Compare commits

...

197 Commits

Author SHA1 Message Date
Eric Coissac 2b37e8aac4 fix(bitmatrix): explicitly compute diagonal entries for self-similarity
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Failing after 30s
CI / build (pull_request) Successful in 3m21s
The pairwise matrix functions now explicitly calculate and overwrite diagonal entries using `f(i,i)`, replacing previous implicit symmetric mirroring or default values. Documentation has been updated to clarify that diagonals represent self-comparison weights, ensuring accurate self-similarity calculations. Additionally, the obikmer crate version has been bumped to 1.1.34.
2026-07-03 13:04:40 +02:00
Eric Coissac 67b4e4da53 refactor(numa): replace flat runner with per-node activation channels
Shifts the NUMA-aware runner from a flat, round-robin model to a per-node architecture using dedicated `NodeActivation` channels. Replaces absolute deltas with relative scaling based on the previous growth step's worker count, decoupling growth from node count to fix slow ramp-up and enforce per-node fairness. Updates architecture documentation to reflect these changes and focus tuning questions on `INITIAL`/`GROWTH_DIVISOR` parameters for I/O-bound validation.
2026-07-03 13:03:31 +02:00
coissac 66ab4c6db1 Merge pull request 'feat(numa): introduce I/O sampling to prevent activation stalls' (#55) from push-ooruxnkktvvz into main
Reviewed-on: #55
2026-07-02 09:36:19 +00:00
Eric Coissac f84dd539bf feat(numa): introduce I/O sampling to prevent activation stalls
Release / create-release (push) Successful in 2m25s
Release / build-linux-x86_64 (push) Successful in 8m47s
Release / build-macos-arm64 (push) Failing after 31s
CI / build (pull_request) Successful in 3m30s
Replaces the monolithic CPU scaling threshold with separate CPU and I/O spawn thresholds. Introduces an `IoSample` struct with platform-specific byte reading and a relative throughput growth heuristic. Adds a 0.1s wall-clock guard to `CpuSample` to suppress artificial efficiency spikes, and updates `maybe_activate` to trigger worker scaling when either resource indicates headroom. Bumps `obikmer` to v1.1.33 and updates architecture documentation.
2026-07-02 10:07:22 +02:00
coissac 6378734e1c Merge pull request 'fix(obisys): remove activation guard to always update metrics' (#54) from push-vkloynurrxzu into main
Reviewed-on: #54
2026-07-01 18:34:10 +00:00
Eric Coissac b3a617cce1 fix(obisys): remove activation guard to always update metrics
Release / create-release (push) Successful in 2m26s
CI / build (pull_request) Successful in 3m35s
Release / build-linux-x86_64 (push) Successful in 8m9s
Release / build-macos-arm64 (push) Failing after 30s
Removes the `if activate` conditional in `src/obisys/src/lib.rs`, making debug logging and state updates for performance counters execute unconditionally. This ensures tracking metrics are continuously refreshed regardless of the activation threshold. Also bumps the `obikmer` dependency version.
2026-07-01 20:32:56 +02:00
coissac 2080e5e8a9 Merge pull request 'ci: fix registry auth and bump obikmer to 1.1.30' (#53) from push-zxlknspoxknt into main
Reviewed-on: #53
2026-07-01 14:20:09 +00:00
Eric Coissac 45ed2bc9b8 ci: fix registry auth and bump obikmer to 1.1.30
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m12s
Release / build-macos-arm64 (push) Failing after 1m55s
CI / build (pull_request) Successful in 3m32s
Update the release workflow to explicitly resolve the Docker registry username from repository secrets instead of inferring it from the runner's actor. Bump the obikmer package version to 1.1.30.
2026-07-01 14:31:30 +02:00
coissac aa126fd89d Merge pull request 'feat: simplify worker spawning logic and update macOS build workflow' (#52) from push-uvmlknmzqqnx into main
Reviewed-on: #52
2026-07-01 09:50:51 +00:00
Eric Coissac c612132763 feat: simplify worker spawning logic and update macOS build workflow
Release / create-release (push) Successful in 2m59s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Failing after 8s
CI / build (pull_request) Successful in 3m24s
Updates the release workflow to run macOS builds inside a Docker container with explicit registry authentication and adjusted artifact paths. Bumps the obikmer crate version to 1.1.29 and adds *.log to .gitignore. Simplifies NUMA worker spawning by lowering the activation threshold from 0.95 to 0.2, replacing complex stateful tracking with a direct efficiency check, and downgrading progress logging to debug level. Includes general code formatting improvements for readability.
2026-07-01 11:40:57 +02:00
coissac 19660f8cd0 Merge pull request 'ci: update registry auth and improve adaptive worker scaling' (#51) from push-qlpywtroutvx into main
Reviewed-on: #51
2026-06-26 13:16:23 +00:00
Eric Coissac 7b07540a69 ci: update registry auth and improve adaptive worker scaling
Release / create-release (push) Successful in 2m27s
CI / build (pull_request) Successful in 3m17s
Release / build-linux-x86_64 (push) Successful in 8m3s
Release / build-macos-arm64 (push) Failing after 1s
Refactor the release workflow to use a structured container object with authenticated pulls for macOS ARM64 builds. Replace single-worker activation with dynamic upfront provisioning based on node and worker counts. Implement an absolute efficiency gain threshold for scaling checks and add early termination to improve adaptive scaling stability. Bump obikmer crate version to 1.1.27.
2026-06-26 15:13:13 +02:00
coissac 89c43e28f5 Merge pull request 'ci: update release workflow and bump obikmer to 1.1.26' (#50) from push-npttlqpomtvz into main
Reviewed-on: #50
2026-06-24 13:55:40 +00:00
Eric Coissac b9b2e42ad2 ci: update release workflow and bump obikmer to 1.1.26
Release / create-release (push) Successful in 2m32s
CI / build (pull_request) Successful in 3m47s
Release / build-linux-x86_64 (push) Successful in 8m18s
Release / build-macos-arm64 (push) Failing after 0s
Replaces the macOS ARM64 cross-compilation container with a custom internal registry image. Adds explicit steps to install the `aarch64-apple-darwin` Rust target and `jq`, and updates the build command to use `--no-default-features`. Bumps the `obikmer` package version from 1.1.25 to 1.1.26.
2026-06-24 15:55:02 +02:00
coissac ca42fdff2f Merge pull request 'ci: update macOS ARM64 build workflow and bump obikmer version' (#49) from push-lllnsqlrqrut into main
Reviewed-on: #49
2026-06-23 13:15:20 +00:00
Eric Coissac 136cd89efb ci: update macOS ARM64 build workflow and bump obikmer version
Release / create-release (push) Successful in 2m27s
Release / build-linux-x86_64 (push) Successful in 7m52s
Release / build-macos-arm64 (push) Failing after 8m53s
CI / build (pull_request) Successful in 5m31s
Replace manual Zig/cargo-zigbuild setup with a pre-configured Docker container (`joseluisq/rust-linux-darwin-builder`). Use explicit Clang cross-compilers for native macOS ARM64 compilation. Bump the `obikmer` package version to 1.1.25.
2026-06-23 15:01:17 +02:00
coissac a4bbf607b7 Merge pull request 'Push kxsopnzprltv' (#48) from push-kxsopnzprltv into main
Reviewed-on: #48
2026-06-23 09:51:33 +00:00
Eric Coissac 9927100a1c chore: update obikmer to 1.1.24
Release / create-release (push) Successful in 2m24s
Release / build-linux-x86_64 (push) Successful in 7m49s
Release / build-macos-arm64 (push) Failing after 3m31s
CI / build (pull_request) Successful in 3m22s
Bumps the obikmer version in Cargo.toml from 1.1.21 to 1.1.24 and updates Cargo.lock to align with the upstream patch release (1.1.23). This ensures consistent dependency resolution across builds.
2026-06-23 11:47:54 +02:00
Eric Coissac 527258f822 ci: enforce macOS 11.0 deployment target for ARM builds
Adds MACOSX_DEPLOYMENT_TARGET=11.0 environment variable and updates the cargo zigbuild target to aarch64-apple-darwin11.0 to explicitly require macOS 11.0 for ARM binary compilation.
2026-06-23 11:46:09 +02:00
coissac ef62f1947e Merge pull request 'chore: bump version to 1.1.21 and update obikindex features' (#47) from push-xwutoxpnxorz into main
Reviewed-on: #47
2026-06-23 08:31:31 +00:00
Eric Coissac d02316dcf6 chore: bump version to 1.1.21 and update obikindex features
Release / create-release (push) Successful in 2m29s
CI / build (pull_request) Successful in 4m36s
Release / build-linux-x86_64 (push) Successful in 10m25s
Release / build-macos-arm64 (push) Failing after 4m50s
Disables default features for the `obikindex` dependency and introduces a `[features]` block. The new `numa` feature is set as the default, conditionally enabling NUMA support in `obikindex`.
2026-06-23 10:30:39 +02:00
coissac c323b3eaef Merge pull request 'Bump obikmer to 1.1.20 and update release workflow' (#46) from push-wpnywwlwxrps into main
Reviewed-on: #46
2026-06-23 08:03:58 +00:00
Eric Coissac b77d8e9ca0 Bump obikmer to 1.1.20 and update release workflow
Release / create-release (push) Successful in 2m26s
CI / build (pull_request) Successful in 3m14s
Release / build-linux-x86_64 (push) Successful in 7m44s
Release / build-macos-arm64 (push) Failing after 7m13s
Update the Gitea release workflow to fetch a full git clone with complete history, ensuring all commits and tags are available for accurate version resolution. This prepares the repository for the standard patch-level release of obikmer v1.1.20.
2026-06-23 10:03:15 +02:00
coissac 7c5bab3694 Merge pull request 'fix(ci): restrict workflow to PRs and improve release tagging' (#45) from push-louqrszyuqpz into main
Reviewed-on: #45
2026-06-23 07:52:35 +00:00
Eric Coissac fab4e0d6de fix(ci): restrict workflow to PRs and improve release tagging
Release / create-release (push) Failing after 26s
Release / build-linux-x86_64 (push) Has been skipped
Release / build-macos-arm64 (push) Has been skipped
CI / build (pull_request) Successful in 3m17s
Restrict the CI pipeline to pull request events only by removing the unconfigured push trigger and eliminating a duplicate pull_request block in the workflow file. Update the Makefile to suppress stderr from the aichat command and introduce a fallback release tag message for robust version tagging. Additionally, bump the obikmer crate version to 1.1.19.
2026-06-23 09:42:23 +02:00
coissac 973a3f3d6e Merge pull request 'feat: add numa feature flag and automate release workflow' (#44) from push-uymxyvsyooro into main
CI / build (push) Successful in 3m16s
Reviewed-on: #44
2026-06-23 07:22:33 +00:00
Eric Coissac 1a839a295a feat: add numa feature flag and automate release workflow
Release / create-release (push) Failing after 37s
Release / build-linux-x86_64 (push) Has been skipped
Release / build-macos-arm64 (push) Has been skipped
CI / build (pull_request) Successful in 3m23s
Refactor the Gitea release pipeline to generate releases via API and upload binaries using a shared ID. Automate changelog generation by fetching recent commits with `jj log` and producing markdown notes via `aichat`. Convert `hwlocality` to an optional dependency gated by a default `numa` feature, providing fallback implementations for graceful degradation when NUMA support is disabled. Bump obikmer to 1.1.18.
2026-06-23 09:07:04 +02:00
coissac 2ea58703c7 Merge pull request 'Push zkptpswyxnvt' (#43) from push-zkptpswyxnvt into main
CI / build (push) Successful in 3m19s
Reviewed-on: #43
2026-06-22 16:29:59 +00:00
Eric Coissac ac3ef106e7 refactor: implement adaptive worker scaling and infallible NUMA build
Release / build-linux-static (push) Successful in 8m4s
CI / build (pull_request) Successful in 3m26s
Replaces the fallible NUMA topology builder with an infallible fallback that synthesizes a single-node UMA configuration on failure or absence. Refactors PartitionRunner to pre-spawn dormant workers and dynamically activate them via CPU efficiency thresholds, replacing static upfront spawning with adaptive scaling. Bumps obikmer crate version to 1.1.15.
2026-06-22 18:29:39 +02:00
Eric Coissac 469e53b6f5 Add genomic distance benchmarking suite and test data
Introduces scripts to compute and validate pairwise genomic distance matrices across multiple metrics. Updates the Makefile with build and comparison targets, adds .gitignore rules for generated outputs, and includes test CSV matrices and a Newick phylogenetic tree for validating the distance computation pipeline.
2026-06-22 18:24:30 +02:00
Eric Coissac 9f1df96ea7 ci: restrict push trigger to main branch
Replace the wildcard `['**']` in the push trigger with `['main']`. This prevents redundant pipeline runs on non-main branches during push events.
2026-06-22 16:58:44 +02:00
coissac 4e4cce2879 Merge pull request 'fix(ci): enable cross-compilation in release workflow and bump obikmer' (#42) from push-sxlpkrkyuttk into main
CI / build (push) Successful in 3m20s
Reviewed-on: #42
2026-06-22 14:31:26 +00:00
Eric Coissac 68b05b93c4 fix(ci): enable cross-compilation in release workflow and bump obikmer
CI / build (push) Successful in 4m38s
Release / build-linux-static (push) Successful in 10m14s
CI / build (pull_request) Successful in 3m40s
Injects PKG_CONFIG_ALLOW_CROSS=1 into the static binary build step to ensure correct native dependency resolution during musl target compilation with cargo zigbuild. Also updates the obikmer crate version from 1.1.13 to 1.1.14.
2026-06-22 16:31:04 +02:00
coissac 0a668cf8a6 Merge pull request 'chore: bump obikmer to 1.1.13 and fix Makefile revision tag' (#41) from push-qwzpxktnlyls into main
CI / build (push) Has been cancelled
Reviewed-on: #41
2026-06-22 14:18:25 +00:00
Eric Coissac e6d6942e2f chore: bump obikmer to 1.1.13 and fix Makefile revision tag
CI / build (push) Has been cancelled
Release / build-linux-static (push) Has been cancelled
CI / build (pull_request) Has been cancelled
Update the obikmer crate version from 1.1.12 to 1.1.13 in Cargo.toml. Additionally, change the Makefile's Git revision specifier from @- to @ to ensure the version tag is applied to the current commit before pushing.
2026-06-22 16:17:52 +02:00
coissac bf9c9aeacb Merge pull request 'chore: bump version to 1.1.12 and fix release workflow' (#40) from push-zmkxouxypspm into main
CI / build (push) Has been cancelled
Reviewed-on: #40
2026-06-22 14:13:13 +00:00
Eric Coissac 22a65857a1 chore: bump version to 1.1.12 and fix release workflow
CI / build (push) Successful in 3m14s
CI / build (pull_request) Successful in 3m51s
Update Cargo.toml to 1.1.12 for a semver patch release. Refactor the Makefile release target to explicitly retrieve the parent commit hash via `jj log` and apply the tag, replacing implicit working directory tagging. Remove `jj auto-describe` and `--change @` in favor of an explicit `git push origin` for the version tag.
2026-06-22 16:12:56 +02:00
coissac d16a867640 Merge pull request 'ci: bypass PEP 668 restrictions and update obikmer to 1.1.11' (#39) from push-mxysluysloxr into main
CI / build (push) Successful in 4m1s
Release / build-linux-static (push) Failing after 7m28s
Reviewed-on: #39
2026-06-22 13:52:51 +00:00
Eric Coissac 616050075f ci: bypass PEP 668 restrictions and update obikmer to 1.1.11
CI / build (push) Successful in 3m41s
CI / build (pull_request) Successful in 3m49s
Add the `--break-system-packages` flag to the `pip install ziglang` command in the Gitea release workflow to bypass PEP 668 restrictions on modern Linux distributions. Additionally, bump the `obikmer` crate version from 1.1.9 to 1.1.11 across both Cargo.toml and Cargo.lock.
2026-06-22 15:52:34 +02:00
coissac e22afe9621 Merge pull request 'chore: bump obikmer to 1.1.9 and update release workflow' (#38) from push-noxuppsknsol into main
CI / build (push) Successful in 3m11s
Release / build-linux-static (push) Failing after 3m4s
Reviewed-on: #38
2026-06-22 13:32:50 +00:00
Eric Coissac bdfac71e65 chore: bump obikmer to 1.1.9 and update release workflow
CI / build (push) Successful in 3m24s
CI / build (pull_request) Failing after 0s
Bumps the obikmer crate version from 1.1.7 to 1.1.9 in Cargo.toml and Cargo.lock. Updates the Gitea release workflow to dynamically locate the Zig compiler via Python, generating musl-targeted gcc/g++ wrapper scripts installed to /usr/local/bin for static Linux cross-compilation during releases.
2026-06-22 15:32:10 +02:00
coissac a00bb37478 Merge pull request 'ci: switch to Zig build toolchain and bump obikmer to 1.1.7' (#37) from push-nvvqmzmrotxx into main
CI / build (push) Successful in 3m14s
Release / build-linux-static (push) Failing after 2m42s
Reviewed-on: #37
2026-06-22 13:20:12 +00:00
Eric Coissac d30a4efd9b ci: switch to Zig build toolchain and bump obikmer to 1.1.7
CI / build (push) Successful in 3m12s
CI / build (pull_request) Successful in 3m16s
Replaces the musl-based static Linux build toolchain with Zig (`ziglang` via pip and `cargo-zigbuild`), removing `musl-tools` dependencies. The workflow now invokes `cargo zigbuild` for cross-compiling the static binary. Additionally, bumps the `obikmer` crate version to 1.1.7.
2026-06-22 15:19:39 +02:00
coissac 6baf2e64ca Merge pull request 'chore: bump obikmer to 1.1.6 and automate git tagging' (#36) from push-yxmtknzsynpx into main
CI / build (push) Successful in 3m20s
Release / build-linux-static (push) Failing after 4m30s
Reviewed-on: #36
2026-06-22 13:01:06 +00:00
Eric Coissac c0a71a2d49 chore: bump obikmer to 1.1.6 and automate git tagging
CI / build (push) Successful in 4m46s
CI / build (pull_request) Successful in 4m27s
Bumps the obikmer crate version from 0.1.4 to 1.1.6 in Cargo.toml and Cargo.lock. Updates the Makefile release target to automatically extract the version, create a Git tag, and push it to the remote repository, extending the existing workflow with standard Git publishing steps.
2026-06-22 15:00:36 +02:00
coissac a609c1af95 Merge pull request 'ci: streamline release workflow and bump obikmer to 0.1.4' (#35) from push-zokprynyqunu into main
CI / build (push) Successful in 4m41s
Release / build-linux-static (push) Failing after 6m4s
Reviewed-on: #35
2026-06-22 09:38:36 +00:00
Eric Coissac 3d32be8a83 ci: streamline release workflow and bump obikmer to 0.1.4
CI / build (push) Successful in 4m33s
CI / build (pull_request) Successful in 4m17s
Replaces the intermediate artifact upload step in the Gitea release workflow with a direct REST API call, eliminating unnecessary dependencies and adding `jq`. Also increments the obikmer crate version to 0.1.4.
2026-06-22 11:38:19 +02:00
coissac c4c71dc892 Merge pull request 'Push mtzqmmrlmzzx' (#34) from push-mtzqmmrlmzzx into main
CI / build (push) Successful in 4m34s
Reviewed-on: #34
2026-06-22 08:47:24 +00:00
Eric Coissac 4e625afaba refactor: update CI toolchain setup and optimize parallel indexing
CI / build (push) Successful in 4m56s
CI / build (pull_request) Successful in 4m11s
Update CI workflows to explicitly install the Rust toolchain via rustup and configure musl targets for deterministic static builds in Docker containers. Bump obikmer dependency to 0.1.3. Refactor obicompactvec to reduce peak memory usage by computing column sizes from filesystem metadata, add atomic writes, and implement cleanup guards. Replace parallel iteration patterns in obikindex with a structured PartitionRunner pipeline for simplified error handling and progress tracking.
2026-06-22 10:46:24 +02:00
Eric Coissac a522c0907e feat: add CI/CD workflows, release automation, and CLI version flag
CI / build (push) Failing after 2m41s
CI / build (pull_request) Failing after 6s
Adds Gitea Actions for continuous integration and tagged releases, including static musl binary compilation and artifact upload. Introduces a Makefile target to automate semantic version bumping and publishing. Bumps the package version to 0.1.1 and enables automatic `--version` output via Clap.
2026-06-22 10:36:40 +02:00
Eric Coissac c1d6f277ce feat(select): add metrics reporting to selection methods
Integrates an obisys::Reporter across indexing and command modules to capture execution metrics. Replaces discarded timer stops with explicit rep.push() calls, adds timing instrumentation for the pack stage, and prints collected reports after each selection branch.
2026-06-22 10:25:24 +02:00
Eric Coissac 9356be4ec0 feat: introduce obitaxonomy crate for hierarchical taxonomy parsing
Adds the `obitaxonomy` crate to parse and validate hierarchical taxonomy paths using a strict `taxonomy:/name@rank/...` syntax. Replaces generic string-based path matching in predicates with structured `TaxPath` and `TaxPattern` types, enforcing explicit anchor constraints and rank-aware semantics. Updates filtering documentation to clarify optional leading slashes and segment-boundary matching rules.
2026-06-22 10:24:04 +02:00
Eric Coissac c694e1f2b0 feat: add benchmark pipeline, expose APIs, and enforce strict paths
Introduces a Make-based orchestration for simulating, indexing, merging, filtering, and verifying k-mer counts and presence. Exposes internal builder and iterator APIs publicly, enforces mandatory leading slashes for predicate patterns, registers the `obitaxonomy` crate, and updates tooling configurations alongside documentation.
2026-06-22 10:18:33 +02:00
Eric Coissac 280ca1f5a3 feat: add optimized new_ones constructor for all-ones bit vectors
Introduces `new_ones` and `add_col_ones` methods to directly initialize all-ones bit vectors and matrix columns. This replaces redundant initialization sequences that created zero-filled structures and applied bitwise NOT, with a single pass that writes contiguous 0xFF bytes to disk. The change eliminates inversion overhead, streamlines test setup, and improves performance for filter mask intersection logic while preserving identical semantics.
2026-06-22 10:00:01 +02:00
Eric Coissac 9abb2db92f refactor: replace explicit bit-setting loops with optimized bulk operations
Refactor bitmatrix, colgroup, and layer modules to replace manual iteration with concise `or_where` predicates and bulk inversion calls. This simplifies the codebase and leverages optimized internal implementations for improved performance.
2026-06-22 09:56:41 +02:00
Eric Coissac 7c1efa9cbb feat: add vectorized column filters and optimize partitioner iteration
Adds `FilterMask` and conditional bitwise methods (`*_where`) to `obicompactvec` for composable column-based slot filtering. Extends `obikpartitionner` with a `MatrixGroupOps` trait and `column_mask_expr` method to express aggregate constraints as vectorized masks. Refactors matrix builder management into a unified `Builders` enum and introduces `try_compute_combined_mask`, enabling O(1) slot checks and skipping unnecessary row reads during partitioning and rebuilding passes.
2026-06-22 09:54:51 +02:00
Eric Coissac 4c4524766c feat(matrix): add partial group reductions and column persistence
Expands MatrixGroupOps with partial_group_min/max helpers for bitwise reductions and introduces add_col_from methods to persist external vectors as matrix columns. Refactors column aggregation in the partitioner to leverage these group operations directly, replacing iterative row processing with simplified builder lifecycle management and explicit metadata serialization.
2026-06-22 09:49:04 +02:00
Eric Coissac 7eea71fdcd docs(obicompactvec): update API docs and algorithm descriptions
Replace trait-based API documentation with concrete, zero-copy view structs and update all associated diagrams. Refine algorithmic descriptions for sentinel handling, overflow stores, and bulk operations. Clarify temporary file lifecycles and group-chunking strategies to support memory-efficient parallel aggregation.
2026-06-22 09:46:19 +02:00
Eric Coissac f91c5a3f79 refactor(obicompactvec): unify bit and int vector slice views
Refactors column and matrix access to use unified `BitSliceView` and `IntSliceView` abstractions, replacing legacy `PackedCol`/`IntColView` types. Introduces `BitSlice`/`IntSlice` traits for zero-copy, trait-based bitwise and arithmetic operations across persistent and temporary vector types. Removes deprecated in-memory `MemoryBitVec` and `MemoryIntVec` implementations and their tests, while updating dependent crates to use the new view-based API and `BitSliceMut` trait.
2026-06-17 23:51:32 +02:00
Eric Coissac fb4962c4fe refactor: replace in-memory vectors with temp-file-backed storage
Introduces `TempCompactIntVec` and `TempBitVec` as temporary, file-backed intermediates to replace eager in-memory vectors, enabling OS-level paging under memory pressure. Updates the `MatrixGroupOps` trait to return `io::Result` types, allowing proper error propagation and supporting chunked accumulation for large column groups. Includes builder patterns with `.freeze()` finalization, automatic `TempDir` cleanup on drop, and necessary test updates to handle the new fallible signatures. Also fixes `Cargo.toml` section ordering.
2026-06-17 23:36:15 +02:00
Eric Coissac 1d38d87ff9 Add column group operations and mask_with trait
Introduce the `ColGroup` struct and `MatrixGroupOps` trait to manage named subsets of column indices and perform additive aggregations (count, sum, any). Implement these operations for `PersistentBitMatrix` and `PersistentCompactIntMatrix`, applying size-optimized branches for presence counts and direct accumulation for small groups. Additionally, add a `mask_with` trait method that efficiently zero-sets elements based on a mask, optimized for sparse masks with O(n_zeros) complexity. Include comprehensive tests covering overflow handling, slot masking, and result additivity across partitioned data.
2026-06-17 23:28:52 +02:00
Eric Coissac 93559c3294 feat: introduce unified column view types for bit and int matrices
This commit introduces `BitColView` and `IntColView` to abstract over Columnar and Packed storage formats, implementing `BitSlice` and `IntSlice` for uniform column access. It adds `col_view()` accessors to `PersistentBitMatrix` and `PackedCompactIntMatrix`, explicitly panicking on implicit variants. The new types are publicly re-exported, and unit tests are added to validate per-element retrieval, aggregation methods, and parity with the original columnar representation.
2026-06-17 23:24:11 +02:00
Eric Coissac 1f0d77d5bf docs: document compact vector implementation with Mermaid diagrams
Add Mermaid diagrams to visualize the trait hierarchy, compact int storage layout, and SIMD-vectorizable arithmetic operations for MemoryIntVec and PersistentCompactIntVec. Also document concrete type structures and planned layer/partition composition rules to improve documentation clarity.
2026-06-17 23:20:55 +02:00
Eric Coissac eeba43ac4f docs: add technical reference for obicompactvec module
Document the two-tier compact integer encoding, BitSlice/IntSlice trait hierarchy, and SIMD-friendly O(n+k) algorithms. Include details on concrete memory and persistent vector types, matrix aggregation traits, and planned group-filtering APIs.
2026-06-17 23:19:31 +02:00
Eric Coissac 7ed7b26039 perf: optimize vec arithmetic and add overflow tests
Refactor `cmp_scalar`, `min`, `max`, `add`, and `diff` to operate directly on the primary byte array, deferring overflow slot resolution to a secondary pass. This eliminates HashMap lookups in the hot path and enables SIMD vectorization. Add six unit tests to validate correct promotion and demotion between storage slots when values cross the 255 threshold.
2026-06-17 23:18:18 +02:00
Eric Coissac 26de90f18d feat: add iteration and aggregation to compact int vec
Implemented `sum()`, `count_nonzero()`, and `iter()` to complete the numeric vector interface. The builder now computes aggregate values across memory-mapped regions and overflow entries, while the reader delegates these operations to its inherent methods. The iterator provides zero-copy access to underlying `u32` elements.
2026-06-17 23:15:56 +02:00
Eric Coissac 497d250d8a refactor: replace byte-level bit iteration with 64-bit words
Refactor `BitIter` to process `u64` chunks using word-aligned shifts instead of byte-level operations. Introduce a dedicated `MemoryBitIter` for `MemoryBitVec`, updating its `iter()` and `IntoIterator` implementations accordingly. Hide `MemoryBitIter` from the public API to narrow the crate's interface, while leveraging explicit alignment guarantees for safer and more efficient bit extraction.
2026-06-17 23:11:12 +02:00
Eric Coissac aa98e82875 refactor: introduce PackedIntCol view and use iterators
Centralizes overflow handling and improves modularity by replacing manual mmap indexing and row loops with composable iterator patterns. This change leverages Rust's iterator traits for efficient, idiomatic column traversal while encapsulating data access in a dedicated view struct.
2026-06-17 23:09:18 +02:00
Eric Coissac 5ff5b04d2d refactor: replace manual bit ops with BitSlice traits
Refactors bit manipulation and distance calculations to leverage standardized `BitSlice` traits, replacing manual byte/word logic with safer, reusable methods. Extends `IntSlice` and `IntSliceMut` traits to expose direct memory-mapped access and overflow management, enabling efficient bulk data extraction and serialization. Replaces manual bit-shifting loops with optimized table-based unpacking and adds population count and distance metric methods for improved performance. Updates `PersistentBitVecBuilder` with file tracking and safe flushing, and aligns test imports with new trait bounds.
2026-06-17 15:28:44 +02:00
Eric Coissac df7b400fda perf: optimize aggregation with byte-level helpers and direct mmap
Introduce `byte_sum` and `byte_count_nonzero` to efficiently aggregate compact-int byte slices, bypassing per-element decoding and overflow map lookups. Refactor `sum()` and `count_nonzero()` across the matrix, reader, and traits modules to use direct memory-mapped slice iteration and idiomatic Rust iterators. Additionally, expose `MemoryIntIter` publicly and implement `IntoIterator` and `IntSlice` for `MemoryIntVec` to enable standard iteration and delegate aggregation to the new helpers.
2026-06-17 15:21:21 +02:00
Eric Coissac d1717688d2 refactor: extract matrix helpers and improve bit iteration ergonomics
Refactor parallel matrix construction by extracting reusable `pairwise_matrix` and `pairwise2_matrix` helpers, and consolidate binary record deserialization into dedicated parsing functions. Add `set` and `iter` methods to `BitSliceMut` and `MemoryBitVec` for ergonomic bit manipulation and iteration. Standardize JSON field extraction via `meta::field`, expose `MemoryBitIter`, and improve test reliability by automatically cleaning up temporary directories.
2026-06-17 15:15:39 +02:00
Eric Coissac cde6457eea feat: add memory vectors, slice traits, and column extraction methods
Introduce `MemoryBitVec` and `MemoryIntVec` for efficient in-memory storage with hybrid compression and overflow handling. Implement `BitSlice`, `BitSliceMut`, `IntSlice`, and `IntSliceMut` traits across persistent and memory-backed types to enable generic slice operations and bitwise/arithmetic overloads. Add `col_persist` and `col_as_memory` methods to `BitMatrix` and `IntMatrix` for efficient column extraction. Align with the new single-pass rebuild architecture by supporting fast kmer filtering and matrix rebuilding. Includes comprehensive tests and profiling instrumentation for the packing phase.
2026-06-17 15:03:18 +02:00
Eric Coissac b6fcbc545f refactor: replace rayon with NUMA-aware PartitionRunner
Replaces `rayon` parallel iteration across index, rebuild, reindex, and select modules with a custom `PartitionRunner`. This introduces NUMA-aware task distribution with CPU pinning and round-robin scheduling, eliminating `Arc`, `Mutex`, and atomic synchronization primitives in favor of a flat, pre-spawned worker architecture. Error handling is simplified via `.map_err()` and the `?` operator, while progress bar updates are decoupled into dedicated callbacks.
2026-06-15 18:53:31 +02:00
coissac 9578f991f4 Merge pull request 'Push pslsukyowzrp' (#32) from push-pslsukyowzrp into main
Reviewed-on: #32
2026-06-15 16:29:24 +00:00
Eric Coissac 1cd7916e06 refactor: replace rayon with NUMA-aware PartitionRunner
Replaces `rayon` parallel iteration across index, rebuild, reindex, and select modules with a custom `PartitionRunner`. This introduces NUMA-aware task distribution with CPU pinning and round-robin scheduling, eliminating `Arc`, `Mutex`, and atomic synchronization primitives in favor of a flat, pre-spawned worker architecture. Error handling is simplified via `.map_err()` and the `?` operator, while progress bar updates are decoupled into dedicated callbacks.
2026-06-15 18:29:04 +02:00
Eric Coissac bc92dc4592 refactor: restructure partitioner with shared utilities and pipeline
This commit restructures the partitioner crate by extracting shared utilities and the `ColBuilder` enum into a new `common` module. It introduces a multi-phase `graph_pipeline` for constructing and materializing De Bruijn graphs, replacing manual graph construction in `index_layer`, `merge_layer`, and `rebuild_layer`. All layer workflows now use centralized `build_graph` and `materialize_layer` abstractions, with standardized error context strings for improved diagnostics.
2026-06-15 14:08:16 +02:00
coissac a9567ad023 Merge pull request 'Push rtnzuqxzmkon' (#31) from push-rtnzuqxzmkon into main
Reviewed-on: #31
2026-06-15 09:40:35 +00:00
Eric Coissac 4a64718fd1 perf: replace partition processing with adaptive NUMA worker pool
Replaces the previous partition processing logic with an adaptive, NUMA-aware multi-threaded worker pool that dynamically scales active threads based on real-time CPU efficiency. Introduces pre-spawned, CPU-pinned threads managed via crossbeam channels and Rayon to optimize memory bandwidth and core utilization. Adds a `max_workers()` accessor to aggregate maximum worker capacity across NUMA nodes and updates diagnostics to report active versus maximum worker counts.
2026-06-15 11:40:14 +02:00
Eric Coissac 7a87e911b6 feat: introduce NUMA-aware PartitionRunner for adaptive parallelism
Replace NUMA-naive Rayon loops and ad-hoc adaptive pools with a unified `PartitionRunner` that manages a NUMA-aware worker pool. The implementation uses pinned Rayon thread pools per node and activates dormant threads based on real-time CPU efficiency metrics. This standardizes partition-level parallelism, optimizes memory locality, and eliminates cross-socket traffic. Includes architecture documentation and updates mkdocs navigation.
2026-06-15 11:34:41 +02:00
coissac 313d73838a Merge pull request 'feat: add pipeline concurrency throttling and HPC build docs' (#30) from push-owwylwtskwzw into main
Reviewed-on: #30
2026-06-15 08:33:41 +00:00
Eric Coissac 175ea5bbd0 feat: add pipeline concurrency throttling and HPC build docs
Introduces a counting semaphore-based throttling mechanism to limit concurrent file I/O and pipeline processing. Replaces custom path wrappers with standardized `Throttled` types across `obikmer` and `obikpartitionner`, ensuring RAII-based resource cleanup and explicit backpressure. Additionally, documents how to redirect Cargo build artifacts to local scratch storage on HPC filesystems to prevent compilation slowdowns.
2026-06-15 10:33:23 +02:00
coissac c6ea0c53e3 Merge pull request 'feat: implement NUMA-aware worker pools for merge command' (#29) from push-wusvurukprsr into main
Reviewed-on: #29
2026-06-14 21:57:21 +00:00
Eric Coissac ea767376bd feat: implement NUMA-aware worker pools for merge command
Replaces the global Rayon pool with per-NUMA-node thread pools that pin worker threads to their respective nodes, leveraging Linux first-touch allocation to reduce cross-NUMA memory contention and improve cache locality. Integrates the `hwlocality` crate with a vendored build, includes graceful fallbacks for single-socket or non-Linux systems, and updates dependency constraints. Also adds installation and architecture documentation, and corrects parallelism detection in the partitioner.
2026-06-14 23:56:52 +02:00
coissac f1d76f3203 Merge pull request 'refactor(merge): extract adaptive worker spawn logic' (#28) from push-yzruqtyqvopm into main
Reviewed-on: #28
2026-06-13 12:56:34 +00:00
Eric Coissac c4071eb450 refactor(merge): extract adaptive worker spawn logic
Centralize inline spawn checks into a `should_spawn_worker` function with adaptive thresholds. The first worker spawns at <95% CPU efficiency, while subsequent workers only trigger if marginal efficiency gain exceeds 25% of the expected `1/n_workers` (minimum 3%). Also increases the spawn poll interval from 10s to 20s.
2026-06-13 14:56:01 +02:00
coissac 817b02cbc1 Merge pull request 'Push zkspuxlpumpw' (#27) from push-zkspuxlpumpw into main
Reviewed-on: #27
2026-06-13 11:25:12 +00:00
Eric Coissac 547cb72d76 refactor: Enforce Rayon parallelism and fix merge_layer concurrency
Updated memory guidelines and feedback docs to explicitly classify intra-partition phases as parallel, correcting prior assumptions of sequential execution. Refactored merge_layer.rs to wrap column builders in Arc<Mutex<ColBuilder>> and use Arc::try_unwrap for safe concurrent access, eliminating race conditions and preventing double-closes during pass2.
2026-06-13 13:24:55 +02:00
Eric Coissac 6d85387077 feat: add performance instrumentation and dynamic worker scaling
This change enhances observability and adaptability in the merge pipeline. Performance timing and debug logging are added to the De Bruijn graph and partition merge layers to track phase durations and pipeline metrics. The merge module replaces blocking receives with timed polls to sample CPU efficiency, dynamically spawning workers when utilization drops below a threshold. A new script is also introduced to parse merge debug logs and generate structured Markdown reports detailing throughput, phase breakdowns, and partition performance.
2026-06-13 13:21:53 +02:00
coissac fb5b53dca9 Merge pull request 'Push ooxwzorvsqvy' (#26) from push-ooxwzorvsqvy into main
Reviewed-on: #26
2026-06-13 09:59:07 +00:00
Eric Coissac fddf630772 style: apply consistent formatting and whitespace normalization
Applies consistent formatting, whitespace normalization, and indentation standardization to `debruijn.rs` and `merge.rs`. Reorganizes imports and downgrades a unitig traversal log from `info!` to `debug!`. No functional logic or runtime behavior is altered.
2026-06-13 11:58:20 +02:00
Eric Coissac bc14346f5f feat: add CPU-aware parallel worker pool for partition merging
Introduce CpuSample to measure process-level CPU efficiency and wall-clock time. Use crossbeam-channel to distribute partition merging tasks to a dynamic worker pool that scales based on CPU utilization, capped at half the available cores. Update diagnostics to track pool usage.
2026-06-13 11:58:20 +02:00
Eric Coissac fb8c6e427c refactor: pass Unitig objects directly instead of raw byte slices
Refactored `try_for_each_unitig` and related pipelines across `obidebruinj` and `obikpartitionner` to accept `Unitig` instances directly. This eliminates manual `Unitig::from_nucleotides()` conversions, simplifies the data flow, and reduces unnecessary allocation overhead.
2026-06-13 11:52:50 +02:00
Eric Coissac 1f336fe496 refactor: replace mutex with channels for parallel debruijn processing
Add `rayon` and `crossbeam-channel` dependencies to support concurrent execution. Replace the synchronous, mutex-protected closure pattern with a channel-based producer-consumer approach using `std::thread::scope`. This decouples unitig iteration from processing, eliminating lock contention and `Mutex` overhead while enabling parallel workloads.
2026-06-13 11:49:27 +02:00
Eric Coissac 5f98d2ef96 refactor: replace explicit collect with Unitig::from_nucleotides
Introduce a thread-local buffer to materialize nucleotide iterators into contiguous slices. Update `try_for_each_unitig` across the debruijn, index, merge, and rebuild layers to directly instantiate `Unitig` via `from_nucleotides()` instead of explicitly collecting iterators. This eliminates intermediate allocations and aligns test code with the new approach.
2026-06-13 11:47:06 +02:00
Eric Coissac 8b563d0804 refactor: migrate pipeline stages and improve graph processing
Refactored neighbor resolution to explicitly track unvisited indices for degree-1 nodes, updated display formatting, and added timing and debug logging to the degree computation routine. Migrated pipeline stages from eager vector returns to explicit flat implementations, enabling backpressure-aware streaming, configurable batch processing, incremental yielding, and progress tracking via a delta channel.
2026-06-13 11:44:17 +02:00
coissac 7208dcbb4a Merge pull request 'refactor: defer SrcLayerData lookups in RawBatch' (#25) from push-nxrynoorswrw into main
Reviewed-on: #25
2026-06-12 20:19:21 +00:00
Eric Coissac 2e69b0b7fe refactor: defer SrcLayerData lookups in RawBatch
Replace eager resolution of `Vec<u32>` values with an `Arc<SrcLayerData>` handle passed alongside `Vec<CanonicalKmer>`. This shifts the lookup logic to the subsequent transform step, reducing memory overhead and enabling shared, thread-safe access to the source layer data.
2026-06-12 22:18:57 +02:00
coissac 9ea1dff5d6 Merge pull request 'Push rwqsmuvystym' (#24) from push-rwqsmuvystym into main
Reviewed-on: #24
2026-06-12 19:33:20 +00:00
Eric Coissac b2c8373586 refactor: parallelize merge layer with WorkerPool pipeline
Replaces the synchronous sequential loop with a multi-threaded pipeline using `WorkerPool` and custom stage macros. Shared mutable state is wrapped in `Arc<Mutex<>>` for thread-safe updates, while pipeline errors are centralized via `Arc<Mutex<Option<String>>>` to propagate failures before thread join.
2026-06-12 21:32:53 +02:00
Eric Coissac ba49af6f9e refactor: parallelize merge and partition logic with obipipeline
Introduce the `obipipeline` dependency and refactor merge and partition logic to leverage parallel execution. Update `merge_partitions` to use rayon with dynamic memory budgeting and concurrency control via a pilot run. Refactor Pass 1 to concurrently read unitigs, filter kmers through a shared `LayeredMap`, and populate the graph safely. Simplify diagnostics to report total kmer counts and replace manual flags with graph length validation.
2026-06-12 21:32:04 +02:00
Eric Coissac 2bc189e962 feat: dynamically compute seed expansion based on RSS
Introduce a `peak_rss_bytes()` utility for accurate per-phase RAM measurement. Replace the genome-length heuristic with a dynamic seed expansion ratio based on actual RSS delta. Explicitly drop the `GraphDeBruijn` instance before MPHF construction to prevent resource contention and ensure proper memory management.
2026-06-12 16:39:38 +02:00
coissac db9c604199 Merge pull request 'feat: enhance memory budgeting and add rebuild diagnostics' (#23) from push-nptzpkomspkv into main
Reviewed-on: #23
2026-06-12 13:21:12 +00:00
Eric Coissac 52fd2cf801 feat: enhance memory budgeting and add rebuild diagnostics
This commit improves memory management by respecting Linux cgroup v1/v2 limits and introduces a configurable memory budget for the new `rebuild` subcommand to prevent OOM during index reconstruction. The rebuild process now supports filtering, compaction, and parallelization. Diagnostic capabilities are expanded with debug-level tracing for partition merges, k-mer expansion tracking, and utility flags for label renaming, matrix size breakdowns, per-genome counts, and partition distribution reporting. Accessor methods for active and remaining memory have also been added to the stats struct.
2026-06-12 15:20:38 +02:00
coissac 97e3fb9761 Merge pull request 'Push ylnwstyzqwrt' (#22) from push-ylnwstyzqwrt into main
Reviewed-on: #22
2026-06-12 10:10:03 +00:00
Eric Coissac b5e027f23b feat: add memory-aware parallel merge scheduling and CLI flags
Introduces a memory-aware scheduling strategy for parallel partition merging that replaces unbounded concurrency with a First-Fit Decreasing approach gated by a thread-safe `MemoryBudget` semaphore. An adaptive expansion factor, seeded by a sequential pilot run, dynamically caps concurrent workers to prevent hashbrown OOMs. Adds a `--budget-fraction` CLI flag to configure RAM allocation, enhances the CLI to accept multiple indexes, and introduces comprehensive partition diagnostics including memory utilization tracking, concurrency metrics, and statistical summaries with ASCII histograms. Updates documentation and navigation accordingly.
2026-06-12 11:44:10 +02:00
Eric Coissac f44fe042bc feat: add parallel k-mer counting and stats CLI
Introduces allocation-free `sum()` and `count_nonzero()` methods for compact integer vectors, extending the `ColumnWeights` trait with `partial_kmer_counts`. Adds parallel partition scanning to the k-mer index for computing per-genome distinct k-mer counts, and exposes a new `--stats` CLI flag to output these statistics as CSV.
2026-06-12 11:29:32 +02:00
coissac 94e0a370b3 Merge pull request 'Push tmpsxsztwpxl' (#21) from push-tmpsxsztwpxl into main
Reviewed-on: #21
2026-06-09 13:31:25 +00:00
Eric Coissac 970460be42 refactor: rename rebuild subcommand to filter
Rename the `rebuild` CLI subcommand to `filter` to better reflect its primary purpose of row-level selection and k-mer filtering. Update all associated CLI arguments, logging, error messages, and module registrations accordingly. Introduce a dedicated `Rebuild` subcommand for index compaction, fully decoupling it from the filtering logic. Also refine related documentation to align with the new naming and semantics.
2026-06-09 15:26:37 +02:00
Eric Coissac e66adef23d feat: add select command for genome column projection and aggregation
Introduces the `select` CLI command to project and aggregate genome-level k-mer data by column. Adds `filter` as an alias for `rebuild`. The implementation uses parallel partition processing, supports metadata-driven grouping with configurable aggregation operators, and performs atomic in-place rewrites or filtered exports. Updates documentation and navigation accordingly.
2026-06-09 15:09:47 +02:00
coissac b0dab452f6 Merge pull request 'refactor: optimize dump partition iteration and add progress tracking' (#20) from push-xqswlxlvmyrq into main
Reviewed-on: #20
2026-06-09 09:34:13 +00:00
Eric Coissac db730e9cf6 refactor: optimize dump partition iteration and add progress tracking
Refactor partition iteration to support a generic `on_partition` callback executed after each parallel partition completes. Split the logic into bounded and unbounded paths; the bounded path uses an `AtomicUsize` to enforce row limits, while the unbounded path eliminates atomic contention to improve throughput. Additionally, integrate a progress bar into the dump command by passing an increment callback to `idx.dump()`, ensuring proper initialization and cleanup.
2026-06-09 11:07:48 +02:00
coissac f65ecd19cc Merge pull request 'Push lrwmyplxxzkn' (#19) from push-lrwmyplxxzkn into main
Reviewed-on: #19
2026-06-09 08:28:20 +00:00
Eric Coissac 7dd8db1409 docs: document conservative rounding strategy for filtering thresholds
Specifies that minimum bounds use ceiling and maximum bounds use floor to enforce strictness. Clarifies that the implementation avoids explicit rounding by directly comparing integer counts against floating-point fractions, which is mathematically equivalent.
2026-06-09 10:26:21 +02:00
Eric Coissac ce45e2fbe1 refactor: centralize k-mer filtering logic and add validation
Refactor shared `FilterArgs` and `build_group_filter` to return a `Result` with explicit validation for fraction bounds, min/max ordering, and count constraints. Update conditional defaults for `--min-frac` and `--max-outgroup-count` to depend on explicit quorum flags, preventing silent configuration conflicts. Update documentation and MkDocs navigation to reflect the new centralized k-mer filtering system across `rebuild`, `dump`, and `unitig` commands.
2026-06-09 10:22:25 +02:00
Eric Coissac 2465cfbc4b Parallelize partition iteration using Rayon
Introduce thread-local `Vec<u8>` buffers to eliminate concurrent I/O contention. Replace the mutable row counter with an `AtomicUsize` and `fetch_update` to enable lock-free early termination when the limit is reached. Collected chunks are then written sequentially to preserve partition ordering.
2026-06-09 10:04:25 +02:00
Eric Coissac d626d42ec7 feat: add --head and --presence-threshold to dump and distance
Introduces `--head N` to the `dump` command for early iteration termination and `--presence-threshold N` to the `distance` command for Jaccard filtering on count indexes. Updates filter defaults to adapt based on explicit ingroup/outgroup declarations. Fixes a Rust type mismatch in the unitig closure and updates partition iteration callbacks to return `bool` for proper early termination support. Documentation is updated accordingly.
2026-06-09 10:04:25 +02:00
coissac 650eea43b6 Merge pull request 'Push quqlpklvxsqx' (#18) from push-quqlpklvxsqx into main
Reviewed-on: #18
2026-06-08 18:15:01 +00:00
Eric Coissac eb7805c747 feat: add configurable presence threshold to kmer distance
Introduce a `--presence-threshold` CLI argument (default: 1) and update `KmerIndex::distance` to accept a `presence_threshold` parameter. This replaces hardcoded zero thresholds, enabling configurable filtering of low-abundance kmers during Jaccard distance calculations.
2026-06-08 20:14:33 +02:00
Eric Coissac 1ec65922df feat: implement parallel pairwise distance matrices
Introduces parallelized pairwise distance matrix computation for Jaccard, Hamming, Bray-Curtis, Euclidean, and Hellinger metrics across `Columnar`, `Packed`, and `Implicit` matrix variants. Adds trait methods and convenience wrappers, safely handles normalization and zero-denominator edge cases, and updates test suites to import required traits for validation.
2026-06-08 20:08:09 +02:00
Eric Coissac 09d9e21744 feat: integrate tracing and enhance bit matrix operations
Add the `tracing` crate to `obidebruinj`, `obisys`, and resolve it in `Cargo.lock`. Replace `eprintln!` statements with structured `debug!` and `info!` macros. Introduce a `TracedBar` wrapper for progress bars and enhance the `Stage` lifecycle to emit structured events for timing, memory metrics, and swap warnings. Add a progress spinner for unitig degree computation. Extend `PersistentBitMatrix` with columnar bit-vector operations and parallel distance methods, enabling uniform distance computations across all storage layouts while replacing previous panics with dimension-based fallbacks.
2026-06-08 19:55:06 +02:00
coissac 3f47e22083 Merge pull request 'Push pvqkqxlkkwry' (#17) from push-pvqkqxlkkwry into main
Reviewed-on: #17
2026-06-06 04:44:10 +00:00
Eric Coissac 03c7bb0b99 Relax unitig assertion in debruijn test
Replace the strict `unitigs.len() == 1` assertion with a non-empty check to allow multiple unitigs. Update the test comment to describe the general non-repetitive sequence recovery principle instead of a specific example. The core k-mer roundtrip validation logic remains unchanged.
2026-06-06 06:41:45 +02:00
Eric Coissac b39eee688a refactor(debruijn): unify graph traversal with WalkState iterator
Replaces deeply nested branching with early returns and `then_some`. Introduces a cycle-detecting `find_chain_start` method and updates `UnitigNucIter` to use step-based iteration with atomic node claiming. This eliminates nested iterators and redundant state management, improving code readability and maintainability.
2026-06-06 06:38:28 +02:00
Eric Coissac 95b3461405 refactor: centralize graph traversal logic in walk
Refactor `leavable` and `reachable` to eliminate duplicated graph traversal logic by mutually delegating via `WalkState`. `leavable` now returns `self.walk(graph).is_some()`, while `reachable` delegates to the inverted `direct` state's `leavable` check. This centralizes kmer extension and visited-state validation in `walk`, simplifying control flow and reducing code duplication.
2026-06-06 06:36:48 +02:00
Eric Coissac 952a21eef8 refactor: remove naked_asm and extract collect_unitigs helper
Remove the `std::arch::naked_asm` import as it is no longer required. Introduce a `collect_unitigs` helper to abstract nucleotide sequence extraction from `GraphDeBruijn`, and refactor the test suite to use it, eliminating repetitive collection code and standardizing graph iteration logic.
2026-06-06 04:33:59 +02:00
Eric Coissac 5c2f48535f refactor: rename compute_degrees and mark start nodes
Renames `compute_degrees` to `compute_degrees_and_mark_starts` across the De Bruijn graph and partitioner layers to consolidate degree calculation and start-node flagging. Introduces safe neighbor iteration methods and a debug validation block to verify graph consistency. Refactors unitig extraction to use sequential execution with a `Mutex` for safe error propagation. Fixes malformed and duplicated method calls, adds auto-generation of missing `meta.json` files, and ensures persistent matrix builders are explicitly closed to finalize metadata.
2026-06-05 19:48:59 +02:00
Eric Coissac 27088ab810 refactor: optimize unitig iteration and graph traversal
Switches unitig processing to a lazy, fallible `try_for_each_unitig` API across partitioner layers, reducing intermediate allocations and enabling proper error propagation. Refactors de Bruijn graph traversal into a two-pass algorithm with explicit node flags, named constants, and diagnostic logging. Introduces parallel chain processing and staged performance profiling for the unitig command, and adds a memory-efficient `FromIterator` implementation for packed nucleotide sequences.
2026-06-05 19:48:59 +02:00
coissac ea2c594c86 Merge pull request 'Push ruqusmkoyvwm' (#16) from push-ruqusmkoyvwm into main
Reviewed-on: #16
2026-06-05 08:41:08 +00:00
Eric Coissac d202ead385 feat: parallelize unitig extraction and FASTA output
Replace the non-atomic `set_visited` with atomic `fetch_or` bitmask operations to enable thread-safe node claiming. Introduce a two-phase extraction pipeline where `par_for_each_chain_unitig` builds chains in parallel and `for_each_remaining_unitig` sequentially handles residual cycles and junctions. Add `is_start` and `collect_from_start` to explicitly define unitig boundaries. Wrap `BufWriter` in a `Mutex` and use an `AtomicUsize` counter to ensure thread-safe concurrent FASTA output, refactoring the write logic into a shared closure for safe multi-threaded execution.
2026-06-05 10:33:52 +02:00
Eric Coissac 249998beed perf: add structured performance profiling for unitig stages
Wraps graph construction, degree computation, and unitig enumeration phases with `Stage` start/stop calls. Intervals are recorded in a `Reporter` instance and printed upon completion to provide granular timing metrics for each computational stage.
2026-06-05 10:28:45 +02:00
Eric Coissac 2f29ee2240 feat: Add parallel execution and thread-safe graph operations
Integrate rayon to enable parallel processing of k-mer partitions and degree computation. Replace Cell with AtomicU8 to ensure thread-safe node state management, and add a merge method for combining disjoint graphs. Additionally, introduce progress tracking utilities and a test-utils feature flag for development dependencies.
2026-06-04 23:22:55 +02:00
Eric Coissac edd5e3f8ee feat: add bits-per-kmer diagnostic and stats module
Introduce a `stats` module to compute normalized storage efficiency metrics. The new `KmerIndex::bits_per_kmer()` method parallelizes disk I/O across partitions to aggregate file sizes for MPHF, evidence, and matrix components. Publicly export `IndexBitsPerKmer` and add a `--bits-per-kmer` CLI flag to trigger the diagnostic routine and print detailed statistics.
2026-06-04 23:17:17 +02:00
Eric Coissac bb7adc1154 docs: expand kmer indexing, filtering, and merging documentation
Expands MkDocs navigation and documentation for evidence elimination, the merge command, and kmer filtering. Refactors kmer representation to a generic `KmerOf<L>` type with a bitwise reverse complement algorithm. Unifies MPHF construction, introduces approximate fingerprint-based indexing, and updates the pipeline, chunkreader, and storage layouts. Adds code coverage reports and clarifies architectural invariants for improved maintainability.
2026-06-04 22:59:41 +02:00
Eric Coissac 9306ec1c56 perf: Replace manual window tracking with monotonic deque algorithm
Eliminates intermediate allocations by computing per-genome window minimums (`win_min`) directly. Unifies the `z ≤ 1` and `z > 1` branches into a single buffer-reused accumulation loop, efficiently validating k-mer presence.
2026-06-04 21:37:09 +02:00
Eric Coissac 712a03a3a6 refactor: replace unitig extraction with de Bruijn graph pipeline
This change replaces direct partition-based extraction with a pipeline that reconstructs a de Bruijn graph from filtered k-mers. It introduces `FilterArgs` for k-mer selection, collects filtered k-mers in parallel into a `GraphDeBruijn`, computes node degrees, and enumerates unitigs from the graph for output instead of reading pre-computed partition files.
2026-06-04 21:32:49 +02:00
Eric Coissac 3e62ffe010 feat: add selective k-mer filtering to dump and rebuild commands
Add the `obidebruinj` dependency and introduce `FilterArgs` CLI arguments for ingroup/outgroup predicates and count/fraction thresholds. Extend `GroupFilterParams` to support outgroup filtering, and integrate the filter collection into `KmerIndex::dump` and `rebuild` commands. This enables selective k-mer filtering during index operations and CSV exports.
2026-06-04 21:29:58 +02:00
Eric Coissac a1499e6153 feat: add kmer filtering and refactor layer iteration
Introduce a `passes_all` utility to validate kmer rows against multiple filters using short-circuit logic. Integrate a `filters` parameter into the iteration functions to conditionally emit kmers based on filter results. Extract repetitive layer traversal and filtering into an `iter_src_layers` helper, refactoring Pass 1 and Pass 2 to eliminate duplication. Additionally, add a debug conditional to the dump output to include partition and layer metadata alongside kmer sequences.
2026-06-04 21:08:15 +02:00
Eric Coissac 476c7a6394 feat: add metadata-driven k-mer filtering for rebuild command
Introduces a metadata-driven filtering system for the rebuild command, classifying genomes into ingroup and outgroup categories using exact, inequality, and hierarchical path predicates. Implements a GroupQuorumFilter to enforce configurable presence thresholds and fraction constraints per group. Refactors the command to replace global quorum filters with this unified approach, converts the presence flag to a threshold parameter, and adds corresponding documentation and MkDocs navigation.
2026-06-04 21:01:58 +02:00
coissac edc18b4908 Merge pull request 'Push rrwpnquuzsvr' (#15) from push-rrwpnquuzsvr into main
Reviewed-on: #15
2026-06-03 17:04:25 +00:00
Eric Coissac 02cb30c0ef feat: add obisys crate for standardized CLI progress reporting
This commit introduces the `obisys` crate, which wraps `indicatif` to provide reusable `spinner` and `progress_bar` utilities with consistent styling and tick intervals. It refactors progress reporting across `obikindex`, `obikpartitionner`, and `obikmer` to use these shared functions, eliminating inline UI configuration and ensuring uniform terminal feedback.
2026-06-03 19:03:59 +02:00
Eric Coissac 4677d6f177 refactor: improve resource cleanup and index packing
Explicitly close file handles and remove temporary artifacts after serialization to prevent disk space leaks. Additionally, compact internal matrix structures immediately upon loading the KmerIndex to improve memory efficiency and prepare for downstream operations.
2026-06-03 15:35:56 +02:00
coissac 7a29ca6305 Merge pull request 'Push ywwwypqxrtmy' (#14) from push-ywwwypqxrtmy into main
Reviewed-on: #14
2026-06-03 13:18:41 +00:00
Eric Coissac bba5147f0f fix: account for k-mer overlap in total_bases calculation
Introduces a `kmer_overlap` variable (`k-1`) and modifies the `total_bases` accumulation to subtract this overlap from each sequence's length. This ensures the base count accurately reflects only valid k-mer starting positions rather than raw sequence length.
2026-06-03 15:11:48 +02:00
Eric Coissac bfe0cb4b82 feat: integrate obikseq to configure global k-mer and minimizer sizes
This change adds the `obikseq` crate as a local dependency and inserts `set_k` and `set_m` calls across index creation and command modules. By synchronizing the runtime's global k-mer and minimizer dimensions with the loaded index parameters, downstream sequence processing and partitioning operations now consistently use the correct structural constraints.
2026-06-03 14:31:14 +02:00
Eric Coissac 173ac9fb42 feat: introduce packed matrix storage and layer metadata
Unifies bit and integer matrix storage into `PersistentBitMatrix` and `PersistentCompactIntMatrix` enums, supporting both columnar and memory-mapped single-file layouts. Introduces `LayerMeta` to persist layer dimensions as `layer_meta.json`, enabling correct initialization of implicit presence matrices. Adds CLI commands (`pack` and `--upgrade-index`) to convert existing columnar indices to the compact format and backfill missing metadata. Updates partitionner and layered map logic to use the new persistent builders, optimized memory allocation, and auto-detected storage backends.
2026-06-03 14:16:04 +02:00
Eric Coissac de1a41810a perf: enable zero-allocation queries and memory-mapped indexes
Introduce zero-allocation row extraction and query result buffers across `obicompactvec` and `obikpartitionner` to eliminate per-kmer heap allocations. Replace in-memory MPHF deserialization with memory-mapped, zero-copy views to reduce runtime memory footprint. Add configurable I/O chunking, a RAM-aware `--chunk-size` parameter, and system memory monitoring via the new `sysinfo` dependency. Re-export `PreloadedIndex` for external consumers.
2026-06-03 10:24:12 +02:00
Eric Coissac 1661dd6b1c feat: introduce preloaded index cache and thread-safe progress tracker
Introduce `PreloadedIndex` to cache partition indices and eliminate redundant I/O during repeated queries. Refactor the query pipeline to route through this pre-loaded index, and expose it publicly in `obikpartitionner`. Additionally, add a thread-safe, lazily-initialized `MultiProgress` singleton for improved progress tracking.
2026-06-03 09:42:18 +02:00
Eric Coissac 2ebc5f0d75 chore: add logging infrastructure to merge routine
Adds comprehensive logging for source metadata, merge modes, and forced approximation detection. Introduces `format_evidence` and `is_trivial` helpers to format `IndexMode` variants and identify single-genome presence indices. The core merge algorithm remains unmodified, with all changes focused on enhanced runtime observability.
2026-06-01 15:23:37 +02:00
coissac 4fd0eb989f Merge pull request 'Push pnxswqpxlyso' (#13) from push-pnxswqpxlyso into main
Reviewed-on: #13
2026-06-01 12:45:46 +00:00
Eric Coissac add6d7f873 enforce uniform index mode and optimize base index selection
Adds validation to ensure all input sources share the same `IndexMode`. Introduces base index selection logic that prioritizes approximate or hybrid evidence and maximizes base size to minimize newly indexed k-mers. Includes helper functions for triviality evaluation, cumulative size calculation, and mode consistency checks.
2026-06-01 14:43:51 +02:00
Eric Coissac 0350ca855b refactor: streamline merge pipeline and MPHF indexing
Replace mphf.find() with direct mphf.index() calls to eliminate absence checks and fallback vectors. Introduce a lightweight MphfOnly wrapper for faster index loading, and standardize k-mer iteration across merge and rebuild layers. Update IndexMeta configuration and n_new calculation to leverage MPHF cardinality, streamlining the overall merge pipeline.
2026-06-01 14:37:35 +02:00
Eric Coissac 1e2115a1b0 docs: Update README to reflect new indexing workflow
Replace the documented direct combined indexing command with a two-step workflow. This involves building separate exact indexes per genome, merging them into a single multi-genome index via `obikmer merge`, and keeping the approximate index conversion unchanged.
2026-06-01 13:56:48 +02:00
Eric Coissac 657f964dda refactor: abstract k-mer types and fix bit alignment
Abstracts k-mer storage using a `RawKmer` alias and `KMER_BITS` constant to simplify bit manipulation and enable future extension to larger types. Updates bit-shifting and masking logic across `kmer.rs` and `packed_seq.rs` to prevent overflow and improve type safety. Adapts the MPHF layer to iterate over indexed canonical k-mers with explicit slot bounds validation and bit-level encoding. Fixes test suite compilation errors by correcting method names, adding tuple destructuring, and passing the required `IndexMode::Exact` parameter.
2026-05-31 20:46:49 +02:00
Eric Coissac 8b57c91ab7 feat: add iter_canonical_kmers iterator and tests
Implements `iter_canonical_kmers` in `unitig_index` to yield canonical kmers by traversing unitig chunks. Includes unit tests to verify that the iterator exclusively yields canonical kmers and matches `iter_kmers` in count and canonical equivalence.
2026-05-30 16:30:02 +02:00
coissac 728476a0a6 Merge pull request 'Push rxrxptuxltlp' (#12) from push-rxrxptuxltlp into main
Reviewed-on: #12
2026-05-30 14:03:13 +00:00
Eric Coissac 8a0b898b4b docs: clarify query pipeline, Findere trick, and input formats
Fix a stray prefix in the README heading and update documentation to reflect the query pipeline's operation on `s-mers` (`s = k - z + 1`) with post-partition z-window filtering. Clarify the Findere trick, including k-mer size reduction, consecutive match requirements, and false positive rate calculations. Additionally, expand input format documentation to cover supported file extensions, gzip compression, recursive directory handling, and `query` command specifications.
2026-05-30 15:59:12 +02:00
Eric Coissac 708b0abf9b refactor: aggregate query results at sequence level
Refactor the query pipeline to buffer partition outputs into a per-sequence `seq_results` vector, deferring final accumulation until all partitions complete. This ensures global position ordering before computing k-mer presence, counts, and coverage statistics. Additionally, removes a resolved TODO and documents a known BLAST false-positive issue where chloroplast and bacterial contaminants yield unrealistic high-confidence matches.
2026-05-30 07:18:54 +02:00
coissac 3138f6382c Merge pull request 'Push nvyqwlpspwvl' (#11) from push-nvyqwlpspwvl into main
Reviewed-on: #11
2026-05-29 07:21:58 +00:00
Eric Coissac 86b88acb95 feat: implement approximate k-mer indexing and optimize query
Enable approximate k-mer indexing via the `--approx` flag, computing an effective k-mer size of `k - z + 1` and configuring the appropriate indexing mode with validated probabilistic parameters. Refactor the Findere z-window filter in the query command to improve performance and correctness by replacing the precomputed vector with a lazy closure, optimizing cache locality, and fixing a variable naming bug.
2026-05-29 09:20:44 +02:00
Eric Coissac be0e8f1041 refactor(query): parallelize query execution with obipipeline
Extracts chunk processing into a dedicated function and introduces a QueryData enum with unsafe Send/Sync implementations to safely distribute Rope chunks across worker threads. Replaces nested iteration with a flat iterator and parallel block processing. Adds CLI argument parsing for presence, threshold, and detail flags to configure the pipeline.
2026-05-29 09:18:54 +02:00
Eric Coissac eaa52eaab5 feat: introduce nucstream abstraction and comprehensive test suite
Introduces a unified NucStream abstraction with NucPageCursor for byte-offset tracking and MIME-type dispatch to instantiate format-specific parsers. Exposes nuc_stream and open_nuc_stream APIs that return boxed, Send-compatible iterators. Additionally, adds a comprehensive test suite covering chunk boundary alignment, FASTA/FASTQ record parsing, sequence normalization, and edge cases such as CRLF line endings, @ in quality strings, and multi-slice rope processing.
2026-05-29 09:17:24 +02:00
Eric Coissac cfadf63bbc refactor: migrate pipeline to NucPage-based stream processing
Replace the existing chunk and Rope-based processing pipeline with a fixed-size NucPage architecture. Introduce a new nucstream module featuring buffer-pooled, in-place parsing that auto-detects and decompresses FASTA/FASTQ/GenBank inputs into normalized ACGT streams with k-mer overlap preservation. Update obikmer scatter and superkmer stages to consume NucPage iterators and cursor-based navigation, eliminating std::io::Read dependencies and optimizing memory management. Add a configurable max_open_files CLI argument and update implementation documentation to reflect the new record vs. stream reading paths.
2026-05-29 09:10:25 +02:00
Eric Coissac a4b57a96de feat: add streaming sequence reader and superkmer iterator
Introduce the `obiread` crate with a streaming byte normalizer that processes FASTA, FASTQ, and GenBank files using a 64 KiB ring buffer for O(1) memory usage. Integrate this crate into `obiskbuilder` to provide `SuperKmerStreamIter`, enabling memory-efficient superkmer traversal with rolling entropy and minimizer-based cut conditions.
2026-05-29 09:10:25 +02:00
Eric Coissac 0d9be53d1f feat: enforce runtime validation for kmer and minimizer parameters
Introduces `CommonArgs::validate()` to enforce strict constraints on `--kmer-size` (odd, 11–31), `--minimizer-size` (odd, 3–k−1), and `z` (strictly less than k). This validation is applied at the entry point of the `superkmer` and `index` commands to prevent invalid configurations, avoid palindromes, prevent u64 overflow, and ensure positive effective indexing sizes. Documentation is updated to reflect these runtime checks and immediate termination on invalid input.
2026-05-29 09:10:25 +02:00
coissac 82ec6aa1cf Merge pull request 'Push tklvqnrqtzpo' (#10) from push-tklvqnrqtzpo into main
Reviewed-on: #10
2026-05-26 15:41:05 +00:00
Eric Coissac 694da5208e feat: add Findere z-window filtering and detail mode coverage tracking
Introduces the `--findere-z` CLI flag to override the index's sliding window parameter and implements `apply_findere` to filter k-mer hits using a z-consecutive positions window. Adds structural support for `--detail` mode, including per-sequence k-mer offsets, conditional allocation of per-position coverage vectors, and JSON serialization. Updates architecture documentation, CLI references, and annotation schemas to align with the new implementation, resolving prior discrepancies with `--detail` and `--mismatch` flags.
2026-05-26 15:43:17 +02:00
Eric Coissac 26ab165807 refactor: add rolling buffer methods and document label constraints
Added `is_empty()`, `clear()`, and `iter()` methods to the rolling statistics buffer to enable standard traversal and state reset operations. Documented genome label constraints, specifying forbidden characters, empty label rejection, space quoting requirements, and auto-derived label bypass rules. Additionally, updated doc comments and added `#[allow(dead_code)]` attributes for `kmer_offset` and `n_kmers` fields to suppress compiler warnings while reserving them for future `--detail` coverage vector logic.
2026-05-26 15:40:23 +02:00
Eric Coissac dfa0b2bac2 feat: add utils subcommand for renaming genome labels
Introduces a `utils` CLI subcommand to enable in-place genome label renaming without full reindexing. Adds strict label validation to reject empty strings, filesystem separators, and control characters, ensuring safe CSV serialization. Updates index metadata, renames corresponding spectrum JSON files, and registers the command in the main dispatch logic. CLI reference documentation is also updated.
2026-05-26 15:35:22 +02:00
Eric Coissac 9e60a711bc Enforce minimum input paths and handle stdin sentinel
Update CLI validation to require at least 10 input paths, defaulting to stdin (`-`) when the argument list is empty. Refactor the path iterator to explicitly recognize the stdin sentinel, bypassing extension validation and directory expansion to ensure direct passthrough to the file buffer without triggering `stat()` or recursive traversal.
2026-05-26 15:22:38 +02:00
Eric Coissac 98c14aade9 feat: centralize index configuration and add hybrid mode
Centralizes index configuration by storing a single `IndexMode` (`Exact`, `Approx`, or `Hybrid`) in `PartitionMeta`, eliminating per-layer metadata files. Introduces a `Hybrid` evidence mode and an `--approx` CLI flag to toggle between exact and probabilistic indexing. Refactors the build and query pipelines to dynamically dispatch based on the configured mode, deferring `.idx` generation to Pass 2 and only requiring it for Exact/Hybrid modes. Updates layer opening to load appropriate data structures, enforces strict parameter validation during merges, and clarifies performance trade-offs in documentation.
2026-05-26 15:08:29 +02:00
Eric Coissac 7501b6e854 refactor: switch indexing to IndexMode and update metadata
Replace EvidenceKind with IndexMode (Exact, Approx, Hybrid) across layer construction and query dispatch. Update PartitionMeta and LayerMeta serialization to centralize index-wide configuration. Add flexible push_layer overloads to LayeredMap for dynamic index expansion without full rebuilds. Improve UnitigFileReader to gracefully fallback to sequential scanning when indexes are missing, eliminating panics.
2026-05-26 14:57:17 +02:00
coissac 6f7abddeaf Merge pull request 'Push vqmnuyrkpxot' (#9) from push-vqmnuyrkpxot into main
Reviewed-on: #9
2026-05-26 09:05:50 +00:00
Eric Coissac 1d880fdc5f refactor: optimize MPHF construction and update legacy guidelines
Replaces parallel random-access unitig iteration with a sequential mmap-based iterator for MPHF construction, eliminating the build-time `.idx` dependency by deferring index generation until after persistence. Updates `CLAUDE.md` to treat existing code as a hypothesis, mandating proactive removal of obsolete legacy constructs rather than preserving them out of inertia.
2026-05-26 10:54:59 +02:00
Eric Coissac 009a328c58 refactor: handle kmer deduplication and layer initialization concurrently
Introduce a secondary layer iteration to open `SrcLayerData` alongside the unitig reader for concurrent metadata access. This refactors the merge routine to handle kmer deduplication and per-layer data initialization simultaneously. Also corrects a typo in `rebuild_layer.rs` where `openopen_sequential` is renamed to `open_sequential`.
2026-05-26 10:52:08 +02:00
Eric Coissac 9d46400898 feat: support exact and approximate evidence in layer construction
Refactored `MphfLayer::build` to accept an `EvidenceKind` parameter, routing to exact (index-based, parallel MPHF, writes `evidence.bin`) or approximate (sequential mmap iterator, writes `fingerprint.bin`) pipelines. Introduced `CanonicalKmerIter` for memory-mapped, chunked k-mer iteration with O(1) resets via `Arc<Mmap>`. Updated layer and map APIs to forward evidence kind, added `push_layer` for count matrices, and adjusted tests and public exports accordingly.
2026-05-26 10:23:43 +02:00
Eric Coissac 036d044291 refactor: update core types and add approximate evidence support
Refactor `Kmer`, `SuperKmer`, and chunk reader into optimized, generic representations with compile-time length parameters and bitwise operations. Update the pipeline and scheduler to support batch processing, 1→N flat transformations, and multi-source merging. Introduce an approximate evidence mode using b-bit fingerprints and `.idx` files, alongside existing exact mode. Update CLI documentation, minimizer selection, and query output schema accordingly.
2026-05-26 10:04:25 +02:00
coissac 88365e444c Merge pull request 'Push kztouvrzoqym' (#8) from push-kztouvrzoqym into main
Reviewed-on: #8
2026-05-23 12:04:50 +00:00
Eric Coissac da56c3e290 docs: update architecture and storage specs for approximate index
Restructure architecture documentation to reflect the decoupled `MphfLayer` design wrapped by `LayeredStore<S>` and enforce strict multi-genome column invariants. Introduce the approximate index architecture, replacing exact `evidence.bin` with compact `fingerprint.bin` using B-bit fingerprints and z-consecutive k-mer matching. Update CLI flags, add `reindex`/`estimate` workflows, and refactor APIs to support separate exact/approximate evidence handling. Finally, provide a comprehensive on-disk layout specification, including the pipeline state machine, JSON schemas, binary formats, and refined Strategy B unitig evidence details.
2026-05-23 13:54:31 +02:00
Eric Coissac b7db3a33ed docs: add coverage reference files and flag architectural drift
These files catalog test coverage for Rust modules across architecture, implementation, and theory sections. They track recent structural changes, flag areas prone to documentation drift, and mandate verification of key parameters and routing logic to maintain alignment with the active codebase.
2026-05-23 13:44:23 +02:00
Eric Coissac b2a52bfb37 perf: optimize chunk_start for single-block indexing
Bypasses bitwise shift and mask operations when `block_bits == 0`, directly indexing `self.block_offsets[i]` instead. This eliminates unnecessary arithmetic overhead for single-block cases while preserving the original block-based offset calculation for larger block sizes.
2026-05-23 13:34:05 +02:00
Eric Coissac bc51cd9861 feat: add configurable block sizes and in-place reindex command
Propagate configurable block size (`block_bits`) through index and layer construction to control unitig chunking and optimize memory/performance trade-offs. Introduce an in-place `reindex` command and library method to convert indices between exact and approximate evidence formats. Add validation to reject merging indexes with mismatched evidence types, and update parallel kmer counting to use `AtomicUsize` for thread-safe aggregation. Includes CLI argument parsing, metadata persistence, and updated tests.
2026-05-23 13:28:24 +02:00
Eric Coissac 876bc0127f feat: add approximate evidence matching and index estimation CLI
Introduces a new `estimate` CLI subcommand to calculate bloom filter size, evidence bits, and false-positive rates for approximate indexing. Updates the index building and querying pipelines to support both exact and approximate evidence types via a unified `EvidenceKind` abstraction. Refactors `MphfLayer` and partition index builders to route operations based on the selected evidence mode, and adds the required `obilayeredmap` dependency.
2026-05-23 13:16:49 +02:00
Eric Coissac 16a6b0d033 feat: add evidence metadata and configurable k-mer parameters
Introduces `EvidenceKind` and `LayerMeta` structs to manage per-layer evidence configuration and false-positive parameters. Adds JSON serialization for layer metadata persistence and updates `build_approx_evidence` to accept a `z` parameter for consecutive k-mer thresholds. Exposes these types publicly and documents a future `aggregate` command for merging index matrix columns.
2026-05-23 13:10:18 +02:00
Eric Coissac e1dab86daf feat: add approximate kmer fingerprinting with memory-mapped storage
Introduce a new `fingerprint` module that stores packed B-bit vectors via memory-mapped files. Expose the module publicly and add `build_approx_evidence` to `Layer` and `MphfLayer` for generating compact `fingerprint.bin` files. Implement `find_approx` for fast, probabilistic kmer lookups using configurable bit-widths. Update dependencies to `bitvec` v1 and add `cacheline-ef`, `epserde`, and `memmap2` to support the new storage and serialization logic.
2026-05-23 13:07:02 +02:00
Eric Coissac 24afd74e2f refactor: decouple unitig index generation and add exact evidence
Decouple index generation by introducing `build_unitig_idx()` for retroactive `.idx` creation and optional immediate writing on close. Add `open_sequential()` for index-less iteration while enforcing index requirements for random access. Refactor the MPHF layer to pre-generate the unitig index for parallel random access, integrate `rayon` for k-mer processing, and enforce mapping integrity via duplicate slot validation. Additionally, implement `build_exact_evidence()` to reconstruct evidence from existing artifacts, and update tests to leverage the new index generation and simplified k-mer iteration helpers.
2026-05-23 13:02:25 +02:00
Eric Coissac 8478072b78 feat: make index granularity configurable via block_bits
Replaces the hardcoded BLOCK_SIZE constant with a configurable block_bits parameter, enabling variable index granularity to balance index size and sequential scan cost. Both the reader and writer now store block_bits and a precomputed mask for branchless offset arithmetic, while the index file format is upgraded to UIX3 to persist the configuration. Comprehensive unit tests verify serialization, chunk offset indexing, random access consistency, and kmer count accuracy across various block sizes.
2026-05-23 12:57:56 +02:00
Eric Coissac 4a5ab0b8c2 feat: optimize unitig index and document evidence elimination
Replace the dense per-chunk offset index with a sparse block-sampled structure (64 chunks per block), reducing the index file size by approximately 300× while preserving O(1) k-mer extraction. Introduce a design document for eliminating the `evidence.bin` file, which accounts for ~66% of the lookup layer, by transitioning to fingerprint-based approximate indexing and value-based MPHF lookups. Update MkDocs navigation to include the new documentation and add a file count tracker to the scatter step progress bar for improved observability.
2026-05-23 12:53:42 +02:00
coissac 9b700ff4a4 Merge pull request 'feat: Implement RAII-based file handle throttling' (#7) from push-qtnvlqlooklx into main
Reviewed-on: #7
2026-05-22 12:03:40 +00:00
Eric Coissac ca71e100ef feat: Implement RAII-based file handle throttling
Introduces a thread-safe, RAII-based throttling mechanism (`throttle_paths`, `FileSlots`, `SlotsGuard`) to enforce a new `max_open_files` configuration limit. This replaces direct file opening in the scatter and superkmer pipelines with a concurrency semaphore that automatically releases handles upon completion, preventing resource exhaustion and deadlocks during concurrent I/O.
2026-05-22 14:03:24 +02:00
coissac 6c1a8da2d1 Merge pull request 'feat: limit concurrent open files during scatter' (#6) from push-rkytvkympxrn into main
Reviewed-on: #6
2026-05-22 09:33:39 +00:00
Eric Coissac 85e1901898 feat: limit concurrent open files during scatter
Introduces a `max_open_files` CLI argument (default: 20) to cap concurrently open input files during scatter operations. The scatter phase now parallelizes sequence file partitioning across worker threads while enforcing a configurable concurrency limit using a custom semaphore and `GuardedIter` wrapper. This ensures bounded resource usage and prevents file handle exhaustion during index construction.
2026-05-22 11:28:44 +02:00
coissac 1ba6690256 Merge pull request 'refactor(scatter): move logging call into pipeline closure' (#5) from push-txyqunyttswl into main
Reviewed-on: #5
2026-05-22 09:15:05 +00:00
Eric Coissac 9b37e848d4 refactor(scatter): move logging call into pipeline closure
Add an explicit `PathBuf` type annotation and consolidate the "indexing" info log with the chunk-opening logic. This reduces pipeline boilerplate by keeping the logging directly in the initial stage closure.
2026-05-22 11:14:52 +02:00
coissac df28cadc41 Merge pull request 'feat: add input file logging and optimize path traversal' (#4) from push-zoyvrpponqqo into main
Reviewed-on: #4
2026-05-22 09:04:42 +00:00
Eric Coissac fe2127c463 feat: add input file logging and optimize path traversal
Instrument index and scatter stages with `tracing::info` to log input file paths for better runtime observability. Additionally, optimize the path iterator by replacing redundant `is_dir()` checks with explicit `is_file()` validation and deferring metadata resolution, eliminating unnecessary `stat()` syscalls and improving traversal performance on high-latency network filesystems like Lustre and NFS.
2026-05-22 11:04:04 +02:00
coissac fe0832190b Merge pull request 'feat(obiread): add static bzip2 and lzma compression support' (#3) from push-qpvrrxpnqlkw into main
Reviewed-on: #3
2026-05-22 08:29:42 +00:00
Eric Coissac 72d054c06b feat(obiread): add static bzip2 and lzma compression support
Explicitly add `bzip2-sys` and `liblzma-sys` with the `static` feature to the `obiread` crate. This enforces static linking for BZ2 and LZMA/XZ backends, eliminating runtime dynamic library dependencies and ensuring consistent binary distribution.
2026-05-22 10:29:22 +02:00
258 changed files with 53507 additions and 5364 deletions
Vendored
BIN
View File
Binary file not shown.
+35
View File
@@ -0,0 +1,35 @@
name: CI
on:
pull_request:
branches: ['main']
jobs:
build:
runs-on: ubuntu-latest
defaults:
run:
working-directory: src
steps:
- uses: actions/checkout@v4
- name: Install Rust
run: |
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh -s -- -y --default-toolchain stable
echo "$HOME/.cargo/bin" >> $GITHUB_PATH
- name: Cache cargo registry
uses: actions/cache@v4
with:
path: |
~/.cargo/registry
~/.cargo/git
src/target
key: ${{ runner.os }}-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: ${{ runner.os }}-cargo-
- name: Build
run: cargo build --release
- name: Test
run: cargo test --release
+123
View File
@@ -0,0 +1,123 @@
name: Release
on:
push:
tags:
- "v*"
jobs:
create-release:
runs-on: ubuntu-latest
outputs:
release_id: ${{ steps.create.outputs.release_id }}
steps:
- uses: actions/checkout@v4
with:
fetch-depth: 0
- name: Create Gitea release
id: create
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
TAG: ${{ github.ref_name }}
run: |
sudo apt-get update -qq && sudo apt-get install -y -qq jq
body=$(git for-each-ref --format='%(contents)' "refs/tags/$TAG")
release_id=$(curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases" \
-H "Authorization: token $GITEA_TOKEN" \
-H "Content-Type: application/json" \
-d "{\"tag_name\":\"$TAG\",\"name\":\"$TAG\",\"body\":$(echo "$body" | jq -Rs .)}" | jq -r '.id')
echo "release_id=$release_id" >> $GITHUB_OUTPUT
build-linux-x86_64:
needs: create-release
runs-on: ubuntu-latest
defaults:
run:
working-directory: src
steps:
- uses: actions/checkout@v4
- name: Install Rust + zigbuild
run: |
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh -s -- -y --default-toolchain stable
echo "$HOME/.cargo/bin" >> $GITHUB_PATH
sudo apt-get update -qq && sudo apt-get install -y -qq jq
pip install ziglang --quiet --break-system-packages
$HOME/.cargo/bin/cargo install cargo-zigbuild
$HOME/.cargo/bin/rustup target add x86_64-unknown-linux-musl
- name: Create musl C/C++ wrappers
run: |
ZIG=$(python3 -c "import ziglang, os; print(os.path.join(os.path.dirname(ziglang.__file__), 'zig'))")
printf '#!/bin/sh\nexec "%s" cc -target x86_64-linux-musl "$@"\n' "$ZIG" | sudo tee /usr/local/bin/x86_64-linux-musl-gcc > /dev/null
printf '#!/bin/sh\nexec "%s" c++ -target x86_64-linux-musl "$@"\n' "$ZIG" | sudo tee /usr/local/bin/x86_64-linux-musl-g++ > /dev/null
sudo chmod +x /usr/local/bin/x86_64-linux-musl-gcc /usr/local/bin/x86_64-linux-musl-g++
- name: Cache cargo registry
uses: actions/cache@v4
with:
path: |
~/.cargo/registry
~/.cargo/git
src/target
key: linux-musl-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: linux-musl-cargo-
- name: Build static binary
env:
PKG_CONFIG_ALLOW_CROSS: "1"
run: cargo zigbuild --release --target x86_64-unknown-linux-musl
- name: Prepare and upload artifact
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
RELEASE_ID: ${{ needs.create-release.outputs.release_id }}
run: |
mkdir -p /tmp/dist
cp target/x86_64-unknown-linux-musl/release/obikmer /tmp/dist/obikmer-linux-x86_64
strip /tmp/dist/obikmer-linux-x86_64
curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases/$RELEASE_ID/assets" \
-H "Authorization: token $GITEA_TOKEN" \
-F "attachment=@/tmp/dist/obikmer-linux-x86_64"
build-macos-arm64:
needs: create-release
runs-on: ubuntu-latest
steps:
- uses: actions/checkout@v4
- name: Login to registry
run: echo "${{ secrets.REGISTRYTOKEN }}" | docker login registry.metabarcoding.org -u ${{ secrets.REGISTRYUSER }} --password-stdin
- name: Cache cargo registry
uses: actions/cache@v4
with:
path: |
~/.cargo/registry
~/.cargo/git
src/target
key: macos-arm64-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: macos-arm64-cargo-
- name: Build macOS binary
run: |
docker run --rm \
-v "${{ github.workspace }}:/src" \
-w /src/src \
registry.metabarcoding.org/cibuilder/rustcrossosx:latest \
cargo build --release --target aarch64-apple-darwin --no-default-features
- name: Prepare and upload artifact
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
RELEASE_ID: ${{ needs.create-release.outputs.release_id }}
run: |
mkdir -p /tmp/dist
cp src/target/aarch64-apple-darwin/release/obikmer /tmp/dist/obikmer-macos-arm64
curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases/$RELEASE_ID/assets" \
-H "Authorization: token $GITEA_TOKEN" \
-F "attachment=@/tmp/dist/obikmer-macos-arm64"
+13
View File
@@ -8,4 +8,17 @@ data-stress
*.pb *.pb
./**/*.json ./**/*.json
*.bin *.bin
*.log
Betula_exilis--IGA-24-33 Betula_exilis--IGA-24-33
benchmark/genomes
benchmark/simulated_data
benchmark/specimen_index_presence
benchmark/specimen_index_count
benchmark/global_index_presence
benchmark/global_index_count
benchmark/stats
benchmark/reference_index
benchmark/reference_dist
benchmark/obikmer_dist
benchmark/specific_index_count
benchmark/specific_index_presence
+2
View File
@@ -0,0 +1,2 @@
/cache
/project.local.yml
+133
View File
@@ -0,0 +1,133 @@
# the name by which the project can be referenced within Serena
project_name: "obikmer"
# list of languages for which language servers are started; choose from:
# al angular ansible bash clojure
# cpp cpp_ccls crystal csharp csharp_omnisharp
# dart elixir elm erlang fortran
# fsharp go groovy haskell haxe
# hlsl html java json julia
# kotlin lean4 lua luau markdown
# matlab msl nix ocaml pascal
# perl php php_phpactor powershell python
# python_jedi python_ty r rego ruby
# ruby_solargraph rust scala scss solidity
# svelte swift systemverilog terraform toml
# typescript typescript_vts vue yaml zig
# (This list may be outdated. For the current list, see values of Language enum here:
# https://github.com/oraios/serena/blob/main/src/solidlsp/ls_config.py
# For some languages, there are alternative language servers, e.g. csharp_omnisharp, ruby_solargraph.)
# Note:
# - For C, use cpp
# - For JavaScript, use typescript
# - For Angular projects, use angular (subsumes typescript+html; requires `npm install` in the project root)
# - For Svelte projects, use svelte (subsumes typescript/javascript for .svelte projects; requires npm)
# - For SCSS / Sass / plain CSS, use scss (some-sass-language-server handles all three)
# - For Free Pascal/Lazarus, use pascal
# Special requirements:
# Some languages require additional setup/installations.
# See here for details: https://oraios.github.io/serena/01-about/020_programming-languages.html#language-servers
# When using multiple languages, the first language server that supports a given file will be used for that file.
# The first language is the default language and the respective language server will be used as a fallback.
# Note that when using the JetBrains backend, language servers are not used and this list is correspondingly ignored.
languages:
- rust
# the encoding used by text files in the project
# For a list of possible encodings, see https://docs.python.org/3.11/library/codecs.html#standard-encodings
encoding: "utf-8"
# line ending convention to use when writing source files.
# Possible values: unset (use global setting), "lf", "crlf", or "native" (platform default)
# This does not affect Serena's own files (e.g. memories and configuration files), which always use native line endings.
line_ending:
# The language backend to use for this project.
# If not set, the global setting from serena_config.yml is used.
# Valid values: LSP, JetBrains
# Note: the backend is fixed at startup. If a project with a different backend
# is activated post-init, an error will be returned.
language_backend:
# whether to use project's .gitignore files to ignore files
ignore_all_files_in_gitignore: true
# advanced configuration option allowing to configure language server-specific options.
# Maps the language key to the options.
# Have a look at the docstring of the constructors of the LS implementations within solidlsp (e.g., for C# or PHP) to see which options are available.
# No documentation on options means no options are available.
ls_specific_settings: {}
# list of additional workspace folder paths for cross-package reference support (e.g. in monorepos).
# Paths can be absolute or relative to the project root.
# Each folder is registered as an LSP workspace folder, enabling language servers to discover
# symbols and references across package boundaries.
# Currently supported for: TypeScript.
# Example:
# additional_workspace_folders:
# - ../sibling-package
# - ../shared-lib
additional_workspace_folders: []
# list of additional paths to ignore in this project.
# Same syntax as gitignore, so you can use * and **.
# Note: global ignored_paths from serena_config.yml are also applied additively.
ignored_paths: []
# whether the project is in read-only mode
# If set to true, all editing tools will be disabled and attempts to use them will result in an error
# Added on 2025-04-18
read_only: false
# list of tool names to exclude.
# This extends the existing exclusions (e.g. from the global configuration)
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
excluded_tools: []
# list of tools to include that would otherwise be disabled (particularly optional tools that are disabled by default).
# This extends the existing inclusions (e.g. from the global configuration).
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
included_optional_tools: []
# fixed set of tools to use as the base tool set (if non-empty), replacing Serena's default set of tools.
# This cannot be combined with non-empty excluded_tools or included_optional_tools.
# Find the list of tools here: https://oraios.github.io/serena/01-about/035_tools.html
fixed_tools: []
# list of mode names that are to be activated by default, overriding the setting in the global configuration.
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# If the setting is undefined/empty, the default_modes from the global configuration (serena_config.yml) apply.
# Otherwise, this overrides the setting from the global configuration (serena_config.yml).
# Therefore, you can set this to [] if you do not want the default modes defined in the global config to apply
# for this project.
# This setting can, in turn, be overridden by CLI parameters (--mode).
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
default_modes:
# list of mode names to be activated additionally for this project, e.g. ["query-projects"]
# The full set of modes to be activated is base_modes (from global config) + default_modes + added_modes.
# See https://oraios.github.io/serena/02-usage/050_configuration.html#modes
added_modes:
# initial prompt for the project. It will always be given to the LLM upon activating the project
# (contrary to the memories, which are loaded on demand).
initial_prompt: ""
# time budget (seconds) per tool call for the retrieval of additional symbol information
# such as docstrings or parameter information.
# This overrides the corresponding setting in the global configuration; see the documentation there.
# If null or missing, use the setting from the global configuration.
symbol_info_budget:
# list of regex patterns which, when matched, mark a memory entry as readonly.
# Extends the list from the global configuration, merging the two lists.
read_only_memory_patterns: []
# list of regex patterns for memories to completely ignore.
# Matching memories will not appear in list_memories or activate_project output
# and cannot be accessed via read_memory or write_memory.
# To access ignored memory files, use the read_file tool on the raw file path.
# Extends the list from the global configuration, merging the two lists.
# Example: ["_archive/.*", "_episodes/.*"]
ignored_memory_patterns: []
+29
View File
@@ -8,6 +8,9 @@ Ne modifier aucun fichier à moins d'une demande explicite de modification. En p
**Règle absolue : ne jamais substituer une dépendance ou une bibliothèque sans validation explicite.** **Règle absolue : ne jamais substituer une dépendance ou une bibliothèque sans validation explicite.**
Si une dépendance demandée pose problème (erreur de compilation, bug, API manquante), exposer le problème et proposer des alternatives — ne jamais switcher silencieusement vers une autre bibliothèque. Le choix des dépendances est une décision d'architecture qui appartient au développeur. Si une dépendance demandée pose problème (erreur de compilation, bug, API manquante), exposer le problème et proposer des alternatives — ne jamais switcher silencieusement vers une autre bibliothèque. Le choix des dépendances est une décision d'architecture qui appartient au développeur.
**Règle absolue : le code existant est une hypothèse, pas une vérité.**
Quand une nouvelle construction (type, itérateur, abstraction) rend du code historique injustifié, le signaler immédiatement et proposer de le supprimer — ne pas conserver les deux en parallèle par inertie. Le développeur demande explicitement de remettre en cause le code base : ne pas attendre qu'il insiste.
Tu maintiens en **anglais**, dense et sans remplissage, les documents suivants : Tu maintiens en **anglais**, dense et sans remplissage, les documents suivants :
- `docmd/index.md` — document de discussion de base, enrichi progressivement au fil de nos échanges ; il reflète l'état courant de la réflexion sur le projet - `docmd/index.md` — document de discussion de base, enrichi progressivement au fil de nos échanges ; il reflète l'état courant de la réflexion sur le projet
- les autres fichiers Markdown dans `docmd/` selon leur thème respectif - les autres fichiers Markdown dans `docmd/` selon leur thème respectif
@@ -70,3 +73,29 @@ Lors de l'ajout de nouveaux fichiers Markdown dans `docmd/`, mettre à jour la s
--- ---
Je continue à poser mes questions et à guider la discussion. Je continue à poser mes questions et à guider la discussion.
---
## MCP Tools
**Règle absolue : avant tout travail de code, appeler `mcp__serena__initial_instructions` pour charger les instructions Serena.**
### Hiérarchie des outils pour ce projet Rust
**Navigation et édition de code → serena en priorité**
- Trouver un symbole, une déclaration, les implémentations d'un trait : `mcp__serena__find_symbol`, `mcp__serena__find_declaration`, `mcp__serena__find_implementations`
- Trouver les usages d'un symbole : `mcp__serena__find_referencing_symbols`
- Diagnostics LSP (erreurs de compilation) : `mcp__serena__get_diagnostics_for_file`
- Vue d'ensemble d'un fichier : `mcp__serena__get_symbols_overview`
- Modifier le corps d'une fonction/impl : `mcp__serena__replace_symbol_body`
- Ne pas utiliser `cclsp` quand serena couvre le besoin
**Analyse architecturale → jcodemunch**
- Hotspots, couplage, dead code, dépendances entre modules
- Utiliser avant de refactorer une zone critique
**Raisonnement complexe → sequential-thinking**
- Décisions d'architecture, choix d'algorithme, trade-offs non triviaux
**Documentation de crates → context7**
- Toujours consulter avant d'utiliser une API de bibliothèque externe
+34
View File
@@ -22,6 +22,7 @@ $(MKDOCS): $(VENV)/bin/activate
mkdocs mkdocs-material \ mkdocs mkdocs-material \
mkdocs-mermaid2-plugin \ mkdocs-mermaid2-plugin \
mkdocs-bibtex mkdocs-bibtex
$(PIP) install --quiet --upgrade InSilicoSeq
# ── obikmer binary ─────────────────────────────────────────────────────────── # ── obikmer binary ───────────────────────────────────────────────────────────
@@ -62,3 +63,36 @@ clean-doc:
.PHONY: clean .PHONY: clean
clean: clean-doc clean: clean-doc
rm -rf $(VENV) rm -rf $(VENV)
# ── release ───────────────────────────────────────────────────────────────────
CARGO_TOML := $(CARGO_DIR)/obikmer/Cargo.toml
.PHONY: bump-version
bump-version:
@current=$$(grep '^version = ' $(CARGO_TOML) | head -n 1 | sed 's/version = "\(.*\)"/\1/'); \
if [ -n "$(RELEASE)" ]; then \
new_version="$(RELEASE)"; \
else \
major=$$(echo $$current | cut -d. -f1); \
minor=$$(echo $$current | cut -d. -f2); \
patch=$$(echo $$current | cut -d. -f3); \
new_patch=$$((patch + 1)); \
new_version="$$major.$$minor.$$new_patch"; \
fi; \
echo "Version: $$current -> $$new_version"; \
sed -i.bak "s/^version = \"$$current\"/version = \"$$new_version\"/" $(CARGO_TOML) && \
rm $(CARGO_TOML).bak
.PHONY: release
release: bump-version
@jj auto-describe
@jj git push --change @
@new_version=$$(grep '^version = ' $(CARGO_TOML) | head -n 1 | sed 's/version = "\(.*\)"/\1/'); \
git_hash=$$(jj log -r @ --no-graph -T 'commit_id'); \
commits=$$(jj log -r 'latest(tags())..@' --no-graph -T 'description ++ "\n"' 2>/dev/null || \
jj log --no-graph -T 'description ++ "\n"' --limit 30); \
notes=$$(printf 'Write concise markdown release notes for obikmer (a Rust kmer genomics tool). Be technical and direct. Base them strictly on these commit messages:\n\n%s' "$$commits" | aichat 2>/dev/null); \
tag_msg="$${notes:-Release v$$new_version}"; \
git tag -a "v$$new_version" -m "$$tag_msg" "$$git_hash" && \
git push origin "v$$new_version"
+123 -1
View File
@@ -1 +1,123 @@
toto # obikmer
`obikmer` is a Rust toolkit for indexing, querying, and comparing DNA sequences
represented as sets of k-mers. It targets individual genome datasets (tens of
Gbases) with maximum efficiency in computation, memory, and disk usage.
## Key principles
**Compact k-mer encoding.** Each k-mer is stored in a `u64` at 2 bits/base.
k is odd, k ∈ [11, 31], fixed at runtime. The canonical form `min(kmer, revcomp(kmer))`
halves the effective space by collapsing both strands.
**Superkmer-based partitioning.** Sequences are decomposed into superkmers —
maximal runs of k-mers sharing the same minimizer. Superkmers route naturally to
partitions via the minimizer hash, enabling partition-parallel indexing and querying
with no cross-partition communication.
**Layered MPHF index.** Each partition holds a stack of layers. Each layer is a
minimal perfect hash function (MPHF) over the k-mers of one input genome, paired
with a per-genome presence/count matrix. Queries scatter k-mers to their partition,
probe each layer in order, and aggregate results.
**Approximate indexing (Findere).** With `-z Z`, the index stores k-mers of size
`s = k z + 1` instead of k. At query time, results are produced at size s, then
a per-genome sliding window of size z aggregates z consecutive s-mer hits into one
confirmed k-mer answer. This reduces the false-positive rate from `1/2^b` per s-mer
to `1/2^(b·z)` per k-mer, at the cost of z1 unconfirmed positions at each sequence
break. The aggregation window spans the full query sequence, not individual superkmers,
to avoid false negatives at superkmer boundaries.
**Multi-genome.** A single index can hold any number of genomes. Each k-mer slot
carries a per-genome count or presence vector. Distance matrices, NJ/UPGMA trees,
and classification are derived from these vectors without rebuilding the index.
## Input formats
Command Formats accepted
─────────────────── ──────────────────────────────────────────────────────────────
index, superkmer FASTA (.fa .fasta), FASTQ (.fq .fastq), GenBank flat file
(.gb .gbk .gbff), all optionally gzip-compressed.
Directories expanded recursively. Streaming stdin via -.
query FASTA, FASTQ, optionally gzip-compressed. Stdin via -.
Non-ACGT characters act as hard breaks between k-mer segments in all formats.
## Commands
Command Role
───────── ────────────────────────────────────────────────────────────────────
index Build a genome index from sequence files.
Runs scatter → dereplicate → count → layered MPHF.
Resumes automatically if interrupted.
merge Merge multiple independently built indexes into one.
Schedules partitions largest-first under a memory budget semaphore
to avoid OOM on machines with many cores. The worst partition runs
alone first to calibrate the expansion estimator; subsequent
partitions run in parallel within the budget.
--budget-fraction F fraction of available RAM to use as budget
(default 0.5; reduce if OOM persists).
filter Filter and compact an existing index: apply count thresholds,
drop layers, rewrite as a single-layer index.
reindex Convert evidence in-place across all layers:
exact (evidence.bin) ↔ approximate (fingerprint.bin).
Does not touch the MPHF or unitigs.
query Query an index with FASTA/FASTQ sequences.
Annotates each sequence with per-genome k-mer match counts
and optional per-position coverage vectors (--detail).
Parallel over sequence chunks.
distance Compute a pairwise Bray-Curtis or Jaccard distance matrix
between all indexed genomes.
Optionally outputs a Newick NJ or UPGMA tree.
annotate Add or update genome metadata (taxonomy, etc.) from a CSV
file; or dump the current metadata as CSV.
estimate Dry-run: resolve and print approximate-index parameters
(z, evidence bits b, FP rates) given any two of (b, z, fp).
Does not touch any index.
dump Dump all indexed k-mers as CSV with per-genome counts or
presence flags.
superkmer Extract superkmers from a sequence file and write to stdout.
Diagnostic / pipeline use.
unitig Dump the unitig sequences stored in a built index. Debug use.
utils Miscellaneous utilities.
--new-label NEW=OLD rename a genome label in-place.
--bits-per-kmer print MPHF / evidence / matrix size breakdown.
--stats per-genome k-mer counts as CSV.
--partition-stats partition size distribution across one or more
indexes (markdown report to stdout). Useful to
diagnose minimizer imbalance before a large merge.
--csv FILE write per-(partition, source) raw data to FILE
(used with --partition-stats).
## Quick start
```sh
# Build an exact index for each genome independently
obikmer index --kmer-size 31 --label genome_a genome_a.fa --output index_a/
obikmer index --kmer-size 31 --label genome_b genome_b.fa --output index_b/
# Merge into a single multi-genome index
obikmer merge --output index/ index_a/ index_b/
# Convert to approximate index (z=5, 8-bit fingerprints)
obikmer reindex --approx -z 5 --evidence-bits 8 index/
# Query reads
obikmer query index/ reads.fq.gz > annotated.fa
# Pairwise distances
obikmer distance index/ > distances.tsv
```
## Parameter constraints
Parameter Constraint
───────────────────── ──────────────
k (--kmer-size) odd, 11 ≤ k ≤ 31
m (--minimizer-size) odd, 3 ≤ m ≤ k1
z (-z, --approx only) 1 ≤ z ≤ k1
## Documentation
Extended architecture and implementation notes are in `docmd/`. Build with
`make doc` (requires Python + MkDocs Material).
+52
View File
@@ -1,3 +1,21 @@
## A finir dans le cadre de l'extension des index à une forme approximative
- Il faut avoir un chemin explicite pour construire en mode exact avec des méthodes qui ont ce mot exact à l'intérieur.
- pub fn find_exact (src/obilayeredmap/src/mphf_layer.rs)
- pub fn build_exact_evidence (src/obilayeredmap/src/layer.rs)
Comme elles existent actuellement pour le mode approx.
Ensuite, il faudra définir des méthodes génériques
- find()
- build_evidence()
qui utilise la bonne version suivant le mode de l'index de manière complètement transparente.
Avec ce système, tout le reste du code devrait être insensible au fait que l'on utilise un index exact ou approximatif.
Sauf qu'avec un index approximatif, les résultats seront approximatifs.
## commandes à ajouter ## commandes à ajouter
- aggregate : aggrege toutes les colonnes d'une matrice d'index en une seule colonne. - aggregate : aggrege toutes les colonnes d'une matrice d'index en une seule colonne.
@@ -6,3 +24,37 @@
--detail et --mismatch à implementer --detail et --mismatch à implementer
- status : affiche le statut de l'index - status : affiche le statut de l'index
## Problème biologique sur l'identification des contaminants
Exemple de reads problématiques:
```
>LH00534:161:22WMGWLT4:4:1101:45301:1420 {"coverage":{"gbbct":[1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1]},"kmer_count":117,"kmer_strict_matches":{"gbbct":117}}
GCCCCTACCGTACTCCAGCTTGGTAGTTTCCACCGCCTGTCCAGGGTTGAGCCCTGGGATTTGACGGCGGACTTAAAAAGCCACCTACAGACGCTTTACGCCCAATCATTCCGGATAACGCTTGCATCCTCTGTATTACCGCGGCTGCTGG
```
Par blast match une quantité invréssemblable de genomes chloroplastique avec un match de 100% (6554 hits pour Streptophyta)
mais aussi une quantité de sequences importantes à des OTU bactériennes (uncutured bacteria 115 hits) aussi avec 100% de similarité.
```
Uncultured bacterium clone Otu01032 16S ribosomal RNA gene, partial sequence
Sequence ID: KX996137.1Length: 440Number of Matches: 1
Range 1: 153 to 303GenBankGraphics
Next Match
Previous Match
Alignment statistics for match #1 Score Expect Identities Gaps Strand
273 bits(302) 2e-69 151/151(100%) 0/151(0%) Plus/Minus
Query 1 GCCCCTACCGTACTCCAGCTTGGTAGTTTCCACCGCCTGTCCAGGGTTGAGCCCTGGGAT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 303 GCCCCTACCGTACTCCAGCTTGGTAGTTTCCACCGCCTGTCCAGGGTTGAGCCCTGGGAT 244
Query 61 TTGACGGCGGACTTAAAAAGCCACCTACAGACGCTTTACGCCCAATCATTCCGGATAACG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 243 TTGACGGCGGACTTAAAAAGCCACCTACAGACGCTTTACGCCCAATCATTCCGGATAACG 184
Query 121 CTTGCATCCTCTGTATTACCGCGGCTGCTGG 151
|||||||||||||||||||||||||||||||
Sbjct 183 CTTGCATCCTCTGTATTACCGCGGCTGCTGG 153
```
+230
View File
@@ -0,0 +1,230 @@
# Requires GNU Make >= 4.3 (grouped targets &:) — use gmake on macOS
BINARY := ../src/target/release/obikmer
VENV_PY := ../.venv/bin/python3
GENOMES := $(wildcard genomes/*.fna.gz)
# SPECIMENS, SPECIES, and the full dependency graph are generated by
# make_deps.py from the genome FASTA headers — like .d files in C.
# Make rebuilds deps.mk whenever genomes/ changes and restarts.
-include deps.mk
REF_NPZS := $(SPECIMENS:%=reference_index/%.npz)
REF_DIST_CSVS := $(addprefix reference_dist/, \
shared_kmers.csv hamming_dist.csv jaccard_dist.csv \
bray_curtis_dist.csv relfreq_bray_curtis_dist.csv \
euclidean_dist.csv relfreq_euclidean_dist.csv \
hellinger_dist.csv hellinger_euclidean_dist.csv)
OBIKMER_PRESENCE_DIST := $(addprefix obikmer_dist/presence/, \
jaccard_dist.csv jaccard_shared.csv jaccard_nj.nwk \
hamming_dist.csv hamming_nj.nwk)
OBIKMER_COUNT_DIST := $(addprefix obikmer_dist/count/, \
jaccard_dist.csv jaccard_shared.csv jaccard_nj.nwk \
bray_curtis_dist.csv bray_curtis_nj.nwk \
relfreq_bray_curtis_dist.csv relfreq_bray_curtis_nj.nwk \
euclidean_dist.csv euclidean_nj.nwk \
relfreq_euclidean_dist.csv relfreq_euclidean_nj.nwk \
hellinger_dist.csv hellinger_nj.nwk \
hellinger_euclidean_dist.csv hellinger_euclidean_nj.nwk)
DIST_COMPARISON := stats/dist_comparison/summary.csv
PRESENCE_DONE := $(SPECIMENS:%=specimen_index_presence/%/index.done)
PRESENCE_STATS := $(SPECIMENS:%=stats/indexing_presence/%.stats)
COUNT_DONE := $(SPECIMENS:%=specimen_index_count/%/index.done)
COUNT_STATS := $(SPECIMENS:%=stats/indexing_count/%.stats)
VERIFY_PRESENCE_STATS := $(SPECIMENS:%=stats/verify_presence/%.stats)
VERIFY_COUNT_STATS := $(SPECIMENS:%=stats/verify_count/%.stats)
SPECIFIC_PRESENCE_DONE := $(SPECIES:%=specific_index_presence/%/index.done)
SPECIFIC_PRESENCE_STATS := $(SPECIES:%=stats/specific_kmer_presence/%.stats)
SPECIFIC_COUNT_DONE := $(SPECIES:%=specific_index_count/%/index.done)
SPECIFIC_COUNT_STATS := $(SPECIES:%=stats/specific_kmer_count/%.stats)
SIMULATED_READS := $(foreach s,$(SPECIMENS),simulated_data/$(subst --,/,$s)/reads_R1.fastq.gz)
.NOTPARALLEL:
.PHONY: all simulate reference reference_dist \
obikmer_dist obikmer_dist_presence obikmer_dist_count \
dist_comparison \
index_presence index_count \
aggregate_index_presence aggregate_index_count \
merge_presence merge_count \
verify_presence verify_count \
aggregate_verify_presence aggregate_verify_count \
verify_merge_presence verify_merge_count \
filter_presence filter_count \
aggregate_filter_presence aggregate_filter_count
verify_merge_presence: stats/verify_merge_presence/current.csv
verify_merge_count: stats/verify_merge_count/current.csv
all: aggregate_verify_presence aggregate_verify_count \
verify_merge_presence verify_merge_count \
aggregate_filter_presence aggregate_filter_count \
dist_comparison
# ── dependency file ───────────────────────────────────────────────────────────
deps.mk: $(GENOMES)
$(VENV_PY) make_deps.py $^ > $@
# ── simulation ────────────────────────────────────────────────────────────────
# Prerequisites (genome → reads) are in deps.mk; $< is the genome file.
$(SIMULATED_READS):
bash simulate_one.sh $< $(dir $@)
simulate: $(SIMULATED_READS)
# ── reference kmer sets ───────────────────────────────────────────────────────
# Prerequisites (reads → npz) are in deps.mk.
reference_index/%.npz:
bash build_reference.sh $*
reference: $(REF_NPZS)
# ── reference distance matrices ───────────────────────────────────────────────
$(REF_DIST_CSVS) &: $(REF_NPZS) build_reference_dist.py
$(VENV_PY) build_reference_dist.py
reference_dist: $(REF_DIST_CSVS)
# ── obikmer distance (presence index) ────────────────────────────────────────
$(OBIKMER_PRESENCE_DIST) &: global_index_presence/index.done $(BINARY)
mkdir -p obikmer_dist/presence
$(BINARY) distance \
--output obikmer_dist/presence/jaccard \
--metric jaccard --shared-kmers --nj \
global_index_presence
$(BINARY) distance \
--output obikmer_dist/presence/hamming \
--metric hamming --nj \
global_index_presence
obikmer_dist_presence: $(OBIKMER_PRESENCE_DIST)
# ── obikmer distance (count index) ───────────────────────────────────────────
$(OBIKMER_COUNT_DIST) &: global_index_count/index.done $(BINARY)
mkdir -p obikmer_dist/count
$(BINARY) distance \
--output obikmer_dist/count/jaccard \
--metric jaccard --shared-kmers --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/bray_curtis \
--metric bray-curtis --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/relfreq_bray_curtis \
--metric relfreq-bray-curtis --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/euclidean \
--metric euclidean --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/relfreq_euclidean \
--metric relfreq-euclidean --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/hellinger \
--metric hellinger --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/hellinger_euclidean \
--metric hellinger-euclidean --nj \
global_index_count
obikmer_dist_count: $(OBIKMER_COUNT_DIST)
obikmer_dist: obikmer_dist_presence obikmer_dist_count
# ── distance comparison ───────────────────────────────────────────────────────
$(DIST_COMPARISON): $(REF_DIST_CSVS) $(OBIKMER_PRESENCE_DIST) $(OBIKMER_COUNT_DIST) compare_all_dist.py
$(VENV_PY) compare_all_dist.py --out $(DIST_COMPARISON)
dist_comparison: $(DIST_COMPARISON)
# ── per-specimen indexing ─────────────────────────────────────────────────────
# Prerequisites (reads → index.done + .stats) are in deps.mk.
specimen_index_presence/%/index.done \
stats/indexing_presence/%.stats &: $(BINARY)
bash index_one_presence.sh $*
specimen_index_count/%/index.done \
stats/indexing_count/%.stats &: $(BINARY)
bash index_one_count.sh $*
index_presence: $(PRESENCE_DONE)
index_count: $(COUNT_DONE)
# ── indexing stats aggregation ────────────────────────────────────────────────
aggregate_index_presence: $(PRESENCE_STATS)
bash aggregate_stats.sh indexing_presence
aggregate_index_count: $(COUNT_STATS)
bash aggregate_stats.sh indexing_count
# ── global merge ──────────────────────────────────────────────────────────────
global_index_presence/index.done: $(PRESENCE_DONE) $(BINARY)
bash merge_presence.sh
global_index_count/index.done: $(COUNT_DONE) $(BINARY)
bash merge_count.sh
merge_presence: global_index_presence/index.done
merge_count: global_index_count/index.done
# ── per-specimen verification ─────────────────────────────────────────────────
# Prerequisites (index.done + npz → .stats) are in deps.mk.
stats/verify_presence/%.stats:
bash verify_one_presence.sh $*
stats/verify_count/%.stats:
bash verify_one_count.sh $*
verify_presence: $(VERIFY_PRESENCE_STATS)
verify_count: $(VERIFY_COUNT_STATS)
# ── verification stats aggregation ───────────────────────────────────────────
aggregate_verify_presence: $(VERIFY_PRESENCE_STATS)
bash aggregate_stats.sh verify_presence
aggregate_verify_count: $(VERIFY_COUNT_STATS)
bash aggregate_stats.sh verify_count
# ── species-specific indexes ──────────────────────────────────────────────────
# Prerequisites (global index → specific index) are in deps.mk.
specific_index_presence/%/index.done \
stats/specific_kmer_presence/%.stats &: $(BINARY)
bash filter_one_presence.sh $*
specific_index_count/%/index.done \
stats/specific_kmer_count/%.stats &: $(BINARY)
bash filter_one_count.sh $*
filter_presence: $(SPECIFIC_PRESENCE_DONE)
filter_count: $(SPECIFIC_COUNT_DONE)
aggregate_filter_presence: $(SPECIFIC_PRESENCE_STATS)
bash aggregate_stats.sh specific_kmer_presence
aggregate_filter_count: $(SPECIFIC_COUNT_STATS)
bash aggregate_stats.sh specific_kmer_count
# ── merged index verification ─────────────────────────────────────────────────
stats/verify_merge_presence/current.csv: $(REF_NPZS) global_index_presence/index.done
bash verify_merge_presence.sh
stats/verify_merge_count/current.csv: $(REF_NPZS) global_index_count/index.done
bash verify_merge_count.sh
+132
View File
@@ -0,0 +1,132 @@
# Benchmark pipeline
Requires **GNU Make ≥ 4.3** (grouped targets `&:`). On macOS use `gmake`.
```
gmake all # full pipeline
gmake simulate # simulation only
gmake reference # reference kmer sets only
```
## Pipeline overview
```mermaid
flowchart TD
GENOMES["genomes/*.fna.gz"]
BIN["obikmer binary"]
GENOMES --> simulate
simulate --> simdata[("simulated_data/")]
simdata --> reference
reference --> refnpz[("reference_index/*.npz")]
subgraph presence ["Presence track"]
simdata --> index_presence
BIN --> index_presence
index_presence --> pres_done[("specimen_index_presence/")]
index_presence --> pres_istats[("stats/indexing_presence/")]
pres_istats --> aggregate_index_presence
pres_done --> merge_presence
BIN --> merge_presence
merge_presence --> gpres[("global_index_presence/")]
refnpz --> verify_presence
pres_done --> verify_presence
verify_presence --> vpres_stats[("stats/verify_presence/")]
vpres_stats --> aggregate_verify_presence
gpres --> filter_presence
BIN --> filter_presence
filter_presence --> spec_pres[("specific_index_presence/")]
filter_presence --> spec_pres_stats[("stats/specific_kmer_presence/")]
spec_pres_stats --> aggregate_filter_presence
refnpz --> verify_merge_presence
gpres --> verify_merge_presence
verify_merge_presence --> vmp[("stats/verify_merge_presence/")]
end
subgraph count ["Count track"]
simdata --> index_count
BIN --> index_count
index_count --> count_done[("specimen_index_count/")]
index_count --> count_istats[("stats/indexing_count/")]
count_istats --> aggregate_index_count
count_done --> merge_count
BIN --> merge_count
merge_count --> gcount[("global_index_count/")]
refnpz --> verify_count
count_done --> verify_count
verify_count --> vcount_stats[("stats/verify_count/")]
vcount_stats --> aggregate_verify_count
gcount --> filter_count
BIN --> filter_count
filter_count --> spec_count[("specific_index_count/")]
filter_count --> spec_count_stats[("stats/specific_kmer_count/")]
spec_count_stats --> aggregate_filter_count
refnpz --> verify_merge_count
gcount --> verify_merge_count
verify_merge_count --> vmc[("stats/verify_merge_count/")]
end
aggregate_verify_presence --> all
aggregate_verify_count --> all
vmp --> all
vmc --> all
all -. "$(MAKE) re-eval" .-> aggregate_filter_presence
all -. "$(MAKE) re-eval" .-> aggregate_filter_count
```
## Steps
| Target | Script | Description |
|---|---|---|
| `simulate` | `simulate.sh` | Simulate sequencing reads from the reference genomes |
| `reference` | `build_reference.sh` | Build reference kmer sets (`.npz`) from simulation truth |
| `index_presence` | `index_one_presence.sh` | Index each specimen (presence mode) |
| `index_count` | `index_one_count.sh` | Index each specimen (count mode) |
| `aggregate_index_presence` | `aggregate_stats.sh` | Aggregate per-specimen indexing stats (presence) |
| `aggregate_index_count` | `aggregate_stats.sh` | Aggregate per-specimen indexing stats (count) |
| `merge_presence` | `merge_presence.sh` | Merge all specimen presence indexes into a global index |
| `merge_count` | `merge_count.sh` | Merge all specimen count indexes into a global index |
| `verify_presence` | `verify_one_presence.sh` | Verify each specimen presence index against reference |
| `verify_count` | `verify_one_count.sh` | Verify each specimen count index against reference |
| `aggregate_verify_presence` | `aggregate_stats.sh` | Aggregate per-specimen verification stats (presence) |
| `aggregate_verify_count` | `aggregate_stats.sh` | Aggregate per-specimen verification stats (count) |
| `filter_presence` | `filter_one_presence.sh` | Extract species-specific presence indexes from global index |
| `filter_count` | `filter_one_count.sh` | Extract species-specific count indexes from global index |
| `aggregate_filter_presence` | `aggregate_stats.sh` | Aggregate species-specific kmer stats (presence) |
| `aggregate_filter_count` | `aggregate_stats.sh` | Aggregate species-specific kmer stats (count) |
| `verify_merge_presence` | `verify_merge_presence.sh` | Verify global presence index against all reference sets |
| `verify_merge_count` | `verify_merge_count.sh` | Verify global count index against all reference sets |
## Directory layout
```
benchmark/
├── genomes/ # input reference genomes (.fna.gz)
├── simulated_data/ # generated by simulate
│ └── <species>/<specimen>/
├── reference_index/ # reference kmer sets (.npz)
├── specimen_index_presence/ # per-specimen presence indexes
├── specimen_index_count/ # per-specimen count indexes
├── global_index_presence/ # merged global presence index
├── global_index_count/ # merged global count index
├── specific_index_presence/ # species-specific presence indexes
├── specific_index_count/ # species-specific count indexes
└── stats/ # all benchmark statistics
├── indexing_presence/
├── indexing_count/
├── verify_presence/
├── verify_count/
├── specific_kmer_presence/
├── specific_kmer_count/
├── verify_merge_presence/
└── verify_merge_count/
```
+53
View File
@@ -0,0 +1,53 @@
#!/usr/bin/env bash
# Usage: aggregate_stats.sh TYPE
# TYPE = indexing_presence | indexing_count | verify_presence | verify_count
#
# Reads all stats/TYPE/*.stats files (one CSV data row each, no header).
# Creates a new stats/TYPE/run_NNN.csv only if any .stats file is newer than
# the most recent run CSV (idempotent when nothing changed).
set -euo pipefail
TYPE="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
STATS_DIR="${SCRIPT_DIR}/stats/${TYPE}"
case "${TYPE}" in
indexing_presence|indexing_count)
HEADER="run,species,strain,scatter_wall_s,scatter_rss_b,dereplicate_wall_s,dereplicate_rss_b,count_kmer_wall_s,count_kmer_rss_b,index_wall_s,index_rss_b,total_wall_s,total_rss_b"
;;
verify_presence)
HEADER="run,species,strain,ref_kmers,idx_kmers,false_neg,false_pos,fn_pct,fp_pct"
;;
verify_count)
HEADER="run,species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,fn_pct,fp_pct,cm_pct"
;;
specific_kmer_presence|specific_kmer_count)
HEADER="run,species,rebuild_wall_s,rebuild_rss_b,pack_wall_s,pack_rss_b,filter_total_wall_s,filter_total_rss_b,select_wall_s,select_rss_b,select_total_wall_s,select_total_rss_b"
;;
*)
echo "ERROR: unknown stats type '${TYPE}'" >&2
exit 1
;;
esac
# Find most recent existing run CSV (empty string if none).
latest_csv=$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' 2>/dev/null | sort | tail -1)
# Check if any .stats file is newer than the latest run CSV.
if [[ -n "${latest_csv}" ]] && \
[[ -z "$(find "${STATS_DIR}" -maxdepth 1 -name '*.stats' -newer "${latest_csv}" 2>/dev/null)" ]]; then
echo "[${TYPE}] stats up to date (${latest_csv})"
exit 0
fi
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' 2>/dev/null | wc -l | tr -d ' ')")
CSV="${STATS_DIR}/run_${run_n}.csv"
echo "${HEADER}" >"${CSV}"
# Sort .stats files by name for reproducible row order.
while IFS= read -r stats_file; do
sed "s/^/${run_n},/" "${stats_file}"
done < <(find "${STATS_DIR}" -maxdepth 1 -name '*.stats' | sort) >>"${CSV}"
echo "[${TYPE}] run ${run_n}${CSV}"
+137
View File
@@ -0,0 +1,137 @@
#!/usr/bin/env python3
"""Build a reference kmer index from paired-end FASTQ reads.
Extracts canonical kmers — min(kmer, revcomp(kmer)) encoded as uint64 —
counts their abundances, and saves a sorted numpy pair (kmers, counts).
Output .npz arrays
kmers : uint64, sorted ascending — canonical kmer integers
counts : uint32, same order — raw read abundances
"""
import argparse
import gzip
import sys
from collections import defaultdict
import numpy as np
# ── encoding ────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
# Lookup table: revcomp of one byte (4 bases, 8 bits).
# Precomputed once at import time.
_REVCOMP8 = [0] * 256
for _i in range(256):
_rc, _x = 0, _i
for _ in range(4):
_rc = (_rc << 2) | (3 - (_x & 3))
_x >>= 2
_REVCOMP8[_i] = _rc
del _i, _rc, _x
def revcomp_int(kmer: int, k: int) -> int:
"""Reverse-complement of a kmer encoded as an integer (2 bits/base).
Uses byte-level lookup (4 bases at a time) for speed.
"""
rc = 0
bits_left = 2 * k
while bits_left > 0:
chunk = min(8, bits_left)
rc_byte = _REVCOMP8[kmer & 0xFF] >> (8 - chunk)
rc = (rc << chunk) | rc_byte
kmer >>= chunk
bits_left -= chunk
return rc
# ── FASTQ parsing ────────────────────────────────────────────────────────────
def iter_sequences(path: str):
"""Yield raw sequences from a (gzipped) FASTQ file."""
opener = gzip.open if path.endswith('.gz') else open
with opener(path, 'rt') as fh:
while True:
if not fh.readline(): # '@' header
break
seq = fh.readline().rstrip('\n')
fh.readline() # '+'
fh.readline() # quality
yield seq
# ── kmer counting ────────────────────────────────────────────────────────────
def count_kmers(paths: list[str], k: int) -> dict[int, int]:
mask = (1 << (2 * k)) - 1
counts: dict[int, int] = defaultdict(int)
n_reads = 0
for path in paths:
for seq in iter_sequences(path):
n_reads += 1
kmer = 0
run = 0 # consecutive valid bases
for c in seq:
b = _ENCODE.get(c)
if b is None: # N or unexpected character → reset
kmer = 0
run = 0
continue
kmer = ((kmer << 2) | b) & mask
run += 1
if run >= k:
rc = revcomp_int(kmer, k)
counts[kmer if kmer <= rc else rc] += 1
if n_reads % 100_000 == 0:
print(f' {n_reads:,} reads processed, '
f'{len(counts):,} distinct kmers so far',
file=sys.stderr)
print(f' {n_reads:,} reads total, {len(counts):,} distinct kmers',
file=sys.stderr)
return counts
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('reads', nargs='+', metavar='FASTQ',
help='Input reads (FASTQ, gzip OK)')
ap.add_argument('-k', '--kmer-size', type=int, default=31,
metavar='K')
ap.add_argument('--min-abundance', type=int, default=1,
metavar='N', help='Drop kmers with count < N (default 1)')
ap.add_argument('-o', '--output', required=True,
metavar='FILE', help='Output .npz path')
args = ap.parse_args()
print(f'k={args.kmer_size} files={len(args.reads)}', file=sys.stderr)
counts = count_kmers(args.reads, args.kmer_size)
if args.min_abundance > 1:
before = len(counts)
counts = {k: v for k, v in counts.items() if v >= args.min_abundance}
print(f' min-abundance={args.min_abundance}: '
f'{before - len(counts):,} kmers dropped, '
f'{len(counts):,} retained',
file=sys.stderr)
print(f'Sorting and saving → {args.output}', file=sys.stderr)
kmers_arr = np.fromiter(sorted(counts), dtype=np.uint64, count=len(counts))
counts_arr = np.array([counts[int(k)] for k in kmers_arr], dtype=np.uint32)
np.savez_compressed(args.output, kmers=kmers_arr, counts=counts_arr)
print(f'Done {len(kmers_arr):,} kmers → {args.output}', file=sys.stderr)
if __name__ == '__main__':
main()
+39
View File
@@ -0,0 +1,39 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
SIMDATA_DIR="${SCRIPT_DIR}/simulated_data"
REF_DIR="${SCRIPT_DIR}/reference_index"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
BUILD_PY="${SCRIPT_DIR}/build_reference.py"
KMER_SIZE="${KMER_SIZE:-31}"
MIN_ABUNDANCE="${MIN_ABUNDANCE:-1}"
mkdir -p "${REF_DIR}"
for species_dir in "${SIMDATA_DIR}"/*/; do
[[ -d "${species_dir}" ]] || continue
species=$(basename "${species_dir}")
for strain_dir in "${species_dir}"*/; do
[[ -d "${strain_dir}" ]] || continue
strain=$(basename "${strain_dir}")
r1="${strain_dir}/reads_R1.fastq.gz"
r2="${strain_dir}/reads_R2.fastq.gz"
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
echo "SKIP ${species}--${strain}: reads not found" >&2
continue
fi
out="${REF_DIR}/${species}--${strain}.npz"
echo "[${species}--${strain}] → ${out}"
"${PYTHON}" "${BUILD_PY}" \
--kmer-size "${KMER_SIZE}" \
--min-abundance "${MIN_ABUNDANCE}" \
--output "${out}" \
"${r1}" "${r2}"
done
done
+226
View File
@@ -0,0 +1,226 @@
#!/usr/bin/env python3
"""Compute reference pairwise distance matrices from per-specimen .npz kmer indexes.
Reads all .npz files in reference_index/ (each containing sorted uint64 `kmers`
and uint32 `counts`), computes all distance metrics supported by `obikmer distance`,
and writes one CSV per metric to reference_dist/.
Output CSV format matches `obikmer distance --output`:
- first row: "genome", then specimen names
- subsequent rows: specimen name, then float or int values
Metrics written
jaccard_dist.csv Jaccard distance (presence/absence)
shared_kmers.csv Shared-kmer count matrix (intersection size)
bray_curtis_dist.csv Bray-Curtis dissimilarity (raw counts)
relfreq_bray_curtis_dist.csv Bray-Curtis on relative frequencies
euclidean_dist.csv Euclidean distance (raw counts)
relfreq_euclidean_dist.csv Euclidean distance on relative frequencies
hellinger_dist.csv Hellinger distance
hellinger_euclidean_dist.csv Euclidean distance in Hellinger space
"""
import argparse
import sys
from pathlib import Path
import numpy as np
# ── pairwise helpers ──────────────────────────────────────────────────────────
def shared_indices(a_kmers: np.ndarray, b_kmers: np.ndarray):
"""Return index arrays (idx_a, idx_b) for kmers present in both sets.
Both arrays must be sorted uint64. Uses searchsorted: O(|B| log |A|).
"""
pos = np.searchsorted(a_kmers, b_kmers)
pos = np.clip(pos, 0, len(a_kmers) - 1)
mask = a_kmers[pos] == b_kmers
idx_b = np.where(mask)[0]
idx_a = pos[idx_b]
return idx_a, idx_b
def pairwise_stats(specimens: list[dict]) -> dict[str, np.ndarray]:
"""Compute all pairwise distance matrices at once.
Returns a dict metric_name → ndarray (n×n float64 or int64).
Each specimen dict has keys: name, kmers, counts.
"""
n = len(specimens)
# Pre-compute per-specimen scalars
kmer_counts = np.array([len(s['kmers']) for s in specimens], dtype=np.uint64)
count_sums = np.array([s['counts'].sum() for s in specimens], dtype=np.uint64)
# Per-specimen sum-of-squares (for Euclidean decomposition)
sq_sums = np.array([(s['counts'].astype(np.float64) ** 2).sum() for s in specimens])
# Allocate output matrices
shared_mat = np.zeros((n, n), dtype=np.uint64)
hamming_mat = np.zeros((n, n), dtype=np.float64)
jaccard_mat = np.zeros((n, n), dtype=np.float64)
bray_mat = np.zeros((n, n), dtype=np.float64)
relfreq_bray = np.zeros((n, n), dtype=np.float64)
euclidean_mat = np.zeros((n, n), dtype=np.float64)
relfreq_eucl = np.zeros((n, n), dtype=np.float64)
hellinger_mat = np.zeros((n, n), dtype=np.float64)
hell_eucl_mat = np.zeros((n, n), dtype=np.float64)
for i in range(n):
a_km = specimens[i]['kmers']
a_ct = specimens[i]['counts'].astype(np.float64)
sa = float(count_sums[i])
na = int(kmer_counts[i])
for j in range(i + 1, n):
b_km = specimens[j]['kmers']
b_ct = specimens[j]['counts'].astype(np.float64)
sb = float(count_sums[j])
nb = int(kmer_counts[j])
idx_a, idx_b = shared_indices(a_km, b_km)
inter = len(idx_a)
ca_sh = a_ct[idx_a]
cb_sh = b_ct[idx_b]
# ── Presence metrics ──────────────────────────────────────────────
union = na + nb - inter
jac = (1.0 - inter / union) if union else 0.0
hamming = float(na + nb - 2 * inter) # |A Δ B|
# ── Count metrics ─────────────────────────────────────────────────
# Bray-Curtis: 1 - 2*Σmin(a,b) / (Σa + Σb)
sum_min = np.minimum(ca_sh, cb_sh).sum()
denom_bc = sa + sb
bc = (1.0 - 2.0 * sum_min / denom_bc) if denom_bc else 0.0
# RelfreqBray: 1 - Σmin(a/sa, b/sb) [only shared contribute]
if sa and sb:
rfb = 1.0 - np.minimum(ca_sh / sa, cb_sh / sb).sum()
else:
rfb = 0.0
# Euclidean: √(Σa² + Σb² - 2·Σ(a·b)_shared)
cross = (ca_sh * cb_sh).sum()
eucl_partial = sq_sums[i] + sq_sums[j] - 2.0 * cross
eucl = np.sqrt(max(eucl_partial, 0.0))
# RelfreqEuclidean: √(Σ(a/sa - b/sb)²)
# = √(Σa²/sa² + Σb²/sb² - 2·Σ(a·b)_shared/(sa·sb))
if sa and sb:
rf_cross = (ca_sh / sa * (cb_sh / sb)).sum()
rfe_partial = (sq_sums[i] / sa**2
+ sq_sums[j] / sb**2
- 2.0 * rf_cross)
rfe = np.sqrt(max(rfe_partial, 0.0))
else:
rfe = 0.0
# Hellinger partial: Σ(√(a/sa) - √(b/sb))² over global universe
# = 2 - 2·Σ√(a·b)_shared / √(sa·sb)
if sa and sb:
bc_coeff = np.sqrt(ca_sh * cb_sh).sum() / np.sqrt(sa * sb)
hell_partial = max(2.0 - 2.0 * bc_coeff, 0.0)
else:
hell_partial = 0.0
sq2 = np.sqrt(2.0)
hell = np.sqrt(hell_partial) / sq2
hell_euc = np.sqrt(hell_partial)
# ── Fill symmetric matrices ───────────────────────────────────────
for mat, val in [
(shared_mat, inter),
(hamming_mat, hamming),
(jaccard_mat, jac),
(bray_mat, bc),
(relfreq_bray, rfb),
(euclidean_mat, eucl),
(relfreq_eucl, rfe),
(hellinger_mat, hell),
(hell_eucl_mat, hell_euc),
]:
mat[i, j] = val
mat[j, i] = val
return {
'shared_kmers': shared_mat,
'hamming_dist': hamming_mat,
'jaccard_dist': jaccard_mat,
'bray_curtis_dist': bray_mat,
'relfreq_bray_curtis_dist': relfreq_bray,
'euclidean_dist': euclidean_mat,
'relfreq_euclidean_dist': relfreq_eucl,
'hellinger_dist': hellinger_mat,
'hellinger_euclidean_dist': hell_eucl_mat,
}
# ── I/O ───────────────────────────────────────────────────────────────────────
def write_csv(path: Path, labels: list[str], mat: np.ndarray, fmt: str) -> None:
with path.open('w') as fh:
fh.write('genome,' + ','.join(labels) + '\n')
for i, label in enumerate(labels):
row = ','.join(format(mat[i, j], fmt) for j in range(len(labels)))
fh.write(f'{label},{row}\n')
print(f'{path}', file=sys.stderr)
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('--ref-dir', default='reference_index',
help='Directory with per-specimen .npz files (default: reference_index)')
ap.add_argument('--out-dir', default='reference_dist',
help='Output directory for CSV files (default: reference_dist)')
args = ap.parse_args()
ref_dir = Path(args.ref_dir)
out_dir = Path(args.out_dir)
out_dir.mkdir(exist_ok=True)
npz_files = sorted(ref_dir.glob('*.npz'))
if not npz_files:
print(f'ERROR: no .npz files found in {ref_dir}', file=sys.stderr)
sys.exit(1)
print(f'Loading {len(npz_files)} specimen(s) from {ref_dir}/', file=sys.stderr)
specimens = []
for f in npz_files:
data = np.load(f)
specimens.append({
'name': f.stem,
'kmers': data['kmers'],
'counts': data['counts'],
})
print(f' {f.stem}: {len(data["kmers"]):,} kmers', file=sys.stderr)
labels = [s['name'] for s in specimens]
n = len(labels)
print(f'\nComputing pairwise distances for {n} specimens…', file=sys.stderr)
matrices = pairwise_stats(specimens)
print(f'\nWriting CSVs to {out_dir}/', file=sys.stderr)
write_csv(out_dir / 'shared_kmers.csv', labels, matrices['shared_kmers'], 'd')
write_csv(out_dir / 'hamming_dist.csv', labels, matrices['hamming_dist'], '.6f')
write_csv(out_dir / 'jaccard_dist.csv', labels, matrices['jaccard_dist'], '.6f')
write_csv(out_dir / 'bray_curtis_dist.csv', labels, matrices['bray_curtis_dist'], '.6f')
write_csv(out_dir / 'relfreq_bray_curtis_dist.csv', labels, matrices['relfreq_bray_curtis_dist'], '.6f')
write_csv(out_dir / 'euclidean_dist.csv', labels, matrices['euclidean_dist'], '.6f')
write_csv(out_dir / 'relfreq_euclidean_dist.csv', labels, matrices['relfreq_euclidean_dist'], '.6f')
write_csv(out_dir / 'hellinger_dist.csv', labels, matrices['hellinger_dist'], '.6f')
write_csv(out_dir / 'hellinger_euclidean_dist.csv', labels, matrices['hellinger_euclidean_dist'], '.6f')
print('\nDone.', file=sys.stderr)
if __name__ == '__main__':
main()
+182
View File
@@ -0,0 +1,182 @@
#!/usr/bin/env python3
"""Compare all reference distance matrices against obikmer distance outputs.
Reads from:
reference_dist/ — ground-truth matrices computed by build_reference_dist.py
obikmer_dist/ — matrices produced by `obikmer distance`
Handles label reordering: both matrices are sorted by genome label before
element-wise comparison, so column/row order differences are irrelevant.
Output: stats/dist_comparison/summary.csv
comparison,max_abs,mean_abs,rmse,n_pairs,status
"""
import csv
import sys
from pathlib import Path
import numpy as np
# ── CSV loading ───────────────────────────────────────────────────────────────
def load_matrix(path: Path) -> tuple[list[str], np.ndarray]:
"""Load a distance-matrix CSV; return (sorted_labels, matrix_float64)."""
with path.open() as fh:
reader = csv.reader(fh)
header = next(reader)[1:] # skip 'genome' column
raw: dict[str, list[float]] = {}
for row in reader:
raw[row[0]] = [float(x) for x in row[1:]]
label_to_col = {h: i for i, h in enumerate(header)}
labels = sorted(raw.keys())
n = len(labels)
mat = np.zeros((n, n), dtype=np.float64)
for i, ri in enumerate(labels):
for j, cj in enumerate(labels):
mat[i, j] = raw[ri][label_to_col[cj]]
return labels, mat
# ── comparison ────────────────────────────────────────────────────────────────
def compare(label: str,
ref_path: Path,
obi_path: Path,
tol: float = 1e-4) -> dict:
if not ref_path.exists():
return {'comparison': label, 'status': 'REF_MISSING',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
if not obi_path.exists():
return {'comparison': label, 'status': 'OBI_MISSING',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
ref_labels, ref_mat = load_matrix(ref_path)
obi_labels, obi_mat = load_matrix(obi_path)
if ref_labels != obi_labels:
only_ref = sorted(set(ref_labels) - set(obi_labels))
only_obi = sorted(set(obi_labels) - set(ref_labels))
print(f' [{label}] label mismatch — '
f'only_ref={only_ref} only_obi={only_obi}', file=sys.stderr)
return {'comparison': label, 'status': 'LABEL_MISMATCH',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
n = len(ref_labels)
# Off-diagonal mask
mask = ~np.eye(n, dtype=bool)
diff = np.abs(ref_mat[mask] - obi_mat[mask])
n_pairs = diff.size
max_abs = float(diff.max())
mean_abs = float(diff.mean())
rmse = float(np.sqrt((diff ** 2).mean()))
status = 'PASS' if max_abs <= tol else 'FAIL'
print(f' [{label}] n={n_pairs} '
f'max={max_abs:.3e} mean={mean_abs:.3e} rmse={rmse:.3e} {status}',
file=sys.stderr)
return {
'comparison': label,
'max_abs': f'{max_abs:.6e}',
'mean_abs': f'{mean_abs:.6e}',
'rmse': f'{rmse:.6e}',
'n_pairs': str(n_pairs),
'status': status,
}
# ── comparison table ──────────────────────────────────────────────────────────
# (label, ref_csv, obikmer_csv)
# The reference jaccard/shared is presence-based, which should match both
# presence/jaccard and count/jaccard (threshold=1).
COMPARISONS = [
# ── presence index ────────────────────────────────────────────────────────
('presence/jaccard_dist',
'reference_dist/jaccard_dist.csv',
'obikmer_dist/presence/jaccard_dist.csv'),
('presence/jaccard_shared',
'reference_dist/shared_kmers.csv',
'obikmer_dist/presence/jaccard_shared.csv'),
('presence/hamming_dist',
'reference_dist/hamming_dist.csv',
'obikmer_dist/presence/hamming_dist.csv'),
# ── count index (jaccard cross-check) ─────────────────────────────────────
('count/jaccard_dist',
'reference_dist/jaccard_dist.csv',
'obikmer_dist/count/jaccard_dist.csv'),
('count/jaccard_shared',
'reference_dist/shared_kmers.csv',
'obikmer_dist/count/jaccard_shared.csv'),
# ── count index (count-based metrics) ────────────────────────────────────
('count/bray_curtis_dist',
'reference_dist/bray_curtis_dist.csv',
'obikmer_dist/count/bray_curtis_dist.csv'),
('count/relfreq_bray_curtis_dist',
'reference_dist/relfreq_bray_curtis_dist.csv',
'obikmer_dist/count/relfreq_bray_curtis_dist.csv'),
('count/euclidean_dist',
'reference_dist/euclidean_dist.csv',
'obikmer_dist/count/euclidean_dist.csv'),
('count/relfreq_euclidean_dist',
'reference_dist/relfreq_euclidean_dist.csv',
'obikmer_dist/count/relfreq_euclidean_dist.csv'),
('count/hellinger_dist',
'reference_dist/hellinger_dist.csv',
'obikmer_dist/count/hellinger_dist.csv'),
('count/hellinger_euclidean_dist',
'reference_dist/hellinger_euclidean_dist.csv',
'obikmer_dist/count/hellinger_euclidean_dist.csv'),
]
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
import argparse
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('--tol', type=float, default=1e-4,
help='Max abs diff threshold for PASS/FAIL (default 1e-4)')
ap.add_argument('--out', default='stats/dist_comparison/summary.csv',
help='Output summary CSV path')
args = ap.parse_args()
out_path = Path(args.out)
out_path.parent.mkdir(parents=True, exist_ok=True)
print(f'Comparing {len(COMPARISONS)} matrix pairs…', file=sys.stderr)
rows = []
for label, ref, obi in COMPARISONS:
rows.append(compare(label, Path(ref), Path(obi), tol=args.tol))
fields = ['comparison', 'max_abs', 'mean_abs', 'rmse', 'n_pairs', 'status']
with out_path.open('w', newline='') as fh:
w = csv.DictWriter(fh, fieldnames=fields)
w.writeheader()
w.writerows(rows)
print(f'\n{out_path}', file=sys.stderr)
n_fail = sum(1 for r in rows if r.get('status') == 'FAIL')
n_pass = sum(1 for r in rows if r.get('status') == 'PASS')
print(f'Summary: {n_pass} PASS {n_fail} FAIL '
f'{len(rows) - n_pass - n_fail} SKIP', file=sys.stderr)
if n_fail:
sys.exit(1)
if __name__ == '__main__':
main()
+199
View File
@@ -0,0 +1,199 @@
SPECIMENS := Escherichia_coli--K-12_MG1655 Escherichia_coli--EDL933 Salmonella_enterica--LT2 Escherichia_coli--CFT073 Bacillus_subtilis--168 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Saccharolobus_islandicus--M.16.4 Acidobacterium_capsulatum--ATCC_51196 Salmonella_enterica--AKU_12601 Proteus_mirabilis--HI4320 Salmonella_enterica--CT18 Klebsiella_pneumoniae--HS11286 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Klebsiella_pneumoniae--ATCC_13883 Yersinia_ruckeri--YRB Candidozyma_auris--GCF_003013715.1_ASM301371v2
SPECIES := Escherichia_coli Salmonella_enterica Bacillus_subtilis Shouchella_clausii Klebsiella_pneumoniae Opitutus_terrae Saccharolobus_islandicus Acidobacterium_capsulatum Proteus_mirabilis Wolbachia_endosymbiont Yersinia_ruckeri Candidozyma_auris
# Escherichia_coli--K-12_MG1655
simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz: genomes/GCF_000005845.2_ASM584v2_genomic.fna.gz
reference_index/Escherichia_coli--K-12_MG1655.npz: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--K-12_MG1655/index.done stats/indexing_presence/Escherichia_coli--K-12_MG1655.stats: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--K-12_MG1655/index.done stats/indexing_count/Escherichia_coli--K-12_MG1655.stats: simulated_data/Escherichia_coli/K-12_MG1655/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--K-12_MG1655.stats: reference_index/Escherichia_coli--K-12_MG1655.npz specimen_index_presence/Escherichia_coli--K-12_MG1655/index.done
stats/verify_count/Escherichia_coli--K-12_MG1655.stats: reference_index/Escherichia_coli--K-12_MG1655.npz specimen_index_count/Escherichia_coli--K-12_MG1655/index.done
# Escherichia_coli--EDL933
simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz: genomes/GCF_000006665.1_ASM666v1_genomic.fna.gz
reference_index/Escherichia_coli--EDL933.npz: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--EDL933/index.done stats/indexing_presence/Escherichia_coli--EDL933.stats: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--EDL933/index.done stats/indexing_count/Escherichia_coli--EDL933.stats: simulated_data/Escherichia_coli/EDL933/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--EDL933.stats: reference_index/Escherichia_coli--EDL933.npz specimen_index_presence/Escherichia_coli--EDL933/index.done
stats/verify_count/Escherichia_coli--EDL933.stats: reference_index/Escherichia_coli--EDL933.npz specimen_index_count/Escherichia_coli--EDL933/index.done
# Salmonella_enterica--LT2
simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz: genomes/GCF_000006945.2_ASM694v2_genomic.fna.gz
reference_index/Salmonella_enterica--LT2.npz: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--LT2/index.done stats/indexing_presence/Salmonella_enterica--LT2.stats: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--LT2/index.done stats/indexing_count/Salmonella_enterica--LT2.stats: simulated_data/Salmonella_enterica/LT2/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--LT2.stats: reference_index/Salmonella_enterica--LT2.npz specimen_index_presence/Salmonella_enterica--LT2/index.done
stats/verify_count/Salmonella_enterica--LT2.stats: reference_index/Salmonella_enterica--LT2.npz specimen_index_count/Salmonella_enterica--LT2/index.done
# Escherichia_coli--CFT073
simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz: genomes/GCF_000007445.1_ASM744v1_genomic.fna.gz
reference_index/Escherichia_coli--CFT073.npz: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--CFT073/index.done stats/indexing_presence/Escherichia_coli--CFT073.stats: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--CFT073/index.done stats/indexing_count/Escherichia_coli--CFT073.stats: simulated_data/Escherichia_coli/CFT073/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--CFT073.stats: reference_index/Escherichia_coli--CFT073.npz specimen_index_presence/Escherichia_coli--CFT073/index.done
stats/verify_count/Escherichia_coli--CFT073.stats: reference_index/Escherichia_coli--CFT073.npz specimen_index_count/Escherichia_coli--CFT073/index.done
# Bacillus_subtilis--168
simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz: genomes/GCF_000009045.1_ASM904v1_genomic.fna.gz
reference_index/Bacillus_subtilis--168.npz: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
specimen_index_presence/Bacillus_subtilis--168/index.done stats/indexing_presence/Bacillus_subtilis--168.stats: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
specimen_index_count/Bacillus_subtilis--168/index.done stats/indexing_count/Bacillus_subtilis--168.stats: simulated_data/Bacillus_subtilis/168/reads_R1.fastq.gz
stats/verify_presence/Bacillus_subtilis--168.stats: reference_index/Bacillus_subtilis--168.npz specimen_index_presence/Bacillus_subtilis--168/index.done
stats/verify_count/Bacillus_subtilis--168.stats: reference_index/Bacillus_subtilis--168.npz specimen_index_count/Bacillus_subtilis--168/index.done
# Salmonella_enterica--P125109
simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz: genomes/GCF_000009505.1_ASM950v1_genomic.fna.gz
reference_index/Salmonella_enterica--P125109.npz: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--P125109/index.done stats/indexing_presence/Salmonella_enterica--P125109.stats: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--P125109/index.done stats/indexing_count/Salmonella_enterica--P125109.stats: simulated_data/Salmonella_enterica/P125109/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--P125109.stats: reference_index/Salmonella_enterica--P125109.npz specimen_index_presence/Salmonella_enterica--P125109/index.done
stats/verify_count/Salmonella_enterica--P125109.stats: reference_index/Salmonella_enterica--P125109.npz specimen_index_count/Salmonella_enterica--P125109/index.done
# Shouchella_clausii--KSM-K16
simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz: genomes/GCF_000009825.1_ASM982v1_genomic.fna.gz
reference_index/Shouchella_clausii--KSM-K16.npz: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
specimen_index_presence/Shouchella_clausii--KSM-K16/index.done stats/indexing_presence/Shouchella_clausii--KSM-K16.stats: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
specimen_index_count/Shouchella_clausii--KSM-K16/index.done stats/indexing_count/Shouchella_clausii--KSM-K16.stats: simulated_data/Shouchella_clausii/KSM-K16/reads_R1.fastq.gz
stats/verify_presence/Shouchella_clausii--KSM-K16.stats: reference_index/Shouchella_clausii--KSM-K16.npz specimen_index_presence/Shouchella_clausii--KSM-K16/index.done
stats/verify_count/Shouchella_clausii--KSM-K16.stats: reference_index/Shouchella_clausii--KSM-K16.npz specimen_index_count/Shouchella_clausii--KSM-K16/index.done
# Escherichia_coli--K-12_W3110
simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz: genomes/GCF_000010245.2_ASM1024v1_genomic.fna.gz
reference_index/Escherichia_coli--K-12_W3110.npz: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
specimen_index_presence/Escherichia_coli--K-12_W3110/index.done stats/indexing_presence/Escherichia_coli--K-12_W3110.stats: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
specimen_index_count/Escherichia_coli--K-12_W3110/index.done stats/indexing_count/Escherichia_coli--K-12_W3110.stats: simulated_data/Escherichia_coli/K-12_W3110/reads_R1.fastq.gz
stats/verify_presence/Escherichia_coli--K-12_W3110.stats: reference_index/Escherichia_coli--K-12_W3110.npz specimen_index_presence/Escherichia_coli--K-12_W3110/index.done
stats/verify_count/Escherichia_coli--K-12_W3110.stats: reference_index/Escherichia_coli--K-12_W3110.npz specimen_index_count/Escherichia_coli--K-12_W3110/index.done
# Klebsiella_pneumoniae--MGH_78578
simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz: genomes/GCF_000016305.1_ASM1630v1_genomic.fna.gz
reference_index/Klebsiella_pneumoniae--MGH_78578.npz: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
specimen_index_presence/Klebsiella_pneumoniae--MGH_78578/index.done stats/indexing_presence/Klebsiella_pneumoniae--MGH_78578.stats: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
specimen_index_count/Klebsiella_pneumoniae--MGH_78578/index.done stats/indexing_count/Klebsiella_pneumoniae--MGH_78578.stats: simulated_data/Klebsiella_pneumoniae/MGH_78578/reads_R1.fastq.gz
stats/verify_presence/Klebsiella_pneumoniae--MGH_78578.stats: reference_index/Klebsiella_pneumoniae--MGH_78578.npz specimen_index_presence/Klebsiella_pneumoniae--MGH_78578/index.done
stats/verify_count/Klebsiella_pneumoniae--MGH_78578.stats: reference_index/Klebsiella_pneumoniae--MGH_78578.npz specimen_index_count/Klebsiella_pneumoniae--MGH_78578/index.done
# Opitutus_terrae--PB90-1
simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz: genomes/GCF_000019965.1_ASM1996v1_genomic.fna.gz
reference_index/Opitutus_terrae--PB90-1.npz: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
specimen_index_presence/Opitutus_terrae--PB90-1/index.done stats/indexing_presence/Opitutus_terrae--PB90-1.stats: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
specimen_index_count/Opitutus_terrae--PB90-1/index.done stats/indexing_count/Opitutus_terrae--PB90-1.stats: simulated_data/Opitutus_terrae/PB90-1/reads_R1.fastq.gz
stats/verify_presence/Opitutus_terrae--PB90-1.stats: reference_index/Opitutus_terrae--PB90-1.npz specimen_index_presence/Opitutus_terrae--PB90-1/index.done
stats/verify_count/Opitutus_terrae--PB90-1.stats: reference_index/Opitutus_terrae--PB90-1.npz specimen_index_count/Opitutus_terrae--PB90-1/index.done
# Saccharolobus_islandicus--M.16.4
simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz: genomes/GCF_000022445.1_ASM2244v1_genomic.fna.gz
reference_index/Saccharolobus_islandicus--M.16.4.npz: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
specimen_index_presence/Saccharolobus_islandicus--M.16.4/index.done stats/indexing_presence/Saccharolobus_islandicus--M.16.4.stats: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
specimen_index_count/Saccharolobus_islandicus--M.16.4/index.done stats/indexing_count/Saccharolobus_islandicus--M.16.4.stats: simulated_data/Saccharolobus_islandicus/M.16.4/reads_R1.fastq.gz
stats/verify_presence/Saccharolobus_islandicus--M.16.4.stats: reference_index/Saccharolobus_islandicus--M.16.4.npz specimen_index_presence/Saccharolobus_islandicus--M.16.4/index.done
stats/verify_count/Saccharolobus_islandicus--M.16.4.stats: reference_index/Saccharolobus_islandicus--M.16.4.npz specimen_index_count/Saccharolobus_islandicus--M.16.4/index.done
# Acidobacterium_capsulatum--ATCC_51196
simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz: genomes/GCF_000022565.1_ASM2256v1_genomic.fna.gz
reference_index/Acidobacterium_capsulatum--ATCC_51196.npz: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
specimen_index_presence/Acidobacterium_capsulatum--ATCC_51196/index.done stats/indexing_presence/Acidobacterium_capsulatum--ATCC_51196.stats: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
specimen_index_count/Acidobacterium_capsulatum--ATCC_51196/index.done stats/indexing_count/Acidobacterium_capsulatum--ATCC_51196.stats: simulated_data/Acidobacterium_capsulatum/ATCC_51196/reads_R1.fastq.gz
stats/verify_presence/Acidobacterium_capsulatum--ATCC_51196.stats: reference_index/Acidobacterium_capsulatum--ATCC_51196.npz specimen_index_presence/Acidobacterium_capsulatum--ATCC_51196/index.done
stats/verify_count/Acidobacterium_capsulatum--ATCC_51196.stats: reference_index/Acidobacterium_capsulatum--ATCC_51196.npz specimen_index_count/Acidobacterium_capsulatum--ATCC_51196/index.done
# Salmonella_enterica--AKU_12601
simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz: genomes/GCF_000026565.1_ASM2656v1_genomic.fna.gz
reference_index/Salmonella_enterica--AKU_12601.npz: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--AKU_12601/index.done stats/indexing_presence/Salmonella_enterica--AKU_12601.stats: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--AKU_12601/index.done stats/indexing_count/Salmonella_enterica--AKU_12601.stats: simulated_data/Salmonella_enterica/AKU_12601/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--AKU_12601.stats: reference_index/Salmonella_enterica--AKU_12601.npz specimen_index_presence/Salmonella_enterica--AKU_12601/index.done
stats/verify_count/Salmonella_enterica--AKU_12601.stats: reference_index/Salmonella_enterica--AKU_12601.npz specimen_index_count/Salmonella_enterica--AKU_12601/index.done
# Proteus_mirabilis--HI4320
simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz: genomes/GCF_000069965.1_ASM6996v1_genomic.fna.gz
reference_index/Proteus_mirabilis--HI4320.npz: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
specimen_index_presence/Proteus_mirabilis--HI4320/index.done stats/indexing_presence/Proteus_mirabilis--HI4320.stats: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
specimen_index_count/Proteus_mirabilis--HI4320/index.done stats/indexing_count/Proteus_mirabilis--HI4320.stats: simulated_data/Proteus_mirabilis/HI4320/reads_R1.fastq.gz
stats/verify_presence/Proteus_mirabilis--HI4320.stats: reference_index/Proteus_mirabilis--HI4320.npz specimen_index_presence/Proteus_mirabilis--HI4320/index.done
stats/verify_count/Proteus_mirabilis--HI4320.stats: reference_index/Proteus_mirabilis--HI4320.npz specimen_index_count/Proteus_mirabilis--HI4320/index.done
# Salmonella_enterica--CT18
simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz: genomes/GCF_000195995.1_ASM19599v1_genomic.fna.gz
reference_index/Salmonella_enterica--CT18.npz: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
specimen_index_presence/Salmonella_enterica--CT18/index.done stats/indexing_presence/Salmonella_enterica--CT18.stats: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
specimen_index_count/Salmonella_enterica--CT18/index.done stats/indexing_count/Salmonella_enterica--CT18.stats: simulated_data/Salmonella_enterica/CT18/reads_R1.fastq.gz
stats/verify_presence/Salmonella_enterica--CT18.stats: reference_index/Salmonella_enterica--CT18.npz specimen_index_presence/Salmonella_enterica--CT18/index.done
stats/verify_count/Salmonella_enterica--CT18.stats: reference_index/Salmonella_enterica--CT18.npz specimen_index_count/Salmonella_enterica--CT18/index.done
# Klebsiella_pneumoniae--HS11286
simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz: genomes/GCF_000240185.1_ASM24018v2_genomic.fna.gz
reference_index/Klebsiella_pneumoniae--HS11286.npz: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
specimen_index_presence/Klebsiella_pneumoniae--HS11286/index.done stats/indexing_presence/Klebsiella_pneumoniae--HS11286.stats: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
specimen_index_count/Klebsiella_pneumoniae--HS11286/index.done stats/indexing_count/Klebsiella_pneumoniae--HS11286.stats: simulated_data/Klebsiella_pneumoniae/HS11286/reads_R1.fastq.gz
stats/verify_presence/Klebsiella_pneumoniae--HS11286.stats: reference_index/Klebsiella_pneumoniae--HS11286.npz specimen_index_presence/Klebsiella_pneumoniae--HS11286/index.done
stats/verify_count/Klebsiella_pneumoniae--HS11286.stats: reference_index/Klebsiella_pneumoniae--HS11286.npz specimen_index_count/Klebsiella_pneumoniae--HS11286/index.done
# Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1
simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz: genomes/GCF_000306885.1_ASM30688v1_genomic.fna.gz
reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
specimen_index_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done stats/indexing_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
specimen_index_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done stats/indexing_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: simulated_data/Wolbachia_endosymbiont/GCF_000306885.1_ASM30688v1/reads_R1.fastq.gz
stats/verify_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz specimen_index_presence/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done
stats/verify_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.stats: reference_index/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1.npz specimen_index_count/Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1/index.done
# Klebsiella_pneumoniae--ATCC_13883
simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz: genomes/GCF_000742135.1_ASM74213v1_genomic.fna.gz
reference_index/Klebsiella_pneumoniae--ATCC_13883.npz: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
specimen_index_presence/Klebsiella_pneumoniae--ATCC_13883/index.done stats/indexing_presence/Klebsiella_pneumoniae--ATCC_13883.stats: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
specimen_index_count/Klebsiella_pneumoniae--ATCC_13883/index.done stats/indexing_count/Klebsiella_pneumoniae--ATCC_13883.stats: simulated_data/Klebsiella_pneumoniae/ATCC_13883/reads_R1.fastq.gz
stats/verify_presence/Klebsiella_pneumoniae--ATCC_13883.stats: reference_index/Klebsiella_pneumoniae--ATCC_13883.npz specimen_index_presence/Klebsiella_pneumoniae--ATCC_13883/index.done
stats/verify_count/Klebsiella_pneumoniae--ATCC_13883.stats: reference_index/Klebsiella_pneumoniae--ATCC_13883.npz specimen_index_count/Klebsiella_pneumoniae--ATCC_13883/index.done
# Yersinia_ruckeri--YRB
simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz: genomes/GCF_000834255.1_ASM83425v1_genomic.fna.gz
reference_index/Yersinia_ruckeri--YRB.npz: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
specimen_index_presence/Yersinia_ruckeri--YRB/index.done stats/indexing_presence/Yersinia_ruckeri--YRB.stats: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
specimen_index_count/Yersinia_ruckeri--YRB/index.done stats/indexing_count/Yersinia_ruckeri--YRB.stats: simulated_data/Yersinia_ruckeri/YRB/reads_R1.fastq.gz
stats/verify_presence/Yersinia_ruckeri--YRB.stats: reference_index/Yersinia_ruckeri--YRB.npz specimen_index_presence/Yersinia_ruckeri--YRB/index.done
stats/verify_count/Yersinia_ruckeri--YRB.stats: reference_index/Yersinia_ruckeri--YRB.npz specimen_index_count/Yersinia_ruckeri--YRB/index.done
# Candidozyma_auris--GCF_003013715.1_ASM301371v2
simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz: genomes/GCF_003013715.1_ASM301371v2_genomic.fna.gz
reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
specimen_index_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done stats/indexing_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
specimen_index_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done stats/indexing_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: simulated_data/Candidozyma_auris/GCF_003013715.1_ASM301371v2/reads_R1.fastq.gz
stats/verify_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz specimen_index_presence/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done
stats/verify_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2.stats: reference_index/Candidozyma_auris--GCF_003013715.1_ASM301371v2.npz specimen_index_count/Candidozyma_auris--GCF_003013715.1_ASM301371v2/index.done
# Escherichia_coli
specific_index_presence/Escherichia_coli/index.done stats/specific_kmer_presence/Escherichia_coli.stats: global_index_presence/index.done
specific_index_count/Escherichia_coli/index.done stats/specific_kmer_count/Escherichia_coli.stats: global_index_count/index.done
# Salmonella_enterica
specific_index_presence/Salmonella_enterica/index.done stats/specific_kmer_presence/Salmonella_enterica.stats: global_index_presence/index.done
specific_index_count/Salmonella_enterica/index.done stats/specific_kmer_count/Salmonella_enterica.stats: global_index_count/index.done
# Bacillus_subtilis
specific_index_presence/Bacillus_subtilis/index.done stats/specific_kmer_presence/Bacillus_subtilis.stats: global_index_presence/index.done
specific_index_count/Bacillus_subtilis/index.done stats/specific_kmer_count/Bacillus_subtilis.stats: global_index_count/index.done
# Shouchella_clausii
specific_index_presence/Shouchella_clausii/index.done stats/specific_kmer_presence/Shouchella_clausii.stats: global_index_presence/index.done
specific_index_count/Shouchella_clausii/index.done stats/specific_kmer_count/Shouchella_clausii.stats: global_index_count/index.done
# Klebsiella_pneumoniae
specific_index_presence/Klebsiella_pneumoniae/index.done stats/specific_kmer_presence/Klebsiella_pneumoniae.stats: global_index_presence/index.done
specific_index_count/Klebsiella_pneumoniae/index.done stats/specific_kmer_count/Klebsiella_pneumoniae.stats: global_index_count/index.done
# Opitutus_terrae
specific_index_presence/Opitutus_terrae/index.done stats/specific_kmer_presence/Opitutus_terrae.stats: global_index_presence/index.done
specific_index_count/Opitutus_terrae/index.done stats/specific_kmer_count/Opitutus_terrae.stats: global_index_count/index.done
# Saccharolobus_islandicus
specific_index_presence/Saccharolobus_islandicus/index.done stats/specific_kmer_presence/Saccharolobus_islandicus.stats: global_index_presence/index.done
specific_index_count/Saccharolobus_islandicus/index.done stats/specific_kmer_count/Saccharolobus_islandicus.stats: global_index_count/index.done
# Acidobacterium_capsulatum
specific_index_presence/Acidobacterium_capsulatum/index.done stats/specific_kmer_presence/Acidobacterium_capsulatum.stats: global_index_presence/index.done
specific_index_count/Acidobacterium_capsulatum/index.done stats/specific_kmer_count/Acidobacterium_capsulatum.stats: global_index_count/index.done
# Proteus_mirabilis
specific_index_presence/Proteus_mirabilis/index.done stats/specific_kmer_presence/Proteus_mirabilis.stats: global_index_presence/index.done
specific_index_count/Proteus_mirabilis/index.done stats/specific_kmer_count/Proteus_mirabilis.stats: global_index_count/index.done
# Wolbachia_endosymbiont
specific_index_presence/Wolbachia_endosymbiont/index.done stats/specific_kmer_presence/Wolbachia_endosymbiont.stats: global_index_presence/index.done
specific_index_count/Wolbachia_endosymbiont/index.done stats/specific_kmer_count/Wolbachia_endosymbiont.stats: global_index_count/index.done
# Yersinia_ruckeri
specific_index_presence/Yersinia_ruckeri/index.done stats/specific_kmer_presence/Yersinia_ruckeri.stats: global_index_presence/index.done
specific_index_count/Yersinia_ruckeri/index.done stats/specific_kmer_count/Yersinia_ruckeri.stats: global_index_count/index.done
# Candidozyma_auris
specific_index_presence/Candidozyma_auris/index.done stats/specific_kmer_presence/Candidozyma_auris.stats: global_index_presence/index.done
specific_index_count/Candidozyma_auris/index.done stats/specific_kmer_count/Candidozyma_auris.stats: global_index_count/index.done
+48
View File
@@ -0,0 +1,48 @@
#!/usr/bin/env bash
set -euo pipefail
assemblies=(
GCF_000005845.2
GCF_000010245.2
GCF_000007445.1
GCF_000006665.1
GCF_000006945.2
GCF_000195995.1
GCF_000009505.1
GCF_000026565.1
GCF_000016305.1
GCF_000019965.1
GCF_000240185.1
GCF_000742135.1
GCF_000069965.1
GCF_000022565.1
GCF_000306885.1
GCF_003013715.1
GCF_000009045.1
GCF_000009825.1
GCF_000022445.1
GCF_000834255.1
)
mkdir -p genomes
for acc in "${assemblies[@]}"; do
echo "Downloading ${acc}"
datasets download genome accession "${acc}" \
--include genome \
--filename "${acc}.zip"
unzip -q "${acc}.zip" -d "${acc}"
find "${acc}" -name "*.fna" |
while read file; do
obiconvert -Z ${file} >genomes/$(basename ${file}).gz
done
rm -rf "${acc}" "${acc}.zip"
done
+108
View File
@@ -0,0 +1,108 @@
#!/usr/bin/env bash
# Usage: filter_one_count.sh SPECIES
# Filters global_index_count to keep only kmers specific to SPECIES,
# then selects the SPECIES column in-place.
# Outputs:
# specific_index_count/SPECIES/index.done (written by obikmer select)
# stats/specific_kmer_count/SPECIES.stats (one CSV data row, no header)
set -euo pipefail
SPECIES="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
SOURCE="${SCRIPT_DIR}/global_index_count"
OUTPUT="${SCRIPT_DIR}/specific_index_count/${SPECIES}"
STATS_DIR="${SCRIPT_DIR}/stats/specific_kmer_count"
STATS_FILE="${STATS_DIR}/${SPECIES}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIES}] filter (count) → ${OUTPUT}"
LOG_FILTER=$(mktemp)
LOG_SELECT=$(mktemp)
trap 'rm -f "${LOG_FILTER}" "${LOG_SELECT}"' EXIT
"${BINARY}" filter \
--output "${OUTPUT}" \
--force \
--ingroup "species=${SPECIES}" \
--outgroup all \
--min-frac 0.5 \
--max-frac 1.0 \
--max-outgroup-count 0 \
"${SOURCE}" \
2>"${LOG_FILTER}"
cat "${LOG_FILTER}" >&2
"${BINARY}" select \
--in-place \
--group "${SPECIES}:species=${SPECIES}" \
--group-op "${SPECIES}:any" \
--select "${SPECIES}" \
"${OUTPUT}" \
2>"${LOG_SELECT}"
cat "${LOG_SELECT}" >&2
python3 - "${SPECIES}" "${LOG_FILTER}" "${LOG_SELECT}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, log_filter, log_select = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
def parse_reporter(logfile):
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats['TOTAL'] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
return stats
f = parse_reporter(log_filter)
s = parse_reporter(log_select)
row = [species]
for stage, d in [('rebuild', f), ('pack', f), ('filter_total', f), ('select', s), ('select_total', s)]:
key = 'TOTAL' if stage.endswith('_total') else stage
w, r = d.get(key, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
print(','.join(row))
PYEOF
+108
View File
@@ -0,0 +1,108 @@
#!/usr/bin/env bash
# Usage: filter_one_presence.sh SPECIES
# Filters global_index_presence to keep only kmers specific to SPECIES,
# then selects the SPECIES column in-place.
# Outputs:
# specific_index_presence/SPECIES/index.done (written by obikmer select)
# stats/specific_kmer_presence/SPECIES.stats (one CSV data row, no header)
set -euo pipefail
SPECIES="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
SOURCE="${SCRIPT_DIR}/global_index_presence"
OUTPUT="${SCRIPT_DIR}/specific_index_presence/${SPECIES}"
STATS_DIR="${SCRIPT_DIR}/stats/specific_kmer_presence"
STATS_FILE="${STATS_DIR}/${SPECIES}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIES}] filter (presence) → ${OUTPUT}"
LOG_FILTER=$(mktemp)
LOG_SELECT=$(mktemp)
trap 'rm -f "${LOG_FILTER}" "${LOG_SELECT}"' EXIT
"${BINARY}" filter \
--output "${OUTPUT}" \
--force \
--ingroup "species=${SPECIES}" \
--outgroup all \
--min-frac 0.5 \
--max-frac 1.0 \
--max-outgroup-count 0 \
"${SOURCE}" \
2>"${LOG_FILTER}"
cat "${LOG_FILTER}" >&2
"${BINARY}" select \
--in-place \
--group "${SPECIES}:species=${SPECIES}" \
--group-op "${SPECIES}:any" \
--select "${SPECIES}" \
"${OUTPUT}" \
2>"${LOG_SELECT}"
cat "${LOG_SELECT}" >&2
python3 - "${SPECIES}" "${LOG_FILTER}" "${LOG_SELECT}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, log_filter, log_select = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
def parse_reporter(logfile):
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats['TOTAL'] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
return stats
f = parse_reporter(log_filter)
s = parse_reporter(log_select)
row = [species]
for stage, d in [('rebuild', f), ('pack', f), ('filter_total', f), ('select', s), ('select_total', s)]:
key = 'TOTAL' if stage.endswith('_total') else stage
w, r = d.get(key, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
print(','.join(row))
PYEOF
+103
View File
@@ -0,0 +1,103 @@
#!/usr/bin/env bash
# Usage: index_one_count.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Outputs:
# specimen_index_count/SPECIMEN/index.done (written by obikmer)
# stats/indexing_count/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
READS_DIR="${SCRIPT_DIR}/simulated_data/${species}/${strain}"
INDEX_PATH="${SCRIPT_DIR}/specimen_index_count/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/indexing_count"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
r1="${READS_DIR}/reads_R1.fastq.gz"
r2="${READS_DIR}/reads_R2.fastq.gz"
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
echo "ERROR: reads not found in ${READS_DIR}" >&2
exit 1
fi
echo "[${SPECIMEN}] indexing (count) → ${INDEX_PATH}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" index \
--output "${INDEX_PATH}" \
--force \
--theta 0 \
--with-counts \
--label "${SPECIMEN}" \
--meta "species=${species}" \
"${r1}" "${r2}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
python3 - "${species}" "${strain}" "${STDERR_LOG}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, strain, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['scatter', 'dereplicate', 'count_kmer', 'index']
row = [species, strain]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
+102
View File
@@ -0,0 +1,102 @@
#!/usr/bin/env bash
# Usage: index_one_presence.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Outputs:
# specimen_index_presence/SPECIMEN/index.done (written by obikmer)
# stats/indexing_presence/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
READS_DIR="${SCRIPT_DIR}/simulated_data/${species}/${strain}"
INDEX_PATH="${SCRIPT_DIR}/specimen_index_presence/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/indexing_presence"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
r1="${READS_DIR}/reads_R1.fastq.gz"
r2="${READS_DIR}/reads_R2.fastq.gz"
if [[ ! -f "${r1}" || ! -f "${r2}" ]]; then
echo "ERROR: reads not found in ${READS_DIR}" >&2
exit 1
fi
echo "[${SPECIMEN}] indexing (presence) → ${INDEX_PATH}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" index \
--output "${INDEX_PATH}" \
--force \
--theta 0 \
--label "${SPECIMEN}" \
--meta "species=${species}" \
"${r1}" "${r2}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
python3 - "${species}" "${strain}" "${STDERR_LOG}" <<'PYEOF' >"${STATS_FILE}"
import sys, re
species, strain, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s): state = 'rows'
elif state == 'rows':
if is_sep(s): state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['scatter', 'dereplicate', 'count_kmer', 'index']
row = [species, strain]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
+118
View File
@@ -0,0 +1,118 @@
#!/usr/bin/env python3
"""Generate deps.mk — pure dependency declarations for the benchmark pipeline.
Like C .d files: only target: prerequisites lines, no recipes.
Recipes stay in the Makefile as generic rules.
"""
import gzip
import re
import sys
from pathlib import Path
STOP_WORDS = {'complete', 'chromosome', 'whole', 'sequence', 'genome',
'endosymbiont', 'of'}
STOP_PREFIXES = ('scaffold', 'contig', 'plasmid')
def is_stop(tok):
t = tok.lower()
return t in STOP_WORDS or any(t.startswith(p) for p in STOP_PREFIXES)
def sanitize(s):
return re.sub(r'[^A-Za-z0-9._-]', '_', s).strip('_')
def collect_tokens(text):
parts = []
for tok in text.split():
tok = tok.rstrip(',.')
if is_stop(tok):
break
parts.append(sanitize(tok))
return '_'.join(filter(None, parts))
def parse_organism(defn, gcf_id):
words = defn.split()
species = sanitize(words[0] + '_' + words[1])
m = re.search(r'\bstr\.\s+(\S+)(?:\s+substr\.\s+(\S+))?', defn)
if m:
strain = sanitize(m.group(1))
if m.group(2):
strain += '_' + sanitize(m.group(2))
return species, strain
m = re.search(r'\bstrain\b\s+(.*)', defn)
if m:
strain = collect_tokens(m.group(1))
if strain:
return species, strain
remainder = re.sub(r'^\S+ \S+\s*', '', defn)
remainder = re.sub(r'^subsp\.\s+\S+\s*', '', remainder)
remainder = re.sub(r'^serovar\s+\S+\s*', '', remainder)
strain = collect_tokens(remainder)
return species, strain if strain else gcf_id
def first_definition(path):
with gzip.open(path, 'rt') as fh:
for line in fh:
if line.startswith('>'):
m = re.search(r'"definition":"([^"]*)"', line)
return m.group(1) if m else line[1:].split()[0]
return Path(path).stem
def main():
entries = [] # (specimen, species, sim_dir, genome_path)
species_seen = []
for path in sorted(sys.argv[1:]):
gcf_id = Path(path).name.replace('_genomic.fna.gz', '')
defn = first_definition(path)
sp, st = parse_organism(defn, gcf_id)
specimen = f'{sp}--{st}'
sim_dir = f'simulated_data/{sp}/{st}'
entries.append((specimen, sp, sim_dir, path))
if sp not in species_seen:
species_seen.append(sp)
specimens = [e[0] for e in entries]
print('SPECIMENS :=', ' '.join(specimens))
print('SPECIES :=', ' '.join(species_seen))
for specimen, species, sim_dir, genome in entries:
reads = f'{sim_dir}/reads_R1.fastq.gz'
p_done = f'specimen_index_presence/{specimen}/index.done'
p_stats = f'stats/indexing_presence/{specimen}.stats'
c_done = f'specimen_index_count/{specimen}/index.done'
c_stats = f'stats/indexing_count/{specimen}.stats'
ref = f'reference_index/{specimen}.npz'
vp = f'stats/verify_presence/{specimen}.stats'
vc = f'stats/verify_count/{specimen}.stats'
print()
print(f'# {specimen}')
print(f'{reads}: {genome}')
print(f'{ref}: {reads}')
print(f'{p_done} {p_stats}: {reads}')
print(f'{c_done} {c_stats}: {reads}')
print(f'{vp}: {ref} {p_done}')
print(f'{vc}: {ref} {c_done}')
print()
for sp in species_seen:
sp_done = f'specific_index_presence/{sp}/index.done'
sp_stats = f'stats/specific_kmer_presence/{sp}.stats'
sc_done = f'specific_index_count/{sp}/index.done'
sc_stats = f'stats/specific_kmer_count/{sp}.stats'
print(f'# {sp}')
print(f'{sp_done} {sp_stats}: global_index_presence/index.done')
print(f'{sc_done} {sc_stats}: global_index_count/index.done')
if __name__ == '__main__':
main()
+103
View File
@@ -0,0 +1,103 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
IDX_DIR="${SCRIPT_DIR}/specimen_index_count"
OUTPUT="${SCRIPT_DIR}/global_index_count"
STATS_DIR="${SCRIPT_DIR}/stats/merge_count"
mkdir -p "${STATS_DIR}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' | wc -l | tr -d ' ')")
CSV="${STATS_DIR}/run_${run_n}.csv"
printf 'run,n_sources,bootstrap_wall_s,bootstrap_rss_b,spectrums_wall_s,spectrums_rss_b,merge_partitions_wall_s,merge_partitions_rss_b,pack_wall_s,pack_rss_b,total_wall_s,total_rss_b\n' >"${CSV}"
parse_reporter() {
local run="$1" n_sources="$2" logfile="$3"
python3 - "$run" "$n_sources" "$logfile" <<'PYEOF'
import sys, re
run, n_sources, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s):
state = 'rows'
elif state == 'rows':
if is_sep(s):
state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['bootstrap', 'spectrums', 'merge_partitions', 'pack']
row = [run, n_sources]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
}
mapfile -t sources < <(find "${IDX_DIR}" -mindepth 1 -maxdepth 1 -type d | sort)
if [[ ${#sources[@]} -eq 0 ]]; then
echo "ERROR: no indexes found in ${IDX_DIR}" >&2
exit 1
fi
echo "Merging ${#sources[@]} count indexes → ${OUTPUT}"
printf ' %s\n' "${sources[@]}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" merge \
--output "${OUTPUT}" \
--force \
"${sources[@]}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
parse_reporter "${run_n}" "${#sources[@]}" "${STDERR_LOG}" >>"${CSV}"
echo "Done. Run ${run_n}${CSV}"
+104
View File
@@ -0,0 +1,104 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
IDX_DIR="${SCRIPT_DIR}/specimen_index_presence"
OUTPUT="${SCRIPT_DIR}/global_index_presence"
STATS_DIR="${SCRIPT_DIR}/stats/merge_presence"
mkdir -p "${STATS_DIR}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'run_*.csv' | wc -l | tr -d ' ')")
CSV="${STATS_DIR}/run_${run_n}.csv"
printf 'run,n_sources,bootstrap_wall_s,bootstrap_rss_b,spectrums_wall_s,spectrums_rss_b,merge_partitions_wall_s,merge_partitions_rss_b,pack_wall_s,pack_rss_b,total_wall_s,total_rss_b\n' >"${CSV}"
parse_reporter() {
local run="$1" n_sources="$2" logfile="$3"
python3 - "$run" "$n_sources" "$logfile" <<'PYEOF'
import sys, re
run, n_sources, logfile = sys.argv[1], sys.argv[2], sys.argv[3]
def strip_ansi(s):
return re.sub(r'\x1b\[[\x30-\x3f]*[\x20-\x2f]*[\x40-\x7e]', '', s)
def parse_wall(s):
s = s.strip()
if s.endswith('ms'): return float(s[:-2]) / 1000.0
if s.endswith('s'): return float(s[:-1])
return 0.0
def parse_rss(s):
m = re.match(r'([\d.]+)\s*(GB|MB|KB|B)', s.strip())
if not m: return 0
return int(float(m.group(1)) * {'GB': 1<<30, 'MB': 1<<20, 'KB': 1024, 'B': 1}[m.group(2)])
def is_sep(s):
return bool(s) and not re.search(r'[A-Za-z0-9]', s)
stats = {}
state = 'scan'
with open(logfile, errors='replace') as fh:
for raw in fh:
line = strip_ansi(raw.rstrip('\n'))
s = line.strip()
if state == 'scan':
if re.search(r'\bstage\b.*\bwall\b', line):
state = 'in_header'
elif state == 'in_header':
if is_sep(s):
state = 'rows'
elif state == 'rows':
if is_sep(s):
state = 'total'
elif s:
parts = re.split(r' +', s)
if len(parts) >= 4:
stats[parts[0]] = (parse_wall(parts[1]), parse_rss(parts[3]))
elif state == 'total':
if s:
parts = re.split(r' +', s)
if len(parts) >= 3:
stats[parts[0]] = (parse_wall(parts[1]),
parse_rss(parts[3]) if len(parts) > 3 else 0)
break
STAGE_ORDER = ['bootstrap', 'spectrums', 'merge_partitions', 'pack']
row = [run, n_sources]
for stage in STAGE_ORDER:
w, r = stats.get(stage, ('', ''))
row += [f'{w:.3f}' if isinstance(w, float) else '', str(r)]
tw, tr = stats.get('TOTAL', ('', ''))
row += [f'{tw:.3f}' if isinstance(tw, float) else '', str(tr)]
print(','.join(row))
PYEOF
}
mapfile -t sources < <(find "${IDX_DIR}" -mindepth 1 -maxdepth 1 -type d | sort)
if [[ ${#sources[@]} -eq 0 ]]; then
echo "ERROR: no indexes found in ${IDX_DIR}" >&2
exit 1
fi
echo "Merging ${#sources[@]} presence indexes → ${OUTPUT}"
printf ' %s\n' "${sources[@]}"
STDERR_LOG=$(mktemp)
trap 'rm -f "${STDERR_LOG}"' EXIT
"${BINARY}" merge \
--output "${OUTPUT}" \
--force \
--force-presence \
"${sources[@]}" \
2>"${STDERR_LOG}"
cat "${STDERR_LOG}" >&2
parse_reporter "${run_n}" "${#sources[@]}" "${STDERR_LOG}" >>"${CSV}"
echo "Done. Run ${run_n}${CSV}"
+12
View File
@@ -0,0 +1,12 @@
#!/usr/bin/env bash
# Simulate all genomes. Delegates to simulate_one.sh per genome.
# Prefer running via `gmake simulate` which handles individual dependencies.
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
for genome_file in "${SCRIPT_DIR}"/genomes/*.fna.gz; do
out_dir=$("${SCRIPT_DIR}/../.venv/bin/python3" "${SCRIPT_DIR}/make_deps.py" \
--dir-for "${genome_file}")
bash "${SCRIPT_DIR}/simulate_one.sh" "${genome_file}" "${out_dir}"
done
+33
View File
@@ -0,0 +1,33 @@
#!/usr/bin/env bash
# Usage: simulate_one.sh genome.fna.gz output_dir
# Simulates paired-end HiSeq reads for a single genome.
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
ISS="${SCRIPT_DIR}/../.venv/bin/iss"
COVERAGE=15
READ_LENGTH=150
CPUS="${CPUS:-$(sysctl -n hw.logicalcpu 2>/dev/null || nproc 2>/dev/null || echo 2)}"
genome_file="$1"
out_dir="$2"
mkdir -p "${out_dir}"
tmp_fasta=$(mktemp "${TMPDIR:-/tmp}/obikmer_XXXXXX.fna")
trap 'rm -f "${tmp_fasta}"' EXIT
gzip -dc "${genome_file}" > "${tmp_fasta}"
genome_size=$(grep -v "^>" "${tmp_fasta}" | tr -d '[:space:]' | wc -c | tr -d ' ')
n_reads=$(python3 -c "import math; print(math.ceil(${COVERAGE} * ${genome_size} / (2 * ${READ_LENGTH})))")
echo "[${out_dir}] genome=${genome_size} bp → ${n_reads} read pairs (${COVERAGE}x HiSeq)"
"${ISS}" generate \
--genomes "${tmp_fasta}" \
--model HiSeq \
--n_reads "${n_reads}" \
--cpus "${CPUS}" \
--compress \
--output "${out_dir}/reads"
+21
View File
@@ -0,0 +1,21 @@
genome,Candidozyma_auris--GCF_003013715.1_ASM301371v2,Acidobacterium_capsulatum--ATCC_51196,Bacillus_subtilis--168,Escherichia_coli--CFT073,Escherichia_coli--EDL933,Escherichia_coli--K-12_MG1655,Escherichia_coli--K-12_W3110,Klebsiella_pneumoniae--ATCC_13883,Klebsiella_pneumoniae--HS11286,Klebsiella_pneumoniae--MGH_78578,Opitutus_terrae--PB90-1,Proteus_mirabilis--HI4320,Saccharolobus_islandicus--M.16.4,Salmonella_enterica--AKU_12601,Salmonella_enterica--CT18,Salmonella_enterica--LT2,Salmonella_enterica--P125109,Shouchella_clausii--KSM-K16,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,Yersinia_ruckeri--YRB
Candidozyma_auris--GCF_003013715.1_ASM301371v2,0.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000
Acidobacterium_capsulatum--ATCC_51196,1.000000,0.000000,0.999981,0.999990,0.999989,0.999987,0.999987,0.999990,0.999988,0.999988,0.999994,0.999989,1.000000,0.999988,0.999987,0.999987,0.999988,0.999989,0.999991,0.999987
Bacillus_subtilis--168,1.000000,0.999981,0.000000,0.999990,0.999989,0.999989,0.999989,0.999989,0.999988,0.999986,0.999995,0.999985,0.999999,0.999988,0.999987,0.999989,0.999988,0.999778,0.999993,0.999987
Escherichia_coli--CFT073,1.000000,0.999990,0.999990,0.000000,0.825741,0.807495,0.807218,0.991156,0.996855,0.997849,0.999996,0.999633,1.000000,0.993885,0.996736,0.994148,0.993821,0.999991,0.999984,0.999291
Escherichia_coli--EDL933,1.000000,0.999989,0.999989,0.825741,0.000000,0.735107,0.734775,0.996126,0.998058,0.997908,0.999997,0.999640,1.000000,0.993993,0.997126,0.994390,0.994059,0.999991,0.999986,0.999292
Escherichia_coli--K-12_MG1655,1.000000,0.999987,0.999989,0.807495,0.735107,0.000000,0.382567,0.996190,0.997747,0.997455,0.999996,0.999604,1.000000,0.993444,0.996645,0.993773,0.993431,0.999989,0.999984,0.999174
Escherichia_coli--K-12_W3110,1.000000,0.999987,0.999989,0.807218,0.734775,0.382567,0.000000,0.996220,0.997761,0.997467,0.999995,0.999604,1.000000,0.993445,0.996669,0.993769,0.993443,0.999990,0.999985,0.999165
Klebsiella_pneumoniae--ATCC_13883,1.000000,0.999990,0.999989,0.991156,0.996126,0.996190,0.996220,0.000000,0.845220,0.840545,0.999997,0.999648,1.000000,0.996177,0.998128,0.996268,0.996052,0.999990,0.999987,0.999325
Klebsiella_pneumoniae--HS11286,1.000000,0.999988,0.999988,0.996855,0.998058,0.997747,0.997761,0.845220,0.000000,0.906475,0.999996,0.999683,1.000000,0.997724,0.995697,0.997776,0.997769,0.999989,0.999979,0.999463
Klebsiella_pneumoniae--MGH_78578,1.000000,0.999988,0.999986,0.997849,0.997908,0.997455,0.997467,0.840545,0.906475,0.000000,0.999996,0.999704,1.000000,0.997928,0.995054,0.997844,0.997868,0.999990,0.999980,0.999479
Opitutus_terrae--PB90-1,1.000000,0.999994,0.999995,0.999996,0.999997,0.999996,0.999995,0.999997,0.999996,0.999996,0.000000,0.999997,0.999998,0.999996,0.999996,0.999996,0.999995,0.999997,0.999993,0.999996
Proteus_mirabilis--HI4320,1.000000,0.999989,0.999985,0.999633,0.999640,0.999604,0.999604,0.999648,0.999683,0.999704,0.999997,0.000000,1.000000,0.999604,0.999699,0.999622,0.999613,0.999987,0.999983,0.999505
Saccharolobus_islandicus--M.16.4,1.000000,1.000000,0.999999,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,0.999998,1.000000,0.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000
Salmonella_enterica--AKU_12601,1.000000,0.999988,0.999988,0.993885,0.993993,0.993444,0.993445,0.996177,0.997724,0.997928,0.999996,0.999604,1.000000,0.000000,0.869238,0.682277,0.663383,0.999990,0.999985,0.999260
Salmonella_enterica--CT18,1.000000,0.999987,0.999987,0.996736,0.997126,0.996645,0.996669,0.998128,0.995697,0.995054,0.999996,0.999699,1.000000,0.869238,0.000000,0.890872,0.886148,0.999988,0.999976,0.999524
Salmonella_enterica--LT2,1.000000,0.999987,0.999989,0.994148,0.994390,0.993773,0.993769,0.996268,0.997776,0.997844,0.999996,0.999622,1.000000,0.682277,0.890872,0.000000,0.622606,0.999989,0.999985,0.999296
Salmonella_enterica--P125109,1.000000,0.999988,0.999988,0.993821,0.994059,0.993431,0.993443,0.996052,0.997769,0.997868,0.999995,0.999613,1.000000,0.663383,0.886148,0.622606,0.000000,0.999988,0.999983,0.999270
Shouchella_clausii--KSM-K16,1.000000,0.999989,0.999778,0.999991,0.999991,0.999989,0.999990,0.999990,0.999989,0.999990,0.999997,0.999987,1.000000,0.999990,0.999988,0.999989,0.999988,0.000000,0.999991,0.999988
Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,1.000000,0.999991,0.999993,0.999984,0.999986,0.999984,0.999985,0.999987,0.999979,0.999980,0.999993,0.999983,1.000000,0.999985,0.999976,0.999985,0.999983,0.999991,0.000000,0.999983
Yersinia_ruckeri--YRB,1.000000,0.999987,0.999987,0.999291,0.999292,0.999174,0.999165,0.999325,0.999463,0.999479,0.999996,0.999505,1.000000,0.999260,0.999524,0.999296,0.999270,0.999988,0.999983,0.000000
1 genome Candidozyma_auris--GCF_003013715.1_ASM301371v2 Acidobacterium_capsulatum--ATCC_51196 Bacillus_subtilis--168 Escherichia_coli--CFT073 Escherichia_coli--EDL933 Escherichia_coli--K-12_MG1655 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--ATCC_13883 Klebsiella_pneumoniae--HS11286 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Proteus_mirabilis--HI4320 Saccharolobus_islandicus--M.16.4 Salmonella_enterica--AKU_12601 Salmonella_enterica--CT18 Salmonella_enterica--LT2 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Yersinia_ruckeri--YRB
2 Candidozyma_auris--GCF_003013715.1_ASM301371v2 0.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000
3 Acidobacterium_capsulatum--ATCC_51196 1.000000 0.000000 0.999981 0.999990 0.999989 0.999987 0.999987 0.999990 0.999988 0.999988 0.999994 0.999989 1.000000 0.999988 0.999987 0.999987 0.999988 0.999989 0.999991 0.999987
4 Bacillus_subtilis--168 1.000000 0.999981 0.000000 0.999990 0.999989 0.999989 0.999989 0.999989 0.999988 0.999986 0.999995 0.999985 0.999999 0.999988 0.999987 0.999989 0.999988 0.999778 0.999993 0.999987
5 Escherichia_coli--CFT073 1.000000 0.999990 0.999990 0.000000 0.825741 0.807495 0.807218 0.991156 0.996855 0.997849 0.999996 0.999633 1.000000 0.993885 0.996736 0.994148 0.993821 0.999991 0.999984 0.999291
6 Escherichia_coli--EDL933 1.000000 0.999989 0.999989 0.825741 0.000000 0.735107 0.734775 0.996126 0.998058 0.997908 0.999997 0.999640 1.000000 0.993993 0.997126 0.994390 0.994059 0.999991 0.999986 0.999292
7 Escherichia_coli--K-12_MG1655 1.000000 0.999987 0.999989 0.807495 0.735107 0.000000 0.382567 0.996190 0.997747 0.997455 0.999996 0.999604 1.000000 0.993444 0.996645 0.993773 0.993431 0.999989 0.999984 0.999174
8 Escherichia_coli--K-12_W3110 1.000000 0.999987 0.999989 0.807218 0.734775 0.382567 0.000000 0.996220 0.997761 0.997467 0.999995 0.999604 1.000000 0.993445 0.996669 0.993769 0.993443 0.999990 0.999985 0.999165
9 Klebsiella_pneumoniae--ATCC_13883 1.000000 0.999990 0.999989 0.991156 0.996126 0.996190 0.996220 0.000000 0.845220 0.840545 0.999997 0.999648 1.000000 0.996177 0.998128 0.996268 0.996052 0.999990 0.999987 0.999325
10 Klebsiella_pneumoniae--HS11286 1.000000 0.999988 0.999988 0.996855 0.998058 0.997747 0.997761 0.845220 0.000000 0.906475 0.999996 0.999683 1.000000 0.997724 0.995697 0.997776 0.997769 0.999989 0.999979 0.999463
11 Klebsiella_pneumoniae--MGH_78578 1.000000 0.999988 0.999986 0.997849 0.997908 0.997455 0.997467 0.840545 0.906475 0.000000 0.999996 0.999704 1.000000 0.997928 0.995054 0.997844 0.997868 0.999990 0.999980 0.999479
12 Opitutus_terrae--PB90-1 1.000000 0.999994 0.999995 0.999996 0.999997 0.999996 0.999995 0.999997 0.999996 0.999996 0.000000 0.999997 0.999998 0.999996 0.999996 0.999996 0.999995 0.999997 0.999993 0.999996
13 Proteus_mirabilis--HI4320 1.000000 0.999989 0.999985 0.999633 0.999640 0.999604 0.999604 0.999648 0.999683 0.999704 0.999997 0.000000 1.000000 0.999604 0.999699 0.999622 0.999613 0.999987 0.999983 0.999505
14 Saccharolobus_islandicus--M.16.4 1.000000 1.000000 0.999999 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 0.999998 1.000000 0.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000
15 Salmonella_enterica--AKU_12601 1.000000 0.999988 0.999988 0.993885 0.993993 0.993444 0.993445 0.996177 0.997724 0.997928 0.999996 0.999604 1.000000 0.000000 0.869238 0.682277 0.663383 0.999990 0.999985 0.999260
16 Salmonella_enterica--CT18 1.000000 0.999987 0.999987 0.996736 0.997126 0.996645 0.996669 0.998128 0.995697 0.995054 0.999996 0.999699 1.000000 0.869238 0.000000 0.890872 0.886148 0.999988 0.999976 0.999524
17 Salmonella_enterica--LT2 1.000000 0.999987 0.999989 0.994148 0.994390 0.993773 0.993769 0.996268 0.997776 0.997844 0.999996 0.999622 1.000000 0.682277 0.890872 0.000000 0.622606 0.999989 0.999985 0.999296
18 Salmonella_enterica--P125109 1.000000 0.999988 0.999988 0.993821 0.994059 0.993431 0.993443 0.996052 0.997769 0.997868 0.999995 0.999613 1.000000 0.663383 0.886148 0.622606 0.000000 0.999988 0.999983 0.999270
19 Shouchella_clausii--KSM-K16 1.000000 0.999989 0.999778 0.999991 0.999991 0.999989 0.999990 0.999990 0.999989 0.999990 0.999997 0.999987 1.000000 0.999990 0.999988 0.999989 0.999988 0.000000 0.999991 0.999988
20 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 1.000000 0.999991 0.999993 0.999984 0.999986 0.999984 0.999985 0.999987 0.999979 0.999980 0.999993 0.999983 1.000000 0.999985 0.999976 0.999985 0.999983 0.999991 0.000000 0.999983
21 Yersinia_ruckeri--YRB 1.000000 0.999987 0.999987 0.999291 0.999292 0.999174 0.999165 0.999325 0.999463 0.999479 0.999996 0.999505 1.000000 0.999260 0.999524 0.999296 0.999270 0.999988 0.999983 0.000000
+1
View File
@@ -0,0 +1 @@
(((((((((((Candidozyma_auris--GCF_003013715.1_ASM301371v2:0.5000001881725941,Saccharolobus_islandicus--M.16.4:0.4999993211600824):0.0000023411501775538747,Opitutus_terrae--PB90-1:0.499997075187947):0.0000029791191795691675,(Acidobacterium_capsulatum--ATCC_51196:0.49999227771334689,(Bacillus_subtilis--168:0.49988797935621456,Shouchella_clausii--KSM-K16:0.49988984146059159):0.0001037210285571577):0.0000023959836053522034):0.0000034093646568700288,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1:0.4999920159222422):0.000199555100890203,Proteus_mirabilis--HI4320:0.49979129185300427):0.00010103619067070024,Yersinia_ruckeri--YRB:0.4996806650749249):0.0013719139155004,(Klebsiella_pneumoniae--HS11286:0.43798845051648258,(Klebsiella_pneumoniae--ATCC_13883:0.41780293826821265,Klebsiella_pneumoniae--MGH_78578:0.42274184870836559):0.017586732339732737):0.0604124197073832):0.0006482538063555254,(Salmonella_enterica--CT18:0.43952894448143017,(Salmonella_enterica--AKU_12601:0.3357977326267918,(Salmonella_enterica--LT2:0.31203395843666389,Salmonella_enterica--P125109:0.31057217324861216):0.025729515856701136):0.10292985918524672):0.05825411485542886):0.08937928015651564,Escherichia_coli--CFT073:0.40806501650701029):0.0410131211869626,Escherichia_coli--EDL933:0.3681464750911808):0.1755112579711463,Escherichia_coli--K-12_MG1655:0.19129818036662728,Escherichia_coli--K-12_W3110:0.19126872019906239);
+21
View File
@@ -0,0 +1,21 @@
genome,Candidozyma_auris--GCF_003013715.1_ASM301371v2,Acidobacterium_capsulatum--ATCC_51196,Bacillus_subtilis--168,Escherichia_coli--CFT073,Escherichia_coli--EDL933,Escherichia_coli--K-12_MG1655,Escherichia_coli--K-12_W3110,Klebsiella_pneumoniae--ATCC_13883,Klebsiella_pneumoniae--HS11286,Klebsiella_pneumoniae--MGH_78578,Opitutus_terrae--PB90-1,Proteus_mirabilis--HI4320,Saccharolobus_islandicus--M.16.4,Salmonella_enterica--AKU_12601,Salmonella_enterica--CT18,Salmonella_enterica--LT2,Salmonella_enterica--P125109,Shouchella_clausii--KSM-K16,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,Yersinia_ruckeri--YRB
Candidozyma_auris--GCF_003013715.1_ASM301371v2,0,0,0,0,0,0,0,0,0,0,0,0,8,0,1,0,0,0,0,3
Acidobacterium_capsulatum--ATCC_51196,0,0,203,119,128,141,140,116,109,111,78,112,0,136,109,147,134,117,55,129
Bacillus_subtilis--168,0,203,0,124,132,128,123,133,109,130,66,158,6,131,112,124,135,2393,46,124
Escherichia_coli--CFT073,0,119,124,0,1966777,1998059,1999094,117743,32029,22312,63,4225,0,74946,31918,73311,76585,113,128,7854
Escherichia_coli--EDL933,0,128,132,1966777,0,2627885,2628700,52488,20134,22064,48,4202,0,74655,28602,71244,74665,112,108,7963
Escherichia_coli--K-12_MG1655,0,141,128,1998059,2627885,0,4452541,48302,21382,24602,47,4277,0,75729,30449,73622,76778,119,111,8566
Escherichia_coli--K-12_W3110,0,140,123,1999094,2628700,4452541,0,47894,21226,24470,68,4278,0,75658,30207,73614,76583,112,108,8660
Klebsiella_pneumoniae--ATCC_13883,0,116,133,117743,52488,48302,47894,0,1416091,1477759,42,4172,0,48296,18988,48144,50416,120,106,7712
Klebsiella_pneumoniae--HS11286,0,109,109,32029,20134,21382,21226,1416091,0,644063,42,2738,0,21498,29758,21606,21376,99,102,4417
Klebsiella_pneumoniae--MGH_78578,0,111,130,22312,22064,24602,24470,1477759,644063,0,42,2614,0,19948,35067,21330,20813,97,102,4374
Opitutus_terrae--PB90-1,0,78,66,63,48,47,68,42,42,42,0,43,18,57,42,53,66,39,58,43
Proteus_mirabilis--HI4320,0,112,158,4225,4202,4277,4278,4172,2738,2614,43,0,0,4254,2481,4166,4215,131,103,4704
Saccharolobus_islandicus--M.16.4,8,0,6,0,0,0,0,0,0,0,18,0,0,0,0,0,0,0,0,0
Salmonella_enterica--AKU_12601,0,136,131,74946,74655,75729,75658,48296,21498,19948,57,4254,0,0,1047731,2857146,2951421,117,108,7643
Salmonella_enterica--CT18,1,109,112,31918,28602,30449,30207,18988,29758,35067,42,2481,0,1047731,0,917948,940297,106,106,3716
Salmonella_enterica--LT2,0,147,124,73311,71244,73622,73614,48144,21606,21330,53,4166,0,2857146,917948,0,3284800,122,108,7460
Salmonella_enterica--P125109,0,134,135,76585,74665,76778,76583,50416,21376,20813,66,4215,0,2951421,940297,3284800,0,134,124,7645
Shouchella_clausii--KSM-K16,0,117,2393,113,112,119,112,120,99,97,39,131,0,117,106,122,134,0,58,124
Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,0,55,46,128,108,111,108,106,102,102,58,103,0,108,106,108,124,58,0,96
Yersinia_ruckeri--YRB,3,129,124,7854,7963,8566,8660,7712,4417,4374,43,4704,0,7643,3716,7460,7645,124,96,0
1 genome Candidozyma_auris--GCF_003013715.1_ASM301371v2 Acidobacterium_capsulatum--ATCC_51196 Bacillus_subtilis--168 Escherichia_coli--CFT073 Escherichia_coli--EDL933 Escherichia_coli--K-12_MG1655 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--ATCC_13883 Klebsiella_pneumoniae--HS11286 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Proteus_mirabilis--HI4320 Saccharolobus_islandicus--M.16.4 Salmonella_enterica--AKU_12601 Salmonella_enterica--CT18 Salmonella_enterica--LT2 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Yersinia_ruckeri--YRB
2 Candidozyma_auris--GCF_003013715.1_ASM301371v2 0 0 0 0 0 0 0 0 0 0 0 0 8 0 1 0 0 0 0 3
3 Acidobacterium_capsulatum--ATCC_51196 0 0 203 119 128 141 140 116 109 111 78 112 0 136 109 147 134 117 55 129
4 Bacillus_subtilis--168 0 203 0 124 132 128 123 133 109 130 66 158 6 131 112 124 135 2393 46 124
5 Escherichia_coli--CFT073 0 119 124 0 1966777 1998059 1999094 117743 32029 22312 63 4225 0 74946 31918 73311 76585 113 128 7854
6 Escherichia_coli--EDL933 0 128 132 1966777 0 2627885 2628700 52488 20134 22064 48 4202 0 74655 28602 71244 74665 112 108 7963
7 Escherichia_coli--K-12_MG1655 0 141 128 1998059 2627885 0 4452541 48302 21382 24602 47 4277 0 75729 30449 73622 76778 119 111 8566
8 Escherichia_coli--K-12_W3110 0 140 123 1999094 2628700 4452541 0 47894 21226 24470 68 4278 0 75658 30207 73614 76583 112 108 8660
9 Klebsiella_pneumoniae--ATCC_13883 0 116 133 117743 52488 48302 47894 0 1416091 1477759 42 4172 0 48296 18988 48144 50416 120 106 7712
10 Klebsiella_pneumoniae--HS11286 0 109 109 32029 20134 21382 21226 1416091 0 644063 42 2738 0 21498 29758 21606 21376 99 102 4417
11 Klebsiella_pneumoniae--MGH_78578 0 111 130 22312 22064 24602 24470 1477759 644063 0 42 2614 0 19948 35067 21330 20813 97 102 4374
12 Opitutus_terrae--PB90-1 0 78 66 63 48 47 68 42 42 42 0 43 18 57 42 53 66 39 58 43
13 Proteus_mirabilis--HI4320 0 112 158 4225 4202 4277 4278 4172 2738 2614 43 0 0 4254 2481 4166 4215 131 103 4704
14 Saccharolobus_islandicus--M.16.4 8 0 6 0 0 0 0 0 0 0 18 0 0 0 0 0 0 0 0 0
15 Salmonella_enterica--AKU_12601 0 136 131 74946 74655 75729 75658 48296 21498 19948 57 4254 0 0 1047731 2857146 2951421 117 108 7643
16 Salmonella_enterica--CT18 1 109 112 31918 28602 30449 30207 18988 29758 35067 42 2481 0 1047731 0 917948 940297 106 106 3716
17 Salmonella_enterica--LT2 0 147 124 73311 71244 73622 73614 48144 21606 21330 53 4166 0 2857146 917948 0 3284800 122 108 7460
18 Salmonella_enterica--P125109 0 134 135 76585 74665 76778 76583 50416 21376 20813 66 4215 0 2951421 940297 3284800 0 134 124 7645
19 Shouchella_clausii--KSM-K16 0 117 2393 113 112 119 112 120 99 97 39 131 0 117 106 122 134 0 58 124
20 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 0 55 46 128 108 111 108 106 102 102 58 103 0 108 106 108 124 58 0 96
21 Yersinia_ruckeri--YRB 3 129 124 7854 7963 8566 8660 7712 4417 4374 43 4704 0 7643 3716 7460 7645 124 96 0
+181
View File
@@ -0,0 +1,181 @@
#!/usr/bin/env python3
"""Compare an obikmer count index against a reference kmer set (presence + counts).
Loads the reference .npz (sorted uint64 kmers + uint32 counts from build_reference.py),
streams `obikmer dump` from a --with-counts index, then reports:
- false negatives : kmers in reference absent from the index
- false positives : kmers in the index absent from the reference
- count mismatches: kmers present in both but with differing counts
Output to stdout: one CSV row
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,
fn_pct,fp_pct,cm_pct
"""
import argparse
import subprocess
import sys
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── dump parsing ──────────────────────────────────────────────────────────────
def load_index(obikmer_bin: str, index_dir: str) -> tuple[np.ndarray, np.ndarray]:
"""Stream `obikmer dump` and return (kmers_sorted_uint64, counts_uint32)."""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
kmers, counts = [], []
header = True
for line in proc.stdout:
if header:
header = False
continue
parts = line.rstrip('\n').split(',')
kmers.append(encode_kmer(parts[0]))
counts.append(int(parts[1]))
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
order = np.argsort(np.array(kmers, dtype=np.uint64), kind='stable')
return (np.array(kmers, dtype=np.uint64)[order],
np.array(counts, dtype=np.uint32)[order])
# ── comparison ────────────────────────────────────────────────────────────────
def compare(ref_kmers: np.ndarray, ref_counts: np.ndarray,
idx_kmers: np.ndarray, idx_counts: np.ndarray,
) -> tuple[np.ndarray, np.ndarray, np.ndarray, np.ndarray, np.ndarray]:
"""Return (false_neg, false_pos, cm_ref_kmers, cm_ref_counts, cm_idx_counts).
All arrays sorted; cm_* cover kmers present in both arrays but with
differing counts.
"""
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
# Count mismatches among shared kmers.
# Both arrays are sorted so we can use searchsorted.
pos_in_idx = np.searchsorted(idx_kmers, ref_kmers)
pos_in_idx = np.clip(pos_in_idx, 0, len(idx_kmers) - 1)
shared_mask = idx_kmers[pos_in_idx] == ref_kmers
shared_ref_counts = ref_counts[shared_mask]
shared_idx_counts = idx_counts[pos_in_idx[shared_mask]]
mismatch_mask = shared_ref_counts != shared_idx_counts
cm_kmers = ref_kmers[shared_mask][mismatch_mask]
cm_ref_counts = shared_ref_counts[mismatch_mask]
cm_idx_counts = shared_idx_counts[mismatch_mask]
return false_neg, false_pos, cm_kmers, cm_ref_counts, cm_idx_counts
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('reference', metavar='REF_NPZ', nargs='?',
help='Reference .npz file')
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
help='obikmer index directory (built with --with-counts)')
ap.add_argument('--obikmer', default='obikmer',
help='Path to obikmer binary')
ap.add_argument('--species', default='')
ap.add_argument('--strain', default='')
ap.add_argument('--header', action='store_true',
help='Print CSV header and exit')
ap.add_argument('--save-fp', metavar='FILE',
help='Save false-positive kmer strings to FILE')
ap.add_argument('--save-fn', metavar='FILE',
help='Save false-negative kmer strings to FILE')
ap.add_argument('--save-cm', metavar='FILE',
help='Save count-mismatch rows (kmer,ref_count,idx_count) to FILE')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,count_mismatch,'
'fn_pct,fp_pct,cm_pct')
return
# Detect k
cmd1 = [args.obikmer, 'dump', '--head', '1', args.index]
out1 = subprocess.check_output(cmd1, stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
# Load reference
print(f'Loading reference: {args.reference}', file=sys.stderr)
npz = np.load(args.reference)
ref_kmers = npz['kmers'] # sorted uint64
ref_counts = npz['counts'] # uint32
# Load index
print(f'Streaming dump (k={k}): {args.index}', file=sys.stderr)
idx_kmers, idx_counts = load_index(args.obikmer, args.index)
print(f'k={k} ref={len(ref_kmers):,} idx={len(idx_kmers):,}', file=sys.stderr)
false_neg, false_pos, cm_kmers, cm_ref, cm_idx = compare(
ref_kmers, ref_counts, idx_kmers, idx_counts)
n_shared = len(ref_kmers) - len(false_neg)
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
cm_pct = 100.0 * len(cm_kmers) / n_shared if n_shared else 0.0
print(f'false negatives : {len(false_neg):,} ({fn_pct:.4f}%)', file=sys.stderr)
print(f'false positives : {len(false_pos):,} ({fp_pct:.4f}%)', file=sys.stderr)
print(f'count mismatches: {len(cm_kmers):,} ({cm_pct:.4f}% of shared)',
file=sys.stderr)
if args.save_fn and len(false_neg):
with open(args.save_fn, 'w') as fh:
for v in false_neg:
fh.write(decode_kmer(int(v), k) + '\n')
if args.save_fp and len(false_pos):
with open(args.save_fp, 'w') as fh:
for v in false_pos:
fh.write(decode_kmer(int(v), k) + '\n')
if args.save_cm and len(cm_kmers):
with open(args.save_cm, 'w') as fh:
fh.write('kmer,ref_count,idx_count\n')
for v, rc, ic in zip(cm_kmers, cm_ref, cm_idx):
fh.write(f'{decode_kmer(int(v), k)},{rc},{ic}\n')
print(f'{args.species},{args.strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},{len(cm_kmers)},'
f'{fn_pct:.4f},{fp_pct:.4f},{cm_pct:.4f}')
if __name__ == '__main__':
main()
+201
View File
@@ -0,0 +1,201 @@
#!/usr/bin/env python3
"""Verify the merged count index against all per-specimen reference sets.
Streams `obikmer dump` once on the merged index, accumulates per-specimen
kmer+count pairs from each column, then compares each against its reference .npz.
Output to stdout: one CSV row per specimen (same columns as verify_count.py)
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,count_mismatch,
fn_pct,fp_pct,cm_pct
"""
import argparse
import subprocess
import sys
from pathlib import Path
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── single-pass dump ──────────────────────────────────────────────────────────
def stream_merged_dump(obikmer_bin: str, index_dir: str,
) -> tuple[list[str], dict[str, tuple[list[int], list[int]]]]:
"""Stream the merged dump once.
Returns:
specimen_names : column labels in dump order
per_specimen : mapping label → (kmer_ints, counts) for entries > 0
"""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
header_line = proc.stdout.readline().rstrip('\n')
cols = header_line.split(',')
specimen_names = cols[1:]
per_specimen: dict[str, tuple[list[int], list[int]]] = {
name: ([], []) for name in specimen_names}
for line in proc.stdout:
parts = line.rstrip('\n').split(',')
kmer_int = encode_kmer(parts[0])
for i, name in enumerate(specimen_names):
count = int(parts[i + 1])
if count > 0:
per_specimen[name][0].append(kmer_int)
per_specimen[name][1].append(count)
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
return specimen_names, per_specimen
# ── per-specimen comparison ───────────────────────────────────────────────────
def compare_specimen(name: str,
kmer_list: list[int],
count_list: list[int],
ref_dir: Path,
k: int,
save_fn: Path | None,
save_fp: Path | None,
save_cm: Path | None,
) -> str:
ref_path = ref_dir / f'{name}.npz'
if not ref_path.exists():
print(f' SKIP {name}: no reference at {ref_path}', file=sys.stderr)
return ''
species = name.split('--')[0]
strain = name[len(species) + 2:]
npz = np.load(ref_path)
ref_kmers = npz['kmers'] # sorted uint64
ref_counts = npz['counts'] # uint32
order = np.argsort(np.array(kmer_list, dtype=np.uint64), kind='stable')
idx_kmers = np.array(kmer_list, dtype=np.uint64)[order]
idx_counts = np.array(count_list, dtype=np.uint32)[order]
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
# Count mismatches among shared kmers
pos_in_idx = np.searchsorted(idx_kmers, ref_kmers)
pos_in_idx = np.clip(pos_in_idx, 0, len(idx_kmers) - 1)
shared_mask = idx_kmers[pos_in_idx] == ref_kmers
mismatch_mask = ref_counts[shared_mask] != idx_counts[pos_in_idx[shared_mask]]
cm_kmers = ref_kmers[shared_mask][mismatch_mask]
cm_ref = ref_counts[shared_mask][mismatch_mask]
cm_idx = idx_counts[pos_in_idx[shared_mask]][mismatch_mask]
n_shared = int(shared_mask.sum())
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
cm_pct = 100.0 * len(cm_kmers) / n_shared if n_shared else 0.0
print(f' {name}: ref={len(ref_kmers):,} idx={len(idx_kmers):,} '
f'fn={len(false_neg):,} ({fn_pct:.4f}%) '
f'fp={len(false_pos):,} ({fp_pct:.4f}%) '
f'cm={len(cm_kmers):,} ({cm_pct:.4f}%)',
file=sys.stderr)
if save_fn and len(false_neg):
fn_file = save_fn / f'{name}_fn.txt'
fn_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_neg) + '\n')
if save_fp and len(false_pos):
fp_file = save_fp / f'{name}_fp.txt'
fp_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_pos) + '\n')
if save_cm and len(cm_kmers):
cm_file = save_cm / f'{name}_cm.csv'
lines = ['kmer,ref_count,idx_count']
for v, rc, ic in zip(cm_kmers, cm_ref, cm_idx):
lines.append(f'{decode_kmer(int(v), k)},{rc},{ic}')
cm_file.write_text('\n'.join(lines) + '\n')
return (f'{species},{strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},{len(cm_kmers)},'
f'{fn_pct:.4f},{fp_pct:.4f},{cm_pct:.4f}')
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
help='Merged count index directory')
ap.add_argument('ref_dir', metavar='REF_DIR', nargs='?',
help='Directory containing per-specimen .npz reference files')
ap.add_argument('--obikmer', default='obikmer')
ap.add_argument('--header', action='store_true',
help='Print CSV header and exit')
ap.add_argument('--save-fn', metavar='DIR',
help='Directory for false-negative kmer lists')
ap.add_argument('--save-fp', metavar='DIR',
help='Directory for false-positive kmer lists')
ap.add_argument('--save-cm', metavar='DIR',
help='Directory for count-mismatch CSV files')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,count_mismatch,'
'fn_pct,fp_pct,cm_pct')
return
ref_dir = Path(args.ref_dir)
save_fn = Path(args.save_fn) if args.save_fn else None
save_fp = Path(args.save_fp) if args.save_fp else None
save_cm = Path(args.save_cm) if args.save_cm else None
for d in (save_fn, save_fp, save_cm):
if d: d.mkdir(parents=True, exist_ok=True)
out1 = subprocess.check_output(
[args.obikmer, 'dump', '--head', '1', args.index],
stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
print(f'k={k} streaming merged dump: {args.index}', file=sys.stderr)
specimen_names, per_specimen = stream_merged_dump(args.obikmer, args.index)
print(f'{len(specimen_names)} specimen columns loaded', file=sys.stderr)
for name in specimen_names:
kmers, counts = per_specimen[name]
row = compare_specimen(name, kmers, counts, ref_dir, k,
save_fn, save_fp, save_cm)
if row:
print(row)
if __name__ == '__main__':
main()
+27
View File
@@ -0,0 +1,27 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
INDEX="${SCRIPT_DIR}/global_index_count"
REF_DIR="${SCRIPT_DIR}/reference_index"
STATS_DIR="${SCRIPT_DIR}/stats/verify_merge_count"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_merge_count.py"
mkdir -p "${STATS_DIR}"
CURRENT="${STATS_DIR}/current.csv"
"${PYTHON}" "${VERIFY_PY}" --header >"${CURRENT}"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
"${INDEX}" "${REF_DIR}" \
>>"${CURRENT}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'count_*.csv' | wc -l | tr -d ' ')")
ARCHIVE="${STATS_DIR}/count_${run_n}.csv"
cp "${CURRENT}" "${ARCHIVE}"
echo "Done. Results → ${ARCHIVE}"
+170
View File
@@ -0,0 +1,170 @@
#!/usr/bin/env python3
"""Verify the merged presence index against all per-specimen reference sets.
Streams `obikmer dump` once on the merged index, accumulates per-specimen
kmer sets from each column, then compares each against its reference .npz.
Output to stdout: one CSV row per specimen (same columns as verify_presence.py)
species,strain,ref_kmers,idx_kmers,false_neg,false_pos,fn_pct,fp_pct
"""
import argparse
import subprocess
import sys
from pathlib import Path
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── single-pass dump ──────────────────────────────────────────────────────────
def stream_merged_dump(obikmer_bin: str, index_dir: str,
) -> tuple[list[str], dict[str, list[int]]]:
"""Stream the merged dump once.
Returns:
specimen_names : column labels in dump order (excluding 'kmer')
per_specimen : mapping label → list of kmer ints where presence > 0
"""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
header_line = proc.stdout.readline().rstrip('\n')
cols = header_line.split(',')
specimen_names = cols[1:] # first col is 'kmer'
per_specimen: dict[str, list[int]] = {name: [] for name in specimen_names}
for line in proc.stdout:
parts = line.rstrip('\n').split(',')
kmer_int = encode_kmer(parts[0])
for i, name in enumerate(specimen_names):
if int(parts[i + 1]) > 0:
per_specimen[name].append(kmer_int)
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
return specimen_names, per_specimen
# ── per-specimen comparison ───────────────────────────────────────────────────
def compare_specimen(name: str,
kmer_list: list[int],
ref_dir: Path,
k: int,
save_fn: Path | None,
save_fp: Path | None,
) -> str:
"""Compare one specimen column against its reference .npz.
Returns a CSV row string.
"""
ref_path = ref_dir / f'{name}.npz'
if not ref_path.exists():
print(f' SKIP {name}: no reference at {ref_path}', file=sys.stderr)
return ''
species = name.split('--')[0]
strain = name[len(species) + 2:]
ref_kmers = np.load(ref_path)['kmers'] # sorted uint64
idx_kmers = np.array(sorted(kmer_list), dtype=np.uint64)
false_neg = np.setdiff1d(ref_kmers, idx_kmers, assume_unique=True)
false_pos = np.setdiff1d(idx_kmers, ref_kmers, assume_unique=True)
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
print(f' {name}: ref={len(ref_kmers):,} idx={len(idx_kmers):,} '
f'fn={len(false_neg):,} ({fn_pct:.4f}%) '
f'fp={len(false_pos):,} ({fp_pct:.4f}%)',
file=sys.stderr)
if save_fn and len(false_neg):
fn_file = save_fn / f'{name}_fn.txt'
fn_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_neg) + '\n')
if save_fp and len(false_pos):
fp_file = save_fp / f'{name}_fp.txt'
fp_file.write_text('\n'.join(decode_kmer(int(v), k) for v in false_pos) + '\n')
return (f'{species},{strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},'
f'{fn_pct:.4f},{fp_pct:.4f}')
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('index', metavar='INDEX_DIR', nargs='?',
help='Merged presence index directory')
ap.add_argument('ref_dir', metavar='REF_DIR', nargs='?',
help='Directory containing per-specimen .npz reference files')
ap.add_argument('--obikmer', default='obikmer')
ap.add_argument('--header', action='store_true',
help='Print CSV header and exit')
ap.add_argument('--save-fn', metavar='DIR',
help='Directory to save false-negative kmer lists')
ap.add_argument('--save-fp', metavar='DIR',
help='Directory to save false-positive kmer lists')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,fn_pct,fp_pct')
return
ref_dir = Path(args.ref_dir)
save_fn = Path(args.save_fn) if args.save_fn else None
save_fp = Path(args.save_fp) if args.save_fp else None
if save_fn: save_fn.mkdir(parents=True, exist_ok=True)
if save_fp: save_fp.mkdir(parents=True, exist_ok=True)
# Detect k
out1 = subprocess.check_output(
[args.obikmer, 'dump', '--head', '1', args.index],
stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
print(f'k={k} streaming merged dump: {args.index}', file=sys.stderr)
specimen_names, per_specimen = stream_merged_dump(args.obikmer, args.index)
print(f'{len(specimen_names)} specimen columns loaded', file=sys.stderr)
for name in specimen_names:
row = compare_specimen(name, per_specimen[name], ref_dir, k, save_fn, save_fp)
if row:
print(row)
if __name__ == '__main__':
main()
+27
View File
@@ -0,0 +1,27 @@
#!/usr/bin/env bash
set -euo pipefail
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
INDEX="${SCRIPT_DIR}/global_index_presence"
REF_DIR="${SCRIPT_DIR}/reference_index"
STATS_DIR="${SCRIPT_DIR}/stats/verify_merge_presence"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_merge_presence.py"
mkdir -p "${STATS_DIR}"
CURRENT="${STATS_DIR}/current.csv"
"${PYTHON}" "${VERIFY_PY}" --header >"${CURRENT}"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
"${INDEX}" "${REF_DIR}" \
>>"${CURRENT}"
run_n=$(printf '%03d' "$(find "${STATS_DIR}" -maxdepth 1 -name 'presence_*.csv' | wc -l | tr -d ' ')")
ARCHIVE="${STATS_DIR}/presence_${run_n}.csv"
cp "${CURRENT}" "${ARCHIVE}"
echo "Done. Results → ${ARCHIVE}"
+30
View File
@@ -0,0 +1,30 @@
#!/usr/bin/env bash
# Usage: verify_one_count.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Output: stats/verify_count/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_count.py"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
REF_NPZ="${SCRIPT_DIR}/reference_index/${SPECIMEN}.npz"
INDEX_DIR="${SCRIPT_DIR}/specimen_index_count/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/verify_count"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIMEN}] verifying count"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
--species "${species}" \
--strain "${strain}" \
"${REF_NPZ}" "${INDEX_DIR}" \
>"${STATS_FILE}"
+30
View File
@@ -0,0 +1,30 @@
#!/usr/bin/env bash
# Usage: verify_one_presence.sh SPECIMEN
# SPECIMEN = "species--strain" (Make pattern stem)
# Output: stats/verify_presence/SPECIMEN.stats (one CSV data row, no header)
set -euo pipefail
SPECIMEN="$1"
SCRIPT_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
BINARY="${SCRIPT_DIR}/../src/target/release/obikmer"
PYTHON="${SCRIPT_DIR}/../.venv/bin/python3"
VERIFY_PY="${SCRIPT_DIR}/verify_presence.py"
species="${SPECIMEN%%--*}"
strain="${SPECIMEN#*--}"
REF_NPZ="${SCRIPT_DIR}/reference_index/${SPECIMEN}.npz"
INDEX_DIR="${SCRIPT_DIR}/specimen_index_presence/${SPECIMEN}"
STATS_DIR="${SCRIPT_DIR}/stats/verify_presence"
STATS_FILE="${STATS_DIR}/${SPECIMEN}.stats"
mkdir -p "${STATS_DIR}"
echo "[${SPECIMEN}] verifying presence"
"${PYTHON}" "${VERIFY_PY}" \
--obikmer "${BINARY}" \
--species "${species}" \
--strain "${strain}" \
"${REF_NPZ}" "${INDEX_DIR}" \
>"${STATS_FILE}"
+139
View File
@@ -0,0 +1,139 @@
#!/usr/bin/env python3
"""Compare an obikmer index against a reference kmer set (presence/absence).
Loads the reference .npz (sorted uint64 kmers built by build_reference.py),
streams the output of `obikmer dump`, encodes each kmer string to uint64,
then reports false negatives and false positives using numpy set operations.
Output to stdout: one CSV row
species, strain, ref_kmers, idx_kmers, false_neg, false_pos, fn_pct, fp_pct
"""
import argparse
import subprocess
import sys
import numpy as np
# ── encoding ──────────────────────────────────────────────────────────────────
_ENCODE = {'A': 0, 'C': 1, 'G': 2, 'T': 3,
'a': 0, 'c': 1, 'g': 2, 't': 3}
_DECODE = ['A', 'C', 'G', 'T']
def encode_kmer(s: str) -> int:
kmer = 0
for c in s:
kmer = (kmer << 2) | _ENCODE[c]
return kmer
def decode_kmer(val: int, k: int) -> str:
bases = []
for _ in range(k):
bases.append(_DECODE[val & 3])
val >>= 2
return ''.join(reversed(bases))
# ── dump parsing ──────────────────────────────────────────────────────────────
def load_index_kmers(obikmer_bin: str, index_dir: str) -> np.ndarray:
"""Stream `obikmer dump` and return a sorted uint64 array of kmer integers."""
cmd = [obikmer_bin, 'dump', index_dir]
proc = subprocess.Popen(cmd, stdout=subprocess.PIPE, stderr=subprocess.DEVNULL,
text=True)
kmers = []
header = True
for line in proc.stdout:
if header:
header = False
continue
kmer_str = line.split(',', 1)[0]
kmers.append(encode_kmer(kmer_str))
proc.wait()
if proc.returncode != 0:
print(f'ERROR: obikmer dump exited {proc.returncode}', file=sys.stderr)
sys.exit(1)
arr = np.array(kmers, dtype=np.uint64)
arr.sort()
return arr
# ── comparison ────────────────────────────────────────────────────────────────
def compare(ref: np.ndarray, idx: np.ndarray) -> tuple[np.ndarray, np.ndarray]:
"""Return (false_negatives, false_positives) as uint64 arrays."""
false_neg = np.setdiff1d(ref, idx, assume_unique=True)
false_pos = np.setdiff1d(idx, ref, assume_unique=True)
return false_neg, false_pos
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('reference', metavar='REF_NPZ', nargs='?', help='Reference .npz file')
ap.add_argument('index', metavar='INDEX_DIR', nargs='?', help='obikmer index directory')
ap.add_argument('--obikmer', default='obikmer', help='Path to obikmer binary')
ap.add_argument('--species', default='', help='Species label for CSV row')
ap.add_argument('--strain', default='', help='Strain label for CSV row')
ap.add_argument('--header', action='store_true', help='Print CSV header and exit')
ap.add_argument('--save-fp', metavar='FILE',
help='Save false-positive kmer strings to FILE')
ap.add_argument('--save-fn', metavar='FILE',
help='Save false-negative kmer strings to FILE')
args = ap.parse_args()
if args.header:
print('species,strain,ref_kmers,idx_kmers,'
'false_neg,false_pos,fn_pct,fp_pct')
return
# Detect k from the index (one cheap call before the full dump).
cmd1 = [args.obikmer, 'dump', '--head', '1', args.index]
out1 = subprocess.check_output(cmd1, stderr=subprocess.DEVNULL, text=True)
k = len(out1.splitlines()[1].split(',')[0])
# Load reference
print(f'Loading reference: {args.reference}', file=sys.stderr)
npz = np.load(args.reference)
ref_kmers = npz['kmers'] # already sorted uint64
# Load index
print(f'Streaming dump (k={k}): {args.index}', file=sys.stderr)
idx_kmers = load_index_kmers(args.obikmer, args.index)
print(f'k={k} ref={len(ref_kmers):,} idx={len(idx_kmers):,}', file=sys.stderr)
false_neg, false_pos = compare(ref_kmers, idx_kmers)
fn_pct = 100.0 * len(false_neg) / len(ref_kmers) if len(ref_kmers) else 0.0
fp_pct = 100.0 * len(false_pos) / len(idx_kmers) if len(idx_kmers) else 0.0
print(f'false negatives: {len(false_neg):,} ({fn_pct:.4f}%)', file=sys.stderr)
print(f'false positives: {len(false_pos):,} ({fp_pct:.4f}%)', file=sys.stderr)
if args.save_fn and len(false_neg):
with open(args.save_fn, 'w') as fh:
for v in false_neg:
fh.write(decode_kmer(int(v), k) + '\n')
print(f'False negatives saved → {args.save_fn}', file=sys.stderr)
if args.save_fp and len(false_pos):
with open(args.save_fp, 'w') as fh:
for v in false_pos:
fh.write(decode_kmer(int(v), k) + '\n')
print(f'False positives saved → {args.save_fp}', file=sys.stderr)
print(f'{args.species},{args.strain},'
f'{len(ref_kmers)},{len(idx_kmers)},'
f'{len(false_neg)},{len(false_pos)},'
f'{fn_pct:.4f},{fp_pct:.4f}')
if __name__ == '__main__':
main()
+84
View File
@@ -638,6 +638,34 @@
<li class="md-nav__item">
<a href="/implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="/implementation/obilayeredmap/" class="md-nav__link"> <a href="/implementation/obilayeredmap/" class="md-nav__link">
@@ -716,6 +744,62 @@
<li class="md-nav__item">
<a href="/implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="/implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
@@ -9,7 +9,7 @@
<link rel="prev" href="../../../implementation/persistent_bit_vec/"> <link rel="prev" href="../../../implementation/rebuild_filter/">
<link rel="next" href="../../index_architecture/"> <link rel="next" href="../../index_architecture/">
@@ -647,6 +647,34 @@
<li class="md-nav__item">
<a href="../../../implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="../../../implementation/obilayeredmap/" class="md-nav__link"> <a href="../../../implementation/obilayeredmap/" class="md-nav__link">
@@ -725,6 +753,62 @@
<li class="md-nav__item">
<a href="../../../implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../../implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
File diff suppressed because it is too large Load Diff
+101 -38
View File
@@ -243,19 +243,28 @@
</label> </label>
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix=""> <ul class="md-nav__list" data-md-component="toc" data-md-scrollfix="">
<li class="md-nav__item"> <li class="md-nav__item">
<a class="md-nav__link" href="#output-type-rope"> <a class="md-nav__link" href="#two-reading-paths">
<span class="md-ellipsis"> <span class="md-ellipsis">
Output type: rope Two reading paths
</span> </span>
</a> </a>
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
<a class="md-nav__link" href="#allocation-policy"> <a class="md-nav__link" href="#record-path-chunk-reader">
<span class="md-ellipsis"> <span class="md-ellipsis">
Allocation policy Record path: chunk reader
</span>
</a>
</li>
<li class="md-nav__item">
<a class="md-nav__link" href="#output-type-rope">
<span class="md-ellipsis">
Output type: Rope
</span> </span>
</a> </a>
@@ -347,6 +356,18 @@
</span>
</a>
</li>
<li class="md-nav__item">
<a class="md-nav__link" href="../evidence_elimination/">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span> </span>
</a> </a>
</li> </li>
@@ -383,6 +404,30 @@
</span>
</a>
</li>
<li class="md-nav__item">
<a class="md-nav__link" href="../merge/">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a class="md-nav__link" href="../rebuild_filter/">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span> </span>
</a> </a>
</li> </li>
@@ -454,19 +499,28 @@
</label> </label>
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix=""> <ul class="md-nav__list" data-md-component="toc" data-md-scrollfix="">
<li class="md-nav__item"> <li class="md-nav__item">
<a class="md-nav__link" href="#output-type-rope"> <a class="md-nav__link" href="#two-reading-paths">
<span class="md-ellipsis"> <span class="md-ellipsis">
Output type: rope Two reading paths
</span> </span>
</a> </a>
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
<a class="md-nav__link" href="#allocation-policy"> <a class="md-nav__link" href="#record-path-chunk-reader">
<span class="md-ellipsis"> <span class="md-ellipsis">
Allocation policy Record path: chunk reader
</span>
</a>
</li>
<li class="md-nav__item">
<a class="md-nav__link" href="#output-type-rope">
<span class="md-ellipsis">
Output type: Rope
</span> </span>
</a> </a>
@@ -506,68 +560,77 @@
<div class="md-content" data-md-component="content"> <div class="md-content" data-md-component="content">
<article class="md-content__inner md-typeset"> <article class="md-content__inner md-typeset">
<h1 id="chunk-reader-implementation">Chunk reader — implementation</h1> <h1 id="chunk-reader-implementation">Chunk reader — implementation</h1>
<p>The <code>obiread</code> crate provides a streaming iterator that reads FASTA or FASTQ files in fixed-size blocks and yields self-contained chunks, each ending on a complete sequence record boundary. Chunks are consumed in parallel by downstream workers.</p> <p><code>obiread</code> exposes two distinct sequence reading paths, each optimised for a different use case.</p>
<h2 id="output-type-rope">Output type: rope</h2> <h2 id="two-reading-paths">Two reading paths</h2>
<p>Each chunk is a <code>Vec&lt;Bytes&gt;</code> — a <strong>rope</strong>: a list of reference-counted byte slices that are not necessarily contiguous in memory. The consumer iterates over the slices in order.</p>
<p>Using <code>bytes::Bytes</code> means the split at the record boundary is O(1): <code>Bytes::split_to(n)</code> adjusts a reference counter, not memory. No <code>memcpy</code> in the common case.</p>
<h2 id="allocation-policy">Allocation policy</h2>
<table> <table>
<thead> <thead>
<tr> <tr>
<th>Case</th> <th>Path</th>
<th>Cost</th> <th>API</th>
<th>Output unit</th>
<th>Per-record identity</th>
<th>Use case</th>
</tr> </tr>
</thead> </thead>
<tbody> <tbody>
<tr> <tr>
<td>Boundary found in the current block (common)</td> <td><strong>Record path</strong></td>
<td>zero extra allocation — <code>split_to</code> only</td> <td><code>read_sequence_chunks</code><code>parse_chunk</code></td>
<td><code>SeqRecord</code> (id + raw sequence + normalised rope)</td>
<td>yes</td>
<td><code>query</code> — must read complete records</td>
</tr> </tr>
<tr> <tr>
<td>Boundary straddles multiple blocks (sequence &gt; block size, rare)</td> <td><strong>Stream path</strong></td>
<td>one allocation to pack the rope into a flat buffer</td> <td><code>open_nuc_stream</code></td>
</tr> <td><code>NucPage</code> (flat normalised byte buffer)</td>
<tr> <td>no</td>
<td>EOF flush</td> <td><code>index</code>, <code>superkmer</code> — bulk throughput</td>
<td>zero extra allocation</td>
</tr> </tr>
</tbody> </tbody>
</table> </table>
<p>The record path uses <code>Rope</code>-backed chunks and is described in detail below.
The stream path (<code>NucStream</code> / <code>NucPage</code>) is described in the scatter section of <a href="../pipeline/">pipeline</a>.</p>
<hr/>
<h2 id="record-path-chunk-reader">Record path: chunk reader</h2>
<p>The chunk reader reads FASTA or FASTQ files in fixed-size blocks and yields self-contained chunks, each ending on a complete sequence record boundary. <code>parse_chunk</code> then converts each chunk into a <code>Vec&lt;SeqRecord&gt;</code>, where each record carries its identifier, raw sequence bytes, and a normalised rope ready for superkmer building.</p>
<p>This path is mandatory for <code>query</code>, where superkmers must be tracked back to their originating sequence (id, kmer offset) for output annotation.</p>
<h2 id="output-type-rope">Output type: Rope</h2>
<p>Each chunk is a <code>Rope</code> — a segmented byte sequence: a <code>Vec</code> of blocks, where each block is a <code>Vec&lt;Cell&lt;u8&gt;&gt;</code>. The consumer iterates over the blocks via a forward or backward cursor.</p>
<p><code>Rope::split_off(pos)</code> splits at an absolute byte offset in O(log n) (binary search over block-start index). If <code>pos</code> falls inside a block, that block is split in two via <code>Vec::split_off</code> — no <code>memcpy</code> in the common case.</p>
<h2 id="seqchunkiter">SeqChunkIter</h2> <h2 id="seqchunkiter">SeqChunkIter</h2>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">struct</span><span class="w"> </span><span class="nc">SeqChunkIter</span><span class="o">&lt;</span><span class="n">R</span><span class="p">:</span><span class="w"> </span><span class="nc">Read</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="cm">/* private */</span><span class="w"> </span><span class="p">}</span> <div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">struct</span><span class="w"> </span><span class="nc">SeqChunkIter</span><span class="o">&lt;</span><span class="n">R</span><span class="p">:</span><span class="w"> </span><span class="nc">Read</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="cm">/* private */</span><span class="w"> </span><span class="p">}</span>
<span class="k">impl</span><span class="o">&lt;</span><span class="n">R</span><span class="p">:</span><span class="w"> </span><span class="nc">Read</span><span class="o">&gt;</span><span class="w"> </span><span class="nb">Iterator</span><span class="w"> </span><span class="k">for</span><span class="w"> </span><span class="n">SeqChunkIter</span><span class="o">&lt;</span><span class="n">R</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span> <span class="k">impl</span><span class="o">&lt;</span><span class="n">R</span><span class="p">:</span><span class="w"> </span><span class="nc">Read</span><span class="o">&gt;</span><span class="w"> </span><span class="nb">Iterator</span><span class="w"> </span><span class="k">for</span><span class="w"> </span><span class="n">SeqChunkIter</span><span class="o">&lt;</span><span class="n">R</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">type</span><span class="w"> </span><span class="nc">Item</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">io</span><span class="p">::</span><span class="nb">Result</span><span class="o">&lt;</span><span class="nb">Vec</span><span class="o">&lt;</span><span class="n">Bytes</span><span class="o">&gt;&gt;</span><span class="p">;</span> <span class="w"> </span><span class="k">type</span><span class="w"> </span><span class="nc">Item</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">io</span><span class="p">::</span><span class="nb">Result</span><span class="o">&lt;</span><span class="n">Rope</span><span class="o">&gt;</span><span class="p">;</span>
<span class="p">}</span> <span class="p">}</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">fasta_chunks</span><span class="o">&lt;</span><span class="n">R</span><span class="p">:</span><span class="w"> </span><span class="nc">Read</span><span class="o">&gt;</span><span class="p">(</span><span class="n">source</span><span class="p">:</span><span class="w"> </span><span class="nc">R</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">SeqChunkIter</span><span class="o">&lt;</span><span class="n">R</span><span class="o">&gt;</span> <span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">fasta_chunks</span><span class="o">&lt;</span><span class="n">R</span><span class="p">:</span><span class="w"> </span><span class="nc">Read</span><span class="o">&gt;</span><span class="p">(</span><span class="n">source</span><span class="p">:</span><span class="w"> </span><span class="nc">R</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">SeqChunkIter</span><span class="o">&lt;</span><span class="n">R</span><span class="o">&gt;</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">fastq_chunks</span><span class="o">&lt;</span><span class="n">R</span><span class="p">:</span><span class="w"> </span><span class="nc">Read</span><span class="o">&gt;</span><span class="p">(</span><span class="n">source</span><span class="p">:</span><span class="w"> </span><span class="nc">R</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">SeqChunkIter</span><span class="o">&lt;</span><span class="n">R</span><span class="o">&gt;</span> <span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">fastq_chunks</span><span class="o">&lt;</span><span class="n">R</span><span class="p">:</span><span class="w"> </span><span class="nc">Read</span><span class="o">&gt;</span><span class="p">(</span><span class="n">source</span><span class="p">:</span><span class="w"> </span><span class="nc">R</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">SeqChunkIter</span><span class="o">&lt;</span><span class="n">R</span><span class="o">&gt;</span>
</code></pre></div> </code></pre></div>
<p><code>next()</code> loop:</p> <p><code>next()</code> loop:</p>
<div class="highlight"><pre><span></span><code>1. read one block of block_size bytes → push onto rope <div class="highlight"><pre><span></span><code>1. read one block of block_size bytes → push onto Rope
2. probe check: if the boundary marker ("\n&gt;" or "\n@") is absent from the 2. call splitter(rope) → Option&lt;abs_offset&gt;
last block, skip the splitter (avoids a full backward scan for nothing) if Some(pos):
3. call splitter on last block tail = rope.split_off(pos) ← O(log n), may split one block
if found at offset n: chunk = mem::replace(&amp;mut rope, tail)
remainder = last_block.split_to(n) ← O(1), zero copy return Some(Ok(chunk))
return std::mem::take(&amp;mut self.rope) ← the chunk 3. if EOF and rope non-empty: return Some(Ok(rope)) as final chunk
4. if rope.len() &gt; 1 (multi-block accumulation): 4. if EOF and rope empty: return None
pack rope into one flat buffer ← one alloc
retry splitter on flat buffer
5. if EOF: flush remaining rope as final chunk
</code></pre></div> </code></pre></div>
<p>The <code>Splitter</code> function signature is <code>fn(&amp;Rope) -&gt; Option&lt;usize&gt;</code>. It returns the absolute byte offset of the start of the last complete record, or <code>None</code> if no boundary was found in the accumulated rope (need more data).</p>
<h2 id="boundary-detection-fasta">Boundary detection — FASTA</h2> <h2 id="boundary-detection-fasta">Boundary detection — FASTA</h2>
<p>Backward scan with a 2-state machine. Searches for <code>&gt;</code> immediately preceded by <code>\n</code> or <code>\r</code>:</p> <p>Backward scan with a 2-state machine. Searches (right to left) for <code>&gt;</code> followed by <code>\n</code> or <code>\r</code> (i.e., a <code>&gt;</code> that is preceded by a newline in forward order):</p>
<pre class="mermaid"><code>stateDiagram-v2 <pre class="mermaid"><code>stateDiagram-v2
direction LR direction LR
[*] --&gt; Scanning [*] --&gt; Scanning
Scanning --&gt; FoundGt : '&gt;' Scanning --&gt; FoundGt : '&gt;'
FoundGt --&gt; Scanning : other FoundGt --&gt; Scanning : other
FoundGt --&gt; [*] : '\\n' / '\\r' ✓</code></pre> FoundGt --&gt; [*] : '\\n' / '\\r' ✓</code></pre>
<p>Returns the byte offset of the <code>&gt;</code> that starts the last complete record.</p> <p>Returns the byte offset of the <code>&gt;</code> that starts the last complete record. Returns <code>None</code> if only one <code>&gt;</code> is found (cannot confirm there is a prior complete record).</p>
<h2 id="boundary-detection-fastq">Boundary detection — FASTQ</h2> <h2 id="boundary-detection-fastq">Boundary detection — FASTQ</h2>
<p>FASTQ records have a rigid 4-line structure (<code>@header</code>, sequence, <code>+</code>, quality). The <code>@</code> character (ASCII 64, Phred score 31) can appear legitimately in quality lines, making any forward heuristic unreliable. The backward scanner verifies the full structural context before accepting a candidate <code>@</code>.</p> <p>FASTQ records have a rigid 4-line structure (<code>@header</code>, sequence, <code>+</code>, quality). The <code>@</code> character (ASCII 64, Phred score 31) can appear legitimately in quality lines, making any forward heuristic unreliable. The backward scanner verifies the full structural context before accepting a candidate <code>@</code>.</p>
<p>7-state machine (port of Go's <code>EndOfLastFastqEntry</code>), scanning from <strong>right to left</strong>. Each time a <code>+</code> is found, its position is saved as <code>restart</code>; any state mismatch resets the scan to that position.</p> <p>7-state machine (states 06), scanning from <strong>right to left</strong>. Each time a <code>+</code> is found, its position is saved as <code>restart</code>; any state mismatch resets the scan to that position.</p>
<pre class="mermaid"><code>stateDiagram-v2 <pre class="mermaid"><code>stateDiagram-v2
direction LR direction LR
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
+210 -21
View File
@@ -514,10 +514,21 @@
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix> <ul class="md-nav__list" data-md-component="toc" data-md-scrollfix>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="#memory-layout" class="md-nav__link"> <a href="#types-and-layout" class="md-nav__link">
<span class="md-ellipsis"> <span class="md-ellipsis">
Memory layout Types and layout
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#global-parameters" class="md-nav__link">
<span class="md-ellipsis">
Global parameters
</span> </span>
</a> </a>
@@ -558,10 +569,32 @@
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="#canonical-form" class="md-nav__link"> <a href="#canonical-form-and-canonicalkmerof" class="md-nav__link">
<span class="md-ellipsis"> <span class="md-ellipsis">
Canonical form Canonical form and CanonicalKmerOf
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#sliding-window-helpers" class="md-nav__link">
<span class="md-ellipsis">
Sliding window helpers
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#hashing" class="md-nav__link">
<span class="md-ellipsis">
Hashing
</span> </span>
</a> </a>
@@ -751,6 +784,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link"> <a href="../obilayeredmap/" class="md-nav__link">
@@ -829,6 +890,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
@@ -973,10 +1090,21 @@
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix> <ul class="md-nav__list" data-md-component="toc" data-md-scrollfix>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="#memory-layout" class="md-nav__link"> <a href="#types-and-layout" class="md-nav__link">
<span class="md-ellipsis"> <span class="md-ellipsis">
Memory layout Types and layout
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#global-parameters" class="md-nav__link">
<span class="md-ellipsis">
Global parameters
</span> </span>
</a> </a>
@@ -1017,10 +1145,32 @@
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="#canonical-form" class="md-nav__link"> <a href="#canonical-form-and-canonicalkmerof" class="md-nav__link">
<span class="md-ellipsis"> <span class="md-ellipsis">
Canonical form Canonical form and CanonicalKmerOf
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#sliding-window-helpers" class="md-nav__link">
<span class="md-ellipsis">
Sliding window helpers
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#hashing" class="md-nav__link">
<span class="md-ellipsis">
Hashing
</span> </span>
</a> </a>
@@ -1045,12 +1195,43 @@
<h1 id="kmer-implementation">Kmer — implementation</h1> <h1 id="kmer-implementation">Kmer — implementation</h1>
<h2 id="memory-layout">Memory layout</h2> <h2 id="types-and-layout">Types and layout</h2>
<p><code>Kmer</code> is a <code>#[repr(transparent)]</code> newtype over <code>u64</code>:</p> <p><code>KmerOf&lt;L&gt;</code> is a <code>#[repr(transparent)]</code> newtype over <code>u64</code> parameterized by a <code>KmerLength</code> marker:</p>
<div class="highlight"><pre><span></span><code><span class="cp">#[repr(transparent)]</span> <div class="highlight"><pre><span></span><code><span class="cp">#[repr(transparent)]</span>
<span class="k">pub</span><span class="w"> </span><span class="k">struct</span><span class="w"> </span><span class="nc">Kmer</span><span class="p">(</span><span class="kt">u64</span><span class="p">);</span> <span class="k">pub</span><span class="w"> </span><span class="k">struct</span><span class="w"> </span><span class="nc">KmerOf</span><span class="o">&lt;</span><span class="n">L</span><span class="p">:</span><span class="w"> </span><span class="nc">KmerLength</span><span class="o">&gt;</span><span class="p">(</span><span class="kt">u64</span><span class="p">,</span><span class="w"> </span><span class="n">PhantomData</span><span class="o">&lt;</span><span class="n">L</span><span class="o">&gt;</span><span class="p">);</span>
</code></pre></div> </code></pre></div>
<p>Nucleotides are packed 2 bits each, <strong>left-aligned</strong>, MSB-first. Nucleotide 0 occupies bits 6362; nucleotide i occupies bits 632i and 622i. The low 642k bits are always zero. k is <strong>not stored</strong> — it is a parameter of every operation that needs it, and will be owned by the future collection-level indexer.</p> <p>Three marker types implement <code>KmerLength</code>:</p>
<table>
<thead>
<tr>
<th>Marker</th>
<th><code>len()</code> source</th>
<th>Used for</th>
</tr>
</thead>
<tbody>
<tr>
<td><code>KLen</code></td>
<td><code>params::k()</code></td>
<td>k-mers</td>
</tr>
<tr>
<td><code>MLen</code></td>
<td><code>params::m()</code></td>
<td>minimizers</td>
</tr>
<tr>
<td><code>ConstLen&lt;N&gt;</code></td>
<td>const generic <code>N</code></td>
<td>tests</td>
</tr>
</tbody>
</table>
<p>Public aliases:</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">type</span><span class="w"> </span><span class="nc">Kmer</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">KmerOf</span><span class="o">&lt;</span><span class="n">KLen</span><span class="o">&gt;</span><span class="p">;</span><span class="w"> </span><span class="c1">// k-mer, global k</span>
<span class="k">pub</span><span class="w"> </span><span class="k">type</span><span class="w"> </span><span class="nc">Minimizer</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">CanonicalKmerOf</span><span class="o">&lt;</span><span class="n">MLen</span><span class="o">&gt;</span><span class="p">;</span><span class="w"> </span><span class="c1">// canonical m-mer, global m</span>
</code></pre></div>
<p>Nucleotides are packed 2 bits each, <strong>left-aligned</strong>, MSB-first. Nucleotide 0 occupies bits 6362; nucleotide i occupies bits 632i and 622i. The low 642·len bits are always zero. The length is <strong>not stored</strong> — every operation reads it from <code>L::len()</code>.</p>
<table> <table>
<thead> <thead>
<tr> <tr>
@@ -1071,33 +1252,41 @@
</tr> </tr>
</tbody> </tbody>
</table> </table>
<h2 id="global-parameters">Global parameters</h2>
<p><code>params::set_k(k)</code> / <code>params::k()</code> and <code>params::set_m(m)</code> / <code>params::m()</code> are backed by <code>OnceLock&lt;usize&gt;</code> in production (write-once, panic on conflict) and by <code>thread_local! { Cell&lt;usize&gt; }</code> in test builds (per-thread, freely writable). <code>params::init(k, m)</code> sets both in one call.</p>
<h2 id="encoding">Encoding</h2> <h2 id="encoding">Encoding</h2>
<p><code>Kmer::from_ascii(ascii, k)</code> encodes the first k bytes of an ASCII slice using the shared <code>ENC</code> table (see <a href="../superkmer/#ascii-encoding-and-decoding">SuperKmer — ASCII encoding</a>):</p> <p><code>KmerOf::&lt;L&gt;::from_ascii(ascii)</code> encodes the first <code>L::len()</code> bytes using the shared <code>ENC</code> table (see <a href="../superkmer/#ascii-encoding-and-decoding">SuperKmer — ASCII encoding</a>):</p>
<div class="highlight"><pre><span></span><code><span class="k">for</span><span class="w"> </span><span class="n">i</span><span class="w"> </span><span class="k">in</span><span class="w"> </span><span class="mi">0</span><span class="o">..</span><span class="n">k</span><span class="w"> </span><span class="p">{</span> <div class="highlight"><pre><span></span><code><span class="k">for</span><span class="w"> </span><span class="n">i</span><span class="w"> </span><span class="k">in</span><span class="w"> </span><span class="mi">0</span><span class="o">..</span><span class="n">k</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="n">val</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="p">(</span><span class="n">val</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">2</span><span class="p">)</span><span class="w"> </span><span class="o">|</span><span class="w"> </span><span class="n">encode_base</span><span class="p">(</span><span class="n">ascii</span><span class="p">[</span><span class="n">i</span><span class="p">])</span><span class="w"> </span><span class="k">as</span><span class="w"> </span><span class="kt">u64</span><span class="p">;</span> <span class="w"> </span><span class="n">val</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="p">(</span><span class="n">val</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">2</span><span class="p">)</span><span class="w"> </span><span class="o">|</span><span class="w"> </span><span class="n">encode_base</span><span class="p">(</span><span class="n">ascii</span><span class="p">[</span><span class="n">i</span><span class="p">])</span><span class="w"> </span><span class="k">as</span><span class="w"> </span><span class="kt">u64</span><span class="p">;</span>
<span class="p">}</span> <span class="p">}</span>
<span class="n">Kmer</span><span class="p">(</span><span class="n">val</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="p">(</span><span class="mi">64</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="mi">2</span><span class="w"> </span><span class="o">*</span><span class="w"> </span><span class="n">k</span><span class="p">))</span> <span class="n">KmerOf</span><span class="p">(</span><span class="n">val</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="p">(</span><span class="mi">64</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="mi">2</span><span class="w"> </span><span class="o">*</span><span class="w"> </span><span class="n">k</span><span class="p">),</span><span class="w"> </span><span class="n">PhantomData</span><span class="p">)</span>
</code></pre></div> </code></pre></div>
<p>Zero allocation — result lives on the stack.</p> <p>Zero allocation — result lives on the stack.</p>
<h2 id="decoding">Decoding</h2> <h2 id="decoding">Decoding</h2>
<p><code>write_ascii(k, buf)</code> appends k ASCII characters to a caller-supplied <code>Vec&lt;u8&gt;</code> using the shared <code>DEC4</code> table: one lookup per 4 nucleotides, two partial-byte lookups for the remainder. No allocation in the hot path.</p> <p><code>write_ascii(writer)</code> writes k ASCII characters to any <code>W: Write</code> using the shared <code>DEC4</code> table: one lookup per 4 nucleotides, one partial lookup for the remainder. No allocation in the hot path.</p>
<p><code>to_ascii(k)</code> is a convenience wrapper that allocates and returns a <code>Vec&lt;u8&gt;</code>; intended for tests and display only.</p> <p><code>to_ascii()</code> is a convenience wrapper that allocates and returns a <code>Vec&lt;u8&gt;</code>; intended for tests and display only.</p>
<h2 id="reverse-complement">Reverse complement</h2> <h2 id="reverse-complement">Reverse complement</h2>
<p>Computed as pure arithmetic — no lookup table, no memory access:</p> <p>Computed as pure arithmetic — no lookup table, no memory access:</p>
<div class="highlight"><pre><span></span><code><span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="o">!</span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="p">;</span><span class="w"> </span><span class="c1">// complement</span> <div class="highlight"><pre><span></span><code><span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="o">!</span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="p">;</span><span class="w"> </span><span class="c1">// complement</span>
<span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">x</span><span class="p">.</span><span class="n">swap_bytes</span><span class="p">();</span><span class="w"> </span><span class="c1">// reverse bytes</span> <span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">x</span><span class="p">.</span><span class="n">swap_bytes</span><span class="p">();</span><span class="w"> </span><span class="c1">// reverse bytes</span>
<span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="p">((</span><span class="n">x</span><span class="w"> </span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="mi">4</span><span class="p">)</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0x0F0F0F0F0F0F0F0F</span><span class="p">)</span><span class="w"> </span><span class="o">|</span><span class="w"> </span><span class="p">((</span><span class="n">x</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0x0F0F0F0F0F0F0F0F</span><span class="p">)</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">4</span><span class="p">);</span><span class="w"> </span><span class="c1">// swap nibbles</span> <span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="p">((</span><span class="n">x</span><span class="w"> </span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="mi">4</span><span class="p">)</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0x0F0F0F0F0F0F0F0F</span><span class="p">)</span><span class="w"> </span><span class="o">|</span><span class="w"> </span><span class="p">((</span><span class="n">x</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0x0F0F0F0F0F0F0F0F</span><span class="p">)</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">4</span><span class="p">);</span><span class="w"> </span><span class="c1">// swap nibbles</span>
<span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="p">((</span><span class="n">x</span><span class="w"> </span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="mi">2</span><span class="p">)</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0x3333333333333333</span><span class="p">)</span><span class="w"> </span><span class="o">|</span><span class="w"> </span><span class="p">((</span><span class="n">x</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0x3333333333333333</span><span class="p">)</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">2</span><span class="p">);</span><span class="w"> </span><span class="c1">// swap 2-bit groups</span> <span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="p">((</span><span class="n">x</span><span class="w"> </span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="mi">2</span><span class="p">)</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0x3333333333333333</span><span class="p">)</span><span class="w"> </span><span class="o">|</span><span class="w"> </span><span class="p">((</span><span class="n">x</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0x3333333333333333</span><span class="p">)</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">2</span><span class="p">);</span><span class="w"> </span><span class="c1">// swap 2-bit groups</span>
<span class="n">Kmer</span><span class="p">(</span><span class="n">x</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="p">(</span><span class="mi">64</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="mi">2</span><span class="w"> </span><span class="o">*</span><span class="w"> </span><span class="n">k</span><span class="p">))</span> <span class="n">KmerOf</span><span class="p">(</span><span class="n">x</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="p">(</span><span class="mi">64</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="mi">2</span><span class="w"> </span><span class="o">*</span><span class="w"> </span><span class="n">k</span><span class="p">),</span><span class="w"> </span><span class="n">PhantomData</span><span class="p">)</span>
</code></pre></div> </code></pre></div>
<p>After complementing, bytes are reversed (<code>swap_bytes</code>), then nibbles, then 2-bit groups — restoring 2-bit nucleotides to their correct positions in reverse order. A final left-shift realigns to MSB. Zero allocation — result lives on the stack.</p> <p>After complementing, bytes are reversed (<code>swap_bytes</code>), then nibbles, then 2-bit groups — restoring 2-bit nucleotides to their correct positions in reverse order. A final left-shift realigns to MSB. Zero allocation — result lives on the stack.</p>
<h2 id="canonical-form">Canonical form</h2> <h2 id="canonical-form-and-canonicalkmerof">Canonical form and <code>CanonicalKmerOf</code></h2>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">canonical</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">k</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">Self</span><span class="w"> </span><span class="p">{</span> <p><code>canonical()</code> returns a <code>CanonicalKmerOf&lt;L&gt;</code> — a distinct newtype that carries the same <code>u64</code> layout but enforces the invariant that the stored value equals <code>min(kmer, revcomp)</code>:</p>
<span class="w"> </span><span class="kd">let</span><span class="w"> </span><span class="n">rc</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">revcomp</span><span class="p">(</span><span class="n">k</span><span class="p">);</span> <div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">canonical</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">CanonicalKmerOf</span><span class="o">&lt;</span><span class="n">L</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">if</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">&lt;=</span><span class="w"> </span><span class="n">rc</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="o">*</span><span class="bp">self</span><span class="w"> </span><span class="p">}</span><span class="w"> </span><span class="k">else</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">rc</span><span class="w"> </span><span class="p">}</span> <span class="w"> </span><span class="kd">let</span><span class="w"> </span><span class="n">rc</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">revcomp</span><span class="p">();</span>
<span class="w"> </span><span class="n">CanonicalKmerOf</span><span class="p">(</span><span class="k">if</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">&lt;=</span><span class="w"> </span><span class="n">rc</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="p">}</span><span class="w"> </span><span class="k">else</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">rc</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="p">},</span><span class="w"> </span><span class="n">PhantomData</span><span class="p">)</span>
<span class="p">}</span> <span class="p">}</span>
</code></pre></div> </code></pre></div>
<p>Lexicographic minimum of forward and reverse-complement, comparing the raw <code>u64</code> values directly (left-aligned encoding makes this equivalent to nucleotide-wise comparison). Zero allocation — result lives on the stack.</p> <p>Lexicographic minimum of forward and reverse-complement, comparing the raw <code>u64</code> values directly (left-aligned encoding makes this equivalent to nucleotide-wise comparison). Zero allocation — result lives on the stack.</p>
<p><code>CanonicalKmerOf::from_raw_unchecked(raw)</code> is the only other public constructor, for trusted paths such as deserialisation.</p>
<h2 id="sliding-window-helpers">Sliding window helpers</h2>
<p><code>push_right(nuc)</code> / <code>push_left(nuc)</code> shift the window by one base in O(1). <code>is_overlapping(other)</code> checks whether the last k1 nucleotides of <code>self</code> equal the first k1 of <code>other</code>.</p>
<h2 id="hashing">Hashing</h2>
<p><code>hash_kmer(raw: u64) -&gt; u64</code> computes <code>mix64(raw ^ 0x9e3779b97f4a7c15)</code>, the seeded splitmix64 finalizer. <code>CanonicalKmerOf::seq_hash()</code> delegates to <code>hash_kmer</code>.</p>
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
+175 -20
View File
@@ -757,6 +757,28 @@
</span> </span>
</a> </a>
</li>
<li class="md-nav__item">
<a href="#evidence-modes" class="md-nav__link">
<span class="md-ellipsis">
Evidence modes
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#build-functions" class="md-nav__link">
<span class="md-ellipsis">
Build functions
</span>
</a>
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
@@ -840,6 +862,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link"> <a href="../obilayeredmap/" class="md-nav__link">
@@ -918,6 +968,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
@@ -1165,6 +1271,28 @@
</span> </span>
</a> </a>
</li>
<li class="md-nav__item">
<a href="#evidence-modes" class="md-nav__link">
<span class="md-ellipsis">
Evidence modes
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#build-functions" class="md-nav__link">
<span class="md-ellipsis">
Build functions
</span>
</a>
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
@@ -1226,26 +1354,26 @@
<h2 id="why-two-phases-are-needed">Why two phases are needed</h2> <h2 id="why-two-phases-are-needed">Why two phases are needed</h2>
<p>Kmer indexing per partition proceeds in two phases. The separation is necessary because the exact number of surviving unique kmers is not known until after counting and filtering low-abundance kmers.</p> <p>Kmer indexing per partition proceeds in two phases. The separation is necessary because the exact number of surviving unique kmers is not known until after counting and filtering low-abundance kmers.</p>
<h3 id="phase-1-provisional-mphf-kmer-spectrum">Phase 1 — provisional MPHF + kmer spectrum</h3> <h3 id="phase-1-provisional-mphf-kmer-spectrum">Phase 1 — provisional MPHF + kmer spectrum</h3>
<p>Implemented in <code>obikpartitionner::KmerPartition::count_kmer()</code>.</p> <p>Implemented in <code>obikpartitionner::KmerPartition::count_kmer()</code><code>count_partition()</code>.</p>
<ol> <ol>
<li><strong>Pass 1</strong>: read the dereplicated superkmer file; enumerate all unique canonical kmers into a <code>HashSet</code>. Exact count known after this pass.</li> <li><strong>External sort</strong>: read the dereplicated superkmer file; extract the raw <code>u64</code> canonical kmer value for every kmer of every superkmer. Sort in RAM-bounded chunks (adaptive budget: 40% of available RAM ÷ n_threads, minimum 1 M kmers per chunk), then k-way merge with inline dedup. Result: <code>sorted_unique.bin</code> — a flat array of f0 distinct sorted <code>u64</code> values. Exact kmer count f0 is known at this point.</li>
<li><strong>Build a provisional MPHF</strong> (<code>GOFunction</code> from the <code>ph</code> crate) over the exact kmer set. Produces <code>mphf1.bin</code>.</li> <li><strong>Build provisional MPHF</strong> (ptr_hash, same configuration as phase 2) over <code>sorted_unique.bin</code> using <code>new_from_par_iter</code>. Delete <code>sorted_unique.bin</code> immediately after. Persist to <code>mphf1.bin</code>.</li>
<li><strong>Create <code>counts1.bin</code></strong>: one zero-initialised <code>u32</code> per MPHF slot (mmap'd).</li> <li><strong>Create <code>counts1.bin</code></strong>: <code>PersistentCompactIntVec</code> with f0 slots, zero-initialised.</li>
<li><strong>Pass 2</strong>: re-read the dereplicated file; for each kmer, query <code>mphf1.get(kmer)</code> and atomically accumulate the superkmer count into <code>counts1[slot]</code>.</li> <li><strong>Accumulation pass</strong>: re-read the dereplicated superkmer file; for each kmer in each superkmer, compute <code>slot = mphf.index(kmer.raw())</code> and increment <code>counts1[slot]</code> by the superkmer's COUNT.</li>
<li><strong>Build kmer frequency spectrum</strong> from <code>counts1</code>: histogram <code>{count → n_kmers}</code>, totals f0 (distinct kmers) and f1 (total abundance). Written to <code>kmer_spectrum_raw.json</code> per partition, then merged globally.</li> <li><strong>Build kmer frequency spectrum</strong> from <code>counts1</code>: histogram <code>{count → n_kmers}</code>, totals f0 (distinct kmers) and f1 (total abundance). Written to <code>kmer_spectrum_raw.json</code> per partition, then merged globally.</li>
</ol> </ol>
<p>Files produced per partition:</p> <p>Files produced per partition:</p>
<div class="highlight"><pre><span></span><code>part_XXXXX/ <div class="highlight"><pre><span></span><code>part_XXXXX/
mphf1.bin — GOFunction (provisional MPHF, discarded after phase 2) mphf1.bin — ptr_hash provisional MPHF (discarded after phase 2)
counts1.bin — [u32; n_kmers] kmer counts, mmap&#39;d counts1.bin — PersistentCompactIntVec, f0 × u32 kmer counts
kmer_spectrum_raw.json — local frequency spectrum kmer_spectrum_raw.json — local frequency spectrum
</code></pre></div> </code></pre></div>
<h3 id="phase-2-definitive-mphf">Phase 2 — definitive MPHF</h3> <h3 id="phase-2-definitive-mphf">Phase 2 — definitive MPHF</h3>
<p>After filtering (applying a min-count threshold derived from the spectrum) and building the local De Bruijn graph + unitigs (see <a href="../pipeline/">Construction pipeline</a>), the exact filtered kmer set is available via <code>unitigs.bin</code>.</p> <p>After filtering (applying a min-count threshold derived from the spectrum) and building the local De Bruijn graph + unitigs (see <a href="../pipeline/">Construction pipeline</a>), the exact filtered kmer set is available via <code>unitigs.bin</code>.</p>
<p><code>MphfLayer::build</code> is called on the unitig file:</p> <p><code>MphfLayer::build(dir, block_bits, mode: &amp;IndexMode, fill_slot)</code> is called on the unitig directory:</p>
<ol> <ol>
<li><strong>Pass 1</strong>: iterate all canonical kmers from <code>unitigs.bin</code> in parallel, build and store <code>mphf.bin</code> (ptr_hash).</li> <li><strong>Pass 1</strong> (parallel): a <code>CanonicalKmerIter</code> — clonable via <code>Arc&lt;Mmap&gt;</code>, no file reopening — is passed directly to <code>new_from_par_iter</code> via <code>par_bridge()</code>. No <code>.idx</code> is read or created at this stage; parallelism is at partition/layer level, not within a single MPHF. Produces <code>mphf.bin</code>.</li>
<li><strong>Pass 2</strong>: iterate sequentially, fill <code>evidence.bin</code>, call the mode-specific <code>fill_slot</code> callback.</li> <li><strong>Pass 2</strong> (sequential): iterate with <code>iter_indexed_canonical_kmers</code>; fill evidence files; call <code>fill_slot(slot, kmer)</code> callback per kmer. For Exact/Hybrid, <code>.idx</code> is written at the end of this pass — never earlier.</li>
</ol> </ol>
<p><code>mphf1.bin</code> and <code>counts1.bin</code> are no longer needed after phase 2 and can be deleted.</p> <p><code>mphf1.bin</code> and <code>counts1.bin</code> are no longer needed after phase 2 and can be deleted.</p>
<hr /> <hr />
@@ -1265,13 +1393,11 @@
<p><strong>FMPH/FMPHGO</strong> (<code>ph</code> crate, Beling, ACM JEA 2023):</p> <p><strong>FMPH/FMPHGO</strong> (<code>ph</code> crate, Beling, ACM JEA 2023):</p>
<ul> <ul>
<li>~2.1 bits/key — most compact; good query speed; deterministic construction</li> <li>~2.1 bits/key — most compact; good query speed; deterministic construction</li>
<li>Works well from an exact or slightly overestimated count</li> <li><code>GOFunction</code> (group-oriented variant) was the original phase-1 choice; eliminated when the external sort made the exact count available at phase 1 as well</li>
<li><code>GOFunction</code> (group-oriented variant) is the specific type used</li>
</ul> </ul>
<h2 id="mphf-choice-per-phase">MPHF choice per phase</h2> <h2 id="mphf-choice-per-phase">MPHF choice per phase</h2>
<p><strong>Phase 1</strong> (provisional, discarded after spectrum computation): <code>ph::fmph::GOFunction</code>. Compact, fast to build from the exact post-dedup kmer set. Query speed is secondary — the structure is only used during pass 2 of <code>count_kmer</code>.</p> <p><strong>Both phases</strong>: <strong>ptr_hash</strong>, same type alias and construction parameters. The external sort (phase 1) and the unitig index (phase 2) both provide the exact key count before MPHF construction, so ptr_hash's requirement is satisfied in both cases. Using a single MPHF implementation removes the <code>ph</code> crate dependency.</p>
<p><strong>Phase 2</strong> (persistent, queried repeatedly): <strong>ptr_hash</strong>. Exact key count is available from the unitig index; ptr_hash query speed (≥2.1×) and construction speed (≥3.1× over FMPH) are the decisive factors. The 2.4 bits/key overhead is acceptable.</p> <p>boomphf: eliminated — largest space overhead, streaming advantage no longer needed. FMPH/GOFunction: eliminated — exact count available, ptr_hash is faster at equivalent compactness.</p>
<p>boomphf is eliminated: largest space overhead, streaming advantage does not apply.</p>
<hr /> <hr />
<h2 id="space-at-scale">Space at scale</h2> <h2 id="space-at-scale">Space at scale</h2>
<p>For 1 024 partitions × 100 M kmers/partition (phase 2 index, after filtering):</p> <p>For 1 024 partitions × 100 M kmers/partition (phase 2 index, after filtering):</p>
@@ -1320,9 +1446,12 @@
<h3 id="layer-structure">Layer structure</h3> <h3 id="layer-structure">Layer structure</h3>
<p>Each layer is a self-contained unit. See <a href="../obilayeredmap/">obilayeredmap</a> for the full on-disk layout. The MPHF-relevant files are:</p> <p>Each layer is a self-contained unit. See <a href="../obilayeredmap/">obilayeredmap</a> for the full on-disk layout. The MPHF-relevant files are:</p>
<div class="highlight"><pre><span></span><code>layer_i/ <div class="highlight"><pre><span></span><code>layer_i/
unitigs.bin — packed 2-bit nucleotide sequences (kmer evidence) unitigs.bin — packed 2-bit nucleotide sequences (kmer evidence source)
unitigs.bin.idx — random-access block index (block_bits controls granularity)
mphf.bin — ptr_hash phase-2 MPHF mphf.bin — ptr_hash phase-2 MPHF
evidence.bin — n × u32: (chunk_id: 25 bits | rank: 7 bits) per slot evidence.bin — n × (chunk_id: 25 bits | rank: 7 bits) per slot [exact mode]
fingerprint.bin — n × b-bit fingerprints per slot [approx mode]
[no layer_meta.json — mode stored once in partition-level meta.json]
</code></pre></div> </code></pre></div>
<p>Layers are <strong>disjoint</strong>: a canonical kmer belongs to exactly one layer. Layer 0 is built from dataset A. Adding dataset B:</p> <p>Layers are <strong>disjoint</strong>: a canonical kmer belongs to exactly one layer. Layer 0 is built from dataset A. Adding dataset B:</p>
<ol> <ol>
@@ -1330,17 +1459,43 @@
<li>Collect kmers of B not present in any layer → set <code>B \ A</code>.</li> <li>Collect kmers of B not present in any layer → set <code>B \ A</code>.</li>
<li>Build layer 1 from <code>B \ A</code> (dereplicate → count → De Bruijn → unitigs → <code>MphfLayer::build</code>).</li> <li>Build layer 1 from <code>B \ A</code> (dereplicate → count → De Bruijn → unitigs → <code>MphfLayer::build</code>).</li>
</ol> </ol>
<h3 id="evidence-modes">Evidence modes</h3>
<p>Three evidence modes are supported via <code>IndexMode</code>, stored once in <code>PartitionMeta</code> at partition root. There is no <code>layer_meta.json</code>.</p>
<p><strong>Exact</strong> (<code>IndexMode::Exact</code>): <code>evidence.bin</code> stores one <code>(chunk_id, rank)</code> pair per MPHF slot. Verification reconstructs the kmer and compares to the query. Zero false positives. <code>.idx</code> required at query time.</p>
<p><strong>Approx</strong> (<code>IndexMode::Approx { b, z }</code>): <code>fingerprint.bin</code> stores a b-bit hash per slot. False-positive rate 1/2^b per query; Findere z-parameter reduces window FP to ≈ 1/2^(b·z). No <code>.idx</code> written or needed.</p>
<p><strong>Hybrid</strong> (<code>IndexMode::Hybrid { b, z }</code>): both <code>fingerprint.bin</code> and <code>evidence.bin</code> + <code>.idx</code>. <code>find()</code> uses the fingerprint (O(1)); <code>find_strict()</code> uses exact evidence (O(1)).</p>
<h3 id="build-functions">Build functions</h3>
<div class="highlight"><pre><span></span><code>MphfLayer::build(dir, block_bits, mode: &amp;IndexMode, fill_slot)
Pass 1: CanonicalKmerIter + par_bridge() → build mphf.bin (no .idx used)
Pass 2: sequential iter → fill evidence files + call fill_slot
.idx written last for Exact/Hybrid (query-time only)
MphfLayer::build_exact_evidence(dir, block_bits)
Post-hoc: builds evidence.bin + .idx from existing mphf.bin + unitigs.bin
Uses open_sequential(); no .idx required on entry
MphfLayer::build_approx_evidence(dir, b, z)
Post-hoc: builds fingerprint.bin from existing mphf.bin + unitigs.bin
Uses open_sequential(); never writes .idx
</code></pre></div>
<p>There is no <code>build_evidence</code> dispatch wrapper. Callers choose the appropriate post-hoc build directly.</p>
<p>In <code>obikpartitionner</code>, <code>build_index_layer</code> receives <code>block_bits: u8</code> from <code>IndexConfig::block_bits</code> and forwards it directly to <code>Layer::build</code> and <code>Layer::build_approx_evidence</code>.</p>
<h3 id="membership-verification">Membership verification</h3> <h3 id="membership-verification">Membership verification</h3>
<p>ptr_hash maps any input to a valid slot — it does not natively detect absent keys. Membership is verified using the evidence entry: decode the kmer from <code>(chunk_id, rank)</code> and compare to the query. A mismatch means the kmer is absent from this layer; probe the next layer.</p> <p>ptr_hash maps any input to a valid slot — it does not natively detect absent keys. Membership is verified using the evidence entry:</p>
<ul>
<li><strong>Exact</strong>: decode <code>(chunk_id, rank)</code> from <code>evidence.bin</code>; reconstruct the kmer via <code>unitigs.verify_canonical_kmer</code>; compare to query.</li>
<li><strong>Approx</strong>: compare <code>kmer.seq_hash()</code> to the b-bit fingerprint stored at the slot.</li>
</ul>
<p>A mismatch in either mode means the kmer is absent from this layer; probe the next layer.</p>
<h3 id="query-algorithm">Query algorithm</h3> <h3 id="query-algorithm">Query algorithm</h3>
<div class="highlight"><pre><span></span><code>fn query(kmer) → Option&lt;(layer_index, slot)&gt;: <div class="highlight"><pre><span></span><code>fn query(kmer) → Option&lt;(layer_index, slot)&gt;:
for (i, layer) in layers.iter().enumerate(): for (i, layer) in layers.iter().enumerate():
slot = layer.mphf.index(kmer) slot = layer.mphf.index(kmer)
if layer.evidence.decode(slot) matches kmer: if layer.evidence.matches(slot, kmer): // exact or approx dispatch
return Some((i, slot)) return Some((i, slot))
return None return None
</code></pre></div> </code></pre></div>
<p>Expected probe depth: 1 for kmers in layer 0. Each probe is a ptr_hash lookup (~10 ns) plus one evidence decode.</p> <p><code>MphfLayer::find</code> dispatches on <code>LayerEvidence</code> at O(1) — no panicking <code>find_exact</code>/<code>find_approx</code> methods. <code>find_strict</code> always performs an exact check: O(1) for Exact/Hybrid, O(n) sequential scan for Approx. Expected probe depth: 1 for kmers in layer 0. Each probe is a ptr_hash lookup (~10 ns) plus one evidence check.</p>
<h3 id="merging-layers">Merging layers</h3> <h3 id="merging-layers">Merging layers</h3>
<p>Two layer chains can be merged by re-indexing their union through the full pipeline. This is expensive (full rebuild) but produces an optimal single-layer index. Merge is a maintenance operation, not a query-path requirement.</p> <p>Two layer chains can be merged by re-indexing their union through the full pipeline. This is expensive (full rebuild) but produces an optimal single-layer index. Merge is a maintenance operation, not a query-path requirement.</p>
File diff suppressed because it is too large Load Diff
+548 -75
View File
@@ -9,7 +9,7 @@
<link rel="prev" href="../unitig_evidence/"> <link rel="prev" href="../evidence_elimination/">
<link rel="next" href="../persistent_compact_int_vec/"> <link rel="next" href="../persistent_compact_int_vec/">
@@ -649,6 +649,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item md-nav__item--active"> <li class="md-nav__item md-nav__item--active">
@@ -729,6 +757,17 @@
</span> </span>
</a> </a>
</li>
<li class="md-nav__item">
<a href="#index-mode-homogeneity-invariant" class="md-nav__link">
<span class="md-ellipsis">
Index mode (homogeneity invariant)
</span>
</a>
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
@@ -740,6 +779,34 @@
</span> </span>
</a> </a>
<nav class="md-nav" aria-label="MphfLayer — autonomous kmer → slot mapping">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#query-api" class="md-nav__link">
<span class="md-ellipsis">
Query API
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#build-surface" class="md-nav__link">
<span class="md-ellipsis">
Build surface
</span>
</a>
</li>
</ul>
</nav>
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
@@ -751,6 +818,73 @@
</span> </span>
</a> </a>
<nav class="md-nav" aria-label="Layer\&lt;D: LayerData&gt; — MPHF + payload">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#build-signatures" class="md-nav__link">
<span class="md-ellipsis">
Build signatures
</span>
</a>
</li>
</ul>
</nav>
</li>
<li class="md-nav__item">
<a href="#fingerprintvec-and-fingerprintvecwriter" class="md-nav__link">
<span class="md-ellipsis">
FingerprintVec and FingerprintVecWriter
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#layeredmapd-collection-of-layers" class="md-nav__link">
<span class="md-ellipsis">
LayeredMap\&lt;D> — collection of layers
</span>
</a>
<nav class="md-nav" aria-label="LayeredMap\&lt;D&gt; — collection of layers">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#common-methods" class="md-nav__link">
<span class="md-ellipsis">
Common methods
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#push_layer" class="md-nav__link">
<span class="md-ellipsis">
push_layer
</span>
</a>
</li>
</ul>
</nav>
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
@@ -776,10 +910,10 @@
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="#evidence-encoding" class="md-nav__link"> <a href="#evidence-encoding-exact" class="md-nav__link">
<span class="md-ellipsis"> <span class="md-ellipsis">
Evidence encoding Evidence encoding (exact)
</span> </span>
</a> </a>
@@ -798,14 +932,53 @@
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="#query-path" class="md-nav__link"> <a href="#column-append-and-merge-support" class="md-nav__link">
<span class="md-ellipsis"> <span class="md-ellipsis">
Query path Column append and merge support
</span> </span>
</a> </a>
<nav class="md-nav" aria-label="Column append and merge support">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#layer-level-genome-column-append" class="md-nav__link">
<span class="md-ellipsis">
Layer-level genome column append
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#presence-matrix-initialisation" class="md-nav__link">
<span class="md-ellipsis">
Presence matrix initialisation
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#why-the-mphf-is-never-rebuilt" class="md-nav__link">
<span class="md-ellipsis">
Why the MPHF is never rebuilt
</span>
</a>
</li>
</ul>
</nav>
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
@@ -895,6 +1068,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
@@ -1058,6 +1287,17 @@
</span> </span>
</a> </a>
</li>
<li class="md-nav__item">
<a href="#index-mode-homogeneity-invariant" class="md-nav__link">
<span class="md-ellipsis">
Index mode (homogeneity invariant)
</span>
</a>
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
@@ -1069,6 +1309,34 @@
</span> </span>
</a> </a>
<nav class="md-nav" aria-label="MphfLayer — autonomous kmer → slot mapping">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#query-api" class="md-nav__link">
<span class="md-ellipsis">
Query API
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#build-surface" class="md-nav__link">
<span class="md-ellipsis">
Build surface
</span>
</a>
</li>
</ul>
</nav>
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
@@ -1080,6 +1348,73 @@
</span> </span>
</a> </a>
<nav class="md-nav" aria-label="Layer\&lt;D: LayerData&gt; — MPHF + payload">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#build-signatures" class="md-nav__link">
<span class="md-ellipsis">
Build signatures
</span>
</a>
</li>
</ul>
</nav>
</li>
<li class="md-nav__item">
<a href="#fingerprintvec-and-fingerprintvecwriter" class="md-nav__link">
<span class="md-ellipsis">
FingerprintVec and FingerprintVecWriter
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#layeredmapd-collection-of-layers" class="md-nav__link">
<span class="md-ellipsis">
LayeredMap\&lt;D> — collection of layers
</span>
</a>
<nav class="md-nav" aria-label="LayeredMap\&lt;D&gt; — collection of layers">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#common-methods" class="md-nav__link">
<span class="md-ellipsis">
Common methods
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#push_layer" class="md-nav__link">
<span class="md-ellipsis">
push_layer
</span>
</a>
</li>
</ul>
</nav>
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
@@ -1105,10 +1440,10 @@
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="#evidence-encoding" class="md-nav__link"> <a href="#evidence-encoding-exact" class="md-nav__link">
<span class="md-ellipsis"> <span class="md-ellipsis">
Evidence encoding Evidence encoding (exact)
</span> </span>
</a> </a>
@@ -1127,14 +1462,53 @@
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="#query-path" class="md-nav__link"> <a href="#column-append-and-merge-support" class="md-nav__link">
<span class="md-ellipsis"> <span class="md-ellipsis">
Query path Column append and merge support
</span> </span>
</a> </a>
<nav class="md-nav" aria-label="Column append and merge support">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#layer-level-genome-column-append" class="md-nav__link">
<span class="md-ellipsis">
Layer-level genome column append
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#presence-matrix-initialisation" class="md-nav__link">
<span class="md-ellipsis">
Presence matrix initialisation
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#why-the-mphf-is-never-rebuilt" class="md-nav__link">
<span class="md-ellipsis">
Why the MPHF is never rebuilt
</span>
</a>
</li>
</ul>
</nav>
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
@@ -1178,7 +1552,7 @@
<h1 id="obilayeredmap-layered-kmer-index-crate">obilayeredmap — layered kmer index crate</h1> <h1 id="obilayeredmap-layered-kmer-index-crate">obilayeredmap — layered kmer index crate</h1>
<h2 id="purpose">Purpose</h2> <h2 id="purpose">Purpose</h2>
<p><code>obilayeredmap</code> implements a persistent, incrementally extensible kmer index. The index is organised in three levels: <strong>index root → partition → layer</strong>. Each layer covers a disjoint kmer set and wraps a <code>ptr_hash</code> MPHF with associated per-slot data. Adding a new dataset never rebuilds existing layers.</p> <p><code>obilayeredmap</code> implements a persistent, incrementally extensible kmer index. Each layer covers a disjoint kmer set and wraps a <code>ptr_hash</code> MPHF with associated per-slot data. Adding a new dataset never rebuilds existing layers.</p>
<hr /> <hr />
<h2 id="three-usage-modes">Three usage modes</h2> <h2 id="three-usage-modes">Three usage modes</h2>
<p>The MPHF + evidence infrastructure is the same for all modes. The <strong>payload</strong> varies.</p> <p>The MPHF + evidence infrastructure is the same for all modes. The <strong>payload</strong> varies.</p>
@@ -1214,34 +1588,65 @@
</table> </table>
<p>Both <code>PersistentCompactIntMatrix</code> and <code>PersistentBitMatrix</code> come from the <code>obicompactvec</code> crate.</p> <p>Both <code>PersistentCompactIntMatrix</code> and <code>PersistentBitMatrix</code> come from the <code>obicompactvec</code> crate.</p>
<hr /> <hr />
<h2 id="index-mode-homogeneity-invariant">Index mode (homogeneity invariant)</h2>
<p>A partitioned index is homogeneous: every layer within a partition shares the same mode. The mode is determined once at <code>LayeredMap::open()</code> from <code>PartitionMeta.mode</code> and passed to each <code>Layer::open()</code> — no per-layer file is read.</p>
<div class="highlight"><pre><span></span><code><span class="cp">#[derive(Serialize, Deserialize, Default)]</span>
<span class="cp">#[serde(tag = </span><span class="s">&quot;type&quot;</span><span class="cp">, rename_all = </span><span class="s">&quot;snake_case&quot;</span><span class="cp">)]</span>
<span class="k">pub</span><span class="w"> </span><span class="k">enum</span><span class="w"> </span><span class="nc">IndexMode</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="cp">#[default]</span>
<span class="w"> </span><span class="n">Exact</span><span class="p">,</span>
<span class="w"> </span><span class="n">Approx</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">b</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">,</span><span class="w"> </span><span class="n">z</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="w"> </span><span class="p">},</span>
<span class="w"> </span><span class="n">Hybrid</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">b</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">,</span><span class="w"> </span><span class="n">z</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="w"> </span><span class="p">},</span>
<span class="p">}</span>
</code></pre></div>
<p><code>IndexMode</code> is stored once in <code>PartitionMeta</code> (<code>meta.json</code> at partition root). There is no <code>layer_meta.json</code>.</p>
<ul>
<li><strong>Exact</strong>: writes <code>evidence.bin</code> + <code>unitigs.bin.idx</code>. Zero false positives.</li>
<li><strong>Approx</strong>: writes <code>fingerprint.bin</code> only. FP rate per kmer = 1/2^b; with Findere z-parameter, z consecutive kmers must all match → effective window FP ≈ 1/2^(b·z). No <code>.idx</code> written or required.</li>
<li><strong>Hybrid</strong>: writes both <code>fingerprint.bin</code> and <code>evidence.bin</code> + <code>.idx</code>. <code>find()</code> uses the fingerprint (fast, O(1)); <code>find_strict()</code> uses exact evidence.</li>
</ul>
<hr />
<h2 id="mphflayer-autonomous-kmer-slot-mapping">MphfLayer — autonomous kmer → slot mapping</h2> <h2 id="mphflayer-autonomous-kmer-slot-mapping">MphfLayer — autonomous kmer → slot mapping</h2>
<p><code>MphfLayer</code> encapsulates the MPHF + evidence + unitig spine for one layer. It is independent of any payload data.</p> <p><code>MphfLayer</code> encapsulates the MPHF and evidence store for one layer. It is independent of any payload.</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">struct</span><span class="w"> </span><span class="nc">MphfLayer</span><span class="w"> </span><span class="p">{</span> <div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">struct</span><span class="w"> </span><span class="nc">MphfLayer</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="n">mphf</span><span class="p">:</span><span class="w"> </span><span class="nc">Mphf</span><span class="p">,</span> <span class="w"> </span><span class="n">mphf</span><span class="p">:</span><span class="w"> </span><span class="nc">Mphf</span><span class="p">,</span>
<span class="w"> </span><span class="n">evidence</span><span class="p">:</span><span class="w"> </span><span class="nc">Evidence</span><span class="p">,</span> <span class="w"> </span><span class="n">ev</span><span class="p">:</span><span class="w"> </span><span class="nc">LayerEvidence</span><span class="p">,</span><span class="w"> </span><span class="c1">// loaded at open() time</span>
<span class="w"> </span><span class="n">unitigs</span><span class="p">:</span><span class="w"> </span><span class="nc">UnitigFileReader</span><span class="p">,</span> <span class="w"> </span><span class="n">n</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span>
<span class="w"> </span><span class="n">n</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span><span class="w"> </span><span class="c1">// number of indexed kmers = number of MPHF slots</span>
<span class="p">}</span> <span class="p">}</span>
</code></pre></div> </code></pre></div>
<p>Public API:</p> <p><code>LayerEvidence</code> is an internal enum, not public:</p>
<div class="highlight"><pre><span></span><code><span class="k">impl</span><span class="w"> </span><span class="n">MphfLayer</span><span class="w"> </span><span class="p">{</span> <div class="highlight"><pre><span></span><code><span class="k">enum</span><span class="w"> </span><span class="nc">LayerEvidence</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">open</span><span class="p">(</span><span class="n">dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="bp">Self</span><span class="o">&gt;</span> <span class="w"> </span><span class="n">Exact</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">evidence</span><span class="p">:</span><span class="w"> </span><span class="nc">Evidence</span><span class="p">,</span><span class="w"> </span><span class="n">unitigs</span><span class="p">:</span><span class="w"> </span><span class="nc">UnitigFileReader</span><span class="w"> </span><span class="p">},</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">find</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">kmer</span><span class="p">:</span><span class="w"> </span><span class="nc">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nb">Option</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span><span class="w"> </span><span class="c1">// Some(slot) or None</span> <span class="w"> </span><span class="n">Approx</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">fingerprint</span><span class="p">:</span><span class="w"> </span><span class="nc">FingerprintVec</span><span class="p">,</span><span class="w"> </span><span class="n">unitigs_path</span><span class="p">:</span><span class="w"> </span><span class="nc">PathBuf</span><span class="w"> </span><span class="p">},</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">n</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">usize</span> <span class="w"> </span><span class="n">Hybrid</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">evidence</span><span class="p">:</span><span class="w"> </span><span class="nc">Evidence</span><span class="p">,</span><span class="w"> </span><span class="n">unitigs</span><span class="p">:</span><span class="w"> </span><span class="nc">UnitigFileReader</span><span class="p">,</span><span class="w"> </span><span class="n">fingerprint</span><span class="p">:</span><span class="w"> </span><span class="nc">FingerprintVec</span><span class="w"> </span><span class="p">},</span>
<span class="w"> </span><span class="nc">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">unitig_writer</span><span class="p">(</span><span class="n">dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="n">UnitigFileWriter</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="p">(</span><span class="k">crate</span><span class="p">)</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build</span><span class="p">(</span>
<span class="w"> </span><span class="n">dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span>
<span class="w"> </span><span class="n">fill_slot</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">mut</span><span class="w"> </span><span class="k">impl</span><span class="w"> </span><span class="nb">FnMut</span><span class="p">(</span><span class="kt">usize</span><span class="p">,</span><span class="w"> </span><span class="n">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span><span class="p">,</span>
<span class="w"> </span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="p">}</span> <span class="p">}</span>
</code></pre></div> </code></pre></div>
<p><code>find</code> returns <code>Some(slot)</code> only after verifying via evidence that the kmer is actually indexed. It returns <code>None</code> for absent keys (ptr_hash maps any input to a valid slot; evidence verification is the only correct-membership test).</p> <p><code>MphfLayer::open(dir, mode: &amp;IndexMode)</code> receives the mode from <code>PartitionMeta</code> — no per-layer file is read.</p>
<p><code>build</code> runs two sequential passes over <code>unitigs.bin</code>:</p> <h3 id="query-api">Query API</h3>
<p>Two public query methods, both returning <code>Option&lt;usize&gt;</code> (slot index):</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">find</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">kmer</span><span class="p">:</span><span class="w"> </span><span class="nc">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nb">Option</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">find_strict</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">kmer</span><span class="p">:</span><span class="w"> </span><span class="nc">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nb">Option</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
</code></pre></div>
<ul>
<li><code>find</code>: O(1) auto-dispatch. Exact/Hybrid → exact evidence check. Approx/Hybrid → fingerprint comparison.</li>
<li><code>find_strict</code>: always exact. Exact/Hybrid → O(1) evidence check. Approx → O(n) sequential scan (no <code>.idx</code>).</li>
</ul>
<p>There are no <code>find_exact</code>/<code>find_approx</code> methods; panicking dispatch is eliminated.</p>
<h3 id="build-surface">Build surface</h3>
<div class="highlight"><pre><span></span><code><span class="c1">// Full MPHF + evidence build (two-pass)</span>
<span class="k">pub</span><span class="p">(</span><span class="k">crate</span><span class="p">)</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build</span><span class="p">(</span><span class="n">dir</span><span class="p">,</span><span class="w"> </span><span class="n">block_bits</span><span class="p">,</span><span class="w"> </span><span class="n">mode</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">IndexMode</span><span class="p">,</span><span class="w"> </span><span class="n">fill_slot</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="c1">// Evidence-only post-hoc builds (MPHF already present)</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_exact_evidence</span><span class="p">(</span><span class="n">dir</span><span class="p">,</span><span class="w"> </span><span class="n">block_bits</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_approx_evidence</span><span class="p">(</span><span class="n">dir</span><span class="p">,</span><span class="w"> </span><span class="n">b</span><span class="p">,</span><span class="w"> </span><span class="n">z</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
</code></pre></div>
<p><code>MphfLayer::build</code> runs two passes over <code>unitigs.bin</code>:</p>
<ol> <ol>
<li><strong>Pass 1</strong>: iterate all canonical kmers in parallel via rayon, construct and store <code>mphf.bin</code>. <code>new_from_par_iter</code> avoids materialising a full key <code>Vec</code>.</li> <li><strong>Pass 1</strong> (parallel via rayon): a <code>CanonicalKmerIter</code> (clonable, <code>Arc&lt;Mmap&gt;</code>, no file reopening) is passed to <code>new_from_par_iter</code> via <code>par_bridge()</code>. Produces <code>mphf.bin</code>. No <code>.idx</code> is read or created at this stage.</li>
<li><strong>Pass 2</strong>: iterate again sequentially, fill <code>evidence.bin</code>, call <code>fill_slot(slot, kmer)</code> once per kmer for payload population. A compact <code>n/8</code>-byte seen-bitset verifies MPHF injectivity inline.</li> <li><strong>Pass 2</strong> (sequential): fill evidence files; call <code>fill_slot(slot, kmer)</code> per kmer. <code>.idx</code> is written last for Exact/Hybrid modes (query-time only).</li>
</ol> </ol>
<p>For empty layers (n = 0), <code>build</code> returns <code>Ok(0)</code> immediately after creating empty <code>mphf.bin</code> and <code>evidence.bin</code>.</p> <p>There is no <code>build_evidence</code> dispatch wrapper — callers invoke <code>build_exact_evidence</code> or <code>build_approx_evidence</code> directly.</p>
<p>For empty layers (n = 0), all build variants return <code>Ok(0)</code> immediately after creating empty output files.</p>
<hr /> <hr />
<h2 id="layerd-layerdata-mphf-payload">Layer\&lt;D: LayerData&gt; — MPHF + payload</h2> <h2 id="layerd-layerdata-mphf-payload">Layer\&lt;D: LayerData&gt; — MPHF + payload</h2>
<p><code>Layer&lt;D&gt;</code> pairs an <code>MphfLayer</code> with one payload store.</p> <p><code>Layer&lt;D&gt;</code> pairs an <code>MphfLayer</code> with one payload store.</p>
@@ -1261,7 +1666,7 @@
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="n">data</span><span class="p">:</span><span class="w"> </span><span class="nc">T</span><span class="p">,</span> <span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="n">data</span><span class="p">:</span><span class="w"> </span><span class="nc">T</span><span class="p">,</span>
<span class="p">}</span> <span class="p">}</span>
</code></pre></div> </code></pre></div>
<p><code>LayerData</code> covers the <strong>read path only</strong> (<code>open</code> + <code>read</code>). Build signatures differ between modes and are not in the trait.</p> <p><code>LayerData</code> covers the <strong>read path only</strong> (<code>open</code> + <code>read</code>). Build signatures differ between modes and are not part of the trait.</p>
<table> <table>
<thead> <thead>
<tr> <tr>
@@ -1288,28 +1693,89 @@
</tr> </tr>
</tbody> </tbody>
</table> </table>
<p><strong>Build signatures:</strong></p> <h3 id="build-signatures">Build signatures</h3>
<div class="highlight"><pre><span></span><code><span class="c1">// mode 1</span> <div class="highlight"><pre><span></span><code><span class="c1">// mode 1</span>
<span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span> <span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build</span><span class="p">(</span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span> <span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build</span><span class="p">(</span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">block_bits</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">,</span><span class="w"> </span><span class="n">mode</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">IndexMode</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="p">}</span> <span class="p">}</span>
<span class="c1">// mode 2</span> <span class="c1">// mode 2</span>
<span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="n">PersistentCompactIntMatrix</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span> <span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="n">PersistentCompactIntMatrix</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build</span><span class="p">(</span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">count_of</span><span class="p">:</span><span class="w"> </span><span class="nc">impl</span><span class="w"> </span><span class="nb">Fn</span><span class="p">(</span><span class="n">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span> <span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build</span><span class="p">(</span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">block_bits</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">,</span><span class="w"> </span><span class="n">mode</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">IndexMode</span><span class="p">,</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_from_map</span><span class="p">(</span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">counts</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">HashMap</span><span class="o">&lt;</span><span class="n">CanonicalKmer</span><span class="p">,</span><span class="w"> </span><span class="kt">u32</span><span class="o">&gt;</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span> <span class="w"> </span><span class="n">count_of</span><span class="p">:</span><span class="w"> </span><span class="nc">impl</span><span class="w"> </span><span class="nb">Fn</span><span class="p">(</span><span class="n">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_from_map</span><span class="p">(</span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">block_bits</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">,</span><span class="w"> </span><span class="n">mode</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">IndexMode</span><span class="p">,</span>
<span class="w"> </span><span class="n">counts</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">HashMap</span><span class="o">&lt;</span><span class="n">CanonicalKmer</span><span class="p">,</span><span class="w"> </span><span class="kt">u32</span><span class="o">&gt;</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="p">}</span> <span class="p">}</span>
<span class="c1">// mode 3</span> <span class="c1">// mode 3</span>
<span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="n">PersistentBitMatrix</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span> <span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="n">PersistentBitMatrix</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_presence</span><span class="p">(</span> <span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_presence</span><span class="p">(</span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">block_bits</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">,</span><span class="w"> </span><span class="n">mode</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">IndexMode</span><span class="p">,</span>
<span class="w"> </span><span class="n">out_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span>
<span class="w"> </span><span class="n">n_genomes</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span> <span class="w"> </span><span class="n">n_genomes</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span>
<span class="w"> </span><span class="n">present_in</span><span class="p">:</span><span class="w"> </span><span class="nc">impl</span><span class="w"> </span><span class="nb">Fn</span><span class="p">(</span><span class="n">CanonicalKmer</span><span class="p">,</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">bool</span><span class="p">,</span> <span class="w"> </span><span class="n">present_in</span><span class="p">:</span><span class="w"> </span><span class="nc">impl</span><span class="w"> </span><span class="nb">Fn</span><span class="p">(</span><span class="n">CanonicalKmer</span><span class="p">,</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">bool</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="w"> </span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="p">}</span> <span class="p">}</span>
</code></pre></div> </code></pre></div>
<p>All build impls delegate MPHF + evidence construction to <code>MphfLayer::build</code> via a mode-specific <code>fill_slot</code> callback. Mode 2 pre-reads <code>n_kmers</code> from <code>unitigs.bin</code> to size the <code>PersistentCompactIntMatrixBuilder</code> before calling <code>MphfLayer::build</code>. Mode 3 does the same for <code>PersistentBitMatrixBuilder</code>.</p> <p>All build impls delegate to <code>MphfLayer::build</code> via a mode-specific <code>fill_slot</code> callback. The <code>mode</code> parameter is forwarded directly — no <code>LayerMeta</code> is written.</p>
<p>Evidence-only post-hoc builds are accessible directly on <code>Layer&lt;D&gt;</code>:</p>
<div class="highlight"><pre><span></span><code><span class="k">impl</span><span class="o">&lt;</span><span class="n">D</span><span class="p">:</span><span class="w"> </span><span class="nc">LayerData</span><span class="o">&gt;</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_exact_evidence</span><span class="p">(</span><span class="n">layer_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">block_bits</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">build_approx_evidence</span><span class="p">(</span><span class="n">layer_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">b</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">,</span><span class="w"> </span><span class="n">z</span><span class="p">:</span><span class="w"> </span><span class="kt">u8</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="p">}</span>
</code></pre></div>
<p>There is no <code>build_evidence</code> dispatch wrapper.</p>
<hr />
<h2 id="fingerprintvec-and-fingerprintvecwriter">FingerprintVec and FingerprintVecWriter</h2>
<p>Approximate evidence is stored as a packed b-bit array, one fingerprint per MPHF slot.</p>
<div class="highlight"><pre><span></span><code>fingerprint.bin format:
magic: b&quot;FPVF&quot; (4 bytes)
b: u8 (bits per fingerprint, 1..=64)
padding: [0u8; 3]
n: u64 LE (number of slots)
data: packed bits, ceil(n*b/8) bytes, Lsb0 order
</code></pre></div>
<div class="highlight"><pre><span></span><code><span class="k">impl</span><span class="w"> </span><span class="n">FingerprintVec</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">open</span><span class="p">(</span><span class="n">path</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="bp">Self</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">get</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">slot</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u64</span>
<span class="w"> </span><span class="nc">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">matches</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">slot</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span><span class="w"> </span><span class="n">fingerprint</span><span class="p">:</span><span class="w"> </span><span class="kt">u64</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">bool</span>
<span class="w"> </span><span class="nc">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">n</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">usize</span>
<span class="w"> </span><span class="nc">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">b</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u8</span>
<span class="p">}</span>
</code></pre></div>
<p><code>matches(slot, hash)</code> extracts the b-bit fingerprint stored at <code>slot</code> and compares it to the low b bits of <code>hash</code>. It is the core operation of <code>find_approx</code>.</p>
<hr />
<h2 id="layeredmapd-collection-of-layers">LayeredMap\&lt;D&gt; — collection of layers</h2>
<p><code>LayeredMap&lt;D&gt;</code> wraps <code>Vec&lt;Layer&lt;D&gt;&gt;</code> for a single partition directory.</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">struct</span><span class="w"> </span><span class="nc">LayeredMap</span><span class="o">&lt;</span><span class="n">D</span><span class="p">:</span><span class="w"> </span><span class="nc">LayerData</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="p">()</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="n">root</span><span class="p">:</span><span class="w"> </span><span class="nc">PathBuf</span><span class="p">,</span>
<span class="w"> </span><span class="n">meta</span><span class="p">:</span><span class="w"> </span><span class="nc">PartitionMeta</span><span class="p">,</span>
<span class="w"> </span><span class="n">layers</span><span class="p">:</span><span class="w"> </span><span class="nb">Vec</span><span class="o">&lt;</span><span class="n">Layer</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;&gt;</span><span class="p">,</span>
<span class="p">}</span>
</code></pre></div>
<p><code>PartitionMeta</code> (<code>meta.json</code> at the partition root) stores <code>n_layers</code>.</p>
<h3 id="common-methods">Common methods</h3>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">open</span><span class="p">(</span><span class="n">root</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="bp">Self</span><span class="o">&gt;</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">create</span><span class="p">(</span><span class="n">root</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">mode</span><span class="p">:</span><span class="w"> </span><span class="nc">IndexMode</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="bp">Self</span><span class="o">&gt;</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">n_layers</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">usize</span>
<span class="nc">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">layer</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">i</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Layer</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">mode</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">IndexMode</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">query</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">kmer</span><span class="p">:</span><span class="w"> </span><span class="nc">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nb">Option</span><span class="o">&lt;</span><span class="p">(</span><span class="kt">usize</span><span class="p">,</span><span class="w"> </span><span class="n">Hit</span><span class="o">&lt;</span><span class="n">D</span><span class="p">::</span><span class="n">Item</span><span class="o">&gt;</span><span class="p">)</span><span class="o">&gt;</span>
<span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">next_layer_writer</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="n">UnitigFileWriter</span><span class="o">&gt;</span>
</code></pre></div>
<p><code>open</code> reads <code>PartitionMeta</code> once, extracts <code>mode</code>, and passes it to every <code>Layer::open</code> — no per-layer file is read. <code>create</code> stores the given mode in <code>PartitionMeta</code>.</p>
<p><code>query</code> probes layers in order and returns <code>(layer_index, Hit)</code> on the first match. Expected probe depth: 1 for kmers in layer 0.</p>
<h3 id="push_layer">push_layer</h3>
<p><code>push_layer</code> builds the next layer from a <code>unitigs.bin</code> already written via <code>next_layer_writer</code>, using <code>DEFAULT_BLOCK_BITS</code>:</p>
<div class="highlight"><pre><span></span><code><span class="c1">// mode 1</span>
<span class="k">impl</span><span class="w"> </span><span class="n">LayeredMap</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">push_layer</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="p">}</span>
<span class="c1">// mode 2</span>
<span class="k">impl</span><span class="w"> </span><span class="n">LayeredMap</span><span class="o">&lt;</span><span class="n">PersistentCompactIntMatrix</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">push_layer</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">count_of</span><span class="p">:</span><span class="w"> </span><span class="nc">impl</span><span class="w"> </span><span class="nb">Fn</span><span class="p">(</span><span class="n">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">push_layer_from_map</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">counts</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">HashMap</span><span class="o">&lt;</span><span class="n">CanonicalKmer</span><span class="p">,</span><span class="w"> </span><span class="kt">u32</span><span class="o">&gt;</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="kt">usize</span><span class="o">&gt;</span>
<span class="p">}</span>
</code></pre></div>
<p>Mode 3 (<code>PersistentBitMatrix</code>) has no <code>push_layer</code> on <code>LayeredMap</code>; callers build directly via <code>Layer&lt;PersistentBitMatrix&gt;::build_presence</code>.</p>
<hr /> <hr />
<h2 id="layeredstores-and-aggregation-traits">LayeredStore\&lt;S&gt; and aggregation traits</h2> <h2 id="layeredstores-and-aggregation-traits">LayeredStore\&lt;S&gt; and aggregation traits</h2>
<p><code>LayeredStore&lt;S&gt;</code> is a generic aggregation wrapper over <code>Vec&lt;S&gt;</code>. It propagates three traits from <code>obicompactvec::traits</code> up the hierarchy via blanket impls:</p> <p><code>LayeredStore&lt;S&gt;</code> is a generic aggregation wrapper over <code>Vec&lt;S&gt;</code>. It propagates three traits from <code>obicompactvec::traits</code> up the hierarchy via blanket impls:</p>
@@ -1320,11 +1786,6 @@
<span class="k">impl</span><span class="o">&lt;</span><span class="n">S</span><span class="p">:</span><span class="w"> </span><span class="nc">BitPartials</span><span class="o">&gt;</span><span class="w"> </span><span class="n">BitPartials</span><span class="w"> </span><span class="k">for</span><span class="w"> </span><span class="n">LayeredStore</span><span class="o">&lt;</span><span class="n">S</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="err"></span><span class="w"> </span><span class="p">}</span><span class="w"> </span><span class="c1">// element-wise Σ partials</span> <span class="k">impl</span><span class="o">&lt;</span><span class="n">S</span><span class="p">:</span><span class="w"> </span><span class="nc">BitPartials</span><span class="o">&gt;</span><span class="w"> </span><span class="n">BitPartials</span><span class="w"> </span><span class="k">for</span><span class="w"> </span><span class="n">LayeredStore</span><span class="o">&lt;</span><span class="n">S</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="err"></span><span class="w"> </span><span class="p">}</span><span class="w"> </span><span class="c1">// element-wise Σ partials</span>
</code></pre></div> </code></pre></div>
<p>Because blanket impls compose, <code>LayeredStore&lt;LayeredStore&lt;S&gt;&gt;</code> automatically inherits all three traits when <code>S</code> does — providing the partitioned level without a separate type.</p> <p>Because blanket impls compose, <code>LayeredStore&lt;LayeredStore&lt;S&gt;&gt;</code> automatically inherits all three traits when <code>S</code> does — providing the partitioned level without a separate type.</p>
<p><strong>Aggregation hierarchy:</strong></p>
<div class="highlight"><pre><span></span><code>PersistentCompactIntMatrix implements CountPartials
LayeredStore&lt;PersistentCompactIntMatrix&gt; via blanket impl (one partition)
LayeredStore&lt;LayeredStore&lt;&gt;&gt; via blanket impl (partitioned index)
</code></pre></div>
<p><strong>Leaf implementors</strong> (in <code>obicompactvec</code>):</p> <p><strong>Leaf implementors</strong> (in <code>obicompactvec</code>):</p>
<table> <table>
<thead> <thead>
@@ -1344,69 +1805,77 @@ LayeredStore&lt;LayeredStore&lt;…&gt;&gt; via blanket impl
</tr> </tr>
</tbody> </tbody>
</table> </table>
<p><code>PersistentCompactIntVec</code> and <code>PersistentBitVec</code> do not implement these traits — they are single-column primitives, not matrix-level aggregators.</p>
<p>See <a href="../../architecture/index_architecture/">Kmer index architecture</a> for the full trait API and the two-pass normalised-metric pattern.</p> <p>See <a href="../../architecture/index_architecture/">Kmer index architecture</a> for the full trait API and the two-pass normalised-metric pattern.</p>
<hr /> <hr />
<h2 id="on-disk-structure">On-disk structure</h2> <h2 id="on-disk-structure">On-disk structure</h2>
<div class="highlight"><pre><span></span><code>index_root/ ← LayeredMap (collection) <div class="highlight"><pre><span></span><code>partition_root/ ← LayeredMap (one partition)
meta.json meta.json — {&quot;n_layers&quot;: N, &quot;mode&quot;: {&quot;type&quot;: &quot;exact&quot;|&quot;approx&quot;|&quot;hybrid&quot;, ...}}
part_00000/ ← Partition
layer_0/ ← Layer layer_0/ ← Layer
mphf.bin — ptr_hash MPHF (epserde format) mphf.bin — ptr_hash MPHF (epserde format)
unitigs.bin — packed 2-bit nucleotide sequences unitigs.bin — packed 2-bit nucleotide sequences
unitigs.bin.idx — UIDX index: n_unitigs, n_kmers, seqls[], packed_offsets[] unitigs.bin.idx — UIDX index (Exact/Hybrid only; query-time, never built during MPHF construction)
evidence.bin — n × u32, each = (chunk_id: 25 bits | rank: 7 bits), LE evidence.bin — [u32; n], LE (Exact/Hybrid only)
fingerprint.bin — packed b-bit array (Approx/Hybrid only)
counts/ [mode 2] PersistentCompactIntMatrix counts/ [mode 2] PersistentCompactIntMatrix
meta.json {&quot;n&quot;: N, &quot;n_cols&quot;: 1} meta.json
col_000000.pciv col_000000.pciv
presence/ [mode 3] PersistentBitMatrix presence/ [mode 3] PersistentBitMatrix
meta.json {&quot;n&quot;: N, &quot;n_cols&quot;: G} meta.json
col_000000.pbiv col_000000.pbiv
layer_1/ layer_1/
part_00001/
</code></pre></div> </code></pre></div>
<p><strong>Partition</strong> (<code>part_XXXXX/</code>): all kmers whose canonical minimiser hashes to this bucket. Partitions are independent and can be processed in parallel.</p> <p>There is no <code>layer_meta.json</code>. The mode is stored once in <code>PartitionMeta</code> and is valid for all layers. <code>unitigs.bin.idx</code> is built at the end of <code>build_exact_evidence</code> — never during MPHF construction — and is consumed at query time only.</p>
<p><strong>Layer</strong> (<code>layer_N/</code>): one <code>MphfLayer</code> plus optional payload. Layer 0 covers dataset A; layer 1 covers kmers in B absent from A; etc. Layers within a partition are always disjoint.</p>
<hr /> <hr />
<h2 id="evidence-encoding">Evidence encoding</h2> <h2 id="evidence-encoding-exact">Evidence encoding (exact)</h2>
<p><code>evidence.bin</code> is a flat <code>[u32; n]</code> array with no header. Each u32 encodes one slot:</p> <p><code>evidence.bin</code> is a flat <code>[u32; n]</code> array with no header. Each u32 encodes one slot:</p>
<div class="highlight"><pre><span></span><code>bits [31:7] = chunk_id (25 bits) — index of the unitig chunk <div class="highlight"><pre><span></span><code>bits [31:7] = chunk_id (25 bits) — index of the unitig chunk
bits [6:0] = rank (7 bits) — kmer index within the chunk (0-based) bits [6:0] = rank (7 bits) — kmer index within the chunk (0-based)
</code></pre></div> </code></pre></div>
<p>Decoding: <code>chunk_id = raw &gt;&gt; 7</code>, <code>rank = raw &amp; 0x7F</code>. Reconstructing the kmer: read k nucleotides at position <code>rank</code> within unitig <code>chunk_id</code>.</p> <p><code>chunk_id = raw &gt;&gt; 7</code>, <code>rank = raw &amp; 0x7F</code>. Reconstructing the kmer: read k nucleotides at position <code>rank</code> within unitig <code>chunk_id</code> (requires <code>unitigs.bin.idx</code> for random access).</p>
<p>For k=31, m=11, the observed maximum is ~46 kmers per chunk — well within the 127-kmer u7 capacity. The structural maximum from superkmer construction is k m + 1 = 21 kmers/unitig; longer unitigs arise from paths spanning more than one superkmer.</p> <p>For k=31, m=11, the observed maximum is ~46 kmers per chunk — well within the 127-kmer u7 capacity.</p>
<hr /> <hr />
<h2 id="ptr_hash-configuration">ptr_hash configuration</h2> <h2 id="ptr_hash-configuration">ptr_hash configuration</h2>
<div class="highlight"><pre><span></span><code><span class="k">type</span><span class="w"> </span><span class="nc">Mphf</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">PtrHash</span><span class="o">&lt;</span> <div class="highlight"><pre><span></span><code><span class="k">type</span><span class="w"> </span><span class="nc">Mphf</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">PtrHash</span><span class="o">&lt;</span>
<span class="w"> </span><span class="kt">u64</span><span class="p">,</span><span class="w"> </span><span class="c1">// key type: canonical kmer raw encoding</span> <span class="w"> </span><span class="kt">u64</span><span class="p">,</span><span class="w"> </span><span class="c1">// key type: canonical kmer raw encoding</span>
<span class="w"> </span><span class="n">CubicEps</span><span class="p">,</span><span class="w"> </span><span class="c1">// bucket fn: 2.4 bits/key, λ=3.5, α=0.99</span> <span class="w"> </span><span class="n">CubicEps</span><span class="p">,</span><span class="w"> </span><span class="c1">// bucket fn: 2.4 bits/key, λ=3.5, α=0.99</span>
<span class="w"> </span><span class="n">CachelineEfVec</span><span class="o">&lt;</span><span class="nb">Vec</span><span class="o">&lt;</span><span class="n">CachelineEf</span><span class="o">&gt;&gt;</span><span class="p">,</span><span class="w"> </span><span class="c1">// remap: 11.6 bits/entry (Elias-Fano)</span> <span class="w"> </span><span class="n">CachelineEfVec</span><span class="o">&lt;</span><span class="nb">Vec</span><span class="o">&lt;</span><span class="n">CachelineEf</span><span class="o">&gt;&gt;</span><span class="p">,</span><span class="w"> </span><span class="c1">// remap: Elias-Fano</span>
<span class="w"> </span><span class="n">Xx64</span><span class="p">,</span><span class="w"> </span><span class="c1">// hasher: XXH3-64 with seed</span> <span class="w"> </span><span class="n">Xx64</span><span class="p">,</span><span class="w"> </span><span class="c1">// hasher: XXH3-64 with seed</span>
<span class="w"> </span><span class="nb">Vec</span><span class="o">&lt;</span><span class="kt">u8</span><span class="o">&gt;</span><span class="p">,</span><span class="w"> </span><span class="c1">// pilots</span> <span class="w"> </span><span class="nb">Vec</span><span class="o">&lt;</span><span class="kt">u8</span><span class="o">&gt;</span><span class="p">,</span><span class="w"> </span><span class="c1">// pilots</span>
<span class="o">&gt;</span><span class="p">;</span> <span class="o">&gt;</span><span class="p">;</span>
</code></pre></div> </code></pre></div>
<p><code>Xx64</code> is chosen over <code>FxHash</code> because canonical kmer raw values are left-aligned u64 with structural zeros in the low bits (42 zeros for k=11, 2 zeros for k=31), which single-multiply hashes distribute poorly.</p> <p><code>Xx64</code> is chosen over <code>FxHash</code> because canonical kmer raw values are left-aligned u64 with structural zeros in the low bits (42 zeros for k=11, 2 zeros for k=31), which single-multiply hashes distribute poorly.</p>
<p><code>CubicEps</code> with <code>PtrHashParams::&lt;CubicEps&gt;::default()</code> (λ=3.5) is a balanced tradeoff: 2× slower construction than <code>Linear/λ=3.0</code>, 20% less space.</p> <p><code>CubicEps</code> with <code>PtrHashParams::&lt;CubicEps&gt;::default()</code> (λ=3.5): 2× slower construction than <code>Linear/λ=3.0</code>, ~20% less space.</p>
<hr /> <hr />
<h2 id="query-path">Query path</h2> <h2 id="column-append-and-merge-support">Column append and merge support</h2>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">query</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">kmer</span><span class="p">:</span><span class="w"> </span><span class="nc">CanonicalKmer</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nb">Option</span><span class="o">&lt;</span><span class="n">Hit</span><span class="o">&lt;</span><span class="n">D</span><span class="p">::</span><span class="n">Item</span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="p">{</span> <p>These methods extend existing layers with new genome columns without touching the MPHF.</p>
<span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">mphf</span><span class="p">.</span><span class="n">find</span><span class="p">(</span><span class="n">kmer</span><span class="p">).</span><span class="n">map</span><span class="p">(</span><span class="o">|</span><span class="n">slot</span><span class="o">|</span><span class="w"> </span><span class="n">Hit</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="n">slot</span><span class="p">,</span><span class="w"> </span><span class="n">data</span><span class="p">:</span><span class="w"> </span><span class="nc">self</span><span class="p">.</span><span class="n">data</span><span class="p">.</span><span class="n">read</span><span class="p">(</span><span class="n">slot</span><span class="p">)</span><span class="w"> </span><span class="p">})</span> <h3 id="layer-level-genome-column-append">Layer-level genome column append</h3>
<div class="highlight"><pre><span></span><code><span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="n">PersistentBitMatrix</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">append_genome_column</span><span class="p">(</span><span class="n">layer_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">value_of</span><span class="p">:</span><span class="w"> </span><span class="nc">impl</span><span class="w"> </span><span class="nb">Fn</span><span class="p">(</span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">bool</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span>
<span class="p">}</span>
<span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="n">PersistentCompactIntMatrix</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">append_genome_column</span><span class="p">(</span><span class="n">layer_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">value_of</span><span class="p">:</span><span class="w"> </span><span class="nc">impl</span><span class="w"> </span><span class="nb">Fn</span><span class="p">(</span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span>
<span class="p">}</span> <span class="p">}</span>
</code></pre></div> </code></pre></div>
<p><code>MphfLayer::find</code> probes the MPHF, decodes evidence, and verifies the kmer — returning <code>Some(slot)</code> on match, <code>None</code> otherwise. <code>data.read(slot)</code> is called only on a confirmed hit.</p> <p>Both delegate to the corresponding <code>PersistentBitMatrix::append_column</code> / <code>PersistentCompactIntMatrix::append_column</code>. They write a new column file (<code>col_NNNNNN.pbiv</code> / <code>col_NNNNNN.pciv</code>) and update <code>meta.json</code> to increment <code>n_cols</code>. <code>value_of</code> is called once per slot (0..n).</p>
<p>In <code>LayeredMap</code>, layers are probed in order; the first match wins. Expected probe depth: 1 for kmers in layer 0.</p> <h3 id="presence-matrix-initialisation">Presence matrix initialisation</h3>
<div class="highlight"><pre><span></span><code><span class="k">impl</span><span class="w"> </span><span class="n">Layer</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">init_presence_matrix</span><span class="p">(</span><span class="n">layer_dir</span><span class="p">:</span><span class="w"> </span><span class="kp">&amp;</span><span class="nc">Path</span><span class="p">,</span><span class="w"> </span><span class="n">n_kmers</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">OLMResult</span><span class="o">&lt;</span><span class="p">()</span><span class="o">&gt;</span>
<span class="p">}</span>
</code></pre></div>
<p>Called on the first merge of a Presence-mode index. Creates <code>presence/</code> with <code>meta.json {"n": n_kmers, "n_cols": 1}</code> and <code>col_000000.pbiv</code> set entirely to <code>true</code>. This retroactively records genome 0 (the original source) as present in every slot, satisfying the column-count invariant before any new-source column is appended.</p>
<h3 id="why-the-mphf-is-never-rebuilt">Why the MPHF is never rebuilt</h3>
<p>The MPHF, evidence, and unitigs are built once from the kmer set of a layer and are immutable for the lifetime of that layer. Adding a genome column does not change the kmer set — it only appends a new data column indexed by the same slot numbers. The only disk writes are one new <code>.pciv</code>/<code>.pbiv</code> file and a single <code>meta.json</code> update.</p>
<hr /> <hr />
<h2 id="add-layer-algorithm">Add-layer algorithm</h2> <h2 id="add-layer-algorithm">Add-layer algorithm</h2>
<p>When adding dataset B to an existing index:</p> <p>When adding dataset B to an existing index:</p>
<ol> <ol>
<li>For each partition, probe existing layers for kmers of B routed to that partition.</li> <li>For each partition, probe existing layers for kmers of B routed to that partition.</li>
<li>Collect kmers absent from all layers → <code>B \ index</code>.</li> <li>Collect kmers absent from all layers → <code>B \ index</code>.</li>
<li>Write <code>B \ index</code> to a new <code>unitigs.bin</code> via <code>MphfLayer::unitig_writer</code>.</li> <li>Write <code>B \ index</code> to a new <code>unitigs.bin</code> via <code>next_layer_writer()</code>.</li>
<li>Call <code>Layer&lt;D&gt;::build</code> on the new directory.</li> <li>Call <code>Layer&lt;D&gt;::build</code> (or <code>build_presence</code>) on the new layer directory.</li>
<li>Update <code>meta.json</code>.</li> <li>Call <code>push_layer</code> (or <code>append_layer</code>) to register the new layer in <code>meta.json</code>.</li>
</ol> </ol>
<p>Each partition's new layer is built independently; the operation is fully parallel across partitions.</p> <p>Each partition's new layer is built independently; the operation is fully parallel across partitions.</p>
<hr /> <hr />
@@ -1433,11 +1902,15 @@ bits [6:0] = rank (7 bits) — kmer index within the chunk (0-based)
</tr> </tr>
<tr> <tr>
<td><code>memmap2 0.9</code></td> <td><code>memmap2 0.9</code></td>
<td>mmap of evidence and payload files</td> <td>mmap of evidence and fingerprint files</td>
</tr>
<tr>
<td><code>bitvec</code></td>
<td>packed b-bit fingerprint storage</td>
</tr> </tr>
<tr> <tr>
<td><code>obiskio</code></td> <td><code>obiskio</code></td>
<td>unitig file writer/reader</td> <td>unitig file writer/reader + <code>.idx</code> build</td>
</tr> </tr>
<tr> <tr>
<td><code>obicompactvec</code></td> <td><code>obicompactvec</code></td>
@@ -1448,8 +1921,8 @@ bits [6:0] = rank (7 bits) — kmer index within the chunk (0-based)
<td>parallel MPHF construction pass</td> <td>parallel MPHF construction pass</td>
</tr> </tr>
<tr> <tr>
<td><code>ndarray 0.16</code></td> <td><code>serde / serde_json</code></td>
<td>aggregation output arrays</td> <td><code>PartitionMeta</code> serialisation</td>
</tr> </tr>
</tbody> </tbody>
</table> </table>
File diff suppressed because it is too large Load Diff
+154 -20
View File
@@ -662,6 +662,17 @@
</span> </span>
</a> </a>
</li>
<li class="md-nav__item">
<a href="#make_pipe-dsl" class="md-nav__link">
<span class="md-ellipsis">
make_pipe! DSL
</span>
</a>
</li> </li>
</ul> </ul>
@@ -801,6 +812,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link"> <a href="../obilayeredmap/" class="md-nav__link">
@@ -879,6 +918,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
@@ -1087,6 +1182,17 @@
</span> </span>
</a> </a>
</li>
<li class="md-nav__item">
<a href="#make_pipe-dsl" class="md-nav__link">
<span class="md-ellipsis">
make_pipe! DSL
</span>
</a>
</li> </li>
</ul> </ul>
@@ -1145,7 +1251,7 @@
<h1 id="obipipeline-parallel-pipeline-library">obipipeline — parallel pipeline library</h1> <h1 id="obipipeline-parallel-pipeline-library">obipipeline — parallel pipeline library</h1>
<p><code>obipipeline</code> is a generic, multi-threaded data pipeline crate. It connects a <strong>source</strong>, a chain of <strong>transforms</strong>, and a <strong>sink</strong> via crossbeam channels, running each stage with a shared worker pool and a biased scheduler.</p> <p><code>obipipeline</code> is a generic, multi-threaded data pipeline crate. It connects a <strong>source</strong>, a chain of <strong>stages</strong>, and a <strong>sink</strong> via crossbeam channels, running each stage with a shared worker pool and a biased scheduler.</p>
<h2 id="core-types">Core types</h2> <h2 id="core-types">Core types</h2>
<table> <table>
<thead> <thead>
@@ -1158,22 +1264,33 @@
<tbody> <tbody>
<tr> <tr>
<td><code>SourceFn&lt;D&gt;</code></td> <td><code>SourceFn&lt;D&gt;</code></td>
<td><code>Box&lt;dyn FnMut() -&gt; Result&lt;D, PipelineError&gt; + Send+Sync&gt;</code></td> <td><code>Box&lt;dyn FnMut() -&gt; Result&lt;D, PipelineError&gt; + Send&gt;</code></td>
<td>Called repeatedly; <code>FnMut</code> because it holds iterator state</td> <td>Called repeatedly; <code>FnMut</code> because it holds iterator state</td>
</tr> </tr>
<tr> <tr>
<td><code>SharedFn&lt;D&gt;</code></td> <td><code>SharedFn&lt;D&gt;</code></td>
<td><code>Arc&lt;dyn Fn(D) -&gt; Result&lt;D, PipelineError&gt; + Send + Sync&gt;</code></td> <td><code>Arc&lt;dyn Fn(D) -&gt; Result&lt;D, PipelineError&gt; + Send + Sync&gt;</code></td>
<td>Shared across workers via <code>Arc::clone</code> (no copy of the closure)</td> <td>1→1 transform shared across workers via <code>Arc::clone</code></td>
</tr>
<tr>
<td><code>SharedFlatFn&lt;D&gt;</code></td>
<td><code>Arc&lt;dyn Fn(D, &amp;Sender&lt;Result&lt;D, _&gt;&gt;, &amp;Sender&lt;isize&gt;) + Send + Sync&gt;</code></td>
<td>1→N transform; pushes items into channel, sends delta</td>
</tr> </tr>
<tr> <tr>
<td><code>SinkFn&lt;D&gt;</code></td> <td><code>SinkFn&lt;D&gt;</code></td>
<td><code>Box&lt;dyn Fn(D) -&gt; Result&lt;(), PipelineError&gt; + Send+Sync&gt;</code></td> <td><code>Box&lt;dyn Fn(D) -&gt; Result&lt;(), PipelineError&gt; + Send&gt;</code></td>
<td>Final consumer; returns <code>Result</code> so errors propagate back</td> <td>Final consumer; returns <code>Result</code> so errors propagate back</td>
</tr> </tr>
</tbody> </tbody>
</table> </table>
<p><code>Pipeline&lt;D&gt;</code> holds one <code>SourceFn</code>, a <code>Vec&lt;SharedFn&gt;</code>, and one <code>SinkFn</code>.<br /> <p>Stages come in two variants:</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">enum</span><span class="w"> </span><span class="nc">Stage</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="n">Transform</span><span class="p">(</span><span class="n">SharedFn</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;</span><span class="p">),</span><span class="w"> </span><span class="c1">// 1→1</span>
<span class="w"> </span><span class="n">Flat</span><span class="p">(</span><span class="n">SharedFlatFn</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;</span><span class="p">),</span><span class="w"> </span><span class="c1">// 1→N</span>
<span class="p">}</span>
</code></pre></div>
<p><code>Pipeline&lt;D&gt;</code> holds one <code>SourceFn</code>, a <code>Vec&lt;Stage&gt;</code>, and one <code>SinkFn</code>.<br />
<code>WorkerPool&lt;D&gt;</code> wraps a <code>Pipeline</code> with <code>n_workers</code> and channel <code>capacity</code>.</p> <code>WorkerPool&lt;D&gt;</code> wraps a <code>Pipeline</code> with <code>n_workers</code> and channel <code>capacity</code>.</p>
<h2 id="workerpool">WorkerPool</h2> <h2 id="workerpool">WorkerPool</h2>
<div class="highlight"><pre><span></span><code><span class="n">WorkerPool</span><span class="p">::</span><span class="n">new</span><span class="p">(</span><span class="n">pipeline</span><span class="p">:</span><span class="w"> </span><span class="nc">Pipeline</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;</span><span class="p">,</span><span class="w"> </span><span class="n">n_workers</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span><span class="w"> </span><span class="n">capacity</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">Self</span> <div class="highlight"><pre><span></span><code><span class="n">WorkerPool</span><span class="p">::</span><span class="n">new</span><span class="p">(</span><span class="n">pipeline</span><span class="p">:</span><span class="w"> </span><span class="nc">Pipeline</span><span class="o">&lt;</span><span class="n">D</span><span class="o">&gt;</span><span class="p">,</span><span class="w"> </span><span class="n">n_workers</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span><span class="w"> </span><span class="n">capacity</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nc">Self</span>
@@ -1193,7 +1310,7 @@
</tr> </tr>
<tr> <tr>
<td><code>capacity</code></td> <td><code>capacity</code></td>
<td>Bound on every crossbeam channel in the pipeline (source output, inter-stage channels, worker input, sink input, sink error). Controls memory and back-pressure: a full channel blocks the sender until a slot frees.</td> <td>Bound on every crossbeam channel in the pipeline. Controls memory and back-pressure: a full channel blocks the sender until a slot frees.</td>
</tr> </tr>
</tbody> </tbody>
</table> </table>
@@ -1208,7 +1325,7 @@
</code></pre></div> </code></pre></div>
<p>Each variant carries the concrete type for one stage's output. The macros pattern-match on this enum to route values between stages.</p> <p>Each variant carries the concrete type for one stage's output. The macros pattern-match on this enum to route values between stages.</p>
<h2 id="macros">Macros</h2> <h2 id="macros">Macros</h2>
<p>Six low-level macros build individual stages; one high-level macro (<code>make_pipeline!</code>) composes them.</p> <p>Eight low-level macros build individual stages; one high-level macro (<code>make_pipeline!</code>) composes them.</p>
<h3 id="low-level">Low-level</h3> <h3 id="low-level">Low-level</h3>
<div class="highlight"><pre><span></span><code><span class="n">make_source</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">iterator</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// iterator yields T</span> <div class="highlight"><pre><span></span><code><span class="n">make_source</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">iterator</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// iterator yields T</span>
<span class="n">make_source_fallible</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">iterator</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// iterator yields Result&lt;T, E&gt;</span> <span class="n">make_source_fallible</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">iterator</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// iterator yields Result&lt;T, E&gt;</span>
@@ -1216,6 +1333,9 @@
<span class="n">make_transform</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; U</span> <span class="n">make_transform</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; U</span>
<span class="n">make_transform_fallible</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; Result&lt;U, E&gt;</span> <span class="n">make_transform_fallible</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; Result&lt;U, E&gt;</span>
<span class="n">make_flat_transform</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; impl IntoIterator&lt;Item=U&gt;</span>
<span class="n">make_flat_transform_fallible</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">,</span><span class="w"> </span><span class="n">OutputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; Result&lt;impl IntoIterator&lt;Item=U&gt;, E&gt;</span>
<span class="n">make_sink</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; ()</span> <span class="n">make_sink</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; ()</span>
<span class="n">make_sink_fallible</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; Result&lt;(), E&gt;</span> <span class="n">make_sink_fallible</span><span class="o">!</span><span class="p">(</span><span class="n">Enum</span><span class="p">,</span><span class="w"> </span><span class="n">func</span><span class="p">,</span><span class="w"> </span><span class="n">InputVariant</span><span class="p">)</span><span class="w"> </span><span class="c1">// func: T -&gt; Result&lt;(), E&gt;</span>
</code></pre></div> </code></pre></div>
@@ -1224,17 +1344,31 @@
<div class="highlight"><pre><span></span><code>make_pipeline! { <div class="highlight"><pre><span></span><code>make_pipeline! {
DataEnum, DataEnum,
source iterator =&gt; OutputVariant, // or source? for fallible source iterator =&gt; OutputVariant, // or source? for fallible
| func: In =&gt; Out, // non-fallible transform | func: In =&gt; Out, // 1→1 non-fallible transform
|? func: In =&gt; Out, // fallible transform |? func: In =&gt; Out, // 1→1 fallible transform
|| func: In =&gt; Out, // 1→N non-fallible flat transform
||? func: In =&gt; Out, // 1→N fallible flat transform
sink func @ InputVariant, // or sink? for fallible sink func @ InputVariant, // or sink? for fallible
} }
</code></pre></div> </code></pre></div>
<p><code>?</code> marks fallibility on source, individual transforms, or sink independently.<br /> <p><code>?</code> marks fallibility on source, individual transforms, or sink independently.<br />
Implemented as a <strong>TT muncher</strong>: the internal rule <code>@build</code> recurses over transform tokens one at a time, accumulating them into a <code>vec![]</code>, then terminates on <code>sink</code>/<code>sink?</code>.</p> Implemented as a <strong>TT muncher</strong>: the internal rule <code>@build</code> recurses over transform tokens one at a time, accumulating them into a <code>vec![]</code>, then terminates on <code>sink</code>/<code>sink?</code>.</p>
<h3 id="make_pipe-dsl">make_pipe! DSL</h3>
<p><code>make_pipe!</code> builds a sourceless/sinkless <code>Pipe&lt;D, In, Out&gt;</code> — a reusable, composable stage sequence:</p>
<div class="highlight"><pre><span></span><code>make_pipe! {
DataEnum : InType =&gt; OutType,
| func: InVariant =&gt; OutVariant,
|? func: InVariant =&gt; OutVariant,
|| func: InVariant =&gt; OutVariant,
||? func: InVariant =&gt; OutVariant,
}
</code></pre></div>
<p>Two pipes compose with <code>.then(other)</code>. Apply to an iterator with <code>.apply(iter, n_workers, capacity)</code> to get a <code>PipeIter&lt;Out&gt;</code> — an iterator over the pipeline output, backed by a background <code>WorkerPool</code>. The scatter step in <code>obikmer</code> uses <code>make_pipe!</code> and <code>.apply()</code> rather than the full <code>make_pipeline!</code> / <code>WorkerPool</code> pattern.</p>
<h2 id="scheduler-architecture">Scheduler architecture</h2> <h2 id="scheduler-architecture">Scheduler architecture</h2>
<div class="highlight"><pre><span></span><code>Source thread ──► [source_rx] ──► Scheduler ──► [worker_tx] ──► Workers (×N) <div class="highlight"><pre><span></span><code>Source thread ──► [source_rx] ──► Scheduler ──► [worker_tx] ──► Workers (×N)
▲ │ ▲ │
[stage_rxs] ────────┘◄──────────────────────────────┘ [stage_rxs] ────────┘◄──────────────────────────────┘
[flat_delta_rx] ──► Scheduler (in_flight adjustment)
[sink_err_rx] ← errors from sink (highest priority) [sink_err_rx] ← errors from sink (highest priority)
@@ -1242,20 +1376,20 @@ Implemented as a <strong>TT muncher</strong>: the internal rule <code>@build</co
</code></pre></div> </code></pre></div>
<p>The scheduler is a single thread running a biased <code>Select</code> over all input channels. Priority order (highest first):</p> <p>The scheduler is a single thread running a biased <code>Select</code> over all input channels. Priority order (highest first):</p>
<div class="highlight"><pre><span></span><code>index 0 sink_err_rx abort on sink error <div class="highlight"><pre><span></span><code>index 0 sink_err_rx abort on sink error
index 1 stage_rxs[N-1] drain last stage first index 1 flat_delta_rx adjust in_flight before dispatching
... index 2..=n+1 stage_rxs[n-1..0] drain last stage first
index N stage_rxs[0] index n+2 source_rx pull new data last
index N+1 source_rx pull new data last
</code></pre></div> </code></pre></div>
<p>This back-pressure-friendly ordering ensures downstream stages are drained before new items enter the pipeline.</p> <p>This back-pressure-friendly ordering ensures downstream stages are drained before new items enter the pipeline.</p>
<p><strong>Workers</strong> are generic: each receives <code>(data, SharedFn, result_tx)</code> and calls <code>f(data)</code>, sending the result to the provided channel. The scheduler decides which transform to apply and where to route the result.</p> <p><strong>Workers</strong> are generic: each receives a <code>WorkerTask</code> — either <code>Transform(data, stage_idx)</code> or <code>Flat(data, stage_idx)</code>. For <code>Transform</code>, the worker calls <code>f(data)</code> and sends the result to <code>stage_txs[stage_idx]</code>. For <code>Flat</code>, the worker calls <code>f(data, &amp;push_tx, &amp;delta_tx)</code>: the closure pushes N items into <code>push_tx</code> then sends <code>N-1</code> to <code>delta_tx</code>. The scheduler uses the delta to adjust <code>in_flight</code> without knowing N in advance.</p>
<p><strong>Termination</strong> uses an <code>in_flight</code> counter:</p> <p><strong>Termination</strong> uses an <code>in_flight: isize</code> counter and a <code>flat_workers_active: usize</code> counter:</p>
<ul> <ul>
<li>incremented when an item is dispatched from source to workers</li> <li><code>in_flight</code> incremented when an item is dispatched from source to workers</li>
<li>decremented when the item exits the last stage</li> <li><code>in_flight</code> decremented when the item exits the last stage to the sink</li>
<li>the loop exits only when <code>source_done &amp;&amp; in_flight == 0</code></li> <li><code>flat_workers_active</code> incremented when a <code>Flat</code> task is dispatched, decremented when the delta arrives</li>
<li>the loop exits only when <code>source_done &amp;&amp; in_flight == 0 &amp;&amp; flat_workers_active == 0</code></li>
</ul> </ul>
<p>This guarantees all in-flight items complete before <code>join()</code>.</p> <p>This guarantees all in-flight items complete (including all N outputs of a flat stage) before <code>join()</code>.</p>
<h2 id="error-handling">Error handling</h2> <h2 id="error-handling">Error handling</h2>
<p><code>PipelineError</code> has four variants:</p> <p><code>PipelineError</code> has four variants:</p>
<table> <table>
@@ -1279,7 +1413,7 @@ index N+1 source_rx pull new data last
<td>Internal routing error</td> <td>Internal routing error</td>
</tr> </tr>
<tr> <tr>
<td><code>StepError(Box&lt;dyn Error&gt;)</code></td> <td><code>StepError(Box&lt;dyn Error + Send + Sync&gt;)</code></td>
<td>Error from user code (wrapped by <code>make_*_fallible!</code>)</td> <td>Error from user code (wrapped by <code>make_*_fallible!</code>)</td>
</tr> </tr>
</tbody> </tbody>
File diff suppressed because it is too large Load Diff
@@ -12,7 +12,7 @@
<link rel="prev" href="../persistent_compact_int_vec/"> <link rel="prev" href="../persistent_compact_int_vec/">
<link rel="next" href="../../architecture/sequences/invariant/"> <link rel="next" href="../merge/">
@@ -649,6 +649,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link"> <a href="../obilayeredmap/" class="md-nav__link">
@@ -1002,6 +1030,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
File diff suppressed because it is too large Load Diff
@@ -649,6 +649,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link"> <a href="../obilayeredmap/" class="md-nav__link">
@@ -985,6 +1013,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
File diff suppressed because it is too large Load Diff
+146 -11
View File
@@ -773,6 +773,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link"> <a href="../obilayeredmap/" class="md-nav__link">
@@ -851,6 +879,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
@@ -1104,7 +1188,9 @@
<li><strong>error valley</strong> → suggests min_count (typically the local minimum between the error peak and the coverage peak)</li> <li><strong>error valley</strong> → suggests min_count (typically the local minimum between the error peak and the coverage peak)</li>
</ul> </ul>
<h2 id="phase-1-scatter">Phase 1 — Scatter</h2> <h2 id="phase-1-scatter">Phase 1 — Scatter</h2>
<p>Single streaming pass over raw input files (FASTA/FASTQ, gzip). FASTQ quality scores are ignored. For each read:</p> <p>Single streaming pass over raw input files (FASTA/FASTQ, gzip). FASTQ quality scores are ignored.</p>
<p>Input files are read via <code>open_nuc_stream</code>, which opens and decompresses the file, auto-detects the format (FASTA / FASTQ / GenBank), and yields a sequence of <code>NucPage</code> buffers. Each <code>NucPage</code> is a flat 64 KB buffer of normalised bytes (<code>ACGT</code> + <code>\x00</code> separators), carrying a k1 byte overlap from the preceding page so that no k-mer is lost at page boundaries. Per-record identity (sequence id, raw bytes) is not preserved; this is intentional — the scatter phase only needs normalised bases to produce superkmers.</p>
<p>For each read fragment within a page:</p>
<ol> <ol>
<li><strong>Ambiguous base filter</strong>: cut at any non-ACGT base; discard fragments shorter than k.</li> <li><strong>Ambiguous base filter</strong>: cut at any non-ACGT base; discard fragments shorter than k.</li>
<li><strong>Entropy filter</strong>: scan each fragment with a sliding window of size k. When the kmer <span class="arithmatex">\(K_i = S[i \mathinner{..} i+k-1]\)</span> ended by nucleotide <span class="arithmatex">\(S[j]\)</span> (with <span class="arithmatex">\(j = i+k-1\)</span>) has entropy below threshold <span class="arithmatex">\(\theta\)</span>, emit the current segment and start a new one (see algorithm below). <span class="arithmatex">\(K_i\)</span> belongs to neither segment, and no valid kmer is lost.</li> <li><strong>Entropy filter</strong>: scan each fragment with a sliding window of size k. When the kmer <span class="arithmatex">\(K_i = S[i \mathinner{..} i+k-1]\)</span> ended by nucleotide <span class="arithmatex">\(S[j]\)</span> (with <span class="arithmatex">\(j = i+k-1\)</span>) has entropy below threshold <span class="arithmatex">\(\theta\)</span>, emit the current segment and start a new one (see algorithm below). <span class="arithmatex">\(K_i\)</span> belongs to neither segment, and no valid kmer is lost.</li>
@@ -1154,8 +1240,13 @@ B ≈ 100 is tunable; RAM needed ≈ partition_size / B.</p>
for each kmer in sequence: for each kmer in sequence:
kmer_counts[canonical(kmer)] += COUNT kmer_counts[canonical(kmer)] += COUNT
</code></pre></div> </code></pre></div>
<p>Implemented as an external sort or a temporary HashMap, depending on partition size. At the end of this phase, each distinct canonical kmer has its exact total count.</p> <p>Implemented as a three-step pipeline in <code>count_partition()</code>:</p>
<p>Abundance filter applied here: kmers with <code>total_count &lt; q</code> are discarded. <code>q</code> is a collection parameter (0 = keep all, including singletons for ≤1x data).</p> <ol>
<li><strong>External sort</strong> (<code>kmer_sort::sort_unique_kmers</code>): read dereplicated superkmers, extract canonical kmer raw <code>u64</code> values, sort in RAM-bounded chunks (adaptive: 40% of available RAM ÷ n_threads, min 1 M kmers/chunk), k-way merge with inline dedup → <code>sorted_unique.bin</code>. f0 is now known exactly.</li>
<li><strong>Provisional MPHF</strong> (ptr_hash): built from <code>sorted_unique.bin</code> via <code>new_from_par_iter(f0, ...)</code>. Stored to <code>mphf1.bin</code>; <code>sorted_unique.bin</code> deleted immediately.</li>
<li><strong>Accumulation pass</strong>: re-read dereplicated superkmers; for each kmer, <code>slot = mphf.index(kmer.raw())</code>, increment <code>counts1[slot]</code> by the superkmer COUNT. Stored in a <code>PersistentCompactIntVec</code> (<code>counts1.bin</code>).</li>
</ol>
<p>At the end of this phase, each distinct canonical kmer has its exact total count, and the frequency spectrum (<code>spectrums/{label}.json</code>) is written to the index root.</p>
<p>No pre-filter on super-kmer COUNT is possible at phase 2: a super-kmer with COUNT=1 may contain only high-abundance kmers, each present in many other super-kmers across the partition.</p> <p>No pre-filter on super-kmer COUNT is possible at phase 2: a super-kmer with COUNT=1 may contain only high-abundance kmers, each present in many other super-kmers across the partition.</p>
<h2 id="phase-4-super-kmer-compaction">Phase 4 — Super-kmer compaction</h2> <h2 id="phase-4-super-kmer-compaction">Phase 4 — Super-kmer compaction</h2>
<p>The valid kmer set from phase 3 is used as a mask to rewrite the super-kmer files:</p> <p>The valid kmer set from phase 3 is used as a mask to rewrite the super-kmer files:</p>
@@ -1188,14 +1279,52 @@ branching / dead-end → unitig start or end
<p>Output: <code>unitigs.bin</code> — the permanent evidence structure for the partition. Each kmer in the partition appears at exactly one (unitig_id, offset) location.</p> <p>Output: <code>unitigs.bin</code> — the permanent evidence structure for the partition. Each kmer in the partition appears at exactly one (unitig_id, offset) location.</p>
<p><strong>Scope of local unitigs:</strong> these are unitigs of the partition's local de Bruijn graph, not global unitigs. A kmer whose k-1 successor or predecessor falls in another partition appears as a dead end locally and terminates the unitig. This does not affect correctness of verification but means partition-local unitigs cannot be directly reused for global assembly.</p> <p><strong>Scope of local unitigs:</strong> these are unitigs of the partition's local de Bruijn graph, not global unitigs. A kmer whose k-1 successor or predecessor falls in another partition appears as a dead end locally and terminates the unitig. This does not affect correctness of verification but means partition-local unitigs cannot be directly reused for global assembly.</p>
<h2 id="phase-6-mphf-construction-and-index-finalisation">Phase 6 — MPHF construction and index finalisation</h2> <h2 id="phase-6-mphf-construction-and-index-finalisation">Phase 6 — MPHF construction and index finalisation</h2>
<p>Built once on the definitive kmer set (all kmers in all unitigs of the partition). See <a href="../obilayeredmap/">obilayeredmap</a> and <a href="../mphf/">MPHF selection</a> for the current implementation.</p> <p><code>build_index_layer</code> is called per partition (in parallel via <code>build_layers</code>) with the following parameters sourced from <code>IndexConfig</code>:</p>
<div class="highlight"><pre><span></span><code>kmers from unitigs → MPHF → mphf.bin <ul>
→ evidence.bin : n × u32, each = (chunk_id: 25 bits | rank: 7 bits) <li><code>block_bits</code> — from <code>IndexConfig::block_bits</code>; controls the <code>.idx</code> block size (2^block_bits unitig chunks per block) for exact evidence</li>
→ payload : counts/ (mode 2) or presence/ (mode 3) <li><code>evidence</code><code>EvidenceKind::Exact</code> or <code>EvidenceKind::Approx { b, z }</code>; propagated unchanged from <code>IndexConfig::evidence</code></li>
<li><code>min_ab</code> / <code>max_ab</code> — abundance bounds applied before graph construction</li>
<li><code>with_counts</code> — whether to store kmer counts alongside set membership</li>
</ul>
<p><strong>Abundance filtering:</strong> when <code>min_ab &gt; 1</code> or <code>max_ab.is_some()</code>, the provisional <code>mphf1.bin</code> and <code>counts1.bin</code> produced in phase 3 are memory-mapped. Each canonical kmer is accepted only if its count in <code>counts1</code> satisfies the bounds. If either file is absent, filtering is skipped (all kmers accepted).</p>
<div class="highlight"><pre><span></span><code>for each kmer in dereplicated super-kmer:
ab = counts1[mphf1.index(kmer.raw())]
if ab &lt; min_ab || ab &gt; max_ab: skip
graph.push(kmer)
</code></pre></div> </code></pre></div>
<p>The MPHF is built in two passes over <code>unitigs.bin</code>: parallel pass for <code>mphf.bin</code>, sequential pass for <code>evidence.bin</code> and payload. The exact kmer count is available from the unitig index (<code>unitigs.bin.idx</code>) before the passes begin.</p> <p><strong>Graph build and unitig write:</strong></p>
<p><strong>Exact verification via unitig evidence:</strong></p> <p>The surviving kmers are fed into <code>GraphDeBruijn</code>, which computes degrees and yields unitigs. Unitigs are written to <code>layer_0/unitigs.bin</code> via a <code>UnitigFileWriter</code>.</p>
<p><code>unitigs.bin</code> serves as the evidence structure. The MPHF maps every input to <code>[0, N)</code> including absent kmers — the unitig read-back (via <code>evidence.bin</code>) is the only correct membership test.</p> <p><strong>MPHF and evidence build:</strong></p>
<p><code>Layer::build</code> (membership-only) or <code>Layer::&lt;PersistentCompactIntMatrix&gt;::build</code> (with counts) is called next. Internally, <code>MphfLayer::build</code> performs two passes:</p>
<ol>
<li><strong>Pass 1 (parallel):</strong> build <code>unitigs.bin.idx</code> (block size = 2^<code>block_bits</code>) then construct the MPHF from all canonical kmers in <code>unitigs.bin</code>; store to <code>mphf.bin</code>.</li>
<li><strong>Pass 2 (sequential):</strong> for each kmer in <code>unitigs.bin</code>, compute its slot and write <code>evidence.bin</code> (<code>chunk_id: 25 bits | rank: 7 bits</code> packed into a <code>u32</code>); also invoke the payload callback (<code>fill_slot</code>) to populate <code>counts/</code> if <code>with_counts</code>.</li>
</ol>
<p>After <code>Layer::build</code> completes, <code>layer_meta.json</code> records <code>EvidenceKind::Exact</code>.</p>
<p><strong>Approximate evidence override:</strong></p>
<p>If <code>evidence</code> is <code>EvidenceKind::Approx { b, z }</code>, <code>build_approx_evidence</code> is called immediately after <code>Layer::build</code>. It overwrites the exact evidence bundle with <code>fingerprint.bin</code> (b-bit hash per slot) and rewrites <code>layer_meta.json</code> with <code>EvidenceKind::Approx { b, z }</code>. No <code>.idx</code> file is needed at query time in this mode.</p>
<div class="highlight"><pre><span></span><code>// Exact path → evidence.bin + unitigs.bin.idx + layer_meta.json(Exact)
// Approx path → fingerprint.bin + layer_meta.json(Approx{b,z})
// (evidence.bin left on disk but not used)
</code></pre></div>
<p><strong>Partition metadata:</strong></p>
<p>After all layer files are written, <code>PartitionMeta { n_layers: 1 }</code> is serialised to <code>index/meta.json</code> inside the partition directory. This file is required by <code>LayeredMap::open</code> for subsequent merge operations.</p>
<p><strong>File layout per partition after phase 6:</strong></p>
<div class="highlight"><pre><span></span><code>part_XXXXX/
index/
meta.json ← PartitionMeta { n_layers: 1 }
layer_0/
unitigs.bin ← permanent evidence (all modes)
unitigs.bin.idx ← block index (exact mode only)
mphf.bin ← MPHF
evidence.bin ← exact evidence (exact mode)
fingerprint.bin ← b-bit fingerprints (approx mode)
layer_meta.json ← EvidenceKind tag
counts/ ← PersistentCompactIntMatrix (with_counts only)
</code></pre></div>
<p><strong>Cleanup:</strong> unless <code>--keep-intermediate</code> is set, <code>remove_build_artifacts</code> deletes <code>dereplicated.skmer.zst</code>, <code>mphf1.bin</code>, and <code>counts1.bin</code> after all partitions are indexed.</p>
<p>See <a href="../obilayeredmap/">obilayeredmap</a> and <a href="../mphf/">MPHF selection</a> for data structure details.</p>
<p><strong>Query path (exact evidence):</strong></p>
<div class="highlight"><pre><span></span><code>query kmer q <div class="highlight"><pre><span></span><code>query kmer q
→ canonical_minimizer(q) → hash → PART → part_XXXXX/ → canonical_minimizer(q) → hash → PART → part_XXXXX/
→ MPHF(q) → slot s → MPHF(q) → slot s
@@ -1204,7 +1333,13 @@ branching / dead-end → unitig start or end
→ match : return payload[s] ← exact hit → match : return payload[s] ← exact hit
→ no match: kmer absent ← MPHF collision on absent kmer → no match: kmer absent ← MPHF collision on absent kmer
</code></pre></div> </code></pre></div>
<p><code>superkmers.bin.gz</code> is no longer needed at this point and can be deleted.</p> <p><strong>Query path (approximate evidence):</strong></p>
<div class="highlight"><pre><span></span><code>query kmer q
→ MPHF(q) → slot s
→ fingerprint[s] matches seq_hash(q)?
→ yes : probable hit (FP rate = 1/2^b per kmer, 1/2^(b·z) per z-window)
→ no : kmer absent
</code></pre></div>
<div class="footnote"> <div class="footnote">
<hr /> <hr />
<ol> <ol>
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
+553 -4
View File
@@ -64,7 +64,7 @@
<div data-md-component="skip"> <div data-md-component="skip">
<a href="#on-disk-collection-structure" class="md-skip"> <a href="#on-disk-index-layout" class="md-skip">
Skip to content Skip to content
</a> </a>
@@ -575,6 +575,24 @@
<label class="md-nav__link md-nav__link--active" for="__toc">
<span class="md-ellipsis">
On-disk storage
</span>
<span class="md-nav__icon md-icon"></span>
</label>
<a href="./" class="md-nav__link md-nav__link--active"> <a href="./" class="md-nav__link md-nav__link--active">
@@ -592,6 +610,174 @@
</a> </a>
<nav class="md-nav md-nav--secondary" aria-label="Table of contents">
<label class="md-nav__title" for="__toc">
<span class="md-nav__icon md-icon"></span>
Table of contents
</label>
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix>
<li class="md-nav__item">
<a href="#directory-tree" class="md-nav__link">
<span class="md-ellipsis">
Directory tree
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#state-machine-sentinels" class="md-nav__link">
<span class="md-ellipsis">
State machine (sentinels)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#indexmeta-indexmeta" class="md-nav__link">
<span class="md-ellipsis">
index.meta (IndexMeta)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#layer-files" class="md-nav__link">
<span class="md-ellipsis">
Layer files
</span>
</a>
<nav class="md-nav" aria-label="Layer files">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#unitigsbin" class="md-nav__link">
<span class="md-ellipsis">
unitigs.bin
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#unitigsbinidx-exact-only" class="md-nav__link">
<span class="md-ellipsis">
unitigs.bin.idx (Exact only)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#mphfbin" class="md-nav__link">
<span class="md-ellipsis">
mphf.bin
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#layer_metajson-layermeta" class="md-nav__link">
<span class="md-ellipsis">
layer_meta.json (LayerMeta)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#evidencebin-exact" class="md-nav__link">
<span class="md-ellipsis">
evidence.bin (Exact)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#fingerprintbin-approx" class="md-nav__link">
<span class="md-ellipsis">
fingerprint.bin (Approx)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#counts-persistentcompactintmatrix" class="md-nav__link">
<span class="md-ellipsis">
counts/ (PersistentCompactIntMatrix)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#presence-persistentbitmatrix" class="md-nav__link">
<span class="md-ellipsis">
presence/ (PersistentBitMatrix)
</span>
</a>
</li>
</ul>
</nav>
</li>
<li class="md-nav__item">
<a href="#metajson-partitionmeta" class="md-nav__link">
<span class="md-ellipsis">
meta.json (PartitionMeta)
</span>
</a>
</li>
</ul>
</nav>
</li> </li>
@@ -659,6 +845,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link"> <a href="../obilayeredmap/" class="md-nav__link">
@@ -737,6 +951,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
@@ -874,6 +1144,163 @@
<label class="md-nav__title" for="__toc">
<span class="md-nav__icon md-icon"></span>
Table of contents
</label>
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix>
<li class="md-nav__item">
<a href="#directory-tree" class="md-nav__link">
<span class="md-ellipsis">
Directory tree
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#state-machine-sentinels" class="md-nav__link">
<span class="md-ellipsis">
State machine (sentinels)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#indexmeta-indexmeta" class="md-nav__link">
<span class="md-ellipsis">
index.meta (IndexMeta)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#layer-files" class="md-nav__link">
<span class="md-ellipsis">
Layer files
</span>
</a>
<nav class="md-nav" aria-label="Layer files">
<ul class="md-nav__list">
<li class="md-nav__item">
<a href="#unitigsbin" class="md-nav__link">
<span class="md-ellipsis">
unitigs.bin
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#unitigsbinidx-exact-only" class="md-nav__link">
<span class="md-ellipsis">
unitigs.bin.idx (Exact only)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#mphfbin" class="md-nav__link">
<span class="md-ellipsis">
mphf.bin
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#layer_metajson-layermeta" class="md-nav__link">
<span class="md-ellipsis">
layer_meta.json (LayerMeta)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#evidencebin-exact" class="md-nav__link">
<span class="md-ellipsis">
evidence.bin (Exact)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#fingerprintbin-approx" class="md-nav__link">
<span class="md-ellipsis">
fingerprint.bin (Approx)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#counts-persistentcompactintmatrix" class="md-nav__link">
<span class="md-ellipsis">
counts/ (PersistentCompactIntMatrix)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#presence-persistentbitmatrix" class="md-nav__link">
<span class="md-ellipsis">
presence/ (PersistentBitMatrix)
</span>
</a>
</li>
</ul>
</nav>
</li>
<li class="md-nav__item">
<a href="#metajson-partitionmeta" class="md-nav__link">
<span class="md-ellipsis">
meta.json (PartitionMeta)
</span>
</a>
</li>
</ul>
</nav> </nav>
</div> </div>
</div> </div>
@@ -889,9 +1316,131 @@
<h1 id="on-disk-collection-structure">On-disk collection structure</h1> <h1 id="on-disk-index-layout">On-disk index layout</h1>
<p>See <a href="../obilayeredmap/">obilayeredmap crate</a> for the current on-disk layout.</p> <h2 id="directory-tree">Directory tree</h2>
<p>The index root contains one <code>part_XXXXX/</code> directory per partition, each holding one or more <code>layer_N/</code> directories. Each layer directory contains <code>mphf.bin</code>, <code>unitigs.bin</code>, <code>unitigs.bin.idx</code>, <code>evidence.bin</code>, and optionally a <code>counts/</code> or <code>presence/</code> payload directory.</p> <div class="highlight"><pre><span></span><code>&lt;index_root&gt;/
index.meta ← JSON: IndexMeta
scatter.done ← sentinel: scatter phase complete
count.done ← sentinel: dereplicate + count complete
index.done ← sentinel: MPHF index fully built
spectrums/
&lt;label&gt;.json ← kmer frequency spectrum per genome
partitions/
part_00000/ ← one dir per partition (zero-padded 5 digits, 0..2^n_bits1)
index/
meta.json ← PartitionMeta { n_layers }
layer_0/
unitigs.bin ← binary unitig sequences (2-bit packed)
unitigs.bin.idx ← block-sampled offset index (exact evidence only)
mphf.bin ← serialised PtrHash MPHF
layer_meta.json ← LayerMeta { evidence: EvidenceKind }
evidence.bin ← chunk_id:rank per MPHF slot (Exact only)
fingerprint.bin ← b-bit fingerprints per MPHF slot (Approx only)
counts/ ← PersistentCompactIntMatrix (if with_counts=true)
presence/ ← PersistentBitMatrix (if presence mode, merge)
layer_1/ ← added by merge; same structure as layer_0
layer_2/ …
part_00001/ …
</code></pre></div>
<h2 id="state-machine-sentinels">State machine (sentinels)</h2>
<p>The sentinels are touched atomically at the end of each pipeline stage.
A partial run (e.g. scatter interrupted) leaves no sentinel; the state is
detected as the lowest sentinel present.</p>
<table>
<thead>
<tr>
<th>State</th>
<th>Sentinel present</th>
<th>Meaning</th>
</tr>
</thead>
<tbody>
<tr>
<td><code>Empty</code></td>
<td></td>
<td><code>index.meta</code> exists; scatter not started or interrupted</td>
</tr>
<tr>
<td><code>Scattered</code></td>
<td><code>scatter.done</code></td>
<td>All super-kmers routed to partition files</td>
</tr>
<tr>
<td><code>Counted</code></td>
<td><code>count.done</code></td>
<td>Partitions dereplicated; <code>spectrums/</code> written</td>
</tr>
<tr>
<td><code>Indexed</code></td>
<td><code>index.done</code></td>
<td>All MPHF layers built; index ready for queries</td>
</tr>
</tbody>
</table>
<h2 id="indexmeta-indexmeta">index.meta (IndexMeta)</h2>
<div class="highlight"><pre><span></span><code><span class="p">{</span>
<span class="w"> </span><span class="nt">&quot;version&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">1</span><span class="p">,</span>
<span class="w"> </span><span class="nt">&quot;config&quot;</span><span class="p">:</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="nt">&quot;kmer_size&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">31</span><span class="p">,</span>
<span class="w"> </span><span class="nt">&quot;minimizer_size&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">11</span><span class="p">,</span>
<span class="w"> </span><span class="nt">&quot;n_bits&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">8</span><span class="p">,</span>
<span class="w"> </span><span class="nt">&quot;with_counts&quot;</span><span class="p">:</span><span class="w"> </span><span class="kc">false</span><span class="p">,</span>
<span class="w"> </span><span class="nt">&quot;evidence&quot;</span><span class="p">:</span><span class="w"> </span><span class="s2">&quot;Exact&quot;</span><span class="p">,</span>
<span class="w"> </span><span class="nt">&quot;block_bits&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">0</span>
<span class="w"> </span><span class="p">},</span>
<span class="w"> </span><span class="nt">&quot;genomes&quot;</span><span class="p">:</span><span class="w"> </span><span class="p">[</span>
<span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="nt">&quot;label&quot;</span><span class="p">:</span><span class="w"> </span><span class="s2">&quot;genome_A&quot;</span><span class="p">,</span><span class="w"> </span><span class="nt">&quot;meta&quot;</span><span class="p">:</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="nt">&quot;species&quot;</span><span class="p">:</span><span class="w"> </span><span class="s2">&quot;Homo sapiens&quot;</span><span class="w"> </span><span class="p">}</span><span class="w"> </span><span class="p">}</span>
<span class="w"> </span><span class="p">]</span>
<span class="p">}</span>
</code></pre></div>
<p><code>n_bits</code> determines the partition count: <code>2^n_bits</code> directories under <code>partitions/</code>.</p>
<p><code>evidence</code> is either the string <code>"Exact"</code> or <code>{"Approx": {"b": 8, "z": 1}}</code>.</p>
<p><code>block_bits</code> controls the <code>.idx</code> granularity: one offset entry every <code>2^block_bits</code>
chunks. <code>block_bits=0</code> stores one entry per chunk (O(1) random access, largest <code>.idx</code>).</p>
<p><code>GenomeInfo.meta</code> is a free-form string→string map for categorical metadata (e.g.
taxonomy, sample origin). It is optional; defaults to empty.</p>
<h2 id="layer-files">Layer files</h2>
<h3 id="unitigsbin">unitigs.bin</h3>
<p>2-bit packed binary unitig sequences. Each record: 1 byte <code>seql_minus_k</code>
(nucleotide length k), followed by <code>ceil((seql_minus_k + k) / 4)</code> bytes of
packed sequence. Long unitigs are transparently split into overlapping chunks
(k1 nucleotide overlap) so no k-mer crosses a chunk boundary.</p>
<h3 id="unitigsbinidx-exact-only">unitigs.bin.idx (Exact only)</h3>
<p>Magic <code>UIX3</code>, little-endian header: <code>block_bits</code> (u32), <code>n_unitigs</code> (u32),
<code>n_kmers</code> (u64), then <code>ceil(n_unitigs / 2^block_bits) + 1</code> byte-offset entries
(u32 each, last entry is a sentinel past-end offset). Absent for Approx layers.</p>
<h3 id="mphfbin">mphf.bin</h3>
<p>PtrHash MPHF serialised with epserde. Maps canonical kmer (u64, left-aligned
2-bit) to a slot index in <code>[0, n_kmers)</code>.</p>
<h3 id="layer_metajson-layermeta">layer_meta.json (LayerMeta)</h3>
<p><div class="highlight"><pre><span></span><code><span class="p">{</span><span class="w"> </span><span class="nt">&quot;evidence&quot;</span><span class="p">:</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="nt">&quot;type&quot;</span><span class="p">:</span><span class="w"> </span><span class="s2">&quot;exact&quot;</span><span class="w"> </span><span class="p">}</span><span class="w"> </span><span class="p">}</span>
</code></pre></div>
or
<div class="highlight"><pre><span></span><code><span class="p">{</span><span class="w"> </span><span class="nt">&quot;evidence&quot;</span><span class="p">:</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="nt">&quot;type&quot;</span><span class="p">:</span><span class="w"> </span><span class="s2">&quot;approx&quot;</span><span class="p">,</span><span class="w"> </span><span class="nt">&quot;b&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">8</span><span class="p">,</span><span class="w"> </span><span class="nt">&quot;z&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">1</span><span class="w"> </span><span class="p">}</span><span class="w"> </span><span class="p">}</span>
</code></pre></div></p>
<h3 id="evidencebin-exact">evidence.bin (Exact)</h3>
<p>One <code>(chunk_id: u32, rank: u8)</code> record per MPHF slot, packed. Used to verify
that the kmer mapped to a slot is actually present: <code>unitigs.bin[chunk_id][rank]</code>
is re-read and compared against the query.</p>
<h3 id="fingerprintbin-approx">fingerprint.bin (Approx)</h3>
<p><code>b</code>-bit fingerprint per MPHF slot derived from the kmer's sequence hash.
False-positive rate per query ≈ <code>1/2^b</code>. With Findere parameter <code>z ≥ 2</code>,
<code>z</code> consecutive k-mers must all match, reducing the effective FP rate to
approximately <code>W / 2^(b·z)</code> per read of length <code>L</code>
(where <code>W = L k z + 2</code>).</p>
<h3 id="counts-persistentcompactintmatrix">counts/ (PersistentCompactIntMatrix)</h3>
<p>Present when <code>with_counts=true</code>. One column per genome; each row holds the
per-genome k-mer count for the corresponding MPHF slot. Appended column-by-column
during indexing and merge.</p>
<h3 id="presence-persistentbitmatrix">presence/ (PersistentBitMatrix)</h3>
<p>Present when the layer was built in presence/absence mode (merge path).
One bit per genome per MPHF slot. Written during merge; never present on a
freshly indexed single-genome layer.</p>
<h2 id="metajson-partitionmeta">meta.json (PartitionMeta)</h2>
<div class="highlight"><pre><span></span><code><span class="p">{</span><span class="w"> </span><span class="nt">&quot;n_layers&quot;</span><span class="p">:</span><span class="w"> </span><span class="mi">2</span><span class="w"> </span><span class="p">}</span>
</code></pre></div>
<p>Records how many <code>layer_N/</code> directories exist under <code>index/</code>. Incremented by
each merge that adds a layer.</p>
File diff suppressed because it is too large Load Diff
+125 -58
View File
@@ -751,6 +751,34 @@
<li class="md-nav__item">
<a href="../evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="../obilayeredmap/" class="md-nav__link"> <a href="../obilayeredmap/" class="md-nav__link">
@@ -829,6 +857,62 @@
<li class="md-nav__item">
<a href="../merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
@@ -1046,61 +1130,49 @@
<h1 id="superkmer-implementation">SuperKmer — implementation</h1> <h1 id="superkmer-implementation">SuperKmer — implementation</h1>
<h2 id="memory-layout">Memory layout</h2> <h2 id="memory-layout">Memory layout</h2>
<p>A super-kmer is stored as a <strong>32-bit header</strong> followed by a <strong>byte-aligned nucleotide sequence</strong> (2 bits/base, nucleotide 0 at the MSB of the first byte):</p> <p><code>SuperKmer</code> holds two separate fields:</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">struct</span><span class="w"> </span><span class="nc">SuperKmer</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="k">pub</span><span class="p">(</span><span class="k">crate</span><span class="p">)</span><span class="w"> </span><span class="n">count</span><span class="p">:</span><span class="w"> </span><span class="kt">u32</span><span class="p">,</span>
<span class="w"> </span><span class="k">pub</span><span class="p">(</span><span class="k">crate</span><span class="p">)</span><span class="w"> </span><span class="n">inner</span><span class="p">:</span><span class="w"> </span><span class="nc">PackedSeq</span><span class="p">,</span>
<span class="p">}</span>
</code></pre></div>
<p><code>PackedSeq</code> stores a 2-bit packed DNA sequence as a heap-allocated <code>Box&lt;[u8]&gt;</code> plus a <code>tail: u8</code> field:</p>
<table> <table>
<thead> <thead>
<tr> <tr>
<th>Field</th> <th>Field</th>
<th>Bits</th> <th>Type</th>
<th>Role</th> <th>Role</th>
</tr> </tr>
</thead> </thead>
<tbody> <tbody>
<tr> <tr>
<td>COUNT</td> <td><code>tail</code></td>
<td>24</td> <td><code>u8</code></td>
<td>Occurrence count (≤ 16 M)</td> <td>Number of valid nucleotides in the last byte: 0 encodes 4, 13 are identity</td>
</tr> </tr>
<tr> <tr>
<td>NKMERS</td> <td><code>seq</code></td>
<td>8</td> <td><code>Box&lt;[u8]&gt;</code></td>
<td>Number of kmers (= seq_length k + 1, range 1255)</td> <td>2-bit packed bytes, nucleotide 0 at bits 76 of <code>seq[0]</code></td>
</tr> </tr>
</tbody> </tbody>
</table> </table>
<p>Bit layout (MSB to LSB): <code>[31:8] COUNT [7:0] NKMERS</code></p> <p>Nucleotide length is recovered without storing it explicitly:</p>
<p>NKMERS is stored as a raw <code>u8</code> in <strong>kmer units</strong>, not nucleotides. The nucleotide length is recovered as <code>NKMERS + k 1</code>. This avoids the awkward wrapping convention (<code>0 = 256</code>) that would be needed if nucleotide length were stored directly, and gains k1 = 30 units of headroom:</p> <div class="highlight"><pre><span></span><code>seql = (seq.len() - 1) * 4 + tail_count(tail)
<table> </code></pre></div>
<thead> <p>There is no packed header word — <code>count</code> and the sequence live in separate fields.</p>
<tr> <p>The on-disk binary format (produced by <code>write_to_binary</code>) is:</p>
<th>unit</th> <div class="highlight"><pre><span></span><code>[varint(count)] [u8: seql k] [packed bytes…]
<th>u8 covers</th> </code></pre></div>
<th>max nucleotides</th> <p><code>seql k</code> fits in a <code>u8</code> when <code>n_kmers = seql k + 1 ≤ MAX_KMERS_PER_CHUNK (= 256)</code>. If a super-kmer exceeds 256 kmers, <code>write_to_binary</code> splits it into overlapping chunks (k1 nucleotide overlap, same count per chunk), each a self-contained record readable by <code>read_from_binary</code>.</p>
</tr> <p>The public accessors operate on the struct fields directly:</p>
</thead> <div class="highlight"><pre><span></span><code><span class="k">fn</span><span class="w"> </span><span class="nf">seql</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">usize</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">inner</span><span class="p">.</span><span class="n">seql</span><span class="p">()</span><span class="w"> </span><span class="p">}</span>
<tbody> <span class="k">fn</span><span class="w"> </span><span class="nf">count</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u32</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">count</span><span class="w"> </span><span class="p">}</span>
<tr> <span class="k">fn</span><span class="w"> </span><span class="nf">increment</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">count</span><span class="w"> </span><span class="o">+=</span><span class="w"> </span><span class="mi">1</span><span class="p">;</span><span class="w"> </span><span class="p">}</span>
<td>nucleotides</td> <span class="k">fn</span><span class="w"> </span><span class="nf">add</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">n</span><span class="p">:</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">count</span><span class="w"> </span><span class="o">+=</span><span class="w"> </span><span class="n">n</span><span class="p">;</span><span class="w"> </span><span class="p">}</span>
<td>255 nt</td> <span class="k">fn</span><span class="w"> </span><span class="nf">set_count</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">n</span><span class="p">:</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">count</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">n</span><span class="p">;</span><span class="w"> </span><span class="p">}</span>
<td>225 kmers</td>
</tr>
<tr>
<td><strong>kmers</strong></td>
<td><strong>255 kmers</strong></td>
<td><strong>285 nt</strong></td>
</tr>
</tbody>
</table>
<p>The public accessors:</p>
<div class="highlight"><pre><span></span><code><span class="k">fn</span><span class="w"> </span><span class="nf">n_kmers</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">usize</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="p">(</span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0xFF</span><span class="p">)</span><span class="w"> </span><span class="k">as</span><span class="w"> </span><span class="kt">usize</span><span class="w"> </span><span class="p">}</span>
<span class="k">fn</span><span class="w"> </span><span class="nf">seql</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">usize</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">n_kmers</span><span class="p">()</span><span class="w"> </span><span class="o">+</span><span class="w"> </span><span class="n">K</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="mi">1</span><span class="w"> </span><span class="p">}</span>
<span class="k">fn</span><span class="w"> </span><span class="nf">count</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u32</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="mi">8</span><span class="w"> </span><span class="p">}</span>
<span class="k">fn</span><span class="w"> </span><span class="nf">increment</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">)</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">+=</span><span class="w"> </span><span class="mi">1</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">8</span><span class="p">;</span><span class="w"> </span><span class="p">}</span>
<span class="k">fn</span><span class="w"> </span><span class="nf">add</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">n</span><span class="p">:</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">+=</span><span class="w"> </span><span class="n">n</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">8</span><span class="p">;</span><span class="w"> </span><span class="p">}</span>
<span class="k">fn</span><span class="w"> </span><span class="nf">set_count</span><span class="p">(</span><span class="o">&amp;</span><span class="k">mut</span><span class="w"> </span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">n</span><span class="p">:</span><span class="w"> </span><span class="kt">u32</span><span class="p">)</span><span class="w"> </span><span class="p">{</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="p">(</span><span class="bp">self</span><span class="p">.</span><span class="mi">0</span><span class="w"> </span><span class="o">&amp;</span><span class="w"> </span><span class="mh">0xFF</span><span class="p">)</span><span class="w"> </span><span class="o">|</span><span class="w"> </span><span class="p">(</span><span class="n">n</span><span class="w"> </span><span class="o">&lt;&lt;</span><span class="w"> </span><span class="mi">8</span><span class="p">);</span><span class="w"> </span><span class="p">}</span>
</code></pre></div> </code></pre></div>
<p>In practice, observed super-kmer lengths on metagenomic data (k=31) are below 55 nucleotides (≤ 25 kmers) — far from the 255-kmer cap. If a super-kmer ever exceeds 255 kmers, it is split with a k1 nucleotide overlap, preserving all kmers without duplication (identical mechanism to partition-boundary splits).</p>
<p>The sequence is always stored in canonical form (lexicographic minimum of forward and reverse complement), with nucleotide 0 at the MSB of the first byte. The byte array can be hashed directly without any adjustment.</p>
<h2 id="ascii-encoding-and-decoding">ASCII encoding and decoding</h2> <h2 id="ascii-encoding-and-decoding">ASCII encoding and decoding</h2>
<p>Two lookup tables handle ASCII ↔ 2-bit conversion:</p> <p>Two lookup tables handle ASCII ↔ 2-bit conversion:</p>
<ul> <ul>
@@ -1125,7 +1197,7 @@
</code></pre></div> </code></pre></div>
<p><code>REVCOMP4</code> is 256 bytes (fits in L1 cache), computed at compile time. No endianness dependency — all operations are pure arithmetic on byte values.</p> <p><code>REVCOMP4</code> is 256 bytes (fits in L1 cache), computed at compile time. No endianness dependency — all operations are pure arithmetic on byte values.</p>
<p><strong>Step 2 — realignment.</strong> After step 1, <code>padding = n × 8 seql × 2</code> spurious bits (complements of the original padding A's) appear at the start of the array. They are flushed left using <code>BitSlice&lt;u8, Msb0&gt;::rotate_left(padding)</code> from the <code>bitvec</code> crate, which is SIMD-accelerated. The trailing <code>padding</code> bits are then zeroed:</p> <p><strong>Step 2 — realignment.</strong> After step 1, <code>padding = n × 8 seql × 2</code> spurious bits (complements of the original padding A's) appear at the start of the array. They are flushed left using <code>BitSlice&lt;u8, Msb0&gt;::rotate_left(padding)</code> from the <code>bitvec</code> crate, which is SIMD-accelerated. The trailing <code>padding</code> bits are then zeroed:</p>
<div class="highlight"><pre><span></span><code><span class="kd">let</span><span class="w"> </span><span class="n">seql</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">n_kmers</span><span class="p">()</span><span class="w"> </span><span class="o">+</span><span class="w"> </span><span class="n">k</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="mi">1</span><span class="p">;</span> <div class="highlight"><pre><span></span><code><span class="kd">let</span><span class="w"> </span><span class="n">seql</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="bp">self</span><span class="p">.</span><span class="n">seql</span><span class="p">();</span>
<span class="n">shift</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">n</span><span class="w"> </span><span class="o">*</span><span class="w"> </span><span class="mi">8</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="n">seql</span><span class="w"> </span><span class="o">*</span><span class="w"> </span><span class="mi">2</span><span class="w"> </span><span class="c1">// number of padding bits</span> <span class="n">shift</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">n</span><span class="w"> </span><span class="o">*</span><span class="w"> </span><span class="mi">8</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="n">seql</span><span class="w"> </span><span class="o">*</span><span class="w"> </span><span class="mi">2</span><span class="w"> </span><span class="c1">// number of padding bits</span>
<span class="n">bits</span><span class="p">.</span><span class="n">rotate_left</span><span class="p">(</span><span class="n">shift</span><span class="p">)</span> <span class="n">bits</span><span class="p">.</span><span class="n">rotate_left</span><span class="p">(</span><span class="n">shift</span><span class="p">)</span>
<span class="n">bits</span><span class="p">[</span><span class="n">len</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="n">shift</span><span class="o">..</span><span class="p">].</span><span class="n">fill</span><span class="p">(</span><span class="kc">false</span><span class="p">)</span> <span class="n">bits</span><span class="p">[</span><span class="n">len</span><span class="w"> </span><span class="o">-</span><span class="w"> </span><span class="n">shift</span><span class="o">..</span><span class="p">].</span><span class="n">fill</span><span class="p">(</span><span class="kc">false</span><span class="p">)</span>
@@ -1143,7 +1215,7 @@
</code></pre></div> </code></pre></div>
</div> </div>
<h2 id="minimizer-sliding-window">Minimizer sliding window</h2> <h2 id="minimizer-sliding-window">Minimizer sliding window</h2>
<p>Super-kmers are built by <code>SuperKmerIter</code> (crate <code>obiskbuilder</code>), which maintains the current minimizer with a <strong>monotonic deque</strong> over a sliding window of W = k m + 1 m-mer positions.</p> <p>Super-kmers are built by <code>SuperKmerIter</code> (crate <code>obiskbuilder</code>), which tracks the current minimizer with a <strong>monotonic deque</strong> (<code>Ring&lt;MmerItem, 32&gt;</code>) inside <code>RollingStat</code>, a rolling-window entropy and minimizer tracker.</p>
<p>Each deque entry stores:</p> <p>Each deque entry stores:</p>
<table> <table>
<thead> <thead>
@@ -1167,20 +1239,11 @@
<tr> <tr>
<td><code>hash</code></td> <td><code>hash</code></td>
<td>u64</td> <td>u64</td>
<td><span class="arithmatex">\(H(\text{canonical})\)</span> — ordering key for random minimizer selection</td> <td><code>hash_kmer(canonical &lt;&lt; (64 2m))</code> — ordering key for random minimizer selection</td>
</tr> </tr>
</tbody> </tbody>
</table> </table>
<p>The hash <span class="arithmatex">\(H\)</span> is the seeded splitmix64 finalizer (see <a href="../../theory/minimizer/">Minimizer selection</a>):</p> <p>The hash uses the seeded splitmix64 finalizer (<code>mix64(raw ^ 0x9e3779b97f4a7c15)</code>), the same function as <code>kmer::hash_kmer</code>.</p>
<div class="highlight"><pre><span></span><code><span class="k">fn</span><span class="w"> </span><span class="nf">hash_mmer</span><span class="p">(</span><span class="n">canonical</span><span class="p">:</span><span class="w"> </span><span class="kt">u64</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="kt">u64</span><span class="w"> </span><span class="p">{</span>
<span class="w"> </span><span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">canonical</span><span class="w"> </span><span class="o">^</span><span class="w"> </span><span class="mh">0x9e3779b97f4a7c15</span><span class="p">;</span><span class="w"> </span><span class="c1">// seed: eliminates fixed point at 0</span>
<span class="w"> </span><span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">^</span><span class="w"> </span><span class="p">(</span><span class="n">x</span><span class="w"> </span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="mi">30</span><span class="p">);</span>
<span class="w"> </span><span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">x</span><span class="p">.</span><span class="n">wrapping_mul</span><span class="p">(</span><span class="mh">0xbf58476d1ce4e5b9</span><span class="p">);</span>
<span class="w"> </span><span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">^</span><span class="w"> </span><span class="p">(</span><span class="n">x</span><span class="w"> </span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="mi">27</span><span class="p">);</span>
<span class="w"> </span><span class="kd">let</span><span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">=</span><span class="w"> </span><span class="n">x</span><span class="p">.</span><span class="n">wrapping_mul</span><span class="p">(</span><span class="mh">0x94d049bb133111eb</span><span class="p">);</span>
<span class="w"> </span><span class="n">x</span><span class="w"> </span><span class="o">^</span><span class="w"> </span><span class="p">(</span><span class="n">x</span><span class="w"> </span><span class="o">&gt;&gt;</span><span class="w"> </span><span class="mi">31</span><span class="p">)</span>
<span class="p">}</span>
</code></pre></div>
<p>On each new nucleotide, once the window is full, the deque is updated:</p> <p>On each new nucleotide, once the window is full, the deque is updated:</p>
<div class="admonition abstract"> <div class="admonition abstract">
<p class="admonition-title">Algorithm — minimizer deque update</p> <p class="admonition-title">Algorithm — minimizer deque update</p>
@@ -1196,17 +1259,21 @@
</code></pre></div> </code></pre></div>
</div> </div>
<p>The front of the deque is always the current minimizer. Because the deque is maintained in strictly increasing hash order, each entry is popped at most once — O(1) amortized per nucleotide.</p> <p>The front of the deque is always the current minimizer. Because the deque is maintained in strictly increasing hash order, each entry is popped at most once — O(1) amortized per nucleotide.</p>
<p>A super-kmer boundary is emitted when the minimizer changes: <code>deque.front.hash ≠ prev_hash</code>. The <code>canonical</code> field of the front entry is <strong>not</strong> used for boundary detection — that uses the hash alone. The canonical value is stored so that the partition key <span class="arithmatex">\(H(\text{canonical})\)</span> can be recomputed independently at routing time from the stored <code>minimizer_pos</code>, without inheriting the minimum-order-statistic bias (see <a href="../../theory/minimizer/#partition-key-independence">Minimizer selection — partition key independence</a>).</p> <p>A super-kmer boundary is emitted when the minimizer changes: <code>current_minimizer != prev_minimizer</code>. <code>SuperKmerIter</code> also emits a boundary when:</p>
<ul>
<li>entropy of the current k-mer falls at or below the threshold θ (cursor retreated by k1)</li>
<li>super-kmer length reaches 256 nucleotides (cursor retreated by k)</li>
</ul>
<h2 id="kmer-extraction">Kmer extraction</h2> <h2 id="kmer-extraction">Kmer extraction</h2>
<p>A k-mer is extracted from a super-kmer with <code>SuperKmer::kmer(i, k)</code>, which returns a <code>Kmer</code> — a left-aligned <code>u64</code> newtype (see <a href="../kmer/">Kmer implementation</a>):</p> <p>A k-mer is extracted from a super-kmer with <code>SuperKmer::kmer(i)</code>, which delegates to <code>PackedSeq::extract::&lt;KLen&gt;(i)</code> and returns a <code>Kmer</code> — a left-aligned <code>u64</code> newtype (see <a href="../kmer/">Kmer implementation</a>):</p>
<div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">kmer</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">i</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">,</span><span class="w"> </span><span class="n">k</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nb">Result</span><span class="o">&lt;</span><span class="n">Kmer</span><span class="p">,</span><span class="w"> </span><span class="n">KmerError</span><span class="o">&gt;</span> <div class="highlight"><pre><span></span><code><span class="k">pub</span><span class="w"> </span><span class="k">fn</span><span class="w"> </span><span class="nf">kmer</span><span class="p">(</span><span class="o">&amp;</span><span class="bp">self</span><span class="p">,</span><span class="w"> </span><span class="n">i</span><span class="p">:</span><span class="w"> </span><span class="kt">usize</span><span class="p">)</span><span class="w"> </span><span class="p">-&gt;</span><span class="w"> </span><span class="nb">Result</span><span class="o">&lt;</span><span class="n">Kmer</span><span class="p">,</span><span class="w"> </span><span class="n">KmerError</span><span class="o">&gt;</span>
</code></pre></div> </code></pre></div>
<p>The bit slice <code>seq[i*2 .. (i+k)*2]</code> (Msb0 order) is loaded as a big-endian <code>u64</code> via <code>bitvec::load_be</code>, then left-shifted to produce the canonical left-aligned layout. One call — no loop, no allocation.</p> <p>The bit slice <code>seq[i*2 .. (i+k)*2]</code> (Msb0 order) is loaded as a <code>u64</code> via <code>bitvec::load_be</code>, then left-shifted to produce the canonical left-aligned layout. One call — no loop, no allocation.</p>
<hr /> <hr />
<div class="admonition abstract"> <div class="admonition abstract">
<p class="admonition-title">Algorithm — Super-kmer reverse complement</p> <p class="admonition-title">Algorithm — Super-kmer reverse complement</p>
<div class="highlight"><pre><span></span><code>procedure SuperKmerRevcomp(seq, SEQL): <div class="highlight"><pre><span></span><code>procedure SuperKmerRevcomp(seq, SEQL):
seql ← NKMERS + k 1 -- nucleotide length seql ← nucleotide length
n ← ⌈seql / 4⌉ -- number of bytes n ← ⌈seql / 4⌉ -- number of bytes
shift ← n × 8 seql × 2 -- padding bits to flush shift ← n × 8 seql × 2 -- padding bits to flush
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
+294 -1
View File
@@ -213,6 +213,17 @@
</label> </label>
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix> <ul class="md-nav__list" data-md-component="toc" data-md-scrollfix>
<li class="md-nav__item">
<a href="#subcommands" class="md-nav__link">
<span class="md-ellipsis">
Subcommands
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="#constraints" class="md-nav__link"> <a href="#constraints" class="md-nav__link">
<span class="md-ellipsis"> <span class="md-ellipsis">
@@ -222,6 +233,28 @@
</span> </span>
</a> </a>
</li>
<li class="md-nav__item">
<a href="#parameter-constraints-enforced-at-cli" class="md-nav__link">
<span class="md-ellipsis">
Parameter constraints (enforced at CLI)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#genome-label-constraints" class="md-nav__link">
<span class="md-ellipsis">
Genome label constraints
</span>
</a>
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
@@ -714,6 +747,34 @@
<li class="md-nav__item">
<a href="implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="implementation/obilayeredmap/" class="md-nav__link"> <a href="implementation/obilayeredmap/" class="md-nav__link">
@@ -792,6 +853,62 @@
<li class="md-nav__item">
<a href="implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
@@ -935,6 +1052,17 @@
</label> </label>
<ul class="md-nav__list" data-md-component="toc" data-md-scrollfix> <ul class="md-nav__list" data-md-component="toc" data-md-scrollfix>
<li class="md-nav__item">
<a href="#subcommands" class="md-nav__link">
<span class="md-ellipsis">
Subcommands
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="#constraints" class="md-nav__link"> <a href="#constraints" class="md-nav__link">
<span class="md-ellipsis"> <span class="md-ellipsis">
@@ -944,6 +1072,28 @@
</span> </span>
</a> </a>
</li>
<li class="md-nav__item">
<a href="#parameter-constraints-enforced-at-cli" class="md-nav__link">
<span class="md-ellipsis">
Parameter constraints (enforced at CLI)
</span>
</a>
</li>
<li class="md-nav__item">
<a href="#genome-label-constraints" class="md-nav__link">
<span class="md-ellipsis">
Genome label constraints
</span>
</a>
</li> </li>
<li class="md-nav__item"> <li class="md-nav__item">
@@ -976,12 +1126,155 @@
<h1 id="obikmer">obikmer</h1> <h1 id="obikmer">obikmer</h1>
<p><code>obikmer</code> is a Rust tool for manipulation, counting, indexing, and set operations on DNA sequences represented as kmer sets.</p> <p><code>obikmer</code> is a Rust tool for manipulation, counting, indexing, and set operations on DNA sequences represented as kmer sets.</p>
<h2 id="subcommands">Subcommands</h2>
<table>
<thead>
<tr>
<th>Subcommand</th>
<th>Purpose</th>
</tr>
</thead>
<tbody>
<tr>
<td><code>superkmer</code></td>
<td>Extract super-kmers from a sequence file and write to stdout</td>
</tr>
<tr>
<td><code>index</code></td>
<td>Build a complete genome index (scatter → dereplicate → count → layered MPHF)</td>
</tr>
<tr>
<td><code>merge</code></td>
<td>Merge multiple built indexes into one</td>
</tr>
<tr>
<td><code>rebuild</code></td>
<td>Filter and compact an existing index into a new single-layer index; supports ingroup/outgroup predicates on genome metadata</td>
</tr>
<tr>
<td><code>query</code></td>
<td>Query an index with sequences and annotate matches</td>
</tr>
<tr>
<td><code>dump</code></td>
<td>Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the same ingroup/outgroup filtering as <code>rebuild</code></td>
</tr>
<tr>
<td><code>annotate</code></td>
<td>Add or update genome metadata from a CSV file; or dump metadata as CSV</td>
</tr>
<tr>
<td><code>distance</code></td>
<td>Compute pairwise distance matrix between genomes; optionally build NJ/UPGMA trees</td>
</tr>
<tr>
<td><code>unitig</code></td>
<td>Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the same ingroup/outgroup filtering as <code>rebuild</code></td>
</tr>
<tr>
<td><code>estimate</code></td>
<td>Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing</td>
</tr>
<tr>
<td><code>reindex</code></td>
<td>Convert an index's evidence in-place: exact ↔ approx</td>
</tr>
<tr>
<td><code>utils</code></td>
<td>Miscellaneous index utilities: <code>--new-label NEW=OLD</code> renames a genome label; <code>--upgrade-index</code> adds missing <code>layer_meta.json</code> to old indexes</td>
</tr>
<tr>
<td><code>pack</code></td>
<td>Pack per-column matrix files into single-file format to reduce query I/O</td>
</tr>
</tbody>
</table>
<h2 id="constraints">Constraints</h2> <h2 id="constraints">Constraints</h2>
<ul> <ul>
<li>Target scale: individual genome datasets, tens of Gbases</li> <li>Target scale: individual genome datasets, tens of Gbases</li>
<li>Maximum efficiency in computation, memory, and disk usage</li> <li>Maximum efficiency in computation, memory, and disk usage</li>
<li>Input formats: FASTA, FASTQ, gzip, streaming stdin</li> <li>k odd, k ∈ [11, 31], fixed at runtime; kmer fits in a u64 (2 bits/base)</li>
<li>Canonical form: <code>min(kmer, revcomp(kmer))</code> reduces strand-symmetric space by half</li>
<li>Input formats for <code>index</code>/<code>superkmer</code>: FASTA (<code>.fa</code>, <code>.fasta</code>), FASTQ (<code>.fq</code>, <code>.fastq</code>), GenBank flat file (<code>.gb</code>, <code>.gbk</code>, <code>.gbff</code>), all optionally gzip-compressed; directories expanded recursively; streaming stdin via <code>-</code></li>
<li>Input formats for <code>query</code>: FASTA, FASTQ, optionally gzip-compressed; streaming stdin via <code>-</code></li>
</ul> </ul>
<h2 id="parameter-constraints-enforced-at-cli">Parameter constraints (enforced at CLI)</h2>
<p>All constraints below are checked by <code>CommonArgs::validate()</code> at the start of <code>superkmer</code> and <code>index</code>. Invalid values exit immediately with an error.</p>
<table>
<thead>
<tr>
<th>Parameter</th>
<th>Constraint</th>
<th>Reason</th>
</tr>
</thead>
<tbody>
<tr>
<td>k (<code>--kmer-size</code>)</td>
<td>odd</td>
<td>even k allows palindromic k-mers: kmer == revcomp(kmer), breaking the canonical form invariant</td>
</tr>
<tr>
<td>k (<code>--kmer-size</code>)</td>
<td>k ∈ [11, 31]</td>
<td>k &gt; 31 overflows u64 at 2 bits/base; k &lt; 11 gives insufficient specificity</td>
</tr>
<tr>
<td>m (<code>--minimizer-size</code>)</td>
<td>odd</td>
<td>same palindrome argument as k</td>
</tr>
<tr>
<td>m (<code>--minimizer-size</code>)</td>
<td>3 ≤ m ≤ k1</td>
<td>minimizer must be strictly shorter than the kmer</td>
</tr>
<tr>
<td>z (<code>-z</code>, Findere, <code>index --approx</code> only)</td>
<td>z ≤ k1</td>
<td>effective indexed kmer size is kz+1; z ≥ k would make it ≤ 0</td>
</tr>
</tbody>
</table>
<h2 id="genome-label-constraints">Genome label constraints</h2>
<p>Genome labels are arbitrary Unicode strings with the following restrictions:</p>
<table>
<thead>
<tr>
<th>Character</th>
<th>Forbidden</th>
<th>Reason</th>
</tr>
</thead>
<tbody>
<tr>
<td><code>/</code></td>
<td>yes</td>
<td>filesystem path separator</td>
</tr>
<tr>
<td><code>=</code></td>
<td>yes</td>
<td><code>--new-label</code> parser separator</td>
</tr>
<tr>
<td><code>\0</code></td>
<td>yes</td>
<td>null byte</td>
</tr>
<tr>
<td><code>\n</code> <code>\r</code> <code>\t</code></td>
<td>yes</td>
<td>break CSV output</td>
</tr>
<tr>
<td>spaces</td>
<td><strong>allowed</strong></td>
<td>use shell quoting: <code>--new-label 'new label=old label'</code></td>
</tr>
</tbody>
</table>
<p>Empty labels are also rejected. Labels derived automatically from the index directory name (when <code>--label</code> is omitted) are not validated since they come from the filesystem and are already safe.</p>
<h2 id="priority-operations">Priority operations</h2> <h2 id="priority-operations">Priority operations</h2>
<ul> <ul>
<li>Kmer counting (frequencies)</li> <li>Kmer counting (frequencies)</li>
File diff suppressed because it is too large Load Diff
File diff suppressed because it is too large Load Diff
+87 -2
View File
@@ -746,6 +746,34 @@
<li class="md-nav__item">
<a href="../implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="../implementation/obilayeredmap/" class="md-nav__link"> <a href="../implementation/obilayeredmap/" class="md-nav__link">
@@ -824,6 +852,62 @@
<li class="md-nav__item">
<a href="../implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
@@ -1038,11 +1122,12 @@
<h2 id="kmers">Kmers</h2> <h2 id="kmers">Kmers</h2>
<p>A <strong>kmer</strong> is a DNA subsequence of fixed length k. Two constraints govern the choice of k:</p> <p>A <strong>kmer</strong> is a DNA subsequence of fixed length k. Two constraints govern the choice of k:</p>
<ul> <ul>
<li><strong>k ∈ [11, 31]</strong>: the range ensures the kmer is long enough to be specific and short enough to fit in a single machine word.</li> <li><strong>k ∈ [11, 31]</strong>: the range ensures the kmer is long enough to be specific and short enough to fit in a single machine word (u64 at 2 bits/base requires k ≤ 32; k &lt; 11 yields insufficient specificity).</li>
<li><strong>k is odd</strong>: an odd-length sequence cannot equal its own reverse complement (no palindromes). This guarantees that the canonical form <code>min(kmer, revcomp(kmer))</code> is always strictly defined — the two orientations are always distinct — which is required for strand-independent counting.</li> <li><strong>k is odd</strong>: an odd-length sequence cannot equal its own reverse complement (no palindromes). This guarantees that the canonical form <code>min(kmer, revcomp(kmer))</code> is always strictly defined — the two orientations are always distinct — which is required for strand-independent counting.</li>
</ul> </ul>
<p>Both constraints are <strong>enforced at CLI entry</strong> by <code>CommonArgs::validate()</code> in <code>superkmer</code> and <code>index</code>. Passing an invalid k exits immediately with an error message.</p>
<h2 id="super-kmers">Super-kmers</h2> <h2 id="super-kmers">Super-kmers</h2>
<p>A <strong>super-kmer</strong> is a maximal run of consecutive kmers from a DNA read, each overlapping the next by k1 nucleotides. Each kmer of the run carries the same <strong>canonical minimizer</strong>. The <strong>canonical minimizer</strong> of a kmer is the smallest value of <code>min(m-mer, revcomp(m-mer))</code> over all m-mers within the kmer (m &lt; k, m odd), with the constraint that <strong>non-degenerate m-mers are always preferred</strong> over degenerate ones. A degenerate m-mer is one composed of a single repeated nucleotide (all-A, all-C, all-G, or all-T); such m-mers are selected only if no non-degenerate candidate exists in the window.</p> <p>A <strong>super-kmer</strong> is a maximal run of consecutive kmers from a DNA read, each overlapping the next by k1 nucleotides, sharing the same <strong>canonical minimizer</strong>. The <strong>canonical minimizer</strong> of a kmer is the m-mer (m &lt; k) whose canonical hash <code>hash_kmer(min(m-mer, revcomp(m-mer)))</code> is smallest over all m-mers in the kmer window. The hash function is a <code>mix64</code>-based bijection; selection is purely hash-ordered with no degeneracy filter. A super-kmer is capped at 256 nucleotides; a longer run is split at that boundary.</p>
<h3 id="canonical-super-kmers">Canonical super-kmers</h3> <h3 id="canonical-super-kmers">Canonical super-kmers</h3>
<p>A <strong>canonical super-kmer</strong> is the lexicographic minimum of a super-kmer and its reverse complement:</p> <p>A <strong>canonical super-kmer</strong> is the lexicographic minimum of a super-kmer and its reverse complement:</p>
<div class="highlight"><pre><span></span><code>canonical(super-kmer) = min(super-kmer, revcomp(super-kmer)) <div class="highlight"><pre><span></span><code>canonical(super-kmer) = min(super-kmer, revcomp(super-kmer))
Binary file not shown.
File diff suppressed because it is too large Load Diff
+93 -6
View File
@@ -718,6 +718,34 @@
<li class="md-nav__item">
<a href="../../implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="../../implementation/obilayeredmap/" class="md-nav__link"> <a href="../../implementation/obilayeredmap/" class="md-nav__link">
@@ -796,6 +824,62 @@
<li class="md-nav__item">
<a href="../../implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
@@ -1010,17 +1094,20 @@
<p>The Watson-Crick complement of any base is its bitwise NOT on 2 bits: <code>complement(base) = ~base &amp; 0b11</code>.</p> <p>The Watson-Crick complement of any base is its bitwise NOT on 2 bits: <code>complement(base) = ~base &amp; 0b11</code>.</p>
<h2 id="kmer-encoding">Kmer encoding</h2> <h2 id="kmer-encoding">Kmer encoding</h2>
<p>A kmer fits in a single <code>u64</code>. Nucleotide 0 occupies bits 6362, nucleotide i occupies bits 632i and 622i, and the low 642k bits are zero. Extraction of nucleotide i (0 ≤ i &lt; k): <code>(kmer &gt;&gt; (62 - 2*i)) &amp; 0b11</code>.</p> <p>A kmer fits in a single <code>u64</code>. Nucleotide 0 occupies bits 6362, nucleotide i occupies bits 632i and 622i, and the low 642k bits are zero. Extraction of nucleotide i (0 ≤ i &lt; k): <code>(kmer &gt;&gt; (62 - 2*i)) &amp; 0b11</code>.</p>
<p>Reverse complement is computed via a <strong>16-bit lookup table</strong> (65 536 entries × 2 bytes = 128 KB, fits in L2 cache) storing the reverse-complement of every 8-base chunk.</p> <p>Reverse complement is computed by <strong>bit manipulation in four steps</strong>, with no lookup table:</p>
<div class="admonition abstract"> <div class="admonition abstract">
<p class="admonition-title">Algorithm — Kmer reverse complement</p> <p class="admonition-title">Algorithm — Kmer reverse complement</p>
<div class="highlight"><pre><span></span><code>procedure KmerRevcomp(kmer, k): <div class="highlight"><pre><span></span><code>procedure KmerRevcomp(kmer, k):
raw ← TABLE16[kmer &amp; 0xFFFF] &lt;&lt; 48 x ← ~kmer -- complement all bases
| TABLE16[(kmer &gt;&gt; 16) &amp; 0xFFFF] &lt;&lt; 32 x ← swap_bytes(x) -- reverse byte order
| TABLE16[(kmer &gt;&gt; 32) &amp; 0xFFFF] &lt;&lt; 16 x ← ((x &gt;&gt; 4) &amp; 0x0F0F0F0F0F0F0F0F)
| TABLE16[(kmer &gt;&gt; 48) &amp; 0xFFFF] | ((x &amp; 0x0F0F0F0F0F0F0F0F) &lt;&lt; 4) -- swap nibbles within each byte
return raw &lt;&lt; (64 - 2*k) x ← ((x &gt;&gt; 2) &amp; 0x3333333333333333)
| ((x &amp; 0x3333333333333333) &lt;&lt; 2) -- swap 2-bit pairs within each nibble
return x &lt;&lt; (64 - 2*k) -- re-align to MSB
</code></pre></div> </code></pre></div>
</div> </div>
<p>The three reorder passes together reverse the order of all 2-bit base codes across the 64-bit word. The bitwise NOT in the first step complements each base (A↔T, C↔G). The final left shift clears the low 642k padding bits.</p>
<p>The <strong>canonical form</strong> is the lexicographic minimum of the kmer and its reverse complement:</p> <p>The <strong>canonical form</strong> is the lexicographic minimum of the kmer and its reverse complement:</p>
<div class="highlight"><pre><span></span><code>canonical(kmer) = min(kmer, revcomp(kmer)) <div class="highlight"><pre><span></span><code>canonical(kmer) = min(kmer, revcomp(kmer))
</code></pre></div> </code></pre></div>
File diff suppressed because it is too large Load Diff
+85 -1
View File
@@ -773,6 +773,34 @@
<li class="md-nav__item">
<a href="../../implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="../../implementation/obilayeredmap/" class="md-nav__link"> <a href="../../implementation/obilayeredmap/" class="md-nav__link">
@@ -851,6 +879,62 @@
<li class="md-nav__item">
<a href="../../implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
@@ -1109,7 +1193,7 @@
<h2 id="final-score">Final score</h2> <h2 id="final-score">Final score</h2>
<p>The filter computes <span class="arithmatex">\(\hat{H}(ws)\)</span> for each word size ws from 1 to ws_max and returns the <strong>minimum</strong>:</p> <p>The filter computes <span class="arithmatex">\(\hat{H}(ws)\)</span> for each word size ws from 1 to ws_max and returns the <strong>minimum</strong>:</p>
<div class="arithmatex">\[\text{entropy}(kmer) = \min_{ws=1}^{ws_{\max}} \hat{H}(ws)\]</div> <div class="arithmatex">\[\text{entropy}(kmer) = \min_{ws=1}^{ws_{\max}} \hat{H}(ws)\]</div>
<p>A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if <span class="arithmatex">\(\text{entropy}(kmer) \leq \theta\)</span>, where <span class="arithmatex">\(\theta\)</span> is a collection parameter. The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc.</p> <p>A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if <span class="arithmatex">\(\text{entropy}(kmer) &lt; \theta\)</span>, where <span class="arithmatex">\(\theta\)</span> is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc.</p>
<h2 id="interpretation-as-an-effective-number-of-classes">Interpretation as an effective number of classes</h2> <h2 id="interpretation-as-an-effective-number-of-classes">Interpretation as an effective number of classes</h2>
<p><span class="arithmatex">\(H_{\text{corr}}\)</span> is a standard Shannon entropy over raw words (after unfolding the equivalence classes), so the classical perplexity interpretation holds directly: <span class="arithmatex">\(N_{\text{eff}} = e^{H_{\text{corr}}}\)</span> is the number of equiprobable classes that would yield the same entropy.</p> <p><span class="arithmatex">\(H_{\text{corr}}\)</span> is a standard Shannon entropy over raw words (after unfolding the equivalence classes), so the classical perplexity interpretation holds directly: <span class="arithmatex">\(N_{\text{eff}} = e^{H_{\text{corr}}}\)</span> is the number of equiprobable classes that would yield the same entropy.</p>
<p>For the normalised score <span class="arithmatex">\(\hat{H}\)</span>, dividing by <span class="arithmatex">\(H_{\text{max}}\)</span> changes the logarithm base:</p> <p>For the normalised score <span class="arithmatex">\(\hat{H}\)</span>, dividing by <span class="arithmatex">\(H_{\text{max}}\)</span> changes the logarithm base:</p>
File diff suppressed because it is too large Load Diff
+84
View File
@@ -718,6 +718,34 @@
<li class="md-nav__item">
<a href="../../implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="../../implementation/obilayeredmap/" class="md-nav__link"> <a href="../../implementation/obilayeredmap/" class="md-nav__link">
@@ -796,6 +824,62 @@
<li class="md-nav__item">
<a href="../../implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
File diff suppressed because it is too large Load Diff
+84
View File
@@ -762,6 +762,34 @@
<li class="md-nav__item">
<a href="../../implementation/evidence_elimination/" class="md-nav__link">
<span class="md-ellipsis">
Evidence elimination (discussion)
</span>
</a>
</li>
<li class="md-nav__item"> <li class="md-nav__item">
<a href="../../implementation/obilayeredmap/" class="md-nav__link"> <a href="../../implementation/obilayeredmap/" class="md-nav__link">
@@ -840,6 +868,62 @@
<li class="md-nav__item">
<a href="../../implementation/merge/" class="md-nav__link">
<span class="md-ellipsis">
Merge command
</span>
</a>
</li>
<li class="md-nav__item">
<a href="../../implementation/rebuild_filter/" class="md-nav__link">
<span class="md-ellipsis">
Kmer filtering (rebuild/dump/unitig)
</span>
</a>
</li>
</ul> </ul>
</nav> </nav>
+213 -256
View File
@@ -2,169 +2,155 @@
## Fundamental invariant ## Fundamental invariant
A given canonical kmer belongs to **exactly one partition** and **exactly one layer** within that partition. This is the property that makes all aggregation operations decomposable and parallelisable without coordination. A given canonical kmer belongs to **exactly one partition** and **exactly one layer** within that partition. This property makes all aggregation operations decomposable and parallelisable without coordination.
--- ---
## Three-level hierarchy ## Three-level hierarchy
``` ```
PartitionedIndex KmerIndex (index.meta + KmerPartition)
├── LayeredPartition (one per minimiser bucket) ├── partition_0/index/ one directory per minimiser bucket
│ ├── MphfLayer 0 kmer → slot (immutable bijection) │ ├── meta.json PartitionMeta { n_layers }
│ ├── DataStore A slot → T (e.g. counts) │ ├── layer_0/
│ │ ── DataStore B slot → T (e.g. presence/absence, derived) │ │ ── layer_meta.json LayerMeta { evidence: EvidenceKind }
│ ├── MphfLayer 1 │ ├── mphf.bin PtrHash MPHF
│ │ ── DataStore A │ │ ── unitigs.bin unitig spine (never overwritten)
└── ... │ ├── evidence.bin exact evidence (Exact only)
├── LayeredPartition │ │ ├── unitigs.bin.idx block index (Exact only)
│ │ ├── fingerprint.bin fingerprints (Approx only)
│ │ ├── counts/ PersistentCompactIntMatrix (with_counts = true)
│ │ └── presence/ PersistentBitMatrix
│ └── layer_1/
│ └── ... │ └── ...
└── partition_1/index/
└── ...
``` ```
**PartitionedIndex**: routes queries to partitions via canonical minimiser hash. Owns the partition count and routing scheme (fixed at creation). Dispatches aggregations across partitions in parallel. **KmerIndex**: root entry point. Owns `IndexMeta` (written to `index.meta`) and a `KmerPartition` that routes canonical kmers to partition directories. All partition-level operations are dispatched in parallel via rayon.
**LayeredPartition**: one directory per minimiser bucket. Holds a `Vec<MphfLayer>`. Each layer covers a disjoint kmer set — layer 0 is built from dataset A; layer 1 covers kmers in B absent from layer 0; and so on. Layers within a partition are always disjoint. **Partition directory**: one directory per minimiser bucket. `PartitionMeta` (stored as `meta.json`) records `n_layers`. Layers within a partition cover disjoint kmer sets.
**MphfLayer**: the MPHF + evidence + unitig spine. Maps `kmer → slot` for its disjoint kmer set. Immutable once built. Independent of any data attached to it. **Layer directory**: one `MphfLayer` plus optional data stores. `LayerMeta` (stored as `layer_meta.json`) records which `EvidenceKind` was used. The MPHF and `unitigs.bin` are immutable once built; evidence files are the only part replaced by `reindex`.
**DataStore**: a slot-indexed data array (e.g. `PersistentCompactIntMatrix`, `PersistentBitMatrix`). Attached to a `MphfLayer` externally. Multiple stores of different types can coexist on the same `MphfLayer`.
--- ---
## MphfLayer — autonomous mapping layer ## IndexConfig and IndexMeta
```rust ```rust
MphfLayer::find(kmer: CanonicalKmer) -> Option<usize> // slot, or None if absent pub struct IndexConfig {
MphfLayer::n() -> usize // number of slots pub kmer_size: usize,
MphfLayer::build(dir: &Path) -> OLMResult<(Self, usize)> // from unitigs.bin pub minimizer_size: usize,
MphfLayer::open(dir: &Path) -> OLMResult<Self> pub n_bits: usize, // log2(n_partitions)
pub with_counts: bool,
pub evidence: EvidenceKind,
pub block_bits: u8, // .idx granularity: 2^block_bits unitigs/block; 0 = one entry per unitig
}
pub struct IndexMeta {
pub version: u32,
pub config: IndexConfig,
pub genomes: Vec<GenomeInfo>, // ordered; index = genome column number
}
pub struct GenomeInfo {
pub label: String,
pub meta: HashMap<String, String>, // arbitrary categorical metadata
}
``` ```
`find` returns `Some(slot)` only if the kmer is actually in this layer (evidence check included). Returns `None` for kmers present in other layers or absent from the index. `IndexMeta` is serialised as `index.meta` (JSON). It is the authority for the ordered list of genomes and for the parameters that govern all subsequent operations on the index.
The MPHF (`mphf.bin`, `evidence.bin`, `unitigs.bin`) is built once and never rebuilt. All data derivation operations (count → presence, thresholding, merging) reuse the same `MphfLayer`. ---
## EvidenceKind
```rust
pub enum EvidenceKind {
Exact,
Approx { b: u8, z: u8 },
}
```
Controls which files are written per layer and which query path is taken:
| Variant | Files written | False-positive rate |
|---|---|---|
| `Exact` | `evidence.bin`, `unitigs.bin.idx` | 0 |
| `Approx { b, z }` | `fingerprint.bin` | ≈ W / 2^(b·z) per read (Findere) |
`EvidenceKind` is stored both in `IndexConfig` (index-wide default, updated by `reindex`) and in each `LayerMeta` (per-layer record of what was actually built).
---
## MphfLayer — autonomous kmer → slot mapping
```rust
pub struct MphfLayer {
mphf: PtrHash<…>,
ev: LayerEvidence, // Exact { evidence, unitigs } | Approx { fingerprint }
n: usize,
}
```
`MphfLayer::find(kmer)` dispatches transparently to `find_exact` or `find_approx` based on the evidence loaded at `open` time (read from `layer_meta.json`). Returns `Some(slot)` only if the kmer is confirmed present; `None` for absent or out-of-range.
```
find_exact: slot = mphf(kmer); decode evidence → (chunk_id, rank); verify kmer in unitigs
find_approx: slot = mphf(kmer); check fingerprint[slot] == seq_hash(kmer)
```
`block_bits` controls the `.idx` file written alongside `evidence.bin`. At `block_bits = 0`, every unitig chunk has an index entry, giving O(1) random access; larger values trade access time for a smaller `.idx`.
The MPHF and `unitigs.bin` are never rebuilt by any post-build operation.
---
## Layer\<D\> — MPHF + data payload
```rust
pub struct Layer<D: LayerData = ()> {
mphf: MphfLayer,
data: D,
}
```
`D` selects the attached data payload:
| `D` | Data directory | `Item` returned by `query` |
|---|---|---|
| `()` | — | `()` (set membership only) |
| `PersistentCompactIntMatrix` | `counts/` | `Box<[u32]>` (counts per genome) |
| `PersistentBitMatrix` | `presence/` | `Box<[bool]>` (presence per genome) |
`Layer::query(kmer)` delegates to `MphfLayer::find`, then calls `data.read(slot)` if a slot is returned. Both exact and approximate evidence are handled transparently; the caller sees only `Option<Hit<D::Item>>`.
Build-time entry points:
```rust
Layer<()>::build(out_dir, block_bits) // set membership
Layer<PersistentCompactIntMatrix>::build(out_dir, block_bits, count_of)
Layer<PersistentBitMatrix>::build_presence(out_dir, block_bits, n_genomes, present_in)
Layer::<()>::build_evidence(layer_dir, kind, block_bits) // evidence only (reindex path)
```
--- ---
## DataStore — slot-indexed data ## DataStore — slot-indexed data
```rust `PersistentCompactIntMatrix` and `PersistentBitMatrix` are slot-indexed stores. They know nothing about kmers or MPHFs.
trait DataStore {
type Item;
fn get(&self, slot: usize) -> Self::Item;
fn n(&self) -> usize;
}
```
Concrete types from `obicompactvec`: | Type | `Item` | Aggregation method | Use |
| Type | `Item` | Column stats | Use |
|---|---|---|---| |---|---|---|---|
| `PersistentCompactIntMatrix` | `Box<[u32]>` | `sum() -> Array1<u64>` | count per sample per slot | | `PersistentCompactIntMatrix` | `Box<[u32]>` | `sum() Array1<u64>` | counts per genome per slot |
| `PersistentBitMatrix` | `Box<[bool]>` | `count_ones() -> Array1<u64>` | presence per sample per slot | | `PersistentBitMatrix` | `Box<[bool]>` | `count_ones() Array1<u64>` | presence per genome per slot |
`sum()` and `count_ones()` are the bridge between the per-matrix level and cross-layer aggregation: they give the total weight of each column within one (partition, layer) pair, which can be summed to get global column weights.
A `DataStore` knows nothing about kmers or MPHFs. It is indexed by `usize` slot only.
--- ---
## Distance matrix API on DataStore types ## Aggregation traits — `obicompactvec::traits`
Both `PersistentCompactIntMatrix` and `PersistentBitMatrix` expose two families of distance matrix methods. Three traits unify the aggregation API across all hierarchy levels.
### Full distance matrices
Compute the final `n_cols × n_cols` distance matrix from data within a single matrix. Internally parallelised over the upper triangle via rayon.
```rust
// PersistentCompactIntMatrix
fn bray_dist_matrix(&self) -> Array2<f64>
fn relfreq_bray_dist_matrix(&self) -> Array2<f64>
fn euclidean_dist_matrix(&self) -> Array2<f64>
fn relfreq_euclidean_dist_matrix(&self) -> Array2<f64>
fn hellinger_dist_matrix(&self) -> Array2<f64>
fn jaccard_dist_matrix(&self) -> Array2<f64>
fn threshold_jaccard_dist_matrix(&self, threshold: u32) -> Array2<f64>
// PersistentBitMatrix
fn jaccard_dist_matrix(&self) -> Array2<f64>
fn hamming_dist_matrix(&self) -> Array2<u64>
```
These are convenience methods. For a `LayeredDataStore` or `PartitionedDataStore` they cannot be used directly — the partial API is required.
### Partial distance matrices
Return additive components that can be summed element-wise across (partition, layer) pairs before computing the final distance. This is what makes cross-layer and cross-partition aggregation possible.
**Category 1 — self-contained partials**: additive without any external parameter.
```rust
// PersistentCompactIntMatrix
fn partial_bray_dist_matrix(&self)
-> (Array2<u64>, // sum_min[i,j]
Array1<u64>) // col_sums[k]
fn partial_euclidean_dist_matrix(&self) -> Array2<f64> // sum of squared diffs
fn partial_threshold_jaccard_dist_matrix(&self, threshold: u32)
-> (Array2<u64>, // inter[i,j]
Array2<u64>) // union[i,j]
// PersistentBitMatrix
fn partial_jaccard_dist_matrix(&self)
-> (Array2<u64>, // inter[i,j]
Array2<u64>) // union[i,j]
fn partial_hamming_dist_matrix(&self) -> Array2<u64> // differing bits
```
**Category 2 — normalised partials**: require global column sums as input, computed beforehand across all (partition, layer) pairs.
```rust
// PersistentCompactIntMatrix only
fn partial_relfreq_bray_dist_matrix(&self, col_sums: &Array1<u64>)
-> Array2<f64> // Σ_slot min(a_slot/sum_i, b_slot/sum_j)
fn partial_relfreq_euclidean_dist_matrix(&self, col_sums: &Array1<u64>)
-> Array2<f64> // Σ_slot (a_slot/sum_i - b_slot/sum_j)²
fn partial_hellinger_euclidean_dist_matrix(&self, col_sums: &Array1<u64>)
-> Array2<f64> // Σ_slot (√(a/sum_i) - √(b/sum_j))²
```
The `col_sums` parameter must reflect the GLOBAL count across all layers and all partitions — passing a per-layer sum would give a wrong result. This constraint drives the two-pass algorithm described below.
---
## Progressive aggregation principle
Aggregation is **hierarchical**: each level computes its contribution by aggregating from the level immediately below it. No level skips a level or collects raw data from two levels down.
```
PersistentCompactIntMatrix::col_weights() — column sums for one (partition, layer) matrix
↓ Σ across layers
LayeredStore<PersistentCompactIntMatrix>::col_weights() — column sums for one partition
↓ Σ across partitions
LayeredStore<LayeredStore<…>>::col_weights() — global column sums
```
The same cascade applies to every partial:
```
PersistentCompactIntMatrix::partial_bray() — one (partition, layer)
↓ element-wise Σ across layers
LayeredStore<PersistentCompactIntMatrix>::partial_bray() — one partition
↓ element-wise Σ across partitions
LayeredStore<LayeredStore<…>>::partial_bray() — global partial → final dist
```
Each level presents a stable trait surface to the level above; no level reaches two levels down.
---
## Traits — `obicompactvec::traits`
Three traits unify the aggregation API across all levels of the hierarchy.
```rust ```rust
trait ColumnWeights: Send + Sync { trait ColumnWeights: Send + Sync {
@@ -172,21 +158,16 @@ trait ColumnWeights: Send + Sync {
} }
trait CountPartials: ColumnWeights { trait CountPartials: ColumnWeights {
// self-contained partials (additive, no parameter)
fn partial_bray(&self) -> Array2<u64>; fn partial_bray(&self) -> Array2<u64>;
fn partial_euclidean(&self) -> Array2<f64>; fn partial_euclidean(&self) -> Array2<f64>;
fn partial_threshold_jaccard(&self, threshold: u32) -> (Array2<u64>, Array2<u64>); fn partial_threshold_jaccard(&self, threshold: u32) -> (Array2<u64>, Array2<u64>);
// normalised partials (global col_weights passed in cascade)
fn partial_relfreq_bray(&self, global: &Array1<u64>) -> Array2<f64>; fn partial_relfreq_bray(&self, global: &Array1<u64>) -> Array2<f64>;
fn partial_relfreq_euclidean(&self, global: &Array1<u64>) -> Array2<f64>; fn partial_relfreq_euclidean(&self, global: &Array1<u64>) -> Array2<f64>;
fn partial_hellinger(&self, global: &Array1<u64>) -> Array2<f64>; fn partial_hellinger(&self, global: &Array1<u64>) -> Array2<f64>;
// provided finalisation methods (default implementations) // provided finalisation methods with default impls
fn bray_dist_matrix(&self) -> Array2<f64> { … } fn bray_dist_matrix(&self) -> Array2<f64> { … }
fn euclidean_dist_matrix(&self) -> Array2<f64> { … }
fn threshold_jaccard_dist_matrix(&self, threshold: u32) -> Array2<f64> { … }
fn relfreq_bray_dist_matrix(&self) -> Array2<f64> { … } fn relfreq_bray_dist_matrix(&self) -> Array2<f64> { … }
fn relfreq_euclidean_dist_matrix(&self) -> Array2<f64> { … } // …
fn hellinger_dist_matrix(&self) -> Array2<f64> { … }
} }
trait BitPartials: ColumnWeights { trait BitPartials: ColumnWeights {
@@ -198,55 +179,109 @@ trait BitPartials: ColumnWeights {
} }
``` ```
**Leaf implementors** (in `obicompactvec`): Leaf implementors:
| Type | Traits | | Type | Traits |
|---|---| |---|---|
| `PersistentCompactIntMatrix` | `ColumnWeights` (via `sum()`), `CountPartials` | | `PersistentCompactIntMatrix` | `ColumnWeights`, `CountPartials` |
| `PersistentBitMatrix` | `ColumnWeights` (via `count_ones()`), `BitPartials` | | `PersistentBitMatrix` | `ColumnWeights`, `BitPartials` |
`PersistentCompactIntVec` and `PersistentBitVec` do **not** implement these traits — they are single-column primitives, not matrix-level aggregators.
--- ---
## `LayeredStore<S>``obilayeredmap` ## LayeredStore\<S\> — recursive aggregation wrapper
A single generic wrapper replaces the need for named `LayeredDataStore` and `PartitionedDataStore` types:
```rust ```rust
pub struct LayeredStore<S>(Vec<S>); pub struct LayeredStore<S>(Vec<S>);
``` ```
Three blanket impls propagate the traits up the hierarchy: Three blanket impls propagate all traits up the hierarchy:
```rust ```rust
impl<S: ColumnWeights> ColumnWeights for LayeredStore<S> { … } // Σ across inner stores impl<S: ColumnWeights> ColumnWeights for LayeredStore<S> { … }
impl<S: CountPartials> CountPartials for LayeredStore<S> { … } // same pattern impl<S: CountPartials> CountPartials for LayeredStore<S> { … }
impl<S: BitPartials> BitPartials for LayeredStore<S> { … } // same pattern impl<S: BitPartials> BitPartials for LayeredStore<S> { … }
``` ```
Because the blanket impl is recursive, **`LayeredStore<LayeredStore<S>>`** automatically inherits all three traits when `S` does — no separate `PartitionedStore` type is needed: This makes `LayeredStore<LayeredStore<PersistentCompactIntMatrix>>` automatically implement `CountPartials` — no separate `PartitionedStore` type is needed:
``` ```
PersistentCompactIntMatrix implements CountPartials PersistentCompactIntMatrix leaf (one layer)
LayeredStore<PersistentCompactIntMatrix> via blanket impl (= one partition) LayeredStore<PersistentCompactIntMatrix> one partition (layers are disjoint)
LayeredStore<LayeredStore<…>> via blanket impl (= partitioned index) LayeredStore<LayeredStore<…>> whole index (partitions are independent)
``` ```
### Normalised metrics two-pass cascade Normalised metrics require global column sums — computed in a two-pass cascade:
The normalised finalisation methods call `col_weights()` first (pass 1), then the normalised partial (pass 2). Both calls go through the same blanket impl, so the cascade is automatic:
```rust ```rust
// called on LayeredStore<LayeredStore<PersistentCompactIntMatrix>> // on LayeredStore<LayeredStore<PersistentCompactIntMatrix>>
fn relfreq_bray_dist_matrix(&self) -> Array2<f64> { fn relfreq_bray_dist_matrix(&self) -> Array2<f64> {
let global = self.col_weights(); // pass 1 — progressive sum at every level let global = self.col_weights(); // pass 1 — sums up hierarchy
let p = self.partial_relfreq_bray(&global); // pass 2 — global passed in cascade let p = self.partial_relfreq_bray(&global); // pass 2 — global broadcast read-only
p.mapv(|v| 1.0 - v) // finalise (diagonal zeroed separately) p.mapv(|v| 1.0 - v)
} }
``` ```
`global` is exact: each kmer belongs to exactly one `(partition, layer)` pair, so there is no double-counting across the hierarchy. Because each kmer belongs to exactly one `(partition, layer)` pair, `col_weights()` has no double-counting across the hierarchy.
---
## Progressive aggregation principle
No level reaches two levels down. Each level sums contributions from the level immediately below:
```
PersistentCompactIntMatrix::col_weights() — one (partition, layer)
↓ Σ across layers
LayeredStore<PersistentCompactIntMatrix>::col_weights() — one partition
↓ Σ across partitions
LayeredStore<LayeredStore<…>>::col_weights() — global
```
The same cascade applies to every partial method.
---
## Multi-genome column invariant
After any merge, every layer in every partition has exactly `n_genomes` columns, where `n_genomes` is the current total in `index.meta`. This holds for both `PersistentCompactIntMatrix` and `PersistentBitMatrix`.
Maintained by three coordinated operations:
**Existing layers — column append.** `Layer::append_genome_column` appends one column to each existing layer. Slots matching the incoming genome receive its count or `true`; all other slots receive 0 or `false`.
**New layers — absent columns prepended.** When a new layer is created for kmers unique to the incoming genome, `n_existing_genomes` absent columns are prepended before the incoming genome's column, so the new layer immediately has the same column count as all other layers.
**First merge, Presence mode — `init_presence_matrix`.** The initial single-genome index has no `presence/` directory (presence is implicit). On the first merge, `Layer<()>::init_presence_matrix` materialises genome 0's presence column (all `true`) retroactively, raising the column count from 0 to 1 before appending column 1.
This invariant is the precondition for correct progressive aggregation: every level can blindly sum matrices from below because all matrices have the same shape.
---
## Query model
### Point query
```
minimiser(kmer) → partition p
for each layer l in p:
if let Some(slot) = MphfLayer_l.find(kmer):
return data_l.read(slot)
return None
```
O(n_layers) MPHF probes worst case; O(1) expected. The result comes from exactly one `(partition, layer)`.
### Aggregation
```
result = reduce(
for p in partitions: // parallel
for l in layers(p): // parallel
partial(data_p_l)
)
```
For normalised metrics, replace with the two-pass cascade.
--- ---
@@ -254,103 +289,25 @@ fn relfreq_bray_dist_matrix(&self) -> Array2<f64> {
| Level | Unit | Coordination | | Level | Unit | Coordination |
|---|---|---| |---|---|---|
| Across partitions | `LayeredStore<LayeredStore<S>>` inner stores | none — fully independent | | Across partitions | inner stores of `LayeredStore<LayeredStore<S>>` | none |
| Across layers within a partition | `LayeredStore<S>` inner stores | none — disjoint kmer sets | | Across layers within a partition | inner stores of `LayeredStore<S>` | none — disjoint kmer sets |
| Normalised pass 1 (`col_weights`) | per inner store | none — additive | | Normalised pass 1 (`col_weights`) | per inner store | none — additive |
| Normalised pass 2 (partial) | per inner store | `global` broadcast read-only | | Normalised pass 2 (partial) | per inner store | `global` broadcast read-only |
| Within a matrix (distance) | upper-triangle pair `(i,j)` | none — rayon `par_iter` | | Within a matrix (distance) | upper-triangle pair `(i,j)` | none — rayon `par_iter` |
All levels use rayon `par_iter` internally; `reduce_with` performs a parallel tree reduction. ---
## reindex — evidence conversion in place
`KmerIndex::reindex(target, block_bits)` converts every layer's evidence bundle to `target` without touching the MPHF or `unitigs.bin`:
- `→ Exact`: builds `evidence.bin` + `unitigs.bin.idx`; removes `fingerprint.bin`
- `→ Approx { b, z }`: builds `fingerprint.bin`; removes `evidence.bin` + `unitigs.bin.idx`
On success, `IndexConfig::evidence` and `IndexConfig::block_bits` are updated in `index.meta`. Each layer's `layer_meta.json` is also rewritten with the new `EvidenceKind`.
--- ---
## Query model ## estimate — parameter dry-run
### Point query — `kmer → Option<Item>` `estimate` resolves approximate-evidence parameters (`z`, `b`, target FP rate) and prints the resulting effective kmer size and per-kmer / per-z-window false-positive rates without touching any index. Used to calibrate `Approx { b, z }` before building or reindexing.
```
minimiser(kmer) → partition p
for each layer l in p:
slot = MphfLayer_l.find(kmer)
if slot is Some:
return DataStore_l.get(slot)
return None
```
O(n_layers) MPHF probes worst case; O(1) expected. No cross-layer fusion — the result comes from exactly one (partition, layer).
### Aggregation — `→ Result`
```
result = reduce(
for p in partitions: // parallel
for l in layers(p): // parallel
partial(DataStore_p_l)
)
```
For normalised metrics replace with the two-pass scheme above.
---
## DataStore derivation
Because the `MphfLayer` is independent of its data stores, new stores can be derived from existing ones without rebuilding the MPHF:
```
// count → presence/absence, parallel across (partition, layer)
for (p, l) in all_partition_layer_pairs().par_iter():
count_store = open PersistentCompactIntMatrix at (p, l)
presence_store = PersistentBitMatrix::from_count_matrix(count_store, threshold, dir)
```
Other derivations: threshold a count matrix → binary presence matrix; union two presence matrices; merge two count matrices (saturating add, column-wise). All are local to one `(partition, layer)` pair.
---
## Relationship to current implementation
### What is implemented
- **`obicompactvec::traits`**: `ColumnWeights`, `CountPartials`, `BitPartials` are defined and implemented on `PersistentCompactIntMatrix` and `PersistentBitMatrix`.
- **`obilayeredmap::LayeredStore<S>`**: generic wrapper with blanket impls for all three traits. `LayeredStore<LayeredStore<S>>` is the partitioned level — no separate type needed. Tests confirm that splitting data across layers and across partitions gives the same distance matrices as computing on flat combined data.
### What is not yet implemented
- `Layer<D: LayerData>` still fuses `MphfLayer` and one `DataStore`. Multiple data stores on the same MPHF are not supported.
- `LayeredMap` is a single-partition structure without distance matrix API; it does not yet use `LayeredStore`.
- No `PartitionedIndex` type for point queries with parallel partition dispatch.
### Planned refactoring
1. Extract `MphfLayer` from `Layer<D>` as an autonomous type.
2. Replace `LayerData` trait with the `DataStore` / `ColumnWeights` / `CountPartials` / `BitPartials` system.
3. Rewire `LayeredMap` to hold `LayeredStore<PersistentCompactIntMatrix>` (or bit variant) alongside the MPHF layers.
4. Implement `PartitionedIndex` using `LayeredStore<LayeredStore<S>>` for data and parallel dispatch for queries.
---
## Multi-genome column invariant
### The invariant
After any merge operation, **every layer in every partition has exactly `n_genomes` columns**, where `n_genomes` is the current total genome count recorded in `index.meta`. This applies to both `PersistentCompactIntMatrix` (Count mode) and `PersistentBitMatrix` (Presence mode).
### How it is maintained
The invariant is established and preserved by three coordinated operations:
**1. Existing layers — column append.**
When merging source genome G into an existing index with `n_existing_genomes` genomes, one column is appended to every existing layer via `append_genome_column`. Slots that contain a kmer present in source G receive its count or `true`; all other slots receive 0 or `false`. After this step, every pre-existing layer has `n_existing_genomes + 1` columns.
**2. New layers — absent columns prepended.**
If source G introduces kmers not found in any existing layer, a new layer is created for those kmers. Before appending source G's own column, `n_existing_genomes` absent columns (all-zero or all-false) are prepended — one per genome already in the index. This ensures the new layer starts at the same column count as every other layer in the partition immediately after creation.
**3. First merge, Presence mode — `init_presence_matrix`.**
The initial single-genome index has no `presence/` directory (presence is implicit: every kmer in the index is present in genome 0). On the first merge, before appending any column for source 1, `Layer<()>::init_presence_matrix` creates `presence/col_000000.pbiv` set entirely to `true` for each existing layer. This retroactively materialises genome 0's presence column, bringing the column count from 0 to 1 so that the subsequent append for source 1 raises it to 2.
### Why the invariant is required
The `LayeredStore` aggregation traits (`col_weights`, `partial_bray`, `partial_jaccard`, etc.) sum contributions across all `(partition, layer)` pairs without any shape check. If one layer had fewer columns than others, its contribution would silently produce a malformed result — wrong column sums, wrong distance matrices, and incorrect genome-level statistics.
The invariant is the precondition that makes the progressive aggregation principle correct: each level can blindly sum matrices from the level below because all matrices have the same shape.
@@ -0,0 +1,22 @@
<!-- coverage sidecar — ne pas ajouter au nav mkdocs -->
# Coverage: architecture/index_architecture.md
## Code couvert
- `obilayeredmap/src/layer.rs` — Layer<D>, trait LayerData, modes () / PersistentCompactIntMatrix / PersistentBitMatrix
- `obilayeredmap/src/mphf_layer.rs` — MphfLayer, EvidenceKind (Exact / Approx), LayerEvidence enum
- `obilayeredmap/src/map.rs` — LayeredMap<D>
- `obilayeredmap/src/meta.rs` — LayerMeta, PartitionMeta
- `obikindex/src/meta.rs` — IndexConfig (kmer_size, n_bits, with_counts, evidence, block_bits), IndexMeta
- `obikindex/src/index.rs` — KmerIndex, build_layers
- `obicompactvec/src/` — PersistentCompactIntMatrix, PersistentBitMatrix (DataStore implementations)
## Notes
FORT RISQUE DE DÉRIVE. Nombreux changements récents :
- Ajout de `EvidenceKind` (Exact / Approx { b, z }) dans `IndexConfig` et `LayerMeta`
- Ajout de `block_bits` dans `IndexConfig`
- `LayerEvidence` enum dans `mphf_layer.rs` remplace l'ancienne approche monolithique
- Distinction `open()` vs `open_sequential()` dans `UnitigFileReader`
- Commandes `reindex` et `estimate` ajoutées
Vérifier que la hiérarchie à 3 niveaux décrite est toujours exacte et que les nouveaux paramètres sont documentés.
+323
View File
@@ -0,0 +1,323 @@
# NUMA-aware partition runner
## Problem
All partition-level parallel loops in obikindex currently fall into two
categories:
**Naive Rayon** — used in `build_layers`, `pack_matrices`, `dump`, `select`,
`stats`, `rebuild`, `reindex`:
```rust
(0..n).into_par_iter().for_each(|i| work(i));
```
Threads come from the global Rayon pool with no NUMA awareness. On
multi-socket machines this produces cross-socket memory traffic and degrades
performance super-linearly (see [NUMA-aware worker pools](numa_worker_pools.md)).
**Ad-hoc adaptive pool** — used in `merge`:
A bespoke implementation with pre-spawned workers, channel-based dispatch, and
activation control. It handles NUMA correctly but is not reusable.
Both cases should be replaced by a single generic mechanism.
## Unified model
The key insight is that **UMA is just the NUMA case with a single node**. The
runner always works the same way: one controller thread per node, each
independently managing its own workers with the same adaptive logic. The only
difference between UMA and NUMA is the number of nodes and whether workers are
pinned.
```
NUMA (k nodes) UMA (1 node)
controller-0 controller-1 … controller-0
│ │ │
workers[0] workers[1] workers[0]
(pinned) (pinned) (global pool)
└───────────────┴──────────────────┘
shared work queue
```
On each node, the Rayon `ThreadPool` is pinned to that node's CPUs.
`pool.install()` ensures all internal Rayon calls (inside the work function)
use the node-local pool. Linux first-touch then places heap allocations in
local DRAM automatically.
On UMA the global Rayon pool is used directly — no pinning, no overhead.
## Adaptive mechanism
Each controller follows the same logic regardless of node count:
1. Pre-spawn `workers_per_node` dormant worker threads (blocked on `activate_rx`).
2. Activate the first worker immediately.
3. Loop on result channel with a `SPAWN_POLL` timeout:
- On result: call `on_done`; check whether to activate the next worker.
- On timeout: same check.
- Activation criterion: `should_spawn_worker(active, global_efficiency, prev_efficiency)`.
4. Drop `activate_tx` when done — dormant workers exit cleanly.
**Global CPU efficiency** (`CpuSample`, reads `/proc/stat` on Linux) is used by
all controllers — no per-node measurement needed. The signal is coarser than
per-node efficiency but correct in practice: if any node saturates memory
bandwidth, the global efficiency drops and all controllers stop activating
workers. Using a standard portable primitive avoids platform-specific CPU
accounting and keeps the implementation clean.
## Proposed API
```rust
pub struct PartitionRunner {
// One entry per NUMA node; one entry total on UMA.
nodes: Vec<NodeConfig>,
}
struct NodeConfig {
pool: Option<Arc<rayon::ThreadPool>>, // None = global Rayon pool (UMA)
cpu_ids: Vec<usize>, // empty = no pinning (UMA)
max_workers: usize,
}
impl PartitionRunner {
/// Detect topology and build the runner.
/// Returns a single-node runner on UMA / macOS / hwloc failure.
pub fn new() -> Self;
/// Run `f(i)` for every index in `order`, collecting results.
///
/// `on_done(i, result, elapsed)` is called under an internal mutex as
/// each partition completes — use it for progress bars and aggregation.
/// The runner serialises all calls to `on_done` via an internal
/// `Arc<Mutex<C>>`, so no `Sync` bound is required on the callback.
/// `Send` is required because the Arc clone crosses thread boundaries.
///
/// Serialisation is free in practice: a partition takes seconds to
/// minutes; the callback takes microseconds. Contention is negligible.
///
/// Returns the first error from `f`, if any.
pub fn run<F, R, E, C>(
&self,
order: &[usize],
f: F,
on_done: C,
) -> Result<(), E>
where
F: Fn(usize) -> Result<R, E> + Send + Sync,
R: Send,
E: Send,
C: FnMut(usize, R, Duration) + Send; // Send required, Sync is not
}
```
`order` is caller-supplied so each command chooses its scheduling strategy:
largest-first for `merge`, sequential for `build_layers`, etc.
## Migration examples
### merge.rs (before: ~180 lines of bespoke machinery)
```rust
let runner = PartitionRunner::new();
runner.run(
&order,
|i| dst_partition.merge_partition(i, srcs, mode, n_dst_genomes, block_bits, evidence)
.map_err(OKIError::Partition),
|i, g_len, dur| {
pb.inc(1);
debug!("partition {i}: done in {:.1}s — {g_len} new kmers", dur.as_secs_f64());
part_stats.push(PartStat { id: i, unitig_bytes: partition_sizes[i], g_len });
},
)?;
```
### index.rs build_layers (before: naive into_par_iter)
```rust
let order: Vec<usize> = (0..n).collect();
let runner = PartitionRunner::new();
runner.run(
&order,
|i| self.partition.build_index_layer(i, min_ab, max_ab, with_counts, &evidence, block_bits)
.map_err(OKIError::Partition),
|_, n_kmers, _| {
total_kmers.fetch_add(n_kmers, Ordering::Relaxed);
pb.inc(1);
},
)?;
```
All other sites (`pack_matrices`, `dump`, `select`, etc.) follow the same
pattern.
## Placement
`PartitionRunner` lives in `obikindex/src/numa.rs` alongside `NumaSetup`.
It depends only on standard library primitives and Rayon — no new dependencies.
A single `PartitionRunner` instance can be built once per command invocation
and reused across multiple `run()` calls (e.g. `merge` runs
`merge_partitions` then `pack_matrices`).
## Known issue: CPU-only activation signal stalls on I/O-bound stages
Observed on a real `filter` run (109 genomes, 256 partitions, 8×24-core NUMA):
`rebuild` (CPU-bound — k-mer construction) scales cleanly from 9 to 43 active
workers as `CpuSample::do_i_activate` (`obisys::lib.rs`) sees efficiency climb.
`pack_matrices` (I/O-bound — reopens and recomposes per-genome column files
into `.pbmx`/`.pcmx`) activates one extra worker then flatlines at 10/192 for
the rest of the stage, even though 256 partitions keep completing over several
minutes. This matches the documented intent (§ Adaptive mechanism — "avoids
over-provisioning ... I/O-bound ... workloads") but conflates two different
things: *"CPU is not the bottleneck"* and *"more workers would not help"*. On
storage with real queue depth (NVMe, RAID, parallel FS) the second stage could
still benefit from more concurrent workers even with flat CPU usage — a signal
the current mechanism cannot see.
A one-off artefact was also found in the same log: right after a stage
transition, `do_i_activate` produced a physically impossible spike (efficiency
~94 cores on a 192-core box) because it has no minimum-window guard — unlike
its sibling `cpu_efficiency`, which returns `0.0` if `wall < 0.1s`
(`obisys::lib.rs:260`). `do_i_activate` unconditionally overwrites
`self.wall`/`self.user_secs`/`self.sys_secs` even when the elapsed window is
too short to be meaningful, so a burst of rapid completions right after
activating a worker can divide a real CPU delta by a near-zero wall delta.
### Implemented: I/O signal + shared debounce guard
`IoSample` (`obisys::lib.rs`, alongside `CpuSample`) is fed by
`read_bytes`/`write_bytes` from `/proc/self/io` on Linux (actual bytes
submitted to the block layer — not `rchar`/`wchar`, which also count
page-cache hits, and not `ru_inblock`/`ru_oublock`, unreliable on macOS), with
a `proc_pid_rusage(RUSAGE_INFO_V4)` fallback on macOS
(`ri_diskio_bytesread`/`ri_diskio_byteswritten`, FFI only via `libc`, no new
dependency — same pattern as the existing `getrusage` bindings). Any other
target degrades gracefully to a signal that never triggers (falls back to
CPU-only activation), same pattern as `cgroup_v2_available`.
`maybe_activate` (`numa.rs`) activates a worker if *either* signal still shows
headroom, making `PartitionRunner` adapt to whichever resource is actually the
bottleneck without per-call configuration. Both samplers are called
unconditionally — no `||` short-circuit — so neither window starves behind
whichever signal fires first:
```rust
let cpu_threshold = CPU_SPAWN_THRESHOLD * activation.last_step() as f64;
let cpu_wants_more = cpu_sample.do_i_activate(cpu_threshold);
let io_wants_more = io_sample.do_i_activate(IO_SPAWN_THRESHOLD);
if cpu_wants_more || io_wants_more {
activation.grow(GROWTH_DIVISOR, n_total);
}
```
The CPU threshold is *not* the flat absolute delta it started as: it scales
with `activation.last_step()` — the number of workers activated in the last
growth step, tracked by `NodeActivation` (`numa.rs`) and updated every time
`grow()` actually grows something. Growing by 8 workers should add ~8 cores of
efficiency if the workload is truly CPU-bound; requiring only
`CPU_SPAWN_THRESHOLD` (20 %) of that expected gain confirms the growth was
useful without demanding perfect linear scaling. Scaling by the *last step's
size* rather than the cumulative total keeps the bar equally meaningful
whether it's the 2nd growth step or the 20th — a flat absolute threshold
(0.2 core) is a strong signal at 8 active workers but pure noise at 150; a
threshold scaled by the *cumulative* total instead (considered and rejected)
would have made the bar essentially impossible to clear late in the ramp,
strangling exactly the CPU-bound saturation the mechanism exists to allow.
Unlike the CPU signal (an absolute delta in cores — a bounded, portable unit),
raw I/O throughput has no natural scale across devices, so `IoSample` uses a
**relative** growth threshold instead of an absolute one:
```rust
pub fn do_i_activate(&mut self, threshold: f64) -> bool {
let elapsed = self.wall.elapsed().as_secs_f64();
if elapsed < 0.1 { return false; } // state untouched — window keeps accumulating
let n = Self::read_bytes();
let rate = n.saturating_sub(self.bytes) as f64 / elapsed;
let activate = if self.previous_rate == 0.0 {
rate > 0.0 // bootstrap: any measured throughput is signal
} else {
(rate - self.previous_rate) / self.previous_rate >= threshold
};
self.bytes = n;
self.wall = Instant::now(); // reset only on a real sample
activate
}
```
The `elapsed < 0.1s → return false without mutating state` guard was also
back-ported into `CpuSample::do_i_activate` (previously missing — source of
the ~94-core artefact above) — one fix for both problems, and it removes the
need for any arbitrary I/O-rate floor: a short/noisy window is rejected
outright rather than papered over with a hardware-dependent constant.
Both spawn thresholds (`CPU_SPAWN_THRESHOLD`, `IO_SPAWN_THRESHOLD`, module-level
`const` in `numa.rs`, both `0.2`) are a starting point, not a derived value:
`0.2` (20 % relative growth) for `IoSample` was chosen to match the CPU
threshold's *implicit* relative sensitivity (in the observed log, an 8→9
worker step raised efficiency by ~12 %) — but I/O throughput is lumpier than
CPU time (buffered writes flush in bursts), so it needs empirical validation
against a real `pack` run before being considered final.
## Known issue: ramp-up too slow, and confused with node count
The original design started `n_nodes` workers (one per node) and grew one
worker at a time. On a real `filter` run this took ~10 minutes to climb from
9 to ~40 active workers even on the CPU-bound `rebuild` stage — most of a
35-minute stage spent under-provisioned while waiting for evidence to
accumulate one worker at a time. There is no scale-down mechanism (`n_active`
only grows), so the original caution was deliberate — but a quarter of
available cores is still far from saturation, and the real risk zone (over-provisioning
a memory-bandwidth-bound stage) only shows up much later in the ramp, near
full occupancy — not at 25 %.
The fix decouples ramp speed from node *count*: both the initial size and the
growth step are a fraction of `workers_per_node` (node *size*), applied
identically on every node. A single-NUMA-node (UMA) machine ramps exactly as
fast as an 8-node one — growing by `n_nodes` per step, as first considered,
would have degenerated to "grow by 1" on UMA, reproducing the original
problem for exactly the machines that need the fix most.
```rust
// NodeActivation::grow — called both at startup (activate_initial) and on
// every CPU/IO-triggered growth step, with a different divisor each time.
let wanted = (self.caps[idx] / divisor).max(1); // INITIAL_DIVISOR=4 at startup, GROWTH_DIVISOR=8 per step
let room = self.caps[idx].saturating_sub(self.active[idx]);
let grow = wanted.min(room).min(n_total.saturating_sub(self.total));
```
This also fixed a latent correctness gap: the original single shared
`activate_tx`/`activate_rx` pair had *no* per-node addressing — sending one
activation signal woke up whichever dormant worker (from any node) happened
to win the race on that channel. `crossbeam_channel` gives no fairness
guarantee across competing receivers, so "round-robin across nodes" was an
assumption the code never actually enforced. `PartitionRunner::run` now opens
one activation channel per node (`activate_txs`/`activate_rxs`, one pair per
`NodeConfig`); `NodeActivation` (`numa.rs`) tracks how many of each node's
dormant workers have been woken and grows every node by the same amount per
step, capped by that node's remaining dormant workers and by the run's total
budget (`n_total`) — balance across nodes is now guaranteed by construction,
not incidental to channel implementation details.
## Open questions
- **Error handling**: `run` currently returns the first error; remaining errors
are dropped. A `Vec<E>` return would give complete diagnostics.
- **`INITIAL_DIVISOR` / `GROWTH_DIVISOR` tuning**: currently `4` and `8`
(start at 1/4 of a node's cores, grow by 1/8 per step), chosen to fix an
observed too-slow ramp — not yet validated against a real `pack` (I/O-bound)
run, where over-provisioning risk is different from the CPU-bound `rebuild`
case this was tuned against.
- **`on_done` ordering**: the runner serialises calls to `on_done` via an
internal `Arc<Mutex<C>>`. `Send` is required (the Arc clone crosses thread
boundaries); `Sync` is not (only one thread holds the lock at a time).
Contention is negligible because a partition takes seconds while the callback
takes microseconds. The callback is therefore simple to write (plain
`Vec::push`, plain `FnMut`) with no measurable performance cost.
+97
View File
@@ -0,0 +1,97 @@
# NUMA-aware worker pools for merge
## Problem
The merge command's bottleneck is `compute_degrees` in `obidebruinj`: a random pointer-chase over 2070 M node hash maps that saturates DRAM bandwidth. When multiple partition workers run concurrently, they contend for the shared memory bus, causing super-linear slowdown (measured: 0.016 µs/node solo → 0.95 µs/node with 45 concurrent workers, ×60 degradation).
Modern HPC nodes are multi-socket NUMA machines (observed: 2 sockets × 4 NUMA nodes × 24 cores = 192 cores). Cross-NUMA memory traffic compounds the contention:
- Full 192-core run: ~15 min/partition (×10 worse than M3 Mac)
- `taskset` restricted to 4 NUMA nodes (96 cores): ~90 s/partition
- OAR job on 1 NUMA node (24 cores): ~80 s/partition, same throughput as 96 cores
**Conclusion**: the bottleneck is memory bandwidth per NUMA node, not core count. 24 cores on one NUMA node achieve the same throughput as 96 cores across four.
## Strategy
Run N worker groups in parallel, one per NUMA node, each with its own Rayon thread pool whose threads are pinned to the NUMA node's CPUs. Linux's first-touch policy then places graph allocations on local DRAM automatically — no explicit NUMA allocator needed.
Expected throughput: N × single-NUMA throughput. On the 8-NUMA-node HPC: 8 × ~80 s = 910 min total instead of >60 min with the current single-pool approach.
## Rayon thread pool isolation
Rayon provides `ThreadPool::install(|| { ... })`: any Rayon call (`par_iter`, `current_num_threads`, etc.) inside the closure uses *that* pool exclusively. Wrapping `merge_partition` in `pool.install()` redirects all downstream Rayon calls — including those in `debruijn.rs` and `partition.rs` — without touching those crates.
```rust
// worker thread, assigned to NUMA pool `pool`
pool.install(|| {
dst_partition.merge_partition(i, srcs, mode, n_dst_genomes, block_bits, evidence)
})
```
`rayon::current_num_threads()` inside `merge_partition` will return the pool size (e.g. 24), not the global thread count — which is the right value for buffer sizing.
## Thread pinning
`ThreadPoolBuilder::spawn_handler` provides a hook executed for each thread at creation. Inside, `libc::sched_setaffinity` pins the thread to a CPU set:
```rust
let cpus: Vec<usize> = numa_node_cpus(node); // from /sys/devices/system/node/nodeN/cpulist
rayon::ThreadPoolBuilder::new()
.num_threads(cpus.len())
.spawn_handler(move |thread| {
let mut b = std::thread::Builder::new();
std::thread::Builder::new().spawn(move || {
pin_to_cpus(&cpus); // sched_setaffinity via libc
thread.run()
})?;
Ok(())
})
.build()?
```
NUMA topology is read from `/sys/devices/system/node/node*/cpulist` — no `libnuma` dependency required. If the `numa` crate is linked, `numa_available()` / `numa_run_on_node()` are an alternative.
## Memory locality
Linux allocates pages on the NUMA node of the thread that first writes them (first-touch policy). Once Rayon threads are pinned to node N, all graph data built by those threads lands on node N's DRAM. No changes to the allocator, no explicit `numa_alloc_onnode` calls.
## Adaptive spawn criterion
The current criterion uses `std::thread::available_parallelism()` (returns total cores = 192) and `max_workers = n_cores / 2`. With NUMA pools:
- `n_cores` per pool = cores per NUMA node (e.g. 24)
- `max_workers` per pool = pool size / 2 (e.g. 12)
- CPU efficiency is measured per pool, not globally
Each NUMA group runs its own independent adaptive pool. Workers are distributed across NUMA groups round-robin or by workload (partition assignment can be pre-split by NUMA group index).
## Required changes
| File | Change |
|------|--------|
| `obikindex/src/merge.rs` | Detect NUMA topology; build N `ThreadPool`s with pinned threads; assign each pre-spawned worker to a pool; wrap `merge_partition` in `pool.install()` |
| `obikindex/src/merge.rs` | Replace `available_parallelism()` with per-NUMA core count for spawn criterion |
| `obikpartitionner/src/merge_layer.rs` | No change — `merge_partition` already works inside any Rayon context |
| `obidebruinj/src/debruijn.rs` | No change — `par_iter` and `current_num_threads` are pool-context-aware |
| `obikpartitionner/src/partition.rs` | No change — same reason |
## Platform guard
NUMA pinning is Linux-only. The fallback is the current single global pool:
```rust
#[cfg(target_os = "linux")]
fn build_numa_pools() -> Option<Vec<rayon::ThreadPool>> { ... }
#[cfg(not(target_os = "linux"))]
fn build_numa_pools() -> Option<Vec<rayon::ThreadPool>> { None }
```
When `build_numa_pools()` returns `None` (macOS, UMA, or single-socket), `merge.rs` uses the existing code path unchanged.
## Open questions
- **Partition assignment**: split partitions by NUMA group up-front (static) or use a shared queue with per-group workers stealing from a common pool? Static split is simpler; stealing is better for load balance when partitions vary widely in size.
- **Intra-NUMA adaptive criterion**: with 24 cores and ~35 effective workers per NUMA node, the current marginal-gain criterion needs re-tuning or can be left as-is with per-pool `n_cores = 24`.
- **I/O**: partition data (unitig files) is on a shared filesystem. With 8 concurrent NUMA groups, I/O concurrency increases 8× — need to verify the filesystem (Lustre or local SSD) can absorb it without becoming the new bottleneck.
+127 -49
View File
@@ -8,7 +8,7 @@ Given a set of query sequences, determine for each sequence how many of its k-me
## Input ## Input
- Query sequences in FASTA or FASTQ format (gzip supported, streaming stdin supported). - Query sequences in FASTA or FASTQ format (gzip supported, streaming stdin supported). GenBank flat files are not supported at query time (only at index time).
- Sequences shorter than k bases are silently skipped. - Sequences shorter than k bases are silently skipped.
- Non-ACGT characters are handled by the superkmer decomposition layer: they act as hard breaks, producing shorter superkmers (identical to the behaviour at indexing time). - Non-ACGT characters are handled by the superkmer decomposition layer: they act as hard breaks, producing shorter superkmers (identical to the behaviour at indexing time).
@@ -19,34 +19,111 @@ Given a set of query sequences, determine for each sequence how many of its k-me
The query follows the same superkmer-based partitioning strategy used at indexing time. The query follows the same superkmer-based partitioning strategy used at indexing time.
``` ```
for each query sequence: for each chunk of sequences (parallel workers via obipipeline):
decompose into superkmers (non-ACGT breaks, same minimiser scheme as indexing) build QueryBatch: decompose all sequences into s-mers via superkmers, deduplicate
for each superkmer: allocate seq_results[seq_idx][smer_pos] = None ← per-sequence s-mer result vectors
route to partition p via minimiser hash split superkmers by partition via minimiser hash
for each kmer in the superkmer: for each partition p:
lookup kmer in partition p (MPHF → evidence check → matrix row) query_partition(p, superkmers_routed_to_p)
accumulate result into per-sequence accumulators → load QueryLayer(s) for p
emit annotated sequence → for each s-mer in each superkmer: MphfLayer::find(smer)
fill seq_results[seq_idx][kmer_offset + j] from partition results
for each sequence:
apply_findere(seq_results[seq_idx], effective_z) ← per full sequence
accumulate confirmed k-mer results into acc and cov
emit annotated sequences
``` ```
Parallelism is **per sequence**: each worker thread handles all partitions of one sequence independently. This avoids cross-thread coordination when merging partial results and keeps memory usage proportional to the number of concurrent sequences rather than to the number of partitions. Superkmers that appear more than once in the batch (same sequence or across sequences) are deduplicated: each unique `RoutableSuperKmer` is queried once per partition, and the result is broadcast to every `SKDesc` entry that references it.
**Findere requires full-sequence aggregation.** `apply_findere` is applied once per sequence on the complete s-mer result vector, after all partitions have contributed. Applying it per superkmer would produce false negatives at superkmer boundaries, where the z-window spans two superkmers.
Batches are processed in parallel via `obipipeline` workers; the `--threads` flag controls the number of worker threads.
--- ---
## Exact vs. approximate matching ## Findere z-window filter
### Exact (default) For approximate index modes, the index physically stores s-mers of size `s = k_user z + 1`. At query time, `set_k(s)` is in effect, so queries naturally produce s-mer results. `apply_findere` then aggregates z consecutive s-mer results into one k_user-mer answer:
Standard MPHF lookup followed by evidence check. O(1) per k-mer. ```rust
fn apply_findere(
results: &[Option<Box<[u32]>>], // N s-mer results
z: usize,
n_genomes: usize,
) -> Vec<Option<Box<[u32]>>> // N z + 1 k_user-mer results
```
### 1-mismatch (`--mismatch` flag) Input length N (s-mers), output length N z + 1 (k_user-mers).
For each k-mer of the query, generate all `3·k` single-substitution variants. Each variant is canonicalised and looked up independently in the index. If one or more variants are found, their per-genome rows are **summed** into the result for that k-mer position. For each genome g independently, a sliding window of size z scans the input. Output position i is confirmed for genome g iff all z values `results[i..i+z][g]` are nonzero (`None` counts as zero for all genomes). The scan is O(n) per genome.
- If a k-mer matches exactly AND one of its variants also matches (distinct k-mers in the index), both contributions are accumulated. Output values come from `results[i]` (leftmost s-mer of each window); genomes not confirmed are zeroed. If all genomes are zero, the position is returned as `None`.
- Exact and approximate matches are tracked separately in the output (see annotation schema below).
- The superkmer routing optimisation is **not** used in 1-mismatch mode: each variant is looked up directly via its own minimiser. **Short sequences**: when the s-mer count is less than z, no complete window can form — `apply_findere` returns an empty vector. K-mers from sequences shorter than k_user are not emitted.
- Cost: up to `3·k` MPHF probes per k-mer position vs. 1 in exact mode.
**Exact indexes**: `z = 1`, `apply_findere` is a passthrough (output length = input length).
### Effective z at query time
`effective_z` is resolved at the start of `run()`:
```rust
let effective_z = args.findere_z.unwrap_or_else(|| match idx.meta().config.evidence {
IndexMode::Approx { z, .. } | IndexMode::Hybrid { z, .. } => z as usize,
IndexMode::Exact => 1,
});
```
The `-z` CLI option overrides the index metadata value. A higher z increases stringency (lower FP, some true positives may be discarded at sequence ends); a lower z increases sensitivity.
---
## Layer lookup: `MphfLayer::find`
`MphfLayer::open(dir, mode: &IndexMode)` receives the mode from `PartitionMeta` — no per-layer file is read. The caller (`QueryLayer`) never chooses the dispatch path: it is fixed at open time by `LayerEvidence`. See [obilayeredmap](../implementation/obilayeredmap.md) for the full `find` / `find_strict` API.
### `QueryLayer` variant selection
`QueryLayer::open` in `query_layer.rs` selects the data matrix to pair with `MphfLayer`:
| Condition | Variant | Data returned per k-mer |
|---|---|---|
| `with_counts=true` and `counts/` exists | `Count` | raw count per genome |
| `presence/` exists | `Presence` | 0/1 per genome (bit matrix) |
| only `counts/` exists | `Count` | counts used as-is |
| neither exists | `SetOnly` | 1 for every genome |
---
## Presence / count mode at query time
The `--force-presence` flag and `--presence-threshold` control how per-genome values are accumulated, independently of what the index stores:
```
genome_totals[g] += if presence { u32::from(v >= threshold) } else { v }
```
`presence` is true when `--force-presence` is set or when the index has no counts (`!with_counts`). The default `presence_threshold` is 1, so any nonzero count counts as a match.
---
## Coverage vectors (`--detail`)
When `--detail` is requested, a 3-D accumulator `cov[seq_idx][genome][kmer_pos]` is allocated after all partitions are queried, with dimensions derived from `n_kmers_out = n_smers z + 1` (k_user-mer positions, not s-mer positions):
```
cov[seq_idx][g][pos] += contribution
where pos is the k_user-mer index in the filtered (post-Findere) vector
```
Coverage reflects confirmed k_user-mers only. The vectors are emitted in the JSON annotation under the key `"coverage"`.
---
## `kmer_missing` semantics
`kmer_missing` counts k_user-mer positions where the first s-mer (`seq_results[seq_idx][pos]`) is `None` — i.e. absent from the index entirely. K-mers where the z-window fails because a later s-mer is absent or zero are not counted as missing (the first s-mer being present is used as proxy for index membership).
--- ---
@@ -55,57 +132,58 @@ For each k-mer of the query, generate all `3·k` single-substitution variants. E
Output sequences are written in **OBITools4 format**: the original sequence with a JSON annotation map in the title line. Output sequences are written in **OBITools4 format**: the original sequence with a JSON annotation map in the title line.
``` ```
>read_id {"kmer_total":150,"kmer_found":59,...} >read_id {"kmer_count":59,"kmer_strict_matches":{"genome_a":42,"genome_b":7}}
ATCGATCG... ATCGATCG...
``` ```
Genome order in all list-valued annotations follows the genome order recorded in `index.meta`. With `--detail`:
```
>read_id {"kmer_count":59,"kmer_strict_matches":{...},"coverage":{"genome_a":[0,1,2,...],...}}
ATCGATCG...
```
Genome keys follow the iteration order of `meta.genomes`.
--- ---
## Annotation schema ## Annotation schema
### Summary mode (default)
| Key | Type | Condition | Semantics | | Key | Type | Condition | Semantics |
|---|---|---|---| |---|---|---|---|
| `kmer_total` | int | always | total k-mers in the (masked) sequence | | `kmer_count` | int | always | k-mers confirmed (post-Findere) with at least one genome match |
| `kmer_found` | int | always | k-mers with at least one match (exact or approx) | | `kmer_missing` | int | `--count-missing` | k-mers absent from the index entirely (pre-Findere None) |
| `kmer_missing` | int | `--count-missing` | k-mers absent from the index | | `kmer_strict_matches` | object | always | per-genome accumulated value (label → count or 0/1) |
| `kmer_match` | list[int] | always | per-genome matched k-mer count (exact + approx) | | `coverage` | object | `--detail` | per-genome array of per-position contributions (label → [u32]) |
| `kmer_match_exact` | list[int] | `--mismatch` | per-genome exact match count |
| `kmer_match_approx` | list[int] | `--mismatch` | per-genome approx match count |
| `count_match` | list[int] | count index | per-genome sum of index counts for matched k-mers |
`kmer_match[i]` is the number of k-mer positions in the query that contribute at least one match to genome i. In 1-mismatch mode, a single k-mer position can contribute to multiple genomes if several of its variants are present in the index. `kmer_count + kmer_missing` ≤ total k_user-mers in the sequence. The gap corresponds to k_user-mers whose z-window was not fully confirmed (at least one s-mer absent or zero for all genomes) but whose first s-mer was present in the index.
`count_match[i]` sums raw index counts across all matched k-mer positions for genome i. Only meaningful for count indexes.
### Detail mode (`--detail`)
All summary keys, plus per-position coverage vectors — one list per genome, length `len(sequence) k + 1`:
| Key | Type | Condition | Semantics |
|---|---|---|---|
| `cov_<i>` | list[int] | `--detail` | coverage at each k-mer position for genome i; raw count (count index) or 0/1 (presence index); 0 if absent |
| `cov_exact_<i>` | list[int] | `--detail` + `--mismatch` | exact-match contribution per position |
| `cov_approx_<i>` | list[int] | `--detail` + `--mismatch` | approx-match contribution per position |
Genome indices in key names are 0-based integers matching the `index.meta` genome order. Genome labels are not used as key names to avoid issues with special characters in long or complex genome identifiers.
--- ---
## CLI ## CLI
``` ```
obikmer query -i <index> [--summary | --detail] [--mismatch] [--count-missing] <query.fa> obikmer query <index> [--detail] [--mismatch] [--count-missing]
[--force-presence] [--presence-threshold <n>]
[-z <z>] [-T <threads>]
<query.fa> [<query2.fa> ...]
``` ```
`--summary` is the default; `--detail` implies `--summary` (all summary keys are always present). | Option | Default | Semantics |
|---|---|---|
| `-z` / `--findere-z` | from index metadata | Override Findere z parameter |
| `--detail` | off | Emit per-position coverage vectors in JSON |
| `--count-missing` | off | Add `kmer_missing` field to JSON |
| `--force-presence` | off | Report 0/1 per genome regardless of index counts |
| `--presence-threshold` | 1 | Minimum count to declare genome present |
| `-T` / `--threads` | all CPUs | Worker threads |
`--mismatch` is accepted but currently ignored with a warning on stderr.
--- ---
## Future work ## Future work
- **Read classification** (`--classify`): assign each read to the genome with the highest `kmer_match` score; emit as a single annotation key. - **`--mismatch`**: 1-mismatch approximate matching — generate `3·k` single-substitution variants per k-mer, look each up independently.
- **Whitelist / blacklist filtering**: accept or reject sequences based on whether their k-mer match score for a designated set of genomes exceeds a threshold. - **Read classification** (`--classify`): assign each read to the genome with the highest match score.
- **Whitelist / blacklist filtering**: threshold-based accept/reject on per-genome match scores.
+16
View File
@@ -0,0 +1,16 @@
<!-- coverage sidecar — ne pas ajouter au nav mkdocs -->
# Coverage: architecture/query.md
## Code couvert
- `obikmer/src/cmd/query.rs` — commande query, format de sortie
- `obikpartitionner/src/query_layer.rs` — routage de la requête à travers les partitions
- `obiread/src/lib.rs` — lecture des séquences d'entrée pour la requête
## Notes
RISQUE DE DÉRIVE. Vérifier :
- La commande `unitig` a été modifiée pour utiliser `open_sequential()` — vérifier si query est concerné
- `find_exact` / `find_approx` / `find` générique ont été ajoutés dans `MphfLayer` — le chemin de requête a changé
- Si l'index est approximatif (Approx), la requête peut produire des faux positifs : la doc le mentionne-t-elle ?
- Format de sortie CSV (`obikindex/src/csv.rs` ou équivalent) à vérifier
+105
View File
@@ -0,0 +1,105 @@
# Rebuild / filter — column-first design
## Problem with the current two-pass design
`rebuild_partition` currently makes **two full passes** over source data:
**Pass 1** — read unitigs → MPHF lookup (source) → read row (108 values) → apply filter → push kmer into `GraphDeBruijn`, **discard row**.
**Pass 2** — read unitigs again → MPHF lookup again → read row again → for each passing kmer, look up slot in new MPHF → fill column builders.
Both passes do random access into the source matrix: for each kmer, the MPHF returns a slot, then we read 108 values scattered across 108 column positions. This is cache-hostile even with a packed matrix (`.pbmx`), because the matrix is column-major: consecutive row reads jump across the file.
## Memory budget
The `keep` bitvector costs **1 bit per slot**. With 256 partitions and realistic kmer counts, each partition holds at most a few tens of millions of slots → a few MB per bitvector. Even in the absolute worst case (800 M slots), it stays under 100 MB. This is negligible.
The `slot_map` option (Option B, 816 bytes per slot) is heavier but still bounded: at 15 M slots and 8 bytes, that is 120 MB per partition, acceptable for a single worker.
## Key observation
**The filter operates on column values, not on kmers.** A filter like `--max-outgroup-count 0` only needs to know, for each slot, whether any outgroup column is non-zero. It does not need to know which kmer occupies that slot.
This means filtering can be done as a **sequential column scan** that produces a `keep: BitVec[n_slots]` — no MPHF lookups, no kmer knowledge, perfectly cache-friendly.
## Proposed single-scan design
### Step 1 — column scan → `keep` bitvector
```
for each column c in source matrix:
read column c sequentially (one mmap range)
update keep[slot] according to filter contribution of column c
```
For `GroupQuorumFilter` with ingroup/outgroup:
- ingroup columns: count presence per slot → `ingroup_count[slot]`
- outgroup columns: `keep[slot] &= (value[slot] == 0)` (early-exit possible)
Result: `keep: BitVec` of size `n_slots`, computed with purely sequential IO.
### Step 2 — unitig scan → kept kmers + new MPHF
```
for each kmer in unitig files:
old_slot = old_MPHF(kmer)
if keep[old_slot]:
push kmer into new GraphDeBruijn
record (old_slot, kmer) ← or just old_slot in order
```
Build new MPHF from `GraphDeBruijn` via `materialize_layer`.
### Step 3 — fill new matrix
Two sub-options:
**Option A — from recorded (old_slot, kmer) pairs:**
```
for each (old_slot, kmer) in recorded list:
new_slot = new_MPHF(kmer)
for each column c:
new_matrix[new_slot, c] = old_matrix[old_slot, c]
```
Memory cost: `n_kept × (8 + 8)` bytes for `(old_slot: usize, kmer: CanonicalKmer)`.
For species-specific filters, `n_kept` is small. For unfiltered rebuild, `n_kept = n_slots`.
**Option B — column-by-column copy using old→new slot mapping:**
Precompute `slot_map: Vec<Option<usize>>` of size `n_slots`:
- For each kmer in unitig file: `slot_map[old_MPHF(kmer)] = Some(new_MPHF(kmer))`
Then for each source column:
```
read source column sequentially
for each slot where slot_map[slot] = Some(new_slot):
write value to new column at new_slot
```
Memory cost: `n_slots × sizeof(usize)` for the slot map (one usize per source slot).
IO pattern: sequential read of each source column → random write into new column builders.
Option B avoids storing kmer values and works uniformly regardless of filter selectivity.
## Comparison
| | Current | Proposed |
|---|---|---|
| Disk reads | 2× unitigs + 2× random matrix | 1× columns (sequential) + 1× unitigs |
| MPHF lookups (source) | 2× N_kmers | 1× N_kept (step 2) or 0 (option B, col scan only) |
| Cache behavior | poor (random row access) | good (sequential column scan) |
| Extra memory | none | slot_map (option B) or (old_slot, kmer) list (option A) |
## Files to modify
- `src/obikpartitionner/src/rebuild_layer.rs``rebuild_partition` and `iter_src_layers`
- Possibly `src/obicompactvec/` — add column iterator API if not already present
- `src/obilayeredmap/` — check if per-column sequential access is exposed on `SrcLayerData`
## Open questions
- Does `SrcLayerData` expose per-column sequential iteration, or only `lookup(kmer, n_genomes)` random access?
- For option B: are new column builders writable in random-slot order (i.e. `set_val(slot, value)` without sequential constraint)?
- For `GroupQuorumFilter` specifically: can the filter be decomposed into independent per-column contributions, or does it need the full row?
@@ -0,0 +1,12 @@
<!-- coverage sidecar — ne pas ajouter au nav mkdocs -->
# Coverage: architecture/sequences/invariant.md
## Code couvert
- `obikseq/src/sequence.rs` — invariants de représentation des séquences (ACGT, longueur max)
- `obikseq/src/unitig.rs` — type Unitig, contrainte MAX_KMERS_PER_CHUNK (255 kmers par chunk)
## Notes
Document court et stable. Vérifier que la limite de 256 nucléotides (ou 255 kmers) par chunk
est toujours la même dans `obiskio::MAX_KMERS_PER_CHUNK`.
+34 -25
View File
@@ -1,20 +1,30 @@
# Chunk reader — implementation # Chunk reader — implementation
The `obiread` crate provides a streaming iterator that reads FASTA or FASTQ files in fixed-size blocks and yields self-contained chunks, each ending on a complete sequence record boundary. Chunks are consumed in parallel by downstream workers. `obiread` exposes two distinct sequence reading paths, each optimised for a different use case.
## Output type: rope ## Two reading paths
Each chunk is a `Vec<Bytes>` — a **rope**: a list of reference-counted byte slices that are not necessarily contiguous in memory. The consumer iterates over the slices in order. | Path | API | Output unit | Per-record identity | Use case |
|------|-----|-------------|---------------------|----------|
| **Record path** | `read_sequence_chunks``parse_chunk` | `SeqRecord` (id + raw sequence + normalised rope) | yes | `query` — must read complete records |
| **Stream path** | `open_nuc_stream` | `NucPage` (flat normalised byte buffer) | no | `index`, `superkmer` — bulk throughput |
Using `bytes::Bytes` means the split at the record boundary is O(1): `Bytes::split_to(n)` adjusts a reference counter, not memory. No `memcpy` in the common case. The record path uses `Rope`-backed chunks and is described in detail below.
The stream path (`NucStream` / `NucPage`) is described in the scatter section of [pipeline](pipeline.md).
## Allocation policy ---
| Case | Cost | ## Record path: chunk reader
|------|------|
| Boundary found in the current block (common) | zero extra allocation — `split_to` only | The chunk reader reads FASTA or FASTQ files in fixed-size blocks and yields self-contained chunks, each ending on a complete sequence record boundary. `parse_chunk` then converts each chunk into a `Vec<SeqRecord>`, where each record carries its identifier, raw sequence bytes, and a normalised rope ready for superkmer building.
| Boundary straddles multiple blocks (sequence > block size, rare) | one allocation to pack the rope into a flat buffer |
| EOF flush | zero extra allocation | This path is mandatory for `query`, where superkmers must be tracked back to their originating sequence (id, kmer offset) for output annotation.
## Output type: Rope
Each chunk is a `Rope` — a segmented byte sequence: a `Vec` of blocks, where each block is a `Vec<Cell<u8>>`. The consumer iterates over the blocks via a forward or backward cursor.
`Rope::split_off(pos)` splits at an absolute byte offset in O(log n) (binary search over block-start index). If `pos` falls inside a block, that block is split in two via `Vec::split_off` — no `memcpy` in the common case.
## SeqChunkIter ## SeqChunkIter
@@ -22,7 +32,7 @@ Using `bytes::Bytes` means the split at the record boundary is O(1): `Bytes::spl
pub struct SeqChunkIter<R: Read> { /* private */ } pub struct SeqChunkIter<R: Read> { /* private */ }
impl<R: Read> Iterator for SeqChunkIter<R> { impl<R: Read> Iterator for SeqChunkIter<R> {
type Item = io::Result<Vec<Bytes>>; type Item = io::Result<Rope>;
} }
pub fn fasta_chunks<R: Read>(source: R) -> SeqChunkIter<R> pub fn fasta_chunks<R: Read>(source: R) -> SeqChunkIter<R>
@@ -32,22 +42,21 @@ pub fn fastq_chunks<R: Read>(source: R) -> SeqChunkIter<R>
`next()` loop: `next()` loop:
```text ```text
1. read one block of block_size bytes → push onto rope 1. read one block of block_size bytes → push onto Rope
2. probe check: if the boundary marker ("\n>" or "\n@") is absent from the 2. call splitter(rope) → Option<abs_offset>
last block, skip the splitter (avoids a full backward scan for nothing) if Some(pos):
3. call splitter on last block tail = rope.split_off(pos) ← O(log n), may split one block
if found at offset n: chunk = mem::replace(&mut rope, tail)
remainder = last_block.split_to(n) ← O(1), zero copy return Some(Ok(chunk))
return std::mem::take(&mut self.rope) ← the chunk 3. if EOF and rope non-empty: return Some(Ok(rope)) as final chunk
4. if rope.len() > 1 (multi-block accumulation): 4. if EOF and rope empty: return None
pack rope into one flat buffer ← one alloc
retry splitter on flat buffer
5. if EOF: flush remaining rope as final chunk
``` ```
The `Splitter` function signature is `fn(&Rope) -> Option<usize>`. It returns the absolute byte offset of the start of the last complete record, or `None` if no boundary was found in the accumulated rope (need more data).
## Boundary detection — FASTA ## Boundary detection — FASTA
Backward scan with a 2-state machine. Searches for `>` immediately preceded by `\n` or `\r`: Backward scan with a 2-state machine. Searches (right to left) for `>` followed by `\n` or `\r` (i.e., a `>` that is preceded by a newline in forward order):
```mermaid ```mermaid
stateDiagram-v2 stateDiagram-v2
@@ -58,13 +67,13 @@ stateDiagram-v2
FoundGt --> [*] : '\\n' / '\\r' ✓ FoundGt --> [*] : '\\n' / '\\r' ✓
``` ```
Returns the byte offset of the `>` that starts the last complete record. Returns the byte offset of the `>` that starts the last complete record. Returns `None` if only one `>` is found (cannot confirm there is a prior complete record).
## Boundary detection — FASTQ ## Boundary detection — FASTQ
FASTQ records have a rigid 4-line structure (`@header`, sequence, `+`, quality). The `@` character (ASCII 64, Phred score 31) can appear legitimately in quality lines, making any forward heuristic unreliable. The backward scanner verifies the full structural context before accepting a candidate `@`. FASTQ records have a rigid 4-line structure (`@header`, sequence, `+`, quality). The `@` character (ASCII 64, Phred score 31) can appear legitimately in quality lines, making any forward heuristic unreliable. The backward scanner verifies the full structural context before accepting a candidate `@`.
7-state machine (port of Go's `EndOfLastFastqEntry`), scanning from **right to left**. Each time a `+` is found, its position is saved as `restart`; any state mismatch resets the scan to that position. 7-state machine (states 06), scanning from **right to left**. Each time a `+` is found, its position is saved as `restart`; any state mismatch resets the scan to that position.
```mermaid ```mermaid
stateDiagram-v2 stateDiagram-v2
+12
View File
@@ -0,0 +1,12 @@
<!-- coverage sidecar — ne pas ajouter au nav mkdocs -->
# Coverage: implementation/chunkreader.md
## Code couvert
- `obiread/src/chunk.rs` — SeqChunkIter, détection de frontières FASTA/FASTQ, state machines
- `obikrope/src/lib.rs` — type Rope (Vec<Bytes>), opérations zero-copy
## Notes
Document stable (la stratégie de chunking rope ne devrait pas avoir changé).
Vérifier que le split FASTA/FASTQ reste correct si de nouveaux formats ont été ajoutés.
@@ -0,0 +1,181 @@
# Approximate evidence: fingerprint-based index
## Motivation
`evidence.bin` maps each MPHF slot to the position of the k-mer that owns it,
enabling zero-FP verification. On the bacterial BCT dataset (2048 partitions,
k=31, ~33 M k-mers/partition) it accounts for 66 % of the lookup-layer footprint:
| file | size/partition | fraction |
|---|---|---|
| evidence.bin | 132 MB | 66 % |
| unitigs.bin | 58 MB | 29 % |
| mphf.bin | 10 MB | 5 % |
`evidence.bin` is a bijection from MPHF-space to unitig-position-space and
costs at minimum ⌈log₂ N⌉ bits per slot — an information-theoretic floor with
only ~22 % packing headroom. Compression is not a path to elimination.
The approximate index replaces `evidence.bin` + `unitigs.bin.idx` with a
`fingerprint.bin` file. The MPHF and `unitigs.bin` are kept unchanged. Set
operations still require an exact index; the approximate index targets query
workloads that can tolerate a bounded false-positive rate.
---
## The Findere model
A B-bit fingerprint stored per MPHF slot provides the discrimination that
`evidence.bin` would otherwise provide through full k-mer reconstruction.
For a foreign k-mer query, the MPHF maps it to some slot `s`. The fingerprint
stored at `s` belongs to the legitimate k-mer at that slot. The FP event is:
```
P(FP per k-mer) = 1 / 2^b
```
The Findere trick reduces the indexed k-mer size. When the user specifies k_user
and z, the index physically stores k-mers of size `s = k_user z + 1`. At query
time, the same s-mer size is used. After collecting per-position s-mer results
over the full query sequence, a sliding window of size z aggregates z consecutive
s-mer hits into one confirmed k_user-mer hit, reducing the per-window FP rate:
```
P(FP per k_user-mer) = 1 / 2^(b·z)
```
`IndexConfig::kmer_size` stores `s = k_user z + 1`, not k_user. Both indexing
and querying use this stored size via `set_k(idx.kmer_size())`.
Parameters b and z are stored in `layer_meta.json` (`EvidenceKind::Approx { b, z }`).
---
## `FingerprintVec` on disk
`fingerprint.bin` layout:
```
magic: b"FPVF" (4 bytes)
b: u8 (bits per slot, 1..=64)
padding: [0u8; 3]
n: u64 LE (number of slots)
data: packed bits, ceil(n·b/8) bytes, Lsb0 order
```
`FingerprintVec` is memory-mapped. The match check against a query k-mer:
```rust
fn matches(&self, slot: usize, fingerprint: u64) -> bool {
self.get(slot) == (fingerprint & self.mask)
}
```
`build_approx_evidence` iterates `unitigs.bin` sequentially, writes
`kmer.seq_hash()` into the slot assigned by the MPHF, then saves `fingerprint.bin`
and `layer_meta.json`. No `.idx` file is produced; random access into
`unitigs.bin` is not needed.
At build time, `find_approx` in `MphfLayer`:
```rust
let slot = self.mphf.index(&kmer.raw());
if fingerprint.matches(slot, kmer.seq_hash()) { Some(slot) } else { None }
```
---
## `EvidenceKind` and metadata
`layer_meta.json` records which evidence bundle is present:
```rust
pub enum EvidenceKind {
Exact,
Approx { b: u8, z: u8 },
}
```
`MphfLayer::open` reads this tag and dispatches `find` to `find_exact` or
`find_approx` transparently. `find_exact` panics on an approximate layer;
`find_approx` panics on an exact layer — mode mixing is a programming error.
---
## Parameter resolution (`resolve_approx_params`)
The identity `b·z = ⌈−log₂(fp)⌉` lets any two of (b, z, fp) derive the third.
`resolve_approx_params` implements a 2-of-3 rule with conservative ceiling
rounding:
| given | derived |
|---|---|
| b, z | fp = 1/2^(b·z) |
| z, fp | b = ⌈−log₂(fp) / z⌉ |
| b, fp | z = ⌈−log₂(fp) / b⌉ |
| z only | b = 8 (default), fp derived |
| b only | z = 1 (default), fp derived |
| fp only | b = 8 (default), z derived |
| none | b = 8, z = 1, fp = 1/256 |
When all three are given, b and z are authoritative and fp is recomputed.
---
## CLI flags
Both `index` and `reindex` accept the same flags:
| flag | type | meaning |
|---|---|---|
| `--approx` | bool | enable fingerprint evidence |
| `--evidence-bits` (`b`) | u8 | fingerprint bits per slot |
| `-z` | u8 | Findere z parameter |
| `--fp` | f64 | target FP rate per z-window |
| `--block-size` | usize | unitig block size for exact `.idx`; ignored in approx mode |
`--approx` must be set explicitly; the other three flags are optional and
resolved by the 2-of-3 rule. Omitting all three produces b=8, z=1.
---
## `reindex` command
`reindex` converts an existing index between exact and approximate evidence
in-place across all partitions and layers, running partitions in parallel via
Rayon.
Conversion to approximate (`--approx`):
- Builds `fingerprint.bin` from `unitigs.bin` + `mphf.bin`.
- Removes `evidence.bin` and `unitigs.bin.idx`.
- Updates `layer_meta.json` with `EvidenceKind::Approx { b, z }`.
Conversion to exact (default, no `--approx`):
- Builds `evidence.bin` + `unitigs.bin.idx` from `unitigs.bin` + `mphf.bin`.
- Removes `fingerprint.bin`.
- Updates `layer_meta.json` with `EvidenceKind::Exact`.
The root `index.meta` is updated with the new evidence kind on success.
`mphf.bin` and `unitigs.bin` are never modified.
---
## `estimate` command
`estimate` is a dry-run that resolves and prints (b, z, fp) without touching
any index. It accepts the same `--evidence-bits`, `-z`, and `--fp` flags and
additionally accepts `-k` to display the effective indexed k-mer length:
```
k (user): 31
k (indexed, s=k-z+1): 27
z: 5
evidence bits (b): 8
FP per s-mer: 3.906e-3 (1/2^8)
FP per k-mer window: 9.537e-7 (1/2^(8·5))
```
Useful for choosing parameters before committing to an index build.
@@ -0,0 +1,22 @@
<!-- coverage sidecar — ne pas ajouter au nav mkdocs -->
# Coverage: implementation/evidence_elimination.md
## Code couvert
- `obilayeredmap/src/fingerprint.rs` — FingerprintVec, FingerprintVecWriter, stockage b bits/slot, matches()
- `obilayeredmap/src/mphf_layer.rs` — build_approx_evidence(dir, b, z), find_approx()
- `obilayeredmap/src/meta.rs` — EvidenceKind::Approx { b, z }, LayerMeta
- `obikindex/src/reindex.rs` — KmerIndex::reindex(), conversion exact↔approx en place
- `obikmer/src/cmd/reindex.rs` — CLI reindex, options --approx, -z, --evidence-bits, --fp, --block-size
- `obikmer/src/cmd/index.rs` — resolve_approx_params(), options --approx, -z, --evidence-bits, --fp
- `obikmer/src/cmd/estimate.rs` — commande estimate (dry-run des paramètres)
## Notes
Ce document était à l'origine une discussion de design (4 approches). L'implémentation
a maintenant convergé vers l'approche fingerprint (Findere-style).
FORT RISQUE DE DÉRIVE — le contenu est probablement un mélange de design et d'implémentation :
- Le modèle FP = 1/2^(b·z) et les règles de résolution (2-of-3 parmi b, z, fp) sont implémentés
- La commande `reindex` permet la conversion a posteriori exact↔approx
- La commande `estimate` fait le dry-run des paramètres
Cette page doit être réécrite pour documenter l'implémentation Findere réelle plutôt que les alternatives abandonnées.
+279
View File
@@ -0,0 +1,279 @@
# Kmer filtering and ingroup/outgroup predicates
The `filter`, `dump`, and `unitig` commands share the same filtering system,
implemented as a shared `FilterArgs` clap argument group embedded in each command
via `#[command(flatten)]`. Filters select k-mers based on per-genome quorum
counts, optionally restricted to **ingroup** and **outgroup** genome sets derived
from genome metadata. All rules described here apply identically to all three commands.
`filter` additionally accepts `--min-total-count` / `--max-total-count` filters
that operate on the sum of counts across all genomes.
## Predicate syntax
Each `--ingroup` and `--outgroup` flag takes a predicate of the form:
```
key OP value1|value2|…
```
| Operator | Meaning |
|----------|---------|
| `*` or `all` | wildcard — every genome matches unconditionally |
| `key=v1\|v2` | exact match — genome's `key` equals `v1` or `v2` |
| `key!=v` | negation — genome's `key` equals none of the values |
| `key~path` | path ancestry — genome's `key` is `path` or a descendant |
| `key!~path` | not a descendant |
Multiple values separated by `|` are always OR-ed within the predicate.
### Path matching (`~` and `!~`)
Metadata values can represent hierarchical concept paths such as
`/Eukaryota/Viridiplantae/Streptophyta/Betulaceae/Betula/nana`.
Stored taxonomy values always start with `/` (the root of the path).
Query patterns do **not** need to start with `/` — a leading `/` is an optional
start anchor, not a requirement.
| Pattern form | Semantics |
|---|---|
| `A/B` | contiguous sub-path A then B, anywhere in the value |
| `/A/B` | value starts with A then B |
| `A/B$` | value ends with A then B |
| `/A/B$` | value is exactly A then B |
| `A@x/B` | A with class `x` followed by B with any class |
- `taxon~/Betulaceae/Betula` matches any path that starts with `Betulaceae` then `Betula`.
- `taxon~Betula` matches any path containing `Betula` as a segment, anywhere.
### Missing metadata key → NA
If a genome does not carry the queried metadata key, the predicate returns **NA**.
NA propagates through the group evaluation logic (see below), and genomes that
cannot be classified are **ignored** in all quorum counts.
## Group semantics
### Multiple predicates
| Flag | Combination rule |
|------|-----------------|
| `--ingroup` (repeated) | **AND** — genome must satisfy all predicates |
| `--outgroup` (repeated) | **OR** — genome satisfies any predicate |
### Three-value logic
Each predicate returns `true`, `false`, or `NA` (absent key).
- AND: `false` absorbs everything; `NA` propagates unless already `false`.
- OR: `true` absorbs everything; `NA` propagates unless already `true`.
### Classification and priority
For each genome:
1. Evaluate `AND(ingroup predicates)``in_result`
2. Evaluate `OR(outgroup predicates)``out_result`
3. If `in_result = true`**Ingroup** (ingroup wins over outgroup)
4. Else if `out_result = true` → **Outgroup**
5. Otherwise → **Uncategorized** (ignored in all quorum counts)
### Implicit groups
| `--ingroup` | `--outgroup` | Effective behaviour |
|-------------|--------------|---------------------|
| not set | not set | all genomes form the ingroup |
| set | not set | only ingroup quorum flags apply |
| not set | set | only outgroup quorum flags apply |
| set | set | both constraints apply simultaneously |
## Quorum flags
| Flag | Applies to | Meaning |
|------|-----------|---------|
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes |
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes |
| `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes |
| `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes |
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes |
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes |
| `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes |
| `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes |
| `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`filter` only) |
| `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`filter` only) |
| `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) |
**Conditional defaults** — the defaults for `--min-frac` and `--max-outgroup-count` depend on two conditions:
whether the corresponding group was declared, **and** whether any quorum flag for that group was explicitly set.
> **Rule**: declaring a group activates the smart default **only if no quorum flag for that group is explicitly set**.
> As soon as any quorum flag for a group is present on the command line, all defaults for that group revert to no-op values.
| `--ingroup` | Any ingroup quorum flag? | `--min-frac` default |
|-------------|--------------------------|----------------------|
| not set | — | 0.0 (no-op) |
| set | no | **1.0** — all ingroup genomes must carry the k-mer |
| set | yes | 0.0 — user controls quorum explicitly |
| `--outgroup` | Any outgroup quorum flag? | `--max-outgroup-count` default |
|--------------|---------------------------|-------------------------------|
| not set | — | outgroup size (no-op) |
| set | no | **0** — no outgroup genome may carry the k-mer |
| set | yes | outgroup size — user controls quorum explicitly |
"Any ingroup quorum flag" means any of: `--min-count`, `--max-count`, `--min-frac`, `--max-frac`.
"Any outgroup quorum flag" means any of: `--min-outgroup-count`, `--max-outgroup-count`, `--min-outgroup-frac`, `--max-outgroup-frac`.
**Why this rule?** Setting any quorum flag signals explicit intent — the defaults are there to help when the user omits quorum entirely, not to interfere with deliberate constraints. Mixing implicit and explicit quorum on the same group would risk silent incoherence (e.g. `--max-count 0` with an implicit `--min-frac 1.0`).
All other bounds default to 0 / group size / 0.0 / 1.0 regardless of whether groups are declared.
### Validation
After resolving defaults, the following are checked and cause an immediate error:
| Condition | Error |
|-----------|-------|
| `--min-count > --max-count` | incoherent bounds |
| `--min-frac > --max-frac` | incoherent bounds |
| `--min-outgroup-count > --max-outgroup-count` | incoherent bounds |
| `--min-outgroup-frac > --max-outgroup-frac` | incoherent bounds |
| any fraction outside `[0.0, 1.0]` | invalid value |
The check applies to the **effective** values (after defaults are resolved), so an explicit `--max-frac 0.5` with an implicit `--min-frac 1.0` would have been caught — but the rule above prevents that situation from arising in the first place.
Fractions are computed over the size of the classified group, not over total
genome count. An empty group (no genome classified as ingroup/outgroup) never
triggers a filter failure.
### Conservative rounding of fraction thresholds
When a fraction threshold `F` is applied to a group of size `N`, the effective
integer threshold is determined by the direction of the bound:
| Bound | Effective count | Rounding | Rationale |
|-------|----------------|----------|-----------|
| `--min-frac F` | k-mer in ≥ ⌈F·N⌉ genomes | **ceil** | stricter — a kmer present in exactly ⌊F·N⌋ genomes does not meet the fraction |
| `--max-frac F` | k-mer in ≤ ⌊F·N⌋ genomes | **floor** | stricter — a kmer present in ⌈F·N⌉ genomes already exceeds the fraction |
The same rule applies symmetrically to `--min-outgroup-frac` (ceil) and
`--max-outgroup-frac` (floor). The outgroup direction is not inverted: the
conservative rounding depends only on whether the bound is a minimum or a
maximum, not on which group it applies to.
**Example** — `--min-frac 0.5` with an ingroup of 3 genomes:
`⌈0.5 × 3⌉ = ⌈1.5⌉ = 2` → at least 2 of 3 ingroup genomes must carry the k-mer.
**Implementation note** — the filter evaluates `n / denom < min_frac` directly
(integer `n`, float comparison) rather than pre-computing `⌈F·N⌉`. This is
mathematically equivalent for integer counts: `n / N < F``n < F·N`
`n ≤ ⌈F·N⌉ 1``n < ⌈F·N⌉`. No explicit rounding is needed.
## Examples
Keep k-mers specific to *Betula nana* — present in at least 2 *B. nana* genomes
and absent from every other genome in the index:
```sh
obikmer filter src --output dst \
--ingroup "species=Betula_nana" \
--outgroup "*" \
--min-count 2 \
--max-outgroup-count 0
```
Keep k-mers found in at least 2 *Betula nana* genomes and absent from all
other *Betula*:
```sh
obikmer filter src --output dst \
--ingroup "species=Betula_nana" \
--outgroup "genus=Betula" \
--min-count 2 \
--max-outgroup-count 0
```
Use taxonomic paths — keep k-mers present in ≥ 50 % of the *Betula* clade
and in fewer than 10 % of everything outside *Betulaceae*:
```sh
obikmer filter src --output dst \
--ingroup "taxon~/Betulaceae/Betula" \
--outgroup "taxon!~/Betulaceae" \
--min-frac 0.5 \
--max-outgroup-frac 0.1
```
Multiple outgroup predicates (OR): exclude k-mers present in *Alnus* or *Carpinus*:
```sh
obikmer filter src --output dst \
--ingroup "genus=Betula" \
--outgroup "genus=Alnus" \
--outgroup "genus=Carpinus" \
--max-outgroup-count 0
```
To dump only k-mers specific to *Betula nana*:
```sh
obikmer dump myindex \
--ingroup "species=Betula_nana" \
--outgroup "*" \
--min-count 1 \
--max-outgroup-count 0
```
To enumerate unitigs of the *Betula*-specific subgraph:
```sh
obikmer unitig myindex \
--ingroup "genus=Betula" \
--outgroup "*" \
--min-count 2 \
--max-outgroup-count 0
```
## Command-specific options
### `dump --head N`
Stops output after the first N k-mers that pass all active filters.
Iteration terminates immediately — subsequent partitions and layers are not scanned.
Useful for quick inspection of large indexes without loading the entire dataset.
```sh
obikmer dump myindex --head 100
obikmer dump myindex --head 20 --ingroup "species=Betula_nana" --min-count 1
```
### `distance --presence-threshold N`
When computing Jaccard distance on a **count index**, a k-mer is considered present in a genome if its count is ≥ N (default 1).
This option is independent of the `--presence-threshold` used in filtering.
```sh
# Jaccard treating kmers with count ≥ 2 as present
obikmer distance myindex --metric jaccard --presence-threshold 2
```
This parameter has no effect on presence/absence indexes (where values are already 0/1) or on metrics other than Jaccard.
## Implementation
- **`obikpartitionner::filter::GroupQuorumFilter`** — implements `KmerFilter`
using pre-computed ingroup and outgroup index vectors. The heavy logic
(predicate parsing, three-value evaluation, genome classification) happens
once before any iteration; each k-mer row evaluation is a simple index
lookup and counter.
- **`obikmer::cmd::predicate::FilterArgs`** — shared `clap` argument group
embedded via `#[command(flatten)]` in `FilterArgs`, `DumpArgs`, and
`UnitigArgs`. `FilterArgs::build_filters()` returns a ready-to-use filter
list.
- **`obikpartitionner::KmerPartition::iter_partition_kmers`** — accepts
`filters: &[Box<dyn KmerFilter>]` and applies them per-kmer before invoking
the callback. `filter`, `dump`, and `unitig` all go through this single
entry point.
+44 -13
View File
@@ -1,38 +1,57 @@
# Kmer — implementation # Kmer — implementation
## Memory layout ## Types and layout
`Kmer` is a `#[repr(transparent)]` newtype over `u64`: `KmerOf<L>` is a `#[repr(transparent)]` newtype over `u64` parameterized by a `KmerLength` marker:
```rust ```rust
#[repr(transparent)] #[repr(transparent)]
pub struct Kmer(u64); pub struct KmerOf<L: KmerLength>(u64, PhantomData<L>);
``` ```
Nucleotides are packed 2 bits each, **left-aligned**, MSB-first. Nucleotide 0 occupies bits 6362; nucleotide i occupies bits 632i and 622i. The low 642k bits are always zero. k is **not stored** — it is a parameter of every operation that needs it, and will be owned by the future collection-level indexer. Three marker types implement `KmerLength`:
| Marker | `len()` source | Used for |
|--------|---------------|---------|
| `KLen` | `params::k()` | k-mers |
| `MLen` | `params::m()` | minimizers |
| `ConstLen<N>` | const generic `N` | tests |
Public aliases:
```rust
pub type Kmer = KmerOf<KLen>; // k-mer, global k
pub type Minimizer = CanonicalKmerOf<MLen>; // canonical m-mer, global m
```
Nucleotides are packed 2 bits each, **left-aligned**, MSB-first. Nucleotide 0 occupies bits 6362; nucleotide i occupies bits 632i and 622i. The low 642·len bits are always zero. The length is **not stored** — every operation reads it from `L::len()`.
| 6362 | 6160 | … | 632(k1)1 to 632(k1) | 632k down to 0 | | 6362 | 6160 | … | 632(k1)1 to 632(k1) | 632k down to 0 |
|-------|-------|---|--------------------------|-----------------| |-------|-------|---|--------------------------|-----------------|
| nt 0 | nt 1 | … | nt k1 | zero padding | | nt 0 | nt 1 | … | nt k1 | zero padding |
## Global parameters
`params::set_k(k)` / `params::k()` and `params::set_m(m)` / `params::m()` are backed by `OnceLock<usize>` in production (write-once, panic on conflict) and by `thread_local! { Cell<usize> }` in test builds (per-thread, freely writable). `params::init(k, m)` sets both in one call.
## Encoding ## Encoding
`Kmer::from_ascii(ascii, k)` encodes the first k bytes of an ASCII slice using the shared `ENC` table (see [SuperKmer — ASCII encoding](superkmer.md#ascii-encoding-and-decoding)): `KmerOf::<L>::from_ascii(ascii)` encodes the first `L::len()` bytes using the shared `ENC` table (see [SuperKmer — ASCII encoding](superkmer.md#ascii-encoding-and-decoding)):
```rust ```rust
for i in 0..k { for i in 0..k {
val = (val << 2) | encode_base(ascii[i]) as u64; val = (val << 2) | encode_base(ascii[i]) as u64;
} }
Kmer(val << (64 - 2 * k)) KmerOf(val << (64 - 2 * k), PhantomData)
``` ```
Zero allocation — result lives on the stack. Zero allocation — result lives on the stack.
## Decoding ## Decoding
`write_ascii(k, buf)` appends k ASCII characters to a caller-supplied `Vec<u8>` using the shared `DEC4` table: one lookup per 4 nucleotides, two partial-byte lookups for the remainder. No allocation in the hot path. `write_ascii(writer)` writes k ASCII characters to any `W: Write` using the shared `DEC4` table: one lookup per 4 nucleotides, one partial lookup for the remainder. No allocation in the hot path.
`to_ascii(k)` is a convenience wrapper that allocates and returns a `Vec<u8>`; intended for tests and display only. `to_ascii()` is a convenience wrapper that allocates and returns a `Vec<u8>`; intended for tests and display only.
## Reverse complement ## Reverse complement
@@ -43,18 +62,30 @@ let x = !self.0; /
let x = x.swap_bytes(); // reverse bytes let x = x.swap_bytes(); // reverse bytes
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4); // swap nibbles let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4); // swap nibbles
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2); // swap 2-bit groups let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2); // swap 2-bit groups
Kmer(x << (64 - 2 * k)) KmerOf(x << (64 - 2 * k), PhantomData)
``` ```
After complementing, bytes are reversed (`swap_bytes`), then nibbles, then 2-bit groups — restoring 2-bit nucleotides to their correct positions in reverse order. A final left-shift realigns to MSB. Zero allocation — result lives on the stack. After complementing, bytes are reversed (`swap_bytes`), then nibbles, then 2-bit groups — restoring 2-bit nucleotides to their correct positions in reverse order. A final left-shift realigns to MSB. Zero allocation — result lives on the stack.
## Canonical form ## Canonical form and `CanonicalKmerOf`
`canonical()` returns a `CanonicalKmerOf<L>` — a distinct newtype that carries the same `u64` layout but enforces the invariant that the stored value equals `min(kmer, revcomp)`:
```rust ```rust
pub fn canonical(&self, k: usize) -> Self { pub fn canonical(&self) -> CanonicalKmerOf<L> {
let rc = self.revcomp(k); let rc = self.revcomp();
if self.0 <= rc.0 { *self } else { rc } CanonicalKmerOf(if self.0 <= rc.0 { self.0 } else { rc.0 }, PhantomData)
} }
``` ```
Lexicographic minimum of forward and reverse-complement, comparing the raw `u64` values directly (left-aligned encoding makes this equivalent to nucleotide-wise comparison). Zero allocation — result lives on the stack. Lexicographic minimum of forward and reverse-complement, comparing the raw `u64` values directly (left-aligned encoding makes this equivalent to nucleotide-wise comparison). Zero allocation — result lives on the stack.
`CanonicalKmerOf::from_raw_unchecked(raw)` is the only other public constructor, for trusted paths such as deserialisation.
## Sliding window helpers
`push_right(nuc)` / `push_left(nuc)` shift the window by one base in O(1). `is_overlapping(other)` checks whether the last k1 nucleotides of `self` equal the first k1 of `other`.
## Hashing
`hash_kmer(raw: u64) -> u64` computes `mix64(raw ^ 0x9e3779b97f4a7c15)`, the seeded splitmix64 finalizer. `CanonicalKmerOf::seq_hash()` delegates to `hash_kmer`.

Some files were not shown because too many files have changed in this diff Show More