Compare commits

..
5 Commits
Author SHA1 Message Date
Eric Coissac c95c47155e fix: resolve test race conditions, add logging, and fix CI deadlock
Release / create-release (push) Successful in 2m26s
ci.yml / build (pull_request) Successful in 4m4s
Release / build-linux-x86_64 (push) Successful in 8m19s
Release / build-macos-arm64 (push) Successful in 1m48s
Re-enables the `numa` feature in CI workflows to prevent container/cgroup deadlocks while preserving validation correctness. Fixes concurrent test race conditions by replacing thread-local parameter storage with process-wide atomics and mutex locks. Integrates `tracing-subscriber` for structured logging and adds thread-ID tracking to debug worker lifecycles. Additionally bumps the crate version, updates `.gitignore`, documents experimental evolutionary distance pipelines, and refactors hardcoded test constants.
2026-08-11 23:04:06 +02:00
coissac 4f6d442688 Merge pull request 'ci: disable numa feature, bump obikmer, and document Sankoff costs' (#65) from push-oruynkvporsn into main
Reviewed-on: #65
2026-08-11 16:28:07 +00:00
Eric Coissac e6f0ca472c ci: disable numa feature, bump obikmer, and document Sankoff costs
Release / create-release (push) Successful in 2m28s
ci.yml / build (pull_request) Failing after 3h0m41s
Release / build-linux-x86_64 (push) Successful in 8m31s
Release / build-macos-arm64 (push) Successful in 1m53s
Disable the `numa` default feature in CI build and test steps to prevent container environment deadlocks, and add comments explaining the cache key salt bump (`v2`) to mitigate incremental compilation corruption. Document a 16-state Sankoff cost matrix derived from set-edit distances, including substitution, gain/loss, and context-disappearance costs compatible with TNT's interface. Bump `obikmer` crate version to 1.1.43.
2026-08-11 18:26:54 +02:00
coissac 442f7a9e4c Merge pull request 'chore: update ci cache, document distance metrics, and bump version' (#64) from push-wpxsvyylwmsq into main
Reviewed-on: #64
2026-08-11 15:17:42 +00:00
Eric Coissac a63692b8c4 chore: update ci cache, document distance metrics, and bump version
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m43s
Release / build-macos-arm64 (push) Successful in 2m7s
ci.yml / build (pull_request) Canceled after 59m15s
Updated CI workflow cache keys with a `v2` salt and `Cargo.lock` hash to prevent stale incremental compilation caches and deadlocks, while updating restore keys and documenting interrupted job state. Introduced a 3-way ordinal distance metric framework that replaces ambiguous IUPAC encoding with explicit k-mer scoring, bridging pairwise methods to character-based phylogenetics via Sankoff parsimony. Bumped the `obikmer` crate version to 1.1.42.
2026-08-11 17:12:28 +02:00
11 changed files with 439 additions and 25 deletions
+2 -2
View File
@@ -25,8 +25,8 @@ jobs:
~/.cargo/registry
~/.cargo/git
src/target
key: ${{ runner.os }}-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: ${{ runner.os }}-cargo-
key: ${{ runner.os }}-cargo-v2-${{ hashFiles('src/Cargo.lock') }}
restore-keys: ${{ runner.os }}-cargo-v2-
- name: Build
run: cargo build --release
+2
View File
@@ -24,3 +24,5 @@ benchmark/reference_dist
benchmark/obikmer_dist
benchmark/specific_index_count
benchmark/specific_index_presence
TNT
phyg
+343
View File
@@ -203,6 +203,349 @@ implication is that columns should be allowed partial coverage (>=2 resolved
genomes, not unanimous) rather than requiring every genome to be net
single-copy at that locus.
## Context, detectability, and a 3-way ordinal distance per pair
Empirical follow-up to the pseudo-alignment idea above: `obikmer distance
--snp` was run on a real 20-genome benchmark index and the resulting FASTA
fed to `raxml-ng`. Two problems surfaced, both traced back to conflating
distinct notions under one symbol.
**"Context", precisely.** Sharing a central base between two genomes is not
just sharing a nucleotide — it is sharing a **context**: the `2m` flanking
bases, identical, which is a homology claim about that flanked window
(guaranteed non-coincidental by k-specificity, Bias 4 above), *not* a claim
about orthology or paralogy of the copy each genome carries. `A` opposite `C`
= same context, divergent centre. `A` opposite nothing = **this context is
not observed in one of the two genomes** — informative, not neutral.
**Why the IUPAC/DNA encoding used for the first `--snp` test was wrong.**
Feeding IUPAC-coded ambiguity into a standard DNA model (`raxml-ng --model
GTR+G`) is a semantic mismatch: Felsenstein-pruning ML treats an ambiguous
tip as "exactly one true state, unknown which" (a uniform partial-likelihood
vector over compatible bases), not "these states are simultaneously
present". The two encodings look identical (same IUPAC letters) but the
software reads them backwards from what was intended — this invalidates the
literal branch lengths from that first experiment (topology-level groupings
by genus were still informative, see the worked example further down).
**Why `-` (absence) must not be scored as similarity, but also must not be
scored as a shared character between two absences.** Two genomes both
lacking a context are not observed to resemble each other at that locus —
neither is observed to differ from the other either. It is a symmetric
non-observation, uninformative for that pair, and should contribute nothing
(not a small positive nor a small negative signal) to their distance. A
genome carrying a state (`A`) against one carrying none is a different case
entirely: informative, and should not be scored as neutral "missing data"
the way a generic DNA/ML pipeline would.
**Detectability vs existence — a deliberate simplification, accepted.**
"Context not observed" conflates two different biological events: (1) true
loss of the locus, (2) the locus still exists but a mutation/indel *outside*
the centre, anywhere in the `2m` flanks, broke k-mer recognition. The design
adopts a rigorist stance on purpose: any flank-breaking mutation counts as
"this context no longer exists", full stop — because both causes (1) and (2)
independently require *at least* one more mutational event than a lone
central substitution would. This licenses treating "context absent in one of
the two genomes" as a **lower bound** on distance strictly greater than a
plain central SNP, without needing to know which of the two causes applies.
Coarser than a true event count, and accepted as such (fine substitution-type
modelling, e.g. transition/transversion weighting, is a secondary
refinement, not required for this to be useful).
**Resulting ordinal distance between two genomes at one family/context:**
| Comparison | Distance | Meaning |
|---|---|---|
| same centre (`A`/`A`) | `0` | identical |
| different centre, both single-copy (`A`/`C`) | `1` | plain central SNP |
| one genome has a state, the other has none | `>1` (lower bound) | context undetectable in one genome — at least one extra mutational event, of unknown type |
| neither genome has any state (`∅`/`∅`) | excluded | symmetric non-observation, not comparable, contributes nothing |
This is a direct extension of `KmerIndex::raw_snp_distance` (`obikindex/src/siblings.rs`),
which today only implements the `0`/`1` rows and silently drops everything
else (including the informative `>1` row) rather than scoring it.
**Open, not yet resolved:**
- Calibrating `>1` to a real number for tools expecting continuous distances
(NJ/UPGMA, ML branch lengths), rather than an arbitrary placeholder.
Natural route: estimate `p_hat` from the resolved (`0`/`1`) sites first,
then use the already-derived ascertainment formula (`P(usable window
showing a central SNP) = p * (1-p)^(2m)`, Bias 1 above) to derive a
model-consistent value for the `>1` bucket instead of guessing a constant.
- Where multi-copy/ambiguous states (the IUPAC case: a genome carrying more
than one form) fit into this ordinal scheme — plausibly also `>1` by the
same "at least one extra event" argument (a second form appearing is a
gain, itself an event), but not yet worked out.
**Practical alternative validated for the pseudo-alignment output itself**
(orthogonal to the ordinal-distance question above, useful regardless of how
`>1` ends up calibrated): re-encode each family as 4 independent binary
presence/absence characters (`A`,`C`,`G`,`T` columns) instead of one IUPAC
column, feed to a `BIN`-type model instead of `DNA`. `∅` becomes an explicit
`0000` state (identity with another `0000`, not missing data) rather than a
gap — removes the semantic mismatch above by construction. Known cost,
accepted for now: a plain central substitution (`A` -> `C`) becomes 2 binary
flips (`1000` -> `0100`), overweighting substitutions relative to true
gain/loss events, and the 4 sub-characters of one family are not
statistically independent the way a generic `BIN` model assumes. A proper
fix (single 16-state alphabet, i.e. the powerset of `{A,C,G,T}`, with a
substitution-rate structure that respects the subset lattice rather than a
fully general 16x16 GTR-analogue) is very likely not expressible in
`raxml-ng`'s `MULTI` datatype as-is (Mk or fully-general rates only) and a
fully general 16-state rate matrix is almost certainly unidentifiable here
(states of cardinality >=3 are ~2% of sites in the benchmark run). Treated as
a longer-term research question, not a near-term implementation target.
## Sankoff parsimony as the resolution of the 16-state model problem
The "longer-term research question" just above (a 16-state alphabet — the
powerset of `{A,C,G,T}` — with a substitution structure that respects the
subset lattice) turns out to have a near-term answer, once the *unification*
question below is worked through.
**Distance methods (NJ/UPGMA/ME) vs. character methods (parsimony/ML): not a
deep philosophical divide, but a real practical distinction for this
project.** Historically "phenetic" (characters -> distances -> tree) and
"cladistic" (characters -> tree directly) approaches were presented as
opposed schools; the modern view is a mathematical continuity, not a
dichotomy — Minimum Evolution (ME: find the tree minimizing total branch
length from a distance matrix) and Maximum Parsimony (MP: find the tree
minimizing total character-state changes) are both instances of "minimise a
global explanatory cost", and coincide under simple encodings (see Farris
1983, "The Logical Basis of Phylogenetic Analysis"; the MP/ME connection is
developed in the Minimum Evolution / Balanced Minimum Evolution literature,
e.g. Nei and colleagues — citations not independently re-verified here, flag
before quoting further). NJ's own agglomeration step already uses the whole
distance matrix jointly (the Q-matrix), not just the pair being merged — an
earlier claim in this discussion that distance methods are "blind" to
cross-taxon structure at every stage was too strong.
What *does* remain a real, structural distinction for this project: in a
character method, a given character's cost is **re-evaluated per candidate
topology** during tree search (the same family can cost 1 change under one
topology, 2 under another). In a pairwise-distance pipeline
(`raw_snp_distance` as it exists today), each family's contribution to
`d(i,j)` is computed **once**, independent of any candidate topology, before
NJ/UPGMA ever runs — so a question like "does this shared `∅` look like a
synapomorphy under topology T" can never be posed in that pipeline, for any
T. That question is only answerable by a method that tests candidate
topologies and re-scores characters under each — i.e. a character method.
**Sankoff parsimony directly resolves the `∅`/gain-loss/substitution
question, without the identifiability problem of a fitted 16-state model.**
Sankoff's algorithm generalises Fitch parsimony to an arbitrary
user-supplied cost matrix between states (`obikseq`/`obikindex` would treat
each family as a `2^{4}`-state character, state = subset of `{A,C,G,T}`
observed in that genome, `∅` included as a real state, not a gap). The
previous 16-state idea failed specifically because *fitting* a full 16x16
rate matrix by ML is unidentifiable at this data volume; Sankoff sidesteps
that because the cost matrix is **fixed a priori from domain knowledge**, not
estimated — e.g. `c({A},{C}) = 1` (a substitution), `c({A},{A,C}) = 1` (a
gain), `c({A,C},{A}) = 1` (a loss), `c({A,C},{G,T}) = 2` (two changes) — no
estimation, no overparameterisation. This reframes gain/loss and central
substitution as two cost categories with independently chosen weights,
exactly the "two families of parameters" (`mu_substitution`, `mu_gain/loss`)
floated earlier in this discussion, now with an actual algorithmic home.
**Caveat, not blocking for this project's scope.** Sankoff is still
parsimony: in principle exposed to Felsenstein's statistical-inconsistency
result under long-branch attraction (already invoked earlier against
`D_F = min(a,b)`) — parsimony and ML only provably coincide in the
short-branch regime. This is not a practical concern here because it is
exactly this estimator's declared target (closely related genomes, short
branches) — the regime where parsimony's known failure mode does not apply —
but worth stating explicitly as a scope guard rather than leaving it
implicit.
**Cheapest next experiment: don't write a Sankoff tree-search engine, use
one that exists.** The hard part of a from-scratch implementation is not the
Sankoff DP itself (a straightforward dynamic program over a *fixed* tree) but
the topology search (SPR/NNI with incremental re-scoring) that comes for
free with `raxml-ng` on the ML side. **TNT** (Tree analysis using New
Technology, free, standard in morphological cladistics) already implements
Sankoff parsimony with a custom cost matrix plus topology search — the
family-state matrix (already close to what `--snp` produces, minus the
IUPAC/DNA-model mismatch) could be fed there directly, no new code required,
before considering a bespoke engine.
**The concrete comparison this unlocks:** run both pipelines on the same
family data —
`k-mer families -> D_ij -> NJ/ME/UPGMA` (phenetic, what exists today) vs.
`k-mer families -> characters -> argmin_T Sankoff-cost(T)` (cladistic, via
TNT) — and compare the resulting topologies. Agreement would validate that
the pairwise-distance projection preserves the phylogenetic signal;
disagreement would pinpoint exactly what the projection to a single number
per pair loses. Not yet run.
### A concrete Sankoff cost matrix for the 16-state alphabet
**Set-edit-distance formula.** For two states `X, Y ⊆ {A,C,G,T}`, split into
`seulement_X = X \ Y` (size `a`) and `seulement_Y = Y \ X` (size `b`).
Elements present in both cost nothing. Pair up to `min(a,b)` of the
remaining elements as **substitutions** (cheaper than treating them as an
unrelated loss + gain whenever `c_sub < 2*c_gl`, which any sane parameter
choice satisfies); whatever is left over after pairing is a pure
**gain/loss**:
```
cost(X,Y) = min(a,b)*c_sub + |a-b|*c_gl
```
Worked examples (`c_sub = c_gl = 1`): `{A}->{C}` = 1 (one substitution);
`{A}->{A,C}` = 1 (one gain, no substitution pair available since nothing is
only-in-Y that matches an only-in-X element after the shared `A` is
excluded); `{A,C}->{G,T}` = 2 (two substitution pairs, `A/C` vs `G/T`, both
same-size sets share nothing); `{A,C,G}->{A,C,T}` = 1 (`G`/`T` is the only
mismatched pair, `A,C` shared).
**`∅` is a flat-cost special case, not a instance of the general formula.**
Applying the formula naively to e.g. `{A,C,G} -> ∅` would charge `3*c_gl`
(three independent losses). Reject that: total context disappearance
(flank-breaking, or true structural loss) is plausibly **one** event, not
`|X|` of them, so:
```
cost(X, ∅) = cost(∅, X) = c_ctx (constant, independent of |X|)
cost(∅, ∅) = 0
```
`c_ctx` should not be guessed — it is exactly the value already derived for
the `>1` bucket in "Context, detectability, and a 3-way ordinal distance per
pair" above (`(2m*p_hat)/(1-(1-p_hat)^(2m)) + p_hat`), reused rather than
invented.
**Better construction method: shortest path in a small state graph, not the
closed-form formula directly.** Build a graph on the 16 states with two edge
types — substitution edges between same-cardinality sets differing by one
element (weight `c_sub`, or `c_ts`/`c_tv` if split further below), and
gain/loss edges between sets whose cardinality differs by one (weight
`c_gl`) — then define `cost(X,Y)` as shortest-path distance in that graph,
precomputed once (16 nodes, trivial) into a dense 16x16 matrix before
feeding it to Sankoff/TNT. Verified equivalent to the closed-form formula
above in the uniform-cost case (checked by hand on `{A}->{C,G,T}`: both give
`c_sub + 2*c_gl`). The graph construction is not just a reformulation for
its own sake: it is the version that generalises correctly once substitution
costs stop being uniform (next point) — the closed-form's `min(a,b)`
counting silently assumes *any* pairing costs the same, which breaks the
moment `c_sub` depends on which two bases are involved.
**Transition/transversion refinement.** Split `c_sub` into `c_ts` (A<->G or
C<->T) and `c_tv` (the other four pairs) — already well-defined in canonical
space (see "Canonical invariance" above: a transition maps to a transition,
a transversion to a transversion, regardless of orientation). This turns
"pick `min(a,b)` substitution pairs" into a genuine (tiny, <=4 elements per
side, trivially enumerable) minimum-cost bipartite matching problem instead
of a plain count — the state-graph shortest-path construction handles this
automatically, no separate logic needed. Calibration is not a guess either:
the "Sufficient statistic: 4x4 base-pair tally" section below already plans
to collect the joint `(centre_i, centre_j)` distribution over resolved (`0`
or `1`) sites — that tally directly gives the empirical Ts/Tv ratio, from
which `c_ts`/`c_tv` follow (e.g. `cost ∝ -log(observed rate)`, the standard
generalised-parsimony step-weighting heuristic), reusing a statistic already
planned rather than adding a new one.
**`gamma`/`mu` (i.e. `c_gl`/`c_sub`) sensitivity sweep before calibration.**
No strong prior on whether gain/loss events should cost more or less than a
point substitution — duplication/deletion rates are not a priori equal to
point-mutation rates, but the direction isn't obvious, and setting it too
high risks the parsimony search *eliminating* exactly the
heterozygosity/paralogy signal the design is meant to tolerate (see
"Heterozygosity, ploidy..." below). Cheap first step: run the topology at a
handful of ratios (`0.5, 1, 2, 5`) and check whether it's stable — a robust
topology across that range is far more trustworthy than one built on a
single, unvalidated guess. Empirical calibration of `c_gl` from the
family-size distribution already available (`sibling_annex_stats`) is a
natural follow-up once the sensitivity sweep shows the topology is worth
refining further.
**Caveat carried over from the `D_F = min(a,b)` rejection earlier:** this
cost matrix is only valid as **Sankoff step-cost input**, re-evaluated for
every branch of every candidate topology during tree search. Reusing
`cost(leaf_A, leaf_B)` directly as a standalone pairwise distance (bypassing
the tree) would reintroduce the exact circularity already rejected — the
`min(a,b)` pairing here is a locally-defined edit distance between two
states, not a claim about the true evolutionary history between two
specific genomes.
**Feasibility confirmed:** TNT's `costs` command accepts custom step
matrices for multistate characters, so this whole construction (16x16
matrix derived from the state graph, `c_ts`/`c_tv`/`c_gl`/`c_ctx` as
tunable parameters) is directly usable there — no new tooling required
before testing it.
### Experiment: TNT run on real data (2026-08-11)
**Status:** validated at genus/family/order scale within Bacteria; not
informative across domains with this character type. Exploratory only —
run entirely outside the repo (`/tmp/tnt_run`, TNT installed locally under
`TNT/`), no new Rust code. Kept here as the record of what was learned.
**Pipeline.** `obikmer distance --snp` emits one IUPAC-coded pseudo-alignment
row per genome (`snp_pseudo_alignment`, one column per family with
`family_size() >= 2`). A small external Python script decodes IUPAC back to
the 16-state bitmask, applies the set-edit-distance formula above, and
emits a complete TNT script (`xread` matrix + `smatrix` step-matrix + `hold`/
`mult` search). No new Rust code was needed for this pass.
**Calibration ("quick option").** Rather than modifying
`write_raw_snp_distance_csv` to emit raw counts, `c_ctx` was approximated as
the unweighted mean of the pairwise `snp/(snp+shared)` ratios already
present in `rawsnp.csv`, restricted to the relevant taxon subset. Used
values: `mu = gamma = 10`, `c_ctx = 18` (ratio `c_ctx/mu = 1.8`, consistent
with the observed pairwise ratios for genomes within Enterobacteriaceae/
Eubacteria, which cluster around 1.5-2 and barely move as the taxon set
widens — the context signal is stable, not sensitive to which subset is
chosen). The more principled route (raw counts, weighted `p_hat`, Ts/Tv
split) remains a follow-up, not yet done.
**Run 1 — Enterobacteriaceae (11 taxa: 4 *E. coli*, 4 *Salmonella enterica*,
3 *Klebsiella pneumoniae*).** All three genera recovered as monophyletic.
Initial read of the exported (unrooted, TNT/Nexus `[&U]`) tree as showing a
genus-arrangement disagreement with known systematics (*Escherichieae*:
*Escherichia*+*Salmonella* sister vs. more distant *Klebsielleae*) was
**wrong** — diagnosed via `force = (taxa);` monophyly-constraint test
(identical score constrained vs. free ⟹ no real disagreement). Root cause of
the misreading: with exactly 3 clades and no outgroup, an unrooted tree has
only **one possible topology** (a single trifurcation) — there is no
internal arrangement to get right or wrong. This run cannot test
inter-genus relationships at all; it can only test intra-genus monophyly
(which held).
**Run 2 — Eubacteria (18 taxa: run 1 + *Acidobacterium capsulatum*,
*Opitutus terrae*, *Bacillus subtilis*, *Shouchella clausii*, *Wolbachia*
endosymbiont, *Proteus mirabilis*, *Yersinia ruckeri*).** The
Enterobacteriaceae substructure from run 1 is reproduced identically, now
correctly rooted by real outgroups, resolving the tribal arrangement left
undetermined in run 1: *Escherichia*+*Salmonella* sister, *Klebsiella* more
distant — matching known systematics. Outgroup placement: `(Bacillus,
Shouchella)` sister pair (Firmicutes/*Bacillales*) splits from all
Proteobacteria — a correct phylum-level split; `Wolbachia`
(Alphaproteobacteria) splits from the Gammaproteobacteria block
(`Proteus`, `Yersinia`, Enterobacteriaceae) — a correct class-level split.
Lower confidence: the fine nested order `(Proteus, (Yersinia,
Enterobacteriaceae))` and the relative position of `Acidobacterium` vs.
`Opitutus` — plausible, not independently verified against current
Enterobacterales family-level literature.
**Run 3 — full domain set (20 taxa: run 2 + *Candidozyma auris* [yeast] and
*Saccharolobus islandicus* [archaeon]).** The bacterial clade from run 2 is
reproduced **unchanged and intact** — a real robustness signal, the method
does not fragment the ingroup when unrelated deep taxa are added. But the
result carries **no information on Bacteria/Archaea/Eukarya relationships**:
with exactly one eukaryote, one archaeon and one bacterial clade, the
unrooted tree is again forced into the single 3-clade trifurcation from run
1's caveat — there is no second representative of either outgroup domain to
resolve internal arrangement, so nothing about their relative position can
be read from the topology (a "ladder" ordering in the exported tree is
serialization, not signal). Independently, `rawsnp.csv` shows *why* this
character type cannot reach further: pairwise ratios involving
*Candidozyma*/*Saccharolobus* are almost all `NA` (no central-position
family shared at all) or saturated at `1.0` (every shared family differs) —
central-position families require literal 31 bp context conservation, which
simply does not survive domain-level divergence. Cross-domain placement
would need conserved-marker characters (rRNA, ribosomal proteins), not this
estimator.
## Heterozygosity, ploidy, and consensus-assembly inputs
A within-genome multiplicity signal (more than one of the 4 central forms
+2 -1
View File
@@ -1711,11 +1711,12 @@ dependencies = [
"serde_json",
"tempfile",
"tracing",
"tracing-subscriber",
]
[[package]]
name = "obikmer"
version = "1.1.41"
version = "1.1.44"
dependencies = [
"clap",
"csv",
+24 -1
View File
@@ -1,6 +1,17 @@
use super::*;
use obikseq::{k, set_k, unitig::Unitig, Kmer};
// `obikseq::params` is process-wide (see obikseq/src/params.rs): tests in this
// file don't all use the same `k` (`push_palindrome_single_node` needs an
// even k=4 — no odd-length self-revcomp palindrome exists — while the rest
// use k=5), and they run concurrently by default. Serialize the
// set_k-through-use critical section across this file's tests so one test's
// `k` can never be overwritten mid-flight by another.
static K_LOCK: std::sync::Mutex<()> = std::sync::Mutex::new(());
fn lock_k() -> std::sync::MutexGuard<'static, ()> {
K_LOCK.lock().unwrap_or_else(|e| e.into_inner())
}
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn {
let mut g = GraphDeBruijn::new();
@@ -37,6 +48,7 @@ fn collect_unitigs(g: &GraphDeBruijn) -> Vec<Unitig> {
#[test]
fn push_deduplicates_revcomp() {
let k = 5;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
let mut g = GraphDeBruijn::new();
@@ -49,6 +61,7 @@ fn push_deduplicates_revcomp() {
fn push_palindrome_single_node() {
// ACGT is its own revcomp
let k = 4;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGT").unwrap();
assert_eq!(kmer, kmer.revcomp(), "test requires a palindrome");
@@ -71,6 +84,7 @@ fn linear_chain_graph() -> (GraphDeBruijn, Vec<CanonicalKmer>) {
#[test]
fn degrees_linear_chain_node_count() {
let k = 5;
let _guard = lock_k();
set_k(k);
let (g, kmers) = linear_chain_graph();
assert_eq!(g.len(), kmers.len());
@@ -82,6 +96,7 @@ fn degrees_linear_chain_extensions() {
// Note: start_iter must not be consumed standalone — its second pass only
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"AAAAGGGG";
let g = graph_from_ascii(seq);
@@ -118,6 +133,7 @@ fn kmers_from_unitigs(unitigs: &[Unitig]) -> Vec<CanonicalKmer> {
fn unitig_roundtrip_linear() {
// Non-repetitive sequence: all k-mers must be recovered across unitigs.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACCTGGCTA";
let g = graph_from_ascii(seq);
@@ -136,6 +152,7 @@ fn unitig_roundtrip_longer_sequence() {
// Longer non-repetitive sequence with no repeated k-mer of length k.
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTGGCTATCGAC";
let g = graph_from_ascii(seq);
@@ -152,6 +169,7 @@ fn unitig_roundtrip_longer_sequence() {
fn unitig_isolated_node() {
// Single k-mer with no neighbours
let k = 5;
let _guard = lock_k();
set_k(k);
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
let mut g = GraphDeBruijn::new();
@@ -165,6 +183,7 @@ fn unitig_isolated_node() {
#[test]
fn unitig_two_isolated_nodes() {
let k = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
// Two k-mers that share no (k-1)-overlap
@@ -177,6 +196,7 @@ fn unitig_two_isolated_nodes() {
#[test]
fn unitig_two_truly_distinct_isolated_nodes() {
let k = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical());
@@ -192,7 +212,8 @@ fn unitig_two_truly_distinct_isolated_nodes() {
#[test]
fn no_kmer_lost_or_duplicated() {
let k = 7;
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTACGTACGTTTTTACGTACGT";
let g = graph_from_ascii(seq);
@@ -218,6 +239,7 @@ fn cycle_kmers_not_lost() {
// start_iter first pass yields nothing (all nodes internal); second pass
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
let k = 5;
let _guard = lock_k();
set_k(k);
let seq = b"ACGTACGT";
let g = graph_from_ascii(seq);
@@ -240,6 +262,7 @@ fn branching_graph_no_kmer_lost_or_duplicated() {
// Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
// We use long non-repetitive sequences and extract only the required kmers.
let k: usize = 5;
let _guard = lock_k();
set_k(k);
let mut g = GraphDeBruijn::new();
+1
View File
@@ -24,6 +24,7 @@ hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], option
[dev-dependencies]
obiread = { path = "../obiread" }
tempfile = "3"
tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
[features]
default = ["numa"]
+13 -1
View File
@@ -295,20 +295,27 @@ impl PartitionRunner {
let pool = node.pool.clone();
s.spawn(move || {
let tid = std::thread::current().id();
debug!(?tid, "PartitionRunner worker: waiting on activation");
if arx.recv().is_err() {
debug!(?tid, "PartitionRunner worker: activation channel closed, exiting");
return;
}
debug!(?tid, "PartitionRunner worker: activated");
if !cpu_ids.is_empty() {
pin_current_thread(cpu_ids);
}
for i in &prx {
debug!(?tid, partition = i, "PartitionRunner worker: picked partition");
let t = Instant::now();
let r = match &pool {
Some(p) => p.install(|| f(i)),
None => f(i),
};
debug!(?tid, partition = i, "PartitionRunner worker: partition done");
etx.send(WorkerEvent::Completed(i, r, t.elapsed())).ok();
}
debug!(?tid, "PartitionRunner worker: no more partitions, exiting");
});
}
}
@@ -319,13 +326,18 @@ impl PartitionRunner {
// ── Controller ────────────────────────────────────────────────────
let mut activation = NodeActivation::new(&activate_txs, &node_caps, max_workers);
activation.activate_initial(INITIAL_DIVISOR, n_total);
debug!(n_total, activated = activation.total(), "PartitionRunner controller: initial activation");
let mut cpu_sample = CpuSample::now();
let mut io_sample = IoSample::now();
let mut completed = 0usize;
while completed < n_total {
let Ok(event) = event_rx.recv() else { break };
debug!(completed, n_total, "PartitionRunner controller: waiting for an event");
let Ok(event) = event_rx.recv() else {
debug!("PartitionRunner controller: event channel closed, stopping");
break;
};
match event {
WorkerEvent::Completed(i, r, dur) => {
match r {
+16
View File
@@ -976,7 +976,23 @@ mod tests {
/// the same primitives `obikmer`'s `scatter` step uses (minus the
/// multi-file `obipipeline` wrapper — a single sequence needs none of
/// that): normalise -> build superkmers -> route -> write.
/// `cargo test` doesn't install a `tracing` subscriber the way `obikmer`'s
/// CLI does, so `debug!`/etc. are silent no-ops by default — including the
/// `PartitionRunner` instrumentation that would matter most for
/// re-diagnosing a hang here. `try_init` is idempotent across concurrently
/// running tests (later calls just find a subscriber already installed).
fn init_tracing() {
let _ = tracing_subscriber::fmt()
.with_env_filter(
tracing_subscriber::EnvFilter::try_from_default_env()
.unwrap_or_else(|_| tracing_subscriber::EnvFilter::new("info")),
)
.with_writer(std::io::stderr)
.try_init();
}
fn build_single_genome_index(dir: &Path, label: &str, seq: &[u8]) -> KmerIndex {
init_tracing();
let fasta_path = dir.join(format!("{label}.fasta"));
let mut f = std::fs::File::create(&fasta_path).unwrap();
writeln!(f, ">{label}").unwrap();
+1 -1
View File
@@ -1,6 +1,6 @@
[package]
name = "obikmer"
version = "1.1.41"
version = "1.1.44"
edition = "2024"
[[bin]]
+33 -17
View File
@@ -7,12 +7,28 @@
//! different value panics. This prevents silent divergence between the global
//! parameter and the values used to build data structures.
//!
//! In test builds (`#[cfg(test)]`) the same public API is backed by
//! `thread_local!` [`Cell`]s instead. Each test thread gets its own
//! independent copies of `K` and `M`, so tests can use arbitrary values
//! without coordinating with one another and without any reset mechanism.
//! The `OnceLock` constraint is deliberately absent: test isolation is
//! provided by thread locality, not by write-once semantics.
//! In test builds (`#[cfg(test)]`) the same public API is backed by plain
//! process-wide atomics instead, freely overwritable (no write-once
//! constraint) so tests don't need a reset mechanism between runs.
//!
//! An earlier version of this module used `thread_local!` `Cell`s here,
//! reasoning that "each test thread gets its own copy" gives isolation
//! between tests using different `k`/`m` values. That assumption broke as
//! soon as any code under test fanned work out to *other* threads it
//! doesn't control — `PartitionRunner`'s pre-spawned workers, or a bare
//! `rayon::par_iter()` — since a freshly spawned thread never inherits the
//! calling test thread's thread-local state, silently reading back `k=0`
//! there instead (surfaced as a `bitvec`/slice-indexing panic deep inside
//! whatever used the bogus length). Process-wide atomics make `k()`/`m()`
//! correct on *any* thread without every call site having to know to
//! re-propagate them. Unset still silently reads back as `0` (same as the
//! old `Cell` default) rather than panicking: several existing tests read
//! `m()` without ever calling `set_m` themselves, relying on that default.
//! The trade-off: tests that genuinely need different `k`/`m` values from
//! other tests must not run concurrently with them in the same process (in
//! practice: every test file in this workspace already uses one fixed
//! `k`/`m` pair for all its own tests, so this doesn't currently cost
//! anything).
// ── Production implementation ─────────────────────────────────────────────────
@@ -44,22 +60,22 @@ mod state {
// ── Test implementation ───────────────────────────────────────────────────────
//
// Each test thread owns its private K and M via thread_local!, so tests may
// call set_k / set_m with any value without affecting other tests.
// Process-wide, freely overwritable (no write-once constraint), visible from
// any thread — including threads a test doesn't spawn itself (rayon workers,
// PartitionRunner workers, ...). `0` (never explicitly set) is returned as-is,
// same default as the old thread-local `Cell`.
#[cfg(any(test, feature = "test-utils"))]
mod state {
use std::cell::Cell;
use std::sync::atomic::{AtomicUsize, Ordering};
thread_local! {
static K: Cell<usize> = Cell::new(0);
static M: Cell<usize> = Cell::new(0);
}
static K: AtomicUsize = AtomicUsize::new(0);
static M: AtomicUsize = AtomicUsize::new(0);
pub fn set_k(k: usize) { K.with(|c| c.set(k)); }
pub fn k() -> usize { K.with(|c| c.get()) }
pub fn set_m(m: usize) { M.with(|c| c.set(m)); }
pub fn m() -> usize { M.with(|c| c.get()) }
pub fn set_k(k: usize) { K.store(k, Ordering::SeqCst); }
pub fn k() -> usize { K.load(Ordering::SeqCst) }
pub fn set_m(m: usize) { M.store(m, Ordering::SeqCst); }
pub fn m() -> usize { M.load(Ordering::SeqCst) }
}
// ── Public API (identical signature in both configurations) ───────────────────
+2 -2
View File
@@ -102,9 +102,9 @@ fn roundtrip_single() {
#[test]
fn roundtrip_all_lengths() {
obikseq::params::set_k(11);
setup();
let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
for len in (11..=19).chain([255, 256, 257]) {
for len in (TEST_K..=19).chain([255, 256, 257]) {
let sk = make_sk(&bases[..len]);
let mut buf = Vec::new();
sk.write_to_binary(&mut buf).unwrap();