Compare commits
20
Commits
v1.1.37
...
442f7a9e4c
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
442f7a9e4c | ||
|
|
a63692b8c4 | ||
|
|
fa82989ea9 | ||
|
|
5f95e866f8 | ||
|
|
2e7cfc4368 | ||
|
|
f5e508ed33 | ||
|
|
49f329edd5 | ||
|
|
1a470eab9e | ||
|
|
ba990a48a0 | ||
|
|
ea914bb536 | ||
|
|
8bc6d533e5 | ||
|
|
45df9919e5 | ||
|
|
2610a4af79 | ||
|
|
dc3392865f | ||
|
|
fd2c23e7df | ||
|
|
912f788f7f | ||
|
|
e725523898 | ||
|
|
165982fb07 | ||
|
|
2740f52326 | ||
|
|
dff5d2f457 |
@@ -1,4 +1,4 @@
|
|||||||
name: CI
|
pname: CI
|
||||||
|
|
||||||
on:
|
on:
|
||||||
pull_request:
|
pull_request:
|
||||||
@@ -25,8 +25,14 @@ jobs:
|
|||||||
~/.cargo/registry
|
~/.cargo/registry
|
||||||
~/.cargo/git
|
~/.cargo/git
|
||||||
src/target
|
src/target
|
||||||
key: ${{ runner.os }}-cargo-${{ hashFiles('src/Cargo.lock') }}
|
# v2: bump this salt to force a clean cache when a stuck/killed job
|
||||||
restore-keys: ${{ runner.os }}-cargo-
|
# may have saved a corrupted incremental-compilation `src/target`
|
||||||
|
# (observed 2026-08-11: a stale test binary deadlocked in NUMA
|
||||||
|
# worker startup; a from-scratch rebuild of the same source fixed
|
||||||
|
# it instantly, pointing at cache corruption rather than a source
|
||||||
|
# bug).
|
||||||
|
key: ${{ runner.os }}-cargo-v2-${{ hashFiles('src/Cargo.lock') }}
|
||||||
|
restore-keys: ${{ runner.os }}-cargo-v2-
|
||||||
|
|
||||||
- name: Build
|
- name: Build
|
||||||
run: cargo build --release
|
run: cargo build --release
|
||||||
|
|||||||
@@ -9,6 +9,7 @@ data-stress
|
|||||||
./**/*.json
|
./**/*.json
|
||||||
*.bin
|
*.bin
|
||||||
*.log
|
*.log
|
||||||
|
*.csv
|
||||||
Betula_exilis--IGA-24-33
|
Betula_exilis--IGA-24-33
|
||||||
benchmark/genomes
|
benchmark/genomes
|
||||||
benchmark/simulated_data
|
benchmark/simulated_data
|
||||||
|
|||||||
@@ -92,18 +92,48 @@ For each genome:
|
|||||||
|
|
||||||
| Flag | Applies to | Meaning |
|
| Flag | Applies to | Meaning |
|
||||||
|------|-----------|---------|
|
|------|-----------|---------|
|
||||||
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes |
|
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes (N may be negative, see below) |
|
||||||
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes |
|
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes (N may be negative, see below) |
|
||||||
| `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes |
|
| `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes |
|
||||||
| `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes |
|
| `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes |
|
||||||
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes |
|
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes (N may be negative, see below) |
|
||||||
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes |
|
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes (N may be negative, see below) |
|
||||||
| `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes |
|
| `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes |
|
||||||
| `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes |
|
| `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes |
|
||||||
| `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`filter` only) |
|
| `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`filter` only) |
|
||||||
| `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`filter` only) |
|
| `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`filter` only) |
|
||||||
| `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) |
|
| `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) |
|
||||||
|
|
||||||
|
### Negative counts — offset from group size
|
||||||
|
|
||||||
|
The four integer count flags (`--min-count`, `--max-count`, `--min-outgroup-count`,
|
||||||
|
`--max-outgroup-count`) accept **negative** values, interpreted as an offset counted
|
||||||
|
down from the group size `n`, resolved at run time once `n` is known:
|
||||||
|
|
||||||
|
| Value | Effective threshold |
|
||||||
|
|-------|---------------------|
|
||||||
|
| `N ≥ 0` | literal absolute count `N` |
|
||||||
|
| `-x` (x > 0) | `max(1, n − x)` — "all but x" |
|
||||||
|
|
||||||
|
`-1` literally means *all but one*, `-2` *all but two*, and so on. This expresses
|
||||||
|
a quorum relative to the group size that a plain fraction cannot state exactly
|
||||||
|
(e.g. "present in every genome except at most one" is `n−1`, which is `0.9` for
|
||||||
|
`n = 10` but `0.857…` for `n = 7`).
|
||||||
|
|
||||||
|
The threshold is **floored at 1**, never 0: the negative form always keeps
|
||||||
|
constraining the group. Without the floor, `--min-count -1` on a singleton
|
||||||
|
ingroup (`n = 1`) would resolve to `0` ("at least 0") and silently drop the
|
||||||
|
constraint; the floor makes it `1` ("present in that one genome") instead.
|
||||||
|
|
||||||
|
To express a count of `0` (e.g. "absent from the ingroup"), use the literal `0`,
|
||||||
|
not a negative — `0` and `-0` are indistinguishable, so the offset form starts at
|
||||||
|
`-1`.
|
||||||
|
|
||||||
|
> **Edge case** — on an *empty* group (`n = 0`, e.g. a predicate matching no
|
||||||
|
> genome), a negative count still resolves to `1`, an impossible constraint that
|
||||||
|
> rejects every k-mer. This is consistent with an empty group letting nothing
|
||||||
|
> through, but differs from the "no constraint" behaviour of the fraction flags.
|
||||||
|
|
||||||
**Conditional defaults** — the defaults for `--min-frac` and `--max-outgroup-count` depend on two conditions:
|
**Conditional defaults** — the defaults for `--min-frac` and `--max-outgroup-count` depend on two conditions:
|
||||||
whether the corresponding group was declared, **and** whether any quorum flag for that group was explicitly set.
|
whether the corresponding group was declared, **and** whether any quorum flag for that group was explicitly set.
|
||||||
|
|
||||||
@@ -215,6 +245,17 @@ obikmer filter src --output dst \
|
|||||||
--max-outgroup-count 0
|
--max-outgroup-count 0
|
||||||
```
|
```
|
||||||
|
|
||||||
|
Noise-tolerant core — keep k-mers present in *all but one* ingroup genome
|
||||||
|
(`-1` = `n−1`) and absent from *all but one* of the outgroup:
|
||||||
|
|
||||||
|
```sh
|
||||||
|
obikmer filter src --output dst \
|
||||||
|
--ingroup "genus=Betula" \
|
||||||
|
--outgroup "*" \
|
||||||
|
--min-count -1 \
|
||||||
|
--max-outgroup-count -1
|
||||||
|
```
|
||||||
|
|
||||||
To dump only k-mers specific to *Betula nana*:
|
To dump only k-mers specific to *Betula nana*:
|
||||||
|
|
||||||
```sh
|
```sh
|
||||||
|
|||||||
@@ -347,11 +347,24 @@ Provided finalisations:
|
|||||||
| `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` |
|
| `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` |
|
||||||
| `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` |
|
| `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` |
|
||||||
| `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` |
|
| `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` |
|
||||||
|
| `threshold_mash_dist_matrix(k, t)` | Mash distance, derived from `threshold_jaccard_dist_matrix(t)` — no separate partial |
|
||||||
|
|
||||||
### BitPartials
|
### BitPartials
|
||||||
|
|
||||||
Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)`, `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions.
|
Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)`, `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions.
|
||||||
|
|
||||||
|
Provided finalisations also include `jaccard_dist_matrix()`, `hamming_dist_matrix()`, and `mash_dist_matrix(k)`.
|
||||||
|
|
||||||
|
### Mash distance
|
||||||
|
|
||||||
|
`mash_dist_matrix`/`threshold_mash_dist_matrix` add no new additive primitive: both are a pointwise transform of the existing Jaccard distance matrix, per the Mash mutation-rate estimator [@Mash-distances-doc; @Fan2015-mash-formula]:
|
||||||
|
|
||||||
|
```
|
||||||
|
D = -1/k · ln(2J / (1+J)), J = 1 - d_jaccard
|
||||||
|
```
|
||||||
|
|
||||||
|
`J ≤ 0` (i.e. `d_jaccard ≥ 1`, no shared k-mers) maps to `D = 1` (maximal distance) rather than the `ln` singularity at `J = 0`.
|
||||||
|
|
||||||
---
|
---
|
||||||
|
|
||||||
## Temp-file-backed types
|
## Temp-file-backed types
|
||||||
|
|||||||
+1
-1
@@ -13,7 +13,7 @@
|
|||||||
| `query` | Query an index with sequences and annotate matches |
|
| `query` | Query an index with sequences and annotate matches |
|
||||||
| `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the shared [kmer filtering](implementation/filtering.md) system; `--head N` limits output to the first N k-mers |
|
| `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the shared [kmer filtering](implementation/filtering.md) system; `--head N` limits output to the first N k-mers |
|
||||||
| `annotate` | Add or update genome metadata from a CSV file; or dump metadata as CSV |
|
| `annotate` | Add or update genome metadata from a CSV file; or dump metadata as CSV |
|
||||||
| `distance` | Compute pairwise distance matrix between genomes; optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard on count indexes (default 1) |
|
| `distance` | Compute pairwise distance matrix between genomes (`--metric jaccard\|mash\|hamming\|bray-curtis\|relfreq-bray-curtis\|euclidean\|relfreq-euclidean\|hellinger\|hellinger-euclidean`); optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard/Mash on count indexes (default 1) |
|
||||||
| `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the shared [kmer filtering](implementation/filtering.md) system |
|
| `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the shared [kmer filtering](implementation/filtering.md) system |
|
||||||
| `select` | Project and/or aggregate genome columns into a new or in-place index; the column-axis counterpart of `filter` (see [select](implementation/select.md)) |
|
| `select` | Project and/or aggregate genome columns into a new or in-place index; the column-axis counterpart of `filter` (see [select](implementation/select.md)) |
|
||||||
| `estimate` | Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing |
|
| `estimate` | Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing |
|
||||||
|
|||||||
@@ -241,3 +241,21 @@
|
|||||||
volume = 33,
|
volume = 33,
|
||||||
year = 2017,
|
year = 2017,
|
||||||
bdsk-url-1 = {http://dx.doi.org/10.1093/bioinformatics/btw832}}
|
bdsk-url-1 = {http://dx.doi.org/10.1093/bioinformatics/btw832}}
|
||||||
|
|
||||||
|
@misc{Mash-distances-doc,
|
||||||
|
author = {{Marbl Lab}},
|
||||||
|
howpublished = {Mash documentation},
|
||||||
|
title = {Mash Distance},
|
||||||
|
url = {https://mash.readthedocs.io/en/latest/distances.html},
|
||||||
|
urldate = {2026-07-09},
|
||||||
|
year = 2026}
|
||||||
|
|
||||||
|
@article{Fan2015-mash-formula,
|
||||||
|
author = {Fan, Huan and Ives, Anthony R and Surget-Groba, Yann and Cannon, Charles H},
|
||||||
|
doi = {10.1186/s12864-015-1647-5},
|
||||||
|
journal = {BMC Genomics},
|
||||||
|
number = 1,
|
||||||
|
title = {An assembly and alignment-free method of phylogeny reconstruction from next-generation sequencing data},
|
||||||
|
url = {https://doi.org/10.1186/s12864-015-1647-5},
|
||||||
|
volume = 16,
|
||||||
|
year = 2015}
|
||||||
|
|||||||
+32
-16
@@ -1,6 +1,6 @@
|
|||||||
# Kmer entropy filter
|
# Kmer entropy filter
|
||||||
|
|
||||||
Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for two sources of bias: the small number of observations within a single kmer, and the unequal sizes of circular equivalence classes.
|
Low-complexity kmers (polyA, polyT, tandem repeats) are detected and excluded during phase 1. The filter computes a **normalized Shannon entropy** over sub-words of multiple sizes, corrected for one source of bias: the small number of observations within a single kmer relative to the number of possible sub-words.
|
||||||
|
|
||||||
## Sub-word frequencies
|
## Sub-word frequencies
|
||||||
|
|
||||||
@@ -8,17 +8,15 @@ For a kmer of length k and a sub-word size ws (1 ≤ ws ≤ ws_max, typically ws
|
|||||||
|
|
||||||
$$w_i = \text{kmer}[i \mathinner{..} i+ws-1], \quad i = 0, \ldots, n_{\text{words}}-1$$
|
$$w_i = \text{kmer}[i \mathinner{..} i+ws-1], \quad i = 0, \ldots, n_{\text{words}}-1$$
|
||||||
|
|
||||||
Each sub-word is mapped to its **circular canonical form**: the lexicographic minimum among all cyclic rotations of the word **and all cyclic rotations of its reverse complement**. This extended equivalence relation ensures that entropy(K) = entropy(revcomp(K)) — the filter is strand-symmetric. Let $s_j$ be the size of equivalence class $j$ (number of distinct raw words mapping to canonical form $j$), and $f_j$ the count of canonical form $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$).
|
Each sub-word is tallied under its own raw 2-bit-packed value — **no canonicalization**. Let $f_j$ be the count of raw word $j$ among the $n_{\text{words}}$ sub-words ($\sum_j f_j = n_{\text{words}}$), over the $4^{ws}$ possible raw words.
|
||||||
|
|
||||||
|
An earlier version of this filter first folded each sub-word into a circular+reverse-complement equivalence class, then "unfolded" the observed class frequency back onto its members to correct for unequal class sizes. That machinery bought nothing it was claimed for — see *Why no equivalence classes* below — while measurably weakening detection of the very sequences the filter exists to catch, so it was removed.
|
||||||
|
|
||||||
## Corrected Shannon entropy
|
## Corrected Shannon entropy
|
||||||
|
|
||||||
The circular equivalence classes have unequal sizes: under a uniform distribution over all $4^{ws}$ raw words, class $j$ is visited with probability $s_j / 4^{ws}$, not $1/n_a$. Computing entropy directly over canonical classes therefore underestimates the entropy of a random sequence.
|
$$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j$$
|
||||||
|
|
||||||
The correction "unfolds" each canonical class back to its member raw words, redistributing each observation of class $j$ equally among its $s_j$ members:
|
This is a plain Shannon entropy over the observed raw-word frequencies.
|
||||||
|
|
||||||
$$H_{\text{corr}} = \log(n_{\text{words}}) - \frac{1}{n_{\text{words}}} \sum_j f_j \log f_j + \frac{1}{n_{\text{words}}} \sum_j f_j \log s_j$$
|
|
||||||
|
|
||||||
The last term is the correction for unequal class sizes. For a uniformly random sequence ($f_j \approx n_{\text{words}} \cdot s_j / 4^{ws}$), this gives $H_{\text{corr}} \approx \log(4^{ws}) = 2 \cdot ws \cdot \log 2$, the maximum entropy over raw words.
|
|
||||||
|
|
||||||
## Maximum entropy correction for small samples
|
## Maximum entropy correction for small samples
|
||||||
|
|
||||||
@@ -42,27 +40,45 @@ $$\text{entropy}(kmer) = \min_{ws=1}^{ws_{\max}} \hat{H}(ws)$$
|
|||||||
|
|
||||||
A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if $\text{entropy}(kmer) < \theta$, where $\theta$ is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc.
|
A value near 0 indicates low complexity (e.g. AAAA…); near 1 indicates high complexity. A kmer is rejected if $\text{entropy}(kmer) < \theta$, where $\theta$ is a collection parameter (default 0.7). The minimum across word sizes ensures that any scale of repetition is detected independently: polyA is caught at ws=1, dinucleotide repeats at ws=2, etc.
|
||||||
|
|
||||||
|
## Why no equivalence classes
|
||||||
|
|
||||||
|
A prior design folded each sub-word into the canonical form of its circular-rotation + reverse-complement equivalence class before tallying, on the reasoning that (a) it guarantees $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, and (b) collapsing phase-shifted repeats (e.g. `ATG` ≡ `TGA` ≡ `GAT`) into one class better reflects that they are "the same" low-complexity pattern.
|
||||||
|
|
||||||
|
Both properties already hold for the raw, unfolded entropy above, without any class machinery:
|
||||||
|
|
||||||
|
- **Reverse complement**: for any K of length n, window $j$ of $\text{revcomp}(K)$ equals $\text{revcomp}$ of window $(n{-}ws{-}j)$ of K. This is a bijection between the window sets under which each window maps to its own revcomp — and revcomp is itself a bijection (involution) on the space of raw ws-mers. So the multiset of raw-word frequencies for $\text{revcomp}(K)$ is exactly a relabeling of the multiset for K, and Shannon entropy — a function of the frequency multiset alone — is exactly invariant. No folding required, for any K.
|
||||||
|
- **Tandem repeats**: a period-p repeat sampled by a stride-1 sliding window naturally cycles through its own rotations as raw tokens (e.g. `ATGATGATG…` yields the raw words `ATG`, `TGA`, `GAT` in rotation as the window slides). The low diversity this represents (few distinct raw words out of $4^{ws}$ possible) is already visible in the raw frequency distribution — no folding needed to detect it.
|
||||||
|
|
||||||
|
What the fold-then-unfold step actually did was credit each observed class with the frequency of equivalence-class members that were **never observed on the read strand**, inflating $H_{\text{corr}}$ for genuine repeats. Worked example: k=31, ws=3, kmer = `ATG` repeated ($n_{\text{words}}=29$, all 29 windows fall into one class of size 6 under the old scheme — 3 rotations × forward/revcomp):
|
||||||
|
|
||||||
|
| | $H_{\text{corr}}$ | normalized |
|
||||||
|
|---|---|---|
|
||||||
|
| old (folded, class size 6) | $\log 6 \approx 1.79$ | $\approx 0.53$ |
|
||||||
|
| current (raw, unfolded) | $\log 3 \approx 1.10$ | $\approx 0.33$ |
|
||||||
|
|
||||||
|
The gap is not a rounding artifact: per sub-word order, the folded score for this same repeat swings from 0.53 (ws=3, aligned with the period) up to **1.03** (ws=5, misaligned with the period) — i.e. a period-3 repeat could score *above* the theoretical maximum for a random sequence, depending on which ws happens to divide the repeat's period. The raw formula stays flat at ≈0.33–0.40 across ws=2..6 regardless of alignment, which is the robustness the "minimum across ws" design was meant to provide in the first place.
|
||||||
|
|
||||||
## Interpretation as an effective number of classes
|
## Interpretation as an effective number of classes
|
||||||
|
|
||||||
$H_{\text{corr}}$ is a standard Shannon entropy over raw words (after unfolding the equivalence classes), so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable classes that would yield the same entropy.
|
$H_{\text{corr}}$ is a standard Shannon entropy over raw words, so the classical perplexity interpretation holds directly: $N_{\text{eff}} = e^{H_{\text{corr}}}$ is the number of equiprobable raw words that would yield the same entropy.
|
||||||
|
|
||||||
For the normalised score $\hat{H}$, dividing by $H_{\text{max}}$ changes the logarithm base:
|
For the normalised score $\hat{H}$, dividing by $H_{\max}$ changes the logarithm base:
|
||||||
|
|
||||||
$$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\text{max}}} = \log_{N_{\text{max}}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\text{max}}^{\,\hat{H}}$$
|
$$\hat{H} = \frac{\log N_{\text{eff}}}{\log N_{\max}} = \log_{N_{\max}} N_{\text{eff}} \quad \Longleftrightarrow \quad N_{\text{eff}} = N_{\max}^{\,\hat{H}}$$
|
||||||
|
|
||||||
The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\text{max}}$) of the effective number of equi-represented classes.
|
The property is preserved: $\hat{H}$ is the logarithm (in base $N_{\max}$) of the effective number of equi-represented raw words.
|
||||||
|
|
||||||
In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\text{max}} \approx 4^{ws}$, giving:
|
In the large-sample limit ($n_{\text{words}} \gg 4^{ws}$), $N_{\max} \approx 4^{ws}$, giving:
|
||||||
|
|
||||||
$$N_{\text{eff}} \approx 4^{ws \cdot \hat{H}}$$
|
$$N_{\text{eff}} \approx 4^{ws \cdot \hat{H}}$$
|
||||||
|
|
||||||
This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective classes out of 16 are occupied.
|
This has a clean interpretation: $ws \cdot \hat{H}$ is the **effective word length** (in bases) of a perfectly uniform distribution that would produce the same entropy. At $\hat{H} = 1$ the full space of $4^{ws}$ words is used; at $\hat{H} = 0.5$ with ws=2, only $4^1 = 4$ effective words out of 16 are occupied.
|
||||||
|
|
||||||
In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\text{max}} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\text{max}}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$.
|
In our actual regime, $n_{\text{words}}$ is small and $4^{ws}$ can exceed $n_{\text{words}}$, so $H_{\max} < \log(4^{ws})$ due to the small-sample correction. The exact effective count is $N_{\max}^{\hat{H}}$, not $4^{ws \cdot \hat{H}}$.
|
||||||
|
|
||||||
## Properties
|
## Properties
|
||||||
|
|
||||||
The entropy score is a function of the kmer sequence alone — it does not depend on the surrounding context or on the position within any genome. Two consequences:
|
The entropy score is a function of the kmer sequence alone — it does not depend on the surrounding context or on the position within any genome. Two consequences:
|
||||||
|
|
||||||
- **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$, guaranteed by the strand-symmetric canonical form.
|
- **Orientation invariance**: $\text{entropy}(K) = \text{entropy}(\text{revcomp}(K))$ — see *Why no equivalence classes* above for why this holds without any explicit strand-folding step.
|
||||||
- **Context independence**: the same kmer is always rejected or always kept, regardless of which genome it occurs in, where in that genome it appears, or which strand is considered. The filter defines a fixed partition of the kmer space into low-complexity and valid kmers.
|
- **Context independence**: the same kmer is always rejected or always kept, regardless of which genome it occurs in, where in that genome it appears, or which strand is considered. The filter defines a fixed partition of the kmer space into low-complexity and valid kmers.
|
||||||
|
|||||||
@@ -3,10 +3,14 @@
|
|||||||
|
|
||||||
## Code couvert
|
## Code couvert
|
||||||
|
|
||||||
- `obiskbuilder/src/entropy_table.rs` — filtre Shannon sur les kmers à basse complexité
|
- `obikentropy/src/table.rs`, `obikentropy/src/tracker.rs` — formule d'entropie et tables de correction petits effectifs
|
||||||
- `obiskbuilder/src/lib.rs` — application du filtre lors du scatter (phase 1)
|
- `obikentropy/src/kmer_entropy.rs` — entropie d'un kmer isolé (`KmerEntropy`)
|
||||||
|
- `obiskbuilder/src/rolling_stat.rs` — composition de `obikentropy::EntropyTracker` dans le suivi streaming (sélection de minimiseur + entropie)
|
||||||
|
- `obiskbuilder/src/iter.rs`, `obiskbuilder/src/stream_iter.rs` — application du filtre lors du scatter (phase 1)
|
||||||
|
|
||||||
## Notes
|
## Notes
|
||||||
|
|
||||||
Document théorique stable. Vérifier que les paramètres `theta` et `level_max` dans le CLI
|
Le repli en classes d'équivalence circulaires + brin inverse (décrit dans une version antérieure de ce document) a été supprimé : voir la section « Why no equivalence classes » de `entropy.md` pour la justification théorique et numérique.
|
||||||
|
|
||||||
|
Vérifier que les paramètres `theta` et `level_max` dans le CLI
|
||||||
(`obikmer/src/cli.rs` → `CommonArgs`) correspondent bien à ce qui est décrit.
|
(`obikmer/src/cli.rs` → `CommonArgs`) correspondent bien à ce qui est décrit.
|
||||||
|
|||||||
@@ -0,0 +1,994 @@
|
|||||||
|
# Central-position SNP distance (discussion)
|
||||||
|
|
||||||
|
Not implemented. Design discussion for a substitution-rate estimator that
|
||||||
|
observes SNPs directly from paired-genome k-mer comparison, as an alternative
|
||||||
|
to Mash's Poisson-Jaccard inference (see [obicompactvec](../implementation/obicompactvec.md)
|
||||||
|
for the implemented Jaccard/Mash distances).
|
||||||
|
|
||||||
|
## Motivation
|
||||||
|
|
||||||
|
**Primary intent: restrict the comparison to what is actually comparable.**
|
||||||
|
Mash's Jaccard is computed over the **union** of both genomes' k-mer content:
|
||||||
|
anything not identically shared is folded into a single undifferentiated
|
||||||
|
mass, whether the cause is a point substitution, a genuinely absent
|
||||||
|
homologous region (lineage-specific content, gene-family expansion, HGT,
|
||||||
|
genome-size asymmetry), or a diverged paralogous copy. The model then
|
||||||
|
back-infers a single mutation rate from that mass, silently attributing
|
||||||
|
non-homology to mutation. The central-SNP approach instead conditions every
|
||||||
|
comparison on local, positive evidence of homology: a locus only enters the
|
||||||
|
statistic if its `2m` flanking bases (`m = (k-1)/2`) are found intact in
|
||||||
|
*both* genomes — genuinely absent or non-homologous content is excluded from
|
||||||
|
the comparison entirely (neither numerator nor denominator), rather than
|
||||||
|
silently counted as divergence. This is a conditioning on comparability, not
|
||||||
|
just a richer summary statistic — see "Statistic and correspondence with
|
||||||
|
`shared`" below for how it plays out against genome-size asymmetry and
|
||||||
|
diverged gene families, and "Heterozygosity, ploidy, and consensus-assembly
|
||||||
|
inputs" for the corresponding paralogy/heterozygosity filter.
|
||||||
|
|
||||||
|
**Secondary benefit: access to the substitution's nature.** Because the
|
||||||
|
central base of an odd-k window is directly observable once the flanks are
|
||||||
|
confirmed conserved, this also yields more than a rate — the
|
||||||
|
transition/transversion split — enabling classical corrected distances
|
||||||
|
(Jukes-Cantor, Kimura 2-parameter, LogDet) that a single Jaccard scalar
|
||||||
|
cannot support.
|
||||||
|
|
||||||
|
## Statistic and correspondence with `shared`
|
||||||
|
|
||||||
|
A genomic position `p` is covered by `k` overlapping k-mer windows. Requiring
|
||||||
|
the substitution to sit at the window's **center** makes exactly one window
|
||||||
|
per SNP eligible — a 1:1 correspondence between SNP and center-neighbor k-mer
|
||||||
|
pair, avoiding the ~k-fold overcount of an any-position neighbor search.
|
||||||
|
|
||||||
|
A locus with a fully conserved `k`-window (flanks **and** center) is an
|
||||||
|
exact-shared k-mer at that locus; a locus with conserved flanks but a
|
||||||
|
substituted center is a "central SNP". Both count each locus exactly once, in
|
||||||
|
matching units:
|
||||||
|
|
||||||
|
```
|
||||||
|
p_hat[i,j] = SNP[i,j] / (SNP[i,j] + shared[i,j])
|
||||||
|
```
|
||||||
|
|
||||||
|
`p_hat` is `P(center substituted | 2m flanks conserved)`. `shared[i,j]` here
|
||||||
|
is **not** the general-purpose `shared_kmers` matrix used by Jaccard/Mash
|
||||||
|
(`--shared-kmers`, `BitPartials::partial_jaccard` /
|
||||||
|
`CountPartials::partial_threshold_jaccard`) — that matrix counts raw k-mer
|
||||||
|
identity with no per-genome copy-number constraint, whereas `p_hat`'s
|
||||||
|
denominator applies the eligibility rule defined below (raw or
|
||||||
|
paralogy-filtered). Both `SNP` and `shared` are accumulated by the same
|
||||||
|
sweep, from the same per-locus candidate set (source k-mer + 3 variants),
|
||||||
|
under the same eligibility rule — see "Locus eligibility" below, and
|
||||||
|
"Heterozygosity, ploidy, and consensus-assembly inputs" for why the
|
||||||
|
copy-number constraint matters and what it costs.
|
||||||
|
|
||||||
|
**Canonical invariance**: for odd k, the central position maps to itself under
|
||||||
|
reverse-complement (`m -> k-1-m = m`, base complemented). A transition maps to
|
||||||
|
a transition, a transversion to a transversion — the transition/transversion
|
||||||
|
split is well-defined in canonical space.
|
||||||
|
|
||||||
|
### Definitions: family, and the canonical form of a family
|
||||||
|
|
||||||
|
**Family.** The family of a k-mer `x` is the set of (up to) 4 k-mers sharing
|
||||||
|
`x`'s `2m` flanking bases, differing only at the central base `m`. Membership
|
||||||
|
is a property of the flank pattern, not of `x` itself: any of the 4 possible
|
||||||
|
central substitutions belongs to the same family.
|
||||||
|
|
||||||
|
**`central_canonical_neighbors()`** (`obikseq`, `CanonicalKmerOf::central_canonical_neighbors`)
|
||||||
|
generates all 4 members from any one of them (observed or not), each
|
||||||
|
independently canonicalised (`.canonical()`, i.e. `min(kmer, revcomp(kmer))`).
|
||||||
|
This independent canonicalisation is necessary because a central substitution
|
||||||
|
can flip which orientation is lexicographically smaller — two members of the
|
||||||
|
same family can end up canonicalised in *different* orientations. Despite
|
||||||
|
that, the **set** of 4 resulting canonical k-mers is invariant: calling
|
||||||
|
`central_canonical_neighbors()` on any member of a family — present in the
|
||||||
|
index or not — yields the same 4 values. This is relied upon throughout the
|
||||||
|
rest of this document.
|
||||||
|
|
||||||
|
**Canonical form of a family.** Because orientation can differ member to
|
||||||
|
member, "which of the 4 is the reference" cannot be defined relative to
|
||||||
|
*whichever member happened to be visited first*, nor relative to the
|
||||||
|
minorant (see below) — both are data-dependent (they depend on what is
|
||||||
|
actually observed), so using either as the reference would make the
|
||||||
|
reference itself vary depending on what happens to be present in a given
|
||||||
|
index. Instead: **the canonical form of a family is, by definition, the
|
||||||
|
member whose own central base — read in its own already-canonical
|
||||||
|
orientation — is `A`.** This is well-defined for every family, computed
|
||||||
|
purely from the flank pattern, whether or not that specific member (or any
|
||||||
|
member at all) is actually observed anywhere in the index. Concretely: call
|
||||||
|
`central_canonical_neighbors()` on any member (observed or not) to get the
|
||||||
|
family's 4 canonical forms; the one among them whose own centre nucleotide is
|
||||||
|
`A` is the family's canonical form. The other 3 (`C`, `G`, `T`) are labelled
|
||||||
|
relative to *that* fixed reference, not relative to the calling member's own
|
||||||
|
orientation.
|
||||||
|
|
||||||
|
**Consequence for the minorant.** With this fixed A-referenced labelling,
|
||||||
|
`minorant` (the smallest raw encoding among the family's *observed* members,
|
||||||
|
introduced further below) becomes directly computable rather than needing to
|
||||||
|
be tracked as extra state: regenerate the family's 4 canonical forms from
|
||||||
|
any member's own k-mer (cheap, no lookup), compare the raw encodings of
|
||||||
|
whichever are marked present, and take the smallest. No separate stored bit
|
||||||
|
is required — see Step 2b below, where this replaces the earlier
|
||||||
|
minorant-bit design.
|
||||||
|
|
||||||
|
## Locus eligibility: raw definition vs. paralogy filter
|
||||||
|
|
||||||
|
For each k-mer `x` observed in genome A (source, one MPHF slot; the 3
|
||||||
|
central-position variants generated as in the sweep below): check whether
|
||||||
|
A's locus (flanks fixed) is resolvable in genome B under one of the 4
|
||||||
|
central forms.
|
||||||
|
|
||||||
|
**Raw / no model.** The locus counts in the denominator iff at least one of
|
||||||
|
the 4 forms is present in B; it counts in the numerator iff the form found in
|
||||||
|
B differs from A's own. No constraint on A's or B's own copy number at this
|
||||||
|
locus. Open question, not resolved: what if **more than one** of the 4 forms
|
||||||
|
is present in B simultaneously (ambiguous target — count once arbitrarily,
|
||||||
|
count all, or drop)? The stringent filter below sidesteps the question by
|
||||||
|
construction rather than answering it.
|
||||||
|
|
||||||
|
**Stringent / paralogy-aware.** The locus counts only if exactly one of the
|
||||||
|
4 forms is present in A **and** exactly one is present in B (`count == 1` at
|
||||||
|
that slot too, when a count index is available, to also exclude same-allele
|
||||||
|
duplicates that presence alone cannot see). This drops the raw definition's
|
||||||
|
ambiguous-B case automatically, at the cost of also dropping heterozygous
|
||||||
|
sites indiscriminately alongside true duplications (see "Heterozygosity,
|
||||||
|
ploidy, and consensus-assembly inputs" below).
|
||||||
|
|
||||||
|
**Rejected: parsimony-based multiset pairing for multiplicity > 1.** Rather
|
||||||
|
than dropping ambiguous loci, pair identical alleles between A and B first
|
||||||
|
(0-mutation explanation preferred), then take `min(unmatched_A, unmatched_B)`
|
||||||
|
as inferred SNP pairs. Rejected on two grounds: (1) circularity — selecting
|
||||||
|
pairs by minimal apparent divergence, then measuring divergence on those same
|
||||||
|
pairs, deflates the estimate by construction, not a neutral heuristic; (2)
|
||||||
|
the discriminating signal is a single base among 4 possible values, and the
|
||||||
|
flanks are *already* guaranteed identical for every candidate by
|
||||||
|
construction (that is how the locus was selected) — no information remains
|
||||||
|
in a k-mer window to tell which copy in B truly corresponds to which copy in
|
||||||
|
A once multiplicity > 1 on either side. Any pairing rule invents a
|
||||||
|
correspondence the data cannot support. Multiplicity > 1 is treated as
|
||||||
|
non-identifiable, not as a puzzle to solve with a heuristic.
|
||||||
|
|
||||||
|
## Multi-genome framing: family as pseudo-alignment column
|
||||||
|
|
||||||
|
**Idea.** Instead of resolving locus eligibility and correspondence one
|
||||||
|
genome pair at a time, treat a family as a column of a pseudo multiple
|
||||||
|
alignment across *all* genomes simultaneously: for each family, each genome
|
||||||
|
has either a net single-copy state (`A`/`C`/`G`/`T`, when the genome carries
|
||||||
|
exactly one of the 4 forms) or "missing" (`?`, multi-copy or absent). Flank
|
||||||
|
conservation (the `2m` bases fixed by construction) supplies positional
|
||||||
|
homology for free — the same role a real MSA would play, without alignment
|
||||||
|
software, gap penalties, or progressive-alignment approximations. Stacking
|
||||||
|
one such column per family, genomes as rows, produces a genuine SNP
|
||||||
|
pseudo-alignment matrix, not just a bag of pairwise distances.
|
||||||
|
|
||||||
|
**Precedent.** This is the same principle behind reference-free
|
||||||
|
k-mer-based phylogenomics tools — SKA (Split K-mer Analysis, Harris 2018) and
|
||||||
|
kSNP: split the k-mer around a variable center, use flank identity to call
|
||||||
|
homologous columns across arbitrarily many genomes with no reference and no
|
||||||
|
MSA step, then feed the resulting pseudo-alignment to standard phylogenetic
|
||||||
|
tools. Landing on the same design independently is a good sign, not a
|
||||||
|
coincidence.
|
||||||
|
|
||||||
|
**Resolves the pairwise-correspondence problem, properly.** The "Rejected:
|
||||||
|
parsimony-based multiset pairing" case above failed because, with only two
|
||||||
|
genomes' cardinalities to look at, there is no external constraint to justify
|
||||||
|
picking one correspondence between leftover alleles over another — `min(a,b)`
|
||||||
|
is a lower bound dressed up as a point estimate (see the follow-up discussion
|
||||||
|
on Felsenstein-style parsimony inconsistency: minimum-event explanations are
|
||||||
|
systematically biased low whenever homoplasy/multiplicity is real, not
|
||||||
|
noise-cancelling). With `N` genomes and many families jointly, the same
|
||||||
|
question can be answered the way real phylogenetics answers it: ancestral
|
||||||
|
state reconstruction / ML mapping over a tree estimated from the whole
|
||||||
|
column set. The tree supplies the missing constraint that two isolated
|
||||||
|
columns cannot — this is the principled way out, not a heuristic replacement
|
||||||
|
for one.
|
||||||
|
|
||||||
|
**Relation to what's already implemented.** `KmerIndex::raw_snp_distance`
|
||||||
|
already computes, internally, per family, exactly this row — `single_form:
|
||||||
|
Vec<Option<u8>>`, one entry per genome, `None` where ambiguous/absent —
|
||||||
|
before immediately collapsing it into pairwise `snp[i,j]`/`shared[i,j]`
|
||||||
|
tallies. The pivot this section proposes is small at the implementation
|
||||||
|
level: stop collapsing early, and surface the per-family row as a first-class
|
||||||
|
artifact (a `families x genomes` matrix). Pairwise raw p-distance becomes one
|
||||||
|
projection of that matrix (what's computed today), not the primary object;
|
||||||
|
downstream, the matrix itself could feed real phylogenetic tools (parsimony/
|
||||||
|
ML, e.g. RAxML/IQ-TREE-style) instead of only NJ/UPGMA on a homemade
|
||||||
|
pairwise-distance matrix.
|
||||||
|
|
||||||
|
**Caveat: column completeness shrinks with `N`.** The probability that a
|
||||||
|
family's flanks stay intact simultaneously across all `N` genomes decays with
|
||||||
|
`N` (same ascertainment-bias mechanism as Bias 1 above, compounded over more
|
||||||
|
genomes) — fully-resolved columns (no `?` anywhere) become rare as more
|
||||||
|
genomes are added. Same missing-data situation any real multi-species
|
||||||
|
alignment faces, and phylogenetic tools already handle it well; the practical
|
||||||
|
implication is that columns should be allowed partial coverage (>=2 resolved
|
||||||
|
genomes, not unanimous) rather than requiring every genome to be net
|
||||||
|
single-copy at that locus.
|
||||||
|
|
||||||
|
## Context, detectability, and a 3-way ordinal distance per pair
|
||||||
|
|
||||||
|
Empirical follow-up to the pseudo-alignment idea above: `obikmer distance
|
||||||
|
--snp` was run on a real 20-genome benchmark index and the resulting FASTA
|
||||||
|
fed to `raxml-ng`. Two problems surfaced, both traced back to conflating
|
||||||
|
distinct notions under one symbol.
|
||||||
|
|
||||||
|
**"Context", precisely.** Sharing a central base between two genomes is not
|
||||||
|
just sharing a nucleotide — it is sharing a **context**: the `2m` flanking
|
||||||
|
bases, identical, which is a homology claim about that flanked window
|
||||||
|
(guaranteed non-coincidental by k-specificity, Bias 4 above), *not* a claim
|
||||||
|
about orthology or paralogy of the copy each genome carries. `A` opposite `C`
|
||||||
|
= same context, divergent centre. `A` opposite nothing = **this context is
|
||||||
|
not observed in one of the two genomes** — informative, not neutral.
|
||||||
|
|
||||||
|
**Why the IUPAC/DNA encoding used for the first `--snp` test was wrong.**
|
||||||
|
Feeding IUPAC-coded ambiguity into a standard DNA model (`raxml-ng --model
|
||||||
|
GTR+G`) is a semantic mismatch: Felsenstein-pruning ML treats an ambiguous
|
||||||
|
tip as "exactly one true state, unknown which" (a uniform partial-likelihood
|
||||||
|
vector over compatible bases), not "these states are simultaneously
|
||||||
|
present". The two encodings look identical (same IUPAC letters) but the
|
||||||
|
software reads them backwards from what was intended — this invalidates the
|
||||||
|
literal branch lengths from that first experiment (topology-level groupings
|
||||||
|
by genus were still informative, see the worked example further down).
|
||||||
|
|
||||||
|
**Why `-` (absence) must not be scored as similarity, but also must not be
|
||||||
|
scored as a shared character between two absences.** Two genomes both
|
||||||
|
lacking a context are not observed to resemble each other at that locus —
|
||||||
|
neither is observed to differ from the other either. It is a symmetric
|
||||||
|
non-observation, uninformative for that pair, and should contribute nothing
|
||||||
|
(not a small positive nor a small negative signal) to their distance. A
|
||||||
|
genome carrying a state (`A`) against one carrying none is a different case
|
||||||
|
entirely: informative, and should not be scored as neutral "missing data"
|
||||||
|
the way a generic DNA/ML pipeline would.
|
||||||
|
|
||||||
|
**Detectability vs existence — a deliberate simplification, accepted.**
|
||||||
|
"Context not observed" conflates two different biological events: (1) true
|
||||||
|
loss of the locus, (2) the locus still exists but a mutation/indel *outside*
|
||||||
|
the centre, anywhere in the `2m` flanks, broke k-mer recognition. The design
|
||||||
|
adopts a rigorist stance on purpose: any flank-breaking mutation counts as
|
||||||
|
"this context no longer exists", full stop — because both causes (1) and (2)
|
||||||
|
independently require *at least* one more mutational event than a lone
|
||||||
|
central substitution would. This licenses treating "context absent in one of
|
||||||
|
the two genomes" as a **lower bound** on distance strictly greater than a
|
||||||
|
plain central SNP, without needing to know which of the two causes applies.
|
||||||
|
Coarser than a true event count, and accepted as such (fine substitution-type
|
||||||
|
modelling, e.g. transition/transversion weighting, is a secondary
|
||||||
|
refinement, not required for this to be useful).
|
||||||
|
|
||||||
|
**Resulting ordinal distance between two genomes at one family/context:**
|
||||||
|
|
||||||
|
| Comparison | Distance | Meaning |
|
||||||
|
|---|---|---|
|
||||||
|
| same centre (`A`/`A`) | `0` | identical |
|
||||||
|
| different centre, both single-copy (`A`/`C`) | `1` | plain central SNP |
|
||||||
|
| one genome has a state, the other has none | `>1` (lower bound) | context undetectable in one genome — at least one extra mutational event, of unknown type |
|
||||||
|
| neither genome has any state (`∅`/`∅`) | excluded | symmetric non-observation, not comparable, contributes nothing |
|
||||||
|
|
||||||
|
This is a direct extension of `KmerIndex::raw_snp_distance` (`obikindex/src/siblings.rs`),
|
||||||
|
which today only implements the `0`/`1` rows and silently drops everything
|
||||||
|
else (including the informative `>1` row) rather than scoring it.
|
||||||
|
|
||||||
|
**Open, not yet resolved:**
|
||||||
|
- Calibrating `>1` to a real number for tools expecting continuous distances
|
||||||
|
(NJ/UPGMA, ML branch lengths), rather than an arbitrary placeholder.
|
||||||
|
Natural route: estimate `p_hat` from the resolved (`0`/`1`) sites first,
|
||||||
|
then use the already-derived ascertainment formula (`P(usable window
|
||||||
|
showing a central SNP) = p * (1-p)^(2m)`, Bias 1 above) to derive a
|
||||||
|
model-consistent value for the `>1` bucket instead of guessing a constant.
|
||||||
|
- Where multi-copy/ambiguous states (the IUPAC case: a genome carrying more
|
||||||
|
than one form) fit into this ordinal scheme — plausibly also `>1` by the
|
||||||
|
same "at least one extra event" argument (a second form appearing is a
|
||||||
|
gain, itself an event), but not yet worked out.
|
||||||
|
|
||||||
|
**Practical alternative validated for the pseudo-alignment output itself**
|
||||||
|
(orthogonal to the ordinal-distance question above, useful regardless of how
|
||||||
|
`>1` ends up calibrated): re-encode each family as 4 independent binary
|
||||||
|
presence/absence characters (`A`,`C`,`G`,`T` columns) instead of one IUPAC
|
||||||
|
column, feed to a `BIN`-type model instead of `DNA`. `∅` becomes an explicit
|
||||||
|
`0000` state (identity with another `0000`, not missing data) rather than a
|
||||||
|
gap — removes the semantic mismatch above by construction. Known cost,
|
||||||
|
accepted for now: a plain central substitution (`A` -> `C`) becomes 2 binary
|
||||||
|
flips (`1000` -> `0100`), overweighting substitutions relative to true
|
||||||
|
gain/loss events, and the 4 sub-characters of one family are not
|
||||||
|
statistically independent the way a generic `BIN` model assumes. A proper
|
||||||
|
fix (single 16-state alphabet, i.e. the powerset of `{A,C,G,T}`, with a
|
||||||
|
substitution-rate structure that respects the subset lattice rather than a
|
||||||
|
fully general 16x16 GTR-analogue) is very likely not expressible in
|
||||||
|
`raxml-ng`'s `MULTI` datatype as-is (Mk or fully-general rates only) and a
|
||||||
|
fully general 16-state rate matrix is almost certainly unidentifiable here
|
||||||
|
(states of cardinality >=3 are ~2% of sites in the benchmark run). Treated as
|
||||||
|
a longer-term research question, not a near-term implementation target.
|
||||||
|
|
||||||
|
## Sankoff parsimony as the resolution of the 16-state model problem
|
||||||
|
|
||||||
|
The "longer-term research question" just above (a 16-state alphabet — the
|
||||||
|
powerset of `{A,C,G,T}` — with a substitution structure that respects the
|
||||||
|
subset lattice) turns out to have a near-term answer, once the *unification*
|
||||||
|
question below is worked through.
|
||||||
|
|
||||||
|
**Distance methods (NJ/UPGMA/ME) vs. character methods (parsimony/ML): not a
|
||||||
|
deep philosophical divide, but a real practical distinction for this
|
||||||
|
project.** Historically "phenetic" (characters -> distances -> tree) and
|
||||||
|
"cladistic" (characters -> tree directly) approaches were presented as
|
||||||
|
opposed schools; the modern view is a mathematical continuity, not a
|
||||||
|
dichotomy — Minimum Evolution (ME: find the tree minimizing total branch
|
||||||
|
length from a distance matrix) and Maximum Parsimony (MP: find the tree
|
||||||
|
minimizing total character-state changes) are both instances of "minimise a
|
||||||
|
global explanatory cost", and coincide under simple encodings (see Farris
|
||||||
|
1983, "The Logical Basis of Phylogenetic Analysis"; the MP/ME connection is
|
||||||
|
developed in the Minimum Evolution / Balanced Minimum Evolution literature,
|
||||||
|
e.g. Nei and colleagues — citations not independently re-verified here, flag
|
||||||
|
before quoting further). NJ's own agglomeration step already uses the whole
|
||||||
|
distance matrix jointly (the Q-matrix), not just the pair being merged — an
|
||||||
|
earlier claim in this discussion that distance methods are "blind" to
|
||||||
|
cross-taxon structure at every stage was too strong.
|
||||||
|
|
||||||
|
What *does* remain a real, structural distinction for this project: in a
|
||||||
|
character method, a given character's cost is **re-evaluated per candidate
|
||||||
|
topology** during tree search (the same family can cost 1 change under one
|
||||||
|
topology, 2 under another). In a pairwise-distance pipeline
|
||||||
|
(`raw_snp_distance` as it exists today), each family's contribution to
|
||||||
|
`d(i,j)` is computed **once**, independent of any candidate topology, before
|
||||||
|
NJ/UPGMA ever runs — so a question like "does this shared `∅` look like a
|
||||||
|
synapomorphy under topology T" can never be posed in that pipeline, for any
|
||||||
|
T. That question is only answerable by a method that tests candidate
|
||||||
|
topologies and re-scores characters under each — i.e. a character method.
|
||||||
|
|
||||||
|
**Sankoff parsimony directly resolves the `∅`/gain-loss/substitution
|
||||||
|
question, without the identifiability problem of a fitted 16-state model.**
|
||||||
|
Sankoff's algorithm generalises Fitch parsimony to an arbitrary
|
||||||
|
user-supplied cost matrix between states (`obikseq`/`obikindex` would treat
|
||||||
|
each family as a `2^{4}`-state character, state = subset of `{A,C,G,T}`
|
||||||
|
observed in that genome, `∅` included as a real state, not a gap). The
|
||||||
|
previous 16-state idea failed specifically because *fitting* a full 16x16
|
||||||
|
rate matrix by ML is unidentifiable at this data volume; Sankoff sidesteps
|
||||||
|
that because the cost matrix is **fixed a priori from domain knowledge**, not
|
||||||
|
estimated — e.g. `c({A},{C}) = 1` (a substitution), `c({A},{A,C}) = 1` (a
|
||||||
|
gain), `c({A,C},{A}) = 1` (a loss), `c({A,C},{G,T}) = 2` (two changes) — no
|
||||||
|
estimation, no overparameterisation. This reframes gain/loss and central
|
||||||
|
substitution as two cost categories with independently chosen weights,
|
||||||
|
exactly the "two families of parameters" (`mu_substitution`, `mu_gain/loss`)
|
||||||
|
floated earlier in this discussion, now with an actual algorithmic home.
|
||||||
|
|
||||||
|
**Caveat, not blocking for this project's scope.** Sankoff is still
|
||||||
|
parsimony: in principle exposed to Felsenstein's statistical-inconsistency
|
||||||
|
result under long-branch attraction (already invoked earlier against
|
||||||
|
`D_F = min(a,b)`) — parsimony and ML only provably coincide in the
|
||||||
|
short-branch regime. This is not a practical concern here because it is
|
||||||
|
exactly this estimator's declared target (closely related genomes, short
|
||||||
|
branches) — the regime where parsimony's known failure mode does not apply —
|
||||||
|
but worth stating explicitly as a scope guard rather than leaving it
|
||||||
|
implicit.
|
||||||
|
|
||||||
|
**Cheapest next experiment: don't write a Sankoff tree-search engine, use
|
||||||
|
one that exists.** The hard part of a from-scratch implementation is not the
|
||||||
|
Sankoff DP itself (a straightforward dynamic program over a *fixed* tree) but
|
||||||
|
the topology search (SPR/NNI with incremental re-scoring) that comes for
|
||||||
|
free with `raxml-ng` on the ML side. **TNT** (Tree analysis using New
|
||||||
|
Technology, free, standard in morphological cladistics) already implements
|
||||||
|
Sankoff parsimony with a custom cost matrix plus topology search — the
|
||||||
|
family-state matrix (already close to what `--snp` produces, minus the
|
||||||
|
IUPAC/DNA-model mismatch) could be fed there directly, no new code required,
|
||||||
|
before considering a bespoke engine.
|
||||||
|
|
||||||
|
**The concrete comparison this unlocks:** run both pipelines on the same
|
||||||
|
family data —
|
||||||
|
`k-mer families -> D_ij -> NJ/ME/UPGMA` (phenetic, what exists today) vs.
|
||||||
|
`k-mer families -> characters -> argmin_T Sankoff-cost(T)` (cladistic, via
|
||||||
|
TNT) — and compare the resulting topologies. Agreement would validate that
|
||||||
|
the pairwise-distance projection preserves the phylogenetic signal;
|
||||||
|
disagreement would pinpoint exactly what the projection to a single number
|
||||||
|
per pair loses. Not yet run.
|
||||||
|
|
||||||
|
## Heterozygosity, ploidy, and consensus-assembly inputs
|
||||||
|
|
||||||
|
A within-genome multiplicity signal (more than one of the 4 central forms
|
||||||
|
present at a locus) is produced identically by two distinct causes:
|
||||||
|
paralogous duplication and diploid/polyploid heterozygosity. K-mer data alone
|
||||||
|
cannot distinguish them. The one real discriminator is sequencing depth
|
||||||
|
(heterozygous site: total depth of the present forms ~= the genome's
|
||||||
|
single-copy average; duplication: ~2x or more) — but that signal only exists
|
||||||
|
if genome "counts" are raw-read depth (FASTQ input), not occurrence counts in
|
||||||
|
an assembled FASTA, where per-locus depth is not preserved.
|
||||||
|
|
||||||
|
**Magnitude is taxon- and mating-system-dependent, not universal.**
|
||||||
|
Heterozygosity density: mammals ~1 site / 1-1.5 kb (~0.1%); highly
|
||||||
|
outcrossing plants (maize, poplar) reported an order of magnitude higher
|
||||||
|
(~1%); self-fertilising plants (*Arabidopsis thaliana*) near zero — but with
|
||||||
|
a documented failure mode where segmental duplication masquerades as
|
||||||
|
"pseudo-heterozygosity"; fungi split between haploid vegetative stages
|
||||||
|
(non-issue) and dikaryotic Basidiomycetes, where two long-diverged haploid
|
||||||
|
nuclei coexist without fusing. The estimator's target use case (closely
|
||||||
|
related genomes, k=31) is exactly where the stringent filter above costs the
|
||||||
|
least for low-heterozygosity taxa and the most for outcrossing/dikaryotic
|
||||||
|
ones — no universal threshold; this is a scope caveat to document, not a
|
||||||
|
problem to solve generically.
|
||||||
|
|
||||||
|
**Why assembled-consensus inputs don't make measured distances wrong.**
|
||||||
|
Phylogenetic inputs are near-universally assemblies, not raw reads, and
|
||||||
|
assemblers collapse heterozygous sites to one consensus allele per
|
||||||
|
position — effectively an arbitrary, largely uncorrelated-between-assemblies
|
||||||
|
choice at each het site. This does not inject unbounded noise: standard
|
||||||
|
population genetics gives `d_xy = d_a + (pi_A + pi_B)/2` — the expected
|
||||||
|
pairwise difference between a random allele of population A and a random
|
||||||
|
allele of population B equals the net (fixed) divergence `d_a` plus the
|
||||||
|
average of the two populations' own within-population diversity `pi`.
|
||||||
|
Consensus flattening realises exactly this random-allele draw, so the
|
||||||
|
measured genome-to-genome distance is a `d_xy`-like quantity, not `d_a` —
|
||||||
|
inflated by heterozygosity by a well-characterised additive term, not
|
||||||
|
distorted unpredictably. The term is negligible when `pi << d_xy` (the common
|
||||||
|
case for cross-species comparisons), and becomes material precisely in the
|
||||||
|
two cases already flagged above: very closely related genomes (this
|
||||||
|
estimator's explicit target) and highly heterozygous outcrossing organisms,
|
||||||
|
where `pi` and `d_xy` are the same order of magnitude.
|
||||||
|
|
||||||
|
Caveat: this assumes the flattening is uncorrelated with the phylogenetic
|
||||||
|
signal — plausible for de novo assembly, not guaranteed for reference-guided
|
||||||
|
assembly biased toward one allele (e.g. the reference's) at each het site,
|
||||||
|
which would turn the noise term into a systematic bias toward the reference
|
||||||
|
lineage. Not evaluated here.
|
||||||
|
|
||||||
|
**Forward-looking implication, not part of the current design.** The
|
||||||
|
multiplicity > 1 signal discarded by the stringent filter is a crude
|
||||||
|
per-genome proxy for `pi` (under low background paralogy). If a `pi_hat` per
|
||||||
|
genome were tallied alongside `SnpTally`, a `d_a` correction
|
||||||
|
(`p_hat - mean(pi_hat_i, pi_hat_j)/2`, roughly) could recover an estimate
|
||||||
|
closer to net divergence instead of `d_xy` — a possible extension, not
|
||||||
|
scoped here.
|
||||||
|
|
||||||
|
## Sufficient statistic: 4x4 base-pair tally
|
||||||
|
|
||||||
|
Tabulating the joint distribution of `(center_i, center_j)` over conserved-flank
|
||||||
|
loci, per genome pair, is sufficient for every downstream correction:
|
||||||
|
|
||||||
|
| Estimator | Input | Formula |
|
||||||
|
|---|---|---|
|
||||||
|
| Raw p-distance | total off-diagonal / total | `p = SNP / (SNP + shared)` |
|
||||||
|
| Jukes-Cantor | p | `d = -3/4 * ln(1 - 4p/3)` |
|
||||||
|
| Kimura 2-parameter | transition rate P, transversion rate Q | `d = 1/2 ln(1/(1-2P-Q)) + 1/4 ln(1/(1-2Q))` |
|
||||||
|
| LogDet/paralinear | full 4x4 + base-composition margins | `d ~= -1/4 ln det(F)`, robust to non-stationary base composition |
|
||||||
|
|
||||||
|
JC/K2P need only the total and the transition/transversion split (the
|
||||||
|
diagonal collapses to a single "shared" total). LogDet needs the full 4x4,
|
||||||
|
already populated at no extra cost (see Step 1/2 below).
|
||||||
|
|
||||||
|
Memory for the 4x4 tally: `n^2 * 16` counters. Trivial for the project's
|
||||||
|
genome-scale use case (tens to hundreds of genomes); ~13 GB at n=10^4 — outside
|
||||||
|
scope but worth flagging if n grows.
|
||||||
|
|
||||||
|
## Biases (properties of the estimator, not defects)
|
||||||
|
|
||||||
|
1. **Conserved-flank ascertainment bias.** Only SNPs with intact `2m`-base
|
||||||
|
flanks are visible; window-intact probability decays as `(1-p)^{2m}`. For
|
||||||
|
k=31 (2m=30): 0.74 at p=1%, 0.21 at p=5%, 0.04 at p=10%. This estimator
|
||||||
|
targets **closely related genomes**. Under rate heterogeneity across sites
|
||||||
|
(universal in practice), conserved flanks correlate with slow centers, so
|
||||||
|
`p_hat` underestimates the genome-wide average rate — it specifically
|
||||||
|
estimates the substitution rate of **conserved regions**.
|
||||||
|
Two distinct factors are at play here, not one: `P(centre of a given
|
||||||
|
window is a SNP) = p` exactly, **independent of k** — a direct restatement
|
||||||
|
of the raw per-site rate via the bijective window<->centre-position
|
||||||
|
correspondence (Statistic section above), not a k-dependent quantity.
|
||||||
|
`(1-p)^{2m}` is the *separate*, genuinely k-dependent ascertainment factor
|
||||||
|
(are the flanks also intact). The two multiply:
|
||||||
|
`P(usable window showing a central SNP) = p * (1-p)^{2m}` — e.g. at
|
||||||
|
p=1/31 (~3.2%), k=31: `p * (1-p)^30 ~= 0.0323 * 0.374 ~= 1.2%`, i.e. about
|
||||||
|
1 window in 83, not 1 in 31 (which is only the centre-mutated fraction,
|
||||||
|
before requiring intact flanks).
|
||||||
|
2. **Bias toward isolated SNPs.** Two SNPs within k of each other disqualify
|
||||||
|
each other's flanks. Hypervariable regions are invisible by construction.
|
||||||
|
3. **Indels are invisible.** A frameshift destroys k-mer matches in a block;
|
||||||
|
this channel captures substitutions only. Indel divergence shows up as lost
|
||||||
|
shared k-mers (lower Jaccard/Mash), not as SNP signal.
|
||||||
|
4. **k-dependent specificity.** "A k-mer match implies common ancestry" is
|
||||||
|
quantitative. For a 3 Gbp genome, expected random flank-30 collisions
|
||||||
|
(k=31): `(3e9)^2 / 4^30 ~= 8` — negligible. At k=21: `(3e9)^2 / 4^20 ~= 2e6`
|
||||||
|
— no longer negligible. k=31 is safe; k<=21 is marginal to unreliable for
|
||||||
|
large genomes. The large k that guarantees homology is the same k that
|
||||||
|
shrinks the detectable-divergence window — an inherent tension.
|
||||||
|
|
||||||
|
## Implementation: avoid materializing a de Bruijn graph
|
||||||
|
|
||||||
|
A central-SNP pair is topologically a simple bubble in the colored de Bruijn
|
||||||
|
graph (source/sink k-mer shared, two length-k branches differing only at the
|
||||||
|
midpoint). Classical bubble-calling (Cortex/discoSNP-style) finds these, but
|
||||||
|
requires the graph — nodes plus adjacency for ~10^9 colored k-mers — resident
|
||||||
|
in memory. **Rejected**: prohibitive RAM for this project's scale.
|
||||||
|
|
||||||
|
A naive per-pair generalisation of variant lookup across n genomes (query each
|
||||||
|
non-shared k-mer's 3 central variants against every counterpart genome's
|
||||||
|
index) costs `O(n^2 . N . 3)` random lookups, with the same k-mer's 3 variants
|
||||||
|
regenerated and requeried once per counterpart genome — pure redundant work.
|
||||||
|
**Rejected** as the basis for an n-genome design.
|
||||||
|
|
||||||
|
## Implementation: sequential per-partition sweep (no scratch, no graph)
|
||||||
|
|
||||||
|
`KmerIndex::distance()` already opens every partition's `presence_store`/
|
||||||
|
`count_store` simultaneously, memory-mapped, into one `LayeredStore`
|
||||||
|
(`distance.rs:73-77`). "Querying another partition" is therefore not a new
|
||||||
|
I/O pattern to design — it is the same O(1) MPHF+evidence lookup the `query`
|
||||||
|
command already performs at scale. This lets the SNP tally be computed with
|
||||||
|
**no scratch files and no auxiliary graph**, by sweeping partitions once each
|
||||||
|
as a source:
|
||||||
|
|
||||||
|
1. For source partition `p`, enumerate its **distinct** k-mers (one per MPHF
|
||||||
|
slot; each already carries its full multi-genome presence/count vector —
|
||||||
|
no need to explode per (k-mer, genome) occurrence).
|
||||||
|
2. For each, generate the 3 central-substitution variants and **canonicalise
|
||||||
|
each independently** (`min(kmer, revcomp)`, exactly as any normal query) —
|
||||||
|
this avoids the orientation edge case a masked-flank grouping would have
|
||||||
|
(a substitution that flips canonical orientation is handled correctly
|
||||||
|
because each variant is canonicalised on its own, not inferred from a
|
||||||
|
fixed-orientation flank key).
|
||||||
|
3. Compute each variant's target partition `q` via its minimizer; batch/sort
|
||||||
|
the partition's outgoing variant queries by `q` for locality.
|
||||||
|
4. Look up each variant in `q`'s already-mmap'd MPHF+evidence; on a hit,
|
||||||
|
combine the source's presence vector (base `a`) with the variant's
|
||||||
|
presence vector (base `b`): for every `i` carrying `a` and `j` carrying
|
||||||
|
`b`, `tally[i,j][a,b] += 1`.
|
||||||
|
|
||||||
|
**Deduplication needs no persisted state.** Sweeping partitions in a fixed
|
||||||
|
order `p = 0, 1, ..., P-1` and only acting on a variant when its target
|
||||||
|
partition `q >= p` guarantees each unordered SNP pair is counted exactly
|
||||||
|
once: a pair with `q < p` was already resolved earlier, when `q` was itself
|
||||||
|
the source partition and `p` (being `>= q`) was a valid forward target. No
|
||||||
|
cross-partition flag array is needed — the sweep order *is* the
|
||||||
|
deduplication rule. Within the same partition (`q == p`), a lightweight
|
||||||
|
transient tie-break suffices: either a `#slots(p)`-bit scratch flag reset per
|
||||||
|
partition, or simply comparing the two k-mers' raw `u64` encodings and only
|
||||||
|
counting when `kmer_source < kmer_variant` — no storage at all.
|
||||||
|
|
||||||
|
This is a distinct computation stage, not a `partial_*` in the existing
|
||||||
|
additive-by-partition sense: step 3-4 read across partition boundaries by
|
||||||
|
construction, unlike the row-local `partial_jaccard`/`partial_threshold_jaccard`
|
||||||
|
primitives. But it requires no new index files, permanent or scratch:
|
||||||
|
`unitigs.bin`, `mphf.bin`, `evidence.bin`, and the presence/count columns are
|
||||||
|
read as-is, and the only extra memory is the current partition's small
|
||||||
|
outgoing-query batch (`#kmers(p) * 3`, released once `p` is done) plus the
|
||||||
|
persistent `tally` accumulator (`n^2 * 16` counters, see above).
|
||||||
|
|
||||||
|
**Outer loop (over source partitions `p`) must stay sequential.** Two
|
||||||
|
independent reasons, not just one: (a) memory — the bounded-footprint claim
|
||||||
|
above only holds with one partition's outgoing-query batch in flight; running
|
||||||
|
`T` source partitions concurrently multiplies that batch by `T`, exactly the
|
||||||
|
blowup the design avoids; (b) correctness — the `q >= p` deduplication rule
|
||||||
|
requires partitions to be claimed as sources in a fixed order; running `p1 <
|
||||||
|
p2` concurrently gives no guarantee `p1` has finished claiming its `q >= p1`
|
||||||
|
targets before `p2` starts claiming its own, breaking the "counted exactly
|
||||||
|
once" property.
|
||||||
|
|
||||||
|
**Inner loop (target-partition lookups for a fixed `p`) parallelises safely.**
|
||||||
|
Each lookup is an O(1) read against an already-mmap'd structure, independent
|
||||||
|
of the others, with no growing allocation — no memory blowup, no ordering
|
||||||
|
dependency between different `q`. The only shared mutable state is `tally`;
|
||||||
|
give each worker thread a **thread-local partial tally** (fixed `n^2 * 16`
|
||||||
|
size, independent of partition size) and merge into the global `tally` once
|
||||||
|
`p`'s inner loop completes — the same reduce-then-merge pattern Rayon already
|
||||||
|
uses elsewhere in this codebase to open partitions in parallel. Extra memory:
|
||||||
|
`#threads * n^2 * 16`, negligible (~512 MB at n~1000, 32 threads) and
|
||||||
|
unrelated to partition size.
|
||||||
|
|
||||||
|
**Cost**: `3 * N_distinct` MPHF lookups total across the whole index (each
|
||||||
|
partition swept once as source) — the same order of magnitude and the same
|
||||||
|
operation as running `query` over the index's entire k-mer content against
|
||||||
|
itself, three times. This is the tool's already-optimized regime, not a new
|
||||||
|
I/O profile to validate.
|
||||||
|
|
||||||
|
## Cheaper: subsampling
|
||||||
|
|
||||||
|
Since the target is a ratio, restricting the source-partition sweep to a
|
||||||
|
bottom-`s` hash sketch (only enumerate k-mers with `hash < threshold` as
|
||||||
|
sources) divides the lookup count by the sampling factor without biasing
|
||||||
|
`p_hat`. Mash-like tradeoff: rate estimated from a sample, not the full
|
||||||
|
k-mer set.
|
||||||
|
|
||||||
|
## Recommendation
|
||||||
|
|
||||||
|
Sequential per-partition sweep (Route D): reuse the already-mmap'd
|
||||||
|
per-partition MPHF/evidence/presence structures for O(1) variant lookups,
|
||||||
|
dedup via the fixed sweep-order rule (`q >= p`, plus an in-partition
|
||||||
|
tie-break), no scratch files, no graph materialisation. Both the SNP
|
||||||
|
(off-diagonal) and shared (diagonal) counts are accumulated by this same
|
||||||
|
sweep, under the locus-eligibility rule chosen (raw or paralogy-filtered) —
|
||||||
|
not reused from the general-purpose `shared_kmers` matrix, whose raw-identity
|
||||||
|
definition does not apply the same copy-number constraint. Distances (p, JC,
|
||||||
|
K2P, LogDet) as finalisations of the resulting 4x4 tally, mirroring the
|
||||||
|
`partial_* -> *_dist_matrix` pattern used for Jaccard/Mash/Bray-Curtis/etc.
|
||||||
|
|
||||||
|
## Detailed implementation plan
|
||||||
|
|
||||||
|
Grounded in the current codebase. File/type references are anchors, not
|
||||||
|
prescriptions; adjust to reality when implementing.
|
||||||
|
|
||||||
|
### Step 0 — new low-level primitives (`obikseq`)
|
||||||
|
|
||||||
|
Two helpers do not yet exist and are prerequisites:
|
||||||
|
|
||||||
|
1. **Central neighbours.** `CanonicalKmerOf<L>` already exposes
|
||||||
|
`left_canonical_neighbors()` / `right_canonical_neighbors()`
|
||||||
|
(`obikseq/src/kmer.rs`), each returning the 4 canonicalised neighbours at
|
||||||
|
an end position. Add `central_canonical_neighbors()` returning the 4
|
||||||
|
variants at position `m = (k-1)/2` (each independently canonicalised via
|
||||||
|
`.canonical()`). The 3 that differ from the source are the query variants;
|
||||||
|
skip the identity. Building on `nucleotide(i)` / the raw 2-bit layout keeps
|
||||||
|
it O(1).
|
||||||
|
2. **Lone-k-mer minimiser.** Routing a *synthetic* variant to its partition
|
||||||
|
needs its minimiser, but `RollingStat` (`obiskbuilder/src/rolling_stat.rs`)
|
||||||
|
only computes minimisers incrementally along a sequence. Add a standalone
|
||||||
|
`minimizer(kmer) -> Minimizer` that scans the `k-m+1` m-mer windows
|
||||||
|
(`PackedSeq::mmer`, `obikseq/src/packed_seq.rs`), canonicalises each, and
|
||||||
|
takes the min by `seq_hash()` — the same selection `RollingStat` performs,
|
||||||
|
evaluated once. Partition index is then
|
||||||
|
`(minimizer.seq_hash() & (n_partitions - 1)) as usize`, exactly as
|
||||||
|
`QueryBatch::from_records` (`obikmer/src/cmd/query.rs:142`); `n_partitions`
|
||||||
|
is a power of two so the mask is valid.
|
||||||
|
|
||||||
|
### Step 1 — the tally accumulator (`obikindex`)
|
||||||
|
|
||||||
|
A `SnpTally` holding, per genome pair, the 4x4 joint count of central bases:
|
||||||
|
`n * n * 4 * 4` `u64` (or a packed lower-triangular form since it is
|
||||||
|
symmetric). Provide `merge(&mut self, other: &SnpTally)` for the thread-local
|
||||||
|
reduce, and accessors yielding, per pair `(i,j)`: total off-diagonal (SNP),
|
||||||
|
diagonal (shared, i.e. `p_hat`'s denominator minus SNP), transition count
|
||||||
|
`P`, transversion count `Q`. The diagonal is always populated — it is not an
|
||||||
|
optional LogDet-only extra, since `p_hat`'s denominator is no longer sourced
|
||||||
|
from the external `shared_kmers` matrix (see "Locus eligibility" and
|
||||||
|
"Statistic and correspondence with `shared`" above): the source k-mer's own
|
||||||
|
presence/count vector, already in hand when it is enumerated, supplies the
|
||||||
|
diagonal entry directly, at no extra lookup cost.
|
||||||
|
|
||||||
|
### Step 2 — the sweep (`obikindex`, new `snp.rs`)
|
||||||
|
|
||||||
|
Mirror `distance.rs`: open the presence or count store per partition. But
|
||||||
|
instead of a per-partition `partial_*`, run the sequential source sweep:
|
||||||
|
|
||||||
|
```text
|
||||||
|
for p in 0..n_partitions: # OUTER — sequential
|
||||||
|
open source partition p's layers (QueryLayer-style, obikpartitionner)
|
||||||
|
enumerate distinct canonical k-mers of p (one per MPHF slot) with their
|
||||||
|
presence/count vectors # column-major, as query stage 2
|
||||||
|
par_iter over these source k-mers: # INNER — rayon, thread-local tally
|
||||||
|
apply eligibility rule to the source's own vector (raw: none; # diagonal
|
||||||
|
stringent: exactly one of the 4 forms present in each genome) # gate
|
||||||
|
for i in genomes eligible with source base a:
|
||||||
|
for j in genomes eligible with source base a:
|
||||||
|
thread_tally[i,j][a,a] += 1 # diagonal — no extra lookup
|
||||||
|
for each of the 3 central variants:
|
||||||
|
q = partition_of(variant)
|
||||||
|
if q < p: continue # dedup: forward targets only
|
||||||
|
if q == p and variant <= source.raw(): continue # in-partition tie-break
|
||||||
|
slot = layers[q].find_slot(variant) # MphfLayer::find, mmap'd
|
||||||
|
if hit:
|
||||||
|
vb = variant presence/count vector
|
||||||
|
apply eligibility rule to vb (as above)
|
||||||
|
for i in eligible genomes with source base a:
|
||||||
|
for j in eligible genomes with variant base b:
|
||||||
|
thread_tally[i,j][a,b] += 1
|
||||||
|
merge thread-local tallies into global SnpTally
|
||||||
|
```
|
||||||
|
|
||||||
|
The inner lookup is precisely `QueryLayer::find_slot` +
|
||||||
|
`col_value(g, slot)` (`obikpartitionner/src/query_layer.rs`) — reuse or factor
|
||||||
|
out that path rather than reimplementing MPHF access. Enumerating "all distinct
|
||||||
|
k-mers of a partition with their vectors" is the `dump`/`query` stage-2
|
||||||
|
column-major scan already implemented in `dump_layer.rs` /
|
||||||
|
`query_partition_with`; factor a reusable iterator if none fits.
|
||||||
|
|
||||||
|
`presence_threshold` applies exactly as elsewhere: a genome "carries base b"
|
||||||
|
iff its count at that slot is `>= presence_threshold` (trivially `>= 1` for
|
||||||
|
presence indexes).
|
||||||
|
|
||||||
|
### Open problem (unresolved, session end — not yet fully convinced)
|
||||||
|
|
||||||
|
The `q >= p` / tie-break dedup rule in Step 2's pseudocode above is **flawed**
|
||||||
|
for the stringent (paralogy-filtered) eligibility rule: it only ever brings
|
||||||
|
two family members into view at once (the source and one looked-up variant),
|
||||||
|
never all four simultaneously, and which subset gets compared depends on
|
||||||
|
partition sweep order. "Exactly one of the 4 forms present in genome A" is a
|
||||||
|
whole-family property and cannot be decided correctly from a sequence of
|
||||||
|
pairwise, order-dependent glimpses — the pseudocode above needs revision, not
|
||||||
|
just the eligibility gate bolted onto it as written.
|
||||||
|
|
||||||
|
Direction discussed, **not yet settled**:
|
||||||
|
|
||||||
|
1. **Every distinct source k-mer looks up all 3 variants unconditionally**
|
||||||
|
(drop the `q < p` skip entirely) so that every observed family member
|
||||||
|
independently gathers all 4 vectors (its own + whichever of the 3
|
||||||
|
variants exist) at once — a whole-family, order-independent view, computed
|
||||||
|
redundantly once per observed member. Same total lookup order of
|
||||||
|
magnitude as already budgeted (`3 * N_distinct`), just organised
|
||||||
|
differently (no lookup actually skipped, versus the original rule which
|
||||||
|
skipped roughly half).
|
||||||
|
2. **Tie-break after gathering, not before**: only the member whose own
|
||||||
|
canonical encoding is the smallest *among the members actually observed*
|
||||||
|
(now known, since all were just looked up) writes to `SnpTally`; the
|
||||||
|
others silently discard their redundant computation. Deterministic,
|
||||||
|
order-independent — as a side effect this also removes the "outer loop
|
||||||
|
must stay sequential" constraint from the cost/parallelism discussion
|
||||||
|
above, since no step depends on partition processing order any more.
|
||||||
|
3. **Proposed optimisation**: precompute, once at index build time, a
|
||||||
|
compact global (not per-genome) annex per MPHF slot — the count of
|
||||||
|
*other* family members observed anywhere in the dataset (0-3). Slots with
|
||||||
|
count 0 (majority under low divergence and few genomes, but see the
|
||||||
|
scaling caveat below) need no cross-lookup at all: eligibility reduces to
|
||||||
|
a local `count == 1` check at that single slot, and only slots with count
|
||||||
|
>= 1 enter the 3-lookup sweep machinery above. Revised (see Step 2b
|
||||||
|
below): minorant status *is* stored alongside the count after all, on 3
|
||||||
|
bits rather than 2 — it comes for free from the same lookups needed to
|
||||||
|
count siblings, and storing it lets the sweep discard non-minorant slots
|
||||||
|
without re-fetching anything.
|
||||||
|
|
||||||
|
**Minorant/sibling-count relationship, worked out precisely.** "Minorant" is
|
||||||
|
a one-way implication from sibling count, not an equivalence: `0 siblings
|
||||||
|
=> minorant` (trivially — with no other observed member, the k-mer is by
|
||||||
|
definition the smallest of the observed set, itself alone), and its
|
||||||
|
contrapositive `not minorant => >= 1 sibling`. The converse does not hold:
|
||||||
|
being the minorant says nothing about sibling count — a minorant can have 0,
|
||||||
|
1, 2 or 3 siblings, all with larger encodings than itself. Consequence: this
|
||||||
|
confirms, as a logical necessity rather than a heuristic, that a 0-sibling
|
||||||
|
slot can always write its diagonal contribution with zero ambiguity and no
|
||||||
|
lookup (it is unconditionally its own minorant) — but it gives no shortcut
|
||||||
|
for the >= 1-sibling case, where minorant status still requires the actual
|
||||||
|
comparison of gathered encodings; sibling count alone never determines it.
|
||||||
|
|
||||||
|
**When to compute the annex, and cache invalidation.** Sibling count is a
|
||||||
|
property of the whole set of columns (genomes/groups) currently in the
|
||||||
|
index, not of any single genome — it cannot be computed correctly at
|
||||||
|
mono-genome build time (a family may gain siblings, or its minorant may
|
||||||
|
change, once more genomes are merged in later). Computing it eagerly at
|
||||||
|
every `merge` would also waste work on intermediate merged states nobody
|
||||||
|
ever queries. Instead: compute it lazily, on first `distance` call against a
|
||||||
|
given index, and persist the result alongside that index for subsequent
|
||||||
|
calls — the same lazy-derived-cache pattern `PersistentBitMatrix` already
|
||||||
|
uses for `Columnar` -> `Packed`. This requires no explicit invalidation for
|
||||||
|
`merge` or `filter` (`obikindex/src/merge.rs`, `obikmer/src/cmd/filter.rs`):
|
||||||
|
both only ever write to a fresh `--output` directory, never mutate an input
|
||||||
|
index in place, so a re-merged/re-filtered index is simply a new state with
|
||||||
|
no annex yet. `select --in-place` (`select_layer.rs:139-235`) is the
|
||||||
|
exception: it aggregates genome columns into groups (Any/All/None/Sum/Min/
|
||||||
|
Max) by mutating the existing index's files without changing its location.
|
||||||
|
It does not remove k-mer rows, but it can still change eligibility and
|
||||||
|
sibling counts derived from those rows (e.g. a `Sum` over several
|
||||||
|
single-copy genomes can read as multi-copy at the group level). Because it
|
||||||
|
mutates in place, **`select --in-place` must explicitly invalidate (delete
|
||||||
|
or mark stale) any cached sibling-count annex for that index** — the one
|
||||||
|
operation in the current pipeline where this doesn't happen for free.
|
||||||
|
|
||||||
|
Not yet convinced this is the right shape, and Step 2's pseudocode above has
|
||||||
|
not been rewritten to match — flagged for the next pass rather than resolved
|
||||||
|
here.
|
||||||
|
|
||||||
|
### Step 2b — sibling-count / minorant annex (consolidated plan)
|
||||||
|
|
||||||
|
Scope: only the precursor annex — not the SNP tally itself, whose Step 2
|
||||||
|
sweep remains unresolved above. This piece is simpler than the sweep,
|
||||||
|
because it writes to an independent per-slot value, not a shared
|
||||||
|
cross-k-mer accumulator, so it needs no dedup/ownership logic at all at this
|
||||||
|
stage.
|
||||||
|
|
||||||
|
**Revised annex encoding — 4-bit presence mask, not 3-bit (minorant +
|
||||||
|
count).** Superseded after settling the "canonical form of a family"
|
||||||
|
definition above. The 3-bit design (1 minorant bit + 2-bit sibling count,
|
||||||
|
§ below, kept for the historical record) had two problems: it discards
|
||||||
|
*which* variants are present (only how many), so any future consumer
|
||||||
|
(the SNP sweep, or a stats pass — see below) that needs to know which bases
|
||||||
|
exist still has to regenerate and blindly re-query all 3 candidates; and
|
||||||
|
the minorant bit's meaning was tied to whichever member was visited, not to
|
||||||
|
a fixed reference. Storing instead a **4-bit mask** — one bit per base
|
||||||
|
(A/C/G/T), set iff that member of the family (labelled relative to the
|
||||||
|
family's fixed canonical form, i.e. the member with `A` at the centre — see
|
||||||
|
above) is observed anywhere in the index — fixes both:
|
||||||
|
- **Sibling count is derived, not stored**: `siblings = popcount(mask) - 1`.
|
||||||
|
- **Minorant is derived, not stored**: regenerate the family's 4 canonical
|
||||||
|
forms from the slot's own k-mer (cheap, no lookup — see above), compare
|
||||||
|
the raw encodings of whichever bits are set in the mask, take the
|
||||||
|
smallest.
|
||||||
|
- **A future consumer knows exactly which variants to (re-)query** —
|
||||||
|
`popcount(mask) - 1` lookups instead of always 3, and it knows *which*
|
||||||
|
3 (or fewer) to issue, not just how many hits to expect.
|
||||||
|
- The all-zero value (no base present at all) is still logically
|
||||||
|
unreachable as a real result — the slot's *own* base is always present in
|
||||||
|
its own family — so it remains available as a free "not yet computed"
|
||||||
|
sentinel, exactly as before.
|
||||||
|
|
||||||
|
1. **Primitive.** Reuse `central_canonical_neighbors()` from Step 0
|
||||||
|
unchanged — the 3 canonicalised central-substitution variants of a k-mer
|
||||||
|
(plus the identity, i.e. all 4 members of the family — see "Definitions"
|
||||||
|
above).
|
||||||
|
2. **New annex type** (`obicompactvec`, alongside `bitmatrix.rs`): a 4-bit-
|
||||||
|
per-slot packed array (the presence mask above), one per partition — same
|
||||||
|
on-disk shape family as `PersistentBitMatrix`'s `Packed` variant, but
|
||||||
|
simpler (no per-genome columns, a single derived read-only value per
|
||||||
|
slot).
|
||||||
|
<details><summary>Superseded 3-bit design (historical)</summary>
|
||||||
|
3 bits, storing minorant status alongside sibling count directly, since
|
||||||
|
it came for free from the same lookups (point 3 below) — 5 real states
|
||||||
|
(not-minorant; minorant with 0/1/2/3 siblings) fit in 3 bits (8 states,
|
||||||
|
3 unused). This let the future SNP sweep discard a non-minorant slot
|
||||||
|
instantly, with no lookup at all. The otherwise-unreachable combination
|
||||||
|
"not-minorant + 0 siblings" (0 siblings always implies minorant) doubled
|
||||||
|
as the "not yet computed" sentinel. Replaced by the 4-bit mask above,
|
||||||
|
which subsumes this benefit (minorant still derivable, now for free at
|
||||||
|
read time rather than stored) while also fixing the "which variant"
|
||||||
|
blindness.
|
||||||
|
</details>
|
||||||
|
3. **Computation pass** (`obikindex`, new `siblings.rs`): **one
|
||||||
|
`obipipeline` run per layer, iterated sequentially over the index's
|
||||||
|
layers** — settled after two false starts, worth recording both.
|
||||||
|
- *False start 1*: "fully parallel over every partition/slot at once,
|
||||||
|
no ordering at all". Correctness is fine with this (sibling count and
|
||||||
|
minorant are order-independent, unlike the old `q >= p` dedup they
|
||||||
|
replace), but it reintroduces, at a larger scale, exactly the
|
||||||
|
memory-blowup the original Step 2 sweep's sequential-outer-loop
|
||||||
|
constraint existed to prevent: scattering every source partition at
|
||||||
|
once multiplies the in-flight outgoing-query volume by the number of
|
||||||
|
partitions.
|
||||||
|
- *False start 2*: push the layer loop itself into the pipeline (source
|
||||||
|
= the index's layers, a first `Flat` stage expands each layer into
|
||||||
|
its k-mers). `obipipeline`'s scheduler already bounds memory on its
|
||||||
|
own — it dispatches every item through a **shared** worker pool at
|
||||||
|
each stage boundary (`scheduler.rs:217-372`, `dispatch()` into a
|
||||||
|
common `worker_tx` queue, any free worker picks up any pending item;
|
||||||
|
not "one worker owns a chunk end to end"), with a biased `Select`
|
||||||
|
that prioritises draining items already advanced in the chain over
|
||||||
|
admitting new source items (`scheduler.rs:271-282`: stage results
|
||||||
|
outrank the source, "vider le pipeline en priorité" / "dernier
|
||||||
|
recours" for new data) — so bounded channel `capacity` plus this
|
||||||
|
drain-first bias already caps in-flight work without any external
|
||||||
|
sequential discipline. Correct, but it means k-mers from several
|
||||||
|
layers can be completing concurrently, so the sink would need to
|
||||||
|
track several open per-layer annex-file writers at once — real,
|
||||||
|
avoidable complexity.
|
||||||
|
- **Settled design**: keep the layer loop external and sequential —
|
||||||
|
not for memory (the pipeline's own `capacity`/priority mechanism
|
||||||
|
already provides that, for free, regardless), but so each pipeline
|
||||||
|
run's sink targets exactly one layer's annex file, no concurrent
|
||||||
|
multi-writer bookkeeping. Per layer: source = that layer's distinct
|
||||||
|
k-mers; a `Flat` (1->N) stage generates the 3 central variants of a
|
||||||
|
k-mer, each tagged with its origin (local slot); a transform stage
|
||||||
|
routes each variant to its target partition (unchanged per-k-mer
|
||||||
|
minimiser); a transform stage performs the lookup (existence-only —
|
||||||
|
`find_slot` hit/miss, cheaper than the SNP sweep's full column
|
||||||
|
fetch); a final stage/sink folds each answer into its origin's
|
||||||
|
running state (below) and, once a layer's k-mers are all resolved,
|
||||||
|
flushes the completed array to that layer's annex file. Many small,
|
||||||
|
single-purpose stages on purpose, to let the scheduler interleave
|
||||||
|
them finely across many in-flight items — this deliberately does
|
||||||
|
**not** mirror how `obipipeline` is used elsewhere today: `query.rs`'s
|
||||||
|
`process_chunk` lumps parse+route+query+serialise into one closure
|
||||||
|
(`query.rs:325,743-758`), and `scatter.rs` only pipelines file-
|
||||||
|
reading/superkmer construction, routing partitions afterwards in a
|
||||||
|
plain sequential loop (`KmerPartition::write_batch`,
|
||||||
|
`partition.rs:140`) — both under-use the fine-grained scheduling the
|
||||||
|
mechanism offers, so they are not precedents to copy, only existing
|
||||||
|
(and arguably improvable, out of scope here) usages. Cross-partition
|
||||||
|
lookups (querying another layer's MPHF for a variant) remain
|
||||||
|
necessary as before — only the *output* side is kept single-layer.
|
||||||
|
- **Reconciliation**: processed at the granularity of one *answer batch
|
||||||
|
per destination partition*, not one source k-mer at a time — this is a
|
||||||
|
proper shuffle, not a per-k-mer wait. Each source partition `p` holds a
|
||||||
|
small array of running states `(minorant = true, siblings = 0)`, one
|
||||||
|
per local slot, initialised at scatter time and **persisting across
|
||||||
|
however many destination-partition batches answer it** (up to 3, one
|
||||||
|
per variant, not necessarily all from the same `q`). Every scattered
|
||||||
|
query carries an origin tag (source partition + local slot) so its
|
||||||
|
answer can be routed back. When target partition `q` returns its batch
|
||||||
|
(all answers for every query that named `q`, regardless of which source
|
||||||
|
k-mer or which source partition they came from), that batch is walked
|
||||||
|
once, locally, and each answer updates — via its origin tag — the
|
||||||
|
matching entry in *its* source partition's array: a miss changes
|
||||||
|
nothing; a hit does `siblings += 1`, and if the found sibling's own
|
||||||
|
encoding is smaller than the source's, `minorant = false`. A given
|
||||||
|
source k-mer's state is final only once every destination batch
|
||||||
|
concerning it has been folded in; its partition's array is flushed to
|
||||||
|
the persistent annex once complete. Commutative per entry, so the order
|
||||||
|
in which destination batches arrive and get folded in doesn't matter.
|
||||||
|
|
||||||
|
**Open optimisation, not adopted yet — real tradeoff, not a free win.**
|
||||||
|
Since looking up sibling `y` from `x`'s visit already yields everything
|
||||||
|
needed to fill `y`'s own annex entry too, one visit per *family* could in
|
||||||
|
principle replace one visit per *observed family member* — cutting this
|
||||||
|
pass's cost roughly by the average family size instead of paying
|
||||||
|
`3 * N_distinct` regardless. But it means threads processing different
|
||||||
|
source k-mers can end up writing the *same* sibling's slot concurrently —
|
||||||
|
the fully independent, ownership-free parallelism of the plan above is
|
||||||
|
deliberately traded away for this gain. It stays safe only because the
|
||||||
|
computed value for a given slot is deterministic regardless of who
|
||||||
|
computes it, so redundant concurrent writes converge to the same
|
||||||
|
value — correct as long as each write is atomic, no locking needed — but
|
||||||
|
it is a real design complexity increase over "every member redoes its
|
||||||
|
own 3 lookups independently," not a strict improvement to adopt by
|
||||||
|
default.
|
||||||
|
4. **Trigger and caching** (`obikindex::KmerIndex`/`distance.rs`): compute
|
||||||
|
lazily on first `distance` call for an SNP-family metric against a given
|
||||||
|
index; check for an existing annex file first (mirrors
|
||||||
|
`PersistentBitMatrix::open()`'s auto-detect-and-fall-back,
|
||||||
|
`bitmatrix.rs:264-287`); if absent, run step 3 and persist; if present,
|
||||||
|
mmap and reuse.
|
||||||
|
5. **Invalidation.** `merge` and `filter` always write to a fresh `--output`
|
||||||
|
directory (`obikindex/src/merge.rs`, `obikmer/src/cmd/filter.rs`) so a
|
||||||
|
re-merged/re-filtered index simply has no annex yet — nothing to
|
||||||
|
invalidate. `select --in-place` (`select_layer.rs:139-235`) mutates
|
||||||
|
columns of an existing index without changing its location, which can
|
||||||
|
change sibling counts without removing rows — it must explicitly delete
|
||||||
|
any cached annex for that index as part of its in-place rewrite.
|
||||||
|
6. **Testing**: hand-built tiny indexes with known sibling counts (0-3);
|
||||||
|
order-independence (recompute twice on a static index, identical
|
||||||
|
result, given the fully-parallel no-ownership design); invalidation
|
||||||
|
(annex absent/correctly recomputed after `select --in-place`); once
|
||||||
|
Step 2's sweep is fixed, a regression check that sibling_count == 0
|
||||||
|
slots are never looked up cross-partition during the sweep.
|
||||||
|
|
||||||
|
Cost: `3 * N_distinct` existence-only lookups, computed once per index
|
||||||
|
state and amortised over every subsequent `distance` call that reuses the
|
||||||
|
cached annex — cheaper per-lookup than the sweep itself (hit/miss only, no
|
||||||
|
column fetch).
|
||||||
|
|
||||||
|
### Step 3 — finalisation (`obikindex`)
|
||||||
|
|
||||||
|
From the global `SnpTally` alone (diagonal and off-diagonal both populated by
|
||||||
|
the sweep, see Step 1/2 — no dependency on the external `shared_kmers`
|
||||||
|
matrix), derive n x n distance matrices, each a pure function of the
|
||||||
|
accumulated counts (same shape as `jaccard_to_mash`):
|
||||||
|
|
||||||
|
- `p_hat[i,j] = SNP / (SNP + shared)`
|
||||||
|
- Jukes-Cantor, Kimura-2P (from `P`, `Q`), optionally LogDet (needs the
|
||||||
|
diagonal + base-composition margins).
|
||||||
|
|
||||||
|
Guard the singularities (`p >= 3/4` for JC, `1-2P-Q <= 0` or `1-2Q <= 0` for
|
||||||
|
K2P) by clamping to a max distance, as `jaccard_to_mash` clamps `J <= 0`.
|
||||||
|
|
||||||
|
### Step 4 — surfacing (`obikindex` + `obikmer` CLI)
|
||||||
|
|
||||||
|
These metrics do not fit `DistanceMetric`'s current `LayeredStore`-partial
|
||||||
|
dispatch (they need the cross-partition sweep and produce a different
|
||||||
|
intermediate). Two options, to decide:
|
||||||
|
|
||||||
|
- **(a)** New `DistanceMetric` variants (`Pdistance`, `JukesCantor`,
|
||||||
|
`Kimura2P`, `LogDet`) whose `KmerIndex::distance` arm calls the sweep
|
||||||
|
(`snp.rs`) instead of the partial path, still returning `DistanceOutput`.
|
||||||
|
Keeps one CLI surface (`--metric jukes-cantor`), at the cost of a branch in
|
||||||
|
`distance()` that ignores the `LayeredStore` it built.
|
||||||
|
- **(b)** A dedicated pathway (`KmerIndex::snp_distance`) and a distinct CLI
|
||||||
|
entry, if mixing a cross-partition sweep into the partition-local `distance`
|
||||||
|
command is judged architecturally muddy.
|
||||||
|
|
||||||
|
Recommendation: (a) for user ergonomics (all pairwise distances under
|
||||||
|
`distance`, all feeding NJ/UPGMA/`--shared-kmers` unchanged), but compute the
|
||||||
|
sweep lazily only when an SNP-family metric is requested, so the existing
|
||||||
|
metrics keep their partition-local fast path untouched.
|
||||||
|
|
||||||
|
### Step 5 — subsampling flag
|
||||||
|
|
||||||
|
Add `--snp-sample <fraction>` (or a bottom-`s` hash threshold): restrict the
|
||||||
|
source-k-mer enumeration in Step 2 to `seq_hash(kmer) < threshold`. Divides
|
||||||
|
lookups proportionally; `p_hat` is unbiased. Off by default (exact).
|
||||||
|
|
||||||
|
### Testing
|
||||||
|
|
||||||
|
- **Primitive unit tests**: `central_canonical_neighbors` on hand-checked
|
||||||
|
k-mers incl. palindrome-boundary cases; lone-k-mer `minimizer` against
|
||||||
|
`RollingStat`'s incremental result on the same k-mer.
|
||||||
|
- **End-to-end tiny index**: two 1-genome indexes differing by a handful of
|
||||||
|
known isolated SNPs (transitions and transversions placed by hand), assert
|
||||||
|
exact `SNP`, `P`, `Q` counts and the resulting JC/K2P values.
|
||||||
|
- **Dedup invariant**: assert the tally is identical regardless of genome/
|
||||||
|
partition order and that no pair is double-counted (compare against a
|
||||||
|
brute-force all-pairs reference on a small index).
|
||||||
|
- **Subsampling**: `p_hat` within sampling error of the exact run.
|
||||||
|
|
||||||
|
### Suggested phasing
|
||||||
|
|
||||||
|
1. Step 0 primitives + their unit tests (self-contained, no distance wiring).
|
||||||
|
This also unblocks the long-declared-but-unimplemented `query --mismatch`
|
||||||
|
(`obikmer/src/cmd/query.rs:676`, currently a warning), which needs the same
|
||||||
|
neighbour + routing machinery.
|
||||||
|
2. `SnpTally` + finalisation math with a brute-force (non-swept) reference
|
||||||
|
backend, validated on a tiny index.
|
||||||
|
3. The real per-partition sweep (Step 2) behind the same finalisation; assert
|
||||||
|
it matches the brute-force backend.
|
||||||
|
4. CLI surfacing (Step 4a) and NJ/UPGMA integration (already generic over the
|
||||||
|
matrix).
|
||||||
|
5. Subsampling (Step 5).
|
||||||
|
|
||||||
|
## References
|
||||||
|
|
||||||
|
The Mash mutation-rate model this discussion contrasts with:
|
||||||
|
[@Mash-distances-doc; @Fan2015-mash-formula].
|
||||||
@@ -36,6 +36,7 @@ nav:
|
|||||||
- Entropy filter: theory/entropy.md
|
- Entropy filter: theory/entropy.md
|
||||||
- Minimizer selection: theory/minimizer.md
|
- Minimizer selection: theory/minimizer.md
|
||||||
- Partitioning architecture: theory/indexing.md
|
- Partitioning architecture: theory/indexing.md
|
||||||
|
- Central-position SNP distance (discussion): theory/evolutionary_distances.md
|
||||||
- Implementation:
|
- Implementation:
|
||||||
- SuperKmer: implementation/superkmer.md
|
- SuperKmer: implementation/superkmer.md
|
||||||
- Kmer: implementation/kmer.md
|
- Kmer: implementation/kmer.md
|
||||||
|
|||||||
Generated
+15
-1
@@ -1682,6 +1682,13 @@ dependencies = [
|
|||||||
"xxhash-rust",
|
"xxhash-rust",
|
||||||
]
|
]
|
||||||
|
|
||||||
|
[[package]]
|
||||||
|
name = "obikentropy"
|
||||||
|
version = "0.1.0"
|
||||||
|
dependencies = [
|
||||||
|
"obikseq",
|
||||||
|
]
|
||||||
|
|
||||||
[[package]]
|
[[package]]
|
||||||
name = "obikindex"
|
name = "obikindex"
|
||||||
version = "0.1.0"
|
version = "0.1.0"
|
||||||
@@ -1694,17 +1701,21 @@ dependencies = [
|
|||||||
"obikpartitionner",
|
"obikpartitionner",
|
||||||
"obikseq",
|
"obikseq",
|
||||||
"obilayeredmap",
|
"obilayeredmap",
|
||||||
|
"obipipeline",
|
||||||
|
"obiread",
|
||||||
|
"obiskbuilder",
|
||||||
"obiskio",
|
"obiskio",
|
||||||
"obisys",
|
"obisys",
|
||||||
"rayon",
|
"rayon",
|
||||||
"serde",
|
"serde",
|
||||||
"serde_json",
|
"serde_json",
|
||||||
|
"tempfile",
|
||||||
"tracing",
|
"tracing",
|
||||||
]
|
]
|
||||||
|
|
||||||
[[package]]
|
[[package]]
|
||||||
name = "obikmer"
|
name = "obikmer"
|
||||||
version = "1.1.37"
|
version = "1.1.42"
|
||||||
dependencies = [
|
dependencies = [
|
||||||
"clap",
|
"clap",
|
||||||
"csv",
|
"csv",
|
||||||
@@ -1742,6 +1753,7 @@ dependencies = [
|
|||||||
"niffler 3.0.0",
|
"niffler 3.0.0",
|
||||||
"obicompactvec",
|
"obicompactvec",
|
||||||
"obidebruinj",
|
"obidebruinj",
|
||||||
|
"obikentropy",
|
||||||
"obikrope",
|
"obikrope",
|
||||||
"obikseq",
|
"obikseq",
|
||||||
"obilayeredmap",
|
"obilayeredmap",
|
||||||
@@ -1824,7 +1836,9 @@ dependencies = [
|
|||||||
name = "obiskbuilder"
|
name = "obiskbuilder"
|
||||||
version = "0.1.0"
|
version = "0.1.0"
|
||||||
dependencies = [
|
dependencies = [
|
||||||
|
"criterion2",
|
||||||
"lazy_static",
|
"lazy_static",
|
||||||
|
"obikentropy",
|
||||||
"obikrope",
|
"obikrope",
|
||||||
"obikseq",
|
"obikseq",
|
||||||
"obiread",
|
"obiread",
|
||||||
|
|||||||
+1
-1
@@ -1,5 +1,5 @@
|
|||||||
[workspace]
|
[workspace]
|
||||||
resolver = "3"
|
resolver = "3"
|
||||||
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy"]
|
members = ["obikseq", "obiread", "obiskbuilder", "obifastwrite", "obikmer","obikrope","obipipeline", "obikpartitionner","obiskio","obidebruinj","obilayeredmap", "obicompactvec", "obisys", "obikindex", "obitaxonomy", "obikentropy"]
|
||||||
[profile.release]
|
[profile.release]
|
||||||
debug = 1
|
debug = 1
|
||||||
|
|||||||
@@ -7,6 +7,7 @@ mod intmatrix;
|
|||||||
mod layer_meta;
|
mod layer_meta;
|
||||||
mod meta;
|
mod meta;
|
||||||
mod reader;
|
mod reader;
|
||||||
|
mod siblingannex;
|
||||||
mod tempbitvec;
|
mod tempbitvec;
|
||||||
mod tempintvec;
|
mod tempintvec;
|
||||||
mod views;
|
mod views;
|
||||||
@@ -18,6 +19,7 @@ pub use builder::PersistentCompactIntVecBuilder;
|
|||||||
pub use colgroup::{ColGroup, FilterMask, MatrixGroupOps, eval_filter_mask};
|
pub use colgroup::{ColGroup, FilterMask, MatrixGroupOps, eval_filter_mask};
|
||||||
pub use intmatrix::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, pack_compact_int_matrix};
|
pub use intmatrix::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, pack_compact_int_matrix};
|
||||||
pub use layer_meta::LayerMeta;
|
pub use layer_meta::LayerMeta;
|
||||||
|
pub use siblingannex::{FamilyMask, SiblingAnnex, SiblingAnnexBuilder};
|
||||||
pub use reader::{PersistentCompactIntVec, Iter as CompactIntVecIter};
|
pub use reader::{PersistentCompactIntVec, Iter as CompactIntVecIter};
|
||||||
pub use tempbitvec::{TempBitVec, TempBitVecBuilder};
|
pub use tempbitvec::{TempBitVec, TempBitVecBuilder};
|
||||||
pub use tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
|
pub use tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
|
||||||
|
|||||||
@@ -0,0 +1,245 @@
|
|||||||
|
//! Family presence-mask annex: a compact, read-only-after-build, per-slot
|
||||||
|
//! derived value used by the central-position SNP distance estimator (see
|
||||||
|
//! `docmd/theory/evolutionary_distances.md`, "Step 2b" and "Definitions:
|
||||||
|
//! family, and the canonical form of a family").
|
||||||
|
//!
|
||||||
|
//! One byte is stored per MPHF slot of a partition/layer, its low 4 bits
|
||||||
|
//! encoding a **presence mask** for the slot's k-mer's "family" (the up to 4
|
||||||
|
//! k-mers sharing the same flanks, differing only at the central base):
|
||||||
|
//! bit `b` (`b` = 0..3, in the fixed A/C/G/T = 0/1/2/3 encoding already used
|
||||||
|
//! for a single nucleotide) is set iff the family member whose *own* central
|
||||||
|
//! base — in its own canonical orientation — is `b`, is observed anywhere in
|
||||||
|
//! the current multi-genome index. This is a property of the whole index,
|
||||||
|
//! not of any one genome.
|
||||||
|
//!
|
||||||
|
//! Both facts the earlier (superseded) 3-bit design stored explicitly are
|
||||||
|
//! derived from the mask instead, not stored:
|
||||||
|
//! - sibling count = `popcount(mask) - 1`;
|
||||||
|
//! - minorant = regenerate the family's 4 canonical forms from the slot's
|
||||||
|
//! own k-mer (`CanonicalKmerOf::central_canonical_neighbors`, cheap, no
|
||||||
|
//! lookup), compare the raw encodings of whichever are set in the mask,
|
||||||
|
//! take the smallest — see `obikindex::siblings`.
|
||||||
|
//!
|
||||||
|
//! Mask value 0 is logically unreachable as a real result (a slot's own base
|
||||||
|
//! is always present in its own family) and is reused as the "not yet
|
||||||
|
//! computed" sentinel: annex files are pre-initialised to all-zero, and a
|
||||||
|
//! real value is only ever written once, by the computation pass.
|
||||||
|
//!
|
||||||
|
//! Deliberately simpler than a true 4-bit pack (1 byte/slot instead of 4
|
||||||
|
//! bits/slot): correctness and simplicity first, for a first implementation.
|
||||||
|
//! Packing to 4 bits/slot is a pure storage-density follow-up, not a
|
||||||
|
//! behavioural change, left for later.
|
||||||
|
|
||||||
|
use std::fs::{File, OpenOptions};
|
||||||
|
use std::io;
|
||||||
|
use std::path::{Path, PathBuf};
|
||||||
|
|
||||||
|
use memmap2::{Mmap, MmapMut};
|
||||||
|
|
||||||
|
const MAGIC: [u8; 4] = *b"PSIB";
|
||||||
|
|
||||||
|
// Header: magic(4) + _pad(4) + n(8) = 16 bytes. Data (1 byte/slot) follows.
|
||||||
|
const HEADER_SIZE: usize = 16;
|
||||||
|
|
||||||
|
/// A family presence mask: bit `b` set iff the member whose own canonical
|
||||||
|
/// central base is `b` (0=A, 1=C, 2=G, 3=T) is observed in the index.
|
||||||
|
#[derive(Debug, Clone, Copy, PartialEq, Eq)]
|
||||||
|
pub struct FamilyMask(u8);
|
||||||
|
|
||||||
|
impl FamilyMask {
|
||||||
|
/// The empty mask — never a valid *computed* result (a slot's own base
|
||||||
|
/// is always present in its own family) — used only to build up a mask
|
||||||
|
/// via repeated [`with`](Self::with) calls before storing it.
|
||||||
|
pub const EMPTY: FamilyMask = FamilyMask(0);
|
||||||
|
|
||||||
|
/// Set bit `base` (0=A, 1=C, 2=G, 3=T).
|
||||||
|
#[inline]
|
||||||
|
pub fn with(self, base: u8) -> Self {
|
||||||
|
debug_assert!(base < 4, "base out of range: {base}");
|
||||||
|
FamilyMask(self.0 | (1 << base))
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Is the member with central base `base` (0..3) present?
|
||||||
|
#[inline]
|
||||||
|
pub fn has(self, base: u8) -> bool {
|
||||||
|
debug_assert!(base < 4, "base out of range: {base}");
|
||||||
|
self.0 & (1 << base) != 0
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Number of family members observed anywhere in the index (1..=4).
|
||||||
|
#[inline]
|
||||||
|
pub fn family_size(self) -> u32 {
|
||||||
|
self.0.count_ones()
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Number of *other* members observed (0..=3) — `family_size() - 1`.
|
||||||
|
#[inline]
|
||||||
|
pub fn siblings(self) -> u32 {
|
||||||
|
self.family_size() - 1
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Raw bitmask (bit `b` = base `b` present) — for callers that build up
|
||||||
|
/// a mask via their own bit operations (e.g. concurrently, via an
|
||||||
|
/// `AtomicU8`) and only need the `FamilyMask` wrapper at the end.
|
||||||
|
#[inline]
|
||||||
|
pub fn bits(self) -> u8 {
|
||||||
|
self.0
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Construct from a raw bitmask (only the low 4 bits are kept).
|
||||||
|
#[inline]
|
||||||
|
pub fn from_bits(bits: u8) -> Self {
|
||||||
|
FamilyMask(bits & 0b1111)
|
||||||
|
}
|
||||||
|
|
||||||
|
#[inline]
|
||||||
|
fn encode(self) -> u8 {
|
||||||
|
self.0
|
||||||
|
}
|
||||||
|
|
||||||
|
#[inline]
|
||||||
|
fn decode(byte: u8) -> Option<Self> {
|
||||||
|
if byte == 0 {
|
||||||
|
// Unreachable for a real result — reserved as the "not yet
|
||||||
|
// computed" sentinel.
|
||||||
|
return None;
|
||||||
|
}
|
||||||
|
Some(FamilyMask(byte & 0b1111))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── SiblingAnnex (reader) ───────────────────────────────────────────────────
|
||||||
|
|
||||||
|
pub struct SiblingAnnex {
|
||||||
|
mmap: Mmap,
|
||||||
|
n: usize,
|
||||||
|
path: PathBuf,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl SiblingAnnex {
|
||||||
|
pub fn open(path: &Path) -> io::Result<Self> {
|
||||||
|
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
|
||||||
|
if mmap.len() < HEADER_SIZE {
|
||||||
|
return Err(io::Error::new(io::ErrorKind::InvalidData, "PSIB file too short"));
|
||||||
|
}
|
||||||
|
if mmap[0..4] != MAGIC {
|
||||||
|
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PSIB magic"));
|
||||||
|
}
|
||||||
|
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
|
||||||
|
if mmap.len() < HEADER_SIZE + n {
|
||||||
|
return Err(io::Error::new(io::ErrorKind::InvalidData, "PSIB file truncated"));
|
||||||
|
}
|
||||||
|
Ok(Self { mmap, n, path: path.to_path_buf() })
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn path(&self) -> &Path { &self.path }
|
||||||
|
pub fn len(&self) -> usize { self.n }
|
||||||
|
pub fn is_empty(&self) -> bool { self.n == 0 }
|
||||||
|
|
||||||
|
/// `None` means the slot has not (yet) been computed — see module docs.
|
||||||
|
pub fn get(&self, slot: usize) -> Option<FamilyMask> {
|
||||||
|
FamilyMask::decode(self.mmap[HEADER_SIZE + slot])
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── SiblingAnnexBuilder (writer) ────────────────────────────────────────────
|
||||||
|
|
||||||
|
pub struct SiblingAnnexBuilder {
|
||||||
|
mmap: MmapMut,
|
||||||
|
n: usize,
|
||||||
|
path: PathBuf,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl SiblingAnnexBuilder {
|
||||||
|
/// Create a new annex of `n` slots at `path`, pre-initialised to the
|
||||||
|
/// "not yet computed" sentinel (all-zero).
|
||||||
|
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
|
||||||
|
let file_size = HEADER_SIZE + n;
|
||||||
|
let file = OpenOptions::new()
|
||||||
|
.read(true).write(true).create(true).truncate(true)
|
||||||
|
.open(path)?;
|
||||||
|
file.set_len(file_size as u64)?;
|
||||||
|
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
|
||||||
|
mmap[0..4].copy_from_slice(&MAGIC);
|
||||||
|
mmap[4..8].copy_from_slice(&[0u8; 4]);
|
||||||
|
mmap[8..16].copy_from_slice(&(n as u64).to_le_bytes());
|
||||||
|
// Data region left at 0 by `set_len`/mmap — the sentinel value.
|
||||||
|
Ok(Self { mmap, n, path: path.to_path_buf() })
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn len(&self) -> usize { self.n }
|
||||||
|
pub fn is_empty(&self) -> bool { self.n == 0 }
|
||||||
|
|
||||||
|
pub fn get(&self, slot: usize) -> Option<FamilyMask> {
|
||||||
|
FamilyMask::decode(self.mmap[HEADER_SIZE + slot])
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn set(&mut self, slot: usize, mask: FamilyMask) {
|
||||||
|
// Redundant concurrent writes from independent recomputation paths
|
||||||
|
// converge to the same encoded byte for a given slot, so a plain
|
||||||
|
// store here is safe even without external synchronisation, as long
|
||||||
|
// as the byte write itself is atomic (true for a single aligned
|
||||||
|
// byte on every platform this project targets).
|
||||||
|
self.mmap[HEADER_SIZE + slot] = mask.encode();
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn close(self) -> io::Result<()> { self.mmap.flush() }
|
||||||
|
|
||||||
|
pub fn finish(self) -> io::Result<SiblingAnnex> {
|
||||||
|
let path = self.path.clone();
|
||||||
|
self.close()?;
|
||||||
|
SiblingAnnex::open(&path)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[cfg(test)]
|
||||||
|
mod tests {
|
||||||
|
use super::*;
|
||||||
|
use tempfile::tempdir;
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn sentinel_is_zero_and_unset_slots_read_as_uncomputed() {
|
||||||
|
let dir = tempdir().unwrap();
|
||||||
|
let path = dir.path().join("test.psib");
|
||||||
|
let builder = SiblingAnnexBuilder::new(4, &path).unwrap();
|
||||||
|
for slot in 0..4 {
|
||||||
|
assert_eq!(builder.get(slot), None);
|
||||||
|
}
|
||||||
|
builder.close().unwrap();
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn roundtrip_all_valid_masks() {
|
||||||
|
let dir = tempdir().unwrap();
|
||||||
|
let path = dir.path().join("test.psib");
|
||||||
|
let mut builder = SiblingAnnexBuilder::new(4, &path).unwrap();
|
||||||
|
|
||||||
|
let masks = [
|
||||||
|
FamilyMask::EMPTY.with(0), // just A: family size 1
|
||||||
|
FamilyMask::EMPTY.with(0).with(3), // A + T: size 2
|
||||||
|
FamilyMask::EMPTY.with(1).with(2).with(3), // C+G+T: size 3
|
||||||
|
FamilyMask::EMPTY.with(0).with(1).with(2).with(3), // all 4
|
||||||
|
];
|
||||||
|
for (slot, mask) in masks.iter().enumerate() {
|
||||||
|
builder.set(slot, *mask);
|
||||||
|
}
|
||||||
|
let annex = builder.finish().unwrap();
|
||||||
|
for (slot, mask) in masks.iter().enumerate() {
|
||||||
|
assert_eq!(annex.get(slot), Some(*mask));
|
||||||
|
}
|
||||||
|
assert_eq!(annex.get(0).unwrap().siblings(), 0);
|
||||||
|
assert_eq!(annex.get(1).unwrap().siblings(), 1);
|
||||||
|
assert_eq!(annex.get(2).unwrap().siblings(), 2);
|
||||||
|
assert_eq!(annex.get(3).unwrap().siblings(), 3);
|
||||||
|
assert_eq!(annex.get(3).unwrap().family_size(), 4);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn has_reflects_individual_bits() {
|
||||||
|
let mask = FamilyMask::EMPTY.with(0).with(2);
|
||||||
|
assert!(mask.has(0));
|
||||||
|
assert!(!mask.has(1));
|
||||||
|
assert!(mask.has(2));
|
||||||
|
assert!(!mask.has(3));
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -1,5 +1,16 @@
|
|||||||
use ndarray::{Array1, Array2};
|
use ndarray::{Array1, Array2};
|
||||||
|
|
||||||
|
/// Convert a Jaccard distance matrix (`1 - J`) into a Mash distance matrix, per
|
||||||
|
/// https://mash.readthedocs.io/en/latest/distances.html:
|
||||||
|
/// `D = -1/k * ln(2J / (1+J))`.
|
||||||
|
fn jaccard_to_mash(d_jaccard: &Array2<f64>, k: usize) -> Array2<f64> {
|
||||||
|
d_jaccard.mapv(|d| {
|
||||||
|
let j = 1.0 - d;
|
||||||
|
if j <= 0.0 { 1.0 }
|
||||||
|
else { -1.0 / k as f64 * (2.0 * j / (1.0 + j)).ln() }
|
||||||
|
})
|
||||||
|
}
|
||||||
|
|
||||||
// ── Column-level weight statistic — total count or presence count per column.
|
// ── Column-level weight statistic — total count or presence count per column.
|
||||||
/// Additive across layers and partitions; used as denominator in normalised distances.
|
/// Additive across layers and partitions; used as denominator in normalised distances.
|
||||||
///
|
///
|
||||||
@@ -74,6 +85,12 @@ pub trait CountPartials: ColumnWeights {
|
|||||||
m
|
m
|
||||||
}
|
}
|
||||||
|
|
||||||
|
/// Mash distance (https://mash.readthedocs.io/en/latest/distances.html), derived
|
||||||
|
/// from the presence-threshold Jaccard distance.
|
||||||
|
fn threshold_mash_dist_matrix(&self, k: usize, threshold: u32) -> Array2<f64> {
|
||||||
|
jaccard_to_mash(&self.threshold_jaccard_dist_matrix(threshold), k)
|
||||||
|
}
|
||||||
|
|
||||||
fn relfreq_bray_dist_matrix(&self) -> Array2<f64> {
|
fn relfreq_bray_dist_matrix(&self) -> Array2<f64> {
|
||||||
let global = self.col_weights();
|
let global = self.col_weights();
|
||||||
let mut m = self.partial_relfreq_bray(&global).mapv(|v| 1.0 - v);
|
let mut m = self.partial_relfreq_bray(&global).mapv(|v| 1.0 - v);
|
||||||
@@ -126,6 +143,12 @@ pub trait BitPartials: ColumnWeights {
|
|||||||
m
|
m
|
||||||
}
|
}
|
||||||
|
|
||||||
|
/// Mash distance (https://mash.readthedocs.io/en/latest/distances.html), derived
|
||||||
|
/// from the Jaccard distance.
|
||||||
|
fn mash_dist_matrix(&self, k: usize) -> Array2<f64> {
|
||||||
|
jaccard_to_mash(&self.jaccard_dist_matrix(), k)
|
||||||
|
}
|
||||||
|
|
||||||
fn hamming_dist_matrix(&self) -> Array2<u64> {
|
fn hamming_dist_matrix(&self) -> Array2<u64> {
|
||||||
self.partial_hamming()
|
self.partial_hamming()
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -0,0 +1,10 @@
|
|||||||
|
[package]
|
||||||
|
name = "obikentropy"
|
||||||
|
version = "0.1.0"
|
||||||
|
edition = "2024"
|
||||||
|
|
||||||
|
[dependencies]
|
||||||
|
obikseq = { path = "../obikseq" }
|
||||||
|
|
||||||
|
[dev-dependencies]
|
||||||
|
obikseq = { path = "../obikseq", features = ["test-utils"] }
|
||||||
@@ -4,57 +4,6 @@ use std::path::PathBuf;
|
|||||||
const K_MAX: usize = 32;
|
const K_MAX: usize = 32;
|
||||||
const WS_MAX: usize = 6;
|
const WS_MAX: usize = 6;
|
||||||
|
|
||||||
fn normalize_circular(kmer: u64, ws: usize) -> u64 {
|
|
||||||
let mask = (1u64 << (ws * 2)) - 1;
|
|
||||||
let mut canonical = kmer & mask;
|
|
||||||
let mut current = canonical;
|
|
||||||
for _ in 0..ws - 1 {
|
|
||||||
let top = (current >> ((ws - 1) * 2)) & 3;
|
|
||||||
current = ((current << 2) | top) & mask;
|
|
||||||
if current < canonical {
|
|
||||||
canonical = current;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
canonical
|
|
||||||
}
|
|
||||||
|
|
||||||
fn revcomp_raw(x: u64, k: usize) -> u64 {
|
|
||||||
let x = !x;
|
|
||||||
let x = x.swap_bytes();
|
|
||||||
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
|
|
||||||
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
|
|
||||||
x << (64 - 2 * k)
|
|
||||||
}
|
|
||||||
|
|
||||||
fn build_normalized_kmer(k: usize) -> Vec<u64> {
|
|
||||||
let n = 1usize << (k * 2);
|
|
||||||
let shift = 64 - k * 2;
|
|
||||||
let mut result = vec![0u64; n];
|
|
||||||
for i in 0..n {
|
|
||||||
let la = (i as u64) << shift;
|
|
||||||
let ra = i as u64;
|
|
||||||
let rc_ra = revcomp_raw(la, k) >> shift;
|
|
||||||
let circ = normalize_circular(ra, k);
|
|
||||||
let circ_rc = normalize_circular(rc_ra, k);
|
|
||||||
result[i] = if circ < circ_rc { circ } else { circ_rc };
|
|
||||||
}
|
|
||||||
result
|
|
||||||
}
|
|
||||||
|
|
||||||
fn build_ln_class(norm: &[u64]) -> Vec<f64> {
|
|
||||||
let n = norm.len();
|
|
||||||
let mut sizes = vec![0u32; n];
|
|
||||||
for &c in norm {
|
|
||||||
sizes[c as usize] += 1;
|
|
||||||
}
|
|
||||||
norm.iter()
|
|
||||||
.map(|&c| {
|
|
||||||
let s = sizes[c as usize];
|
|
||||||
if s > 0 { (s as f64).ln() } else { 0.0 }
|
|
||||||
})
|
|
||||||
.collect()
|
|
||||||
}
|
|
||||||
|
|
||||||
fn build_n_log_n() -> [f64; K_MAX + 1] {
|
fn build_n_log_n() -> [f64; K_MAX + 1] {
|
||||||
let mut t = [0.0f64; K_MAX + 1];
|
let mut t = [0.0f64; K_MAX + 1];
|
||||||
for n in 1..=K_MAX {
|
for n in 1..=K_MAX {
|
||||||
@@ -63,6 +12,9 @@ fn build_n_log_n() -> [f64; K_MAX + 1] {
|
|||||||
t
|
t
|
||||||
}
|
}
|
||||||
|
|
||||||
|
/// Max achievable entropy over `4^ws` raw sub-words given only `nwords`
|
||||||
|
/// observations (most-uniform integer partition), per
|
||||||
|
/// `docmd/theory/entropy.md`.
|
||||||
fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] {
|
fn build_emax() -> [[f64; WS_MAX + 1]; K_MAX + 1] {
|
||||||
let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1];
|
let mut t = [[0.0f64; WS_MAX + 1]; K_MAX + 1];
|
||||||
for k in 2..=K_MAX {
|
for k in 2..=K_MAX {
|
||||||
@@ -125,13 +77,6 @@ fn main() {
|
|||||||
let out_dir = PathBuf::from(std::env::var("OUT_DIR").unwrap());
|
let out_dir = PathBuf::from(std::env::var("OUT_DIR").unwrap());
|
||||||
let mut out = String::new();
|
let mut out = String::new();
|
||||||
|
|
||||||
for k in 1..=6usize {
|
|
||||||
let n = 1usize << (k * 2);
|
|
||||||
let norm = build_normalized_kmer(k);
|
|
||||||
let ln_class = build_ln_class(&norm);
|
|
||||||
emit_f64_1d(&mut out, &format!("LN_CLASS{k}"), n, &ln_class);
|
|
||||||
}
|
|
||||||
|
|
||||||
let n_log_n = build_n_log_n();
|
let n_log_n = build_n_log_n();
|
||||||
emit_f64_1d(&mut out, "N_LOG_N", K_MAX + 1, &n_log_n);
|
emit_f64_1d(&mut out, "N_LOG_N", K_MAX + 1, &n_log_n);
|
||||||
|
|
||||||
@@ -141,5 +86,5 @@ fn main() {
|
|||||||
let log_nwords = build_log_nwords();
|
let log_nwords = build_log_nwords();
|
||||||
emit_f64_2d(&mut out, "LOG_NWORDS", K_MAX + 1, WS_MAX + 1, &log_nwords);
|
emit_f64_2d(&mut out, "LOG_NWORDS", K_MAX + 1, WS_MAX + 1, &log_nwords);
|
||||||
|
|
||||||
fs::write(out_dir.join("ln_class_tables.rs"), out).unwrap();
|
fs::write(out_dir.join("entropy_tables.rs"), out).unwrap();
|
||||||
}
|
}
|
||||||
@@ -0,0 +1,41 @@
|
|||||||
|
//! Normalized entropy of an isolated, already-built k-mer (e.g. one
|
||||||
|
//! reconstructed from an index's `unitigs.bin`, with no surrounding
|
||||||
|
//! sequence) — drives the window through [`EntropyTracker`] one base at a
|
||||||
|
//! time, exactly like the streaming path, so a `theta` threshold means the
|
||||||
|
//! same thing whether applied during index construction or after the fact
|
||||||
|
//! (e.g. `obikmer filter`).
|
||||||
|
|
||||||
|
use obikseq::CanonicalKmer;
|
||||||
|
|
||||||
|
use crate::tracker::EntropyTracker;
|
||||||
|
|
||||||
|
/// Extension trait: compute the normalized entropy of a single canonical
|
||||||
|
/// k-mer, independent of any surrounding sequence.
|
||||||
|
pub trait KmerEntropy {
|
||||||
|
/// Normalized entropy across sub-word orders `1..=level_max` (the
|
||||||
|
/// minimum is taken across orders). Lower means less complex; `theta`
|
||||||
|
/// in `index`/`filter` rejects k-mers with a score `< theta`.
|
||||||
|
fn entropy(&self, level_max: usize) -> f64;
|
||||||
|
}
|
||||||
|
|
||||||
|
impl KmerEntropy for CanonicalKmer {
|
||||||
|
fn entropy(&self, level_max: usize) -> f64 {
|
||||||
|
let raw = self.raw(); // left-aligned, 2 bits/base, MSB-first
|
||||||
|
let k = obikseq::params::k();
|
||||||
|
let mask = (!0u64) >> (64 - k * 2);
|
||||||
|
|
||||||
|
let mut tracker = EntropyTracker::new(k);
|
||||||
|
let mut rolling: u64 = 0;
|
||||||
|
for i in 0..k {
|
||||||
|
let shift = 64 - 2 * (i + 1);
|
||||||
|
let base = (raw >> shift) & 3;
|
||||||
|
rolling = ((rolling << 2) | base) & mask;
|
||||||
|
tracker.push(i + 1, rolling);
|
||||||
|
}
|
||||||
|
tracker.normalized_entropy(level_max)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[cfg(test)]
|
||||||
|
#[path = "tests/kmer_entropy.rs"]
|
||||||
|
mod tests;
|
||||||
@@ -0,0 +1,17 @@
|
|||||||
|
//! Normalized k-mer entropy: formulas, tables, and a streaming tracker.
|
||||||
|
//!
|
||||||
|
//! This crate holds every piece of the entropy computation described in
|
||||||
|
//! `docmd/theory/entropy.md`: the compile-time tables ([`table`], private),
|
||||||
|
//! the incremental accumulator ([`EntropyTracker`]) that callers compose
|
||||||
|
//! into their own streaming state, and the [`KmerEntropy`] convenience trait
|
||||||
|
//! for scoring a single, already-built k-mer.
|
||||||
|
|
||||||
|
#![deny(missing_docs)]
|
||||||
|
|
||||||
|
mod kmer_entropy;
|
||||||
|
mod ring;
|
||||||
|
mod table;
|
||||||
|
mod tracker;
|
||||||
|
|
||||||
|
pub use kmer_entropy::KmerEntropy;
|
||||||
|
pub use tracker::EntropyTracker;
|
||||||
@@ -0,0 +1,40 @@
|
|||||||
|
//! Stack-allocated ring buffer backing the sliding sub-word windows.
|
||||||
|
|
||||||
|
/// Fixed-capacity ring buffer backed by a stack array.
|
||||||
|
/// N must be a power of two; operations are branchless via `% N`.
|
||||||
|
pub(crate) struct Ring<T: Copy + Default, const N: usize> {
|
||||||
|
buf: [T; N],
|
||||||
|
head: usize,
|
||||||
|
len: usize,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl<T: Copy + Default, const N: usize> Ring<T, N> {
|
||||||
|
#[inline]
|
||||||
|
pub(crate) fn new() -> Self {
|
||||||
|
Self {
|
||||||
|
buf: [T::default(); N],
|
||||||
|
head: 0,
|
||||||
|
len: 0,
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[inline]
|
||||||
|
pub(crate) fn clear(&mut self) {
|
||||||
|
self.len = 0;
|
||||||
|
self.head = 0;
|
||||||
|
}
|
||||||
|
|
||||||
|
#[inline]
|
||||||
|
pub(crate) fn push_back(&mut self, val: T) {
|
||||||
|
self.buf[(self.head + self.len) % N] = val;
|
||||||
|
self.len += 1;
|
||||||
|
}
|
||||||
|
|
||||||
|
#[inline]
|
||||||
|
pub(crate) fn pop_front(&mut self) -> T {
|
||||||
|
let val = self.buf[self.head];
|
||||||
|
self.head = (self.head + 1) % N;
|
||||||
|
self.len -= 1;
|
||||||
|
val
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -0,0 +1,30 @@
|
|||||||
|
//! Compile-time tables backing the normalized k-mer entropy formula: the
|
||||||
|
//! max-entropy correction for small samples. See `docmd/theory/entropy.md`.
|
||||||
|
//!
|
||||||
|
//! Entropy is computed directly on raw (non-canonicalized) sub-words — no
|
||||||
|
//! equivalence-class folding. Empirically (see the discussion that produced
|
||||||
|
//! this crate's history), folding sub-words into circular/revcomp classes
|
||||||
|
//! before unfolding them back buys nothing for the invariances it was meant
|
||||||
|
//! to guarantee (both hold for raw sub-word entropy already, by a direct
|
||||||
|
//! bijection argument for revcomp and by the sliding window's own dynamics
|
||||||
|
//! for tandem repeats), while it measurably *weakens* detection of the
|
||||||
|
//! low-complexity sequences the filter exists to catch.
|
||||||
|
|
||||||
|
include!(concat!(env!("OUT_DIR"), "/entropy_tables.rs"));
|
||||||
|
|
||||||
|
pub(crate) const WS_MAX: usize = 6;
|
||||||
|
|
||||||
|
#[inline(always)]
|
||||||
|
pub(crate) const fn n_log_n(n: usize) -> f64 {
|
||||||
|
N_LOG_N[n]
|
||||||
|
}
|
||||||
|
|
||||||
|
#[inline(always)]
|
||||||
|
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
|
||||||
|
EMAX[k][ws]
|
||||||
|
}
|
||||||
|
|
||||||
|
#[inline(always)]
|
||||||
|
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
|
||||||
|
LOG_NWORDS[k][ws]
|
||||||
|
}
|
||||||
@@ -0,0 +1,52 @@
|
|||||||
|
use super::*;
|
||||||
|
use obikseq::Sequence;
|
||||||
|
use obikseq::kmer::Kmer;
|
||||||
|
|
||||||
|
const K: usize = 21;
|
||||||
|
const LEVEL_MAX: usize = 6;
|
||||||
|
|
||||||
|
fn kmer_from_ascii(seq: &[u8]) -> CanonicalKmer {
|
||||||
|
obikseq::set_k(K);
|
||||||
|
Kmer::from_ascii(seq).expect("valid k-mer sequence").canonical()
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn homopolymer_scores_lower_than_diverse_sequence() {
|
||||||
|
let homopolymer = kmer_from_ascii(b"AAAAAAAAAAAAAAAAAAAAA"); // 21 bases
|
||||||
|
let diverse = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT"); // 21 bases, same as used elsewhere in this workspace's tests
|
||||||
|
|
||||||
|
let e_homopolymer = homopolymer.entropy(LEVEL_MAX);
|
||||||
|
let e_diverse = diverse.entropy(LEVEL_MAX);
|
||||||
|
|
||||||
|
assert!(
|
||||||
|
e_homopolymer < e_diverse,
|
||||||
|
"homopolymer ({e_homopolymer}) should score lower than a diverse sequence ({e_diverse})"
|
||||||
|
);
|
||||||
|
// A pure homopolymer is the most degenerate case representable — its
|
||||||
|
// score should sit near the bottom of the range, not just "somewhat lower".
|
||||||
|
assert!(e_homopolymer < 0.3, "homopolymer entropy unexpectedly high: {e_homopolymer}");
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn entropy_is_deterministic_for_the_same_kmer() {
|
||||||
|
let a = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
|
||||||
|
let b = kmer_from_ascii(b"CATTAGCGTACCTGATCAGGT");
|
||||||
|
assert_eq!(a.entropy(LEVEL_MAX), b.entropy(LEVEL_MAX));
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn entropy_is_within_zero_one_range() {
|
||||||
|
let mut repeat = "AT".repeat(K / 2 + 1);
|
||||||
|
repeat.truncate(K);
|
||||||
|
|
||||||
|
for seq in [
|
||||||
|
"AAAAAAAAAAAAAAAAAAAAA".to_string(),
|
||||||
|
repeat,
|
||||||
|
"CATTAGCGTACCTGATCAGGT".to_string(),
|
||||||
|
] {
|
||||||
|
assert_eq!(seq.len(), K, "test sequence must be exactly K bases: {seq:?}");
|
||||||
|
let kmer = kmer_from_ascii(seq.as_bytes());
|
||||||
|
let e = kmer.entropy(LEVEL_MAX);
|
||||||
|
assert!((0.0..=1.0).contains(&e), "entropy {e} out of [0,1] for {seq:?}");
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -0,0 +1,255 @@
|
|||||||
|
//! Incremental (streaming) normalized k-mer entropy.
|
||||||
|
//!
|
||||||
|
//! [`EntropyTracker`] maintains, over a sliding window of the last `k` bases,
|
||||||
|
//! the per-sub-word-size raw-word frequency statistics needed to evaluate
|
||||||
|
//! the corrected Shannon entropy described in `docmd/theory/entropy.md`,
|
||||||
|
//! updated in O(1) per base rather than recomputed from scratch. No
|
||||||
|
//! canonicalization is applied — each sub-word is tallied under its own raw
|
||||||
|
//! 2-bit-packed value; only the small-sample max-entropy correction departs
|
||||||
|
//! from a textbook Shannon entropy.
|
||||||
|
//!
|
||||||
|
//! It carries no notion of minimizers or superkmer segmentation — callers
|
||||||
|
//! that need both (e.g. `obiskbuilder::RollingStat`) compose an
|
||||||
|
//! `EntropyTracker` as a plain field alongside their own state, so the two
|
||||||
|
//! concerns update in the same streaming pass without being conflated in one
|
||||||
|
//! struct.
|
||||||
|
|
||||||
|
use crate::ring::Ring;
|
||||||
|
use crate::table::{WS_MAX, emax, log_nwords, n_log_n};
|
||||||
|
|
||||||
|
/// Incremental normalized-entropy accumulator over a sliding window of `k`
|
||||||
|
/// bases. Composed as a plain field by callers that also need other
|
||||||
|
/// per-base state (e.g. minimizer selection) in the same streaming pass.
|
||||||
|
pub struct EntropyTracker {
|
||||||
|
k: usize,
|
||||||
|
steady: bool,
|
||||||
|
|
||||||
|
// Sliding-window queues over the last `k` raw sub-words, one per word
|
||||||
|
// size — stack-allocated, capacity ≤ k ≤ 31.
|
||||||
|
k1q: Ring<u64, 32>,
|
||||||
|
k2q: Ring<u64, 32>,
|
||||||
|
k3q: Ring<u64, 32>,
|
||||||
|
k4q: Ring<u64, 32>,
|
||||||
|
k5q: Ring<u64, 32>,
|
||||||
|
k6q: Ring<u64, 32>,
|
||||||
|
|
||||||
|
// Frequency count arrays, indexed by the raw sub-word value (2 bits per
|
||||||
|
// base). Max count per cell ≤ k ≤ 31 → u8 is sufficient.
|
||||||
|
k1c: [u8; 4],
|
||||||
|
k2c: [u8; 16],
|
||||||
|
k3c: [u8; 64],
|
||||||
|
k4c: [u8; 256],
|
||||||
|
k5c: [u8; 1024],
|
||||||
|
k6c: [u8; 4096],
|
||||||
|
|
||||||
|
sum_f_log_f: [f64; WS_MAX + 1],
|
||||||
|
}
|
||||||
|
|
||||||
|
impl EntropyTracker {
|
||||||
|
/// New tracker for a window of `k` bases (1..=31).
|
||||||
|
pub fn new(k: usize) -> Self {
|
||||||
|
Self {
|
||||||
|
k,
|
||||||
|
steady: false,
|
||||||
|
k1q: Ring::new(),
|
||||||
|
k2q: Ring::new(),
|
||||||
|
k3q: Ring::new(),
|
||||||
|
k4q: Ring::new(),
|
||||||
|
k5q: Ring::new(),
|
||||||
|
k6q: Ring::new(),
|
||||||
|
k1c: [0; 4],
|
||||||
|
k2c: [0; 16],
|
||||||
|
k3c: [0; 64],
|
||||||
|
k4c: [0; 256],
|
||||||
|
k5c: [0; 1024],
|
||||||
|
k6c: [0; 4096],
|
||||||
|
sum_f_log_f: [0.0; WS_MAX + 1],
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Clear all accumulated state, ready to track a new window from
|
||||||
|
/// scratch (`k` is unchanged).
|
||||||
|
pub fn reset(&mut self) {
|
||||||
|
self.steady = false;
|
||||||
|
|
||||||
|
self.k1c.fill(0);
|
||||||
|
self.k2c.fill(0);
|
||||||
|
self.k3c.fill(0);
|
||||||
|
self.k4c.fill(0);
|
||||||
|
self.k5c.fill(0);
|
||||||
|
self.k6c.fill(0);
|
||||||
|
|
||||||
|
self.k1q.clear();
|
||||||
|
self.k2q.clear();
|
||||||
|
self.k3q.clear();
|
||||||
|
self.k4q.clear();
|
||||||
|
self.k5q.clear();
|
||||||
|
self.k6q.clear();
|
||||||
|
|
||||||
|
self.sum_f_log_f = [0.0; WS_MAX + 1];
|
||||||
|
}
|
||||||
|
|
||||||
|
#[inline]
|
||||||
|
fn update_sums_decrement<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], f: usize) {
|
||||||
|
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[inline]
|
||||||
|
fn update_sums_increment<const K: usize>(sum_f_log_f: &mut [f64; WS_MAX + 1], g: usize) {
|
||||||
|
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Advance the window by one base. `received` is the caller's running
|
||||||
|
/// count of bases pushed so far (1-based, i.e. after this base);
|
||||||
|
/// `rolling_kmer` is the current right-aligned, 2-bit-packed k-mer
|
||||||
|
/// window (same convention as `obiskbuilder::RollingStat::rolling_k`).
|
||||||
|
pub fn push(&mut self, received: usize, rolling_kmer: u64) {
|
||||||
|
let raw1 = rolling_kmer & 3;
|
||||||
|
let raw2 = rolling_kmer & 15;
|
||||||
|
let raw3 = rolling_kmer & 63;
|
||||||
|
let raw4 = rolling_kmer & 255;
|
||||||
|
let raw5 = rolling_kmer & 1023;
|
||||||
|
let raw6 = rolling_kmer & 4095;
|
||||||
|
|
||||||
|
if received > self.k {
|
||||||
|
let old1 = self.k1q.pop_front();
|
||||||
|
let f1 = self.k1c[old1 as usize] as usize;
|
||||||
|
Self::update_sums_decrement::<1>(&mut self.sum_f_log_f, f1);
|
||||||
|
self.k1c[old1 as usize] -= 1;
|
||||||
|
|
||||||
|
let old2 = self.k2q.pop_front();
|
||||||
|
let f2 = self.k2c[old2 as usize] as usize;
|
||||||
|
Self::update_sums_decrement::<2>(&mut self.sum_f_log_f, f2);
|
||||||
|
self.k2c[old2 as usize] -= 1;
|
||||||
|
|
||||||
|
let old3 = self.k3q.pop_front();
|
||||||
|
let f3 = self.k3c[old3 as usize] as usize;
|
||||||
|
Self::update_sums_decrement::<3>(&mut self.sum_f_log_f, f3);
|
||||||
|
self.k3c[old3 as usize] -= 1;
|
||||||
|
|
||||||
|
let old4 = self.k4q.pop_front();
|
||||||
|
let f4 = self.k4c[old4 as usize] as usize;
|
||||||
|
Self::update_sums_decrement::<4>(&mut self.sum_f_log_f, f4);
|
||||||
|
self.k4c[old4 as usize] -= 1;
|
||||||
|
|
||||||
|
let old5 = self.k5q.pop_front();
|
||||||
|
let f5 = self.k5c[old5 as usize] as usize;
|
||||||
|
Self::update_sums_decrement::<5>(&mut self.sum_f_log_f, f5);
|
||||||
|
self.k5c[old5 as usize] -= 1;
|
||||||
|
|
||||||
|
let old6 = self.k6q.pop_front();
|
||||||
|
let f6 = self.k6c[old6 as usize] as usize;
|
||||||
|
Self::update_sums_decrement::<6>(&mut self.sum_f_log_f, f6);
|
||||||
|
self.k6c[old6 as usize] -= 1;
|
||||||
|
}
|
||||||
|
|
||||||
|
if self.steady {
|
||||||
|
let g1 = self.k1c[raw1 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
|
||||||
|
self.k1c[raw1 as usize] += 1;
|
||||||
|
self.k1q.push_back(raw1);
|
||||||
|
|
||||||
|
let g2 = self.k2c[raw2 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
|
||||||
|
self.k2c[raw2 as usize] += 1;
|
||||||
|
self.k2q.push_back(raw2);
|
||||||
|
|
||||||
|
let g3 = self.k3c[raw3 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
|
||||||
|
self.k3c[raw3 as usize] += 1;
|
||||||
|
self.k3q.push_back(raw3);
|
||||||
|
|
||||||
|
let g4 = self.k4c[raw4 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
|
||||||
|
self.k4c[raw4 as usize] += 1;
|
||||||
|
self.k4q.push_back(raw4);
|
||||||
|
|
||||||
|
let g5 = self.k5c[raw5 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
|
||||||
|
self.k5c[raw5 as usize] += 1;
|
||||||
|
self.k5q.push_back(raw5);
|
||||||
|
|
||||||
|
let g6 = self.k6c[raw6 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
|
||||||
|
self.k6c[raw6 as usize] += 1;
|
||||||
|
self.k6q.push_back(raw6);
|
||||||
|
} else {
|
||||||
|
self.push_warmup_increments(received, raw1, raw2, raw3, raw4, raw5, raw6);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[cold]
|
||||||
|
#[inline(never)]
|
||||||
|
fn push_warmup_increments(
|
||||||
|
&mut self,
|
||||||
|
received: usize,
|
||||||
|
raw1: u64, raw2: u64, raw3: u64,
|
||||||
|
raw4: u64, raw5: u64, raw6: u64,
|
||||||
|
) {
|
||||||
|
let g1 = self.k1c[raw1 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, g1);
|
||||||
|
self.k1c[raw1 as usize] += 1;
|
||||||
|
self.k1q.push_back(raw1);
|
||||||
|
|
||||||
|
if received >= 2 {
|
||||||
|
let g2 = self.k2c[raw2 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, g2);
|
||||||
|
self.k2c[raw2 as usize] += 1;
|
||||||
|
self.k2q.push_back(raw2);
|
||||||
|
|
||||||
|
if received >= 3 {
|
||||||
|
let g3 = self.k3c[raw3 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, g3);
|
||||||
|
self.k3c[raw3 as usize] += 1;
|
||||||
|
self.k3q.push_back(raw3);
|
||||||
|
|
||||||
|
if received >= 4 {
|
||||||
|
let g4 = self.k4c[raw4 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, g4);
|
||||||
|
self.k4c[raw4 as usize] += 1;
|
||||||
|
self.k4q.push_back(raw4);
|
||||||
|
|
||||||
|
if received >= 5 {
|
||||||
|
let g5 = self.k5c[raw5 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, g5);
|
||||||
|
self.k5c[raw5 as usize] += 1;
|
||||||
|
self.k5q.push_back(raw5);
|
||||||
|
|
||||||
|
if received >= 6 {
|
||||||
|
let g6 = self.k6c[raw6 as usize] as usize;
|
||||||
|
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, g6);
|
||||||
|
self.k6c[raw6 as usize] += 1;
|
||||||
|
self.k6q.push_back(raw6);
|
||||||
|
self.steady = true;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Normalized entropy at sub-word size `order` (1..=6). The caller is
|
||||||
|
/// responsible for not calling this before the window is full (`k`
|
||||||
|
/// bases pushed) — an empty/partial window yields a meaningless value.
|
||||||
|
pub fn entropy(&self, order: usize) -> f64 {
|
||||||
|
let k = self.k;
|
||||||
|
let em = emax(k, order);
|
||||||
|
if em <= 0.0 {
|
||||||
|
return 1.0;
|
||||||
|
}
|
||||||
|
let nwords = k - order + 1;
|
||||||
|
let log_nw = log_nwords(k, order);
|
||||||
|
let nw_f = nwords as f64;
|
||||||
|
let h_corr = log_nw - self.sum_f_log_f[order] / nw_f;
|
||||||
|
(h_corr / em).max(0.0)
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Minimum of [`Self::entropy`] over sub-word sizes `1..=order_max`, same
|
||||||
|
/// caller responsibility re: window readiness as `entropy`.
|
||||||
|
pub fn normalized_entropy(&self, order_max: usize) -> f64 {
|
||||||
|
let min_e = (1..=order_max)
|
||||||
|
.map(|ws| self.entropy(ws))
|
||||||
|
.fold(f64::MAX, f64::min);
|
||||||
|
if min_e == f64::MAX { 1.0 } else { min_e }
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -10,6 +10,8 @@ obiskio = { path = "../obiskio" }
|
|||||||
obisys = { path = "../obisys" }
|
obisys = { path = "../obisys" }
|
||||||
obicompactvec = { path = "../obicompactvec" }
|
obicompactvec = { path = "../obicompactvec" }
|
||||||
obilayeredmap = { path = "../obilayeredmap" }
|
obilayeredmap = { path = "../obilayeredmap" }
|
||||||
|
obiskbuilder = { path = "../obiskbuilder" }
|
||||||
|
obipipeline = { path = "../obipipeline" }
|
||||||
ndarray = "0.16"
|
ndarray = "0.16"
|
||||||
rayon = "1"
|
rayon = "1"
|
||||||
crossbeam-channel = "0.5"
|
crossbeam-channel = "0.5"
|
||||||
@@ -19,6 +21,10 @@ indicatif = "0.17"
|
|||||||
tracing = "0.1.44"
|
tracing = "0.1.44"
|
||||||
hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], optional = true }
|
hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], optional = true }
|
||||||
|
|
||||||
|
[dev-dependencies]
|
||||||
|
obiread = { path = "../obiread" }
|
||||||
|
tempfile = "3"
|
||||||
|
|
||||||
[features]
|
[features]
|
||||||
default = ["numa"]
|
default = ["numa"]
|
||||||
numa = ["hwlocality"]
|
numa = ["hwlocality"]
|
||||||
|
|||||||
@@ -14,6 +14,8 @@ pub enum DistanceMetric {
|
|||||||
Jaccard,
|
Jaccard,
|
||||||
/// Hamming distance (number of differing kmer positions) on presence/absence data.
|
/// Hamming distance (number of differing kmer positions) on presence/absence data.
|
||||||
Hamming,
|
Hamming,
|
||||||
|
/// Mash distance on presence/absence data (Jaccard-derived mutation-rate estimate).
|
||||||
|
Mash,
|
||||||
/// Bray-Curtis dissimilarity on raw counts.
|
/// Bray-Curtis dissimilarity on raw counts.
|
||||||
BrayCurtis,
|
BrayCurtis,
|
||||||
/// Bray-Curtis dissimilarity normalised by per-genome total counts.
|
/// Bray-Curtis dissimilarity normalised by per-genome total counts.
|
||||||
@@ -84,6 +86,7 @@ impl KmerIndex {
|
|||||||
DistanceMetric::Hellinger => CountPartials::hellinger_dist_matrix(&global),
|
DistanceMetric::Hellinger => CountPartials::hellinger_dist_matrix(&global),
|
||||||
DistanceMetric::HellingerEuclidean => CountPartials::hellinger_euclidean_dist_matrix(&global),
|
DistanceMetric::HellingerEuclidean => CountPartials::hellinger_euclidean_dist_matrix(&global),
|
||||||
DistanceMetric::Jaccard => CountPartials::threshold_jaccard_dist_matrix(&global, presence_threshold),
|
DistanceMetric::Jaccard => CountPartials::threshold_jaccard_dist_matrix(&global, presence_threshold),
|
||||||
|
DistanceMetric::Mash => CountPartials::threshold_mash_dist_matrix(&global, self.kmer_size(), presence_threshold),
|
||||||
DistanceMetric::Hamming => {
|
DistanceMetric::Hamming => {
|
||||||
return Err(OKIError::InvalidInput(
|
return Err(OKIError::InvalidInput(
|
||||||
"Hamming is only available for presence/absence indexes".into(),
|
"Hamming is only available for presence/absence indexes".into(),
|
||||||
@@ -108,6 +111,7 @@ impl KmerIndex {
|
|||||||
|
|
||||||
let matrix = match metric {
|
let matrix = match metric {
|
||||||
DistanceMetric::Jaccard => BitPartials::jaccard_dist_matrix(&global),
|
DistanceMetric::Jaccard => BitPartials::jaccard_dist_matrix(&global),
|
||||||
|
DistanceMetric::Mash => BitPartials::mash_dist_matrix(&global, self.kmer_size()),
|
||||||
DistanceMetric::Hamming => {
|
DistanceMetric::Hamming => {
|
||||||
BitPartials::hamming_dist_matrix(&global).mapv(|v| v as f64)
|
BitPartials::hamming_dist_matrix(&global).mapv(|v| v as f64)
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -9,6 +9,7 @@ mod numa;
|
|||||||
mod rebuild;
|
mod rebuild;
|
||||||
mod reindex;
|
mod reindex;
|
||||||
mod select;
|
mod select;
|
||||||
|
mod siblings;
|
||||||
mod stats;
|
mod stats;
|
||||||
|
|
||||||
pub use error::{OKIError, OKIResult};
|
pub use error::{OKIError, OKIResult};
|
||||||
@@ -18,3 +19,4 @@ pub use merge::MergeMode;
|
|||||||
pub use meta::{validate_label, GenomeInfo, IndexConfig, IndexMeta, META_FILENAME};
|
pub use meta::{validate_label, GenomeInfo, IndexConfig, IndexMeta, META_FILENAME};
|
||||||
pub use state::{IndexState, SENTINEL_COUNTED, SENTINEL_INDEXED, SENTINEL_SCATTERED};
|
pub use state::{IndexState, SENTINEL_COUNTED, SENTINEL_INDEXED, SENTINEL_SCATTERED};
|
||||||
pub use stats::IndexBitsPerKmer;
|
pub use stats::IndexBitsPerKmer;
|
||||||
|
pub use siblings::{RawSnpDistanceOutput, SiblingAnnexStats, SnpAlignment};
|
||||||
|
|||||||
@@ -79,9 +79,7 @@ pub fn build() -> NumaSetup {
|
|||||||
}
|
}
|
||||||
|
|
||||||
// UMA fallback: single synthetic node, all cores, no pool, no pinning.
|
// UMA fallback: single synthetic node, all cores, no pool, no pinning.
|
||||||
let n_cores = std::thread::available_parallelism()
|
let n_cores = obisys::effective_parallelism();
|
||||||
.map(|n| n.get())
|
|
||||||
.unwrap_or(1);
|
|
||||||
debug!("UMA: single synthetic node, {} core(s)", n_cores);
|
debug!("UMA: single synthetic node, {} core(s)", n_cores);
|
||||||
NumaSetup {
|
NumaSetup {
|
||||||
pools: vec![None],
|
pools: vec![None],
|
||||||
@@ -91,9 +89,7 @@ pub fn build() -> NumaSetup {
|
|||||||
|
|
||||||
#[cfg(not(feature = "numa"))]
|
#[cfg(not(feature = "numa"))]
|
||||||
pub fn build() -> NumaSetup {
|
pub fn build() -> NumaSetup {
|
||||||
let n_cores = std::thread::available_parallelism()
|
let n_cores = obisys::effective_parallelism();
|
||||||
.map(|n| n.get())
|
|
||||||
.unwrap_or(1);
|
|
||||||
debug!("UMA: single synthetic node, {} core(s)", n_cores);
|
debug!("UMA: single synthetic node, {} core(s)", n_cores);
|
||||||
NumaSetup {
|
NumaSetup {
|
||||||
pools: vec![None],
|
pools: vec![None],
|
||||||
|
|||||||
File diff suppressed because it is too large
Load Diff
@@ -1,6 +1,6 @@
|
|||||||
[package]
|
[package]
|
||||||
name = "obikmer"
|
name = "obikmer"
|
||||||
version = "1.1.37"
|
version = "1.1.42"
|
||||||
edition = "2024"
|
edition = "2024"
|
||||||
|
|
||||||
[[bin]]
|
[[bin]]
|
||||||
|
|||||||
@@ -38,9 +38,7 @@ pub struct CommonArgs {
|
|||||||
#[arg(
|
#[arg(
|
||||||
short = 'T',
|
short = 'T',
|
||||||
long,
|
long,
|
||||||
default_value_t = std::thread::available_parallelism()
|
default_value_t = obisys::effective_parallelism()
|
||||||
.map(|n| n.get())
|
|
||||||
.unwrap_or(1)
|
|
||||||
)]
|
)]
|
||||||
pub threads: usize,
|
pub threads: usize,
|
||||||
|
|
||||||
|
|||||||
@@ -3,13 +3,15 @@ use std::path::PathBuf;
|
|||||||
|
|
||||||
use clap::Args;
|
use clap::Args;
|
||||||
use kodama::{Method, linkage};
|
use kodama::{Method, linkage};
|
||||||
use obikindex::{DistanceMetric, KmerIndex};
|
use obifastwrite::{JsonVal, write_record};
|
||||||
|
use obikindex::{DistanceMetric, KmerIndex, RawSnpDistanceOutput, SiblingAnnexStats, SnpAlignment};
|
||||||
use speedytree::{DistanceMatrix, Hybrid, NeighborJoiningSolver, to_newick};
|
use speedytree::{DistanceMatrix, Hybrid, NeighborJoiningSolver, to_newick};
|
||||||
use tracing::info;
|
use tracing::info;
|
||||||
|
|
||||||
#[derive(clap::ValueEnum, Clone, Copy, Debug)]
|
#[derive(clap::ValueEnum, Clone, Copy, Debug)]
|
||||||
pub enum MetricArg {
|
pub enum MetricArg {
|
||||||
Jaccard,
|
Jaccard,
|
||||||
|
Mash,
|
||||||
Hamming,
|
Hamming,
|
||||||
BrayCurtis,
|
BrayCurtis,
|
||||||
#[value(name = "relfreq-bray-curtis")]
|
#[value(name = "relfreq-bray-curtis")]
|
||||||
@@ -26,6 +28,7 @@ impl From<MetricArg> for DistanceMetric {
|
|||||||
fn from(m: MetricArg) -> Self {
|
fn from(m: MetricArg) -> Self {
|
||||||
match m {
|
match m {
|
||||||
MetricArg::Jaccard => DistanceMetric::Jaccard,
|
MetricArg::Jaccard => DistanceMetric::Jaccard,
|
||||||
|
MetricArg::Mash => DistanceMetric::Mash,
|
||||||
MetricArg::Hamming => DistanceMetric::Hamming,
|
MetricArg::Hamming => DistanceMetric::Hamming,
|
||||||
MetricArg::BrayCurtis => DistanceMetric::BrayCurtis,
|
MetricArg::BrayCurtis => DistanceMetric::BrayCurtis,
|
||||||
MetricArg::RelfreqBrayCurtis => DistanceMetric::RelfreqBrayCurtis,
|
MetricArg::RelfreqBrayCurtis => DistanceMetric::RelfreqBrayCurtis,
|
||||||
@@ -62,7 +65,37 @@ pub struct DistanceArgs {
|
|||||||
#[arg(long)]
|
#[arg(long)]
|
||||||
pub upgma: bool,
|
pub upgma: bool,
|
||||||
|
|
||||||
|
/// Build the sibling-count/minorant annex on this (multi-genome) index
|
||||||
|
/// — see `docmd/theory/evolutionary_distances.md`, Step 2b. Construction
|
||||||
|
/// only; does not by itself compute or write any statistics.
|
||||||
|
#[arg(long)]
|
||||||
|
pub sibling_annex: bool,
|
||||||
|
|
||||||
|
/// Tally the sibling-count distribution (CSV) of an already-built annex
|
||||||
|
/// (run with `--sibling-annex` first, in this invocation or an earlier
|
||||||
|
/// one). A separate, occasional diagnostic pass — not run every time the
|
||||||
|
/// annex itself is (re)built.
|
||||||
|
#[arg(long)]
|
||||||
|
pub sibling_stats: bool,
|
||||||
|
|
||||||
|
/// Compute the raw p-distance restricted to loci that are single-copy
|
||||||
|
/// in both genomes of each pair (an already-built sibling annex is
|
||||||
|
/// required — run with `--sibling-annex` first, in this invocation or
|
||||||
|
/// an earlier one). A quick way to test the central-position SNP
|
||||||
|
/// estimator against a real index; not the full `SnpTally` design.
|
||||||
|
#[arg(long)]
|
||||||
|
pub raw_snp_distance: bool,
|
||||||
|
|
||||||
|
/// Write a SNP-only pseudo-alignment (FASTA, IUPAC-coded) from an
|
||||||
|
/// already-built sibling annex — one row per genome, one column per
|
||||||
|
/// variable family (monomorphic families skipped), no flanking
|
||||||
|
/// sequence. See `docmd/theory/evolutionary_distances.md`,
|
||||||
|
/// "Multi-genome framing: family as pseudo-alignment column".
|
||||||
|
#[arg(long)]
|
||||||
|
pub snp: bool,
|
||||||
|
|
||||||
/// Output prefix: <prefix>_dist.csv, <prefix>_shared.csv,
|
/// Output prefix: <prefix>_dist.csv, <prefix>_shared.csv,
|
||||||
|
/// <prefix>_siblings.csv, <prefix>_rawsnp.csv, <prefix>_snp.fasta,
|
||||||
/// <prefix>_nj.nwk, <prefix>_upgma.nwk.
|
/// <prefix>_nj.nwk, <prefix>_upgma.nwk.
|
||||||
/// If omitted, the distance matrix is written to stdout.
|
/// If omitted, the distance matrix is written to stdout.
|
||||||
#[arg(short, long)]
|
#[arg(short, long)]
|
||||||
@@ -78,6 +111,51 @@ pub fn run(args: DistanceArgs) {
|
|||||||
|
|
||||||
let labels: Vec<String> = idx.meta().genomes.iter().map(|g| g.label.clone()).collect();
|
let labels: Vec<String> = idx.meta().genomes.iter().map(|g| g.label.clone()).collect();
|
||||||
let n = labels.len();
|
let n = labels.len();
|
||||||
|
|
||||||
|
// ── Sibling-count/minorant annex (independent of the distance metric) ──
|
||||||
|
// Construction (`--sibling-annex`) and stats (`--sibling-stats`) are
|
||||||
|
// deliberately decoupled: the annex is meant to be (re)built routinely,
|
||||||
|
// the distribution only occasionally, on demand.
|
||||||
|
if args.sibling_annex {
|
||||||
|
info!("building sibling-count/minorant annex");
|
||||||
|
idx.build_sibling_annex().unwrap_or_else(|e| {
|
||||||
|
eprintln!("error building sibling annex: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
}
|
||||||
|
if args.sibling_stats {
|
||||||
|
let stats = idx.sibling_annex_stats().unwrap_or_else(|e| {
|
||||||
|
eprintln!("error computing sibling-annex stats: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
write_sibling_stats_csv(&stats, &labels, &args.output);
|
||||||
|
}
|
||||||
|
if args.raw_snp_distance {
|
||||||
|
let result = idx.raw_snp_distance().unwrap_or_else(|e| {
|
||||||
|
eprintln!("error computing raw SNP distance: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
write_raw_snp_distance_csv(&result, &labels, &args.output);
|
||||||
|
}
|
||||||
|
if args.snp {
|
||||||
|
let alignment = idx.snp_pseudo_alignment().unwrap_or_else(|e| {
|
||||||
|
eprintln!("error computing SNP pseudo-alignment: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
write_snp_fasta(&alignment, &labels, &args.output);
|
||||||
|
}
|
||||||
|
|
||||||
|
// `--sibling-annex`/`--sibling-stats`/`--raw-snp-distance`/`--snp` are
|
||||||
|
// their own operation, not a modifier on top of a distance-metric
|
||||||
|
// computation — a metric was never requested by asking for any of them,
|
||||||
|
// so there is nothing for the rest of this function to compute. Not a
|
||||||
|
// historical accident to keep: stop here rather than always also
|
||||||
|
// running a Jaccard (or whichever `--metric` defaults to) pass and
|
||||||
|
// printing an unrequested matrix.
|
||||||
|
if args.sibling_annex || args.sibling_stats || args.raw_snp_distance || args.snp {
|
||||||
|
return;
|
||||||
|
}
|
||||||
|
|
||||||
info!(
|
info!(
|
||||||
"computing {:?} distances for {} genome(s)",
|
"computing {:?} distances for {} genome(s)",
|
||||||
args.metric, n
|
args.metric, n
|
||||||
@@ -189,6 +267,103 @@ pub fn run(args: DistanceArgs) {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ── Family-size distribution → CSV ──────────────────────────────────────────
|
||||||
|
//
|
||||||
|
// Each row is a family (the up-to-4 k-mers sharing flanks, differing only at
|
||||||
|
// the centre), counted once — at its minorant — regardless of how many of
|
||||||
|
// its members are observed. Family size 1..4 (not "sibling count" 0..3):
|
||||||
|
// see `docmd/theory/evolutionary_distances.md`, "Definitions".
|
||||||
|
|
||||||
|
fn write_sibling_stats_csv(stats: &SiblingAnnexStats, labels: &[String], output: &Option<PathBuf>) {
|
||||||
|
// One row per genome (4 columns, family size 1-4: number of families of
|
||||||
|
// that size for which the genome carries at least one member), plus a
|
||||||
|
// `global` row — the actual deduplicated family-size histogram
|
||||||
|
// (`stats.counts`), NOT a sum of the per-genome columns (a family shared
|
||||||
|
// by several genomes would otherwise be counted once per genome it
|
||||||
|
// appears in, inflating the total beyond the real family count).
|
||||||
|
let path = output.as_ref()
|
||||||
|
.map(|p| format!("{}_siblings.csv", p.display()))
|
||||||
|
.unwrap_or_else(|| "siblings.csv".into());
|
||||||
|
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error creating {path}: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
}));
|
||||||
|
writeln!(f, "genome,1,2,3,4").unwrap();
|
||||||
|
for (label, counts) in labels.iter().zip(stats.per_genome.iter()) {
|
||||||
|
writeln!(f, "{label},{},{},{},{}", counts[0], counts[1], counts[2], counts[3]).unwrap();
|
||||||
|
}
|
||||||
|
writeln!(
|
||||||
|
f, "global,{},{},{},{}",
|
||||||
|
stats.counts[0], stats.counts[1], stats.counts[2], stats.counts[3],
|
||||||
|
).unwrap();
|
||||||
|
let total: u64 = stats.counts.iter().sum();
|
||||||
|
info!("family-size distribution → {path} (total {total} famil{})",
|
||||||
|
if total == 1 { "y" } else { "ies" });
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Raw single-copy SNP distance → CSV ──────────────────────────────────────
|
||||||
|
//
|
||||||
|
// p_hat[i,j] = snp[i,j] / (snp[i,j] + shared[i,j]) over loci single-copy in
|
||||||
|
// both i and j — see `RawSnpDistanceOutput` / `KmerIndex::raw_snp_distance`.
|
||||||
|
// A single file: the distance matrix, with an eligible-loci count alongside
|
||||||
|
// each value so a 0/0 pair (no eligible locus at all) is distinguishable
|
||||||
|
// from a genuinely identical pair.
|
||||||
|
|
||||||
|
fn write_raw_snp_distance_csv(result: &RawSnpDistanceOutput, labels: &[String], output: &Option<PathBuf>) {
|
||||||
|
let path = output.as_ref()
|
||||||
|
.map(|p| format!("{}_rawsnp.csv", p.display()))
|
||||||
|
.unwrap_or_else(|| "rawsnp.csv".into());
|
||||||
|
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error creating {path}: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
}));
|
||||||
|
let n = labels.len();
|
||||||
|
write!(f, "genome").unwrap();
|
||||||
|
for g in labels { write!(f, ",{g}").unwrap(); }
|
||||||
|
writeln!(f).unwrap();
|
||||||
|
for (i, g) in labels.iter().enumerate() {
|
||||||
|
write!(f, "{g}").unwrap();
|
||||||
|
for j in 0..n {
|
||||||
|
let snp = result.snp[[i, j]];
|
||||||
|
let shared = result.shared[[i, j]];
|
||||||
|
let eligible = snp + shared;
|
||||||
|
if eligible == 0 {
|
||||||
|
write!(f, ",NA").unwrap();
|
||||||
|
} else {
|
||||||
|
write!(f, ",{:.6}", snp as f64 / eligible as f64).unwrap();
|
||||||
|
}
|
||||||
|
}
|
||||||
|
writeln!(f).unwrap();
|
||||||
|
}
|
||||||
|
info!("raw single-copy SNP distance matrix → {path}");
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── SNP-only pseudo-alignment → FASTA ───────────────────────────────────────
|
||||||
|
//
|
||||||
|
// One record per genome, IUPAC-coded, no flanking sequence — see
|
||||||
|
// `SnpAlignment` / `KmerIndex::snp_pseudo_alignment`. Uses the project's
|
||||||
|
// existing FASTA writer (`obifastwrite::write_record`) rather than
|
||||||
|
// hand-rolling one.
|
||||||
|
|
||||||
|
fn write_snp_fasta(alignment: &SnpAlignment, labels: &[String], output: &Option<PathBuf>) {
|
||||||
|
let path = output.as_ref()
|
||||||
|
.map(|p| format!("{}_snp.fasta", p.display()))
|
||||||
|
.unwrap_or_else(|| "snp.fasta".into());
|
||||||
|
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error creating {path}: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
}));
|
||||||
|
let n_sites = alignment.sequences.first().map(|s| s.len()).unwrap_or(0);
|
||||||
|
for (label, seq) in labels.iter().zip(alignment.sequences.iter()) {
|
||||||
|
write_record(seq, label, &[("n_sites", JsonVal::Num(n_sites as u64))], &mut f).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error writing {path}: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
}
|
||||||
|
info!("SNP pseudo-alignment → {path} ({n_sites} site{})",
|
||||||
|
if n_sites == 1 { "" } else { "s" });
|
||||||
|
}
|
||||||
|
|
||||||
// ── UPGMA Newick from kodama dendrogram ───────────────────────────────────────
|
// ── UPGMA Newick from kodama dendrogram ───────────────────────────────────────
|
||||||
|
|
||||||
fn upgma_to_newick(dendro: &kodama::Dendrogram<f64>, names: &[String]) -> String {
|
fn upgma_to_newick(dendro: &kodama::Dendrogram<f64>, names: &[String]) -> String {
|
||||||
|
|||||||
@@ -2,14 +2,14 @@ use std::path::PathBuf;
|
|||||||
|
|
||||||
use clap::Args;
|
use clap::Args;
|
||||||
use obikindex::{KmerIndex, MergeMode};
|
use obikindex::{KmerIndex, MergeMode};
|
||||||
use obikpartitionner::filter::{MaxTotalCount, MinTotalCount};
|
use obikpartitionner::filter::{MaxTotalCount, MinComplexity, MinTotalCount};
|
||||||
use obisys::Reporter;
|
use obisys::Reporter;
|
||||||
use tracing::info;
|
use tracing::info;
|
||||||
|
|
||||||
use super::predicate::FilterArgs as KmerFilterArgs;
|
use super::predicate::FilterArgs as KmerFilterArgs;
|
||||||
|
|
||||||
#[derive(Args)]
|
#[derive(Args)]
|
||||||
pub struct FilterArgs {
|
pub struct FilterCmdArgs {
|
||||||
/// Source index directory
|
/// Source index directory
|
||||||
pub source: PathBuf,
|
pub source: PathBuf,
|
||||||
|
|
||||||
@@ -28,6 +28,18 @@ pub struct FilterArgs {
|
|||||||
#[arg(long)]
|
#[arg(long)]
|
||||||
pub max_total_count: Option<u32>,
|
pub max_total_count: Option<u32>,
|
||||||
|
|
||||||
|
/// Minimum normalized entropy (complexity) to keep a k-mer — same metric
|
||||||
|
/// as `obikmer index`'s --theta, applied here to k-mers already committed
|
||||||
|
/// to the source index (reconstructed from unitigs.bin). K-mers scoring
|
||||||
|
/// below this are removed.
|
||||||
|
#[arg(long)]
|
||||||
|
pub min_complexity: Option<f64>,
|
||||||
|
|
||||||
|
/// Maximum sub-word size for the complexity computation (see `obikmer
|
||||||
|
/// index`'s --level-max). Only used when --min-complexity is set.
|
||||||
|
#[arg(long, default_value_t = 6)]
|
||||||
|
pub complexity_level_max: usize,
|
||||||
|
|
||||||
/// Output as presence/absence instead of counts
|
/// Output as presence/absence instead of counts
|
||||||
#[arg(long)]
|
#[arg(long)]
|
||||||
pub presence: bool,
|
pub presence: bool,
|
||||||
@@ -37,7 +49,7 @@ pub struct FilterArgs {
|
|||||||
pub force: bool,
|
pub force: bool,
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn run(args: FilterArgs) {
|
pub fn run(args: FilterCmdArgs) {
|
||||||
let src = KmerIndex::open(&args.source).unwrap_or_else(|e| {
|
let src = KmerIndex::open(&args.source).unwrap_or_else(|e| {
|
||||||
eprintln!("error opening source index: {e}");
|
eprintln!("error opening source index: {e}");
|
||||||
std::process::exit(1);
|
std::process::exit(1);
|
||||||
@@ -62,6 +74,9 @@ pub fn run(args: FilterArgs) {
|
|||||||
if let Some(v) = args.max_total_count {
|
if let Some(v) = args.max_total_count {
|
||||||
filters.push(Box::new(MaxTotalCount { total: v }));
|
filters.push(Box::new(MaxTotalCount { total: v }));
|
||||||
}
|
}
|
||||||
|
if let Some(theta) = args.min_complexity {
|
||||||
|
filters.push(Box::new(MinComplexity { level_max: args.complexity_level_max, theta }));
|
||||||
|
}
|
||||||
|
|
||||||
let mut rep = Reporter::new();
|
let mut rep = Reporter::new();
|
||||||
KmerIndex::rebuild(&args.output, &src, &filters, mode, args.force, &mut rep)
|
KmerIndex::rebuild(&args.output, &src, &filters, mode, args.force, &mut rep)
|
||||||
|
|||||||
@@ -151,12 +151,14 @@ pub struct FilterArgs {
|
|||||||
pub outgroup: Vec<String>,
|
pub outgroup: Vec<String>,
|
||||||
|
|
||||||
/// Minimum number of ingroup genomes containing the k-mer
|
/// Minimum number of ingroup genomes containing the k-mer
|
||||||
#[arg(long)]
|
/// (negative: offset from group size, e.g. -1 = all but one)
|
||||||
pub min_count: Option<usize>,
|
#[arg(long, allow_hyphen_values = true)]
|
||||||
|
pub min_count: Option<isize>,
|
||||||
|
|
||||||
/// Maximum number of ingroup genomes containing the k-mer
|
/// Maximum number of ingroup genomes containing the k-mer
|
||||||
#[arg(long)]
|
/// (negative: offset from group size, e.g. -1 = all but one)
|
||||||
pub max_count: Option<usize>,
|
#[arg(long, allow_hyphen_values = true)]
|
||||||
|
pub max_count: Option<isize>,
|
||||||
|
|
||||||
/// Minimum fraction of ingroup genomes containing the k-mer [0.0–1.0]
|
/// Minimum fraction of ingroup genomes containing the k-mer [0.0–1.0]
|
||||||
/// (default 1.0 when --ingroup is set, 0.0 otherwise)
|
/// (default 1.0 when --ingroup is set, 0.0 otherwise)
|
||||||
@@ -168,13 +170,15 @@ pub struct FilterArgs {
|
|||||||
pub max_frac: Option<f64>,
|
pub max_frac: Option<f64>,
|
||||||
|
|
||||||
/// Minimum number of outgroup genomes containing the k-mer
|
/// Minimum number of outgroup genomes containing the k-mer
|
||||||
#[arg(long)]
|
/// (negative: offset from outgroup size, e.g. -1 = all but one)
|
||||||
pub min_outgroup_count: Option<usize>,
|
#[arg(long, allow_hyphen_values = true)]
|
||||||
|
pub min_outgroup_count: Option<isize>,
|
||||||
|
|
||||||
/// Maximum number of outgroup genomes containing the k-mer
|
/// Maximum number of outgroup genomes containing the k-mer
|
||||||
/// (default 0 when --outgroup is set, no constraint otherwise)
|
/// (default 0 when --outgroup is set, no constraint otherwise;
|
||||||
#[arg(long)]
|
/// negative: offset from outgroup size, e.g. -1 = all but one)
|
||||||
pub max_outgroup_count: Option<usize>,
|
#[arg(long, allow_hyphen_values = true)]
|
||||||
|
pub max_outgroup_count: Option<isize>,
|
||||||
|
|
||||||
/// Minimum fraction of outgroup genomes containing the k-mer [0.0–1.0]
|
/// Minimum fraction of outgroup genomes containing the k-mer [0.0–1.0]
|
||||||
#[arg(long)]
|
#[arg(long)]
|
||||||
@@ -239,12 +243,12 @@ pub fn matching_genome_indices(pred_str: &str, genomes: &[GenomeInfo]) -> Result
|
|||||||
|
|
||||||
pub struct GroupFilterParams {
|
pub struct GroupFilterParams {
|
||||||
pub threshold: u32,
|
pub threshold: u32,
|
||||||
pub min_count: Option<usize>,
|
pub min_count: Option<isize>,
|
||||||
pub max_count: Option<usize>,
|
pub max_count: Option<isize>,
|
||||||
pub min_frac: Option<f64>,
|
pub min_frac: Option<f64>,
|
||||||
pub max_frac: Option<f64>,
|
pub max_frac: Option<f64>,
|
||||||
pub min_outgroup_count: Option<usize>,
|
pub min_outgroup_count: Option<isize>,
|
||||||
pub max_outgroup_count: Option<usize>,
|
pub max_outgroup_count: Option<isize>,
|
||||||
pub min_outgroup_frac: Option<f64>,
|
pub min_outgroup_frac: Option<f64>,
|
||||||
pub max_outgroup_frac: Option<f64>,
|
pub max_outgroup_frac: Option<f64>,
|
||||||
}
|
}
|
||||||
@@ -279,12 +283,20 @@ pub fn build_group_filter(
|
|||||||
let default_min_frac = if !ingroup_preds.is_empty() && !ingroup_quorum_explicit { 1.0 } else { 0.0 };
|
let default_min_frac = if !ingroup_preds.is_empty() && !ingroup_quorum_explicit { 1.0 } else { 0.0 };
|
||||||
let default_max_outgroup_count = if !outgroup_preds.is_empty() && !outgroup_quorum_explicit { 0 } else { out_size };
|
let default_max_outgroup_count = if !outgroup_preds.is_empty() && !outgroup_quorum_explicit { 0 } else { out_size };
|
||||||
|
|
||||||
let min_count = p.min_count.unwrap_or(0);
|
// Resolve a signed count: negative means an offset from the group size
|
||||||
let max_count = p.max_count.unwrap_or(in_size);
|
// (e.g. -1 = all but one), floored at 1 so the negative form always keeps
|
||||||
|
// constraining the group — even a singleton group, where n-1 would be 0
|
||||||
|
// and would otherwise drop the constraint entirely.
|
||||||
|
let resolve = |v: isize, size: usize| -> usize {
|
||||||
|
if v < 0 { (size as isize + v).max(1) as usize } else { v as usize }
|
||||||
|
};
|
||||||
|
|
||||||
|
let min_count = p.min_count.map(|v| resolve(v, in_size)).unwrap_or(0);
|
||||||
|
let max_count = p.max_count.map(|v| resolve(v, in_size)).unwrap_or(in_size);
|
||||||
let min_frac = p.min_frac.unwrap_or(default_min_frac);
|
let min_frac = p.min_frac.unwrap_or(default_min_frac);
|
||||||
let max_frac = p.max_frac.unwrap_or(1.0);
|
let max_frac = p.max_frac.unwrap_or(1.0);
|
||||||
let min_outgroup_count = p.min_outgroup_count.unwrap_or(0);
|
let min_outgroup_count = p.min_outgroup_count.map(|v| resolve(v, out_size)).unwrap_or(0);
|
||||||
let max_outgroup_count = p.max_outgroup_count.unwrap_or(default_max_outgroup_count);
|
let max_outgroup_count = p.max_outgroup_count.map(|v| resolve(v, out_size)).unwrap_or(default_max_outgroup_count);
|
||||||
let min_outgroup_frac = p.min_outgroup_frac.unwrap_or(0.0);
|
let min_outgroup_frac = p.min_outgroup_frac.unwrap_or(0.0);
|
||||||
let max_outgroup_frac = p.max_outgroup_frac.unwrap_or(1.0);
|
let max_outgroup_frac = p.max_outgroup_frac.unwrap_or(1.0);
|
||||||
|
|
||||||
|
|||||||
@@ -70,9 +70,7 @@ pub struct QueryArgs {
|
|||||||
#[arg(
|
#[arg(
|
||||||
short = 'T',
|
short = 'T',
|
||||||
long,
|
long,
|
||||||
default_value_t = std::thread::available_parallelism()
|
default_value_t = obisys::effective_parallelism()
|
||||||
.map(|n| n.get())
|
|
||||||
.unwrap_or(1)
|
|
||||||
)]
|
)]
|
||||||
pub threads: usize,
|
pub threads: usize,
|
||||||
|
|
||||||
@@ -325,6 +323,42 @@ fn process_chunk(
|
|||||||
let batch = QueryBatch::from_records(records, k, 6, 0.7, n_partitions);
|
let batch = QueryBatch::from_records(records, k, 6, 0.7, n_partitions);
|
||||||
let n_seqs = batch.ids.len();
|
let n_seqs = batch.ids.len();
|
||||||
|
|
||||||
|
// Estimate QueryBatch::by_partition's actual memory footprint: the
|
||||||
|
// k-mer-level dedup map (roadmap point 5) — one HashMap<CanonicalKmer,
|
||||||
|
// Vec<KmerDesc>> per partition, sized by *unique* k-mers, not shrunk by
|
||||||
|
// dedup. On real workloads with a low intra-chunk duplication rate this
|
||||||
|
// can dwarf every other per-chunk structure, including the sparse
|
||||||
|
// Findere ones logged further down — unlike those, chunk_bytes's formula
|
||||||
|
// (run()) does not account for this at all today. Measured by allocated
|
||||||
|
// capacity, not logical length, to reflect real memory pressure
|
||||||
|
// (HashMap/Vec growth slack) — `by_partition` is alive for the entire
|
||||||
|
// process_chunk call (never drained, only iterated by reference), so
|
||||||
|
// this is its footprint for the whole chunk lifetime, not a transient.
|
||||||
|
let hashmap_slot_bytes = (std::mem::size_of::<CanonicalKmer>()
|
||||||
|
+ std::mem::size_of::<Vec<KmerDesc>>()
|
||||||
|
+ 1) as u64; // +1 ≈ hashbrown control byte per slot
|
||||||
|
let by_partition_map_bytes: u64 = batch
|
||||||
|
.by_partition
|
||||||
|
.iter()
|
||||||
|
.map(|m| m.capacity() as u64 * hashmap_slot_bytes)
|
||||||
|
.sum();
|
||||||
|
let by_partition_desc_bytes: u64 = batch
|
||||||
|
.by_partition
|
||||||
|
.iter()
|
||||||
|
.flat_map(|m| m.values())
|
||||||
|
.map(|v| v.capacity() as u64 * std::mem::size_of::<KmerDesc>() as u64)
|
||||||
|
.sum();
|
||||||
|
let by_partition_bytes = by_partition_map_bytes + by_partition_desc_bytes;
|
||||||
|
|
||||||
|
debug!(
|
||||||
|
n_unique_kmers_total = batch.by_partition.iter().map(|m| m.len() as u64).sum::<u64>(),
|
||||||
|
by_partition_map_bytes,
|
||||||
|
by_partition_desc_bytes,
|
||||||
|
by_partition_bytes,
|
||||||
|
chunk_bytes,
|
||||||
|
"by_partition memory retained"
|
||||||
|
);
|
||||||
|
|
||||||
// Sparse bookkeeping for the whole chunk:
|
// Sparse bookkeeping for the whole chunk:
|
||||||
// - smer_index: O(total_smers) — is this s-mer in the index at all.
|
// - smer_index: O(total_smers) — is this s-mer in the index at all.
|
||||||
// - by_genome[g]: raw (seq_idx, pos_smer, value) hits for genome g, only
|
// - by_genome[g]: raw (seq_idx, pos_smer, value) hits for genome g, only
|
||||||
|
|||||||
@@ -21,7 +21,7 @@ enum Commands {
|
|||||||
/// Merge multiple built indexes into one
|
/// Merge multiple built indexes into one
|
||||||
Merge(cmd::merge::MergeArgs),
|
Merge(cmd::merge::MergeArgs),
|
||||||
/// Apply row-level selection (σ) to an index: retain only k-mers matching the predicates
|
/// Apply row-level selection (σ) to an index: retain only k-mers matching the predicates
|
||||||
Filter(cmd::filter::FilterArgs),
|
Filter(cmd::filter::FilterCmdArgs),
|
||||||
/// Project and/or aggregate genome columns into a new or in-place index
|
/// Project and/or aggregate genome columns into a new or in-place index
|
||||||
Select(cmd::select::SelectArgs),
|
Select(cmd::select::SelectArgs),
|
||||||
/// Query an index with sequences and annotate matches
|
/// Query an index with sequences and annotate matches
|
||||||
|
|||||||
@@ -6,7 +6,6 @@ edition = "2024"
|
|||||||
[dev-dependencies]
|
[dev-dependencies]
|
||||||
tempfile = "3"
|
tempfile = "3"
|
||||||
obikseq = { path = "../obikseq", features = ["test-utils"] }
|
obikseq = { path = "../obikseq", features = ["test-utils"] }
|
||||||
obiskbuilder = { path = "../obiskbuilder" }
|
|
||||||
obiread = { path = "../obiread" }
|
obiread = { path = "../obiread" }
|
||||||
obikrope = { path = "../obikrope" }
|
obikrope = { path = "../obikrope" }
|
||||||
|
|
||||||
@@ -14,6 +13,8 @@ obikrope = { path = "../obikrope" }
|
|||||||
niffler = "3.0.0"
|
niffler = "3.0.0"
|
||||||
remove_dir_all = "0.8"
|
remove_dir_all = "0.8"
|
||||||
obikseq = { path = "../obikseq" }
|
obikseq = { path = "../obikseq" }
|
||||||
|
obikentropy = { path = "../obikentropy" }
|
||||||
|
obiskbuilder = { path = "../obiskbuilder" }
|
||||||
obiskio = { path = "../obiskio" }
|
obiskio = { path = "../obiskio" }
|
||||||
obidebruinj = { path = "../obidebruinj" }
|
obidebruinj = { path = "../obidebruinj" }
|
||||||
obilayeredmap = { path = "../obilayeredmap" }
|
obilayeredmap = { path = "../obilayeredmap" }
|
||||||
|
|||||||
@@ -62,7 +62,7 @@ impl KmerPartition {
|
|||||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||||
if let Some(slot) = mphf.find(kmer) {
|
if let Some(slot) = mphf.find(kmer) {
|
||||||
let row = mat.row(slot);
|
let row = mat.row(slot);
|
||||||
if passes_all(filters, &row, n_genomes) {
|
if passes_all(filters, kmer, &row, n_genomes) {
|
||||||
cont = cb(kmer, row);
|
cont = cb(kmer, row);
|
||||||
if !cont { break; }
|
if !cont { break; }
|
||||||
}
|
}
|
||||||
@@ -75,7 +75,7 @@ impl KmerPartition {
|
|||||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||||
if let Some(slot) = mphf.find(kmer) {
|
if let Some(slot) = mphf.find(kmer) {
|
||||||
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
|
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
|
||||||
if passes_all(filters, &row, n_genomes) {
|
if passes_all(filters, kmer, &row, n_genomes) {
|
||||||
cont = cb(kmer, row);
|
cont = cb(kmer, row);
|
||||||
if !cont { break; }
|
if !cont { break; }
|
||||||
}
|
}
|
||||||
@@ -83,16 +83,17 @@ impl KmerPartition {
|
|||||||
}
|
}
|
||||||
cont
|
cont
|
||||||
} else {
|
} else {
|
||||||
// No data matrix: implicit presence — all values are 1.
|
// No data matrix: implicit presence — all values are 1. `row`
|
||||||
// The filter result is identical for every kmer, so evaluate once.
|
// is identical for every kmer, but a filter can still depend
|
||||||
|
// on the kmer's own sequence (e.g. MinComplexity), so this
|
||||||
|
// cannot be evaluated once for the whole layer — filters must
|
||||||
|
// still be tested per kmer.
|
||||||
let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
|
let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
|
||||||
let mut cont = true;
|
let mut cont = true;
|
||||||
if passes_all(filters, &all_present, n_genomes) {
|
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
|
||||||
if mphf.find(kmer).is_some() {
|
cont = cb(kmer, all_present.clone());
|
||||||
cont = cb(kmer, all_present.clone());
|
if !cont { break; }
|
||||||
if !cont { break; }
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
cont
|
cont
|
||||||
@@ -140,7 +141,7 @@ impl KmerPartition {
|
|||||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||||
if let Some(slot) = mphf.find(kmer) {
|
if let Some(slot) = mphf.find(kmer) {
|
||||||
let row = mat.row(slot);
|
let row = mat.row(slot);
|
||||||
if passes_all(filters, &row, n_genomes) {
|
if passes_all(filters, kmer, &row, n_genomes) {
|
||||||
cont = cb(part, layer, kmer, row);
|
cont = cb(part, layer, kmer, row);
|
||||||
if !cont { break; }
|
if !cont { break; }
|
||||||
}
|
}
|
||||||
@@ -153,7 +154,7 @@ impl KmerPartition {
|
|||||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||||
if let Some(slot) = mphf.find(kmer) {
|
if let Some(slot) = mphf.find(kmer) {
|
||||||
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
|
let row: Box<[u32]> = mat.row(slot).iter().map(|&b| b as u32).collect();
|
||||||
if passes_all(filters, &row, n_genomes) {
|
if passes_all(filters, kmer, &row, n_genomes) {
|
||||||
cont = cb(part, layer, kmer, row);
|
cont = cb(part, layer, kmer, row);
|
||||||
if !cont { break; }
|
if !cont { break; }
|
||||||
}
|
}
|
||||||
@@ -161,14 +162,15 @@ impl KmerPartition {
|
|||||||
}
|
}
|
||||||
cont
|
cont
|
||||||
} else {
|
} else {
|
||||||
|
// Same as iter_partition_kmers: row is constant but a filter
|
||||||
|
// may still depend on the kmer's own sequence, so this must
|
||||||
|
// be tested per kmer, not once for the whole layer.
|
||||||
let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
|
let all_present: Box<[u32]> = vec![1u32; n_genomes].into();
|
||||||
let mut cont = true;
|
let mut cont = true;
|
||||||
if passes_all(filters, &all_present, n_genomes) {
|
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
||||||
for (kmer, _, _) in reader.iter_indexed_canonical_kmers() {
|
if mphf.find(kmer).is_some() && passes_all(filters, kmer, &all_present, n_genomes) {
|
||||||
if mphf.find(kmer).is_some() {
|
cont = cb(part, layer, kmer, all_present.clone());
|
||||||
cont = cb(part, layer, kmer, all_present.clone());
|
if !cont { break; }
|
||||||
if !cont { break; }
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
cont
|
cont
|
||||||
|
|||||||
@@ -1,17 +1,24 @@
|
|||||||
use obicompactvec::FilterMask;
|
use obicompactvec::FilterMask;
|
||||||
|
use obikseq::CanonicalKmer;
|
||||||
|
|
||||||
/// Trait for kmer row filters.
|
/// Trait for kmer filters.
|
||||||
///
|
///
|
||||||
|
/// `kmer` is the k-mer's own canonical sequence, reconstructed from the
|
||||||
|
/// source index's `unitigs.bin` (always present — see `rebuild_layer.rs`);
|
||||||
/// `row` contains raw per-genome counts (or 0/1 for presence/absence data).
|
/// `row` contains raw per-genome counts (or 0/1 for presence/absence data).
|
||||||
/// `n_genomes` equals `row.len()`.
|
/// `n_genomes` equals `row.len()`. Most filters only need `row` — `kmer` is
|
||||||
|
/// there for filters that reason about the k-mer's sequence itself (e.g.
|
||||||
|
/// [`MinComplexity`]).
|
||||||
pub trait KmerFilter: Send + Sync {
|
pub trait KmerFilter: Send + Sync {
|
||||||
fn passes(&self, row: &[u32], n_genomes: usize) -> bool;
|
fn passes(&self, kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool;
|
||||||
|
|
||||||
/// Express this filter as a [`FilterMask`] column-operation expression.
|
/// Express this filter as a [`FilterMask`] column-operation expression.
|
||||||
///
|
///
|
||||||
/// Returns `Some(expr)` if the filter can be evaluated solely from matrix
|
/// Returns `Some(expr)` if the filter can be evaluated solely from matrix
|
||||||
/// column aggregates (no per-kmer row scan needed). Returns `None` if the
|
/// column aggregates (no per-kmer row scan needed). Returns `None` if the
|
||||||
/// filter requires row-level inspection.
|
/// filter requires row-level inspection — always the case for a filter
|
||||||
|
/// that needs the k-mer's sequence, since a `FilterMask` only expresses
|
||||||
|
/// per-genome column aggregates, never per-slot sequence data.
|
||||||
///
|
///
|
||||||
/// `threshold` semantics in the returned mask use `>= threshold`, matching
|
/// `threshold` semantics in the returned mask use `>= threshold`, matching
|
||||||
/// [`obicompactvec::MatrixGroupOps`]. Implementations must add 1 to any
|
/// [`obicompactvec::MatrixGroupOps`]. Implementations must add 1 to any
|
||||||
@@ -23,8 +30,13 @@ pub trait KmerFilter: Send + Sync {
|
|||||||
|
|
||||||
/// True when `row` passes every filter in `filters`.
|
/// True when `row` passes every filter in `filters`.
|
||||||
/// Returns `true` if `filters` is empty.
|
/// Returns `true` if `filters` is empty.
|
||||||
pub fn passes_all(filters: &[Box<dyn KmerFilter>], row: &[u32], n_genomes: usize) -> bool {
|
pub fn passes_all(
|
||||||
filters.iter().all(|f| f.passes(row, n_genomes))
|
filters: &[Box<dyn KmerFilter>],
|
||||||
|
kmer: CanonicalKmer,
|
||||||
|
row: &[u32],
|
||||||
|
n_genomes: usize,
|
||||||
|
) -> bool {
|
||||||
|
filters.iter().all(|f| f.passes(kmer, row, n_genomes))
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Quorum filters ─────────────────────────────────────────────────────────────
|
// ── Quorum filters ─────────────────────────────────────────────────────────────
|
||||||
@@ -40,7 +52,7 @@ pub struct MinGenomeFraction {
|
|||||||
}
|
}
|
||||||
|
|
||||||
impl KmerFilter for MinGenomeFraction {
|
impl KmerFilter for MinGenomeFraction {
|
||||||
fn passes(&self, row: &[u32], n_genomes: usize) -> bool {
|
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool {
|
||||||
let p = present_count(row, self.threshold);
|
let p = present_count(row, self.threshold);
|
||||||
p as f64 / n_genomes as f64 >= self.frac
|
p as f64 / n_genomes as f64 >= self.frac
|
||||||
}
|
}
|
||||||
@@ -63,7 +75,7 @@ pub struct MaxGenomeFraction {
|
|||||||
}
|
}
|
||||||
|
|
||||||
impl KmerFilter for MaxGenomeFraction {
|
impl KmerFilter for MaxGenomeFraction {
|
||||||
fn passes(&self, row: &[u32], n_genomes: usize) -> bool {
|
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], n_genomes: usize) -> bool {
|
||||||
let p = present_count(row, self.threshold);
|
let p = present_count(row, self.threshold);
|
||||||
p as f64 / n_genomes as f64 <= self.frac
|
p as f64 / n_genomes as f64 <= self.frac
|
||||||
}
|
}
|
||||||
@@ -86,7 +98,7 @@ pub struct MinGenomeCount {
|
|||||||
}
|
}
|
||||||
|
|
||||||
impl KmerFilter for MinGenomeCount {
|
impl KmerFilter for MinGenomeCount {
|
||||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
|
||||||
present_count(row, self.threshold) >= self.count
|
present_count(row, self.threshold) >= self.count
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -107,7 +119,7 @@ pub struct MaxGenomeCount {
|
|||||||
}
|
}
|
||||||
|
|
||||||
impl KmerFilter for MaxGenomeCount {
|
impl KmerFilter for MaxGenomeCount {
|
||||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
|
||||||
present_count(row, self.threshold) <= self.count
|
present_count(row, self.threshold) <= self.count
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -129,7 +141,7 @@ pub struct MinTotalCount {
|
|||||||
}
|
}
|
||||||
|
|
||||||
impl KmerFilter for MinTotalCount {
|
impl KmerFilter for MinTotalCount {
|
||||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
|
||||||
row.iter().sum::<u32>() >= self.total
|
row.iter().sum::<u32>() >= self.total
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -147,7 +159,7 @@ pub struct MaxTotalCount {
|
|||||||
}
|
}
|
||||||
|
|
||||||
impl KmerFilter for MaxTotalCount {
|
impl KmerFilter for MaxTotalCount {
|
||||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
|
||||||
row.iter().sum::<u32>() <= self.total
|
row.iter().sum::<u32>() <= self.total
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -212,7 +224,7 @@ impl GroupQuorumFilter {
|
|||||||
}
|
}
|
||||||
|
|
||||||
impl KmerFilter for GroupQuorumFilter {
|
impl KmerFilter for GroupQuorumFilter {
|
||||||
fn passes(&self, row: &[u32], _n_genomes: usize) -> bool {
|
fn passes(&self, _kmer: CanonicalKmer, row: &[u32], _n_genomes: usize) -> bool {
|
||||||
if !self.ingroup_idx.is_empty() {
|
if !self.ingroup_idx.is_empty() {
|
||||||
let n = self.ingroup_idx.iter()
|
let n = self.ingroup_idx.iter()
|
||||||
.filter(|&&i| row.get(i).copied().unwrap_or(0) > self.threshold)
|
.filter(|&&i| row.get(i).copied().unwrap_or(0) > self.threshold)
|
||||||
@@ -260,3 +272,27 @@ impl KmerFilter for GroupQuorumFilter {
|
|||||||
Some(FilterMask::And(parts))
|
Some(FilterMask::And(parts))
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ── Complexity filter (post-hoc, sequence-based) ──────────────────────────────
|
||||||
|
|
||||||
|
/// Reject k-mers with normalized entropy below `theta` — the same complexity
|
||||||
|
/// metric `obikmer index`'s `--theta`/`--level-max` apply *during* superkmer
|
||||||
|
/// construction (see [`obikentropy::KmerEntropy`]), applied here after the
|
||||||
|
/// fact, to k-mers already committed to a built index.
|
||||||
|
///
|
||||||
|
/// Unlike every other filter in this module, this one needs the k-mer's own
|
||||||
|
/// sequence, not its per-genome row — `column_mask_expr` is never overridden
|
||||||
|
/// (stays `None`), so this filter always forces the row-level scan path in
|
||||||
|
/// `rebuild_layer.rs` (which reconstructs the sequence from `unitigs.bin`
|
||||||
|
/// regardless, so no extra I/O beyond what filtering already requires).
|
||||||
|
pub struct MinComplexity {
|
||||||
|
pub level_max: usize,
|
||||||
|
pub theta: f64,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl KmerFilter for MinComplexity {
|
||||||
|
fn passes(&self, kmer: CanonicalKmer, _row: &[u32], _n_genomes: usize) -> bool {
|
||||||
|
use obikentropy::KmerEntropy;
|
||||||
|
kmer.entropy(self.level_max) >= self.theta
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|||||||
@@ -126,7 +126,7 @@ fn iter_src_kmers_masked(
|
|||||||
Some(m) => m.get(slot),
|
Some(m) => m.get(slot),
|
||||||
None => {
|
None => {
|
||||||
let row = src_data.fill_row_by_slot(slot, n_genomes);
|
let row = src_data.fill_row_by_slot(slot, n_genomes);
|
||||||
filters.iter().all(|f| f.passes(&row, n_genomes))
|
filters.iter().all(|f| f.passes(kmer, &row, n_genomes))
|
||||||
}
|
}
|
||||||
};
|
};
|
||||||
if passes { cb(kmer); }
|
if passes { cb(kmer); }
|
||||||
@@ -165,7 +165,7 @@ fn iter_src_layers(
|
|||||||
cb(kmer, row.into_boxed_slice());
|
cb(kmer, row.into_boxed_slice());
|
||||||
} else {
|
} else {
|
||||||
let row = src_data.fill_row_by_slot(slot, n_genomes);
|
let row = src_data.fill_row_by_slot(slot, n_genomes);
|
||||||
if filters.iter().all(|f| f.passes(&row, n_genomes)) {
|
if filters.iter().all(|f| f.passes(kmer, &row, n_genomes)) {
|
||||||
cb(kmer, row.into_boxed_slice());
|
cb(kmer, row.into_boxed_slice());
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -341,6 +341,27 @@ impl<L: KmerLength> CanonicalKmerOf<L> {
|
|||||||
]
|
]
|
||||||
}
|
}
|
||||||
|
|
||||||
|
/// Return the four central canonical neighbours (each already canonical),
|
||||||
|
/// substituting the base at the middle position `m = (L::len()-1)/2`
|
||||||
|
/// (well-defined for odd `L::len()`). Each of the 4 substitutions is
|
||||||
|
/// canonicalised independently — this correctly handles the case where a
|
||||||
|
/// substitution flips the canonical orientation, unlike inferring the
|
||||||
|
/// variant from a fixed-orientation flank key. One of the 4 equals
|
||||||
|
/// `self`'s own canonical form (the identity substitution); callers that
|
||||||
|
/// only want the 3 genuine variants should skip it.
|
||||||
|
pub fn central_canonical_neighbors(&self) -> [CanonicalKmerOf<L>; 4] {
|
||||||
|
let k = L::len();
|
||||||
|
let m = (k - 1) / 2;
|
||||||
|
let shift = KMER_BITS - 2 - 2 * m;
|
||||||
|
let cleared = self.0 & !((0b11 as RawKmer) << shift);
|
||||||
|
[
|
||||||
|
KmerOf::<L>(cleared | ((0 as RawKmer) << shift), PhantomData).canonical(),
|
||||||
|
KmerOf::<L>(cleared | ((1 as RawKmer) << shift), PhantomData).canonical(),
|
||||||
|
KmerOf::<L>(cleared | ((2 as RawKmer) << shift), PhantomData).canonical(),
|
||||||
|
KmerOf::<L>(cleared | ((3 as RawKmer) << shift), PhantomData).canonical(),
|
||||||
|
]
|
||||||
|
}
|
||||||
|
|
||||||
/// Return the inner value as a raw [`KmerOf<L>`].
|
/// Return the inner value as a raw [`KmerOf<L>`].
|
||||||
#[inline]
|
#[inline]
|
||||||
pub fn into_kmer(self) -> KmerOf<L> {
|
pub fn into_kmer(self) -> KmerOf<L> {
|
||||||
|
|||||||
@@ -210,4 +210,46 @@ mod tests {
|
|||||||
check!(31);
|
check!(31);
|
||||||
check!(32);
|
check!(32);
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ── central_canonical_neighbors ─────────────────────────────────────────
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn central_canonical_neighbors_hand_checked_k3() {
|
||||||
|
// k=3, centre = index 1. For "ACG", every one of the 4 central
|
||||||
|
// substitutions ("AAG","ACG","AGG","ATG") happens to stay in forward
|
||||||
|
// orientation when canonicalised (verified by hand: each is already
|
||||||
|
// lexicographically <= its own reverse complement), so this case
|
||||||
|
// exercises the substitution logic without the RC-flip edge case.
|
||||||
|
let ck = KmerOf::<ConstLen<3>>::from_ascii(b"ACG").unwrap().canonical();
|
||||||
|
let neighbours = ck.central_canonical_neighbors();
|
||||||
|
let ascii: Vec<Vec<u8>> = neighbours.iter().map(|n| n.to_ascii()).collect();
|
||||||
|
assert_eq!(ascii, vec![b"AAG".to_vec(), b"ACG".to_vec(), b"AGG".to_vec(), b"ATG".to_vec()]);
|
||||||
|
// The identity substitution (centre unchanged) must reproduce `ck`.
|
||||||
|
assert!(neighbours.contains(&ck));
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn central_canonical_neighbors_identity_present_for_various_k() {
|
||||||
|
macro_rules! check {
|
||||||
|
($n:expr) => {{
|
||||||
|
let ck = KmerOf::<ConstLen<$n>>::from_ascii(&make_seq::<$n>())
|
||||||
|
.unwrap()
|
||||||
|
.canonical();
|
||||||
|
let neighbours = ck.central_canonical_neighbors();
|
||||||
|
assert!(
|
||||||
|
neighbours.contains(&ck),
|
||||||
|
"identity substitution missing from central_canonical_neighbors for k={}",
|
||||||
|
$n
|
||||||
|
);
|
||||||
|
// Every returned neighbour must itself already be canonical.
|
||||||
|
for n in &neighbours {
|
||||||
|
assert_eq!(n.into_kmer().canonical(), *n, "neighbour not canonical for k={}", $n);
|
||||||
|
}
|
||||||
|
}};
|
||||||
|
}
|
||||||
|
check!(1);
|
||||||
|
check!(3);
|
||||||
|
check!(5);
|
||||||
|
check!(31);
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -7,7 +7,13 @@ edition = "2024"
|
|||||||
obikseq = { path = "../obikseq" }
|
obikseq = { path = "../obikseq" }
|
||||||
obikrope = { path = "../obikrope" }
|
obikrope = { path = "../obikrope" }
|
||||||
obiread = { path = "../obiread" }
|
obiread = { path = "../obiread" }
|
||||||
|
obikentropy = { path = "../obikentropy" }
|
||||||
lazy_static = "1.5.0"
|
lazy_static = "1.5.0"
|
||||||
|
|
||||||
[dev-dependencies]
|
[dev-dependencies]
|
||||||
obikseq = { path = "../obikseq", features = ["test-utils"] }
|
obikseq = { path = "../obikseq", features = ["test-utils"] }
|
||||||
|
criterion2 = { version = "3", features = ["cargo_bench_support"] }
|
||||||
|
|
||||||
|
[[bench]]
|
||||||
|
name = "superkmer_stream"
|
||||||
|
harness = false
|
||||||
|
|||||||
@@ -0,0 +1,58 @@
|
|||||||
|
//! Throughput of the streaming superkmer pipeline (`RollingStat`'s hot path:
|
||||||
|
//! minimizer selection + entropy tracking fused in a single pass).
|
||||||
|
//!
|
||||||
|
//! Reference point for the `obikentropy` extraction: the entropy bookkeeping
|
||||||
|
//! that used to live inline in `RollingStat` was pulled out into a composed
|
||||||
|
//! `EntropyTracker`. This benchmark is run before and after that change to
|
||||||
|
//! confirm no regression.
|
||||||
|
|
||||||
|
use criterion::{Criterion, Throughput, criterion_group, criterion_main};
|
||||||
|
use obikrope::Rope;
|
||||||
|
use obiskbuilder::SuperKmerIter;
|
||||||
|
|
||||||
|
const K: usize = 21;
|
||||||
|
const M: usize = 9;
|
||||||
|
const LEVEL_MAX: usize = 6;
|
||||||
|
const THETA: f64 = 0.7;
|
||||||
|
const SEQ_LEN: usize = 200_000;
|
||||||
|
|
||||||
|
/// Deterministic pseudo-random ACGT sequence — high enough complexity that
|
||||||
|
/// the entropy filter rarely rejects, so the bench stays on the steady-state
|
||||||
|
/// path rather than repeatedly resetting.
|
||||||
|
fn make_sequence(len: usize) -> Vec<u8> {
|
||||||
|
let mut state: u64 = 0x9E3779B97F4A7C15;
|
||||||
|
(0..len)
|
||||||
|
.map(|_| {
|
||||||
|
state ^= state << 13;
|
||||||
|
state ^= state >> 7;
|
||||||
|
state ^= state << 17;
|
||||||
|
b"ACGT"[(state % 4) as usize]
|
||||||
|
})
|
||||||
|
.collect()
|
||||||
|
}
|
||||||
|
|
||||||
|
fn make_rope(seq: &[u8]) -> Rope {
|
||||||
|
let mut rope = Rope::new(None);
|
||||||
|
rope.push(seq.to_vec());
|
||||||
|
rope
|
||||||
|
}
|
||||||
|
|
||||||
|
fn bench_build_superkmers(c: &mut Criterion) {
|
||||||
|
obikseq::set_k(K);
|
||||||
|
obikseq::set_m(M);
|
||||||
|
|
||||||
|
let seq = make_sequence(SEQ_LEN);
|
||||||
|
let rope = make_rope(&seq);
|
||||||
|
|
||||||
|
let mut group = c.benchmark_group("build_superkmers");
|
||||||
|
group.throughput(Throughput::Bytes(SEQ_LEN as u64));
|
||||||
|
group.bench_function("stream", |b| {
|
||||||
|
b.iter(|| {
|
||||||
|
SuperKmerIter::new(std::hint::black_box(&rope), K, LEVEL_MAX, THETA).count()
|
||||||
|
});
|
||||||
|
});
|
||||||
|
group.finish();
|
||||||
|
}
|
||||||
|
|
||||||
|
criterion_group!(benches, bench_build_superkmers);
|
||||||
|
criterion_main!(benches);
|
||||||
@@ -1,108 +0,0 @@
|
|||||||
pub(crate) const NORMK1: [u64; 4] = build_normalized_kmer::<4>();
|
|
||||||
pub(crate) const NORMK2: [u64; 16] = build_normalized_kmer::<16>();
|
|
||||||
pub(crate) const NORMK3: [u64; 64] = build_normalized_kmer::<64>();
|
|
||||||
pub(crate) const NORMK4: [u64; 256] = build_normalized_kmer::<256>();
|
|
||||||
pub(crate) const NORMK5: [u64; 1024] = build_normalized_kmer::<1024>();
|
|
||||||
pub(crate) const NORMK6: [u64; 4096] = build_normalized_kmer::<4096>();
|
|
||||||
|
|
||||||
include!(concat!(env!("OUT_DIR"), "/ln_class_tables.rs"));
|
|
||||||
|
|
||||||
const fn normalize_circular(kmer: u64, ws: usize) -> u64 {
|
|
||||||
let mask = (1u64 << (ws * 2)) - 1;
|
|
||||||
let mut canonical = kmer & mask;
|
|
||||||
let mut current = canonical;
|
|
||||||
let mut i = 0;
|
|
||||||
while i < (ws - 1) {
|
|
||||||
let top = (current >> ((ws - 1) * 2)) & 3;
|
|
||||||
current = ((current << 2) | top) & mask;
|
|
||||||
if current < canonical {
|
|
||||||
canonical = current;
|
|
||||||
}
|
|
||||||
i += 1;
|
|
||||||
}
|
|
||||||
canonical
|
|
||||||
}
|
|
||||||
|
|
||||||
const fn build_normalized_kmer<const N: usize>() -> [u64; N] {
|
|
||||||
let mut result = [0u64; N];
|
|
||||||
let k = k_from_n::<N>();
|
|
||||||
let shift = 64 - k * 2;
|
|
||||||
let mut i = 0;
|
|
||||||
while i < N {
|
|
||||||
let la = (i as u64) << shift;
|
|
||||||
let ra = i as u64;
|
|
||||||
let rc_ra = revcomp_raw(la, k) >> shift;
|
|
||||||
let circ = normalize_circular(ra, k);
|
|
||||||
let circ_rc = normalize_circular(rc_ra, k);
|
|
||||||
result[i] = if circ < circ_rc { circ } else { circ_rc };
|
|
||||||
i += 1;
|
|
||||||
}
|
|
||||||
result
|
|
||||||
}
|
|
||||||
|
|
||||||
const fn revcomp_raw(x: u64, k: usize) -> u64 {
|
|
||||||
let x = !x;
|
|
||||||
let x = x.swap_bytes();
|
|
||||||
let x = ((x >> 4) & 0x0F0F0F0F0F0F0F0F) | ((x & 0x0F0F0F0F0F0F0F0F) << 4);
|
|
||||||
let x = ((x >> 2) & 0x3333333333333333) | ((x & 0x3333333333333333) << 2);
|
|
||||||
x << (64 - 2 * k)
|
|
||||||
}
|
|
||||||
|
|
||||||
const fn k_from_n<const N: usize>() -> usize {
|
|
||||||
match N {
|
|
||||||
4 => 1,
|
|
||||||
16 => 2,
|
|
||||||
64 => 3,
|
|
||||||
256 => 4,
|
|
||||||
1024 => 5,
|
|
||||||
4096 => 6,
|
|
||||||
_ => panic!("N must be a power of 4"),
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
pub(crate) const WS_MAX: usize = 6;
|
|
||||||
|
|
||||||
#[inline(always)]
|
|
||||||
pub(crate) const fn n_log_n(n: usize) -> f64 {
|
|
||||||
N_LOG_N[n]
|
|
||||||
}
|
|
||||||
|
|
||||||
#[inline(always)]
|
|
||||||
pub(crate) const fn emax(k: usize, ws: usize) -> f64 {
|
|
||||||
EMAX[k][ws]
|
|
||||||
}
|
|
||||||
|
|
||||||
#[inline(always)]
|
|
||||||
pub(crate) const fn log_nwords(k: usize, ws: usize) -> f64 {
|
|
||||||
LOG_NWORDS[k][ws]
|
|
||||||
}
|
|
||||||
|
|
||||||
#[inline(always)]
|
|
||||||
pub(crate) const fn entropy_norm_kmer<const LEFT: bool, const K: usize>(kmer: u64) -> u64 {
|
|
||||||
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
|
|
||||||
const NORM: [&[u64]; 7] = [&[], &NORMK1, &NORMK2, &NORMK3, &NORMK4, &NORMK5, &NORMK6];
|
|
||||||
|
|
||||||
let shift = SHIFT[K];
|
|
||||||
let ra = if LEFT { kmer >> shift } else { kmer };
|
|
||||||
let canonical_ra = NORM[K][ra as usize];
|
|
||||||
if LEFT {
|
|
||||||
canonical_ra << shift
|
|
||||||
} else {
|
|
||||||
canonical_ra
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
#[inline(always)]
|
|
||||||
pub(crate) const fn ln_class_size<const LEFT: bool, const K: usize>(kmer: u64) -> f64 {
|
|
||||||
const SHIFT: [usize; 7] = [0, 62, 60, 58, 56, 54, 52];
|
|
||||||
let ra = if LEFT { kmer >> SHIFT[K] } else { kmer };
|
|
||||||
match K {
|
|
||||||
1 => LN_CLASS1[ra as usize],
|
|
||||||
2 => LN_CLASS2[ra as usize],
|
|
||||||
3 => LN_CLASS3[ra as usize],
|
|
||||||
4 => LN_CLASS4[ra as usize],
|
|
||||||
5 => LN_CLASS5[ra as usize],
|
|
||||||
6 => LN_CLASS6[ra as usize],
|
|
||||||
_ => panic!("k must be 1..=6"),
|
|
||||||
}
|
|
||||||
}
|
|
||||||
@@ -149,157 +149,5 @@ impl Iterator for SuperKmerIter<'_> {
|
|||||||
// ── tests ─────────────────────────────────────────────────────────────────────
|
// ── tests ─────────────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
#[cfg(test)]
|
#[cfg(test)]
|
||||||
mod tests {
|
#[path = "tests/iter.rs"]
|
||||||
use super::*;
|
mod tests;
|
||||||
use obikrope::Rope;
|
|
||||||
|
|
||||||
fn setup() {
|
|
||||||
obikseq::params::set_k(K);
|
|
||||||
obikseq::params::set_m(5);
|
|
||||||
}
|
|
||||||
|
|
||||||
fn make_rope(data: &[u8]) -> Rope {
|
|
||||||
let mut r = Rope::new(None);
|
|
||||||
r.push(data.to_vec());
|
|
||||||
r
|
|
||||||
}
|
|
||||||
|
|
||||||
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
|
|
||||||
let rope = make_rope(data);
|
|
||||||
SuperKmerIter::new(&rope, k, 1, 0.0)
|
|
||||||
.map(|rsk| rsk.superkmer().to_ascii())
|
|
||||||
.collect()
|
|
||||||
}
|
|
||||||
|
|
||||||
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
|
|
||||||
const K: usize = 11;
|
|
||||||
|
|
||||||
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
|
|
||||||
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
|
|
||||||
(0..seq.len().saturating_sub(K - 1))
|
|
||||||
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
|
|
||||||
.collect()
|
|
||||||
}
|
|
||||||
|
|
||||||
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
|
|
||||||
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
|
|
||||||
SuperKmerIter::new(rope, K, 1, 0.0)
|
|
||||||
.flat_map(|rsk| {
|
|
||||||
rsk.superkmer()
|
|
||||||
.iter_canonical_kmers()
|
|
||||||
.map(|km| km.to_ascii())
|
|
||||||
.collect::<Vec<_>>()
|
|
||||||
})
|
|
||||||
.collect()
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn coverage_single_segment() {
|
|
||||||
setup();
|
|
||||||
let seq = b"ACGTACGTACGTACGTACGT";
|
|
||||||
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
|
|
||||||
let direct = direct_canonical_kmers(seq);
|
|
||||||
let from_iter = iter_canonical_kmers(&rope);
|
|
||||||
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
|
||||||
assert!(
|
|
||||||
missing.is_empty(),
|
|
||||||
"k-mers perdus dans segment unique : {missing:?}"
|
|
||||||
);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn coverage_two_segments() {
|
|
||||||
setup();
|
|
||||||
let seg1 = b"ACGTACGTACGTACGTACGT";
|
|
||||||
let seg2 = b"TGCATGCATGCATGCATGCA";
|
|
||||||
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
|
|
||||||
let mut direct = direct_canonical_kmers(seg1);
|
|
||||||
direct.extend(direct_canonical_kmers(seg2));
|
|
||||||
let from_iter = iter_canonical_kmers(&rope);
|
|
||||||
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
|
||||||
assert!(
|
|
||||||
missing.is_empty(),
|
|
||||||
"k-mers perdus dans deux segments : {missing:?}"
|
|
||||||
);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn coverage_minimizer_boundary() {
|
|
||||||
setup();
|
|
||||||
// sequence assez longue pour forcer plusieurs changements de minimiseur
|
|
||||||
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
|
|
||||||
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
|
|
||||||
let direct = direct_canonical_kmers(&seq);
|
|
||||||
let from_iter = iter_canonical_kmers(&rope);
|
|
||||||
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
|
||||||
assert!(
|
|
||||||
missing.is_empty(),
|
|
||||||
"k-mers perdus à la frontière de minimiseur : {missing:?}"
|
|
||||||
);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn single_segment_one_superkmer() {
|
|
||||||
setup();
|
|
||||||
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
|
|
||||||
assert!(!out.is_empty());
|
|
||||||
let total: Vec<u8> = out.into_iter().flatten().collect();
|
|
||||||
assert!(total.len() >= K);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn segment_shorter_than_k_emits_nothing() {
|
|
||||||
setup();
|
|
||||||
let out = run_nofilter(b"ACGTACGT\x00", K);
|
|
||||||
assert_eq!(out, Vec::<Vec<u8>>::new());
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn empty_input_emits_nothing() {
|
|
||||||
setup();
|
|
||||||
let out = run_nofilter(b"", K);
|
|
||||||
assert_eq!(out, Vec::<Vec<u8>>::new());
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn two_segments_both_emitted() {
|
|
||||||
setup();
|
|
||||||
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
|
|
||||||
assert!(!out.is_empty());
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn low_complexity_kmer_is_rejected() {
|
|
||||||
setup();
|
|
||||||
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
|
|
||||||
assert!(!out_pass.is_empty());
|
|
||||||
|
|
||||||
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
|
|
||||||
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
|
|
||||||
.map(|rsk| rsk.superkmer().to_ascii())
|
|
||||||
.collect();
|
|
||||||
assert!(out_reject.is_empty());
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn multi_slice_rope() {
|
|
||||||
setup();
|
|
||||||
let data = b"ACGTACGTACGTACGTACGT\x00";
|
|
||||||
let mid = data.len() / 2;
|
|
||||||
let mut rope = Rope::new(None);
|
|
||||||
rope.push(data[..mid].to_vec());
|
|
||||||
rope.push(data[mid..].to_vec());
|
|
||||||
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
|
|
||||||
.map(|rsk| rsk.superkmer().to_ascii())
|
|
||||||
.collect();
|
|
||||||
assert!(!out.is_empty());
|
|
||||||
}
|
|
||||||
|
|
||||||
#[test]
|
|
||||||
fn yields_minimizer_value() {
|
|
||||||
setup();
|
|
||||||
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
|
|
||||||
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
|
|
||||||
assert!(!results.is_empty());
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|||||||
@@ -10,8 +10,8 @@ pub mod stream_iter;
|
|||||||
mod scratch;
|
mod scratch;
|
||||||
|
|
||||||
pub(crate) mod encoding;
|
pub(crate) mod encoding;
|
||||||
pub(crate) mod entropy_table;
|
#[allow(missing_docs)]
|
||||||
pub(crate) mod rolling_stat;
|
pub mod rolling_stat;
|
||||||
|
|
||||||
pub use iter::SuperKmerIter;
|
pub use iter::SuperKmerIter;
|
||||||
pub use scratch::SuperKmerScratch;
|
pub use scratch::SuperKmerScratch;
|
||||||
|
|||||||
@@ -1,8 +1,8 @@
|
|||||||
|
use obikentropy::EntropyTracker;
|
||||||
use obikseq::kmer::{Minimizer, hash_kmer};
|
use obikseq::kmer::{Minimizer, hash_kmer};
|
||||||
use obikseq::params;
|
use obikseq::params;
|
||||||
|
|
||||||
use crate::encoding::encode_nuc;
|
use crate::encoding::encode_nuc;
|
||||||
use crate::entropy_table::{WS_MAX, emax, entropy_norm_kmer, ln_class_size, log_nwords, n_log_n};
|
|
||||||
|
|
||||||
// ── Stack-allocated ring buffer ───────────────────────────────────────────────
|
// ── Stack-allocated ring buffer ───────────────────────────────────────────────
|
||||||
|
|
||||||
@@ -83,33 +83,19 @@ pub struct RollingStat {
|
|||||||
entropy_max_k: usize,
|
entropy_max_k: usize,
|
||||||
k: usize,
|
k: usize,
|
||||||
m: usize,
|
m: usize,
|
||||||
steady: bool,
|
|
||||||
rolling_k: u64,
|
rolling_k: u64,
|
||||||
rolling_rck: u64,
|
rolling_rck: u64,
|
||||||
k_mask: u64,
|
k_mask: u64,
|
||||||
m_mask: u64,
|
m_mask: u64,
|
||||||
received: usize,
|
received: usize,
|
||||||
|
|
||||||
// Sliding-window queues — stack-allocated, capacity ≤ k ≤ 31.
|
// Minimizer selection state.
|
||||||
k1q: Ring<u64, 32>,
|
|
||||||
k2q: Ring<u64, 32>,
|
|
||||||
k3q: Ring<u64, 32>,
|
|
||||||
k4q: Ring<u64, 32>,
|
|
||||||
k5q: Ring<u64, 32>,
|
|
||||||
k6q: Ring<u64, 32>,
|
|
||||||
minimier: Ring<MmerItem, 32>,
|
minimier: Ring<MmerItem, 32>,
|
||||||
|
|
||||||
// Frequency count arrays.
|
// Entropy tracking, composed as a plain inline field so both concerns
|
||||||
// Max count per cell ≤ k ≤ 31 → u8 is sufficient.
|
// update in the same streaming pass without being conflated in one
|
||||||
k1c: [u8; 4],
|
// struct — see `obikentropy::EntropyTracker`.
|
||||||
k2c: [u8; 16],
|
entropy: EntropyTracker,
|
||||||
k3c: [u8; 64],
|
|
||||||
k4c: [u8; 256],
|
|
||||||
k5c: [u8; 1024],
|
|
||||||
k6c: [u8; 4096],
|
|
||||||
|
|
||||||
sum_f_log_f: [f64; WS_MAX + 1],
|
|
||||||
sum_f_log_s: [f64; WS_MAX + 1],
|
|
||||||
}
|
}
|
||||||
|
|
||||||
impl RollingStat {
|
impl RollingStat {
|
||||||
@@ -120,27 +106,13 @@ impl RollingStat {
|
|||||||
entropy_max_k,
|
entropy_max_k,
|
||||||
k,
|
k,
|
||||||
m,
|
m,
|
||||||
steady: false,
|
|
||||||
rolling_k: 0,
|
rolling_k: 0,
|
||||||
rolling_rck: 0,
|
rolling_rck: 0,
|
||||||
k_mask: (!0u64) >> (64 - k * 2),
|
k_mask: (!0u64) >> (64 - k * 2),
|
||||||
m_mask: (!0u64) >> (64 - m * 2),
|
m_mask: (!0u64) >> (64 - m * 2),
|
||||||
received: 0,
|
received: 0,
|
||||||
k1q: Ring::new(),
|
|
||||||
k2q: Ring::new(),
|
|
||||||
k3q: Ring::new(),
|
|
||||||
k4q: Ring::new(),
|
|
||||||
k5q: Ring::new(),
|
|
||||||
k6q: Ring::new(),
|
|
||||||
minimier: Ring::new(),
|
minimier: Ring::new(),
|
||||||
k1c: [0; 4],
|
entropy: EntropyTracker::new(k),
|
||||||
k2c: [0; 16],
|
|
||||||
k3c: [0; 64],
|
|
||||||
k4c: [0; 256],
|
|
||||||
k5c: [0; 1024],
|
|
||||||
k6c: [0; 4096],
|
|
||||||
sum_f_log_f: [0.0; WS_MAX + 1],
|
|
||||||
sum_f_log_s: [0.0; WS_MAX + 1],
|
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -148,54 +120,9 @@ impl RollingStat {
|
|||||||
self.rolling_k = 0;
|
self.rolling_k = 0;
|
||||||
self.rolling_rck = 0;
|
self.rolling_rck = 0;
|
||||||
self.received = 0;
|
self.received = 0;
|
||||||
self.steady = false;
|
|
||||||
|
|
||||||
// for i in self.k1q.iter() { self.k1c[i as usize] = 0; }
|
|
||||||
// for i in self.k2q.iter() { self.k2c[i as usize] = 0; }
|
|
||||||
// for i in self.k3q.iter() { self.k3c[i as usize] = 0; }
|
|
||||||
// for i in self.k4q.iter() { self.k4c[i as usize] = 0; }
|
|
||||||
// for i in self.k5q.iter() { self.k5c[i as usize] = 0; }
|
|
||||||
// for i in self.k6q.iter() { self.k6c[i as usize] = 0; }
|
|
||||||
|
|
||||||
self.k1c.fill(0);
|
|
||||||
self.k2c.fill(0);
|
|
||||||
self.k3c.fill(0);
|
|
||||||
self.k4c.fill(0);
|
|
||||||
self.k5c.fill(0);
|
|
||||||
self.k6c.fill(0);
|
|
||||||
|
|
||||||
self.k1q.clear();
|
|
||||||
self.k2q.clear();
|
|
||||||
self.k3q.clear();
|
|
||||||
self.k4q.clear();
|
|
||||||
self.k5q.clear();
|
|
||||||
self.k6q.clear();
|
|
||||||
self.minimier.clear();
|
self.minimier.clear();
|
||||||
|
self.entropy.reset();
|
||||||
self.sum_f_log_f = [0.0; WS_MAX + 1];
|
|
||||||
self.sum_f_log_s = [0.0; WS_MAX + 1];
|
|
||||||
}
|
|
||||||
|
|
||||||
#[inline]
|
|
||||||
fn update_sums_decrement<const K: usize>(
|
|
||||||
sum_f_log_f: &mut [f64; WS_MAX + 1],
|
|
||||||
sum_f_log_s: &mut [f64; WS_MAX + 1],
|
|
||||||
canonical: u64,
|
|
||||||
f: usize,
|
|
||||||
) {
|
|
||||||
sum_f_log_f[K] += n_log_n(f - 1) - n_log_n(f);
|
|
||||||
sum_f_log_s[K] -= ln_class_size::<false, K>(canonical);
|
|
||||||
}
|
|
||||||
|
|
||||||
#[inline]
|
|
||||||
fn update_sums_increment<const K: usize>(
|
|
||||||
sum_f_log_f: &mut [f64; WS_MAX + 1],
|
|
||||||
sum_f_log_s: &mut [f64; WS_MAX + 1],
|
|
||||||
canonical: u64,
|
|
||||||
g: usize,
|
|
||||||
) {
|
|
||||||
sum_f_log_f[K] += n_log_n(g + 1) - n_log_n(g);
|
|
||||||
sum_f_log_s[K] += ln_class_size::<false, K>(canonical);
|
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn push(&mut self, nuc: u8) {
|
pub fn push(&mut self, nuc: u8) {
|
||||||
@@ -209,13 +136,6 @@ impl RollingStat {
|
|||||||
self.rolling_rck =
|
self.rolling_rck =
|
||||||
((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask;
|
((self.rolling_rck >> 2) | ((cnuc as u64) << ((k - 1) * 2))) & self.k_mask;
|
||||||
|
|
||||||
let canonical_k1 = entropy_norm_kmer::<false, 1>(self.rolling_k & 3);
|
|
||||||
let canonical_k2 = entropy_norm_kmer::<false, 2>(self.rolling_k & 15);
|
|
||||||
let canonical_k3 = entropy_norm_kmer::<false, 3>(self.rolling_k & 63);
|
|
||||||
let canonical_k4 = entropy_norm_kmer::<false, 4>(self.rolling_k & 255);
|
|
||||||
let canonical_k5 = entropy_norm_kmer::<false, 5>(self.rolling_k & 1023);
|
|
||||||
let canonical_k6 = entropy_norm_kmer::<false, 6>(self.rolling_k & 4095);
|
|
||||||
|
|
||||||
self.received += 1;
|
self.received += 1;
|
||||||
|
|
||||||
if self.received >= m {
|
if self.received >= m {
|
||||||
@@ -248,153 +168,7 @@ impl RollingStat {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
if self.received > k {
|
self.entropy.push(self.received, self.rolling_k);
|
||||||
let old1 = self.k1q.pop_front();
|
|
||||||
let f1 = self.k1c[old1 as usize] as usize;
|
|
||||||
Self::update_sums_decrement::<1>(
|
|
||||||
&mut self.sum_f_log_f,
|
|
||||||
&mut self.sum_f_log_s,
|
|
||||||
old1,
|
|
||||||
f1,
|
|
||||||
);
|
|
||||||
self.k1c[old1 as usize] -= 1;
|
|
||||||
|
|
||||||
let old2 = self.k2q.pop_front();
|
|
||||||
let f2 = self.k2c[old2 as usize] as usize;
|
|
||||||
Self::update_sums_decrement::<2>(
|
|
||||||
&mut self.sum_f_log_f,
|
|
||||||
&mut self.sum_f_log_s,
|
|
||||||
old2,
|
|
||||||
f2,
|
|
||||||
);
|
|
||||||
self.k2c[old2 as usize] -= 1;
|
|
||||||
|
|
||||||
let old3 = self.k3q.pop_front();
|
|
||||||
let f3 = self.k3c[old3 as usize] as usize;
|
|
||||||
Self::update_sums_decrement::<3>(
|
|
||||||
&mut self.sum_f_log_f,
|
|
||||||
&mut self.sum_f_log_s,
|
|
||||||
old3,
|
|
||||||
f3,
|
|
||||||
);
|
|
||||||
self.k3c[old3 as usize] -= 1;
|
|
||||||
|
|
||||||
let old4 = self.k4q.pop_front();
|
|
||||||
let f4 = self.k4c[old4 as usize] as usize;
|
|
||||||
Self::update_sums_decrement::<4>(
|
|
||||||
&mut self.sum_f_log_f,
|
|
||||||
&mut self.sum_f_log_s,
|
|
||||||
old4,
|
|
||||||
f4,
|
|
||||||
);
|
|
||||||
self.k4c[old4 as usize] -= 1;
|
|
||||||
|
|
||||||
let old5 = self.k5q.pop_front();
|
|
||||||
let f5 = self.k5c[old5 as usize] as usize;
|
|
||||||
Self::update_sums_decrement::<5>(
|
|
||||||
&mut self.sum_f_log_f,
|
|
||||||
&mut self.sum_f_log_s,
|
|
||||||
old5,
|
|
||||||
f5,
|
|
||||||
);
|
|
||||||
self.k5c[old5 as usize] -= 1;
|
|
||||||
|
|
||||||
let old6 = self.k6q.pop_front();
|
|
||||||
let f6 = self.k6c[old6 as usize] as usize;
|
|
||||||
Self::update_sums_decrement::<6>(
|
|
||||||
&mut self.sum_f_log_f,
|
|
||||||
&mut self.sum_f_log_s,
|
|
||||||
old6,
|
|
||||||
f6,
|
|
||||||
);
|
|
||||||
self.k6c[old6 as usize] -= 1;
|
|
||||||
}
|
|
||||||
|
|
||||||
if self.steady {
|
|
||||||
let g1 = self.k1c[canonical_k1 as usize] as usize;
|
|
||||||
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
|
|
||||||
self.k1c[canonical_k1 as usize] += 1;
|
|
||||||
self.k1q.push_back(canonical_k1);
|
|
||||||
|
|
||||||
let g2 = self.k2c[canonical_k2 as usize] as usize;
|
|
||||||
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
|
|
||||||
self.k2c[canonical_k2 as usize] += 1;
|
|
||||||
self.k2q.push_back(canonical_k2);
|
|
||||||
|
|
||||||
let g3 = self.k3c[canonical_k3 as usize] as usize;
|
|
||||||
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
|
|
||||||
self.k3c[canonical_k3 as usize] += 1;
|
|
||||||
self.k3q.push_back(canonical_k3);
|
|
||||||
|
|
||||||
let g4 = self.k4c[canonical_k4 as usize] as usize;
|
|
||||||
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
|
|
||||||
self.k4c[canonical_k4 as usize] += 1;
|
|
||||||
self.k4q.push_back(canonical_k4);
|
|
||||||
|
|
||||||
let g5 = self.k5c[canonical_k5 as usize] as usize;
|
|
||||||
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
|
|
||||||
self.k5c[canonical_k5 as usize] += 1;
|
|
||||||
self.k5q.push_back(canonical_k5);
|
|
||||||
|
|
||||||
let g6 = self.k6c[canonical_k6 as usize] as usize;
|
|
||||||
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
|
|
||||||
self.k6c[canonical_k6 as usize] += 1;
|
|
||||||
self.k6q.push_back(canonical_k6);
|
|
||||||
} else {
|
|
||||||
self.push_warmup_increments(
|
|
||||||
canonical_k1, canonical_k2, canonical_k3,
|
|
||||||
canonical_k4, canonical_k5, canonical_k6,
|
|
||||||
);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
#[cold]
|
|
||||||
#[inline(never)]
|
|
||||||
fn push_warmup_increments(
|
|
||||||
&mut self,
|
|
||||||
canonical_k1: u64, canonical_k2: u64, canonical_k3: u64,
|
|
||||||
canonical_k4: u64, canonical_k5: u64, canonical_k6: u64,
|
|
||||||
) {
|
|
||||||
let g1 = self.k1c[canonical_k1 as usize] as usize;
|
|
||||||
Self::update_sums_increment::<1>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k1, g1);
|
|
||||||
self.k1c[canonical_k1 as usize] += 1;
|
|
||||||
self.k1q.push_back(canonical_k1);
|
|
||||||
|
|
||||||
if self.received >= 2 {
|
|
||||||
let g2 = self.k2c[canonical_k2 as usize] as usize;
|
|
||||||
Self::update_sums_increment::<2>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k2, g2);
|
|
||||||
self.k2c[canonical_k2 as usize] += 1;
|
|
||||||
self.k2q.push_back(canonical_k2);
|
|
||||||
|
|
||||||
if self.received >= 3 {
|
|
||||||
let g3 = self.k3c[canonical_k3 as usize] as usize;
|
|
||||||
Self::update_sums_increment::<3>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k3, g3);
|
|
||||||
self.k3c[canonical_k3 as usize] += 1;
|
|
||||||
self.k3q.push_back(canonical_k3);
|
|
||||||
|
|
||||||
if self.received >= 4 {
|
|
||||||
let g4 = self.k4c[canonical_k4 as usize] as usize;
|
|
||||||
Self::update_sums_increment::<4>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k4, g4);
|
|
||||||
self.k4c[canonical_k4 as usize] += 1;
|
|
||||||
self.k4q.push_back(canonical_k4);
|
|
||||||
|
|
||||||
if self.received >= 5 {
|
|
||||||
let g5 = self.k5c[canonical_k5 as usize] as usize;
|
|
||||||
Self::update_sums_increment::<5>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k5, g5);
|
|
||||||
self.k5c[canonical_k5 as usize] += 1;
|
|
||||||
self.k5q.push_back(canonical_k5);
|
|
||||||
|
|
||||||
if self.received >= 6 {
|
|
||||||
let g6 = self.k6c[canonical_k6 as usize] as usize;
|
|
||||||
Self::update_sums_increment::<6>(&mut self.sum_f_log_f, &mut self.sum_f_log_s, canonical_k6, g6);
|
|
||||||
self.k6c[canonical_k6 as usize] += 1;
|
|
||||||
self.k6q.push_back(canonical_k6);
|
|
||||||
self.steady = true;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn ready(&self) -> bool {
|
pub fn ready(&self) -> bool {
|
||||||
@@ -422,29 +196,10 @@ impl RollingStat {
|
|||||||
.map(|raw| Minimizer::from_raw_unchecked(raw << (64 - self.m * 2)))
|
.map(|raw| Minimizer::from_raw_unchecked(raw << (64 - self.m * 2)))
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn entropy(&self, order: usize) -> Option<f64> {
|
|
||||||
if !self.ready() {
|
|
||||||
return None;
|
|
||||||
}
|
|
||||||
let k = self.k;
|
|
||||||
let em = emax(k, order);
|
|
||||||
if em <= 0.0 {
|
|
||||||
return Some(1.0);
|
|
||||||
}
|
|
||||||
let nwords = k - order + 1;
|
|
||||||
let log_nw = log_nwords(k, order);
|
|
||||||
let nw_f = nwords as f64;
|
|
||||||
let h_corr = log_nw + (self.sum_f_log_s[order] - self.sum_f_log_f[order]) / nw_f;
|
|
||||||
Some((h_corr / em).max(0.0))
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn normalized_entropy(&self) -> Option<f64> {
|
pub fn normalized_entropy(&self) -> Option<f64> {
|
||||||
if !self.ready() {
|
if !self.ready() {
|
||||||
return None;
|
return None;
|
||||||
}
|
}
|
||||||
let min_e = (1..=self.entropy_max_k)
|
Some(self.entropy.normalized_entropy(self.entropy_max_k))
|
||||||
.filter_map(|ws| self.entropy(ws))
|
|
||||||
.fold(f64::MAX, f64::min);
|
|
||||||
Some(if min_e == f64::MAX { 1.0 } else { min_e })
|
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -0,0 +1,152 @@
|
|||||||
|
use super::*;
|
||||||
|
use obikrope::Rope;
|
||||||
|
|
||||||
|
fn setup() {
|
||||||
|
obikseq::params::set_k(K);
|
||||||
|
obikseq::params::set_m(5);
|
||||||
|
}
|
||||||
|
|
||||||
|
fn make_rope(data: &[u8]) -> Rope {
|
||||||
|
let mut r = Rope::new(None);
|
||||||
|
r.push(data.to_vec());
|
||||||
|
r
|
||||||
|
}
|
||||||
|
|
||||||
|
fn run_nofilter(data: &[u8], k: usize) -> Vec<Vec<u8>> {
|
||||||
|
let rope = make_rope(data);
|
||||||
|
SuperKmerIter::new(&rope, k, 1, 0.0)
|
||||||
|
.map(|rsk| rsk.superkmer().to_ascii())
|
||||||
|
.collect()
|
||||||
|
}
|
||||||
|
|
||||||
|
// k=11, m=5 — valeurs minimales du projet (k ∈ [11,31])
|
||||||
|
const K: usize = 11;
|
||||||
|
|
||||||
|
/// Collect the set of canonical k-mers from a raw ASCII sequence (no NUL).
|
||||||
|
fn direct_canonical_kmers(seq: &[u8]) -> std::collections::HashSet<Vec<u8>> {
|
||||||
|
(0..seq.len().saturating_sub(K - 1))
|
||||||
|
.map(|i| obikseq::SuperKmer::from_ascii(&seq[i..i + K]).to_ascii())
|
||||||
|
.collect()
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Collect the set of canonical k-mers emitted by SuperKmerIter over a rope.
|
||||||
|
fn iter_canonical_kmers(rope: &Rope) -> std::collections::HashSet<Vec<u8>> {
|
||||||
|
SuperKmerIter::new(rope, K, 1, 0.0)
|
||||||
|
.flat_map(|rsk| {
|
||||||
|
rsk.superkmer()
|
||||||
|
.iter_canonical_kmers()
|
||||||
|
.map(|km| km.to_ascii())
|
||||||
|
.collect::<Vec<_>>()
|
||||||
|
})
|
||||||
|
.collect()
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn coverage_single_segment() {
|
||||||
|
setup();
|
||||||
|
let seq = b"ACGTACGTACGTACGTACGT";
|
||||||
|
let rope = make_rope(&[seq.as_ref(), b"\x00"].concat());
|
||||||
|
let direct = direct_canonical_kmers(seq);
|
||||||
|
let from_iter = iter_canonical_kmers(&rope);
|
||||||
|
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
||||||
|
assert!(
|
||||||
|
missing.is_empty(),
|
||||||
|
"k-mers perdus dans segment unique : {missing:?}"
|
||||||
|
);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn coverage_two_segments() {
|
||||||
|
setup();
|
||||||
|
let seg1 = b"ACGTACGTACGTACGTACGT";
|
||||||
|
let seg2 = b"TGCATGCATGCATGCATGCA";
|
||||||
|
let rope = make_rope(&[seg1.as_ref(), b"\x00", seg2.as_ref(), b"\x00"].concat());
|
||||||
|
let mut direct = direct_canonical_kmers(seg1);
|
||||||
|
direct.extend(direct_canonical_kmers(seg2));
|
||||||
|
let from_iter = iter_canonical_kmers(&rope);
|
||||||
|
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
||||||
|
assert!(
|
||||||
|
missing.is_empty(),
|
||||||
|
"k-mers perdus dans deux segments : {missing:?}"
|
||||||
|
);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn coverage_minimizer_boundary() {
|
||||||
|
setup();
|
||||||
|
// sequence assez longue pour forcer plusieurs changements de minimiseur
|
||||||
|
let seq: Vec<u8> = (0..80).map(|i| b"ACGT"[i % 4]).collect();
|
||||||
|
let rope = make_rope(&[seq.as_slice(), b"\x00"].concat());
|
||||||
|
let direct = direct_canonical_kmers(&seq);
|
||||||
|
let from_iter = iter_canonical_kmers(&rope);
|
||||||
|
let missing: Vec<_> = direct.difference(&from_iter).collect();
|
||||||
|
assert!(
|
||||||
|
missing.is_empty(),
|
||||||
|
"k-mers perdus à la frontière de minimiseur : {missing:?}"
|
||||||
|
);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn single_segment_one_superkmer() {
|
||||||
|
setup();
|
||||||
|
let out = run_nofilter(b"ACGTACGTACGTACGTACGT\x00", K);
|
||||||
|
assert!(!out.is_empty());
|
||||||
|
let total: Vec<u8> = out.into_iter().flatten().collect();
|
||||||
|
assert!(total.len() >= K);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn segment_shorter_than_k_emits_nothing() {
|
||||||
|
setup();
|
||||||
|
let out = run_nofilter(b"ACGTACGT\x00", K);
|
||||||
|
assert_eq!(out, Vec::<Vec<u8>>::new());
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn empty_input_emits_nothing() {
|
||||||
|
setup();
|
||||||
|
let out = run_nofilter(b"", K);
|
||||||
|
assert_eq!(out, Vec::<Vec<u8>>::new());
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn two_segments_both_emitted() {
|
||||||
|
setup();
|
||||||
|
let out = run_nofilter(b"ACGTACGTACGTACGT\x00TGCATGCATGCATGCA\x00", K);
|
||||||
|
assert!(!out.is_empty());
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn low_complexity_kmer_is_rejected() {
|
||||||
|
setup();
|
||||||
|
let out_pass = run_nofilter(b"AAAAAAAAAAAACGTACGTACGT\x00", K);
|
||||||
|
assert!(!out_pass.is_empty());
|
||||||
|
|
||||||
|
let rope = make_rope(b"AAAAAAAAAAAAAAAAAAAA\x00");
|
||||||
|
let out_reject: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 6, 0.9)
|
||||||
|
.map(|rsk| rsk.superkmer().to_ascii())
|
||||||
|
.collect();
|
||||||
|
assert!(out_reject.is_empty());
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn multi_slice_rope() {
|
||||||
|
setup();
|
||||||
|
let data = b"ACGTACGTACGTACGTACGT\x00";
|
||||||
|
let mid = data.len() / 2;
|
||||||
|
let mut rope = Rope::new(None);
|
||||||
|
rope.push(data[..mid].to_vec());
|
||||||
|
rope.push(data[mid..].to_vec());
|
||||||
|
let out: Vec<Vec<u8>> = SuperKmerIter::new(&rope, K, 1, 0.0)
|
||||||
|
.map(|rsk| rsk.superkmer().to_ascii())
|
||||||
|
.collect();
|
||||||
|
assert!(!out.is_empty());
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn yields_minimizer_value() {
|
||||||
|
setup();
|
||||||
|
let rope = make_rope(b"ACGTACGTACGTACGTACGT\x00");
|
||||||
|
let results: Vec<RoutableSuperKmer> = SuperKmerIter::new(&rope, K, 1, 0.0).collect();
|
||||||
|
assert!(!results.is_empty());
|
||||||
|
}
|
||||||
+89
-3
@@ -202,6 +202,94 @@ fn cgroup_v1_available() -> Option<u64> {
|
|||||||
Some(limit.saturating_sub(used))
|
Some(limit.saturating_sub(used))
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ── CPU parallelism query ────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Returns the number of cores this process can actually use concurrently.
|
||||||
|
///
|
||||||
|
/// `std::thread::available_parallelism()` reads CPU affinity
|
||||||
|
/// (`sched_getaffinity`), not the container's CPU quota — a Docker/cgroup
|
||||||
|
/// container commonly reports the *host's* full core count this way while
|
||||||
|
/// actually being throttled (via `cpu.max`/`cpu.cfs_quota_us`) to a fraction
|
||||||
|
/// of a core. Sizing a thread/worker pool off the unthrottled count causes
|
||||||
|
/// severe oversubscription: dozens of threads contending for a sliver of
|
||||||
|
/// real CPU time, which can look indistinguishable from a hang for minutes
|
||||||
|
/// or hours (observed in CI). On Linux, this reads the cgroup CPU quota
|
||||||
|
/// first and returns `min(cgroup_quota, host_parallelism)` when a finite
|
||||||
|
/// quota is found; falls back to `available_parallelism()` otherwise (same
|
||||||
|
/// convention as [`available_memory_bytes`]).
|
||||||
|
pub fn effective_parallelism() -> usize {
|
||||||
|
let host = std::thread::available_parallelism().map(|n| n.get()).unwrap_or(1);
|
||||||
|
#[cfg(target_os = "linux")]
|
||||||
|
{
|
||||||
|
if let Some(quota) = cgroup_v2_cpu_quota() {
|
||||||
|
let effective = quota.clamp(1, host);
|
||||||
|
tracing::debug!(host, quota, effective, source = "cgroup v2", "effective_parallelism");
|
||||||
|
return effective;
|
||||||
|
}
|
||||||
|
if let Some(quota) = cgroup_v1_cpu_quota() {
|
||||||
|
let effective = quota.clamp(1, host);
|
||||||
|
tracing::debug!(host, quota, effective, source = "cgroup v1", "effective_parallelism");
|
||||||
|
return effective;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
tracing::debug!(host, effective = host, source = "available_parallelism (no cgroup quota found)", "effective_parallelism");
|
||||||
|
host
|
||||||
|
}
|
||||||
|
|
||||||
|
/// cgroup v2 (unified hierarchy): reads `cpu.max` ("<quota> <period>", or
|
||||||
|
/// "max <period>" when unlimited) for the current process's cgroup, rounded
|
||||||
|
/// up to whole cores. Returns `None` if unlimited or on any parse error.
|
||||||
|
#[cfg(target_os = "linux")]
|
||||||
|
fn cgroup_v2_cpu_quota() -> Option<usize> {
|
||||||
|
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
|
||||||
|
let rel = cgroup
|
||||||
|
.lines()
|
||||||
|
.find(|l| l.starts_with("0::"))?
|
||||||
|
.strip_prefix("0::")?
|
||||||
|
.trim();
|
||||||
|
let base = format!("/sys/fs/cgroup{rel}");
|
||||||
|
let raw = std::fs::read_to_string(format!("{base}/cpu.max")).ok()?;
|
||||||
|
let mut parts = raw.split_whitespace();
|
||||||
|
let quota_str = parts.next()?;
|
||||||
|
let period: f64 = parts.next()?.parse().ok()?;
|
||||||
|
if quota_str == "max" {
|
||||||
|
return None; // unlimited
|
||||||
|
}
|
||||||
|
let quota: f64 = quota_str.parse().ok()?;
|
||||||
|
Some((quota / period).ceil().max(1.0) as usize)
|
||||||
|
}
|
||||||
|
|
||||||
|
/// cgroup v1 (cpu subsystem): reads `cpu.cfs_quota_us`/`cpu.cfs_period_us`,
|
||||||
|
/// rounded up to whole cores. Returns `None` if unlimited (quota <= 0) or on
|
||||||
|
/// any parse error.
|
||||||
|
#[cfg(target_os = "linux")]
|
||||||
|
fn cgroup_v1_cpu_quota() -> Option<usize> {
|
||||||
|
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
|
||||||
|
let path = cgroup
|
||||||
|
.lines()
|
||||||
|
.find(|l| l.contains(":cpu:") || l.contains(":cpu,cpuacct:"))?
|
||||||
|
.split(':')
|
||||||
|
.nth(2)?;
|
||||||
|
let base = format!("/sys/fs/cgroup/cpu{path}");
|
||||||
|
let quota: i64 = std::fs::read_to_string(format!("{base}/cpu.cfs_quota_us"))
|
||||||
|
.ok()?
|
||||||
|
.trim()
|
||||||
|
.parse()
|
||||||
|
.ok()?;
|
||||||
|
if quota <= 0 {
|
||||||
|
return None; // unlimited
|
||||||
|
}
|
||||||
|
let period: i64 = std::fs::read_to_string(format!("{base}/cpu.cfs_period_us"))
|
||||||
|
.ok()?
|
||||||
|
.trim()
|
||||||
|
.parse()
|
||||||
|
.ok()?;
|
||||||
|
if period <= 0 {
|
||||||
|
return None;
|
||||||
|
}
|
||||||
|
Some(((quota as f64) / (period as f64)).ceil().max(1.0) as usize)
|
||||||
|
}
|
||||||
|
|
||||||
// ── raw helpers ───────────────────────────────────────────────────────────────
|
// ── raw helpers ───────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
fn get_rusage() -> rusage {
|
fn get_rusage() -> rusage {
|
||||||
@@ -654,9 +742,7 @@ impl fmt::Display for Reporter {
|
|||||||
return Ok(());
|
return Ok(());
|
||||||
}
|
}
|
||||||
|
|
||||||
let n_cores = std::thread::available_parallelism()
|
let n_cores = effective_parallelism();
|
||||||
.map(|n| n.get())
|
|
||||||
.unwrap_or(1);
|
|
||||||
|
|
||||||
// column widths
|
// column widths
|
||||||
let nw = self
|
let nw = self
|
||||||
|
|||||||
Reference in New Issue
Block a user