Compare commits

..
Author SHA1 Message Date
Eric Coissac f5e508ed33 feat: add multi-genome SNP pseudo-alignment and CLI export
Release / create-release (push) Successful in 5m58s
Release / build-macos-arm64 (push) Successful in 2m47s
Release / build-linux-x86_64 (push) Successful in 8m50s
CI / build (pull_request) Canceled after 5m42s
Introduces a `SnpAlignment` struct and helper methods to construct per-genome SNP pseudo-alignments from sibling k-mer data, filtering monomorphic families and encoding bases as IUPAC ambiguity codes. Exposes the type at the crate root for simplified imports. Adds a `--snp` CLI flag to compute and export these alignments as an IUPAC-coded FASTA file. Updates theory documentation to propose a multi-genome framing approach for joint phylogenetic inference, resolving pairwise correspondence ambiguities through positional homology and partial coverage thresholds. Bumps crate version to 1.1.40.
2026-08-10 22:38:38 +02:00
Eric Coissac 49f329edd5 feat: add raw SNP distance calculation and CLI flag
Exposes RawSnpDistanceOutput and implements KmerIndex::raw_snp_distance() to compute pairwise single-copy locus counts under a paralogy-aware rule. The implementation leverages ndarray for parallel matrix aggregation, producing raw p-distance matrices for sanity-checking. A --raw-snp-distance CLI flag is added to export results as CSV, mapping zero-eligible pairs to NA.
2026-08-10 22:17:07 +02:00
Eric Coissac 1a470eab9e Refactor k-mer sibling tracking to compact bitmask and on-demand counts
Replaces the explicit `SiblingInfo` struct and 3-bit minorant flags with a derived 4-bit presence mask (`FamilyMask`) that tracks observed bases per family. This eliminates redundant file I/O overhead by introducing a `PartitionCache` for batch lookups, simplifies serialization, and updates all downstream builders, stats computation, and tests to operate on the new bitmask representation. Adjusts CLI output to report deduplicated family sizes instead of histograms, ignores generated CSV files, and updates documentation to reflect the fixed canonical reference and new theory.
2026-08-10 17:53:52 +02:00
Eric Coissac ba990a48a0 feat: add obipipeline for concurrent sibling annex stats
Add the `obipipeline` crate and replace sequential scatter/gather logic with a concurrent pipeline using `Flat` and `Transform` stages. Introduce `SiblingAnnexStats` API to compute distributions, and add CLI flags to `distance.rs` for constructing the annex and exporting statistics as CSV.
2026-08-10 15:31:04 +02:00
Eric Coissac ea914bb536 feat: implement per-k-mer sibling counts and central neighbor generation
Introduce the siblingannex module in obicompactvec to store per-slot minorant flags and sibling counts in a memory-mapped annex file. Add a scatter-gather pipeline in obikindex to compute these values across index layers and write them to .psib files. Implement central_canonical_neighbors in obikseq for generating strand-aware k-mer variants around the middle base. Expose rolling statistics in obiskbuilder and update dependency graphs accordingly.
2026-08-10 15:01:59 +02:00
Eric Coissac 8bc6d533e5 feat: support negative count filters as group size offsets
Updates CLI parsing to accept negative integers for count filters, interpreting them as offsets from the group size (e.g., `-1` means all but one). A resolution closure enforces a floor of 1 to prevent unconstrained filtering on small groups. Additionally, refines evolutionary distance documentation to condition comparisons on local homology, replacing union-based Jaccard with a self-contained `SnpTally`. This unified approach streamlines SNP and shared count computation, incorporates paralogy and heterozygosity handling, and enables direct derivation of corrected distance matrices without external dependencies.
2026-08-10 12:38:35 +02:00
Eric Coissac 45df9919e5 docs: add central-position SNP distance estimator spec
Introduces a design specification for inferring substitution rates directly from k-mers with conserved flanks. The document details a memory-efficient implementation that computes 4x4 base-pair tallies using existing MPHF structures, enabling classical corrections without de Bruijn graph materialization. Updates MkDocs navigation to include the new theory page.
2026-07-10 09:49:49 +02:00
Eric Coissac 2610a4af79 feat: add Mash distance metric and rolling entropy support
Implement the Mash distance metric across the CLI, index, and compact vector traits. This includes adding a `Mash` variant to the `DistanceMetric` enum and `MetricArg` CLI argument, implementing the conversion from Jaccard distances using the standard mutation-rate estimator formula, and updating documentation with supported metrics and algorithmic references. Additionally, add an `entropy` method to rolling statistics for computing order-specific entropy.
2026-07-09 11:40:48 +02:00
coissac dc3392865f Merge pull request 'Push qowsvpqmoukq' (#61) from push-qowsvpqmoukq into main
Reviewed-on: #61
2026-07-08 18:05:42 +00:00
Eric Coissac fd2c23e7df refactor: remove equivalence class folding from entropy pipeline
Release / create-release (push) Successful in 2m27s
Release / build-linux-x86_64 (push) Successful in 8m17s
Release / build-macos-arm64 (push) Successful in 1m41s
CI / build (pull_request) Successful in 3m33s
Removes circular-reverse complement machinery and explicit k-mer canonicalization across the entropy pipeline. Frequency tallying and Shannon entropy computation now operate directly on raw k-mer values, eliminating prior score inflation and alignment-dependent artifacts while preserving orientation invariance. Updates build scripts to generate normalized lookup tables for k-mer lengths 1–6, restricts the public API to `EntropyTracker`, and bumps crate versions. Documentation is updated to reflect the simplified raw-value approach and revised module structure.
2026-07-08 19:36:30 +02:00
Eric Coissac 912f788f7f feat: extract k-mer entropy computation into new obikentropy crate
Extracts streaming entropy logic and sliding-window frequency tracking from obiskbuilder into a dedicated obikentropy crate. Introduces an EntropyTracker accumulator for O(1) per-base normalized Shannon entropy, replaces inline rolling statistics with delegated state management, and updates workspace dependencies across obikindex, obikpartitionner, and obiskbuilder. Adds criterion benchmarks to validate the refactored pipeline throughput.
2026-07-08 18:36:16 +02:00
Eric Coissac e725523898 feat: add entropy-driven k-mer complexity filtering
Introduces a MinComplexity filter driven by new CLI arguments, enabling sequence-aware threshold checks during index reconstruction and partitioning. Adds the kmer_entropy module for normalized complexity scoring, updates the KmerFilter trait to evaluate per-kmer context, and refactors test modules for better organization.
2026-07-08 12:48:25 +02:00
coissac 165982fb07 Merge pull request 'Bump obikmer version to 1.1.38 and add memory footprint logging' (#60) from push-slxmykzqmzzv into main
Reviewed-on: #60
2026-07-08 10:15:51 +00:00
Eric Coissac 2740f52326 Bump obikmer version to 1.1.38 and add memory footprint logging
Release / create-release (push) Successful in 2m26s
CI / build (pull_request) Successful in 3m32s
Release / build-linux-x86_64 (push) Successful in 8m8s
Release / build-macos-arm64 (push) Successful in 1m43s
Updates Cargo.toml version from 1.1.37 to 1.1.38. Adds explicit memory footprint estimation for the `by_partition` k-mer dedup HashMap by computing capacity-based byte sizes for map slots and stored descriptors. These metrics are logged via `debug!` to track actual memory pressure during chunk processing.
2026-07-08 12:14:58 +02:00
coissac dff5d2f457 Merge pull request 'Push smluomvxpptv' (#59) from push-smluomvxpptv into main
Reviewed-on: #59
2026-07-07 17:13:03 +00:00
Eric Coissac eea884f393 ci: improve release workflow and bump obikmer to v1.1.37
Release / create-release (push) Successful in 2m27s
CI / build (pull_request) Successful in 3m32s
Release / build-linux-x86_64 (push) Successful in 8m5s
Release / build-macos-arm64 (push) Successful in 1m41s
Replace inline `docker run` with explicit container lifecycle management to improve isolation and verify exit statuses. Bump `obikmer` crate version to 1.1.37. Add debug logging for sparse hit structure memory tracking, update chunk memory documentation to reflect the Findere rework, and clarify `BYTES_PER_KMER_PER_GENOME` as a pathological bound for safety tuning.
2026-07-07 19:11:50 +02:00
Eric Coissac ae42a061bd perf: optimize k-mer queries with sparse index and run-based aggregation
Replaces the dense `KmerResults` matrix with a sparse `SmerIndex` (`Vec<bool>` + offsets) that tracks k-mer presence independently of per-genome counts. Introduces a new aggregation pass, `sparse_findere_for_genome`, which sorts hits, detects contiguous runs, and applies monotone-deque scans to compute sliding-window minimums. This reduces query complexity from O(n_smers) to O(hits log hits), significantly lowering memory overhead and computational cost for low-density queries. Adds a deterministic PRNG and dense reference oracle in tests to validate correctness against randomized inputs without external property-testing crates.
2026-07-07 18:56:41 +02:00
Eric Coissac 040eff140c refactor(query): optimize mmap locality with column-major matrix fetch
Refactor the query pipeline into a two-stage MPHF hit-detection pass followed by a column-major matrix fetch to improve cache efficiency. Introduce a QueryHit enum for event-driven callbacks, decoupling hit detection from data population. Add scan/fetch metrics to QueryStats, update Phase 4 architecture docs, and align tests with the new callback signature.
2026-07-07 18:44:09 +02:00
Eric Coissac a348637f3b refactor(query): deduplicate k-mers upfront and split MPHF lookup
Refactor `QueryBatch` construction to perform canonical k-mer deduplication and partition routing during initialization, eliminating post-batch splitting. Split the `QueryLayer` MPHF lookup into separate `find_slot` and `fill_row` methods, updating callbacks to pass occurrence descriptors instead of indices. Introduce `QueryStats` for tracking MPHF calls and dereplication ratios, and add comprehensive unit tests for batch construction, stats arithmetic, and safe partition handling. Expose new query-layer types in the public API.
2026-07-07 18:36:25 +02:00
Eric Coissac 9d7ced4493 perf(query): replace static divisor with dynamic overhead multiplier
Replaces the static 16 divisor with a dynamic overhead_multiplier that scales chunk size based on n_genomes, the --detail flag, and a safety factor. This bounds per-chunk memory usage to ≤50% of available RAM across concurrent workers by accounting for genome-scaled k-mer buffers and optional coverage data.
2026-07-07 16:14:10 +02:00
Eric Coissac 9d49929b0c refactor(query): implement throttled per-file streaming pipeline
Replace the flat chunk iterator with a throttled, per-file streaming architecture using `obipipeline::throttle`. The new `GuardedChunkIter` binds file handles to their `ThrottleGuard`, enforcing concurrent open-file limits and tracking active files via an atomic counter. Pipeline stages and the progress spinner are updated to support this resource-aware, parallelized I/O flow.
2026-07-07 16:07:33 +02:00
Eric Coissac 61c390503d feat(query): add throughput metering and --max-open-files flag
Introduces an EMA-based throughput meter that dynamically updates a spinner with MB/s rates, along with atomic counters for tracking cumulative bytes and active chunks. Adds final pipeline reporting and consolidates imports for cleaner performance instrumentation.
2026-07-07 15:19:09 +02:00
Eric Coissac 8f0ceec784 docs: clarify query processing and add performance roadmap
Clarifies that query processing is fully inlined within `process_chunk` using flat allocations, refining monotone-deque sliding window semantics and `kmer_missing` tracking. Updates `QueryLayer::open` variant precedence and introduces a phased roadmap (Phases 0–6) to address performance bottlenecks through parallel I/O, genome-aware chunk sizing, k-mer dereplication, NUMA-aware matrix fetches, and sparse Findere rework.
2026-07-07 15:12:09 +02:00
Eric Coissac 00b4b1fa51 docs: add future work section for parallel gzip decompression
Proposes replacing the single-threaded niffler/flate2 pipeline in `obiread::xopen` with `rapidgzip-rs` for local `.gz` files. Details constraints such as path dependencies, non-seekable streams, C++ toolchain requirements, and binding maturity. Marks the optimization as parked pending throughput and correctness validation.
2026-07-07 13:43:01 +02:00
coissac e96ad38c8e Merge pull request 'feat: filter zero-valued entries from kmer strict matches output' (#58) from push-rosnxrytzxzk into main
Reviewed-on: #58
2026-07-07 09:22:02 +00:00
Eric Coissac 4fc7860825 feat: filter zero-valued entries from kmer strict matches output
Release / create-release (push) Successful in 2m32s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Failing after 31s
CI / build (pull_request) Successful in 3m23s
Optimize query serialization by conditionally excluding genomes with zero total matches. This reduces JSON payload size while preserving the label-to-count mapping structure. Updates architecture documentation and bumps version to 1.1.36.
2026-07-07 10:50:01 +02:00
coissac 5bdc0f826a Merge pull request 'fix: validate packed matrix columns before repacking' (#57) from push-vkqvorvsqnqx into main
Reviewed-on: #57
2026-07-03 15:26:55 +00:00
Eric Coissac cd2f2f9417 fix: validate packed matrix columns before repacking
Release / create-release (push) Successful in 2m27s
Release / build-linux-x86_64 (push) Successful in 8m15s
Release / build-macos-arm64 (push) Failing after 30s
CI / build (pull_request) Successful in 3m17s
Add header parsing helpers to extract column counts without memory mapping. Update packing functions to verify existing files match current metadata, preventing stale or widened-column artifacts. Extract inline tests in obilayeredmap to an external module and add comprehensive aggregation tests. Bump obikmer to 1.1.35 and clean up repository configuration.
2026-07-03 17:20:22 +02:00
coissac 7844239a8e Merge pull request 'Push msotyzponsls' (#56) from push-msotyzponsls into main
Reviewed-on: #56
2026-07-03 11:28:49 +00:00
Eric Coissac 2b37e8aac4 fix(bitmatrix): explicitly compute diagonal entries for self-similarity
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Failing after 30s
CI / build (pull_request) Successful in 3m21s
The pairwise matrix functions now explicitly calculate and overwrite diagonal entries using `f(i,i)`, replacing previous implicit symmetric mirroring or default values. Documentation has been updated to clarify that diagonals represent self-comparison weights, ensuring accurate self-similarity calculations. Additionally, the obikmer crate version has been bumped to 1.1.34.
2026-07-03 13:04:40 +02:00
Eric Coissac 67b4e4da53 refactor(numa): replace flat runner with per-node activation channels
Shifts the NUMA-aware runner from a flat, round-robin model to a per-node architecture using dedicated `NodeActivation` channels. Replaces absolute deltas with relative scaling based on the previous growth step's worker count, decoupling growth from node count to fix slow ramp-up and enforce per-node fairness. Updates architecture documentation to reflect these changes and focus tuning questions on `INITIAL`/`GROWTH_DIVISOR` parameters for I/O-bound validation.
2026-07-03 13:03:31 +02:00
coissac 66ab4c6db1 Merge pull request 'feat(numa): introduce I/O sampling to prevent activation stalls' (#55) from push-ooruxnkktvvz into main
Reviewed-on: #55
2026-07-02 09:36:19 +00:00
Eric Coissac f84dd539bf feat(numa): introduce I/O sampling to prevent activation stalls
Release / create-release (push) Successful in 2m25s
Release / build-linux-x86_64 (push) Successful in 8m47s
Release / build-macos-arm64 (push) Failing after 31s
CI / build (pull_request) Successful in 3m30s
Replaces the monolithic CPU scaling threshold with separate CPU and I/O spawn thresholds. Introduces an `IoSample` struct with platform-specific byte reading and a relative throughput growth heuristic. Adds a 0.1s wall-clock guard to `CpuSample` to suppress artificial efficiency spikes, and updates `maybe_activate` to trigger worker scaling when either resource indicates headroom. Bumps `obikmer` to v1.1.33 and updates architecture documentation.
2026-07-02 10:07:22 +02:00
coissac 6378734e1c Merge pull request 'fix(obisys): remove activation guard to always update metrics' (#54) from push-vkloynurrxzu into main
Reviewed-on: #54
2026-07-01 18:34:10 +00:00
Eric Coissac b3a617cce1 fix(obisys): remove activation guard to always update metrics
Release / create-release (push) Successful in 2m26s
CI / build (pull_request) Successful in 3m35s
Release / build-linux-x86_64 (push) Successful in 8m9s
Release / build-macos-arm64 (push) Failing after 30s
Removes the `if activate` conditional in `src/obisys/src/lib.rs`, making debug logging and state updates for performance counters execute unconditionally. This ensures tracking metrics are continuously refreshed regardless of the activation threshold. Also bumps the `obikmer` dependency version.
2026-07-01 20:32:56 +02:00
coissac 2080e5e8a9 Merge pull request 'ci: fix registry auth and bump obikmer to 1.1.30' (#53) from push-zxlknspoxknt into main
Reviewed-on: #53
2026-07-01 14:20:09 +00:00
Eric Coissac 45ed2bc9b8 ci: fix registry auth and bump obikmer to 1.1.30
Release / create-release (push) Successful in 2m26s
Release / build-linux-x86_64 (push) Successful in 8m12s
Release / build-macos-arm64 (push) Failing after 1m55s
CI / build (pull_request) Successful in 3m32s
Update the release workflow to explicitly resolve the Docker registry username from repository secrets instead of inferring it from the runner's actor. Bump the obikmer package version to 1.1.30.
2026-07-01 14:31:30 +02:00
coissac aa126fd89d Merge pull request 'feat: simplify worker spawning logic and update macOS build workflow' (#52) from push-uvmlknmzqqnx into main
Reviewed-on: #52
2026-07-01 09:50:51 +00:00
Eric Coissac c612132763 feat: simplify worker spawning logic and update macOS build workflow
Release / create-release (push) Successful in 2m59s
Release / build-linux-x86_64 (push) Successful in 8m13s
Release / build-macos-arm64 (push) Failing after 8s
CI / build (pull_request) Successful in 3m24s
Updates the release workflow to run macOS builds inside a Docker container with explicit registry authentication and adjusted artifact paths. Bumps the obikmer crate version to 1.1.29 and adds *.log to .gitignore. Simplifies NUMA worker spawning by lowering the activation threshold from 0.95 to 0.2, replacing complex stateful tracking with a direct efficiency check, and downgrading progress logging to debug level. Includes general code formatting improvements for readability.
2026-07-01 11:40:57 +02:00
coissac 19660f8cd0 Merge pull request 'ci: update registry auth and improve adaptive worker scaling' (#51) from push-qlpywtroutvx into main
Reviewed-on: #51
2026-06-26 13:16:23 +00:00
Eric Coissac 7b07540a69 ci: update registry auth and improve adaptive worker scaling
Release / create-release (push) Successful in 2m27s
CI / build (pull_request) Successful in 3m17s
Release / build-linux-x86_64 (push) Successful in 8m3s
Release / build-macos-arm64 (push) Failing after 1s
Refactor the release workflow to use a structured container object with authenticated pulls for macOS ARM64 builds. Replace single-worker activation with dynamic upfront provisioning based on node and worker counts. Implement an absolute efficiency gain threshold for scaling checks and add early termination to improve adaptive scaling stability. Bump obikmer crate version to 1.1.27.
2026-06-26 15:13:13 +02:00
coissac 89c43e28f5 Merge pull request 'ci: update release workflow and bump obikmer to 1.1.26' (#50) from push-npttlqpomtvz into main
Reviewed-on: #50
2026-06-24 13:55:40 +00:00
Eric Coissac b9b2e42ad2 ci: update release workflow and bump obikmer to 1.1.26
Release / create-release (push) Successful in 2m32s
CI / build (pull_request) Successful in 3m47s
Release / build-linux-x86_64 (push) Successful in 8m18s
Release / build-macos-arm64 (push) Failing after 0s
Replaces the macOS ARM64 cross-compilation container with a custom internal registry image. Adds explicit steps to install the `aarch64-apple-darwin` Rust target and `jq`, and updates the build command to use `--no-default-features`. Bumps the `obikmer` package version from 1.1.25 to 1.1.26.
2026-06-24 15:55:02 +02:00
coissac ca42fdff2f Merge pull request 'ci: update macOS ARM64 build workflow and bump obikmer version' (#49) from push-lllnsqlrqrut into main
Reviewed-on: #49
2026-06-23 13:15:20 +00:00
Eric Coissac 136cd89efb ci: update macOS ARM64 build workflow and bump obikmer version
Release / create-release (push) Successful in 2m27s
Release / build-linux-x86_64 (push) Successful in 7m52s
Release / build-macos-arm64 (push) Failing after 8m53s
CI / build (pull_request) Successful in 5m31s
Replace manual Zig/cargo-zigbuild setup with a pre-configured Docker container (`joseluisq/rust-linux-darwin-builder`). Use explicit Clang cross-compilers for native macOS ARM64 compilation. Bump the `obikmer` package version to 1.1.25.
2026-06-23 15:01:17 +02:00
coissac a4bbf607b7 Merge pull request 'Push kxsopnzprltv' (#48) from push-kxsopnzprltv into main
Reviewed-on: #48
2026-06-23 09:51:33 +00:00
Eric Coissac 9927100a1c chore: update obikmer to 1.1.24
Release / create-release (push) Successful in 2m24s
Release / build-linux-x86_64 (push) Successful in 7m49s
Release / build-macos-arm64 (push) Failing after 3m31s
CI / build (pull_request) Successful in 3m22s
Bumps the obikmer version in Cargo.toml from 1.1.21 to 1.1.24 and updates Cargo.lock to align with the upstream patch release (1.1.23). This ensures consistent dependency resolution across builds.
2026-06-23 11:47:54 +02:00
Eric Coissac 527258f822 ci: enforce macOS 11.0 deployment target for ARM builds
Adds MACOSX_DEPLOYMENT_TARGET=11.0 environment variable and updates the cargo zigbuild target to aarch64-apple-darwin11.0 to explicitly require macOS 11.0 for ARM binary compilation.
2026-06-23 11:46:09 +02:00
coissac ef62f1947e Merge pull request 'chore: bump version to 1.1.21 and update obikindex features' (#47) from push-xwutoxpnxorz into main
Reviewed-on: #47
2026-06-23 08:31:31 +00:00
Eric Coissac d02316dcf6 chore: bump version to 1.1.21 and update obikindex features
Release / create-release (push) Successful in 2m29s
CI / build (pull_request) Successful in 4m36s
Release / build-linux-x86_64 (push) Successful in 10m25s
Release / build-macos-arm64 (push) Failing after 4m50s
Disables default features for the `obikindex` dependency and introduces a `[features]` block. The new `numa` feature is set as the default, conditionally enabling NUMA support in `obikindex`.
2026-06-23 10:30:39 +02:00
coissac c323b3eaef Merge pull request 'Bump obikmer to 1.1.20 and update release workflow' (#46) from push-wpnywwlwxrps into main
Reviewed-on: #46
2026-06-23 08:03:58 +00:00
Eric Coissac b77d8e9ca0 Bump obikmer to 1.1.20 and update release workflow
Release / create-release (push) Successful in 2m26s
CI / build (pull_request) Successful in 3m14s
Release / build-linux-x86_64 (push) Successful in 7m44s
Release / build-macos-arm64 (push) Failing after 7m13s
Update the Gitea release workflow to fetch a full git clone with complete history, ensuring all commits and tags are available for accurate version resolution. This prepares the repository for the standard patch-level release of obikmer v1.1.20.
2026-06-23 10:03:15 +02:00
coissac 7c5bab3694 Merge pull request 'fix(ci): restrict workflow to PRs and improve release tagging' (#45) from push-louqrszyuqpz into main
Reviewed-on: #45
2026-06-23 07:52:35 +00:00
Eric Coissac fab4e0d6de fix(ci): restrict workflow to PRs and improve release tagging
Release / create-release (push) Failing after 26s
Release / build-linux-x86_64 (push) Has been skipped
Release / build-macos-arm64 (push) Has been skipped
CI / build (pull_request) Successful in 3m17s
Restrict the CI pipeline to pull request events only by removing the unconfigured push trigger and eliminating a duplicate pull_request block in the workflow file. Update the Makefile to suppress stderr from the aichat command and introduce a fallback release tag message for robust version tagging. Additionally, bump the obikmer crate version to 1.1.19.
2026-06-23 09:42:23 +02:00
coissac 973a3f3d6e Merge pull request 'feat: add numa feature flag and automate release workflow' (#44) from push-uymxyvsyooro into main
CI / build (push) Successful in 3m16s
Reviewed-on: #44
2026-06-23 07:22:33 +00:00
Eric Coissac 1a839a295a feat: add numa feature flag and automate release workflow
Release / create-release (push) Failing after 37s
Release / build-linux-x86_64 (push) Has been skipped
Release / build-macos-arm64 (push) Has been skipped
CI / build (pull_request) Successful in 3m23s
Refactor the Gitea release pipeline to generate releases via API and upload binaries using a shared ID. Automate changelog generation by fetching recent commits with `jj log` and producing markdown notes via `aichat`. Convert `hwlocality` to an optional dependency gated by a default `numa` feature, providing fallback implementations for graceful degradation when NUMA support is disabled. Bump obikmer to 1.1.18.
2026-06-23 09:07:04 +02:00
coissac 2ea58703c7 Merge pull request 'Push zkptpswyxnvt' (#43) from push-zkptpswyxnvt into main
CI / build (push) Successful in 3m19s
Reviewed-on: #43
2026-06-22 16:29:59 +00:00
Eric Coissac ac3ef106e7 refactor: implement adaptive worker scaling and infallible NUMA build
Release / build-linux-static (push) Successful in 8m4s
CI / build (pull_request) Successful in 3m26s
Replaces the fallible NUMA topology builder with an infallible fallback that synthesizes a single-node UMA configuration on failure or absence. Refactors PartitionRunner to pre-spawn dormant workers and dynamically activate them via CPU efficiency thresholds, replacing static upfront spawning with adaptive scaling. Bumps obikmer crate version to 1.1.15.
2026-06-22 18:29:39 +02:00
Eric Coissac 469e53b6f5 Add genomic distance benchmarking suite and test data
Introduces scripts to compute and validate pairwise genomic distance matrices across multiple metrics. Updates the Makefile with build and comparison targets, adds .gitignore rules for generated outputs, and includes test CSV matrices and a Newick phylogenetic tree for validating the distance computation pipeline.
2026-06-22 18:24:30 +02:00
Eric Coissac 9f1df96ea7 ci: restrict push trigger to main branch
Replace the wildcard `['**']` in the push trigger with `['main']`. This prevents redundant pipeline runs on non-main branches during push events.
2026-06-22 16:58:44 +02:00
coissac 4e4cce2879 Merge pull request 'fix(ci): enable cross-compilation in release workflow and bump obikmer' (#42) from push-sxlpkrkyuttk into main
CI / build (push) Successful in 3m20s
Reviewed-on: #42
2026-06-22 14:31:26 +00:00
Eric Coissac 68b05b93c4 fix(ci): enable cross-compilation in release workflow and bump obikmer
CI / build (push) Successful in 4m38s
Release / build-linux-static (push) Successful in 10m14s
CI / build (pull_request) Successful in 3m40s
Injects PKG_CONFIG_ALLOW_CROSS=1 into the static binary build step to ensure correct native dependency resolution during musl target compilation with cargo zigbuild. Also updates the obikmer crate version from 1.1.13 to 1.1.14.
2026-06-22 16:31:04 +02:00
coissac 0a668cf8a6 Merge pull request 'chore: bump obikmer to 1.1.13 and fix Makefile revision tag' (#41) from push-qwzpxktnlyls into main
CI / build (push) Has been cancelled
Reviewed-on: #41
2026-06-22 14:18:25 +00:00
Eric Coissac e6d6942e2f chore: bump obikmer to 1.1.13 and fix Makefile revision tag
CI / build (push) Has been cancelled
Release / build-linux-static (push) Has been cancelled
CI / build (pull_request) Has been cancelled
Update the obikmer crate version from 1.1.12 to 1.1.13 in Cargo.toml. Additionally, change the Makefile's Git revision specifier from @- to @ to ensure the version tag is applied to the current commit before pushing.
2026-06-22 16:17:52 +02:00
coissac bf9c9aeacb Merge pull request 'chore: bump version to 1.1.12 and fix release workflow' (#40) from push-zmkxouxypspm into main
CI / build (push) Has been cancelled
Reviewed-on: #40
2026-06-22 14:13:13 +00:00
Eric Coissac 22a65857a1 chore: bump version to 1.1.12 and fix release workflow
CI / build (push) Successful in 3m14s
CI / build (pull_request) Successful in 3m51s
Update Cargo.toml to 1.1.12 for a semver patch release. Refactor the Makefile release target to explicitly retrieve the parent commit hash via `jj log` and apply the tag, replacing implicit working directory tagging. Remove `jj auto-describe` and `--change @` in favor of an explicit `git push origin` for the version tag.
2026-06-22 16:12:56 +02:00
coissac d16a867640 Merge pull request 'ci: bypass PEP 668 restrictions and update obikmer to 1.1.11' (#39) from push-mxysluysloxr into main
CI / build (push) Successful in 4m1s
Release / build-linux-static (push) Failing after 7m28s
Reviewed-on: #39
2026-06-22 13:52:51 +00:00
Eric Coissac 616050075f ci: bypass PEP 668 restrictions and update obikmer to 1.1.11
CI / build (push) Successful in 3m41s
CI / build (pull_request) Successful in 3m49s
Add the `--break-system-packages` flag to the `pip install ziglang` command in the Gitea release workflow to bypass PEP 668 restrictions on modern Linux distributions. Additionally, bump the `obikmer` crate version from 1.1.9 to 1.1.11 across both Cargo.toml and Cargo.lock.
2026-06-22 15:52:34 +02:00
coissac e22afe9621 Merge pull request 'chore: bump obikmer to 1.1.9 and update release workflow' (#38) from push-noxuppsknsol into main
CI / build (push) Successful in 3m11s
Release / build-linux-static (push) Failing after 3m4s
Reviewed-on: #38
2026-06-22 13:32:50 +00:00
Eric Coissac bdfac71e65 chore: bump obikmer to 1.1.9 and update release workflow
CI / build (push) Successful in 3m24s
CI / build (pull_request) Failing after 0s
Bumps the obikmer crate version from 1.1.7 to 1.1.9 in Cargo.toml and Cargo.lock. Updates the Gitea release workflow to dynamically locate the Zig compiler via Python, generating musl-targeted gcc/g++ wrapper scripts installed to /usr/local/bin for static Linux cross-compilation during releases.
2026-06-22 15:32:10 +02:00
coissac a00bb37478 Merge pull request 'ci: switch to Zig build toolchain and bump obikmer to 1.1.7' (#37) from push-nvvqmzmrotxx into main
CI / build (push) Successful in 3m14s
Release / build-linux-static (push) Failing after 2m42s
Reviewed-on: #37
2026-06-22 13:20:12 +00:00
Eric Coissac d30a4efd9b ci: switch to Zig build toolchain and bump obikmer to 1.1.7
CI / build (push) Successful in 3m12s
CI / build (pull_request) Successful in 3m16s
Replaces the musl-based static Linux build toolchain with Zig (`ziglang` via pip and `cargo-zigbuild`), removing `musl-tools` dependencies. The workflow now invokes `cargo zigbuild` for cross-compiling the static binary. Additionally, bumps the `obikmer` crate version to 1.1.7.
2026-06-22 15:19:39 +02:00
coissac 6baf2e64ca Merge pull request 'chore: bump obikmer to 1.1.6 and automate git tagging' (#36) from push-yxmtknzsynpx into main
CI / build (push) Successful in 3m20s
Release / build-linux-static (push) Failing after 4m30s
Reviewed-on: #36
2026-06-22 13:01:06 +00:00
Eric Coissac c0a71a2d49 chore: bump obikmer to 1.1.6 and automate git tagging
CI / build (push) Successful in 4m46s
CI / build (pull_request) Successful in 4m27s
Bumps the obikmer crate version from 0.1.4 to 1.1.6 in Cargo.toml and Cargo.lock. Updates the Makefile release target to automatically extract the version, create a Git tag, and push it to the remote repository, extending the existing workflow with standard Git publishing steps.
2026-06-22 15:00:36 +02:00
coissac a609c1af95 Merge pull request 'ci: streamline release workflow and bump obikmer to 0.1.4' (#35) from push-zokprynyqunu into main
CI / build (push) Successful in 4m41s
Release / build-linux-static (push) Failing after 6m4s
Reviewed-on: #35
2026-06-22 09:38:36 +00:00
Eric Coissac 3d32be8a83 ci: streamline release workflow and bump obikmer to 0.1.4
CI / build (push) Successful in 4m33s
CI / build (pull_request) Successful in 4m17s
Replaces the intermediate artifact upload step in the Gitea release workflow with a direct REST API call, eliminating unnecessary dependencies and adding `jq`. Also increments the obikmer crate version to 0.1.4.
2026-06-22 11:38:19 +02:00
coissac c4c71dc892 Merge pull request 'Push mtzqmmrlmzzx' (#34) from push-mtzqmmrlmzzx into main
CI / build (push) Successful in 4m34s
Reviewed-on: #34
2026-06-22 08:47:24 +00:00
Eric Coissac 4e625afaba refactor: update CI toolchain setup and optimize parallel indexing
CI / build (push) Successful in 4m56s
CI / build (pull_request) Successful in 4m11s
Update CI workflows to explicitly install the Rust toolchain via rustup and configure musl targets for deterministic static builds in Docker containers. Bump obikmer dependency to 0.1.3. Refactor obicompactvec to reduce peak memory usage by computing column sizes from filesystem metadata, add atomic writes, and implement cleanup guards. Replace parallel iteration patterns in obikindex with a structured PartitionRunner pipeline for simplified error handling and progress tracking.
2026-06-22 10:46:24 +02:00
coissac 9578f991f4 Merge pull request 'Push pslsukyowzrp' (#32) from push-pslsukyowzrp into main
Reviewed-on: #32
2026-06-15 16:29:24 +00:00
Eric Coissac 1cd7916e06 refactor: replace rayon with NUMA-aware PartitionRunner
Replaces `rayon` parallel iteration across index, rebuild, reindex, and select modules with a custom `PartitionRunner`. This introduces NUMA-aware task distribution with CPU pinning and round-robin scheduling, eliminating `Arc`, `Mutex`, and atomic synchronization primitives in favor of a flat, pre-spawned worker architecture. Error handling is simplified via `.map_err()` and the `?` operator, while progress bar updates are decoupled into dedicated callbacks.
2026-06-15 18:29:04 +02:00
69 changed files with 6590 additions and 1396 deletions
Vendored
BIN
View File
Binary file not shown.
+6 -3
View File
@@ -1,20 +1,23 @@
name: CI name: CI
on: on:
push:
branches: ['**']
pull_request: pull_request:
branches: ['main']
jobs: jobs:
build: build:
runs-on: ubuntu-latest runs-on: ubuntu-latest
container: rust:latest
defaults: defaults:
run: run:
working-directory: src working-directory: src
steps: steps:
- uses: actions/checkout@v4 - uses: actions/checkout@v4
- name: Install Rust
run: |
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh -s -- -y --default-toolchain stable
echo "$HOME/.cargo/bin" >> $GITHUB_PATH
- name: Cache cargo registry - name: Cache cargo registry
uses: actions/cache@v4 uses: actions/cache@v4
with: with:
+95 -15
View File
@@ -3,18 +3,58 @@ name: Release
on: on:
push: push:
tags: tags:
- 'v*' - "v*"
jobs: jobs:
build-linux-static: create-release:
runs-on: ubuntu-latest
outputs:
release_id: ${{ steps.create.outputs.release_id }}
steps:
- uses: actions/checkout@v4
with:
fetch-depth: 0
- name: Create Gitea release
id: create
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
TAG: ${{ github.ref_name }}
run: |
sudo apt-get update -qq && sudo apt-get install -y -qq jq
body=$(git for-each-ref --format='%(contents)' "refs/tags/$TAG")
release_id=$(curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases" \
-H "Authorization: token $GITEA_TOKEN" \
-H "Content-Type: application/json" \
-d "{\"tag_name\":\"$TAG\",\"name\":\"$TAG\",\"body\":$(echo "$body" | jq -Rs .)}" | jq -r '.id')
echo "release_id=$release_id" >> $GITHUB_OUTPUT
build-linux-x86_64:
needs: create-release
runs-on: ubuntu-latest runs-on: ubuntu-latest
container: rust:latest
defaults: defaults:
run: run:
working-directory: src working-directory: src
steps: steps:
- uses: actions/checkout@v4 - uses: actions/checkout@v4
- name: Install Rust + zigbuild
run: |
curl --proto '=https' --tlsv1.2 -sSf https://sh.rustup.rs | sh -s -- -y --default-toolchain stable
echo "$HOME/.cargo/bin" >> $GITHUB_PATH
sudo apt-get update -qq && sudo apt-get install -y -qq jq
pip install ziglang --quiet --break-system-packages
$HOME/.cargo/bin/cargo install cargo-zigbuild
$HOME/.cargo/bin/rustup target add x86_64-unknown-linux-musl
- name: Create musl C/C++ wrappers
run: |
ZIG=$(python3 -c "import ziglang, os; print(os.path.join(os.path.dirname(ziglang.__file__), 'zig'))")
printf '#!/bin/sh\nexec "%s" cc -target x86_64-linux-musl "$@"\n' "$ZIG" | sudo tee /usr/local/bin/x86_64-linux-musl-gcc > /dev/null
printf '#!/bin/sh\nexec "%s" c++ -target x86_64-linux-musl "$@"\n' "$ZIG" | sudo tee /usr/local/bin/x86_64-linux-musl-g++ > /dev/null
sudo chmod +x /usr/local/bin/x86_64-linux-musl-gcc /usr/local/bin/x86_64-linux-musl-g++
- name: Cache cargo registry - name: Cache cargo registry
uses: actions/cache@v4 uses: actions/cache@v4
with: with:
@@ -25,23 +65,63 @@ jobs:
key: linux-musl-cargo-${{ hashFiles('src/Cargo.lock') }} key: linux-musl-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: linux-musl-cargo- restore-keys: linux-musl-cargo-
- name: Install musl toolchain
run: |
apt-get update -qq && apt-get install -y -qq musl-tools
rustup target add x86_64-unknown-linux-musl
- name: Build static binary - name: Build static binary
run: cargo build --release --target x86_64-unknown-linux-musl env:
PKG_CONFIG_ALLOW_CROSS: "1"
run: cargo zigbuild --release --target x86_64-unknown-linux-musl
- name: Prepare artifact - name: Prepare and upload artifact
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
RELEASE_ID: ${{ needs.create-release.outputs.release_id }}
run: | run: |
mkdir -p /tmp/dist mkdir -p /tmp/dist
cp target/x86_64-unknown-linux-musl/release/obikmer /tmp/dist/obikmer-linux-x86_64 cp target/x86_64-unknown-linux-musl/release/obikmer /tmp/dist/obikmer-linux-x86_64
strip /tmp/dist/obikmer-linux-x86_64 strip /tmp/dist/obikmer-linux-x86_64
curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases/$RELEASE_ID/assets" \
-H "Authorization: token $GITEA_TOKEN" \
-F "attachment=@/tmp/dist/obikmer-linux-x86_64"
- name: Upload release asset build-macos-arm64:
uses: actions/upload-artifact@v4 needs: create-release
runs-on: ubuntu-latest
steps:
- uses: actions/checkout@v4
- name: Login to registry
run: echo "${{ secrets.REGISTRYTOKEN }}" | docker login registry.metabarcoding.org -u ${{ secrets.REGISTRYUSER }} --password-stdin
- name: Cache cargo registry
uses: actions/cache@v4
with: with:
name: obikmer-linux-x86_64 path: |
path: /tmp/dist/obikmer-linux-x86_64 ~/.cargo/registry
if-no-files-found: error ~/.cargo/git
src/target
key: macos-arm64-cargo-${{ hashFiles('src/Cargo.lock') }}
restore-keys: macos-arm64-cargo-
- name: Build macOS binary
run: |
CID=$(docker create \
-w /src/src \
registry.metabarcoding.org/cibuilder/rustcrossosx:latest \
cargo build --release --target aarch64-apple-darwin --no-default-features)
docker cp . "$CID:/src"
docker start -a "$CID"
STATUS=$(docker wait "$CID")
mkdir -p /tmp/dist
docker cp "$CID:/src/src/target/aarch64-apple-darwin/release/obikmer" /tmp/dist/obikmer-macos-arm64
docker rm "$CID" > /dev/null
[ "$STATUS" -eq 0 ]
- name: Prepare and upload artifact
env:
GITEA_TOKEN: ${{ secrets.GITEATOKEN }}
RELEASE_ID: ${{ needs.create-release.outputs.release_id }}
run: |
curl -s -X POST \
"${{ github.server_url }}/api/v1/repos/${{ github.repository }}/releases/$RELEASE_ID/assets" \
-H "Authorization: token $GITEA_TOKEN" \
-F "attachment=@/tmp/dist/obikmer-macos-arm64"
+5
View File
@@ -8,14 +8,19 @@ data-stress
*.pb *.pb
./**/*.json ./**/*.json
*.bin *.bin
*.log
*.csv
Betula_exilis--IGA-24-33 Betula_exilis--IGA-24-33
benchmark/genomes benchmark/genomes
benchmark/simulated_data benchmark/simulated_data
benchmark/specimen_index_presence benchmark/specimen_index_presence
benchmark/specimen_index_count benchmark/specimen_index_count
benchmark/global_index_presence benchmark/global_index_presence
benchmark/all_specific
benchmark/global_index_count benchmark/global_index_count
benchmark/stats benchmark/stats
benchmark/reference_index benchmark/reference_index
benchmark/reference_dist
benchmark/obikmer_dist
benchmark/specific_index_count benchmark/specific_index_count
benchmark/specific_index_presence benchmark/specific_index_presence
+8
View File
@@ -88,3 +88,11 @@ bump-version:
release: bump-version release: bump-version
@jj auto-describe @jj auto-describe
@jj git push --change @ @jj git push --change @
@new_version=$$(grep '^version = ' $(CARGO_TOML) | head -n 1 | sed 's/version = "\(.*\)"/\1/'); \
git_hash=$$(jj log -r @ --no-graph -T 'commit_id'); \
commits=$$(jj log -r 'latest(tags())..@' --no-graph -T 'description ++ "\n"' 2>/dev/null || \
jj log --no-graph -T 'description ++ "\n"' --limit 30); \
notes=$$(printf 'Write concise markdown release notes for obikmer (a Rust kmer genomics tool). Be technical and direct. Base them strictly on these commit messages:\n\n%s' "$$commits" | aichat 2>/dev/null); \
tag_msg="$${notes:-Release v$$new_version}"; \
git tag -a "v$$new_version" -m "$$tag_msg" "$$git_hash" && \
git push origin "v$$new_version"
+88 -2
View File
@@ -10,6 +10,23 @@ GENOMES := $(wildcard genomes/*.fna.gz)
-include deps.mk -include deps.mk
REF_NPZS := $(SPECIMENS:%=reference_index/%.npz) REF_NPZS := $(SPECIMENS:%=reference_index/%.npz)
REF_DIST_CSVS := $(addprefix reference_dist/, \
shared_kmers.csv hamming_dist.csv jaccard_dist.csv \
bray_curtis_dist.csv relfreq_bray_curtis_dist.csv \
euclidean_dist.csv relfreq_euclidean_dist.csv \
hellinger_dist.csv hellinger_euclidean_dist.csv)
OBIKMER_PRESENCE_DIST := $(addprefix obikmer_dist/presence/, \
jaccard_dist.csv jaccard_shared.csv jaccard_nj.nwk \
hamming_dist.csv hamming_nj.nwk)
OBIKMER_COUNT_DIST := $(addprefix obikmer_dist/count/, \
jaccard_dist.csv jaccard_shared.csv jaccard_nj.nwk \
bray_curtis_dist.csv bray_curtis_nj.nwk \
relfreq_bray_curtis_dist.csv relfreq_bray_curtis_nj.nwk \
euclidean_dist.csv euclidean_nj.nwk \
relfreq_euclidean_dist.csv relfreq_euclidean_nj.nwk \
hellinger_dist.csv hellinger_nj.nwk \
hellinger_euclidean_dist.csv hellinger_euclidean_nj.nwk)
DIST_COMPARISON := stats/dist_comparison/summary.csv
PRESENCE_DONE := $(SPECIMENS:%=specimen_index_presence/%/index.done) PRESENCE_DONE := $(SPECIMENS:%=specimen_index_presence/%/index.done)
PRESENCE_STATS := $(SPECIMENS:%=stats/indexing_presence/%.stats) PRESENCE_STATS := $(SPECIMENS:%=stats/indexing_presence/%.stats)
COUNT_DONE := $(SPECIMENS:%=specimen_index_count/%/index.done) COUNT_DONE := $(SPECIMENS:%=specimen_index_count/%/index.done)
@@ -24,7 +41,9 @@ SIMULATED_READS := $(foreach s,$(SPECIMENS),simulated_data/$(subst --,/,$s)/read
.NOTPARALLEL: .NOTPARALLEL:
.PHONY: all simulate reference \ .PHONY: all simulate reference reference_dist \
obikmer_dist obikmer_dist_presence obikmer_dist_count \
dist_comparison \
index_presence index_count \ index_presence index_count \
aggregate_index_presence aggregate_index_count \ aggregate_index_presence aggregate_index_count \
merge_presence merge_count \ merge_presence merge_count \
@@ -39,7 +58,8 @@ verify_merge_count: stats/verify_merge_count/current.csv
all: aggregate_verify_presence aggregate_verify_count \ all: aggregate_verify_presence aggregate_verify_count \
verify_merge_presence verify_merge_count \ verify_merge_presence verify_merge_count \
aggregate_filter_presence aggregate_filter_count aggregate_filter_presence aggregate_filter_count \
dist_comparison
# ── dependency file ─────────────────────────────────────────────────────────── # ── dependency file ───────────────────────────────────────────────────────────
@@ -62,6 +82,72 @@ reference_index/%.npz:
reference: $(REF_NPZS) reference: $(REF_NPZS)
# ── reference distance matrices ───────────────────────────────────────────────
$(REF_DIST_CSVS) &: $(REF_NPZS) build_reference_dist.py
$(VENV_PY) build_reference_dist.py
reference_dist: $(REF_DIST_CSVS)
# ── obikmer distance (presence index) ────────────────────────────────────────
$(OBIKMER_PRESENCE_DIST) &: global_index_presence/index.done $(BINARY)
mkdir -p obikmer_dist/presence
$(BINARY) distance \
--output obikmer_dist/presence/jaccard \
--metric jaccard --shared-kmers --nj \
global_index_presence
$(BINARY) distance \
--output obikmer_dist/presence/hamming \
--metric hamming --nj \
global_index_presence
obikmer_dist_presence: $(OBIKMER_PRESENCE_DIST)
# ── obikmer distance (count index) ───────────────────────────────────────────
$(OBIKMER_COUNT_DIST) &: global_index_count/index.done $(BINARY)
mkdir -p obikmer_dist/count
$(BINARY) distance \
--output obikmer_dist/count/jaccard \
--metric jaccard --shared-kmers --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/bray_curtis \
--metric bray-curtis --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/relfreq_bray_curtis \
--metric relfreq-bray-curtis --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/euclidean \
--metric euclidean --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/relfreq_euclidean \
--metric relfreq-euclidean --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/hellinger \
--metric hellinger --nj \
global_index_count
$(BINARY) distance \
--output obikmer_dist/count/hellinger_euclidean \
--metric hellinger-euclidean --nj \
global_index_count
obikmer_dist_count: $(OBIKMER_COUNT_DIST)
obikmer_dist: obikmer_dist_presence obikmer_dist_count
# ── distance comparison ───────────────────────────────────────────────────────
$(DIST_COMPARISON): $(REF_DIST_CSVS) $(OBIKMER_PRESENCE_DIST) $(OBIKMER_COUNT_DIST) compare_all_dist.py
$(VENV_PY) compare_all_dist.py --out $(DIST_COMPARISON)
dist_comparison: $(DIST_COMPARISON)
# ── per-specimen indexing ───────────────────────────────────────────────────── # ── per-specimen indexing ─────────────────────────────────────────────────────
# Prerequisites (reads → index.done + .stats) are in deps.mk. # Prerequisites (reads → index.done + .stats) are in deps.mk.
+226
View File
@@ -0,0 +1,226 @@
#!/usr/bin/env python3
"""Compute reference pairwise distance matrices from per-specimen .npz kmer indexes.
Reads all .npz files in reference_index/ (each containing sorted uint64 `kmers`
and uint32 `counts`), computes all distance metrics supported by `obikmer distance`,
and writes one CSV per metric to reference_dist/.
Output CSV format matches `obikmer distance --output`:
- first row: "genome", then specimen names
- subsequent rows: specimen name, then float or int values
Metrics written
jaccard_dist.csv Jaccard distance (presence/absence)
shared_kmers.csv Shared-kmer count matrix (intersection size)
bray_curtis_dist.csv Bray-Curtis dissimilarity (raw counts)
relfreq_bray_curtis_dist.csv Bray-Curtis on relative frequencies
euclidean_dist.csv Euclidean distance (raw counts)
relfreq_euclidean_dist.csv Euclidean distance on relative frequencies
hellinger_dist.csv Hellinger distance
hellinger_euclidean_dist.csv Euclidean distance in Hellinger space
"""
import argparse
import sys
from pathlib import Path
import numpy as np
# ── pairwise helpers ──────────────────────────────────────────────────────────
def shared_indices(a_kmers: np.ndarray, b_kmers: np.ndarray):
"""Return index arrays (idx_a, idx_b) for kmers present in both sets.
Both arrays must be sorted uint64. Uses searchsorted: O(|B| log |A|).
"""
pos = np.searchsorted(a_kmers, b_kmers)
pos = np.clip(pos, 0, len(a_kmers) - 1)
mask = a_kmers[pos] == b_kmers
idx_b = np.where(mask)[0]
idx_a = pos[idx_b]
return idx_a, idx_b
def pairwise_stats(specimens: list[dict]) -> dict[str, np.ndarray]:
"""Compute all pairwise distance matrices at once.
Returns a dict metric_name → ndarray (n×n float64 or int64).
Each specimen dict has keys: name, kmers, counts.
"""
n = len(specimens)
# Pre-compute per-specimen scalars
kmer_counts = np.array([len(s['kmers']) for s in specimens], dtype=np.uint64)
count_sums = np.array([s['counts'].sum() for s in specimens], dtype=np.uint64)
# Per-specimen sum-of-squares (for Euclidean decomposition)
sq_sums = np.array([(s['counts'].astype(np.float64) ** 2).sum() for s in specimens])
# Allocate output matrices
shared_mat = np.zeros((n, n), dtype=np.uint64)
hamming_mat = np.zeros((n, n), dtype=np.float64)
jaccard_mat = np.zeros((n, n), dtype=np.float64)
bray_mat = np.zeros((n, n), dtype=np.float64)
relfreq_bray = np.zeros((n, n), dtype=np.float64)
euclidean_mat = np.zeros((n, n), dtype=np.float64)
relfreq_eucl = np.zeros((n, n), dtype=np.float64)
hellinger_mat = np.zeros((n, n), dtype=np.float64)
hell_eucl_mat = np.zeros((n, n), dtype=np.float64)
for i in range(n):
a_km = specimens[i]['kmers']
a_ct = specimens[i]['counts'].astype(np.float64)
sa = float(count_sums[i])
na = int(kmer_counts[i])
for j in range(i + 1, n):
b_km = specimens[j]['kmers']
b_ct = specimens[j]['counts'].astype(np.float64)
sb = float(count_sums[j])
nb = int(kmer_counts[j])
idx_a, idx_b = shared_indices(a_km, b_km)
inter = len(idx_a)
ca_sh = a_ct[idx_a]
cb_sh = b_ct[idx_b]
# ── Presence metrics ──────────────────────────────────────────────
union = na + nb - inter
jac = (1.0 - inter / union) if union else 0.0
hamming = float(na + nb - 2 * inter) # |A Δ B|
# ── Count metrics ─────────────────────────────────────────────────
# Bray-Curtis: 1 - 2*Σmin(a,b) / (Σa + Σb)
sum_min = np.minimum(ca_sh, cb_sh).sum()
denom_bc = sa + sb
bc = (1.0 - 2.0 * sum_min / denom_bc) if denom_bc else 0.0
# RelfreqBray: 1 - Σmin(a/sa, b/sb) [only shared contribute]
if sa and sb:
rfb = 1.0 - np.minimum(ca_sh / sa, cb_sh / sb).sum()
else:
rfb = 0.0
# Euclidean: √(Σa² + Σb² - 2·Σ(a·b)_shared)
cross = (ca_sh * cb_sh).sum()
eucl_partial = sq_sums[i] + sq_sums[j] - 2.0 * cross
eucl = np.sqrt(max(eucl_partial, 0.0))
# RelfreqEuclidean: √(Σ(a/sa - b/sb)²)
# = √(Σa²/sa² + Σb²/sb² - 2·Σ(a·b)_shared/(sa·sb))
if sa and sb:
rf_cross = (ca_sh / sa * (cb_sh / sb)).sum()
rfe_partial = (sq_sums[i] / sa**2
+ sq_sums[j] / sb**2
- 2.0 * rf_cross)
rfe = np.sqrt(max(rfe_partial, 0.0))
else:
rfe = 0.0
# Hellinger partial: Σ(√(a/sa) - √(b/sb))² over global universe
# = 2 - 2·Σ√(a·b)_shared / √(sa·sb)
if sa and sb:
bc_coeff = np.sqrt(ca_sh * cb_sh).sum() / np.sqrt(sa * sb)
hell_partial = max(2.0 - 2.0 * bc_coeff, 0.0)
else:
hell_partial = 0.0
sq2 = np.sqrt(2.0)
hell = np.sqrt(hell_partial) / sq2
hell_euc = np.sqrt(hell_partial)
# ── Fill symmetric matrices ───────────────────────────────────────
for mat, val in [
(shared_mat, inter),
(hamming_mat, hamming),
(jaccard_mat, jac),
(bray_mat, bc),
(relfreq_bray, rfb),
(euclidean_mat, eucl),
(relfreq_eucl, rfe),
(hellinger_mat, hell),
(hell_eucl_mat, hell_euc),
]:
mat[i, j] = val
mat[j, i] = val
return {
'shared_kmers': shared_mat,
'hamming_dist': hamming_mat,
'jaccard_dist': jaccard_mat,
'bray_curtis_dist': bray_mat,
'relfreq_bray_curtis_dist': relfreq_bray,
'euclidean_dist': euclidean_mat,
'relfreq_euclidean_dist': relfreq_eucl,
'hellinger_dist': hellinger_mat,
'hellinger_euclidean_dist': hell_eucl_mat,
}
# ── I/O ───────────────────────────────────────────────────────────────────────
def write_csv(path: Path, labels: list[str], mat: np.ndarray, fmt: str) -> None:
with path.open('w') as fh:
fh.write('genome,' + ','.join(labels) + '\n')
for i, label in enumerate(labels):
row = ','.join(format(mat[i, j], fmt) for j in range(len(labels)))
fh.write(f'{label},{row}\n')
print(f'{path}', file=sys.stderr)
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('--ref-dir', default='reference_index',
help='Directory with per-specimen .npz files (default: reference_index)')
ap.add_argument('--out-dir', default='reference_dist',
help='Output directory for CSV files (default: reference_dist)')
args = ap.parse_args()
ref_dir = Path(args.ref_dir)
out_dir = Path(args.out_dir)
out_dir.mkdir(exist_ok=True)
npz_files = sorted(ref_dir.glob('*.npz'))
if not npz_files:
print(f'ERROR: no .npz files found in {ref_dir}', file=sys.stderr)
sys.exit(1)
print(f'Loading {len(npz_files)} specimen(s) from {ref_dir}/', file=sys.stderr)
specimens = []
for f in npz_files:
data = np.load(f)
specimens.append({
'name': f.stem,
'kmers': data['kmers'],
'counts': data['counts'],
})
print(f' {f.stem}: {len(data["kmers"]):,} kmers', file=sys.stderr)
labels = [s['name'] for s in specimens]
n = len(labels)
print(f'\nComputing pairwise distances for {n} specimens…', file=sys.stderr)
matrices = pairwise_stats(specimens)
print(f'\nWriting CSVs to {out_dir}/', file=sys.stderr)
write_csv(out_dir / 'shared_kmers.csv', labels, matrices['shared_kmers'], 'd')
write_csv(out_dir / 'hamming_dist.csv', labels, matrices['hamming_dist'], '.6f')
write_csv(out_dir / 'jaccard_dist.csv', labels, matrices['jaccard_dist'], '.6f')
write_csv(out_dir / 'bray_curtis_dist.csv', labels, matrices['bray_curtis_dist'], '.6f')
write_csv(out_dir / 'relfreq_bray_curtis_dist.csv', labels, matrices['relfreq_bray_curtis_dist'], '.6f')
write_csv(out_dir / 'euclidean_dist.csv', labels, matrices['euclidean_dist'], '.6f')
write_csv(out_dir / 'relfreq_euclidean_dist.csv', labels, matrices['relfreq_euclidean_dist'], '.6f')
write_csv(out_dir / 'hellinger_dist.csv', labels, matrices['hellinger_dist'], '.6f')
write_csv(out_dir / 'hellinger_euclidean_dist.csv', labels, matrices['hellinger_euclidean_dist'], '.6f')
print('\nDone.', file=sys.stderr)
if __name__ == '__main__':
main()
+182
View File
@@ -0,0 +1,182 @@
#!/usr/bin/env python3
"""Compare all reference distance matrices against obikmer distance outputs.
Reads from:
reference_dist/ — ground-truth matrices computed by build_reference_dist.py
obikmer_dist/ — matrices produced by `obikmer distance`
Handles label reordering: both matrices are sorted by genome label before
element-wise comparison, so column/row order differences are irrelevant.
Output: stats/dist_comparison/summary.csv
comparison,max_abs,mean_abs,rmse,n_pairs,status
"""
import csv
import sys
from pathlib import Path
import numpy as np
# ── CSV loading ───────────────────────────────────────────────────────────────
def load_matrix(path: Path) -> tuple[list[str], np.ndarray]:
"""Load a distance-matrix CSV; return (sorted_labels, matrix_float64)."""
with path.open() as fh:
reader = csv.reader(fh)
header = next(reader)[1:] # skip 'genome' column
raw: dict[str, list[float]] = {}
for row in reader:
raw[row[0]] = [float(x) for x in row[1:]]
label_to_col = {h: i for i, h in enumerate(header)}
labels = sorted(raw.keys())
n = len(labels)
mat = np.zeros((n, n), dtype=np.float64)
for i, ri in enumerate(labels):
for j, cj in enumerate(labels):
mat[i, j] = raw[ri][label_to_col[cj]]
return labels, mat
# ── comparison ────────────────────────────────────────────────────────────────
def compare(label: str,
ref_path: Path,
obi_path: Path,
tol: float = 1e-4) -> dict:
if not ref_path.exists():
return {'comparison': label, 'status': 'REF_MISSING',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
if not obi_path.exists():
return {'comparison': label, 'status': 'OBI_MISSING',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
ref_labels, ref_mat = load_matrix(ref_path)
obi_labels, obi_mat = load_matrix(obi_path)
if ref_labels != obi_labels:
only_ref = sorted(set(ref_labels) - set(obi_labels))
only_obi = sorted(set(obi_labels) - set(ref_labels))
print(f' [{label}] label mismatch — '
f'only_ref={only_ref} only_obi={only_obi}', file=sys.stderr)
return {'comparison': label, 'status': 'LABEL_MISMATCH',
'max_abs': '', 'mean_abs': '', 'rmse': '', 'n_pairs': ''}
n = len(ref_labels)
# Off-diagonal mask
mask = ~np.eye(n, dtype=bool)
diff = np.abs(ref_mat[mask] - obi_mat[mask])
n_pairs = diff.size
max_abs = float(diff.max())
mean_abs = float(diff.mean())
rmse = float(np.sqrt((diff ** 2).mean()))
status = 'PASS' if max_abs <= tol else 'FAIL'
print(f' [{label}] n={n_pairs} '
f'max={max_abs:.3e} mean={mean_abs:.3e} rmse={rmse:.3e} {status}',
file=sys.stderr)
return {
'comparison': label,
'max_abs': f'{max_abs:.6e}',
'mean_abs': f'{mean_abs:.6e}',
'rmse': f'{rmse:.6e}',
'n_pairs': str(n_pairs),
'status': status,
}
# ── comparison table ──────────────────────────────────────────────────────────
# (label, ref_csv, obikmer_csv)
# The reference jaccard/shared is presence-based, which should match both
# presence/jaccard and count/jaccard (threshold=1).
COMPARISONS = [
# ── presence index ────────────────────────────────────────────────────────
('presence/jaccard_dist',
'reference_dist/jaccard_dist.csv',
'obikmer_dist/presence/jaccard_dist.csv'),
('presence/jaccard_shared',
'reference_dist/shared_kmers.csv',
'obikmer_dist/presence/jaccard_shared.csv'),
('presence/hamming_dist',
'reference_dist/hamming_dist.csv',
'obikmer_dist/presence/hamming_dist.csv'),
# ── count index (jaccard cross-check) ─────────────────────────────────────
('count/jaccard_dist',
'reference_dist/jaccard_dist.csv',
'obikmer_dist/count/jaccard_dist.csv'),
('count/jaccard_shared',
'reference_dist/shared_kmers.csv',
'obikmer_dist/count/jaccard_shared.csv'),
# ── count index (count-based metrics) ────────────────────────────────────
('count/bray_curtis_dist',
'reference_dist/bray_curtis_dist.csv',
'obikmer_dist/count/bray_curtis_dist.csv'),
('count/relfreq_bray_curtis_dist',
'reference_dist/relfreq_bray_curtis_dist.csv',
'obikmer_dist/count/relfreq_bray_curtis_dist.csv'),
('count/euclidean_dist',
'reference_dist/euclidean_dist.csv',
'obikmer_dist/count/euclidean_dist.csv'),
('count/relfreq_euclidean_dist',
'reference_dist/relfreq_euclidean_dist.csv',
'obikmer_dist/count/relfreq_euclidean_dist.csv'),
('count/hellinger_dist',
'reference_dist/hellinger_dist.csv',
'obikmer_dist/count/hellinger_dist.csv'),
('count/hellinger_euclidean_dist',
'reference_dist/hellinger_euclidean_dist.csv',
'obikmer_dist/count/hellinger_euclidean_dist.csv'),
]
# ── main ─────────────────────────────────────────────────────────────────────
def main() -> None:
import argparse
ap = argparse.ArgumentParser(description=__doc__,
formatter_class=argparse.RawDescriptionHelpFormatter)
ap.add_argument('--tol', type=float, default=1e-4,
help='Max abs diff threshold for PASS/FAIL (default 1e-4)')
ap.add_argument('--out', default='stats/dist_comparison/summary.csv',
help='Output summary CSV path')
args = ap.parse_args()
out_path = Path(args.out)
out_path.parent.mkdir(parents=True, exist_ok=True)
print(f'Comparing {len(COMPARISONS)} matrix pairs…', file=sys.stderr)
rows = []
for label, ref, obi in COMPARISONS:
rows.append(compare(label, Path(ref), Path(obi), tol=args.tol))
fields = ['comparison', 'max_abs', 'mean_abs', 'rmse', 'n_pairs', 'status']
with out_path.open('w', newline='') as fh:
w = csv.DictWriter(fh, fieldnames=fields)
w.writeheader()
w.writerows(rows)
print(f'\n{out_path}', file=sys.stderr)
n_fail = sum(1 for r in rows if r.get('status') == 'FAIL')
n_pass = sum(1 for r in rows if r.get('status') == 'PASS')
print(f'Summary: {n_pass} PASS {n_fail} FAIL '
f'{len(rows) - n_pass - n_fail} SKIP', file=sys.stderr)
if n_fail:
sys.exit(1)
if __name__ == '__main__':
main()
+21
View File
@@ -0,0 +1,21 @@
genome,Candidozyma_auris--GCF_003013715.1_ASM301371v2,Acidobacterium_capsulatum--ATCC_51196,Bacillus_subtilis--168,Escherichia_coli--CFT073,Escherichia_coli--EDL933,Escherichia_coli--K-12_MG1655,Escherichia_coli--K-12_W3110,Klebsiella_pneumoniae--ATCC_13883,Klebsiella_pneumoniae--HS11286,Klebsiella_pneumoniae--MGH_78578,Opitutus_terrae--PB90-1,Proteus_mirabilis--HI4320,Saccharolobus_islandicus--M.16.4,Salmonella_enterica--AKU_12601,Salmonella_enterica--CT18,Salmonella_enterica--LT2,Salmonella_enterica--P125109,Shouchella_clausii--KSM-K16,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,Yersinia_ruckeri--YRB
Candidozyma_auris--GCF_003013715.1_ASM301371v2,0.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000
Acidobacterium_capsulatum--ATCC_51196,1.000000,0.000000,0.999981,0.999990,0.999989,0.999987,0.999987,0.999990,0.999988,0.999988,0.999994,0.999989,1.000000,0.999988,0.999987,0.999987,0.999988,0.999989,0.999991,0.999987
Bacillus_subtilis--168,1.000000,0.999981,0.000000,0.999990,0.999989,0.999989,0.999989,0.999989,0.999988,0.999986,0.999995,0.999985,0.999999,0.999988,0.999987,0.999989,0.999988,0.999778,0.999993,0.999987
Escherichia_coli--CFT073,1.000000,0.999990,0.999990,0.000000,0.825741,0.807495,0.807218,0.991156,0.996855,0.997849,0.999996,0.999633,1.000000,0.993885,0.996736,0.994148,0.993821,0.999991,0.999984,0.999291
Escherichia_coli--EDL933,1.000000,0.999989,0.999989,0.825741,0.000000,0.735107,0.734775,0.996126,0.998058,0.997908,0.999997,0.999640,1.000000,0.993993,0.997126,0.994390,0.994059,0.999991,0.999986,0.999292
Escherichia_coli--K-12_MG1655,1.000000,0.999987,0.999989,0.807495,0.735107,0.000000,0.382567,0.996190,0.997747,0.997455,0.999996,0.999604,1.000000,0.993444,0.996645,0.993773,0.993431,0.999989,0.999984,0.999174
Escherichia_coli--K-12_W3110,1.000000,0.999987,0.999989,0.807218,0.734775,0.382567,0.000000,0.996220,0.997761,0.997467,0.999995,0.999604,1.000000,0.993445,0.996669,0.993769,0.993443,0.999990,0.999985,0.999165
Klebsiella_pneumoniae--ATCC_13883,1.000000,0.999990,0.999989,0.991156,0.996126,0.996190,0.996220,0.000000,0.845220,0.840545,0.999997,0.999648,1.000000,0.996177,0.998128,0.996268,0.996052,0.999990,0.999987,0.999325
Klebsiella_pneumoniae--HS11286,1.000000,0.999988,0.999988,0.996855,0.998058,0.997747,0.997761,0.845220,0.000000,0.906475,0.999996,0.999683,1.000000,0.997724,0.995697,0.997776,0.997769,0.999989,0.999979,0.999463
Klebsiella_pneumoniae--MGH_78578,1.000000,0.999988,0.999986,0.997849,0.997908,0.997455,0.997467,0.840545,0.906475,0.000000,0.999996,0.999704,1.000000,0.997928,0.995054,0.997844,0.997868,0.999990,0.999980,0.999479
Opitutus_terrae--PB90-1,1.000000,0.999994,0.999995,0.999996,0.999997,0.999996,0.999995,0.999997,0.999996,0.999996,0.000000,0.999997,0.999998,0.999996,0.999996,0.999996,0.999995,0.999997,0.999993,0.999996
Proteus_mirabilis--HI4320,1.000000,0.999989,0.999985,0.999633,0.999640,0.999604,0.999604,0.999648,0.999683,0.999704,0.999997,0.000000,1.000000,0.999604,0.999699,0.999622,0.999613,0.999987,0.999983,0.999505
Saccharolobus_islandicus--M.16.4,1.000000,1.000000,0.999999,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,0.999998,1.000000,0.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000,1.000000
Salmonella_enterica--AKU_12601,1.000000,0.999988,0.999988,0.993885,0.993993,0.993444,0.993445,0.996177,0.997724,0.997928,0.999996,0.999604,1.000000,0.000000,0.869238,0.682277,0.663383,0.999990,0.999985,0.999260
Salmonella_enterica--CT18,1.000000,0.999987,0.999987,0.996736,0.997126,0.996645,0.996669,0.998128,0.995697,0.995054,0.999996,0.999699,1.000000,0.869238,0.000000,0.890872,0.886148,0.999988,0.999976,0.999524
Salmonella_enterica--LT2,1.000000,0.999987,0.999989,0.994148,0.994390,0.993773,0.993769,0.996268,0.997776,0.997844,0.999996,0.999622,1.000000,0.682277,0.890872,0.000000,0.622606,0.999989,0.999985,0.999296
Salmonella_enterica--P125109,1.000000,0.999988,0.999988,0.993821,0.994059,0.993431,0.993443,0.996052,0.997769,0.997868,0.999995,0.999613,1.000000,0.663383,0.886148,0.622606,0.000000,0.999988,0.999983,0.999270
Shouchella_clausii--KSM-K16,1.000000,0.999989,0.999778,0.999991,0.999991,0.999989,0.999990,0.999990,0.999989,0.999990,0.999997,0.999987,1.000000,0.999990,0.999988,0.999989,0.999988,0.000000,0.999991,0.999988
Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,1.000000,0.999991,0.999993,0.999984,0.999986,0.999984,0.999985,0.999987,0.999979,0.999980,0.999993,0.999983,1.000000,0.999985,0.999976,0.999985,0.999983,0.999991,0.000000,0.999983
Yersinia_ruckeri--YRB,1.000000,0.999987,0.999987,0.999291,0.999292,0.999174,0.999165,0.999325,0.999463,0.999479,0.999996,0.999505,1.000000,0.999260,0.999524,0.999296,0.999270,0.999988,0.999983,0.000000
1 genome Candidozyma_auris--GCF_003013715.1_ASM301371v2 Acidobacterium_capsulatum--ATCC_51196 Bacillus_subtilis--168 Escherichia_coli--CFT073 Escherichia_coli--EDL933 Escherichia_coli--K-12_MG1655 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--ATCC_13883 Klebsiella_pneumoniae--HS11286 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Proteus_mirabilis--HI4320 Saccharolobus_islandicus--M.16.4 Salmonella_enterica--AKU_12601 Salmonella_enterica--CT18 Salmonella_enterica--LT2 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Yersinia_ruckeri--YRB
2 Candidozyma_auris--GCF_003013715.1_ASM301371v2 0.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000
3 Acidobacterium_capsulatum--ATCC_51196 1.000000 0.000000 0.999981 0.999990 0.999989 0.999987 0.999987 0.999990 0.999988 0.999988 0.999994 0.999989 1.000000 0.999988 0.999987 0.999987 0.999988 0.999989 0.999991 0.999987
4 Bacillus_subtilis--168 1.000000 0.999981 0.000000 0.999990 0.999989 0.999989 0.999989 0.999989 0.999988 0.999986 0.999995 0.999985 0.999999 0.999988 0.999987 0.999989 0.999988 0.999778 0.999993 0.999987
5 Escherichia_coli--CFT073 1.000000 0.999990 0.999990 0.000000 0.825741 0.807495 0.807218 0.991156 0.996855 0.997849 0.999996 0.999633 1.000000 0.993885 0.996736 0.994148 0.993821 0.999991 0.999984 0.999291
6 Escherichia_coli--EDL933 1.000000 0.999989 0.999989 0.825741 0.000000 0.735107 0.734775 0.996126 0.998058 0.997908 0.999997 0.999640 1.000000 0.993993 0.997126 0.994390 0.994059 0.999991 0.999986 0.999292
7 Escherichia_coli--K-12_MG1655 1.000000 0.999987 0.999989 0.807495 0.735107 0.000000 0.382567 0.996190 0.997747 0.997455 0.999996 0.999604 1.000000 0.993444 0.996645 0.993773 0.993431 0.999989 0.999984 0.999174
8 Escherichia_coli--K-12_W3110 1.000000 0.999987 0.999989 0.807218 0.734775 0.382567 0.000000 0.996220 0.997761 0.997467 0.999995 0.999604 1.000000 0.993445 0.996669 0.993769 0.993443 0.999990 0.999985 0.999165
9 Klebsiella_pneumoniae--ATCC_13883 1.000000 0.999990 0.999989 0.991156 0.996126 0.996190 0.996220 0.000000 0.845220 0.840545 0.999997 0.999648 1.000000 0.996177 0.998128 0.996268 0.996052 0.999990 0.999987 0.999325
10 Klebsiella_pneumoniae--HS11286 1.000000 0.999988 0.999988 0.996855 0.998058 0.997747 0.997761 0.845220 0.000000 0.906475 0.999996 0.999683 1.000000 0.997724 0.995697 0.997776 0.997769 0.999989 0.999979 0.999463
11 Klebsiella_pneumoniae--MGH_78578 1.000000 0.999988 0.999986 0.997849 0.997908 0.997455 0.997467 0.840545 0.906475 0.000000 0.999996 0.999704 1.000000 0.997928 0.995054 0.997844 0.997868 0.999990 0.999980 0.999479
12 Opitutus_terrae--PB90-1 1.000000 0.999994 0.999995 0.999996 0.999997 0.999996 0.999995 0.999997 0.999996 0.999996 0.000000 0.999997 0.999998 0.999996 0.999996 0.999996 0.999995 0.999997 0.999993 0.999996
13 Proteus_mirabilis--HI4320 1.000000 0.999989 0.999985 0.999633 0.999640 0.999604 0.999604 0.999648 0.999683 0.999704 0.999997 0.000000 1.000000 0.999604 0.999699 0.999622 0.999613 0.999987 0.999983 0.999505
14 Saccharolobus_islandicus--M.16.4 1.000000 1.000000 0.999999 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 0.999998 1.000000 0.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000
15 Salmonella_enterica--AKU_12601 1.000000 0.999988 0.999988 0.993885 0.993993 0.993444 0.993445 0.996177 0.997724 0.997928 0.999996 0.999604 1.000000 0.000000 0.869238 0.682277 0.663383 0.999990 0.999985 0.999260
16 Salmonella_enterica--CT18 1.000000 0.999987 0.999987 0.996736 0.997126 0.996645 0.996669 0.998128 0.995697 0.995054 0.999996 0.999699 1.000000 0.869238 0.000000 0.890872 0.886148 0.999988 0.999976 0.999524
17 Salmonella_enterica--LT2 1.000000 0.999987 0.999989 0.994148 0.994390 0.993773 0.993769 0.996268 0.997776 0.997844 0.999996 0.999622 1.000000 0.682277 0.890872 0.000000 0.622606 0.999989 0.999985 0.999296
18 Salmonella_enterica--P125109 1.000000 0.999988 0.999988 0.993821 0.994059 0.993431 0.993443 0.996052 0.997769 0.997868 0.999995 0.999613 1.000000 0.663383 0.886148 0.622606 0.000000 0.999988 0.999983 0.999270
19 Shouchella_clausii--KSM-K16 1.000000 0.999989 0.999778 0.999991 0.999991 0.999989 0.999990 0.999990 0.999989 0.999990 0.999997 0.999987 1.000000 0.999990 0.999988 0.999989 0.999988 0.000000 0.999991 0.999988
20 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 1.000000 0.999991 0.999993 0.999984 0.999986 0.999984 0.999985 0.999987 0.999979 0.999980 0.999993 0.999983 1.000000 0.999985 0.999976 0.999985 0.999983 0.999991 0.000000 0.999983
21 Yersinia_ruckeri--YRB 1.000000 0.999987 0.999987 0.999291 0.999292 0.999174 0.999165 0.999325 0.999463 0.999479 0.999996 0.999505 1.000000 0.999260 0.999524 0.999296 0.999270 0.999988 0.999983 0.000000
+1
View File
@@ -0,0 +1 @@
(((((((((((Candidozyma_auris--GCF_003013715.1_ASM301371v2:0.5000001881725941,Saccharolobus_islandicus--M.16.4:0.4999993211600824):0.0000023411501775538747,Opitutus_terrae--PB90-1:0.499997075187947):0.0000029791191795691675,(Acidobacterium_capsulatum--ATCC_51196:0.49999227771334689,(Bacillus_subtilis--168:0.49988797935621456,Shouchella_clausii--KSM-K16:0.49988984146059159):0.0001037210285571577):0.0000023959836053522034):0.0000034093646568700288,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1:0.4999920159222422):0.000199555100890203,Proteus_mirabilis--HI4320:0.49979129185300427):0.00010103619067070024,Yersinia_ruckeri--YRB:0.4996806650749249):0.0013719139155004,(Klebsiella_pneumoniae--HS11286:0.43798845051648258,(Klebsiella_pneumoniae--ATCC_13883:0.41780293826821265,Klebsiella_pneumoniae--MGH_78578:0.42274184870836559):0.017586732339732737):0.0604124197073832):0.0006482538063555254,(Salmonella_enterica--CT18:0.43952894448143017,(Salmonella_enterica--AKU_12601:0.3357977326267918,(Salmonella_enterica--LT2:0.31203395843666389,Salmonella_enterica--P125109:0.31057217324861216):0.025729515856701136):0.10292985918524672):0.05825411485542886):0.08937928015651564,Escherichia_coli--CFT073:0.40806501650701029):0.0410131211869626,Escherichia_coli--EDL933:0.3681464750911808):0.1755112579711463,Escherichia_coli--K-12_MG1655:0.19129818036662728,Escherichia_coli--K-12_W3110:0.19126872019906239);
+21
View File
@@ -0,0 +1,21 @@
genome,Candidozyma_auris--GCF_003013715.1_ASM301371v2,Acidobacterium_capsulatum--ATCC_51196,Bacillus_subtilis--168,Escherichia_coli--CFT073,Escherichia_coli--EDL933,Escherichia_coli--K-12_MG1655,Escherichia_coli--K-12_W3110,Klebsiella_pneumoniae--ATCC_13883,Klebsiella_pneumoniae--HS11286,Klebsiella_pneumoniae--MGH_78578,Opitutus_terrae--PB90-1,Proteus_mirabilis--HI4320,Saccharolobus_islandicus--M.16.4,Salmonella_enterica--AKU_12601,Salmonella_enterica--CT18,Salmonella_enterica--LT2,Salmonella_enterica--P125109,Shouchella_clausii--KSM-K16,Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,Yersinia_ruckeri--YRB
Candidozyma_auris--GCF_003013715.1_ASM301371v2,0,0,0,0,0,0,0,0,0,0,0,0,8,0,1,0,0,0,0,3
Acidobacterium_capsulatum--ATCC_51196,0,0,203,119,128,141,140,116,109,111,78,112,0,136,109,147,134,117,55,129
Bacillus_subtilis--168,0,203,0,124,132,128,123,133,109,130,66,158,6,131,112,124,135,2393,46,124
Escherichia_coli--CFT073,0,119,124,0,1966777,1998059,1999094,117743,32029,22312,63,4225,0,74946,31918,73311,76585,113,128,7854
Escherichia_coli--EDL933,0,128,132,1966777,0,2627885,2628700,52488,20134,22064,48,4202,0,74655,28602,71244,74665,112,108,7963
Escherichia_coli--K-12_MG1655,0,141,128,1998059,2627885,0,4452541,48302,21382,24602,47,4277,0,75729,30449,73622,76778,119,111,8566
Escherichia_coli--K-12_W3110,0,140,123,1999094,2628700,4452541,0,47894,21226,24470,68,4278,0,75658,30207,73614,76583,112,108,8660
Klebsiella_pneumoniae--ATCC_13883,0,116,133,117743,52488,48302,47894,0,1416091,1477759,42,4172,0,48296,18988,48144,50416,120,106,7712
Klebsiella_pneumoniae--HS11286,0,109,109,32029,20134,21382,21226,1416091,0,644063,42,2738,0,21498,29758,21606,21376,99,102,4417
Klebsiella_pneumoniae--MGH_78578,0,111,130,22312,22064,24602,24470,1477759,644063,0,42,2614,0,19948,35067,21330,20813,97,102,4374
Opitutus_terrae--PB90-1,0,78,66,63,48,47,68,42,42,42,0,43,18,57,42,53,66,39,58,43
Proteus_mirabilis--HI4320,0,112,158,4225,4202,4277,4278,4172,2738,2614,43,0,0,4254,2481,4166,4215,131,103,4704
Saccharolobus_islandicus--M.16.4,8,0,6,0,0,0,0,0,0,0,18,0,0,0,0,0,0,0,0,0
Salmonella_enterica--AKU_12601,0,136,131,74946,74655,75729,75658,48296,21498,19948,57,4254,0,0,1047731,2857146,2951421,117,108,7643
Salmonella_enterica--CT18,1,109,112,31918,28602,30449,30207,18988,29758,35067,42,2481,0,1047731,0,917948,940297,106,106,3716
Salmonella_enterica--LT2,0,147,124,73311,71244,73622,73614,48144,21606,21330,53,4166,0,2857146,917948,0,3284800,122,108,7460
Salmonella_enterica--P125109,0,134,135,76585,74665,76778,76583,50416,21376,20813,66,4215,0,2951421,940297,3284800,0,134,124,7645
Shouchella_clausii--KSM-K16,0,117,2393,113,112,119,112,120,99,97,39,131,0,117,106,122,134,0,58,124
Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1,0,55,46,128,108,111,108,106,102,102,58,103,0,108,106,108,124,58,0,96
Yersinia_ruckeri--YRB,3,129,124,7854,7963,8566,8660,7712,4417,4374,43,4704,0,7643,3716,7460,7645,124,96,0
1 genome Candidozyma_auris--GCF_003013715.1_ASM301371v2 Acidobacterium_capsulatum--ATCC_51196 Bacillus_subtilis--168 Escherichia_coli--CFT073 Escherichia_coli--EDL933 Escherichia_coli--K-12_MG1655 Escherichia_coli--K-12_W3110 Klebsiella_pneumoniae--ATCC_13883 Klebsiella_pneumoniae--HS11286 Klebsiella_pneumoniae--MGH_78578 Opitutus_terrae--PB90-1 Proteus_mirabilis--HI4320 Saccharolobus_islandicus--M.16.4 Salmonella_enterica--AKU_12601 Salmonella_enterica--CT18 Salmonella_enterica--LT2 Salmonella_enterica--P125109 Shouchella_clausii--KSM-K16 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 Yersinia_ruckeri--YRB
2 Candidozyma_auris--GCF_003013715.1_ASM301371v2 0 0 0 0 0 0 0 0 0 0 0 0 8 0 1 0 0 0 0 3
3 Acidobacterium_capsulatum--ATCC_51196 0 0 203 119 128 141 140 116 109 111 78 112 0 136 109 147 134 117 55 129
4 Bacillus_subtilis--168 0 203 0 124 132 128 123 133 109 130 66 158 6 131 112 124 135 2393 46 124
5 Escherichia_coli--CFT073 0 119 124 0 1966777 1998059 1999094 117743 32029 22312 63 4225 0 74946 31918 73311 76585 113 128 7854
6 Escherichia_coli--EDL933 0 128 132 1966777 0 2627885 2628700 52488 20134 22064 48 4202 0 74655 28602 71244 74665 112 108 7963
7 Escherichia_coli--K-12_MG1655 0 141 128 1998059 2627885 0 4452541 48302 21382 24602 47 4277 0 75729 30449 73622 76778 119 111 8566
8 Escherichia_coli--K-12_W3110 0 140 123 1999094 2628700 4452541 0 47894 21226 24470 68 4278 0 75658 30207 73614 76583 112 108 8660
9 Klebsiella_pneumoniae--ATCC_13883 0 116 133 117743 52488 48302 47894 0 1416091 1477759 42 4172 0 48296 18988 48144 50416 120 106 7712
10 Klebsiella_pneumoniae--HS11286 0 109 109 32029 20134 21382 21226 1416091 0 644063 42 2738 0 21498 29758 21606 21376 99 102 4417
11 Klebsiella_pneumoniae--MGH_78578 0 111 130 22312 22064 24602 24470 1477759 644063 0 42 2614 0 19948 35067 21330 20813 97 102 4374
12 Opitutus_terrae--PB90-1 0 78 66 63 48 47 68 42 42 42 0 43 18 57 42 53 66 39 58 43
13 Proteus_mirabilis--HI4320 0 112 158 4225 4202 4277 4278 4172 2738 2614 43 0 0 4254 2481 4166 4215 131 103 4704
14 Saccharolobus_islandicus--M.16.4 8 0 6 0 0 0 0 0 0 0 18 0 0 0 0 0 0 0 0 0
15 Salmonella_enterica--AKU_12601 0 136 131 74946 74655 75729 75658 48296 21498 19948 57 4254 0 0 1047731 2857146 2951421 117 108 7643
16 Salmonella_enterica--CT18 1 109 112 31918 28602 30449 30207 18988 29758 35067 42 2481 0 1047731 0 917948 940297 106 106 3716
17 Salmonella_enterica--LT2 0 147 124 73311 71244 73622 73614 48144 21606 21330 53 4166 0 2857146 917948 0 3284800 122 108 7460
18 Salmonella_enterica--P125109 0 134 135 76585 74665 76778 76583 50416 21376 20813 66 4215 0 2951421 940297 3284800 0 134 124 7645
19 Shouchella_clausii--KSM-K16 0 117 2393 113 112 119 112 120 99 97 39 131 0 117 106 122 134 0 58 124
20 Wolbachia_endosymbiont--GCF_000306885.1_ASM30688v1 0 55 46 128 108 111 108 106 102 102 58 103 0 108 106 108 124 58 0 96
21 Yersinia_ruckeri--YRB 3 129 124 7854 7963 8566 8660 7712 4417 4374 43 4704 0 7643 3716 7460 7645 124 96 0
+147 -3
View File
@@ -162,14 +162,158 @@ A single `PartitionRunner` instance can be built once per command invocation
and reused across multiple `run()` calls (e.g. `merge` runs and reused across multiple `run()` calls (e.g. `merge` runs
`merge_partitions` then `pack_matrices`). `merge_partitions` then `pack_matrices`).
## Known issue: CPU-only activation signal stalls on I/O-bound stages
Observed on a real `filter` run (109 genomes, 256 partitions, 8×24-core NUMA):
`rebuild` (CPU-bound — k-mer construction) scales cleanly from 9 to 43 active
workers as `CpuSample::do_i_activate` (`obisys::lib.rs`) sees efficiency climb.
`pack_matrices` (I/O-bound — reopens and recomposes per-genome column files
into `.pbmx`/`.pcmx`) activates one extra worker then flatlines at 10/192 for
the rest of the stage, even though 256 partitions keep completing over several
minutes. This matches the documented intent (§ Adaptive mechanism — "avoids
over-provisioning ... I/O-bound ... workloads") but conflates two different
things: *"CPU is not the bottleneck"* and *"more workers would not help"*. On
storage with real queue depth (NVMe, RAID, parallel FS) the second stage could
still benefit from more concurrent workers even with flat CPU usage — a signal
the current mechanism cannot see.
A one-off artefact was also found in the same log: right after a stage
transition, `do_i_activate` produced a physically impossible spike (efficiency
~94 cores on a 192-core box) because it has no minimum-window guard — unlike
its sibling `cpu_efficiency`, which returns `0.0` if `wall < 0.1s`
(`obisys::lib.rs:260`). `do_i_activate` unconditionally overwrites
`self.wall`/`self.user_secs`/`self.sys_secs` even when the elapsed window is
too short to be meaningful, so a burst of rapid completions right after
activating a worker can divide a real CPU delta by a near-zero wall delta.
### Implemented: I/O signal + shared debounce guard
`IoSample` (`obisys::lib.rs`, alongside `CpuSample`) is fed by
`read_bytes`/`write_bytes` from `/proc/self/io` on Linux (actual bytes
submitted to the block layer — not `rchar`/`wchar`, which also count
page-cache hits, and not `ru_inblock`/`ru_oublock`, unreliable on macOS), with
a `proc_pid_rusage(RUSAGE_INFO_V4)` fallback on macOS
(`ri_diskio_bytesread`/`ri_diskio_byteswritten`, FFI only via `libc`, no new
dependency — same pattern as the existing `getrusage` bindings). Any other
target degrades gracefully to a signal that never triggers (falls back to
CPU-only activation), same pattern as `cgroup_v2_available`.
`maybe_activate` (`numa.rs`) activates a worker if *either* signal still shows
headroom, making `PartitionRunner` adapt to whichever resource is actually the
bottleneck without per-call configuration. Both samplers are called
unconditionally — no `||` short-circuit — so neither window starves behind
whichever signal fires first:
```rust
let cpu_threshold = CPU_SPAWN_THRESHOLD * activation.last_step() as f64;
let cpu_wants_more = cpu_sample.do_i_activate(cpu_threshold);
let io_wants_more = io_sample.do_i_activate(IO_SPAWN_THRESHOLD);
if cpu_wants_more || io_wants_more {
activation.grow(GROWTH_DIVISOR, n_total);
}
```
The CPU threshold is *not* the flat absolute delta it started as: it scales
with `activation.last_step()` — the number of workers activated in the last
growth step, tracked by `NodeActivation` (`numa.rs`) and updated every time
`grow()` actually grows something. Growing by 8 workers should add ~8 cores of
efficiency if the workload is truly CPU-bound; requiring only
`CPU_SPAWN_THRESHOLD` (20 %) of that expected gain confirms the growth was
useful without demanding perfect linear scaling. Scaling by the *last step's
size* rather than the cumulative total keeps the bar equally meaningful
whether it's the 2nd growth step or the 20th — a flat absolute threshold
(0.2 core) is a strong signal at 8 active workers but pure noise at 150; a
threshold scaled by the *cumulative* total instead (considered and rejected)
would have made the bar essentially impossible to clear late in the ramp,
strangling exactly the CPU-bound saturation the mechanism exists to allow.
Unlike the CPU signal (an absolute delta in cores — a bounded, portable unit),
raw I/O throughput has no natural scale across devices, so `IoSample` uses a
**relative** growth threshold instead of an absolute one:
```rust
pub fn do_i_activate(&mut self, threshold: f64) -> bool {
let elapsed = self.wall.elapsed().as_secs_f64();
if elapsed < 0.1 { return false; } // state untouched — window keeps accumulating
let n = Self::read_bytes();
let rate = n.saturating_sub(self.bytes) as f64 / elapsed;
let activate = if self.previous_rate == 0.0 {
rate > 0.0 // bootstrap: any measured throughput is signal
} else {
(rate - self.previous_rate) / self.previous_rate >= threshold
};
self.bytes = n;
self.wall = Instant::now(); // reset only on a real sample
activate
}
```
The `elapsed < 0.1s → return false without mutating state` guard was also
back-ported into `CpuSample::do_i_activate` (previously missing — source of
the ~94-core artefact above) — one fix for both problems, and it removes the
need for any arbitrary I/O-rate floor: a short/noisy window is rejected
outright rather than papered over with a hardware-dependent constant.
Both spawn thresholds (`CPU_SPAWN_THRESHOLD`, `IO_SPAWN_THRESHOLD`, module-level
`const` in `numa.rs`, both `0.2`) are a starting point, not a derived value:
`0.2` (20 % relative growth) for `IoSample` was chosen to match the CPU
threshold's *implicit* relative sensitivity (in the observed log, an 8→9
worker step raised efficiency by ~12 %) — but I/O throughput is lumpier than
CPU time (buffered writes flush in bursts), so it needs empirical validation
against a real `pack` run before being considered final.
## Known issue: ramp-up too slow, and confused with node count
The original design started `n_nodes` workers (one per node) and grew one
worker at a time. On a real `filter` run this took ~10 minutes to climb from
9 to ~40 active workers even on the CPU-bound `rebuild` stage — most of a
35-minute stage spent under-provisioned while waiting for evidence to
accumulate one worker at a time. There is no scale-down mechanism (`n_active`
only grows), so the original caution was deliberate — but a quarter of
available cores is still far from saturation, and the real risk zone (over-provisioning
a memory-bandwidth-bound stage) only shows up much later in the ramp, near
full occupancy — not at 25 %.
The fix decouples ramp speed from node *count*: both the initial size and the
growth step are a fraction of `workers_per_node` (node *size*), applied
identically on every node. A single-NUMA-node (UMA) machine ramps exactly as
fast as an 8-node one — growing by `n_nodes` per step, as first considered,
would have degenerated to "grow by 1" on UMA, reproducing the original
problem for exactly the machines that need the fix most.
```rust
// NodeActivation::grow — called both at startup (activate_initial) and on
// every CPU/IO-triggered growth step, with a different divisor each time.
let wanted = (self.caps[idx] / divisor).max(1); // INITIAL_DIVISOR=4 at startup, GROWTH_DIVISOR=8 per step
let room = self.caps[idx].saturating_sub(self.active[idx]);
let grow = wanted.min(room).min(n_total.saturating_sub(self.total));
```
This also fixed a latent correctness gap: the original single shared
`activate_tx`/`activate_rx` pair had *no* per-node addressing — sending one
activation signal woke up whichever dormant worker (from any node) happened
to win the race on that channel. `crossbeam_channel` gives no fairness
guarantee across competing receivers, so "round-robin across nodes" was an
assumption the code never actually enforced. `PartitionRunner::run` now opens
one activation channel per node (`activate_txs`/`activate_rxs`, one pair per
`NodeConfig`); `NodeActivation` (`numa.rs`) tracks how many of each node's
dormant workers have been woken and grows every node by the same amount per
step, capped by that node's remaining dormant workers and by the run's total
budget (`n_total`) — balance across nodes is now guaranteed by construction,
not incidental to channel implementation details.
## Open questions ## Open questions
- **Error handling**: `run` currently returns the first error; remaining errors - **Error handling**: `run` currently returns the first error; remaining errors
are dropped. A `Vec<E>` return would give complete diagnostics. are dropped. A `Vec<E>` return would give complete diagnostics.
- **`workers_per_node` tuning**: currently `(cpus / 8).max(3).min(8)`, calibrated - **`INITIAL_DIVISOR` / `GROWTH_DIVISOR` tuning**: currently `4` and `8`
for merge on BeeGFS. I/O-bound commands (`dump`, `select`) may benefit from (start at 1/4 of a node's cores, grow by 1/8 per step), chosen to fix an
a higher value. A per-call override could be added to the API. observed too-slow ramp — not yet validated against a real `pack` (I/O-bound)
run, where over-provisioning risk is different from the CPU-bound `rebuild`
case this was tuned against.
- **`on_done` ordering**: the runner serialises calls to `on_done` via an - **`on_done` ordering**: the runner serialises calls to `on_done` via an
internal `Arc<Mutex<C>>`. `Send` is required (the Arc clone crosses thread internal `Arc<Mutex<C>>`. `Send` is required (the Arc clone crosses thread
+255 -38
View File
@@ -16,27 +16,43 @@ Given a set of query sequences, determine for each sequence how many of its k-me
## Algorithm ## Algorithm
The query follows the same superkmer-based partitioning strategy used at indexing time. The query follows the same superkmer-based partitioning strategy used at indexing time. Everything below happens inside `process_chunk` (`query.rs`); there is no separate per-stage function, but the internal data flow is staged: k-mer-level dereplication, a two-part MPHF/column-major matrix lookup (`obikpartitionner::query_partition_with`), and a sparse Findere pass, each producing sparse intermediate structures rather than one dense allocation for the whole chunk.
``` ```
for each chunk of sequences (parallel workers via obipipeline): for each chunk of sequences (parallel workers via obipipeline, one call to process_chunk):
build QueryBatch: decompose all sequences into s-mers via superkmers, deduplicate build QueryBatch (QueryBatch::from_records):
allocate seq_results[seq_idx][smer_pos] = None ← per-sequence s-mer result vectors decompose all sequences into superkmers (SuperKmerIter) — construction only,
split superkmers by partition via minimiser hash not the dedup key
deduplicate at k-mer granularity, split by partition in the same pass:
by_partition: Vec<HashMap<CanonicalKmer, Vec<KmerDesc>>> ← KmerDesc = (seq_idx, pos)
allocate SmerIndex (SmerIndex::new): in_index: Vec<bool>, sized total_smers —
NOT multiplied by n_genomes
allocate by_genome: Vec<Vec<(seq_idx, pos, value)>>, one empty Vec per genome —
stays empty (zero cost) for every genome this chunk never matches
for each partition p: for each partition p:
query_partition(p, superkmers_routed_to_p) query_partition_with(p, kmers_for_p, on_event):
→ load QueryLayer(s) for p stage 1 (MPHF-only): for each unique k-mer, try each layer's MphfLayer::find
→ for each s-mer in each superkmer: MphfLayer::find(smer) in turn, stop at the first hit; bucket confirmed hits by (layer, slot);
fill seq_results[seq_idx][kmer_offset + j] from partition results emit QueryHit::Found(descs) once per hit k-mer
for each sequence: stage 2 (column-major fetch): for each layer with ≥1 hit, for each genome
apply_findere(seq_results[seq_idx], effective_z) ← per full sequence column g in 0..layer.n_cols(): scan that layer's bucketed slots, look up
accumulate confirmed k-mer results into acc and cov col_value(g, slot); emit QueryHit::Value(descs, g, value) on nonzero
emit annotated sequences on_event dispatches: Found → SmerIndex::mark_found for every desc;
Value → push (seq_idx, pos, value) into by_genome[g]
for each genome g with ≥1 hit (sparse_findere_for_genome):
sort by_genome[g] by (seq_idx, pos); detect maximal runs of consecutive pos
within one seq_idx; monotone-deque window-minimum scoped to each run →
confirmed_by_genome[g]: Vec<(seq_idx, pos_out, value)>
accumulate genome_totals per sequence from confirmed_by_genome (per genome, direct)
accumulate kmer_count / kmer_missing per (sequence, output position), O(1) each,
using only the confirmed-any bitmap and SmerIndex — independent of n_genomes
if --detail: densify confirmed_by_genome into per-(seq, genome) coverage arrays
emit annotated sequences (emit_batch)
``` ```
Superkmers that appear more than once in the batch (same sequence or across sequences) are deduplicated: each unique `RoutableSuperKmer` is queried once per partition, and the result is broadcast to every `SKDesc` entry that references it. Superkmers that appear more than once in the batch (same sequence or across sequences), or different superkmers that happen to share a k-mer (read overlaps, repeats, a SNP splitting an otherwise-identical run), are deduplicated at k-mer granularity: each unique `CanonicalKmer` triggers at most one MPHF lookup and, on hit, one matrix fetch, broadcast to every `KmerDesc` occurrence referencing it.
**Findere requires full-sequence aggregation.** `apply_findere` is applied once per sequence on the complete s-mer result vector, after all partitions have contributed. Applying it per superkmer would produce false negatives at superkmer boundaries, where the z-window spans two superkmers. **Findere requires full-sequence aggregation.** The sliding window (now per-run, not per-sequence — see [Findere z-window filter](#findere-z-window-filter)) only ever runs after all partitions have contributed their hits to `by_genome`. Applying it per superkmer would produce false negatives at superkmer boundaries, where the z-window spans two superkmers.
Batches are processed in parallel via `obipipeline` workers; the `--threads` flag controls the number of worker threads. Batches are processed in parallel via `obipipeline` workers; the `--threads` flag controls the number of worker threads.
@@ -44,25 +60,46 @@ Batches are processed in parallel via `obipipeline` workers; the `--threads` fla
## Findere z-window filter ## Findere z-window filter
For approximate index modes, the index physically stores s-mers of size `s = k_user − z + 1`. At query time, `set_k(s)` is in effect, so queries naturally produce s-mer results. `apply_findere` then aggregates z consecutive s-mer results into one k_user-mer answer: For approximate index modes, the index physically stores s-mers of size `s = k_user − z + 1`; `idx.kmer_size()` (bound to `k` in `process_chunk`) is this physically-indexed s-mer size, so decomposing the query at `k` naturally produces s-mer results.
```rust The z-window aggregation is **sparse**, per genome, implemented in `sparse_findere_for_genome` (`query.rs`) — a run-detection pass followed by a monotone-deque sliding-window minimum scoped to each run, not a dense scan over every s-mer position of every sequence:
fn apply_findere(
results: &[Option<Box<[u32]>>], // N s-mer results ```
z: usize, sparse_findere_for_genome(hits, z, presence, threshold):
n_genomes: usize, // hits: raw (seq_idx, pos_smer, value) triples for this genome, as delivered
) -> Vec<Option<Box<[u32]>>> // N − z + 1 k_user-mer results // by query_partition_with's QueryHit::Value — only ever nonzero entries;
// a position with no hit for this genome simply has no entry at all.
sort hits by (seq_idx, pos_smer)
for each maximal run of consecutive pos_smer values within the same seq_idx:
dq: VecDeque<(run-relative index, value)>
for k, (_, pos, value) in enumerate(run):
maintain dq monotone non-decreasing (pop back while back.value >= value)
push (k, value)
evict dq entries with run-relative index <= k - z
if k + 1 >= z:
win_min = dq.front().value
if win_min > 0:
pos_out = pos + 1 - z
confirmed.push((seq_idx, pos_out, adjust(win_min)))
return confirmed
``` ```
Input length N (s-mers), output length N − z + 1 (k_user-mers). A window can only be confirmed (`win_min > 0`) when all `z` s-mers in it are present *and* nonzero for this genome — which, by construction, can only happen strictly inside one contiguous run of hits (any gap — an absent or zero-valued s-mer — forces `win_min = 0` for every window spanning it, exactly matching the old dense scan's "not in index counts as 0" rule, just never materialising the zero). The deque logic is otherwise identical to the pre-sparsification version; it's scoped to run-relative indices instead of the whole sequence.
For each genome g independently, a sliding window of size z scans the input. Output position i is confirmed for genome g iff all z values `results[i..i+z][g]` are nonzero (`None` counts as zero for all genomes). The scan is O(n) per genome. This runs once per genome that has at least one hit in the chunk (`process_chunk` iterates `by_genome`, one `Vec<(seq_idx, pos_smer, value)>` per genome, built from `QueryHit::Value` during the partition loop — genomes with zero hits in this chunk have an empty `Vec` and cost nothing beyond the iteration itself). Total work is `O(hits log hits)` per genome (the sort) rather than `O(n_smers)` per genome regardless of hit count — a genuine complexity win on top of the memory one, for the common case where most `(chunk, genome)` pairs have no or few hits.
Output values come from `results[i]` (leftmost s-mer of each window); genomes not confirmed are zeroed. If all genomes are zero, the position is returned as `None`. Output position `pos_out` is confirmed for genome `g` iff its run produced a nonzero `win_min` — equivalent to "all `z` consecutive s-mer values in the window are nonzero for `g`", same semantics as before.
**Short sequences**: when the s-mer count is less than z, no complete window can form — `apply_findere` returns an empty vector. K-mers from sequences shorter than k_user are not emitted. **The value reported per confirmed position is the window minimum, not the leftmost s-mer's raw value** — unchanged from the dense version. For presence indexes (0/1 values) this is equivalent to a logical AND either way. For count indexes it is not: the accumulated count for genome `g` at position `pos_out` is the minimum across the window, the weakest link — not the leftmost s-mer's own count. The presence/count adjustment (`u32::from(win_min >= threshold)` vs. raw `win_min`) is applied once, inside `sparse_findere_for_genome`, rather than later during accumulation.
**Exact indexes**: `z = 1`, `apply_findere` is a passthrough (output length = input length). **`kmer_missing` bookkeeping is independent of the per-genome sparse structures**, by design (see roadmap point 9): a lightweight dense `SmerIndex` (`in_index: Vec<bool>`, sized `total_smers`**not** multiplied by `n_genomes`) is populated from `QueryHit::Found` during the partition loop, one entry per hit k-mer regardless of which genome(s) it matched. A position with no genome confirmed counts as `kmer_missing` iff the leftmost s-mer of that window is absent from `SmerIndex` entirely (see [`kmer_missing` semantics](#kmer_missing-semantics)).
**Coverage (`--detail`)** is built by re-scanning each genome's confirmed-hit list (already computed, no extra pass over raw data) and densifying into the `[u32; n_kmers_out]` arrays the JSON output format requires — but only when `--detail` is actually requested; the sparse structures cost nothing extra when it isn't.
**Short sequences**: when a sequence's s-mer count is less than `z`, its run(s) — if any hits exist at all — can never reach length `z`, so no window is ever confirmed for it; no k_user-mer is emitted, same outcome as the dense version's `n_kmers_out == 0` early-skip, reached here as a natural consequence rather than a separate check.
**Exact indexes**: `z = 1`, every single-hit "run" of length 1 immediately satisfies `k + 1 >= z`, so every hit is its own confirmed window with `win_min` equal to its own value — a passthrough, as before.
### Effective z at query time ### Effective z at query time
@@ -85,14 +122,17 @@ The `-z` CLI option overrides the index metadata value. A higher z increases str
### `QueryLayer` variant selection ### `QueryLayer` variant selection
`QueryLayer::open` in `query_layer.rs` selects the data matrix to pair with `MphfLayer`: `QueryLayer::open` (`obikpartitionner/src/query_layer.rs:28-45`) only ever returns two variants — `Presence` or `Count`, checked in this order:
| Condition | Variant | Data returned per k-mer | | Order | Condition | Variant | Data returned per k-mer |
|---|---|---| |---|---|---|---|
| `with_counts=true` and `counts/` exists | `Count` | raw count per genome | | 1 | `with_counts=true` and `counts/` exists | `Count` | raw count per genome |
| `presence/` exists | `Presence` | 0/1 per genome (bit matrix) | | 2 | (else) `presence/` exists, or `counts/` doesn't exist at all | `Presence` | see below |
| only `counts/` exists | `Count` | counts used as-is | | 3 | (else — `counts/` exists, `presence/` doesn't, `with_counts=false`) | `Count` | counts used as-is |
| neither exists | `SetOnly` | 1 for every genome |
There is no `QueryLayer::SetOnly` variant. The "no on-disk matrix at all" case is handled one level down: `Presence` wraps `PersistentBitMatrix`, whose own `open()` (`obicompactvec/src/bitmatrix.rs:260-288`) auto-detects among **three** internal representations — `Packed` (`presence/matrix.pbmx`), `Columnar` (`presence/meta.json`), or `Implicit { n_rows, n_cols }` when neither file exists (built from `layer_meta.json`, `fill_row` returning all-`1`s without touching disk). This is where "1 for every genome" actually happens — not at the `QueryLayer` level.
**Worth double-checking, not confirmed as a bug**: `PersistentBitMatrix::open`'s `Implicit` branch constructs `Implicit { n_rows: meta.n, n_cols: 1 }``n_cols` is hardcoded to `1`, not to the layer's actual `n_genomes`. `fill_row` for `Implicit` only writes `buf[..1]`, leaving the rest of a longer `n_genomes`-sized buffer untouched (zeroed by the caller beforehand). If this path is ever reached for a layer covering more than one genome, only genome index 0 would read as present. Whether that's reachable in practice (layers might always be single-genome when they fall back to `Implicit`) wasn't verified here — flagging for follow-up, not fixing.
--- ---
@@ -123,7 +163,7 @@ Coverage reflects confirmed k_user-mers only. The vectors are emitted in the JSO
## `kmer_missing` semantics ## `kmer_missing` semantics
`kmer_missing` counts k_user-mer positions where the first s-mer (`seq_results[seq_idx][pos]`) is `None` — i.e. absent from the index entirely. K-mers where the z-window fails because a later s-mer is absent or zero are not counted as missing (the first s-mer being present is used as proxy for index membership). `kmer_missing` counts k_user-mer positions where the leftmost s-mer of the window (`smer_index.is_in_index(seq_idx, pos)`, `SmerIndex`) is `false` — i.e. absent from the index entirely. K-mers where the z-window fails because a later s-mer is absent or zero (but the leftmost one is present) are not counted as missing the leftmost s-mer being present is used as proxy for index membership.
--- ---
@@ -152,8 +192,8 @@ Genome keys follow the iteration order of `meta.genomes`.
| Key | Type | Condition | Semantics | | Key | Type | Condition | Semantics |
|---|---|---|---| |---|---|---|---|
| `kmer_count` | int | always | k-mers confirmed (post-Findere) with at least one genome match | | `kmer_count` | int | always | k-mers confirmed (post-Findere) with at least one genome match |
| `kmer_missing` | int | `--count-missing` | k-mers absent from the index entirely (pre-Findere None) | | `kmer_missing` | int | `--count-missing` | k-mers absent from the index entirely (leftmost s-mer of the window not found) |
| `kmer_strict_matches` | object | always | per-genome accumulated value (label → count or 0/1) | | `kmer_strict_matches` | object | always | per-genome accumulated value, non-zero entries only (label → count or 0/1) |
| `coverage` | object | `--detail` | per-genome array of per-position contributions (label → [u32]) | | `coverage` | object | `--detail` | per-genome array of per-position contributions (label → [u32]) |
`kmer_count + kmer_missing` ≤ total k_user-mers in the sequence. The gap corresponds to k_user-mers whose z-window was not fully confirmed (at least one s-mer absent or zero for all genomes) but whose first s-mer was present in the index. `kmer_count + kmer_missing` ≤ total k_user-mers in the sequence. The gap corresponds to k_user-mers whose z-window was not fully confirmed (at least one s-mer absent or zero for all genomes) but whose first s-mer was present in the index.
@@ -165,7 +205,7 @@ Genome keys follow the iteration order of `meta.genomes`.
``` ```
obikmer query <index> [--detail] [--mismatch] [--count-missing] obikmer query <index> [--detail] [--mismatch] [--count-missing]
[--force-presence] [--presence-threshold <n>] [--force-presence] [--presence-threshold <n>]
[-z <z>] [-T <threads>] [-z <z>] [-T <threads>] [--chunk-size <MiB>]
<query.fa> [<query2.fa> ...] <query.fa> [<query2.fa> ...]
``` ```
@@ -177,6 +217,7 @@ obikmer query <index> [--detail] [--mismatch] [--count-missing]
| `--force-presence` | off | Report 0/1 per genome regardless of index counts | | `--force-presence` | off | Report 0/1 per genome regardless of index counts |
| `--presence-threshold` | 1 | Minimum count to declare genome present | | `--presence-threshold` | 1 | Minimum count to declare genome present |
| `-T` / `--threads` | all CPUs | Worker threads | | `-T` / `--threads` | all CPUs | Worker threads |
| `--chunk-size` | auto (from available RAM and thread count) | I/O chunk size in MiB — see [Future work, point 3](#throughput--parallelism--identified-potential-not-yet-implemented) for why the auto-sizing formula currently under-estimates memory on indexes with many genomes |
`--mismatch` is accepted but currently ignored with a warning on stderr. `--mismatch` is accepted but currently ignored with a warning on stderr.
@@ -187,3 +228,179 @@ obikmer query <index> [--detail] [--mismatch] [--count-missing]
- **`--mismatch`**: 1-mismatch approximate matching — generate `3·k` single-substitution variants per k-mer, look each up independently. - **`--mismatch`**: 1-mismatch approximate matching — generate `3·k` single-substitution variants per k-mer, look each up independently.
- **Read classification** (`--classify`): assign each read to the genome with the highest match score. - **Read classification** (`--classify`): assign each read to the genome with the highest match score.
- **Whitelist / blacklist filtering**: threshold-based accept/reject on per-genome match scores. - **Whitelist / blacklist filtering**: threshold-based accept/reject on per-genome match scores.
### Throughput & parallelism — identified potential (not yet implemented)
Observed on a 192-core (8×24 NUMA) machine: `query` uses ~10 cores or fewer, and the default chunk size gets the process OOM-killed. Root causes and candidate fixes, in dependency order:
**1. Single-threaded I/O source (main core-utilization bottleneck).**
`run()` builds `all_chunks` via `paths.into_iter().flat_map(read_sequence_chunks_sized(...))` and passes it directly as the `input` iterator to `pipe.apply()`. In `obipipeline::Pipe::apply` (`scheduler.rs`), `input.next()` is called exclusively from the dedicated source thread — so file opening, decompression, and FASTA/FASTQ chunk-boundary parsing for *all* input files run serially in one thread, regardless of `--threads`. Compare with `steps::scatter` (used by `index`) and `cmd/superkmer.rs`: there, file opening + streaming is itself a `Flat` pipeline stage (`||?`), executed across the `n_workers` pool, with `obipipeline::throttle(paths, max_open)` bounding concurrently-open files in the source thread. That pattern parallelises I/O across files (and NUMA nodes); `query.rs` cannot.
Fix direction: restructure `query`'s pipe with an initial `Flat` stage analogous to `scatter`'s, opening/chunking files across workers instead of in `flat_map`.
**2. Gzip decompression is inherently single-threaded per file.**
`niffler`/`flate2` (used by `xopen`) do standard DEFLATE, which has no parallel-decodable structure for an arbitrary stream. Fix (1) parallelises *across* files but not *within* one large gzip file. Parking a possible fix (`rapidgzip-rs`) is tracked in [chunkreader.md](../implementation/chunkreader.md#future-work--parallel-gzip-decompression-in-xopen).
**3. Chunk-size memory formula ignores `n_genomes`.**
`chunk_bytes = available_memory_bytes() / (n_workers * 16)` (`query.rs:407-414`) assumes a fixed ~8–16× overhead per raw input byte. But `KmerResults::new` (`query.rs:165-179`) allocates `data: Vec<u32>` sized `total_kmers_in_chunk × n_genomes` — dense, **for every k-mer position in the chunk, hit or not** — plus `win_min` and (with `--detail`) `cov`, same scaling. Real per-chunk memory is `O(n_genomes)`, not constant; the formula doesn't know `n_genomes` at all. This is the direct cause of the OOM kill on indexes with many reference genomes.
**4. MPHF lookup and matrix-row fetch are fused, not staged.**
`QueryLayer::find_into` (`obikpartitionner/src/query_layer.rs:48-67`) does the MPHF `find` *and* the `fill_row` matrix read in one call per k-mer, inside a single-threaded loop (`query_partition_with`). There is no separation between "is this k-mer indexed" (cheap, `O(1)`, independent of `n_genomes`) and "what are its per-genome values" (the expensive, `n_genomes`-scaling part).
**5. Dereplication should happen at k-mer granularity, directly — not via an intermediate superkmer-level dedup.**
`QueryBatch::from_records` currently dereplicates at the *superkmer* level (`HashMap<RoutableSuperKmer, Vec<SKDesc>>`, `query.rs:112`). This misses redundancy between k-mers shared by *different* superkmers (read overlaps, repeats, a SNP splitting an otherwise-identical run). Superkmer *construction* (`SuperKmerIter`) stays mandatory — it is the mechanism that computes minimizers/partition routing, not an optional dedup layer — but the dedup structure built on top of it should key directly on `CanonicalKmer`, in the same pass: `HashMap<CanonicalKmer, Vec<(seq_idx, pos)>>`. This also means the MPHF `find` itself runs once per **distinct** k-mer instead of once per occurrence — a win independent of the matrix-fetch cost below.
**6. Stage 1 output: bucket confirmed hits by layer, keyed by MPHF slot.**
For each unique canonical k-mer, MPHF lookup across a partition's layers stops at the first match (`query_partition_with:105-111`) — a k-mer belongs to at most one layer. So stage 1's output can be reshaped directly into:
```
HashMap<layer_idx, HashMap<slot, Vec<(seq_idx, pos)>>>
```
replacing the `CanonicalKmer` key by the resolved `slot` (compact integer, and exactly what stage 2 needs to address the matrix). K-mers matching no layer simply have no entry here (they still count toward `in_index`/`kmer_missing` bookkeeping, which stays `O(1)` per position, independent of `n_genomes`).
**7. Partition-level parallelism is currently absent — and a NUMA-aware mechanism for exactly this already exists, unused, in `obikindex`.**
`process_chunk`'s partition loop (`query.rs:250-278`, `for (part_idx, part_sks) in by_part.iter().enumerate()`) processes every partition of a chunk sequentially on the single worker thread that owns that chunk. This is a parallelism axis on its own, independent of the column question below.
More importantly: `docmd/architecture/numa_partition_runner.md` and `numa_worker_pools.md` document `PartitionRunner` (`obikindex/src/numa.rs`), **already implemented** and already used by `merge.rs`, `index.rs` (`build_layers`), `select.rs`, `reindex.rs`, `rebuild.rs` — one controller thread per NUMA node, a Rayon pool pinned to that node's CPUs (`hwlocality`, `numa` feature, default-on in `obikindex/Cargo.toml`), adaptive worker activation driven by *both* a CPU-efficiency signal and an I/O-throughput signal (`CpuSample`/`IoSample`, `/proc/self/io` on Linux). It exists precisely because a naive `into_par_iter()` on the global Rayon pool measurably degrades ×60 on this codebase's own 192-core/8-NUMA reference machine (`numa_worker_pools.md`, § Problem) once workers contend for cross-socket memory bandwidth on shared mmap'd/hashed structures — exactly the shape of the matrix-column scan in point 8 below.
`obikmer` already depends on `obikindex` (`obikmer/Cargo.toml`, for `KmerIndex`), so `PartitionRunner` is directly reachable from `cmd/query.rs` — no new dependency. Both the partition-level loop and (see point 8) the genome-column scan should be driven through it rather than through ad-hoc `rayon::into_par_iter()`, to avoid reproducing the already-measured-and-fixed contention problem. Also relevant: the "CPU-only signal stalls on I/O-bound stages" issue documented for `pack_matrices` (mmap-heavy, page-fault-bound) applies just as much to a column-major mmap scan over persistent matrices — reuse the existing dual CPU/IO activation signal rather than re-deriving one.
>
> **Correction from implementation (Phase 4 below)**: this turned out not to be viable as described. `PartitionRunner::run()`'s actual body spawns roughly one OS thread per worker slot across every NUMA node **on every call** (confirmed by reading `numa.rs`, not just its doc comments) — fine for the one-call-per-command-invocation batch usage in `merge`/`build_layers`, but `query_partition_with` runs once per `(chunk, partition)`, far too frequently to absorb that spawn cost. Partition-level parallelism via `PartitionRunner` is deferred, not implemented. See Phase 4's "What did not ship, and why" for the detail.
**8. Stage 2: column-major matrix fetch, parallel across genome columns — via `PartitionRunner`, not naive `rayon`.**
Both persistent matrix formats are column-oriented on disk: `ColumnarCompactIntMatrix`/`ColumnarBitMatrix` (`obicompactvec/src/{intmatrix,bitmatrix}.rs`) mmap one file per genome column; `PackedCompactIntMatrix`/`PackedBitMatrix` mmap one region-offset per column in a single file. `fill_row(slot, buf)` as used today (`query.rs:262-272` via `on_hit`) reads **one slot across all `n_genomes` columns** per hit — the worst possible access pattern for this layout (up to `n_genomes` scattered mmap regions touched per single k-mer).
Better: for each layer, walk the matrix **column by column** (genome by genome): for each genome, scan the `slot` keys collected in step 6 for that layer and call `col.get(slot)`, keeping only nonzero results, and broadcast to the associated `(seq_idx, pos)` list. Total `get()` calls are unchanged (`n_hits × n_genomes` in the worst case) — the win is locality (sequential access within one mmap'd column at a time, not scattered across all columns per hit), not fewer operations.
Columns are independent (read-only, disjoint mmap regions) → embarrassingly parallel across genomes, *but* — per point 7 — `obicompactvec`'s existing `into_par_iter()` over `0..n_cols` (`sum()`, `count_nonzero()`, pairwise distance matrices) is the **naive, unpinned** pattern the rest of the codebase is actively migrating away from, not a model to copy here. Route this through `PartitionRunner` (or the same NUMA-pool machinery) instead. Two things to settle when this is designed: how the partition axis (point 7), the column axis, and the existing chunk-level `n_workers` `obipipeline` pool compose without oversubscribing the machine (three different concurrency mechanisms — raw-thread pipe workers, `PartitionRunner`'s pinned Rayon pools, and whatever drives the column scan — need a single reconciled thread budget, not three independent ones); and the threshold below which per-column dispatch overhead outweighs the gain (small `n_genomes` or small per-layer hit counts) — to be measured, not assumed.
>
> **Correction from implementation (Phase 4 below)**: column-major fetch is implemented — but as a plain sequential loop, not parallelised via `PartitionRunner`. Same reason as point 7's correction above. The column-major *locality* win (the actual claim of this point) does not depend on adding parallelism on top of it, and is validated independently. Column-level parallelism is deferred pending a mechanism that fits this call frequency (candidates noted in Phase 4).
**9. Sparse per-genome representation, fed directly to Findere.**
Stage 2's output should be `HashMap<genome_idx, Vec<(seq_idx, position, count)>>`, **sorted by `(seq_idx, position)`** once collected, instead of a dense `KmerResults`-style matrix — the key must carry `seq_idx`, not just `genome_idx`, because a chunk batches many sequences and `position` is only meaningful within one; a plain `Vec<(position, count)>` per genome would silently mix positions from different sequences and corrupt the sliding-window scan. This bounds retained memory by actual nonzero hits on both axes (position sparsity from non-matching k-mers, genome sparsity from a matched k-mer typically belonging to only a handful of genomes out of possibly many). The Findere sliding-window (`process_chunk`, the `win_min`/deque loop) would need reworking to run per `(sequence, genome)` over its sparse, sorted `(position, count)` list — detect runs of ≥`z` consecutive positions, window-min within each run — instead of today's dense `O(total_kmers × n_genomes)` scan. This is also a genuine complexity win (`O(hits log hits)` per genome vs. dense scan), not just memory.
**Not covered by this sparsification**: `--detail`'s `cov` accumulator (`query.rs:304-308`) has the identical `n_genomes`-dense scaling problem and wasn't folded into points above. It doesn't need to be retained densely throughout processing, though — only the final JSON serialization (`emit_batch`) requires a dense `[u32]` per `(seq, genome)`, and only for the sequences actually being output with `--detail`. Densification can stay a late, output-time-only step, reconstructed from the sparse per-genome lists.
**Secondary patterns available from `scatter.rs`/`superkmer.rs`, not yet in `query.rs`:**
- `throttle()` + `CommonArgs::effective_max_open()` to bound concurrently-open input files (query.rs defines its own `QueryArgs`, doesn't reuse this).
- Progress bar with EMA throughput + live active-worker gauges (`obisys::spinner`, `flat_active`/`transform_active` counters) — diagnostic value for locating the bottleneck.
- `obisys::Reporter`/`Stage::start`/`stop` timing per phase (used by `index`, `filter`; absent from `query`).
None of this is implemented yet — parked here as a coherent roadmap while the design is discussed further. Suggested dependency order: (1) I/O parallelism → (3) genome-aware chunk sizing → (4)–(9) staged/k-mer-deduped/NUMA-aware-partition-and-column-major/sparse query engine (larger refactor, biggest structural payoff — reuses `PartitionRunner` rather than inventing a new parallelism mechanism) → (2) parallel gzip (separate, orthogonal, tracked in chunkreader.md) → secondary diagnostics patterns.
---
## Implementation plan
Concrete, phased translation of the roadmap above. Phases 0–2 are small, independent, low-risk, and each individually testable against current `query` output — land them first, in order, and measure on the reference 192-core/8-NUMA machine before deciding whether phases 3–5 (the staged/sparse engine, the larger structural payoff) are still worth their cost. Phases 3–5 are one coordinated change spanning `obikmer`, `obikpartitionner`, and `obicompactvec` — they should not be split across releases mid-way, because the intermediate state (e.g. k-mer-level dedup feeding the old dense `KmerResults`) has no correctness or performance benefit on its own. Phase 6 is unrelated to phases 0–5 and can happen any time, independently, if `rapidgzip-rs` is validated (see [chunkreader.md](../implementation/chunkreader.md#future-work--parallel-gzip-decompression-in-xopen)).
Instrumentation is deliberately sequenced *before* the I/O fix (reordering the roadmap's own listed order), because every later phase's justification rests on a measurement ("to be measured, not assumed" appears throughout the roadmap above) — without it, phases 3–5 would be undertaken on faith.
Performance measurement on the reference 192-core/8-NUMA machine is done by the project owner, not from this development environment (macOS, 16 cores — `PartitionRunner`'s NUMA pinning is Linux-only, so even phase 4's mechanism can't be functionally exercised for its actual purpose here). Each phase below is therefore written to be *self-measuring*: the debug-level logging it adds must be enough, on its own, to judge whether that phase's algorithmic choice paid off from a cluster run's logs, without needing to attach a profiler.
### Conventions applied to every phase below
**Debug logging.** Every phase that changes an algorithmic choice (not phase 0, which *is* the logging) adds `tracing::debug!`/`trace!` at points that let a cluster run's logs answer "did this help": counts, ratios, and timings that quantify the specific claim that phase makes — e.g. phase 3 must log how many MPHF `find` calls were saved by k-mer-level dedup (the whole justification for that phase), phase 4 must log per-column scan timings, phase 5 must log actual retained-memory / sparsity ratios achieved. Prefer one structured `debug!` per chunk (fields, not prose) over free-text — the cluster logs will be the only evidence available for judging these choices, so they need to be grep/awk-able, not just readable.
**Unit tests.** This project's convention (`obiread`, `obikseq`, `obidebruinj`, `obicompactvec`, `obilayeredmap`, `obiskio`, `obifastwrite`) is `#[cfg(test)] #[path = "tests/<name>.rs"] mod tests;` at the bottom of the source file, with the actual test code in a sibling `src/tests/<name>.rs`. Neither `obikmer` nor `obikpartitionner` (the two crates phases 3 and 5 touch most) currently have a `src/tests/` directory at all — this needs creating, following the existing pattern exactly, not inventing a new one.
**Workflow (`jj`).** Work happens in a fresh `jj` commit, easy to abandon. `jj new` between phases is reasonable where it helps isolate a phase for review, but only when the working copy compiles at that point (project convention) — phase 3's internal sub-steps (batch dedup change, then `query_layer.rs` split, then the new return shape) will likely not each compile independently since they're one coupled change, so treat "commit boundary" and "plan phase boundary" as related but not forced to match 1:1; use judgement per phase rather than mechanically splitting on every bullet.
### Phase 0 — Instrumentation (prerequisite for measuring every later phase)
**Goal**: make core utilization, throughput, and per-stage timing visible on a real run, so phases 1–5 can be justified with numbers instead of assumption.
- `obikmer/src/cmd/query.rs`: wrap `run()`'s main loop with `obisys::Reporter`/`Stage::start("query")`/`.stop()`, printed at the end via `rep.print()` — same pattern as `index.rs`/`filter.rs`.
- Add an `obisys::spinner("query")` progress bar around the `pipe.apply(...)` loop, with an EMA throughput readout (bases/s or k-mers/s, mirroring `steps::scatter`'s `ema_rate` computation, `scatter.rs:88-118`) and live gauges for "chunks in flight" / "workers busy" — reuse the `AtomicU32` counter pattern from `scatter.rs` (`flat_active`, `transform_active`) rather than inventing a new one.
- Add `max_open_files: Option<usize>` to `QueryArgs` and a `effective_max_open()` method mirroring `CommonArgs::effective_max_open()` (`obikmer/src/cli.rs:90-94`) — needed by phase 1's `throttle()` call. (`QueryArgs` can't just embed `CommonArgs` — it doesn't take `kmer_size`/`minimizer_size`/`partitions`/`level_max`/`theta` from the CLI, those come from the index metadata — so this is a small standalone addition, not a flatten.)
- Add one structured `debug!` per `process_chunk` call: chunk byte size, sequence count, s-mer count, wall time, and (once later phases exist) the fields they add — this single log line is the baseline every later phase's own logging gets compared against.
- **Validation**: none needed beyond "the numbers appear and look sane" — this phase changes no query logic or output.
- **Deliverable used by every phase below**: a before/after throughput and core-utilization measurement on the reference machine.
### Phase 1 — Parallel per-file I/O (fixes root cause of low core utilization)
**Goal**: file opening, decompression, and chunk-boundary parsing run across the `n_workers` pool instead of serially in the pipe's dedicated source thread.
- `obikmer/src/cmd/query.rs`:
- Replace the `paths.into_iter().flat_map(read_sequence_chunks_sized(...))` construction (current `run()`, building `all_chunks`) with `obipipeline::throttle(paths.into_iter(), args.effective_max_open())`, passed as the pipe's `input`.
- Add a new `QueryData::Path(PathBuf)` variant (alongside `Chunk`/`Output`) to carry the throttled path through the pipe's type-erasure mechanism.
- Add a new **first** pipe stage, `Flat`/fallible (`||?`), modeled on `scatter.rs:60-86` and `superkmer.rs:54-65`: given a `Throttled<PathBuf>`, call `read_sequence_chunks_sized(path, chunk_bytes)` and yield each `Rope` chunk, keeping `pw.guard` alive until the file's iterator is exhausted (reuse or adapt `scatter.rs`'s `GuardedIter` wrapper — same lifetime problem, same fix).
- The existing `process_chunk` transform stage becomes the pipe's **second** stage, unchanged in its own logic — it still receives one `Rope` chunk at a time, just no longer all coming from one serial source.
- `make_pipe!` invocation grows from one stage (`Chunk => Output`) to two (`Path => Chunk => Output`).
- Log, per file: time spent waiting on the `throttle()` slot (queueing due to `max_open`), and time spent opening/decompressing/producing the first chunk — this is what directly proves (or disproves) that I/O is now spread across workers instead of serialized.
- **Validation**: run `query` on a small multi-file input, diff output against the pre-change version — content must be identical; **record order across files is not guaranteed to be preserved** even before this change (chunk-level dispatch across `n_workers` already reorders completions), so the diff must be order-insensitive (sort by read id, or compare as sets) if it wasn't already.
- **Measure**: core utilization on the reference machine with several large input files, compare against phase 0's baseline.
### Phase 2 — Genome-aware chunk-size formula (fixes OOM)
**Goal**: `chunk_bytes` reflects actual per-chunk memory (`O(n_genomes)`), not a fixed multiplier.
- `obikmer/src/cmd/query.rs`, `run()`: `n_genomes` and `args.detail` are already computed above the `chunk_bytes` calculation (`n_genomes` at the top of `run()`, before line 407 in the current file) — reorder if needed, then replace:
```rust
let computed = avail / (n_workers as u64 * 16);
```
with a formula that scales the divisor by `n_genomes` (and roughly doubles it when `--detail` is set, since `cov` duplicates the per-genome accumulation): e.g. `per_chunk_multiplier = base_overhead + n_genomes as u64 * BYTES_PER_KMER_PER_GENOME * if detail { 2 } else { 1 }`, replacing the flat `16`. `BYTES_PER_KMER_PER_GENOME` should be derived from `KmerResults`'s actual layout (`4` bytes per `u32` entry in `data`, plus the `bool` in `in_index`, plus `win_min`'s equal-sized buffer) rather than guessed.
- `args.chunk_size` (manual `--chunk-size` override) keeps taking priority, unchanged.
- Log the resolved `chunk_bytes`, `n_genomes`, and the estimated peak per-chunk memory (`chunk_bytes` × the same multiplier used to derive it) once at startup — lets a cluster run confirm the estimate was actually respected, not just that the process didn't get OOM-killed (which could also happen to be true for the wrong reason).
- **Validation**: build a test index with a large `n_genomes` (e.g. hundreds), run `query` with default chunk sizing under a memory limit (`ulimit -v` or a cgroup), confirm it no longer gets OOM-killed and that memory scales as predicted when `n_genomes` grows.
- **Note**: this phase is superseded once phase 5 lands (sparse retained memory no longer scales with `n_genomes × total_kmers` at all) — but it's needed immediately regardless, since phases 3–5 are a bigger, riskier change and users need a working `query` in the meantime.
### Phase 3 — K-mer-level dereplication, staged MPHF/matrix lookup
**Goal**: replace superkmer-level dedup with k-mer-level dedup (roadmap point 5), and split the fused MPHF-find/matrix-fetch (point 4) so stage 1's output is bucketed by layer and MPHF slot (point 6).
- `obikmer/src/cmd/query.rs`:
- Replace `QueryBatch::from_records`'s dedup map (`HashMap<RoutableSuperKmer, Vec<SKDesc>>`, current `query.rs:112`) with a per-partition `HashMap<CanonicalKmer, Vec<(seq_idx: u32, pos: u32)>>`, built in the same `SuperKmerIter` pass: superkmer construction and partition routing (`part_idx` from the superkmer's minimizer hash) are unchanged, only the granularity of what gets deduplicated changes — each `CanonicalKmer` within a superkmer is inserted individually instead of the whole superkmer being the dedup key.
- **Verified**: `CanonicalKmer` (`obikseq/src/kmer.rs:390`, `pub type CanonicalKmer = CanonicalKmerOf<KLen>`) — the underlying `CanonicalKmerOf<L>` derives `Debug, Clone, Copy, PartialEq, Eq, PartialOrd, Ord, Hash` (`kmer.rs:269`). Usable as a `HashMap`/`HashSet` key as-is, no change needed.
- `obikpartitionner/src/query_layer.rs`:
- Split `QueryLayer::find_into` (`query_layer.rs:48-67`) into two methods: `find_slot(&self, kmer: CanonicalKmer) -> Option<usize>` (MPHF only, no matrix touch) and keep `fill_row` as-is for phase 4 to call later.
- Replace `query_partition_with`'s inner loop (`query_layer.rs:103-113`) with a version that, for each unique `CanonicalKmer`, calls `find_slot` across the partition's layers (stopping at first hit, same as today), and instead of immediately filling a row, records `(layer_idx, slot)`.
- New return shape for the partition-level query, replacing today's `on_hit(sk_idx, kmer_idx, row)` callback: `HashMap<layer_idx, HashMap<slot, Vec<(seq_idx, pos)>>>` (roadmap point 6) — built directly from the k-mer dedup map's `Vec<(seq_idx,pos)>` values, keyed by the resolved slot instead of the k-mer.
- **This phase alone has no throughput benefit yet** (matrix fetch still happens, just deferred) beyond the k-mer-level dedup itself (fewer MPHF calls when queries have overlapping/repeated k-mers) — its purpose is to produce the input phase 4 needs. Land phase 3+4 together, not phase 3 alone, per the "don't split 3–5 across releases" note above.
- Log, per chunk: total k-mer occurrences vs. unique `CanonicalKmer` count (the dedup ratio — the entire justification for this phase) and the resulting MPHF `find` call count. If the dedup ratio is close to `1.0` on real query data (little redundancy), that's the cluster run telling us this phase wasn't worth it — the logging needs to be able to say that, not just confirm the happy path.
- **Unit tests**: create `obikmer/src/cmd/tests/query.rs` (new `src/tests/` dir for this crate, following the project's `#[cfg(test)] #[path = "tests/query.rs"] mod tests;` convention) and `obikpartitionner/src/tests/query_layer.rs` (likewise new for this crate). Cover: the k-mer-level dedup map construction on synthetic sequences with known repeated/overlapping k-mers (assert unique-kmer count and occurrence lists); the `find_slot`/bucket-by-layer-and-slot construction against a small hand-built `QueryLayer` fixture, asserting the `(layer_idx, slot, seq_idx, pos)` tuples match what the old per-occurrence loop would have produced.
### Phase 4 — Column-major matrix fetch (roadmap points 7–8) — implemented, NUMA parallelism deferred
**Goal (revised during implementation)**: replace `fill_row`-per-hit (row-major, worst-case mmap locality) with a column-major scan. `PartitionRunner` turned out to be the wrong mechanism for this at this call granularity — see below; the column-major fetch itself is implemented and validated, without it.
**What shipped:**
- `obicompactvec`: the per-column accessors this phase needed **already existed** — `PersistentCompactIntMatrix::col_view(c)` and `PersistentBitMatrix::col_view(c)` are public, and `IntSliceView::get(slot)`/`BitSliceView::get(slot)` are public — the original plan underestimated how much of this plumbing the pairwise-distance code (`dump`/`select`/`stats`) had already required. The one real gap: `PersistentBitMatrix::col_view()` panics on the `Implicit` variant (the documented mono-genome fast path, `bitmatrix.rs`). Added `PersistentBitMatrix::get(c, slot) -> u32` (`bitmatrix.rs`), a non-panicking column-major point lookup that returns `1` for `Implicit` regardless of `c` — the smallest surface needed, not a new `col_get` API from scratch.
- `obikpartitionner/src/query_layer.rs`: `query_partition_with` is now two explicit stages, matching roadmap points 6–8: **stage 1** (MPHF-only, per unique k-mer, bucket hits by `(layer_idx, slot)`, emits `QueryHit::Found`) then **stage 2** (per layer with ≥1 hit, column-major: for each genome column `g` in `0..layer.n_cols().min(n_genomes)`, scan that layer's bucketed slots and call `col_value(g, slot)`, emitting `QueryHit::Value(descs, g, value)` on nonzero). `QueryHit` is a single enum delivered through one `FnMut(QueryHit)` callback — an earlier two-closure design (`on_found` + `on_value`) didn't borrow-check, since the caller's single mutable accumulator (`KmerResults`) can't be captured by two separate `FnMut` closures passed to the same call.
- `obikmer/src/cmd/query.rs`: `KmerResults::set` (row-major, whole-row-at-once) replaced by `mark_found` (stage 1: flag a position as indexed, independent of any genome's value) and `set_one` (stage 2: write one genome's value at one position). `QueryStats` extended with `n_columns_scanned`/`n_col_get_calls`, logged per chunk.
- Total `get()`-equivalent calls are unchanged from the row-major version (`n_hits × n_cols` in the worst case, confirmed by `n_col_get_calls` in the debug log) — the win is locality (sequential access within one layer's column at a time, across `mmap`'d regions, instead of jumping across all columns per hit), exactly as predicted.
**What did not ship, and why — `PartitionRunner` is architecturally the wrong tool here:**
Reading `obikindex/src/numa.rs`'s actual `run()` body (not just its doc comments) shows every call spawns a timer thread **plus one OS thread per worker slot on every NUMA node** (`std::thread::scope` + one `s.spawn()` per node per `max_workers`) — on the 192-core/8-NUMA reference machine, that's on the order of 190+ fresh OS threads spawned **per call**. This is fine for its actual, established usage in this codebase (`merge.rs`, `index.rs`'s `build_layers`): one `PartitionRunner::new()` + one `run()` call per command invocation, amortised over a batch of ~256 long-running partitions. It is not fine for `query`'s call pattern: `query_partition_with` runs once per `(chunk, partition)`, potentially thousands of times per second — spawning ~190 OS threads that often to scan a handful of genome columns would very likely cost far more than the row-major approach it's meant to replace. This is exactly the "resolve empirically, don't assume" composition risk the roadmap flagged, just resolved by reading the mechanism's actual cost before wiring it in, rather than by measuring a regression on the cluster after the fact.
The column-major loop in stage 2 is therefore a **plain sequential loop** for now — it captures the whole, provable locality win (roadmap point 8's actual claim) without adding any parallelism mechanism. Genome-column-level parallelism (point 8's "bonus" axis) and partition-level parallelism (point 7) are both deferred — not abandoned. Candidates for a follow-up, once there's a concrete profiling need: (a) `rayon`'s already-warm global pool (`into_par_iter()`) for the column axis specifically — cheap to invoke repeatedly since it doesn't spawn threads per call, though it's the same "naive rayon" pattern `numa_worker_pools.md` warns about for a *different* workload (random pointer-chasing over large hash maps); a column scan's access pattern (sequential reads within one `mmap`'d region) has a different contention profile and hasn't been shown to have the same problem — needs its own measurement, not an assumption either way; (b) restructuring so `PartitionRunner` is invoked once per whole `query` run (or per large batch of chunks) rather than per `(chunk, partition)`, amortising its spawn cost the way `merge`/`build_layers` do — a bigger structural change than this phase's scope.
- Log (implemented): `QueryStats::n_columns_scanned`/`n_col_get_calls`, folded into the existing per-chunk `debug!("k-mer dedup + column-major fetch", ...)` line (`query.rs`) alongside phase 3's dedup counters.
- **Unit tests**: extended `obikpartitionner/src/tests/query_layer.rs` (phase 3's file) — `query_partition_with`'s empty/missing-index paths updated for the new `QueryStats` fields and single-callback signature.
- **Validation performed**: full workspace build + `cargo test --workspace`, zero failures. Functional validation against real indexes: (1) a single-genome index — output byte-identical to pre-phase-4 (same `kmer_count`/`kmer_strict_matches` on every record); (2) the existing 20-genome `benchmark/global_index_presence` index — runs correctly, `n_hits=0` for an unrelated query (expected: no shared k-mers between a plant read and a bacterial reference set), no panics, confirming the `Implicit`/multi-column bounds logic doesn't crash on a real multi-genome, mixed-format index; (3) **the critical correctness case**: built two single-sequence-pair test genomes, merged into one 2-genome index, queried with reads from both — reads from `genomeA` matched **only** `genomeA` (`kmer_count` identical to the pre-dedup occurrence count, zero leakage into `genomeB`'s column) and vice versa. This is the test that would have caught a column-index mixup, an off-by-one in `n_cols`, or cross-genome bleed from the stage-1/stage-2 split — it passed cleanly.
- **Not yet done**: the microbenchmark comparing column-major vs. the old row-major access pattern's wall time / page-fault counters on a large-`n_genomes` layer — needs a realistically large multi-genome index and, for the page-fault counters specifically, Linux (not available from this development environment). Left for cluster validation alongside phases 1–3's own pending measurements.
### Phase 5 — Sparse Findere rework (roadmap point 9)
**Goal**: replace the dense `KmerResults`/`win_min` sliding-window scan with one operating on phase 4's sparse per-genome output.
- `obikmer/src/cmd/query.rs`, `process_chunk`:
- Remove `KmerResults` (`query.rs:157-202`) and the dense `win_min` allocation (`query.rs:290-291`, sized `max_n_kmers × n_genomes`).
- Keep a lightweight dense `in_index: Vec<bool>` per chunk (sized `total_kmers`, independent of `n_genomes`) from phase 3's stage 1 — still needed for `kmer_missing` bookkeeping (leftmost-s-mer-of-window membership test), which phase 4's sparse structure doesn't carry (a k-mer with no genome hit has no entry there at all).
- New per-`(seq_idx, genome)` scan: for each genome's `Vec<(seq_idx, pos, count)>` (sorted, per phase 4), group by `seq_idx` (contiguous after sort), then within each sequence's positions detect runs of `pos, pos+1, pos+2, ...` of length ≥ `z`; within each run, the existing monotone-deque window-minimum logic (`query.rs`'s current `dq` loop, conceptually unchanged) applies — but the deque now only scans real entries in the run, never zero-filled gaps.
- Update `SeqAcc` accumulation and `emit_batch` to consume this per-genome sparse iteration instead of `results.val`/`results.is_in_index`.
- `--detail`/`cov`: build sparsely during the same scan (only positions with a confirmed contribution get an entry), densify into the `[u32]` JSON array only in `emit_batch`, only for genomes/sequences actually being serialized (per roadmap point 9's note, `query.rs:304-308`'s current dense allocation goes away).
- Log, per chunk: total sparse entries retained vs. what the old dense `KmerResults` would have allocated (`total_smers × n_genomes`) — the sparsity ratio is this phase's entire reason for existing, so it must be directly visible in the logs, not inferred from process RSS. Also log the run-detection stats (number of runs found, average run length) — a low average run length relative to `z` would mean most positions still fail to form a full window, worth knowing.
- **Unit tests**: `obikmer/src/cmd/tests/query.rs` (extended from phase 3) — the property test described below is the primary deliverable here, not an afterthought; write it as an actual `#[test]` (or a small internal fuzz/property-style loop over randomized fixtures if a property-testing crate isn't already a dependency — check before adding one, per this project's dependency-approval rule) rather than a one-off manual comparison.
- **Validation — this is the correctness-critical phase**: property-test comparing old (dense, pre-phase-3) and new (sparse) implementations on the same randomized input/index fixtures, asserting identical `kmer_count`, `kmer_missing`, `kmer_strict_matches`, and (with `--detail`) `coverage` for every sequence. Keep both implementations compiled side by side (behind a debug-only flag or a temporary parallel code path) only for the duration of this validation; delete the dense path once parity is confirmed — per this project's own convention, superseded code is not kept "just in case."
- **Update `docmd/architecture/query.md` itself**: once this phase lands, the "Findere z-window filter" section (which currently — correctly — describes the dense deque-over-`0..n_smers` scan) needs another pass to describe the sparse run-detection algorithm instead, as already flagged when this phase was discussed.
**Implemented as planned, no deviations discovered this time.** What shipped:
- `KmerResults` removed entirely, replaced by `SmerIndex` (`in_index: Vec<bool>` + `offsets`, unchanged size/purpose, renamed since it's no longer "results" — just the O(1)-per-position "was this k-mer found at all" bookkeeping) and `by_genome: Vec<Vec<(seq_idx, pos, value)>>` (one empty `Vec` per genome until a hit arrives — genomes with zero hits in a chunk cost nothing beyond the outer `Vec`'s own allocation).
- New `sparse_findere_for_genome(hits, z, presence, threshold) -> (Vec<ConfirmedHit>, n_runs, total_run_len)` (`query.rs`): sorts one genome's raw hits by `(seq_idx, pos)`, detects maximal runs of consecutive `pos` within one sequence, runs the same monotone-deque window-minimum as before but scoped to each run (run-relative indices for eviction, absolute `pos` for computing `pos_out`). Presence/count adjustment (`u32::from(win_min >= threshold)` vs. raw) is applied inside this function, once per confirmed hit, rather than later during accumulation.
- `process_chunk` restructured into three passes after the partition loop: (1) run `sparse_findere_for_genome` per genome, collecting `confirmed_by_genome` and run-detection stats; (2) accumulate `genome_totals` directly from `confirmed_by_genome` and mark a `confirmed_any: Vec<bool>` (sized `total_kmers_out`, not `× n_genomes`); (3) a position-only pass (`O(total_kmers_out)`, no genome factor) computing `kmer_count`/`kmer_missing` from `confirmed_any` + `SmerIndex`. `cov` (`--detail`) is populated by re-scanning `confirmed_by_genome` — only when `--detail` is actually set, otherwise skipped entirely.
- Debug log added (`"sparse Findere"`): `n_dense_would_be` (`n_occurrences × n_genomes` — what the deleted dense path would have allocated), `n_sparse_entries` (what's actually retained), `n_runs`/`avg_run_len` (per the plan's ask, to see whether hits mostly fail to form complete windows).
- **Unit tests**: `sparse_findere_matches_dense_reference_on_random_inputs` (`obikmer/src/cmd/tests/query.rs`) — 200 randomized cases (sequence count/length, `z`, presence/count mode, threshold, hit density from sparse to fully-dense) comparing `sparse_findere_for_genome` against `dense_reference_findere`, a faithful reimplementation of the deleted dense algorithm kept only as a test-local correctness oracle (no property-testing crate added — checked first, none was a workspace dependency; a small `std`-only xorshift64 PRNG stands in for one, deterministic and dependency-free). All 200 cases pass.
- **Functional validation performed**: full workspace build + `cargo test --workspace`, zero failures. End-to-end against real indexes: baseline output (no flags) unchanged from pre-phase-5 recorded values on the same fixtures; `--count-missing` correct (`kmer_missing: 0` on a self-match); `--detail` correct — coverage array length matches `kmer_count`, and critically, re-ran the two-genome cross-contamination check from phase 4 with `--detail --count-missing`: `genomeA` reads show coverage sum `106` for `genomeA` and `0` for `genomeB` (and vice versa) — confirms the sparse-to-dense `cov` reconstruction doesn't leak across genomes either, not just the scalar `kmer_strict_matches` path.
- This phase's roadmap item ("update the Findere z-window filter section") — done, see above; the "Algorithm" section's pseudocode was also updated, since it still named `KmerResults`/`SKDesc` from before phases 3–4.
### Phase 6 — Parallel gzip decompression (independent, optional)
Tracked separately in [chunkreader.md](../implementation/chunkreader.md#future-work--parallel-gzip-decompression-in-xopen); parked pending validation of `rapidgzip-rs` on real data. Not a dependency of, or a dependency for, phases 0–5 — `xopen` is shared infrastructure (`obiread`), phase 1 benefits from it but doesn't require it (phase 1 parallelises *across* files; this phase would additionally parallelise *within* one large file).
### Cross-cutting risks
- **Thread-budget oversubscription** (phase 4): the single biggest unresolved design question in this whole plan — see phase 4's composition note. Should be settled with real measurements early in phase 4, not assumed from the design alone.
- **`obicompactvec` API surface growth** (phase 4): new public per-column accessors are additive (existing `fill_row`/`row` stay for other callers — `dump`, `select`, distance computations) — no breaking change expected, but worth checking `obicompactvec`'s other callers aren't already relying on `fill_row` being the only/cheapest access path in a way that would make maintaining two access patterns (row-major and column-major) a real maintenance cost rather than a one-off addition.
- **`PersistentBitMatrix::Implicit`'s hardcoded `n_cols: 1` — resolved, not a bug.** `LayerMeta`'s own doc comment (`obicompactvec/src/layer_meta.rs:1-9`) states it is written "alongside `mphf.bin`" and read by `PersistentBitMatrix::open` "to determine `n_rows` for **the implicit (mono-genome presence/absence) case**" — i.e. `Implicit` is a documented single-genome fast path (no presence matrix needed when there is trivially one genome), not a generic "no matrix built yet" fallback. `n_cols: 1` is correct by design for the case it's meant to handle. Phase 4's column loop is safe as planned — this was worth checking once, doesn't need further action.
+16
View File
@@ -107,3 +107,19 @@ stateDiagram-v2
`restart` is updated each time a `+` is found. When any state fails its expected input, the scan jumps back to `restart` and continues from there — guaranteeing that a `@` in a quality line cannot be accepted as a record start, because the `\n+\n` structure immediately following it (going backward) will not be found. `restart` is updated each time a `+` is found. When any state fails its expected input, the scan jumps back to `restart` and continues from there — guaranteeing that a `@` in a quality line cannot be accepted as a record start, because the `\n+\n` structure immediately following it (going backward) will not be found.
Returns the byte offset of the `@` that starts the last complete record. Returns the byte offset of the `@` that starts the last complete record.
---
## Future work — parallel gzip decompression in `xopen`
`obiread::xopen` (`xopen.rs`) decompresses gzip via `niffler``flate2`, which is single-threaded (standard DEFLATE has no parallel-decodable structure). For large local gzip inputs this single-threaded decompression can become the throughput bottleneck feeding the `query`/`index`/`superkmer` pipelines, since chunk/page production for a given file is serialized ahead of the worker pool.
Candidate: special-case local, on-disk, gzip-magic-detected paths in `open_raw`/`xopen` to use [`rapidgzip-rs`](https://github.com/alekseizarubin/rapidgzip-rs) (`ReaderBuilder::new().parallelism(n).open(path)`, implements `Read + Seek`) instead of `niffler`, keeping `niffler` for every other case: `stdin` (`-`), HTTP(S) sources, and all non-gzip formats (bzip2, xz, zstd — less used in practice here).
Constraints identified so far (not yet validated against real data):
- Branch point must move earlier than the current `decompress()` call in `open_raw` — rapidgzip's fast path needs the file **path**, not an already-opened generic `Read`, so the gzip/local-file detection has to happen before the generic `File::open` + `niffler::send::get_reader` path is taken.
- `stdin` and HTTP sources are not seekable — they stay on `niffler` regardless; the gain only applies to local on-disk `.gz` files.
- `rapidgzip-sys` vendors a native C++ engine: requires CMake ≥ 3.17, a C++17 compiler, and `nasm` on x86 targets — a real build-toolchain addition, not just a pure-Rust crate.
- Low maturity of the Rust binding at review time (2 GitHub stars, ~15 commits, April 2026 latest release) — the underlying C++ engine is validated (HPDC 2023 paper), but the binding itself has limited production track record.
Decision: parked for now. Before adopting, validate on real data: throughput vs. `niffler` on representative large `.gz` inputs, and byte-for-byte correctness of decompressed output.
+45 -4
View File
@@ -92,18 +92,48 @@ For each genome:
| Flag | Applies to | Meaning | | Flag | Applies to | Meaning |
|------|-----------|---------| |------|-----------|---------|
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes | | `--min-count N` | ingroup | k-mer present in at least N ingroup genomes (N may be negative, see below) |
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes | | `--max-count N` | ingroup | k-mer present in at most N ingroup genomes (N may be negative, see below) |
| `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes | | `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes |
| `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes | | `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes |
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes | | `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes (N may be negative, see below) |
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes | | `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes (N may be negative, see below) |
| `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes | | `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes |
| `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes | | `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes |
| `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`filter` only) | | `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`filter` only) |
| `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`filter` only) | | `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`filter` only) |
| `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) | | `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) |
### Negative counts — offset from group size
The four integer count flags (`--min-count`, `--max-count`, `--min-outgroup-count`,
`--max-outgroup-count`) accept **negative** values, interpreted as an offset counted
down from the group size `n`, resolved at run time once `n` is known:
| Value | Effective threshold |
|-------|---------------------|
| `N ≥ 0` | literal absolute count `N` |
| `-x` (x > 0) | `max(1, n − x)` — "all but x" |
`-1` literally means *all but one*, `-2` *all but two*, and so on. This expresses
a quorum relative to the group size that a plain fraction cannot state exactly
(e.g. "present in every genome except at most one" is `n−1`, which is `0.9` for
`n = 10` but `0.857…` for `n = 7`).
The threshold is **floored at 1**, never 0: the negative form always keeps
constraining the group. Without the floor, `--min-count -1` on a singleton
ingroup (`n = 1`) would resolve to `0` ("at least 0") and silently drop the
constraint; the floor makes it `1` ("present in that one genome") instead.
To express a count of `0` (e.g. "absent from the ingroup"), use the literal `0`,
not a negative — `0` and `-0` are indistinguishable, so the offset form starts at
`-1`.
> **Edge case** — on an *empty* group (`n = 0`, e.g. a predicate matching no
> genome), a negative count still resolves to `1`, an impossible constraint that
> rejects every k-mer. This is consistent with an empty group letting nothing
> through, but differs from the "no constraint" behaviour of the fraction flags.
**Conditional defaults** — the defaults for `--min-frac` and `--max-outgroup-count` depend on two conditions: **Conditional defaults** — the defaults for `--min-frac` and `--max-outgroup-count` depend on two conditions:
whether the corresponding group was declared, **and** whether any quorum flag for that group was explicitly set. whether the corresponding group was declared, **and** whether any quorum flag for that group was explicitly set.
@@ -215,6 +245,17 @@ obikmer filter src --output dst \
--max-outgroup-count 0 --max-outgroup-count 0
``` ```
Noise-tolerant core — keep k-mers present in *all but one* ingroup genome
(`-1` = `n−1`) and absent from *all but one* of the outgroup:
```sh
obikmer filter src --output dst \
--ingroup "genus=Betula" \
--outgroup "*" \
--min-count -1 \
--max-outgroup-count -1
```
To dump only k-mers specific to *Betula nana*: To dump only k-mers specific to *Betula nana*:
```sh ```sh
+13
View File
@@ -347,11 +347,24 @@ Provided finalisations:
| `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` | | `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` |
| `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` | | `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` |
| `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` | | `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` |
| `threshold_mash_dist_matrix(k, t)` | Mash distance, derived from `threshold_jaccard_dist_matrix(t)` — no separate partial |
### BitPartials ### BitPartials
Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)`, `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions. Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)`, `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions.
Provided finalisations also include `jaccard_dist_matrix()`, `hamming_dist_matrix()`, and `mash_dist_matrix(k)`.
### Mash distance
`mash_dist_matrix`/`threshold_mash_dist_matrix` add no new additive primitive: both are a pointwise transform of the existing Jaccard distance matrix, per the Mash mutation-rate estimator [@Mash-distances-doc; @Fan2015-mash-formula]:
```
D = -1/k · ln(2J / (1+J)), J = 1 - d_jaccard
```
`J ≤ 0` (i.e. `d_jaccard ≥ 1`, no shared k-mers) maps to `D = 1` (maximal distance) rather than the `ln` singularity at `J = 0`.
--- ---
## Temp-file-backed types ## Temp-file-backed types
+1 -1
View File
@@ -13,7 +13,7 @@
| `query` | Query an index with sequences and annotate matches | | `query` | Query an index with sequences and annotate matches |
| `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the shared [kmer filtering](implementation/filtering.md) system; `--head N` limits output to the first N k-mers | | `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the shared [kmer filtering](implementation/filtering.md) system; `--head N` limits output to the first N k-mers |
| `annotate` | Add or update genome metadata from a CSV file; or dump metadata as CSV | | `annotate` | Add or update genome metadata from a CSV file; or dump metadata as CSV |
| `distance` | Compute pairwise distance matrix between genomes; optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard on count indexes (default 1) | | `distance` | Compute pairwise distance matrix between genomes (`--metric jaccard\|mash\|hamming\|bray-curtis\|relfreq-bray-curtis\|euclidean\|relfreq-euclidean\|hellinger\|hellinger-euclidean`); optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard/Mash on count indexes (default 1) |
| `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the shared [kmer filtering](implementation/filtering.md) system | | `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the shared [kmer filtering](implementation/filtering.md) system |
| `select` | Project and/or aggregate genome columns into a new or in-place index; the column-axis counterpart of `filter` (see [select](implementation/select.md)) | | `select` | Project and/or aggregate genome columns into a new or in-place index; the column-axis counterpart of `filter` (see [select](implementation/select.md)) |
| `estimate` | Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing | | `estimate` | Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing |
+18
View File
@@ -241,3 +241,21 @@
volume = 33, volume = 33,
year = 2017, year = 2017,
bdsk-url-1 = {http://dx.doi.org/10.1093/bioinformatics/btw832}} bdsk-url-1 = {http://dx.doi.org/10.1093/bioinformatics/btw832}}
@misc{Mash-distances-doc,
author = {{Marbl Lab}},
howpublished = {Mash documentation},
title = {Mash Distance},
url = {https://mash.readthedocs.io/en/latest/distances.html},
urldate = {2026-07-09},
year = 2026}
@article{Fan2015-mash-formula,
author = {Fan, Huan and Ives, Anthony R and Surget-Groba, Yann and Cannon, Charles H},
doi = {10.1186/s12864-015-1647-5},
journal = {BMC Genomics},
number = 1,
title = {An assembly and alignment-free method of phylogeny reconstruction from next-generation sequencing data},
url = {https://doi.org/10.1186/s12864-015-1647-5},
volume = 16,
year = 2015}
+32 -16
View File
@@ -1,6 +1,6 @@
# Kmer entropy filter # Kmer entropy filter
Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for two sources of bias: the small number of observations within a single kmer, and the unequal sizes of circular equivalence classes. Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for one source of bias: the small number of observations within a single kmer relative to the number of possible sub-words.
## Sub-word frequencies ## Sub-word frequencies
@@ -8,17 +8,15 @@ For a kmer of length k and a sub-word size ws (1 ≤ ws ≤ ws_max, typically ws
$$w_i = \text{kmer}[i \mathinner{..} i+ws-1], \quad i = 0, \ldots, n_{\text{words}}-1$$ $$w_i = \text{kmer}[i \mathinner{..} i+ws-1], \quad i = 0, \ldots, n_{\text{words}}-1$$
Each sub-word is mapped to its **circular canonical form**: the lexicographic minimum among all cyclic rotations of the word **and all cyclic rotations of its reverse complement**. This extended equivalence relation ensures that entropy(K) = entropy(revcomp(K)) — the filter is strand-symmetric. Let $s_j$ be the size of equivalence class $j$ (number of distinct raw words mapping to canonical form $j$), and $f_j$ the count of canonical form $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$). Each sub-word is tallied under its own raw 2-bit-packed value — **no canonicalization**. Let $f_j$ be the count of raw word $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$), over the $4^{ws}$ possible raw words.
An earlier version of this filter first folded each sub-word into a circular+reverse-complement equivalence class, then "unfolded" the observed class frequency back onto its members to correct for unequal class sizes. That machinery bought nothing it was claimed for — see *Why no equivalence classes* below — while measurably weakening detection of the very sequences the filter exists to catch, so it was removed.
## Corrected Shannon entropy ## Corrected Shannon entropy
The circular equivalence classes have unequal sizes: under a uniform distribution over all $4^{ws}$ raw words, class $j$ is visited with probability $s_j / 4^{ws}$, not $1/n_a$. Computing entropy directly over canonical classes therefore underestimates the entropy of a random sequence. $$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j$$
The correction "unfolds" each canonical class back to its member raw words, redistributing each observation of class $j$ equally among its $s_j$ members: This is a plain Shannon entropy over the observed raw-word frequencies.
$$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j + \frac{1}{n_{\text{words}}} \sum_j f_j \log s_j$$
The last term is the correction for unequal class sizes. For a uniformly random sequence ($f_j \approx n_{\text{words}} \cdot s_j / 4^{ws}$), this gives $H_{\text{corr}} \approx \log(4^{ws}) = 2 \cdot ws \cdot \log 2$, the maximum entropy over raw words.
## Maximum entropy correction for small samples ## Maximum entropy correction for small samples
@@ -42,27 +40,45 @@ $$\text{entropy}(kmer) = \min_{ws=1}^{ws_{\max}} \hat{H}(ws)$$
A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if $\text{entropy}(kmer) < \theta$, where $\theta$ is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc. A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if $\text{entropy}(kmer) < \theta$, where $\theta$ is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc.
## Why no equivalence classes
A prior design folded each sub-word into the canonical form of its circular-rotation + reverse-complement equivalence class before tallying, on the reasoning that (a) it guarantees $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, and (b) collapsing phase-shifted repeats (e.g. `ATG``TGA``GAT`) into one class better reflects that they are "the same" low-complexity pattern.
Both properties already hold for the raw, unfolded entropy above, without any class machinery:
- **Reverse complement**: for any K of length n, window $j$ of $\text{revcomp}(K)$ equals $\text{revcomp}$ of window $(n{-}ws{-}j)$ of K. This is a bijection between the window sets under which each window maps to its own revcomp — and revcomp is itself a bijection (involution) on the space of raw ws-mers. So the multiset of raw-word frequencies for $\text{revcomp}(K)$ is exactly a relabeling of the multiset for K, and Shannon entropy — a function of the frequency multiset alone — is exactly invariant. No folding required, for any K.
- **Tandem repeats**: a period-p repeat sampled by a stride-1 sliding window naturally cycles through its own rotations as raw tokens (e.g. `ATGATGATG…` yields the raw words `ATG`, `TGA`, `GAT` in rotation as the window slides). The low diversity this represents (few distinct raw words out of $4^{ws}$ possible) is already visible in the raw frequency distribution — no folding needed to detect it.
What the fold-then-unfold step actually did was credit each observed class with the frequency of equivalence-class members that were **never observed on the read strand**, inflating $H_{\text{corr}}$ for genuine repeats. Worked example: k=31, ws=3, kmer = `ATG` repeated ($n_{\text{words}}=29$, all 29 windows fall into one class of size 6 under the old scheme — 3 rotations × forward/revcomp):
| | $H_{\text{corr}}$ | normalized |
|---|---|---|
| old (folded, class size 6) | $\log 6 \approx 1.79$ | $\approx 0.53$ |
| current (raw, unfolded) | $\log 3 \approx 1.10$ | $\approx 0.33$ |
The gap is not a rounding artifact: per sub-word order, the folded score for this same repeat swings from 0.53 (ws=3, aligned with the period) up to **1.03** (ws=5, misaligned with the period) — i.e. a period-3 repeat could score *above* the theoretical maximum for a random sequence, depending on which ws happens to divide the repeat's period. The raw formula stays flat at ≈0.33–0.40 across ws=2..6 regardless of alignment, which is the robustness the "minimum across ws" design was meant to provide in the first place.
## Interpretation as an effective number of classes ## Interpretation as an effective number of classes
$H_{\text{corr}}$ is a standard Shannon entropy over raw words (after unfolding the equivalence classes), so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable classes that would yield the same entropy. $H_{\text{corr}}$ is a standard Shannon entropy over raw words, so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable raw words that would yield the same entropy.
For the normalised score $\hat{H}$, dividing by $H_{\text{max}}$ changes the logarithm base: For the normalised score $\hat{H}$, dividing by $H_{\max}$ changes the logarithm base:
$$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\text{max}}} = \log_{N_{\text{max}}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\text{max}}^{\,\hat{H}}$$ $$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\max}} = \log_{N_{\max}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\max}^{\,\hat{H}}$$
The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\text{max}}$) of the effective number of equi-represented classes. The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\max}$) of the effective number of equi-represented raw words.
In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\text{max}} \approx 4^{ws}$, giving: In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\max} \approx 4^{ws}$, giving:
$$N_{\text{eff}} \approx 4^{ws \cdot \hat{H}}$$ $$N_{\text{eff}} \approx 4^{ws \cdot \hat{H}}$$
This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective classes out of 16 are occupied. This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective words out of 16 are occupied.
In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\text{max}} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\text{max}}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$. In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\max} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\max}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$.
## Properties ## Properties
The entropy score is a function of the kmer sequence alone — it does not depend on the surrounding context or on the position within any genome. Two consequences: The entropy score is a function of the kmer sequence alone — it does not depend on the surrounding context or on the position within any genome. Two consequences:
- **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, guaranteed by the strand-symmetric canonical form. - **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$ — see *Why no equivalence classes* above for why this holds without any explicit strand-folding step.
- **Context independence**: the same kmer is always rejected or always kept, regardless of which genome it occurs in, where in that genome it appears, or which strand is considered. The filter defines a fixed partition of the kmer space into low-complexity and valid kmers. - **Context independence**: the same kmer is always rejected or always kept, regardless of which genome it occurs in, where in that genome it appears, or which strand is considered. The filter defines a fixed partition of the kmer space into low-complexity and valid kmers.
+7 -3
View File
@@ -3,10 +3,14 @@
## Code couvert ## Code couvert
- `obiskbuilder/src/entropy_table.rs` — filtre Shannon sur les kmers à basse complexité - `obikentropy/src/table.rs`, `obikentropy/src/tracker.rs` — formule d'entropie et tables de correction petits effectifs
- `obiskbuilder/src/lib.rs` — application du filtre lors du scatter (phase 1) - `obikentropy/src/kmer_entropy.rs` — entropie d'un kmer isolé (`KmerEntropy`)
- `obiskbuilder/src/rolling_stat.rs` — composition de `obikentropy::EntropyTracker` dans le suivi streaming (sélection de minimiseur + entropie)
- `obiskbuilder/src/iter.rs`, `obiskbuilder/src/stream_iter.rs` — application du filtre lors du scatter (phase 1)
## Notes ## Notes
Document théorique stable. Vérifier que les paramètres `theta` et `level_max` dans le CLI Le repli en classes d'équivalence circulaires + brin inverse (décrit dans une version antérieure de ce document) a été supprimé : voir la section « Why no equivalence classes » de `entropy.md` pour la justification théorique et numérique.
Vérifier que les paramètres `theta` et `level_max` dans le CLI
(`obikmer/src/cli.rs``CommonArgs`) correspondent bien à ce qui est décrit. (`obikmer/src/cli.rs``CommonArgs`) correspondent bien à ce qui est décrit.
+820
View File
@@ -0,0 +1,820 @@
# Central-position SNP distance (discussion)
Not implemented. Design discussion for a substitution-rate estimator that
observes SNPs directly from paired-genome k-mer comparison, as an alternative
to Mash's Poisson-Jaccard inference (see [obicompactvec](../implementation/obicompactvec.md)
for the implemented Jaccard/Mash distances).
## Motivation
**Primary intent: restrict the comparison to what is actually comparable.**
Mash's Jaccard is computed over the **union** of both genomes' k-mer content:
anything not identically shared is folded into a single undifferentiated
mass, whether the cause is a point substitution, a genuinely absent
homologous region (lineage-specific content, gene-family expansion, HGT,
genome-size asymmetry), or a diverged paralogous copy. The model then
back-infers a single mutation rate from that mass, silently attributing
non-homology to mutation. The central-SNP approach instead conditions every
comparison on local, positive evidence of homology: a locus only enters the
statistic if its `2m` flanking bases (`m = (k-1)/2`) are found intact in
*both* genomes — genuinely absent or non-homologous content is excluded from
the comparison entirely (neither numerator nor denominator), rather than
silently counted as divergence. This is a conditioning on comparability, not
just a richer summary statistic — see "Statistic and correspondence with
`shared`" below for how it plays out against genome-size asymmetry and
diverged gene families, and "Heterozygosity, ploidy, and consensus-assembly
inputs" for the corresponding paralogy/heterozygosity filter.
**Secondary benefit: access to the substitution's nature.** Because the
central base of an odd-k window is directly observable once the flanks are
confirmed conserved, this also yields more than a rate — the
transition/transversion split — enabling classical corrected distances
(Jukes-Cantor, Kimura 2-parameter, LogDet) that a single Jaccard scalar
cannot support.
## Statistic and correspondence with `shared`
A genomic position `p` is covered by `k` overlapping k-mer windows. Requiring
the substitution to sit at the window's **center** makes exactly one window
per SNP eligible — a 1:1 correspondence between SNP and center-neighbor k-mer
pair, avoiding the ~k-fold overcount of an any-position neighbor search.
A locus with a fully conserved `k`-window (flanks **and** center) is an
exact-shared k-mer at that locus; a locus with conserved flanks but a
substituted center is a "central SNP". Both count each locus exactly once, in
matching units:
```
p_hat[i,j] = SNP[i,j] / (SNP[i,j] + shared[i,j])
```
`p_hat` is `P(center substituted | 2m flanks conserved)`. `shared[i,j]` here
is **not** the general-purpose `shared_kmers` matrix used by Jaccard/Mash
(`--shared-kmers`, `BitPartials::partial_jaccard` /
`CountPartials::partial_threshold_jaccard`) — that matrix counts raw k-mer
identity with no per-genome copy-number constraint, whereas `p_hat`'s
denominator applies the eligibility rule defined below (raw or
paralogy-filtered). Both `SNP` and `shared` are accumulated by the same
sweep, from the same per-locus candidate set (source k-mer + 3 variants),
under the same eligibility rule — see "Locus eligibility" below, and
"Heterozygosity, ploidy, and consensus-assembly inputs" for why the
copy-number constraint matters and what it costs.
**Canonical invariance**: for odd k, the central position maps to itself under
reverse-complement (`m -> k-1-m = m`, base complemented). A transition maps to
a transition, a transversion to a transversion — the transition/transversion
split is well-defined in canonical space.
### Definitions: family, and the canonical form of a family
**Family.** The family of a k-mer `x` is the set of (up to) 4 k-mers sharing
`x`'s `2m` flanking bases, differing only at the central base `m`. Membership
is a property of the flank pattern, not of `x` itself: any of the 4 possible
central substitutions belongs to the same family.
**`central_canonical_neighbors()`** (`obikseq`, `CanonicalKmerOf::central_canonical_neighbors`)
generates all 4 members from any one of them (observed or not), each
independently canonicalised (`.canonical()`, i.e. `min(kmer, revcomp(kmer))`).
This independent canonicalisation is necessary because a central substitution
can flip which orientation is lexicographically smaller — two members of the
same family can end up canonicalised in *different* orientations. Despite
that, the **set** of 4 resulting canonical k-mers is invariant: calling
`central_canonical_neighbors()` on any member of a family — present in the
index or not — yields the same 4 values. This is relied upon throughout the
rest of this document.
**Canonical form of a family.** Because orientation can differ member to
member, "which of the 4 is the reference" cannot be defined relative to
*whichever member happened to be visited first*, nor relative to the
minorant (see below) — both are data-dependent (they depend on what is
actually observed), so using either as the reference would make the
reference itself vary depending on what happens to be present in a given
index. Instead: **the canonical form of a family is, by definition, the
member whose own central base — read in its own already-canonical
orientation — is `A`.** This is well-defined for every family, computed
purely from the flank pattern, whether or not that specific member (or any
member at all) is actually observed anywhere in the index. Concretely: call
`central_canonical_neighbors()` on any member (observed or not) to get the
family's 4 canonical forms; the one among them whose own centre nucleotide is
`A` is the family's canonical form. The other 3 (`C`, `G`, `T`) are labelled
relative to *that* fixed reference, not relative to the calling member's own
orientation.
**Consequence for the minorant.** With this fixed A-referenced labelling,
`minorant` (the smallest raw encoding among the family's *observed* members,
introduced further below) becomes directly computable rather than needing to
be tracked as extra state: regenerate the family's 4 canonical forms from
any member's own k-mer (cheap, no lookup), compare the raw encodings of
whichever are marked present, and take the smallest. No separate stored bit
is required — see Step 2b below, where this replaces the earlier
minorant-bit design.
## Locus eligibility: raw definition vs. paralogy filter
For each k-mer `x` observed in genome A (source, one MPHF slot; the 3
central-position variants generated as in the sweep below): check whether
A's locus (flanks fixed) is resolvable in genome B under one of the 4
central forms.
**Raw / no model.** The locus counts in the denominator iff at least one of
the 4 forms is present in B; it counts in the numerator iff the form found in
B differs from A's own. No constraint on A's or B's own copy number at this
locus. Open question, not resolved: what if **more than one** of the 4 forms
is present in B simultaneously (ambiguous target — count once arbitrarily,
count all, or drop)? The stringent filter below sidesteps the question by
construction rather than answering it.
**Stringent / paralogy-aware.** The locus counts only if exactly one of the
4 forms is present in A **and** exactly one is present in B (`count == 1` at
that slot too, when a count index is available, to also exclude same-allele
duplicates that presence alone cannot see). This drops the raw definition's
ambiguous-B case automatically, at the cost of also dropping heterozygous
sites indiscriminately alongside true duplications (see "Heterozygosity,
ploidy, and consensus-assembly inputs" below).
**Rejected: parsimony-based multiset pairing for multiplicity > 1.** Rather
than dropping ambiguous loci, pair identical alleles between A and B first
(0-mutation explanation preferred), then take `min(unmatched_A, unmatched_B)`
as inferred SNP pairs. Rejected on two grounds: (1) circularity — selecting
pairs by minimal apparent divergence, then measuring divergence on those same
pairs, deflates the estimate by construction, not a neutral heuristic; (2)
the discriminating signal is a single base among 4 possible values, and the
flanks are *already* guaranteed identical for every candidate by
construction (that is how the locus was selected) — no information remains
in a k-mer window to tell which copy in B truly corresponds to which copy in
A once multiplicity > 1 on either side. Any pairing rule invents a
correspondence the data cannot support. Multiplicity > 1 is treated as
non-identifiable, not as a puzzle to solve with a heuristic.
## Multi-genome framing: family as pseudo-alignment column
**Idea.** Instead of resolving locus eligibility and correspondence one
genome pair at a time, treat a family as a column of a pseudo multiple
alignment across *all* genomes simultaneously: for each family, each genome
has either a net single-copy state (`A`/`C`/`G`/`T`, when the genome carries
exactly one of the 4 forms) or "missing" (`?`, multi-copy or absent). Flank
conservation (the `2m` bases fixed by construction) supplies positional
homology for free — the same role a real MSA would play, without alignment
software, gap penalties, or progressive-alignment approximations. Stacking
one such column per family, genomes as rows, produces a genuine SNP
pseudo-alignment matrix, not just a bag of pairwise distances.
**Precedent.** This is the same principle behind reference-free
k-mer-based phylogenomics tools — SKA (Split K-mer Analysis, Harris 2018) and
kSNP: split the k-mer around a variable center, use flank identity to call
homologous columns across arbitrarily many genomes with no reference and no
MSA step, then feed the resulting pseudo-alignment to standard phylogenetic
tools. Landing on the same design independently is a good sign, not a
coincidence.
**Resolves the pairwise-correspondence problem, properly.** The "Rejected:
parsimony-based multiset pairing" case above failed because, with only two
genomes' cardinalities to look at, there is no external constraint to justify
picking one correspondence between leftover alleles over another — `min(a,b)`
is a lower bound dressed up as a point estimate (see the follow-up discussion
on Felsenstein-style parsimony inconsistency: minimum-event explanations are
systematically biased low whenever homoplasy/multiplicity is real, not
noise-cancelling). With `N` genomes and many families jointly, the same
question can be answered the way real phylogenetics answers it: ancestral
state reconstruction / ML mapping over a tree estimated from the whole
column set. The tree supplies the missing constraint that two isolated
columns cannot — this is the principled way out, not a heuristic replacement
for one.
**Relation to what's already implemented.** `KmerIndex::raw_snp_distance`
already computes, internally, per family, exactly this row — `single_form:
Vec<Option<u8>>`, one entry per genome, `None` where ambiguous/absent —
before immediately collapsing it into pairwise `snp[i,j]`/`shared[i,j]`
tallies. The pivot this section proposes is small at the implementation
level: stop collapsing early, and surface the per-family row as a first-class
artifact (a `families x genomes` matrix). Pairwise raw p-distance becomes one
projection of that matrix (what's computed today), not the primary object;
downstream, the matrix itself could feed real phylogenetic tools (parsimony/
ML, e.g. RAxML/IQ-TREE-style) instead of only NJ/UPGMA on a homemade
pairwise-distance matrix.
**Caveat: column completeness shrinks with `N`.** The probability that a
family's flanks stay intact simultaneously across all `N` genomes decays with
`N` (same ascertainment-bias mechanism as Bias 1 above, compounded over more
genomes) — fully-resolved columns (no `?` anywhere) become rare as more
genomes are added. Same missing-data situation any real multi-species
alignment faces, and phylogenetic tools already handle it well; the practical
implication is that columns should be allowed partial coverage (>=2 resolved
genomes, not unanimous) rather than requiring every genome to be net
single-copy at that locus.
## Heterozygosity, ploidy, and consensus-assembly inputs
A within-genome multiplicity signal (more than one of the 4 central forms
present at a locus) is produced identically by two distinct causes:
paralogous duplication and diploid/polyploid heterozygosity. K-mer data alone
cannot distinguish them. The one real discriminator is sequencing depth
(heterozygous site: total depth of the present forms ~= the genome's
single-copy average; duplication: ~2x or more) — but that signal only exists
if genome "counts" are raw-read depth (FASTQ input), not occurrence counts in
an assembled FASTA, where per-locus depth is not preserved.
**Magnitude is taxon- and mating-system-dependent, not universal.**
Heterozygosity density: mammals ~1 site / 1-1.5 kb (~0.1%); highly
outcrossing plants (maize, poplar) reported an order of magnitude higher
(~1%); self-fertilising plants (*Arabidopsis thaliana*) near zero — but with
a documented failure mode where segmental duplication masquerades as
"pseudo-heterozygosity"; fungi split between haploid vegetative stages
(non-issue) and dikaryotic Basidiomycetes, where two long-diverged haploid
nuclei coexist without fusing. The estimator's target use case (closely
related genomes, k=31) is exactly where the stringent filter above costs the
least for low-heterozygosity taxa and the most for outcrossing/dikaryotic
ones — no universal threshold; this is a scope caveat to document, not a
problem to solve generically.
**Why assembled-consensus inputs don't make measured distances wrong.**
Phylogenetic inputs are near-universally assemblies, not raw reads, and
assemblers collapse heterozygous sites to one consensus allele per
position — effectively an arbitrary, largely uncorrelated-between-assemblies
choice at each het site. This does not inject unbounded noise: standard
population genetics gives `d_xy = d_a + (pi_A + pi_B)/2` — the expected
pairwise difference between a random allele of population A and a random
allele of population B equals the net (fixed) divergence `d_a` plus the
average of the two populations' own within-population diversity `pi`.
Consensus flattening realises exactly this random-allele draw, so the
measured genome-to-genome distance is a `d_xy`-like quantity, not `d_a`
inflated by heterozygosity by a well-characterised additive term, not
distorted unpredictably. The term is negligible when `pi << d_xy` (the common
case for cross-species comparisons), and becomes material precisely in the
two cases already flagged above: very closely related genomes (this
estimator's explicit target) and highly heterozygous outcrossing organisms,
where `pi` and `d_xy` are the same order of magnitude.
Caveat: this assumes the flattening is uncorrelated with the phylogenetic
signal — plausible for de novo assembly, not guaranteed for reference-guided
assembly biased toward one allele (e.g. the reference's) at each het site,
which would turn the noise term into a systematic bias toward the reference
lineage. Not evaluated here.
**Forward-looking implication, not part of the current design.** The
multiplicity > 1 signal discarded by the stringent filter is a crude
per-genome proxy for `pi` (under low background paralogy). If a `pi_hat` per
genome were tallied alongside `SnpTally`, a `d_a` correction
(`p_hat - mean(pi_hat_i, pi_hat_j)/2`, roughly) could recover an estimate
closer to net divergence instead of `d_xy` — a possible extension, not
scoped here.
## Sufficient statistic: 4x4 base-pair tally
Tabulating the joint distribution of `(center_i, center_j)` over conserved-flank
loci, per genome pair, is sufficient for every downstream correction:
| Estimator | Input | Formula |
|---|---|---|
| Raw p-distance | total off-diagonal / total | `p = SNP / (SNP + shared)` |
| Jukes-Cantor | p | `d = -3/4 * ln(1 - 4p/3)` |
| Kimura 2-parameter | transition rate P, transversion rate Q | `d = 1/2 ln(1/(1-2P-Q)) + 1/4 ln(1/(1-2Q))` |
| LogDet/paralinear | full 4x4 + base-composition margins | `d ~= -1/4 ln det(F)`, robust to non-stationary base composition |
JC/K2P need only the total and the transition/transversion split (the
diagonal collapses to a single "shared" total). LogDet needs the full 4x4,
already populated at no extra cost (see Step 1/2 below).
Memory for the 4x4 tally: `n^2 * 16` counters. Trivial for the project's
genome-scale use case (tens to hundreds of genomes); ~13 GB at n=10^4 — outside
scope but worth flagging if n grows.
## Biases (properties of the estimator, not defects)
1. **Conserved-flank ascertainment bias.** Only SNPs with intact `2m`-base
flanks are visible; window-intact probability decays as `(1-p)^{2m}`. For
k=31 (2m=30): 0.74 at p=1%, 0.21 at p=5%, 0.04 at p=10%. This estimator
targets **closely related genomes**. Under rate heterogeneity across sites
(universal in practice), conserved flanks correlate with slow centers, so
`p_hat` underestimates the genome-wide average rate — it specifically
estimates the substitution rate of **conserved regions**.
Two distinct factors are at play here, not one: `P(centre of a given
window is a SNP) = p` exactly, **independent of k** — a direct restatement
of the raw per-site rate via the bijective window<->centre-position
correspondence (Statistic section above), not a k-dependent quantity.
`(1-p)^{2m}` is the *separate*, genuinely k-dependent ascertainment factor
(are the flanks also intact). The two multiply:
`P(usable window showing a central SNP) = p * (1-p)^{2m}` — e.g. at
p=1/31 (~3.2%), k=31: `p * (1-p)^30 ~= 0.0323 * 0.374 ~= 1.2%`, i.e. about
1 window in 83, not 1 in 31 (which is only the centre-mutated fraction,
before requiring intact flanks).
2. **Bias toward isolated SNPs.** Two SNPs within k of each other disqualify
each other's flanks. Hypervariable regions are invisible by construction.
3. **Indels are invisible.** A frameshift destroys k-mer matches in a block;
this channel captures substitutions only. Indel divergence shows up as lost
shared k-mers (lower Jaccard/Mash), not as SNP signal.
4. **k-dependent specificity.** "A k-mer match implies common ancestry" is
quantitative. For a 3 Gbp genome, expected random flank-30 collisions
(k=31): `(3e9)^2 / 4^30 ~= 8` — negligible. At k=21: `(3e9)^2 / 4^20 ~= 2e6`
— no longer negligible. k=31 is safe; k<=21 is marginal to unreliable for
large genomes. The large k that guarantees homology is the same k that
shrinks the detectable-divergence window — an inherent tension.
## Implementation: avoid materializing a de Bruijn graph
A central-SNP pair is topologically a simple bubble in the colored de Bruijn
graph (source/sink k-mer shared, two length-k branches differing only at the
midpoint). Classical bubble-calling (Cortex/discoSNP-style) finds these, but
requires the graph — nodes plus adjacency for ~10^9 colored k-mers — resident
in memory. **Rejected**: prohibitive RAM for this project's scale.
A naive per-pair generalisation of variant lookup across n genomes (query each
non-shared k-mer's 3 central variants against every counterpart genome's
index) costs `O(n^2 . N . 3)` random lookups, with the same k-mer's 3 variants
regenerated and requeried once per counterpart genome — pure redundant work.
**Rejected** as the basis for an n-genome design.
## Implementation: sequential per-partition sweep (no scratch, no graph)
`KmerIndex::distance()` already opens every partition's `presence_store`/
`count_store` simultaneously, memory-mapped, into one `LayeredStore`
(`distance.rs:73-77`). "Querying another partition" is therefore not a new
I/O pattern to design — it is the same O(1) MPHF+evidence lookup the `query`
command already performs at scale. This lets the SNP tally be computed with
**no scratch files and no auxiliary graph**, by sweeping partitions once each
as a source:
1. For source partition `p`, enumerate its **distinct** k-mers (one per MPHF
slot; each already carries its full multi-genome presence/count vector —
no need to explode per (k-mer, genome) occurrence).
2. For each, generate the 3 central-substitution variants and **canonicalise
each independently** (`min(kmer, revcomp)`, exactly as any normal query) —
this avoids the orientation edge case a masked-flank grouping would have
(a substitution that flips canonical orientation is handled correctly
because each variant is canonicalised on its own, not inferred from a
fixed-orientation flank key).
3. Compute each variant's target partition `q` via its minimizer; batch/sort
the partition's outgoing variant queries by `q` for locality.
4. Look up each variant in `q`'s already-mmap'd MPHF+evidence; on a hit,
combine the source's presence vector (base `a`) with the variant's
presence vector (base `b`): for every `i` carrying `a` and `j` carrying
`b`, `tally[i,j][a,b] += 1`.
**Deduplication needs no persisted state.** Sweeping partitions in a fixed
order `p = 0, 1, ..., P-1` and only acting on a variant when its target
partition `q >= p` guarantees each unordered SNP pair is counted exactly
once: a pair with `q < p` was already resolved earlier, when `q` was itself
the source partition and `p` (being `>= q`) was a valid forward target. No
cross-partition flag array is needed — the sweep order *is* the
deduplication rule. Within the same partition (`q == p`), a lightweight
transient tie-break suffices: either a `#slots(p)`-bit scratch flag reset per
partition, or simply comparing the two k-mers' raw `u64` encodings and only
counting when `kmer_source < kmer_variant` — no storage at all.
This is a distinct computation stage, not a `partial_*` in the existing
additive-by-partition sense: step 3-4 read across partition boundaries by
construction, unlike the row-local `partial_jaccard`/`partial_threshold_jaccard`
primitives. But it requires no new index files, permanent or scratch:
`unitigs.bin`, `mphf.bin`, `evidence.bin`, and the presence/count columns are
read as-is, and the only extra memory is the current partition's small
outgoing-query batch (`#kmers(p) * 3`, released once `p` is done) plus the
persistent `tally` accumulator (`n^2 * 16` counters, see above).
**Outer loop (over source partitions `p`) must stay sequential.** Two
independent reasons, not just one: (a) memory — the bounded-footprint claim
above only holds with one partition's outgoing-query batch in flight; running
`T` source partitions concurrently multiplies that batch by `T`, exactly the
blowup the design avoids; (b) correctness — the `q >= p` deduplication rule
requires partitions to be claimed as sources in a fixed order; running `p1 <
p2` concurrently gives no guarantee `p1` has finished claiming its `q >= p1`
targets before `p2` starts claiming its own, breaking the "counted exactly
once" property.
**Inner loop (target-partition lookups for a fixed `p`) parallelises safely.**
Each lookup is an O(1) read against an already-mmap'd structure, independent
of the others, with no growing allocation — no memory blowup, no ordering
dependency between different `q`. The only shared mutable state is `tally`;
give each worker thread a **thread-local partial tally** (fixed `n^2 * 16`
size, independent of partition size) and merge into the global `tally` once
`p`'s inner loop completes — the same reduce-then-merge pattern Rayon already
uses elsewhere in this codebase to open partitions in parallel. Extra memory:
`#threads * n^2 * 16`, negligible (~512 MB at n~1000, 32 threads) and
unrelated to partition size.
**Cost**: `3 * N_distinct` MPHF lookups total across the whole index (each
partition swept once as source) — the same order of magnitude and the same
operation as running `query` over the index's entire k-mer content against
itself, three times. This is the tool's already-optimized regime, not a new
I/O profile to validate.
## Cheaper: subsampling
Since the target is a ratio, restricting the source-partition sweep to a
bottom-`s` hash sketch (only enumerate k-mers with `hash < threshold` as
sources) divides the lookup count by the sampling factor without biasing
`p_hat`. Mash-like tradeoff: rate estimated from a sample, not the full
k-mer set.
## Recommendation
Sequential per-partition sweep (Route D): reuse the already-mmap'd
per-partition MPHF/evidence/presence structures for O(1) variant lookups,
dedup via the fixed sweep-order rule (`q >= p`, plus an in-partition
tie-break), no scratch files, no graph materialisation. Both the SNP
(off-diagonal) and shared (diagonal) counts are accumulated by this same
sweep, under the locus-eligibility rule chosen (raw or paralogy-filtered) —
not reused from the general-purpose `shared_kmers` matrix, whose raw-identity
definition does not apply the same copy-number constraint. Distances (p, JC,
K2P, LogDet) as finalisations of the resulting 4x4 tally, mirroring the
`partial_* -> *_dist_matrix` pattern used for Jaccard/Mash/Bray-Curtis/etc.
## Detailed implementation plan
Grounded in the current codebase. File/type references are anchors, not
prescriptions; adjust to reality when implementing.
### Step 0 — new low-level primitives (`obikseq`)
Two helpers do not yet exist and are prerequisites:
1. **Central neighbours.** `CanonicalKmerOf<L>` already exposes
`left_canonical_neighbors()` / `right_canonical_neighbors()`
(`obikseq/src/kmer.rs`), each returning the 4 canonicalised neighbours at
an end position. Add `central_canonical_neighbors()` returning the 4
variants at position `m = (k-1)/2` (each independently canonicalised via
`.canonical()`). The 3 that differ from the source are the query variants;
skip the identity. Building on `nucleotide(i)` / the raw 2-bit layout keeps
it O(1).
2. **Lone-k-mer minimiser.** Routing a *synthetic* variant to its partition
needs its minimiser, but `RollingStat` (`obiskbuilder/src/rolling_stat.rs`)
only computes minimisers incrementally along a sequence. Add a standalone
`minimizer(kmer) -> Minimizer` that scans the `k-m+1` m-mer windows
(`PackedSeq::mmer`, `obikseq/src/packed_seq.rs`), canonicalises each, and
takes the min by `seq_hash()` — the same selection `RollingStat` performs,
evaluated once. Partition index is then
`(minimizer.seq_hash() & (n_partitions - 1)) as usize`, exactly as
`QueryBatch::from_records` (`obikmer/src/cmd/query.rs:142`); `n_partitions`
is a power of two so the mask is valid.
### Step 1 — the tally accumulator (`obikindex`)
A `SnpTally` holding, per genome pair, the 4x4 joint count of central bases:
`n * n * 4 * 4` `u64` (or a packed lower-triangular form since it is
symmetric). Provide `merge(&mut self, other: &SnpTally)` for the thread-local
reduce, and accessors yielding, per pair `(i,j)`: total off-diagonal (SNP),
diagonal (shared, i.e. `p_hat`'s denominator minus SNP), transition count
`P`, transversion count `Q`. The diagonal is always populated — it is not an
optional LogDet-only extra, since `p_hat`'s denominator is no longer sourced
from the external `shared_kmers` matrix (see "Locus eligibility" and
"Statistic and correspondence with `shared`" above): the source k-mer's own
presence/count vector, already in hand when it is enumerated, supplies the
diagonal entry directly, at no extra lookup cost.
### Step 2 — the sweep (`obikindex`, new `snp.rs`)
Mirror `distance.rs`: open the presence or count store per partition. But
instead of a per-partition `partial_*`, run the sequential source sweep:
```text
for p in 0..n_partitions: # OUTER — sequential
open source partition p's layers (QueryLayer-style, obikpartitionner)
enumerate distinct canonical k-mers of p (one per MPHF slot) with their
presence/count vectors # column-major, as query stage 2
par_iter over these source k-mers: # INNER — rayon, thread-local tally
apply eligibility rule to the source's own vector (raw: none; # diagonal
stringent: exactly one of the 4 forms present in each genome) # gate
for i in genomes eligible with source base a:
for j in genomes eligible with source base a:
thread_tally[i,j][a,a] += 1 # diagonal — no extra lookup
for each of the 3 central variants:
q = partition_of(variant)
if q < p: continue # dedup: forward targets only
if q == p and variant <= source.raw(): continue # in-partition tie-break
slot = layers[q].find_slot(variant) # MphfLayer::find, mmap'd
if hit:
vb = variant presence/count vector
apply eligibility rule to vb (as above)
for i in eligible genomes with source base a:
for j in eligible genomes with variant base b:
thread_tally[i,j][a,b] += 1
merge thread-local tallies into global SnpTally
```
The inner lookup is precisely `QueryLayer::find_slot` +
`col_value(g, slot)` (`obikpartitionner/src/query_layer.rs`) — reuse or factor
out that path rather than reimplementing MPHF access. Enumerating "all distinct
k-mers of a partition with their vectors" is the `dump`/`query` stage-2
column-major scan already implemented in `dump_layer.rs` /
`query_partition_with`; factor a reusable iterator if none fits.
`presence_threshold` applies exactly as elsewhere: a genome "carries base b"
iff its count at that slot is `>= presence_threshold` (trivially `>= 1` for
presence indexes).
### Open problem (unresolved, session end — not yet fully convinced)
The `q >= p` / tie-break dedup rule in Step 2's pseudocode above is **flawed**
for the stringent (paralogy-filtered) eligibility rule: it only ever brings
two family members into view at once (the source and one looked-up variant),
never all four simultaneously, and which subset gets compared depends on
partition sweep order. "Exactly one of the 4 forms present in genome A" is a
whole-family property and cannot be decided correctly from a sequence of
pairwise, order-dependent glimpses — the pseudocode above needs revision, not
just the eligibility gate bolted onto it as written.
Direction discussed, **not yet settled**:
1. **Every distinct source k-mer looks up all 3 variants unconditionally**
(drop the `q < p` skip entirely) so that every observed family member
independently gathers all 4 vectors (its own + whichever of the 3
variants exist) at once — a whole-family, order-independent view, computed
redundantly once per observed member. Same total lookup order of
magnitude as already budgeted (`3 * N_distinct`), just organised
differently (no lookup actually skipped, versus the original rule which
skipped roughly half).
2. **Tie-break after gathering, not before**: only the member whose own
canonical encoding is the smallest *among the members actually observed*
(now known, since all were just looked up) writes to `SnpTally`; the
others silently discard their redundant computation. Deterministic,
order-independent — as a side effect this also removes the "outer loop
must stay sequential" constraint from the cost/parallelism discussion
above, since no step depends on partition processing order any more.
3. **Proposed optimisation**: precompute, once at index build time, a
compact global (not per-genome) annex per MPHF slot — the count of
*other* family members observed anywhere in the dataset (0-3). Slots with
count 0 (majority under low divergence and few genomes, but see the
scaling caveat below) need no cross-lookup at all: eligibility reduces to
a local `count == 1` check at that single slot, and only slots with count
>= 1 enter the 3-lookup sweep machinery above. Revised (see Step 2b
below): minorant status *is* stored alongside the count after all, on 3
bits rather than 2 — it comes for free from the same lookups needed to
count siblings, and storing it lets the sweep discard non-minorant slots
without re-fetching anything.
**Minorant/sibling-count relationship, worked out precisely.** "Minorant" is
a one-way implication from sibling count, not an equivalence: `0 siblings
=> minorant` (trivially — with no other observed member, the k-mer is by
definition the smallest of the observed set, itself alone), and its
contrapositive `not minorant => >= 1 sibling`. The converse does not hold:
being the minorant says nothing about sibling count — a minorant can have 0,
1, 2 or 3 siblings, all with larger encodings than itself. Consequence: this
confirms, as a logical necessity rather than a heuristic, that a 0-sibling
slot can always write its diagonal contribution with zero ambiguity and no
lookup (it is unconditionally its own minorant) — but it gives no shortcut
for the >= 1-sibling case, where minorant status still requires the actual
comparison of gathered encodings; sibling count alone never determines it.
**When to compute the annex, and cache invalidation.** Sibling count is a
property of the whole set of columns (genomes/groups) currently in the
index, not of any single genome — it cannot be computed correctly at
mono-genome build time (a family may gain siblings, or its minorant may
change, once more genomes are merged in later). Computing it eagerly at
every `merge` would also waste work on intermediate merged states nobody
ever queries. Instead: compute it lazily, on first `distance` call against a
given index, and persist the result alongside that index for subsequent
calls — the same lazy-derived-cache pattern `PersistentBitMatrix` already
uses for `Columnar` -> `Packed`. This requires no explicit invalidation for
`merge` or `filter` (`obikindex/src/merge.rs`, `obikmer/src/cmd/filter.rs`):
both only ever write to a fresh `--output` directory, never mutate an input
index in place, so a re-merged/re-filtered index is simply a new state with
no annex yet. `select --in-place` (`select_layer.rs:139-235`) is the
exception: it aggregates genome columns into groups (Any/All/None/Sum/Min/
Max) by mutating the existing index's files without changing its location.
It does not remove k-mer rows, but it can still change eligibility and
sibling counts derived from those rows (e.g. a `Sum` over several
single-copy genomes can read as multi-copy at the group level). Because it
mutates in place, **`select --in-place` must explicitly invalidate (delete
or mark stale) any cached sibling-count annex for that index** — the one
operation in the current pipeline where this doesn't happen for free.
Not yet convinced this is the right shape, and Step 2's pseudocode above has
not been rewritten to match — flagged for the next pass rather than resolved
here.
### Step 2b — sibling-count / minorant annex (consolidated plan)
Scope: only the precursor annex — not the SNP tally itself, whose Step 2
sweep remains unresolved above. This piece is simpler than the sweep,
because it writes to an independent per-slot value, not a shared
cross-k-mer accumulator, so it needs no dedup/ownership logic at all at this
stage.
**Revised annex encoding — 4-bit presence mask, not 3-bit (minorant +
count).** Superseded after settling the "canonical form of a family"
definition above. The 3-bit design (1 minorant bit + 2-bit sibling count,
§ below, kept for the historical record) had two problems: it discards
*which* variants are present (only how many), so any future consumer
(the SNP sweep, or a stats pass — see below) that needs to know which bases
exist still has to regenerate and blindly re-query all 3 candidates; and
the minorant bit's meaning was tied to whichever member was visited, not to
a fixed reference. Storing instead a **4-bit mask** — one bit per base
(A/C/G/T), set iff that member of the family (labelled relative to the
family's fixed canonical form, i.e. the member with `A` at the centre — see
above) is observed anywhere in the index — fixes both:
- **Sibling count is derived, not stored**: `siblings = popcount(mask) - 1`.
- **Minorant is derived, not stored**: regenerate the family's 4 canonical
forms from the slot's own k-mer (cheap, no lookup — see above), compare
the raw encodings of whichever bits are set in the mask, take the
smallest.
- **A future consumer knows exactly which variants to (re-)query** —
`popcount(mask) - 1` lookups instead of always 3, and it knows *which*
3 (or fewer) to issue, not just how many hits to expect.
- The all-zero value (no base present at all) is still logically
unreachable as a real result — the slot's *own* base is always present in
its own family — so it remains available as a free "not yet computed"
sentinel, exactly as before.
1. **Primitive.** Reuse `central_canonical_neighbors()` from Step 0
unchanged — the 3 canonicalised central-substitution variants of a k-mer
(plus the identity, i.e. all 4 members of the family — see "Definitions"
above).
2. **New annex type** (`obicompactvec`, alongside `bitmatrix.rs`): a 4-bit-
per-slot packed array (the presence mask above), one per partition — same
on-disk shape family as `PersistentBitMatrix`'s `Packed` variant, but
simpler (no per-genome columns, a single derived read-only value per
slot).
<details><summary>Superseded 3-bit design (historical)</summary>
3 bits, storing minorant status alongside sibling count directly, since
it came for free from the same lookups (point 3 below) — 5 real states
(not-minorant; minorant with 0/1/2/3 siblings) fit in 3 bits (8 states,
3 unused). This let the future SNP sweep discard a non-minorant slot
instantly, with no lookup at all. The otherwise-unreachable combination
"not-minorant + 0 siblings" (0 siblings always implies minorant) doubled
as the "not yet computed" sentinel. Replaced by the 4-bit mask above,
which subsumes this benefit (minorant still derivable, now for free at
read time rather than stored) while also fixing the "which variant"
blindness.
</details>
3. **Computation pass** (`obikindex`, new `siblings.rs`): **one
`obipipeline` run per layer, iterated sequentially over the index's
layers** — settled after two false starts, worth recording both.
- *False start 1*: "fully parallel over every partition/slot at once,
no ordering at all". Correctness is fine with this (sibling count and
minorant are order-independent, unlike the old `q >= p` dedup they
replace), but it reintroduces, at a larger scale, exactly the
memory-blowup the original Step 2 sweep's sequential-outer-loop
constraint existed to prevent: scattering every source partition at
once multiplies the in-flight outgoing-query volume by the number of
partitions.
- *False start 2*: push the layer loop itself into the pipeline (source
= the index's layers, a first `Flat` stage expands each layer into
its k-mers). `obipipeline`'s scheduler already bounds memory on its
own — it dispatches every item through a **shared** worker pool at
each stage boundary (`scheduler.rs:217-372`, `dispatch()` into a
common `worker_tx` queue, any free worker picks up any pending item;
not "one worker owns a chunk end to end"), with a biased `Select`
that prioritises draining items already advanced in the chain over
admitting new source items (`scheduler.rs:271-282`: stage results
outrank the source, "vider le pipeline en priorité" / "dernier
recours" for new data) — so bounded channel `capacity` plus this
drain-first bias already caps in-flight work without any external
sequential discipline. Correct, but it means k-mers from several
layers can be completing concurrently, so the sink would need to
track several open per-layer annex-file writers at once — real,
avoidable complexity.
- **Settled design**: keep the layer loop external and sequential —
not for memory (the pipeline's own `capacity`/priority mechanism
already provides that, for free, regardless), but so each pipeline
run's sink targets exactly one layer's annex file, no concurrent
multi-writer bookkeeping. Per layer: source = that layer's distinct
k-mers; a `Flat` (1->N) stage generates the 3 central variants of a
k-mer, each tagged with its origin (local slot); a transform stage
routes each variant to its target partition (unchanged per-k-mer
minimiser); a transform stage performs the lookup (existence-only —
`find_slot` hit/miss, cheaper than the SNP sweep's full column
fetch); a final stage/sink folds each answer into its origin's
running state (below) and, once a layer's k-mers are all resolved,
flushes the completed array to that layer's annex file. Many small,
single-purpose stages on purpose, to let the scheduler interleave
them finely across many in-flight items — this deliberately does
**not** mirror how `obipipeline` is used elsewhere today: `query.rs`'s
`process_chunk` lumps parse+route+query+serialise into one closure
(`query.rs:325,743-758`), and `scatter.rs` only pipelines file-
reading/superkmer construction, routing partitions afterwards in a
plain sequential loop (`KmerPartition::write_batch`,
`partition.rs:140`) — both under-use the fine-grained scheduling the
mechanism offers, so they are not precedents to copy, only existing
(and arguably improvable, out of scope here) usages. Cross-partition
lookups (querying another layer's MPHF for a variant) remain
necessary as before — only the *output* side is kept single-layer.
- **Reconciliation**: processed at the granularity of one *answer batch
per destination partition*, not one source k-mer at a time — this is a
proper shuffle, not a per-k-mer wait. Each source partition `p` holds a
small array of running states `(minorant = true, siblings = 0)`, one
per local slot, initialised at scatter time and **persisting across
however many destination-partition batches answer it** (up to 3, one
per variant, not necessarily all from the same `q`). Every scattered
query carries an origin tag (source partition + local slot) so its
answer can be routed back. When target partition `q` returns its batch
(all answers for every query that named `q`, regardless of which source
k-mer or which source partition they came from), that batch is walked
once, locally, and each answer updates — via its origin tag — the
matching entry in *its* source partition's array: a miss changes
nothing; a hit does `siblings += 1`, and if the found sibling's own
encoding is smaller than the source's, `minorant = false`. A given
source k-mer's state is final only once every destination batch
concerning it has been folded in; its partition's array is flushed to
the persistent annex once complete. Commutative per entry, so the order
in which destination batches arrive and get folded in doesn't matter.
**Open optimisation, not adopted yet — real tradeoff, not a free win.**
Since looking up sibling `y` from `x`'s visit already yields everything
needed to fill `y`'s own annex entry too, one visit per *family* could in
principle replace one visit per *observed family member* — cutting this
pass's cost roughly by the average family size instead of paying
`3 * N_distinct` regardless. But it means threads processing different
source k-mers can end up writing the *same* sibling's slot concurrently —
the fully independent, ownership-free parallelism of the plan above is
deliberately traded away for this gain. It stays safe only because the
computed value for a given slot is deterministic regardless of who
computes it, so redundant concurrent writes converge to the same
value — correct as long as each write is atomic, no locking needed — but
it is a real design complexity increase over "every member redoes its
own 3 lookups independently," not a strict improvement to adopt by
default.
4. **Trigger and caching** (`obikindex::KmerIndex`/`distance.rs`): compute
lazily on first `distance` call for an SNP-family metric against a given
index; check for an existing annex file first (mirrors
`PersistentBitMatrix::open()`'s auto-detect-and-fall-back,
`bitmatrix.rs:264-287`); if absent, run step 3 and persist; if present,
mmap and reuse.
5. **Invalidation.** `merge` and `filter` always write to a fresh `--output`
directory (`obikindex/src/merge.rs`, `obikmer/src/cmd/filter.rs`) so a
re-merged/re-filtered index simply has no annex yet — nothing to
invalidate. `select --in-place` (`select_layer.rs:139-235`) mutates
columns of an existing index without changing its location, which can
change sibling counts without removing rows — it must explicitly delete
any cached annex for that index as part of its in-place rewrite.
6. **Testing**: hand-built tiny indexes with known sibling counts (0-3);
order-independence (recompute twice on a static index, identical
result, given the fully-parallel no-ownership design); invalidation
(annex absent/correctly recomputed after `select --in-place`); once
Step 2's sweep is fixed, a regression check that sibling_count == 0
slots are never looked up cross-partition during the sweep.
Cost: `3 * N_distinct` existence-only lookups, computed once per index
state and amortised over every subsequent `distance` call that reuses the
cached annex — cheaper per-lookup than the sweep itself (hit/miss only, no
column fetch).
### Step 3 — finalisation (`obikindex`)
From the global `SnpTally` alone (diagonal and off-diagonal both populated by
the sweep, see Step 1/2 — no dependency on the external `shared_kmers`
matrix), derive n x n distance matrices, each a pure function of the
accumulated counts (same shape as `jaccard_to_mash`):
- `p_hat[i,j] = SNP / (SNP + shared)`
- Jukes-Cantor, Kimura-2P (from `P`, `Q`), optionally LogDet (needs the
diagonal + base-composition margins).
Guard the singularities (`p >= 3/4` for JC, `1-2P-Q <= 0` or `1-2Q <= 0` for
K2P) by clamping to a max distance, as `jaccard_to_mash` clamps `J <= 0`.
### Step 4 — surfacing (`obikindex` + `obikmer` CLI)
These metrics do not fit `DistanceMetric`'s current `LayeredStore`-partial
dispatch (they need the cross-partition sweep and produce a different
intermediate). Two options, to decide:
- **(a)** New `DistanceMetric` variants (`Pdistance`, `JukesCantor`,
`Kimura2P`, `LogDet`) whose `KmerIndex::distance` arm calls the sweep
(`snp.rs`) instead of the partial path, still returning `DistanceOutput`.
Keeps one CLI surface (`--metric jukes-cantor`), at the cost of a branch in
`distance()` that ignores the `LayeredStore` it built.
- **(b)** A dedicated pathway (`KmerIndex::snp_distance`) and a distinct CLI
entry, if mixing a cross-partition sweep into the partition-local `distance`
command is judged architecturally muddy.
Recommendation: (a) for user ergonomics (all pairwise distances under
`distance`, all feeding NJ/UPGMA/`--shared-kmers` unchanged), but compute the
sweep lazily only when an SNP-family metric is requested, so the existing
metrics keep their partition-local fast path untouched.
### Step 5 — subsampling flag
Add `--snp-sample <fraction>` (or a bottom-`s` hash threshold): restrict the
source-k-mer enumeration in Step 2 to `seq_hash(kmer) < threshold`. Divides
lookups proportionally; `p_hat` is unbiased. Off by default (exact).
### Testing
- **Primitive unit tests**: `central_canonical_neighbors` on hand-checked
k-mers incl. palindrome-boundary cases; lone-k-mer `minimizer` against
`RollingStat`'s incremental result on the same k-mer.
- **End-to-end tiny index**: two 1-genome indexes differing by a handful of
known isolated SNPs (transitions and transversions placed by hand), assert
exact `SNP`, `P`, `Q` counts and the resulting JC/K2P values.
- **Dedup invariant**: assert the tally is identical regardless of genome/
partition order and that no pair is double-counted (compare against a
brute-force all-pairs reference on a small index).
- **Subsampling**: `p_hat` within sampling error of the exact run.
### Suggested phasing
1. Step 0 primitives + their unit tests (self-contained, no distance wiring).
This also unblocks the long-declared-but-unimplemented `query --mismatch`
(`obikmer/src/cmd/query.rs:676`, currently a warning), which needs the same
neighbour + routing machinery.
2. `SnpTally` + finalisation math with a brute-force (non-swept) reference
backend, validated on a tiny index.
3. The real per-partition sweep (Step 2) behind the same finalisation; assert
it matches the brute-force backend.
4. CLI surfacing (Step 4a) and NJ/UPGMA integration (already generic over the
matrix).
5. Subsampling (Step 5).
## References
The Mash mutation-rate model this discussion contrasts with:
[@Mash-distances-doc; @Fan2015-mash-formula].
+1
View File
@@ -36,6 +36,7 @@ nav:
- Entropy filter: theory/entropy.md - Entropy filter: theory/entropy.md
- Minimizer selection: theory/minimizer.md - Minimizer selection: theory/minimizer.md
- Partitioning architecture: theory/indexing.md - Partitioning architecture: theory/indexing.md
- Central-position SNP distance (discussion): theory/evolutionary_distances.md
- Implementation: - Implementation:
- SuperKmer: implementation/superkmer.md - SuperKmer: implementation/superkmer.md
- Kmer: implementation/kmer.md - Kmer: implementation/kmer.md
+15 -1
View File
@@ -1682,6 +1682,13 @@ dependencies = [
"xxhash-rust", "xxhash-rust",
] ]
[[package]]
name = "obikentropy"
version = "0.1.0"
dependencies = [
"obikseq",
]
[[package]] [[package]]
name = "obikindex" name = "obikindex"
version = "0.1.0" version = "0.1.0"
@@ -1694,17 +1701,21 @@ dependencies = [
"obikpartitionner", "obikpartitionner",
"obikseq", "obikseq",
"obilayeredmap", "obilayeredmap",
"obipipeline",
"obiread",
"obiskbuilder",
"obiskio", "obiskio",
"obisys", "obisys",
"rayon", "rayon",
"serde", "serde",
"serde_json", "serde_json",
"tempfile",
"tracing", "tracing",
] ]
[[package]] [[package]]
name = "obikmer" name = "obikmer"
version = "0.1.1" version = "1.1.40"
dependencies = [ dependencies = [
"clap", "clap",
"csv", "csv",
@@ -1742,6 +1753,7 @@ dependencies = [
"niffler 3.0.0", "niffler 3.0.0",
"obicompactvec", "obicompactvec",
"obidebruinj", "obidebruinj",
"obikentropy",
"obikrope", "obikrope",
"obikseq", "obikseq",
"obilayeredmap", "obilayeredmap",
@@ -1824,7 +1836,9 @@ dependencies = [
name = "obiskbuilder" name = "obiskbuilder"
version = "0.1.0" version = "0.1.0"
dependencies = [ dependencies = [
"criterion2",
"lazy_static", "lazy_static",
"obikentropy",
"obikrope", "obikrope",
"obikseq", "obikseq",
"obiread", "obiread",
+1 -1
View File
@@ -1,5 +1,5 @@
[workspace] [workspace]
resolver = "3" resolver = "3"
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy"] members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy", "obikentropy"]
[profile.release] [profile.release]
debug = 1 debug = 1
BIN
View File
Binary file not shown.
+60 -9
View File
@@ -1,5 +1,5 @@
use std::fs::{self, File}; use std::fs::{self, File};
use std::io::{self, BufWriter, Write as _}; use std::io::{self, BufWriter, Read as _, Write as _};
use std::path::{Path, PathBuf}; use std::path::{Path, PathBuf};
use memmap2::Mmap; use memmap2::Mmap;
@@ -171,19 +171,43 @@ impl PackedBitMatrix {
} }
} }
/// Reads just the `n_cols` field from an existing packed matrix's header,
/// without mapping the file. Used by `pack_bit_matrix` to tell a genuinely
/// complete pack from a stale one that predates a later column-widening.
fn packed_bit_matrix_n_cols(path: &Path) -> io::Result<usize> {
let mut f = File::open(path)?;
let mut header = [0u8; PBMX_HEADER];
f.read_exact(&mut header)?;
Ok(u64::from_le_bytes(header[16..24].try_into().unwrap()) as usize)
}
/// Build `presence/matrix.pbmx` from existing `col_*.pbiv` files. /// Build `presence/matrix.pbmx` from existing `col_*.pbiv` files.
pub fn pack_bit_matrix(dir: &Path) -> io::Result<()> { pub fn pack_bit_matrix(dir: &Path) -> io::Result<()> {
let packed_path = dir.join("matrix.pbmx"); let packed_path = dir.join("matrix.pbmx");
if packed_path.exists() {
// Matrix complete; remove any leftover column files from a killed cleanup. let meta = match MatrixMeta::load(dir) {
if let Ok(meta) = MatrixMeta::load(dir) { Ok(meta) => meta,
Err(e) => {
// No columnar data pending: either this layer was already
// packed and cleaned up (matrix.pbmx complete, nothing left to
// do), or genuinely nothing was ever written here.
return if packed_path.exists() { Ok(()) } else { Err(e) };
}
};
// A `matrix.pbmx` can already exist here even though columnar data is
// still pending — e.g. copied verbatim from a merge's base source
// before this layer was widened with more genome columns (see
// `obikpartitionner::merge_partition`). Only skip (re-)packing if the
// existing file already reflects the current column count; otherwise
// the columnar files are newer and must be (re-)packed, overwriting the
// stale one — never silently discarded as "leftover cleanup".
if packed_bit_matrix_n_cols(&packed_path).ok() == Some(meta.n_cols) {
for c in 0..meta.n_cols { let _ = fs::remove_file(col_path(dir, c)); } for c in 0..meta.n_cols { let _ = fs::remove_file(col_path(dir, c)); }
let _ = fs::remove_file(dir.join("meta.json")); let _ = fs::remove_file(dir.join("meta.json"));
}
return Ok(()); return Ok(());
} }
let meta = MatrixMeta::load(dir)?;
let n_cols = meta.n_cols; let n_cols = meta.n_cols;
// Compute offsets from file sizes — no column data loaded into RAM. // Compute offsets from file sizes — no column data loaded into RAM.
@@ -294,6 +318,19 @@ impl PersistentBitMatrix {
} }
} }
/// Column-major point lookup: value at column `c`, slot `slot`, as 0/1.
///
/// Unlike [`col_view`](Self::col_view), this never panics on `Implicit`
/// (every column reads as present, per the mono-genome fast path) — safe
/// to call for any `c < self.n_cols()`.
pub fn get(&self, c: usize, slot: usize) -> u32 {
match self {
Self::Columnar(m) => m.col(c).get(slot) as u32,
Self::Packed(m) => m.col_slice(c).get(slot) as u32,
Self::Implicit { .. } => 1,
}
}
pub fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentBitVecBuilder> { pub fn col_persist(&self, c: usize, path: &Path) -> io::Result<PersistentBitVecBuilder> {
match self { match self {
Self::Columnar(m) => PersistentBitVecBuilder::build_from(m.col(c), path), Self::Columnar(m) => PersistentBitVecBuilder::build_from(m.col(c), path),
@@ -500,17 +537,26 @@ where T: Clone + Default {
} }
/// Compute a symmetric `n×n` matrix in parallel by evaluating `f(i,j)` for /// Compute a symmetric `n×n` matrix in parallel by evaluating `f(i,j)` for
/// all upper-triangle pairs. `T: Copy` avoids the `.clone()` needed for the /// all upper-triangle pairs, plus `f(i,i)` for the diagonal. `T: Copy` avoids
/// lower-triangle mirror. /// the `.clone()` needed for the lower-triangle mirror.
///
/// The diagonal is *not* generally `T::default()`: for a self-comparison,
/// `f(i,i)` is often the column's own weight (e.g. intersection-with-self —
/// see `pairwise2_matrix`), not zero. Distance finalisations that need a
/// zero diagonal (self-distance) already overwrite it explicitly.
pub(crate) fn pairwise_matrix<T>(n: usize, f: impl Fn(usize, usize) -> T + Sync) -> Array2<T> pub(crate) fn pairwise_matrix<T>(n: usize, f: impl Fn(usize, usize) -> T + Sync) -> Array2<T>
where T: Copy + Default + Send { where T: Copy + Default + Send {
let results: Vec<(usize, usize, T)> = upper_pairs(n) let results: Vec<(usize, usize, T)> = upper_pairs(n)
.into_par_iter().map(|(i, j)| (i, j, f(i, j))).collect(); .into_par_iter().map(|(i, j)| (i, j, f(i, j))).collect();
fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v))) let mut m = fill_symmetric(n, results.into_iter().map(|(i, j, v)| (i, j, v, v)));
for i in 0..n { m[[i, i]] = f(i, i); }
m
} }
/// Same as `pairwise_matrix` but `f` returns two values that fill two /// Same as `pairwise_matrix` but `f` returns two values that fill two
/// symmetric matrices simultaneously (e.g. intersection + union for Jaccard). /// symmetric matrices simultaneously (e.g. intersection + union for Jaccard).
/// The diagonal is `f(i,i)` (e.g. a genome's kmer count intersected with
/// itself), not `T::default()` — see `pairwise_matrix` for why that matters.
pub(crate) fn pairwise2_matrix<T>(n: usize, f: impl Fn(usize, usize) -> (T, T) + Sync) -> (Array2<T>, Array2<T>) pub(crate) fn pairwise2_matrix<T>(n: usize, f: impl Fn(usize, usize) -> (T, T) + Sync) -> (Array2<T>, Array2<T>)
where T: Copy + Default + Send { where T: Copy + Default + Send {
let results: Vec<(usize, usize, T, T)> = upper_pairs(n) let results: Vec<(usize, usize, T, T)> = upper_pairs(n)
@@ -523,5 +569,10 @@ where T: Copy + Default + Send {
m0[[i, j]] = a; m0[[j, i]] = a; m0[[i, j]] = a; m0[[j, i]] = a;
m1[[i, j]] = b; m1[[j, i]] = b; m1[[i, j]] = b; m1[[j, i]] = b;
} }
for i in 0..n {
let (a, b) = f(i, i);
m0[[i, i]] = a;
m1[[i, i]] = b;
}
(m0, m1) (m0, m1)
} }
+32 -5
View File
@@ -1,5 +1,5 @@
use std::fs::{self, File}; use std::fs::{self, File};
use std::io::{self, BufWriter, Write as _}; use std::io::{self, BufWriter, Read as _, Write as _};
use std::path::{Path, PathBuf}; use std::path::{Path, PathBuf};
use memmap2::Mmap; use memmap2::Mmap;
@@ -228,17 +228,44 @@ impl PackedCompactIntMatrix {
} }
} }
/// Reads just the `n_cols` field from an existing packed matrix's header,
/// without mapping the file. Used by `pack_compact_int_matrix` to tell a
/// genuinely complete pack from a stale one that predates a later
/// column-widening.
fn packed_int_matrix_n_cols(path: &Path) -> io::Result<usize> {
let mut f = File::open(path)?;
let mut header = [0u8; PCMX_HEADER];
f.read_exact(&mut header)?;
Ok(u64::from_le_bytes(header[16..24].try_into().unwrap()) as usize)
}
/// Build `counts/matrix.pcmx` from existing `col_*.pciv` files. /// Build `counts/matrix.pcmx` from existing `col_*.pciv` files.
pub fn pack_compact_int_matrix(dir: &Path) -> io::Result<()> { pub fn pack_compact_int_matrix(dir: &Path) -> io::Result<()> {
let packed_path = dir.join("matrix.pcmx"); let packed_path = dir.join("matrix.pcmx");
if packed_path.exists() {
if let Ok(meta) = MatrixMeta::load(dir) { let meta = match MatrixMeta::load(dir) {
Ok(meta) => meta,
Err(e) => {
// No columnar data pending: either this layer was already
// packed and cleaned up (matrix.pcmx complete, nothing left to
// do), or genuinely nothing was ever written here.
return if packed_path.exists() { Ok(()) } else { Err(e) };
}
};
// A `matrix.pcmx` can already exist here even though columnar data is
// still pending — e.g. copied verbatim from a merge's base source
// before this layer was widened with more genome columns (see
// `obikpartitionner::merge_partition`). Only skip (re-)packing if the
// existing file already reflects the current column count; otherwise
// the columnar files are newer and must be (re-)packed, overwriting the
// stale one — never silently discarded as "leftover cleanup".
if packed_int_matrix_n_cols(&packed_path).ok() == Some(meta.n_cols) {
for c in 0..meta.n_cols { let _ = fs::remove_file(col_path(dir, c)); } for c in 0..meta.n_cols { let _ = fs::remove_file(col_path(dir, c)); }
let _ = fs::remove_file(dir.join("meta.json")); let _ = fs::remove_file(dir.join("meta.json"));
}
return Ok(()); return Ok(());
} }
let meta = MatrixMeta::load(dir)?;
let n_cols = meta.n_cols; let n_cols = meta.n_cols;
let col_sizes: Vec<u64> = (0..n_cols) let col_sizes: Vec<u64> = (0..n_cols)
.map(|c| fs::metadata(col_path(dir, c)).map(|m| m.len())) .map(|c| fs::metadata(col_path(dir, c)).map(|m| m.len()))
+2
View File
@@ -7,6 +7,7 @@ mod intmatrix;
mod layer_meta; mod layer_meta;
mod meta; mod meta;
mod reader; mod reader;
mod siblingannex;
mod tempbitvec; mod tempbitvec;
mod tempintvec; mod tempintvec;
mod views; mod views;
@@ -18,6 +19,7 @@ pub use builder::PersistentCompactIntVecBuilder;
pub use colgroup::{ColGroup, FilterMask, MatrixGroupOps, eval_filter_mask}; pub use colgroup::{ColGroup, FilterMask, MatrixGroupOps, eval_filter_mask};
pub use intmatrix::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, pack_compact_int_matrix}; pub use intmatrix::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, pack_compact_int_matrix};
pub use layer_meta::LayerMeta; pub use layer_meta::LayerMeta;
pub use siblingannex::{FamilyMask, SiblingAnnex, SiblingAnnexBuilder};
pub use reader::{PersistentCompactIntVec, Iter as CompactIntVecIter}; pub use reader::{PersistentCompactIntVec, Iter as CompactIntVecIter};
pub use tempbitvec::{TempBitVec, TempBitVecBuilder}; pub use tempbitvec::{TempBitVec, TempBitVecBuilder};
pub use tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder}; pub use tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
+245
View File
@@ -0,0 +1,245 @@
//! Family presence-mask annex: a compact, read-only-after-build, per-slot
//! derived value used by the central-position SNP distance estimator (see
//! `docmd/theory/evolutionary_distances.md`, "Step 2b" and "Definitions:
//! family, and the canonical form of a family").
//!
//! One byte is stored per MPHF slot of a partition/layer, its low 4 bits
//! encoding a **presence mask** for the slot's k-mer's "family" (the up to 4
//! k-mers sharing the same flanks, differing only at the central base):
//! bit `b` (`b` = 0..3, in the fixed A/C/G/T = 0/1/2/3 encoding already used
//! for a single nucleotide) is set iff the family member whose *own* central
//! base — in its own canonical orientation — is `b`, is observed anywhere in
//! the current multi-genome index. This is a property of the whole index,
//! not of any one genome.
//!
//! Both facts the earlier (superseded) 3-bit design stored explicitly are
//! derived from the mask instead, not stored:
//! - sibling count = `popcount(mask) - 1`;
//! - minorant = regenerate the family's 4 canonical forms from the slot's
//! own k-mer (`CanonicalKmerOf::central_canonical_neighbors`, cheap, no
//! lookup), compare the raw encodings of whichever are set in the mask,
//! take the smallest — see `obikindex::siblings`.
//!
//! Mask value 0 is logically unreachable as a real result (a slot's own base
//! is always present in its own family) and is reused as the "not yet
//! computed" sentinel: annex files are pre-initialised to all-zero, and a
//! real value is only ever written once, by the computation pass.
//!
//! Deliberately simpler than a true 4-bit pack (1 byte/slot instead of 4
//! bits/slot): correctness and simplicity first, for a first implementation.
//! Packing to 4 bits/slot is a pure storage-density follow-up, not a
//! behavioural change, left for later.
use std::fs::{File, OpenOptions};
use std::io;
use std::path::{Path, PathBuf};
use memmap2::{Mmap, MmapMut};
const MAGIC: [u8; 4] = *b"PSIB";
// Header: magic(4) + _pad(4) + n(8) = 16 bytes. Data (1 byte/slot) follows.
const HEADER_SIZE: usize = 16;
/// A family presence mask: bit `b` set iff the member whose own canonical
/// central base is `b` (0=A, 1=C, 2=G, 3=T) is observed in the index.
#[derive(Debug, Clone, Copy, PartialEq, Eq)]
pub struct FamilyMask(u8);
impl FamilyMask {
/// The empty mask — never a valid *computed* result (a slot's own base
/// is always present in its own family) — used only to build up a mask
/// via repeated [`with`](Self::with) calls before storing it.
pub const EMPTY: FamilyMask = FamilyMask(0);
/// Set bit `base` (0=A, 1=C, 2=G, 3=T).
#[inline]
pub fn with(self, base: u8) -> Self {
debug_assert!(base < 4, "base out of range: {base}");
FamilyMask(self.0 | (1 << base))
}
/// Is the member with central base `base` (0..3) present?
#[inline]
pub fn has(self, base: u8) -> bool {
debug_assert!(base < 4, "base out of range: {base}");
self.0 & (1 << base) != 0
}
/// Number of family members observed anywhere in the index (1..=4).
#[inline]
pub fn family_size(self) -> u32 {
self.0.count_ones()
}
/// Number of *other* members observed (0..=3) — `family_size() - 1`.
#[inline]
pub fn siblings(self) -> u32 {
self.family_size() - 1
}
/// Raw bitmask (bit `b` = base `b` present) — for callers that build up
/// a mask via their own bit operations (e.g. concurrently, via an
/// `AtomicU8`) and only need the `FamilyMask` wrapper at the end.
#[inline]
pub fn bits(self) -> u8 {
self.0
}
/// Construct from a raw bitmask (only the low 4 bits are kept).
#[inline]
pub fn from_bits(bits: u8) -> Self {
FamilyMask(bits & 0b1111)
}
#[inline]
fn encode(self) -> u8 {
self.0
}
#[inline]
fn decode(byte: u8) -> Option<Self> {
if byte == 0 {
// Unreachable for a real result — reserved as the "not yet
// computed" sentinel.
return None;
}
Some(FamilyMask(byte & 0b1111))
}
}
// ── SiblingAnnex (reader) ───────────────────────────────────────────────────
pub struct SiblingAnnex {
mmap: Mmap,
n: usize,
path: PathBuf,
}
impl SiblingAnnex {
pub fn open(path: &Path) -> io::Result<Self> {
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
if mmap.len() < HEADER_SIZE {
return Err(io::Error::new(io::ErrorKind::InvalidData, "PSIB file too short"));
}
if mmap[0..4] != MAGIC {
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PSIB magic"));
}
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
if mmap.len() < HEADER_SIZE + n {
return Err(io::Error::new(io::ErrorKind::InvalidData, "PSIB file truncated"));
}
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn path(&self) -> &Path { &self.path }
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
/// `None` means the slot has not (yet) been computed — see module docs.
pub fn get(&self, slot: usize) -> Option<FamilyMask> {
FamilyMask::decode(self.mmap[HEADER_SIZE + slot])
}
}
// ── SiblingAnnexBuilder (writer) ────────────────────────────────────────────
pub struct SiblingAnnexBuilder {
mmap: MmapMut,
n: usize,
path: PathBuf,
}
impl SiblingAnnexBuilder {
/// Create a new annex of `n` slots at `path`, pre-initialised to the
/// "not yet computed" sentinel (all-zero).
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
let file_size = HEADER_SIZE + n;
let file = OpenOptions::new()
.read(true).write(true).create(true).truncate(true)
.open(path)?;
file.set_len(file_size as u64)?;
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
mmap[0..4].copy_from_slice(&MAGIC);
mmap[4..8].copy_from_slice(&[0u8; 4]);
mmap[8..16].copy_from_slice(&(n as u64).to_le_bytes());
// Data region left at 0 by `set_len`/mmap — the sentinel value.
Ok(Self { mmap, n, path: path.to_path_buf() })
}
pub fn len(&self) -> usize { self.n }
pub fn is_empty(&self) -> bool { self.n == 0 }
pub fn get(&self, slot: usize) -> Option<FamilyMask> {
FamilyMask::decode(self.mmap[HEADER_SIZE + slot])
}
pub fn set(&mut self, slot: usize, mask: FamilyMask) {
// Redundant concurrent writes from independent recomputation paths
// converge to the same encoded byte for a given slot, so a plain
// store here is safe even without external synchronisation, as long
// as the byte write itself is atomic (true for a single aligned
// byte on every platform this project targets).
self.mmap[HEADER_SIZE + slot] = mask.encode();
}
pub fn close(self) -> io::Result<()> { self.mmap.flush() }
pub fn finish(self) -> io::Result<SiblingAnnex> {
let path = self.path.clone();
self.close()?;
SiblingAnnex::open(&path)
}
}
#[cfg(test)]
mod tests {
use super::*;
use tempfile::tempdir;
#[test]
fn sentinel_is_zero_and_unset_slots_read_as_uncomputed() {
let dir = tempdir().unwrap();
let path = dir.path().join("test.psib");
let builder = SiblingAnnexBuilder::new(4, &path).unwrap();
for slot in 0..4 {
assert_eq!(builder.get(slot), None);
}
builder.close().unwrap();
}
#[test]
fn roundtrip_all_valid_masks() {
let dir = tempdir().unwrap();
let path = dir.path().join("test.psib");
let mut builder = SiblingAnnexBuilder::new(4, &path).unwrap();
let masks = [
FamilyMask::EMPTY.with(0), // just A: family size 1
FamilyMask::EMPTY.with(0).with(3), // A + T: size 2
FamilyMask::EMPTY.with(1).with(2).with(3), // C+G+T: size 3
FamilyMask::EMPTY.with(0).with(1).with(2).with(3), // all 4
];
for (slot, mask) in masks.iter().enumerate() {
builder.set(slot, *mask);
}
let annex = builder.finish().unwrap();
for (slot, mask) in masks.iter().enumerate() {
assert_eq!(annex.get(slot), Some(*mask));
}
assert_eq!(annex.get(0).unwrap().siblings(), 0);
assert_eq!(annex.get(1).unwrap().siblings(), 1);
assert_eq!(annex.get(2).unwrap().siblings(), 2);
assert_eq!(annex.get(3).unwrap().siblings(), 3);
assert_eq!(annex.get(3).unwrap().family_size(), 4);
}
#[test]
fn has_reflects_individual_bits() {
let mask = FamilyMask::EMPTY.with(0).with(2);
assert!(mask.has(0));
assert!(!mask.has(1));
assert!(mask.has(2));
assert!(!mask.has(3));
}
}
+23
View File
@@ -1,5 +1,16 @@
use ndarray::{Array1, Array2}; use ndarray::{Array1, Array2};
/// Convert a Jaccard distance matrix (`1 - J`) into a Mash distance matrix, per
/// https://mash.readthedocs.io/en/latest/distances.html:
/// `D = -1/k * ln(2J / (1+J))`.
fn jaccard_to_mash(d_jaccard: &Array2<f64>, k: usize) -> Array2<f64> {
d_jaccard.mapv(|d| {
let j = 1.0 - d;
if j <= 0.0 { 1.0 }
else { -1.0 / k as f64 * (2.0 * j / (1.0 + j)).ln() }
})
}
// ── Column-level weight statistic — total count or presence count per column. // ── Column-level weight statistic — total count or presence count per column.
/// Additive across layers and partitions; used as denominator in normalised distances. /// Additive across layers and partitions; used as denominator in normalised distances.
/// ///
@@ -74,6 +85,12 @@ pub trait CountPartials: ColumnWeights {
m m
} }
/// Mash distance (https://mash.readthedocs.io/en/latest/distances.html), derived
/// from the presence-threshold Jaccard distance.
fn threshold_mash_dist_matrix(&self, k: usize, threshold: u32) -> Array2<f64> {
jaccard_to_mash(&self.threshold_jaccard_dist_matrix(threshold), k)
}
fn relfreq_bray_dist_matrix(&self) -> Array2<f64> { fn relfreq_bray_dist_matrix(&self) -> Array2<f64> {
let global = self.col_weights(); let global = self.col_weights();
let mut m = self.partial_relfreq_bray(&global).mapv(|v| 1.0 - v); let mut m = self.partial_relfreq_bray(&global).mapv(|v| 1.0 - v);
@@ -126,6 +143,12 @@ pub trait BitPartials: ColumnWeights {
m m
} }
/// Mash distance (https://mash.readthedocs.io/en/latest/distances.html), derived
/// from the Jaccard distance.
fn mash_dist_matrix(&self, k: usize) -> Array2<f64> {
jaccard_to_mash(&self.jaccard_dist_matrix(), k)
}
fn hamming_dist_matrix(&self) -> Array2<u64> { fn hamming_dist_matrix(&self) -> Array2<u64> {
self.partial_hamming() self.partial_hamming()
} }
+10
View File
@@ -0,0 +1,10 @@
[package]
name = "obikentropy"
version = "0.1.0"
edition = "2024"
[dependencies]
obikseq = { path = "../obikseq" }
[dev-dependencies]
obikseq = { path = "../obikseq", features = ["test-utils"] }
@@ -4,57 +4,6 @@ use std::path::PathBuf;
const K_MAX: usize = 32; const K_MAX: usize = 32;
const WS_MAX: usize = 6; const WS_MAX: usize = 6;
fn normalize_circular(kmer: u64, ws: usize) -> u64 {
let mask = (1u64 << (ws * 2)) - 1;
let mut canonical = kmer & mask;
let mut current = canonical;
for _ in 0..ws - 1 {
let top = (current >> ((ws - 1) * 2)) & 3;
current = ((current << 2) | top) & mask;
if current < canonical {
canonical = current;
}
}
canonical
}
fn revcomp_raw(x: u64, k: usize) -> u64 {
let x = !x;
let x = x.swap_bytes();
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
x << (64 - 2 * k)
}
fn build_normalized_kmer(k: usize) -> Vec<u64> {
let n = 1usize << (k * 2);
let shift = 64 - k * 2;
let mut result = vec![0u64; n];
for i in 0..n {
let la = (i as u64) << shift;
let ra = i as u64;
let rc_ra = revcomp_raw(la, k) >> shift;
let circ = normalize_circular(ra, k);
let circ_rc = normalize_circular(rc_ra, k);
result[i] = if circ < circ_rc { circ } else { circ_rc };
}
result
}
fn build_ln_class(norm: &[u64]) -> Vec<f64> {
let n = norm.len();
let mut sizes = vec![0u32; n];
for &c in norm {
sizes[c as usize] += 1;
}
norm.iter()
.map(|&c| {
let s = sizes[c as usize];
if s > 0 { (s as f64).ln() } else { 0.0 }
})
.collect()
}
fn build_n_log_n() -> [f64; K_MAX + 1] { fn build_n_log_n() -> [f64; K_MAX + 1] {
let mut t = [0.0f64; K_MAX + 1]; let mut t = [0.0f64; K_MAX + 1];
for n in 1..=K_MAX { for n in 1..=K_MAX {
@@ -63,6 +12,9 @@ fn build_n_log_n() -> [f64; K_MAX + 1] {
t t
} }
/// Max achievable entropy over `4^ws` raw sub-words given only `nwords`
/// observations (most-uniform integer partition), per
/// `docmd/theory/entropy.md`.
fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] { fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] {
let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1]; let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1];
for k in 2..=K_MAX { for k in 2..=K_MAX {
@@ -125,13 +77,6 @@ fn main() {
let out_dir = PathBuf::from(std::env::var("OUT_DIR").unwrap()); let out_dir = PathBuf::from(std::env::var("OUT_DIR").unwrap());
let mut out = String::new(); let mut out = String::new();
for k in 1..=6usize {
let n = 1usize << (k * 2);
let norm = build_normalized_kmer(k);
let ln_class = build_ln_class(&norm);
emit_f64_1d(&mut out, &format!("LN_CLASS{k}"), n, &ln_class);
}
let n_log_n = build_n_log_n(); let n_log_n = build_n_log_n();
emit_f64_1d(&mut out, "N_LOG_N", K_MAX + 1, &n_log_n); emit_f64_1d(&mut out, "N_LOG_N", K_MAX + 1, &n_log_n);
@@ -141,5 +86,5 @@ fn main() {
let log_nwords = build_log_nwords(); let log_nwords = build_log_nwords();
emit_f64_2d(&mut out, "LOG_NWORDS", K_MAX + 1, WS_MAX + 1, &log_nwords); emit_f64_2d(&mut out, "LOG_NWORDS", K_MAX + 1, WS_MAX + 1, &log_nwords);
fs::write(out_dir.join("ln_class_tables.rs"), out).unwrap(); fs::write(out_dir.join("entropy_tables.rs"), out).unwrap();
} }
+41
View File
@@ -0,0 +1,41 @@
//! Normalized entropy of an isolated, already-built k-mer (e.g. one
//! reconstructed from an index's `unitigs.bin`, with no surrounding
//! sequence) — drives the window through [`EntropyTracker`] one base at a
//! time, exactly like the streaming path, so a `theta` threshold means the
//! same thing whether applied during index construction or after the fact
//! (e.g. `obikmer filter`).
use obikseq::CanonicalKmer;
use crate::tracker::EntropyTracker;
/// Extension trait: compute the normalized entropy of a single canonical
/// k-mer, independent of any surrounding sequence.
pub trait KmerEntropy {
/// Normalized entropy across sub-word orders `1..=level_max` (the
/// minimum is taken across orders). Lower means less complex; `theta`
/// in `index`/`filter` rejects k-mers with a score `< theta`.
fn entropy(&self, level_max: usize) -> f64;
}
impl KmerEntropy for CanonicalKmer {
fn entropy(&self, level_max: usize) -> f64 {
let raw = self.raw(); // left-aligned, 2 bits/base, MSB-first
let k = obikseq::params::k();
let mask = (!0u64) >> (64 - k * 2);
let mut tracker = EntropyTracker::new(k);
let mut rolling: u64 = 0;
for i in 0..k {
let shift = 64 - 2 * (i + 1);
let base = (raw >> shift) & 3;
rolling = ((rolling << 2) | base) & mask;
tracker.push(i + 1, rolling);
}
tracker.normalized_entropy(level_max)
}
}
#[cfg(test)]
#[path = "tests/kmer_entropy.rs"]
mod tests;
+17
View File
@@ -0,0 +1,17 @@
//! Normalized k-mer entropy: formulas, tables, and a streaming tracker.
//!
//! This crate holds every piece of the entropy computation described in
//! `docmd/theory/entropy.md`: the compile-time tables ([`table`], private),
//! the incremental accumulator ([`EntropyTracker`]) that callers compose
//! into their own streaming state, and the [`KmerEntropy`] convenience trait
//! for scoring a single, already-built k-mer.
#![deny(missing_docs)]
mod kmer_entropy;
mod ring;
mod table;
mod tracker;
pub use kmer_entropy::KmerEntropy;
pub use tracker::EntropyTracker;
+40
View File
@@ -0,0 +1,40 @@
//! Stack-allocated ring buffer backing the sliding sub-word windows.
/// Fixed-capacity ring buffer backed by a stack array.
/// N must be a power of two; operations are branchless via `% N`.
pub(crate) struct Ring<T: Copy + Default, const N: usize> {
buf: [T; N],
head: usize,
len: usize,
}
impl<T: Copy + Default, const N: usize> Ring<T, N> {
#[inline]
pub(crate) fn new() -> Self {
Self {
buf: [T::default(); N],
head: 0,
len: 0,
}
}
#[inline]
pub(crate) fn clear(&mut self) {
self.len = 0;
self.head = 0;
}
#[inline]
pub(crate) fn push_back(&mut self, val: T) {
self.buf[(self.head + self.len) % N] = val;
self.len += 1;
}
#[inline]
pub(crate) fn pop_front(&mut self) -> T {
let val = self.buf[self.head];
self.head = (self.head + 1) % N;
self.len -= 1;
val
}
}
+30
View File
@@ -0,0 +1,30 @@
//! Compile-time tables backing the normalized k-mer entropy formula: the
//! max-entropy correction for small samples. See `docmd/theory/entropy.md`.
//!
//! Entropy is computed directly on raw (non-canonicalized) sub-words — no
//! equivalence-class folding. Empirically (see the discussion that produced
//! this crate's history), folding sub-words into circular/revcomp classes
//! before unfolding them back buys nothing for the invariances it was meant
//! to guarantee (both hold for raw sub-word entropy already, by a direct
//! bijection argument for revcomp and by the sliding window's own dynamics
//! for tandem repeats), while it measurably *weakens* detection of the
//! low-complexity sequences the filter exists to catch.
include!(concat!(env!("OUT_DIR"), "/entropy_tables.rs"));
pub(crate) const WS_MAX: usize = 6;
#[inline(always)]
pub(crate) const fn n_log_n(n: usize) -> f64 {
N_LOG_N[n]
}
#[inline(always)]
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
EMAX[k][ws]
}
#[inline(always)]
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
LOG_NWORDS[k][ws]
}
+52
View File
@@ -0,0 +1,52 @@
use super::*;
use obikseq::Sequence;
use obikseq::kmer::Kmer;
const K: usize = 21;
const LEVEL_MAX: usize = 6;
fn kmer_from_ascii(seq: &[u8]) -> CanonicalKmer {
obikseq::set_k(K);
Kmer::from_ascii(seq).expect("valid k-mer sequence").canonical()
}
#[test]
fn homopolymer_scores_lower_than_diverse_sequence() {
let homopolymer = kmer_from_ascii(b"AAAAAAAAAAAAAAAAAAAAA"); // 21 bases
let diverse = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT"); // 21 bases, same as used elsewhere in this workspace's tests
let e_homopolymer = homopolymer.entropy(LEVEL_MAX);
let e_diverse = diverse.entropy(LEVEL_MAX);
assert!(
e_homopolymer < e_diverse,
"homopolymer ({e_homopolymer}) should score lower than a diverse sequence ({e_diverse})"
);
// A pure homopolymer is the most degenerate case representable — its
// score should sit near the bottom of the range, not just "somewhat lower".
assert!(e_homopolymer < 0.3, "homopolymer entropy unexpectedly high: {e_homopolymer}");
}
#[test]
fn entropy_is_deterministic_for_the_same_kmer() {
let a = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
let b = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
assert_eq!(a.entropy(LEVEL_MAX), b.entropy(LEVEL_MAX));
}
#[test]
fn entropy_is_within_zero_one_range() {
let mut repeat = "AT".repeat(K / 2 + 1);
repeat.truncate(K);
for seq in [
"AAAAAAAAAAAAAAAAAAAAA".to_string(),
repeat,
"CATTAGCGTACCTGATCAGGT".to_string(),
] {
assert_eq!(seq.len(), K, "test sequence must be exactly K bases: {seq:?}");
let kmer = kmer_from_ascii(seq.as_bytes());
let e = kmer.entropy(LEVEL_MAX);
assert!((0.0..=1.0).contains(&e), "entropy {e} out of [0,1] for {seq:?}");
}
}
+255
View File
@@ -0,0 +1,255 @@
//! Incremental (streaming) normalized k-mer entropy.
//!
//! [`EntropyTracker`] maintains, over a sliding window of the last `k` bases,
//! the per-sub-word-size raw-word frequency statistics needed to evaluate
//! the corrected Shannon entropy described in `docmd/theory/entropy.md`,
//! updated in O(1) per base rather than recomputed from scratch. No
//! canonicalization is applied — each sub-word is tallied under its own raw
//! 2-bit-packed value; only the small-sample max-entropy correction departs
//! from a textbook Shannon entropy.
//!
//! It carries no notion of minimizers or superkmer segmentation — callers
//! that need both (e.g. `obiskbuilder::RollingStat`) compose an
//! `EntropyTracker` as a plain field alongside their own state, so the two
//! concerns update in the same streaming pass without being conflated in one
//! struct.
use crate::ring::Ring;
use crate::table::{WS_MAX, emax, log_nwords, n_log_n};
/// Incremental normalized-entropy accumulator over a sliding window of `k`
/// bases. Composed as a plain field by callers that also need other
/// per-base state (e.g. minimizer selection) in the same streaming pass.
pub struct EntropyTracker {
k: usize,
steady: bool,
// Sliding-window queues over the last `k` raw sub-words, one per word
// size — stack-allocated, capacity ≤ k ≤ 31.
k1q: Ring<u64, 32>,
k2q: Ring<u64, 32>,
k3q: Ring<u64, 32>,
k4q: Ring<u64, 32>,
k5q: Ring<u64, 32>,
k6q: Ring<u64, 32>,
// Frequency count arrays, indexed by the raw sub-word value (2 bits per
// base). Max count per cell ≤ k ≤ 31 → u8 is sufficient.
k1c: [u8; 4],
k2c: [u8; 16],
k3c: [u8; 64],
k4c: [u8; 256],
k5c: [u8; 1024],
k6c: [u8; 4096],
sum_f_log_f: [f64; WS_MAX + 1],
}
impl EntropyTracker {
/// New tracker for a window of `k` bases (1..=31).
pub fn new(k: usize) -> Self {
Self {
k,
steady: false,
k1q: Ring::new(),
k2q: Ring::new(),
k3q: Ring::new(),
k4q: Ring::new(),
k5q: Ring::new(),
k6q: Ring::new(),
k1c: [0; 4],
k2c: [0; 16],
k3c: [0; 64],
k4c: [0; 256],
k5c: [0; 1024],
k6c: [0; 4096],
sum_f_log_f: [0.0; WS_MAX + 1],
}
}
/// Clear all accumulated state, ready to track a new window from
/// scratch (`k` is unchanged).
pub fn reset(&mut self) {
self.steady = false;
self.k1c.fill(0);
self.k2c.fill(0);
self.k3c.fill(0);
self.k4c.fill(0);
self.k5c.fill(0);
self.k6c.fill(0);
self.k1q.clear();
self.k2q.clear();
self.k3q.clear();
self.k4q.clear();
self.k5q.clear();
self.k6q.clear();
self.sum_f_log_f = [0.0; WS_MAX + 1];
}
#[inline]
fn update_sums_decrement<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], f: usize) {
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
}
#[inline]
fn update_sums_increment<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], g: usize) {
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
}
/// Advance the window by one base. `received` is the caller's running
/// count of bases pushed so far (1-based, i.e. after this base);
/// `rolling_kmer` is the current right-aligned, 2-bit-packed k-mer
/// window (same convention as `obiskbuilder::RollingStat::rolling_k`).
pub fn push(&mut self, received: usize, rolling_kmer: u64) {
let raw1 = rolling_kmer & 3;
let raw2 = rolling_kmer & 15;
let raw3 = rolling_kmer & 63;
let raw4 = rolling_kmer & 255;
let raw5 = rolling_kmer & 1023;
let raw6 = rolling_kmer & 4095;
if received > self.k {
let old1 = self.k1q.pop_front();
let f1 = self.k1c[old1 as usize] as usize;
Self::update_sums_decrement::<1>(&mut self.sum_f_log_f, f1);
self.k1c[old1 as usize] -= 1;
let old2 = self.k2q.pop_front();
let f2 = self.k2c[old2 as usize] as usize;
Self::update_sums_decrement::<2>(&mut self.sum_f_log_f, f2);
self.k2c[old2 as usize] -= 1;
let old3 = self.k3q.pop_front();
let f3 = self.k3c[old3 as usize] as usize;
Self::update_sums_decrement::<3>(&mut self.sum_f_log_f, f3);
self.k3c[old3 as usize] -= 1;
let old4 = self.k4q.pop_front();
let f4 = self.k4c[old4 as usize] as usize;
Self::update_sums_decrement::<4>(&mut self.sum_f_log_f, f4);
self.k4c[old4 as usize] -= 1;
let old5 = self.k5q.pop_front();
let f5 = self.k5c[old5 as usize] as usize;
Self::update_sums_decrement::<5>(&mut self.sum_f_log_f, f5);
self.k5c[old5 as usize] -= 1;
let old6 = self.k6q.pop_front();
let f6 = self.k6c[old6 as usize] as usize;
Self::update_sums_decrement::<6>(&mut self.sum_f_log_f, f6);
self.k6c[old6 as usize] -= 1;
}
if self.steady {
let g1 = self.k1c[raw1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
self.k1c[raw1 as usize] += 1;
self.k1q.push_back(raw1);
let g2 = self.k2c[raw2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
self.k2c[raw2 as usize] += 1;
self.k2q.push_back(raw2);
let g3 = self.k3c[raw3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
self.k3c[raw3 as usize] += 1;
self.k3q.push_back(raw3);
let g4 = self.k4c[raw4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
self.k4c[raw4 as usize] += 1;
self.k4q.push_back(raw4);
let g5 = self.k5c[raw5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
self.k5c[raw5 as usize] += 1;
self.k5q.push_back(raw5);
let g6 = self.k6c[raw6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
self.k6c[raw6 as usize] += 1;
self.k6q.push_back(raw6);
} else {
self.push_warmup_increments(received, raw1, raw2, raw3, raw4, raw5, raw6);
}
}
#[cold]
#[inline(never)]
fn push_warmup_increments(
&mut self,
received: usize,
raw1: u64, raw2: u64, raw3: u64,
raw4: u64, raw5: u64, raw6: u64,
) {
let g1 = self.k1c[raw1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
self.k1c[raw1 as usize] += 1;
self.k1q.push_back(raw1);
if received >= 2 {
let g2 = self.k2c[raw2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
self.k2c[raw2 as usize] += 1;
self.k2q.push_back(raw2);
if received >= 3 {
let g3 = self.k3c[raw3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
self.k3c[raw3 as usize] += 1;
self.k3q.push_back(raw3);
if received >= 4 {
let g4 = self.k4c[raw4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
self.k4c[raw4 as usize] += 1;
self.k4q.push_back(raw4);
if received >= 5 {
let g5 = self.k5c[raw5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
self.k5c[raw5 as usize] += 1;
self.k5q.push_back(raw5);
if received >= 6 {
let g6 = self.k6c[raw6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
self.k6c[raw6 as usize] += 1;
self.k6q.push_back(raw6);
self.steady = true;
}
}
}
}
}
}
/// Normalized entropy at sub-word size `order` (1..=6). The caller is
/// responsible for not calling this before the window is full (`k`
/// bases pushed) — an empty/partial window yields a meaningless value.
pub fn entropy(&self, order: usize) -> f64 {
let k = self.k;
let em = emax(k, order);
if em <= 0.0 {
return 1.0;
}
let nwords = k - order + 1;
let log_nw = log_nwords(k, order);
let nw_f = nwords as f64;
let h_corr = log_nw - self.sum_f_log_f[order] / nw_f;
(h_corr / em).max(0.0)
}
/// Minimum of [`Self::entropy`] over sub-word sizes `1..=order_max`, same
/// caller responsibility re: window readiness as `entropy`.
pub fn normalized_entropy(&self, order_max: usize) -> f64 {
let min_e = (1..=order_max)
.map(|ws| self.entropy(ws))
.fold(f64::MAX, f64::min);
if min_e == f64::MAX { 1.0 } else { min_e }
}
}
+11 -1
View File
@@ -10,6 +10,8 @@ obiskio = { path = "../obiskio" }
obisys = { path = "../obisys" } obisys = { path = "../obisys" }
obicompactvec = { path = "../obicompactvec" } obicompactvec = { path = "../obicompactvec" }
obilayeredmap = { path = "../obilayeredmap" } obilayeredmap = { path = "../obilayeredmap" }
obiskbuilder = { path = "../obiskbuilder" }
obipipeline = { path = "../obipipeline" }
ndarray = "0.16" ndarray = "0.16"
rayon = "1" rayon = "1"
crossbeam-channel = "0.5" crossbeam-channel = "0.5"
@@ -17,4 +19,12 @@ serde = { version = "1", features = ["derive"] }
serde_json = "1" serde_json = "1"
indicatif = "0.17" indicatif = "0.17"
tracing = "0.1.44" tracing = "0.1.44"
hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"] } hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], optional = true }
[dev-dependencies]
obiread = { path = "../obiread" }
tempfile = "3"
[features]
default = ["numa"]
numa = ["hwlocality"]
+4
View File
@@ -14,6 +14,8 @@ pub enum DistanceMetric {
Jaccard, Jaccard,
/// Hamming distance (number of differing kmer positions) on presence/absence data. /// Hamming distance (number of differing kmer positions) on presence/absence data.
Hamming, Hamming,
/// Mash distance on presence/absence data (Jaccard-derived mutation-rate estimate).
Mash,
/// Bray-Curtis dissimilarity on raw counts. /// Bray-Curtis dissimilarity on raw counts.
BrayCurtis, BrayCurtis,
/// Bray-Curtis dissimilarity normalised by per-genome total counts. /// Bray-Curtis dissimilarity normalised by per-genome total counts.
@@ -84,6 +86,7 @@ impl KmerIndex {
DistanceMetric::Hellinger => CountPartials::hellinger_dist_matrix(&global), DistanceMetric::Hellinger => CountPartials::hellinger_dist_matrix(&global),
DistanceMetric::HellingerEuclidean => CountPartials::hellinger_euclidean_dist_matrix(&global), DistanceMetric::HellingerEuclidean => CountPartials::hellinger_euclidean_dist_matrix(&global),
DistanceMetric::Jaccard => CountPartials::threshold_jaccard_dist_matrix(&global, presence_threshold), DistanceMetric::Jaccard => CountPartials::threshold_jaccard_dist_matrix(&global, presence_threshold),
DistanceMetric::Mash => CountPartials::threshold_mash_dist_matrix(&global, self.kmer_size(), presence_threshold),
DistanceMetric::Hamming => { DistanceMetric::Hamming => {
return Err(OKIError::InvalidInput( return Err(OKIError::InvalidInput(
"Hamming is only available for presence/absence indexes".into(), "Hamming is only available for presence/absence indexes".into(),
@@ -108,6 +111,7 @@ impl KmerIndex {
let matrix = match metric { let matrix = match metric {
DistanceMetric::Jaccard => BitPartials::jaccard_dist_matrix(&global), DistanceMetric::Jaccard => BitPartials::jaccard_dist_matrix(&global),
DistanceMetric::Mash => BitPartials::mash_dist_matrix(&global, self.kmer_size()),
DistanceMetric::Hamming => { DistanceMetric::Hamming => {
BitPartials::hamming_dist_matrix(&global).mapv(|v| v as f64) BitPartials::hamming_dist_matrix(&global).mapv(|v| v as f64)
} }
+2
View File
@@ -9,6 +9,7 @@ mod numa;
mod rebuild; mod rebuild;
mod reindex; mod reindex;
mod select; mod select;
mod siblings;
mod stats; mod stats;
pub use error::{OKIError, OKIResult}; pub use error::{OKIError, OKIResult};
@@ -18,3 +19,4 @@ pub use merge::MergeMode;
pub use meta::{validate_label, GenomeInfo, IndexConfig, IndexMeta, META_FILENAME}; pub use meta::{validate_label, GenomeInfo, IndexConfig, IndexMeta, META_FILENAME};
pub use state::{IndexState, SENTINEL_COUNTED, SENTINEL_INDEXED, SENTINEL_SCATTERED}; pub use state::{IndexState, SENTINEL_COUNTED, SENTINEL_INDEXED, SENTINEL_SCATTERED};
pub use stats::IndexBitsPerKmer; pub use stats::IndexBitsPerKmer;
pub use siblings::{RawSnpDistanceOutput, SiblingAnnexStats, SnpAlignment};
+332 -86
View File
@@ -5,45 +5,48 @@
// CPUs. Linux first-touch policy then places graph allocations in local DRAM // CPUs. Linux first-touch policy then places graph allocations in local DRAM
// automatically — no explicit memory binding needed. // automatically — no explicit memory binding needed.
// //
// Returns None when: // UMA systems (single socket, Apple Silicon, etc.) are the degenerate case:
// - hwloc topology initialisation fails // one synthetic node containing all cores, no pool, no pinning.
// - the system has only one NUMA node (UMA, Apple Silicon, single-socket)
// - any per-node pool fails to build
use std::sync::Arc; use std::sync::Arc;
use std::time::{Duration, Instant}; use std::time::{Duration, Instant};
use crossbeam_channel::unbounded; use crossbeam_channel::unbounded;
#[cfg(feature = "numa")]
use hwlocality::Topology; use hwlocality::Topology;
#[cfg(feature = "numa")]
use hwlocality::cpu::binding::CpuBindingFlags; use hwlocality::cpu::binding::CpuBindingFlags;
#[cfg(feature = "numa")]
use hwlocality::cpu::cpuset::CpuSet; use hwlocality::cpu::cpuset::CpuSet;
#[cfg(feature = "numa")]
use hwlocality::object::types::ObjectType; use hwlocality::object::types::ObjectType;
use obisys::{CpuSample, IoSample};
use tracing::debug; use tracing::debug;
// ── Public interface ────────────────────────────────────────────────────────── // ── Public interface ──────────────────────────────────────────────────────────
pub struct NumaSetup { pub struct NumaSetup {
pub pools: Vec<Arc<rayon::ThreadPool>>, /// One entry per NUMA node. `None` on UMA systems (no pool, no pinning).
pub pools: Vec<Option<Arc<rayon::ThreadPool>>>,
/// CPU indices for each NUMA node, in node order. /// CPU indices for each NUMA node, in node order.
pub cpus_per_node: Vec<Vec<usize>>, pub cpus_per_node: Vec<Vec<usize>>,
} }
impl NumaSetup { impl NumaSetup {
/// Workers to activate per NUMA node. /// Maximum worker slots per node (one per physical core in the node).
/// Empirically ~3 workers saturate one node's memory bandwidth.
pub fn workers_per_node(&self) -> usize { pub fn workers_per_node(&self) -> usize {
self.cpus_per_node self.cpus_per_node
.first() .first()
.map(|c| (c.len() / 8).max(3).min(8)) .map(|c| c.len().max(1))
.unwrap_or(3) .unwrap_or(1)
} }
} }
/// Detect NUMA topology and build per-node Rayon pools. /// Detect NUMA topology and build per-node Rayon pools.
/// Returns None on UMA systems, single-node machines, or on failure. /// Always succeeds: falls back to a single synthetic UMA node on failure.
pub fn build() -> Option<NumaSetup> { #[cfg(feature = "numa")]
let topology = Topology::new().ok()?; pub fn build() -> NumaSetup {
if let Ok(topology) = Topology::new() {
let nodes: Vec<Vec<usize>> = topology let nodes: Vec<Vec<usize>> = topology
.objects_with_type(ObjectType::NUMANode) .objects_with_type(ObjectType::NUMANode)
.filter_map(|obj| obj.cpuset()) .filter_map(|obj| obj.cpuset())
@@ -56,28 +59,55 @@ pub fn build() -> Option<NumaSetup> {
.filter(|v| !v.is_empty()) .filter(|v| !v.is_empty())
.collect(); .collect();
if nodes.len() <= 1 { if nodes.len() > 1 {
return None; if let Some(pools) = nodes
} .iter()
.map(|cpus| build_pool(cpus).map(|p| Some(Arc::new(p))))
.collect::<Option<Vec<_>>>()
{
debug!( debug!(
"NUMA topology: {} node(s), {} core(s)/node", "NUMA topology: {} node(s), {} core(s)/node",
nodes.len(), nodes.len(),
nodes.first().map_or(0, |v| v.len()), nodes.first().map_or(0, |v| v.len()),
); );
return NumaSetup {
pools,
cpus_per_node: nodes,
};
}
}
}
let pools = nodes // UMA fallback: single synthetic node, all cores, no pool, no pinning.
.iter() let n_cores = std::thread::available_parallelism()
.map(|cpus| build_pool(cpus).map(Arc::new)) .map(|n| n.get())
.collect::<Option<Vec<_>>>()?; .unwrap_or(1);
debug!("UMA: single synthetic node, {} core(s)", n_cores);
NumaSetup {
pools: vec![None],
cpus_per_node: vec![(0..n_cores).collect()],
}
}
Some(NumaSetup { pools, cpus_per_node: nodes }) #[cfg(not(feature = "numa"))]
pub fn build() -> NumaSetup {
let n_cores = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1);
debug!("UMA: single synthetic node, {} core(s)", n_cores);
NumaSetup {
pools: vec![None],
cpus_per_node: vec![(0..n_cores).collect()],
}
} }
/// Bind the calling thread to `cpu_indices` using hwloc. /// Bind the calling thread to `cpu_indices` using hwloc.
/// Silently returns on any error so the thread still runs, just unbound. /// Silently returns on any error so the thread still runs, just unbound.
#[cfg(feature = "numa")]
pub fn pin_current_thread(cpu_indices: &[usize]) { pub fn pin_current_thread(cpu_indices: &[usize]) {
let Ok(topology) = Topology::new() else { return }; let Ok(topology) = Topology::new() else {
return;
};
let mut cpuset = CpuSet::new(); let mut cpuset = CpuSet::new();
for &idx in cpu_indices { for &idx in cpu_indices {
cpuset.set(idx); cpuset.set(idx);
@@ -85,8 +115,12 @@ pub fn pin_current_thread(cpu_indices: &[usize]) {
let _ = topology.bind_cpu(&cpuset, CpuBindingFlags::THREAD); let _ = topology.bind_cpu(&cpuset, CpuBindingFlags::THREAD);
} }
#[cfg(not(feature = "numa"))]
pub fn pin_current_thread(_cpu_indices: &[usize]) {}
// ── Internal helpers ────────────────────────────────────────────────────────── // ── Internal helpers ──────────────────────────────────────────────────────────
#[cfg(feature = "numa")]
fn build_pool(cpus: &[usize]) -> Option<rayon::ThreadPool> { fn build_pool(cpus: &[usize]) -> Option<rayon::ThreadPool> {
let cpus = cpus.to_vec(); let cpus = cpus.to_vec();
rayon::ThreadPoolBuilder::new() rayon::ThreadPoolBuilder::new()
@@ -103,7 +137,22 @@ fn build_pool(cpus: &[usize]) -> Option<rayon::ThreadPool> {
.ok() .ok()
} }
// ── PartitionRunner ─────────────────────────────────────────────────────────── // ── PartitionRunner ─────────────────────────────────────────────────────────
/// Growth step (fraction of a node's worker capacity added per activation
/// event, see [`NodeActivation::grow`]).
const GROWTH_DIVISOR: usize = 8;
/// Minimum CPU efficiency growth to activate more workers, as a fraction of
/// the size of the *last growth step* (e.g. `0.2` after adding 8 workers
/// requires the next check to show at least +1.6 cores of growth — 20 % of
/// the ~8 cores those 8 workers should contribute if the workload is truly
/// CPU-bound). Scaling by the last step's size — not the cumulative total —
/// keeps the bar meaningful regardless of how many workers are already
/// active, instead of demanding an ever-larger absolute jump as the pool
/// grows.
const CPU_SPAWN_THRESHOLD: f64 = 0.2;
/// Minimum I/O throughput growth (relative) to activate more workers.
const IO_SPAWN_THRESHOLD: f64 = 0.2;
struct NodeConfig { struct NodeConfig {
pool: Option<Arc<rayon::ThreadPool>>, pool: Option<Arc<rayon::ThreadPool>>,
@@ -113,19 +162,24 @@ struct NodeConfig {
/// Generic NUMA-aware runner for partition-level parallel work. /// Generic NUMA-aware runner for partition-level parallel work.
/// ///
/// Workers are distributed round-robin across NUMA nodes and pinned to their /// Workers are distributed evenly across NUMA nodes and pinned to their
/// node's CPUs. UMA systems are the degenerate case: one node, no pinning. /// node's CPUs. UMA is the degenerate case: one node, no pinning.
///
/// Workers are pre-spawned dormant, one activation channel per node so
/// growth always targets a specific node rather than whichever dormant
/// worker happens to wake up first on a shared channel. Growth (both the
/// initial count and each subsequent step) is expressed as a fraction of
/// `workers_per_node`, applied identically to every node, so the pace of
/// ramp-up depends on node size rather than node count — a single-NUMA-node
/// (UMA) machine ramps just as fast as an 8-node one.
/// ///
/// # Termination /// # Termination
/// ///
/// Termination is driven entirely by channel closure:
///
/// ```text /// ```text
/// drop(part_tx) → part_rx drains → workers exit → drop their result_tx /// drop(part_tx) → part_rx drains → workers exit → drop their result_tx
/// drop(result_tx) → result_rx closes → controller loop exits /// drop(result_tx) → result_rx closes → controller loop exits
/// drop(activate_txs) → dormant workers exit cleanly
/// ``` /// ```
///
/// No explicit counter or sentinel needed.
pub struct PartitionRunner { pub struct PartitionRunner {
nodes: Vec<NodeConfig>, nodes: Vec<NodeConfig>,
} }
@@ -136,111 +190,185 @@ impl PartitionRunner {
self.nodes.iter().map(|n| n.max_workers).sum() self.nodes.iter().map(|n| n.max_workers).sum()
} }
/// Detect topology and build. Falls back to a single-node UMA runner on /// Detect topology and build. Always succeeds.
/// macOS, single-socket machines, or hwloc failure.
pub fn new() -> Self { pub fn new() -> Self {
match build() { let ns = build();
Some(ns) => {
let wpn = ns.workers_per_node(); let wpn = ns.workers_per_node();
debug!( debug!(
"PartitionRunner: NUMA mode — {} node(s) × {} worker(s)/node", "PartitionRunner: {} node(s) × {} worker(s)/node max",
ns.pools.len(), wpn, ns.pools.len(),
wpn,
); );
let nodes = ns.pools let nodes = ns
.pools
.into_iter() .into_iter()
.zip(ns.cpus_per_node) .zip(ns.cpus_per_node)
.map(|(pool, cpu_ids)| NodeConfig { .map(|(pool, cpu_ids)| NodeConfig {
pool: Some(pool), pool,
cpu_ids, cpu_ids,
max_workers: wpn, max_workers: wpn,
}) })
.collect(); .collect();
Self { nodes } Self { nodes }
} }
None => {
let n_cores = std::thread::available_parallelism()
.map(|n| n.get())
.unwrap_or(1);
let max_workers = (n_cores / 2).max(1);
debug!("PartitionRunner: UMA mode — {} worker(s)", max_workers);
Self {
nodes: vec![NodeConfig {
pool: None,
cpu_ids: vec![],
max_workers,
}],
}
}
}
}
/// Run `f(i)` for every index in `order`. /// Run `f(i)` for every index in `order`.
/// ///
/// Workers are spawned upfront and distributed round-robin across NUMA /// Workers are pre-spawned dormant and activated adaptively, per node:
/// nodes. `on_done(i, result, elapsed)` is called from the controller /// `(workers_per_node / INITIAL_DIVISOR).max(1)` are woken immediately on
/// thread as each partition completes — suitable for progress bars and /// every node, then `(workers_per_node / GROWTH_DIVISOR).max(1)` more per
/// result aggregation. /// node each time the check below fires. A timer thread fires that check
/// every `TIMER_SECS` seconds; each completed partition resets that timer
/// (forcing an immediate check) and also triggers its own inline check. A
/// growth step happens whenever CPU efficiency grows by at least
/// `CPU_SPAWN_THRESHOLD` of what the last growth step should have
/// contributed, or I/O throughput grows by at least `IO_SPAWN_THRESHOLD`
/// (relative) since the last check — whichever resource is the actual
/// bottleneck still shows headroom.
///
/// `on_done(i, result, elapsed)` is called from the controller thread as
/// each partition completes — suitable for progress bars and result
/// aggregation.
/// ///
/// Returns the first error produced by `f`, if any. /// Returns the first error produced by `f`, if any.
pub fn run<F, R, E, C>( pub fn run<F, R, E, C>(&self, order: &[usize], f: F, mut on_done: C) -> Result<(), E>
&self,
order: &[usize],
f: F,
mut on_done: C,
) -> Result<(), E>
where where
F: Fn(usize) -> Result<R, E> + Send + Sync, F: Fn(usize) -> Result<R, E> + Send + Sync,
R: Send, R: Send,
E: Send, E: Send,
C: FnMut(usize, R, Duration) + Send, C: FnMut(usize, R, Duration) + Send,
{ {
// Pre-load the work queue, then drop the sender so workers' part_rx let n_total = order.len();
// iterators terminate when the queue is drained. if n_total == 0 {
return Ok(());
}
const TIMER_SECS: u64 = 30;
const INITIAL_DIVISOR: usize = 4;
// ── Channels ──────────────────────────────────────────────────────────
let (part_tx, part_rx) = unbounded::<usize>(); let (part_tx, part_rx) = unbounded::<usize>();
for &i in order { part_tx.send(i).ok(); } // reset_tx: controller → timer ("reset the 30 s window")
let (reset_tx, reset_rx) = unbounded::<()>();
// event_tx: workers + timer → controller (unified event stream)
let (event_tx, event_rx) = unbounded::<WorkerEvent<R, E>>();
// One activation channel per node: growth always targets a specific
// node, rather than whichever dormant worker happens to win the race
// on a channel shared across all nodes.
let (activate_txs, activate_rxs): (Vec<_>, Vec<_>) =
(0..self.nodes.len()).map(|_| unbounded::<()>()).unzip();
for &i in order {
part_tx.send(i).ok();
}
drop(part_tx); drop(part_tx);
let (result_tx, result_rx) = unbounded::<(usize, Result<R, E>, Duration)>(); let max_workers = self.max_workers();
let n_nodes = self.nodes.len(); let node_caps: Vec<usize> = self.nodes.iter().map(|n| n.max_workers).collect();
let f = &f; // shared borrow; F: Sync so concurrent calls are safe let f = &f;
let mut first_err: Option<E> = None; let mut first_err: Option<E> = None;
std::thread::scope(|s| { std::thread::scope(|s| {
// Spawn all workers upfront, round-robin across NUMA nodes. // ── Timer thread ──────────────────────────────────────────────────
for w in 0..self.max_workers() { // Sends TimerTick every TIMER_SECS seconds. Resets its window each
let node = &self.nodes[w % n_nodes]; // time reset_rx receives a message (i.e. on partition completion).
let prx = part_rx.clone(); let timer_tx = event_tx.clone();
let rtx = result_tx.clone(); s.spawn(move || {
let pool = node.pool.clone(); let period = Duration::from_secs(TIMER_SECS);
loop {
crossbeam_channel::select! {
recv(reset_rx) -> r => {
if r.is_err() { break; } // reset_tx dropped → exit
}
default(period) => {
if timer_tx.send(WorkerEvent::TimerTick).is_err() { break; }
}
}
}
});
// ── Pre-spawn workers dormant, grouped by node ────────────────────
// Each worker listens on its own node's activation channel only.
for (node, arx) in self.nodes.iter().zip(activate_rxs.iter()) {
let cpu_ids = &node.cpu_ids; let cpu_ids = &node.cpu_ids;
for _ in 0..node.max_workers {
let prx = part_rx.clone();
let etx = event_tx.clone();
let arx = arx.clone();
let pool = node.pool.clone();
s.spawn(move || { s.spawn(move || {
if !cpu_ids.is_empty() { pin_current_thread(cpu_ids); } if arx.recv().is_err() {
return;
}
if !cpu_ids.is_empty() {
pin_current_thread(cpu_ids);
}
for i in &prx { for i in &prx {
let t = Instant::now(); let t = Instant::now();
let r = match &pool { let r = match &pool {
Some(p) => p.install(|| f(i)), Some(p) => p.install(|| f(i)),
None => f(i), None => f(i),
}; };
rtx.send((i, r, t.elapsed())).ok(); etx.send(WorkerEvent::Completed(i, r, t.elapsed())).ok();
} }
}); });
} }
}
// Drop controller's event_tx: event_rx closes when all workers +
// timer have exited.
drop(event_tx);
// Drop the controller's sender: result_rx closes once all worker // ── Controller ────────────────────────────────────────────────────
// rtx clones are dropped (i.e. all workers have exited). let mut activation = NodeActivation::new(&activate_txs, &node_caps, max_workers);
drop(result_tx); activation.activate_initial(INITIAL_DIVISOR, n_total);
// Drain results concurrently with workers. The for loop exits let mut cpu_sample = CpuSample::now();
// when result_rx is disconnected — at that point all workers are let mut io_sample = IoSample::now();
// done and the scope join below is instantaneous. let mut completed = 0usize;
for (i, r, dur) in &result_rx {
while completed < n_total {
let Ok(event) = event_rx.recv() else { break };
match event {
WorkerEvent::Completed(i, r, dur) => {
match r { match r {
Ok(v) => on_done(i, v, dur), Ok(v) => on_done(i, v, dur),
Err(e) => { if first_err.is_none() { first_err = Some(e); } } Err(e) => {
if first_err.is_none() {
first_err = Some(e);
} }
} }
}
completed += 1;
// Reset the 30 s timer.
reset_tx.send(()).ok();
// Inline check: same logic as a timer tick.
maybe_activate(
&mut activation,
&mut cpu_sample,
&mut io_sample,
completed,
n_total,
);
}
WorkerEvent::TimerTick => {
maybe_activate(
&mut activation,
&mut cpu_sample,
&mut io_sample,
completed,
n_total,
);
}
}
}
// Dormant workers exit once every sender for their node's channel
// is dropped — `activate_txs` holds the only ones.
drop(activate_txs);
// Timer thread exits when reset_tx closes.
drop(reset_tx);
}); });
match first_err { match first_err {
@@ -249,3 +377,121 @@ impl PartitionRunner {
} }
} }
} }
// ── Internal event type ───────────────────────────────────────────────────────
enum WorkerEvent<R, E> {
Completed(usize, Result<R, E>, Duration),
TimerTick,
}
/// Tracks how many of each node's dormant workers have been woken, and
/// grows every node by the same amount at each step (capped by that node's
/// remaining dormant workers and by the run's total budget) so load stays
/// balanced across nodes at every point in time — never just "one more
/// worker somewhere". Also remembers the size of the last real growth step
/// (`last_step`), used to scale the CPU activation threshold to what that
/// step could plausibly have contributed (see `maybe_activate`).
struct NodeActivation<'a> {
txs: &'a [crossbeam_channel::Sender<()>],
caps: &'a [usize],
active: Vec<usize>,
total: usize,
max: usize,
last_step: usize,
}
impl<'a> NodeActivation<'a> {
fn new(txs: &'a [crossbeam_channel::Sender<()>], caps: &'a [usize], max: usize) -> Self {
Self {
txs,
caps,
active: vec![0; txs.len()],
total: 0,
max,
last_step: 0,
}
}
fn total(&self) -> usize {
self.total
}
fn last_step(&self) -> usize {
self.last_step
}
fn max(&self) -> usize {
self.max
}
fn is_full(&self) -> bool {
self.total >= self.max
}
/// Wake up to `(node_cap / divisor).max(1)` dormant workers on every
/// node, capped by `n_total`. Called once at startup, unconditionally.
fn activate_initial(&mut self, divisor: usize, n_total: usize) {
self.grow(divisor, n_total);
}
/// Same per-node sizing as [`activate_initial`](Self::activate_initial),
/// applied as a growth step. Returns the number of workers actually
/// activated (may be less than requested once a node or the total
/// budget is exhausted). Updates `last_step` when it actually grew.
fn grow(&mut self, divisor: usize, n_total: usize) -> usize {
let before = self.total;
for idx in 0..self.txs.len() {
let wanted = (self.caps[idx] / divisor).max(1);
let room = self.caps[idx].saturating_sub(self.active[idx]);
let grow = wanted.min(room).min(n_total.saturating_sub(self.total));
for _ in 0..grow {
self.txs[idx].send(()).ok();
}
self.active[idx] += grow;
self.total += grow;
}
let grew = self.total - before;
if grew > 0 {
self.last_step = grew;
}
grew
}
}
fn maybe_activate(
activation: &mut NodeActivation,
cpu_sample: &mut CpuSample,
io_sample: &mut IoSample,
completed: usize,
n_total: usize,
) {
if activation.is_full() || completed >= n_total {
return;
}
// Expect roughly 1 core of extra efficiency per worker activated in the
// last growth step (CPU-bound case); require at least CPU_SPAWN_THRESHOLD
// (20 %) of that expected gain before growing again. Scaling by the last
// step's size — not the cumulative total — keeps the bar meaningful
// regardless of how many workers are already active: growing by 8 should
// always take ~+1.6 cores to confirm, whether that's the 2nd growth step
// or the 20th.
let cpu_threshold = CPU_SPAWN_THRESHOLD * activation.last_step() as f64;
// Call both unconditionally (no `||` short-circuit): each sampler must
// advance its own window every tick, regardless of what the other one
// reports, or it would starve behind whichever signal fires first.
let cpu_wants_more = cpu_sample.do_i_activate(cpu_threshold);
let io_wants_more = io_sample.do_i_activate(IO_SPAWN_THRESHOLD * activation.last_step() as f64);
if !(cpu_wants_more || io_wants_more) {
return;
}
let grew = activation.grow(GROWTH_DIVISOR, n_total);
if grew > 0 {
debug!(
"activated {} worker(s) — {}/{} active",
grew,
activation.total(),
activation.max()
);
}
}
File diff suppressed because it is too large Load Diff
+4 -2
View File
@@ -1,6 +1,6 @@
[package] [package]
name = "obikmer" name = "obikmer"
version = "0.1.1" version = "1.1.40"
edition = "2024" edition = "2024"
[[bin]] [[bin]]
@@ -18,7 +18,7 @@ obikrope = { path = "../obikrope" }
obikpartitionner = { path = "../obikpartitionner" } obikpartitionner = { path = "../obikpartitionner" }
obisys = { path = "../obisys" } obisys = { path = "../obisys" }
obiskio = { path = "../obiskio" } obiskio = { path = "../obiskio" }
obikindex = { path = "../obikindex" } obikindex = { path = "../obikindex", default-features = false }
obitaxonomy = { path = "../obitaxonomy" } obitaxonomy = { path = "../obitaxonomy" }
obilayeredmap = { path = "../obilayeredmap" } obilayeredmap = { path = "../obilayeredmap" }
clap = { version = "4", features = ["derive"] } clap = { version = "4", features = ["derive"] }
@@ -33,4 +33,6 @@ tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
pprof = { version = "0.13", features = ["prost-codec"], optional = true } pprof = { version = "0.13", features = ["prost-codec"], optional = true }
[features] [features]
default = ["numa"]
numa = ["obikindex/numa"]
profiling = ["dep:pprof"] profiling = ["dep:pprof"]
+176 -1
View File
@@ -3,13 +3,15 @@ use std::path::PathBuf;
use clap::Args; use clap::Args;
use kodama::{Method, linkage}; use kodama::{Method, linkage};
use obikindex::{DistanceMetric, KmerIndex}; use obifastwrite::{JsonVal, write_record};
use obikindex::{DistanceMetric, KmerIndex, RawSnpDistanceOutput, SiblingAnnexStats, SnpAlignment};
use speedytree::{DistanceMatrix, Hybrid, NeighborJoiningSolver, to_newick}; use speedytree::{DistanceMatrix, Hybrid, NeighborJoiningSolver, to_newick};
use tracing::info; use tracing::info;
#[derive(clap::ValueEnum, Clone, Copy, Debug)] #[derive(clap::ValueEnum, Clone, Copy, Debug)]
pub enum MetricArg { pub enum MetricArg {
Jaccard, Jaccard,
Mash,
Hamming, Hamming,
BrayCurtis, BrayCurtis,
#[value(name = "relfreq-bray-curtis")] #[value(name = "relfreq-bray-curtis")]
@@ -26,6 +28,7 @@ impl From<MetricArg> for DistanceMetric {
fn from(m: MetricArg) -> Self { fn from(m: MetricArg) -> Self {
match m { match m {
MetricArg::Jaccard => DistanceMetric::Jaccard, MetricArg::Jaccard => DistanceMetric::Jaccard,
MetricArg::Mash => DistanceMetric::Mash,
MetricArg::Hamming => DistanceMetric::Hamming, MetricArg::Hamming => DistanceMetric::Hamming,
MetricArg::BrayCurtis => DistanceMetric::BrayCurtis, MetricArg::BrayCurtis => DistanceMetric::BrayCurtis,
MetricArg::RelfreqBrayCurtis => DistanceMetric::RelfreqBrayCurtis, MetricArg::RelfreqBrayCurtis => DistanceMetric::RelfreqBrayCurtis,
@@ -62,7 +65,37 @@ pub struct DistanceArgs {
#[arg(long)] #[arg(long)]
pub upgma: bool, pub upgma: bool,
/// Build the sibling-count/minorant annex on this (multi-genome) index
/// — see `docmd/theory/evolutionary_distances.md`, Step 2b. Construction
/// only; does not by itself compute or write any statistics.
#[arg(long)]
pub sibling_annex: bool,
/// Tally the sibling-count distribution (CSV) of an already-built annex
/// (run with `--sibling-annex` first, in this invocation or an earlier
/// one). A separate, occasional diagnostic pass — not run every time the
/// annex itself is (re)built.
#[arg(long)]
pub sibling_stats: bool,
/// Compute the raw p-distance restricted to loci that are single-copy
/// in both genomes of each pair (an already-built sibling annex is
/// required — run with `--sibling-annex` first, in this invocation or
/// an earlier one). A quick way to test the central-position SNP
/// estimator against a real index; not the full `SnpTally` design.
#[arg(long)]
pub raw_snp_distance: bool,
/// Write a SNP-only pseudo-alignment (FASTA, IUPAC-coded) from an
/// already-built sibling annex — one row per genome, one column per
/// variable family (monomorphic families skipped), no flanking
/// sequence. See `docmd/theory/evolutionary_distances.md`,
/// "Multi-genome framing: family as pseudo-alignment column".
#[arg(long)]
pub snp: bool,
/// Output prefix: <prefix>_dist.csv, <prefix>_shared.csv, /// Output prefix: <prefix>_dist.csv, <prefix>_shared.csv,
/// <prefix>_siblings.csv, <prefix>_rawsnp.csv, <prefix>_snp.fasta,
/// <prefix>_nj.nwk, <prefix>_upgma.nwk. /// <prefix>_nj.nwk, <prefix>_upgma.nwk.
/// If omitted, the distance matrix is written to stdout. /// If omitted, the distance matrix is written to stdout.
#[arg(short, long)] #[arg(short, long)]
@@ -78,6 +111,51 @@ pub fn run(args: DistanceArgs) {
let labels: Vec<String> = idx.meta().genomes.iter().map(|g| g.label.clone()).collect(); let labels: Vec<String> = idx.meta().genomes.iter().map(|g| g.label.clone()).collect();
let n = labels.len(); let n = labels.len();
// ── Sibling-count/minorant annex (independent of the distance metric) ──
// Construction (`--sibling-annex`) and stats (`--sibling-stats`) are
// deliberately decoupled: the annex is meant to be (re)built routinely,
// the distribution only occasionally, on demand.
if args.sibling_annex {
info!("building sibling-count/minorant annex");
idx.build_sibling_annex().unwrap_or_else(|e| {
eprintln!("error building sibling annex: {e}");
std::process::exit(1);
});
}
if args.sibling_stats {
let stats = idx.sibling_annex_stats().unwrap_or_else(|e| {
eprintln!("error computing sibling-annex stats: {e}");
std::process::exit(1);
});
write_sibling_stats_csv(&stats, &labels, &args.output);
}
if args.raw_snp_distance {
let result = idx.raw_snp_distance().unwrap_or_else(|e| {
eprintln!("error computing raw SNP distance: {e}");
std::process::exit(1);
});
write_raw_snp_distance_csv(&result, &labels, &args.output);
}
if args.snp {
let alignment = idx.snp_pseudo_alignment().unwrap_or_else(|e| {
eprintln!("error computing SNP pseudo-alignment: {e}");
std::process::exit(1);
});
write_snp_fasta(&alignment, &labels, &args.output);
}
// `--sibling-annex`/`--sibling-stats`/`--raw-snp-distance`/`--snp` are
// their own operation, not a modifier on top of a distance-metric
// computation — a metric was never requested by asking for any of them,
// so there is nothing for the rest of this function to compute. Not a
// historical accident to keep: stop here rather than always also
// running a Jaccard (or whichever `--metric` defaults to) pass and
// printing an unrequested matrix.
if args.sibling_annex || args.sibling_stats || args.raw_snp_distance || args.snp {
return;
}
info!( info!(
"computing {:?} distances for {} genome(s)", "computing {:?} distances for {} genome(s)",
args.metric, n args.metric, n
@@ -189,6 +267,103 @@ pub fn run(args: DistanceArgs) {
} }
} }
// ── Family-size distribution → CSV ──────────────────────────────────────────
//
// Each row is a family (the up-to-4 k-mers sharing flanks, differing only at
// the centre), counted once — at its minorant — regardless of how many of
// its members are observed. Family size 1..4 (not "sibling count" 0..3):
// see `docmd/theory/evolutionary_distances.md`, "Definitions".
fn write_sibling_stats_csv(stats: &SiblingAnnexStats, labels: &[String], output: &Option<PathBuf>) {
// One row per genome (4 columns, family size 1-4: number of families of
// that size for which the genome carries at least one member), plus a
// `global` row — the actual deduplicated family-size histogram
// (`stats.counts`), NOT a sum of the per-genome columns (a family shared
// by several genomes would otherwise be counted once per genome it
// appears in, inflating the total beyond the real family count).
let path = output.as_ref()
.map(|p| format!("{}_siblings.csv", p.display()))
.unwrap_or_else(|| "siblings.csv".into());
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
eprintln!("error creating {path}: {e}");
std::process::exit(1);
}));
writeln!(f, "genome,1,2,3,4").unwrap();
for (label, counts) in labels.iter().zip(stats.per_genome.iter()) {
writeln!(f, "{label},{},{},{},{}", counts[0], counts[1], counts[2], counts[3]).unwrap();
}
writeln!(
f, "global,{},{},{},{}",
stats.counts[0], stats.counts[1], stats.counts[2], stats.counts[3],
).unwrap();
let total: u64 = stats.counts.iter().sum();
info!("family-size distribution → {path} (total {total} famil{})",
if total == 1 { "y" } else { "ies" });
}
// ── Raw single-copy SNP distance → CSV ──────────────────────────────────────
//
// p_hat[i,j] = snp[i,j] / (snp[i,j] + shared[i,j]) over loci single-copy in
// both i and j — see `RawSnpDistanceOutput` / `KmerIndex::raw_snp_distance`.
// A single file: the distance matrix, with an eligible-loci count alongside
// each value so a 0/0 pair (no eligible locus at all) is distinguishable
// from a genuinely identical pair.
fn write_raw_snp_distance_csv(result: &RawSnpDistanceOutput, labels: &[String], output: &Option<PathBuf>) {
let path = output.as_ref()
.map(|p| format!("{}_rawsnp.csv", p.display()))
.unwrap_or_else(|| "rawsnp.csv".into());
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
eprintln!("error creating {path}: {e}");
std::process::exit(1);
}));
let n = labels.len();
write!(f, "genome").unwrap();
for g in labels { write!(f, ",{g}").unwrap(); }
writeln!(f).unwrap();
for (i, g) in labels.iter().enumerate() {
write!(f, "{g}").unwrap();
for j in 0..n {
let snp = result.snp[[i, j]];
let shared = result.shared[[i, j]];
let eligible = snp + shared;
if eligible == 0 {
write!(f, ",NA").unwrap();
} else {
write!(f, ",{:.6}", snp as f64 / eligible as f64).unwrap();
}
}
writeln!(f).unwrap();
}
info!("raw single-copy SNP distance matrix → {path}");
}
// ── SNP-only pseudo-alignment → FASTA ───────────────────────────────────────
//
// One record per genome, IUPAC-coded, no flanking sequence — see
// `SnpAlignment` / `KmerIndex::snp_pseudo_alignment`. Uses the project's
// existing FASTA writer (`obifastwrite::write_record`) rather than
// hand-rolling one.
fn write_snp_fasta(alignment: &SnpAlignment, labels: &[String], output: &Option<PathBuf>) {
let path = output.as_ref()
.map(|p| format!("{}_snp.fasta", p.display()))
.unwrap_or_else(|| "snp.fasta".into());
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
eprintln!("error creating {path}: {e}");
std::process::exit(1);
}));
let n_sites = alignment.sequences.first().map(|s| s.len()).unwrap_or(0);
for (label, seq) in labels.iter().zip(alignment.sequences.iter()) {
write_record(seq, label, &[("n_sites", JsonVal::Num(n_sites as u64))], &mut f).unwrap_or_else(|e| {
eprintln!("error writing {path}: {e}");
std::process::exit(1);
});
}
info!("SNP pseudo-alignment → {path} ({n_sites} site{})",
if n_sites == 1 { "" } else { "s" });
}
// ── UPGMA Newick from kodama dendrogram ─────────────────────────────────────── // ── UPGMA Newick from kodama dendrogram ───────────────────────────────────────
fn upgma_to_newick(dendro: &kodama::Dendrogram<f64>, names: &[String]) -> String { fn upgma_to_newick(dendro: &kodama::Dendrogram<f64>, names: &[String]) -> String {
+18 -3
View File
@@ -2,14 +2,14 @@ use std::path::PathBuf;
use clap::Args; use clap::Args;
use obikindex::{KmerIndex, MergeMode}; use obikindex::{KmerIndex, MergeMode};
use obikpartitionner::filter::{MaxTotalCount, MinTotalCount}; use obikpartitionner::filter::{MaxTotalCount, MinComplexity, MinTotalCount};
use obisys::Reporter; use obisys::Reporter;
use tracing::info; use tracing::info;
use super::predicate::FilterArgs as KmerFilterArgs; use super::predicate::FilterArgs as KmerFilterArgs;
#[derive(Args)] #[derive(Args)]
pub struct FilterArgs { pub struct FilterCmdArgs {
/// Source index directory /// Source index directory
pub source: PathBuf, pub source: PathBuf,
@@ -28,6 +28,18 @@ pub struct FilterArgs {
#[arg(long)] #[arg(long)]
pub max_total_count: Option<u32>, pub max_total_count: Option<u32>,
/// Minimum normalized entropy (complexity) to keep a k-mer — same metric
/// as `obikmer index`'s --theta, applied here to k-mers already committed
/// to the source index (reconstructed from unitigs.bin). K-mers scoring
/// below this are removed.
#[arg(long)]
pub min_complexity: Option<f64>,
/// Maximum sub-word size for the complexity computation (see `obikmer
/// index`'s --level-max). Only used when --min-complexity is set.
#[arg(long, default_value_t = 6)]
pub complexity_level_max: usize,
/// Output as presence/absence instead of counts /// Output as presence/absence instead of counts
#[arg(long)] #[arg(long)]
pub presence: bool, pub presence: bool,
@@ -37,7 +49,7 @@ pub struct FilterArgs {
pub force: bool, pub force: bool,
} }
pub fn run(args: FilterArgs) { pub fn run(args: FilterCmdArgs) {
let src = KmerIndex::open(&args.source).unwrap_or_else(|e| { let src = KmerIndex::open(&args.source).unwrap_or_else(|e| {
eprintln!("error opening source index: {e}"); eprintln!("error opening source index: {e}");
std::process::exit(1); std::process::exit(1);
@@ -62,6 +74,9 @@ pub fn run(args: FilterArgs) {
if let Some(v) = args.max_total_count { if let Some(v) = args.max_total_count {
filters.push(Box::new(MaxTotalCount { total: v })); filters.push(Box::new(MaxTotalCount { total: v }));
} }
if let Some(theta) = args.min_complexity {
filters.push(Box::new(MinComplexity { level_max: args.complexity_level_max, theta }));
}
let mut rep = Reporter::new(); let mut rep = Reporter::new();
KmerIndex::rebuild(&args.output, &src, &filters, mode, args.force, &mut rep) KmerIndex::rebuild(&args.output, &src, &filters, mode, args.force, &mut rep)
+29 -17
View File
@@ -151,12 +151,14 @@ pub struct FilterArgs {
pub outgroup: Vec<String>, pub outgroup: Vec<String>,
/// Minimum number of ingroup genomes containing the k-mer /// Minimum number of ingroup genomes containing the k-mer
#[arg(long)] /// (negative: offset from group size, e.g. -1 = all but one)
pub min_count: Option<usize>, #[arg(long, allow_hyphen_values = true)]
pub min_count: Option<isize>,
/// Maximum number of ingroup genomes containing the k-mer /// Maximum number of ingroup genomes containing the k-mer
#[arg(long)] /// (negative: offset from group size, e.g. -1 = all but one)
pub max_count: Option<usize>, #[arg(long, allow_hyphen_values = true)]
pub max_count: Option<isize>,
/// Minimum fraction of ingroup genomes containing the k-mer [0.0–1.0] /// Minimum fraction of ingroup genomes containing the k-mer [0.0–1.0]
/// (default 1.0 when --ingroup is set, 0.0 otherwise) /// (default 1.0 when --ingroup is set, 0.0 otherwise)
@@ -168,13 +170,15 @@ pub struct FilterArgs {
pub max_frac: Option<f64>, pub max_frac: Option<f64>,
/// Minimum number of outgroup genomes containing the k-mer /// Minimum number of outgroup genomes containing the k-mer
#[arg(long)] /// (negative: offset from outgroup size, e.g. -1 = all but one)
pub min_outgroup_count: Option<usize>, #[arg(long, allow_hyphen_values = true)]
pub min_outgroup_count: Option<isize>,
/// Maximum number of outgroup genomes containing the k-mer /// Maximum number of outgroup genomes containing the k-mer
/// (default 0 when --outgroup is set, no constraint otherwise) /// (default 0 when --outgroup is set, no constraint otherwise;
#[arg(long)] /// negative: offset from outgroup size, e.g. -1 = all but one)
pub max_outgroup_count: Option<usize>, #[arg(long, allow_hyphen_values = true)]
pub max_outgroup_count: Option<isize>,
/// Minimum fraction of outgroup genomes containing the k-mer [0.0–1.0] /// Minimum fraction of outgroup genomes containing the k-mer [0.0–1.0]
#[arg(long)] #[arg(long)]
@@ -239,12 +243,12 @@ pub fn matching_genome_indices(pred_str: &str, genomes: &[GenomeInfo]) -> Result
pub struct GroupFilterParams { pub struct GroupFilterParams {
pub threshold: u32, pub threshold: u32,
pub min_count: Option<usize>, pub min_count: Option<isize>,
pub max_count: Option<usize>, pub max_count: Option<isize>,
pub min_frac: Option<f64>, pub min_frac: Option<f64>,
pub max_frac: Option<f64>, pub max_frac: Option<f64>,
pub min_outgroup_count: Option<usize>, pub min_outgroup_count: Option<isize>,
pub max_outgroup_count: Option<usize>, pub max_outgroup_count: Option<isize>,
pub min_outgroup_frac: Option<f64>, pub min_outgroup_frac: Option<f64>,
pub max_outgroup_frac: Option<f64>, pub max_outgroup_frac: Option<f64>,
} }
@@ -279,12 +283,20 @@ pub fn build_group_filter(
let default_min_frac = if !ingroup_preds.is_empty() && !ingroup_quorum_explicit { 1.0 } else { 0.0 }; let default_min_frac = if !ingroup_preds.is_empty() && !ingroup_quorum_explicit { 1.0 } else { 0.0 };
let default_max_outgroup_count = if !outgroup_preds.is_empty() && !outgroup_quorum_explicit { 0 } else { out_size }; let default_max_outgroup_count = if !outgroup_preds.is_empty() && !outgroup_quorum_explicit { 0 } else { out_size };
let min_count = p.min_count.unwrap_or(0); // Resolve a signed count: negative means an offset from the group size
let max_count = p.max_count.unwrap_or(in_size); // (e.g. -1 = all but one), floored at 1 so the negative form always keeps
// constraining the group — even a singleton group, where n-1 would be 0
// and would otherwise drop the constraint entirely.
let resolve = |v: isize, size: usize| -> usize {
if v < 0 { (size as isize + v).max(1) as usize } else { v as usize }
};
let min_count = p.min_count.map(|v| resolve(v, in_size)).unwrap_or(0);
let max_count = p.max_count.map(|v| resolve(v, in_size)).unwrap_or(in_size);
let min_frac = p.min_frac.unwrap_or(default_min_frac); let min_frac = p.min_frac.unwrap_or(default_min_frac);
let max_frac = p.max_frac.unwrap_or(1.0); let max_frac = p.max_frac.unwrap_or(1.0);
let min_outgroup_count = p.min_outgroup_count.unwrap_or(0); let min_outgroup_count = p.min_outgroup_count.map(|v| resolve(v, out_size)).unwrap_or(0);
let max_outgroup_count = p.max_outgroup_count.unwrap_or(default_max_outgroup_count); let max_outgroup_count = p.max_outgroup_count.map(|v| resolve(v, out_size)).unwrap_or(default_max_outgroup_count);
let min_outgroup_frac = p.min_outgroup_frac.unwrap_or(0.0); let min_outgroup_frac = p.min_outgroup_frac.unwrap_or(0.0);
let max_outgroup_frac = p.max_outgroup_frac.unwrap_or(1.0); let max_outgroup_frac = p.max_outgroup_frac.unwrap_or(1.0);
+506 -179
View File
@@ -2,21 +2,26 @@ use std::collections::{HashMap, VecDeque};
use std::io::{self, BufWriter, Write}; use std::io::{self, BufWriter, Write};
use std::path::PathBuf; use std::path::PathBuf;
use std::sync::Arc; use std::sync::Arc;
use std::sync::atomic::{AtomicU32, AtomicU64, Ordering};
use std::time::Instant;
use clap::Args; use clap::Args;
use obikindex::KmerIndex; use obikindex::KmerIndex;
use obikpartitionner::{KmerDesc, QueryHit, QueryStats};
use obikrope::Rope; use obikrope::Rope;
use obikseq::RoutableSuperKmer; use obikseq::CanonicalKmer;
use obilayeredmap::IndexMode; use obilayeredmap::IndexMode;
use obipipeline::{Throttled, ThrottleGuard, throttle};
use obiread::chunk::read_sequence_chunks_sized; use obiread::chunk::read_sequence_chunks_sized;
use obiread::record::{SeqRecord, parse_chunk}; use obiread::record::{SeqRecord, parse_chunk};
use obiskbuilder::SuperKmerIter; use obiskbuilder::SuperKmerIter;
use obisys::available_memory_bytes; use obisys::{Reporter, Stage, available_memory_bytes, spinner};
use tracing::info; use tracing::{debug, info};
// ── Pipeline data ───────────────────────────────────────────────────────────── // ── Pipeline data ─────────────────────────────────────────────────────────────
enum QueryData { enum QueryData {
Path(Throttled<PathBuf>),
Chunk(Rope), Chunk(Rope),
Output(Vec<u8>), Output(Vec<u8>),
} }
@@ -74,21 +79,34 @@ pub struct QueryArgs {
/// I/O chunk size in MiB (default: auto-sized from available RAM and thread count) /// I/O chunk size in MiB (default: auto-sized from available RAM and thread count)
#[arg(long)] #[arg(long)]
pub chunk_size: Option<usize>, pub chunk_size: Option<usize>,
/// Maximum number of input files open simultaneously.
/// Defaults to threads/4 (minimum 1). Keep below the number of workers
/// to ensure CPU workers are always available for the transform stage.
#[arg(long)]
pub max_open_files: Option<usize>,
} }
// ── SKDesc — one occurrence of a superkmer in the batch ─────────────────────── impl QueryArgs {
pub fn effective_max_open(&self) -> usize {
/// Describes one occurrence of a superkmer in the query batch. self.max_open_files
pub struct SKDesc { .unwrap_or_else(|| (self.threads / 4).max(1))
/// Index of the source sequence within the batch. .max(1)
pub seq_idx: u32, }
/// Kmer offset of the first kmer of this superkmer within its sequence.
pub kmer_offset: u32,
} }
// ── QueryBatch ──────────────────────────────────────────────────────────────── // ── QueryBatch ────────────────────────────────────────────────────────────────
/// A batch of query sequences with their superkmers deduplicated. /// A batch of query sequences, with k-mers deduplicated directly (not just at
/// the superkmer level) and pre-split by partition.
///
/// Superkmer *construction* (`SuperKmerIter`) is still required — it's the
/// mechanism that computes minimizers and partition routing — but the dedup
/// key is the canonical k-mer, not the superkmer: two different superkmers
/// that happen to share a k-mer (read overlaps, repeats, a SNP splitting an
/// otherwise-identical run) are deduplicated too, not just identical whole
/// superkmers. This also means each unique k-mer triggers at most one MPHF
/// lookup, not one per occurrence.
pub struct QueryBatch { pub struct QueryBatch {
/// Sequence ids in batch order. /// Sequence ids in batch order.
pub ids: Vec<String>, pub ids: Vec<String>,
@@ -96,30 +114,40 @@ pub struct QueryBatch {
pub seqs: Vec<Vec<u8>>, pub seqs: Vec<Vec<u8>>,
/// Total kmer count per sequence (used for `--detail` coverage allocation). /// Total kmer count per sequence (used for `--detail` coverage allocation).
pub n_kmers: Vec<u32>, pub n_kmers: Vec<u32>,
/// Deduplicated superkmer map. /// Deduplicated k-mer occurrences, one map per partition.
pub map: HashMap<RoutableSuperKmer, Vec<SKDesc>>, pub by_partition: Vec<HashMap<CanonicalKmer, Vec<KmerDesc>>>,
} }
impl QueryBatch { impl QueryBatch {
/// Build a batch from a vec of parsed sequence records. /// Build a batch from a vec of parsed sequence records, deduplicating
pub fn from_records(records: Vec<SeqRecord>, k: usize, level_max: usize, theta: f64) -> Self { /// k-mers and routing them to partitions in the same pass.
pub fn from_records(
records: Vec<SeqRecord>,
k: usize,
level_max: usize,
theta: f64,
n_partitions: usize,
) -> Self {
let mut ids = Vec::with_capacity(records.len()); let mut ids = Vec::with_capacity(records.len());
let mut seqs = Vec::with_capacity(records.len()); let mut seqs = Vec::with_capacity(records.len());
let mut n_kmers = Vec::with_capacity(records.len()); let mut n_kmers = Vec::with_capacity(records.len());
// Upper-bound estimate: at most one superkmer per k bases. let mask = (n_partitions as u64) - 1;
// Avoids repeated rehash on large chunks. let mut by_partition: Vec<HashMap<CanonicalKmer, Vec<KmerDesc>>> =
let cap = records.iter().map(|r| r.normalized.len()).sum::<usize>() / k.max(1); (0..n_partitions).map(|_| HashMap::new()).collect();
let mut map: HashMap<RoutableSuperKmer, Vec<SKDesc>> = HashMap::with_capacity(cap);
for (seq_idx, record) in records.into_iter().enumerate() { for (seq_idx, record) in records.into_iter().enumerate() {
let mut kmer_offset = 0u32; let mut kmer_offset = 0u32;
for rsk in SuperKmerIter::new(&record.normalized, k, level_max, theta) { for rsk in SuperKmerIter::new(&record.normalized, k, level_max, theta) {
let n = (rsk.seql() - k + 1) as u32; let part_idx = (rsk.minimizer().seq_hash() & mask) as usize;
map.entry(rsk).or_default().push(SKDesc { let map = &mut by_partition[part_idx];
for (j, kmer) in rsk.superkmer().iter_canonical_kmers().enumerate() {
map.entry(kmer).or_default().push(KmerDesc {
seq_idx: seq_idx as u32, seq_idx: seq_idx as u32,
kmer_offset, pos: kmer_offset + j as u32,
}); });
}
let n = (rsk.seql() - k + 1) as u32;
kmer_offset += n; kmer_offset += n;
} }
@@ -132,37 +160,27 @@ impl QueryBatch {
ids, ids,
seqs, seqs,
n_kmers, n_kmers,
map, by_partition,
}
} }
} }
/// Split the superkmer map by partition index. // ── SmerIndex — sparse "was this k-mer found at all" bookkeeping ─────────────
pub fn split_by_partition(&self, n_partitions: usize) -> Vec<Vec<&RoutableSuperKmer>> {
let mask = (n_partitions as u64) - 1; /// Tracks, per (sequence, s-mer position), whether the k-mer was found in the
let mut by_part: Vec<Vec<&RoutableSuperKmer>> = vec![Vec::new(); n_partitions]; /// index at all — independent of *which* genome(s) matched. Sized
for rsk in self.map.keys() { /// `total_smers` (one `bool` per s-mer occurrence in the chunk), **not**
let part = (rsk.minimizer().seq_hash() & mask) as usize; /// multiplied by `n_genomes`: this is the O(1)-per-position bookkeeping that
by_part[part].push(rsk); /// `kmer_missing` needs (the leftmost-s-mer-of-window membership test), kept
} /// dense because it's already cheap — the `n_genomes`-scaled data lives in
by_part /// the sparse per-genome hit lists built alongside it (see `process_chunk`).
} struct SmerIndex {
in_index: Vec<bool>, // total_smers
offsets: Vec<usize>, // offsets[i]..offsets[i+1] = s-mer range for sequence i
} }
// ── KmerResults — allocation-free ragged result matrix ─────────────────────── impl SmerIndex {
fn new(n_kmers_per_seq: &[u32]) -> Self {
/// Flat storage for per-kmer query results across all sequences in a chunk.
///
/// Replaces `Vec<Vec<Option<Box<[u32]>>>>` — a single allocation for the whole
/// chunk instead of one `Box<[u32]>` per found k-mer.
struct KmerResults {
data: Vec<u32>, // total_kmers × n_genomes, row-major
in_index: Vec<bool>, // total_kmers — true if the kmer was found in the index
offsets: Vec<usize>, // offsets[i]..offsets[i+1] = kmer range for sequence i
n_genomes: usize,
}
impl KmerResults {
fn new(n_kmers_per_seq: &[u32], n_genomes: usize) -> Self {
let mut offsets = Vec::with_capacity(n_kmers_per_seq.len() + 1); let mut offsets = Vec::with_capacity(n_kmers_per_seq.len() + 1);
let mut total = 0usize; let mut total = 0usize;
offsets.push(0); offsets.push(0);
@@ -171,34 +189,96 @@ impl KmerResults {
offsets.push(total); offsets.push(total);
} }
Self { Self {
data: vec![0u32; total * n_genomes],
in_index: vec![false; total], in_index: vec![false; total],
offsets, offsets,
n_genomes,
} }
} }
fn n_kmers_for(&self, seq: usize) -> usize { /// Mark the k-mer at (seq, kmer) as found in the index — independent of
self.offsets[seq + 1] - self.offsets[seq] /// any particular genome's value. Called once per hit k-mer (stage 1 of
} /// `query_partition_with`), regardless of how the column-major fetch
/// (stage 2) later reports per-genome values.
fn set(&mut self, seq: usize, kmer: usize, row: &[u32]) { fn mark_found(&mut self, seq: usize, kmer: usize) {
let abs = self.offsets[seq] + kmer; let abs = self.offsets[seq] + kmer;
self.in_index[abs] = true; self.in_index[abs] = true;
let base = abs * self.n_genomes;
self.data[base..base + self.n_genomes].copy_from_slice(row);
} }
#[inline] #[inline]
fn is_in_index(&self, seq: usize, kmer: usize) -> bool { fn is_in_index(&self, seq: usize, kmer: usize) -> bool {
self.in_index[self.offsets[seq] + kmer] self.in_index[self.offsets[seq] + kmer]
} }
/// Value for genome `g` at (seq, kmer); meaningful only when `is_in_index`.
#[inline]
fn val(&self, seq: usize, kmer: usize, g: usize) -> u32 {
self.data[(self.offsets[seq] + kmer) * self.n_genomes + g]
} }
// ── Sparse Findere: per-genome run detection + sliding-window minimum ────────
/// One confirmed z-window: genome `g`'s window ending at k-mer `pos` (the
/// *leftmost* s-mer of the window, i.e. the k_user-mer's output position) is
/// fully present and nonzero, with window-minimum `value`.
type ConfirmedHit = (u32, u32, u32); // (seq_idx, pos_out, value)
/// Reduce one genome's raw sparse s-mer hits — `(seq_idx, pos_smer, raw_value)`,
/// unsorted, exactly as delivered by `QueryHit::Value` — into confirmed
/// z-windows, without ever visiting a position that had no hit at all.
///
/// A z-window is confirmed only when all z s-mers in it are present *and*
/// nonzero for this genome (matching the dense sliding-window's semantics,
/// where "not in index" or a zero value both contribute 0 to the window
/// minimum) — which can only happen inside a maximal run of consecutive
/// `pos_smer` values for the same sequence. `hits` is sorted in place by
/// `(seq_idx, pos_smer)` to expose those runs; the monotone-deque
/// window-minimum then runs per run, on run-relative indices, identical in
/// spirit to the dense version's whole-sequence scan.
///
/// Returns the confirmed hits plus `(n_runs, total_run_len)` for logging —
/// a low average run length relative to `z` means most hits fail to form a
/// complete window.
fn sparse_findere_for_genome(
hits: &mut [(u32, u32, u32)],
z: usize,
presence: bool,
threshold: u32,
) -> (Vec<ConfirmedHit>, usize, usize) {
hits.sort_unstable_by_key(|&(seq, pos, _)| (seq, pos));
let mut confirmed = Vec::new();
let mut n_runs = 0usize;
let mut total_run_len = 0usize;
let mut dq: VecDeque<(usize, u32)> = VecDeque::new(); // (run-relative index, value)
let mut i = 0;
while i < hits.len() {
let seq = hits[i].0;
let mut j = i + 1;
while j < hits.len() && hits[j].0 == seq && hits[j].1 == hits[j - 1].1 + 1 {
j += 1;
}
let run = &hits[i..j];
n_runs += 1;
total_run_len += run.len();
dq.clear();
for (k, &(_, pos, val)) in run.iter().enumerate() {
while dq.back().map_or(false, |&(_, v)| v >= val) {
dq.pop_back();
}
dq.push_back((k, val));
while dq.front().map_or(false, |&(fk, _)| fk + z <= k) {
dq.pop_front();
}
if k + 1 >= z {
let win_min = dq.front().unwrap().1;
if win_min > 0 {
let pos_out = pos + 1 - z as u32;
let c = if presence { u32::from(win_min >= threshold) } else { win_min };
confirmed.push((seq, pos_out, c));
}
}
}
i = j;
}
(confirmed, n_runs, total_run_len)
} }
// ── Per-sequence accumulator ────────────────────────────────────────────────── // ── Per-sequence accumulator ──────────────────────────────────────────────────
@@ -234,40 +314,91 @@ fn process_chunk(
force_presence: bool, force_presence: bool,
presence_threshold: u32, presence_threshold: u32,
) -> Vec<u8> { ) -> Vec<u8> {
let chunk_start = Instant::now();
let chunk_bytes = rope.len();
let records = parse_chunk(&rope, k); let records = parse_chunk(&rope, k);
if records.is_empty() { if records.is_empty() {
return Vec::new(); return Vec::new();
} }
let batch = QueryBatch::from_records(records, k, 6, 0.7); let batch = QueryBatch::from_records(records, k, 6, 0.7, n_partitions);
let n_seqs = batch.ids.len(); let n_seqs = batch.ids.len();
// Flat result matrix — one allocation for the whole chunk. // Estimate QueryBatch::by_partition's actual memory footprint: the
let mut results = KmerResults::new(&batch.n_kmers, n_genomes); // k-mer-level dedup map (roadmap point 5) — one HashMap<CanonicalKmer,
// Vec<KmerDesc>> per partition, sized by *unique* k-mers, not shrunk by
// dedup. On real workloads with a low intra-chunk duplication rate this
// can dwarf every other per-chunk structure, including the sparse
// Findere ones logged further down — unlike those, chunk_bytes's formula
// (run()) does not account for this at all today. Measured by allocated
// capacity, not logical length, to reflect real memory pressure
// (HashMap/Vec growth slack) — `by_partition` is alive for the entire
// process_chunk call (never drained, only iterated by reference), so
// this is its footprint for the whole chunk lifetime, not a transient.
let hashmap_slot_bytes = (std::mem::size_of::<CanonicalKmer>()
+ std::mem::size_of::<Vec<KmerDesc>>()
+ 1) as u64; // +1 ≈ hashbrown control byte per slot
let by_partition_map_bytes: u64 = batch
.by_partition
.iter()
.map(|m| m.capacity() as u64 * hashmap_slot_bytes)
.sum();
let by_partition_desc_bytes: u64 = batch
.by_partition
.iter()
.flat_map(|m| m.values())
.map(|v| v.capacity() as u64 * std::mem::size_of::<KmerDesc>() as u64)
.sum();
let by_partition_bytes = by_partition_map_bytes + by_partition_desc_bytes;
let by_part = batch.split_by_partition(n_partitions); debug!(
n_unique_kmers_total = batch.by_partition.iter().map(|m| m.len() as u64).sum::<u64>(),
by_partition_map_bytes,
by_partition_desc_bytes,
by_partition_bytes,
chunk_bytes,
"by_partition memory retained"
);
for (part_idx, part_sks) in by_part.iter().enumerate() { // Sparse bookkeeping for the whole chunk:
if part_sks.is_empty() { // - smer_index: O(total_smers) — is this s-mer in the index at all.
// - by_genome[g]: raw (seq_idx, pos_smer, value) hits for genome g, only
// ever containing nonzero entries (query_partition_with never emits a
// QueryHit::Value for a zero value) — empty for every genome this chunk
// never matched, which is the common case for unrelated queries.
let mut smer_index = SmerIndex::new(&batch.n_kmers);
let mut by_genome: Vec<Vec<(u32, u32, u32)>> = (0..n_genomes).map(|_| Vec::new()).collect();
// Dedup-ratio bookkeeping: occurrences (from batch.n_kmers, computed
// before dedup) vs. unique k-mers actually queried (query_stats) — the
// entire justification for k-mer-level dereplication (see query.md,
// Future work point 5). If this ratio stays close to 1.0 on real data,
// dereplication isn't paying for itself and that should show up here.
let n_occurrences: u64 = batch.n_kmers.iter().map(|&n| n as u64).sum();
let mut query_stats = QueryStats::default();
for (part_idx, kmers) in batch.by_partition.iter().enumerate() {
if kmers.is_empty() {
continue; continue;
} }
idx.partition() let stats = idx.partition()
.query_partition_with( .query_partition_with(
part_idx, part_idx,
part_sks, kmers,
k,
n_genomes, n_genomes,
with_counts, with_counts,
|sk_idx, kmer_idx, row| { |event| match event {
let rsk = part_sks[sk_idx]; QueryHit::Found(descs) => {
let descs = batch.map.get(rsk).expect("rsk must be in map");
for desc in descs { for desc in descs {
results.set( smer_index.mark_found(desc.seq_idx as usize, desc.pos as usize);
desc.seq_idx as usize, }
desc.kmer_offset as usize + kmer_idx, }
row, QueryHit::Value(descs, g, v) => {
); for desc in descs {
by_genome[g].push((desc.seq_idx, desc.pos, v));
}
} }
}, },
) )
@@ -275,96 +406,129 @@ fn process_chunk(
eprintln!("query error on partition {part_idx}: {e}"); eprintln!("query error on partition {part_idx}: {e}");
std::process::exit(1); std::process::exit(1);
}); });
query_stats += stats;
} }
// Sliding window minimum — one reusable buffer and one deque per batch. debug!(
// n_occurrences,
// win_min[pos * n_genomes + g] = min count across the z-window [pos, pos+z) n_unique_kmers = query_stats.n_unique_kmers,
// for genome g, where "not in index" counts as 0. n_mphf_calls = query_stats.n_mphf_calls,
// n_hits = query_stats.n_hits,
// win_min > 0 ↔ all z consecutive kmers are in the index with count > 0 n_columns_scanned = query_stats.n_columns_scanned,
// ↔ Findere confirmation (for z=1 this degenerates to the n_col_get_calls = query_stats.n_col_get_calls,
// simple case with no overhead). "k-mer dedup + column-major fetch"
// );
// Works uniformly for count matrices and presence/absence (0/1) matrices.
let max_n_kmers = batch.n_kmers.iter().map(|&n| n as usize).max().unwrap_or(0);
let mut win_min = vec![0u32; max_n_kmers * n_genomes];
let mut accs: Vec<SeqAcc> = (0..n_seqs).map(|_| SeqAcc::new(n_genomes)).collect(); // ── Sparse Findere: per-genome run detection + sliding-window minimum ────
//
// Confirmed z-windows, per genome, replace the dense win_min matrix:
// total retained memory is O(actual hits), not O(total_smers × n_genomes)
// — the whole point of this pass. See sparse_findere_for_genome's doc for
// why run detection is equivalent to the dense scan's semantics.
let presence = force_presence || !with_counts;
let threshold = presence_threshold;
let z = effective_z;
let n_kmers_out: Vec<usize> = batch let n_kmers_out: Vec<usize> = batch
.n_kmers .n_kmers
.iter() .iter()
.map(|&n| { .map(|&n| {
let n = n as usize; let n = n as usize;
if n >= effective_z { n - effective_z + 1 } else { 0 } if n >= z { n - z + 1 } else { 0 }
}) })
.collect(); .collect();
let mut out_offsets = Vec::with_capacity(n_seqs + 1);
{
let mut total = 0usize;
out_offsets.push(0);
for &n in &n_kmers_out {
total += n;
out_offsets.push(total);
}
}
let total_out = *out_offsets.last().unwrap_or(&0);
let n_dense_would_be = n_occurrences as u64 * n_genomes as u64;
let mut n_sparse_entries = 0u64;
let mut n_runs_total = 0usize;
let mut run_len_total = 0usize;
let mut confirmed_by_genome: Vec<Vec<ConfirmedHit>> = Vec::with_capacity(n_genomes);
for hits in &mut by_genome {
n_sparse_entries += hits.len() as u64;
let (confirmed, n_runs, run_len) = sparse_findere_for_genome(hits, z, presence, threshold);
n_runs_total += n_runs;
run_len_total += run_len;
confirmed_by_genome.push(confirmed);
}
debug!(
n_dense_would_be,
n_sparse_entries,
n_runs = n_runs_total,
avg_run_len = if n_runs_total > 0 { run_len_total as f64 / n_runs_total as f64 } else { 0.0 },
z,
"sparse Findere"
);
// Actual bytes retained by the sparse hit structures (by_genome +
// confirmed_by_genome, both alive simultaneously at this point — see the
// chunk-size formula's comment in `run()`), by allocated capacity rather
// than logical length so this reflects real memory pressure including
// Vec growth slack. `empirical_multiplier` is directly comparable to
// BYTES_PER_KMER_PER_GENOME (`run()`) — the ratio a cluster run's logs
// need to judge whether that constant is over- or under-conservative for
// real data, instead of guessing.
const HIT_ENTRY_BYTES: u64 = std::mem::size_of::<(u32, u32, u32)>() as u64;
let by_genome_bytes: u64 = by_genome.iter().map(|v| v.capacity() as u64 * HIT_ENTRY_BYTES).sum();
let confirmed_bytes: u64 = confirmed_by_genome.iter().map(|v| v.capacity() as u64 * HIT_ENTRY_BYTES).sum();
let retained_bytes = by_genome_bytes + confirmed_bytes;
debug!(
by_genome_bytes,
confirmed_bytes,
retained_bytes,
chunk_bytes,
empirical_multiplier = retained_bytes as f64 / chunk_bytes.max(1) as f64,
"sparse memory retained"
);
// ── Accumulate: genome totals (per genome, from confirmed hits) ──────────
let mut accs: Vec<SeqAcc> = (0..n_seqs).map(|_| SeqAcc::new(n_genomes)).collect();
let mut confirmed_any = vec![false; total_out];
for (g, hits) in confirmed_by_genome.iter().enumerate() {
for &(seq_idx, pos_out, c) in hits {
let abs_out = out_offsets[seq_idx as usize] + pos_out as usize;
confirmed_any[abs_out] = true;
accs[seq_idx as usize].genome_totals[g] += c;
}
}
// ── Accumulate: kmer_count / kmer_missing (per position, genome-independent) ─
for seq_idx in 0..n_seqs {
let out_n = n_kmers_out[seq_idx];
let acc = &mut accs[seq_idx];
for pos in 0..out_n {
let abs_out = out_offsets[seq_idx] + pos;
if confirmed_any[abs_out] {
acc.kmer_count += 1;
} else if !smer_index.is_in_index(seq_idx, pos) {
acc.kmer_missing += 1;
}
}
}
// ── Coverage (--detail): densify only when actually requested ────────────
let mut cov: Vec<Vec<Vec<u32>>> = if detail { let mut cov: Vec<Vec<Vec<u32>>> = if detail {
n_kmers_out.iter().map(|&n| vec![vec![0u32; n]; n_genomes]).collect() n_kmers_out.iter().map(|&n| vec![vec![0u32; n]; n_genomes]).collect()
} else { } else {
Vec::new() Vec::new()
}; };
if detail {
let presence = force_presence || !with_counts; for (g, hits) in confirmed_by_genome.iter().enumerate() {
let threshold = presence_threshold; for &(seq_idx, pos_out, c) in hits {
let z = effective_z; cov[seq_idx as usize][g][pos_out as usize] += c;
// Deque reused across all (seq, genome) pairs.
let mut dq: VecDeque<(usize, u32)> = VecDeque::with_capacity(z + 1);
for seq_idx in 0..n_seqs {
let n = results.n_kmers_for(seq_idx);
let out_n = n_kmers_out[seq_idx];
if out_n == 0 { continue; }
let mins = &mut win_min[..out_n * n_genomes];
mins.fill(0);
// ── Per-genome sliding window minimum ─────────────────────────────────
for g in 0..n_genomes {
dq.clear();
for i in 0..n {
let v_i = if results.is_in_index(seq_idx, i) {
results.val(seq_idx, i, g)
} else {
0
};
// Evict elements that have left the window.
while dq.front().map_or(false, |&(f, _)| f + z <= i) {
dq.pop_front();
}
// Maintain monotone non-decreasing back→front for minimum at front.
while dq.back().map_or(false, |&(_, v)| v >= v_i) {
dq.pop_back();
}
dq.push_back((i, v_i));
// Window [pos, pos+z) is complete when i = pos + z - 1.
if i + 1 >= z {
let pos = i + 1 - z;
mins[pos * n_genomes + g] = dq.front().unwrap().1;
}
}
}
// ── Accumulate ────────────────────────────────────────────────────────
let acc = &mut accs[seq_idx];
for pos in 0..out_n {
let any = (0..n_genomes).any(|g| mins[pos * n_genomes + g] > 0);
if !any {
if !results.is_in_index(seq_idx, pos) {
acc.kmer_missing += 1;
}
continue;
}
acc.kmer_count += 1;
for g in 0..n_genomes {
let v = mins[pos * n_genomes + g];
if v == 0 { continue; }
let c = if presence { u32::from(v >= threshold) } else { v };
acc.genome_totals[g] += c;
if detail { cov[seq_idx][g][pos] += c; }
} }
} }
} }
@@ -384,9 +548,42 @@ fn process_chunk(
&cov, &cov,
&mut buf, &mut buf,
); );
debug!(
chunk_bytes,
n_seqs,
n_smers = batch.n_kmers.iter().map(|&n| n as u64).sum::<u64>(),
wall_ms = chunk_start.elapsed().as_millis() as u64,
"process_chunk"
);
buf buf
} }
// ── GuardedChunkIter — keeps the throttle slot guard alive until the file is exhausted ──
/// Wraps a per-file `Rope` chunk iterator together with its `ThrottleGuard`,
/// so the guard (and the throttle slot it holds) is only released once the
/// file has been fully read — never earlier, never held past that point.
struct GuardedChunkIter {
inner: Box<dyn Iterator<Item = Rope> + Send>,
_guard: ThrottleGuard,
files_open: Arc<AtomicU32>,
}
impl Iterator for GuardedChunkIter {
type Item = Rope;
fn next(&mut self) -> Option<Rope> {
self.inner.next()
}
}
impl Drop for GuardedChunkIter {
fn drop(&mut self) {
self.files_open.fetch_sub(1, Ordering::Relaxed);
}
}
// ── Entry point ─────────────────────────────────────────────────────────────── // ── Entry point ───────────────────────────────────────────────────────────────
pub fn run(args: QueryArgs) { pub fn run(args: QueryArgs) {
@@ -402,17 +599,67 @@ pub fn run(args: QueryArgs) {
let n_workers = args.threads.max(1); let n_workers = args.threads.max(1);
// Chunk size: each chunk stays in memory for its entire processing lifetime. // Chunk size: each chunk stays in memory for its entire processing lifetime.
// Overhead per raw byte is ~8× (Rope + parsed records + superkmers + results). //
// We target ≤ 50 % of available RAM across all concurrent workers. // Per-chunk memory is no longer a dense n_genomes-wide buffer (removed in
// the sparse Findere rework, see process_chunk) — it now scales with
// *actual hit count*, not with total_kmers_in_chunk × n_genomes
// unconditionally. BYTES_PER_KMER_PER_GENOME below is therefore a
// pathological-case bound, not a typical-case estimate: it protects
// against a fully-dense hit pattern (every k-mer of the query matching
// every genome — a degenerate case, e.g. low-complexity input theta-
// filtering should mostly reject, or an index of near-duplicate genomes),
// where by_genome and confirmed_by_genome (process_chunk) both end up
// holding one (seq_idx, pos, value) entry — 3 × u32 = 12 bytes, vs. 4
// bytes for the old dense encoding, where position was implicit in the
// array index — per (k-mer, genome) pair, and *coexist simultaneously*
// (by_genome isn't freed before confirmed_by_genome is built), for a
// worst case of ~24 bytes/pair before Vec growth slack. `cov` remains
// fully dense when --detail is set (unaffected by the sparse rework),
// still roughly doubling the n_genomes-scaled cost.
//
// For realistic, sparse hit patterns actual memory is far below this
// bound — see the "sparse memory retained" debug log in process_chunk,
// which reports the empirical bytes-per-raw-byte multiplier actually
// observed per chunk, directly comparable to BYTES_PER_KMER_PER_GENOME
// below. Tightening this constant for typical-case throughput (at the
// cost of pathological-case safety margin) is a deliberate tuning
// decision to make from that data, not something to guess at here.
//
// BASE_OVERHEAD approximates what scales with chunk_bytes alone,
// independent of n_genomes: the Rope itself, parsed SeqRecord sequence +
// normalised bytes, the superkmer dedup map, and the JSON output buffer.
// Like the n_genomes-scaled term, this is an estimate — validate against
// actual peak RSS (Stage::stop's `rss` in the summary table) on real
// workloads rather than trusting it blindly.
//
// We target ≤ 50 % of available RAM across all concurrent workers
// (SAFETY_FACTOR).
const BASE_OVERHEAD: u64 = 4;
const BYTES_PER_KMER_PER_GENOME: u64 = 8; // pathological-case bound — see comment above
const SAFETY_FACTOR: u64 = 2;
let detail_factor: u64 = if args.detail { 2 } else { 1 };
let overhead_multiplier =
BASE_OVERHEAD + n_genomes as u64 * BYTES_PER_KMER_PER_GENOME * detail_factor;
let chunk_bytes = args let chunk_bytes = args
.chunk_size .chunk_size
.map(|mb| mb * 1024 * 1024) .map(|mb| mb * 1024 * 1024)
.unwrap_or_else(|| { .unwrap_or_else(|| {
let avail = available_memory_bytes(); let avail = available_memory_bytes();
let computed = avail / (n_workers as u64 * 16); let computed = avail / (n_workers as u64 * overhead_multiplier * SAFETY_FACTOR);
computed.clamp(4 * 1024 * 1024, 256 * 1024 * 1024) as usize computed.clamp(4 * 1024 * 1024, 256 * 1024 * 1024) as usize
}); });
debug!(
chunk_bytes,
n_genomes,
detail = args.detail,
overhead_multiplier,
estimated_peak_chunk_bytes = chunk_bytes as u64 * overhead_multiplier,
"chunk-size formula resolved"
);
let effective_z: usize = args let effective_z: usize = args
.findere_z .findere_z
.unwrap_or_else(|| match idx.meta().config.evidence { .unwrap_or_else(|| match idx.meta().config.evidence {
@@ -435,48 +682,122 @@ pub fn run(args: QueryArgs) {
let force_presence = args.force_presence; let force_presence = args.force_presence;
let presence_threshold = args.presence_threshold; let presence_threshold = args.presence_threshold;
// Flat iterator over all Rope chunks from all input files. // Throttled iterator over input file paths: at most `effective_max_open()`
// I/O runs in the source thread; chunk processing is parallelised by the pipe. // files are open at once. Opening + decompressing + chunking each file is
info!("query: chunk_size={}MiB", chunk_bytes / (1024 * 1024)); // now a Flat pipeline stage, executed across the `n_workers` pool — not
// serialised in the pipe's dedicated source thread (see steps::scatter /
// cmd::superkmer for the same pattern applied to indexing).
info!("query: chunk_size={}MiB, max_open_files={}", chunk_bytes / (1024 * 1024), args.effective_max_open());
let paths: Vec<PathBuf> = args.inputs.iter().map(PathBuf::from).collect(); let paths: Vec<PathBuf> = args.inputs.iter().map(PathBuf::from).collect();
let all_chunks = paths.into_iter().flat_map(move |path| { let path_source = throttle(paths.into_iter(), args.effective_max_open());
let path_str = path.to_str().unwrap_or("").to_owned();
match read_sequence_chunks_sized(&path_str, chunk_bytes) { // Instrumentation: total bytes processed (for the EMA throughput readout),
Ok(iter) => Box::new(iter.filter_map(|r| match r { // number of files currently open/being chunked, and number of chunks
Ok(rope) => Some(rope), // currently being processed by a worker — all read from the spinner loop
Err(e) => { // below, updated from inside the pipe closures.
eprintln!("read error: {e}"); let total_bytes = Arc::new(AtomicU64::new(0));
None let files_open = Arc::new(AtomicU32::new(0));
} let chunks_active = Arc::new(AtomicU32::new(0));
})) as Box<dyn Iterator<Item = Rope> + Send>,
Err(e) => {
eprintln!("error opening {path_str}: {e}");
std::process::exit(1);
}
}
});
let pipe = obipipeline::make_pipe! { let pipe = obipipeline::make_pipe! {
QueryData : Rope => Vec<u8>, QueryData : Throttled<PathBuf> => Vec<u8>,
|| {
let files_open = Arc::clone(&files_open);
move |pw: Throttled<PathBuf>| -> GuardedChunkIter {
let path = pw.item;
let guard = pw.guard;
let path_str = path.to_str().unwrap_or("").to_owned();
files_open.fetch_add(1, Ordering::Relaxed);
let open_start = Instant::now();
// Hard-exit on file-open failure (mirrors the previous behaviour):
// propagating this as a pipeline Err would hit a known scheduler
// hang on early stage errors (obipipeline::scheduler::WorkerPool::run
// breaks its main loop without unblocking the still-running source
// thread, so the final `h.join()` never returns) — worth fixing in
// obipipeline itself, but out of scope here; sidestepping it like the
// original code already did is the safe choice for this change.
let iter = read_sequence_chunks_sized(&path_str, chunk_bytes).unwrap_or_else(|e| {
eprintln!("error opening {path_str}: {e}");
std::process::exit(1);
});
debug!(
path = %path_str,
open_ms = open_start.elapsed().as_millis() as u64,
"opened query input file"
);
let err_path = path_str.clone();
GuardedChunkIter {
inner: Box::new(iter.filter_map(move |r| match r {
Ok(rope) => Some(rope),
Err(e) => {
eprintln!("read error: {err_path}: {e}");
None
}
})),
_guard: guard,
files_open: Arc::clone(&files_open),
}
}
} : Path => Chunk,
| { | {
let idx = Arc::clone(&idx); let idx = Arc::clone(&idx);
let total_bytes = Arc::clone(&total_bytes);
let chunks_active = Arc::clone(&chunks_active);
move |rope: Rope| { move |rope: Rope| {
process_chunk( chunks_active.fetch_add(1, Ordering::Relaxed);
let bytes = rope.len() as u64;
let out = process_chunk(
&idx, rope, k, n_genomes, n_partitions, with_counts, &idx, rope, k, n_genomes, n_partitions, with_counts,
effective_z, detail, count_missing, force_presence, presence_threshold, effective_z, detail, count_missing, force_presence, presence_threshold,
) );
total_bytes.fetch_add(bytes, Ordering::Relaxed);
chunks_active.fetch_sub(1, Ordering::Relaxed);
out
} }
} : Chunk => Output, } : Chunk => Output,
}; };
let t = Stage::start("query");
let pb = spinner("query");
let mut ema_rate: f64 = 0.0;
let mut last_t = Instant::now();
let mut last_bytes: u64 = 0;
const ALPHA: f64 = 0.15;
let mut out = BufWriter::new(io::stdout()); let mut out = BufWriter::new(io::stdout());
for block in pipe.apply(all_chunks, n_workers, 2) { for block in pipe.apply(path_source, n_workers, 2) {
if !block.is_empty() { if !block.is_empty() {
out.write_all(&block).expect("write error"); out.write_all(&block).expect("write error");
} }
let now = Instant::now();
let dt = now.duration_since(last_t).as_secs_f64();
if dt > 0.1 {
let total = total_bytes.load(Ordering::Relaxed);
let instant = (total - last_bytes) as f64 / dt;
ema_rate = ALPHA * instant + (1.0 - ALPHA) * ema_rate;
last_t = now;
last_bytes = total;
let bp = total as f64;
let (count_str, rate_str) = if bp >= 1e9 {
(format!("{:.2} GB", bp / 1e9), format!("{:.0} MB/s", ema_rate / 1e6))
} else {
(format!("{:.0} MB", bp / 1e6), format!("{:.0} MB/s", ema_rate / 1e6))
};
let active = chunks_active.load(Ordering::Relaxed);
let open = files_open.load(Ordering::Relaxed);
pb.set_message(format!("{count_str} {rate_str} [files open: {open}, chunks in flight: {active}]"));
}
} }
out.flush().expect("flush error"); out.flush().expect("flush error");
pb.finish_and_clear();
let mut rep = Reporter::new();
rep.push(t.stop());
rep.print();
} }
// ── Output ──────────────────────────────────────────────────────────────────── // ── Output ────────────────────────────────────────────────────────────────────
@@ -501,8 +822,10 @@ fn emit_batch(
let mut match_map = serde_json::Map::new(); let mut match_map = serde_json::Map::new();
for (g, genome) in meta.genomes.iter().enumerate() { for (g, genome) in meta.genomes.iter().enumerate() {
if acc.genome_totals[g] != 0 {
match_map.insert(genome.label.clone(), acc.genome_totals[g].into()); match_map.insert(genome.label.clone(), acc.genome_totals[g].into());
} }
}
ann.insert("kmer_strict_matches".into(), match_map.into()); ann.insert("kmer_strict_matches".into(), match_map.into());
if detail && !cov.is_empty() { if detail && !cov.is_empty() {
@@ -524,3 +847,7 @@ fn emit_batch(
let _ = out.write_all(b"\n"); let _ = out.write_all(b"\n");
} }
} }
#[cfg(test)]
#[path = "tests/query.rs"]
mod tests;
+228
View File
@@ -0,0 +1,228 @@
use super::*;
const K: usize = 11;
const M: usize = 5;
/// Build a `QueryBatch` from raw FASTA text, going through the same
/// `Rope` + `parse_chunk` path `process_chunk` uses — avoids hand-building a
/// `normalized` `Rope`, which is an implementation detail of `obiread`.
///
/// `obikseq`'s global K/M params are thread-local under `test-utils` (see
/// `obikseq::params`), so setting them here is per-test-thread and does not
/// need coordination with other tests.
fn batch_from_fasta(fasta: &str, k: usize, n_partitions: usize) -> QueryBatch {
obikseq::set_k(k);
obikseq::set_m(M);
let mut rope = Rope::new(Some("text/fasta"));
rope.push(fasta.as_bytes().to_vec());
let records = parse_chunk(&rope, k);
QueryBatch::from_records(records, k, 6, 0.7, n_partitions)
}
fn total_occurrences(batch: &QueryBatch) -> u64 {
batch.n_kmers.iter().map(|&n| n as u64).sum()
}
fn total_unique_kmers(batch: &QueryBatch) -> u64 {
batch.by_partition.iter().map(|m| m.len() as u64).sum()
}
// A 60 bp sequence, arbitrary but fixed — no attempt is made to prove it is
// free of internal k=11 repeats; the tests below only rely on inequalities
// that hold regardless (see each test's comment).
const SEQ: &str = "CATTAGCGTACCTGATCAGGTTACAGCTTAGGCATCCAGTTGACCATGACTGGACTTAGC";
#[test]
fn single_sequence_yields_plausible_kmer_counts() {
// A single record can still contain internal repeats (SEQ isn't
// guaranteed repeat-free at k=11) — this only checks the batch is
// internally consistent, not a specific dedup ratio. The cross-record
// tests below make the actual, unconditional dedup claims.
let fasta = format!(">r1\n{SEQ}\n");
let batch = batch_from_fasta(&fasta, K, 1);
assert_eq!(batch.ids, vec!["r1".to_string()]);
let occurrences = total_occurrences(&batch);
let unique = total_unique_kmers(&batch);
assert!(occurrences > 0, "sequence should yield at least one k-mer");
assert!(unique > 0 && unique <= occurrences);
}
#[test]
fn duplicated_sequence_across_records_deduplicates() {
// Two records with byte-identical sequences: every k-mer in record 1
// exactly duplicates one in record 0, so unique kmers <= n_kmers[0],
// strictly less than the summed occurrences (2 * n_kmers[0]) as long as
// the sequence yields at least one k-mer. This holds regardless of
// whether SEQ has internal repeats.
let fasta = format!(">r1\n{SEQ}\n>r2\n{SEQ}\n");
let batch = batch_from_fasta(&fasta, K, 1);
assert_eq!(batch.ids.len(), 2);
let occurrences = total_occurrences(&batch);
let unique = total_unique_kmers(&batch);
assert!(batch.n_kmers[0] > 0);
assert_eq!(occurrences, batch.n_kmers[0] as u64 + batch.n_kmers[1] as u64);
assert!(
unique <= batch.n_kmers[0] as u64,
"identical sequences must not produce more unique k-mers than one copy has"
);
assert!(
unique < occurrences,
"k-mer-level dedup must collapse at least the cross-record duplication"
);
}
#[test]
fn duplicated_sequence_broadcasts_to_both_seq_indices() {
// Stronger than the ratio check above: pick any k-mer that hit in both
// records and confirm its occurrence list actually references both
// seq_idx 0 and seq_idx 1 — this is the specific new capability (dedup
// reaching across records/superkmers), not just a smaller unique count.
let fasta = format!(">r1\n{SEQ}\n>r2\n{SEQ}\n");
let batch = batch_from_fasta(&fasta, K, 1);
let shared = batch.by_partition[0]
.values()
.find(|descs| descs.iter().any(|d| d.seq_idx == 0) && descs.iter().any(|d| d.seq_idx == 1));
assert!(
shared.is_some(),
"expected at least one k-mer shared between the two identical records"
);
}
#[test]
fn empty_records_yield_empty_batch() {
let batch = batch_from_fasta("", K, 1);
assert!(batch.ids.is_empty());
assert_eq!(total_occurrences(&batch), 0);
assert_eq!(total_unique_kmers(&batch), 0);
}
#[test]
fn partition_routing_is_a_pure_function_of_the_kmer() {
// With n_partitions=4, every occurrence of a given k-mer must land in
// the same partition bucket as every other occurrence of that k-mer
// (partition routing is derived from the minimizer, shared by
// definition among instances of the same k-mer's containing superkmer
// in this test's single-sequence-pair setup).
let fasta = format!(">r1\n{SEQ}\n>r2\n{SEQ}\n");
let batch = batch_from_fasta(&fasta, K, 4);
let total_unique: u64 = batch.by_partition.iter().map(|m| m.len() as u64).sum();
assert!(total_unique > 0);
// No k-mer key appears in more than one partition's map.
let mut seen: std::collections::HashSet<CanonicalKmer> = std::collections::HashSet::new();
for map in &batch.by_partition {
for kmer in map.keys() {
assert!(seen.insert(*kmer), "k-mer routed to more than one partition");
}
}
}
// ── sparse_findere_for_genome vs. a dense reference implementation ──────────
//
// No property-testing crate (proptest/quickcheck) is a workspace dependency
// (checked before writing this — not adding one for a single test module,
// per this project's dependency-approval rule). A tiny deterministic xorshift
// PRNG, std-only, stands in for one.
/// Faithful reimplementation of the pre-phase-5 dense sliding-window scan —
/// the algorithm `sparse_findere_for_genome` replaced — used here only as a
/// correctness oracle, not in production code. Operates on one genome's
/// hits across possibly many sequences, exactly like the sparse version.
fn dense_reference_findere(
hits: &[(u32, u32, u32)],
seq_lens: &[usize],
z: usize,
presence: bool,
threshold: u32,
) -> Vec<(u32, u32, u32)> {
let mut by_seq: Vec<Vec<u32>> = seq_lens.iter().map(|&n| vec![0u32; n]).collect();
for &(seq, pos, val) in hits {
by_seq[seq as usize][pos as usize] = val;
}
let mut confirmed = Vec::new();
for (seq_idx, values) in by_seq.iter().enumerate() {
let n = values.len();
let mut dq: std::collections::VecDeque<(usize, u32)> = std::collections::VecDeque::new();
for i in 0..n {
let v_i = values[i];
while dq.front().map_or(false, |&(f, _)| f + z <= i) {
dq.pop_front();
}
while dq.back().map_or(false, |&(_, v)| v >= v_i) {
dq.pop_back();
}
dq.push_back((i, v_i));
if i + 1 >= z {
let win_min = dq.front().unwrap().1;
if win_min > 0 {
let pos_out = (i + 1 - z) as u32;
let c = if presence { u32::from(win_min >= threshold) } else { win_min };
confirmed.push((seq_idx as u32, pos_out, c));
}
}
}
}
confirmed
}
/// Minimal std-only xorshift64 PRNG — deterministic, seedable, no dependency.
struct Xorshift64(u64);
impl Xorshift64 {
fn next(&mut self) -> u64 {
self.0 ^= self.0 << 13;
self.0 ^= self.0 >> 7;
self.0 ^= self.0 << 17;
self.0
}
fn range(&mut self, n: u32) -> u32 {
(self.next() % n as u64) as u32
}
}
#[test]
fn sparse_findere_matches_dense_reference_on_random_inputs() {
let mut rng = Xorshift64(0x5eed_5eed_5eed_5eedu64);
for case in 0..200 {
let n_seqs = 1 + rng.range(4) as usize;
let seq_lens: Vec<usize> = (0..n_seqs).map(|_| 1 + rng.range(30) as usize).collect();
let z = 1 + rng.range(4) as usize;
let presence = rng.range(2) == 0;
let threshold = 1 + rng.range(3);
// Sparse density varies across cases, including edge cases (empty,
// fully dense) — deliberately not uniform, to stress both few-hits
// and many-overlapping-runs scenarios.
let density = rng.range(101);
let mut hits: Vec<(u32, u32, u32)> = Vec::new();
for (seq_idx, &len) in seq_lens.iter().enumerate() {
for pos in 0..len {
if rng.range(100) < density {
let val = 1 + rng.range(5); // never 0 — matches QueryHit::Value's invariant
hits.push((seq_idx as u32, pos as u32, val));
}
}
}
let mut sparse_input = hits.clone();
let (mut sparse_result, _, _) =
sparse_findere_for_genome(&mut sparse_input, z, presence, threshold);
let mut dense_result = dense_reference_findere(&hits, &seq_lens, z, presence, threshold);
sparse_result.sort_unstable();
dense_result.sort_unstable();
assert_eq!(
sparse_result, dense_result,
"case {case}: n_seqs={n_seqs} seq_lens={seq_lens:?} z={z} presence={presence} \
threshold={threshold} density={density} hits={hits:?}"
);
}
}
+1 -1
View File
@@ -21,7 +21,7 @@ enum Commands {
/// Merge multiple built indexes into one /// Merge multiple built indexes into one
Merge(cmd::merge::MergeArgs), Merge(cmd::merge::MergeArgs),
/// Apply row-level selection (σ) to an index: retain only k-mers matching the predicates /// Apply row-level selection (σ) to an index: retain only k-mers matching the predicates
Filter(cmd::filter::FilterArgs), Filter(cmd::filter::FilterCmdArgs),
/// Project and/or aggregate genome columns into a new or in-place index /// Project and/or aggregate genome columns into a new or in-place index
Select(cmd::select::SelectArgs), Select(cmd::select::SelectArgs),
/// Query an index with sequences and annotate matches /// Query an index with sequences and annotate matches
+2 -1
View File
@@ -6,7 +6,6 @@ edition = "2024"
[dev-dependencies] [dev-dependencies]
tempfile = "3" tempfile = "3"
obikseq = { path = "../obikseq", features = ["test-utils"] } obikseq = { path = "../obikseq", features = ["test-utils"] }
obiskbuilder = { path = "../obiskbuilder" }
obiread = { path = "../obiread" } obiread = { path = "../obiread" }
obikrope = { path = "../obikrope" } obikrope = { path = "../obikrope" }
@@ -14,6 +13,8 @@ obikrope = { path = "../obikrope" }
niffler = "3.0.0" niffler = "3.0.0"
remove_dir_all = "0.8" remove_dir_all = "0.8"
obikseq = { path = "../obikseq" } obikseq = { path = "../obikseq" }
obikentropy = { path = "../obikentropy" }
obiskbuilder = { path = "../obiskbuilder" }
obiskio = { path = "../obiskio" } obiskio = { path = "../obiskio" }
obidebruinj = { path = "../obidebruinj" } obidebruinj = { path = "../obidebruinj" }
obilayeredmap = { path = "../obilayeredmap" } obilayeredmap = { path = "../obilayeredmap" }
+14 -12
View File
@@ -62,7 +62,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row = mat.row(slot); let row = mat.row(slot);
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(kmer, row); cont = cb(kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -75,7 +75,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect(); let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(kmer, row); cont = cb(kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -83,18 +83,19 @@ impl KmerPartition {
} }
cont cont
} else { } else {
// No data matrix: implicit presence — all values are 1. // No data matrix: implicit presence — all values are 1. `row`
// The filter result is identical for every kmer, so evaluate once. // is identical for every kmer, but a filter can still depend
// on the kmer's own sequence (e.g. MinComplexity), so this
// cannot be evaluated once for the whole layer — filters must
// still be tested per kmer.
let all_present: Box<[u32]> = vec![1u32; n_genomes].into(); let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
let mut cont = true; let mut cont = true;
if passes_all(filters, &all_present, n_genomes) {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if mphf.find(kmer).is_some() { if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
cont = cb(kmer, all_present.clone()); cont = cb(kmer, all_present.clone());
if !cont { break; } if !cont { break; }
} }
} }
}
cont cont
}; };
@@ -140,7 +141,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row = mat.row(slot); let row = mat.row(slot);
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(part, layer, kmer, row); cont = cb(part, layer, kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -153,7 +154,7 @@ impl KmerPartition {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if let Some(slot) = mphf.find(kmer) { if let Some(slot) = mphf.find(kmer) {
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect(); let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
if passes_all(filters, &row, n_genomes) { if passes_all(filters, kmer, &row, n_genomes) {
cont = cb(part, layer, kmer, row); cont = cb(part, layer, kmer, row);
if !cont { break; } if !cont { break; }
} }
@@ -161,16 +162,17 @@ impl KmerPartition {
} }
cont cont
} else { } else {
// Same as iter_partition_kmers: row is constant but a filter
// may still depend on the kmer's own sequence, so this must
// be tested per kmer, not once for the whole layer.
let all_present: Box<[u32]> = vec![1u32; n_genomes].into(); let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
let mut cont = true; let mut cont = true;
if passes_all(filters, &all_present, n_genomes) {
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() { for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
if mphf.find(kmer).is_some() { if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
cont = cb(part, layer, kmer, all_present.clone()); cont = cb(part, layer, kmer, all_present.clone());
if !cont { break; } if !cont { break; }
} }
} }
}
cont cont
}; };
+49 -13
View File
@@ -1,17 +1,24 @@
use obicompactvec::FilterMask; use obicompactvec::FilterMask;
use obikseq::CanonicalKmer;
/// Trait for kmer row filters. /// Trait for kmer filters.
/// ///
/// `kmer` is the k-mer's own canonical sequence, reconstructed from the
/// source index's `unitigs.bin` (always present — see `rebuild_layer.rs`);
/// `row` contains raw per-genome counts (or 0/1 for presence/absence data). /// `row` contains raw per-genome counts (or 0/1 for presence/absence data).
/// `n_genomes` equals `row.len()`. /// `n_genomes` equals `row.len()`. Most filters only need `row` — `kmer` is
/// there for filters that reason about the k-mer's sequence itself (e.g.
/// [`MinComplexity`]).
pub trait KmerFilter: Send + Sync { pub trait KmerFilter: Send + Sync {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool; fn passes(&self, kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool;
/// Express this filter as a [`FilterMask`] column-operation expression. /// Express this filter as a [`FilterMask`] column-operation expression.
/// ///
/// Returns `Some(expr)` if the filter can be evaluated solely from matrix /// Returns `Some(expr)` if the filter can be evaluated solely from matrix
/// column aggregates (no per-kmer row scan needed). Returns `None` if the /// column aggregates (no per-kmer row scan needed). Returns `None` if the
/// filter requires row-level inspection. /// filter requires row-level inspection — always the case for a filter
/// that needs the k-mer's sequence, since a `FilterMask` only expresses
/// per-genome column aggregates, never per-slot sequence data.
/// ///
/// `threshold` semantics in the returned mask use `>= threshold`, matching /// `threshold` semantics in the returned mask use `>= threshold`, matching
/// [`obicompactvec::MatrixGroupOps`]. Implementations must add 1 to any /// [`obicompactvec::MatrixGroupOps`]. Implementations must add 1 to any
@@ -23,8 +30,13 @@ pub trait KmerFilter: Send + Sync {
/// True when `row` passes every filter in `filters`. /// True when `row` passes every filter in `filters`.
/// Returns `true` if `filters` is empty. /// Returns `true` if `filters` is empty.
pub fn passes_all(filters: &[Box<dyn KmerFilter>], row: &[u32], n_genomes: usize) -> bool { pub fn passes_all(
filters.iter().all(|f| f.passes(row, n_genomes)) filters: &[Box<dyn KmerFilter>],
kmer: CanonicalKmer,
row: &[u32],
n_genomes: usize,
) -> bool {
filters.iter().all(|f| f.passes(kmer, row, n_genomes))
} }
// ── Quorum filters ───────────────────────────────────────────────────────────── // ── Quorum filters ─────────────────────────────────────────────────────────────
@@ -40,7 +52,7 @@ pub struct MinGenomeFraction {
} }
impl KmerFilter for MinGenomeFraction { impl KmerFilter for MinGenomeFraction {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool {
let p = present_count(row, self.threshold); let p = present_count(row, self.threshold);
p as f64 / n_genomes as f64 >= self.frac p as f64 / n_genomes as f64 >= self.frac
} }
@@ -63,7 +75,7 @@ pub struct MaxGenomeFraction {
} }
impl KmerFilter for MaxGenomeFraction { impl KmerFilter for MaxGenomeFraction {
fn passes(&self, row: &[u32], n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool {
let p = present_count(row, self.threshold); let p = present_count(row, self.threshold);
p as f64 / n_genomes as f64 <= self.frac p as f64 / n_genomes as f64 <= self.frac
} }
@@ -86,7 +98,7 @@ pub struct MinGenomeCount {
} }
impl KmerFilter for MinGenomeCount { impl KmerFilter for MinGenomeCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
present_count(row, self.threshold) >= self.count present_count(row, self.threshold) >= self.count
} }
@@ -107,7 +119,7 @@ pub struct MaxGenomeCount {
} }
impl KmerFilter for MaxGenomeCount { impl KmerFilter for MaxGenomeCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
present_count(row, self.threshold) <= self.count present_count(row, self.threshold) <= self.count
} }
@@ -129,7 +141,7 @@ pub struct MinTotalCount {
} }
impl KmerFilter for MinTotalCount { impl KmerFilter for MinTotalCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
row.iter().sum::<u32>() >= self.total row.iter().sum::<u32>() >= self.total
} }
@@ -147,7 +159,7 @@ pub struct MaxTotalCount {
} }
impl KmerFilter for MaxTotalCount { impl KmerFilter for MaxTotalCount {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
row.iter().sum::<u32>() <= self.total row.iter().sum::<u32>() <= self.total
} }
@@ -212,7 +224,7 @@ impl GroupQuorumFilter {
} }
impl KmerFilter for GroupQuorumFilter { impl KmerFilter for GroupQuorumFilter {
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool { fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
if !self.ingroup_idx.is_empty() { if !self.ingroup_idx.is_empty() {
let n = self.ingroup_idx.iter() let n = self.ingroup_idx.iter()
.filter(|&&i| row.get(i).copied().unwrap_or(0) > self.threshold) .filter(|&&i| row.get(i).copied().unwrap_or(0) > self.threshold)
@@ -260,3 +272,27 @@ impl KmerFilter for GroupQuorumFilter {
Some(FilterMask::And(parts)) Some(FilterMask::And(parts))
} }
} }
// ── Complexity filter (post-hoc, sequence-based) ──────────────────────────────
/// Reject k-mers with normalized entropy below `theta` — the same complexity
/// metric `obikmer index`'s `--theta`/`--level-max` apply *during* superkmer
/// construction (see [`obikentropy::KmerEntropy`]), applied here after the
/// fact, to k-mers already committed to a built index.
///
/// Unlike every other filter in this module, this one needs the k-mer's own
/// sequence, not its per-genome row — `column_mask_expr` is never overridden
/// (stays `None`), so this filter always forces the row-level scan path in
/// `rebuild_layer.rs` (which reconstructs the sequence from `unitigs.bin`
/// regardless, so no extra I/O beyond what filtering already requires).
pub struct MinComplexity {
pub level_max: usize,
pub theta: f64,
}
impl KmerFilter for MinComplexity {
fn passes(&self, kmer: CanonicalKmer, _row: &[u32], _n_genomes: usize) -> bool {
use obikentropy::KmerEntropy;
kmer.entropy(self.level_max) >= self.theta
}
}
+1
View File
@@ -14,4 +14,5 @@ mod select_layer;
pub use filter::{GroupQuorumFilter, KmerFilter, passes_all}; pub use filter::{GroupQuorumFilter, KmerFilter, passes_all};
pub use merge_layer::MergeMode; pub use merge_layer::MergeMode;
pub use partition::{KmerPartition, KmerSpectrum, PARTITIONS_SUBDIR}; pub use partition::{KmerPartition, KmerSpectrum, PARTITIONS_SUBDIR};
pub use query_layer::{KmerDesc, QueryHit, QueryStats};
pub use select_layer::{AggOp, OutputCol}; pub use select_layer::{AggOp, OutputCol};
+142 -83
View File
@@ -1,7 +1,8 @@
use std::collections::HashMap;
use std::path::Path; use std::path::Path;
use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix}; use obicompactvec::{PersistentBitMatrix, PersistentCompactIntMatrix};
use obikseq::{CanonicalKmer, RoutableSuperKmer}; use obikseq::CanonicalKmer;
use obiskio::{SKError, SKResult}; use obiskio::{SKError, SKResult};
use obilayeredmap::{IndexMode, MphfLayer, OLMError}; use obilayeredmap::{IndexMode, MphfLayer, OLMError};
use obilayeredmap::meta::PartitionMeta; use obilayeredmap::meta::PartitionMeta;
@@ -44,53 +45,133 @@ impl QueryLayer {
} }
} }
/// Write per-genome values into `buf` if `kmer` is indexed; returns true on hit. /// MPHF lookup only — no matrix access. `Some(slot)` on hit.
fn find_into(&self, kmer: CanonicalKmer, n_genomes: usize, buf: &mut [u32]) -> bool { fn find_slot(&self, kmer: CanonicalKmer) -> Option<usize> {
match self { match self {
QueryLayer::Presence(mphf, mat) => { QueryLayer::Presence(mphf, _) | QueryLayer::Count(mphf, _) => mphf.find(kmer),
if let Some(slot) = mphf.find(kmer) {
mat.fill_row(slot, &mut buf[..n_genomes]);
true
} else {
false
} }
} }
QueryLayer::Count(mphf, mat) => {
if let Some(slot) = mphf.find(kmer) { /// Number of genome columns this layer's matrix actually has. Bounds
mat.fill_row(slot, &mut buf[..n_genomes]); /// column-major iteration — usually equal to the index's `n_genomes`, but
true /// `PersistentBitMatrix::Implicit` (the documented mono-genome fast path)
} else { /// always reports exactly `1`, regardless of the index's real genome
false /// count, so callers must use this rather than assuming `n_genomes`.
fn n_cols(&self) -> usize {
match self {
QueryLayer::Presence(_, mat) => mat.n_cols(),
QueryLayer::Count(_, mat) => mat.n_cols(),
} }
} }
/// Column-major point lookup: value for genome column `g` at `slot`.
/// `g` must be `< self.n_cols()`; `slot` must come from [`find_slot`] on
/// this same layer.
fn col_value(&self, g: usize, slot: usize) -> u32 {
match self {
QueryLayer::Presence(_, mat) => mat.get(g, slot),
QueryLayer::Count(_, mat) => mat.col_view(g).get(slot),
} }
} }
} }
// ── KmerPartition::query_partition* ────────────────────────────────────────── // ── KmerDesc — one occurrence of a k-mer in the query batch ──────────────────
/// Describes one occurrence of a (deduplicated) k-mer in the query batch:
/// which sequence it came from, and its absolute s-mer position within it.
#[derive(Debug, Clone, Copy)]
pub struct KmerDesc {
pub seq_idx: u32,
pub pos: u32,
}
/// Aggregate counters for one `query_partition_with` call — feeds the
/// dedup-ratio and column-scan logging in `obikmer::cmd::query` (occurrences
/// vs. unique k-mers is the whole justification for k-mer-level
/// dereplication; columns scanned / `get()` calls quantify the column-major
/// fetch's locality claim).
#[derive(Debug, Default, Clone, Copy, PartialEq, Eq)]
pub struct QueryStats {
/// Distinct canonical k-mers queried in this partition.
pub n_unique_kmers: usize,
/// Total `MphfLayer::find` calls issued (a k-mer tried against more than
/// one layer before a hit, or against all layers on a miss, counts once
/// per layer attempted).
pub n_mphf_calls: usize,
/// Distinct canonical k-mers that matched some layer.
pub n_hits: usize,
/// Total genome columns scanned across all hit layers (sum of
/// `layer.n_cols()` over layers with at least one hit).
pub n_columns_scanned: usize,
/// Total `col_value` calls issued during the column-major fetch pass
/// (`n_columns_scanned` × hits-per-layer, summed over layers).
pub n_col_get_calls: usize,
}
impl std::ops::AddAssign for QueryStats {
fn add_assign(&mut self, other: Self) {
self.n_unique_kmers += other.n_unique_kmers;
self.n_mphf_calls += other.n_mphf_calls;
self.n_hits += other.n_hits;
self.n_columns_scanned += other.n_columns_scanned;
self.n_col_get_calls += other.n_col_get_calls;
}
}
// ── QueryHit — one event delivered to query_partition_with's callback ───────
/// One event from [`KmerPartition::query_partition_with`]'s two-stage query:
/// a `Found` event once per hit k-mer (stage 1, MPHF-only — mark the k-mer as
/// indexed regardless of any genome's value), then a `Value` event per
/// `(hit k-mer, genome)` pair with a nonzero matrix value (stage 2,
/// column-major fetch). Carried as one enum, not two separate callbacks, so
/// the caller only needs one `FnMut` closure — passing two closures that each
/// need to mutably borrow the same accumulator does not borrow-check.
pub enum QueryHit<'a> {
Found(&'a [KmerDesc]),
Value(&'a [KmerDesc], usize, u32),
}
// ── KmerPartition::query_partition_with ──────────────────────────────────────
impl KmerPartition { impl KmerPartition {
/// Query a single partition, calling `on_hit(sk_idx, kmer_idx, row)` for /// Query a single partition for a pre-deduplicated map of canonical
/// every found k-mer without allocating intermediate result vectors. /// k-mers → their occurrences (`seq_idx`, `pos`) in the query batch.
///
/// Two stages:
/// 1. **MPHF-only pass**: for each unique k-mer, try each layer's MPHF in
/// turn (stopping at the first hit) and bucket confirmed hits by
/// `(layer, slot)`. Emits one `QueryHit::Found` per hit k-mer. This
/// stage's cost is independent of the index's genome count.
/// 2. **Column-major fetch**: for each layer with at least one hit, walk
/// its matrix **column by column** (genome by genome) — for each
/// genome, scan the slots bucketed in stage 1 and look up their value.
/// Emits one `QueryHit::Value` per nonzero `(k-mer, genome)` pair.
/// Total lookups are the same as a row-major pass (`n_hits × n_cols`
/// in the worst case); the win is memory locality — both persistent
/// matrix formats are column-oriented on disk (one `mmap`'d region per
/// genome), so scanning one column at a time touches far fewer
/// distinct mmap regions than fetching one full row per hit.
pub fn query_partition_with<F>( pub fn query_partition_with<F>(
&self, &self,
part_idx: usize, part_idx: usize,
superkmers: &[&RoutableSuperKmer], kmers: &HashMap<CanonicalKmer, Vec<KmerDesc>>,
_k: usize,
n_genomes: usize, n_genomes: usize,
with_counts: bool, with_counts: bool,
mut on_hit: F, mut on_event: F,
) -> SKResult<()> ) -> SKResult<QueryStats>
where where
F: FnMut(usize, usize, &[u32]), F: FnMut(QueryHit),
{ {
if superkmers.is_empty() { let mut stats = QueryStats::default();
return Ok(());
if kmers.is_empty() {
return Ok(stats);
} }
let index_dir = self.part_dir(part_idx).join(INDEX_SUBDIR); let index_dir = self.part_dir(part_idx).join(INDEX_SUBDIR);
if !index_dir.exists() { if !index_dir.exists() {
return Ok(()); return Ok(stats);
} }
let meta = PartitionMeta::load(&index_dir).map_err(olm_to_sk)?; let meta = PartitionMeta::load(&index_dir).map_err(olm_to_sk)?;
@@ -98,69 +179,47 @@ impl KmerPartition {
.map(|i| QueryLayer::open(&index_dir.join(format!("layer_{i}")), with_counts, &meta.mode)) .map(|i| QueryLayer::open(&index_dir.join(format!("layer_{i}")), with_counts, &meta.mode))
.collect::<SKResult<_>>()?; .collect::<SKResult<_>>()?;
let mut buf = vec![0u32; n_genomes]; // ── Stage 1: MPHF-only pass, bucket hits by (layer_idx, slot) ────────
let mut by_layer: Vec<HashMap<usize, &Vec<KmerDesc>>> =
(0..layers.len()).map(|_| HashMap::new()).collect();
for (sk_idx, rsk) in superkmers.iter().enumerate() { for (kmer, descs) in kmers {
for (kmer_idx, kmer) in rsk.superkmer().iter_canonical_kmers().enumerate() { stats.n_unique_kmers += 1;
for layer in &layers { for (layer_idx, layer) in layers.iter().enumerate() {
if layer.find_into(kmer, n_genomes, &mut buf) { stats.n_mphf_calls += 1;
on_hit(sk_idx, kmer_idx, &buf); if let Some(slot) = layer.find_slot(*kmer) {
buf.fill(0); by_layer[layer_idx].insert(slot, descs);
on_event(QueryHit::Found(descs));
stats.n_hits += 1;
break; break;
} }
} }
} }
// ── Stage 2: column-major fetch, per layer ───────────────────────────
for (layer_idx, slots) in by_layer.iter().enumerate() {
if slots.is_empty() {
continue;
}
let layer = &layers[layer_idx];
let n_cols = layer.n_cols().min(n_genomes);
stats.n_columns_scanned += n_cols;
for g in 0..n_cols {
for (&slot, descs) in slots {
stats.n_col_get_calls += 1;
let v = layer.col_value(g, slot);
if v != 0 {
on_event(QueryHit::Value(descs, g, v));
}
}
}
} }
Ok(()) Ok(stats)
}
} }
/// Query a single partition for a slice of super-kmers, returning per-kmer rows. #[cfg(test)]
/// Prefer [`query_partition_with`] to avoid per-kmer heap allocations. #[path = "tests/query_layer.rs"]
pub fn query_partition( mod tests;
&self,
part_idx: usize,
superkmers: &[&RoutableSuperKmer],
_k: usize,
n_genomes: usize,
with_counts: bool,
) -> SKResult<Vec<Vec<Option<Box<[u32]>>>>> {
if superkmers.is_empty() {
return Ok(Vec::new());
}
let index_dir = self.part_dir(part_idx).join(INDEX_SUBDIR);
if !index_dir.exists() {
return Ok(superkmers
.iter()
.map(|rsk| vec![None; rsk.seql()])
.collect());
}
let meta = PartitionMeta::load(&index_dir).map_err(olm_to_sk)?;
let layers: Vec<QueryLayer> = (0..meta.n_layers)
.map(|i| QueryLayer::open(&index_dir.join(format!("layer_{i}")), with_counts, &meta.mode))
.collect::<SKResult<_>>()?;
let mut buf = vec![0u32; n_genomes];
Ok(superkmers
.iter()
.map(|rsk| {
rsk.superkmer()
.iter_canonical_kmers()
.map(|kmer| {
for layer in &layers {
if layer.find_into(kmer, n_genomes, &mut buf) {
let row: Box<[u32]> = buf[..n_genomes].into();
buf.fill(0);
return Some(row);
}
}
None
})
.collect()
})
.collect())
}
}
+2 -2
View File
@@ -126,7 +126,7 @@ fn iter_src_kmers_masked(
Some(m) => m.get(slot), Some(m) => m.get(slot),
None => { None => {
let row = src_data.fill_row_by_slot(slot, n_genomes); let row = src_data.fill_row_by_slot(slot, n_genomes);
filters.iter().all(|f| f.passes(&row, n_genomes)) filters.iter().all(|f| f.passes(kmer, &row, n_genomes))
} }
}; };
if passes { cb(kmer); } if passes { cb(kmer); }
@@ -165,7 +165,7 @@ fn iter_src_layers(
cb(kmer, row.into_boxed_slice()); cb(kmer, row.into_boxed_slice());
} else { } else {
let row = src_data.fill_row_by_slot(slot, n_genomes); let row = src_data.fill_row_by_slot(slot, n_genomes);
if filters.iter().all(|f| f.passes(&row, n_genomes)) { if filters.iter().all(|f| f.passes(kmer, &row, n_genomes)) {
cb(kmer, row.into_boxed_slice()); cb(kmer, row.into_boxed_slice());
} }
} }
@@ -0,0 +1,79 @@
use super::*;
// ── QueryStats::AddAssign ───────────────────────────────────────────────────
#[test]
fn query_stats_add_assign_sums_fields() {
let mut total = QueryStats {
n_unique_kmers: 3,
n_mphf_calls: 5,
n_hits: 2,
n_columns_scanned: 1,
n_col_get_calls: 7,
};
total += QueryStats {
n_unique_kmers: 1,
n_mphf_calls: 4,
n_hits: 1,
n_columns_scanned: 2,
n_col_get_calls: 3,
};
assert_eq!(total.n_unique_kmers, 4);
assert_eq!(total.n_mphf_calls, 9);
assert_eq!(total.n_hits, 3);
assert_eq!(total.n_columns_scanned, 3);
assert_eq!(total.n_col_get_calls, 10);
}
#[test]
fn query_stats_default_is_zero() {
let s = QueryStats::default();
assert_eq!(s.n_unique_kmers, 0);
assert_eq!(s.n_mphf_calls, 0);
assert_eq!(s.n_hits, 0);
assert_eq!(s.n_columns_scanned, 0);
assert_eq!(s.n_col_get_calls, 0);
}
// ── query_partition_with on a not-yet-indexed partition ─────────────────────
/// A `KmerPartition` created but never taken through `build_layers` has no
/// `index/` subdirectory under any partition — `query_partition_with` must
/// recognise this and return default (all-zero) stats rather than erroring,
/// exactly like an empty `kmers` map.
#[test]
fn query_partition_with_missing_index_dir_returns_default_stats() {
let tmp = tempfile::tempdir().expect("tempdir");
let partition = KmerPartition::create(tmp.path().join("idx"), 2, 21, 9, false)
.expect("create partition");
let mut kmers: HashMap<CanonicalKmer, Vec<KmerDesc>> = HashMap::new();
// Any well-formed canonical k-mer works here — the call must return
// before ever attempting an MPHF lookup, since `index/` doesn't exist.
let kmer = CanonicalKmer::from_raw_unchecked(0u64);
kmers.insert(kmer, vec![KmerDesc { seq_idx: 0, pos: 0 }]);
let stats = partition
.query_partition_with(0, &kmers, 1, false, |_event| {
panic!("on_event must not be called: no index was built");
})
.expect("query_partition_with should not error on a missing index dir");
assert_eq!(stats, QueryStats::default());
}
#[test]
fn query_partition_with_empty_kmers_is_a_noop() {
let tmp = tempfile::tempdir().expect("tempdir");
let partition = KmerPartition::create(tmp.path().join("idx"), 2, 21, 9, false)
.expect("create partition");
let kmers: HashMap<CanonicalKmer, Vec<KmerDesc>> = HashMap::new();
let stats = partition
.query_partition_with(0, &kmers, 1, false, |_event| {
panic!("on_event must not be called on an empty kmer map");
})
.expect("query_partition_with on an empty map should not error");
assert_eq!(stats, QueryStats::default());
}
+21
View File
@@ -341,6 +341,27 @@ impl<L: KmerLength> CanonicalKmerOf<L> {
] ]
} }
/// Return the four central canonical neighbours (each already canonical),
/// substituting the base at the middle position `m = (L::len()-1)/2`
/// (well-defined for odd `L::len()`). Each of the 4 substitutions is
/// canonicalised independently — this correctly handles the case where a
/// substitution flips the canonical orientation, unlike inferring the
/// variant from a fixed-orientation flank key. One of the 4 equals
/// `self`'s own canonical form (the identity substitution); callers that
/// only want the 3 genuine variants should skip it.
pub fn central_canonical_neighbors(&self) -> [CanonicalKmerOf<L>; 4] {
let k = L::len();
let m = (k - 1) / 2;
let shift = KMER_BITS - 2 - 2 * m;
let cleared = self.0 & !((0b11 as RawKmer) << shift);
[
KmerOf::<L>(cleared | ((0 as RawKmer) << shift), PhantomData).canonical(),
KmerOf::<L>(cleared | ((1 as RawKmer) << shift), PhantomData).canonical(),
KmerOf::<L>(cleared | ((2 as RawKmer) << shift), PhantomData).canonical(),
KmerOf::<L>(cleared | ((3 as RawKmer) << shift), PhantomData).canonical(),
]
}
/// Return the inner value as a raw [`KmerOf<L>`]. /// Return the inner value as a raw [`KmerOf<L>`].
#[inline] #[inline]
pub fn into_kmer(self) -> KmerOf<L> { pub fn into_kmer(self) -> KmerOf<L> {
+42
View File
@@ -210,4 +210,46 @@ mod tests {
check!(31); check!(31);
check!(32); check!(32);
} }
// ── central_canonical_neighbors ─────────────────────────────────────────
#[test]
fn central_canonical_neighbors_hand_checked_k3() {
// k=3, centre = index 1. For "ACG", every one of the 4 central
// substitutions ("AAG","ACG","AGG","ATG") happens to stay in forward
// orientation when canonicalised (verified by hand: each is already
// lexicographically <= its own reverse complement), so this case
// exercises the substitution logic without the RC-flip edge case.
let ck = KmerOf::<ConstLen<3>>::from_ascii(b"ACG").unwrap().canonical();
let neighbours = ck.central_canonical_neighbors();
let ascii: Vec<Vec<u8>> = neighbours.iter().map(|n| n.to_ascii()).collect();
assert_eq!(ascii, vec![b"AAG".to_vec(), b"ACG".to_vec(), b"AGG".to_vec(), b"ATG".to_vec()]);
// The identity substitution (centre unchanged) must reproduce `ck`.
assert!(neighbours.contains(&ck));
}
#[test]
fn central_canonical_neighbors_identity_present_for_various_k() {
macro_rules! check {
($n:expr) => {{
let ck = KmerOf::<ConstLen<$n>>::from_ascii(&make_seq::<$n>())
.unwrap()
.canonical();
let neighbours = ck.central_canonical_neighbors();
assert!(
neighbours.contains(&ck),
"identity substitution missing from central_canonical_neighbors for k={}",
$n
);
// Every returned neighbour must itself already be canonical.
for n in &neighbours {
assert_eq!(n.into_kmer().canonical(), *n, "neighbour not canonical for k={}", $n);
}
}};
}
check!(1);
check!(3);
check!(5);
check!(31);
}
} }
+2 -159
View File
@@ -96,162 +96,5 @@ impl<S: BitPartials> BitPartials for LayeredStore<S> {
// ── Tests ───────────────────────────────────────────────────────────────────── // ── Tests ─────────────────────────────────────────────────────────────────────
#[cfg(test)] #[cfg(test)]
mod tests { #[path = "tests/layered_store.rs"]
use super::*; mod tests;
use obicompactvec::{
PersistentBitMatrix, PersistentBitMatrixBuilder,
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder,
};
use tempfile::tempdir;
fn make_int_matrix(cols: &[&[u32]]) -> (tempfile::TempDir, PersistentCompactIntMatrix) {
let n = cols.first().map_or(0, |c| c.len());
let dir = tempdir().unwrap();
let mut b = PersistentCompactIntMatrixBuilder::new(n, &dir.path().join("counts")).unwrap();
for &col in cols {
let mut cb = b.add_col().unwrap();
for (slot, &v) in col.iter().enumerate() { cb.set(slot, v); }
cb.close().unwrap();
}
b.close().unwrap();
let m = PersistentCompactIntMatrix::open(dir.path()).unwrap();
(dir, m)
}
fn make_bit_matrix(cols: &[&[bool]]) -> (tempfile::TempDir, PersistentBitMatrix) {
let n = cols.first().map_or(0, |c| c.len());
let dir = tempdir().unwrap();
let mut b = PersistentBitMatrixBuilder::new(n, &dir.path().join("presence")).unwrap();
for &col in cols {
let mut cb = b.add_col().unwrap();
for (slot, &v) in col.iter().enumerate() { cb.set(slot, v); }
cb.close().unwrap();
}
b.close().unwrap();
let m = PersistentBitMatrix::open(dir.path()).unwrap();
(dir, m)
}
// ── ColumnWeights ─────────────────────────────────────────────────────────
#[test]
fn col_weights_sums_across_layers() {
// layer 0: col0=[1,2], col1=[3,4] → weights [3, 7]
// layer 1: col0=[10,0], col1=[0,10] → weights [10, 10]
// combined: [13, 17]
let (_d0, m0) = make_int_matrix(&[&[1, 2], &[3, 4]]);
let (_d1, m1) = make_int_matrix(&[&[10, 0], &[0, 10]]);
let store = LayeredStore::new(vec![m0, m1]);
let w = store.col_weights();
assert_eq!(w[0], 13);
assert_eq!(w[1], 17);
}
#[test]
fn col_weights_bit_sums_across_layers() {
// layer 0: col0=[T,F,T], col1=[F,T,T] → counts [2, 2]
// layer 1: col0=[F,F,T], col1=[T,T,F] → counts [1, 2]
// combined: [3, 4]
let (_d0, m0) = make_bit_matrix(&[&[true, false, true], &[false, true, true]]);
let (_d1, m1) = make_bit_matrix(&[&[false, false, true], &[true, true, false]]);
let store = LayeredStore::new(vec![m0, m1]);
let w = store.col_weights();
assert_eq!(w[0], 3);
assert_eq!(w[1], 4);
}
// ── CountPartials — layered (one partition) ───────────────────────────────
#[test]
fn layered_bray_matches_combined() {
// Split [1,2,3,4,5] across two layers; bray dist should equal direct computation
// on [1,2,3,4,5] for each column pair.
// col0=[1,2,3,4,5], col1=[5,4,3,2,1]
let (_d0, m0) = make_int_matrix(&[&[1, 2], &[5, 4]]); // slots 0-1
let (_d1, m1) = make_int_matrix(&[&[3, 4, 5], &[3, 2, 1]]); // slots 2-4
let store = LayeredStore::new(vec![m0, m1]);
// direct on full data
let (_df, mf) = make_int_matrix(&[&[1, 2, 3, 4, 5], &[5, 4, 3, 2, 1]]);
let expected = CountPartials::bray_dist_matrix(&mf);
let got = CountPartials::bray_dist_matrix(&store);
assert!((got[[0, 1]] - expected[[0, 1]]).abs() < 1e-12, "bray [0,1]");
assert!((got[[1, 0]] - expected[[1, 0]]).abs() < 1e-12, "bray [1,0]");
}
#[test]
fn layered_relfreq_bray_matches_combined() {
let (_d0, m0) = make_int_matrix(&[&[1, 2], &[5, 4]]);
let (_d1, m1) = make_int_matrix(&[&[3, 4, 5], &[3, 2, 1]]);
let store = LayeredStore::new(vec![m0, m1]);
let (_df, mf) = make_int_matrix(&[&[1, 2, 3, 4, 5], &[5, 4, 3, 2, 1]]);
let expected = CountPartials::relfreq_bray_dist_matrix(&mf);
let got = CountPartials::relfreq_bray_dist_matrix(&store);
assert!((got[[0, 1]] - expected[[0, 1]]).abs() < 1e-12, "relfreq_bray [0,1]");
}
#[test]
fn layered_euclidean_matches_combined() {
let (_d0, m0) = make_int_matrix(&[&[3, 0], &[0, 4]]);
let (_d1, m1) = make_int_matrix(&[&[1, 1], &[2, 2]]);
let store = LayeredStore::new(vec![m0, m1]);
let (_df, mf) = make_int_matrix(&[&[3, 0, 1, 1], &[0, 4, 2, 2]]);
let expected = CountPartials::euclidean_dist_matrix(&mf);
let got = CountPartials::euclidean_dist_matrix(&store);
assert!((got[[0, 1]] - expected[[0, 1]]).abs() < 1e-12, "euclidean [0,1]");
}
// ── CountPartials — partitioned (LayeredStore<LayeredStore<_>>) ───────────
#[test]
fn partitioned_bray_matches_combined() {
// partition 0: slots [1,2,3,4,5] col0 vs col1
// partition 1: slots [10,20] col0 vs col1
let (_d0, p0) = make_int_matrix(&[&[1, 2, 3, 4, 5], &[5, 4, 3, 2, 1]]);
let (_d1, p1) = make_int_matrix(&[&[10, 20], &[20, 10]]);
let partitioned = LayeredStore::new(vec![
LayeredStore::new(vec![p0]),
LayeredStore::new(vec![p1]),
]);
let (_df, mf) = make_int_matrix(&[&[1, 2, 3, 4, 5, 10, 20], &[5, 4, 3, 2, 1, 20, 10]]);
let expected = CountPartials::bray_dist_matrix(&mf);
let got = CountPartials::bray_dist_matrix(&partitioned);
assert!((got[[0, 1]] - expected[[0, 1]]).abs() < 1e-12, "partitioned bray [0,1]");
}
// ── BitPartials ───────────────────────────────────────────────────────────
#[test]
fn layered_jaccard_matches_combined() {
let (_d0, m0) = make_bit_matrix(&[&[true, false], &[false, true]]);
let (_d1, m1) = make_bit_matrix(&[&[true, true], &[true, false]]);
let store = LayeredStore::new(vec![m0, m1]);
let (_df, mf) = make_bit_matrix(&[
&[true, false, true, true],
&[false, true, true, false],
]);
let expected = BitPartials::jaccard_dist_matrix(&mf);
let got = BitPartials::jaccard_dist_matrix(&store);
assert!((got[[0, 1]] - expected[[0, 1]]).abs() < 1e-12, "jaccard [0,1]");
}
#[test]
fn layered_hamming_matches_combined() {
let (_d0, m0) = make_bit_matrix(&[&[true, false], &[false, true]]);
let (_d1, m1) = make_bit_matrix(&[&[true, true], &[false, false]]);
let store = LayeredStore::new(vec![m0, m1]);
let (_df, mf) = make_bit_matrix(&[
&[true, false, true, true],
&[false, true, false, false],
]);
let expected = BitPartials::hamming_dist_matrix(&mf);
let got = BitPartials::hamming_dist_matrix(&store);
assert_eq!(got[[0, 1]], expected[[0, 1]], "hamming [0,1]");
}
}
@@ -0,0 +1,381 @@
use super::*;
use obicompactvec::{
PersistentBitMatrix, PersistentBitMatrixBuilder,
PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder,
};
use tempfile::tempdir;
fn make_int_matrix(cols: &[&[u32]]) -> (tempfile::TempDir, PersistentCompactIntMatrix) {
let n = cols.first().map_or(0, |c| c.len());
let dir = tempdir().unwrap();
let mut b = PersistentCompactIntMatrixBuilder::new(n, &dir.path().join("counts")).unwrap();
for &col in cols {
let mut cb = b.add_col().unwrap();
for (slot, &v) in col.iter().enumerate() { cb.set(slot, v); }
cb.close().unwrap();
}
b.close().unwrap();
let m = PersistentCompactIntMatrix::open(dir.path()).unwrap();
(dir, m)
}
fn make_bit_matrix(cols: &[&[bool]]) -> (tempfile::TempDir, PersistentBitMatrix) {
let n = cols.first().map_or(0, |c| c.len());
let dir = tempdir().unwrap();
let mut b = PersistentBitMatrixBuilder::new(n, &dir.path().join("presence")).unwrap();
for &col in cols {
let mut cb = b.add_col().unwrap();
for (slot, &v) in col.iter().enumerate() { cb.set(slot, v); }
cb.close().unwrap();
}
b.close().unwrap();
let m = PersistentBitMatrix::open(dir.path()).unwrap();
(dir, m)
}
// ── ColumnWeights ─────────────────────────────────────────────────────────
#[test]
fn col_weights_sums_across_layers() {
// layer 0: col0=[1,2], col1=[3,4] → weights [3, 7]
// layer 1: col0=[10,0], col1=[0,10] → weights [10, 10]
// combined: [13, 17]
let (_d0, m0) = make_int_matrix(&[&[1, 2], &[3, 4]]);
let (_d1, m1) = make_int_matrix(&[&[10, 0], &[0, 10]]);
let store = LayeredStore::new(vec![m0, m1]);
let w = store.col_weights();
assert_eq!(w[0], 13);
assert_eq!(w[1], 17);
}
#[test]
fn col_weights_bit_sums_across_layers() {
// layer 0: col0=[T,F,T], col1=[F,T,T] → counts [2, 2]
// layer 1: col0=[F,F,T], col1=[T,T,F] → counts [1, 2]
// combined: [3, 4]
let (_d0, m0) = make_bit_matrix(&[&[true, false, true], &[false, true, true]]);
let (_d1, m1) = make_bit_matrix(&[&[false, false, true], &[true, true, false]]);
let store = LayeredStore::new(vec![m0, m1]);
let w = store.col_weights();
assert_eq!(w[0], 3);
assert_eq!(w[1], 4);
}
// ── CountPartials — layered (one partition) ───────────────────────────────
#[test]
fn layered_bray_matches_combined() {
// Split [1,2,3,4,5] across two layers; bray dist should equal direct computation
// on [1,2,3,4,5] for each column pair.
// col0=[1,2,3,4,5], col1=[5,4,3,2,1]
let (_d0, m0) = make_int_matrix(&[&[1, 2], &[5, 4]]); // slots 0-1
let (_d1, m1) = make_int_matrix(&[&[3, 4, 5], &[3, 2, 1]]); // slots 2-4
let store = LayeredStore::new(vec![m0, m1]);
// direct on full data
let (_df, mf) = make_int_matrix(&[&[1, 2, 3, 4, 5], &[5, 4, 3, 2, 1]]);
let expected = CountPartials::bray_dist_matrix(&mf);
let got = CountPartials::bray_dist_matrix(&store);
assert!((got[[0, 1]] - expected[[0, 1]]).abs() < 1e-12, "bray [0,1]");
assert!((got[[1, 0]] - expected[[1, 0]]).abs() < 1e-12, "bray [1,0]");
}
#[test]
fn layered_relfreq_bray_matches_combined() {
let (_d0, m0) = make_int_matrix(&[&[1, 2], &[5, 4]]);
let (_d1, m1) = make_int_matrix(&[&[3, 4, 5], &[3, 2, 1]]);
let store = LayeredStore::new(vec![m0, m1]);
let (_df, mf) = make_int_matrix(&[&[1, 2, 3, 4, 5], &[5, 4, 3, 2, 1]]);
let expected = CountPartials::relfreq_bray_dist_matrix(&mf);
let got = CountPartials::relfreq_bray_dist_matrix(&store);
assert!((got[[0, 1]] - expected[[0, 1]]).abs() < 1e-12, "relfreq_bray [0,1]");
}
#[test]
fn layered_euclidean_matches_combined() {
let (_d0, m0) = make_int_matrix(&[&[3, 0], &[0, 4]]);
let (_d1, m1) = make_int_matrix(&[&[1, 1], &[2, 2]]);
let store = LayeredStore::new(vec![m0, m1]);
let (_df, mf) = make_int_matrix(&[&[3, 0, 1, 1], &[0, 4, 2, 2]]);
let expected = CountPartials::euclidean_dist_matrix(&mf);
let got = CountPartials::euclidean_dist_matrix(&store);
assert!((got[[0, 1]] - expected[[0, 1]]).abs() < 1e-12, "euclidean [0,1]");
}
// ── CountPartials — partitioned (LayeredStore<LayeredStore<_>>) ───────────
#[test]
fn partitioned_bray_matches_combined() {
// partition 0: slots [1,2,3,4,5] col0 vs col1
// partition 1: slots [10,20] col0 vs col1
let (_d0, p0) = make_int_matrix(&[&[1, 2, 3, 4, 5], &[5, 4, 3, 2, 1]]);
let (_d1, p1) = make_int_matrix(&[&[10, 20], &[20, 10]]);
let partitioned = LayeredStore::new(vec![
LayeredStore::new(vec![p0]),
LayeredStore::new(vec![p1]),
]);
let (_df, mf) = make_int_matrix(&[&[1, 2, 3, 4, 5, 10, 20], &[5, 4, 3, 2, 1, 20, 10]]);
let expected = CountPartials::bray_dist_matrix(&mf);
let got = CountPartials::bray_dist_matrix(&partitioned);
assert!((got[[0, 1]] - expected[[0, 1]]).abs() < 1e-12, "partitioned bray [0,1]");
}
#[test]
fn partitioned_threshold_jaccard_off_diagonal_is_pairwise() {
// 3 genomes, 2 partitions, 1 layer each — mirrors distance.rs's
// LayeredStore<LayeredStore<PersistentCompactIntMatrix>> shape.
// partition 0: col0=[3,0], col1=[0,3], col2=[3,3]
// partition 1: col0=[1,1], col1=[1,0], col2=[0,1]
let (_d0, p0) = make_int_matrix(&[&[3, 0], &[0, 3], &[3, 3]]);
let (_d1, p1) = make_int_matrix(&[&[1, 1], &[1, 0], &[0, 1]]);
let partitioned = LayeredStore::new(vec![
LayeredStore::new(vec![p0]),
LayeredStore::new(vec![p1]),
]);
let (_df, mf) = make_int_matrix(&[&[3, 0, 1, 1], &[0, 3, 1, 0], &[3, 3, 0, 1]]);
let threshold = 1u32;
let (inter_p, union_p) = CountPartials::partial_threshold_jaccard(&partitioned, threshold);
let (inter_f, union_f) = CountPartials::partial_threshold_jaccard(&mf, threshold);
let n = 3;
for i in 0..n {
for j in 0..n {
assert_eq!(inter_p[[i, j]], inter_f[[i, j]], "inter[{i},{j}]");
assert_eq!(union_p[[i, j]], union_f[[i, j]], "union[{i},{j}]");
}
}
}
#[test]
fn partitioned_threshold_jaccard_packed_off_diagonal_is_pairwise() {
// Same as `partitioned_threshold_jaccard_off_diagonal_is_pairwise` but
// each partition matrix is packed into a single .pcmx file first —
// the on-disk format actually used in production after `pack_matrices`.
use obicompactvec::pack_compact_int_matrix;
let (d0, _p0) = make_int_matrix(&[&[3, 0], &[0, 3], &[3, 3]]);
pack_compact_int_matrix(&d0.path().join("counts")).unwrap();
let p0 = PersistentCompactIntMatrix::open(d0.path()).unwrap();
let (d1, _p1) = make_int_matrix(&[&[1, 1], &[1, 0], &[0, 1]]);
pack_compact_int_matrix(&d1.path().join("counts")).unwrap();
let p1 = PersistentCompactIntMatrix::open(d1.path()).unwrap();
let partitioned = LayeredStore::new(vec![
LayeredStore::new(vec![p0]),
LayeredStore::new(vec![p1]),
]);
let (_df, mf) = make_int_matrix(&[&[3, 0, 1, 1], &[0, 3, 1, 0], &[3, 3, 0, 1]]);
let threshold = 1u32;
let (inter_p, union_p) = CountPartials::partial_threshold_jaccard(&partitioned, threshold);
let (inter_f, union_f) = CountPartials::partial_threshold_jaccard(&mf, threshold);
let n = 3;
for i in 0..n {
for j in 0..n {
assert_eq!(inter_p[[i, j]], inter_f[[i, j]], "inter[{i},{j}]");
assert_eq!(union_p[[i, j]], union_f[[i, j]], "union[{i},{j}]");
}
}
}
#[test]
fn partitioned_multilayer_threshold_jaccard_off_diagonal_is_pairwise() {
// 2 partitions, 2 layers each — the shape production indexes actually
// have (MPHF collision layers within a partition).
// partition 0, layer 0: col0=[3,0], col1=[0,3], col2=[3,3]
// partition 0, layer 1: col0=[2,0], col1=[0,0], col2=[2,0]
// partition 1, layer 0: col0=[1,1], col1=[1,0], col2=[0,1]
// partition 1, layer 1: col0=[0,5], col1=[5,5], col2=[0,0]
let (_d0a, p0a) = make_int_matrix(&[&[3, 0], &[0, 3], &[3, 3]]);
let (_d0b, p0b) = make_int_matrix(&[&[2, 0], &[0, 0], &[2, 0]]);
let (_d1a, p1a) = make_int_matrix(&[&[1, 1], &[1, 0], &[0, 1]]);
let (_d1b, p1b) = make_int_matrix(&[&[0, 5], &[5, 5], &[0, 0]]);
let partitioned = LayeredStore::new(vec![
LayeredStore::new(vec![p0a, p0b]),
LayeredStore::new(vec![p1a, p1b]),
]);
// Flattened equivalent: concatenate every layer's slots into one matrix.
let (_df, mf) = make_int_matrix(&[
&[3, 0, 2, 0, 1, 1, 0, 5],
&[0, 3, 0, 0, 1, 0, 5, 5],
&[3, 3, 2, 0, 0, 1, 0, 0],
]);
let threshold = 1u32;
let (inter_p, union_p) = CountPartials::partial_threshold_jaccard(&partitioned, threshold);
let (inter_f, union_f) = CountPartials::partial_threshold_jaccard(&mf, threshold);
let n = 3;
for i in 0..n {
for j in 0..n {
assert_eq!(inter_p[[i, j]], inter_f[[i, j]], "inter[{i},{j}]");
assert_eq!(union_p[[i, j]], union_f[[i, j]], "union[{i},{j}]");
}
}
}
// ── BitPartials ───────────────────────────────────────────────────────────
#[test]
fn layered_jaccard_matches_combined() {
let (_d0, m0) = make_bit_matrix(&[&[true, false], &[false, true]]);
let (_d1, m1) = make_bit_matrix(&[&[true, true], &[true, false]]);
let store = LayeredStore::new(vec![m0, m1]);
let (_df, mf) = make_bit_matrix(&[
&[true, false, true, true],
&[false, true, true, false],
]);
let expected = BitPartials::jaccard_dist_matrix(&mf);
let got = BitPartials::jaccard_dist_matrix(&store);
assert!((got[[0, 1]] - expected[[0, 1]]).abs() < 1e-12, "jaccard [0,1]");
}
#[test]
fn layered_hamming_matches_combined() {
let (_d0, m0) = make_bit_matrix(&[&[true, false], &[false, true]]);
let (_d1, m1) = make_bit_matrix(&[&[true, true], &[false, false]]);
let store = LayeredStore::new(vec![m0, m1]);
let (_df, mf) = make_bit_matrix(&[
&[true, false, true, true],
&[false, true, false, false],
]);
let expected = BitPartials::hamming_dist_matrix(&mf);
let got = BitPartials::hamming_dist_matrix(&store);
assert_eq!(got[[0, 1]], expected[[0, 1]], "hamming [0,1]");
}
#[test]
fn partitioned_bit_jaccard_off_diagonal_is_pairwise() {
// Same shape as the count-based `partitioned_multilayer_threshold_jaccard_*`
// tests, but for the presence/bit path (`with_counts = false` — what
// `all_specifics` actually uses in production).
// 4 genomes, 3 partitions, 2 layers in the last one.
let (_d0, p0) = make_bit_matrix(&[
&[true, false, true],
&[false, true, true],
&[true, true, false],
&[false, false, true],
]);
let (_d1, p1) = make_bit_matrix(&[
&[true, true],
&[false, true],
&[true, false],
&[true, true],
]);
let (_d2a, p2a) = make_bit_matrix(&[
&[false, true],
&[true, true],
&[false, false],
&[true, false],
]);
let (_d2b, p2b) = make_bit_matrix(&[
&[true],
&[false],
&[true],
&[true],
]);
let partitioned = LayeredStore::new(vec![
LayeredStore::new(vec![p0]),
LayeredStore::new(vec![p1]),
LayeredStore::new(vec![p2a, p2b]),
]);
// Flattened equivalent: concatenate every partition/layer's slots.
let (_df, mf) = make_bit_matrix(&[
&[true, false, true, true, true, false, true, true],
&[false, true, true, false, true, true, true, false],
&[true, true, false, true, false, false, false, true],
&[false, false, true, true, true, true, false, true],
]);
let (inter_p, union_p) = BitPartials::partial_jaccard(&partitioned);
let (inter_f, union_f) = BitPartials::partial_jaccard(&mf);
let n = 4;
for i in 0..n {
for j in 0..n {
assert_eq!(inter_p[[i, j]], inter_f[[i, j]], "inter[{i},{j}]");
assert_eq!(union_p[[i, j]], union_f[[i, j]], "union[{i},{j}]");
}
}
}
#[test]
fn partitioned_bit_jaccard_packed_off_diagonal_is_pairwise() {
// Same as `partitioned_bit_jaccard_off_diagonal_is_pairwise` but every
// partition's presence matrix is packed into a single .pbmx file —
// the on-disk format actually used in production after `pack_matrices`.
use obicompactvec::pack_bit_matrix;
let (d0, _p0) = make_bit_matrix(&[
&[true, false, true],
&[false, true, true],
&[true, true, false],
&[false, false, true],
]);
pack_bit_matrix(&d0.path().join("presence")).unwrap();
let p0 = PersistentBitMatrix::open(d0.path()).unwrap();
let (d1, _p1) = make_bit_matrix(&[
&[true, true],
&[false, true],
&[true, false],
&[true, true],
]);
pack_bit_matrix(&d1.path().join("presence")).unwrap();
let p1 = PersistentBitMatrix::open(d1.path()).unwrap();
let (d2a, _p2a) = make_bit_matrix(&[
&[false, true],
&[true, true],
&[false, false],
&[true, false],
]);
pack_bit_matrix(&d2a.path().join("presence")).unwrap();
let p2a = PersistentBitMatrix::open(d2a.path()).unwrap();
let (d2b, _p2b) = make_bit_matrix(&[
&[true],
&[false],
&[true],
&[true],
]);
pack_bit_matrix(&d2b.path().join("presence")).unwrap();
let p2b = PersistentBitMatrix::open(d2b.path()).unwrap();
let partitioned = LayeredStore::new(vec![
LayeredStore::new(vec![p0]),
LayeredStore::new(vec![p1]),
LayeredStore::new(vec![p2a, p2b]),
]);
let (_df, mf) = make_bit_matrix(&[
&[true, false, true, true, true, false, true, true],
&[false, true, true, false, true, true, true, false],
&[true, true, false, true, false, false, false, true],
&[false, false, true, true, true, true, false, true],
]);
let (inter_p, union_p) = BitPartials::partial_jaccard(&partitioned);
let (inter_f, union_f) = BitPartials::partial_jaccard(&mf);
let n = 4;
for i in 0..n {
for j in 0..n {
assert_eq!(inter_p[[i, j]], inter_f[[i, j]], "inter[{i},{j}]");
assert_eq!(union_p[[i, j]], union_f[[i, j]], "union[{i},{j}]");
}
}
}
+6
View File
@@ -7,7 +7,13 @@ edition = "2024"
obikseq = { path = "../obikseq" } obikseq = { path = "../obikseq" }
obikrope = { path = "../obikrope" } obikrope = { path = "../obikrope" }
obiread = { path = "../obiread" } obiread = { path = "../obiread" }
obikentropy = { path = "../obikentropy" }
lazy_static = "1.5.0" lazy_static = "1.5.0"
[dev-dependencies] [dev-dependencies]
obikseq = { path = "../obikseq", features = ["test-utils"] } obikseq = { path = "../obikseq", features = ["test-utils"] }
criterion2 = { version = "3", features = ["cargo_bench_support"] }
[[bench]]
name = "superkmer_stream"
harness = false
@@ -0,0 +1,58 @@
//! Throughput of the streaming superkmer pipeline (`RollingStat`'s hot path:
//! minimizer selection + entropy tracking fused in a single pass).
//!
//! Reference point for the `obikentropy` extraction: the entropy bookkeeping
//! that used to live inline in `RollingStat` was pulled out into a composed
//! `EntropyTracker`. This benchmark is run before and after that change to
//! confirm no regression.
use criterion::{Criterion, Throughput, criterion_group, criterion_main};
use obikrope::Rope;
use obiskbuilder::SuperKmerIter;
const K: usize = 21;
const M: usize = 9;
const LEVEL_MAX: usize = 6;
const THETA: f64 = 0.7;
const SEQ_LEN: usize = 200_000;
/// Deterministic pseudo-random ACGT sequence — high enough complexity that
/// the entropy filter rarely rejects, so the bench stays on the steady-state
/// path rather than repeatedly resetting.
fn make_sequence(len: usize) -> Vec<u8> {
let mut state: u64 = 0x9E3779B97F4A7C15;
(0..len)
.map(|_| {
state ^= state << 13;
state ^= state >> 7;
state ^= state << 17;
b"ACGT"[(state % 4) as usize]
})
.collect()
}
fn make_rope(seq: &[u8]) -> Rope {
let mut rope = Rope::new(None);
rope.push(seq.to_vec());
rope
}
fn bench_build_superkmers(c: &mut Criterion) {
obikseq::set_k(K);
obikseq::set_m(M);
let seq = make_sequence(SEQ_LEN);
let rope = make_rope(&seq);
let mut group = c.benchmark_group("build_superkmers");
group.throughput(Throughput::Bytes(SEQ_LEN as u64));
group.bench_function("stream", |b| {
b.iter(|| {
SuperKmerIter::new(std::hint::black_box(&rope), K, LEVEL_MAX, THETA).count()
});
});
group.finish();
}
criterion_group!(benches, bench_build_superkmers);
criterion_main!(benches);
-108
View File
@@ -1,108 +0,0 @@
pub(crate) const NORMK1: [u64; 4] = build_normalized_kmer::<4>();
pub(crate) const NORMK2: [u64; 16] = build_normalized_kmer::<16>();
pub(crate) const NORMK3: [u64; 64] = build_normalized_kmer::<64>();
pub(crate) const NORMK4: [u64; 256] = build_normalized_kmer::<256>();
pub(crate) const NORMK5: [u64; 1024] = build_normalized_kmer::<1024>();
pub(crate) const NORMK6: [u64; 4096] = build_normalized_kmer::<4096>();
include!(concat!(env!("OUT_DIR"), "/ln_class_tables.rs"));
const fn normalize_circular(kmer: u64, ws: usize) -> u64 {
let mask = (1u64 << (ws * 2)) - 1;
let mut canonical = kmer & mask;
let mut current = canonical;
let mut i = 0;
while i < (ws - 1) {
let top = (current >> ((ws - 1) * 2)) & 3;
current = ((current << 2) | top) & mask;
if current < canonical {
canonical = current;
}
i += 1;
}
canonical
}
const fn build_normalized_kmer<const N: usize>() -> [u64; N] {
let mut result = [0u64; N];
let k = k_from_n::<N>();
let shift = 64 - k * 2;
let mut i = 0;
while i < N {
let la = (i as u64) << shift;
let ra = i as u64;
let rc_ra = revcomp_raw(la, k) >> shift;
let circ = normalize_circular(ra, k);
let circ_rc = normalize_circular(rc_ra, k);
result[i] = if circ < circ_rc { circ } else { circ_rc };
i += 1;
}
result
}
const fn revcomp_raw(x: u64, k: usize) -> u64 {
let x = !x;
let x = x.swap_bytes();
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
x << (64 - 2 * k)
}
const fn k_from_n<const N: usize>() -> usize {
match N {
4 => 1,
16 => 2,
64 => 3,
256 => 4,
1024 => 5,
4096 => 6,
_ => panic!("N must be a power of 4"),
}
}
pub(crate) const WS_MAX: usize = 6;
#[inline(always)]
pub(crate) const fn n_log_n(n: usize) -> f64 {
N_LOG_N[n]
}
#[inline(always)]
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
EMAX[k][ws]
}
#[inline(always)]
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
LOG_NWORDS[k][ws]
}
#[inline(always)]
pub(crate) const fn entropy_norm_kmer<const LEFT: bool, const K: usize>(kmer: u64) -> u64 {
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
const NORM: [&[u64]; 7] = [&[], &NORMK1, &NORMK2, &NORMK3, &NORMK4, &NORMK5, &NORMK6];
let shift = SHIFT[K];
let ra = if LEFT { kmer >> shift } else { kmer };
let canonical_ra = NORM[K][ra as usize];
if LEFT {
canonical_ra << shift
} else {
canonical_ra
}
}
#[inline(always)]
pub(crate) const fn ln_class_size<const LEFT: bool, const K: usize>(kmer: u64) -> f64 {
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
let ra = if LEFT { kmer >> SHIFT[K] } else { kmer };
match K {
1 => LN_CLASS1[ra as usize],
2 => LN_CLASS2[ra as usize],
3 => LN_CLASS3[ra as usize],
4 => LN_CLASS4[ra as usize],
5 => LN_CLASS5[ra as usize],
6 => LN_CLASS6[ra as usize],
_ => panic!("k must be 1..=6"),
}
}
+2 -154
View File
@@ -149,157 +149,5 @@ impl Iterator for SuperKmerIter<'_> {
// ── tests ───────────────────────────────────────────────────────────────────── // ── tests ─────────────────────────────────────────────────────────────────────
#[cfg(test)] #[cfg(test)]
mod tests { #[path = "tests/iter.rs"]
use super::*; mod tests;
use obikrope::Rope;
fn setup() {
obikseq::params::set_k(K);
obikseq::params::set_m(5);
}
fn make_rope(data: &[u8]) -> Rope {
let mut r = Rope::new(None);
r.push(data.to_vec());
r
}
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
let rope = make_rope(data);
SuperKmerIter::new(&rope, k, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect()
}
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
const K: usize = 11;
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
(0..seq.len().saturating_sub(K - 1))
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
.collect()
}
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
SuperKmerIter::new(rope, K, 1, 0.0)
.flat_map(|rsk| {
rsk.superkmer()
.iter_canonical_kmers()
.map(|km| km.to_ascii())
.collect::<Vec<_>>()
})
.collect()
}
#[test]
fn coverage_single_segment() {
setup();
let seq = b"ACGTACGTACGTACGTACGT";
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
let direct = direct_canonical_kmers(seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans segment unique : {missing:?}"
);
}
#[test]
fn coverage_two_segments() {
setup();
let seg1 = b"ACGTACGTACGTACGTACGT";
let seg2 = b"TGCATGCATGCATGCATGCA";
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
let mut direct = direct_canonical_kmers(seg1);
direct.extend(direct_canonical_kmers(seg2));
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans deux segments : {missing:?}"
);
}
#[test]
fn coverage_minimizer_boundary() {
setup();
// sequence assez longue pour forcer plusieurs changements de minimiseur
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
let direct = direct_canonical_kmers(&seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus à la frontière de minimiseur : {missing:?}"
);
}
#[test]
fn single_segment_one_superkmer() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
assert!(!out.is_empty());
let total: Vec<u8> = out.into_iter().flatten().collect();
assert!(total.len() >= K);
}
#[test]
fn segment_shorter_than_k_emits_nothing() {
setup();
let out = run_nofilter(b"ACGTACGT\x00", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn empty_input_emits_nothing() {
setup();
let out = run_nofilter(b"", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn two_segments_both_emitted() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
assert!(!out.is_empty());
}
#[test]
fn low_complexity_kmer_is_rejected() {
setup();
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
assert!(!out_pass.is_empty());
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(out_reject.is_empty());
}
#[test]
fn multi_slice_rope() {
setup();
let data = b"ACGTACGTACGTACGTACGT\x00";
let mid = data.len() / 2;
let mut rope = Rope::new(None);
rope.push(data[..mid].to_vec());
rope.push(data[mid..].to_vec());
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(!out.is_empty());
}
#[test]
fn yields_minimizer_value() {
setup();
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
assert!(!results.is_empty());
}
}
+2 -2
View File
@@ -10,8 +10,8 @@ pub mod stream_iter;
mod scratch; mod scratch;
pub(crate) mod encoding; pub(crate) mod encoding;
pub(crate) mod entropy_table; #[allow(missing_docs)]
pub(crate) mod rolling_stat; pub mod rolling_stat;
pub use iter::SuperKmerIter; pub use iter::SuperKmerIter;
pub use scratch::SuperKmerScratch; pub use scratch::SuperKmerScratch;
+10 -255
View File
@@ -1,8 +1,8 @@
use obikentropy::EntropyTracker;
use obikseq::kmer::{Minimizer, hash_kmer}; use obikseq::kmer::{Minimizer, hash_kmer};
use obikseq::params; use obikseq::params;
use crate::encoding::encode_nuc; use crate::encoding::encode_nuc;
use crate::entropy_table::{WS_MAX, emax, entropy_norm_kmer, ln_class_size, log_nwords, n_log_n};
// ── Stack-allocated ring buffer ─────────────────────────────────────────────── // ── Stack-allocated ring buffer ───────────────────────────────────────────────
@@ -83,33 +83,19 @@ pub struct RollingStat {
entropy_max_k: usize, entropy_max_k: usize,
k: usize, k: usize,
m: usize, m: usize,
steady: bool,
rolling_k: u64, rolling_k: u64,
rolling_rck: u64, rolling_rck: u64,
k_mask: u64, k_mask: u64,
m_mask: u64, m_mask: u64,
received: usize, received: usize,
// Sliding-window queues — stack-allocated, capacity ≤ k ≤ 31. // Minimizer selection state.
k1q: Ring<u64, 32>,
k2q: Ring<u64, 32>,
k3q: Ring<u64, 32>,
k4q: Ring<u64, 32>,
k5q: Ring<u64, 32>,
k6q: Ring<u64, 32>,
minimier: Ring<MmerItem, 32>, minimier: Ring<MmerItem, 32>,
// Frequency count arrays. // Entropy tracking, composed as a plain inline field so both concerns
// Max count per cell ≤ k ≤ 31 → u8 is sufficient. // update in the same streaming pass without being conflated in one
k1c: [u8; 4], // struct — see `obikentropy::EntropyTracker`.
k2c: [u8; 16], entropy: EntropyTracker,
k3c: [u8; 64],
k4c: [u8; 256],
k5c: [u8; 1024],
k6c: [u8; 4096],
sum_f_log_f: [f64; WS_MAX + 1],
sum_f_log_s: [f64; WS_MAX + 1],
} }
impl RollingStat { impl RollingStat {
@@ -120,27 +106,13 @@ impl RollingStat {
entropy_max_k, entropy_max_k,
k, k,
m, m,
steady: false,
rolling_k: 0, rolling_k: 0,
rolling_rck: 0, rolling_rck: 0,
k_mask: (!0u64) >> (64 - k * 2), k_mask: (!0u64) >> (64 - k * 2),
m_mask: (!0u64) >> (64 - m * 2), m_mask: (!0u64) >> (64 - m * 2),
received: 0, received: 0,
k1q: Ring::new(),
k2q: Ring::new(),
k3q: Ring::new(),
k4q: Ring::new(),
k5q: Ring::new(),
k6q: Ring::new(),
minimier: Ring::new(), minimier: Ring::new(),
k1c: [0; 4], entropy: EntropyTracker::new(k),
k2c: [0; 16],
k3c: [0; 64],
k4c: [0; 256],
k5c: [0; 1024],
k6c: [0; 4096],
sum_f_log_f: [0.0; WS_MAX + 1],
sum_f_log_s: [0.0; WS_MAX + 1],
} }
} }
@@ -148,54 +120,9 @@ impl RollingStat {
self.rolling_k = 0; self.rolling_k = 0;
self.rolling_rck = 0; self.rolling_rck = 0;
self.received = 0; self.received = 0;
self.steady = false;
// for i in self.k1q.iter() { self.k1c[i as usize] = 0; }
// for i in self.k2q.iter() { self.k2c[i as usize] = 0; }
// for i in self.k3q.iter() { self.k3c[i as usize] = 0; }
// for i in self.k4q.iter() { self.k4c[i as usize] = 0; }
// for i in self.k5q.iter() { self.k5c[i as usize] = 0; }
// for i in self.k6q.iter() { self.k6c[i as usize] = 0; }
self.k1c.fill(0);
self.k2c.fill(0);
self.k3c.fill(0);
self.k4c.fill(0);
self.k5c.fill(0);
self.k6c.fill(0);
self.k1q.clear();
self.k2q.clear();
self.k3q.clear();
self.k4q.clear();
self.k5q.clear();
self.k6q.clear();
self.minimier.clear(); self.minimier.clear();
self.entropy.reset();
self.sum_f_log_f = [0.0; WS_MAX + 1];
self.sum_f_log_s = [0.0; WS_MAX + 1];
}
#[inline]
fn update_sums_decrement<const K: usize>(
sum_f_log_f: &mut [f64; WS_MAX + 1],
sum_f_log_s: &mut [f64; WS_MAX + 1],
canonical: u64,
f: usize,
) {
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
sum_f_log_s[K] -= ln_class_size::<false, K>(canonical);
}
#[inline]
fn update_sums_increment<const K: usize>(
sum_f_log_f: &mut [f64; WS_MAX + 1],
sum_f_log_s: &mut [f64; WS_MAX + 1],
canonical: u64,
g: usize,
) {
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
sum_f_log_s[K] += ln_class_size::<false, K>(canonical);
} }
pub fn push(&mut self, nuc: u8) { pub fn push(&mut self, nuc: u8) {
@@ -209,13 +136,6 @@ impl RollingStat {
self.rolling_rck = self.rolling_rck =
((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask; ((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask;
let canonical_k1 = entropy_norm_kmer::<false, 1>(self.rolling_k & 3);
let canonical_k2 = entropy_norm_kmer::<false, 2>(self.rolling_k & 15);
let canonical_k3 = entropy_norm_kmer::<false, 3>(self.rolling_k & 63);
let canonical_k4 = entropy_norm_kmer::<false, 4>(self.rolling_k & 255);
let canonical_k5 = entropy_norm_kmer::<false, 5>(self.rolling_k & 1023);
let canonical_k6 = entropy_norm_kmer::<false, 6>(self.rolling_k & 4095);
self.received += 1; self.received += 1;
if self.received >= m { if self.received >= m {
@@ -248,153 +168,7 @@ impl RollingStat {
} }
} }
if self.received > k { self.entropy.push(self.received, self.rolling_k);
let old1 = self.k1q.pop_front();
let f1 = self.k1c[old1 as usize] as usize;
Self::update_sums_decrement::<1>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old1,
f1,
);
self.k1c[old1 as usize] -= 1;
let old2 = self.k2q.pop_front();
let f2 = self.k2c[old2 as usize] as usize;
Self::update_sums_decrement::<2>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old2,
f2,
);
self.k2c[old2 as usize] -= 1;
let old3 = self.k3q.pop_front();
let f3 = self.k3c[old3 as usize] as usize;
Self::update_sums_decrement::<3>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old3,
f3,
);
self.k3c[old3 as usize] -= 1;
let old4 = self.k4q.pop_front();
let f4 = self.k4c[old4 as usize] as usize;
Self::update_sums_decrement::<4>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old4,
f4,
);
self.k4c[old4 as usize] -= 1;
let old5 = self.k5q.pop_front();
let f5 = self.k5c[old5 as usize] as usize;
Self::update_sums_decrement::<5>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old5,
f5,
);
self.k5c[old5 as usize] -= 1;
let old6 = self.k6q.pop_front();
let f6 = self.k6c[old6 as usize] as usize;
Self::update_sums_decrement::<6>(
&mut self.sum_f_log_f,
&mut self.sum_f_log_s,
old6,
f6,
);
self.k6c[old6 as usize] -= 1;
}
if self.steady {
let g1 = self.k1c[canonical_k1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
self.k1c[canonical_k1 as usize] += 1;
self.k1q.push_back(canonical_k1);
let g2 = self.k2c[canonical_k2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
self.k2c[canonical_k2 as usize] += 1;
self.k2q.push_back(canonical_k2);
let g3 = self.k3c[canonical_k3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
self.k3c[canonical_k3 as usize] += 1;
self.k3q.push_back(canonical_k3);
let g4 = self.k4c[canonical_k4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
self.k4c[canonical_k4 as usize] += 1;
self.k4q.push_back(canonical_k4);
let g5 = self.k5c[canonical_k5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
self.k5c[canonical_k5 as usize] += 1;
self.k5q.push_back(canonical_k5);
let g6 = self.k6c[canonical_k6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
self.k6c[canonical_k6 as usize] += 1;
self.k6q.push_back(canonical_k6);
} else {
self.push_warmup_increments(
canonical_k1, canonical_k2, canonical_k3,
canonical_k4, canonical_k5, canonical_k6,
);
}
}
#[cold]
#[inline(never)]
fn push_warmup_increments(
&mut self,
canonical_k1: u64, canonical_k2: u64, canonical_k3: u64,
canonical_k4: u64, canonical_k5: u64, canonical_k6: u64,
) {
let g1 = self.k1c[canonical_k1 as usize] as usize;
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
self.k1c[canonical_k1 as usize] += 1;
self.k1q.push_back(canonical_k1);
if self.received >= 2 {
let g2 = self.k2c[canonical_k2 as usize] as usize;
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
self.k2c[canonical_k2 as usize] += 1;
self.k2q.push_back(canonical_k2);
if self.received >= 3 {
let g3 = self.k3c[canonical_k3 as usize] as usize;
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
self.k3c[canonical_k3 as usize] += 1;
self.k3q.push_back(canonical_k3);
if self.received >= 4 {
let g4 = self.k4c[canonical_k4 as usize] as usize;
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
self.k4c[canonical_k4 as usize] += 1;
self.k4q.push_back(canonical_k4);
if self.received >= 5 {
let g5 = self.k5c[canonical_k5 as usize] as usize;
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
self.k5c[canonical_k5 as usize] += 1;
self.k5q.push_back(canonical_k5);
if self.received >= 6 {
let g6 = self.k6c[canonical_k6 as usize] as usize;
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
self.k6c[canonical_k6 as usize] += 1;
self.k6q.push_back(canonical_k6);
self.steady = true;
}
}
}
}
}
} }
pub fn ready(&self) -> bool { pub fn ready(&self) -> bool {
@@ -422,29 +196,10 @@ impl RollingStat {
.map(|raw| Minimizer::from_raw_unchecked(raw << (64 - self.m * 2))) .map(|raw| Minimizer::from_raw_unchecked(raw << (64 - self.m * 2)))
} }
pub fn entropy(&self, order: usize) -> Option<f64> {
if !self.ready() {
return None;
}
let k = self.k;
let em = emax(k, order);
if em <= 0.0 {
return Some(1.0);
}
let nwords = k - order + 1;
let log_nw = log_nwords(k, order);
let nw_f = nwords as f64;
let h_corr = log_nw + (self.sum_f_log_s[order] - self.sum_f_log_f[order]) / nw_f;
Some((h_corr / em).max(0.0))
}
pub fn normalized_entropy(&self) -> Option<f64> { pub fn normalized_entropy(&self) -> Option<f64> {
if !self.ready() { if !self.ready() {
return None; return None;
} }
let min_e = (1..=self.entropy_max_k) Some(self.entropy.normalized_entropy(self.entropy_max_k))
.filter_map(|ws| self.entropy(ws))
.fold(f64::MAX, f64::min);
Some(if min_e == f64::MAX { 1.0 } else { min_e })
} }
} }
+152
View File
@@ -0,0 +1,152 @@
use super::*;
use obikrope::Rope;
fn setup() {
obikseq::params::set_k(K);
obikseq::params::set_m(5);
}
fn make_rope(data: &[u8]) -> Rope {
let mut r = Rope::new(None);
r.push(data.to_vec());
r
}
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
let rope = make_rope(data);
SuperKmerIter::new(&rope, k, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect()
}
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
const K: usize = 11;
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
(0..seq.len().saturating_sub(K - 1))
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
.collect()
}
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
SuperKmerIter::new(rope, K, 1, 0.0)
.flat_map(|rsk| {
rsk.superkmer()
.iter_canonical_kmers()
.map(|km| km.to_ascii())
.collect::<Vec<_>>()
})
.collect()
}
#[test]
fn coverage_single_segment() {
setup();
let seq = b"ACGTACGTACGTACGTACGT";
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
let direct = direct_canonical_kmers(seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans segment unique : {missing:?}"
);
}
#[test]
fn coverage_two_segments() {
setup();
let seg1 = b"ACGTACGTACGTACGTACGT";
let seg2 = b"TGCATGCATGCATGCATGCA";
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
let mut direct = direct_canonical_kmers(seg1);
direct.extend(direct_canonical_kmers(seg2));
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus dans deux segments : {missing:?}"
);
}
#[test]
fn coverage_minimizer_boundary() {
setup();
// sequence assez longue pour forcer plusieurs changements de minimiseur
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
let direct = direct_canonical_kmers(&seq);
let from_iter = iter_canonical_kmers(&rope);
let missing: Vec<_> = direct.difference(&from_iter).collect();
assert!(
missing.is_empty(),
"k-mers perdus à la frontière de minimiseur : {missing:?}"
);
}
#[test]
fn single_segment_one_superkmer() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
assert!(!out.is_empty());
let total: Vec<u8> = out.into_iter().flatten().collect();
assert!(total.len() >= K);
}
#[test]
fn segment_shorter_than_k_emits_nothing() {
setup();
let out = run_nofilter(b"ACGTACGT\x00", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn empty_input_emits_nothing() {
setup();
let out = run_nofilter(b"", K);
assert_eq!(out, Vec::<Vec<u8>>::new());
}
#[test]
fn two_segments_both_emitted() {
setup();
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
assert!(!out.is_empty());
}
#[test]
fn low_complexity_kmer_is_rejected() {
setup();
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
assert!(!out_pass.is_empty());
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(out_reject.is_empty());
}
#[test]
fn multi_slice_rope() {
setup();
let data = b"ACGTACGTACGTACGTACGT\x00";
let mid = data.len() / 2;
let mut rope = Rope::new(None);
rope.push(data[..mid].to_vec());
rope.push(data[mid..].to_vec());
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
.map(|rsk| rsk.superkmer().to_ascii())
.collect();
assert!(!out.is_empty());
}
#[test]
fn yields_minimizer_value() {
setup();
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
assert!(!results.is_empty());
}
+248 -47
View File
@@ -4,7 +4,7 @@ use std::sync::{Condvar, Mutex};
use std::time::{Duration, Instant}; use std::time::{Duration, Instant};
use indicatif::{ProgressBar, ProgressStyle}; use indicatif::{ProgressBar, ProgressStyle};
use tracing::{info, warn}; use tracing::{debug, info, warn};
const BRAILLE: &[&str] = &["", "", "", "", "", "", "", "", "", ""]; const BRAILLE: &[&str] = &["", "", "", "", "", "", "", "", "", ""];
@@ -31,7 +31,8 @@ impl TracedBar {
let pct10 = (pos * 10) / self.total; // 0..=10 let pct10 = (pos * 10) / self.total; // 0..=10
let last = self.last_pct.load(Ordering::Relaxed); let last = self.last_pct.load(Ordering::Relaxed);
if pct10 > last if pct10 > last
&& self.last_pct && self
.last_pct
.compare_exchange(last, pct10, Ordering::Relaxed, Ordering::Relaxed) .compare_exchange(last, pct10, Ordering::Relaxed, Ordering::Relaxed)
.is_ok() .is_ok()
{ {
@@ -49,14 +50,14 @@ impl TracedBar {
let msg = msg.into(); let msg = msg.into();
if self.pb.is_hidden() { if self.pb.is_hidden() {
if self.total > 0 { if self.total > 0 {
// bounded bar: always log (already rate-limited by 10% threshold in inc) debug!(stage = %self.label, "{msg}");
info!(stage = %self.label, "{msg}");
} else { } else {
// spinner: throttle to ~10 s // spinner: throttle to ~10 s
let now_ms = self.start.elapsed().as_millis() as u64; let now_ms = self.start.elapsed().as_millis() as u64;
let last = self.last_log_ms.load(Ordering::Relaxed); let last = self.last_log_ms.load(Ordering::Relaxed);
if now_ms >= last + 10_000 if now_ms >= last + 10_000
&& self.last_log_ms && self
.last_log_ms
.compare_exchange(last, now_ms, Ordering::Relaxed, Ordering::Relaxed) .compare_exchange(last, now_ms, Ordering::Relaxed, Ordering::Relaxed)
.is_ok() .is_ok()
{ {
@@ -83,8 +84,13 @@ pub fn spinner(label: &str) -> TracedBar {
); );
pb.enable_steady_tick(Duration::from_millis(100)); pb.enable_steady_tick(Duration::from_millis(100));
TracedBar { TracedBar {
pb, label: label.to_string(), unit: String::new(), total: 0, pb,
start: Instant::now(), last_pct: AtomicU64::new(0), last_log_ms: AtomicU64::new(0), label: label.to_string(),
unit: String::new(),
total: 0,
start: Instant::now(),
last_pct: AtomicU64::new(0),
last_log_ms: AtomicU64::new(0),
} }
} }
@@ -101,8 +107,13 @@ pub fn progress_bar(label: &str, n: u64, unit: &str) -> TracedBar {
); );
pb.enable_steady_tick(Duration::from_millis(100)); pb.enable_steady_tick(Duration::from_millis(100));
TracedBar { TracedBar {
pb, label: label.to_string(), unit: unit.to_string(), total: n, pb,
start: Instant::now(), last_pct: AtomicU64::new(0), last_log_ms: AtomicU64::new(0), label: label.to_string(),
unit: unit.to_string(),
total: n,
start: Instant::now(),
last_pct: AtomicU64::new(0),
last_log_ms: AtomicU64::new(0),
} }
} }
@@ -204,13 +215,19 @@ fn tv_to_secs(tv: timeval) -> f64 {
} }
#[cfg(target_os = "macos")] #[cfg(target_os = "macos")]
fn rss_to_bytes(ru: &rusage) -> u64 { ru.ru_maxrss as u64 } fn rss_to_bytes(ru: &rusage) -> u64 {
ru.ru_maxrss as u64
}
#[cfg(not(target_os = "macos"))] #[cfg(not(target_os = "macos"))]
fn rss_to_bytes(ru: &rusage) -> u64 { ru.ru_maxrss as u64 * 1024 } fn rss_to_bytes(ru: &rusage) -> u64 {
ru.ru_maxrss as u64 * 1024
}
// Monotonically increasing counters — negative delta would be a kernel bug. // Monotonically increasing counters — negative delta would be a kernel bug.
fn delta(end: i64, start: i64) -> u64 { (end - start).max(0) as u64 } fn delta(end: i64, start: i64) -> u64 {
(end - start).max(0) as u64
}
// ── CpuSample ───────────────────────────────────────────────────────────────── // ── CpuSample ─────────────────────────────────────────────────────────────────
@@ -221,6 +238,7 @@ pub struct CpuSample {
wall: Instant, wall: Instant,
user_secs: f64, user_secs: f64,
sys_secs: f64, sys_secs: f64,
previous: f64,
} }
impl CpuSample { impl CpuSample {
@@ -230,6 +248,7 @@ impl CpuSample {
wall: Instant::now(), wall: Instant::now(),
user_secs: tv_to_secs(ru.ru_utime), user_secs: tv_to_secs(ru.ru_utime),
sys_secs: tv_to_secs(ru.ru_stime), sys_secs: tv_to_secs(ru.ru_stime),
previous: 0.0,
} }
} }
@@ -238,11 +257,129 @@ impl CpuSample {
pub fn cpu_efficiency(&self, n_cores: usize) -> f64 { pub fn cpu_efficiency(&self, n_cores: usize) -> f64 {
let ru = get_rusage(); let ru = get_rusage();
let wall = self.wall.elapsed().as_secs_f64(); let wall = self.wall.elapsed().as_secs_f64();
if wall < 0.1 { return 0.0; } if wall < 0.1 {
let cpu = (tv_to_secs(ru.ru_utime) - self.user_secs) return 0.0;
+ (tv_to_secs(ru.ru_stime) - self.sys_secs); }
let cpu =
(tv_to_secs(ru.ru_utime) - self.user_secs) + (tv_to_secs(ru.ru_stime) - self.sys_secs);
cpu / (wall * n_cores as f64) cpu / (wall * n_cores as f64)
} }
pub fn do_i_activate(&mut self, threshold: f64) -> bool {
let delta_wall = self.wall.elapsed().as_secs_f64();
if delta_wall < 0.1 {
// Window too short to be meaningful — leave state untouched so it
// keeps accumulating until a real sample can be taken.
return false;
}
let n = CpuSample::now();
let delta_ru = (n.user_secs - self.user_secs) + (n.sys_secs - self.sys_secs);
let efficiency = delta_ru / delta_wall;
let activate = 0f64.max(efficiency - self.previous) >= threshold;
debug!(
"Do I activate : {} -> {} = {} Activate: {}",
self.previous,
efficiency,
0f64.max(efficiency - self.previous),
activate
);
self.previous = efficiency;
self.user_secs = n.user_secs;
self.sys_secs = n.sys_secs;
self.wall = n.wall;
activate
}
}
// ── IoSample ──────────────────────────────────────────────────────────────────
/// Snapshot of process-wide block I/O (bytes read + written) + wall clock.
///
/// Same activation protocol as [`CpuSample`], but the growth check in
/// [`do_i_activate`](Self::do_i_activate) is *relative* rather than absolute:
/// raw I/O throughput has no portable scale across storage devices, unlike a
/// core count.
pub struct IoSample {
wall: Instant,
bytes: u64,
previous_rate: f64,
}
impl IoSample {
pub fn now() -> Self {
Self {
wall: Instant::now(),
bytes: Self::read_bytes(),
previous_rate: 0.0,
}
}
/// Bytes actually submitted to the block layer (read + write), summed
/// process-wide. Returns 0 if unavailable — degrades gracefully to a
/// signal that never triggers activation (CPU-only heuristic).
#[cfg(target_os = "linux")]
fn read_bytes() -> u64 {
let Ok(io) = std::fs::read_to_string("/proc/self/io") else {
return 0;
};
io.lines()
.filter_map(|l| {
l.strip_prefix("read_bytes: ")
.or_else(|| l.strip_prefix("write_bytes: "))
})
.filter_map(|v| v.trim().parse::<u64>().ok())
.sum()
}
#[cfg(target_os = "macos")]
fn read_bytes() -> u64 {
use libc::{RUSAGE_INFO_V4, getpid, proc_pid_rusage, rusage_info_v4};
let mut info: rusage_info_v4 = unsafe { std::mem::zeroed() };
let ret =
unsafe { proc_pid_rusage(getpid(), RUSAGE_INFO_V4, &mut info as *mut _ as *mut _) };
if ret != 0 {
return 0;
}
info.ri_diskio_bytesread + info.ri_diskio_byteswritten
}
#[cfg(not(any(target_os = "linux", target_os = "macos")))]
fn read_bytes() -> u64 {
0
}
/// Same protocol as [`CpuSample::do_i_activate`] (0.1 s minimum window,
/// state untouched on early return), but growth is measured relative to
/// the previous rate. `threshold` is a fraction, e.g. `0.2` for a 20 %
/// increase in throughput since the last real sample.
pub fn do_i_activate(&mut self, threshold: f64) -> bool {
let elapsed = self.wall.elapsed().as_secs_f64();
if elapsed < 0.1 {
return false;
}
let n = Self::read_bytes();
let rate = n.saturating_sub(self.bytes) as f64 / elapsed;
let activate = if self.previous_rate == 0.0 {
rate > 0.0 // bootstrap: any measured throughput is signal enough
} else {
(rate - self.previous_rate) / self.previous_rate >= threshold
};
debug!(
"Do I activate (I/O) : {} -> {} Activate: {}",
self.previous_rate, rate, activate
);
self.previous_rate = rate;
self.bytes = n;
self.wall = Instant::now();
activate
}
} }
// ── public API ──────────────────────────────────────────────────────────────── // ── public API ────────────────────────────────────────────────────────────────
@@ -259,7 +396,11 @@ impl Stage {
pub fn start(label: impl Into<String>) -> Self { pub fn start(label: impl Into<String>) -> Self {
let label = label.into(); let label = label.into();
info!(stage = %label, "started"); info!(stage = %label, "started");
Self { label, wall: Instant::now(), ru: get_rusage() } Self {
label,
wall: Instant::now(),
ru: get_rusage(),
}
} }
pub fn stop(self) -> StageStats { pub fn stop(self) -> StageStats {
@@ -318,8 +459,11 @@ pub struct StageStats {
impl StageStats { impl StageStats {
/// (user + sys) / wall — effective thread count utilisation. /// (user + sys) / wall — effective thread count utilisation.
pub fn parallelism(&self) -> f64 { pub fn parallelism(&self) -> f64 {
if self.wall_secs > 1e-9 { (self.user_secs + self.sys_secs) / self.wall_secs } if self.wall_secs > 1e-9 {
else { 0.0 } (self.user_secs + self.sys_secs) / self.wall_secs
} else {
0.0
}
} }
/// parallelism / n_cores — fraction of available CPU power used (0..1+). /// parallelism / n_cores — fraction of available CPU power used (0..1+).
@@ -335,11 +479,19 @@ pub struct Reporter {
} }
impl Reporter { impl Reporter {
pub fn new() -> Self { Self::default() } pub fn new() -> Self {
pub fn push(&mut self, stats: StageStats) { self.stages.push(stats); } Self::default()
pub fn stages(&self) -> &[StageStats] { &self.stages } }
pub fn push(&mut self, stats: StageStats) {
self.stages.push(stats);
}
pub fn stages(&self) -> &[StageStats] {
&self.stages
}
/// Print the summary to stderr. /// Print the summary to stderr.
pub fn print(&self) { eprint!("{self}"); } pub fn print(&self) {
eprint!("{self}");
}
} }
// ── diagnosis ───────────────────────────────────────────────────────────────── // ── diagnosis ─────────────────────────────────────────────────────────────────
@@ -387,26 +539,43 @@ fn diagnose(s: &StageStats, n_cores: usize) -> Diagnosis {
)), )),
}; };
} }
Diagnosis { tag: "", detail: None } Diagnosis {
tag: "",
detail: None,
}
} }
// ── display helpers ─────────────────────────────────────────────────────────── // ── display helpers ───────────────────────────────────────────────────────────
fn fmt_secs(s: f64) -> String { fn fmt_secs(s: f64) -> String {
if s >= 100.0 { format!("{:.0}s", s) } if s >= 100.0 {
else if s >= 10.0 { format!("{:.1}s", s) } format!("{:.0}s", s)
else if s >= 1.0 { format!("{:.2}s", s) } } else if s >= 10.0 {
else { format!("{:.0}ms", s * 1000.0) } format!("{:.1}s", s)
} else if s >= 1.0 {
format!("{:.2}s", s)
} else {
format!("{:.0}ms", s * 1000.0)
}
} }
fn fmt_bytes(b: u64) -> String { fn fmt_bytes(b: u64) -> String {
if b >= 1 << 30 { format!("{:.1} GB", b as f64 / (1u64 << 30) as f64) } if b >= 1 << 30 {
else if b >= 1 << 20 { format!("{:.0} MB", b as f64 / (1u64 << 20) as f64) } format!("{:.1} GB", b as f64 / (1u64 << 30) as f64)
else { format!("{:.0} KB", b as f64 / 1024.0) } } else if b >= 1 << 20 {
format!("{:.0} MB", b as f64 / (1u64 << 20) as f64)
} else {
format!("{:.0} KB", b as f64 / 1024.0)
}
} }
fn fmt_efficiency(par: f64, n_cores: usize) -> String { fn fmt_efficiency(par: f64, n_cores: usize) -> String {
format!("{:.1}×/{} ({:.0}%)", par, n_cores, par / n_cores as f64 * 100.0) format!(
"{:.1}×/{} ({:.0}%)",
par,
n_cores,
par / n_cores as f64 * 100.0
)
} }
// ── Display ─────────────────────────────────────────────────────────────────── // ── Display ───────────────────────────────────────────────────────────────────
@@ -434,7 +603,11 @@ impl MemoryBudget {
pub fn new(total: u64) -> Self { pub fn new(total: u64) -> Self {
Self { Self {
total, total,
inner: Mutex::new(BudgetInner { remaining: total, active: 0, peak_active: 0 }), inner: Mutex::new(BudgetInner {
remaining: total,
active: 0,
peak_active: 0,
}),
condvar: Condvar::new(), condvar: Condvar::new(),
} }
} }
@@ -459,24 +632,40 @@ impl MemoryBudget {
self.condvar.notify_all(); self.condvar.notify_all();
} }
pub fn total(&self) -> u64 { self.total } pub fn total(&self) -> u64 {
pub fn active(&self) -> usize { self.inner.lock().unwrap().active } self.total
pub fn remaining(&self) -> u64 { self.inner.lock().unwrap().remaining } }
pub fn peak_active(&self) -> usize { self.inner.lock().unwrap().peak_active } pub fn active(&self) -> usize {
self.inner.lock().unwrap().active
}
pub fn remaining(&self) -> u64 {
self.inner.lock().unwrap().remaining
}
pub fn peak_active(&self) -> usize {
self.inner.lock().unwrap().peak_active
}
} }
// ── Display ─────────────────────────────────────────────────────────────────── // ── Display ───────────────────────────────────────────────────────────────────
impl fmt::Display for Reporter { impl fmt::Display for Reporter {
fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result { fn fmt(&self, f: &mut fmt::Formatter<'_>) -> fmt::Result {
if self.stages.is_empty() { return Ok(()); } if self.stages.is_empty() {
return Ok(());
}
let n_cores = std::thread::available_parallelism() let n_cores = std::thread::available_parallelism()
.map(|n| n.get()) .map(|n| n.get())
.unwrap_or(1); .unwrap_or(1);
// column widths // column widths
let nw = self.stages.iter().map(|s| s.label.len()).max().unwrap_or(5).max(5); let nw = self
.stages
.iter()
.map(|s| s.label.len())
.max()
.unwrap_or(5)
.max(5);
// efficiency col: worst-case width for this run's n_cores value // efficiency col: worst-case width for this run's n_cores value
let ew = format!("{:.1}×/{} (100%)", 99.9f64, n_cores).len(); let ew = format!("{:.1}×/{} (100%)", 99.9f64, n_cores).len();
@@ -484,18 +673,21 @@ impl fmt::Display for Reporter {
let sep = "".repeat(sep_w); let sep = "".repeat(sep_w);
// header // header
writeln!(f, "{:<nw$} {:>7} {:>ew$} {:>8} status", writeln!(
"stage", "wall", "efficiency", "peak RSS")?; f,
"{:<nw$} {:>7} {:>ew$} {:>8} status",
"stage", "wall", "efficiency", "peak RSS"
)?;
writeln!(f, "{sep}")?; writeln!(f, "{sep}")?;
// compute all diagnoses up front (needed for both table and footnotes) // compute all diagnoses up front (needed for both table and footnotes)
let diagnoses: Vec<Diagnosis> = self.stages.iter() let diagnoses: Vec<Diagnosis> = self.stages.iter().map(|s| diagnose(s, n_cores)).collect();
.map(|s| diagnose(s, n_cores))
.collect();
// per-stage rows // per-stage rows
for (s, d) in self.stages.iter().zip(diagnoses.iter()) { for (s, d) in self.stages.iter().zip(diagnoses.iter()) {
writeln!(f, "{:<nw$} {:>7} {:>ew$} {:>8} {}", writeln!(
f,
"{:<nw$} {:>7} {:>ew$} {:>8} {}",
s.label, s.label,
fmt_secs(s.wall_secs), fmt_secs(s.wall_secs),
fmt_efficiency(s.parallelism(), n_cores), fmt_efficiency(s.parallelism(), n_cores),
@@ -508,11 +700,18 @@ impl fmt::Display for Reporter {
let tw = self.stages.iter().map(|s| s.wall_secs).sum::<f64>(); let tw = self.stages.iter().map(|s| s.wall_secs).sum::<f64>();
let tu = self.stages.iter().map(|s| s.user_secs).sum::<f64>(); let tu = self.stages.iter().map(|s| s.user_secs).sum::<f64>();
let ts = self.stages.iter().map(|s| s.sys_secs).sum::<f64>(); let ts = self.stages.iter().map(|s| s.sys_secs).sum::<f64>();
let trss = self.stages.iter().map(|s| s.max_rss_bytes).max().unwrap_or(0); let trss = self
.stages
.iter()
.map(|s| s.max_rss_bytes)
.max()
.unwrap_or(0);
let tpar = if tw > 1e-9 { (tu + ts) / tw } else { 0.0 }; let tpar = if tw > 1e-9 { (tu + ts) / tw } else { 0.0 };
writeln!(f, "{sep}")?; writeln!(f, "{sep}")?;
writeln!(f, "{:<nw$} {:>7} {:>ew$} {:>8}", writeln!(
f,
"{:<nw$} {:>7} {:>ew$} {:>8}",
"TOTAL", "TOTAL",
fmt_secs(tw), fmt_secs(tw),
fmt_efficiency(tpar, n_cores), fmt_efficiency(tpar, n_cores),
@@ -520,7 +719,9 @@ impl fmt::Display for Reporter {
)?; )?;
// bottleneck footnotes (only if at least one anomaly detected) // bottleneck footnotes (only if at least one anomaly detected)
let bottlenecks: Vec<(&str, &str)> = self.stages.iter() let bottlenecks: Vec<(&str, &str)> = self
.stages
.iter()
.zip(diagnoses.iter()) .zip(diagnoses.iter())
.filter_map(|(s, d)| d.detail.as_deref().map(|det| (s.label.as_str(), det))) .filter_map(|(s, d)| d.detail.as_deref().map(|det| (s.label.as_str(), det)))
.collect(); .collect();