Compare commits
18
Commits
v1.1.39
...
14aa82521d
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
14aa82521d | ||
|
|
c95c47155e | ||
|
|
4f6d442688 | ||
|
|
e6f0ca472c | ||
|
|
442f7a9e4c | ||
|
|
a63692b8c4 | ||
|
|
fa82989ea9 | ||
|
|
5f95e866f8 | ||
|
|
2e7cfc4368 | ||
|
|
f5e508ed33 | ||
|
|
49f329edd5 | ||
|
|
1a470eab9e | ||
|
|
ba990a48a0 | ||
|
|
ea914bb536 | ||
|
|
8bc6d533e5 | ||
|
|
45df9919e5 | ||
|
|
2610a4af79 | ||
|
|
dc3392865f |
@@ -1,4 +1,4 @@
|
|||||||
name: CI
|
pname: CI
|
||||||
|
|
||||||
on:
|
on:
|
||||||
pull_request:
|
pull_request:
|
||||||
@@ -25,8 +25,8 @@ jobs:
|
|||||||
~/.cargo/registry
|
~/.cargo/registry
|
||||||
~/.cargo/git
|
~/.cargo/git
|
||||||
src/target
|
src/target
|
||||||
key: ${{ runner.os }}-cargo-${{ hashFiles('src/Cargo.lock') }}
|
key: ${{ runner.os }}-cargo-v2-${{ hashFiles('src/Cargo.lock') }}
|
||||||
restore-keys: ${{ runner.os }}-cargo-
|
restore-keys: ${{ runner.os }}-cargo-v2-
|
||||||
|
|
||||||
- name: Build
|
- name: Build
|
||||||
run: cargo build --release
|
run: cargo build --release
|
||||||
|
|||||||
@@ -9,6 +9,7 @@ data-stress
|
|||||||
./**/*.json
|
./**/*.json
|
||||||
*.bin
|
*.bin
|
||||||
*.log
|
*.log
|
||||||
|
*.csv
|
||||||
Betula_exilis--IGA-24-33
|
Betula_exilis--IGA-24-33
|
||||||
benchmark/genomes
|
benchmark/genomes
|
||||||
benchmark/simulated_data
|
benchmark/simulated_data
|
||||||
@@ -23,3 +24,5 @@ benchmark/reference_dist
|
|||||||
benchmark/obikmer_dist
|
benchmark/obikmer_dist
|
||||||
benchmark/specific_index_count
|
benchmark/specific_index_count
|
||||||
benchmark/specific_index_presence
|
benchmark/specific_index_presence
|
||||||
|
TNT
|
||||||
|
phyg
|
||||||
|
|||||||
@@ -92,18 +92,48 @@ For each genome:
|
|||||||
|
|
||||||
| Flag | Applies to | Meaning |
|
| Flag | Applies to | Meaning |
|
||||||
|------|-----------|---------|
|
|------|-----------|---------|
|
||||||
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes |
|
| `--min-count N` | ingroup | k-mer present in at least N ingroup genomes (N may be negative, see below) |
|
||||||
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes |
|
| `--max-count N` | ingroup | k-mer present in at most N ingroup genomes (N may be negative, see below) |
|
||||||
| `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes |
|
| `--min-frac F` | ingroup | k-mer present in at least fraction F of ingroup genomes |
|
||||||
| `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes |
|
| `--max-frac F` | ingroup | k-mer present in at most fraction F of ingroup genomes |
|
||||||
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes |
|
| `--min-outgroup-count N` | outgroup | k-mer present in at least N outgroup genomes (N may be negative, see below) |
|
||||||
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes |
|
| `--max-outgroup-count N` | outgroup | k-mer present in at most N outgroup genomes (N may be negative, see below) |
|
||||||
| `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes |
|
| `--min-outgroup-frac F` | outgroup | k-mer present in at least fraction F of outgroup genomes |
|
||||||
| `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes |
|
| `--max-outgroup-frac F` | outgroup | k-mer present in at most fraction F of outgroup genomes |
|
||||||
| `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`filter` only) |
|
| `--min-total-count N` | all genomes | sum of per-genome counts ≥ N (`filter` only) |
|
||||||
| `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`filter` only) |
|
| `--max-total-count N` | all genomes | sum of per-genome counts ≤ N (`filter` only) |
|
||||||
| `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) |
|
| `--presence-threshold N` | all | per-genome count > N to be considered "present" (default 0) |
|
||||||
|
|
||||||
|
### Negative counts — offset from group size
|
||||||
|
|
||||||
|
The four integer count flags (`--min-count`, `--max-count`, `--min-outgroup-count`,
|
||||||
|
`--max-outgroup-count`) accept **negative** values, interpreted as an offset counted
|
||||||
|
down from the group size `n`, resolved at run time once `n` is known:
|
||||||
|
|
||||||
|
| Value | Effective threshold |
|
||||||
|
|-------|---------------------|
|
||||||
|
| `N ≥ 0` | literal absolute count `N` |
|
||||||
|
| `-x` (x > 0) | `max(1, n − x)` — "all but x" |
|
||||||
|
|
||||||
|
`-1` literally means *all but one*, `-2` *all but two*, and so on. This expresses
|
||||||
|
a quorum relative to the group size that a plain fraction cannot state exactly
|
||||||
|
(e.g. "present in every genome except at most one" is `n−1`, which is `0.9` for
|
||||||
|
`n = 10` but `0.857…` for `n = 7`).
|
||||||
|
|
||||||
|
The threshold is **floored at 1**, never 0: the negative form always keeps
|
||||||
|
constraining the group. Without the floor, `--min-count -1` on a singleton
|
||||||
|
ingroup (`n = 1`) would resolve to `0` ("at least 0") and silently drop the
|
||||||
|
constraint; the floor makes it `1` ("present in that one genome") instead.
|
||||||
|
|
||||||
|
To express a count of `0` (e.g. "absent from the ingroup"), use the literal `0`,
|
||||||
|
not a negative — `0` and `-0` are indistinguishable, so the offset form starts at
|
||||||
|
`-1`.
|
||||||
|
|
||||||
|
> **Edge case** — on an *empty* group (`n = 0`, e.g. a predicate matching no
|
||||||
|
> genome), a negative count still resolves to `1`, an impossible constraint that
|
||||||
|
> rejects every k-mer. This is consistent with an empty group letting nothing
|
||||||
|
> through, but differs from the "no constraint" behaviour of the fraction flags.
|
||||||
|
|
||||||
**Conditional defaults** — the defaults for `--min-frac` and `--max-outgroup-count` depend on two conditions:
|
**Conditional defaults** — the defaults for `--min-frac` and `--max-outgroup-count` depend on two conditions:
|
||||||
whether the corresponding group was declared, **and** whether any quorum flag for that group was explicitly set.
|
whether the corresponding group was declared, **and** whether any quorum flag for that group was explicitly set.
|
||||||
|
|
||||||
@@ -215,6 +245,17 @@ obikmer filter src --output dst \
|
|||||||
--max-outgroup-count 0
|
--max-outgroup-count 0
|
||||||
```
|
```
|
||||||
|
|
||||||
|
Noise-tolerant core — keep k-mers present in *all but one* ingroup genome
|
||||||
|
(`-1` = `n−1`) and absent from *all but one* of the outgroup:
|
||||||
|
|
||||||
|
```sh
|
||||||
|
obikmer filter src --output dst \
|
||||||
|
--ingroup "genus=Betula" \
|
||||||
|
--outgroup "*" \
|
||||||
|
--min-count -1 \
|
||||||
|
--max-outgroup-count -1
|
||||||
|
```
|
||||||
|
|
||||||
To dump only k-mers specific to *Betula nana*:
|
To dump only k-mers specific to *Betula nana*:
|
||||||
|
|
||||||
```sh
|
```sh
|
||||||
|
|||||||
@@ -347,11 +347,24 @@ Provided finalisations:
|
|||||||
| `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` |
|
| `relfreq_euclidean_dist_matrix()` | `√partial_relfreq_euclidean[i,j]` |
|
||||||
| `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` |
|
| `hellinger_dist_matrix()` | `√partial_hellinger[i,j] / √2` |
|
||||||
| `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` |
|
| `hellinger_euclidean_dist_matrix()` | `√partial_hellinger[i,j]` |
|
||||||
|
| `threshold_mash_dist_matrix(k, t)` | Mash distance, derived from `threshold_jaccard_dist_matrix(t)` — no separate partial |
|
||||||
|
|
||||||
### BitPartials
|
### BitPartials
|
||||||
|
|
||||||
Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)`, `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions.
|
Required: `partial_jaccard() -> (Array2<u64>, Array2<u64>)`, `partial_hamming() -> Array2<u64>`. Both additive across layers and partitions.
|
||||||
|
|
||||||
|
Provided finalisations also include `jaccard_dist_matrix()`, `hamming_dist_matrix()`, and `mash_dist_matrix(k)`.
|
||||||
|
|
||||||
|
### Mash distance
|
||||||
|
|
||||||
|
`mash_dist_matrix`/`threshold_mash_dist_matrix` add no new additive primitive: both are a pointwise transform of the existing Jaccard distance matrix, per the Mash mutation-rate estimator [@Mash-distances-doc; @Fan2015-mash-formula]:
|
||||||
|
|
||||||
|
```
|
||||||
|
D = -1/k · ln(2J / (1+J)), J = 1 - d_jaccard
|
||||||
|
```
|
||||||
|
|
||||||
|
`J ≤ 0` (i.e. `d_jaccard ≥ 1`, no shared k-mers) maps to `D = 1` (maximal distance) rather than the `ln` singularity at `J = 0`.
|
||||||
|
|
||||||
---
|
---
|
||||||
|
|
||||||
## Temp-file-backed types
|
## Temp-file-backed types
|
||||||
|
|||||||
+1
-1
@@ -13,7 +13,7 @@
|
|||||||
| `query` | Query an index with sequences and annotate matches |
|
| `query` | Query an index with sequences and annotate matches |
|
||||||
| `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the shared [kmer filtering](implementation/filtering.md) system; `--head N` limits output to the first N k-mers |
|
| `dump` | Dump all indexed k-mers as CSV (kmer + per-genome counts or presence); supports the shared [kmer filtering](implementation/filtering.md) system; `--head N` limits output to the first N k-mers |
|
||||||
| `annotate` | Add or update genome metadata from a CSV file; or dump metadata as CSV |
|
| `annotate` | Add or update genome metadata from a CSV file; or dump metadata as CSV |
|
||||||
| `distance` | Compute pairwise distance matrix between genomes; optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard on count indexes (default 1) |
|
| `distance` | Compute pairwise distance matrix between genomes (`--metric jaccard\|mash\|hamming\|bray-curtis\|relfreq-bray-curtis\|euclidean\|relfreq-euclidean\|hellinger\|hellinger-euclidean`); optionally build NJ/UPGMA trees; `--presence-threshold N` sets the minimum count to consider a k-mer present when computing Jaccard/Mash on count indexes (default 1) |
|
||||||
| `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the shared [kmer filtering](implementation/filtering.md) system |
|
| `unitig` | Build a global de Bruijn graph across all partitions and enumerate its unitigs as FASTA; supports the shared [kmer filtering](implementation/filtering.md) system |
|
||||||
| `select` | Project and/or aggregate genome columns into a new or in-place index; the column-axis counterpart of `filter` (see [select](implementation/select.md)) |
|
| `select` | Project and/or aggregate genome columns into a new or in-place index; the column-axis counterpart of `filter` (see [select](implementation/select.md)) |
|
||||||
| `estimate` | Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing |
|
| `estimate` | Estimate approximate-index parameters (z, evidence bits, FP rates) before indexing |
|
||||||
|
|||||||
@@ -241,3 +241,21 @@
|
|||||||
volume = 33,
|
volume = 33,
|
||||||
year = 2017,
|
year = 2017,
|
||||||
bdsk-url-1 = {http://dx.doi.org/10.1093/bioinformatics/btw832}}
|
bdsk-url-1 = {http://dx.doi.org/10.1093/bioinformatics/btw832}}
|
||||||
|
|
||||||
|
@misc{Mash-distances-doc,
|
||||||
|
author = {{Marbl Lab}},
|
||||||
|
howpublished = {Mash documentation},
|
||||||
|
title = {Mash Distance},
|
||||||
|
url = {https://mash.readthedocs.io/en/latest/distances.html},
|
||||||
|
urldate = {2026-07-09},
|
||||||
|
year = 2026}
|
||||||
|
|
||||||
|
@article{Fan2015-mash-formula,
|
||||||
|
author = {Fan, Huan and Ives, Anthony R and Surget-Groba, Yann and Cannon, Charles H},
|
||||||
|
doi = {10.1186/s12864-015-1647-5},
|
||||||
|
journal = {BMC Genomics},
|
||||||
|
number = 1,
|
||||||
|
title = {An assembly and alignment-free method of phylogeny reconstruction from next-generation sequencing data},
|
||||||
|
url = {https://doi.org/10.1186/s12864-015-1647-5},
|
||||||
|
volume = 16,
|
||||||
|
year = 2015}
|
||||||
|
|||||||
File diff suppressed because it is too large
Load Diff
@@ -36,6 +36,7 @@ nav:
|
|||||||
- Entropy filter: theory/entropy.md
|
- Entropy filter: theory/entropy.md
|
||||||
- Minimizer selection: theory/minimizer.md
|
- Minimizer selection: theory/minimizer.md
|
||||||
- Partitioning architecture: theory/indexing.md
|
- Partitioning architecture: theory/indexing.md
|
||||||
|
- Central-position SNP distance (discussion): theory/evolutionary_distances.md
|
||||||
- Implementation:
|
- Implementation:
|
||||||
- SuperKmer: implementation/superkmer.md
|
- SuperKmer: implementation/superkmer.md
|
||||||
- Kmer: implementation/kmer.md
|
- Kmer: implementation/kmer.md
|
||||||
|
|||||||
Generated
+6
-1
@@ -1701,17 +1701,22 @@ dependencies = [
|
|||||||
"obikpartitionner",
|
"obikpartitionner",
|
||||||
"obikseq",
|
"obikseq",
|
||||||
"obilayeredmap",
|
"obilayeredmap",
|
||||||
|
"obipipeline",
|
||||||
|
"obiread",
|
||||||
|
"obiskbuilder",
|
||||||
"obiskio",
|
"obiskio",
|
||||||
"obisys",
|
"obisys",
|
||||||
"rayon",
|
"rayon",
|
||||||
"serde",
|
"serde",
|
||||||
"serde_json",
|
"serde_json",
|
||||||
|
"tempfile",
|
||||||
"tracing",
|
"tracing",
|
||||||
|
"tracing-subscriber",
|
||||||
]
|
]
|
||||||
|
|
||||||
[[package]]
|
[[package]]
|
||||||
name = "obikmer"
|
name = "obikmer"
|
||||||
version = "1.1.39"
|
version = "1.1.44"
|
||||||
dependencies = [
|
dependencies = [
|
||||||
"clap",
|
"clap",
|
||||||
"csv",
|
"csv",
|
||||||
|
|||||||
@@ -7,6 +7,7 @@ mod intmatrix;
|
|||||||
mod layer_meta;
|
mod layer_meta;
|
||||||
mod meta;
|
mod meta;
|
||||||
mod reader;
|
mod reader;
|
||||||
|
mod siblingannex;
|
||||||
mod tempbitvec;
|
mod tempbitvec;
|
||||||
mod tempintvec;
|
mod tempintvec;
|
||||||
mod views;
|
mod views;
|
||||||
@@ -18,6 +19,7 @@ pub use builder::PersistentCompactIntVecBuilder;
|
|||||||
pub use colgroup::{ColGroup, FilterMask, MatrixGroupOps, eval_filter_mask};
|
pub use colgroup::{ColGroup, FilterMask, MatrixGroupOps, eval_filter_mask};
|
||||||
pub use intmatrix::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, pack_compact_int_matrix};
|
pub use intmatrix::{PersistentCompactIntMatrix, PersistentCompactIntMatrixBuilder, pack_compact_int_matrix};
|
||||||
pub use layer_meta::LayerMeta;
|
pub use layer_meta::LayerMeta;
|
||||||
|
pub use siblingannex::{FamilyMask, SiblingAnnex, SiblingAnnexBuilder};
|
||||||
pub use reader::{PersistentCompactIntVec, Iter as CompactIntVecIter};
|
pub use reader::{PersistentCompactIntVec, Iter as CompactIntVecIter};
|
||||||
pub use tempbitvec::{TempBitVec, TempBitVecBuilder};
|
pub use tempbitvec::{TempBitVec, TempBitVecBuilder};
|
||||||
pub use tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
|
pub use tempintvec::{TempCompactIntVec, TempCompactIntVecBuilder};
|
||||||
|
|||||||
@@ -0,0 +1,245 @@
|
|||||||
|
//! Family presence-mask annex: a compact, read-only-after-build, per-slot
|
||||||
|
//! derived value used by the central-position SNP distance estimator (see
|
||||||
|
//! `docmd/theory/evolutionary_distances.md`, "Step 2b" and "Definitions:
|
||||||
|
//! family, and the canonical form of a family").
|
||||||
|
//!
|
||||||
|
//! One byte is stored per MPHF slot of a partition/layer, its low 4 bits
|
||||||
|
//! encoding a **presence mask** for the slot's k-mer's "family" (the up to 4
|
||||||
|
//! k-mers sharing the same flanks, differing only at the central base):
|
||||||
|
//! bit `b` (`b` = 0..3, in the fixed A/C/G/T = 0/1/2/3 encoding already used
|
||||||
|
//! for a single nucleotide) is set iff the family member whose *own* central
|
||||||
|
//! base — in its own canonical orientation — is `b`, is observed anywhere in
|
||||||
|
//! the current multi-genome index. This is a property of the whole index,
|
||||||
|
//! not of any one genome.
|
||||||
|
//!
|
||||||
|
//! Both facts the earlier (superseded) 3-bit design stored explicitly are
|
||||||
|
//! derived from the mask instead, not stored:
|
||||||
|
//! - sibling count = `popcount(mask) - 1`;
|
||||||
|
//! - minorant = regenerate the family's 4 canonical forms from the slot's
|
||||||
|
//! own k-mer (`CanonicalKmerOf::central_canonical_neighbors`, cheap, no
|
||||||
|
//! lookup), compare the raw encodings of whichever are set in the mask,
|
||||||
|
//! take the smallest — see `obikindex::siblings`.
|
||||||
|
//!
|
||||||
|
//! Mask value 0 is logically unreachable as a real result (a slot's own base
|
||||||
|
//! is always present in its own family) and is reused as the "not yet
|
||||||
|
//! computed" sentinel: annex files are pre-initialised to all-zero, and a
|
||||||
|
//! real value is only ever written once, by the computation pass.
|
||||||
|
//!
|
||||||
|
//! Deliberately simpler than a true 4-bit pack (1 byte/slot instead of 4
|
||||||
|
//! bits/slot): correctness and simplicity first, for a first implementation.
|
||||||
|
//! Packing to 4 bits/slot is a pure storage-density follow-up, not a
|
||||||
|
//! behavioural change, left for later.
|
||||||
|
|
||||||
|
use std::fs::{File, OpenOptions};
|
||||||
|
use std::io;
|
||||||
|
use std::path::{Path, PathBuf};
|
||||||
|
|
||||||
|
use memmap2::{Mmap, MmapMut};
|
||||||
|
|
||||||
|
const MAGIC: [u8; 4] = *b"PSIB";
|
||||||
|
|
||||||
|
// Header: magic(4) + _pad(4) + n(8) = 16 bytes. Data (1 byte/slot) follows.
|
||||||
|
const HEADER_SIZE: usize = 16;
|
||||||
|
|
||||||
|
/// A family presence mask: bit `b` set iff the member whose own canonical
|
||||||
|
/// central base is `b` (0=A, 1=C, 2=G, 3=T) is observed in the index.
|
||||||
|
#[derive(Debug, Clone, Copy, PartialEq, Eq)]
|
||||||
|
pub struct FamilyMask(u8);
|
||||||
|
|
||||||
|
impl FamilyMask {
|
||||||
|
/// The empty mask — never a valid *computed* result (a slot's own base
|
||||||
|
/// is always present in its own family) — used only to build up a mask
|
||||||
|
/// via repeated [`with`](Self::with) calls before storing it.
|
||||||
|
pub const EMPTY: FamilyMask = FamilyMask(0);
|
||||||
|
|
||||||
|
/// Set bit `base` (0=A, 1=C, 2=G, 3=T).
|
||||||
|
#[inline]
|
||||||
|
pub fn with(self, base: u8) -> Self {
|
||||||
|
debug_assert!(base < 4, "base out of range: {base}");
|
||||||
|
FamilyMask(self.0 | (1 << base))
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Is the member with central base `base` (0..3) present?
|
||||||
|
#[inline]
|
||||||
|
pub fn has(self, base: u8) -> bool {
|
||||||
|
debug_assert!(base < 4, "base out of range: {base}");
|
||||||
|
self.0 & (1 << base) != 0
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Number of family members observed anywhere in the index (1..=4).
|
||||||
|
#[inline]
|
||||||
|
pub fn family_size(self) -> u32 {
|
||||||
|
self.0.count_ones()
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Number of *other* members observed (0..=3) — `family_size() - 1`.
|
||||||
|
#[inline]
|
||||||
|
pub fn siblings(self) -> u32 {
|
||||||
|
self.family_size() - 1
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Raw bitmask (bit `b` = base `b` present) — for callers that build up
|
||||||
|
/// a mask via their own bit operations (e.g. concurrently, via an
|
||||||
|
/// `AtomicU8`) and only need the `FamilyMask` wrapper at the end.
|
||||||
|
#[inline]
|
||||||
|
pub fn bits(self) -> u8 {
|
||||||
|
self.0
|
||||||
|
}
|
||||||
|
|
||||||
|
/// Construct from a raw bitmask (only the low 4 bits are kept).
|
||||||
|
#[inline]
|
||||||
|
pub fn from_bits(bits: u8) -> Self {
|
||||||
|
FamilyMask(bits & 0b1111)
|
||||||
|
}
|
||||||
|
|
||||||
|
#[inline]
|
||||||
|
fn encode(self) -> u8 {
|
||||||
|
self.0
|
||||||
|
}
|
||||||
|
|
||||||
|
#[inline]
|
||||||
|
fn decode(byte: u8) -> Option<Self> {
|
||||||
|
if byte == 0 {
|
||||||
|
// Unreachable for a real result — reserved as the "not yet
|
||||||
|
// computed" sentinel.
|
||||||
|
return None;
|
||||||
|
}
|
||||||
|
Some(FamilyMask(byte & 0b1111))
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── SiblingAnnex (reader) ───────────────────────────────────────────────────
|
||||||
|
|
||||||
|
pub struct SiblingAnnex {
|
||||||
|
mmap: Mmap,
|
||||||
|
n: usize,
|
||||||
|
path: PathBuf,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl SiblingAnnex {
|
||||||
|
pub fn open(path: &Path) -> io::Result<Self> {
|
||||||
|
let mmap = unsafe { Mmap::map(&File::open(path)?)? };
|
||||||
|
if mmap.len() < HEADER_SIZE {
|
||||||
|
return Err(io::Error::new(io::ErrorKind::InvalidData, "PSIB file too short"));
|
||||||
|
}
|
||||||
|
if mmap[0..4] != MAGIC {
|
||||||
|
return Err(io::Error::new(io::ErrorKind::InvalidData, "bad PSIB magic"));
|
||||||
|
}
|
||||||
|
let n = u64::from_le_bytes(mmap[8..16].try_into().unwrap()) as usize;
|
||||||
|
if mmap.len() < HEADER_SIZE + n {
|
||||||
|
return Err(io::Error::new(io::ErrorKind::InvalidData, "PSIB file truncated"));
|
||||||
|
}
|
||||||
|
Ok(Self { mmap, n, path: path.to_path_buf() })
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn path(&self) -> &Path { &self.path }
|
||||||
|
pub fn len(&self) -> usize { self.n }
|
||||||
|
pub fn is_empty(&self) -> bool { self.n == 0 }
|
||||||
|
|
||||||
|
/// `None` means the slot has not (yet) been computed — see module docs.
|
||||||
|
pub fn get(&self, slot: usize) -> Option<FamilyMask> {
|
||||||
|
FamilyMask::decode(self.mmap[HEADER_SIZE + slot])
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── SiblingAnnexBuilder (writer) ────────────────────────────────────────────
|
||||||
|
|
||||||
|
pub struct SiblingAnnexBuilder {
|
||||||
|
mmap: MmapMut,
|
||||||
|
n: usize,
|
||||||
|
path: PathBuf,
|
||||||
|
}
|
||||||
|
|
||||||
|
impl SiblingAnnexBuilder {
|
||||||
|
/// Create a new annex of `n` slots at `path`, pre-initialised to the
|
||||||
|
/// "not yet computed" sentinel (all-zero).
|
||||||
|
pub fn new(n: usize, path: &Path) -> io::Result<Self> {
|
||||||
|
let file_size = HEADER_SIZE + n;
|
||||||
|
let file = OpenOptions::new()
|
||||||
|
.read(true).write(true).create(true).truncate(true)
|
||||||
|
.open(path)?;
|
||||||
|
file.set_len(file_size as u64)?;
|
||||||
|
let mut mmap = unsafe { MmapMut::map_mut(&file)? };
|
||||||
|
mmap[0..4].copy_from_slice(&MAGIC);
|
||||||
|
mmap[4..8].copy_from_slice(&[0u8; 4]);
|
||||||
|
mmap[8..16].copy_from_slice(&(n as u64).to_le_bytes());
|
||||||
|
// Data region left at 0 by `set_len`/mmap — the sentinel value.
|
||||||
|
Ok(Self { mmap, n, path: path.to_path_buf() })
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn len(&self) -> usize { self.n }
|
||||||
|
pub fn is_empty(&self) -> bool { self.n == 0 }
|
||||||
|
|
||||||
|
pub fn get(&self, slot: usize) -> Option<FamilyMask> {
|
||||||
|
FamilyMask::decode(self.mmap[HEADER_SIZE + slot])
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn set(&mut self, slot: usize, mask: FamilyMask) {
|
||||||
|
// Redundant concurrent writes from independent recomputation paths
|
||||||
|
// converge to the same encoded byte for a given slot, so a plain
|
||||||
|
// store here is safe even without external synchronisation, as long
|
||||||
|
// as the byte write itself is atomic (true for a single aligned
|
||||||
|
// byte on every platform this project targets).
|
||||||
|
self.mmap[HEADER_SIZE + slot] = mask.encode();
|
||||||
|
}
|
||||||
|
|
||||||
|
pub fn close(self) -> io::Result<()> { self.mmap.flush() }
|
||||||
|
|
||||||
|
pub fn finish(self) -> io::Result<SiblingAnnex> {
|
||||||
|
let path = self.path.clone();
|
||||||
|
self.close()?;
|
||||||
|
SiblingAnnex::open(&path)
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#[cfg(test)]
|
||||||
|
mod tests {
|
||||||
|
use super::*;
|
||||||
|
use tempfile::tempdir;
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn sentinel_is_zero_and_unset_slots_read_as_uncomputed() {
|
||||||
|
let dir = tempdir().unwrap();
|
||||||
|
let path = dir.path().join("test.psib");
|
||||||
|
let builder = SiblingAnnexBuilder::new(4, &path).unwrap();
|
||||||
|
for slot in 0..4 {
|
||||||
|
assert_eq!(builder.get(slot), None);
|
||||||
|
}
|
||||||
|
builder.close().unwrap();
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn roundtrip_all_valid_masks() {
|
||||||
|
let dir = tempdir().unwrap();
|
||||||
|
let path = dir.path().join("test.psib");
|
||||||
|
let mut builder = SiblingAnnexBuilder::new(4, &path).unwrap();
|
||||||
|
|
||||||
|
let masks = [
|
||||||
|
FamilyMask::EMPTY.with(0), // just A: family size 1
|
||||||
|
FamilyMask::EMPTY.with(0).with(3), // A + T: size 2
|
||||||
|
FamilyMask::EMPTY.with(1).with(2).with(3), // C+G+T: size 3
|
||||||
|
FamilyMask::EMPTY.with(0).with(1).with(2).with(3), // all 4
|
||||||
|
];
|
||||||
|
for (slot, mask) in masks.iter().enumerate() {
|
||||||
|
builder.set(slot, *mask);
|
||||||
|
}
|
||||||
|
let annex = builder.finish().unwrap();
|
||||||
|
for (slot, mask) in masks.iter().enumerate() {
|
||||||
|
assert_eq!(annex.get(slot), Some(*mask));
|
||||||
|
}
|
||||||
|
assert_eq!(annex.get(0).unwrap().siblings(), 0);
|
||||||
|
assert_eq!(annex.get(1).unwrap().siblings(), 1);
|
||||||
|
assert_eq!(annex.get(2).unwrap().siblings(), 2);
|
||||||
|
assert_eq!(annex.get(3).unwrap().siblings(), 3);
|
||||||
|
assert_eq!(annex.get(3).unwrap().family_size(), 4);
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn has_reflects_individual_bits() {
|
||||||
|
let mask = FamilyMask::EMPTY.with(0).with(2);
|
||||||
|
assert!(mask.has(0));
|
||||||
|
assert!(!mask.has(1));
|
||||||
|
assert!(mask.has(2));
|
||||||
|
assert!(!mask.has(3));
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -1,5 +1,16 @@
|
|||||||
use ndarray::{Array1, Array2};
|
use ndarray::{Array1, Array2};
|
||||||
|
|
||||||
|
/// Convert a Jaccard distance matrix (`1 - J`) into a Mash distance matrix, per
|
||||||
|
/// https://mash.readthedocs.io/en/latest/distances.html:
|
||||||
|
/// `D = -1/k * ln(2J / (1+J))`.
|
||||||
|
fn jaccard_to_mash(d_jaccard: &Array2<f64>, k: usize) -> Array2<f64> {
|
||||||
|
d_jaccard.mapv(|d| {
|
||||||
|
let j = 1.0 - d;
|
||||||
|
if j <= 0.0 { 1.0 }
|
||||||
|
else { -1.0 / k as f64 * (2.0 * j / (1.0 + j)).ln() }
|
||||||
|
})
|
||||||
|
}
|
||||||
|
|
||||||
// ── Column-level weight statistic — total count or presence count per column.
|
// ── Column-level weight statistic — total count or presence count per column.
|
||||||
/// Additive across layers and partitions; used as denominator in normalised distances.
|
/// Additive across layers and partitions; used as denominator in normalised distances.
|
||||||
///
|
///
|
||||||
@@ -74,6 +85,12 @@ pub trait CountPartials: ColumnWeights {
|
|||||||
m
|
m
|
||||||
}
|
}
|
||||||
|
|
||||||
|
/// Mash distance (https://mash.readthedocs.io/en/latest/distances.html), derived
|
||||||
|
/// from the presence-threshold Jaccard distance.
|
||||||
|
fn threshold_mash_dist_matrix(&self, k: usize, threshold: u32) -> Array2<f64> {
|
||||||
|
jaccard_to_mash(&self.threshold_jaccard_dist_matrix(threshold), k)
|
||||||
|
}
|
||||||
|
|
||||||
fn relfreq_bray_dist_matrix(&self) -> Array2<f64> {
|
fn relfreq_bray_dist_matrix(&self) -> Array2<f64> {
|
||||||
let global = self.col_weights();
|
let global = self.col_weights();
|
||||||
let mut m = self.partial_relfreq_bray(&global).mapv(|v| 1.0 - v);
|
let mut m = self.partial_relfreq_bray(&global).mapv(|v| 1.0 - v);
|
||||||
@@ -126,6 +143,12 @@ pub trait BitPartials: ColumnWeights {
|
|||||||
m
|
m
|
||||||
}
|
}
|
||||||
|
|
||||||
|
/// Mash distance (https://mash.readthedocs.io/en/latest/distances.html), derived
|
||||||
|
/// from the Jaccard distance.
|
||||||
|
fn mash_dist_matrix(&self, k: usize) -> Array2<f64> {
|
||||||
|
jaccard_to_mash(&self.jaccard_dist_matrix(), k)
|
||||||
|
}
|
||||||
|
|
||||||
fn hamming_dist_matrix(&self) -> Array2<u64> {
|
fn hamming_dist_matrix(&self) -> Array2<u64> {
|
||||||
self.partial_hamming()
|
self.partial_hamming()
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -1,6 +1,17 @@
|
|||||||
use super::*;
|
use super::*;
|
||||||
use obikseq::{k, set_k, unitig::Unitig, Kmer};
|
use obikseq::{k, set_k, unitig::Unitig, Kmer};
|
||||||
|
|
||||||
|
// `obikseq::params` is process-wide (see obikseq/src/params.rs): tests in this
|
||||||
|
// file don't all use the same `k` (`push_palindrome_single_node` needs an
|
||||||
|
// even k=4 — no odd-length self-revcomp palindrome exists — while the rest
|
||||||
|
// use k=5), and they run concurrently by default. Serialize the
|
||||||
|
// set_k-through-use critical section across this file's tests so one test's
|
||||||
|
// `k` can never be overwritten mid-flight by another.
|
||||||
|
static K_LOCK: std::sync::Mutex<()> = std::sync::Mutex::new(());
|
||||||
|
fn lock_k() -> std::sync::MutexGuard<'static, ()> {
|
||||||
|
K_LOCK.lock().unwrap_or_else(|e| e.into_inner())
|
||||||
|
}
|
||||||
|
|
||||||
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
|
// Build a graph from an ASCII sequence, inserting all canonical k-mers.
|
||||||
fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn {
|
fn graph_from_ascii(seq: &[u8]) -> GraphDeBruijn {
|
||||||
let mut g = GraphDeBruijn::new();
|
let mut g = GraphDeBruijn::new();
|
||||||
@@ -37,6 +48,7 @@ fn collect_unitigs(g: &GraphDeBruijn) -> Vec<Unitig> {
|
|||||||
#[test]
|
#[test]
|
||||||
fn push_deduplicates_revcomp() {
|
fn push_deduplicates_revcomp() {
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
|
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
|
||||||
let mut g = GraphDeBruijn::new();
|
let mut g = GraphDeBruijn::new();
|
||||||
@@ -49,6 +61,7 @@ fn push_deduplicates_revcomp() {
|
|||||||
fn push_palindrome_single_node() {
|
fn push_palindrome_single_node() {
|
||||||
// ACGT is its own revcomp
|
// ACGT is its own revcomp
|
||||||
let k = 4;
|
let k = 4;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let kmer = Kmer::from_ascii(b"ACGT").unwrap();
|
let kmer = Kmer::from_ascii(b"ACGT").unwrap();
|
||||||
assert_eq!(kmer, kmer.revcomp(), "test requires a palindrome");
|
assert_eq!(kmer, kmer.revcomp(), "test requires a palindrome");
|
||||||
@@ -71,6 +84,7 @@ fn linear_chain_graph() -> (GraphDeBruijn, Vec<CanonicalKmer>) {
|
|||||||
#[test]
|
#[test]
|
||||||
fn degrees_linear_chain_node_count() {
|
fn degrees_linear_chain_node_count() {
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let (g, kmers) = linear_chain_graph();
|
let (g, kmers) = linear_chain_graph();
|
||||||
assert_eq!(g.len(), kmers.len());
|
assert_eq!(g.len(), kmers.len());
|
||||||
@@ -82,6 +96,7 @@ fn degrees_linear_chain_extensions() {
|
|||||||
// Note: start_iter must not be consumed standalone — its second pass only
|
// Note: start_iter must not be consumed standalone — its second pass only
|
||||||
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
|
// finds true cycle nodes when interleaved with chain traversal (iter_unitig).
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let seq = b"AAAAGGGG";
|
let seq = b"AAAAGGGG";
|
||||||
let g = graph_from_ascii(seq);
|
let g = graph_from_ascii(seq);
|
||||||
@@ -118,6 +133,7 @@ fn kmers_from_unitigs(unitigs: &[Unitig]) -> Vec<CanonicalKmer> {
|
|||||||
fn unitig_roundtrip_linear() {
|
fn unitig_roundtrip_linear() {
|
||||||
// Non-repetitive sequence: all k-mers must be recovered across unitigs.
|
// Non-repetitive sequence: all k-mers must be recovered across unitigs.
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let seq = b"ACCTGGCTA";
|
let seq = b"ACCTGGCTA";
|
||||||
let g = graph_from_ascii(seq);
|
let g = graph_from_ascii(seq);
|
||||||
@@ -136,6 +152,7 @@ fn unitig_roundtrip_longer_sequence() {
|
|||||||
// Longer non-repetitive sequence with no repeated k-mer of length k.
|
// Longer non-repetitive sequence with no repeated k-mer of length k.
|
||||||
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
|
// ACGTGGCTATCGAC with k=5 → 10 distinct k-mers, one linear chain.
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let seq = b"ACGTGGCTATCGAC";
|
let seq = b"ACGTGGCTATCGAC";
|
||||||
let g = graph_from_ascii(seq);
|
let g = graph_from_ascii(seq);
|
||||||
@@ -152,6 +169,7 @@ fn unitig_roundtrip_longer_sequence() {
|
|||||||
fn unitig_isolated_node() {
|
fn unitig_isolated_node() {
|
||||||
// Single k-mer with no neighbours
|
// Single k-mer with no neighbours
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
|
let kmer = Kmer::from_ascii(b"ACGTA").unwrap();
|
||||||
let mut g = GraphDeBruijn::new();
|
let mut g = GraphDeBruijn::new();
|
||||||
@@ -165,6 +183,7 @@ fn unitig_isolated_node() {
|
|||||||
#[test]
|
#[test]
|
||||||
fn unitig_two_isolated_nodes() {
|
fn unitig_two_isolated_nodes() {
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let mut g = GraphDeBruijn::new();
|
let mut g = GraphDeBruijn::new();
|
||||||
// Two k-mers that share no (k-1)-overlap
|
// Two k-mers that share no (k-1)-overlap
|
||||||
@@ -177,6 +196,7 @@ fn unitig_two_isolated_nodes() {
|
|||||||
#[test]
|
#[test]
|
||||||
fn unitig_two_truly_distinct_isolated_nodes() {
|
fn unitig_two_truly_distinct_isolated_nodes() {
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let mut g = GraphDeBruijn::new();
|
let mut g = GraphDeBruijn::new();
|
||||||
g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical());
|
g.push(Kmer::from_ascii(b"AAAAC").unwrap().canonical());
|
||||||
@@ -192,7 +212,8 @@ fn unitig_two_truly_distinct_isolated_nodes() {
|
|||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn no_kmer_lost_or_duplicated() {
|
fn no_kmer_lost_or_duplicated() {
|
||||||
let k = 7;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let seq = b"ACGTACGTACGTTTTTACGTACGT";
|
let seq = b"ACGTACGTACGTTTTTACGTACGT";
|
||||||
let g = graph_from_ascii(seq);
|
let g = graph_from_ascii(seq);
|
||||||
@@ -218,6 +239,7 @@ fn cycle_kmers_not_lost() {
|
|||||||
// start_iter first pass yields nothing (all nodes internal); second pass
|
// start_iter first pass yields nothing (all nodes internal); second pass
|
||||||
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
|
// picks up cycle entries. All 4 k-mers must appear in the unitigs.
|
||||||
let k = 5;
|
let k = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let seq = b"ACGTACGT";
|
let seq = b"ACGTACGT";
|
||||||
let g = graph_from_ascii(seq);
|
let g = graph_from_ascii(seq);
|
||||||
@@ -240,6 +262,7 @@ fn branching_graph_no_kmer_lost_or_duplicated() {
|
|||||||
// Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
|
// Each "node" is a distinct 5-mer; edges share a 4-mer suffix/prefix.
|
||||||
// We use long non-repetitive sequences and extract only the required kmers.
|
// We use long non-repetitive sequences and extract only the required kmers.
|
||||||
let k: usize = 5;
|
let k: usize = 5;
|
||||||
|
let _guard = lock_k();
|
||||||
set_k(k);
|
set_k(k);
|
||||||
let mut g = GraphDeBruijn::new();
|
let mut g = GraphDeBruijn::new();
|
||||||
|
|
||||||
|
|||||||
@@ -10,6 +10,8 @@ obiskio = { path = "../obiskio" }
|
|||||||
obisys = { path = "../obisys" }
|
obisys = { path = "../obisys" }
|
||||||
obicompactvec = { path = "../obicompactvec" }
|
obicompactvec = { path = "../obicompactvec" }
|
||||||
obilayeredmap = { path = "../obilayeredmap" }
|
obilayeredmap = { path = "../obilayeredmap" }
|
||||||
|
obiskbuilder = { path = "../obiskbuilder" }
|
||||||
|
obipipeline = { path = "../obipipeline" }
|
||||||
ndarray = "0.16"
|
ndarray = "0.16"
|
||||||
rayon = "1"
|
rayon = "1"
|
||||||
crossbeam-channel = "0.5"
|
crossbeam-channel = "0.5"
|
||||||
@@ -19,6 +21,11 @@ indicatif = "0.17"
|
|||||||
tracing = "0.1.44"
|
tracing = "0.1.44"
|
||||||
hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], optional = true }
|
hwlocality = { version = "1.0.0-alpha.11", features = ["vendored"], optional = true }
|
||||||
|
|
||||||
|
[dev-dependencies]
|
||||||
|
obiread = { path = "../obiread" }
|
||||||
|
tempfile = "3"
|
||||||
|
tracing-subscriber = { version = "0.3", features = ["fmt", "env-filter"] }
|
||||||
|
|
||||||
[features]
|
[features]
|
||||||
default = ["numa"]
|
default = ["numa"]
|
||||||
numa = ["hwlocality"]
|
numa = ["hwlocality"]
|
||||||
|
|||||||
@@ -14,6 +14,8 @@ pub enum DistanceMetric {
|
|||||||
Jaccard,
|
Jaccard,
|
||||||
/// Hamming distance (number of differing kmer positions) on presence/absence data.
|
/// Hamming distance (number of differing kmer positions) on presence/absence data.
|
||||||
Hamming,
|
Hamming,
|
||||||
|
/// Mash distance on presence/absence data (Jaccard-derived mutation-rate estimate).
|
||||||
|
Mash,
|
||||||
/// Bray-Curtis dissimilarity on raw counts.
|
/// Bray-Curtis dissimilarity on raw counts.
|
||||||
BrayCurtis,
|
BrayCurtis,
|
||||||
/// Bray-Curtis dissimilarity normalised by per-genome total counts.
|
/// Bray-Curtis dissimilarity normalised by per-genome total counts.
|
||||||
@@ -84,6 +86,7 @@ impl KmerIndex {
|
|||||||
DistanceMetric::Hellinger => CountPartials::hellinger_dist_matrix(&global),
|
DistanceMetric::Hellinger => CountPartials::hellinger_dist_matrix(&global),
|
||||||
DistanceMetric::HellingerEuclidean => CountPartials::hellinger_euclidean_dist_matrix(&global),
|
DistanceMetric::HellingerEuclidean => CountPartials::hellinger_euclidean_dist_matrix(&global),
|
||||||
DistanceMetric::Jaccard => CountPartials::threshold_jaccard_dist_matrix(&global, presence_threshold),
|
DistanceMetric::Jaccard => CountPartials::threshold_jaccard_dist_matrix(&global, presence_threshold),
|
||||||
|
DistanceMetric::Mash => CountPartials::threshold_mash_dist_matrix(&global, self.kmer_size(), presence_threshold),
|
||||||
DistanceMetric::Hamming => {
|
DistanceMetric::Hamming => {
|
||||||
return Err(OKIError::InvalidInput(
|
return Err(OKIError::InvalidInput(
|
||||||
"Hamming is only available for presence/absence indexes".into(),
|
"Hamming is only available for presence/absence indexes".into(),
|
||||||
@@ -108,6 +111,7 @@ impl KmerIndex {
|
|||||||
|
|
||||||
let matrix = match metric {
|
let matrix = match metric {
|
||||||
DistanceMetric::Jaccard => BitPartials::jaccard_dist_matrix(&global),
|
DistanceMetric::Jaccard => BitPartials::jaccard_dist_matrix(&global),
|
||||||
|
DistanceMetric::Mash => BitPartials::mash_dist_matrix(&global, self.kmer_size()),
|
||||||
DistanceMetric::Hamming => {
|
DistanceMetric::Hamming => {
|
||||||
BitPartials::hamming_dist_matrix(&global).mapv(|v| v as f64)
|
BitPartials::hamming_dist_matrix(&global).mapv(|v| v as f64)
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -9,6 +9,7 @@ mod numa;
|
|||||||
mod rebuild;
|
mod rebuild;
|
||||||
mod reindex;
|
mod reindex;
|
||||||
mod select;
|
mod select;
|
||||||
|
mod siblings;
|
||||||
mod stats;
|
mod stats;
|
||||||
|
|
||||||
pub use error::{OKIError, OKIResult};
|
pub use error::{OKIError, OKIResult};
|
||||||
@@ -18,3 +19,4 @@ pub use merge::MergeMode;
|
|||||||
pub use meta::{validate_label, GenomeInfo, IndexConfig, IndexMeta, META_FILENAME};
|
pub use meta::{validate_label, GenomeInfo, IndexConfig, IndexMeta, META_FILENAME};
|
||||||
pub use state::{IndexState, SENTINEL_COUNTED, SENTINEL_INDEXED, SENTINEL_SCATTERED};
|
pub use state::{IndexState, SENTINEL_COUNTED, SENTINEL_INDEXED, SENTINEL_SCATTERED};
|
||||||
pub use stats::IndexBitsPerKmer;
|
pub use stats::IndexBitsPerKmer;
|
||||||
|
pub use siblings::{RawSnpDistanceOutput, SiblingAnnexStats, SnpAlignment};
|
||||||
|
|||||||
@@ -79,9 +79,7 @@ pub fn build() -> NumaSetup {
|
|||||||
}
|
}
|
||||||
|
|
||||||
// UMA fallback: single synthetic node, all cores, no pool, no pinning.
|
// UMA fallback: single synthetic node, all cores, no pool, no pinning.
|
||||||
let n_cores = std::thread::available_parallelism()
|
let n_cores = obisys::effective_parallelism();
|
||||||
.map(|n| n.get())
|
|
||||||
.unwrap_or(1);
|
|
||||||
debug!("UMA: single synthetic node, {} core(s)", n_cores);
|
debug!("UMA: single synthetic node, {} core(s)", n_cores);
|
||||||
NumaSetup {
|
NumaSetup {
|
||||||
pools: vec![None],
|
pools: vec![None],
|
||||||
@@ -91,9 +89,7 @@ pub fn build() -> NumaSetup {
|
|||||||
|
|
||||||
#[cfg(not(feature = "numa"))]
|
#[cfg(not(feature = "numa"))]
|
||||||
pub fn build() -> NumaSetup {
|
pub fn build() -> NumaSetup {
|
||||||
let n_cores = std::thread::available_parallelism()
|
let n_cores = obisys::effective_parallelism();
|
||||||
.map(|n| n.get())
|
|
||||||
.unwrap_or(1);
|
|
||||||
debug!("UMA: single synthetic node, {} core(s)", n_cores);
|
debug!("UMA: single synthetic node, {} core(s)", n_cores);
|
||||||
NumaSetup {
|
NumaSetup {
|
||||||
pools: vec![None],
|
pools: vec![None],
|
||||||
@@ -299,20 +295,27 @@ impl PartitionRunner {
|
|||||||
let pool = node.pool.clone();
|
let pool = node.pool.clone();
|
||||||
|
|
||||||
s.spawn(move || {
|
s.spawn(move || {
|
||||||
|
let tid = std::thread::current().id();
|
||||||
|
debug!(?tid, "PartitionRunner worker: waiting on activation");
|
||||||
if arx.recv().is_err() {
|
if arx.recv().is_err() {
|
||||||
|
debug!(?tid, "PartitionRunner worker: activation channel closed, exiting");
|
||||||
return;
|
return;
|
||||||
}
|
}
|
||||||
|
debug!(?tid, "PartitionRunner worker: activated");
|
||||||
if !cpu_ids.is_empty() {
|
if !cpu_ids.is_empty() {
|
||||||
pin_current_thread(cpu_ids);
|
pin_current_thread(cpu_ids);
|
||||||
}
|
}
|
||||||
for i in &prx {
|
for i in &prx {
|
||||||
|
debug!(?tid, partition = i, "PartitionRunner worker: picked partition");
|
||||||
let t = Instant::now();
|
let t = Instant::now();
|
||||||
let r = match &pool {
|
let r = match &pool {
|
||||||
Some(p) => p.install(|| f(i)),
|
Some(p) => p.install(|| f(i)),
|
||||||
None => f(i),
|
None => f(i),
|
||||||
};
|
};
|
||||||
|
debug!(?tid, partition = i, "PartitionRunner worker: partition done");
|
||||||
etx.send(WorkerEvent::Completed(i, r, t.elapsed())).ok();
|
etx.send(WorkerEvent::Completed(i, r, t.elapsed())).ok();
|
||||||
}
|
}
|
||||||
|
debug!(?tid, "PartitionRunner worker: no more partitions, exiting");
|
||||||
});
|
});
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
@@ -323,13 +326,18 @@ impl PartitionRunner {
|
|||||||
// ── Controller ────────────────────────────────────────────────────
|
// ── Controller ────────────────────────────────────────────────────
|
||||||
let mut activation = NodeActivation::new(&activate_txs, &node_caps, max_workers);
|
let mut activation = NodeActivation::new(&activate_txs, &node_caps, max_workers);
|
||||||
activation.activate_initial(INITIAL_DIVISOR, n_total);
|
activation.activate_initial(INITIAL_DIVISOR, n_total);
|
||||||
|
debug!(n_total, activated = activation.total(), "PartitionRunner controller: initial activation");
|
||||||
|
|
||||||
let mut cpu_sample = CpuSample::now();
|
let mut cpu_sample = CpuSample::now();
|
||||||
let mut io_sample = IoSample::now();
|
let mut io_sample = IoSample::now();
|
||||||
let mut completed = 0usize;
|
let mut completed = 0usize;
|
||||||
|
|
||||||
while completed < n_total {
|
while completed < n_total {
|
||||||
let Ok(event) = event_rx.recv() else { break };
|
debug!(completed, n_total, "PartitionRunner controller: waiting for an event");
|
||||||
|
let Ok(event) = event_rx.recv() else {
|
||||||
|
debug!("PartitionRunner controller: event channel closed, stopping");
|
||||||
|
break;
|
||||||
|
};
|
||||||
match event {
|
match event {
|
||||||
WorkerEvent::Completed(i, r, dur) => {
|
WorkerEvent::Completed(i, r, dur) => {
|
||||||
match r {
|
match r {
|
||||||
|
|||||||
File diff suppressed because it is too large
Load Diff
@@ -1,6 +1,6 @@
|
|||||||
[package]
|
[package]
|
||||||
name = "obikmer"
|
name = "obikmer"
|
||||||
version = "1.1.39"
|
version = "1.1.44"
|
||||||
edition = "2024"
|
edition = "2024"
|
||||||
|
|
||||||
[[bin]]
|
[[bin]]
|
||||||
|
|||||||
@@ -38,9 +38,7 @@ pub struct CommonArgs {
|
|||||||
#[arg(
|
#[arg(
|
||||||
short = 'T',
|
short = 'T',
|
||||||
long,
|
long,
|
||||||
default_value_t = std::thread::available_parallelism()
|
default_value_t = obisys::effective_parallelism()
|
||||||
.map(|n| n.get())
|
|
||||||
.unwrap_or(1)
|
|
||||||
)]
|
)]
|
||||||
pub threads: usize,
|
pub threads: usize,
|
||||||
|
|
||||||
|
|||||||
@@ -3,13 +3,15 @@ use std::path::PathBuf;
|
|||||||
|
|
||||||
use clap::Args;
|
use clap::Args;
|
||||||
use kodama::{Method, linkage};
|
use kodama::{Method, linkage};
|
||||||
use obikindex::{DistanceMetric, KmerIndex};
|
use obifastwrite::{JsonVal, write_record};
|
||||||
|
use obikindex::{DistanceMetric, KmerIndex, RawSnpDistanceOutput, SiblingAnnexStats, SnpAlignment};
|
||||||
use speedytree::{DistanceMatrix, Hybrid, NeighborJoiningSolver, to_newick};
|
use speedytree::{DistanceMatrix, Hybrid, NeighborJoiningSolver, to_newick};
|
||||||
use tracing::info;
|
use tracing::info;
|
||||||
|
|
||||||
#[derive(clap::ValueEnum, Clone, Copy, Debug)]
|
#[derive(clap::ValueEnum, Clone, Copy, Debug)]
|
||||||
pub enum MetricArg {
|
pub enum MetricArg {
|
||||||
Jaccard,
|
Jaccard,
|
||||||
|
Mash,
|
||||||
Hamming,
|
Hamming,
|
||||||
BrayCurtis,
|
BrayCurtis,
|
||||||
#[value(name = "relfreq-bray-curtis")]
|
#[value(name = "relfreq-bray-curtis")]
|
||||||
@@ -26,6 +28,7 @@ impl From<MetricArg> for DistanceMetric {
|
|||||||
fn from(m: MetricArg) -> Self {
|
fn from(m: MetricArg) -> Self {
|
||||||
match m {
|
match m {
|
||||||
MetricArg::Jaccard => DistanceMetric::Jaccard,
|
MetricArg::Jaccard => DistanceMetric::Jaccard,
|
||||||
|
MetricArg::Mash => DistanceMetric::Mash,
|
||||||
MetricArg::Hamming => DistanceMetric::Hamming,
|
MetricArg::Hamming => DistanceMetric::Hamming,
|
||||||
MetricArg::BrayCurtis => DistanceMetric::BrayCurtis,
|
MetricArg::BrayCurtis => DistanceMetric::BrayCurtis,
|
||||||
MetricArg::RelfreqBrayCurtis => DistanceMetric::RelfreqBrayCurtis,
|
MetricArg::RelfreqBrayCurtis => DistanceMetric::RelfreqBrayCurtis,
|
||||||
@@ -62,7 +65,37 @@ pub struct DistanceArgs {
|
|||||||
#[arg(long)]
|
#[arg(long)]
|
||||||
pub upgma: bool,
|
pub upgma: bool,
|
||||||
|
|
||||||
|
/// Build the sibling-count/minorant annex on this (multi-genome) index
|
||||||
|
/// — see `docmd/theory/evolutionary_distances.md`, Step 2b. Construction
|
||||||
|
/// only; does not by itself compute or write any statistics.
|
||||||
|
#[arg(long)]
|
||||||
|
pub sibling_annex: bool,
|
||||||
|
|
||||||
|
/// Tally the sibling-count distribution (CSV) of an already-built annex
|
||||||
|
/// (run with `--sibling-annex` first, in this invocation or an earlier
|
||||||
|
/// one). A separate, occasional diagnostic pass — not run every time the
|
||||||
|
/// annex itself is (re)built.
|
||||||
|
#[arg(long)]
|
||||||
|
pub sibling_stats: bool,
|
||||||
|
|
||||||
|
/// Compute the raw p-distance restricted to loci that are single-copy
|
||||||
|
/// in both genomes of each pair (an already-built sibling annex is
|
||||||
|
/// required — run with `--sibling-annex` first, in this invocation or
|
||||||
|
/// an earlier one). A quick way to test the central-position SNP
|
||||||
|
/// estimator against a real index; not the full `SnpTally` design.
|
||||||
|
#[arg(long)]
|
||||||
|
pub raw_snp_distance: bool,
|
||||||
|
|
||||||
|
/// Write a SNP-only pseudo-alignment (FASTA, IUPAC-coded) from an
|
||||||
|
/// already-built sibling annex — one row per genome, one column per
|
||||||
|
/// variable family (monomorphic families skipped), no flanking
|
||||||
|
/// sequence. See `docmd/theory/evolutionary_distances.md`,
|
||||||
|
/// "Multi-genome framing: family as pseudo-alignment column".
|
||||||
|
#[arg(long)]
|
||||||
|
pub snp: bool,
|
||||||
|
|
||||||
/// Output prefix: <prefix>_dist.csv, <prefix>_shared.csv,
|
/// Output prefix: <prefix>_dist.csv, <prefix>_shared.csv,
|
||||||
|
/// <prefix>_siblings.csv, <prefix>_rawsnp.csv, <prefix>_snp.fasta,
|
||||||
/// <prefix>_nj.nwk, <prefix>_upgma.nwk.
|
/// <prefix>_nj.nwk, <prefix>_upgma.nwk.
|
||||||
/// If omitted, the distance matrix is written to stdout.
|
/// If omitted, the distance matrix is written to stdout.
|
||||||
#[arg(short, long)]
|
#[arg(short, long)]
|
||||||
@@ -78,6 +111,51 @@ pub fn run(args: DistanceArgs) {
|
|||||||
|
|
||||||
let labels: Vec<String> = idx.meta().genomes.iter().map(|g| g.label.clone()).collect();
|
let labels: Vec<String> = idx.meta().genomes.iter().map(|g| g.label.clone()).collect();
|
||||||
let n = labels.len();
|
let n = labels.len();
|
||||||
|
|
||||||
|
// ── Sibling-count/minorant annex (independent of the distance metric) ──
|
||||||
|
// Construction (`--sibling-annex`) and stats (`--sibling-stats`) are
|
||||||
|
// deliberately decoupled: the annex is meant to be (re)built routinely,
|
||||||
|
// the distribution only occasionally, on demand.
|
||||||
|
if args.sibling_annex {
|
||||||
|
info!("building sibling-count/minorant annex");
|
||||||
|
idx.build_sibling_annex().unwrap_or_else(|e| {
|
||||||
|
eprintln!("error building sibling annex: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
}
|
||||||
|
if args.sibling_stats {
|
||||||
|
let stats = idx.sibling_annex_stats().unwrap_or_else(|e| {
|
||||||
|
eprintln!("error computing sibling-annex stats: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
write_sibling_stats_csv(&stats, &labels, &args.output);
|
||||||
|
}
|
||||||
|
if args.raw_snp_distance {
|
||||||
|
let result = idx.raw_snp_distance().unwrap_or_else(|e| {
|
||||||
|
eprintln!("error computing raw SNP distance: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
write_raw_snp_distance_csv(&result, &labels, &args.output);
|
||||||
|
}
|
||||||
|
if args.snp {
|
||||||
|
let alignment = idx.snp_pseudo_alignment().unwrap_or_else(|e| {
|
||||||
|
eprintln!("error computing SNP pseudo-alignment: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
write_snp_fasta(&alignment, &labels, &args.output);
|
||||||
|
}
|
||||||
|
|
||||||
|
// `--sibling-annex`/`--sibling-stats`/`--raw-snp-distance`/`--snp` are
|
||||||
|
// their own operation, not a modifier on top of a distance-metric
|
||||||
|
// computation — a metric was never requested by asking for any of them,
|
||||||
|
// so there is nothing for the rest of this function to compute. Not a
|
||||||
|
// historical accident to keep: stop here rather than always also
|
||||||
|
// running a Jaccard (or whichever `--metric` defaults to) pass and
|
||||||
|
// printing an unrequested matrix.
|
||||||
|
if args.sibling_annex || args.sibling_stats || args.raw_snp_distance || args.snp {
|
||||||
|
return;
|
||||||
|
}
|
||||||
|
|
||||||
info!(
|
info!(
|
||||||
"computing {:?} distances for {} genome(s)",
|
"computing {:?} distances for {} genome(s)",
|
||||||
args.metric, n
|
args.metric, n
|
||||||
@@ -189,6 +267,103 @@ pub fn run(args: DistanceArgs) {
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ── Family-size distribution → CSV ──────────────────────────────────────────
|
||||||
|
//
|
||||||
|
// Each row is a family (the up-to-4 k-mers sharing flanks, differing only at
|
||||||
|
// the centre), counted once — at its minorant — regardless of how many of
|
||||||
|
// its members are observed. Family size 1..4 (not "sibling count" 0..3):
|
||||||
|
// see `docmd/theory/evolutionary_distances.md`, "Definitions".
|
||||||
|
|
||||||
|
fn write_sibling_stats_csv(stats: &SiblingAnnexStats, labels: &[String], output: &Option<PathBuf>) {
|
||||||
|
// One row per genome (4 columns, family size 1-4: number of families of
|
||||||
|
// that size for which the genome carries at least one member), plus a
|
||||||
|
// `global` row — the actual deduplicated family-size histogram
|
||||||
|
// (`stats.counts`), NOT a sum of the per-genome columns (a family shared
|
||||||
|
// by several genomes would otherwise be counted once per genome it
|
||||||
|
// appears in, inflating the total beyond the real family count).
|
||||||
|
let path = output.as_ref()
|
||||||
|
.map(|p| format!("{}_siblings.csv", p.display()))
|
||||||
|
.unwrap_or_else(|| "siblings.csv".into());
|
||||||
|
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error creating {path}: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
}));
|
||||||
|
writeln!(f, "genome,1,2,3,4").unwrap();
|
||||||
|
for (label, counts) in labels.iter().zip(stats.per_genome.iter()) {
|
||||||
|
writeln!(f, "{label},{},{},{},{}", counts[0], counts[1], counts[2], counts[3]).unwrap();
|
||||||
|
}
|
||||||
|
writeln!(
|
||||||
|
f, "global,{},{},{},{}",
|
||||||
|
stats.counts[0], stats.counts[1], stats.counts[2], stats.counts[3],
|
||||||
|
).unwrap();
|
||||||
|
let total: u64 = stats.counts.iter().sum();
|
||||||
|
info!("family-size distribution → {path} (total {total} famil{})",
|
||||||
|
if total == 1 { "y" } else { "ies" });
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── Raw single-copy SNP distance → CSV ──────────────────────────────────────
|
||||||
|
//
|
||||||
|
// p_hat[i,j] = snp[i,j] / (snp[i,j] + shared[i,j]) over loci single-copy in
|
||||||
|
// both i and j — see `RawSnpDistanceOutput` / `KmerIndex::raw_snp_distance`.
|
||||||
|
// A single file: the distance matrix, with an eligible-loci count alongside
|
||||||
|
// each value so a 0/0 pair (no eligible locus at all) is distinguishable
|
||||||
|
// from a genuinely identical pair.
|
||||||
|
|
||||||
|
fn write_raw_snp_distance_csv(result: &RawSnpDistanceOutput, labels: &[String], output: &Option<PathBuf>) {
|
||||||
|
let path = output.as_ref()
|
||||||
|
.map(|p| format!("{}_rawsnp.csv", p.display()))
|
||||||
|
.unwrap_or_else(|| "rawsnp.csv".into());
|
||||||
|
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error creating {path}: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
}));
|
||||||
|
let n = labels.len();
|
||||||
|
write!(f, "genome").unwrap();
|
||||||
|
for g in labels { write!(f, ",{g}").unwrap(); }
|
||||||
|
writeln!(f).unwrap();
|
||||||
|
for (i, g) in labels.iter().enumerate() {
|
||||||
|
write!(f, "{g}").unwrap();
|
||||||
|
for j in 0..n {
|
||||||
|
let snp = result.snp[[i, j]];
|
||||||
|
let shared = result.shared[[i, j]];
|
||||||
|
let eligible = snp + shared;
|
||||||
|
if eligible == 0 {
|
||||||
|
write!(f, ",NA").unwrap();
|
||||||
|
} else {
|
||||||
|
write!(f, ",{:.6}", snp as f64 / eligible as f64).unwrap();
|
||||||
|
}
|
||||||
|
}
|
||||||
|
writeln!(f).unwrap();
|
||||||
|
}
|
||||||
|
info!("raw single-copy SNP distance matrix → {path}");
|
||||||
|
}
|
||||||
|
|
||||||
|
// ── SNP-only pseudo-alignment → FASTA ───────────────────────────────────────
|
||||||
|
//
|
||||||
|
// One record per genome, IUPAC-coded, no flanking sequence — see
|
||||||
|
// `SnpAlignment` / `KmerIndex::snp_pseudo_alignment`. Uses the project's
|
||||||
|
// existing FASTA writer (`obifastwrite::write_record`) rather than
|
||||||
|
// hand-rolling one.
|
||||||
|
|
||||||
|
fn write_snp_fasta(alignment: &SnpAlignment, labels: &[String], output: &Option<PathBuf>) {
|
||||||
|
let path = output.as_ref()
|
||||||
|
.map(|p| format!("{}_snp.fasta", p.display()))
|
||||||
|
.unwrap_or_else(|| "snp.fasta".into());
|
||||||
|
let mut f = BufWriter::new(std::fs::File::create(&path).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error creating {path}: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
}));
|
||||||
|
let n_sites = alignment.sequences.first().map(|s| s.len()).unwrap_or(0);
|
||||||
|
for (label, seq) in labels.iter().zip(alignment.sequences.iter()) {
|
||||||
|
write_record(seq, label, &[("n_sites", JsonVal::Num(n_sites as u64))], &mut f).unwrap_or_else(|e| {
|
||||||
|
eprintln!("error writing {path}: {e}");
|
||||||
|
std::process::exit(1);
|
||||||
|
});
|
||||||
|
}
|
||||||
|
info!("SNP pseudo-alignment → {path} ({n_sites} site{})",
|
||||||
|
if n_sites == 1 { "" } else { "s" });
|
||||||
|
}
|
||||||
|
|
||||||
// ── UPGMA Newick from kodama dendrogram ───────────────────────────────────────
|
// ── UPGMA Newick from kodama dendrogram ───────────────────────────────────────
|
||||||
|
|
||||||
fn upgma_to_newick(dendro: &kodama::Dendrogram<f64>, names: &[String]) -> String {
|
fn upgma_to_newick(dendro: &kodama::Dendrogram<f64>, names: &[String]) -> String {
|
||||||
|
|||||||
@@ -151,12 +151,14 @@ pub struct FilterArgs {
|
|||||||
pub outgroup: Vec<String>,
|
pub outgroup: Vec<String>,
|
||||||
|
|
||||||
/// Minimum number of ingroup genomes containing the k-mer
|
/// Minimum number of ingroup genomes containing the k-mer
|
||||||
#[arg(long)]
|
/// (negative: offset from group size, e.g. -1 = all but one)
|
||||||
pub min_count: Option<usize>,
|
#[arg(long, allow_hyphen_values = true)]
|
||||||
|
pub min_count: Option<isize>,
|
||||||
|
|
||||||
/// Maximum number of ingroup genomes containing the k-mer
|
/// Maximum number of ingroup genomes containing the k-mer
|
||||||
#[arg(long)]
|
/// (negative: offset from group size, e.g. -1 = all but one)
|
||||||
pub max_count: Option<usize>,
|
#[arg(long, allow_hyphen_values = true)]
|
||||||
|
pub max_count: Option<isize>,
|
||||||
|
|
||||||
/// Minimum fraction of ingroup genomes containing the k-mer [0.0–1.0]
|
/// Minimum fraction of ingroup genomes containing the k-mer [0.0–1.0]
|
||||||
/// (default 1.0 when --ingroup is set, 0.0 otherwise)
|
/// (default 1.0 when --ingroup is set, 0.0 otherwise)
|
||||||
@@ -168,13 +170,15 @@ pub struct FilterArgs {
|
|||||||
pub max_frac: Option<f64>,
|
pub max_frac: Option<f64>,
|
||||||
|
|
||||||
/// Minimum number of outgroup genomes containing the k-mer
|
/// Minimum number of outgroup genomes containing the k-mer
|
||||||
#[arg(long)]
|
/// (negative: offset from outgroup size, e.g. -1 = all but one)
|
||||||
pub min_outgroup_count: Option<usize>,
|
#[arg(long, allow_hyphen_values = true)]
|
||||||
|
pub min_outgroup_count: Option<isize>,
|
||||||
|
|
||||||
/// Maximum number of outgroup genomes containing the k-mer
|
/// Maximum number of outgroup genomes containing the k-mer
|
||||||
/// (default 0 when --outgroup is set, no constraint otherwise)
|
/// (default 0 when --outgroup is set, no constraint otherwise;
|
||||||
#[arg(long)]
|
/// negative: offset from outgroup size, e.g. -1 = all but one)
|
||||||
pub max_outgroup_count: Option<usize>,
|
#[arg(long, allow_hyphen_values = true)]
|
||||||
|
pub max_outgroup_count: Option<isize>,
|
||||||
|
|
||||||
/// Minimum fraction of outgroup genomes containing the k-mer [0.0–1.0]
|
/// Minimum fraction of outgroup genomes containing the k-mer [0.0–1.0]
|
||||||
#[arg(long)]
|
#[arg(long)]
|
||||||
@@ -239,12 +243,12 @@ pub fn matching_genome_indices(pred_str: &str, genomes: &[GenomeInfo]) -> Result
|
|||||||
|
|
||||||
pub struct GroupFilterParams {
|
pub struct GroupFilterParams {
|
||||||
pub threshold: u32,
|
pub threshold: u32,
|
||||||
pub min_count: Option<usize>,
|
pub min_count: Option<isize>,
|
||||||
pub max_count: Option<usize>,
|
pub max_count: Option<isize>,
|
||||||
pub min_frac: Option<f64>,
|
pub min_frac: Option<f64>,
|
||||||
pub max_frac: Option<f64>,
|
pub max_frac: Option<f64>,
|
||||||
pub min_outgroup_count: Option<usize>,
|
pub min_outgroup_count: Option<isize>,
|
||||||
pub max_outgroup_count: Option<usize>,
|
pub max_outgroup_count: Option<isize>,
|
||||||
pub min_outgroup_frac: Option<f64>,
|
pub min_outgroup_frac: Option<f64>,
|
||||||
pub max_outgroup_frac: Option<f64>,
|
pub max_outgroup_frac: Option<f64>,
|
||||||
}
|
}
|
||||||
@@ -279,12 +283,20 @@ pub fn build_group_filter(
|
|||||||
let default_min_frac = if !ingroup_preds.is_empty() && !ingroup_quorum_explicit { 1.0 } else { 0.0 };
|
let default_min_frac = if !ingroup_preds.is_empty() && !ingroup_quorum_explicit { 1.0 } else { 0.0 };
|
||||||
let default_max_outgroup_count = if !outgroup_preds.is_empty() && !outgroup_quorum_explicit { 0 } else { out_size };
|
let default_max_outgroup_count = if !outgroup_preds.is_empty() && !outgroup_quorum_explicit { 0 } else { out_size };
|
||||||
|
|
||||||
let min_count = p.min_count.unwrap_or(0);
|
// Resolve a signed count: negative means an offset from the group size
|
||||||
let max_count = p.max_count.unwrap_or(in_size);
|
// (e.g. -1 = all but one), floored at 1 so the negative form always keeps
|
||||||
|
// constraining the group — even a singleton group, where n-1 would be 0
|
||||||
|
// and would otherwise drop the constraint entirely.
|
||||||
|
let resolve = |v: isize, size: usize| -> usize {
|
||||||
|
if v < 0 { (size as isize + v).max(1) as usize } else { v as usize }
|
||||||
|
};
|
||||||
|
|
||||||
|
let min_count = p.min_count.map(|v| resolve(v, in_size)).unwrap_or(0);
|
||||||
|
let max_count = p.max_count.map(|v| resolve(v, in_size)).unwrap_or(in_size);
|
||||||
let min_frac = p.min_frac.unwrap_or(default_min_frac);
|
let min_frac = p.min_frac.unwrap_or(default_min_frac);
|
||||||
let max_frac = p.max_frac.unwrap_or(1.0);
|
let max_frac = p.max_frac.unwrap_or(1.0);
|
||||||
let min_outgroup_count = p.min_outgroup_count.unwrap_or(0);
|
let min_outgroup_count = p.min_outgroup_count.map(|v| resolve(v, out_size)).unwrap_or(0);
|
||||||
let max_outgroup_count = p.max_outgroup_count.unwrap_or(default_max_outgroup_count);
|
let max_outgroup_count = p.max_outgroup_count.map(|v| resolve(v, out_size)).unwrap_or(default_max_outgroup_count);
|
||||||
let min_outgroup_frac = p.min_outgroup_frac.unwrap_or(0.0);
|
let min_outgroup_frac = p.min_outgroup_frac.unwrap_or(0.0);
|
||||||
let max_outgroup_frac = p.max_outgroup_frac.unwrap_or(1.0);
|
let max_outgroup_frac = p.max_outgroup_frac.unwrap_or(1.0);
|
||||||
|
|
||||||
|
|||||||
@@ -70,9 +70,7 @@ pub struct QueryArgs {
|
|||||||
#[arg(
|
#[arg(
|
||||||
short = 'T',
|
short = 'T',
|
||||||
long,
|
long,
|
||||||
default_value_t = std::thread::available_parallelism()
|
default_value_t = obisys::effective_parallelism()
|
||||||
.map(|n| n.get())
|
|
||||||
.unwrap_or(1)
|
|
||||||
)]
|
)]
|
||||||
pub threads: usize,
|
pub threads: usize,
|
||||||
|
|
||||||
|
|||||||
@@ -341,6 +341,27 @@ impl<L: KmerLength> CanonicalKmerOf<L> {
|
|||||||
]
|
]
|
||||||
}
|
}
|
||||||
|
|
||||||
|
/// Return the four central canonical neighbours (each already canonical),
|
||||||
|
/// substituting the base at the middle position `m = (L::len()-1)/2`
|
||||||
|
/// (well-defined for odd `L::len()`). Each of the 4 substitutions is
|
||||||
|
/// canonicalised independently — this correctly handles the case where a
|
||||||
|
/// substitution flips the canonical orientation, unlike inferring the
|
||||||
|
/// variant from a fixed-orientation flank key. One of the 4 equals
|
||||||
|
/// `self`'s own canonical form (the identity substitution); callers that
|
||||||
|
/// only want the 3 genuine variants should skip it.
|
||||||
|
pub fn central_canonical_neighbors(&self) -> [CanonicalKmerOf<L>; 4] {
|
||||||
|
let k = L::len();
|
||||||
|
let m = (k - 1) / 2;
|
||||||
|
let shift = KMER_BITS - 2 - 2 * m;
|
||||||
|
let cleared = self.0 & !((0b11 as RawKmer) << shift);
|
||||||
|
[
|
||||||
|
KmerOf::<L>(cleared | ((0 as RawKmer) << shift), PhantomData).canonical(),
|
||||||
|
KmerOf::<L>(cleared | ((1 as RawKmer) << shift), PhantomData).canonical(),
|
||||||
|
KmerOf::<L>(cleared | ((2 as RawKmer) << shift), PhantomData).canonical(),
|
||||||
|
KmerOf::<L>(cleared | ((3 as RawKmer) << shift), PhantomData).canonical(),
|
||||||
|
]
|
||||||
|
}
|
||||||
|
|
||||||
/// Return the inner value as a raw [`KmerOf<L>`].
|
/// Return the inner value as a raw [`KmerOf<L>`].
|
||||||
#[inline]
|
#[inline]
|
||||||
pub fn into_kmer(self) -> KmerOf<L> {
|
pub fn into_kmer(self) -> KmerOf<L> {
|
||||||
|
|||||||
+33
-17
@@ -7,12 +7,28 @@
|
|||||||
//! different value panics. This prevents silent divergence between the global
|
//! different value panics. This prevents silent divergence between the global
|
||||||
//! parameter and the values used to build data structures.
|
//! parameter and the values used to build data structures.
|
||||||
//!
|
//!
|
||||||
//! In test builds (`#[cfg(test)]`) the same public API is backed by
|
//! In test builds (`#[cfg(test)]`) the same public API is backed by plain
|
||||||
//! `thread_local!` [`Cell`]s instead. Each test thread gets its own
|
//! process-wide atomics instead, freely overwritable (no write-once
|
||||||
//! independent copies of `K` and `M`, so tests can use arbitrary values
|
//! constraint) so tests don't need a reset mechanism between runs.
|
||||||
//! without coordinating with one another and without any reset mechanism.
|
//!
|
||||||
//! The `OnceLock` constraint is deliberately absent: test isolation is
|
//! An earlier version of this module used `thread_local!` `Cell`s here,
|
||||||
//! provided by thread locality, not by write-once semantics.
|
//! reasoning that "each test thread gets its own copy" gives isolation
|
||||||
|
//! between tests using different `k`/`m` values. That assumption broke as
|
||||||
|
//! soon as any code under test fanned work out to *other* threads it
|
||||||
|
//! doesn't control — `PartitionRunner`'s pre-spawned workers, or a bare
|
||||||
|
//! `rayon::par_iter()` — since a freshly spawned thread never inherits the
|
||||||
|
//! calling test thread's thread-local state, silently reading back `k=0`
|
||||||
|
//! there instead (surfaced as a `bitvec`/slice-indexing panic deep inside
|
||||||
|
//! whatever used the bogus length). Process-wide atomics make `k()`/`m()`
|
||||||
|
//! correct on *any* thread without every call site having to know to
|
||||||
|
//! re-propagate them. Unset still silently reads back as `0` (same as the
|
||||||
|
//! old `Cell` default) rather than panicking: several existing tests read
|
||||||
|
//! `m()` without ever calling `set_m` themselves, relying on that default.
|
||||||
|
//! The trade-off: tests that genuinely need different `k`/`m` values from
|
||||||
|
//! other tests must not run concurrently with them in the same process (in
|
||||||
|
//! practice: every test file in this workspace already uses one fixed
|
||||||
|
//! `k`/`m` pair for all its own tests, so this doesn't currently cost
|
||||||
|
//! anything).
|
||||||
|
|
||||||
// ── Production implementation ─────────────────────────────────────────────────
|
// ── Production implementation ─────────────────────────────────────────────────
|
||||||
|
|
||||||
@@ -44,22 +60,22 @@ mod state {
|
|||||||
|
|
||||||
// ── Test implementation ───────────────────────────────────────────────────────
|
// ── Test implementation ───────────────────────────────────────────────────────
|
||||||
//
|
//
|
||||||
// Each test thread owns its private K and M via thread_local!, so tests may
|
// Process-wide, freely overwritable (no write-once constraint), visible from
|
||||||
// call set_k / set_m with any value without affecting other tests.
|
// any thread — including threads a test doesn't spawn itself (rayon workers,
|
||||||
|
// PartitionRunner workers, ...). `0` (never explicitly set) is returned as-is,
|
||||||
|
// same default as the old thread-local `Cell`.
|
||||||
|
|
||||||
#[cfg(any(test, feature = "test-utils"))]
|
#[cfg(any(test, feature = "test-utils"))]
|
||||||
mod state {
|
mod state {
|
||||||
use std::cell::Cell;
|
use std::sync::atomic::{AtomicUsize, Ordering};
|
||||||
|
|
||||||
thread_local! {
|
static K: AtomicUsize = AtomicUsize::new(0);
|
||||||
static K: Cell<usize> = Cell::new(0);
|
static M: AtomicUsize = AtomicUsize::new(0);
|
||||||
static M: Cell<usize> = Cell::new(0);
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn set_k(k: usize) { K.with(|c| c.set(k)); }
|
pub fn set_k(k: usize) { K.store(k, Ordering::SeqCst); }
|
||||||
pub fn k() -> usize { K.with(|c| c.get()) }
|
pub fn k() -> usize { K.load(Ordering::SeqCst) }
|
||||||
pub fn set_m(m: usize) { M.with(|c| c.set(m)); }
|
pub fn set_m(m: usize) { M.store(m, Ordering::SeqCst); }
|
||||||
pub fn m() -> usize { M.with(|c| c.get()) }
|
pub fn m() -> usize { M.load(Ordering::SeqCst) }
|
||||||
}
|
}
|
||||||
|
|
||||||
// ── Public API (identical signature in both configurations) ───────────────────
|
// ── Public API (identical signature in both configurations) ───────────────────
|
||||||
|
|||||||
@@ -210,4 +210,46 @@ mod tests {
|
|||||||
check!(31);
|
check!(31);
|
||||||
check!(32);
|
check!(32);
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ── central_canonical_neighbors ─────────────────────────────────────────
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn central_canonical_neighbors_hand_checked_k3() {
|
||||||
|
// k=3, centre = index 1. For "ACG", every one of the 4 central
|
||||||
|
// substitutions ("AAG","ACG","AGG","ATG") happens to stay in forward
|
||||||
|
// orientation when canonicalised (verified by hand: each is already
|
||||||
|
// lexicographically <= its own reverse complement), so this case
|
||||||
|
// exercises the substitution logic without the RC-flip edge case.
|
||||||
|
let ck = KmerOf::<ConstLen<3>>::from_ascii(b"ACG").unwrap().canonical();
|
||||||
|
let neighbours = ck.central_canonical_neighbors();
|
||||||
|
let ascii: Vec<Vec<u8>> = neighbours.iter().map(|n| n.to_ascii()).collect();
|
||||||
|
assert_eq!(ascii, vec![b"AAG".to_vec(), b"ACG".to_vec(), b"AGG".to_vec(), b"ATG".to_vec()]);
|
||||||
|
// The identity substitution (centre unchanged) must reproduce `ck`.
|
||||||
|
assert!(neighbours.contains(&ck));
|
||||||
|
}
|
||||||
|
|
||||||
|
#[test]
|
||||||
|
fn central_canonical_neighbors_identity_present_for_various_k() {
|
||||||
|
macro_rules! check {
|
||||||
|
($n:expr) => {{
|
||||||
|
let ck = KmerOf::<ConstLen<$n>>::from_ascii(&make_seq::<$n>())
|
||||||
|
.unwrap()
|
||||||
|
.canonical();
|
||||||
|
let neighbours = ck.central_canonical_neighbors();
|
||||||
|
assert!(
|
||||||
|
neighbours.contains(&ck),
|
||||||
|
"identity substitution missing from central_canonical_neighbors for k={}",
|
||||||
|
$n
|
||||||
|
);
|
||||||
|
// Every returned neighbour must itself already be canonical.
|
||||||
|
for n in &neighbours {
|
||||||
|
assert_eq!(n.into_kmer().canonical(), *n, "neighbour not canonical for k={}", $n);
|
||||||
|
}
|
||||||
|
}};
|
||||||
|
}
|
||||||
|
check!(1);
|
||||||
|
check!(3);
|
||||||
|
check!(5);
|
||||||
|
check!(31);
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -10,7 +10,8 @@ pub mod stream_iter;
|
|||||||
mod scratch;
|
mod scratch;
|
||||||
|
|
||||||
pub(crate) mod encoding;
|
pub(crate) mod encoding;
|
||||||
pub(crate) mod rolling_stat;
|
#[allow(missing_docs)]
|
||||||
|
pub mod rolling_stat;
|
||||||
|
|
||||||
pub use iter::SuperKmerIter;
|
pub use iter::SuperKmerIter;
|
||||||
pub use scratch::SuperKmerScratch;
|
pub use scratch::SuperKmerScratch;
|
||||||
|
|||||||
@@ -196,13 +196,6 @@ impl RollingStat {
|
|||||||
.map(|raw| Minimizer::from_raw_unchecked(raw << (64 - self.m * 2)))
|
.map(|raw| Minimizer::from_raw_unchecked(raw << (64 - self.m * 2)))
|
||||||
}
|
}
|
||||||
|
|
||||||
pub fn entropy(&self, order: usize) -> Option<f64> {
|
|
||||||
if !self.ready() {
|
|
||||||
return None;
|
|
||||||
}
|
|
||||||
Some(self.entropy.entropy(order))
|
|
||||||
}
|
|
||||||
|
|
||||||
pub fn normalized_entropy(&self) -> Option<f64> {
|
pub fn normalized_entropy(&self) -> Option<f64> {
|
||||||
if !self.ready() {
|
if !self.ready() {
|
||||||
return None;
|
return None;
|
||||||
|
|||||||
@@ -102,9 +102,9 @@ fn roundtrip_single() {
|
|||||||
|
|
||||||
#[test]
|
#[test]
|
||||||
fn roundtrip_all_lengths() {
|
fn roundtrip_all_lengths() {
|
||||||
obikseq::params::set_k(11);
|
setup();
|
||||||
let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
|
let bases: Vec<u8> = (0..300).map(|i| b"ACGT"[i % 4]).collect();
|
||||||
for len in (11..=19).chain([255, 256, 257]) {
|
for len in (TEST_K..=19).chain([255, 256, 257]) {
|
||||||
let sk = make_sk(&bases[..len]);
|
let sk = make_sk(&bases[..len]);
|
||||||
let mut buf = Vec::new();
|
let mut buf = Vec::new();
|
||||||
sk.write_to_binary(&mut buf).unwrap();
|
sk.write_to_binary(&mut buf).unwrap();
|
||||||
|
|||||||
+89
-3
@@ -202,6 +202,94 @@ fn cgroup_v1_available() -> Option<u64> {
|
|||||||
Some(limit.saturating_sub(used))
|
Some(limit.saturating_sub(used))
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// ── CPU parallelism query ────────────────────────────────────────────────────
|
||||||
|
|
||||||
|
/// Returns the number of cores this process can actually use concurrently.
|
||||||
|
///
|
||||||
|
/// `std::thread::available_parallelism()` reads CPU affinity
|
||||||
|
/// (`sched_getaffinity`), not the container's CPU quota — a Docker/cgroup
|
||||||
|
/// container commonly reports the *host's* full core count this way while
|
||||||
|
/// actually being throttled (via `cpu.max`/`cpu.cfs_quota_us`) to a fraction
|
||||||
|
/// of a core. Sizing a thread/worker pool off the unthrottled count causes
|
||||||
|
/// severe oversubscription: dozens of threads contending for a sliver of
|
||||||
|
/// real CPU time, which can look indistinguishable from a hang for minutes
|
||||||
|
/// or hours (observed in CI). On Linux, this reads the cgroup CPU quota
|
||||||
|
/// first and returns `min(cgroup_quota, host_parallelism)` when a finite
|
||||||
|
/// quota is found; falls back to `available_parallelism()` otherwise (same
|
||||||
|
/// convention as [`available_memory_bytes`]).
|
||||||
|
pub fn effective_parallelism() -> usize {
|
||||||
|
let host = std::thread::available_parallelism().map(|n| n.get()).unwrap_or(1);
|
||||||
|
#[cfg(target_os = "linux")]
|
||||||
|
{
|
||||||
|
if let Some(quota) = cgroup_v2_cpu_quota() {
|
||||||
|
let effective = quota.clamp(1, host);
|
||||||
|
tracing::debug!(host, quota, effective, source = "cgroup v2", "effective_parallelism");
|
||||||
|
return effective;
|
||||||
|
}
|
||||||
|
if let Some(quota) = cgroup_v1_cpu_quota() {
|
||||||
|
let effective = quota.clamp(1, host);
|
||||||
|
tracing::debug!(host, quota, effective, source = "cgroup v1", "effective_parallelism");
|
||||||
|
return effective;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
tracing::debug!(host, effective = host, source = "available_parallelism (no cgroup quota found)", "effective_parallelism");
|
||||||
|
host
|
||||||
|
}
|
||||||
|
|
||||||
|
/// cgroup v2 (unified hierarchy): reads `cpu.max` ("<quota> <period>", or
|
||||||
|
/// "max <period>" when unlimited) for the current process's cgroup, rounded
|
||||||
|
/// up to whole cores. Returns `None` if unlimited or on any parse error.
|
||||||
|
#[cfg(target_os = "linux")]
|
||||||
|
fn cgroup_v2_cpu_quota() -> Option<usize> {
|
||||||
|
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
|
||||||
|
let rel = cgroup
|
||||||
|
.lines()
|
||||||
|
.find(|l| l.starts_with("0::"))?
|
||||||
|
.strip_prefix("0::")?
|
||||||
|
.trim();
|
||||||
|
let base = format!("/sys/fs/cgroup{rel}");
|
||||||
|
let raw = std::fs::read_to_string(format!("{base}/cpu.max")).ok()?;
|
||||||
|
let mut parts = raw.split_whitespace();
|
||||||
|
let quota_str = parts.next()?;
|
||||||
|
let period: f64 = parts.next()?.parse().ok()?;
|
||||||
|
if quota_str == "max" {
|
||||||
|
return None; // unlimited
|
||||||
|
}
|
||||||
|
let quota: f64 = quota_str.parse().ok()?;
|
||||||
|
Some((quota / period).ceil().max(1.0) as usize)
|
||||||
|
}
|
||||||
|
|
||||||
|
/// cgroup v1 (cpu subsystem): reads `cpu.cfs_quota_us`/`cpu.cfs_period_us`,
|
||||||
|
/// rounded up to whole cores. Returns `None` if unlimited (quota <= 0) or on
|
||||||
|
/// any parse error.
|
||||||
|
#[cfg(target_os = "linux")]
|
||||||
|
fn cgroup_v1_cpu_quota() -> Option<usize> {
|
||||||
|
let cgroup = std::fs::read_to_string("/proc/self/cgroup").ok()?;
|
||||||
|
let path = cgroup
|
||||||
|
.lines()
|
||||||
|
.find(|l| l.contains(":cpu:") || l.contains(":cpu,cpuacct:"))?
|
||||||
|
.split(':')
|
||||||
|
.nth(2)?;
|
||||||
|
let base = format!("/sys/fs/cgroup/cpu{path}");
|
||||||
|
let quota: i64 = std::fs::read_to_string(format!("{base}/cpu.cfs_quota_us"))
|
||||||
|
.ok()?
|
||||||
|
.trim()
|
||||||
|
.parse()
|
||||||
|
.ok()?;
|
||||||
|
if quota <= 0 {
|
||||||
|
return None; // unlimited
|
||||||
|
}
|
||||||
|
let period: i64 = std::fs::read_to_string(format!("{base}/cpu.cfs_period_us"))
|
||||||
|
.ok()?
|
||||||
|
.trim()
|
||||||
|
.parse()
|
||||||
|
.ok()?;
|
||||||
|
if period <= 0 {
|
||||||
|
return None;
|
||||||
|
}
|
||||||
|
Some(((quota as f64) / (period as f64)).ceil().max(1.0) as usize)
|
||||||
|
}
|
||||||
|
|
||||||
// ── raw helpers ───────────────────────────────────────────────────────────────
|
// ── raw helpers ───────────────────────────────────────────────────────────────
|
||||||
|
|
||||||
fn get_rusage() -> rusage {
|
fn get_rusage() -> rusage {
|
||||||
@@ -654,9 +742,7 @@ impl fmt::Display for Reporter {
|
|||||||
return Ok(());
|
return Ok(());
|
||||||
}
|
}
|
||||||
|
|
||||||
let n_cores = std::thread::available_parallelism()
|
let n_cores = effective_parallelism();
|
||||||
.map(|n| n.get())
|
|
||||||
.unwrap_or(1);
|
|
||||||
|
|
||||||
// column widths
|
// column widths
|
||||||
let nw = self
|
let nw = self
|
||||||
|
|||||||
Reference in New Issue
Block a user