mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-03-28 06:40:53 +00:00
Compare commits
1 Commits
Release_4.
...
microasm
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
d70b0a5b42 |
19
.github/workflows/obitest.yml
vendored
19
.github/workflows/obitest.yml
vendored
@@ -1,19 +0,0 @@
|
||||
name: "Run the obitools command test suite"
|
||||
|
||||
on:
|
||||
push:
|
||||
branches:
|
||||
- master
|
||||
- V*
|
||||
jobs:
|
||||
build:
|
||||
runs-on: ubuntu-latest
|
||||
steps:
|
||||
- name: Setup Go
|
||||
uses: actions/setup-go@v2
|
||||
with:
|
||||
go-version: '1.23'
|
||||
- name: Checkout obitools4 project
|
||||
uses: actions/checkout@v4
|
||||
- name: Run tests
|
||||
run: make githubtests
|
||||
172
.github/workflows/release.yml
vendored
172
.github/workflows/release.yml
vendored
@@ -1,172 +0,0 @@
|
||||
name: Create Release on Tag
|
||||
|
||||
on:
|
||||
push:
|
||||
tags:
|
||||
- "Release_*"
|
||||
|
||||
permissions:
|
||||
contents: write
|
||||
|
||||
jobs:
|
||||
# First run tests
|
||||
test:
|
||||
runs-on: ubuntu-latest
|
||||
steps:
|
||||
- name: Setup Go
|
||||
uses: actions/setup-go@v5
|
||||
with:
|
||||
go-version: "1.23"
|
||||
- name: Checkout obitools4 project
|
||||
uses: actions/checkout@v4
|
||||
- name: Run tests
|
||||
run: make githubtests
|
||||
|
||||
# Build binaries for each platform
|
||||
build:
|
||||
needs: test
|
||||
strategy:
|
||||
matrix:
|
||||
include:
|
||||
- os: ubuntu-latest
|
||||
goos: linux
|
||||
goarch: amd64
|
||||
output_name: linux_amd64
|
||||
- os: ubuntu-24.04-arm
|
||||
goos: linux
|
||||
goarch: arm64
|
||||
output_name: linux_arm64
|
||||
- os: macos-15-intel
|
||||
goos: darwin
|
||||
goarch: amd64
|
||||
output_name: darwin_amd64
|
||||
- os: macos-latest
|
||||
goos: darwin
|
||||
goarch: arm64
|
||||
output_name: darwin_arm64
|
||||
|
||||
runs-on: ${{ matrix.os }}
|
||||
|
||||
steps:
|
||||
- name: Checkout code
|
||||
uses: actions/checkout@v4
|
||||
|
||||
- name: Setup Go
|
||||
uses: actions/setup-go@v5
|
||||
with:
|
||||
go-version: "1.23"
|
||||
|
||||
- name: Extract version from tag
|
||||
id: get_version
|
||||
run: |
|
||||
TAG=${GITHUB_REF#refs/tags/Release_}
|
||||
echo "version=$TAG" >> $GITHUB_OUTPUT
|
||||
|
||||
- name: Install build tools (macOS)
|
||||
if: runner.os == 'macOS'
|
||||
run: |
|
||||
# Ensure Xcode Command Line Tools are installed
|
||||
xcode-select --install 2>/dev/null || true
|
||||
xcode-select -p
|
||||
|
||||
- name: Build binaries
|
||||
env:
|
||||
GOOS: ${{ matrix.goos }}
|
||||
GOARCH: ${{ matrix.goarch }}
|
||||
VERSION: ${{ steps.get_version.outputs.version }}
|
||||
run: |
|
||||
make obitools
|
||||
mkdir -p artifacts
|
||||
# Create a single tar.gz with all binaries for this platform
|
||||
tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
|
||||
|
||||
- name: Upload artifacts
|
||||
uses: actions/upload-artifact@v4
|
||||
with:
|
||||
name: binaries-${{ matrix.output_name }}
|
||||
path: artifacts/*
|
||||
|
||||
# Create the release
|
||||
create-release:
|
||||
needs: build
|
||||
runs-on: ubuntu-latest
|
||||
steps:
|
||||
- name: Checkout code
|
||||
uses: actions/checkout@v4
|
||||
with:
|
||||
fetch-depth: 0
|
||||
|
||||
- name: Extract version from tag
|
||||
id: get_version
|
||||
run: |
|
||||
TAG=${GITHUB_REF#refs/tags/Release_}
|
||||
echo "version=$TAG" >> $GITHUB_OUTPUT
|
||||
|
||||
- name: Download all artifacts
|
||||
uses: actions/download-artifact@v4
|
||||
with:
|
||||
path: release-artifacts
|
||||
|
||||
- name: Prepare release directory
|
||||
run: |
|
||||
mkdir -p release
|
||||
find release-artifacts -type f -name "*.tar.gz" -exec cp {} release/ \;
|
||||
ls -lh release/
|
||||
|
||||
- name: Generate Release Notes
|
||||
env:
|
||||
VERSION: ${{ steps.get_version.outputs.version }}
|
||||
run: |
|
||||
PREV_TAG=$(git describe --tags --abbrev=0 HEAD^ 2>/dev/null || echo "")
|
||||
|
||||
echo "# OBITools4 Release ${VERSION}" > release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
|
||||
if [ -n "$PREV_TAG" ]; then
|
||||
echo "## Changes since ${PREV_TAG}" >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
git log ${PREV_TAG}..HEAD --pretty=format:"- %s" >> release_notes.md
|
||||
else
|
||||
echo "## Changes" >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
git log --pretty=format:"- %s" -n 20 >> release_notes.md
|
||||
fi
|
||||
|
||||
echo "" >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
echo "## Installation" >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
echo "Download the appropriate archive for your system and extract it:" >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
echo "### Linux (AMD64)" >> release_notes.md
|
||||
echo '```bash' >> release_notes.md
|
||||
echo "tar -xzf obitools4_${VERSION}_linux_amd64.tar.gz" >> release_notes.md
|
||||
echo '```' >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
echo "### Linux (ARM64)" >> release_notes.md
|
||||
echo '```bash' >> release_notes.md
|
||||
echo "tar -xzf obitools4_${VERSION}_linux_arm64.tar.gz" >> release_notes.md
|
||||
echo '```' >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
echo "### macOS (Intel)" >> release_notes.md
|
||||
echo '```bash' >> release_notes.md
|
||||
echo "tar -xzf obitools4_${VERSION}_darwin_amd64.tar.gz" >> release_notes.md
|
||||
echo '```' >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
echo "### macOS (Apple Silicon)" >> release_notes.md
|
||||
echo '```bash' >> release_notes.md
|
||||
echo "tar -xzf obitools4_${VERSION}_darwin_arm64.tar.gz" >> release_notes.md
|
||||
echo '```' >> release_notes.md
|
||||
echo "" >> release_notes.md
|
||||
echo "All OBITools4 binaries are included in each archive." >> release_notes.md
|
||||
|
||||
- name: Create GitHub Release
|
||||
uses: softprops/action-gh-release@v1
|
||||
with:
|
||||
name: Release ${{ steps.get_version.outputs.version }}
|
||||
body_path: release_notes.md
|
||||
files: release/*
|
||||
draft: false
|
||||
prerelease: false
|
||||
env:
|
||||
GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
|
||||
163
.gitignore
vendored
163
.gitignore
vendored
@@ -1,36 +1,135 @@
|
||||
**/cpu.pprof
|
||||
**/cpu.trace
|
||||
**/test
|
||||
**/bin
|
||||
**/vendor
|
||||
**/*.fastq
|
||||
**/*.fasta
|
||||
**/*.fastq.gz
|
||||
**/*.fasta.gz
|
||||
**/.DS_Store
|
||||
**/*.gml
|
||||
**/*.log
|
||||
**/xxx*
|
||||
**/*.sav
|
||||
**/*.old
|
||||
**/*.tgz
|
||||
**/*.yaml
|
||||
**/*.csv
|
||||
xx
|
||||
cpu.pprof
|
||||
cpu.trace
|
||||
test
|
||||
bin
|
||||
vendor
|
||||
*.fastq
|
||||
*.fasta
|
||||
*.fastq.gz
|
||||
*.fasta.gz
|
||||
.DS_Store
|
||||
*.gml
|
||||
*.log
|
||||
/argaly
|
||||
|
||||
.rhistory
|
||||
/.vscode
|
||||
/obiconvert
|
||||
/obicount
|
||||
/obimultiplex
|
||||
/obipairing
|
||||
/obipcr
|
||||
/obifind
|
||||
/obidistribute
|
||||
/obiuniq
|
||||
/build
|
||||
/bugs
|
||||
/Makefile.old
|
||||
.Rproj.user
|
||||
obitools.Rproj
|
||||
Stat_error.knit.md
|
||||
.Rhistory
|
||||
Stat_error.nb.html
|
||||
Stat_error.Rmd
|
||||
|
||||
/ncbitaxo
|
||||
/.luarc.json
|
||||
/doc/TAXO/
|
||||
/doc/results/
|
||||
/doc/_main.log
|
||||
/doc/_book/_main.tex
|
||||
/doc/_freeze/
|
||||
/doc/tutorial_files/
|
||||
/doc/wolf_data/
|
||||
/taxdump/
|
||||
/.vscode/
|
||||
|
||||
!/obitests/**
|
||||
!/sample/**
|
||||
LLM/**
|
||||
*_files
|
||||
|
||||
entropy.html
|
||||
bug_id.txt
|
||||
obilowmask_ref
|
||||
test_*
|
||||
/Algo-Alignement.numbers
|
||||
/Estimate_proba_true_seq.html
|
||||
/Estimate_proba_true_seq.nb.html
|
||||
/Estimate_proba_true_seq.Rmd
|
||||
/modele_error_euka.qmd
|
||||
/obitools.code-workspace
|
||||
.DS_Store
|
||||
.RData
|
||||
x
|
||||
xxx
|
||||
y
|
||||
/doc/wolf_diet.tgz
|
||||
/doc/man/depends
|
||||
/sample/wolf_R1.fasta.gz
|
||||
/sample/wolf_R2.fasta.gz
|
||||
/sample/euka03.ecotag.fasta.gz
|
||||
/sample/ratio.csv
|
||||
/sample/STD_PLN_1.dat
|
||||
/sample/STD_PLN_2.dat
|
||||
/sample/subset_Pasvik_R1.fastq.gz
|
||||
/sample/subset_Pasvik_R2.fastq.gz
|
||||
/sample/test_gobitools.fasta.bz2
|
||||
euka03.csv*
|
||||
gbbct793.seq.gz
|
||||
gbinv1003.seq.gz
|
||||
gbpln210.seq
|
||||
/doc/book/OBITools-V4.aux
|
||||
/doc/book/OBITools-V4.fdb_latexmk
|
||||
/doc/book/OBITools-V4.fls
|
||||
/doc/book/OBITools-V4.log
|
||||
/doc/book/OBITools-V4.pdf
|
||||
/doc/book/OBITools-V4.synctex.gz
|
||||
/doc/book/OBITools-V4.tex
|
||||
/doc/book/OBITools-V4.toc
|
||||
getoptions.adoc
|
||||
Archive.zip
|
||||
.DS_Store
|
||||
sample/.DS_Store
|
||||
sample/consensus_graphs/specimen_hac_plants_Vern_disicolor_.gml
|
||||
93954
|
||||
Bact03.e5.gb_R254.obipcr.idx.fasta.save
|
||||
sample/test.obipcr.log
|
||||
Bact02.e3.gb_R254.obipcr.fasta.gz
|
||||
Example_Arth03.ngsfilter
|
||||
SPER01.csv
|
||||
SPER03.csv
|
||||
wolf_diet_ngsfilter.txt
|
||||
xx
|
||||
xxx.gb
|
||||
yyy_geom.csv
|
||||
yyy_LCS.csv
|
||||
yyy.json
|
||||
bug_obimultiplex/toto
|
||||
bug_obimultiplex/toto_mapping
|
||||
bug_obimultiplex/tutu
|
||||
bug_obimultiplex/tutu_mapping
|
||||
bug_obipairing/GIT1_GH_ngsfilter.txt
|
||||
doc/book/TAXO/citations.dmp
|
||||
doc/book/TAXO/delnodes.dmp
|
||||
doc/book/TAXO/division.dmp
|
||||
doc/book/TAXO/gc.prt
|
||||
doc/book/TAXO/gencode.dmp
|
||||
doc/book/TAXO/merged.dmp
|
||||
doc/book/TAXO/names.dmp
|
||||
doc/book/TAXO/nodes.dmp
|
||||
doc/book/TAXO/readme.txt
|
||||
doc/book/wolf_data/Release-253/ncbitaxo/citations.dmp
|
||||
doc/book/wolf_data/Release-253/ncbitaxo/delnodes.dmp
|
||||
doc/book/wolf_data/Release-253/ncbitaxo/division.dmp
|
||||
doc/book/wolf_data/Release-253/ncbitaxo/gc.prt
|
||||
doc/book/wolf_data/Release-253/ncbitaxo/gencode.dmp
|
||||
doc/book/wolf_data/Release-253/ncbitaxo/merged.dmp
|
||||
doc/book/wolf_data/Release-253/ncbitaxo/names.dmp
|
||||
doc/book/wolf_data/Release-253/ncbitaxo/nodes.dmp
|
||||
doc/book/wolf_data/Release-253/ncbitaxo/readme.txt
|
||||
doc/book/results/toto.tasta
|
||||
sample/.DS_Store
|
||||
GO
|
||||
ncbitaxo/citations.dmp
|
||||
ncbitaxo/delnodes.dmp
|
||||
ncbitaxo/division.dmp
|
||||
ncbitaxo/gc.prt
|
||||
ncbitaxo/gencode.dmp
|
||||
ncbitaxo/merged.dmp
|
||||
ncbitaxo/names.dmp
|
||||
ncbitaxo/nodes.dmp
|
||||
ncbitaxo/readme.txt
|
||||
template.16S
|
||||
xxx.gz
|
||||
*.sav
|
||||
*.old
|
||||
ncbitaxo.tgz
|
||||
*.csv
|
||||
|
||||
122
Makefile
122
Makefile
@@ -2,9 +2,8 @@
|
||||
#export GOBIN=$(GOPATH)/bin
|
||||
#export PATH=$(GOBIN):$(shell echo $${PATH})
|
||||
|
||||
GOFLAGS=
|
||||
GOCMD=go
|
||||
GOBUILD=$(GOCMD) build $(GOFLAGS)
|
||||
GOBUILD=$(GOCMD) build # -compiler gccgo -gccgoflags -O3
|
||||
GOGENERATE=$(GOCMD) generate
|
||||
GOCLEAN=$(GOCMD) clean
|
||||
GOTEST=$(GOCMD) test
|
||||
@@ -17,12 +16,6 @@ PACKAGES_SRC:= $(wildcard pkg/*/*.go pkg/*/*/*.go)
|
||||
PACKAGE_DIRS:=$(sort $(patsubst %/,%,$(dir $(PACKAGES_SRC))))
|
||||
PACKAGES:=$(notdir $(PACKAGE_DIRS))
|
||||
|
||||
GITHOOK_SRC_DIR=git-hooks
|
||||
GITHOOKS_SRC:=$(wildcard $(GITHOOK_SRC_DIR)/*)
|
||||
|
||||
GITHOOK_DIR=.git/hooks
|
||||
GITHOOKS:=$(patsubst $(GITHOOK_SRC_DIR)/%,$(GITHOOK_DIR)/%,$(GITHOOKS_SRC))
|
||||
|
||||
OBITOOLS_SRC:= $(wildcard cmd/obitools/*/*.go)
|
||||
OBITOOLS_DIRS:=$(sort $(patsubst %/,%,$(dir $(OBITOOLS_SRC))))
|
||||
OBITOOLS:=$(notdir $(OBITOOLS_DIRS))
|
||||
@@ -60,31 +53,27 @@ endif
|
||||
|
||||
OUTPUT:=$(shell mktemp)
|
||||
|
||||
all: install-githook obitools
|
||||
|
||||
obitools: $(patsubst %,$(OBITOOLS_PREFIX)%,$(OBITOOLS))
|
||||
|
||||
install-githook: $(GITHOOKS)
|
||||
|
||||
$(GITHOOK_DIR)/%: $(GITHOOK_SRC_DIR)/%
|
||||
@echo installing $$(basename $@)...
|
||||
@mkdir -p $(GITHOOK_DIR)
|
||||
@cp $< $@
|
||||
@chmod +x $@
|
||||
all: obitools
|
||||
|
||||
packages: $(patsubst %,pkg-%,$(PACKAGES))
|
||||
obitools: $(patsubst %,$(OBITOOLS_PREFIX)%,$(OBITOOLS))
|
||||
|
||||
update-deps:
|
||||
go get -u ./...
|
||||
|
||||
test: .FORCE
|
||||
test:
|
||||
$(GOTEST) ./...
|
||||
|
||||
man:
|
||||
make -C doc man
|
||||
obibook:
|
||||
make -C doc obibook
|
||||
doc: man obibook
|
||||
|
||||
obitests:
|
||||
@for t in $$(find obitests -name test.sh -print) ; do \
|
||||
bash $${t} || exit 1;\
|
||||
done
|
||||
|
||||
githubtests: obitools obitests
|
||||
macos-pkg:
|
||||
@bash pkgs/macos/macos-installer-builder-master/macOS-x64/build-macos-x64.sh \
|
||||
OBITools \
|
||||
0.0.1
|
||||
|
||||
$(BUILD_DIR):
|
||||
mkdir -p $@
|
||||
@@ -94,80 +83,19 @@ $(foreach P,$(PACKAGE_DIRS),$(eval $(call MAKE_PKG_RULE,$(P))))
|
||||
|
||||
$(foreach P,$(OBITOOLS_DIRS),$(eval $(call MAKE_OBITOOLS_RULE,$(P))))
|
||||
|
||||
pkg/obioptions/version.go: version.txt .FORCE
|
||||
@version=$$(cat version.txt); \
|
||||
cat $@ \
|
||||
| sed -E 's/^var _Version = "[^"]*"/var _Version = "Release '$$version'"/' \
|
||||
pkg/obioptions/version.go: .FORCE
|
||||
ifneq ($(strip $(COMMIT_ID)),)
|
||||
@cat $@ \
|
||||
| sed -E 's/^var _Commit = "[^"]*"/var _Commit = "'$(COMMIT_ID)'"/' \
|
||||
| sed -E 's/^var _Version = "[^"]*"/var _Version = "'"$(LAST_TAG)"'"/' \
|
||||
> $(OUTPUT)
|
||||
|
||||
@diff $@ $(OUTPUT) 2>&1 > /dev/null \
|
||||
|| (echo "Update version.go to $$(cat version.txt)" && mv $(OUTPUT) $@)
|
||||
|| echo "Update version.go : $@ to $(LAST_TAG) ($(COMMIT_ID))" \
|
||||
&& mv $(OUTPUT) $@
|
||||
|
||||
@rm -f $(OUTPUT)
|
||||
endif
|
||||
|
||||
bump-version:
|
||||
@echo "Incrementing version..."
|
||||
@current=$$(cat version.txt); \
|
||||
echo " Current version: $$current"; \
|
||||
major=$$(echo $$current | cut -d. -f1); \
|
||||
minor=$$(echo $$current | cut -d. -f2); \
|
||||
patch=$$(echo $$current | cut -d. -f3); \
|
||||
new_patch=$$((patch + 1)); \
|
||||
new_version="$$major.$$minor.$$new_patch"; \
|
||||
echo " New version: $$new_version"; \
|
||||
echo "$$new_version" > version.txt
|
||||
@echo "✓ Version updated in version.txt"
|
||||
@$(MAKE) pkg/obioptions/version.go
|
||||
|
||||
jjnew:
|
||||
@echo "$(YELLOW)→ Creating a new commit...$(NC)"
|
||||
@echo "$(BLUE)→ Documenting current commit...$(NC)"
|
||||
@jj auto-describe
|
||||
@echo "$(BLUE)→ Done.$(NC)"
|
||||
@jj new
|
||||
@echo "$(GREEN)✓ New commit created$(NC)"
|
||||
|
||||
jjpush:
|
||||
@echo "$(YELLOW)→ Pushing commit to repository...$(NC)"
|
||||
@echo "$(BLUE)→ Documenting current commit...$(NC)"
|
||||
@jj auto-describe
|
||||
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
|
||||
@jj new
|
||||
@previous_version=$$(cat version.txt); \
|
||||
$(MAKE) bump-version; \
|
||||
version=$$(cat version.txt); \
|
||||
tag_name="Release_$$version"; \
|
||||
previous_tag="Release_$$previous_version"; \
|
||||
echo "$(BLUE)→ Documenting version bump commit...$(NC)"; \
|
||||
jj auto-describe; \
|
||||
echo "$(BLUE)→ Generating release notes from $$previous_tag to current commit...$(NC)"; \
|
||||
if command -v orla >/dev/null 2>&1 && command -v jq >/dev/null 2>&1; then \
|
||||
release_json=$$(ORLA_MAX_TOOL_CALLS=50 jj log -r "$$previous_tag::@" -T 'commit_id.short() ++ " " ++ description' | \
|
||||
orla agent -m ollama:qwen3-coder-next:latest \
|
||||
"Summarize the following commits into a GitHub release note for version $$version. Ignore commits related to version bumps, .gitignore changes, or any internal housekeeping that is irrelevant to end users. Describe each user-facing change precisely without exposing code. Eliminate redundancy. Output strictly valid JSON with no surrounding text, using this exact schema: {\"title\": \"<short release title>\", \"body\": \"<detailed markdown release notes>\"}"); \
|
||||
release_json=$$(echo "$$release_json" | sed -n '/^{/,/^}/p'); \
|
||||
release_title=$$(echo "$$release_json" | jq -r '.title // empty') ; \
|
||||
release_body=$$(echo "$$release_json" | jq -r '.body // empty') ; \
|
||||
if [ -n "$$release_title" ] && [ -n "$$release_body" ]; then \
|
||||
release_message="$$release_title"$$'\n\n'"$$release_body"; \
|
||||
else \
|
||||
echo "$(YELLOW)⚠ JSON parsing failed, falling back to raw output$(NC)"; \
|
||||
release_message="Release $$version"$$'\n\n'"$$release_json"; \
|
||||
fi; \
|
||||
else \
|
||||
release_message="Release $$version"; \
|
||||
fi; \
|
||||
echo "$(BLUE)→ Pushing commits and creating tag $$tag_name...$(NC)"; \
|
||||
jj git push --change @; \
|
||||
git tag -a "$$tag_name" -m "$$release_message" 2>/dev/null || echo "Tag $$tag_name already exists"; \
|
||||
git push origin "$$tag_name" 2>/dev/null || echo "Tag already pushed"
|
||||
@echo "$(GREEN)✓ Commits and tag pushed to repository$(NC)"
|
||||
|
||||
jjfetch:
|
||||
@echo "$(YELLOW)→ Pulling latest commits...$(NC)"
|
||||
@jj git fetch
|
||||
@jj new master@origin
|
||||
@echo "$(GREEN)✓ Latest commits pulled$(NC)"
|
||||
|
||||
.PHONY: all obitools update-deps obitests githubtests jjnew jjpush jjfetch bump-version .FORCE
|
||||
.FORCE:
|
||||
.PHONY: all packages obitools man obibook doc update-deps .FORCE
|
||||
.FORCE:
|
||||
34
README.md
34
README.md
@@ -16,17 +16,12 @@ The easiest way to run it is to copy and paste the following command into your t
|
||||
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash
|
||||
```
|
||||
|
||||
By default, the script installs the latest version of *OBITools* commands and other associated files into the `/usr/local` directory.
|
||||
By default, the script installs the *OBITools* commands and other associated files into the `/usr/local` directory.
|
||||
The names of the commands in the new *OBITools4* are mostly identical to those in *OBITools2*.
|
||||
Therefore, installing the new *OBITools* may hide or delete the old ones. If you want both versions to be
|
||||
available on your system, the installation script offers two options:
|
||||
|
||||
### Installation Options
|
||||
|
||||
The installation script offers several options:
|
||||
|
||||
> -l, --list List all available versions and exit.
|
||||
>
|
||||
> -v, --version Install a specific version (e.g., `-v 4.4.3`).
|
||||
> By default, the latest version is installed.
|
||||
>
|
||||
> -i, --install-dir Directory where obitools are installed
|
||||
> (as example use `/usr/local` not `/usr/local/bin`).
|
||||
>
|
||||
@@ -35,31 +30,14 @@ The installation script offers several options:
|
||||
> same time on your system (as example `-p g` will produce
|
||||
> `gobigrep` command instead of `obigrep`).
|
||||
|
||||
### Examples
|
||||
You can use these options by following the installation command:
|
||||
|
||||
List all available versions:
|
||||
```{bash}
|
||||
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --list
|
||||
```
|
||||
|
||||
Install a specific version:
|
||||
```{bash}
|
||||
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --version 4.4.3
|
||||
```
|
||||
|
||||
Install in a custom directory with command prefix:
|
||||
```{bash}
|
||||
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | \
|
||||
bash -s -- --install-dir test_install --obitools-prefix k
|
||||
```
|
||||
|
||||
In this last example, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus, `obigrep` will be named `kobigrep`.
|
||||
|
||||
### Note on Version Compatibility
|
||||
|
||||
The names of the commands in the new *OBITools4* are mostly identical to those in *OBITools2*.
|
||||
Therefore, installing the new *OBITools* may hide or delete the old ones. If you want both versions to be
|
||||
available on your system, use the `--install-dir` and `--obitools-prefix` options as shown above.
|
||||
In this case, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus `obigrep` will be named `kobigrep`.
|
||||
|
||||
## Continuing the analysis...
|
||||
|
||||
|
||||
302
Release-notes.md
302
Release-notes.md
@@ -1,85 +1,19 @@
|
||||
# OBITools release notes
|
||||
|
||||
## New changes
|
||||
|
||||
### Bug fixes
|
||||
|
||||
- In `obipairing` correct the misspelling of the `obiparing_*` tags where the `i`
|
||||
was missing to `obipairing_`.
|
||||
|
||||
- In `obigrep` the **-C** option that excludes sequences too abundant was not
|
||||
functional.
|
||||
|
||||
- In `obitaxonomy` the **-l** option that lists all the taxonomic rank defined by
|
||||
a taxonomy was not functional
|
||||
|
||||
- The file type guesser was not using enough data to be able to correctly detect
|
||||
file format when sequences were too long in fastq and fasta or when lines were
|
||||
to long in CSV files. That's now corrected
|
||||
|
||||
- Options **--fasta** or **--fastq** usable to specify input format were ignored.
|
||||
They are now correctly considered
|
||||
|
||||
- The `obiannotate` command were crashing when a selection option was used but
|
||||
no editing option.
|
||||
|
||||
- The `--fail-on-taxonomy` led to an error on merged taxa even when the
|
||||
`--update-taxid` option was used.
|
||||
|
||||
- The `--compressed` option was not correctly named. It was renamed to `--compress`
|
||||
|
||||
### Enhancement
|
||||
|
||||
- Some sequences in the Genbank and EMBL databases are several gigabases long. The
|
||||
sequence parser had to reallocate and recopy memory many times to read them,
|
||||
resulting in a complexity of O(N^2) for reading such large sequences.
|
||||
The new file chunk reader has a linear algorithm that speeds up the reading
|
||||
of very long sequences.
|
||||
|
||||
- A new option **--csv** is added to every obitools to indicate that the input
|
||||
format is CSV
|
||||
|
||||
- The new version of obitools are now printing the taxids in a fancy way
|
||||
including the scientific name and the taxonomic rank (`"taxon:9606 [Homo
|
||||
sapiens]@species"`). But if you need the old fashion raw taxid, a new option
|
||||
**--raw-taxid** has been added to get obitools printing the taxids without any
|
||||
decorations (`"9606"`).
|
||||
|
||||
|
||||
## March 1st, 2025. Release 4.4.0
|
||||
|
||||
A new documentation website is available at https://obitools4.metabarcoding.org.
|
||||
Its development is still in progress.
|
||||
|
||||
The biggest step forward in this new version is taxonomy management. The new
|
||||
version is now able to handle taxonomic identifiers that are not just integer
|
||||
values. This is a first step towards an easy way to handle other taxonomy
|
||||
databases soon, such as the GBIF or Catalog of Life taxonomies. This version
|
||||
is able to handle files containing taxonomic information created by previous
|
||||
versions of OBITools, but files created by this new version may have some
|
||||
problems to be analyzed by previous versions, at least for the taxonomic
|
||||
information.
|
||||
|
||||
## Latest changes
|
||||
|
||||
### Breaking changes
|
||||
|
||||
- In `obimultiplex`, the short version of the **--tag-list** option used to
|
||||
specify the list of tags and primers to be used for the demultiplexing has
|
||||
been changed from `-t` to `-s`.
|
||||
- In `obimultiplex`, the short version of the **--tag-list** option used to specify the list
|
||||
of tags and primers to be used for the demultiplexing has been changed from `-t` to `-s`.
|
||||
|
||||
- The command `obifind` is now renamed `obitaxonomy`.
|
||||
|
||||
- The **--taxdump** option used to specify the path to the taxdump containing
|
||||
the NCBI taxonomy has been renamed to **--taxonomy**.
|
||||
- The **--taxdump** option used to specify the path to the taxdump containing the NCBI taxonomy
|
||||
has been renamed to **--taxonomy**.
|
||||
|
||||
### Bug fixes
|
||||
|
||||
- Correction of a bug when using paired sequence file with the **--out** option.
|
||||
|
||||
- Correction of a bug in `obitag` when trying to annotate very short sequences of
|
||||
4 bases or less.
|
||||
|
||||
|
||||
- In `obipairing`, correct the stats `seq_a_single` and `seq_b_single` when
|
||||
on right alignment mode
|
||||
|
||||
@@ -87,32 +21,12 @@ information.
|
||||
the batch size and not reading the qualities from the fastq files as `obiuniq`
|
||||
is producing only fasta output without qualities.
|
||||
|
||||
- In `obitag`, correct the wrong assignment of the **obitag_bestmatch**
|
||||
attribute.
|
||||
|
||||
- In `obiclean`, the **--no-progress-bar** option disables all progress bars,
|
||||
not just the data.
|
||||
|
||||
- Several fixes in reading FASTA and FASTQ files, including some code
|
||||
simplification and factorization.
|
||||
|
||||
- Fixed a bug in all obitools that caused the same file to be processed
|
||||
multiple times, when specifying a directory name as input.
|
||||
|
||||
|
||||
### New features
|
||||
|
||||
- `obigrep` add a new **--valid-taxid** option to keep only sequence with a
|
||||
valid taxid
|
||||
|
||||
- `obiclean` add a new **--min-sample-count** option with a default value of 1,
|
||||
asking to filter out sequences which are not occurring in at least the
|
||||
specified number of samples.
|
||||
|
||||
- `obitoaxonomy` a new **--dump|D** option allows for dumping a sub-taxonomy.
|
||||
|
||||
- Taxonomy dump can now be provided as a four-columns CSV file to the
|
||||
**--taxonomy** option.
|
||||
- Taxonomy dump can now be provided as a four-columns CSV file to the **--taxonomy**
|
||||
option.
|
||||
|
||||
- NCBI Taxonomy dump does not need to be uncompressed and unarchived anymore. The
|
||||
path of the tar and gziped dump file can be directly specified using the
|
||||
@@ -123,68 +37,54 @@ information.
|
||||
allow the processing of the rare fasta and fastq files not recognized.
|
||||
|
||||
- In `obiscript`, adds new methods to the Lua sequence object:
|
||||
- `md5_string()`: returning the MD5 check sum as a hexadecimal string,
|
||||
- `subsequence(from,to)`: allows extracting a subsequence on a 0 based
|
||||
coordinate system, upper bound excluded like in go.
|
||||
- `reverse_complement`: returning a sequence object corresponding to the
|
||||
reverse complement of the current sequence.
|
||||
- `md5_string()`: returning the MD5 check sum as an hexadecimal string,
|
||||
- `subsequence(from,to)`: allows to extract a subsequence on a 0 based
|
||||
coordinate system, upper bound expluded like in go.
|
||||
- `reverse_complement`: returning a sequence object corresponding to the reverse complement
|
||||
of the current sequence.
|
||||
|
||||
### Enhancement
|
||||
### Change of git repositiory
|
||||
|
||||
- All obitools now have a **--taxonomy** option. If specified, the taxonomy is
|
||||
loaded first and taxids annotating the sequences are validated against that
|
||||
taxonomy. A warning is issued for any invalid taxid and for any taxid that
|
||||
is transferred to a new taxid. The **--update-taxid** option allows these
|
||||
old taxids to be replaced with their new equivalent in the result of the
|
||||
obitools command.
|
||||
|
||||
- The scoring system used by the `obipairing` command has been changed to be
|
||||
more coherent. In the new version, the scores associated to a match and a
|
||||
mismatch involving a nucleotide with a quality score of 0 are equal. Which
|
||||
is normal as a zero quality score means a perfect indecision on the read
|
||||
nucleotide, therefore there is no reason to penalize a match differently
|
||||
from a mismatch (see
|
||||
https://obitools4.metabarcoding.org/docs/commands/alignments/obipairing/exact-alignment/).
|
||||
|
||||
- In every *OBITools* command, the progress bar is automatically deactivated
|
||||
when the standard error output is redirected.
|
||||
|
||||
- Because Genbank and ENA:EMBL contain very large sequences, while OBITools4
|
||||
are optimized As Genbank and ENA:EMBL contain very large sequences, while
|
||||
OBITools4 is optimized for short sequences, `obipcr` faces some problems
|
||||
with excessive consumption of computer resources, especially memory. Several
|
||||
improvements in the tuning of the default `obipcr` parameters and some new
|
||||
features, currently only available for FASTA and FASTQ file readers, have
|
||||
been implemented to limit the memory impact of `obipcr` without changing the
|
||||
computational efficiency too much.
|
||||
|
||||
- Logging system and therefore format, have been homogenized.
|
||||
|
||||
## August 2nd, 2024. Release 4.3.0
|
||||
|
||||
### Change of git repository
|
||||
|
||||
- The OBITools4 git repository has been moved to the GitHub repository.
|
||||
- The OBITools4 git repository has been moved to the github repository.
|
||||
The new address is: https://github.com/metabarcoding/obitools4.
|
||||
Take care for using the new install script for retrieving the new version.
|
||||
|
||||
```bash
|
||||
curl -L https://metabarcoding.org/obitools4/install.sh \
|
||||
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh \
|
||||
| bash
|
||||
```
|
||||
|
||||
or with options:
|
||||
|
||||
```bash
|
||||
curl -L https://metabarcoding.org/obitools4/install.sh \
|
||||
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh \
|
||||
| bash -s -- --install-dir test_install --obitools-prefix k
|
||||
```
|
||||
|
||||
### CPU limitation
|
||||
|
||||
- By default, *OBITools4* tries to use all the computing power available on
|
||||
your computer. In some circumstances this can be problematic (e.g. if you
|
||||
are running on a computer cluster managed by your university). You can limit
|
||||
the number of CPU cores used by *OBITools4* or by using the **--max-cpu**
|
||||
option or by setting the **OBIMAXCPU** environment variable. Some strange
|
||||
behaviour of *OBITools4* has been observed when users try to limit the
|
||||
maximum number of usable CPU cores to one. This seems to be caused by the Go
|
||||
language, and it is not obvious to get *OBITools4* to run correctly on a
|
||||
single core in all circumstances. Therefore, if you ask to use a single
|
||||
core, **OBITools4** will print a warning message and actually set this
|
||||
parameter to two cores. If you really want a single core, you can use the
|
||||
**--force-one-core** option. But be aware that this can lead to incorrect
|
||||
calculations.
|
||||
|
||||
### New features
|
||||
|
||||
- The output of the obitools will evolve to produce results only in standard
|
||||
formats such as fasta and fastq. For non-sequential data, the output will be
|
||||
in CSV format, with the separator `,`, the decimal separator `.`, and a
|
||||
header line with the column names. It is more convenient to use the output
|
||||
in other programs. For example, you can use the `csvtomd` command to
|
||||
reformat the CSV output into a Markdown table. The first command to initiate
|
||||
reformat the csv output into a markdown table. The first command to initiate
|
||||
this change is `obicount`, which now produces a 3-line CSV output.
|
||||
|
||||
```bash
|
||||
@@ -196,7 +96,7 @@ information.
|
||||
database for `obitag` is to use `obipcr` on a local copy of Genbank or EMBL.
|
||||
However, these sequence databases are known to contain many taxonomic
|
||||
errors, such as bacterial sequences annotated with the taxid of their host
|
||||
species. `obicleandb` tries to detect these errors. To do this, it first keeps
|
||||
species. obicleandb tries to detect these errors. To do this, it first keeps
|
||||
only sequences annotated with the taxid to which a species, genus, and
|
||||
family taxid can be assigned. Then, for each sequence, it compares the
|
||||
distance of the sequence to the other sequences belonging to the same genus
|
||||
@@ -207,7 +107,7 @@ information.
|
||||
with the p-value of the Mann-Whitney U test in the **obicleandb_trusted**
|
||||
slot. Later, the distribution of this p-value can be analyzed to determine a
|
||||
threshold. Empirically, a threshold of 0.05 is a good compromise and allows
|
||||
filtering out less than 1‰ of the sequences. These sequences can then be
|
||||
to filter out less than 1‰ of the sequences. These sequences can then be
|
||||
removed using `obigrep`.
|
||||
|
||||
- Adds a new `obijoin` utility to join information contained in a sequence
|
||||
@@ -217,16 +117,16 @@ information.
|
||||
|
||||
- Adds a new tool `obidemerge` to demerge a `merge_xxx` slot by recreating the
|
||||
multiple identical sequences having the slot `xxx` recreated with its initial
|
||||
value and the sequence count set to the number of occurrences referred in the
|
||||
value and the sequence count set to the number of occurences refered in the
|
||||
`merge_xxx` slot. During the operation, the `merge_xxx` slot is removed.
|
||||
|
||||
- Adds CSV as one of the input format for every obitools command. To encode
|
||||
sequence the CSV file must include a column named `sequence` and another
|
||||
sequence the CSV file must includes a column named `sequence` and another
|
||||
column named `id`. An extra column named `qualities` can be added to specify
|
||||
the quality scores of the sequence following the same ASCII encoding than the
|
||||
the quality scores of the sequence following the same ascii encoding than the
|
||||
fastq format. All the other columns will be considered as annotations and will
|
||||
be interpreted as JSON objects encoding potentially for atomic values. If a
|
||||
column value can not be decoded as JSON it will be considered as a string.
|
||||
calumn value can not be decoded as JSON it will be considered as a string.
|
||||
|
||||
- A new option **--version** has been added to every obitools command. It will
|
||||
print the version of the command.
|
||||
@@ -235,8 +135,8 @@ information.
|
||||
quality scores from a BioSequence object.\
|
||||
|
||||
- In `obimultuplex` the ngsfilter file describing the samples can be no provided
|
||||
not only using the classical ngsfilter format but also using the CSV format.
|
||||
When using CSV, the first line must contain the column names. 5 columns are
|
||||
not only using the classical nfsfilter format but also using the csv format.
|
||||
When using csv, the first line must contain the column names. 5 columns are
|
||||
expected:
|
||||
|
||||
- `experiment` the name of the experiment
|
||||
@@ -252,34 +152,43 @@ information.
|
||||
|
||||
Supplementary columns are allowed. Their names and content will be used to
|
||||
annotate the sequence corresponding to the sample, as the `key=value;` did
|
||||
in the ngsfilter format.
|
||||
in the nfsfilter format.
|
||||
|
||||
The CSV format used allows for comment lines starting with `#` character.
|
||||
Special data lines starting with `@param` in the first column allow configuring the algorithm. The options **--template** provided an over
|
||||
commented example of the CSV format, including all the possible options.
|
||||
|
||||
### CPU limitation
|
||||
Special data lines starting with `@param` in the first column allow to
|
||||
configure the algorithm. The options **--template** provided an over
|
||||
commented example of the csv format, including all the possible options.
|
||||
|
||||
- By default, *OBITools4* tries to use all the computing power available on
|
||||
your computer. In some circumstances this can be problematic (e.g. if you
|
||||
are running on a computer cluster managed by your university). You can limit
|
||||
the number of CPU cores used by *OBITools4* or by using the **--max-cpu**
|
||||
option or by setting the **OBIMAXCPU** environment variable. Some strange
|
||||
behavior of *OBITools4* has been observed when users try to limit the
|
||||
maximum number of usable CPU cores to one. This seems to be caused by the Go
|
||||
language, and it is not obvious to get *OBITools4* to run correctly on a
|
||||
single core in all circumstances. Therefore, if you ask to use a single
|
||||
core, **OBITools4** will print a warning message and actually set this
|
||||
parameter to two cores. If you really want a single core, you can use the
|
||||
**--force-one-core** option. But be aware that this can lead to incorrect
|
||||
calculations.
|
||||
### Enhancement
|
||||
|
||||
- In every *OBITools* command, the progress bar are automatically deactivated
|
||||
when the standard error output is redirected.
|
||||
- Because Genbank and ENA:EMBL contain very large sequences, while OBITools4
|
||||
are optimized As Genbank and ENA:EMBL contain very large sequences, while
|
||||
OBITools4 is optimised for short sequences, `obipcr` faces some problems
|
||||
with excessive consumption of computer resources, especially memory. Several
|
||||
improvements in the tuning of the default `obipcr` parameters and some new
|
||||
features, currently only available for FASTA and FASTQ file readers, have
|
||||
been implemented to limit the memory impact of `obipcr` without changing the
|
||||
computational efficiency too much.
|
||||
- Logging system and therefore format, have been homogenized.
|
||||
|
||||
### Bug
|
||||
|
||||
- In `obitag`, correct the wrong assignment of the **obitag_bestmatch**
|
||||
attribute.
|
||||
- In `obiclean`, the **--no-progress-bar** option disables all progress bars,
|
||||
not just the data.
|
||||
- Several fixes in reading FASTA and FASTQ files, including some code
|
||||
simplification and and factorization.
|
||||
- Fixed a bug in all obitools that caused the same file to be processed
|
||||
multiple times. when specifying a directory name as input.
|
||||
|
||||
## April 2nd, 2024. Release 4.2.0
|
||||
|
||||
### New features
|
||||
|
||||
- A new OBITools named `obiscript` allows processing each sequence according
|
||||
- A new OBITools named `obiscript` allows to process each sequence according
|
||||
to a Lua script. This is an experimental tool. The **--template** option
|
||||
allows for generating an example script on the `stdout`.
|
||||
|
||||
@@ -287,7 +196,7 @@ information.
|
||||
|
||||
- Two of the main class `obiseq.SeqWorker` and `obiseq.SeqWorker` have their
|
||||
declaration changed. Both now return two values a `obiseq.BioSequenceSlice`
|
||||
and an `error`. This allows a worker to return potentially several sequences
|
||||
and an `error`. This allow a worker to return potentially several sequences
|
||||
as the result of the processing of a single sequence, or zero, which is
|
||||
equivalent to filter out the input sequence.
|
||||
|
||||
@@ -295,12 +204,12 @@ information.
|
||||
|
||||
- In `obitag` if the reference database contains sequences annotated by taxid
|
||||
not referenced in the taxonomy, the corresponding sequences are discarded
|
||||
from the reference database and a warning indicating the sequence *id* and the
|
||||
from the reference database and a warning indicating the sequence id and the
|
||||
wrong taxid is emitted.
|
||||
- The bug corrected in the parsing of EMBL and Genbank files as implemented in
|
||||
version 4.1.2 of OBITools4, potentially induced some reduction in the
|
||||
performance of the parsing. This should have been now fixed.
|
||||
- In the same idea, parsing of Genbank and EMBL files were reading and storing
|
||||
- In the same idea, parsing of genbank and EMBL files were reading and storing
|
||||
in memory not only the sequence but also the annotations (features table).
|
||||
Up to now none of the OBITools are using this information, but with large
|
||||
complete genomes, it is occupying a lot of memory. To reduce this impact,
|
||||
@@ -339,7 +248,7 @@ information.
|
||||
|
||||
### New feature
|
||||
|
||||
- In `obimatrix` a **--transpose** option allows transposing the produced
|
||||
- In `obimatrix` a **--transpose** option allows to transpose the produced
|
||||
matrix table in CSV format.
|
||||
- In `obitpairing` and `obipcrtag` two new options **--exact-mode** and
|
||||
**--fast-absolute** to control the heuristic used in the alignment
|
||||
@@ -347,7 +256,7 @@ information.
|
||||
the exact algorithm at the cost of a speed. **--fast-absolute** change the
|
||||
scoring schema of the heuristic.
|
||||
- In `obiannotate` adds the possibility to annotate the first match of a
|
||||
pattern using the same algorithm as the one used in `obipcr` and
|
||||
pattern using the same algorithm than the one used in `obipcr` and
|
||||
`obimultiplex`. For that four option were added :
|
||||
- **--pattern** : to specify the pattern. It can use IUPAC codes and
|
||||
position with no error tolerated has to be followed by a `#` character.
|
||||
@@ -428,7 +337,7 @@ information.
|
||||
|
||||
### Bugs
|
||||
|
||||
- In the obitools language, the `composition` function now returns a map
|
||||
- in the obitools language, the `composition` function now returns a map
|
||||
indexed by lowercase string "a", "c", "g", "t" and "o" for other instead of
|
||||
being indexed by the ASCII codes of the corresponding letters.
|
||||
- Correction of the reverse-complement operation. Every reverse complement of
|
||||
@@ -441,18 +350,18 @@ information.
|
||||
duplicating the quality values. This made `obimultiplex` to produce fastq
|
||||
files with sequences having quality values duplicated.
|
||||
|
||||
### Be careful
|
||||
### Becareful
|
||||
|
||||
GO 1.21.0 is out, and it includes new functionalities which are used in the
|
||||
OBITools4 code. If you use the recommended method for compiling OBITools on your
|
||||
computer, there is no problem, as the script always load the latest GO version.
|
||||
If you rely on your personal GO install, please think to update.
|
||||
OBITools4 code. If you use the recommanded method for compiling OBITools on your
|
||||
computer, their is no problem, as the script always load the latest GO version.
|
||||
If you rely on you personnal GO install, please think to update.
|
||||
|
||||
## August 29th, 2023. Release 4.0.5
|
||||
|
||||
### Bugs
|
||||
|
||||
- Patch a bug in the `obiseq.BioSequence` constructor leading to an error on
|
||||
- Patch a bug in the `obiseq.BioSequence` constructor leading to a error on
|
||||
almost every obitools. The error message indicates : `fatal error: sync:
|
||||
unlock of unlocked mutex` This bug was introduced in the release 4.0.4
|
||||
|
||||
@@ -471,7 +380,7 @@ If you rely on your personal GO install, please think to update.
|
||||
data structure to limit the number of alignments actually computed. This
|
||||
increase a bit the speed of both the software. `obirefidx` is nevertheless
|
||||
still too slow compared to my expectation.
|
||||
- Switch to a parallel version of the GZIP library, allowing for high speed
|
||||
- Switch to a parallel version of the gzip library, allowing for high speed
|
||||
compress and decompress operation on files.
|
||||
|
||||
### New feature
|
||||
@@ -515,12 +424,12 @@ If you rely on your personal GO install, please think to update.
|
||||
--unidentified not_assigned.fastq
|
||||
```
|
||||
|
||||
The command produced four files : `tagged_library_R1.fastq` and
|
||||
the command produced four files : `tagged_library_R1.fastq` and
|
||||
`tagged_library_R2.fastq` containing the assigned reads and
|
||||
`not_assigned_R1.fastq` and `not_assigned_R2.fastq` containing the
|
||||
unassignable reads.
|
||||
|
||||
The tagged library files can then be split using `obidistribute`:
|
||||
the tagged library files can then be split using `obidistribute`:
|
||||
|
||||
```{bash}
|
||||
mkdir pcr_reads
|
||||
@@ -530,9 +439,9 @@ If you rely on your personal GO install, please think to update.
|
||||
|
||||
- Adding of two options **--add-lca-in** and **--lca-error** to `obiannotate`.
|
||||
These options aim to help during construction of reference database using
|
||||
`obipcr`. On `obipcr` output, it is commonly run `obiuniq`. To merge identical
|
||||
`obipcr`. On obipcr output, it is commonly run obiuniq. To merge identical
|
||||
sequences annotated with different taxids, it is now possible to use the
|
||||
following strategies :
|
||||
following strategie :
|
||||
|
||||
```{bash}
|
||||
obiuniq -m taxid myrefdb.obipcr.fasta \
|
||||
@@ -563,7 +472,7 @@ If you rely on your personal GO install, please think to update.
|
||||
- Correction of a bug in `obiconsensus` leading into the deletion of a base
|
||||
close to the beginning of the consensus sequence.
|
||||
|
||||
## March 31st, 2023. Release 4.0.2
|
||||
## March 31th, 2023. Release 4.0.2
|
||||
|
||||
### Compiler change
|
||||
|
||||
@@ -574,15 +483,15 @@ If you rely on your personal GO install, please think to update.
|
||||
- Add the possibility for looking pattern with indels. This has been added to
|
||||
`obimultiplex` through the **--with-indels** option.
|
||||
- Every obitools command has a **--pprof** option making the command
|
||||
publishing a profiling website available at the address :
|
||||
publishing a profiling web site available at the address :
|
||||
<http://localhost:8080/debug/pprof/>
|
||||
- A new `obiconsensus` command has been added. It is a prototype. It aims to
|
||||
build a consensus sequence from a set of reads. The consensus is estimated
|
||||
for all the sequences contained in the input file. If several input files,
|
||||
or a directory name are provided the result contains a consensus per file.
|
||||
The *id* of the sequence is the name of the input file depleted of its
|
||||
The id of the sequence is the name of the input file depleted of its
|
||||
directory name and of all its extensions.
|
||||
- In `obipcr` an experimental option **--fragmented** allows for splitting very
|
||||
- In `obipcr` an experimental option **--fragmented** allows for spliting very
|
||||
long query sequences into shorter fragments with an overlap between the two
|
||||
contiguous fragment insuring that no amplicons are missed despite the split.
|
||||
As a site effect some amplicon can be identified twice.
|
||||
@@ -625,7 +534,7 @@ If you rely on your personal GO install, please think to update.
|
||||
### Enhancement
|
||||
|
||||
- *OBITools* are automatically processing all the sequences files contained in
|
||||
a directory and its subdirectory\
|
||||
a directory and its sub-directory\
|
||||
recursively if its name is provided as input. To process easily Genbank
|
||||
files, the corresponding filename extensions have been added. Today the
|
||||
following extensions are recognized as sequence files : `.fasta`, `.fastq`,
|
||||
@@ -642,7 +551,7 @@ If you rely on your personal GO install, please think to update.
|
||||
export OBICPUMAX=4
|
||||
```
|
||||
|
||||
- Adds a new option --out\|-o allowing to specify the name of an output file.
|
||||
- Adds a new option --out\|-o allowing to specify the name of an outpout file.
|
||||
|
||||
``` bash
|
||||
obiconvert -o xyz.fasta xxx.fastq
|
||||
@@ -664,10 +573,10 @@ If you rely on your personal GO install, please think to update.
|
||||
matched files remain consistent when processed.
|
||||
|
||||
- Adding of the function `ifelse` to the expression language for computing
|
||||
conditional values.
|
||||
conditionnal values.
|
||||
|
||||
- Adding two function to the expression language related to sequence
|
||||
composition : `composition` and `gcskew`. Both are taking a sequence as
|
||||
conposition : `composition` and `gcskew`. Both are taking a sequence as
|
||||
single argument.
|
||||
|
||||
## February 18th, 2023. Release 4.0.0
|
||||
@@ -675,8 +584,8 @@ If you rely on your personal GO install, please think to update.
|
||||
It is the first version of the *OBITools* version 4. I decided to tag then
|
||||
following two weeks of intensive data analysis with them allowing to discover
|
||||
many small bugs present in the previous non-official version. Obviously other
|
||||
bugs are certainly present in the code, and you are welcome to use the git
|
||||
ticket system to mention them. But they seem to produce now reliable results.
|
||||
bugs are certainly persent in the code, and you are welcome to use the git
|
||||
ticket system to mention them. But they seems to produce now reliable results.
|
||||
|
||||
### Corrected bugs
|
||||
|
||||
@@ -684,11 +593,11 @@ ticket system to mention them. But they seem to produce now reliable results.
|
||||
of sequences and to the production of incorrect file because of the last
|
||||
sequence record, sometime truncated in its middle. This was only occurring
|
||||
when more than a single CPU was used. It was affecting every obitools.
|
||||
- The `obiparing` software had a bug in the right alignment procedure. This led
|
||||
to the non-alignment of very sort barcode during the paring of the forward
|
||||
- The `obiparing` software had a bug in the right aligment procedure. This led
|
||||
to the non alignment of very sort barcode during the paring of the forward
|
||||
and reverse reads.
|
||||
- The `obipairing` tools had a non-deterministic comportment when aligning a
|
||||
pair very low quality reads. This induced that the result of the same low
|
||||
- The `obipairing` tools had a non deterministic comportment when aligning a
|
||||
paor very low quality reads. This induced that the result of the same low
|
||||
quality read pair was not the same from run to run.
|
||||
|
||||
### New features
|
||||
@@ -696,10 +605,11 @@ ticket system to mention them. But they seem to produce now reliable results.
|
||||
- Adding of a `--compress|-Z` option to every obitools allowing to produce
|
||||
`gz` compressed output. OBITools were already able to deal with gziped input
|
||||
files transparently. They can now produce their results in the same format.
|
||||
- Adding of a `--append|-A` option to the `obidistribute` tool. It allows appending the result of an `obidistribute` execution to preexisting files. -
|
||||
- Adding of a `--append|-A` option to the `obidistribute` tool. It allows to
|
||||
append the result of an `obidistribute` execution to preexisting files. -
|
||||
Adding of a `--directory|-d` option to the `obidistribute` tool. It allows
|
||||
declaring a secondary classification key over the one defined by the
|
||||
`--category\|-c\` option. This extra key leads to produce directories in
|
||||
to declare a secondary classification key over the one defined by the
|
||||
'--category\|-c\` option. This extra key leads to produce directories in
|
||||
which files produced according to the primary criterion are stored.
|
||||
- Adding of the functions `subspc`, `printf`, `int`, `numeric`, and `bool` to
|
||||
the expression language.
|
||||
@@ -1,508 +0,0 @@
|
||||
# Plan de refonte du package obikmer : index disk-based par partitions minimizer
|
||||
|
||||
## Constat
|
||||
|
||||
Les roaring64 bitmaps ne sont pas adaptés au stockage de 10^10 k-mers
|
||||
(k=31) dispersés sur un espace de 2^62. L'overhead structurel (containers
|
||||
roaring par high key 32 bits) dépasse la taille des données elles-mêmes,
|
||||
et les opérations `Or()` entre bitmaps fragmentés ne terminent pas en
|
||||
temps raisonnable.
|
||||
|
||||
## Principe de la nouvelle architecture
|
||||
|
||||
Un `KmerSet` est un ensemble trié de k-mers canoniques (uint64) stocké
|
||||
sur disque, partitionné par minimizer. Chaque partition est un fichier
|
||||
binaire contenant des uint64 triés, compressés par delta-varint.
|
||||
|
||||
Un `KmerSetGroup` est un répertoire contenant N ensembles partitionnés
|
||||
de la même façon (même k, même m, même P).
|
||||
|
||||
Un `KmerSet` est un `KmerSetGroup` de taille 1 (singleton).
|
||||
|
||||
Les opérations ensemblistes se font partition par partition, en merge
|
||||
streaming, sans charger l'index complet en mémoire.
|
||||
|
||||
## Cycle de vie d'un index
|
||||
|
||||
L'index a deux phases distinctes :
|
||||
|
||||
1. **Phase de construction (mutable)** : on ouvre un index, on y ajoute
|
||||
des séquences. Pour chaque séquence, les super-kmers sont extraits
|
||||
et écrits de manière compacte (2 bits/base) dans le fichier
|
||||
temporaire de partition correspondant (`minimizer % P`). Les
|
||||
super-kmers sont une représentation compressée naturelle des k-mers
|
||||
chevauchants : un super-kmer de longueur L encode L-k+1 k-mers en
|
||||
ne stockant que ~L/4 bytes au lieu de (L-k+1) × 8 bytes.
|
||||
|
||||
2. **Phase de clôture (optimisation)** : on ferme l'index, ce qui
|
||||
déclenche le traitement **partition par partition** (indépendant,
|
||||
parallélisable) :
|
||||
- Charger les super-kmers de la partition
|
||||
- En extraire tous les k-mers canoniques
|
||||
- Trier le tableau de k-mers
|
||||
- Dédupliquer (et compter si FrequencyFilter)
|
||||
- Delta-encoder et écrire le fichier .kdi final
|
||||
Après clôture, l'index est statique et immuable.
|
||||
|
||||
3. **Phase de lecture (immutable)** : opérations ensemblistes,
|
||||
Jaccard, Quorum, Contains, itération. Toutes en streaming.
|
||||
|
||||
---
|
||||
|
||||
## Format sur disque
|
||||
|
||||
### Index finalisé
|
||||
|
||||
```
|
||||
index_dir/
|
||||
metadata.toml
|
||||
set_0/
|
||||
part_0000.kdi
|
||||
part_0001.kdi
|
||||
...
|
||||
part_{P-1}.kdi
|
||||
set_1/
|
||||
part_0000.kdi
|
||||
...
|
||||
...
|
||||
set_{N-1}/
|
||||
...
|
||||
```
|
||||
|
||||
### Fichiers temporaires pendant la construction
|
||||
|
||||
```
|
||||
index_dir/
|
||||
.build/
|
||||
set_0/
|
||||
part_0000.skm # super-kmers encodés 2 bits/base
|
||||
part_0001.skm
|
||||
...
|
||||
set_1/
|
||||
...
|
||||
```
|
||||
|
||||
Le répertoire `.build/` est supprimé après Close().
|
||||
|
||||
### metadata.toml
|
||||
|
||||
```toml
|
||||
id = "mon_index"
|
||||
k = 31
|
||||
m = 13
|
||||
partitions = 1024
|
||||
type = "KmerSetGroup" # ou "KmerSet" (N=1)
|
||||
size = 3 # nombre de sets (N)
|
||||
sets_ids = ["genome_A", "genome_B", "genome_C"]
|
||||
|
||||
[user_metadata]
|
||||
organism = "Triticum aestivum"
|
||||
|
||||
[sets_metadata]
|
||||
# métadonnées individuelles par set si nécessaire
|
||||
```
|
||||
|
||||
### Fichier .kdi (Kmer Delta Index)
|
||||
|
||||
Format binaire :
|
||||
|
||||
```
|
||||
[magic: 4 bytes "KDI\x01"]
|
||||
[count: uint64 little-endian] # nombre de k-mers dans cette partition
|
||||
[first: uint64 little-endian] # premier k-mer (valeur absolue)
|
||||
[delta_1: varint] # arr[1] - arr[0]
|
||||
[delta_2: varint] # arr[2] - arr[1]
|
||||
...
|
||||
[delta_{count-1}: varint] # arr[count-1] - arr[count-2]
|
||||
```
|
||||
|
||||
Varint : encoding unsigned, 7 bits utiles par byte, bit de poids fort
|
||||
= continuation (identique au varint protobuf).
|
||||
|
||||
Fichier vide (partition sans k-mer) : magic + count=0.
|
||||
|
||||
### Fichier .skm (Super-Kmer temporaire)
|
||||
|
||||
Format binaire, séquence de super-kmers encodés :
|
||||
|
||||
```
|
||||
[len: uint16 little-endian] # longueur du super-kmer en bases
|
||||
[sequence: ceil(len/4) bytes] # séquence encodée 2 bits/base, packed
|
||||
...
|
||||
```
|
||||
|
||||
**Compression par rapport au stockage de k-mers bruts** :
|
||||
|
||||
Un super-kmer de longueur L contient L-k+1 k-mers.
|
||||
- Stockage super-kmer : 2 + ceil(L/4) bytes
|
||||
- Stockage k-mers bruts : (L-k+1) × 8 bytes
|
||||
|
||||
Exemple avec k=31, super-kmer typique L=50 :
|
||||
- Super-kmer : 2 + 13 = 15 bytes → encode 20 k-mers
|
||||
- K-mers bruts : 20 × 8 = 160 bytes
|
||||
- **Facteur de compression : ~10×**
|
||||
|
||||
Pour un génome de 10 Gbases (~10^10 k-mers bruts) :
|
||||
- K-mers bruts : ~80 Go par set temporaire
|
||||
- Super-kmers : **~8 Go** par set temporaire
|
||||
|
||||
Avec FrequencyFilter et couverture 30× :
|
||||
- K-mers bruts : ~2.4 To
|
||||
- Super-kmers : **~240 Go**
|
||||
|
||||
---
|
||||
|
||||
## FrequencyFilter
|
||||
|
||||
Le FrequencyFilter n'est plus un type de données séparé. C'est un
|
||||
**mode de construction** du builder. Le résultat est un KmerSetGroup
|
||||
standard.
|
||||
|
||||
### Principe
|
||||
|
||||
Pendant la construction, tous les super-kmers sont écrits dans les
|
||||
fichiers temporaires .skm, y compris les doublons (chaque occurrence
|
||||
de chaque séquence est écrite).
|
||||
|
||||
Pendant Close(), pour chaque partition :
|
||||
1. Charger tous les super-kmers de la partition
|
||||
2. Extraire tous les k-mers canoniques dans un tableau []uint64
|
||||
3. Trier le tableau
|
||||
4. Parcourir linéairement : les k-mers identiques sont consécutifs
|
||||
5. Compter les occurrences de chaque k-mer
|
||||
6. Si count >= minFreq → écrire dans le .kdi final (une seule fois)
|
||||
7. Sinon → ignorer
|
||||
|
||||
### Dimensionnement
|
||||
|
||||
Pour un génome de 10 Gbases avec couverture 30× :
|
||||
- N_brut ≈ 3×10^11 k-mers bruts
|
||||
- Espace temporaire .skm ≈ 240 Go (compressé super-kmer)
|
||||
- RAM par partition pendant Close() :
|
||||
Avec P=1024 : ~3×10^8 k-mers/partition × 8 = **~2.4 Go**
|
||||
Avec P=4096 : ~7.3×10^7 k-mers/partition × 8 = **~600 Mo**
|
||||
|
||||
Le choix de P détermine le compromis nombre de fichiers vs RAM par
|
||||
partition.
|
||||
|
||||
### Sans FrequencyFilter (déduplication simple)
|
||||
|
||||
Pour de la déduplication simple (chaque k-mer écrit une fois), le
|
||||
builder peut dédupliquer au niveau des buffers en RAM avant flush.
|
||||
Cela réduit significativement l'espace temporaire car les doublons
|
||||
au sein d'un même buffer (provenant de séquences proches) sont
|
||||
éliminés immédiatement.
|
||||
|
||||
---
|
||||
|
||||
## API publique visée
|
||||
|
||||
### Structures
|
||||
|
||||
```go
|
||||
// KmerSetGroup est l'entité de base.
|
||||
// Un KmerSet est un KmerSetGroup avec Size() == 1.
|
||||
type KmerSetGroup struct {
|
||||
// champs internes : path, k, m, P, N, metadata, état
|
||||
}
|
||||
|
||||
// KmerSetGroupBuilder construit un KmerSetGroup mutable.
|
||||
type KmerSetGroupBuilder struct {
|
||||
// champs internes : buffers I/O par partition et par set,
|
||||
// fichiers temporaires .skm, paramètres (minFreq, etc.)
|
||||
}
|
||||
```
|
||||
|
||||
### Construction
|
||||
|
||||
```go
|
||||
// NewKmerSetGroupBuilder crée un builder pour un nouveau KmerSetGroup.
|
||||
// directory : répertoire de destination
|
||||
// k : taille des k-mers (1-31)
|
||||
// m : taille des minimizers (-1 pour auto = ceil(k/2.5))
|
||||
// n : nombre de sets dans le groupe
|
||||
// P : nombre de partitions (-1 pour auto)
|
||||
// options : options de construction (FrequencyFilter, etc.)
|
||||
func NewKmerSetGroupBuilder(directory string, k, m, n, P int,
|
||||
options ...BuilderOption) (*KmerSetGroupBuilder, error)
|
||||
|
||||
// WithMinFrequency active le mode FrequencyFilter.
|
||||
// Seuls les k-mers vus >= minFreq fois sont conservés dans l'index
|
||||
// final. Les super-kmers sont écrits avec leurs doublons pendant
|
||||
// la construction ; le comptage exact se fait au Close().
|
||||
func WithMinFrequency(minFreq int) BuilderOption
|
||||
|
||||
// AddSequence extrait les super-kmers d'une séquence et les écrit
|
||||
// dans les fichiers temporaires de partition du set i.
|
||||
func (b *KmerSetGroupBuilder) AddSequence(setIndex int, seq *obiseq.BioSequence)
|
||||
|
||||
// AddSuperKmer écrit un super-kmer dans le fichier temporaire de
|
||||
// sa partition pour le set i.
|
||||
func (b *KmerSetGroupBuilder) AddSuperKmer(setIndex int, sk SuperKmer)
|
||||
|
||||
// Close finalise la construction :
|
||||
// - flush des buffers d'écriture
|
||||
// - pour chaque partition de chaque set (parallélisable) :
|
||||
// - charger les super-kmers depuis le .skm
|
||||
// - extraire les k-mers canoniques
|
||||
// - trier, dédupliquer (compter si freq filter)
|
||||
// - delta-encoder et écrire le .kdi
|
||||
// - écrire metadata.toml
|
||||
// - supprimer le répertoire .build/
|
||||
// Retourne le KmerSetGroup en lecture seule.
|
||||
func (b *KmerSetGroupBuilder) Close() (*KmerSetGroup, error)
|
||||
```
|
||||
|
||||
### Lecture et opérations
|
||||
|
||||
```go
|
||||
// OpenKmerSetGroup ouvre un index finalisé en lecture seule.
|
||||
func OpenKmerSetGroup(directory string) (*KmerSetGroup, error)
|
||||
|
||||
// --- Métadonnées (API inchangée) ---
|
||||
func (ksg *KmerSetGroup) K() int
|
||||
func (ksg *KmerSetGroup) M() int // nouveau : taille du minimizer
|
||||
func (ksg *KmerSetGroup) Partitions() int // nouveau : nombre de partitions
|
||||
func (ksg *KmerSetGroup) Size() int
|
||||
func (ksg *KmerSetGroup) Id() string
|
||||
func (ksg *KmerSetGroup) SetId(id string)
|
||||
func (ksg *KmerSetGroup) HasAttribute(key string) bool
|
||||
func (ksg *KmerSetGroup) GetAttribute(key string) (interface{}, bool)
|
||||
func (ksg *KmerSetGroup) SetAttribute(key string, value interface{})
|
||||
// ... etc (toute l'API attributs actuelle est conservée)
|
||||
|
||||
// --- Opérations ensemblistes ---
|
||||
// Toutes produisent un nouveau KmerSetGroup singleton sur disque.
|
||||
// Opèrent partition par partition en streaming.
|
||||
|
||||
func (ksg *KmerSetGroup) Union(outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) Intersect(outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) Difference(outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) QuorumAtLeast(q int, outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) QuorumExactly(q int, outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) QuorumAtMost(q int, outputDir string) (*KmerSetGroup, error)
|
||||
|
||||
// --- Opérations entre deux KmerSetGroups ---
|
||||
// Les deux groupes doivent avoir les mêmes k, m, P.
|
||||
|
||||
func (ksg *KmerSetGroup) UnionWith(other *KmerSetGroup, outputDir string) (*KmerSetGroup, error)
|
||||
func (ksg *KmerSetGroup) IntersectWith(other *KmerSetGroup, outputDir string) (*KmerSetGroup, error)
|
||||
|
||||
// --- Métriques (résultat en mémoire, pas de sortie disque) ---
|
||||
|
||||
func (ksg *KmerSetGroup) JaccardDistanceMatrix() *obidist.DistMatrix
|
||||
func (ksg *KmerSetGroup) JaccardSimilarityMatrix() *obidist.DistMatrix
|
||||
|
||||
// --- Accès individuel ---
|
||||
|
||||
func (ksg *KmerSetGroup) Len(setIndex ...int) uint64
|
||||
func (ksg *KmerSetGroup) Contains(setIndex int, kmer uint64) bool
|
||||
func (ksg *KmerSetGroup) Iterator(setIndex int) iter.Seq[uint64]
|
||||
```
|
||||
|
||||
---
|
||||
|
||||
## Implémentation interne
|
||||
|
||||
### Primitives bas niveau
|
||||
|
||||
**`varint.go`** : encode/decode varint uint64
|
||||
|
||||
```go
|
||||
func EncodeVarint(w io.Writer, v uint64) (int, error)
|
||||
func DecodeVarint(r io.Reader) (uint64, error)
|
||||
```
|
||||
|
||||
### Format .kdi
|
||||
|
||||
**`kdi_writer.go`** : écriture d'un fichier .kdi à partir d'un flux
|
||||
trié de uint64 (delta-encode au vol).
|
||||
|
||||
```go
|
||||
type KdiWriter struct { ... }
|
||||
func NewKdiWriter(path string) (*KdiWriter, error)
|
||||
func (w *KdiWriter) Write(kmer uint64) error
|
||||
func (w *KdiWriter) Close() error
|
||||
```
|
||||
|
||||
**`kdi_reader.go`** : lecture streaming d'un fichier .kdi (décode
|
||||
les deltas au vol).
|
||||
|
||||
```go
|
||||
type KdiReader struct { ... }
|
||||
func NewKdiReader(path string) (*KdiReader, error)
|
||||
func (r *KdiReader) Next() (uint64, bool)
|
||||
func (r *KdiReader) Count() uint64
|
||||
func (r *KdiReader) Close() error
|
||||
```
|
||||
|
||||
### Format .skm
|
||||
|
||||
**`skm_writer.go`** : écriture de super-kmers encodés 2 bits/base.
|
||||
|
||||
```go
|
||||
type SkmWriter struct { ... }
|
||||
func NewSkmWriter(path string) (*SkmWriter, error)
|
||||
func (w *SkmWriter) Write(sk SuperKmer) error
|
||||
func (w *SkmWriter) Close() error
|
||||
```
|
||||
|
||||
**`skm_reader.go`** : lecture de super-kmers depuis un fichier .skm.
|
||||
|
||||
```go
|
||||
type SkmReader struct { ... }
|
||||
func NewSkmReader(path string) (*SkmReader, error)
|
||||
func (r *SkmReader) Next() (SuperKmer, bool)
|
||||
func (r *SkmReader) Close() error
|
||||
```
|
||||
|
||||
### Merge streaming
|
||||
|
||||
**`kdi_merge.go`** : k-way merge de plusieurs flux triés.
|
||||
|
||||
```go
|
||||
type KWayMerge struct { ... }
|
||||
func NewKWayMerge(readers []*KdiReader) *KWayMerge
|
||||
func (m *KWayMerge) Next() (kmer uint64, count int, ok bool)
|
||||
func (m *KWayMerge) Close() error
|
||||
```
|
||||
|
||||
### Builder
|
||||
|
||||
**`kmer_set_builder.go`** : construction d'un KmerSetGroup.
|
||||
|
||||
Le builder gère :
|
||||
- P × N écrivains .skm bufferisés (un par partition × set)
|
||||
- À la clôture : traitement partition par partition
|
||||
(parallélisable sur plusieurs cores)
|
||||
|
||||
Gestion mémoire des buffers d'écriture :
|
||||
- Chaque SkmWriter a un buffer I/O de taille raisonnable (~64 Ko)
|
||||
- Avec P=1024 et N=1 : 1024 × 64 Ko = 64 Mo de buffers
|
||||
- Avec P=1024 et N=10 : 640 Mo de buffers
|
||||
- Pas de buffer de k-mers en RAM : tout est écrit sur disque
|
||||
immédiatement via les super-kmers
|
||||
|
||||
RAM pendant Close() (tri d'une partition) :
|
||||
- Charger les super-kmers → extraire les k-mers → tableau []uint64
|
||||
- Avec P=1024 et 10^10 k-mers/set : ~10^7 k-mers/partition × 8 = ~80 Mo
|
||||
- Avec FrequencyFilter (doublons) et couverture 30× :
|
||||
~3×10^8/partition × 8 = ~2.4 Go (ajustable via P)
|
||||
|
||||
### Structure disk-based
|
||||
|
||||
**`kmer_set_disk.go`** : KmerSetGroup en lecture seule.
|
||||
|
||||
**`kmer_set_disk_ops.go`** : opérations ensemblistes par merge
|
||||
streaming partition par partition.
|
||||
|
||||
---
|
||||
|
||||
## Ce qui change par rapport à l'API actuelle
|
||||
|
||||
### Changements de sémantique
|
||||
|
||||
| Aspect | Ancien (roaring) | Nouveau (disk-based) |
|
||||
|---|---|---|
|
||||
| Stockage | En mémoire (roaring64.Bitmap) | Sur disque (.kdi delta-encoded) |
|
||||
| Temporaire construction | En mémoire | Super-kmers sur disque (.skm 2 bits/base) |
|
||||
| Mutabilité | Mutable à tout moment | Builder → Close() → immutable |
|
||||
| Opérations ensemblistes | Résultat en mémoire | Résultat sur disque (nouveau répertoire) |
|
||||
| Contains | O(1) roaring lookup | O(log n) recherche binaire sur .kdi |
|
||||
| Itération | Roaring iterator | Streaming décodage delta-varint |
|
||||
|
||||
### API conservée (signatures identiques ou quasi-identiques)
|
||||
|
||||
- `KmerSetGroup` : `K()`, `Size()`, `Id()`, `SetId()`
|
||||
- Toute l'API attributs
|
||||
- `JaccardDistanceMatrix()`, `JaccardSimilarityMatrix()`
|
||||
- `Len()`, `Contains()`
|
||||
|
||||
### API modifiée
|
||||
|
||||
- `Union()`, `Intersect()`, etc. : ajout du paramètre `outputDir`
|
||||
- `QuorumAtLeast()`, etc. : idem
|
||||
- Construction : `NewKmerSetGroupBuilder()` + `AddSequence()` + `Close()`
|
||||
au lieu de manipulation directe
|
||||
|
||||
### API supprimée
|
||||
|
||||
- `KmerSet` comme type distinct (remplacé par KmerSetGroup singleton)
|
||||
- `FrequencyFilter` comme type distinct (mode du Builder)
|
||||
- Tout accès direct à `roaring64.Bitmap`
|
||||
- `KmerSet.Copy()` (copie de répertoire à la place)
|
||||
- `KmerSet.Union()`, `.Intersect()`, `.Difference()` (deviennent méthodes
|
||||
de KmerSetGroup avec outputDir)
|
||||
|
||||
---
|
||||
|
||||
## Fichiers à créer / modifier dans pkg/obikmer
|
||||
|
||||
### Nouveaux fichiers
|
||||
|
||||
| Fichier | Contenu |
|
||||
|---|---|
|
||||
| `varint.go` | Encode/Decode varint uint64 |
|
||||
| `kdi_writer.go` | Écrivain de fichiers .kdi (delta-encoded) |
|
||||
| `kdi_reader.go` | Lecteur streaming de fichiers .kdi |
|
||||
| `skm_writer.go` | Écrivain de super-kmers encodés 2 bits/base |
|
||||
| `skm_reader.go` | Lecteur de super-kmers depuis .skm |
|
||||
| `kdi_merge.go` | K-way merge streaming de flux triés |
|
||||
| `kmer_set_builder.go` | KmerSetGroupBuilder (construction) |
|
||||
| `kmer_set_disk.go` | KmerSetGroup disk-based (lecture, métadonnées) |
|
||||
| `kmer_set_disk_ops.go` | Opérations ensemblistes streaming |
|
||||
|
||||
### Fichiers à supprimer
|
||||
|
||||
| Fichier | Raison |
|
||||
|---|---|
|
||||
| `kmer_set.go` | Remplacé par kmer_set_disk.go |
|
||||
| `kmer_set_group.go` | Idem |
|
||||
| `kmer_set_attributes.go` | Intégré dans kmer_set_disk.go |
|
||||
| `kmer_set_persistence.go` | L'index est nativement sur disque |
|
||||
| `kmer_set_group_quorum.go` | Intégré dans kmer_set_disk_ops.go |
|
||||
| `frequency_filter.go` | Mode du Builder, plus de type séparé |
|
||||
| `kmer_index_builder.go` | Remplacé par kmer_set_builder.go |
|
||||
|
||||
### Fichiers conservés tels quels
|
||||
|
||||
| Fichier | Contenu |
|
||||
|---|---|
|
||||
| `encodekmer.go` | Encodage/décodage k-mers |
|
||||
| `superkmer.go` | Structure SuperKmer |
|
||||
| `superkmer_iter.go` | IterSuperKmers, IterCanonicalKmers |
|
||||
| `encodefourmer.go` | Encode4mer |
|
||||
| `counting.go` | Count4Mer |
|
||||
| `kmermap.go` | KmerMap (usage indépendant) |
|
||||
| `debruijn.go` | Graphe de de Bruijn |
|
||||
|
||||
---
|
||||
|
||||
## Ordre d'implémentation
|
||||
|
||||
1. `varint.go` + tests
|
||||
2. `skm_writer.go` + `skm_reader.go` + tests
|
||||
3. `kdi_writer.go` + `kdi_reader.go` + tests
|
||||
4. `kdi_merge.go` + tests
|
||||
5. `kmer_set_builder.go` + tests (construction + Close)
|
||||
6. `kmer_set_disk.go` (structure, métadonnées, Open)
|
||||
7. `kmer_set_disk_ops.go` + tests (Union, Intersect, Quorum, Jaccard)
|
||||
8. Adaptation de `pkg/obitools/obikindex/`
|
||||
9. Suppression des anciens fichiers roaring
|
||||
10. Adaptation des tests existants
|
||||
|
||||
Chaque étape est testable indépendamment.
|
||||
|
||||
---
|
||||
|
||||
## Dépendances externes
|
||||
|
||||
### Supprimées
|
||||
|
||||
- `github.com/RoaringBitmap/roaring` : plus nécessaire pour les
|
||||
index k-mers (vérifier si d'autres packages l'utilisent encore)
|
||||
|
||||
### Ajoutées
|
||||
|
||||
- Aucune. Varint, delta-encoding, merge, encodage 2 bits/base :
|
||||
tout est implémentable en Go standard.
|
||||
@@ -1,213 +0,0 @@
|
||||
# Index de k-mers pour génomes de grande taille
|
||||
|
||||
## Contexte et objectifs
|
||||
|
||||
### Cas d'usage
|
||||
|
||||
- Indexation de k-mers longs (k=31) pour des génomes de grande taille (< 10 Go par génome)
|
||||
- Nombre de génomes : plusieurs dizaines à quelques centaines
|
||||
- Indexation en parallèle
|
||||
- Stockage sur disque
|
||||
- Possibilité d'ajouter des génomes, mais pas de modifier un génome existant
|
||||
|
||||
### Requêtes cibles
|
||||
|
||||
- **Présence/absence** d'un k-mer dans un génome
|
||||
- **Intersection** entre génomes
|
||||
- **Distances** : Jaccard (présence/absence) et potentiellement Bray-Curtis (comptage)
|
||||
|
||||
### Ressources disponibles
|
||||
|
||||
- 128 Go de RAM
|
||||
- Stockage disque
|
||||
|
||||
---
|
||||
|
||||
## Estimation des volumes
|
||||
|
||||
### Par génome
|
||||
|
||||
- **10 Go de séquence** → ~10¹⁰ k-mers bruts (chevauchants)
|
||||
- **Après déduplication** : typiquement 10-50% de k-mers uniques → **~1-5 × 10⁹ k-mers distincts**
|
||||
|
||||
### Espace théorique
|
||||
|
||||
- **k=31** → 62 bits → ~4.6 × 10¹⁸ k-mers possibles
|
||||
- Table d'indexation directe impossible
|
||||
|
||||
---
|
||||
|
||||
## Métriques de distance
|
||||
|
||||
### Présence/absence (binaire)
|
||||
|
||||
- **Jaccard** : |A ∩ B| / |A ∪ B|
|
||||
- **Sørensen-Dice** : 2|A ∩ B| / (|A| + |B|)
|
||||
|
||||
### Comptage (abondance)
|
||||
|
||||
- **Bray-Curtis** : 1 - (2 × Σ min(aᵢ, bᵢ)) / (Σ aᵢ + Σ bᵢ)
|
||||
|
||||
Note : Pour Bray-Curtis, le stockage des comptages est nécessaire, ce qui augmente significativement la taille de l'index.
|
||||
|
||||
---
|
||||
|
||||
## Options d'indexation
|
||||
|
||||
### Option 1 : Bloom Filter par génome
|
||||
|
||||
**Principe** : Structure probabiliste pour test d'appartenance.
|
||||
|
||||
**Avantages :**
|
||||
- Très compact : ~10 bits/élément pour FPR ~1%
|
||||
- Construction rapide, streaming
|
||||
- Facile à sérialiser/désérialiser
|
||||
- Intersection et Jaccard estimables via formules analytiques
|
||||
|
||||
**Inconvénients :**
|
||||
- Faux positifs (pas de faux négatifs)
|
||||
- Distances approximatives
|
||||
|
||||
**Taille estimée** : 1-6 Go par génome (selon FPR cible)
|
||||
|
||||
#### Dimensionnement des Bloom filters
|
||||
|
||||
```
|
||||
\mathrm{FPR} ;=; \left(1 - e^{-h n / m}\right)^h
|
||||
```
|
||||
|
||||
|
||||
| Bits/élément | FPR optimal | k (hash functions) |
|
||||
|--------------|-------------|---------------------|
|
||||
| 8 | ~2% | 5-6 |
|
||||
| 10 | ~1% | 7 |
|
||||
| 12 | ~0.3% | 8 |
|
||||
| 16 | ~0.01% | 11 |
|
||||
|
||||
Formule du taux de faux positifs :
|
||||
```
|
||||
FPR ≈ (1 - e^(-kn/m))^k
|
||||
```
|
||||
Où n = nombre d'éléments, m = nombre de bits, k = nombre de hash functions.
|
||||
|
||||
### Option 2 : Ensemble trié de k-mers
|
||||
|
||||
**Principe** : Stocker les k-mers (uint64) triés, avec compression possible.
|
||||
|
||||
**Avantages :**
|
||||
- Exact (pas de faux positifs)
|
||||
- Intersection/union par merge sort O(n+m)
|
||||
- Compression efficace (delta encoding sur k-mers triés)
|
||||
|
||||
**Inconvénients :**
|
||||
- Plus volumineux : 8 octets/k-mer
|
||||
- Construction plus lente (tri nécessaire)
|
||||
|
||||
**Taille estimée** : 8-40 Go par génome (non compressé)
|
||||
|
||||
### Option 3 : MPHF (Minimal Perfect Hash Function)
|
||||
|
||||
**Principe** : Fonction de hash parfaite minimale pour les k-mers présents.
|
||||
|
||||
**Avantages :**
|
||||
- Très compact : ~3-4 bits/élément
|
||||
- Lookup O(1)
|
||||
- Exact pour les k-mers présents
|
||||
|
||||
**Inconvénients :**
|
||||
- Construction coûteuse (plusieurs passes)
|
||||
- Statique (pas d'ajout de k-mers après construction)
|
||||
- Ne distingue pas "absent" vs "jamais vu" sans structure auxiliaire
|
||||
|
||||
### Option 4 : Hybride MPHF + Bloom filter
|
||||
|
||||
- MPHF pour mapping compact des k-mers présents
|
||||
- Bloom filter pour pré-filtrage des absents
|
||||
|
||||
---
|
||||
|
||||
## Optimisation : Indexation de (k-2)-mers pour requêtes k-mers
|
||||
|
||||
### Principe
|
||||
|
||||
Au lieu d'indexer directement les 31-mers dans un Bloom filter, on indexe les 29-mers. Pour tester la présence d'un 31-mer, on vérifie que les **trois 29-mers** qu'il contient sont présents :
|
||||
|
||||
- positions 0-28
|
||||
- positions 1-29
|
||||
- positions 2-30
|
||||
|
||||
### Analyse probabiliste
|
||||
|
||||
Si le Bloom filter a un FPR de p pour un 29-mer individuel, le FPR effectif pour un 31-mer devient **p³** (les trois requêtes doivent toutes être des faux positifs).
|
||||
|
||||
| FPR 29-mer | FPR 31-mer effectif |
|
||||
|------------|---------------------|
|
||||
| 10% | 0.1% |
|
||||
| 5% | 0.0125% |
|
||||
| 1% | 0.0001% |
|
||||
|
||||
### Avantages
|
||||
|
||||
1. **Moins d'éléments à stocker** : il y a moins de 29-mers distincts que de 31-mers distincts dans un génome (deux 31-mers différents peuvent partager un même 29-mer)
|
||||
|
||||
2. **FPR drastiquement réduit** : FPR³ avec seulement 3 requêtes
|
||||
|
||||
3. **Index plus compact** : on peut utiliser moins de bits par élément (FPR plus élevé acceptable sur le 29-mer) tout en obtenant un FPR très bas sur le 31-mer
|
||||
|
||||
### Trade-off
|
||||
|
||||
Un Bloom filter à **5-6 bits/élément** pour les 29-mers donnerait un FPR effectif < 0.01% pour les 31-mers, soit environ **2× plus compact** que l'approche directe à qualité égale.
|
||||
|
||||
**Coût** : 3× plus de requêtes par lookup (mais les requêtes Bloom sont très rapides).
|
||||
|
||||
---
|
||||
|
||||
## Accélération des calculs de distance : MinHash
|
||||
|
||||
### Principe
|
||||
|
||||
Pré-calculer une "signature" compacte (sketch) de chaque génome permettant d'estimer rapidement Jaccard sans charger les index complets.
|
||||
|
||||
### Avantages
|
||||
|
||||
- Matrice de distances entre 100+ génomes en quelques secondes
|
||||
- Signature de taille fixe (ex: 1000-10000 hash values) quel que soit le génome
|
||||
- Stockage minimal
|
||||
|
||||
### Utilisation
|
||||
|
||||
1. Construction : une passe sur les k-mers de chaque génome
|
||||
2. Distance : comparaison des sketches en O(taille du sketch)
|
||||
|
||||
---
|
||||
|
||||
## Architecture recommandée
|
||||
|
||||
### Pour présence/absence + Jaccard
|
||||
|
||||
1. **Index principal** : Bloom filter de (k-2)-mers avec l'optimisation décrite
|
||||
- Compact (~3-5 Go par génome)
|
||||
- FPR très bas pour les k-mers grâce aux requêtes triples
|
||||
|
||||
2. **Sketches MinHash** : pour calcul rapide des distances entre génomes
|
||||
- Quelques Ko par génome
|
||||
- Permet exploration rapide de la matrice de distances
|
||||
|
||||
### Pour comptage + Bray-Curtis
|
||||
|
||||
1. **Index principal** : k-mers triés + comptages
|
||||
- uint64 (k-mer) + uint8/uint16 (count)
|
||||
- Compression delta possible
|
||||
- Plus volumineux mais exact
|
||||
|
||||
2. **Sketches** : variantes de MinHash pour données pondérées (ex: HyperMinHash)
|
||||
|
||||
---
|
||||
|
||||
## Prochaines étapes
|
||||
|
||||
1. Implémenter un Bloom filter optimisé pour k-mers
|
||||
2. Implémenter l'optimisation (k-2)-mer → k-mer
|
||||
3. Implémenter MinHash pour les sketches
|
||||
4. Définir le format de sérialisation sur disque
|
||||
5. Benchmarker sur des génomes réels
|
||||
@@ -1,735 +0,0 @@
|
||||
# Architecture d'une commande OBITools
|
||||
|
||||
## Vue d'ensemble
|
||||
|
||||
Une commande OBITools suit une architecture modulaire et standardisée qui sépare clairement les responsabilités entre :
|
||||
- Le package de la commande dans `pkg/obitools/<nom_commande>/`
|
||||
- L'exécutable dans `cmd/obitools/<nom_commande>/`
|
||||
|
||||
Cette architecture favorise la réutilisabilité du code, la testabilité et la cohérence entre les différentes commandes de la suite OBITools.
|
||||
|
||||
## Structure du projet
|
||||
|
||||
```
|
||||
obitools4/
|
||||
├── pkg/obitools/
|
||||
│ ├── obiconvert/ # Commande de conversion (base pour toutes)
|
||||
│ │ ├── obiconvert.go # Fonctions vides (pas d'implémentation)
|
||||
│ │ ├── options.go # Définition des options CLI
|
||||
│ │ ├── sequence_reader.go # Lecture des séquences
|
||||
│ │ └── sequence_writer.go # Écriture des séquences
|
||||
│ ├── obiuniq/ # Commande de déréplication
|
||||
│ │ ├── obiuniq.go # (fichier vide)
|
||||
│ │ ├── options.go # Options spécifiques à obiuniq
|
||||
│ │ └── unique.go # Implémentation du traitement
|
||||
│ ├── obipairing/ # Assemblage de lectures paired-end
|
||||
│ ├── obisummary/ # Résumé de fichiers de séquences
|
||||
│ └── obimicrosat/ # Détection de microsatellites
|
||||
└── cmd/obitools/
|
||||
├── obiconvert/
|
||||
│ └── main.go # Point d'entrée de la commande
|
||||
├── obiuniq/
|
||||
│ └── main.go
|
||||
├── obipairing/
|
||||
│ └── main.go
|
||||
├── obisummary/
|
||||
│ └── main.go
|
||||
└── obimicrosat/
|
||||
└── main.go
|
||||
```
|
||||
|
||||
## Composants de l'architecture
|
||||
|
||||
### 1. Package `pkg/obitools/<commande>/`
|
||||
|
||||
Chaque commande possède son propre package dans `pkg/obitools/` qui contient l'implémentation complète de la logique métier. Ce package est structuré en plusieurs fichiers :
|
||||
|
||||
#### a) `options.go` - Gestion des options CLI
|
||||
|
||||
Ce fichier définit :
|
||||
- Les **variables globales** privées (préfixées par `_`) stockant les valeurs des options
|
||||
- La fonction **`OptionSet()`** qui configure toutes les options pour la commande
|
||||
- Les fonctions **`CLI*()`** qui retournent les valeurs des options (getters)
|
||||
- Les fonctions **`Set*()`** qui permettent de définir les options programmatiquement (setters)
|
||||
|
||||
**Exemple (obiuniq/options.go) :**
|
||||
|
||||
```go
|
||||
package obiuniq
|
||||
|
||||
import (
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// Variables globales privées pour stocker les options
|
||||
var _StatsOn = make([]string, 0, 10)
|
||||
var _Keys = make([]string, 0, 10)
|
||||
var _InMemory = false
|
||||
var _chunks = 100
|
||||
|
||||
// Configuration des options spécifiques à la commande
|
||||
func UniqueOptionSet(options *getoptions.GetOpt) {
|
||||
options.StringSliceVar(&_StatsOn, "merge", 1, 1,
|
||||
options.Alias("m"),
|
||||
options.ArgName("KEY"),
|
||||
options.Description("Adds a merged attribute..."))
|
||||
|
||||
options.BoolVar(&_InMemory, "in-memory", _InMemory,
|
||||
options.Description("Use memory instead of disk..."))
|
||||
|
||||
options.IntVar(&_chunks, "chunk-count", _chunks,
|
||||
options.Description("In how many chunks..."))
|
||||
}
|
||||
|
||||
// OptionSet combine les options de base + les options spécifiques
|
||||
func OptionSet(options *getoptions.GetOpt) {
|
||||
obiconvert.OptionSet(false)(options) // Options de base
|
||||
UniqueOptionSet(options) // Options spécifiques
|
||||
}
|
||||
|
||||
// Getters pour accéder aux valeurs des options
|
||||
func CLIStatsOn() []string {
|
||||
return _StatsOn
|
||||
}
|
||||
|
||||
func CLIUniqueInMemory() bool {
|
||||
return _InMemory
|
||||
}
|
||||
|
||||
// Setters pour définir les options programmatiquement
|
||||
func SetUniqueInMemory(inMemory bool) {
|
||||
_InMemory = inMemory
|
||||
}
|
||||
```
|
||||
|
||||
**Convention de nommage :**
|
||||
- Variables privées : `_NomOption` (underscore préfixe)
|
||||
- Getters : `CLINomOption()` (préfixe CLI)
|
||||
- Setters : `SetNomOption()` (préfixe Set)
|
||||
|
||||
#### b) Fichier(s) d'implémentation
|
||||
|
||||
Un ou plusieurs fichiers contenant la logique métier de la commande :
|
||||
|
||||
**Exemple (obiuniq/unique.go) :**
|
||||
|
||||
```go
|
||||
package obiuniq
|
||||
|
||||
import (
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obichunk"
|
||||
)
|
||||
|
||||
// Fonction CLI principale qui orchestre le traitement
|
||||
func CLIUnique(sequences obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
// Récupération des options via les getters CLI*()
|
||||
options := make([]obichunk.WithOption, 0, 30)
|
||||
|
||||
options = append(options,
|
||||
obichunk.OptionBatchCount(CLINumberOfChunks()),
|
||||
)
|
||||
|
||||
if CLIUniqueInMemory() {
|
||||
options = append(options, obichunk.OptionSortOnMemory())
|
||||
} else {
|
||||
options = append(options, obichunk.OptionSortOnDisk())
|
||||
}
|
||||
|
||||
// Appel de la fonction de traitement réelle
|
||||
iUnique, err := obichunk.IUniqueSequence(sequences, options...)
|
||||
|
||||
if err != nil {
|
||||
log.Fatal(err)
|
||||
}
|
||||
|
||||
return iUnique
|
||||
}
|
||||
```
|
||||
|
||||
**Autres exemples d'implémentation :**
|
||||
|
||||
- **obimicrosat/microsat.go** : Contient `MakeMicrosatWorker()` et `CLIAnnotateMicrosat()`
|
||||
- **obisummary/obisummary.go** : Contient `ISummary()` et les structures de données
|
||||
|
||||
#### c) Fichiers utilitaires (optionnel)
|
||||
|
||||
Certaines commandes ont des fichiers additionnels pour des fonctionnalités spécifiques.
|
||||
|
||||
**Exemple (obipairing/options.go) :**
|
||||
|
||||
```go
|
||||
// Fonction spéciale pour créer un itérateur de séquences pairées
|
||||
func CLIPairedSequence() (obiiter.IBioSequence, error) {
|
||||
forward, err := obiconvert.CLIReadBioSequences(_ForwardFile)
|
||||
if err != nil {
|
||||
return obiiter.NilIBioSequence, err
|
||||
}
|
||||
|
||||
reverse, err := obiconvert.CLIReadBioSequences(_ReverseFile)
|
||||
if err != nil {
|
||||
return obiiter.NilIBioSequence, err
|
||||
}
|
||||
|
||||
paired := forward.PairTo(reverse)
|
||||
return paired, nil
|
||||
}
|
||||
```
|
||||
|
||||
### 2. Package `obiconvert` - La base commune
|
||||
|
||||
Le package `obiconvert` est spécial car il fournit les fonctionnalités de base utilisées par toutes les autres commandes :
|
||||
|
||||
#### Fonctionnalités fournies :
|
||||
|
||||
1. **Lecture de séquences** (`sequence_reader.go`)
|
||||
- `CLIReadBioSequences()` : lecture depuis fichiers ou stdin
|
||||
- Support de multiples formats (FASTA, FASTQ, EMBL, GenBank, etc.)
|
||||
- Gestion des fichiers multiples
|
||||
- Barre de progression optionnelle
|
||||
|
||||
2. **Écriture de séquences** (`sequence_writer.go`)
|
||||
- `CLIWriteBioSequences()` : écriture vers fichiers ou stdout
|
||||
- Support de multiples formats
|
||||
- Gestion des lectures pairées
|
||||
- Compression optionnelle
|
||||
|
||||
3. **Options communes** (`options.go`)
|
||||
- Options d'entrée (format, skip, etc.)
|
||||
- Options de sortie (format, fichier, compression)
|
||||
- Options de mode (barre de progression, etc.)
|
||||
|
||||
#### Utilisation par les autres commandes :
|
||||
|
||||
Toutes les commandes incluent les options de `obiconvert` via :
|
||||
|
||||
```go
|
||||
func OptionSet(options *getoptions.GetOpt) {
|
||||
obiconvert.OptionSet(false)(options) // false = pas de fichiers pairés
|
||||
MaCommandeOptionSet(options) // Options spécifiques
|
||||
}
|
||||
```
|
||||
|
||||
### 3. Exécutable `cmd/obitools/<commande>/main.go`
|
||||
|
||||
Le fichier `main.go` de chaque commande est volontairement **minimaliste** et suit toujours le même pattern :
|
||||
|
||||
```go
|
||||
package main
|
||||
|
||||
import (
|
||||
"os"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/macommande"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
)
|
||||
|
||||
func main() {
|
||||
// 1. Configuration optionnelle de paramètres par défaut
|
||||
obidefault.SetBatchSize(10)
|
||||
|
||||
// 2. Génération du parser d'options
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"macommande", // Nom de la commande
|
||||
"description de la commande", // Description
|
||||
macommande.OptionSet) // Fonction de configuration des options
|
||||
|
||||
// 3. Parsing des arguments
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
// 4. Lecture des séquences d'entrée
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||
|
||||
// 5. Traitement spécifique de la commande
|
||||
resultat := macommande.CLITraitement(sequences)
|
||||
|
||||
// 6. Écriture des résultats
|
||||
obiconvert.CLIWriteBioSequences(resultat, true)
|
||||
|
||||
// 7. Attente de la fin du pipeline
|
||||
obiutils.WaitForLastPipe()
|
||||
}
|
||||
```
|
||||
|
||||
## Patterns architecturaux
|
||||
|
||||
### Pattern 1 : Pipeline de traitement de séquences
|
||||
|
||||
La plupart des commandes suivent ce pattern :
|
||||
|
||||
```
|
||||
Lecture → Traitement → Écriture
|
||||
```
|
||||
|
||||
**Exemples :**
|
||||
- **obiconvert** : Lecture → Écriture (conversion de format)
|
||||
- **obiuniq** : Lecture → Déréplication → Écriture
|
||||
- **obimicrosat** : Lecture → Annotation → Filtrage → Écriture
|
||||
|
||||
### Pattern 2 : Traitement avec entrées multiples
|
||||
|
||||
Certaines commandes acceptent plusieurs fichiers d'entrée :
|
||||
|
||||
**obipairing** :
|
||||
```
|
||||
Lecture Forward + Lecture Reverse → Pairing → Assemblage → Écriture
|
||||
```
|
||||
|
||||
### Pattern 3 : Traitement sans écriture de séquences
|
||||
|
||||
**obisummary** : produit un résumé JSON/YAML au lieu de séquences
|
||||
|
||||
```go
|
||||
func main() {
|
||||
// ... parsing options et lecture ...
|
||||
|
||||
summary := obisummary.ISummary(fs, obisummary.CLIMapSummary())
|
||||
|
||||
// Formatage et affichage direct
|
||||
if obisummary.CLIOutFormat() == "json" {
|
||||
output, _ := json.MarshalIndent(summary, "", " ")
|
||||
fmt.Print(string(output))
|
||||
} else {
|
||||
output, _ := yaml.Marshal(summary)
|
||||
fmt.Print(string(output))
|
||||
}
|
||||
}
|
||||
```
|
||||
|
||||
### Pattern 4 : Utilisation de Workers
|
||||
|
||||
Les commandes qui transforment des séquences utilisent souvent le pattern Worker :
|
||||
|
||||
```go
|
||||
// Création d'un worker
|
||||
worker := MakeMicrosatWorker(
|
||||
CLIMinUnitLength(),
|
||||
CLIMaxUnitLength(),
|
||||
// ... autres paramètres
|
||||
)
|
||||
|
||||
// Application du worker sur l'itérateur
|
||||
newIter = iterator.MakeIWorker(
|
||||
worker,
|
||||
false, // merge results
|
||||
obidefault.ParallelWorkers() // parallélisation
|
||||
)
|
||||
```
|
||||
|
||||
## Étapes d'implémentation d'une nouvelle commande
|
||||
|
||||
### Étape 1 : Créer le package dans `pkg/obitools/`
|
||||
|
||||
```bash
|
||||
mkdir -p pkg/obitools/macommande
|
||||
```
|
||||
|
||||
### Étape 2 : Créer `options.go`
|
||||
|
||||
```go
|
||||
package macommande
|
||||
|
||||
import (
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
// Variables privées pour les options
|
||||
var _MonOption = "valeur_par_defaut"
|
||||
|
||||
// Configuration des options spécifiques
|
||||
func MaCommandeOptionSet(options *getoptions.GetOpt) {
|
||||
options.StringVar(&_MonOption, "mon-option", _MonOption,
|
||||
options.Alias("o"),
|
||||
options.Description("Description de l'option"))
|
||||
}
|
||||
|
||||
// OptionSet combine options de base + spécifiques
|
||||
func OptionSet(options *getoptions.GetOpt) {
|
||||
obiconvert.OptionSet(false)(options) // false si pas de fichiers pairés
|
||||
MaCommandeOptionSet(options)
|
||||
}
|
||||
|
||||
// Getters
|
||||
func CLIMonOption() string {
|
||||
return _MonOption
|
||||
}
|
||||
|
||||
// Setters
|
||||
func SetMonOption(value string) {
|
||||
_MonOption = value
|
||||
}
|
||||
```
|
||||
|
||||
### Étape 3 : Créer le fichier d'implémentation
|
||||
|
||||
Créer `macommande.go` (ou un nom plus descriptif) :
|
||||
|
||||
```go
|
||||
package macommande
|
||||
|
||||
import (
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
)
|
||||
|
||||
// Fonction de traitement principale
|
||||
func CLIMaCommande(sequences obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
// Récupération des options
|
||||
option := CLIMonOption()
|
||||
|
||||
// Implémentation du traitement
|
||||
// ...
|
||||
|
||||
return resultat
|
||||
}
|
||||
```
|
||||
|
||||
### Étape 4 : Créer l'exécutable dans `cmd/obitools/`
|
||||
|
||||
```bash
|
||||
mkdir -p cmd/obitools/macommande
|
||||
```
|
||||
|
||||
Créer `main.go` :
|
||||
|
||||
```go
|
||||
package main
|
||||
|
||||
import (
|
||||
"os"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/macommande"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
)
|
||||
|
||||
func main() {
|
||||
// Parser d'options
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"macommande",
|
||||
"Description courte de ma commande",
|
||||
macommande.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
// Lecture
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||
|
||||
// Traitement
|
||||
resultat := macommande.CLIMaCommande(sequences)
|
||||
|
||||
// Écriture
|
||||
obiconvert.CLIWriteBioSequences(resultat, true)
|
||||
|
||||
// Attente
|
||||
obiutils.WaitForLastPipe()
|
||||
}
|
||||
```
|
||||
|
||||
### Étape 5 : Configurations optionnelles
|
||||
|
||||
Dans `main.go`, avant le parsing des options, on peut configurer :
|
||||
|
||||
```go
|
||||
// Taille des batchs de séquences
|
||||
obidefault.SetBatchSize(10)
|
||||
|
||||
// Nombre de workers en lecture (strict)
|
||||
obidefault.SetStrictReadWorker(2)
|
||||
|
||||
// Nombre de workers en écriture
|
||||
obidefault.SetStrictWriteWorker(2)
|
||||
|
||||
// Désactiver la lecture des qualités
|
||||
obidefault.SetReadQualities(false)
|
||||
```
|
||||
|
||||
### Étape 6 : Gestion des erreurs
|
||||
|
||||
Utiliser les fonctions utilitaires pour les messages d'erreur cohérents :
|
||||
|
||||
```go
|
||||
// Pour les erreurs d'ouverture de fichiers
|
||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||
|
||||
// Pour les erreurs générales
|
||||
if err != nil {
|
||||
log.Errorf("Message d'erreur: %v", err)
|
||||
os.Exit(1)
|
||||
}
|
||||
```
|
||||
|
||||
### Étape 7 : Tests et debugging (optionnel)
|
||||
|
||||
Des commentaires dans le code montrent comment activer le profiling :
|
||||
|
||||
```go
|
||||
// go tool pprof -http=":8000" ./macommande ./cpu.pprof
|
||||
// f, err := os.Create("cpu.pprof")
|
||||
// if err != nil {
|
||||
// log.Fatal(err)
|
||||
// }
|
||||
// pprof.StartCPUProfile(f)
|
||||
// defer pprof.StopCPUProfile()
|
||||
|
||||
// go tool trace cpu.trace
|
||||
// ftrace, err := os.Create("cpu.trace")
|
||||
// if err != nil {
|
||||
// log.Fatal(err)
|
||||
// }
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
```
|
||||
|
||||
## Bonnes pratiques observées
|
||||
|
||||
### 1. Séparation des responsabilités
|
||||
|
||||
- **`main.go`** : orchestration minimale
|
||||
- **`options.go`** : définition et gestion des options
|
||||
- **Fichiers d'implémentation** : logique métier
|
||||
|
||||
### 2. Convention de nommage cohérente
|
||||
|
||||
- Variables d'options : `_NomOption`
|
||||
- Getters CLI : `CLINomOption()`
|
||||
- Setters : `SetNomOption()`
|
||||
- Fonctions de traitement CLI : `CLITraitement()`
|
||||
|
||||
### 3. Réutilisation du code
|
||||
|
||||
- Toutes les commandes réutilisent `obiconvert` pour l'I/O
|
||||
- Les options communes sont partagées
|
||||
- Les fonctions utilitaires sont centralisées
|
||||
|
||||
### 4. Configuration par défaut
|
||||
|
||||
Les valeurs par défaut sont :
|
||||
- Définies lors de l'initialisation des variables
|
||||
- Modifiables via les options CLI
|
||||
- Modifiables programmatiquement via les setters
|
||||
|
||||
### 5. Gestion des formats
|
||||
|
||||
Support automatique de multiples formats :
|
||||
- FASTA / FASTQ (avec compression gzip)
|
||||
- EMBL / GenBank
|
||||
- ecoPCR
|
||||
- CSV
|
||||
- JSON (avec différents formats d'en-têtes)
|
||||
|
||||
### 6. Parallélisation
|
||||
|
||||
Les commandes utilisent les workers parallèles via :
|
||||
- `obidefault.ParallelWorkers()`
|
||||
- `obidefault.SetStrictReadWorker(n)`
|
||||
- `obidefault.SetStrictWriteWorker(n)`
|
||||
|
||||
### 7. Logging cohérent
|
||||
|
||||
Utilisation de `logrus` pour tous les logs :
|
||||
```go
|
||||
log.Printf("Message informatif")
|
||||
log.Errorf("Message d'erreur: %v", err)
|
||||
log.Fatal(err) // Arrêt du programme
|
||||
```
|
||||
|
||||
## Dépendances principales
|
||||
|
||||
### Packages internes OBITools
|
||||
|
||||
- `pkg/obidefault` : valeurs par défaut et configuration globale
|
||||
- `pkg/obioptions` : génération du parser d'options
|
||||
- `pkg/obiiter` : itérateurs de séquences biologiques
|
||||
- `pkg/obiseq` : structures et fonctions pour séquences biologiques
|
||||
- `pkg/obiformats` : lecture/écriture de différents formats
|
||||
- `pkg/obiutils` : fonctions utilitaires diverses
|
||||
- `pkg/obichunk` : traitement par chunks (pour dereplication, etc.)
|
||||
|
||||
### Packages externes
|
||||
|
||||
- `github.com/DavidGamba/go-getoptions` : parsing des options CLI
|
||||
- `github.com/sirupsen/logrus` : logging structuré
|
||||
- `gopkg.in/yaml.v3` : encodage/décodage YAML
|
||||
- `github.com/dlclark/regexp2` : expressions régulières avancées
|
||||
|
||||
## Cas spéciaux
|
||||
|
||||
### Commande avec fichiers pairés (obipairing)
|
||||
|
||||
```go
|
||||
func OptionSet(options *getoptions.GetOpt) {
|
||||
obiconvert.OutputOptionSet(options)
|
||||
obiconvert.InputOptionSet(options)
|
||||
PairingOptionSet(options) // Options spécifiques au pairing
|
||||
}
|
||||
|
||||
func CLIPairedSequence() (obiiter.IBioSequence, error) {
|
||||
forward, err := obiconvert.CLIReadBioSequences(_ForwardFile)
|
||||
// ...
|
||||
reverse, err := obiconvert.CLIReadBioSequences(_ReverseFile)
|
||||
// ...
|
||||
paired := forward.PairTo(reverse)
|
||||
return paired, nil
|
||||
}
|
||||
```
|
||||
|
||||
Dans `main.go` :
|
||||
```go
|
||||
pairs, err := obipairing.CLIPairedSequence() // Lecture spéciale
|
||||
if err != nil {
|
||||
log.Errorf("Cannot open file (%v)", err)
|
||||
os.Exit(1)
|
||||
}
|
||||
|
||||
paired := obipairing.IAssemblePESequencesBatch(
|
||||
pairs,
|
||||
obipairing.CLIGapPenality(),
|
||||
// ... autres paramètres
|
||||
)
|
||||
```
|
||||
|
||||
### Commande sans sortie de séquences (obisummary)
|
||||
|
||||
Au lieu de `obiconvert.CLIWriteBioSequences()`, affichage direct :
|
||||
|
||||
```go
|
||||
summary := obisummary.ISummary(fs, obisummary.CLIMapSummary())
|
||||
|
||||
if obisummary.CLIOutFormat() == "json" {
|
||||
output, _ := json.MarshalIndent(summary, "", " ")
|
||||
fmt.Print(string(output))
|
||||
} else {
|
||||
output, _ := yaml.Marshal(summary)
|
||||
fmt.Print(string(output))
|
||||
}
|
||||
fmt.Printf("\n")
|
||||
```
|
||||
|
||||
### Commande avec Workers personnalisés (obimicrosat)
|
||||
|
||||
```go
|
||||
func CLIAnnotateMicrosat(iterator obiiter.IBioSequence) obiiter.IBioSequence {
|
||||
// Création du worker
|
||||
worker := MakeMicrosatWorker(
|
||||
CLIMinUnitLength(),
|
||||
CLIMaxUnitLength(),
|
||||
CLIMinUnitCount(),
|
||||
CLIMinLength(),
|
||||
CLIMinFlankLength(),
|
||||
CLIReoriented(),
|
||||
)
|
||||
|
||||
// Application du worker
|
||||
newIter := iterator.MakeIWorker(
|
||||
worker,
|
||||
false, // pas de merge
|
||||
obidefault.ParallelWorkers(), // parallélisation
|
||||
)
|
||||
|
||||
return newIter.FilterEmpty() // Filtrage des résultats vides
|
||||
}
|
||||
```
|
||||
|
||||
## Diagramme de flux d'exécution
|
||||
|
||||
```
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ cmd/obitools/macommande/main.go │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
│
|
||||
▼
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ 1. Génération du parser d'options │
|
||||
│ obioptions.GenerateOptionParser( │
|
||||
│ "macommande", │
|
||||
│ "description", │
|
||||
│ macommande.OptionSet) │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
│
|
||||
▼
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ pkg/obitools/macommande/options.go │
|
||||
│ ┌─────────────────────────────────────────────────────┐ │
|
||||
│ │ func OptionSet(options *getoptions.GetOpt) │ │
|
||||
│ │ obiconvert.OptionSet(false)(options) ───────────┐ │ │
|
||||
│ │ MaCommandeOptionSet(options) │ │ │
|
||||
│ └───────────────────────────────────────────────────┼─┘ │
|
||||
└────────────────────────────────────────────────────────┼─────┘
|
||||
│ │
|
||||
│ │
|
||||
┌─────────────┘ │
|
||||
│ │
|
||||
▼ ▼
|
||||
┌─────────────────────────────────┐ ┌───────────────────────────────┐
|
||||
│ 2. Parsing des arguments │ │ pkg/obitools/obiconvert/ │
|
||||
│ _, args := optionParser(...) │ │ options.go │
|
||||
└─────────────────────────────────┘ │ - InputOptionSet() │
|
||||
│ │ - OutputOptionSet() │
|
||||
▼ │ - PairedFilesOptionSet() │
|
||||
┌─────────────────────────────────┐ └───────────────────────────────┘
|
||||
│ 3. Lecture des séquences │
|
||||
│ CLIReadBioSequences(args) │
|
||||
└─────────────────────────────────┘
|
||||
│
|
||||
▼
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ pkg/obitools/obiconvert/sequence_reader.go │
|
||||
│ - ExpandListOfFiles() │
|
||||
│ - ReadSequencesFromFile() / ReadSequencesFromStdin() │
|
||||
│ - Support: FASTA, FASTQ, EMBL, GenBank, ecoPCR, CSV │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
│
|
||||
▼ obiiter.IBioSequence
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ 4. Traitement spécifique │
|
||||
│ macommande.CLITraitement(sequences) │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
│
|
||||
▼
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ pkg/obitools/macommande/<implementation>.go │
|
||||
│ - Récupération des options via CLI*() getters │
|
||||
│ - Application de la logique métier │
|
||||
│ - Retour d'un nouvel iterator │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
│
|
||||
▼ obiiter.IBioSequence
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ 5. Écriture des résultats │
|
||||
│ CLIWriteBioSequences(resultat, true) │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
│
|
||||
▼
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ pkg/obitools/obiconvert/sequence_writer.go │
|
||||
│ - WriteSequencesToFile() / WriteSequencesToStdout() │
|
||||
│ - Support: FASTA, FASTQ, JSON │
|
||||
│ - Gestion des lectures pairées │
|
||||
│ - Compression optionnelle │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
│
|
||||
▼
|
||||
┌─────────────────────────────────────────────────────────────┐
|
||||
│ 6. Attente de fin du pipeline │
|
||||
│ obiutils.WaitForLastPipe() │
|
||||
└─────────────────────────────────────────────────────────────┘
|
||||
```
|
||||
|
||||
## Conclusion
|
||||
|
||||
L'architecture des commandes OBITools est conçue pour :
|
||||
|
||||
1. **Maximiser la réutilisation** : `obiconvert` fournit les fonctionnalités communes
|
||||
2. **Simplifier l'ajout de nouvelles commandes** : pattern standardisé et minimaliste
|
||||
3. **Faciliter la maintenance** : séparation claire des responsabilités
|
||||
4. **Garantir la cohérence** : conventions de nommage et structure uniforme
|
||||
5. **Optimiser les performances** : parallélisation intégrée et traitement par batch
|
||||
|
||||
Cette architecture modulaire permet de créer rapidement de nouvelles commandes tout en maintenant une qualité et une cohérence élevées dans toute la suite OBITools.
|
||||
@@ -1,99 +0,0 @@
|
||||
# Définition du super k-mer
|
||||
|
||||
## Définition
|
||||
|
||||
Un **super k-mer** est une **sous-séquence MAXIMALE** d'une séquence dans laquelle **tous les k-mers consécutifs partagent le même minimiseur**.
|
||||
|
||||
### Termes
|
||||
|
||||
- **k-mer** : sous-séquence de longueur k
|
||||
- **minimiseur** : le plus petit m-mer canonique parmi tous les m-mers d'un k-mer
|
||||
- **k-mers consécutifs** : k-mers aux positions i et i+1 (chevauchement de k-1 nucléotides)
|
||||
- **MAXIMALE** : ne peut être étendue ni à gauche ni à droite
|
||||
|
||||
## RÈGLES ABSOLUES
|
||||
|
||||
### RÈGLE 1 : Longueur minimum = k
|
||||
|
||||
Un super k-mer contient au minimum k nucléotides.
|
||||
|
||||
```
|
||||
longueur(super-kmer) >= k
|
||||
```
|
||||
|
||||
### RÈGLE 2 : Chevauchement obligatoire = k-1
|
||||
|
||||
Deux super-kmers consécutifs se chevauchent d'EXACTEMENT k-1 nucléotides.
|
||||
|
||||
```
|
||||
SK1.End - SK2.Start = k - 1
|
||||
```
|
||||
|
||||
### RÈGLE 3 : Bijection séquence ↔ minimiseur
|
||||
|
||||
Une séquence de super k-mer a UN et UN SEUL minimiseur.
|
||||
|
||||
```
|
||||
Même séquence → Même minimiseur (TOUJOURS)
|
||||
```
|
||||
|
||||
**Si vous observez la même séquence avec deux minimiseurs différents, c'est un BUG.**
|
||||
|
||||
### RÈGLE 4 : Tous les k-mers partagent le minimiseur
|
||||
|
||||
TOUS les k-mers contenus dans un super k-mer ont le même minimiseur.
|
||||
|
||||
```
|
||||
∀ k-mer K dans SK : minimiseur(K) = SK.minimizer
|
||||
```
|
||||
|
||||
### RÈGLE 5 : Maximalité
|
||||
|
||||
Un super k-mer ne peut pas être étendu.
|
||||
|
||||
- Si on ajoute un nucléotide à gauche : le nouveau k-mer a un minimiseur différent
|
||||
- Si on ajoute un nucléotide à droite : le nouveau k-mer a un minimiseur différent
|
||||
|
||||
## VIOLATIONS INTERDITES
|
||||
|
||||
❌ **Super k-mer de longueur < k**
|
||||
❌ **Chevauchement ≠ k-1 entre consécutifs**
|
||||
❌ **Même séquence avec minimiseurs différents**
|
||||
❌ **K-mer dans le super k-mer avec minimiseur différent**
|
||||
❌ **Super k-mer extensible (non-maximal)**
|
||||
|
||||
## CONSÉQUENCES PRATIQUES
|
||||
|
||||
### Pour l'extraction
|
||||
|
||||
L'algorithme doit :
|
||||
1. Calculer le minimiseur de chaque k-mer
|
||||
2. Découper quand le minimiseur change
|
||||
3. Assigner au super k-mer le minimiseur commun à tous ses k-mers
|
||||
4. Garantir que chaque super k-mer contient au moins k nucléotides
|
||||
5. Garantir le chevauchement de k-1 entre consécutifs
|
||||
|
||||
### Pour la validation
|
||||
|
||||
Si après déduplication (obiuniq) on observe :
|
||||
```
|
||||
Séquence: ACGT...
|
||||
Minimiseurs: {M1, M2} // plusieurs minimiseurs
|
||||
```
|
||||
|
||||
C'est la PREUVE d'un bug : l'algorithme a produit cette séquence avec des minimiseurs différents, ce qui viole la RÈGLE 3.
|
||||
|
||||
## DIAGNOSTIC DU BUG
|
||||
|
||||
**Bug observé** : Même séquence avec minimiseurs différents après obiuniq
|
||||
|
||||
**Cause possible** : L'algorithme assigne le mauvais minimiseur OU découpe mal les super-kmers
|
||||
|
||||
**Ce que le bug NE PEUT PAS être** :
|
||||
- Un problème d'obiuniq (révèle le bug, ne le crée pas)
|
||||
- Un problème de chevauchement légitime (k-1 est correct)
|
||||
|
||||
**Ce que le bug DOIT être** :
|
||||
- Minimiseur mal calculé ou mal assigné
|
||||
- Découpage incorrect (mauvais endPos)
|
||||
- Copie incorrecte des données
|
||||
@@ -1,316 +0,0 @@
|
||||
# Guide de rédaction d'un obitest
|
||||
|
||||
## Règles essentielles
|
||||
|
||||
1. **Données < 1 KB** - Fichiers de test très petits
|
||||
2. **Exécution < 10 sec** - Tests rapides pour CI/CD
|
||||
3. **Auto-contenu** - Pas de dépendances externes
|
||||
4. **Auto-nettoyage** - Pas de fichiers résiduels
|
||||
|
||||
## Structure minimale
|
||||
|
||||
```
|
||||
obitests/obitools/<commande>/
|
||||
├── test.sh # Script exécutable
|
||||
└── data.fasta # Données minimales (optionnel)
|
||||
```
|
||||
|
||||
## Template de test.sh
|
||||
|
||||
```bash
|
||||
#!/bin/bash
|
||||
|
||||
TEST_NAME=<commande>
|
||||
CMD=<commande>
|
||||
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR"
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
########## TESTS ##########
|
||||
|
||||
# Test 1: Help (OBLIGATOIRE)
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Ajoutez vos tests ici...
|
||||
|
||||
###########################
|
||||
|
||||
cleanup
|
||||
```
|
||||
|
||||
## Pattern de test
|
||||
|
||||
```bash
|
||||
((ntest++))
|
||||
if commande args > "${TMPDIR}/output.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: description OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: description failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
## Tests courants
|
||||
|
||||
### Exécution basique
|
||||
```bash
|
||||
((ntest++))
|
||||
if $CMD "${TEST_DIR}/input.fasta" > "${TMPDIR}/output.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: basic execution OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: basic execution failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
### Sortie non vide
|
||||
```bash
|
||||
((ntest++))
|
||||
if [ -s "${TMPDIR}/output.fasta" ]
|
||||
then
|
||||
log "$MCMD: output not empty OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: output empty - failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
### Comptage
|
||||
```bash
|
||||
((ntest++))
|
||||
count=$(grep -c "^>" "${TMPDIR}/output.fasta")
|
||||
if [ "$count" -gt 0 ]
|
||||
then
|
||||
log "$MCMD: extracted $count sequences OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: no sequences - failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
### Présence de contenu
|
||||
```bash
|
||||
((ntest++))
|
||||
if grep -q "expected_string" "${TMPDIR}/output.fasta"
|
||||
then
|
||||
log "$MCMD: expected content found OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: content not found - failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
### Comparaison avec référence
|
||||
```bash
|
||||
((ntest++))
|
||||
if diff "${TEST_DIR}/expected.fasta" "${TMPDIR}/output.fasta" > /dev/null
|
||||
then
|
||||
log "$MCMD: matches reference OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: differs from reference - failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
### Test avec options
|
||||
```bash
|
||||
((ntest++))
|
||||
if $CMD --opt value "${TEST_DIR}/input.fasta" > "${TMPDIR}/out.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: with option OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: with option failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
## Variables importantes
|
||||
|
||||
- **TEST_DIR** - Répertoire du test (données d'entrée)
|
||||
- **TMPDIR** - Répertoire temporaire (sorties)
|
||||
- **CMD** - Nom de la commande
|
||||
- **MCMD** - Nom formaté pour les logs
|
||||
|
||||
## Règles d'or
|
||||
|
||||
✅ **Entrées** → `${TEST_DIR}/`
|
||||
✅ **Sorties** → `${TMPDIR}/`
|
||||
✅ **Toujours rediriger** → `> file 2>&1`
|
||||
✅ **Incrémenter ntest** → Avant chaque test
|
||||
✅ **Messages clairs** → Descriptions explicites
|
||||
|
||||
❌ **Pas de chemins en dur**
|
||||
❌ **Pas de /tmp direct**
|
||||
❌ **Pas de sortie vers TEST_DIR**
|
||||
❌ **Pas de commandes sans redirection**
|
||||
|
||||
## Données de test
|
||||
|
||||
Créer un fichier minimal (< 500 bytes) :
|
||||
|
||||
```fasta
|
||||
>seq1
|
||||
ACGTACGTACGTACGT
|
||||
>seq2
|
||||
AAAACCCCGGGGTTTT
|
||||
>seq3
|
||||
ATCGATCGATCGATCG
|
||||
```
|
||||
|
||||
## Création rapide
|
||||
|
||||
```bash
|
||||
# 1. Créer le répertoire
|
||||
mkdir -p obitests/obitools/<commande>
|
||||
cd obitests/obitools/<commande>
|
||||
|
||||
# 2. Créer les données de test
|
||||
cat > test_data.fasta << 'EOF'
|
||||
>seq1
|
||||
ACGTACGTACGTACGT
|
||||
>seq2
|
||||
AAAACCCCGGGGTTTT
|
||||
EOF
|
||||
|
||||
# 3. Copier le template dans test.sh
|
||||
# 4. Adapter le TEST_NAME et CMD
|
||||
# 5. Ajouter les tests
|
||||
# 6. Rendre exécutable
|
||||
chmod +x test.sh
|
||||
|
||||
# 7. Tester
|
||||
./test.sh
|
||||
```
|
||||
|
||||
## Checklist
|
||||
|
||||
- [ ] `test.sh` exécutable (`chmod +x`)
|
||||
- [ ] Test d'aide inclus
|
||||
- [ ] Données < 1 KB
|
||||
- [ ] Sorties vers `${TMPDIR}/`
|
||||
- [ ] Entrées depuis `${TEST_DIR}/`
|
||||
- [ ] Redirections `2>&1`
|
||||
- [ ] Messages clairs
|
||||
- [ ] Testé localement
|
||||
- [ ] Exit code 0 si succès
|
||||
|
||||
## Debug
|
||||
|
||||
Conserver TMPDIR pour inspection :
|
||||
```bash
|
||||
cleanup() {
|
||||
echo "Temporary directory: $TMPDIR" 1>&2
|
||||
# rm -rf "$TMPDIR" # Commenté
|
||||
...
|
||||
}
|
||||
```
|
||||
|
||||
Mode verbose :
|
||||
```bash
|
||||
set -x # Au début du script
|
||||
```
|
||||
|
||||
## Exemples
|
||||
|
||||
**Simple (1 test)** - obimicrosat
|
||||
```bash
|
||||
# Juste l'aide
|
||||
```
|
||||
|
||||
**Moyen (4-5 tests)** - obisuperkmer
|
||||
```bash
|
||||
# Aide + exécution + validation sortie + contenu
|
||||
```
|
||||
|
||||
**Complet (7+ tests)** - obiuniq
|
||||
```bash
|
||||
# Aide + exécution + comparaison CSV + options + multiples cas
|
||||
```
|
||||
|
||||
## Commandes utiles
|
||||
|
||||
```bash
|
||||
# Compter séquences
|
||||
grep -c "^>" file.fasta
|
||||
|
||||
# Fichier non vide
|
||||
[ -s file ]
|
||||
|
||||
# Comparer
|
||||
diff file1 file2 > /dev/null
|
||||
|
||||
# Comparer compressés
|
||||
zdiff file1.gz file2.gz
|
||||
|
||||
# Compter bases
|
||||
grep -v "^>" file | tr -d '\n' | wc -c
|
||||
```
|
||||
|
||||
## Ce qu'il faut retenir
|
||||
|
||||
Un bon test est **COURT**, **RAPIDE** et **SIMPLE** :
|
||||
- 3-10 tests maximum
|
||||
- Données < 1 KB
|
||||
- Exécution < 10 secondes
|
||||
- Pattern standard respecté
|
||||
@@ -1,268 +0,0 @@
|
||||
# Implémentation de la commande obisuperkmer
|
||||
|
||||
## Vue d'ensemble
|
||||
|
||||
La commande `obisuperkmer` a été implémentée en suivant l'architecture standard des commandes OBITools décrite dans `architecture-commande-obitools.md`. Cette commande permet d'extraire les super k-mers de fichiers de séquences biologiques.
|
||||
|
||||
## Qu'est-ce qu'un super k-mer ?
|
||||
|
||||
Un super k-mer est une sous-séquence maximale dans laquelle tous les k-mers consécutifs partagent le même minimiseur. Cette décomposition est utile pour :
|
||||
- L'indexation efficace de k-mers
|
||||
- La réduction de la redondance dans les analyses
|
||||
- L'optimisation de la mémoire pour les structures de données de k-mers
|
||||
|
||||
## Structure de l'implémentation
|
||||
|
||||
### 1. Package `pkg/obitools/obisuperkmer/`
|
||||
|
||||
Le package contient trois fichiers :
|
||||
|
||||
#### `obisuperkmer.go`
|
||||
Documentation du package avec une description de son rôle.
|
||||
|
||||
#### `options.go`
|
||||
Définit les options de ligne de commande :
|
||||
|
||||
```go
|
||||
var _KmerSize = 21 // Taille des k-mers (par défaut 21)
|
||||
var _MinimizerSize = 11 // Taille des minimiseurs (par défaut 11)
|
||||
```
|
||||
|
||||
**Options CLI disponibles :**
|
||||
- `--kmer-size` / `-k` : Taille des k-mers (entre m+1 et 31)
|
||||
- `--minimizer-size` / `-m` : Taille des minimiseurs (entre 1 et k-1)
|
||||
|
||||
**Fonctions d'accès :**
|
||||
- `CLIKmerSize()` : retourne la taille des k-mers
|
||||
- `CLIMinimizerSize()` : retourne la taille des minimiseurs
|
||||
- `SetKmerSize(k int)` : définit la taille des k-mers
|
||||
- `SetMinimizerSize(m int)` : définit la taille des minimiseurs
|
||||
|
||||
#### `superkmer.go`
|
||||
Implémente la logique de traitement :
|
||||
|
||||
```go
|
||||
func CLIExtractSuperKmers(iterator obiiter.IBioSequence) obiiter.IBioSequence
|
||||
```
|
||||
|
||||
Cette fonction :
|
||||
1. Récupère les paramètres k et m depuis les options CLI
|
||||
2. Valide les paramètres (m < k, k <= 31, etc.)
|
||||
3. Crée un worker utilisant `obikmer.SuperKmerWorker(k, m)`
|
||||
4. Applique le worker en parallèle sur l'itérateur de séquences
|
||||
5. Retourne un itérateur de super k-mers
|
||||
|
||||
### 2. Exécutable `cmd/obitools/obisuperkmer/main.go`
|
||||
|
||||
L'exécutable suit le pattern standard minimal :
|
||||
|
||||
```go
|
||||
func main() {
|
||||
// 1. Génération du parser d'options
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obisuperkmer",
|
||||
"extract super k-mers from sequence files",
|
||||
obisuperkmer.OptionSet)
|
||||
|
||||
// 2. Parsing des arguments
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
// 3. Lecture des séquences
|
||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||
|
||||
// 4. Extraction des super k-mers
|
||||
superkmers := obisuperkmer.CLIExtractSuperKmers(sequences)
|
||||
|
||||
// 5. Écriture des résultats
|
||||
obiconvert.CLIWriteBioSequences(superkmers, true)
|
||||
|
||||
// 6. Attente de la fin du pipeline
|
||||
obiutils.WaitForLastPipe()
|
||||
}
|
||||
```
|
||||
|
||||
## Utilisation du package `obikmer`
|
||||
|
||||
L'implémentation s'appuie sur le package `obikmer` qui fournit :
|
||||
|
||||
### `SuperKmerWorker(k int, m int) obiseq.SeqWorker`
|
||||
|
||||
Crée un worker qui :
|
||||
- Extrait les super k-mers d'une BioSequence
|
||||
- Retourne une slice de BioSequence, une par super k-mer
|
||||
- Chaque super k-mer contient les attributs suivants :
|
||||
|
||||
```go
|
||||
// Métadonnées ajoutées à chaque super k-mer :
|
||||
{
|
||||
"minimizer_value": uint64, // Valeur canonique du minimiseur
|
||||
"minimizer_seq": string, // Séquence ADN du minimiseur
|
||||
"k": int, // Taille des k-mers utilisée
|
||||
"m": int, // Taille des minimiseurs utilisée
|
||||
"start": int, // Position de début (0-indexé)
|
||||
"end": int, // Position de fin (exclusif)
|
||||
"parent_id": string, // ID de la séquence parente
|
||||
}
|
||||
```
|
||||
|
||||
### Algorithme sous-jacent
|
||||
|
||||
Le package `obikmer` utilise :
|
||||
- `IterSuperKmers(seq []byte, k int, m int)` : itérateur sur les super k-mers
|
||||
- Une deque monotone pour suivre les minimiseurs dans une fenêtre glissante
|
||||
- Complexité temporelle : O(n) où n est la longueur de la séquence
|
||||
- Complexité spatiale : O(k-m+1) pour la deque
|
||||
|
||||
## Exemple d'utilisation
|
||||
|
||||
### Ligne de commande
|
||||
|
||||
```bash
|
||||
# Extraction avec paramètres par défaut (k=21, m=11)
|
||||
obisuperkmer sequences.fasta > superkmers.fasta
|
||||
|
||||
# Spécifier les tailles de k-mers et minimiseurs
|
||||
obisuperkmer -k 25 -m 13 sequences.fasta -o superkmers.fasta
|
||||
|
||||
# Avec plusieurs fichiers d'entrée
|
||||
obisuperkmer --kmer-size 31 --minimizer-size 15 file1.fasta file2.fasta > output.fasta
|
||||
|
||||
# Format FASTQ en entrée, FASTA en sortie
|
||||
obisuperkmer sequences.fastq --fasta-output -o superkmers.fasta
|
||||
|
||||
# Avec compression
|
||||
obisuperkmer sequences.fasta -o superkmers.fasta.gz --compress
|
||||
```
|
||||
|
||||
### Exemple de sortie
|
||||
|
||||
Pour une séquence d'entrée :
|
||||
```
|
||||
>seq1
|
||||
ACGTACGTACGTACGTACGTACGT
|
||||
```
|
||||
|
||||
La sortie contiendra plusieurs super k-mers :
|
||||
```
|
||||
>seq1_superkmer_0_15 {"minimizer_value":123456,"minimizer_seq":"acgtacgt","k":21,"m":11,"start":0,"end":15,"parent_id":"seq1"}
|
||||
ACGTACGTACGTACG
|
||||
>seq1_superkmer_8_24 {"minimizer_value":789012,"minimizer_seq":"gtacgtac","k":21,"m":11,"start":8,"end":24,"parent_id":"seq1"}
|
||||
TACGTACGTACGTACGT
|
||||
```
|
||||
|
||||
## Options héritées de `obiconvert`
|
||||
|
||||
La commande hérite de toutes les options standard d'OBITools :
|
||||
|
||||
### Options d'entrée
|
||||
- `--fasta` : forcer le format FASTA
|
||||
- `--fastq` : forcer le format FASTQ
|
||||
- `--ecopcr` : format ecoPCR
|
||||
- `--embl` : format EMBL
|
||||
- `--genbank` : format GenBank
|
||||
- `--input-json-header` : en-têtes JSON
|
||||
- `--input-OBI-header` : en-têtes OBI
|
||||
|
||||
### Options de sortie
|
||||
- `--out` / `-o` : fichier de sortie (défaut : stdout)
|
||||
- `--fasta-output` : sortie en format FASTA
|
||||
- `--fastq-output` : sortie en format FASTQ
|
||||
- `--json-output` : sortie en format JSON
|
||||
- `--output-json-header` : en-têtes JSON en sortie
|
||||
- `--output-OBI-header` / `-O` : en-têtes OBI en sortie
|
||||
- `--compress` / `-Z` : compression gzip
|
||||
- `--skip-empty` : ignorer les séquences vides
|
||||
- `--no-progressbar` : désactiver la barre de progression
|
||||
|
||||
## Compilation
|
||||
|
||||
Pour compiler la commande :
|
||||
|
||||
```bash
|
||||
cd /chemin/vers/obitools4
|
||||
go build -o bin/obisuperkmer ./cmd/obitools/obisuperkmer/
|
||||
```
|
||||
|
||||
## Tests
|
||||
|
||||
Pour tester la commande :
|
||||
|
||||
```bash
|
||||
# Créer un fichier de test
|
||||
echo -e ">test\nACGTACGTACGTACGTACGTACGTACGTACGT" > test.fasta
|
||||
|
||||
# Exécuter obisuperkmer
|
||||
obisuperkmer test.fasta
|
||||
|
||||
# Vérifier avec des paramètres différents
|
||||
obisuperkmer -k 15 -m 7 test.fasta
|
||||
```
|
||||
|
||||
## Validation des paramètres
|
||||
|
||||
La commande valide automatiquement :
|
||||
- `1 <= m < k` : le minimiseur doit être plus petit que le k-mer
|
||||
- `2 <= k <= 31` : contrainte du codage sur 64 bits
|
||||
- `len(sequence) >= k` : la séquence doit être assez longue
|
||||
|
||||
En cas de paramètres invalides, la commande affiche une erreur explicite et s'arrête.
|
||||
|
||||
## Intégration avec le pipeline OBITools
|
||||
|
||||
La commande s'intègre naturellement dans les pipelines OBITools :
|
||||
|
||||
```bash
|
||||
# Pipeline complet d'analyse
|
||||
obiconvert sequences.fastq --fasta-output | \
|
||||
obisuperkmer -k 21 -m 11 | \
|
||||
obiuniq | \
|
||||
obigrep -p "minimizer_value>1000" > filtered_superkmers.fasta
|
||||
```
|
||||
|
||||
## Parallélisation
|
||||
|
||||
La commande utilise automatiquement :
|
||||
- `obidefault.ParallelWorkers()` pour le traitement parallèle
|
||||
- Les workers sont distribués sur les séquences d'entrée
|
||||
- La parallélisation est transparente pour l'utilisateur
|
||||
|
||||
## Conformité avec l'architecture OBITools
|
||||
|
||||
L'implémentation respecte tous les principes de l'architecture :
|
||||
|
||||
✅ Séparation des responsabilités (package + commande)
|
||||
✅ Convention de nommage cohérente (CLI*, Set*, _variables)
|
||||
✅ Réutilisation de `obiconvert` pour l'I/O
|
||||
✅ Options standard partagées
|
||||
✅ Pattern Worker pour le traitement
|
||||
✅ Validation des paramètres
|
||||
✅ Logging avec `logrus`
|
||||
✅ Gestion d'erreurs cohérente
|
||||
✅ Documentation complète
|
||||
|
||||
## Fichiers créés
|
||||
|
||||
```
|
||||
pkg/obitools/obisuperkmer/
|
||||
├── obisuperkmer.go # Documentation du package
|
||||
├── options.go # Définition des options CLI
|
||||
└── superkmer.go # Implémentation du traitement
|
||||
|
||||
cmd/obitools/obisuperkmer/
|
||||
└── main.go # Point d'entrée de la commande
|
||||
```
|
||||
|
||||
## Prochaines étapes
|
||||
|
||||
1. **Compilation** : Compiler la commande avec `go build`
|
||||
2. **Tests unitaires** : Créer des tests dans `pkg/obitools/obisuperkmer/superkmer_test.go`
|
||||
3. **Documentation utilisateur** : Ajouter la documentation de la commande
|
||||
4. **Intégration CI/CD** : Ajouter aux tests d'intégration
|
||||
5. **Benchmarks** : Mesurer les performances sur différents jeux de données
|
||||
|
||||
## Références
|
||||
|
||||
- Architecture des commandes OBITools : `architecture-commande-obitools.md`
|
||||
- Package `obikmer` : `pkg/obikmer/`
|
||||
- Tests du package : `pkg/obikmer/superkmer_iter_test.go`
|
||||
@@ -1,440 +0,0 @@
|
||||
# Tests automatisés pour obisuperkmer
|
||||
|
||||
## Vue d'ensemble
|
||||
|
||||
Des tests automatisés ont été créés pour la commande `obisuperkmer` dans le répertoire `obitests/obitools/obisuperkmer/`. Ces tests suivent le pattern standard utilisé par toutes les commandes OBITools et sont conçus pour être exécutés dans un environnement CI/CD.
|
||||
|
||||
## Fichiers créés
|
||||
|
||||
```
|
||||
obitests/obitools/obisuperkmer/
|
||||
├── test.sh # Script de test principal (6.7 KB)
|
||||
├── test_sequences.fasta # Données de test (117 bytes)
|
||||
└── README.md # Documentation (4.1 KB)
|
||||
```
|
||||
|
||||
### Taille totale : ~11 KB
|
||||
|
||||
Cette taille minimale est idéale pour un dépôt Git et des tests CI/CD rapides.
|
||||
|
||||
## Jeu de données de test
|
||||
|
||||
### Fichier : `test_sequences.fasta` (117 bytes)
|
||||
|
||||
Le fichier contient 3 séquences de 32 nucléotides chacune :
|
||||
|
||||
```fasta
|
||||
>seq1
|
||||
ACGTACGTACGTACGTACGTACGTACGTACGT
|
||||
>seq2
|
||||
AAAACCCCGGGGTTTTAAAACCCCGGGGTTTT
|
||||
>seq3
|
||||
ATCGATCGATCGATCGATCGATCGATCGATCG
|
||||
```
|
||||
|
||||
#### Justification du choix
|
||||
|
||||
1. **seq1** : Motif répétitif simple (ACGT)
|
||||
- Teste l'extraction de super k-mers sur une séquence avec faible complexité
|
||||
- Les minimiseurs devraient être assez réguliers
|
||||
|
||||
2. **seq2** : Blocs homopolymères
|
||||
- Teste le comportement avec des régions de très faible complexité
|
||||
- Les minimiseurs varieront entre les blocs A, C, G et T
|
||||
|
||||
3. **seq3** : Motif différent (ATCG)
|
||||
- Teste la diversité des super k-mers extraits
|
||||
- Différent de seq1 pour vérifier la distinction
|
||||
|
||||
#### Caractéristiques
|
||||
|
||||
- **Longueur** : 32 nucléotides par séquence
|
||||
- **Taille totale** : 96 nucléotides (3 × 32)
|
||||
- **Format** : FASTA avec en-têtes JSON compatibles
|
||||
- **Alphabet** : A, C, G, T uniquement (pas de bases ambiguës)
|
||||
- **Taille du fichier** : 117 bytes
|
||||
|
||||
Avec k=21 (défaut), chaque séquence de 32 bp peut produire :
|
||||
- 32 - 21 + 1 = 12 k-mers
|
||||
- Plusieurs super k-mers selon les minimiseurs
|
||||
|
||||
## Script de test : `test.sh`
|
||||
|
||||
### Structure
|
||||
|
||||
Le script suit le pattern standard OBITools :
|
||||
|
||||
```bash
|
||||
#!/bin/bash
|
||||
|
||||
TEST_NAME=obisuperkmer
|
||||
CMD=obisuperkmer
|
||||
|
||||
# Variables et fonctions standard
|
||||
TEST_DIR="..."
|
||||
OBITOOLS_DIR="..."
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() { ... }
|
||||
log() { ... }
|
||||
|
||||
# Tests (12 au total)
|
||||
# ...
|
||||
|
||||
cleanup
|
||||
```
|
||||
|
||||
### Tests implémentés
|
||||
|
||||
#### 1. Test d'aide (`-h`)
|
||||
```bash
|
||||
obisuperkmer -h
|
||||
```
|
||||
Vérifie que la commande peut afficher son aide sans erreur.
|
||||
|
||||
#### 2. Extraction basique avec paramètres par défaut
|
||||
```bash
|
||||
obisuperkmer test_sequences.fasta > output_default.fasta
|
||||
```
|
||||
Teste l'exécution avec k=21, m=11 (défaut).
|
||||
|
||||
#### 3. Vérification de sortie non vide
|
||||
```bash
|
||||
[ -s output_default.fasta ]
|
||||
```
|
||||
S'assure que la commande produit un résultat.
|
||||
|
||||
#### 4. Comptage des super k-mers
|
||||
```bash
|
||||
grep -c "^>" output_default.fasta
|
||||
```
|
||||
Vérifie qu'au moins un super k-mer a été extrait.
|
||||
|
||||
#### 5. Présence des métadonnées
|
||||
```bash
|
||||
grep -q "minimizer_value" output_default.fasta
|
||||
grep -q "minimizer_seq" output_default.fasta
|
||||
grep -q "parent_id" output_default.fasta
|
||||
```
|
||||
Vérifie que les attributs requis sont présents.
|
||||
|
||||
#### 6. Extraction avec paramètres personnalisés
|
||||
```bash
|
||||
obisuperkmer -k 15 -m 7 test_sequences.fasta > output_k15_m7.fasta
|
||||
```
|
||||
Teste la configuration de k et m.
|
||||
|
||||
#### 7. Validation des paramètres personnalisés
|
||||
```bash
|
||||
grep -q '"k":15' output_k15_m7.fasta
|
||||
grep -q '"m":7' output_k15_m7.fasta
|
||||
```
|
||||
Vérifie que les paramètres sont correctement enregistrés.
|
||||
|
||||
#### 8. Format de sortie FASTA
|
||||
```bash
|
||||
obisuperkmer --fasta-output test_sequences.fasta > output_fasta.fasta
|
||||
```
|
||||
Teste l'option de format explicite.
|
||||
|
||||
#### 9. Vérification des IDs
|
||||
```bash
|
||||
grep "^>" output_default.fasta | grep -q "superkmer"
|
||||
```
|
||||
S'assure que les IDs contiennent "superkmer".
|
||||
|
||||
#### 10. Préservation des IDs parents
|
||||
```bash
|
||||
grep -q "seq1" output_default.fasta
|
||||
grep -q "seq2" output_default.fasta
|
||||
grep -q "seq3" output_default.fasta
|
||||
```
|
||||
Vérifie que les IDs des séquences parentes sont préservés.
|
||||
|
||||
#### 11. Option de fichier de sortie (`-o`)
|
||||
```bash
|
||||
obisuperkmer -o output_file.fasta test_sequences.fasta
|
||||
```
|
||||
Teste la redirection vers un fichier.
|
||||
|
||||
#### 12. Vérification de création du fichier
|
||||
```bash
|
||||
[ -s output_file.fasta ]
|
||||
```
|
||||
S'assure que le fichier a été créé.
|
||||
|
||||
#### 13. Cohérence des longueurs
|
||||
```bash
|
||||
# Vérifie que longueur(output) <= longueur(input)
|
||||
```
|
||||
S'assure que les super k-mers ne sont pas plus longs que l'entrée.
|
||||
|
||||
### Compteurs
|
||||
|
||||
- **ntest** : Nombre de tests exécutés
|
||||
- **success** : Nombre de tests réussis
|
||||
- **failed** : Nombre de tests échoués
|
||||
|
||||
### Sortie du script
|
||||
|
||||
#### En cas de succès
|
||||
```
|
||||
========================================
|
||||
## Results of the obisuperkmer tests:
|
||||
|
||||
- 12 tests run
|
||||
- 12 successfully completed
|
||||
- 0 failed tests
|
||||
|
||||
Cleaning up the temporary directory...
|
||||
|
||||
========================================
|
||||
```
|
||||
|
||||
Exit code : **0**
|
||||
|
||||
#### En cas d'échec
|
||||
```
|
||||
========================================
|
||||
## Results of the obisuperkmer tests:
|
||||
|
||||
- 12 tests run
|
||||
- 10 successfully completed
|
||||
- 2 failed tests
|
||||
|
||||
Cleaning up the temporary directory...
|
||||
|
||||
========================================
|
||||
```
|
||||
|
||||
Exit code : **1**
|
||||
|
||||
## Intégration CI/CD
|
||||
|
||||
### Exécution automatique
|
||||
|
||||
Le script est conçu pour être exécuté automatiquement dans un pipeline CI/CD :
|
||||
|
||||
1. Le build produit l'exécutable dans `build/obisuperkmer`
|
||||
2. Le script de test ajoute `build/` au PATH
|
||||
3. Les tests s'exécutent
|
||||
4. Le code de retour indique le succès (0) ou l'échec (1)
|
||||
|
||||
### Exemple de configuration CI/CD
|
||||
|
||||
```yaml
|
||||
# .github/workflows/test.yml ou équivalent
|
||||
test-obisuperkmer:
|
||||
runs-on: ubuntu-latest
|
||||
steps:
|
||||
- uses: actions/checkout@v2
|
||||
- name: Build obitools
|
||||
run: make build
|
||||
- name: Test obisuperkmer
|
||||
run: ./obitests/obitools/obisuperkmer/test.sh
|
||||
```
|
||||
|
||||
### Avantages
|
||||
|
||||
✅ **Rapidité** : Données de test minimales (117 bytes)
|
||||
✅ **Fiabilité** : Tests reproductibles
|
||||
✅ **Isolation** : Utilisation d'un répertoire temporaire
|
||||
✅ **Nettoyage automatique** : Pas de fichiers résiduels
|
||||
✅ **Logging** : Messages horodatés et détaillés
|
||||
✅ **Compatibilité** : Pattern standard OBITools
|
||||
|
||||
## Exécution locale
|
||||
|
||||
### Prérequis
|
||||
|
||||
1. Compiler obisuperkmer :
|
||||
```bash
|
||||
cd /chemin/vers/obitools4
|
||||
go build -o build/obisuperkmer ./cmd/obitools/obisuperkmer/
|
||||
```
|
||||
|
||||
2. Se placer dans le répertoire de test :
|
||||
```bash
|
||||
cd obitests/obitools/obisuperkmer
|
||||
```
|
||||
|
||||
3. Exécuter le script :
|
||||
```bash
|
||||
./test.sh
|
||||
```
|
||||
|
||||
### Exemple de sortie
|
||||
|
||||
```
|
||||
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] Testing obisuperkmer...
|
||||
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] Test directory is /path/to/obitests/obitools/obisuperkmer
|
||||
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] obitools directory is /path/to/build
|
||||
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] Temporary directory is /tmp/tmp.abc123
|
||||
[obisuperkmer @ Fri Feb 7 13:00:00 CET 2026] files: README.md test.sh test_sequences.fasta
|
||||
[obisuperkmer @ Fri Feb 7 13:00:01 CET 2026] OBISuperkmer: printing help OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: basic extraction with default parameters OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: output file is not empty OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: extracted 8 super k-mers OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:02 CET 2026] OBISuperkmer: super k-mers contain required metadata OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: extraction with custom k=15, m=7 OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: custom parameters correctly set in metadata OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: FASTA output format OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: super k-mer IDs contain 'superkmer' OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:03 CET 2026] OBISuperkmer: parent sequence IDs preserved OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:04 CET 2026] OBISuperkmer: output to file with -o option OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:04 CET 2026] OBISuperkmer: output file created with -o option OK
|
||||
[obisuperkmer @ Fri Feb 7 13:00:04 CET 2026] OBISuperkmer: super k-mer total length <= input length OK
|
||||
========================================
|
||||
## Results of the obisuperkmer tests:
|
||||
|
||||
- 12 tests run
|
||||
- 12 successfully completed
|
||||
- 0 failed tests
|
||||
|
||||
Cleaning up the temporary directory...
|
||||
|
||||
========================================
|
||||
```
|
||||
|
||||
## Debugging des tests
|
||||
|
||||
### Conserver les fichiers temporaires
|
||||
|
||||
Modifier temporairement la fonction `cleanup()` :
|
||||
|
||||
```bash
|
||||
cleanup() {
|
||||
echo "Temporary directory: $TMPDIR" 1>&2
|
||||
# Commenter cette ligne pour conserver les fichiers
|
||||
# rm -rf "$TMPDIR"
|
||||
...
|
||||
}
|
||||
```
|
||||
|
||||
### Activer le mode verbose
|
||||
|
||||
Ajouter au début du script :
|
||||
|
||||
```bash
|
||||
set -x # Active l'affichage de toutes les commandes
|
||||
```
|
||||
|
||||
### Tester une seule commande
|
||||
|
||||
Extraire et exécuter manuellement :
|
||||
|
||||
```bash
|
||||
export TEST_DIR=/chemin/vers/obitests/obitools/obisuperkmer
|
||||
export TMPDIR=$(mktemp -d)
|
||||
obisuperkmer "${TEST_DIR}/test_sequences.fasta" > "${TMPDIR}/output.fasta"
|
||||
cat "${TMPDIR}/output.fasta"
|
||||
```
|
||||
|
||||
## Ajout de nouveaux tests
|
||||
|
||||
Pour ajouter un test supplémentaire :
|
||||
|
||||
1. Incrémenter le compteur `ntest`
|
||||
2. Écrire la condition de test
|
||||
3. Logger le succès ou l'échec
|
||||
4. Incrémenter le bon compteur
|
||||
|
||||
```bash
|
||||
((ntest++))
|
||||
if ma_nouvelle_commande_de_test
|
||||
then
|
||||
log "Description du test: OK"
|
||||
((success++))
|
||||
else
|
||||
log "Description du test: failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
## Comparaison avec d'autres tests
|
||||
|
||||
### Taille des données de test
|
||||
|
||||
| Commande | Taille des données | Nombre de fichiers |
|
||||
|----------|-------------------|-------------------|
|
||||
| obiconvert | 925 KB | 1 fichier |
|
||||
| obiuniq | ~600 bytes | 4 fichiers |
|
||||
| obimicrosat | 0 bytes | 0 fichiers (génère à la volée) |
|
||||
| **obisuperkmer** | **117 bytes** | **1 fichier** |
|
||||
|
||||
Notre test `obisuperkmer` est parmi les plus légers, ce qui est optimal pour CI/CD.
|
||||
|
||||
### Nombre de tests
|
||||
|
||||
| Commande | Nombre de tests |
|
||||
|----------|----------------|
|
||||
| obiconvert | 3 tests |
|
||||
| obiuniq | 7 tests |
|
||||
| obimicrosat | 1 test |
|
||||
| **obisuperkmer** | **12 tests** |
|
||||
|
||||
Notre test `obisuperkmer` offre une couverture complète avec 12 tests différents.
|
||||
|
||||
## Couverture de test
|
||||
|
||||
Les tests couvrent :
|
||||
|
||||
✅ Affichage de l'aide
|
||||
✅ Exécution basique
|
||||
✅ Paramètres par défaut (k=21, m=11)
|
||||
✅ Paramètres personnalisés (k=15, m=7)
|
||||
✅ Formats de sortie (FASTA)
|
||||
✅ Redirection vers fichier (`-o`)
|
||||
✅ Présence des métadonnées
|
||||
✅ Validation des IDs
|
||||
✅ Préservation des IDs parents
|
||||
✅ Cohérence des longueurs
|
||||
✅ Production de résultats non vides
|
||||
|
||||
## Maintenance
|
||||
|
||||
### Mise à jour des tests
|
||||
|
||||
Si l'implémentation de `obisuperkmer` change :
|
||||
|
||||
1. Vérifier que les tests existants passent toujours
|
||||
2. Ajouter de nouveaux tests pour les nouvelles fonctionnalités
|
||||
3. Mettre à jour `README.md` si nécessaire
|
||||
4. Documenter les changements
|
||||
|
||||
### Vérification régulière
|
||||
|
||||
Exécuter périodiquement :
|
||||
|
||||
```bash
|
||||
cd obitests/obitools/obisuperkmer
|
||||
./test.sh
|
||||
```
|
||||
|
||||
Ou via l'ensemble des tests :
|
||||
|
||||
```bash
|
||||
cd obitests
|
||||
for dir in obitools/*/; do
|
||||
if [ -f "$dir/test.sh" ]; then
|
||||
echo "Testing $(basename $dir)..."
|
||||
(cd "$dir" && ./test.sh) || echo "FAILED: $(basename $dir)"
|
||||
fi
|
||||
done
|
||||
```
|
||||
|
||||
## Conclusion
|
||||
|
||||
Les tests pour `obisuperkmer` sont :
|
||||
|
||||
- ✅ **Complets** : 12 tests couvrant toutes les fonctionnalités principales
|
||||
- ✅ **Légers** : 117 bytes de données de test
|
||||
- ✅ **Rapides** : Exécution en quelques secondes
|
||||
- ✅ **Fiables** : Pattern éprouvé utilisé par toutes les commandes OBITools
|
||||
- ✅ **Maintenables** : Structure claire et documentée
|
||||
- ✅ **CI/CD ready** : Code de retour approprié et nettoyage automatique
|
||||
|
||||
Ils garantissent que la commande fonctionne correctement à chaque commit et facilitent la détection précoce des régressions.
|
||||
@@ -30,11 +30,7 @@ func main() {
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obiannotate",
|
||||
"edits the sequence annotations",
|
||||
obiannotate.OptionSet,
|
||||
)
|
||||
optionParser := obioptions.GenerateOptionParser(obiannotate.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
@@ -42,11 +38,6 @@ func main() {
|
||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||
|
||||
annotator := obiannotate.CLIAnnotationPipeline()
|
||||
|
||||
if obiannotate.CLIHasSetNumberFlag() {
|
||||
sequences = sequences.NumberSequences(1, !obiconvert.CLINoInputOrder())
|
||||
}
|
||||
|
||||
obiconvert.CLIWriteBioSequences(sequences.Pipe(annotator), true)
|
||||
|
||||
obiutils.WaitForLastPipe()
|
||||
|
||||
@@ -11,10 +11,7 @@ import (
|
||||
)
|
||||
|
||||
func main() {
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obiclean",
|
||||
"",
|
||||
obiclean.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obiclean.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -14,10 +14,7 @@ import (
|
||||
func main() {
|
||||
obidefault.SetBatchSize(10)
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obicleandb",
|
||||
"clean-up reference databases",
|
||||
obicleandb.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obicleandb.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -11,10 +11,7 @@ import (
|
||||
)
|
||||
|
||||
func main() {
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obicomplement",
|
||||
"reverse complement of sequences",
|
||||
obiconvert.OptionSet(true))
|
||||
optionParser := obioptions.GenerateOptionParser(obiconvert.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -11,10 +11,7 @@ import (
|
||||
)
|
||||
|
||||
func main() {
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obiconsensus",
|
||||
"ONT reads denoising",
|
||||
obiconsensus.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obiconsensus.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -14,10 +14,7 @@ func main() {
|
||||
obidefault.SetStrictReadWorker(2)
|
||||
obidefault.SetStrictWriteWorker(2)
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obiconvert",
|
||||
"convertion of sequence files to various formats",
|
||||
obiconvert.OptionSet(true))
|
||||
optionParser := obioptions.GenerateOptionParser(obiconvert.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -28,8 +28,6 @@ func main() {
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obicount",
|
||||
"counts the sequences present in a file of sequences",
|
||||
obiconvert.InputOptionSet,
|
||||
obicount.OptionSet,
|
||||
)
|
||||
|
||||
@@ -10,10 +10,7 @@ import (
|
||||
)
|
||||
|
||||
func main() {
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obicsv",
|
||||
"converts sequence files to CSV format",
|
||||
obicsv.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obicsv.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -15,10 +15,7 @@ func main() {
|
||||
obidefault.SetStrictReadWorker(2)
|
||||
obidefault.SetStrictWriteWorker(2)
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obidemerge",
|
||||
"",
|
||||
obidemerge.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obidemerge.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -11,10 +11,7 @@ import (
|
||||
)
|
||||
|
||||
func main() {
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obidistribute",
|
||||
"divided an input set of sequences into subsets",
|
||||
obidistribute.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obidistribute.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -30,10 +30,7 @@ func main() {
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obigrep",
|
||||
"select a subset of sequences on various criteria",
|
||||
obigrep.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obigrep.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -15,10 +15,7 @@ func main() {
|
||||
obidefault.SetStrictReadWorker(2)
|
||||
obidefault.SetStrictWriteWorker(2)
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obijoin",
|
||||
"merge annotations contained in a file to another file",
|
||||
obijoin.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obijoin.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -1,34 +0,0 @@
|
||||
package main
|
||||
|
||||
import (
|
||||
"context"
|
||||
"errors"
|
||||
"os"
|
||||
|
||||
log "github.com/sirupsen/logrus"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obik"
|
||||
"github.com/DavidGamba/go-getoptions"
|
||||
)
|
||||
|
||||
func main() {
|
||||
defer obiseq.LogBioSeqStatus()
|
||||
|
||||
opt, parser := obioptions.GenerateSubcommandParser(
|
||||
"obik",
|
||||
"Manage disk-based kmer indices",
|
||||
obik.OptionSet,
|
||||
)
|
||||
|
||||
_, remaining := parser(os.Args)
|
||||
|
||||
err := opt.Dispatch(context.Background(), remaining)
|
||||
if err != nil {
|
||||
if errors.Is(err, getoptions.ErrorHelpCalled) {
|
||||
os.Exit(0)
|
||||
}
|
||||
log.Fatalf("Error: %v", err)
|
||||
}
|
||||
}
|
||||
@@ -31,10 +31,7 @@ func main() {
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obikmermatch",
|
||||
"",
|
||||
obikmersim.MatchOptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obikmersim.MatchOptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -32,10 +32,7 @@ func main() {
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obikmersimcount",
|
||||
"",
|
||||
obikmersim.CountOptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obikmersim.CountOptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -11,10 +11,7 @@ import (
|
||||
)
|
||||
|
||||
func main() {
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obilandmark",
|
||||
"",
|
||||
obilandmark.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obilandmark.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -31,8 +31,6 @@ func main() {
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obimatrix",
|
||||
"",
|
||||
obimatrix.OptionSet,
|
||||
)
|
||||
|
||||
|
||||
42
cmd/obitools/obimicroasm/main.go
Normal file
42
cmd/obitools/obimicroasm/main.go
Normal file
@@ -0,0 +1,42 @@
|
||||
package main
|
||||
|
||||
import (
|
||||
"os"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obimicroasm"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
)
|
||||
|
||||
func main() {
|
||||
|
||||
// go tool pprof -http=":8000" ./obipairing ./cpu.pprof
|
||||
// f, err := os.Create("cpu.pprof")
|
||||
// if err != nil {
|
||||
// log.Fatal(err)
|
||||
// }
|
||||
// pprof.StartCPUProfile(f)
|
||||
// defer pprof.StopCPUProfile()
|
||||
|
||||
// go tool trace cpu.trace
|
||||
// ftrace, err := os.Create("cpu.trace")
|
||||
// if err != nil {
|
||||
// log.Fatal(err)
|
||||
// }
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(obimicroasm.OptionSet)
|
||||
|
||||
optionParser(os.Args)
|
||||
|
||||
obidefault.SetStrictReadWorker(2)
|
||||
obidefault.SetStrictWriteWorker(2)
|
||||
|
||||
seq := obimicroasm.CLIAssemblePCR()
|
||||
|
||||
println(obiformats.FormatFasta(seq, obiformats.FormatFastSeqJsonHeader))
|
||||
obiutils.WaitForLastPipe()
|
||||
}
|
||||
@@ -30,10 +30,7 @@ func main() {
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obimicrosat",
|
||||
"looks for microsatellites sequences in a sequence file",
|
||||
obimicrosat.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obimicrosat.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -28,10 +28,7 @@ func main() {
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obimultiplex",
|
||||
"demultiplex amplicons",
|
||||
obimultiplex.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obimultiplex.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -30,10 +30,7 @@ func main() {
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obipairing",
|
||||
"align forward with reverse reads with paired reads",
|
||||
obipairing.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obipairing.OptionSet)
|
||||
|
||||
optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -29,10 +29,7 @@ func main() {
|
||||
obidefault.SetParallelFilesRead(obidefault.ParallelWorkers() / 4)
|
||||
obidefault.SetBatchSize(10)
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obipcr",
|
||||
"simulates a PCR on a sequence files",
|
||||
obipcr.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obipcr.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -11,10 +11,7 @@ import (
|
||||
)
|
||||
|
||||
func main() {
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obireffamidx",
|
||||
"",
|
||||
obirefidx.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obirefidx.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -11,10 +11,7 @@ import (
|
||||
)
|
||||
|
||||
func main() {
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obirefidx",
|
||||
"",
|
||||
obirefidx.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obirefidx.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -31,10 +31,7 @@ func main() {
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obiscript",
|
||||
"executes a lua script on the input sequences",
|
||||
obiscript.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obiscript.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -31,10 +31,7 @@ func main() {
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obisplit",
|
||||
"",
|
||||
obisplit.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obisplit.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -33,10 +33,7 @@ func main() {
|
||||
// trace.Start(ftrace)
|
||||
// defer trace.Stop()
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obisummary",
|
||||
"resume main information from a sequence file",
|
||||
obisummary.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obisummary.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -11,7 +11,6 @@ import (
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitag"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitaxonomy"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||
@@ -40,10 +39,7 @@ func main() {
|
||||
obidefault.SetStrictWriteWorker(1)
|
||||
obidefault.SetBatchSize(10)
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obitag",
|
||||
"realizes taxonomic assignment",
|
||||
obitag.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obitag.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
@@ -59,7 +55,7 @@ func main() {
|
||||
}
|
||||
|
||||
if taxo == nil {
|
||||
taxo, err = references.ExtractTaxonomy(nil, obitaxonomy.CLINewickWithLeaves())
|
||||
taxo, err = references.ExtractTaxonomy(nil)
|
||||
|
||||
if err != nil {
|
||||
log.Fatalf("No taxonomy specified or extractable from reference database: %v", err)
|
||||
@@ -74,12 +70,10 @@ func main() {
|
||||
|
||||
var identified obiiter.IBioSequence
|
||||
|
||||
fsrb := fs.Rebatch(obidefault.BatchSize())
|
||||
|
||||
if obitag.CLIGeometricMode() {
|
||||
identified = obitag.CLIGeomAssignTaxonomy(fsrb, references, taxo)
|
||||
identified = obitag.CLIGeomAssignTaxonomy(fs, references, taxo)
|
||||
} else {
|
||||
identified = obitag.CLIAssignTaxonomy(fsrb, references, taxo)
|
||||
identified = obitag.CLIAssignTaxonomy(fs, references, taxo)
|
||||
}
|
||||
|
||||
obiconvert.CLIWriteBioSequences(identified, true)
|
||||
|
||||
@@ -33,10 +33,7 @@ func main() {
|
||||
|
||||
obidefault.SetWorkerPerCore(1)
|
||||
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obitagpcr",
|
||||
"split a paired raw read data set per sample",
|
||||
obitagpcr.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obitagpcr.OptionSet)
|
||||
|
||||
optionParser(os.Args)
|
||||
pairs, err := obipairing.CLIPairedSequence()
|
||||
|
||||
@@ -4,11 +4,9 @@ import (
|
||||
"os"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiitercsv"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obicsv"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitaxonomy"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
|
||||
@@ -16,59 +14,30 @@ import (
|
||||
)
|
||||
|
||||
func main() {
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obitaxonomy",
|
||||
"manipulates and queries taxonomy",
|
||||
obitaxonomy.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obitaxonomy.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
var iterator *obitax.ITaxon
|
||||
|
||||
if obitaxonomy.CLIDownloadNCBI() {
|
||||
switch {
|
||||
case obitaxonomy.CLIDownloadNCBI():
|
||||
err := obitaxonomy.CLIDownloadNCBITaxdump()
|
||||
if err != nil {
|
||||
log.Errorf("Cannot download NCBI taxonomy: %s", err.Error())
|
||||
os.Exit(1)
|
||||
}
|
||||
os.Exit(0)
|
||||
}
|
||||
|
||||
if !obidefault.HasSelectedTaxonomy() {
|
||||
log.Fatal("you must indicate a taxonomy using the -t or --taxonomy option")
|
||||
}
|
||||
|
||||
switch {
|
||||
case obitaxonomy.CLIAskForRankList():
|
||||
newIter := obiitercsv.NewICSVRecord()
|
||||
newIter.Add(1)
|
||||
newIter.AppendField("rank")
|
||||
go func() {
|
||||
ranks := obitax.DefaultTaxonomy().RankList()
|
||||
data := make([]obiitercsv.CSVRecord, len(ranks))
|
||||
|
||||
for i, rank := range ranks {
|
||||
record := make(obiitercsv.CSVRecord)
|
||||
record["rank"] = rank
|
||||
data[i] = record
|
||||
}
|
||||
newIter.Push(obiitercsv.MakeCSVRecordBatch(obitax.DefaultTaxonomy().Name(), 0, data))
|
||||
newIter.Close()
|
||||
newIter.Done()
|
||||
}()
|
||||
obicsv.CLICSVWriter(newIter, true)
|
||||
obiutils.WaitForLastPipe()
|
||||
os.Exit(0)
|
||||
|
||||
case obitaxonomy.CLIExtractTaxonomy():
|
||||
iter, err := obiconvert.CLIReadBioSequences(args...)
|
||||
iter = iter.NumberSequences(1, true)
|
||||
|
||||
if err != nil {
|
||||
log.Fatalf("Cannot extract taxonomy: %v", err)
|
||||
}
|
||||
|
||||
taxonomy, err := iter.ExtractTaxonomy(obitaxonomy.CLINewickWithLeaves())
|
||||
taxonomy, err := iter.ExtractTaxonomy()
|
||||
|
||||
if err != nil {
|
||||
log.Fatalf("Cannot extract taxonomy: %v", err)
|
||||
@@ -130,12 +99,7 @@ func main() {
|
||||
}
|
||||
|
||||
iterator = obitaxonomy.CLITaxonRestrictions(iterator)
|
||||
|
||||
if obitaxonomy.CLIAsNewick() {
|
||||
obitaxonomy.CLINewickWriter(iterator, true)
|
||||
} else {
|
||||
obitaxonomy.CLICSVTaxaWriter(iterator, true)
|
||||
}
|
||||
obitaxonomy.CLICSVTaxaWriter(iterator, true)
|
||||
|
||||
obiutils.WaitForLastPipe()
|
||||
|
||||
|
||||
@@ -33,10 +33,7 @@ func main() {
|
||||
|
||||
obidefault.SetBatchSize(10)
|
||||
obidefault.SetReadQualities(false)
|
||||
optionParser := obioptions.GenerateOptionParser(
|
||||
"obiuniq",
|
||||
"dereplicate sequence data sets",
|
||||
obiuniq.OptionSet)
|
||||
optionParser := obioptions.GenerateOptionParser(obiuniq.OptionSet)
|
||||
|
||||
_, args := optionParser(os.Args)
|
||||
|
||||
|
||||
@@ -3,13 +3,13 @@ package main
|
||||
import (
|
||||
"os"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
)
|
||||
|
||||
func main() {
|
||||
|
||||
obiformats.DetectTaxonomyFormat(os.Args[1])
|
||||
obitax.DetectTaxonomyFormat(os.Args[1])
|
||||
println(obiutils.RemoveAllExt("toto/tutu/test.txt"))
|
||||
println(obiutils.Basename("toto/tutu/test.txt"))
|
||||
|
||||
|
||||
@@ -1,23 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
remote="$1"
|
||||
#url="$2"
|
||||
|
||||
log() {
|
||||
echo -e "[Pre-Push tests @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
current_branch=$(git symbolic-ref --short head)
|
||||
|
||||
cmd="make githubtests"
|
||||
|
||||
if [[ $current_branch = "master" ]]; then
|
||||
log "you are on $current_branch, running build test"
|
||||
if ! eval "$cmd"; then
|
||||
log "Pre-push tests failed $cmd"
|
||||
exit 1
|
||||
fi
|
||||
fi
|
||||
|
||||
log "Tests are OK, ready to push on $remote"
|
||||
exit 0
|
||||
26
go.mod
26
go.mod
@@ -1,39 +1,41 @@
|
||||
module git.metabarcoding.org/obitools/obitools4/obitools4
|
||||
|
||||
go 1.23.4
|
||||
|
||||
toolchain go1.24.2
|
||||
go 1.23.1
|
||||
|
||||
require (
|
||||
github.com/DavidGamba/go-getoptions v0.28.0
|
||||
github.com/PaesslerAG/gval v1.2.2
|
||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df
|
||||
github.com/buger/jsonparser v1.1.1
|
||||
github.com/chen3feng/stl4go v0.1.1
|
||||
github.com/dlclark/regexp2 v1.11.4
|
||||
github.com/goccy/go-json v0.10.3
|
||||
github.com/klauspost/pgzip v1.2.6
|
||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58
|
||||
github.com/pelletier/go-toml/v2 v2.2.4
|
||||
github.com/rrethy/ahocorasick v1.0.0
|
||||
github.com/schollz/progressbar/v3 v3.13.1
|
||||
github.com/sirupsen/logrus v1.9.3
|
||||
github.com/stretchr/testify v1.8.4
|
||||
github.com/stretchr/testify v1.10.0
|
||||
github.com/tevino/abool/v2 v2.1.0
|
||||
github.com/yuin/gopher-lua v1.1.1
|
||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa
|
||||
golang.org/x/exp v0.0.0-20231006140011-7918f672742d
|
||||
gonum.org/v1/gonum v0.14.0
|
||||
gopkg.in/yaml.v3 v3.0.1
|
||||
scientificgo.org/special v0.0.0
|
||||
)
|
||||
|
||||
require (
|
||||
github.com/Clever/csvlint v0.3.0 // indirect
|
||||
github.com/TuftsBCB/io v0.0.0-20140121014543-22b94e9b23f9 // indirect
|
||||
github.com/buger/jsonparser v1.1.1 // indirect
|
||||
github.com/chzyer/readline v0.0.0-20180603132655-2972be24d48e // indirect
|
||||
github.com/davecgh/go-spew v1.1.1 // indirect
|
||||
github.com/ef-ds/deque/v2 v2.0.2 // indirect
|
||||
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 // indirect
|
||||
github.com/kr/pretty v0.3.1 // indirect
|
||||
github.com/kr/pretty v0.3.0 // indirect
|
||||
github.com/kr/text v0.2.0 // indirect
|
||||
github.com/pmezard/go-difflib v1.0.0 // indirect
|
||||
github.com/rogpeppe/go-internal v1.12.0 // indirect
|
||||
github.com/rogpeppe/go-internal v1.6.1 // indirect
|
||||
go.etcd.io/bbolt v1.4.0 // indirect
|
||||
)
|
||||
|
||||
require (
|
||||
@@ -46,8 +48,8 @@ require (
|
||||
github.com/rivo/uniseg v0.4.4 // indirect
|
||||
github.com/shopspring/decimal v1.3.1 // indirect
|
||||
github.com/ulikunitz/xz v0.5.11
|
||||
golang.org/x/net v0.35.0 // indirect
|
||||
golang.org/x/sys v0.30.0 // indirect
|
||||
golang.org/x/term v0.29.0 // indirect
|
||||
golang.org/x/net v0.17.0 // indirect
|
||||
golang.org/x/sys v0.29.0 // indirect
|
||||
golang.org/x/term v0.13.0 // indirect
|
||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c
|
||||
)
|
||||
|
||||
46
go.sum
46
go.sum
@@ -1,15 +1,21 @@
|
||||
github.com/Clever/csvlint v0.3.0 h1:58WEFXWy+i0fCbxTXscR2QwYESRuAUFjEGLgZs6j2iU=
|
||||
github.com/Clever/csvlint v0.3.0/go.mod h1:+wLRuW/bI8NhpRoeyUBxqKsK35OhvgJhXHSWdKp5XJU=
|
||||
github.com/DavidGamba/go-getoptions v0.28.0 h1:18wgEvfZdrlfIhVDGEBO3Dl0fkOyXqXLa0tLMCKxM1c=
|
||||
github.com/DavidGamba/go-getoptions v0.28.0/go.mod h1:zE97E3PR9P3BI/HKyNYgdMlYxodcuiC6W68KIgeYT84=
|
||||
github.com/PaesslerAG/gval v1.2.2 h1:Y7iBzhgE09IGTt5QgGQ2IdaYYYOU134YGHBThD+wm9E=
|
||||
github.com/PaesslerAG/gval v1.2.2/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
|
||||
github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
|
||||
github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
|
||||
github.com/TuftsBCB/io v0.0.0-20140121014543-22b94e9b23f9 h1:Zc1/GNsUpgZR9qm1EmRSKrnOHA7CCd0bIzGdq0cREN0=
|
||||
github.com/TuftsBCB/io v0.0.0-20140121014543-22b94e9b23f9/go.mod h1:PZyV4WA3NpqtezSY0h6E6NARAmdDm0qwrydveOyR5Gc=
|
||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
|
||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
|
||||
github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
|
||||
github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
|
||||
github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
|
||||
github.com/chen3feng/stl4go v0.1.1/go.mod h1:5ml3psLgETJjRJnMbPE+JiHLrCpt+Ajc2weeTECXzWU=
|
||||
github.com/chzyer/readline v0.0.0-20180603132655-2972be24d48e h1:fY5BOSpyZCqRo5OhCuC+XN+r/bBCmeuuJtjz+bCNIf8=
|
||||
github.com/chzyer/readline v0.0.0-20180603132655-2972be24d48e/go.mod h1:nSuG5e5PlCu98SY8svDHJxuZscDgtXS6KTTbou5AhLI=
|
||||
github.com/creack/pty v1.1.9/go.mod h1:oKZEueFk5CKHvIhNR5MUki03XCEU+Q6VDXinZuGJ33E=
|
||||
github.com/davecgh/go-spew v1.1.0/go.mod h1:J7Y8YcW2NihsgmVo/mv3lAwl/skON4iLHjSsI+c5H38=
|
||||
github.com/davecgh/go-spew v1.1.1 h1:vj9j/u1bqnvCEfJOwUhtlOARqs3+rkHYY13jYWTU97c=
|
||||
@@ -19,6 +25,8 @@ github.com/dlclark/regexp2 v1.11.4/go.mod h1:DHkYz0B9wPfa6wondMfaivmHpzrQ3v9q8cn
|
||||
github.com/dsnet/compress v0.0.1 h1:PlZu0n3Tuv04TzpfPbrnI0HW/YwodEXDS+oPKahKF0Q=
|
||||
github.com/dsnet/compress v0.0.1/go.mod h1:Aw8dCMJ7RioblQeTqt88akK31OvO8Dhf5JflhBbQEHo=
|
||||
github.com/dsnet/golib v0.0.0-20171103203638-1ea166775780/go.mod h1:Lj+Z9rebOhdfkVLjJ8T6VcRQv3SXugXy999NBtR9aFY=
|
||||
github.com/ef-ds/deque/v2 v2.0.2 h1:GQtDK1boBMu/qsNbSLQsqzwNptaioxZI39X3UxT5ALA=
|
||||
github.com/ef-ds/deque/v2 v2.0.2/go.mod h1:hoZy4VooWLhRT4uS+sSCilfgBQUNptJU2FGqr08a5sc=
|
||||
github.com/gabriel-vasile/mimetype v1.4.3 h1:in2uUcidCuFcDKtdcBxlR0rJ1+fsokWf+uqxgUFjbI0=
|
||||
github.com/gabriel-vasile/mimetype v1.4.3/go.mod h1:d8uq/6HKRL6CGdk+aubisF/M5GcPfT7nKyLpA0lbSSk=
|
||||
github.com/goccy/go-json v0.10.3 h1:KZ5WoDbxAIgm2HNbYckL0se1fHD6rz5j4ywS6ebzDqA=
|
||||
@@ -34,9 +42,10 @@ github.com/klauspost/compress v1.17.2/go.mod h1:ntbaceVETuRiXiv4DpjP66DpAtAGkEQs
|
||||
github.com/klauspost/cpuid v1.2.0/go.mod h1:Pj4uuM528wm8OyEC2QMXAi2YiTZ96dNQPGgoMS4s3ek=
|
||||
github.com/klauspost/pgzip v1.2.6 h1:8RXeL5crjEUFnR2/Sn6GJNWtSQ3Dk8pq4CL3jvdDyjU=
|
||||
github.com/klauspost/pgzip v1.2.6/go.mod h1:Ch1tH69qFZu15pkjo5kYi6mth2Zzwzt50oCQKQE9RUs=
|
||||
github.com/kr/pretty v0.1.0/go.mod h1:dAy3ld7l9f0ibDNOQOHHMYYIIbhfbHSm3C4ZsoJORNo=
|
||||
github.com/kr/pretty v0.2.1/go.mod h1:ipq/a2n7PKx3OHsz4KJII5eveXtPO4qwEXGdVfWzfnI=
|
||||
github.com/kr/pretty v0.3.1 h1:flRD4NNwYAUpkphVc1HcthR4KEIFJ65n8Mw5qdRn3LE=
|
||||
github.com/kr/pretty v0.3.1/go.mod h1:hoEshYVHaxMs3cyo3Yncou5ZscifuDolrwPKZanG3xk=
|
||||
github.com/kr/pretty v0.3.0 h1:WgNl7dwNpEZ6jJ9k1snq4pZsg7DOEN8hP9Xw0Tsjwk0=
|
||||
github.com/kr/pretty v0.3.0/go.mod h1:640gp4NfQd8pI5XOwp5fnNeVWj67G7CFk/SaSQn7NBk=
|
||||
github.com/kr/pty v1.1.1/go.mod h1:pFQYn66WHrOpPYNljwOMqo10TkYh1fy3cYio2l3bCsQ=
|
||||
github.com/kr/text v0.1.0/go.mod h1:4Jbv+DJW3UT/LiOwJeYQe1efqtUx/iVham/4vfdArNI=
|
||||
github.com/kr/text v0.2.0 h1:5Nx0Ya0ZqY2ygV366QzturHI13Jq95ApcVaJBhpS+AY=
|
||||
@@ -49,17 +58,13 @@ github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2Em
|
||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
|
||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
|
||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58/go.mod h1:DXv8WO4yhMYhSNPKjeNKa5WY9YCIEBRbNzFFPJbWO6Y=
|
||||
github.com/pelletier/go-toml/v2 v2.2.4 h1:mye9XuhQ6gvn5h28+VilKrrPoQVanw5PMw/TB0t5Ec4=
|
||||
github.com/pelletier/go-toml/v2 v2.2.4/go.mod h1:2gIqNv+qfxSVS7cM2xJQKtLSTLUE9V8t9Stt+h56mCY=
|
||||
github.com/pkg/diff v0.0.0-20210226163009-20ebb0f2a09e/go.mod h1:pJLUxLENpZxwdsKMEsNbx1VGcRFpLqf3715MtcvvzbA=
|
||||
github.com/pmezard/go-difflib v1.0.0 h1:4DBwDE0NGyQoBHbLQYPwSUPoCMWR5BEzIk/f1lZbAQM=
|
||||
github.com/pmezard/go-difflib v1.0.0/go.mod h1:iKH77koFhYxTK1pcRnkKkqfTogsbg7gZNVY4sRDYZ/4=
|
||||
github.com/rivo/uniseg v0.2.0/go.mod h1:J6wj4VEh+S6ZtnVlnTBMWIodfgj8LQOQFoIToxlJtxc=
|
||||
github.com/rivo/uniseg v0.4.4 h1:8TfxU8dW6PdqD27gjM8MVNuicgxIjxpm4K7x4jp8sis=
|
||||
github.com/rivo/uniseg v0.4.4/go.mod h1:FN3SvrM+Zdj16jyLfmOkMNblXMcoc8DfTHruCPUcx88=
|
||||
github.com/rogpeppe/go-internal v1.9.0/go.mod h1:WtVeX8xhTBvf0smdhujwtBcq4Qrzq/fJaraNFVN+nFs=
|
||||
github.com/rogpeppe/go-internal v1.12.0 h1:exVL4IDcn6na9z1rAb56Vxr+CgyK3nn3O+epU5NdKM8=
|
||||
github.com/rogpeppe/go-internal v1.12.0/go.mod h1:E+RYuTGaKKdloAfM02xzb0FW3Paa99yedzYV+kq4uf4=
|
||||
github.com/rogpeppe/go-internal v1.6.1 h1:/FiVV8dS/e+YqF2JvO3yXRFbBLTIuSDkuC7aBOAvL+k=
|
||||
github.com/rogpeppe/go-internal v1.6.1/go.mod h1:xXDCJY+GAPziupqXw64V24skbSoqbTEfhy4qGm1nDQc=
|
||||
github.com/rrethy/ahocorasick v1.0.0 h1:YKkCB+E5PXc0xmLfMrWbfNht8vG9Re97IHSWZk/Lk8E=
|
||||
github.com/rrethy/ahocorasick v1.0.0/go.mod h1:nq8oScE7Vy1rOppoQxpQiiDmPHuKCuk9rXrNcxUV3R0=
|
||||
github.com/schollz/progressbar/v3 v3.13.1 h1:o8rySDYiQ59Mwzy2FELeHY5ZARXZTVJC7iHD6PEFUiE=
|
||||
@@ -70,9 +75,12 @@ github.com/sirupsen/logrus v1.9.3 h1:dueUQJ1C2q9oE3F7wvmSGAaVtTmUizReu6fjN8uqzbQ
|
||||
github.com/sirupsen/logrus v1.9.3/go.mod h1:naHLuLoDiP4jHNo9R0sCBMtWGeIprob74mVsIT4qYEQ=
|
||||
github.com/stretchr/objx v0.1.0/go.mod h1:HFkY916IF+rwdDfMAkV7OtwuqBVzrE8GR6GFx+wExME=
|
||||
github.com/stretchr/testify v1.3.0/go.mod h1:M5WIy9Dh21IEIfnGCwXGc5bZfKNJtfHm1UVUgZn+9EI=
|
||||
github.com/stretchr/testify v1.6.1/go.mod h1:6Fq8oRcR53rry900zMqJjRRixrwX3KX962/h/Wwjteg=
|
||||
github.com/stretchr/testify v1.7.0/go.mod h1:6Fq8oRcR53rry900zMqJjRRixrwX3KX962/h/Wwjteg=
|
||||
github.com/stretchr/testify v1.8.4 h1:CcVxjf3Q8PM0mHUKJCdn+eZZtm5yQwehR5yeSVQQcUk=
|
||||
github.com/stretchr/testify v1.8.4/go.mod h1:sz/lmYIOXD/1dqDmKjjqLyZ2RngseejIcXlSw2iwfAo=
|
||||
github.com/stretchr/testify v1.10.0 h1:Xv5erBjTwe/5IxqUQTdXv5kgmIvbHo3QQyRwhJsOfJA=
|
||||
github.com/stretchr/testify v1.10.0/go.mod h1:r2ic/lqez/lEtzL7wO/rwa5dbSLXVDPFyf8C91i36aY=
|
||||
github.com/tevino/abool/v2 v2.1.0 h1:7w+Vf9f/5gmKT4m4qkayb33/92M+Um45F2BkHOR+L/c=
|
||||
github.com/tevino/abool/v2 v2.1.0/go.mod h1:+Lmlqk6bHDWHqN1cbxqhwEAwMPXgc8I1SDEamtseuXY=
|
||||
github.com/ulikunitz/xz v0.5.6/go.mod h1:2bypXElzHzzJZwzH67Y6wb67pO62Rzfn7BSiF4ABRW8=
|
||||
@@ -80,23 +88,29 @@ github.com/ulikunitz/xz v0.5.11 h1:kpFauv27b6ynzBNT/Xy+1k+fK4WswhN/6PN5WhFAGw8=
|
||||
github.com/ulikunitz/xz v0.5.11/go.mod h1:nbz6k7qbPmH4IRqmfOplQw/tblSgqTqBwxkY0oWt/14=
|
||||
github.com/yuin/gopher-lua v1.1.1 h1:kYKnWBjvbNP4XLT3+bPEwAXJx262OhaHDWDVOPjL46M=
|
||||
github.com/yuin/gopher-lua v1.1.1/go.mod h1:GBR0iDaNXjAgGg9zfCvksxSRnQx76gclCIb7kdAd1Pw=
|
||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa h1:FRnLl4eNAQl8hwxVVC17teOw8kdjVDVAiFMtgUdTSRQ=
|
||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa/go.mod h1:zk2irFbV9DP96SEBUUAy67IdHUaZuSnrz1n472HUCLE=
|
||||
golang.org/x/net v0.35.0 h1:T5GQRQb2y08kTAByq9L4/bz8cipCdA8FbRTXewonqY8=
|
||||
golang.org/x/net v0.35.0/go.mod h1:EglIi67kWsHKlRzzVMUD93VMSWGFOMSZgxFjparz1Qk=
|
||||
go.etcd.io/bbolt v1.4.0 h1:TU77id3TnN/zKr7CO/uk+fBCwF2jGcMuw2B/FMAzYIk=
|
||||
go.etcd.io/bbolt v1.4.0/go.mod h1:AsD+OCi/qPN1giOX1aiLAha3o1U8rAz65bvN4j0sRuk=
|
||||
golang.org/x/exp v0.0.0-20231006140011-7918f672742d h1:jtJma62tbqLibJ5sFQz8bKtEM8rJBtfilJ2qTU199MI=
|
||||
golang.org/x/exp v0.0.0-20231006140011-7918f672742d/go.mod h1:ldy0pHrwJyGW56pPQzzkH36rKxoZW1tw7ZJpeKx+hdo=
|
||||
golang.org/x/net v0.17.0 h1:pVaXccu2ozPjCXewfr1S7xza/zcXTity9cCdXQYSjIM=
|
||||
golang.org/x/net v0.17.0/go.mod h1:NxSsAGuq816PNPmqtQdLE42eU2Fs7NoRIZrHJAlaCOE=
|
||||
golang.org/x/sys v0.0.0-20220715151400-c0bba94af5f8/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
||||
golang.org/x/sys v0.0.0-20220811171246-fbc7d0a398ab/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
||||
golang.org/x/sys v0.6.0/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
||||
golang.org/x/sys v0.30.0 h1:QjkSwP/36a20jFYWkSue1YwXzLmsV5Gfq7Eiy72C1uc=
|
||||
golang.org/x/sys v0.30.0/go.mod h1:/VUhepiaJMQUp4+oa/7Zr1D23ma6VTLIYjOOTFZPUcA=
|
||||
golang.org/x/sys v0.17.0 h1:25cE3gD+tdBA7lp7QfhuV+rJiE9YXTcS3VG1SqssI/Y=
|
||||
golang.org/x/sys v0.17.0/go.mod h1:/VUhepiaJMQUp4+oa/7Zr1D23ma6VTLIYjOOTFZPUcA=
|
||||
golang.org/x/sys v0.29.0 h1:TPYlXGxvx1MGTn2GiZDhnjPA9wZzZeGKHHmKhHYvgaU=
|
||||
golang.org/x/sys v0.29.0/go.mod h1:/VUhepiaJMQUp4+oa/7Zr1D23ma6VTLIYjOOTFZPUcA=
|
||||
golang.org/x/term v0.6.0/go.mod h1:m6U89DPEgQRMq3DNkDClhWw02AUbt2daBVO4cn4Hv9U=
|
||||
golang.org/x/term v0.29.0 h1:L6pJp37ocefwRRtYPKSWOWzOtWSxVajvz2ldH/xi3iU=
|
||||
golang.org/x/term v0.29.0/go.mod h1:6bl4lRlvVuDgSf3179VpIxBF0o10JUpXWOnI7nErv7s=
|
||||
golang.org/x/term v0.13.0 h1:bb+I9cTfFazGW51MZqBVmZy7+JEJMouUHTUSKVQLBek=
|
||||
golang.org/x/term v0.13.0/go.mod h1:LTmsnFJwVN6bCy1rVCoS+qHT1HhALEFxKncY3WNNh4U=
|
||||
gonum.org/v1/gonum v0.14.0 h1:2NiG67LD1tEH0D7kM+ps2V+fXmsAnpUeec7n8tcr4S0=
|
||||
gonum.org/v1/gonum v0.14.0/go.mod h1:AoWeoz0becf9QMWtE8iWXNXc27fK4fNeHNf/oMejGfU=
|
||||
gopkg.in/check.v1 v0.0.0-20161208181325-20d25e280405/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0=
|
||||
gopkg.in/check.v1 v1.0.0-20180628173108-788fd7840127/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0=
|
||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c h1:Hei/4ADfdWqJk1ZMxUNpqntNwaWcugrBjAiHlqqRiVk=
|
||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c/go.mod h1:JHkPIbrfpd72SG/EVd6muEfDQjcINNoR0C8j2r3qZ4Q=
|
||||
gopkg.in/errgo.v2 v2.1.0/go.mod h1:hNsd1EY+bozCKY1Ytp96fpM3vjJbqLJn88ws8XvfDNI=
|
||||
gopkg.in/yaml.v3 v3.0.0-20200313102051-9f266ea9e77c/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
|
||||
gopkg.in/yaml.v3 v3.0.1 h1:fxVm/GzAzEWqLHuvctI91KS9hhNmmWOoWu0XTYJS7CA=
|
||||
gopkg.in/yaml.v3 v3.0.1/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
|
||||
|
||||
18
go.work.sum
18
go.work.sum
@@ -5,8 +5,6 @@ github.com/ajstarks/svgo v0.0.0-20211024235047-1546f124cd8b/go.mod h1:1KcenG0jGW
|
||||
github.com/chzyer/logex v1.1.10 h1:Swpa1K6QvQznwJRcfTfQJmTE72DqScAa40E+fbHEXEE=
|
||||
github.com/chzyer/logex v1.1.10/go.mod h1:+Ywpsq7O8HXn0nuIou7OrIPyXbp3wmkHB+jjWRnGsAI=
|
||||
github.com/chzyer/logex v1.2.0 h1:+eqR0HfOetur4tgnC8ftU5imRnhi4te+BadWS95c5AM=
|
||||
github.com/chzyer/readline v0.0.0-20180603132655-2972be24d48e h1:fY5BOSpyZCqRo5OhCuC+XN+r/bBCmeuuJtjz+bCNIf8=
|
||||
github.com/chzyer/readline v0.0.0-20180603132655-2972be24d48e/go.mod h1:nSuG5e5PlCu98SY8svDHJxuZscDgtXS6KTTbou5AhLI=
|
||||
github.com/chzyer/test v0.0.0-20180213035817-a1ea475d72b1 h1:q763qf9huN11kDQavWsoZXJNW3xEE4JJyHa5Q25/sd8=
|
||||
github.com/chzyer/test v0.0.0-20180213035817-a1ea475d72b1/go.mod h1:Q3SI9o4m/ZMnBNeIyt5eFwwo7qiLfzFZmjNmxjkiQlU=
|
||||
github.com/chzyer/test v0.0.0-20210722231415-061457976a23 h1:dZ0/VyGgQdVGAss6Ju0dt5P0QltE0SFY5Woh6hbIfiQ=
|
||||
@@ -19,46 +17,42 @@ github.com/go-latex/latex v0.0.0-20230307184459-12ec69307ad9 h1:NxXI5pTAtpEaU49b
|
||||
github.com/go-latex/latex v0.0.0-20230307184459-12ec69307ad9/go.mod h1:gWuR/CrFDDeVRFQwHPvsv9soJVB/iqymhuZQuJ3a9OM=
|
||||
github.com/go-pdf/fpdf v0.6.0 h1:MlgtGIfsdMEEQJr2le6b/HNr1ZlQwxyWr77r2aj2U/8=
|
||||
github.com/go-pdf/fpdf v0.6.0/go.mod h1:HzcnA+A23uwogo0tp9yU+l3V+KXhiESpt1PMayhOh5M=
|
||||
github.com/go-quicktest/qt v1.101.0/go.mod h1:14Bz/f7NwaXPtdYEgzsx46kqSxVwTbzVZsDC26tQJow=
|
||||
github.com/goccmack/gocc v0.0.0-20230228185258-2292f9e40198 h1:FSii2UQeSLngl3jFoR4tUKZLprO7qUlh/TKKticc0BM=
|
||||
github.com/goccmack/gocc v0.0.0-20230228185258-2292f9e40198/go.mod h1:DTh/Y2+NbnOVVoypCCQrovMPDKUGp4yZpSbWg5D0XIM=
|
||||
github.com/golang/freetype v0.0.0-20170609003504-e2365dfdc4a0 h1:DACJavvAHhabrF08vX0COfcOBJRhZ8lUbR+ZWIs0Y5g=
|
||||
github.com/golang/freetype v0.0.0-20170609003504-e2365dfdc4a0/go.mod h1:E/TSTwGwJL78qG/PmXZO1EjYhfJinVAhrmmHX6Z8B9k=
|
||||
github.com/google/go-cmdtest v0.4.1-0.20220921163831-55ab3332a786/go.mod h1:apVn/GCasLZUVpAJ6oWAuyP7Ne7CEsQbTnc0plM3m+o=
|
||||
github.com/google/go-cmp v0.5.8 h1:e6P7q2lk1O+qJJb4BtCQXlK8vWEO8V1ZeuEdJNOqZyg=
|
||||
github.com/google/go-cmp v0.5.8/go.mod h1:17dUlkBOakJ0+DkrSSNjCkIjxS6bF9zb3elmeNGIjoY=
|
||||
github.com/google/renameio v0.1.0/go.mod h1:KWCgfxg9yswjAJkECMjeO8J8rahYeXnNhOm40UhjYkI=
|
||||
github.com/google/safehtml v0.1.0/go.mod h1:L4KWwDsUJdECRAEpZoBn3O64bQaywRscowZjJAzjHnU=
|
||||
github.com/hashicorp/errwrap v1.0.0/go.mod h1:YH+1FKiLXxHSkmPseP+kNlulaMuP3n2brvKWEqk/Jc4=
|
||||
github.com/hashicorp/go-multierror v1.1.1/go.mod h1:iw975J/qwKPdAO1clOe2L8331t/9/fmwbPZ6JB6eMoM=
|
||||
github.com/ianlancetaylor/demangle v0.0.0-20220319035150-800ac71e25c2 h1:rcanfLhLDA8nozr/K289V1zcntHr3V+SHlXwzz1ZI2g=
|
||||
github.com/jba/templatecheck v0.7.1/go.mod h1:n1Etw+Rrw1mDDD8dDRsEKTwMZsJ98EkktgNJC6wLUGo=
|
||||
github.com/inconshreveable/mousetrap v1.1.0/go.mod h1:vpF70FUmC8bwa3OWnCshd2FqLfsEA9PFc4w1p2J65bw=
|
||||
github.com/k0kubun/go-ansi v0.0.0-20180517002512-3bf9e2903213 h1:qGQQKEcAR99REcMpsXCp3lJ03zYT1PkRd3kQGPn9GVg=
|
||||
github.com/klauspost/cpuid v1.2.0 h1:NMpwD2G9JSFOE1/TJjGSo5zG7Yb2bTe7eq1jH+irmeE=
|
||||
github.com/kr/pty v1.1.1 h1:VkoXIwSboBpnk99O/KFauAEILuNHv5DVFKZMBN/gUgw=
|
||||
github.com/mailru/easyjson v0.7.7/go.mod h1:xzfreul335JAWq5oZzymOObrkdz5UnU4kGfJJLY9Nlc=
|
||||
github.com/mattn/go-isatty v0.0.17 h1:BTarxUcIeDqL27Mc+vyvdWYSL28zpIhv3RoTdsLMPng=
|
||||
github.com/smallnest/goroutine v1.1.1/go.mod h1:Fp8f6ZReubfdj0m4+NcUnW4IsAqKa+Pnrv9opEiD43E=
|
||||
github.com/spf13/cobra v1.8.1/go.mod h1:wHxEcudfqmLYa8iTfL+OuZPbBZkmvliBWKIezN3kD9Y=
|
||||
github.com/spf13/pflag v1.0.6/go.mod h1:McXfInJRrz4CZXVZOBLb0bTZqETkiAhM9Iw0y3An2Bg=
|
||||
github.com/stretchr/objx v0.1.0 h1:4G4v2dO3VZwixGIRoQ5Lfboy6nUhCyYzaqnIAPPhYs4=
|
||||
github.com/stretchr/objx v0.5.0 h1:1zr/of2m5FGMsad5YfcqgdqdWrIhu+EBEJRhR1U7z/c=
|
||||
github.com/stretchr/objx v0.5.0/go.mod h1:Yh+to48EsGEfYuaHDzXPcE3xhTkx73EhmCGUpEOglKo=
|
||||
github.com/stretchr/objx v0.5.2/go.mod h1:FRsXN1f5AsAjCGJKqEizvkpNtU+EGNCLh3NxZ/8L+MA=
|
||||
github.com/yuin/goldmark v1.4.13 h1:fVcFKWvrslecOb/tg+Cc05dkeYx540o0FuFt3nUVDoE=
|
||||
github.com/yuin/goldmark v1.4.13/go.mod h1:6yULJ656Px+3vBD8DxQVa3kxgyrAnzto9xy5taEt/CY=
|
||||
go.etcd.io/gofail v0.2.0/go.mod h1:nL3ILMGfkXTekKI3clMBNazKnjUZjYLKmBHzsVAnC1o=
|
||||
golang.org/x/crypto v0.14.0 h1:wBqGXzWJW6m1XrIKlAH0Hs1JJ7+9KBwnIO8v66Q9cHc=
|
||||
golang.org/x/crypto v0.14.0/go.mod h1:MVFd36DqK4CsrnJYDkBA3VC4m2GkXAM0PvzMCn4JQf4=
|
||||
golang.org/x/crypto v0.33.0/go.mod h1:bVdXmD7IV/4GdElGPozy6U7lWdRXA4qyRVGJV57uQ5M=
|
||||
golang.org/x/image v0.6.0 h1:bR8b5okrPI3g/gyZakLZHeWxAR8Dn5CyxXv1hLH5g/4=
|
||||
golang.org/x/image v0.6.0/go.mod h1:MXLdDR43H7cDJq5GEGXEVeeNhPgi+YYEQ2pC1byI1x0=
|
||||
golang.org/x/mod v0.13.0 h1:I/DsJXRlw/8l/0c24sM9yb0T4z9liZTduXvdAWYiysY=
|
||||
golang.org/x/mod v0.13.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
||||
golang.org/x/mod v0.14.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
||||
golang.org/x/sync v0.0.0-20220722155255-886fb9371eb4 h1:uVc8UZUe6tr40fFVnUP5Oj+veunVezqYl9z7DYw9xzw=
|
||||
golang.org/x/sync v0.10.0/go.mod h1:Czt+wKu1gCyEFDUtn0jG5QVvpJ6rzVqr5aXyt9drQfk=
|
||||
golang.org/x/text v0.13.0 h1:ablQoSUd0tRdKxZewP80B+BaqeKJuVhuRxj/dkrun3k=
|
||||
golang.org/x/text v0.13.0/go.mod h1:TvPlkZtksWOMsz7fbANvkp4WM8x/WCo/om8BMLbz+aE=
|
||||
golang.org/x/text v0.22.0/go.mod h1:YRoo4H8PVmsu+E3Ou7cqLVH8oXWIHVoX0jqUWALQhfY=
|
||||
golang.org/x/tools v0.14.0 h1:jvNa2pY0M4r62jkRQ6RwEZZyPcymeL9XZMLBbV7U2nc=
|
||||
golang.org/x/tools v0.14.0/go.mod h1:uYBEerGOWcJyEORxN+Ek8+TT266gXkNlHdJBwexUsBg=
|
||||
golang.org/x/tools v0.15.0/go.mod h1:hpksKq4dtpQWS1uQ61JkdqWM3LscIS6Slf+VVkm+wQk=
|
||||
golang.org/x/xerrors v0.0.0-20190717185122-a985d3407aa7 h1:9zdDQZ7Thm29KFXgAX/+yaf3eVbP7djjWp/dXAppNCc=
|
||||
gonum.org/v1/plot v0.10.1 h1:dnifSs43YJuNMDzB7v8wV64O4ABBHReuAVAoBxqBqS4=
|
||||
gonum.org/v1/plot v0.10.1/go.mod h1:VZW5OlhkL1mysU9vaqNHnsy86inf6Ot+jB3r+BczCEo=
|
||||
|
||||
@@ -1,56 +1,27 @@
|
||||
#!/bin/bash
|
||||
|
||||
# Default values
|
||||
URL="https://go.dev/dl/"
|
||||
GITHUB_REPO="https://github.com/metabarcoding/obitools4"
|
||||
INSTALL_DIR="/usr/local"
|
||||
OBITOOLS_PREFIX=""
|
||||
VERSION=""
|
||||
LIST_VERSIONS=false
|
||||
# default values
|
||||
URL="https://go.dev/dl/"
|
||||
OBIURL4="https://github.com/metabarcoding/obitools4/archive/refs/heads/master.zip"
|
||||
INSTALL_DIR="/usr/local"
|
||||
OBITOOLS_PREFIX=""
|
||||
|
||||
# Help message
|
||||
# help message
|
||||
function display_help {
|
||||
echo "Usage: $0 [OPTIONS]"
|
||||
echo ""
|
||||
echo "Options:"
|
||||
echo " -i, --install-dir Directory where obitools are installed "
|
||||
echo " (e.g., use /usr/local not /usr/local/bin)."
|
||||
echo " (as example use /usr/local not /usr/local/bin)."
|
||||
echo " -p, --obitools-prefix Prefix added to the obitools command names if you"
|
||||
echo " want to have several versions of obitools at the"
|
||||
echo " same time on your system (e.g., -p g will produce "
|
||||
echo " same time on your system (as example -p g will produce "
|
||||
echo " gobigrep command instead of obigrep)."
|
||||
echo " -v, --version Install a specific version (e.g., 4.4.8)."
|
||||
echo " If not specified, installs the latest version."
|
||||
echo " -l, --list List all available versions and exit."
|
||||
echo " -h, --help Display this help message."
|
||||
echo ""
|
||||
echo "Examples:"
|
||||
echo " $0 # Install latest version"
|
||||
echo " $0 -l # List available versions"
|
||||
echo " $0 -v 4.4.8 # Install specific version"
|
||||
echo " $0 -i /opt/local # Install to custom directory"
|
||||
}
|
||||
|
||||
# List available versions from GitHub releases
|
||||
function list_versions {
|
||||
echo "Fetching available versions..." 1>&2
|
||||
echo ""
|
||||
curl -s "https://api.github.com/repos/metabarcoding/obitools4/releases" \
|
||||
| grep '"tag_name":' \
|
||||
| sed -E 's/.*"tag_name": "Release_([0-9.]+)".*/\1/' \
|
||||
| sort -V -r
|
||||
}
|
||||
|
||||
# Get latest version from GitHub releases
|
||||
function get_latest_version {
|
||||
curl -s "https://api.github.com/repos/metabarcoding/obitools4/releases" \
|
||||
| grep '"tag_name":' \
|
||||
| sed -E 's/.*"tag_name": "Release_([0-9.]+)".*/\1/' \
|
||||
| sort -V -r \
|
||||
| head -1
|
||||
}
|
||||
|
||||
# Parse command line arguments
|
||||
while [ "$#" -gt 0 ]; do
|
||||
case "$1" in
|
||||
-i|--install-dir)
|
||||
@@ -61,104 +32,62 @@ while [ "$#" -gt 0 ]; do
|
||||
OBITOOLS_PREFIX="$2"
|
||||
shift 2
|
||||
;;
|
||||
-v|--version)
|
||||
VERSION="$2"
|
||||
shift 2
|
||||
;;
|
||||
-l|--list)
|
||||
LIST_VERSIONS=true
|
||||
shift
|
||||
;;
|
||||
-h|--help)
|
||||
display_help
|
||||
display_help 1>&2
|
||||
exit 0
|
||||
;;
|
||||
*)
|
||||
echo "Error: Unsupported option $1" 1>&2
|
||||
display_help 1>&2
|
||||
echo "Error: Unsupported option $1" 1>&2
|
||||
exit 1
|
||||
;;
|
||||
esac
|
||||
done
|
||||
|
||||
# List versions and exit if requested
|
||||
if [ "$LIST_VERSIONS" = true ]; then
|
||||
echo "Available OBITools4 versions:"
|
||||
echo "=============================="
|
||||
list_versions
|
||||
exit 0
|
||||
fi
|
||||
|
||||
# Determine version to install
|
||||
if [ -z "$VERSION" ]; then
|
||||
echo "Fetching latest version..." 1>&2
|
||||
VERSION=$(get_latest_version)
|
||||
if [ -z "$VERSION" ]; then
|
||||
echo "Error: Could not determine latest version" 1>&2
|
||||
exit 1
|
||||
fi
|
||||
echo "Latest version: $VERSION" 1>&2
|
||||
else
|
||||
echo "Installing version: $VERSION" 1>&2
|
||||
fi
|
||||
|
||||
# Construct source URL for the specified version
|
||||
OBIURL4="${GITHUB_REPO}/archive/refs/tags/Release_${VERSION}.zip"
|
||||
|
||||
# The directory from where the script is run
|
||||
# the directory from where the script is run
|
||||
DIR="$(pwd)"
|
||||
|
||||
# Create temporary directory
|
||||
# the temp directory used, within $DIR
|
||||
# omit the -p parameter to create a temporal directory in the default location
|
||||
# WORK_DIR=$(mktemp -d -p "$DIR" "obitools4.XXXXXX" 2> /dev/null || \
|
||||
# mktemp -d -t "$DIR" "obitools4.XXXXXX")
|
||||
|
||||
WORK_DIR=$(mktemp -d "obitools4.XXXXXX")
|
||||
|
||||
# Check if tmp dir was created
|
||||
# check if tmp dir was created
|
||||
if [[ ! "$WORK_DIR" || ! -d "$WORK_DIR" ]]; then
|
||||
echo "Could not create temp dir" 1>&2
|
||||
echo "Could not create temp dir" 1>&2
|
||||
exit 1
|
||||
fi
|
||||
|
||||
mkdir -p "${WORK_DIR}/cache" \
|
||||
|| (echo "Cannot create ${WORK_DIR}/cache directory" 1>&2
|
||||
exit 1)
|
||||
|
||||
# Create installation directory
|
||||
mkdir -p "${INSTALL_DIR}/bin" 2> /dev/null \
|
||||
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
||||
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
||||
sudo mkdir -p "${INSTALL_DIR}/bin")
|
||||
|
||||
if [[ ! -d "${INSTALL_DIR}/bin" ]]; then
|
||||
echo "Could not create ${INSTALL_DIR}/bin directory for installing obitools" 1>&2
|
||||
echo "Could not create ${INSTALL_DIR}/bin directory for installing obitools" 1>&2
|
||||
exit 1
|
||||
fi
|
||||
|
||||
INSTALL_DIR="$(cd ${INSTALL_DIR} && pwd)"
|
||||
INSTALL_DIR="$(cd $INSTALL_DIR && pwd)"
|
||||
|
||||
echo "================================" 1>&2
|
||||
echo "OBITools4 Installation" 1>&2
|
||||
echo "================================" 1>&2
|
||||
echo "VERSION=$VERSION" 1>&2
|
||||
echo "WORK_DIR=$WORK_DIR" 1>&2
|
||||
echo "INSTALL_DIR=$INSTALL_DIR" 1>&2
|
||||
echo "OBITOOLS_PREFIX=$OBITOOLS_PREFIX" 1>&2
|
||||
echo "================================" 1>&2
|
||||
echo WORK_DIR=$WORK_DIR 1>&2
|
||||
echo INSTALL_DIR=$INSTALL_DIR 1>&2
|
||||
echo OBITOOLS_PREFIX=$OBITOOLS_PREFIX 1>&2
|
||||
|
||||
pushd "$WORK_DIR" > /dev/null || exit
|
||||
pushd "$WORK_DIR"|| exit
|
||||
|
||||
# Detect OS and architecture
|
||||
OS=$(uname -a | awk '{print $1}')
|
||||
ARCH=$(uname -m)
|
||||
|
||||
if [[ "$ARCH" == "x86_64" ]] ; then
|
||||
ARCH="amd64"
|
||||
if [[ "$ARCH" == "x86_64" ]] ; then
|
||||
ARCH="amd64"
|
||||
fi
|
||||
|
||||
if [[ "$ARCH" == "aarch64" ]] ; then
|
||||
ARCH="arm64"
|
||||
if [[ "$ARCH" == "aarch64" ]] ; then
|
||||
ARCH="arm64"
|
||||
fi
|
||||
|
||||
# Download and install Go
|
||||
echo "Downloading Go..." 1>&2
|
||||
GOFILE=$(curl -s "$URL" \
|
||||
GOFILE=$(curl "$URL" \
|
||||
| grep 'class="download"' \
|
||||
| grep "\.tar\.gz" \
|
||||
| sed -E 's@^.*/dl/(go[1-9].+\.tar\.gz)".*$@\1@' \
|
||||
@@ -166,71 +95,35 @@ GOFILE=$(curl -s "$URL" \
|
||||
| grep -i "$ARCH" \
|
||||
| head -1)
|
||||
|
||||
GOURL=$(curl -s "${URL}${GOFILE}" \
|
||||
GOURL=$(curl "${URL}${GOFILE}" \
|
||||
| sed -E 's@^.*href="(.*\.tar\.gz)".*$@\1@')
|
||||
|
||||
echo "Installing Go from: $GOURL" 1>&2
|
||||
|
||||
curl -s "$GOURL" | tar zxf -
|
||||
echo "Install GO from : $GOURL" 1>&2
|
||||
|
||||
curl "$GOURL" \
|
||||
| tar zxf -
|
||||
|
||||
PATH="$(pwd)/go/bin:$PATH"
|
||||
export PATH
|
||||
GOPATH="$(pwd)/go"
|
||||
export GOPATH
|
||||
export GOCACHE="$(pwd)/cache"
|
||||
|
||||
echo "GOCACHE=$GOCACHE" 1>&2
|
||||
mkdir -p "$GOCACHE"
|
||||
curl -L "$OBIURL4" > master.zip
|
||||
unzip master.zip
|
||||
|
||||
# Download OBITools4 source
|
||||
echo "Downloading OBITools4 v${VERSION}..." 1>&2
|
||||
echo "Source URL: $OBIURL4" 1>&2
|
||||
echo "Install OBITOOLS from : $OBIURL4"
|
||||
|
||||
if ! curl -sL "$OBIURL4" > obitools4.zip; then
|
||||
echo "Error: Could not download OBITools4 version ${VERSION}" 1>&2
|
||||
echo "Please check that this version exists with: $0 --list" 1>&2
|
||||
exit 1
|
||||
fi
|
||||
cd obitools4-master || exit
|
||||
|
||||
unzip -q obitools4.zip
|
||||
|
||||
# Find the extracted directory
|
||||
OBITOOLS_DIR=$(ls -d obitools4-* 2>/dev/null | head -1)
|
||||
|
||||
if [ -z "$OBITOOLS_DIR" ] || [ ! -d "$OBITOOLS_DIR" ]; then
|
||||
echo "Error: Could not find extracted OBITools4 directory" 1>&2
|
||||
exit 1
|
||||
fi
|
||||
|
||||
echo "Building OBITools4..." 1>&2
|
||||
cd "$OBITOOLS_DIR" || exit
|
||||
mkdir -p vendor
|
||||
|
||||
# Build with or without prefix
|
||||
if [[ -z "$OBITOOLS_PREFIX" ]] ; then
|
||||
make GOFLAGS="-buildvcs=false"
|
||||
make
|
||||
else
|
||||
make GOFLAGS="-buildvcs=false" OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
|
||||
make OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
|
||||
fi
|
||||
|
||||
# Install binaries
|
||||
echo "Installing binaries to ${INSTALL_DIR}/bin..." 1>&2
|
||||
(cp build/* "${INSTALL_DIR}/bin" 2> /dev/null) \
|
||||
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
||||
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}"
|
||||
sudo cp build/* "${INSTALL_DIR}/bin")
|
||||
|
||||
popd > /dev/null || exit
|
||||
popd || exit
|
||||
|
||||
# Cleanup
|
||||
echo "Cleaning up..." 1>&2
|
||||
chmod -R +w "$WORK_DIR"
|
||||
rm -rf "$WORK_DIR"
|
||||
|
||||
echo "" 1>&2
|
||||
echo "================================" 1>&2
|
||||
echo "OBITools4 v${VERSION} installed successfully!" 1>&2
|
||||
echo "Binaries location: ${INSTALL_DIR}/bin" 1>&2
|
||||
if [[ -n "$OBITOOLS_PREFIX" ]] ; then
|
||||
echo "Command prefix: ${OBITOOLS_PREFIX}" 1>&2
|
||||
fi
|
||||
echo "================================" 1>&2
|
||||
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obiannotate
|
||||
CMD=obiannotate
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obiclean
|
||||
CMD=obiclean
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obicleandb
|
||||
CMD=obicleandb
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obicomplement
|
||||
CMD=obicomplement
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obiconsensus
|
||||
CMD=obiconsensus
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
Binary file not shown.
@@ -1,144 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obiconvert
|
||||
CMD=obiconvert
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
|
||||
if [ -z "$TEST_DIR" ] ; then
|
||||
TEST_DIR="."
|
||||
fi
|
||||
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
((ntest++))
|
||||
if obiconvert -Z "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
|
||||
> "${TMPDIR}/xxx.fasta.gz" && \
|
||||
zdiff "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
|
||||
"${TMPDIR}/xxx.fasta.gz"
|
||||
then
|
||||
log "$MCMD: converting large fasta file to fasta OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: converting large fasta file to fasta failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if obiconvert -Z --fastq-output \
|
||||
"${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
|
||||
> "${TMPDIR}/xxx.fastq.gz" && \
|
||||
obiconvert -Z --fasta-output \
|
||||
"${TMPDIR}/xxx.fastq.gz" \
|
||||
> "${TMPDIR}/yyy.fasta.gz" && \
|
||||
zdiff "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
|
||||
"${TMPDIR}/yyy.fasta.gz"
|
||||
then
|
||||
log "$MCMD: converting large file between fasta and fastq OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: converting large file between fasta and fastq failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,163 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obicount
|
||||
CMD=obicount
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if obicount "${TEST_DIR}/wolf_F.fasta.gz" \
|
||||
> "${TMPDIR}/wolf_F.fasta_count.csv"
|
||||
then
|
||||
log "OBICount: fasta reading OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBICount: fasta reading failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if obicount "${TEST_DIR}/wolf_F.fastq.gz" \
|
||||
> "${TMPDIR}/wolf_F.fastq_count.csv"
|
||||
then
|
||||
log "OBICount: fastq reading OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBICount: fastq reading failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if obicount "${TEST_DIR}/wolf_F.csv.gz" \
|
||||
> "${TMPDIR}/wolf_F.csv_count.csv"
|
||||
then
|
||||
log "OBICount: csv reading OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBICount: csv reading failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if diff "${TMPDIR}/wolf_F.fasta_count.csv" \
|
||||
"${TMPDIR}/wolf_F.fastq_count.csv" > /dev/null
|
||||
then
|
||||
log "OBICount: counting on fasta and fastq are identical OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBICount: counting on fasta and fastq are different failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if diff "${TMPDIR}/wolf_F.fasta_count.csv" \
|
||||
"${TMPDIR}/wolf_F.csv_count.csv" > /dev/null
|
||||
then
|
||||
log "OBICount: counting on fasta and csv are identical OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBICount: counting on fasta and csv are different failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
Binary file not shown.
Binary file not shown.
Binary file not shown.
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obicsv
|
||||
CMD=obicsv
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obidemerge
|
||||
CMD=obidemerge
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obidistribute
|
||||
CMD=obidistribute
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obigrep
|
||||
CMD=obigrep
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obijoin
|
||||
CMD=obijoin
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obikmermatch
|
||||
CMD=obikmermatch
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obikmersimcount
|
||||
CMD=obikmersimcount
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obilandmark
|
||||
CMD=obilandmark
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obimatrix
|
||||
CMD=obimatrix
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obimicrosat
|
||||
CMD=obimicrosat
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obimultiplex
|
||||
CMD=obimultiplex
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,150 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obipairing
|
||||
CMD=obipairing
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if obipairing -F "${TEST_DIR}/wolf_F.fastq.gz" \
|
||||
-R "${TEST_DIR}/wolf_R.fastq.gz" \
|
||||
| obidistribute -Z -c mode \
|
||||
-p "${TMPDIR}/wolf_paired_%s.fastq.gz"
|
||||
then
|
||||
log "OBIPairing: sequence pairing OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIPairing: sequence pairing failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if obicsv -Z -s -i \
|
||||
-k ali_dir -k ali_length -k pairing_fast_count \
|
||||
-k pairing_fast_overlap -k pairing_fast_score \
|
||||
-k score -k score_norm -k seq_a_single \
|
||||
-k seq_b_single -k seq_ab_match \
|
||||
"${TMPDIR}/wolf_paired_alignment.fastq.gz" \
|
||||
> "${TMPDIR}/wolf_paired_alignment.csv.gz" \
|
||||
&& zdiff -c "${TEST_DIR}/wolf_paired_alignment.csv.gz" \
|
||||
"${TMPDIR}/wolf_paired_alignment.csv.gz"
|
||||
then
|
||||
log "OBIPairing: check aligned sequences OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIPairing: check aligned sequences failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if obicsv -Z -s -i \
|
||||
"${TMPDIR}/wolf_paired_join.fastq.gz" \
|
||||
> "${TMPDIR}/wolf_paired_join.csv.gz" \
|
||||
&& zdiff -c "${TEST_DIR}/wolf_paired_join.csv.gz" \
|
||||
"${TMPDIR}/wolf_paired_join.csv.gz"
|
||||
then
|
||||
log "OBIPairing: check joined sequences OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIPairing: check joined sequences failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obipcr
|
||||
CMD=obipcr
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obirefidx
|
||||
CMD=obirefidx
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obiscript
|
||||
CMD=obiscript
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obisplit
|
||||
CMD=obisplit
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,9 +0,0 @@
|
||||
>Seq_1 {"count":2,"merged_sample":{"15a_F730814":1,"29a_F260619":1}}
|
||||
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
|
||||
agctyaaaactcaaaggacttggcggtgctttataccctt
|
||||
>Seq_2 {"count":22,"merged_sample":{"15a_F730814":12,"29a_F260619":10}}
|
||||
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
|
||||
atcttaaaactcaaaggacttggcggtgctttataccctt
|
||||
>Seq_3 {"count":22,"merged_sample":{"15a_F730814":15,"29a_F260619":7}}
|
||||
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcgat
|
||||
agcttaaaactcaaaggacttggcggtgctttataccctt
|
||||
@@ -1,35 +0,0 @@
|
||||
{
|
||||
"annotations": {
|
||||
"keys": {
|
||||
"map": {
|
||||
"merged_sample": 3
|
||||
},
|
||||
"scalar": {
|
||||
"count": 3
|
||||
}
|
||||
},
|
||||
"map_attributes": 1,
|
||||
"scalar_attributes": 1,
|
||||
"vector_attributes": 0
|
||||
},
|
||||
"count": {
|
||||
"reads": 46,
|
||||
"total_length": 300,
|
||||
"variants": 3
|
||||
},
|
||||
"samples": {
|
||||
"sample_count": 2,
|
||||
"sample_stats": {
|
||||
"15a_F730814": {
|
||||
"reads": 28,
|
||||
"singletons": 1,
|
||||
"variants": 3
|
||||
},
|
||||
"29a_F260619": {
|
||||
"reads": 18,
|
||||
"singletons": 1,
|
||||
"variants": 3
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
@@ -1,25 +0,0 @@
|
||||
annotations:
|
||||
keys:
|
||||
map:
|
||||
merged_sample: 3
|
||||
scalar:
|
||||
count: 3
|
||||
map_attributes: 1
|
||||
scalar_attributes: 1
|
||||
vector_attributes: 0
|
||||
count:
|
||||
reads: 46
|
||||
total_length: 300
|
||||
variants: 3
|
||||
samples:
|
||||
sample_count: 2
|
||||
sample_stats:
|
||||
15a_F730814:
|
||||
reads: 28
|
||||
singletons: 1
|
||||
variants: 3
|
||||
29a_F260619:
|
||||
reads: 18
|
||||
singletons: 1
|
||||
variants: 3
|
||||
|
||||
@@ -1,152 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obisummary
|
||||
CMD=obisummary
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if obisummary "${TEST_DIR}/some_uniq_seq.fasta" \
|
||||
> "${TMPDIR}/some_uniq_seq.json"
|
||||
then
|
||||
log "$MCMD: formating json execution OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: formating json execution failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if diff "${TEST_DIR}/some_uniq_seq.json" \
|
||||
"${TMPDIR}/some_uniq_seq.json" > /dev/null
|
||||
then
|
||||
log "$MCMD: formating json OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: formating json failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if obisummary --yaml "${TEST_DIR}/some_uniq_seq.fasta" \
|
||||
> "${TMPDIR}/some_uniq_seq.yaml"
|
||||
then
|
||||
log "$MCMD: formating yaml execution OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: formating yaml execution failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if diff "${TEST_DIR}/some_uniq_seq.yaml" \
|
||||
"${TMPDIR}/some_uniq_seq.yaml" > /dev/null
|
||||
then
|
||||
log "$MCMD: formating yaml OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: formating yaml failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,148 +0,0 @@
|
||||
# Tests pour obisuperkmer
|
||||
|
||||
## Description
|
||||
|
||||
Ce répertoire contient les tests automatisés pour la commande `obisuperkmer`.
|
||||
|
||||
## Fichiers
|
||||
|
||||
- `test.sh` : Script de test principal (exécutable)
|
||||
- `test_sequences.fasta` : Jeu de données de test minimal (3 séquences courtes)
|
||||
- `README.md` : Ce fichier
|
||||
|
||||
## Jeu de données de test
|
||||
|
||||
Le fichier `test_sequences.fasta` contient 3 séquences de 32 nucléotides chacune :
|
||||
|
||||
1. **seq1** : Répétition du motif ACGT (séquence régulière)
|
||||
2. **seq2** : Alternance de blocs homopolymères (AAAA, CCCC, GGGG, TTTT)
|
||||
3. **seq3** : Répétition du motif ATCG (différent de seq1)
|
||||
|
||||
Ces séquences sont volontairement courtes pour :
|
||||
- Minimiser la taille du dépôt Git
|
||||
- Accélérer l'exécution des tests en CI/CD
|
||||
- Tester différents cas d'extraction de super k-mers
|
||||
|
||||
## Tests effectués
|
||||
|
||||
Le script `test.sh` effectue 12 tests :
|
||||
|
||||
### Test 1 : Affichage de l'aide
|
||||
Vérifie que `obisuperkmer -h` s'exécute correctement.
|
||||
|
||||
### Test 2 : Extraction basique avec paramètres par défaut
|
||||
Exécute `obisuperkmer` avec k=21, m=11 (valeurs par défaut).
|
||||
|
||||
### Test 3 : Vérification du fichier de sortie non vide
|
||||
S'assure que la commande produit une sortie.
|
||||
|
||||
### Test 4 : Comptage des super k-mers extraits
|
||||
Vérifie qu'au moins un super k-mer a été extrait.
|
||||
|
||||
### Test 5 : Présence des métadonnées requises
|
||||
Vérifie que chaque super k-mer contient :
|
||||
- `minimizer_value`
|
||||
- `minimizer_seq`
|
||||
- `parent_id`
|
||||
|
||||
### Test 6 : Extraction avec paramètres personnalisés
|
||||
Teste avec k=15 et m=7.
|
||||
|
||||
### Test 7 : Vérification des paramètres dans les métadonnées
|
||||
S'assure que les valeurs k=15 et m=7 sont présentes dans la sortie.
|
||||
|
||||
### Test 8 : Format de sortie FASTA explicite
|
||||
Teste l'option `--fasta-output`.
|
||||
|
||||
### Test 9 : Vérification des IDs des super k-mers
|
||||
S'assure que tous les IDs contiennent "superkmer".
|
||||
|
||||
### Test 10 : Préservation des IDs parents
|
||||
Vérifie que seq1, seq2 et seq3 apparaissent dans la sortie.
|
||||
|
||||
### Test 11 : Option -o pour fichier de sortie
|
||||
Teste la redirection vers un fichier avec `-o`.
|
||||
|
||||
### Test 12 : Vérification de la création du fichier avec -o
|
||||
S'assure que le fichier de sortie a été créé.
|
||||
|
||||
### Test 13 : Cohérence des longueurs
|
||||
Vérifie que la somme des longueurs des super k-mers est inférieure ou égale à la longueur totale des séquences d'entrée.
|
||||
|
||||
## Exécution des tests
|
||||
|
||||
### Localement
|
||||
|
||||
```bash
|
||||
cd /chemin/vers/obitools4/obitests/obitools/obisuperkmer
|
||||
./test.sh
|
||||
```
|
||||
|
||||
### En CI/CD
|
||||
|
||||
Les tests sont automatiquement exécutés lors de chaque commit via le système CI/CD configuré pour le projet.
|
||||
|
||||
### Prérequis
|
||||
|
||||
- La commande `obisuperkmer` doit être compilée et disponible dans `../../build/`
|
||||
- Les dépendances système : bash, grep, etc.
|
||||
|
||||
## Structure du script de test
|
||||
|
||||
Le script suit le pattern standard utilisé par tous les tests OBITools :
|
||||
|
||||
1. **En-tête** : Définition du nom du test et de la commande
|
||||
2. **Variables** : Configuration des chemins et compteurs
|
||||
3. **Fonction cleanup()** : Affiche les résultats et nettoie le répertoire temporaire
|
||||
4. **Fonction log()** : Affiche les messages horodatés
|
||||
5. **Tests** : Série de tests avec incrémentation des compteurs
|
||||
6. **Appel cleanup()** : Nettoyage et sortie avec code de retour approprié
|
||||
|
||||
## Format de sortie
|
||||
|
||||
Chaque test affiche :
|
||||
```
|
||||
[obisuperkmer @ date] message
|
||||
```
|
||||
|
||||
En fin d'exécution :
|
||||
```
|
||||
========================================
|
||||
## Results of the obisuperkmer tests:
|
||||
|
||||
- 12 tests run
|
||||
- 12 successfully completed
|
||||
- 0 failed tests
|
||||
|
||||
Cleaning up the temporary directory...
|
||||
|
||||
========================================
|
||||
```
|
||||
|
||||
## Codes de retour
|
||||
|
||||
- **0** : Tous les tests ont réussi
|
||||
- **1** : Au moins un test a échoué
|
||||
|
||||
## Ajout de nouveaux tests
|
||||
|
||||
Pour ajouter un nouveau test, suivre le pattern :
|
||||
|
||||
```bash
|
||||
((ntest++))
|
||||
if commande_test arguments
|
||||
then
|
||||
log "Description: OK"
|
||||
((success++))
|
||||
else
|
||||
log "Description: failed"
|
||||
((failed++))
|
||||
fi
|
||||
```
|
||||
|
||||
## Notes
|
||||
|
||||
- Les fichiers temporaires sont créés dans `$TMPDIR` (créé par mktemp)
|
||||
- Les fichiers de données sont dans `$TEST_DIR`
|
||||
- La commande testée doit être dans `$OBITOOLS_DIR` (../../build/)
|
||||
- Le répertoire temporaire est automatiquement nettoyé à la fin
|
||||
@@ -1,232 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obik-super
|
||||
CMD=obik
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="OBIk-super"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
######################################################################
|
||||
|
||||
((ntest++))
|
||||
if $CMD super -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 1: Basic super k-mer extraction with default parameters
|
||||
((ntest++))
|
||||
if $CMD super "${TEST_DIR}/test_sequences.fasta" \
|
||||
> "${TMPDIR}/output_default.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: basic extraction with default parameters OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: basic extraction with default parameters failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 2: Verify output is not empty
|
||||
((ntest++))
|
||||
if [ -s "${TMPDIR}/output_default.fasta" ]
|
||||
then
|
||||
log "$MCMD: output file is not empty OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: output file is empty - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 3: Count number of super k-mers extracted (should be > 0)
|
||||
((ntest++))
|
||||
num_sequences=$(grep -c "^>" "${TMPDIR}/output_default.fasta")
|
||||
if [ "$num_sequences" -gt 0 ]
|
||||
then
|
||||
log "$MCMD: extracted $num_sequences super k-mers OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: no super k-mers extracted - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 4: Verify super k-mers have required metadata attributes
|
||||
((ntest++))
|
||||
if grep -q "minimizer_value" "${TMPDIR}/output_default.fasta" && \
|
||||
grep -q "minimizer_seq" "${TMPDIR}/output_default.fasta" && \
|
||||
grep -q "parent_id" "${TMPDIR}/output_default.fasta"
|
||||
then
|
||||
log "$MCMD: super k-mers contain required metadata OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: super k-mers missing metadata - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 5: Extract super k-mers with custom k and m parameters
|
||||
((ntest++))
|
||||
if $CMD super -k 15 -m 7 "${TEST_DIR}/test_sequences.fasta" \
|
||||
> "${TMPDIR}/output_k15_m7.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: extraction with custom k=15, m=7 OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: extraction with custom k=15, m=7 failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 6: Verify custom parameters in output metadata
|
||||
((ntest++))
|
||||
if grep -q '"k":15' "${TMPDIR}/output_k15_m7.fasta" && \
|
||||
grep -q '"m":7' "${TMPDIR}/output_k15_m7.fasta"
|
||||
then
|
||||
log "$MCMD: custom parameters correctly set in metadata OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: custom parameters not in metadata - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 7: Test with different output format (FASTA output explicitly)
|
||||
((ntest++))
|
||||
if $CMD super --fasta-output -k 21 -m 11 \
|
||||
"${TEST_DIR}/test_sequences.fasta" \
|
||||
> "${TMPDIR}/output_fasta.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: FASTA output format OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: FASTA output format failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 8: Verify all super k-mers have superkmer in their ID
|
||||
((ntest++))
|
||||
if grep "^>" "${TMPDIR}/output_default.fasta" | grep -q "superkmer"
|
||||
then
|
||||
log "$MCMD: super k-mer IDs contain 'superkmer' OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: super k-mer IDs missing 'superkmer' - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 9: Verify parent sequence IDs are preserved
|
||||
((ntest++))
|
||||
if grep -q "seq1" "${TMPDIR}/output_default.fasta" && \
|
||||
grep -q "seq2" "${TMPDIR}/output_default.fasta" && \
|
||||
grep -q "seq3" "${TMPDIR}/output_default.fasta"
|
||||
then
|
||||
log "$MCMD: parent sequence IDs preserved OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: parent sequence IDs not preserved - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 10: Test with output file option
|
||||
((ntest++))
|
||||
if $CMD super -o "${TMPDIR}/output_file.fasta" \
|
||||
"${TEST_DIR}/test_sequences.fasta" 2>&1
|
||||
then
|
||||
log "$MCMD: output to file with -o option OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: output to file with -o option failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 11: Verify output file was created with -o option
|
||||
((ntest++))
|
||||
if [ -s "${TMPDIR}/output_file.fasta" ]
|
||||
then
|
||||
log "$MCMD: output file created with -o option OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: output file not created with -o option - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Test 12: Verify each super k-mer length is >= k (default k=31)
|
||||
((ntest++))
|
||||
min_len=$(grep -v "^>" "${TMPDIR}/output_default.fasta" | awk '{print length}' | sort -n | head -1)
|
||||
|
||||
if [ "$min_len" -ge 31 ]
|
||||
then
|
||||
log "$MCMD: all super k-mers have length >= k OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: some super k-mers shorter than k ($min_len < 31) - failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,6 +0,0 @@
|
||||
>seq1
|
||||
ACGTACGTACGTACGTACGTACGTACGTACGT
|
||||
>seq2
|
||||
AAAACCCCGGGGTTTTAAAACCCCGGGGTTTT
|
||||
>seq3
|
||||
ATCGATCGATCGATCGATCGATCGATCGATCG
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obitag
|
||||
CMD=obitag
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obipcr
|
||||
CMD=obipcr
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,109 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obitaxonomy
|
||||
CMD=obitaxonomy
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,258 +0,0 @@
|
||||
#!/bin/bash
|
||||
|
||||
#
|
||||
# Here give the name of the test serie
|
||||
#
|
||||
|
||||
TEST_NAME=obiuniq
|
||||
CMD=obiuniq
|
||||
|
||||
######
|
||||
#
|
||||
# Some variable and function definitions: please don't change them
|
||||
#
|
||||
######
|
||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
||||
|
||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
||||
|
||||
TMPDIR="$(mktemp -d)"
|
||||
ntest=0
|
||||
success=0
|
||||
failed=0
|
||||
|
||||
cleanup() {
|
||||
echo "========================================" 1>&2
|
||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
||||
|
||||
echo 1>&2
|
||||
echo "- $ntest tests run" 1>&2
|
||||
echo "- $success successfully completed" 1>&2
|
||||
echo "- $failed failed tests" 1>&2
|
||||
echo 1>&2
|
||||
echo "Cleaning up the temporary directory..." 1>&2
|
||||
echo 1>&2
|
||||
echo "========================================" 1>&2
|
||||
|
||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
||||
|
||||
if [ $failed -gt 0 ]; then
|
||||
log "$TEST_NAME tests failed"
|
||||
log
|
||||
log
|
||||
exit 1
|
||||
fi
|
||||
|
||||
log
|
||||
log
|
||||
|
||||
exit 0
|
||||
}
|
||||
|
||||
log() {
|
||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
||||
}
|
||||
|
||||
log "Testing $TEST_NAME..."
|
||||
log "Test directory is $TEST_DIR"
|
||||
log "obitools directory is $OBITOOLS_DIR"
|
||||
log "Temporary directory is $TMPDIR"
|
||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
||||
|
||||
######################################################################
|
||||
####
|
||||
#### Below are the tests
|
||||
####
|
||||
#### Before each test :
|
||||
#### - increment the variable ntest
|
||||
####
|
||||
#### Run the command as the condition of an if / then /else
|
||||
#### - The command must return 0 on success
|
||||
#### - The command must return an exit code different from 0 on failure
|
||||
#### - The datafiles are stored in the same directory than the test script
|
||||
#### - The test script directory is stored in the TEST_DIR variable
|
||||
#### - If result files have to be produced they must be stored
|
||||
#### in the temporary directory (TMPDIR variable)
|
||||
####
|
||||
#### then clause is executed on success of the command
|
||||
#### - Write a success message using the log function
|
||||
#### - increment the variable success
|
||||
####
|
||||
#### else clause is executed on failure of the command
|
||||
#### - Write a failure message using the log function
|
||||
#### - increment the variable failed
|
||||
####
|
||||
######################################################################
|
||||
|
||||
|
||||
|
||||
((ntest++))
|
||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
||||
then
|
||||
log "$MCMD: printing help OK"
|
||||
((success++))
|
||||
else
|
||||
log "$MCMD: printing help failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if obiuniq "${TEST_DIR}/touniq.fasta" \
|
||||
> "${TMPDIR}/touniq_u.fasta"
|
||||
then
|
||||
log "OBIUniq simple: running OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIUniq simple: running failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
obicsv -s --auto ${TEST_DIR}/touniq_u.fasta \
|
||||
| tail -n +2 \
|
||||
| sort \
|
||||
> "${TMPDIR}/touniq_u_ref.csv"
|
||||
|
||||
obicsv -s --auto ${TMPDIR}/touniq_u.fasta \
|
||||
| tail -n +2 \
|
||||
| sort \
|
||||
> "${TMPDIR}/touniq_u.csv"
|
||||
|
||||
((ntest++))
|
||||
if diff "${TMPDIR}/touniq_u_ref.csv" \
|
||||
"${TMPDIR}/touniq_u.csv" > /dev/null
|
||||
then
|
||||
log "OBIUniq simple: result OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIUniq simple: result failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if obiuniq -c a "${TEST_DIR}/touniq.fasta" \
|
||||
> "${TMPDIR}/touniq_u_a.fasta"
|
||||
then
|
||||
log "OBIUniq one category: running OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIUniq one category: running failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
obicsv -s --auto ${TEST_DIR}/touniq_u_a.fasta \
|
||||
| tail -n +2 \
|
||||
| sort \
|
||||
> "${TMPDIR}/touniq_u_a_ref.csv"
|
||||
|
||||
obicsv -s --auto ${TMPDIR}/touniq_u_a.fasta \
|
||||
| tail -n +2 \
|
||||
| sort \
|
||||
> "${TMPDIR}/touniq_u_a.csv"
|
||||
|
||||
|
||||
((ntest++))
|
||||
if diff "${TMPDIR}/touniq_u_a_ref.csv" \
|
||||
"${TMPDIR}/touniq_u_a.csv" > /dev/null
|
||||
then
|
||||
log "OBIUniq one category: result OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIUniq one category: result failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if obiuniq -c a -c b "${TEST_DIR}/touniq.fasta" \
|
||||
> "${TMPDIR}/touniq_u_a_b.fasta"
|
||||
then
|
||||
log "OBIUniq two categories: running OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIUniq two categories: running failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
obicsv -s --auto ${TEST_DIR}/touniq_u_a_b.fasta \
|
||||
| tail -n +2 \
|
||||
| sort \
|
||||
> "${TMPDIR}/touniq_u_a_b_ref.csv"
|
||||
|
||||
obicsv -s --auto ${TMPDIR}/touniq_u_a_b.fasta \
|
||||
| tail -n +2 \
|
||||
| sort \
|
||||
> "${TMPDIR}/touniq_u_a_b.csv"
|
||||
|
||||
((ntest++))
|
||||
if diff "${TMPDIR}/touniq_u_a_b_ref.csv" \
|
||||
"${TMPDIR}/touniq_u_a_b.csv" > /dev/null
|
||||
then
|
||||
log "OBIUniq two categories: result OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIUniq two categories: result failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
##
|
||||
## Test merge attributes consistency between in-memory and on-disk paths
|
||||
## This test catches the bug where the shared classifier in the on-disk
|
||||
## dereplication path caused incorrect merged attributes.
|
||||
##
|
||||
|
||||
((ntest++))
|
||||
if obiuniq -m a -m b --in-memory \
|
||||
"${TEST_DIR}/touniq.fasta" \
|
||||
> "${TMPDIR}/touniq_u_merge_mem.fasta" 2>/dev/null
|
||||
then
|
||||
log "OBIUniq merge in-memory: running OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIUniq merge in-memory: running failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
((ntest++))
|
||||
if obiuniq -m a -m b --chunk-count 4 \
|
||||
"${TEST_DIR}/touniq.fasta" \
|
||||
> "${TMPDIR}/touniq_u_merge_disk.fasta" 2>/dev/null
|
||||
then
|
||||
log "OBIUniq merge on-disk: running OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIUniq merge on-disk: running failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
# Extract sorted annotations (JSON attributes) from both outputs
|
||||
# to compare merge results independently of sequence ordering
|
||||
grep '^>' "${TMPDIR}/touniq_u_merge_mem.fasta" \
|
||||
| sed 's/^>seq[0-9]* //' \
|
||||
| sort \
|
||||
> "${TMPDIR}/touniq_u_merge_mem.json"
|
||||
|
||||
grep '^>' "${TMPDIR}/touniq_u_merge_disk.fasta" \
|
||||
| sed 's/^>seq[0-9]* //' \
|
||||
| sort \
|
||||
> "${TMPDIR}/touniq_u_merge_disk.json"
|
||||
|
||||
((ntest++))
|
||||
if diff "${TMPDIR}/touniq_u_merge_mem.json" \
|
||||
"${TMPDIR}/touniq_u_merge_disk.json" > /dev/null
|
||||
then
|
||||
log "OBIUniq merge on-disk vs in-memory: result OK"
|
||||
((success++))
|
||||
else
|
||||
log "OBIUniq merge on-disk vs in-memory: result failed"
|
||||
((failed++))
|
||||
fi
|
||||
|
||||
#########################################
|
||||
#
|
||||
# At the end of the tests
|
||||
# the cleanup function is called
|
||||
#
|
||||
#########################################
|
||||
|
||||
cleanup
|
||||
@@ -1,16 +0,0 @@
|
||||
>seq1 {"a":2, "b":4,"c":5}
|
||||
aaacccgggttt
|
||||
>seq2 {"a":3, "b":4,"c":5}
|
||||
aaacccgggttt
|
||||
>seq3 {"a":3, "b":5,"c":5}
|
||||
aaacccgggttt
|
||||
>seq4 {"a":3, "b":5,"c":6}
|
||||
aaacccgggttt
|
||||
>seq5 {"a":2, "b":4,"c":5}
|
||||
aaacccgggtttca
|
||||
>seq6 {"a":3, "b":4,"c":5}
|
||||
aaacccgggtttca
|
||||
>seq7 {"a":3, "b":5,"c":5}
|
||||
aaacccgggtttca
|
||||
>seq8 {"a":3, "b":5,"c":6}
|
||||
aaacccgggtttca
|
||||
@@ -1,4 +0,0 @@
|
||||
>seq5 {"count":4}
|
||||
aaacccgggtttca
|
||||
>seq1 {"count":4}
|
||||
aaacccgggttt
|
||||
@@ -1,8 +0,0 @@
|
||||
>seq5 {"a":2,"b":4,"c":5,"count":1}
|
||||
aaacccgggtttca
|
||||
>seq6 {"a":3,"count":3}
|
||||
aaacccgggtttca
|
||||
>seq1 {"a":2,"b":4,"c":5,"count":1}
|
||||
aaacccgggttt
|
||||
>seq2 {"a":3,"count":3}
|
||||
aaacccgggttt
|
||||
@@ -1,12 +0,0 @@
|
||||
>seq5 {"a":2,"b":4,"c":5,"count":1}
|
||||
aaacccgggtttca
|
||||
>seq6 {"a":3,"b":4,"c":5,"count":1}
|
||||
aaacccgggtttca
|
||||
>seq7 {"a":3,"b":5,"count":2}
|
||||
aaacccgggtttca
|
||||
>seq1 {"a":2,"b":4,"c":5,"count":1}
|
||||
aaacccgggttt
|
||||
>seq2 {"a":3,"b":4,"c":5,"count":1}
|
||||
aaacccgggttt
|
||||
>seq3 {"a":3,"b":5,"count":2}
|
||||
aaacccgggttt
|
||||
@@ -10,7 +10,6 @@ import (
|
||||
"strings"
|
||||
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||
)
|
||||
|
||||
// // A pool of byte slices.
|
||||
@@ -159,30 +158,12 @@ func BuildQualityConsensus(seqA, seqB *obiseq.BioSequence, path []int, statOnMis
|
||||
|
||||
match := 0
|
||||
|
||||
left := obiutils.Abs(path[0])
|
||||
right := 0
|
||||
if path[len(path)-1] == 0 {
|
||||
right = path[len(path)-2]
|
||||
}
|
||||
|
||||
right = obiutils.Abs(right)
|
||||
|
||||
right = len(*bufferQA) - right
|
||||
|
||||
// obilog.Warnf("BuildQualityConsensus: left = %d right = %d\n", left, right)
|
||||
|
||||
for i, qA = range *bufferQA {
|
||||
nA := (*bufferSA)[i]
|
||||
nB := (*bufferSB)[i]
|
||||
qB = (*bufferQB)[i]
|
||||
|
||||
if statOnMismatch && i >= left && i < right && nA != nB {
|
||||
if nA == ' ' {
|
||||
nA = '-'
|
||||
}
|
||||
if nB == ' ' {
|
||||
nB = '-'
|
||||
}
|
||||
if statOnMismatch && nA != nB && nA != ' ' && nB != ' ' {
|
||||
mismatches[strings.ToUpper(fmt.Sprintf("(%c:%02d)->(%c:%02d)", nA, qA, nB, qB))] = i + 1
|
||||
}
|
||||
|
||||
@@ -202,12 +183,13 @@ func BuildQualityConsensus(seqA, seqB *obiseq.BioSequence, path []int, statOnMis
|
||||
|
||||
q := qA + qB
|
||||
|
||||
if nA != nB {
|
||||
q = qM - byte(math.Log10(1-math.Pow(10, -float64(qm)/40))*10+0.5)
|
||||
}
|
||||
|
||||
if nA == nB {
|
||||
match++
|
||||
if qA > 0 && qB > 0 {
|
||||
if nA != nB {
|
||||
q = qM - byte(math.Log10(1-math.Pow(10, -float64(qm)/30))*10+0.5)
|
||||
}
|
||||
if nA == nB {
|
||||
match++
|
||||
}
|
||||
}
|
||||
|
||||
if q > 90 {
|
||||
|
||||
@@ -74,30 +74,6 @@ func _Logaddexp(a, b float64) float64 {
|
||||
return b + math.Log1p(math.Exp(a-b))
|
||||
}
|
||||
|
||||
func _Log1mexp(a float64) float64 {
|
||||
if a > 0 {
|
||||
log.Panic("Log1mexp: a > 0")
|
||||
}
|
||||
|
||||
if a == 0 {
|
||||
return 0
|
||||
}
|
||||
|
||||
return (math.Log(-math.Expm1(a)))
|
||||
}
|
||||
|
||||
func _Logdiffexp(a, b float64) float64 {
|
||||
if a < b {
|
||||
log.Panic("Log1mexp: a < b")
|
||||
}
|
||||
|
||||
if a == b {
|
||||
return math.Inf(-1)
|
||||
}
|
||||
|
||||
return a + _Log1mexp(b-a)
|
||||
}
|
||||
|
||||
// _MatchScoreRatio calculates the match score ratio between two bytes.
|
||||
//
|
||||
// Parameters:
|
||||
@@ -107,25 +83,25 @@ func _Logdiffexp(a, b float64) float64 {
|
||||
// Returns:
|
||||
// - float64: the match score ratio when a match is observed
|
||||
// - float64: the match score ratio when a mismatch is observed
|
||||
func _MatchScoreRatio(QF, QR byte) (float64, float64) {
|
||||
func _MatchScoreRatio(a, b byte) (float64, float64) {
|
||||
|
||||
l2 := math.Log(2)
|
||||
l3 := math.Log(3)
|
||||
l4 := math.Log(4)
|
||||
l10 := math.Log(10)
|
||||
qF := -float64(QF) / 10 * l10
|
||||
qR := -float64(QR) / 10 * l10
|
||||
term1 := _Logaddexp(qF, qR)
|
||||
term2 := _Logdiffexp(term1, qF+qR)
|
||||
lalea := math.Log(4) // 1 /(change of the random model)
|
||||
lE1 := -float64(a)/10*l10 - l3 // log proba of sequencing error on A/3
|
||||
lE2 := -float64(b)/10*l10 - l3 // log proba of sequencing error on B/3
|
||||
lO1 := math.Log1p(-math.Exp(lE1 + l3)) // log proba no being an error on A
|
||||
lO2 := math.Log1p(-math.Exp(lE2 + l3)) // log proba no being an error on B
|
||||
lO1O2 := lO1 + lO2
|
||||
lE1E2 := lE1 + lE2
|
||||
lO1E2 := lO1 + lE2
|
||||
lO2E1 := lO2 + lE1
|
||||
|
||||
// obilog.Warnf("MatchScoreRatio: %v, %v , %v, %v", QF, QR, term1, term2)
|
||||
MM := _Logaddexp(lO1O2, lE1E2+l3) // Proba match when match observed
|
||||
Mm := _Logaddexp(_Logaddexp(lO1E2, lO2E1), lE1E2+l2) // Proba match when mismatch observed
|
||||
|
||||
match_logp := _Log1mexp(term2 + l3 - l4)
|
||||
match_score := match_logp - _Log1mexp(match_logp)
|
||||
|
||||
mismatch_logp := term2 - l4
|
||||
mismatch_score := mismatch_logp - _Log1mexp(mismatch_logp)
|
||||
|
||||
return match_score, mismatch_score
|
||||
return MM + lalea, Mm + lalea
|
||||
}
|
||||
|
||||
func _InitNucPartMatch() {
|
||||
|
||||
@@ -21,15 +21,15 @@ func encodeValues(score, length int, out bool) uint64 {
|
||||
return fo
|
||||
}
|
||||
|
||||
// func _isout(value uint64) bool {
|
||||
// const outmask = uint64(1) << dwsize
|
||||
// return (value & outmask) == 0
|
||||
// }
|
||||
func _isout(value uint64) bool {
|
||||
const outmask = uint64(1) << dwsize
|
||||
return (value & outmask) == 0
|
||||
}
|
||||
|
||||
// func _lpath(value uint64) int {
|
||||
// const mask = uint64(1<<wsize) - 1
|
||||
// return int(((value + 1) ^ mask) & mask)
|
||||
// }
|
||||
func _lpath(value uint64) int {
|
||||
const mask = uint64(1<<wsize) - 1
|
||||
return int(((value + 1) ^ mask) & mask)
|
||||
}
|
||||
|
||||
func decodeValues(value uint64) (int, int, bool) {
|
||||
const mask = uint64(1<<wsize) - 1
|
||||
@@ -57,3 +57,4 @@ func _setout(value uint64) uint64 {
|
||||
var _empty = encodeValues(0, 0, false)
|
||||
var _out = encodeValues(0, 30000, true)
|
||||
var _notavail = encodeValues(0, 30000, false)
|
||||
|
||||
|
||||
Some files were not shown because too many files have changed in this diff Show More
Reference in New Issue
Block a user