Compare commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
c95c47155e | ||
|
|
4f6d442688 | ||
|
|
e6f0ca472c | ||
|
|
442f7a9e4c | ||
|
|
a63692b8c4 | ||
|
|
fa82989ea9 | ||
|
|
5f95e866f8 | ||
|
|
2e7cfc4368 |
@@ -1,4 +1,4 @@
|
||||
name: CI
|
||||
pname: CI
|
||||
|
||||
on:
|
||||
pull_request:
|
||||
@@ -25,8 +25,8 @@ jobs:
|
||||
~/.cargo/registry
|
||||
~/.cargo/git
|
||||
src/target
|
||||
key: ${{ runner.os }}-cargo-${{ hashFiles('src/Cargo.lock') }}
|
||||
restore-keys: ${{ runner.os }}-cargo-
|
||||
key: ${{ runner.os }}-cargo-v2-${{ hashFiles('src/Cargo.lock') }}
|
||||
restore-keys: ${{ runner.os }}-cargo-v2-
|
||||
|
||||
- name: Build
|
||||
run: cargo build --release
|
||||
|
||||
@@ -24,3 +24,5 @@ benchmark/reference_dist
|
||||
benchmark/obikmer_dist
|
||||
benchmark/specific_index_count
|
||||
benchmark/specific_index_presence
|
||||
TNT
|
||||
phyg
|
||||
|
||||
@@ -203,6 +203,349 @@ implication is that columns should be allowed partial coverage (>=2 resolved
|
||||
genomes, not unanimous) rather than requiring every genome to be net
|
||||
single-copy at that locus.
|
||||
|
||||
## Context, detectability, and a 3-way ordinal distance per pair
|
||||
|
||||
Empirical follow-up to the pseudo-alignment idea above: `obikmer distance
|
||||
--snp` was run on a real 20-genome benchmark index and the resulting FASTA
|
||||
fed to `raxml-ng`. Two problems surfaced, both traced back to conflating
|
||||
distinct notions under one symbol.
|
||||
|
||||
**"Context", precisely.** Sharing a central base between two genomes is not
|
||||
just sharing a nucleotide — it is sharing a **context**: the `2m` flanking
|
||||
bases, identical, which is a homology claim about that flanked window
|
||||
(guaranteed non-coincidental by k-specificity, Bias 4 above), *not* a claim
|
||||
about orthology or paralogy of the copy each genome carries. `A` opposite `C`
|
||||
= same context, divergent centre. `A` opposite nothing = **this context is
|
||||
not observed in one of the two genomes** — informative, not neutral.
|
||||
|
||||
**Why the IUPAC/DNA encoding used for the first `--snp` test was wrong.**
|
||||
Feeding IUPAC-coded ambiguity into a standard DNA model (`raxml-ng --model
|
||||
GTR+G`) is a semantic mismatch: Felsenstein-pruning ML treats an ambiguous
|
||||
tip as "exactly one true state, unknown which" (a uniform partial-likelihood
|
||||
vector over compatible bases), not "these states are simultaneously
|
||||
present". The two encodings look identical (same IUPAC letters) but the
|
||||
software reads them backwards from what was intended — this invalidates the
|
||||
literal branch lengths from that first experiment (topology-level groupings
|
||||
by genus were still informative, see the worked example further down).
|
||||
|
||||
**Why `-` (absence) must not be scored as similarity, but also must not be
|
||||
scored as a shared character between two absences.** Two genomes both
|
||||
lacking a context are not observed to resemble each other at that locus —
|
||||
neither is observed to differ from the other either. It is a symmetric
|
||||
non-observation, uninformative for that pair, and should contribute nothing
|
||||
(not a small positive nor a small negative signal) to their distance. A
|
||||
genome carrying a state (`A`) against one carrying none is a different case
|
||||
entirely: informative, and should not be scored as neutral "missing data"
|
||||
the way a generic DNA/ML pipeline would.
|
||||
|
||||
**Detectability vs existence — a deliberate simplification, accepted.**
|
||||
"Context not observed" conflates two different biological events: (1) true
|
||||
loss of the locus, (2) the locus still exists but a mutation/indel *outside*
|
||||
the centre, anywhere in the `2m` flanks, broke k-mer recognition. The design
|
||||
adopts a rigorist stance on purpose: any flank-breaking mutation counts as
|
||||
"this context no longer exists", full stop — because both causes (1) and (2)
|
||||
independently require *at least* one more mutational event than a lone
|
||||
central substitution would. This licenses treating "context absent in one of
|
||||
the two genomes" as a **lower bound** on distance strictly greater than a
|
||||
plain central SNP, without needing to know which of the two causes applies.
|
||||
Coarser than a true event count, and accepted as such (fine substitution-type
|
||||
modelling, e.g. transition/transversion weighting, is a secondary
|
||||
refinement, not required for this to be useful).
|
||||
|
||||
**Resulting ordinal distance between two genomes at one family/context:**
|
||||
|
||||
| Comparison | Distance | Meaning |
|
||||
|---|---|---|
|
||||
| same centre (`A`/`A`) | `0` | identical |
|
||||
| different centre, both single-copy (`A`/`C`) | `1` | plain central SNP |
|
||||
| one genome has a state, the other has none | `>1` (lower bound) | context undetectable in one genome — at least one extra mutational event, of unknown type |
|
||||
| neither genome has any state (`∅`/`∅`) | excluded | symmetric non-observation, not comparable, contributes nothing |
|
||||
|
||||
This is a direct extension of `KmerIndex::raw_snp_distance` (`obikindex/src/siblings.rs`),
|
||||
which today only implements the `0`/`1` rows and silently drops everything
|
||||
else (including the informative `>1` row) rather than scoring it.
|
||||
|
||||
**Open, not yet resolved:**
|
||||
- Calibrating `>1` to a real number for tools expecting continuous distances
|
||||
(NJ/UPGMA, ML branch lengths), rather than an arbitrary placeholder.
|
||||
Natural route: estimate `p_hat` from the resolved (`0`/`1`) sites first,
|
||||
then use the already-derived ascertainment formula (`P(usable window
|
||||
showing a central SNP) = p * (1-p)^(2m)`, Bias 1 above) to derive a
|
||||
model-consistent value for the `>1` bucket instead of guessing a constant.
|
||||
- Where multi-copy/ambiguous states (the IUPAC case: a genome carrying more
|
||||
than one form) fit into this ordinal scheme — plausibly also `>1` by the
|
||||
same "at least one extra event" argument (a second form appearing is a
|
||||
gain, itself an event), but not yet worked out.
|
||||
|
||||
**Practical alternative validated for the pseudo-alignment output itself**
|
||||
(orthogonal to the ordinal-distance question above, useful regardless of how
|
||||
`>1` ends up calibrated): re-encode each family as 4 independent binary
|
||||
presence/absence characters (`A`,`C`,`G`,`T` columns) instead of one IUPAC
|
||||
column, feed to a `BIN`-type model instead of `DNA`. `∅` becomes an explicit
|
||||
`0000` state (identity with another `0000`, not missing data) rather than a
|
||||
gap — removes the semantic mismatch above by construction. Known cost,
|
||||
accepted for now: a plain central substitution (`A` -> `C`) becomes 2 binary
|
||||
flips (`1000` -> `0100`), overweighting substitutions relative to true
|
||||
gain/loss events, and the 4 sub-characters of one family are not
|
||||
statistically independent the way a generic `BIN` model assumes. A proper
|
||||
fix (single 16-state alphabet, i.e. the powerset of `{A,C,G,T}`, with a
|
||||
substitution-rate structure that respects the subset lattice rather than a
|
||||
fully general 16x16 GTR-analogue) is very likely not expressible in
|
||||
`raxml-ng`'s `MULTI` datatype as-is (Mk or fully-general rates only) and a
|
||||
fully general 16-state rate matrix is almost certainly unidentifiable here
|
||||
(states of cardinality >=3 are ~2% of sites in the benchmark run). Treated as
|
||||
a longer-term research question, not a near-term implementation target.
|
||||
|
||||
## Sankoff parsimony as the resolution of the 16-state model problem
|
||||
|
||||
The "longer-term research question" just above (a 16-state alphabet — the
|
||||
powerset of `{A,C,G,T}` — with a substitution structure that respects the
|
||||
subset lattice) turns out to have a near-term answer, once the *unification*
|
||||
question below is worked through.
|
||||
|
||||
**Distance methods (NJ/UPGMA/ME) vs. character methods (parsimony/ML): not a
|
||||
deep philosophical divide, but a real practical distinction for this
|
||||
project.** Historically "phenetic" (characters -> distances -> tree) and
|
||||
"cladistic" (characters -> tree directly) approaches were presented as
|
||||
opposed schools; the modern view is a mathematical continuity, not a
|
||||
dichotomy — Minimum Evolution (ME: find the tree minimizing total branch
|
||||
length from a distance matrix) and Maximum Parsimony (MP: find the tree
|
||||
minimizing total character-state changes) are both instances of "minimise a
|
||||
global explanatory cost", and coincide under simple encodings (see Farris
|
||||
1983, "The Logical Basis of Phylogenetic Analysis"; the MP/ME connection is
|
||||
developed in the Minimum Evolution / Balanced Minimum Evolution literature,
|
||||
e.g. Nei and colleagues — citations not independently re-verified here, flag
|
||||
before quoting further). NJ's own agglomeration step already uses the whole
|
||||
distance matrix jointly (the Q-matrix), not just the pair being merged — an
|
||||
earlier claim in this discussion that distance methods are "blind" to
|
||||
cross-taxon structure at every stage was too strong.
|
||||
|
||||
What *does* remain a real, structural distinction for this project: in a
|
||||
character method, a given character's cost is **re-evaluated per candidate
|
||||
topology** during tree search (the same family can cost 1 change under one
|
||||
topology, 2 under another). In a pairwise-distance pipeline
|
||||
(`raw_snp_distance` as it exists today), each family's contribution to
|
||||
`d(i,j)` is computed **once**, independent of any candidate topology, before
|
||||
NJ/UPGMA ever runs — so a question like "does this shared `∅` look like a
|
||||
synapomorphy under topology T" can never be posed in that pipeline, for any
|
||||
T. That question is only answerable by a method that tests candidate
|
||||
topologies and re-scores characters under each — i.e. a character method.
|
||||
|
||||
**Sankoff parsimony directly resolves the `∅`/gain-loss/substitution
|
||||
question, without the identifiability problem of a fitted 16-state model.**
|
||||
Sankoff's algorithm generalises Fitch parsimony to an arbitrary
|
||||
user-supplied cost matrix between states (`obikseq`/`obikindex` would treat
|
||||
each family as a `2^{4}`-state character, state = subset of `{A,C,G,T}`
|
||||
observed in that genome, `∅` included as a real state, not a gap). The
|
||||
previous 16-state idea failed specifically because *fitting* a full 16x16
|
||||
rate matrix by ML is unidentifiable at this data volume; Sankoff sidesteps
|
||||
that because the cost matrix is **fixed a priori from domain knowledge**, not
|
||||
estimated — e.g. `c({A},{C}) = 1` (a substitution), `c({A},{A,C}) = 1` (a
|
||||
gain), `c({A,C},{A}) = 1` (a loss), `c({A,C},{G,T}) = 2` (two changes) — no
|
||||
estimation, no overparameterisation. This reframes gain/loss and central
|
||||
substitution as two cost categories with independently chosen weights,
|
||||
exactly the "two families of parameters" (`mu_substitution`, `mu_gain/loss`)
|
||||
floated earlier in this discussion, now with an actual algorithmic home.
|
||||
|
||||
**Caveat, not blocking for this project's scope.** Sankoff is still
|
||||
parsimony: in principle exposed to Felsenstein's statistical-inconsistency
|
||||
result under long-branch attraction (already invoked earlier against
|
||||
`D_F = min(a,b)`) — parsimony and ML only provably coincide in the
|
||||
short-branch regime. This is not a practical concern here because it is
|
||||
exactly this estimator's declared target (closely related genomes, short
|
||||
branches) — the regime where parsimony's known failure mode does not apply —
|
||||
but worth stating explicitly as a scope guard rather than leaving it
|
||||
implicit.
|
||||
|
||||
**Cheapest next experiment: don't write a Sankoff tree-search engine, use
|
||||
one that exists.** The hard part of a from-scratch implementation is not the
|
||||
Sankoff DP itself (a straightforward dynamic program over a *fixed* tree) but
|
||||
the topology search (SPR/NNI with incremental re-scoring) that comes for
|
||||
free with `raxml-ng` on the ML side. **TNT** (Tree analysis using New
|
||||
Technology, free, standard in morphological cladistics) already implements
|
||||
Sankoff parsimony with a custom cost matrix plus topology search — the
|
||||
family-state matrix (already close to what `--snp` produces, minus the
|
||||
IUPAC/DNA-model mismatch) could be fed there directly, no new code required,
|
||||
before considering a bespoke engine.
|
||||
|
||||
**The concrete comparison this unlocks:** run both pipelines on the same
|
||||
family data —
|
||||
`k-mer families -> D_ij -> NJ/ME/UPGMA` (phenetic, what exists today) vs.
|
||||
`k-mer families -> characters -> argmin_T Sankoff-cost(T)` (cladistic, via
|
||||
TNT) — and compare the resulting topologies. Agreement would validate that
|
||||
the pairwise-distance projection preserves the phylogenetic signal;
|
||||
disagreement would pinpoint exactly what the projection to a single number
|
||||
per pair loses. Not yet run.
|
||||
|
||||
### A concrete Sankoff cost matrix for the 16-state alphabet
|
||||
|
||||
**Set-edit-distance formula.** For two states `X, Y ⊆ {A,C,G,T}`, split into
|
||||
`seulement_X = X \ Y` (size `a`) and `seulement_Y = Y \ X` (size `b`).
|
||||
Elements present in both cost nothing. Pair up to `min(a,b)` of the
|
||||
remaining elements as **substitutions** (cheaper than treating them as an
|
||||
unrelated loss + gain whenever `c_sub < 2*c_gl`, which any sane parameter
|
||||
choice satisfies); whatever is left over after pairing is a pure
|
||||
**gain/loss**:
|
||||
|
||||
```
|
||||
cost(X,Y) = min(a,b)*c_sub + |a-b|*c_gl
|
||||
```
|
||||
|
||||
Worked examples (`c_sub = c_gl = 1`): `{A}->{C}` = 1 (one substitution);
|
||||
`{A}->{A,C}` = 1 (one gain, no substitution pair available since nothing is
|
||||
only-in-Y that matches an only-in-X element after the shared `A` is
|
||||
excluded); `{A,C}->{G,T}` = 2 (two substitution pairs, `A/C` vs `G/T`, both
|
||||
same-size sets share nothing); `{A,C,G}->{A,C,T}` = 1 (`G`/`T` is the only
|
||||
mismatched pair, `A,C` shared).
|
||||
|
||||
**`∅` is a flat-cost special case, not a instance of the general formula.**
|
||||
Applying the formula naively to e.g. `{A,C,G} -> ∅` would charge `3*c_gl`
|
||||
(three independent losses). Reject that: total context disappearance
|
||||
(flank-breaking, or true structural loss) is plausibly **one** event, not
|
||||
`|X|` of them, so:
|
||||
|
||||
```
|
||||
cost(X, ∅) = cost(∅, X) = c_ctx (constant, independent of |X|)
|
||||
cost(∅, ∅) = 0
|
||||
```
|
||||
|
||||
`c_ctx` should not be guessed — it is exactly the value already derived for
|
||||
the `>1` bucket in "Context, detectability, and a 3-way ordinal distance per
|
||||
pair" above (`(2m*p_hat)/(1-(1-p_hat)^(2m)) + p_hat`), reused rather than
|
||||
invented.
|
||||
|
||||
**Better construction method: shortest path in a small state graph, not the
|
||||
closed-form formula directly.** Build a graph on the 16 states with two edge
|
||||
types — substitution edges between same-cardinality sets differing by one
|
||||
element (weight `c_sub`, or `c_ts`/`c_tv` if split further below), and
|
||||
gain/loss edges between sets whose cardinality differs by one (weight
|
||||
`c_gl`) — then define `cost(X,Y)` as shortest-path distance in that graph,
|
||||
precomputed once (16 nodes, trivial) into a dense 16x16 matrix before
|
||||
feeding it to Sankoff/TNT. Verified equivalent to the closed-form formula
|
||||
above in the uniform-cost case (checked by hand on `{A}->{C,G,T}`: both give
|
||||
`c_sub + 2*c_gl`). The graph construction is not just a reformulation for
|
||||
its own sake: it is the version that generalises correctly once substitution
|
||||
costs stop being uniform (next point) — the closed-form's `min(a,b)`
|
||||
counting silently assumes *any* pairing costs the same, which breaks the
|
||||
moment `c_sub` depends on which two bases are involved.
|
||||
|
||||
**Transition/transversion refinement.** Split `c_sub` into `c_ts` (A<->G or
|
||||
C<->T) and `c_tv` (the other four pairs) — already well-defined in canonical
|
||||
space (see "Canonical invariance" above: a transition maps to a transition,
|
||||
a transversion to a transversion, regardless of orientation). This turns
|
||||
"pick `min(a,b)` substitution pairs" into a genuine (tiny, <=4 elements per
|
||||
side, trivially enumerable) minimum-cost bipartite matching problem instead
|
||||
of a plain count — the state-graph shortest-path construction handles this
|
||||
automatically, no separate logic needed. Calibration is not a guess either:
|
||||
the "Sufficient statistic: 4x4 base-pair tally" section below already plans
|
||||
to collect the joint `(centre_i, centre_j)` distribution over resolved (`0`
|
||||
or `1`) sites — that tally directly gives the empirical Ts/Tv ratio, from
|
||||
which `c_ts`/`c_tv` follow (e.g. `cost ∝ -log(observed rate)`, the standard
|
||||
generalised-parsimony step-weighting heuristic), reusing a statistic already
|
||||
planned rather than adding a new one.
|
||||
|
||||
**`gamma`/`mu` (i.e. `c_gl`/`c_sub`) sensitivity sweep before calibration.**
|
||||
No strong prior on whether gain/loss events should cost more or less than a
|
||||
point substitution — duplication/deletion rates are not a priori equal to
|
||||
point-mutation rates, but the direction isn't obvious, and setting it too
|
||||
high risks the parsimony search *eliminating* exactly the
|
||||
heterozygosity/paralogy signal the design is meant to tolerate (see
|
||||
"Heterozygosity, ploidy..." below). Cheap first step: run the topology at a
|
||||
handful of ratios (`0.5, 1, 2, 5`) and check whether it's stable — a robust
|
||||
topology across that range is far more trustworthy than one built on a
|
||||
single, unvalidated guess. Empirical calibration of `c_gl` from the
|
||||
family-size distribution already available (`sibling_annex_stats`) is a
|
||||
natural follow-up once the sensitivity sweep shows the topology is worth
|
||||
refining further.
|
||||
|
||||
**Caveat carried over from the `D_F = min(a,b)` rejection earlier:** this
|
||||
cost matrix is only valid as **Sankoff step-cost input**, re-evaluated for
|
||||
every branch of every candidate topology during tree search. Reusing
|
||||
`cost(leaf_A, leaf_B)` directly as a standalone pairwise distance (bypassing
|
||||
the tree) would reintroduce the exact circularity already rejected — the
|
||||
`min(a,b)` pairing here is a locally-defined edit distance between two
|
||||
states, not a claim about the true evolutionary history between two
|
||||
specific genomes.
|
||||
|
||||
**Feasibility confirmed:** TNT's `costs` command accepts custom step
|
||||
matrices for multistate characters, so this whole construction (16x16
|
||||
matrix derived from the state graph, `c_ts`/`c_tv`/`c_gl`/`c_ctx` as
|
||||
tunable parameters) is directly usable there — no new tooling required
|
||||
before testing it.
|
||||
|
||||
### Experiment: TNT run on real data (2026-08-11)
|
||||
|
||||
**Status:** validated at genus/family/order scale within Bacteria; not
|
||||
informative across domains with this character type. Exploratory only —
|
||||
run entirely outside the repo (`/tmp/tnt_run`, TNT installed locally under
|
||||
`TNT/`), no new Rust code. Kept here as the record of what was learned.
|
||||
|
||||
**Pipeline.** `obikmer distance --snp` emits one IUPAC-coded pseudo-alignment
|
||||
row per genome (`snp_pseudo_alignment`, one column per family with
|
||||
`family_size() >= 2`). A small external Python script decodes IUPAC back to
|
||||
the 16-state bitmask, applies the set-edit-distance formula above, and
|
||||
emits a complete TNT script (`xread` matrix + `smatrix` step-matrix + `hold`/
|
||||
`mult` search). No new Rust code was needed for this pass.
|
||||
|
||||
**Calibration ("quick option").** Rather than modifying
|
||||
`write_raw_snp_distance_csv` to emit raw counts, `c_ctx` was approximated as
|
||||
the unweighted mean of the pairwise `snp/(snp+shared)` ratios already
|
||||
present in `rawsnp.csv`, restricted to the relevant taxon subset. Used
|
||||
values: `mu = gamma = 10`, `c_ctx = 18` (ratio `c_ctx/mu = 1.8`, consistent
|
||||
with the observed pairwise ratios for genomes within Enterobacteriaceae/
|
||||
Eubacteria, which cluster around 1.5-2 and barely move as the taxon set
|
||||
widens — the context signal is stable, not sensitive to which subset is
|
||||
chosen). The more principled route (raw counts, weighted `p_hat`, Ts/Tv
|
||||
split) remains a follow-up, not yet done.
|
||||
|
||||
**Run 1 — Enterobacteriaceae (11 taxa: 4 *E. coli*, 4 *Salmonella enterica*,
|
||||
3 *Klebsiella pneumoniae*).** All three genera recovered as monophyletic.
|
||||
Initial read of the exported (unrooted, TNT/Nexus `[&U]`) tree as showing a
|
||||
genus-arrangement disagreement with known systematics (*Escherichieae*:
|
||||
*Escherichia*+*Salmonella* sister vs. more distant *Klebsielleae*) was
|
||||
**wrong** — diagnosed via `force = (taxa);` monophyly-constraint test
|
||||
(identical score constrained vs. free ⟹ no real disagreement). Root cause of
|
||||
the misreading: with exactly 3 clades and no outgroup, an unrooted tree has
|
||||
only **one possible topology** (a single trifurcation) — there is no
|
||||
internal arrangement to get right or wrong. This run cannot test
|
||||
inter-genus relationships at all; it can only test intra-genus monophyly
|
||||
(which held).
|
||||
|
||||
**Run 2 — Eubacteria (18 taxa: run 1 + *Acidobacterium capsulatum*,
|
||||
*Opitutus terrae*, *Bacillus subtilis*, *Shouchella clausii*, *Wolbachia*
|
||||
endosymbiont, *Proteus mirabilis*, *Yersinia ruckeri*).** The
|
||||
Enterobacteriaceae substructure from run 1 is reproduced identically, now
|
||||
correctly rooted by real outgroups, resolving the tribal arrangement left
|
||||
undetermined in run 1: *Escherichia*+*Salmonella* sister, *Klebsiella* more
|
||||
distant — matching known systematics. Outgroup placement: `(Bacillus,
|
||||
Shouchella)` sister pair (Firmicutes/*Bacillales*) splits from all
|
||||
Proteobacteria — a correct phylum-level split; `Wolbachia`
|
||||
(Alphaproteobacteria) splits from the Gammaproteobacteria block
|
||||
(`Proteus`, `Yersinia`, Enterobacteriaceae) — a correct class-level split.
|
||||
Lower confidence: the fine nested order `(Proteus, (Yersinia,
|
||||
Enterobacteriaceae))` and the relative position of `Acidobacterium` vs.
|
||||
`Opitutus` — plausible, not independently verified against current
|
||||
Enterobacterales family-level literature.
|
||||
|
||||
**Run 3 — full domain set (20 taxa: run 2 + *Candidozyma auris* [yeast] and
|
||||
*Saccharolobus islandicus* [archaeon]).** The bacterial clade from run 2 is
|
||||
reproduced **unchanged and intact** — a real robustness signal, the method
|
||||
does not fragment the ingroup when unrelated deep taxa are added. But the
|
||||
result carries **no information on Bacteria/Archaea/Eukarya relationships**:
|
||||
with exactly one eukaryote, one archaeon and one bacterial clade, the
|
||||
unrooted tree is again forced into the single 3-clade trifurcation from run
|
||||
1's caveat — there is no second representative of either outgroup domain to
|
||||
resolve internal arrangement, so nothing about their relative position can
|
||||
be read from the topology (a "ladder" ordering in the exported tree is
|
||||
serialization, not signal). Independently, `rawsnp.csv` shows *why* this
|
||||
character type cannot reach further: pairwise ratios involving
|
||||
*Candidozyma*/*Saccharolobus* are almost all `NA` (no central-position
|
||||
family shared at all) or saturated at `1.0` (every shared family differs) —
|
||||
central-position families require literal 31 bp context conservation, which
|
||||
simply does not survive domain-level divergence. Cross-domain placement
|
||||
would need conserved-marker characters (rRNA, ribosomal proteins), not this
|
||||
estimator.
|
||||
|
||||
## Heterozygosity, ploidy, and consensus-assembly inputs
|
||||
|
||||
A within-genome multiplicity signal (more than one of the 4 central forms
|
||||
|
||||
Generated
+2
-1
@@ -1711,11 +1711,12 @@ dependencies = [
|
||||
"serde_json",
|
||||
"tempfile",
|
||||
"tracing",
|
||||
"tracing-subscriber",
|
||||
]
|
||||
|
||||
[[package]]
|
||||
name = "obikmer"
|
||||
version = "1.1.40"
|
||||
version = "1.1.44"
|
||||
dependencies = [
|
||||
"clap",
|
||||
"csv",
|
||||
|
||||
@@ -1,6 +1,17 @@
|
||||
use super::*;
|
||||
use obikseq::{k, set_k, unitig::Unitig, Kmer};
|
||||
|
||||
// `obikseq::params` is process-wide (see obikseq/src/params.rs): tests in this
|
||||
// file don't all use the same `k` (`push_palindrome_single_node` needs an
|
||||
// even k=4 — no odd-length self-revcomp palindrome exists — while the rest
|
||||
// use k=5), and they run concurrently by default. Serialize the
|
||||
// set_k-through-use critical section across this file's tests so one test's
|
||||
// `k` can never be overwritten mid-flight by another.
|
||||
static K_LOCK: std::sync::Mutex<()> = std::sync::Mutex::new(());
|
||||
fn lock_k() -> std::sync::MutexGuard<'static, ()> {
|
||||
K_LOCK.lock().unwrap_or_else(|e| e.into_inner())
|
||||
}
|
||||
|
||||
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
|
||||
fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn {
|
||||
let mut g = GraphDeBruijn::new();
|
||||
@@ -37,6 +48,7 @@ fn collect_unitigs(g: &GraphDeBruijn) -> Vec<Unitig> {
|
||||
#[test]
|
||||
fn push_deduplicates_revcomp() {
|
||||
let k = 5;
|
||||
let _guard = lock_k();
|
||||
set_k(k);
|
||||
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
|
||||
let mut g = GraphDeBruijn::new();
|
||||
@@ -49,6 +61,7 @@ fn push_deduplicates_revcomp() {
|
||||
fn push_palindrome_single_node() {
|
||||
// ACGT is its own revcomp
|
||||
let k = 4;
|
||||
let _guard = lock_k();
|
||||
set_k(k);
|
||||
let kmer = Kmer::from_ascii(b"ACGT").unwrap();
|
||||
assert_eq!(kmer, kmer.revcomp(), "test requires a palindrome");
|
||||
@@ -71,6 +84,7 @@ fn linear_chain_graph() -> (GraphDeBruijn, Vec<CanonicalKmer>) {
|
||||
#[test]
|
||||
fn degrees_linear_chain_node_count() {
|
||||
let k = 5;
|
||||
let _guard = lock_k();
|
||||
set_k(k);
|
||||
let (g, kmers) = linear_chain_graph();
|
||||
assert_eq!(g.len(), kmers.len());
|
||||
@@ -82,6 +96,7 @@ fn degrees_linear_chain_extensions() {
|
||||
// Note: start_iter must not be consumed standalone — its second pass only
|
||||
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
|
||||
let k = 5;
|
||||
let _guard = lock_k();
|
||||
set_k(k);
|
||||
let seq = b"AAAAGGGG";
|
||||
let g = graph_from_ascii(seq);
|
||||
@@ -118,6 +133,7 @@ fn kmers_from_unitigs(unitigs: &[Unitig]) -> Vec<CanonicalKmer> {
|
||||
fn unitig_roundtrip_linear() {
|
||||
// Non-repetitive sequence: all k-mers must be recovered across unitigs.
|
||||
let k = 5;
|
||||
let _guard = lock_k();
|
||||
set_k(k);
|
||||
let seq = b"ACCTGGCTA";
|
||||
let g = graph_from_ascii(seq);
|
||||
@@ -136,6 +152,7 @@ fn unitig_roundtrip_longer_sequence() {
|
||||
// Longer non-repetitive sequence with no repeated k-mer of length k.
|
||||
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
|
||||
let k = 5;
|
||||
let _guard = lock_k();
|
||||
set_k(k);
|
||||
let seq = b"ACGTGGCTATCGAC";
|
||||
let g = graph_from_ascii(seq);
|
||||
@@ -152,6 +169,7 @@ fn unitig_roundtrip_longer_sequence() {
|
||||
fn unitig_isolated_node() {
|
||||
// Single k-mer with no neighbours
|
||||
let k = 5;
|
||||
let _guard = lock_k();
|
||||
set_k(k);
|
||||
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
|
||||
let mut g = GraphDeBruijn::new();
|
||||
@@ -165,6 +183,7 @@ fn unitig_isolated_node() {
|
||||
#[test]
|
||||
fn unitig_two_isolated_nodes() {
|
||||
let k = 5;
|
||||
let _guard = lock_k();
|
||||
set_k(k);
|
||||
let mut g = GraphDeBruijn::new();
|
||||
// Two k-mers that share no (k-1)-overlap
|
||||
@@ -177,6 +196,7 @@ fn unitig_two_isolated_nodes() {
|
||||
#[test]
|
||||
fn unitig_two_truly_distinct_isolated_nodes() {
|
||||
let k = 5;
|
||||
let _guard = lock_k();
|
||||
set_k(k);
|
||||
let mut g = GraphDeBruijn::new();
|
||||
g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical());
|
||||
@@ -192,7 +212,8 @@ fn unitig_two_truly_distinct_isolated_nodes() {
|
||||
|
||||
#[test]
|
||||
fn no_kmer_lost_or_duplicated() {
|
||||
let k = 7;
|
||||
let k = 5;
|
||||
let _guard = lock_k();
|
||||
set_k(k);
|
||||
let seq = b"ACGTACGTACGTTTTTACGTACGT";
|
||||
let g = graph_from_ascii(seq);
|
||||
@@ -218,6 +239,7 @@ fn cycle_kmers_not_lost() {
|
||||
// start_iter first pass yields nothing (all nodes internal); second pass
|
||||
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
|
||||
let k = 5;
|
||||
let _guard = lock_k();
|
||||
set_k(k);
|
||||
let seq = b"ACGTACGT";
|
||||
let g = graph_from_ascii(seq);
|
||||
@@ -240,6 +262,7 @@ fn branching_graph_no_kmer_lost_or_duplicated() {
|
||||
// Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
|
||||
// We use long non-repetitive sequences and extract only the required kmers.
|
||||
let k: usize = 5;
|
||||
let _guard = lock_k();
|
||||
set_k(k);
|
||||
let mut g = GraphDeBruijn::new();
|
||||
|
||||
|
||||
@@ -24,6 +24,7 @@ hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], option
|
||||
[dev-dependencies]
|
||||
obiread = { path = "../obiread" }
|
||||
tempfile = "3"
|
||||
tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
|
||||
|
||||
[features]
|
||||
default = ["numa"]
|
||||
|
||||
@@ -79,9 +79,7 @@ pub fn build() -> NumaSetup {
|
||||
}
|
||||
|
||||
// UMA fallback: single synthetic node, all cores, no pool, no pinning.
|
||||
let n_cores = std::thread::available_parallelism()
|
||||
.map(|n| n.get())
|
||||
.unwrap_or(1);
|
||||
let n_cores = obisys::effective_parallelism();
|
||||
debug!("UMA: single synthetic node, {} core(s)", n_cores);
|
||||
NumaSetup {
|
||||
pools: vec![None],
|
||||
@@ -91,9 +89,7 @@ pub fn build() -> NumaSetup {
|
||||
|
||||
#[cfg(not(feature = "numa"))]
|
||||
pub fn build() -> NumaSetup {
|
||||
let n_cores = std::thread::available_parallelism()
|
||||
.map(|n| n.get())
|
||||
.unwrap_or(1);
|
||||
let n_cores = obisys::effective_parallelism();
|
||||
debug!("UMA: single synthetic node, {} core(s)", n_cores);
|
||||
NumaSetup {
|
||||
pools: vec![None],
|
||||
@@ -299,20 +295,27 @@ impl PartitionRunner {
|
||||
let pool = node.pool.clone();
|
||||
|
||||
s.spawn(move || {
|
||||
let tid = std::thread::current().id();
|
||||
debug!(?tid, "PartitionRunner worker: waiting on activation");
|
||||
if arx.recv().is_err() {
|
||||
debug!(?tid, "PartitionRunner worker: activation channel closed, exiting");
|
||||
return;
|
||||
}
|
||||
debug!(?tid, "PartitionRunner worker: activated");
|
||||
if !cpu_ids.is_empty() {
|
||||
pin_current_thread(cpu_ids);
|
||||
}
|
||||
for i in &prx {
|
||||
debug!(?tid, partition = i, "PartitionRunner worker: picked partition");
|
||||
let t = Instant::now();
|
||||
let r = match &pool {
|
||||
Some(p) => p.install(|| f(i)),
|
||||
None => f(i),
|
||||
};
|
||||
debug!(?tid, partition = i, "PartitionRunner worker: partition done");
|
||||
etx.send(WorkerEvent::Completed(i, r, t.elapsed())).ok();
|
||||
}
|
||||
debug!(?tid, "PartitionRunner worker: no more partitions, exiting");
|
||||
});
|
||||
}
|
||||
}
|
||||
@@ -323,13 +326,18 @@ impl PartitionRunner {
|
||||
// ── Controller ────────────────────────────────────────────────────
|
||||
let mut activation = NodeActivation::new(&activate_txs, &node_caps, max_workers);
|
||||
activation.activate_initial(INITIAL_DIVISOR, n_total);
|
||||
debug!(n_total, activated = activation.total(), "PartitionRunner controller: initial activation");
|
||||
|
||||
let mut cpu_sample = CpuSample::now();
|
||||
let mut io_sample = IoSample::now();
|
||||
let mut completed = 0usize;
|
||||
|
||||
while completed < n_total {
|
||||
let Ok(event) = event_rx.recv() else { break };
|
||||
debug!(completed, n_total, "PartitionRunner controller: waiting for an event");
|
||||
let Ok(event) = event_rx.recv() else {
|
||||
debug!("PartitionRunner controller: event channel closed, stopping");
|
||||
break;
|
||||
};
|
||||
match event {
|
||||
WorkerEvent::Completed(i, r, dur) => {
|
||||
match r {
|
||||
|
||||
@@ -350,7 +350,7 @@ impl KmerIndex {
|
||||
// every single variant — fine at the scale of a handful of test
|
||||
// k-mers, but with billions of lookups against a real index this
|
||||
// manifested as ~90% system time, observed in practice. ───────────
|
||||
let n_workers = std::thread::available_parallelism().map(|n| n.get()).unwrap_or(4);
|
||||
let n_workers = obisys::effective_parallelism();
|
||||
let capacity = 256;
|
||||
|
||||
// Throttling is not optional once a `Flat` stage is in the pipeline
|
||||
@@ -976,7 +976,23 @@ mod tests {
|
||||
/// the same primitives `obikmer`'s `scatter` step uses (minus the
|
||||
/// multi-file `obipipeline` wrapper — a single sequence needs none of
|
||||
/// that): normalise -> build superkmers -> route -> write.
|
||||
/// `cargo test` doesn't install a `tracing` subscriber the way `obikmer`'s
|
||||
/// CLI does, so `debug!`/etc. are silent no-ops by default — including the
|
||||
/// `PartitionRunner` instrumentation that would matter most for
|
||||
/// re-diagnosing a hang here. `try_init` is idempotent across concurrently
|
||||
/// running tests (later calls just find a subscriber already installed).
|
||||
fn init_tracing() {
|
||||
let _ = tracing_subscriber::fmt()
|
||||
.with_env_filter(
|
||||
tracing_subscriber::EnvFilter::try_from_default_env()
|
||||
.unwrap_or_else(|_| tracing_subscriber::EnvFilter::new("info")),
|
||||
)
|
||||
.with_writer(std::io::stderr)
|
||||
.try_init();
|
||||
}
|
||||
|
||||
fn build_single_genome_index(dir: &Path, label: &str, seq: &[u8]) -> KmerIndex {
|
||||
init_tracing();
|
||||
let fasta_path = dir.join(format!("{label}.fasta"));
|
||||
let mut f = std::fs::File::create(&fasta_path).unwrap();
|
||||
writeln!(f, ">{label}").unwrap();
|
||||
|
||||
@@ -1,6 +1,6 @@
|
||||
[package]
|
||||
name = "obikmer"
|
||||
version = "1.1.40"
|
||||
version = "1.1.44"
|
||||
edition = "2024"
|
||||
|
||||
[[bin]]
|
||||
|
||||
@@ -38,9 +38,7 @@ pub struct CommonArgs {
|
||||
#[arg(
|
||||
short = 'T',
|
||||
long,
|
||||
default_value_t = std::thread::available_parallelism()
|
||||
.map(|n| n.get())
|
||||
.unwrap_or(1)
|
||||
default_value_t = obisys::effective_parallelism()
|
||||
)]
|
||||
pub threads: usize,
|
||||
|
||||
|
||||
@@ -70,9 +70,7 @@ pub struct QueryArgs {
|
||||
#[arg(
|
||||
short = 'T',
|
||||
long,
|
||||
default_value_t = std::thread::available_parallelism()
|
||||
.map(|n| n.get())
|
||||
.unwrap_or(1)
|
||||
default_value_t = obisys::effective_parallelism()
|
||||
)]
|
||||
pub threads: usize,
|
||||
|
||||
|
||||
+33
-17
@@ -7,12 +7,28 @@
|
||||
//! different value panics. This prevents silent divergence between the global
|
||||
//! parameter and the values used to build data structures.
|
||||
//!
|
||||
//! In test builds (`#[cfg(test)]`) the same public API is backed by
|
||||
//! `thread_local!` [`Cell`]s instead. Each test thread gets its own
|
||||
//! independent copies of `K` and `M`, so tests can use arbitrary values
|
||||
//! without coordinating with one another and without any reset mechanism.
|
||||
//! The `OnceLock` constraint is deliberately absent: test isolation is
|
||||
//! provided by thread locality, not by write-once semantics.
|
||||
//! In test builds (`#[cfg(test)]`) the same public API is backed by plain
|
||||
//! process-wide atomics instead, freely overwritable (no write-once
|
||||
//! constraint) so tests don't need a reset mechanism between runs.
|
||||
//!
|
||||
//! An earlier version of this module used `thread_local!` `Cell`s here,
|
||||
//! reasoning that "each test thread gets its own copy" gives isolation
|
||||
//! between tests using different `k`/`m` values. That assumption broke as
|
||||
//! soon as any code under test fanned work out to *other* threads it
|
||||
//! doesn't control — `PartitionRunner`'s pre-spawned workers, or a bare
|
||||
//! `rayon::par_iter()` — since a freshly spawned thread never inherits the
|
||||
//! calling test thread's thread-local state, silently reading back `k=0`
|
||||
//! there instead (surfaced as a `bitvec`/slice-indexing panic deep inside
|
||||
//! whatever used the bogus length). Process-wide atomics make `k()`/`m()`
|
||||
//! correct on *any* thread without every call site having to know to
|
||||
//! re-propagate them. Unset still silently reads back as `0` (same as the
|
||||
//! old `Cell` default) rather than panicking: several existing tests read
|
||||
//! `m()` without ever calling `set_m` themselves, relying on that default.
|
||||
//! The trade-off: tests that genuinely need different `k`/`m` values from
|
||||
//! other tests must not run concurrently with them in the same process (in
|
||||
//! practice: every test file in this workspace already uses one fixed
|
||||
//! `k`/`m` pair for all its own tests, so this doesn't currently cost
|
||||
//! anything).
|
||||
|
||||
// ── Production implementation ─────────────────────────────────────────────────
|
||||
|
||||
@@ -44,22 +60,22 @@ mod state {
|
||||
|
||||
// ── Test implementation ───────────────────────────────────────────────────────
|
||||
//
|
||||
// Each test thread owns its private K and M via thread_local!, so tests may
|
||||
// call set_k / set_m with any value without affecting other tests.
|
||||
// Process-wide, freely overwritable (no write-once constraint), visible from
|
||||
// any thread — including threads a test doesn't spawn itself (rayon workers,
|
||||
// PartitionRunner workers, ...). `0` (never explicitly set) is returned as-is,
|
||||
// same default as the old thread-local `Cell`.
|
||||
|
||||
#[cfg(any(test, feature = "test-utils"))]
|
||||
mod state {
|
||||
use std::cell::Cell;
|
||||
use std::sync::atomic::{AtomicUsize, Ordering};
|
||||
|
||||
thread_local! {
|
||||
static K: Cell<usize> = Cell::new(0);
|
||||
static M: Cell<usize> = Cell::new(0);
|
||||
}
|
||||
static K: AtomicUsize = AtomicUsize::new(0);
|
||||
static M: AtomicUsize = AtomicUsize::new(0);
|
||||
|
||||
pub fn set_k(k: usize) { K.with(|c| c.set(k)); }
|
||||
pub fn k() -> usize { K.with(|c| c.get()) }
|
||||
pub fn set_m(m: usize) { M.with(|c| c.set(m)); }
|
||||
pub fn m() -> usize { M.with(|c| c.get()) }
|
||||
pub fn set_k(k: usize) { K.store(k, Ordering::SeqCst); }
|
||||
pub fn k() -> usize { K.load(Ordering::SeqCst) }
|
||||
pub fn set_m(m: usize) { M.store(m, Ordering::SeqCst); }
|
||||
pub fn m() -> usize { M.load(Ordering::SeqCst) }
|
||||
}
|
||||
|
||||
// ── Public API (identical signature in both configurations) ───────────────────
|
||||
|
||||
@@ -102,9 +102,9 @@ fn roundtrip_single() {
|
||||
|
||||
#[test]
|
||||
fn roundtrip_all_lengths() {
|
||||
obikseq::params::set_k(11);
|
||||
setup();
|
||||
let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
|
||||
for len in (11..=19).chain([255, 256, 257]) {
|
||||
for len in (TEST_K..=19).chain([255, 256, 257]) {
|
||||
let sk = make_sk(&bases[..len]);
|
||||
let mut buf = Vec::new();
|
||||
sk.write_to_binary(&mut buf).unwrap();
|
||||
|
||||
+89
-3
@@ -202,6 +202,94 @@ fn cgroup_v1_available() -> Option<u64> {
|
||||
Some(limit.saturating_sub(used))
|
||||
}
|
||||
|
||||
// ── CPU parallelism query ────────────────────────────────────────────────────
|
||||
|
||||
/// Returns the number of cores this process can actually use concurrently.
|
||||
///
|
||||
/// `std::thread::available_parallelism()` reads CPU affinity
|
||||
/// (`sched_getaffinity`), not the container's CPU quota — a Docker/cgroup
|
||||
/// container commonly reports the *host's* full core count this way while
|
||||
/// actually being throttled (via `cpu.max`/`cpu.cfs_quota_us`) to a fraction
|
||||
/// of a core. Sizing a thread/worker pool off the unthrottled count causes
|
||||
/// severe oversubscription: dozens of threads contending for a sliver of
|
||||
/// real CPU time, which can look indistinguishable from a hang for minutes
|
||||
/// or hours (observed in CI). On Linux, this reads the cgroup CPU quota
|
||||
/// first and returns `min(cgroup_quota, host_parallelism)` when a finite
|
||||
/// quota is found; falls back to `available_parallelism()` otherwise (same
|
||||
/// convention as [`available_memory_bytes`]).
|
||||
pub fn effective_parallelism() -> usize {
|
||||
let host = std::thread::available_parallelism().map(|n| n.get()).unwrap_or(1);
|
||||
#[cfg(target_os = "linux")]
|
||||
{
|
||||
if let Some(quota) = cgroup_v2_cpu_quota() {
|
||||
let effective = quota.clamp(1, host);
|
||||
tracing::debug!(host, quota, effective, source = "cgroup v2", "effective_parallelism");
|
||||
return effective;
|
||||
}
|
||||
if let Some(quota) = cgroup_v1_cpu_quota() {
|
||||
let effective = quota.clamp(1, host);
|
||||
tracing::debug!(host, quota, effective, source = "cgroup v1", "effective_parallelism");
|
||||
return effective;
|
||||
}
|
||||
}
|
||||
tracing::debug!(host, effective = host, source = "available_parallelism (no cgroup quota found)", "effective_parallelism");
|
||||
host
|
||||
}
|
||||
|
||||
/// cgroup v2 (unified hierarchy): reads `cpu.max` ("<quota> <period>", or
|
||||
/// "max <period>" when unlimited) for the current process's cgroup, rounded
|
||||
/// up to whole cores. Returns `None` if unlimited or on any parse error.
|
||||
#[cfg(target_os = "linux")]
|
||||
fn cgroup_v2_cpu_quota() -> Option<usize> {
|
||||
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
|
||||
let rel = cgroup
|
||||
.lines()
|
||||
.find(|l| l.starts_with("0::"))?
|
||||
.strip_prefix("0::")?
|
||||
.trim();
|
||||
let base = format!("/sys/fs/cgroup{rel}");
|
||||
let raw = std::fs::read_to_string(format!("{base}/cpu.max")).ok()?;
|
||||
let mut parts = raw.split_whitespace();
|
||||
let quota_str = parts.next()?;
|
||||
let period: f64 = parts.next()?.parse().ok()?;
|
||||
if quota_str == "max" {
|
||||
return None; // unlimited
|
||||
}
|
||||
let quota: f64 = quota_str.parse().ok()?;
|
||||
Some((quota / period).ceil().max(1.0) as usize)
|
||||
}
|
||||
|
||||
/// cgroup v1 (cpu subsystem): reads `cpu.cfs_quota_us`/`cpu.cfs_period_us`,
|
||||
/// rounded up to whole cores. Returns `None` if unlimited (quota <= 0) or on
|
||||
/// any parse error.
|
||||
#[cfg(target_os = "linux")]
|
||||
fn cgroup_v1_cpu_quota() -> Option<usize> {
|
||||
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
|
||||
let path = cgroup
|
||||
.lines()
|
||||
.find(|l| l.contains(":cpu:") || l.contains(":cpu,cpuacct:"))?
|
||||
.split(':')
|
||||
.nth(2)?;
|
||||
let base = format!("/sys/fs/cgroup/cpu{path}");
|
||||
let quota: i64 = std::fs::read_to_string(format!("{base}/cpu.cfs_quota_us"))
|
||||
.ok()?
|
||||
.trim()
|
||||
.parse()
|
||||
.ok()?;
|
||||
if quota <= 0 {
|
||||
return None; // unlimited
|
||||
}
|
||||
let period: i64 = std::fs::read_to_string(format!("{base}/cpu.cfs_period_us"))
|
||||
.ok()?
|
||||
.trim()
|
||||
.parse()
|
||||
.ok()?;
|
||||
if period <= 0 {
|
||||
return None;
|
||||
}
|
||||
Some(((quota as f64) / (period as f64)).ceil().max(1.0) as usize)
|
||||
}
|
||||
|
||||
// ── raw helpers ───────────────────────────────────────────────────────────────
|
||||
|
||||
fn get_rusage() -> rusage {
|
||||
@@ -654,9 +742,7 @@ impl fmt::Display for Reporter {
|
||||
return Ok(());
|
||||
}
|
||||
|
||||
let n_cores = std::thread::available_parallelism()
|
||||
.map(|n| n.get())
|
||||
.unwrap_or(1);
|
||||
let n_cores = effective_parallelism();
|
||||
|
||||
// column widths
|
||||
let nw = self
|
||||
|
||||
Reference in New Issue
Block a user