorTok{=}\NormalTok{2 }
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
all the following OBITools commands will be limited to use at max 2
|
|
CPU cores.
|
|
\item
|
|
If all the time you want to impose this limit, you must include the
|
|
above \texttt{export} command in your \texttt{.bashrc} file.
|
|
\end{itemize}
|
|
|
|
\textbf{OBITools debuging related options}
|
|
|
|
\textbf{-\/-debug}
|
|
|
|
\hypertarget{obitools-expression-language}{%
|
|
\chapter{OBITools expression
|
|
language}\label{obitools-expression-language}}
|
|
|
|
Several OBITools (\emph{e.g.} obigrep, obiannotate) allow the user to
|
|
specify some simple expressions to compute values or define predicates.
|
|
This expressions are parsed and evaluated using the
|
|
\href{https://pkg.go.dev/github.com/PaesslerAG/gval}{gval} go package,
|
|
which allows for evaluating go-Like expression.
|
|
|
|
\hypertarget{variables-usable-in-the-expression}{%
|
|
\section{Variables usable in the
|
|
expression}\label{variables-usable-in-the-expression}}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{sequence} is the sequence object on which the expression is
|
|
evaluated.
|
|
\item
|
|
\texttt{annotations}is a map object containing every annotations
|
|
associated to the currently processed sequence.
|
|
\end{itemize}
|
|
|
|
\hypertarget{function-defined-in-the-language}{%
|
|
\section{Function defined in the
|
|
language}\label{function-defined-in-the-language}}
|
|
|
|
\hypertarget{instrospection-functions}{%
|
|
\subsection*{Instrospection functions}\label{instrospection-functions}}
|
|
\addcontentsline{toc}{subsection}{Instrospection functions}
|
|
|
|
\begin{description}
|
|
\item[\textbf{\texttt{len(x)}}]
|
|
It is a generic function allowing to retreive the size of a object. It
|
|
returns the length of a sequences, the number of element in a map like
|
|
\texttt{annotations}, the number of elements in an array. The reurned
|
|
value is an \texttt{int}.
|
|
\item[\textbf{\texttt{contains(map,key)}}]
|
|
Tests if the \texttt{map} contains a value assciated to \texttt{key}
|
|
\end{description}
|
|
|
|
\hypertarget{cast-functions}{%
|
|
\subsection*{Cast functions}\label{cast-functions}}
|
|
\addcontentsline{toc}{subsection}{Cast functions}
|
|
|
|
\begin{description}
|
|
\item[\textbf{\texttt{int(x)}}]
|
|
Converts if possible the \texttt{x} value to an integer value. The
|
|
function returns an \texttt{int}.
|
|
\item[\textbf{\texttt{numeric(x)}}]
|
|
Converts if possible the \texttt{x} value to a float value. The function
|
|
returns a \texttt{float}.
|
|
\item[\textbf{\texttt{bool(x)}}]
|
|
Converts if possible the \texttt{x} value to a boolean value. The
|
|
function returns a \texttt{bool}.
|
|
\end{description}
|
|
|
|
\hypertarget{string-related-functions}{%
|
|
\subsection*{String related functions}\label{string-related-functions}}
|
|
\addcontentsline{toc}{subsection}{String related functions}
|
|
|
|
\begin{description}
|
|
\item[\textbf{\texttt{printf(format,...)}}]
|
|
Allows to combine several values to build a string. \texttt{format}
|
|
follows the classical C \texttt{printf} syntax. The function returns a
|
|
\texttt{string}.
|
|
\item[\textbf{\texttt{subspc(x)}}]
|
|
substitutes every space in the \texttt{x} string by the underscore
|
|
(\texttt{\_}) character. The function returns a \texttt{string}.
|
|
\end{description}
|
|
|
|
\hypertarget{condition-function}{%
|
|
\subsection*{Condition function}\label{condition-function}}
|
|
\addcontentsline{toc}{subsection}{Condition function}
|
|
|
|
\begin{description}
|
|
\item[\textbf{\texttt{ifelse(condition,val1,val2)}}]
|
|
The \texttt{condition} value has to be a \texttt{bool} value. If it is
|
|
\texttt{true} the function returns \texttt{val1}, otherwise, it is
|
|
returning \texttt{val2}.
|
|
\end{description}
|
|
|
|
\hypertarget{sequence-analysis-related-function}{%
|
|
\subsection{Sequence analysis related
|
|
function}\label{sequence-analysis-related-function}}
|
|
|
|
\begin{description}
|
|
\item[\textbf{\texttt{composition(sequence)}}]
|
|
The nucleotide composition of the sequence is returned as as map indexed
|
|
by \texttt{a}, \texttt{c}, \texttt{g}, or \texttt{t} and each value is
|
|
the number of occurrences of that nucleotide. A fifth key
|
|
\texttt{others} accounts for all others symboles.
|
|
\item[\textbf{\texttt{gcskew(sequence)}}]
|
|
Computes the excess of g compare to c of the sequence, known as the GC
|
|
skew.
|
|
|
|
\[
|
|
Skew_{GC}=\frac{G-C}{G+C}
|
|
\]
|
|
\end{description}
|
|
|
|
\hypertarget{accessing-to-the-sequence-annotations}{%
|
|
\section{Accessing to the sequence
|
|
annotations}\label{accessing-to-the-sequence-annotations}}
|
|
|
|
The \texttt{annotations} variable is a map object containing all the
|
|
annotations associated to the currently processed sequence. Index of the
|
|
map are the attribute names. It exists to possibillities to retreive an
|
|
annotation. It is possible to use the classical \texttt{{[}{]}} indexing
|
|
operator, putting the attribute name quoted by double quotes between
|
|
them.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\NormalTok{annotations}\OperatorTok{[}\StringTok{"direction"}\OperatorTok{]}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
The above code retreives the \texttt{direction} annotation. A second
|
|
notation using the dot (\texttt{.}) is often more convenient.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\NormalTok{annotations}\OperatorTok{.}\NormalTok{direction}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
Special attributes of the sequence are accessible only by dedicated
|
|
methods of the \texttt{sequence} object.
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
The sequence identifier : \texttt{Id()}
|
|
\item
|
|
THe sequence definition : \texttt{Definition()}
|
|
\end{itemize}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\NormalTok{sequence}\OperatorTok{.}\NormalTok{Id}\OperatorTok{()}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\hypertarget{metabarcode-design-and-quality-assessment}{%
|
|
\chapter{Metabarcode design and quality
|
|
assessment}\label{metabarcode-design-and-quality-assessment}}
|
|
|
|
\hypertarget{obipcr}{%
|
|
\section{\texorpdfstring{\texttt{obipcr}}{obipcr}}\label{obipcr}}
|
|
|
|
\begin{quote}
|
|
Replace the \texttt{ecoPCR} original \emph{OBITools}
|
|
\end{quote}
|
|
|
|
\hypertarget{file-format-conversions}{%
|
|
\chapter{File format conversions}\label{file-format-conversions}}
|
|
|
|
\hypertarget{obiconvert}{%
|
|
\section{\texorpdfstring{\texttt{obiconvert}}{obiconvert}}\label{obiconvert}}
|
|
|
|
\hypertarget{sequence-annotations}{%
|
|
\chapter{Sequence annotations}\label{sequence-annotations}}
|
|
|
|
\hypertarget{obiannotate}{%
|
|
\section{\texorpdfstring{\texttt{obiannotate}}{obiannotate}}\label{obiannotate}}
|
|
|
|
\hypertarget{obitag}{%
|
|
\section{\texorpdfstring{\texttt{obitag}}{obitag}}\label{obitag}}
|
|
|
|
\hypertarget{obitagpcr}{%
|
|
\section{\texorpdfstring{\texttt{obitagpcr}}{obitagpcr}}\label{obitagpcr}}
|
|
|
|
\hypertarget{computations-on-sequences}{%
|
|
\chapter{Computations on sequences}\label{computations-on-sequences}}
|
|
|
|
\hypertarget{obipairing}{%
|
|
\section{\texorpdfstring{\texttt{obipairing}}{obipairing}}\label{obipairing}}
|
|
|
|
\begin{quote}
|
|
Replace the \texttt{illuminapairedends} original \emph{OBITools}
|
|
\end{quote}
|
|
|
|
\hypertarget{alignment-procedure}{%
|
|
\subsection*{Alignment procedure}\label{alignment-procedure}}
|
|
\addcontentsline{toc}{subsection}{Alignment procedure}
|
|
|
|
\texttt{obipairing} is introducing a new alignment algorithm compared to
|
|
the \texttt{illuminapairedend} command of the \texttt{OBITools\ V2}.
|
|
Nethertheless this new algorithm has been design to produce the same
|
|
results than the previous, except in very few cases.
|
|
|
|
The new algorithm is a two-step procedure. First, a FASTN-type algorithm
|
|
(Lipman and Pearson 1985) identifies the best offset between the two
|
|
matched readings. This identifies the region of overlap.
|
|
|
|
In the second step, the matching regions of the two reads are extracted
|
|
along with a flanking sequence of \(\Delta\) base pairs. The two
|
|
subsequences are then aligned using a ``one side free end-gap'' dynamic
|
|
programming algorithm. This latter step is only called if at least one
|
|
mismatch is detected by the FASTP step.
|
|
|
|
Unless the similarity between the two reads at their overlap region is
|
|
very low, the addition of the flanking regions in the second step of the
|
|
alignment ensures the same alignment as if the dynamic programming
|
|
alignment was performed on the full reads.
|
|
|
|
\hypertarget{the-scoring-system}{%
|
|
\subsection*{The scoring system}\label{the-scoring-system}}
|
|
\addcontentsline{toc}{subsection}{The scoring system}
|
|
|
|
In the dynamic programming step, the match and mismatch scores take into
|
|
account the quality scores of the two aligned nucleotides. By taking
|
|
these into account, the probability of a true match can be calculated
|
|
for each aligned base pair.
|
|
|
|
If we consider a nucleotide read with a quality score \(Q\), the
|
|
probability of misreading this base (\(P_E\)) is : \[
|
|
P_E = 10^{-\frac{Q}{10}}
|
|
\]
|
|
|
|
Thus, when a given nucleotide \(X\) is observed with the quality score
|
|
\(Q\). The probability that \(X\) is really an \(X\) is :
|
|
|
|
\[
|
|
P(X=X) = 1 - P_E
|
|
\]
|
|
|
|
Otherwise, \(X\) is actually one of the three other possible nucleotides
|
|
(\(X_{E1}\), \(X_{E2}\) or \(X_{E3}\)). If we suppose that the three
|
|
reading error have the same probability :
|
|
|
|
\[
|
|
P(X=X_{E1}) = P(X=X_{E3}) = P(X=X_{E3}) = \frac{P_E}{3}
|
|
\]
|
|
|
|
At each position in an alignment where the two nucleotides \(X_1\) and
|
|
\(X_2\) face each other (not a gapped position), the probability of a
|
|
true match varies depending on whether \(X_1=X_2\), an observed match,
|
|
or \(X_1 \neq X_2\), an observed mismatch.
|
|
|
|
\textbf{Probability of a true match when \(X_1=X_2\)}
|
|
|
|
That probability can be divided in two parts. First \(X_1\) and \(X_2\)
|
|
have been correctly read. The corresponding probability is :
|
|
|
|
\[
|
|
\begin{aligned}
|
|
P_{TM} &= (1- PE_1)(1-PE_2)\\
|
|
&=(1 - 10^{-\frac{Q_1}{10} } )(1 - 10^{-\frac{Q_2}{10}} )
|
|
\end{aligned}
|
|
\]
|
|
|
|
Secondly, a match can occure if the true nucleotides read as \(X_1\) and
|
|
\(X_2\) are not \(X_1\) and \(X_2\) but identical.
|
|
|
|
\[
|
|
\begin{aligned}
|
|
P(X_1==X_{E1}) \cap P(X_2==X_{E1}) &= \frac{P_{E1} P_{E2}}{9} \\
|
|
P(X_1==X_{Ex}) \cap P(X_2==X_{Ex}) & = \frac{P_{E1} P_{E2}}{3}
|
|
\end{aligned}
|
|
\]
|
|
|
|
The probability of a true match between \(X_1\) and \(X_2\) when
|
|
\(X_1 = X_2\) an observed match :
|
|
|
|
\[
|
|
\begin{aligned}
|
|
P(MATCH | X_1 = X_2) = (1- PE_1)(1-PE_2) + \frac{P_{E1} P_{E2}}{3}
|
|
\end{aligned}
|
|
\]
|
|
|
|
\textbf{Probability of a true match when \(X_1 \neq X_2\)}
|
|
|
|
That probability can be divided in three parts.
|
|
|
|
\begin{enumerate}
|
|
\def\labelenumi{\alph{enumi}.}
|
|
\tightlist
|
|
\item
|
|
\(X_1\) has been correctly read and \(X_2\) is a sequencing error and
|
|
is actually equal to \(X_1\). \[
|
|
P_a = (1-P_{E1})\frac{P_{E2}}{3}
|
|
\]
|
|
\item
|
|
\(X_2\) has been correctly read and \(X_1\) is a sequencing error and
|
|
is actually equal to \(X_2\). \[
|
|
P_b = (1-P_{E2})\frac{P_{E1}}{3}
|
|
\]
|
|
\item
|
|
\(X_1\) and \(X_2\) corresponds to sequencing error but are actually
|
|
the same base \(X_{Ex}\) \[
|
|
P_c = 2\frac{P_{E1} P_{E2}}{9}
|
|
\]
|
|
\end{enumerate}
|
|
|
|
Consequently : \[
|
|
\begin{aligned}
|
|
P(MATCH | X_1 \neq X_2) = (1-P_{E1})\frac{P_{E2}}{3} + (1-P_{E2})\frac{P_{E1}}{3} + 2\frac{P_{E1} P_{E2}}{9}
|
|
\end{aligned}
|
|
\]
|
|
|
|
\textbf{Probability of a match under the random model}
|
|
|
|
The second considered model is a pure random model where every base is
|
|
equiprobable, hence having a probability of occurrence of a nucleotide
|
|
equals \(0.25\). Under that hypothesis
|
|
|
|
\[
|
|
P(MATCH | \text{Random model}) = 0.25
|
|
\]
|
|
|
|
\textbf{The score is a log ration of likelyhood}
|
|
|
|
Score is define as the logarithm of the ratio between the likelyhood of
|
|
the observations considering the sequencer error model over tha
|
|
likelyhood u
|
|
|
|
\begin{figure}
|
|
|
|
{\centering \includegraphics{./comm_computation_files/figure-pdf/unnamed-chunk-1-1.pdf}
|
|
|
|
}
|
|
|
|
\caption{Evolution of the match and mismatch scores when the quality of
|
|
base is 20 while the second range from 10 to 40.}
|
|
|
|
\end{figure}
|
|
|
|
\hypertarget{obimultiplex}{%
|
|
\section{\texorpdfstring{\texttt{obimultiplex}}{obimultiplex}}\label{obimultiplex}}
|
|
|
|
\begin{quote}
|
|
Replace the \texttt{ngsfilter} original \emph{OBITools}
|
|
\end{quote}
|
|
|
|
\hypertarget{obicomplement}{%
|
|
\section{\texorpdfstring{\texttt{obicomplement}}{obicomplement}}\label{obicomplement}}
|
|
|
|
\hypertarget{obiclean}{%
|
|
\section{\texorpdfstring{\texttt{obiclean}}{obiclean}}\label{obiclean}}
|
|
|
|
\hypertarget{obiuniq}{%
|
|
\section{\texorpdfstring{\texttt{obiuniq}}{obiuniq}}\label{obiuniq}}
|
|
|
|
\hypertarget{sequence-sampling-and-filtering}{%
|
|
\chapter{Sequence sampling and
|
|
filtering}\label{sequence-sampling-and-filtering}}
|
|
|
|
\hypertarget{obigrep-filters-sequence-files-according-to-numerous-conditions}{%
|
|
\section{\texorpdfstring{\texttt{obigrep} -- filters sequence files
|
|
according to numerous
|
|
conditions}{obigrep -- filters sequence files according to numerous conditions}}\label{obigrep-filters-sequence-files-according-to-numerous-conditions}}
|
|
|
|
The \texttt{obigrep} command is somewhat analogous to the standard Unix
|
|
\texttt{grep} command. It selects a subset of sequence records from a
|
|
sequence file. A sequence record is a complex object consisting of an
|
|
identifier, a set of attributes (a key, defined by its name, associated
|
|
with a value), a definition, and the sequence itself. Instead of working
|
|
text line by text line like the standard Unix tool, \texttt{obigrep}
|
|
selection is done sequence record by sequence record. A large number of
|
|
options allow you to refine the selection on any element of the
|
|
sequence. \texttt{obigrep} allows you to specify multiple conditions
|
|
simultaneously (which take on the value \texttt{TRUE} or \texttt{FALSE})
|
|
and only those sequence records which meet all conditions (all
|
|
conditions are \texttt{TRUE}) are selected. \texttt{obigrep} is able to
|
|
work on two paired read files. The selection criteria apply to one or
|
|
the other of the readings in each pair depending on the mode chosen
|
|
(\textbf{-\/-paired-mode} option). In all cases the selection is applied
|
|
in the same way to both files, thus maintaining their consistency.
|
|
|
|
\hypertarget{the-options-usable-with-obigrep}{%
|
|
\subsection{\texorpdfstring{The options usable with
|
|
\texttt{obigrep}}{The options usable with obigrep}}\label{the-options-usable-with-obigrep}}
|
|
|
|
\hypertarget{selecting-sequences-based-on-their-caracteristics}{%
|
|
\subsubsection{Selecting sequences based on their
|
|
caracteristics}\label{selecting-sequences-based-on-their-caracteristics}}
|
|
|
|
Sequences can be selected on several of their caracteristics, their
|
|
length, their id, their sequence. Options allow for specifying the
|
|
condition if selection.
|
|
|
|
\textbf{Selection based on the sequence}
|
|
|
|
Sequence records can be selected according if they match or not with a
|
|
pattern. The simplest pattern is as short sequence (\emph{e.g}
|
|
\texttt{AACCTT}). But the usage of regular patterns allows for looking
|
|
for more complex pattern. As example, \texttt{A{[}TG{]}C+G} matches a
|
|
\texttt{A}, followed by a \texttt{T} or a \texttt{G}, then one or
|
|
several \texttt{C} and endly a \texttt{G}.
|
|
|
|
\begin{description}
|
|
\item[\textbf{-\/-sequence}\textbar{}\textbf{-s} \emph{PATTERN}]
|
|
Regular expression pattern to be tested against the sequence itself. The
|
|
pattern is case insensitive. A complete description of the regular
|
|
pattern grammar is available
|
|
\href{https://yourbasic.org/golang/regexp-cheat-sheet/\#cheat-sheet}{here}.
|
|
\item[\emph{Examples:}]
|
|
Selects only the sequence records that contain an \emph{EcoRI}
|
|
restriction site.
|
|
\end{description}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obigrep} \AttributeTok{{-}s} \StringTok{\textquotesingle{}GAATTC\textquotesingle{}}\NormalTok{ seq1.fasta }\OperatorTok{\textgreater{}}\NormalTok{ seq2.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
: Selects only the sequence records that contain a stretch of at least
|
|
10 \texttt{A}.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obigrep} \AttributeTok{{-}s} \StringTok{\textquotesingle{}A\{10,\}\textquotesingle{}}\NormalTok{ seq1.fasta }\OperatorTok{\textgreater{}}\NormalTok{ seq2.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
: Selects only the sequence records that do not contain ambiguous
|
|
nucleotides.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obigrep} \AttributeTok{{-}s} \StringTok{\textquotesingle{}\^{}[ACGT]+$\textquotesingle{}}\NormalTok{ seq1.fasta }\OperatorTok{\textgreater{}}\NormalTok{ seq2.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\begin{description}
|
|
\item[\textbf{-\/-min-count} \textbar{} \textbf{-c} \emph{COUNT}]
|
|
only sequences reprensenting at least \emph{COUNT} reads will be
|
|
selected. That option rely on the \texttt{count} attribute. If the
|
|
\texttt{count} attribute is not defined for a sequence record, it is
|
|
assumed equal to \(1\).
|
|
\item[\textbf{-\/-max-count} \textbar{} \textbf{-C} \emph{COUNT}]
|
|
only sequences reprensenting no more than \emph{COUNT} reads will be
|
|
selected. That option rely on the \texttt{count} attribute. If the
|
|
\texttt{count} attribute is not defined for a sequence record, it is
|
|
assumed equal to \(1\).
|
|
\item[\emph{Examples}]
|
|
Selecting sequence records representing at least five reads in the
|
|
dataset.
|
|
\end{description}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obigrep} \AttributeTok{{-}c}\NormalTok{ 5 data\_SPER01.fasta }\OperatorTok{\textgreater{}}\NormalTok{ data\_norare\_SPER01.fasta}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\hypertarget{utilities}{%
|
|
\chapter{Utilities}\label{utilities}}
|
|
|
|
\hypertarget{obicount}{%
|
|
\section{\texorpdfstring{\texttt{obicount}}{obicount}}\label{obicount}}
|
|
|
|
\texttt{obicount} counts the number of sequence records, the sum of the
|
|
\texttt{count} attributes, and the sum of the length of all the
|
|
sequences.
|
|
|
|
\emph{Example:}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\ExtensionTok{obicount}\NormalTok{ seq.fasta }
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
Prints the number of sequence records contained in the
|
|
\texttt{seq.fasta} file and the sum of their \texttt{count} attributes.
|
|
|
|
\emph{Options specific to the command}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{-\/-reads\textbar{}-r} Prints read counts.
|
|
\item
|
|
\texttt{-\/-symbols\textbar{}-s} Prints symbol counts.
|
|
\item
|
|
\texttt{-\/-variants\textbar{}-v} Prints variant counts.
|
|
\end{itemize}
|
|
|
|
\hypertarget{obidistribute}{%
|
|
\section{\texorpdfstring{\texttt{obidistribute}}{obidistribute}}\label{obidistribute}}
|
|
|
|
\hypertarget{obifind}{%
|
|
\section{\texorpdfstring{\texttt{obifind}}{obifind}}\label{obifind}}
|
|
|
|
\begin{quote}
|
|
Replace the \texttt{ecofind} original \emph{OBITools.}
|
|
\end{quote}
|
|
|
|
\part{The GO \emph{OBITools} library}
|
|
|
|
\hypertarget{biosequence}{%
|
|
\section*{BioSequence}\label{biosequence}}
|
|
\addcontentsline{toc}{section}{BioSequence}
|
|
|
|
\markright{BioSequence}
|
|
|
|
The \texttt{BioSequence} class is used to represent biological
|
|
sequences. It allows for storing : - the sequence itself as a
|
|
\texttt{{[}{]}byte} - the sequencing quality score as a
|
|
\texttt{{[}{]}byte} if needed - an identifier as a \texttt{string} - a
|
|
definition as a \texttt{string} - a set of \emph{(key, value)} pairs in
|
|
a \texttt{map{[}sting{]}interface\{\}}
|
|
|
|
BioSequence is defined in the obiseq module and is included using the
|
|
code
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\KeywordTok{import} \OperatorTok{(}
|
|
\StringTok{"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"}
|
|
\OperatorTok{)}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\hypertarget{creating-new-instances}{%
|
|
\subsection*{Creating new instances}\label{creating-new-instances}}
|
|
\addcontentsline{toc}{subsection}{Creating new instances}
|
|
|
|
To create new instance, use
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{MakeBioSequence(id\ string,\ sequence\ {[}{]}byte,\ definition\ string)\ obiseq.BioSequence}
|
|
\item
|
|
\texttt{NewBioSequence(id\ string,\ sequence\ {[}{]}byte,\ definition\ string)\ *obiseq.BioSequence}
|
|
\end{itemize}
|
|
|
|
Both create a \texttt{BioSequence} instance, but when the first one
|
|
returns the instance, the second returns a pointer on the new instance.
|
|
Two other functions \texttt{MakeEmptyBioSequence}, and
|
|
\texttt{NewEmptyBioSequence} do the same job but provide an
|
|
uninitialized objects.
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{id} parameters corresponds to the unique identifier of the
|
|
sequence. It mist be a string constituted of a single word (not
|
|
containing any space).
|
|
\item
|
|
\texttt{sequence} is the DNA sequence itself, provided as a
|
|
\texttt{byte} array (\texttt{{[}{]}byte}).
|
|
\item
|
|
\texttt{definition} is a \texttt{string}, potentially empty, but
|
|
usualy containing a sentence explaining what is that sequence.
|
|
\end{itemize}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\KeywordTok{import} \OperatorTok{(}
|
|
\StringTok{"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"}
|
|
\OperatorTok{)}
|
|
|
|
\KeywordTok{func}\NormalTok{ main}\OperatorTok{()} \OperatorTok{\{}
|
|
\NormalTok{ myseq }\OperatorTok{:=}\NormalTok{ obiseq}\OperatorTok{.}\NormalTok{NewBiosequence}\OperatorTok{(}
|
|
\StringTok{"seq\_GH0001"}\OperatorTok{,}
|
|
\NormalTok{ bytes}\OperatorTok{.}\NormalTok{FromString}\OperatorTok{(}\StringTok{"ACGTGTCAGTCG"}\OperatorTok{),}
|
|
\StringTok{"A short test sequence"}\OperatorTok{,}
|
|
\OperatorTok{)}
|
|
\OperatorTok{\}}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
When formated as fasta the parameters correspond to the following schema
|
|
|
|
\begin{verbatim}
|
|
>id definition containing potentially several words
|
|
sequence
|
|
\end{verbatim}
|
|
|
|
\hypertarget{end-of-life-of-a-biosequence-instance}{%
|
|
\subsection*{\texorpdfstring{End of life of a \texttt{BioSequence}
|
|
instance}{End of life of a BioSequence instance}}\label{end-of-life-of-a-biosequence-instance}}
|
|
\addcontentsline{toc}{subsection}{End of life of a \texttt{BioSequence}
|
|
instance}
|
|
|
|
When an instance of \texttt{BioSequence} is no longer in use, it is
|
|
normally taken over by the GO garbage collector. If you know that an
|
|
instance will never be used again, you can, if you wish, call the
|
|
\texttt{Recycle} method on it to store the allocated memory elements in
|
|
a \texttt{pool} to limit the allocation effort when many sequences are
|
|
being handled. Once the recycle method has been called on an instance,
|
|
you must ensure that no other method is called on it.
|
|
|
|
\hypertarget{accessing-to-the-elements-of-a-sequence}{%
|
|
\subsection*{Accessing to the elements of a
|
|
sequence}\label{accessing-to-the-elements-of-a-sequence}}
|
|
\addcontentsline{toc}{subsection}{Accessing to the elements of a
|
|
sequence}
|
|
|
|
The different elements of an \texttt{obiseq.BioSequence} must be
|
|
accessed using a set of methods. For the three main elements provided
|
|
during the creation of a new instance methodes are :
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{Id()\ string}
|
|
\item
|
|
\texttt{Sequence()\ {[}{]}byte}
|
|
\item
|
|
\texttt{Definition()\ string}
|
|
\end{itemize}
|
|
|
|
It exists pending method to change the value of these elements
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{SetId(id\ string)}
|
|
\item
|
|
\texttt{SetSequence(sequence\ {[}{]}byte)}
|
|
\item
|
|
\texttt{SetDefinition(definition\ string)}
|
|
\end{itemize}
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\KeywordTok{import} \OperatorTok{(}
|
|
\StringTok{"fmt"}
|
|
\StringTok{"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"}
|
|
\OperatorTok{)}
|
|
|
|
\KeywordTok{func}\NormalTok{ main}\OperatorTok{()} \OperatorTok{\{}
|
|
\NormalTok{ myseq }\OperatorTok{:=}\NormalTok{ obiseq}\OperatorTok{.}\NormalTok{NewBiosequence}\OperatorTok{(}
|
|
\StringTok{"seq\_GH0001"}\OperatorTok{,}
|
|
\NormalTok{ bytes}\OperatorTok{.}\NormalTok{FromString}\OperatorTok{(}\StringTok{"ACGTGTCAGTCG"}\OperatorTok{),}
|
|
\StringTok{"A short test sequence"}\OperatorTok{,}
|
|
\OperatorTok{)}
|
|
|
|
\NormalTok{ fmt}\OperatorTok{.}\NormalTok{Println}\OperatorTok{(}\NormalTok{myseq}\OperatorTok{.}\NormalTok{Id}\OperatorTok{())}
|
|
\NormalTok{ myseq}\OperatorTok{.}\NormalTok{SetId}\OperatorTok{(}\StringTok{"SPE01\_0001"}\OperatorTok{)}
|
|
\NormalTok{ fmt}\OperatorTok{.}\NormalTok{Println}\OperatorTok{(}\NormalTok{myseq}\OperatorTok{.}\NormalTok{Id}\OperatorTok{())}
|
|
\OperatorTok{\}}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\hypertarget{different-ways-for-accessing-an-editing-the-sequence}{%
|
|
\subsubsection*{Different ways for accessing an editing the
|
|
sequence}\label{different-ways-for-accessing-an-editing-the-sequence}}
|
|
\addcontentsline{toc}{subsubsection}{Different ways for accessing an
|
|
editing the sequence}
|
|
|
|
If \texttt{Sequence()}and \texttt{SetSequence(sequence\ {[}{]}byte)}
|
|
methods are the basic ones, several other methods exist.
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{String()\ string} return the sequence directly converted to a
|
|
\texttt{string} instance.
|
|
\item
|
|
The \texttt{Write} method family allows for extending an existing
|
|
sequence following the buffer protocol.
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{Write(data\ {[}{]}byte)\ (int,\ error)} allows for appending
|
|
a byte array on 3' end of the sequence.
|
|
\item
|
|
\texttt{WriteString(data\ string)\ (int,\ error)} allows for
|
|
appending a \texttt{string}.
|
|
\item
|
|
\texttt{WriteByte(data\ byte)\ error} allows for appending a single
|
|
\texttt{byte}.
|
|
\end{itemize}
|
|
\end{itemize}
|
|
|
|
The \texttt{Clear} method empties the sequence buffer.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\KeywordTok{import} \OperatorTok{(}
|
|
\StringTok{"fmt"}
|
|
\StringTok{"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiseq"}
|
|
\OperatorTok{)}
|
|
|
|
\KeywordTok{func}\NormalTok{ main}\OperatorTok{()} \OperatorTok{\{}
|
|
\NormalTok{ myseq }\OperatorTok{:=}\NormalTok{ obiseq}\OperatorTok{.}\NormalTok{NewEmptyBiosequence}\OperatorTok{()}
|
|
|
|
\NormalTok{ myseq}\OperatorTok{.}\NormalTok{WriteString}\OperatorTok{(}\StringTok{"accc"}\OperatorTok{)}
|
|
\NormalTok{ myseq}\OperatorTok{.}\NormalTok{WriteByte}\OperatorTok{(}\DataTypeTok{byte}\OperatorTok{(}\CharTok{\textquotesingle{}c\textquotesingle{}}\OperatorTok{))}
|
|
\NormalTok{ fmt}\OperatorTok{.}\NormalTok{Println}\OperatorTok{(}\NormalTok{myseq}\OperatorTok{.}\NormalTok{String}\OperatorTok{())}
|
|
\OperatorTok{\}}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\hypertarget{sequence-quality-scores-1}{%
|
|
\subsubsection*{Sequence quality
|
|
scores}\label{sequence-quality-scores-1}}
|
|
\addcontentsline{toc}{subsubsection}{Sequence quality scores}
|
|
|
|
Sequence quality scores cannot be initialized at the time of instance
|
|
creation. You must use dedicated methods to add quality scores to a
|
|
sequence.
|
|
|
|
To be coherent the length of both the DNA sequence and que quality score
|
|
sequence must be equal. But assessment of this constraint is realized.
|
|
It is of the programmer responsability to check that invariant.
|
|
|
|
While accessing to the quality scores relies on the method
|
|
\texttt{Quality()\ {[}{]}byte}, setting the quality need to call one of
|
|
the following method. They run similarly to their sequence dedicated
|
|
conterpart.
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{SetQualities(qualities\ Quality)}
|
|
\item
|
|
\texttt{WriteQualities(data\ {[}{]}byte)\ (int,\ error)}
|
|
\item
|
|
\texttt{WriteByteQualities(data\ byte)\ error}
|
|
\end{itemize}
|
|
|
|
In a way analogous to the \texttt{Clear} method,
|
|
\texttt{ClearQualities()} empties the sequence of quality scores.
|
|
|
|
\hypertarget{the-annotations-of-a-sequence}{%
|
|
\subsection*{The annotations of a
|
|
sequence}\label{the-annotations-of-a-sequence}}
|
|
\addcontentsline{toc}{subsection}{The annotations of a sequence}
|
|
|
|
A sequence can be annotated with attributes. Each attribute is
|
|
associated with a value. An attribute is identified by its name. The
|
|
name of an attribute consists of a character string containing no spaces
|
|
or blank characters. Values can be of several types.
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Scalar types:
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
integer
|
|
\item
|
|
numeric
|
|
\item
|
|
character
|
|
\item
|
|
boolean
|
|
\end{itemize}
|
|
\item
|
|
Container types:
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
vector
|
|
\item
|
|
map
|
|
\end{itemize}
|
|
\end{itemize}
|
|
|
|
Vectors can contain any type of scalar. Maps are compulsorily indexed by
|
|
strings and can contain any scalar type. It is not possible to have
|
|
nested container type.
|
|
|
|
Annotations are stored in an object of type \texttt{bioseq.Annotation}
|
|
which is an alias of \texttt{map{[}string{]}interface\{\}}. This map can
|
|
be retrieved using the \texttt{Annotations()\ Annotation} method. If no
|
|
annotation has been defined for this sequence, the method returns an
|
|
empty map. It is possible to test an instance of \texttt{BioSequence}
|
|
using its \texttt{HasAnnotation()\ bool} method to see if it has any
|
|
annotations associated with it.
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
GetAttribute(key string) (interface\{\}, bool)
|
|
\end{itemize}
|
|
|
|
\hypertarget{the-sequence-iterator}{%
|
|
\section*{The sequence iterator}\label{the-sequence-iterator}}
|
|
\addcontentsline{toc}{section}{The sequence iterator}
|
|
|
|
\markright{The sequence iterator}
|
|
|
|
The pakage \emph{obiter} provides an iterator mecanism for manipulating
|
|
sequences. The main class provided by this package is
|
|
\texttt{obiiter.IBioSequence}. An \texttt{IBioSequence} iterator
|
|
provides batch of sequences.
|
|
|
|
\hypertarget{basic-usage-of-a-sequence-iterator}{%
|
|
\subsection*{Basic usage of a sequence
|
|
iterator}\label{basic-usage-of-a-sequence-iterator}}
|
|
\addcontentsline{toc}{subsection}{Basic usage of a sequence iterator}
|
|
|
|
Many functions, among them functions reading sequences from a text file,
|
|
return a \texttt{IBioSequence} iterator. The iterator class provides two
|
|
main methods:
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
\texttt{Next()\ bool}
|
|
\item
|
|
\texttt{Get()\ obiiter.BioSequenceBatch}
|
|
\end{itemize}
|
|
|
|
The \texttt{Next} method moves the iterator to the next value, while the
|
|
\texttt{Get} method returns the currently pointed value. Using them, it
|
|
is possible to loop over the data as in the following code chunk.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\KeywordTok{import} \OperatorTok{(}
|
|
\StringTok{"git.metabarcoding.org/lecasofts/go/obitools/pkg/obiformats"}
|
|
\OperatorTok{)}
|
|
|
|
\KeywordTok{func}\NormalTok{ main}\OperatorTok{()} \OperatorTok{\{}
|
|
\NormalTok{ mydata }\OperatorTok{:=}\NormalTok{ obiformats}\OperatorTok{.}\NormalTok{ReadFastSeqFromFile}\OperatorTok{(}\StringTok{"myfile.fasta"}\OperatorTok{)}
|
|
|
|
\ControlFlowTok{for}\NormalTok{ mydata}\OperatorTok{.}\NormalTok{Next}\OperatorTok{()} \OperatorTok{\{}
|
|
\NormalTok{ data }\OperatorTok{:=}\NormalTok{ mydata}\OperatorTok{.}\NormalTok{Get}\OperatorTok{()}
|
|
\CommentTok{//}
|
|
\CommentTok{// Whatever you want to do with the data chunk}
|
|
\CommentTok{//}
|
|
\OperatorTok{\}}
|
|
\OperatorTok{\}}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
An \texttt{obiseq.BioSequenceBatch} instance is a set of sequences
|
|
stored in an \texttt{obiseq.BioSequenceSlice} and a sequence number. The
|
|
number of sequences in a batch is not defined. A batch can even contain
|
|
zero sequences, if for example all sequences initially included in the
|
|
batch have been filtered out at some stage of their processing.
|
|
|
|
\hypertarget{the-pipable-functions}{%
|
|
\subsection*{\texorpdfstring{The \texttt{Pipable}
|
|
functions}{The Pipable functions}}\label{the-pipable-functions}}
|
|
\addcontentsline{toc}{subsection}{The \texttt{Pipable} functions}
|
|
|
|
A function consuming a \texttt{obiiter.IBioSequence} and returning a
|
|
\texttt{obiiter.IBioSequence} is of class \texttt{obiiter.Pipable}.
|
|
|
|
\hypertarget{the-teeable-functions}{%
|
|
\subsection*{\texorpdfstring{The \texttt{Teeable}
|
|
functions}{The Teeable functions}}\label{the-teeable-functions}}
|
|
\addcontentsline{toc}{subsection}{The \texttt{Teeable} functions}
|
|
|
|
A function consuming a \texttt{obiiter.IBioSequence} and returning two
|
|
\texttt{obiiter.IBioSequence} instance is of class
|
|
\texttt{obiiter.Teeable}.
|
|
|
|
\appendix
|
|
\addcontentsline{toc}{part}{Appendices}
|
|
|
|
\hypertarget{annexes}{%
|
|
\chapter{Annexes}\label{annexes}}
|
|
|
|
\hypertarget{sequence-attributes}{%
|
|
\section{Sequence attributes}\label{sequence-attributes}}
|
|
|
|
\textbf{ali\_dir (\texttt{string})}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Set by the \emph{obipairing} tool
|
|
\item
|
|
The attribute can contain 2 string values \texttt{left} or
|
|
\texttt{right}.
|
|
\end{itemize}
|
|
|
|
The alignment generated by \emph{obipairing} is a 3'-end gap free
|
|
algorithm. Two cases can occur when aligning the forward and reverse
|
|
reads. If the barcode is long enough, both the reads overlap only on
|
|
their 3' ends. In such case, the alignment direction \texttt{ali\_dir}
|
|
is set to \emph{left}. If the barcode is shorter than the read length,
|
|
the paired reads overlap by their 5' ends, and the complete barcode is
|
|
sequenced by both the reads. In that later case, \texttt{ali\_dir} is
|
|
set to \emph{right}.
|
|
|
|
\textbf{ali\_length (\texttt{int})}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Set by the \emph{obipairing} tool
|
|
\end{itemize}
|
|
|
|
Length of the aligned parts when merging forward and reverse reads
|
|
|
|
\textbf{count (\texttt{int})}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Set by the \emph{obiuniq} tool
|
|
\item
|
|
Getter : method \texttt{Count()}
|
|
\item
|
|
Setter : method \texttt{SetCount(int)}
|
|
\end{itemize}
|
|
|
|
The \texttt{count} attribute indicates how-many strictly identical reads
|
|
have been merged in a single record. It contains an integer value. If it
|
|
is absent this means that the sequence record represents a single
|
|
occurrence of the sequence.
|
|
|
|
The \texttt{Count()} method allows to access to the count attribute as
|
|
an integer value. If the \texttt{count} attribute is not defined for the
|
|
given sequence, the value \emph{1} is returned
|
|
|
|
\textbf{merged\_* (\texttt{map{[}string{]}int})}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Set by the \emph{obiuniq} tool
|
|
\end{itemize}
|
|
|
|
The \texttt{-m} option of the \emph{obiuniq} tools allows for keeping
|
|
track of the distribution of the values stored in given attribute of
|
|
interest. Often this option is used to summarise distribution of a
|
|
sequence variant accross samples when \emph{obiuniq} is run after
|
|
running \emph{obimultiplex}. The actual name of the attribute depends on
|
|
the name of the monitored attribute. If \texttt{-m} option is used with
|
|
the attribute \emph{sample}, then this attribute names
|
|
\emph{merged\_sample}.
|
|
|
|
\textbf{mode (\texttt{string})}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Set by the \emph{obipairing} tool
|
|
\item
|
|
The attribute can contain 2 string values \texttt{join} or
|
|
\texttt{alignment}.
|
|
\end{itemize}
|
|
|
|
\textbf{obitag\_ref\_index (\texttt{map{[}string{]}string})}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Set by the \emph{obirefidx} tool.
|
|
\end{itemize}
|
|
|
|
It resumes to which taxonomic annotation a match to that sequence must
|
|
lead according to the number of differences existing between the query
|
|
sequence and the reference sequence having that tag.
|
|
|
|
\begin{Shaded}
|
|
\begin{Highlighting}[]
|
|
\FunctionTok{\{}\DataTypeTok{"0"}\FunctionTok{:}\StringTok{"9606@Homo sapiens@species"}\FunctionTok{,}
|
|
\DataTypeTok{"2"}\FunctionTok{:}\StringTok{"207598@Homininae@subfamily"}\FunctionTok{,}
|
|
\DataTypeTok{"3"}\FunctionTok{:}\StringTok{"9604@Hominidae@family"}\FunctionTok{,}
|
|
\DataTypeTok{"8"}\FunctionTok{:}\StringTok{"314295@Hominoidea@superfamily"}\FunctionTok{,}
|
|
\DataTypeTok{"10"}\FunctionTok{:}\StringTok{"9526@Catarrhini@parvorder"}\FunctionTok{,}
|
|
\DataTypeTok{"12"}\FunctionTok{:}\StringTok{"1437010@Boreoeutheria@clade"}\FunctionTok{,}
|
|
\DataTypeTok{"16"}\FunctionTok{:}\StringTok{"9347@Eutheria@clade"}\FunctionTok{,}
|
|
\DataTypeTok{"17"}\FunctionTok{:}\StringTok{"40674@Mammalia@class"}\FunctionTok{,}
|
|
\DataTypeTok{"22"}\FunctionTok{:}\StringTok{"117571@Euteleostomi@clade"}\FunctionTok{,}
|
|
\DataTypeTok{"25"}\FunctionTok{:}\StringTok{"7776@Gnathostomata@clade"}\FunctionTok{,}
|
|
\DataTypeTok{"29"}\FunctionTok{:}\StringTok{"33213@Bilateria@clade"}\FunctionTok{,}
|
|
\DataTypeTok{"30"}\FunctionTok{:}\StringTok{"6072@Eumetazoa@clade"}\FunctionTok{\}}
|
|
\end{Highlighting}
|
|
\end{Shaded}
|
|
|
|
\textbf{pairing\_mismatches (\texttt{map{[}string{]}string})}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Set by the \emph{obipairing} tool
|
|
\end{itemize}
|
|
|
|
\textbf{seq\_a\_single (\texttt{int})}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Set by the \emph{obipairing} tool
|
|
\end{itemize}
|
|
|
|
\textbf{seq\_ab\_match (\texttt{int})}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Set by the \emph{obipairing} tool
|
|
\end{itemize}
|
|
|
|
\textbf{seq\_b\_single (\texttt{int})}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Set by the \emph{obipairing} tool
|
|
\end{itemize}
|
|
|
|
\textbf{score (\texttt{int})}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Set by the \emph{obipairing} tool
|
|
\end{itemize}
|
|
|
|
\textbf{score\_norm (\texttt{float})}
|
|
|
|
\begin{itemize}
|
|
\tightlist
|
|
\item
|
|
Set by the \emph{obipairing} tool
|
|
\item
|
|
The value ranges between 0 and 1.
|
|
\end{itemize}
|
|
|
|
Score of the alignment between forward and reverse reads expressed as a
|
|
fraction of identity.
|
|
|
|
\hypertarget{references}{%
|
|
\chapter*{References}\label{references}}
|
|
\addcontentsline{toc}{chapter}{References}
|
|
|
|
\markboth{References}{References}
|
|
|
|
\hypertarget{refs}{}
|
|
\begin{CSLReferences}{1}{0}
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Andersen2012-gj}{}}%
|
|
Andersen, Kenneth, Karen Lise Bird, Morten Rasmussen, James Haile,
|
|
Henrik Breuning-Madsen, Kurt H Kjaer, Ludovic Orlando, M Thomas P
|
|
Gilbert, and Eske Willerslev. 2012. {``{Meta-barcoding of {ë}dirt{ı́}DNA
|
|
from soil reflects vertebrate biodiversity}.''} \emph{Molecular Ecology}
|
|
21 (8): 1966--79.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Baldwin2013-yc}{}}%
|
|
Baldwin, Darren S, Matthew J Colloff, Gavin N Rees, Anthony A Chariton,
|
|
Garth O Watson, Leon N Court, Diana M Hartley, et al. 2013. {``{Impacts
|
|
of inundation and drought on eukaryote biodiversity in semi-arid
|
|
floodplain soils}.''} \emph{Molecular Ecology} 22 (6): 1746--58.
|
|
\url{https://doi.org/10.1111/mec.12190}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Boyer2016-gq}{}}%
|
|
Boyer, Frédéric, Céline Mercier, Aurélie Bonin, Yvan Le Bras, Pierre
|
|
Taberlet, and Eric Coissac. 2016. {``{obitools: a unix-inspired software
|
|
package for DNA metabarcoding}.''} \emph{Molecular Ecology Resources} 16
|
|
(1): 176--82. \url{https://doi.org/10.1111/1755-0998.12428}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Caporaso2010-ii}{}}%
|
|
Caporaso, J Gregory, Justin Kuczynski, Jesse Stombaugh, Kyle Bittinger,
|
|
Frederic D Bushman, Elizabeth K Costello, Noah Fierer, et al. 2010.
|
|
{``{QIIME allows analysis of high-throughput community sequencing
|
|
data}.''} \emph{Nature Methods} 7 (5): 335--36.
|
|
\url{https://doi.org/10.1038/nmeth.f.303}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Chariton2010-cz}{}}%
|
|
Chariton, Anthony A, Anthony C Roach, Stuart L Simpson, and Graeme E
|
|
Batley. 2010. {``{Influence of the choice of physical and chemistry
|
|
variables on interpreting patterns of sediment contaminants and their
|
|
relationships with estuarine macrobenthic communities}.''} \emph{Marine
|
|
and Freshwater Research}. \url{https://doi.org/10.1071/mf09263}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-cock2010sanger}{}}%
|
|
Cock, Peter JA, Christopher J Fields, Naohisa Goto, Michael L Heuer, and
|
|
Peter M Rice. 2010. {``The Sanger FASTQ File Format for Sequences with
|
|
Quality Scores, and the Solexa/Illumina FASTQ Variants.''} \emph{Nucleic
|
|
Acids Research} 38 (6): 1767--71.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Deagle2009-yh}{}}%
|
|
Deagle, Bruce E, Roger Kirkwood, and Simon N Jarman. 2009. {``{Analysis
|
|
of Australian fur seal diet by pyrosequencing prey DNA in faeces}.''}
|
|
\emph{Molecular Ecology} 18 (9): 2022--38.
|
|
\url{https://doi.org/10.1111/j.1365-294X.2009.04158.x}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Kowalczyk2011-kg}{}}%
|
|
Kowalczyk, Rafał, Pierre Taberlet, Eric Coissac, Alice Valentini,
|
|
Christian Miquel, Tomasz Kamiński, and Jan M Wójcik. 2011. {``{Influence
|
|
of management practices on large herbivore diet---Case of European bison
|
|
in Bia{ł}owie{ż}a Primeval Forest (Poland)}.''} \emph{Forest Ecology and
|
|
Management} 261 (4): 821--28.
|
|
\url{https://doi.org/10.1016/j.foreco.2010.11.026}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Lipman1985-hw}{}}%
|
|
Lipman, D J, and W R Pearson. 1985. {``{Rapid and sensitive protein
|
|
similarity searches}.''} \emph{Science} 227 (4693): 1435--41.
|
|
\url{http://www.ncbi.nlm.nih.gov/pubmed/2983426}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Parducci2012-rn}{}}%
|
|
Parducci, Laura, Tina Jørgensen, Mari Mette Tollefsrud, Ellen Elverland,
|
|
Torbjørn Alm, Sonia L Fontana, K D Bennett, et al. 2012. {``{Glacial
|
|
survival of boreal trees in northern Scandinavia}.''} \emph{Science} 335
|
|
(6072): 1083--86. \url{https://doi.org/10.1126/science.1216043}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Riaz2011-gn}{}}%
|
|
Riaz, Tiayyba, Wasim Shehzad, Alain Viari, François Pompanon, Pierre
|
|
Taberlet, and Eric Coissac. 2011. {``{ecoPrimers: inference of new DNA
|
|
barcode markers from whole genome sequence analysis}.''} \emph{Nucleic
|
|
Acids Research} 39 (21): e145. \url{https://doi.org/10.1093/nar/gkr732}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Schloss2009-qy}{}}%
|
|
Schloss, Patrick D, Sarah L Westcott, Thomas Ryabin, Justine R Hall,
|
|
Martin Hartmann, Emily B Hollister, Ryan A Lesniewski, et al. 2009.
|
|
{``{Introducing mothur: open-source, platform-independent,
|
|
community-supported software for describing and comparing microbial
|
|
communities}.''} \emph{Applied and Environmental Microbiology} 75 (23):
|
|
7537--41. \url{https://doi.org/10.1128/AEM.01541-09}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Seguritan2001-tg}{}}%
|
|
Seguritan, V, and F Rohwer. 2001. {``{FastGroup: a program to
|
|
dereplicate libraries of 16S rDNA sequences}.''} \emph{BMC
|
|
Bioinformatics} 2 (October): 9.
|
|
\url{https://doi.org/10.1186/1471-2105-2-9}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Shehzad2012-pn}{}}%
|
|
Shehzad, Wasim, Tiayyba Riaz, Muhammad A Nawaz, Christian Miquel, Carole
|
|
Poillot, Safdar A Shah, Francois Pompanon, Eric Coissac, and Pierre
|
|
Taberlet. 2012. {``{Carnivore diet analysis based on next-generation
|
|
sequencing: Application to the leopard cat (Prionailurus bengalensis) in
|
|
Pakistan}.''} \emph{Molecular Ecology} 21 (8): 1951--65.
|
|
\url{https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1365-294X.2011.05424.x}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Sogin2006-ab}{}}%
|
|
Sogin, Mitchell L, Hilary G Morrison, Julie A Huber, David Mark Welch,
|
|
Susan M Huse, Phillip R Neal, Jesus M Arrieta, and Gerhard J Herndl.
|
|
2006. {``{Microbial diversity in the deep sea and the underexplored
|
|
"rare biosphere"}.''} \emph{Proceedings of the National Academy of
|
|
Sciences of the United States of America} 103 (32): 12115--20.
|
|
\url{https://doi.org/10.1073/pnas.0605127103}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Sonstebo2010-vv}{}}%
|
|
Sønstebø, J H, L Gielly, A K Brysting, R Elven, M Edwards, J Haile, E
|
|
Willerslev, et al. 2010. {``{Using next-generation sequencing for
|
|
molecular reconstruction of past Arctic vegetation and climate}.''}
|
|
\emph{Molecular Ecology Resources} 10 (6): 1009--18.
|
|
\url{https://doi.org/10.1111/j.1755-0998.2010.02855.x}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Taberlet2012-pf}{}}%
|
|
Taberlet, Pierre, Eric Coissac, Mehrdad Hajibabaei, and Loren H
|
|
Rieseberg. 2012. {``{Environmental DNA}.''} \emph{Molecular Ecology} 21
|
|
(8): 1789--93. \url{https://doi.org/10.1111/j.1365-294X.2012.05542.x}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Thomsen2012-au}{}}%
|
|
Thomsen, Philip Francis, Jos Kielgast, Lars L Iversen, Carsten Wiuf,
|
|
Morten Rasmussen, M Thomas P Gilbert, Ludovic Orlando, and Eske
|
|
Willerslev. 2012. {``{Monitoring endangered freshwater biodiversity
|
|
using environmental DNA}.''} \emph{Molecular Ecology} 21 (11): 2565--73.
|
|
\url{https://doi.org/10.1111/j.1365-294X.2011.05418.x}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Valentini2009-ay}{}}%
|
|
Valentini, Alice, Christian Miquel, Muhammad Ali Nawaz, Eva Bellemain,
|
|
Eric Coissac, François Pompanon, Ludovic Gielly, et al. 2009. {``{New
|
|
perspectives in diet analysis based on DNA barcoding and parallel
|
|
pyrosequencing: the trnL approach}.''} \emph{Molecular Ecology
|
|
Resources} 9 (1): 51--60.
|
|
\url{https://doi.org/10.1111/j.1755-0998.2008.02352.x}.
|
|
|
|
\leavevmode\vadjust pre{\hypertarget{ref-Yoccoz2012-ix}{}}%
|
|
Yoccoz, N G, K A Bråthen, L Gielly, J Haile, M E Edwards, T Goslar, H
|
|
Von Stedingk, et al. 2012. {``{DNA from soil mirrors plant taxonomic and
|
|
growth form diversity}.''} \emph{Molecular Ecology} 21 (15): 3647--55.
|
|
\url{https://doi.org/10.1111/j.1365-294X.2012.05545.x}.
|
|
|
|
\end{CSLReferences}
|
|
|
|
|
|
|
|
\end{document}
|