mirror of
https://github.com/metabarcoding/obitools4.git
synced 2026-08-08 22:40:36 +00:00
Compare commits
1
Commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
d70b0a5b42 |
@@ -1,19 +0,0 @@
|
|||||||
name: "Run the obitools command test suite"
|
|
||||||
|
|
||||||
on:
|
|
||||||
push:
|
|
||||||
branches:
|
|
||||||
- master
|
|
||||||
- V*
|
|
||||||
jobs:
|
|
||||||
build:
|
|
||||||
runs-on: ubuntu-latest
|
|
||||||
steps:
|
|
||||||
- name: Setup Go
|
|
||||||
uses: actions/setup-go@v2
|
|
||||||
with:
|
|
||||||
go-version: '1.23'
|
|
||||||
- name: Checkout obitools4 project
|
|
||||||
uses: actions/checkout@v4
|
|
||||||
- name: Run tests
|
|
||||||
run: make githubtests
|
|
||||||
@@ -1,176 +0,0 @@
|
|||||||
name: Create Release on Tag
|
|
||||||
|
|
||||||
on:
|
|
||||||
push:
|
|
||||||
tags:
|
|
||||||
- "Release_*"
|
|
||||||
|
|
||||||
permissions:
|
|
||||||
contents: write
|
|
||||||
|
|
||||||
jobs:
|
|
||||||
# First run tests
|
|
||||||
test:
|
|
||||||
runs-on: ubuntu-latest
|
|
||||||
steps:
|
|
||||||
- name: Setup Go
|
|
||||||
uses: actions/setup-go@v5
|
|
||||||
with:
|
|
||||||
go-version: "1.23"
|
|
||||||
- name: Checkout obitools4 project
|
|
||||||
uses: actions/checkout@v4
|
|
||||||
- name: Run tests
|
|
||||||
run: make githubtests
|
|
||||||
|
|
||||||
# Then create release only if tests pass
|
|
||||||
create-release:
|
|
||||||
needs: test
|
|
||||||
runs-on: ubuntu-latest
|
|
||||||
steps:
|
|
||||||
- name: Checkout code
|
|
||||||
uses: actions/checkout@v4
|
|
||||||
with:
|
|
||||||
fetch-depth: 0
|
|
||||||
|
|
||||||
- name: Setup Go
|
|
||||||
uses: actions/setup-go@v5
|
|
||||||
with:
|
|
||||||
go-version: "1.23"
|
|
||||||
|
|
||||||
- name: Extract version from tag
|
|
||||||
id: get_version
|
|
||||||
run: |
|
|
||||||
TAG=${GITHUB_REF#refs/tags/Release_}
|
|
||||||
echo "version=$TAG" >> $GITHUB_OUTPUT
|
|
||||||
echo "tag_name=Release_$TAG" >> $GITHUB_OUTPUT
|
|
||||||
|
|
||||||
- name: Build binaries for multiple platforms
|
|
||||||
env:
|
|
||||||
VERSION: ${{ steps.get_version.outputs.version }}
|
|
||||||
run: |
|
|
||||||
mkdir -p release
|
|
||||||
|
|
||||||
# Build for Linux AMD64
|
|
||||||
echo "Building for Linux AMD64..."
|
|
||||||
GOOS=linux GOARCH=amd64 make obitools
|
|
||||||
cd build
|
|
||||||
for binary in *; do
|
|
||||||
tar -czf ../release/${binary}_${VERSION}_linux_amd64.tar.gz ${binary}
|
|
||||||
done
|
|
||||||
cd ..
|
|
||||||
rm -rf build
|
|
||||||
|
|
||||||
|
|
||||||
# Build for Linux ARM64
|
|
||||||
echo "Building for Linux ARM64..."
|
|
||||||
GOOS=linux GOARCH=arm64 make obitools
|
|
||||||
cd build
|
|
||||||
for binary in *; do
|
|
||||||
tar -czf ../release/${binary}_${VERSION}_linux_arm64.tar.gz ${binary}
|
|
||||||
done
|
|
||||||
cd ..
|
|
||||||
rm -rf build
|
|
||||||
|
|
||||||
|
|
||||||
# Build for macOS AMD64 (Intel)
|
|
||||||
echo "Building for macOS AMD64..."
|
|
||||||
GOOS=darwin GOARCH=amd64 make obitools
|
|
||||||
cd build
|
|
||||||
for binary in *; do
|
|
||||||
tar -czf ../release/${binary}_${VERSION}_darwin_amd64.tar.gz ${binary}
|
|
||||||
done
|
|
||||||
cd ..
|
|
||||||
rm -rf build
|
|
||||||
|
|
||||||
|
|
||||||
# Build for macOS ARM64 (Apple Silicon)
|
|
||||||
echo "Building for macOS ARM64..."
|
|
||||||
GOOS=darwin GOARCH=arm64 make obitools
|
|
||||||
cd build
|
|
||||||
for binary in *; do
|
|
||||||
tar -czf ../release/${binary}_${VERSION}_darwin_arm64.tar.gz ${binary}
|
|
||||||
done
|
|
||||||
cd ..
|
|
||||||
rm -rf build
|
|
||||||
|
|
||||||
|
|
||||||
# Build for Windows AMD64
|
|
||||||
echo "Building for Windows AMD64..."
|
|
||||||
GOOS=windows GOARCH=amd64 make obitools
|
|
||||||
cd build
|
|
||||||
for binary in *; do
|
|
||||||
# Windows binaries have .exe extension
|
|
||||||
if [ -f "${binary}.exe" ]; then
|
|
||||||
zip ../release/${binary}_${VERSION}_windows_amd64.zip ${binary}.exe
|
|
||||||
else
|
|
||||||
zip ../release/${binary}_${VERSION}_windows_amd64.zip ${binary}
|
|
||||||
fi
|
|
||||||
done
|
|
||||||
cd ..
|
|
||||||
|
|
||||||
echo "Built archives:"
|
|
||||||
ls -lh release/
|
|
||||||
|
|
||||||
- name: Generate Release Notes
|
|
||||||
id: release_notes
|
|
||||||
env:
|
|
||||||
VERSION: ${{ steps.get_version.outputs.version }}
|
|
||||||
run: |
|
|
||||||
PREV_TAG=$(git describe --tags --abbrev=0 HEAD^ 2>/dev/null || echo "")
|
|
||||||
|
|
||||||
echo "# OBITools4 Release ${VERSION}" > release_notes.md
|
|
||||||
echo "" >> release_notes.md
|
|
||||||
|
|
||||||
if [ -n "$PREV_TAG" ]; then
|
|
||||||
echo "## Changes since ${PREV_TAG}" >> release_notes.md
|
|
||||||
echo "" >> release_notes.md
|
|
||||||
git log ${PREV_TAG}..HEAD --pretty=format:"- %s" >> release_notes.md
|
|
||||||
else
|
|
||||||
echo "## Changes" >> release_notes.md
|
|
||||||
echo "" >> release_notes.md
|
|
||||||
git log --pretty=format:"- %s" -n 20 >> release_notes.md
|
|
||||||
fi
|
|
||||||
|
|
||||||
echo "" >> release_notes.md
|
|
||||||
echo "" >> release_notes.md
|
|
||||||
echo "## Installation" >> release_notes.md
|
|
||||||
echo "" >> release_notes.md
|
|
||||||
echo "Download the appropriate binary for your system and extract it:" >> release_notes.md
|
|
||||||
echo "" >> release_notes.md
|
|
||||||
echo "### Linux (AMD64)" >> release_notes.md
|
|
||||||
echo '```bash' >> release_notes.md
|
|
||||||
echo "tar -xzf <tool>_${VERSION}_linux_amd64.tar.gz" >> release_notes.md
|
|
||||||
echo '```' >> release_notes.md
|
|
||||||
echo "" >> release_notes.md
|
|
||||||
echo "### Linux (ARM64)" >> release_notes.md
|
|
||||||
echo '```bash' >> release_notes.md
|
|
||||||
echo "tar -xzf <tool>_${VERSION}_linux_arm64.tar.gz" >> release_notes.md
|
|
||||||
echo '```' >> release_notes.md
|
|
||||||
echo "" >> release_notes.md
|
|
||||||
echo "### macOS (Intel)" >> release_notes.md
|
|
||||||
echo '```bash' >> release_notes.md
|
|
||||||
echo "tar -xzf <tool>_${VERSION}_darwin_amd64.tar.gz" >> release_notes.md
|
|
||||||
echo '```' >> release_notes.md
|
|
||||||
echo "" >> release_notes.md
|
|
||||||
echo "### macOS (Apple Silicon)" >> release_notes.md
|
|
||||||
echo '```bash' >> release_notes.md
|
|
||||||
echo "tar -xzf <tool>_${VERSION}_darwin_arm64.tar.gz" >> release_notes.md
|
|
||||||
echo '```' >> release_notes.md
|
|
||||||
echo "" >> release_notes.md
|
|
||||||
echo "### Windows (AMD64)" >> release_notes.md
|
|
||||||
echo '```powershell' >> release_notes.md
|
|
||||||
echo "Expand-Archive <tool>_${VERSION}_windows_amd64.zip" >> release_notes.md
|
|
||||||
echo '```' >> release_notes.md
|
|
||||||
echo "" >> release_notes.md
|
|
||||||
echo "Available tools: Replace \`<tool>\` with one of the obitools commands." >> release_notes.md
|
|
||||||
|
|
||||||
- name: Create GitHub Release
|
|
||||||
uses: softprops/action-gh-release@v1
|
|
||||||
with:
|
|
||||||
name: Release ${{ steps.get_version.outputs.version }}
|
|
||||||
body_path: release_notes.md
|
|
||||||
files: release/*
|
|
||||||
draft: false
|
|
||||||
prerelease: false
|
|
||||||
env:
|
|
||||||
GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
|
|
||||||
+131
-29
@@ -1,33 +1,135 @@
|
|||||||
**/cpu.pprof
|
cpu.pprof
|
||||||
**/cpu.trace
|
cpu.trace
|
||||||
**/test
|
test
|
||||||
**/bin
|
bin
|
||||||
**/vendor
|
vendor
|
||||||
**/*.fastq
|
*.fastq
|
||||||
**/*.fasta
|
*.fasta
|
||||||
**/*.fastq.gz
|
*.fastq.gz
|
||||||
**/*.fasta.gz
|
*.fasta.gz
|
||||||
**/.DS_Store
|
.DS_Store
|
||||||
**/*.gml
|
*.gml
|
||||||
**/*.log
|
*.log
|
||||||
**/xxx*
|
/argaly
|
||||||
**/*.sav
|
|
||||||
**/*.old
|
|
||||||
**/*.tgz
|
|
||||||
**/*.yaml
|
|
||||||
**/*.csv
|
|
||||||
xx
|
|
||||||
|
|
||||||
.rhistory
|
/obiconvert
|
||||||
/.vscode
|
/obicount
|
||||||
|
/obimultiplex
|
||||||
|
/obipairing
|
||||||
|
/obipcr
|
||||||
|
/obifind
|
||||||
|
/obidistribute
|
||||||
|
/obiuniq
|
||||||
/build
|
/build
|
||||||
/bugs
|
/Makefile.old
|
||||||
|
.Rproj.user
|
||||||
|
obitools.Rproj
|
||||||
|
Stat_error.knit.md
|
||||||
|
.Rhistory
|
||||||
|
Stat_error.nb.html
|
||||||
|
Stat_error.Rmd
|
||||||
|
|
||||||
/ncbitaxo
|
/.luarc.json
|
||||||
|
/doc/TAXO/
|
||||||
|
/doc/results/
|
||||||
|
/doc/_main.log
|
||||||
|
/doc/_book/_main.tex
|
||||||
|
/doc/_freeze/
|
||||||
|
/doc/tutorial_files/
|
||||||
|
/doc/wolf_data/
|
||||||
|
/taxdump/
|
||||||
|
/.vscode/
|
||||||
|
|
||||||
!/obitests/**
|
/Algo-Alignement.numbers
|
||||||
!/sample/**
|
/Estimate_proba_true_seq.html
|
||||||
LLM/**
|
/Estimate_proba_true_seq.nb.html
|
||||||
*_files
|
/Estimate_proba_true_seq.Rmd
|
||||||
|
/modele_error_euka.qmd
|
||||||
entropy.html
|
/obitools.code-workspace
|
||||||
|
.DS_Store
|
||||||
|
.RData
|
||||||
|
x
|
||||||
|
xxx
|
||||||
|
y
|
||||||
|
/doc/wolf_diet.tgz
|
||||||
|
/doc/man/depends
|
||||||
|
/sample/wolf_R1.fasta.gz
|
||||||
|
/sample/wolf_R2.fasta.gz
|
||||||
|
/sample/euka03.ecotag.fasta.gz
|
||||||
|
/sample/ratio.csv
|
||||||
|
/sample/STD_PLN_1.dat
|
||||||
|
/sample/STD_PLN_2.dat
|
||||||
|
/sample/subset_Pasvik_R1.fastq.gz
|
||||||
|
/sample/subset_Pasvik_R2.fastq.gz
|
||||||
|
/sample/test_gobitools.fasta.bz2
|
||||||
|
euka03.csv*
|
||||||
|
gbbct793.seq.gz
|
||||||
|
gbinv1003.seq.gz
|
||||||
|
gbpln210.seq
|
||||||
|
/doc/book/OBITools-V4.aux
|
||||||
|
/doc/book/OBITools-V4.fdb_latexmk
|
||||||
|
/doc/book/OBITools-V4.fls
|
||||||
|
/doc/book/OBITools-V4.log
|
||||||
|
/doc/book/OBITools-V4.pdf
|
||||||
|
/doc/book/OBITools-V4.synctex.gz
|
||||||
|
/doc/book/OBITools-V4.tex
|
||||||
|
/doc/book/OBITools-V4.toc
|
||||||
|
getoptions.adoc
|
||||||
|
Archive.zip
|
||||||
|
.DS_Store
|
||||||
|
sample/.DS_Store
|
||||||
|
sample/consensus_graphs/specimen_hac_plants_Vern_disicolor_.gml
|
||||||
|
93954
|
||||||
|
Bact03.e5.gb_R254.obipcr.idx.fasta.save
|
||||||
|
sample/test.obipcr.log
|
||||||
|
Bact02.e3.gb_R254.obipcr.fasta.gz
|
||||||
|
Example_Arth03.ngsfilter
|
||||||
|
SPER01.csv
|
||||||
|
SPER03.csv
|
||||||
|
wolf_diet_ngsfilter.txt
|
||||||
|
xx
|
||||||
|
xxx.gb
|
||||||
|
yyy_geom.csv
|
||||||
|
yyy_LCS.csv
|
||||||
|
yyy.json
|
||||||
|
bug_obimultiplex/toto
|
||||||
|
bug_obimultiplex/toto_mapping
|
||||||
|
bug_obimultiplex/tutu
|
||||||
|
bug_obimultiplex/tutu_mapping
|
||||||
|
bug_obipairing/GIT1_GH_ngsfilter.txt
|
||||||
|
doc/book/TAXO/citations.dmp
|
||||||
|
doc/book/TAXO/delnodes.dmp
|
||||||
|
doc/book/TAXO/division.dmp
|
||||||
|
doc/book/TAXO/gc.prt
|
||||||
|
doc/book/TAXO/gencode.dmp
|
||||||
|
doc/book/TAXO/merged.dmp
|
||||||
|
doc/book/TAXO/names.dmp
|
||||||
|
doc/book/TAXO/nodes.dmp
|
||||||
|
doc/book/TAXO/readme.txt
|
||||||
|
doc/book/wolf_data/Release-253/ncbitaxo/citations.dmp
|
||||||
|
doc/book/wolf_data/Release-253/ncbitaxo/delnodes.dmp
|
||||||
|
doc/book/wolf_data/Release-253/ncbitaxo/division.dmp
|
||||||
|
doc/book/wolf_data/Release-253/ncbitaxo/gc.prt
|
||||||
|
doc/book/wolf_data/Release-253/ncbitaxo/gencode.dmp
|
||||||
|
doc/book/wolf_data/Release-253/ncbitaxo/merged.dmp
|
||||||
|
doc/book/wolf_data/Release-253/ncbitaxo/names.dmp
|
||||||
|
doc/book/wolf_data/Release-253/ncbitaxo/nodes.dmp
|
||||||
|
doc/book/wolf_data/Release-253/ncbitaxo/readme.txt
|
||||||
|
doc/book/results/toto.tasta
|
||||||
|
sample/.DS_Store
|
||||||
|
GO
|
||||||
|
ncbitaxo/citations.dmp
|
||||||
|
ncbitaxo/delnodes.dmp
|
||||||
|
ncbitaxo/division.dmp
|
||||||
|
ncbitaxo/gc.prt
|
||||||
|
ncbitaxo/gencode.dmp
|
||||||
|
ncbitaxo/merged.dmp
|
||||||
|
ncbitaxo/names.dmp
|
||||||
|
ncbitaxo/nodes.dmp
|
||||||
|
ncbitaxo/readme.txt
|
||||||
|
template.16S
|
||||||
|
xxx.gz
|
||||||
|
*.sav
|
||||||
|
*.old
|
||||||
|
ncbitaxo.tgz
|
||||||
|
*.csv
|
||||||
|
|||||||
@@ -2,9 +2,8 @@
|
|||||||
#export GOBIN=$(GOPATH)/bin
|
#export GOBIN=$(GOPATH)/bin
|
||||||
#export PATH=$(GOBIN):$(shell echo $${PATH})
|
#export PATH=$(GOBIN):$(shell echo $${PATH})
|
||||||
|
|
||||||
GOFLAGS=
|
|
||||||
GOCMD=go
|
GOCMD=go
|
||||||
GOBUILD=$(GOCMD) build $(GOFLAGS)
|
GOBUILD=$(GOCMD) build # -compiler gccgo -gccgoflags -O3
|
||||||
GOGENERATE=$(GOCMD) generate
|
GOGENERATE=$(GOCMD) generate
|
||||||
GOCLEAN=$(GOCMD) clean
|
GOCLEAN=$(GOCMD) clean
|
||||||
GOTEST=$(GOCMD) test
|
GOTEST=$(GOCMD) test
|
||||||
@@ -17,12 +16,6 @@ PACKAGES_SRC:= $(wildcard pkg/*/*.go pkg/*/*/*.go)
|
|||||||
PACKAGE_DIRS:=$(sort $(patsubst %/,%,$(dir $(PACKAGES_SRC))))
|
PACKAGE_DIRS:=$(sort $(patsubst %/,%,$(dir $(PACKAGES_SRC))))
|
||||||
PACKAGES:=$(notdir $(PACKAGE_DIRS))
|
PACKAGES:=$(notdir $(PACKAGE_DIRS))
|
||||||
|
|
||||||
GITHOOK_SRC_DIR=git-hooks
|
|
||||||
GITHOOKS_SRC:=$(wildcard $(GITHOOK_SRC_DIR)/*)
|
|
||||||
|
|
||||||
GITHOOK_DIR=.git/hooks
|
|
||||||
GITHOOKS:=$(patsubst $(GITHOOK_SRC_DIR)/%,$(GITHOOK_DIR)/%,$(GITHOOKS_SRC))
|
|
||||||
|
|
||||||
OBITOOLS_SRC:= $(wildcard cmd/obitools/*/*.go)
|
OBITOOLS_SRC:= $(wildcard cmd/obitools/*/*.go)
|
||||||
OBITOOLS_DIRS:=$(sort $(patsubst %/,%,$(dir $(OBITOOLS_SRC))))
|
OBITOOLS_DIRS:=$(sort $(patsubst %/,%,$(dir $(OBITOOLS_SRC))))
|
||||||
OBITOOLS:=$(notdir $(OBITOOLS_DIRS))
|
OBITOOLS:=$(notdir $(OBITOOLS_DIRS))
|
||||||
@@ -60,31 +53,27 @@ endif
|
|||||||
|
|
||||||
OUTPUT:=$(shell mktemp)
|
OUTPUT:=$(shell mktemp)
|
||||||
|
|
||||||
all: install-githook obitools
|
all: obitools
|
||||||
|
|
||||||
|
packages: $(patsubst %,pkg-%,$(PACKAGES))
|
||||||
obitools: $(patsubst %,$(OBITOOLS_PREFIX)%,$(OBITOOLS))
|
obitools: $(patsubst %,$(OBITOOLS_PREFIX)%,$(OBITOOLS))
|
||||||
|
|
||||||
install-githook: $(GITHOOKS)
|
|
||||||
|
|
||||||
$(GITHOOK_DIR)/%: $(GITHOOK_SRC_DIR)/%
|
|
||||||
@echo installing $$(basename $@)...
|
|
||||||
@mkdir -p $(GITHOOK_DIR)
|
|
||||||
@cp $< $@
|
|
||||||
@chmod +x $@
|
|
||||||
|
|
||||||
|
|
||||||
update-deps:
|
update-deps:
|
||||||
go get -u ./...
|
go get -u ./...
|
||||||
|
|
||||||
test: .FORCE
|
test:
|
||||||
$(GOTEST) ./...
|
$(GOTEST) ./...
|
||||||
|
|
||||||
obitests:
|
man:
|
||||||
@for t in $$(find obitests -name test.sh -print) ; do \
|
make -C doc man
|
||||||
bash $${t} || exit 1;\
|
obibook:
|
||||||
done
|
make -C doc obibook
|
||||||
|
doc: man obibook
|
||||||
|
|
||||||
githubtests: obitools obitests
|
macos-pkg:
|
||||||
|
@bash pkgs/macos/macos-installer-builder-master/macOS-x64/build-macos-x64.sh \
|
||||||
|
OBITools \
|
||||||
|
0.0.1
|
||||||
|
|
||||||
$(BUILD_DIR):
|
$(BUILD_DIR):
|
||||||
mkdir -p $@
|
mkdir -p $@
|
||||||
@@ -94,61 +83,19 @@ $(foreach P,$(PACKAGE_DIRS),$(eval $(call MAKE_PKG_RULE,$(P))))
|
|||||||
|
|
||||||
$(foreach P,$(OBITOOLS_DIRS),$(eval $(call MAKE_OBITOOLS_RULE,$(P))))
|
$(foreach P,$(OBITOOLS_DIRS),$(eval $(call MAKE_OBITOOLS_RULE,$(P))))
|
||||||
|
|
||||||
pkg/obioptions/version.go: version.txt .FORCE
|
pkg/obioptions/version.go: .FORCE
|
||||||
@version=$$(cat version.txt); \
|
ifneq ($(strip $(COMMIT_ID)),)
|
||||||
cat $@ \
|
@cat $@ \
|
||||||
| sed -E 's/^var _Version = "[^"]*"/var _Version = "Release '$$version'"/' \
|
| sed -E 's/^var _Commit = "[^"]*"/var _Commit = "'$(COMMIT_ID)'"/' \
|
||||||
|
| sed -E 's/^var _Version = "[^"]*"/var _Version = "'"$(LAST_TAG)"'"/' \
|
||||||
> $(OUTPUT)
|
> $(OUTPUT)
|
||||||
|
|
||||||
@diff $@ $(OUTPUT) 2>&1 > /dev/null \
|
@diff $@ $(OUTPUT) 2>&1 > /dev/null \
|
||||||
|| (echo "Update version.go to $$(cat version.txt)" && mv $(OUTPUT) $@)
|
|| echo "Update version.go : $@ to $(LAST_TAG) ($(COMMIT_ID))" \
|
||||||
|
&& mv $(OUTPUT) $@
|
||||||
|
|
||||||
@rm -f $(OUTPUT)
|
@rm -f $(OUTPUT)
|
||||||
|
endif
|
||||||
|
|
||||||
bump-version:
|
.PHONY: all packages obitools man obibook doc update-deps .FORCE
|
||||||
@echo "Incrementing version..."
|
|
||||||
@current=$$(cat version.txt); \
|
|
||||||
echo " Current version: $$current"; \
|
|
||||||
major=$$(echo $$current | cut -d. -f1); \
|
|
||||||
minor=$$(echo $$current | cut -d. -f2); \
|
|
||||||
patch=$$(echo $$current | cut -d. -f3); \
|
|
||||||
new_patch=$$((patch + 1)); \
|
|
||||||
new_version="$$major.$$minor.$$new_patch"; \
|
|
||||||
echo " New version: $$new_version"; \
|
|
||||||
echo "$$new_version" > version.txt
|
|
||||||
@echo "✓ Version updated in version.txt"
|
|
||||||
@$(MAKE) pkg/obioptions/version.go
|
|
||||||
|
|
||||||
jjnew:
|
|
||||||
@echo "$(YELLOW)→ Creating a new commit...$(NC)"
|
|
||||||
@echo "$(BLUE)→ Documenting current commit...$(NC)"
|
|
||||||
@jj auto-describe
|
|
||||||
@echo "$(BLUE)→ Done.$(NC)"
|
|
||||||
@jj new
|
|
||||||
@echo "$(GREEN)✓ New commit created$(NC)"
|
|
||||||
|
|
||||||
jjpush:
|
|
||||||
@echo "$(YELLOW)→ Pushing commit to repository...$(NC)"
|
|
||||||
@echo "$(BLUE)→ Documenting current commit...$(NC)"
|
|
||||||
@jj auto-describe
|
|
||||||
@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
|
|
||||||
@jj new
|
|
||||||
@$(MAKE) bump-version
|
|
||||||
@echo "$(BLUE)→ Documenting version bump commit...$(NC)"
|
|
||||||
@jj auto-describe
|
|
||||||
@version=$$(cat version.txt); \
|
|
||||||
tag_name="Release_$$version"; \
|
|
||||||
echo "$(BLUE)→ Pushing commits and creating tag $$tag_name...$(NC)"; \
|
|
||||||
jj git push --change @; \
|
|
||||||
git tag -a "$$tag_name" -m "Release $$version" 2>/dev/null || echo "Tag $$tag_name already exists"; \
|
|
||||||
git push origin "$$tag_name" 2>/dev/null || echo "Tag already pushed"
|
|
||||||
@echo "$(GREEN)✓ Commits and tag pushed to repository$(NC)"
|
|
||||||
|
|
||||||
jjfetch:
|
|
||||||
@echo "$(YELLOW)→ Pulling latest commits...$(NC)"
|
|
||||||
@jj git fetch
|
|
||||||
@jj new master@origin
|
|
||||||
@echo "$(GREEN)✓ Latest commits pulled$(NC)"
|
|
||||||
|
|
||||||
.PHONY: all obitools update-deps obitests githubtests jjnew jjpush jjfetch bump-version .FORCE
|
|
||||||
.FORCE:
|
.FORCE:
|
||||||
@@ -37,7 +37,7 @@ curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install
|
|||||||
bash -s -- --install-dir test_install --obitools-prefix k
|
bash -s -- --install-dir test_install --obitools-prefix k
|
||||||
```
|
```
|
||||||
|
|
||||||
In this case, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus, `obigrep` will be named `kobigrep`.
|
In this case, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus `obigrep` will be named `kobigrep`.
|
||||||
|
|
||||||
## Continuing the analysis...
|
## Continuing the analysis...
|
||||||
|
|
||||||
|
|||||||
+105
-195
@@ -1,85 +1,19 @@
|
|||||||
# OBITools release notes
|
# OBITools release notes
|
||||||
|
|
||||||
## New changes
|
## Latest changes
|
||||||
|
|
||||||
### Bug fixes
|
|
||||||
|
|
||||||
- In `obipairing` correct the misspelling of the `obiparing_*` tags where the `i`
|
|
||||||
was missing to `obipairing_`.
|
|
||||||
|
|
||||||
- In `obigrep` the **-C** option that excludes sequences too abundant was not
|
|
||||||
functional.
|
|
||||||
|
|
||||||
- In `obitaxonomy` the **-l** option that lists all the taxonomic rank defined by
|
|
||||||
a taxonomy was not functional
|
|
||||||
|
|
||||||
- The file type guesser was not using enough data to be able to correctly detect
|
|
||||||
file format when sequences were too long in fastq and fasta or when lines were
|
|
||||||
to long in CSV files. That's now corrected
|
|
||||||
|
|
||||||
- Options **--fasta** or **--fastq** usable to specify input format were ignored.
|
|
||||||
They are now correctly considered
|
|
||||||
|
|
||||||
- The `obiannotate` command were crashing when a selection option was used but
|
|
||||||
no editing option.
|
|
||||||
|
|
||||||
- The `--fail-on-taxonomy` led to an error on merged taxa even when the
|
|
||||||
`--update-taxid` option was used.
|
|
||||||
|
|
||||||
- The `--compressed` option was not correctly named. It was renamed to `--compress`
|
|
||||||
|
|
||||||
### Enhancement
|
|
||||||
|
|
||||||
- Some sequences in the Genbank and EMBL databases are several gigabases long. The
|
|
||||||
sequence parser had to reallocate and recopy memory many times to read them,
|
|
||||||
resulting in a complexity of O(N^2) for reading such large sequences.
|
|
||||||
The new file chunk reader has a linear algorithm that speeds up the reading
|
|
||||||
of very long sequences.
|
|
||||||
|
|
||||||
- A new option **--csv** is added to every obitools to indicate that the input
|
|
||||||
format is CSV
|
|
||||||
|
|
||||||
- The new version of obitools are now printing the taxids in a fancy way
|
|
||||||
including the scientific name and the taxonomic rank (`"taxon:9606 [Homo
|
|
||||||
sapiens]@species"`). But if you need the old fashion raw taxid, a new option
|
|
||||||
**--raw-taxid** has been added to get obitools printing the taxids without any
|
|
||||||
decorations (`"9606"`).
|
|
||||||
|
|
||||||
|
|
||||||
## March 1st, 2025. Release 4.4.0
|
|
||||||
|
|
||||||
A new documentation website is available at https://obitools4.metabarcoding.org.
|
|
||||||
Its development is still in progress.
|
|
||||||
|
|
||||||
The biggest step forward in this new version is taxonomy management. The new
|
|
||||||
version is now able to handle taxonomic identifiers that are not just integer
|
|
||||||
values. This is a first step towards an easy way to handle other taxonomy
|
|
||||||
databases soon, such as the GBIF or Catalog of Life taxonomies. This version
|
|
||||||
is able to handle files containing taxonomic information created by previous
|
|
||||||
versions of OBITools, but files created by this new version may have some
|
|
||||||
problems to be analyzed by previous versions, at least for the taxonomic
|
|
||||||
information.
|
|
||||||
|
|
||||||
|
|
||||||
### Breaking changes
|
### Breaking changes
|
||||||
|
|
||||||
- In `obimultiplex`, the short version of the **--tag-list** option used to
|
- In `obimultiplex`, the short version of the **--tag-list** option used to specify the list
|
||||||
specify the list of tags and primers to be used for the demultiplexing has
|
of tags and primers to be used for the demultiplexing has been changed from `-t` to `-s`.
|
||||||
been changed from `-t` to `-s`.
|
|
||||||
|
|
||||||
- The command `obifind` is now renamed `obitaxonomy`.
|
- The command `obifind` is now renamed `obitaxonomy`.
|
||||||
|
|
||||||
- The **--taxdump** option used to specify the path to the taxdump containing
|
- The **--taxdump** option used to specify the path to the taxdump containing the NCBI taxonomy
|
||||||
the NCBI taxonomy has been renamed to **--taxonomy**.
|
has been renamed to **--taxonomy**.
|
||||||
|
|
||||||
### Bug fixes
|
### Bug fixes
|
||||||
|
|
||||||
- Correction of a bug when using paired sequence file with the **--out** option.
|
|
||||||
|
|
||||||
- Correction of a bug in `obitag` when trying to annotate very short sequences of
|
|
||||||
4 bases or less.
|
|
||||||
|
|
||||||
|
|
||||||
- In `obipairing`, correct the stats `seq_a_single` and `seq_b_single` when
|
- In `obipairing`, correct the stats `seq_a_single` and `seq_b_single` when
|
||||||
on right alignment mode
|
on right alignment mode
|
||||||
|
|
||||||
@@ -87,32 +21,12 @@ information.
|
|||||||
the batch size and not reading the qualities from the fastq files as `obiuniq`
|
the batch size and not reading the qualities from the fastq files as `obiuniq`
|
||||||
is producing only fasta output without qualities.
|
is producing only fasta output without qualities.
|
||||||
|
|
||||||
- In `obitag`, correct the wrong assignment of the **obitag_bestmatch**
|
|
||||||
attribute.
|
|
||||||
|
|
||||||
- In `obiclean`, the **--no-progress-bar** option disables all progress bars,
|
|
||||||
not just the data.
|
|
||||||
|
|
||||||
- Several fixes in reading FASTA and FASTQ files, including some code
|
|
||||||
simplification and factorization.
|
|
||||||
|
|
||||||
- Fixed a bug in all obitools that caused the same file to be processed
|
|
||||||
multiple times, when specifying a directory name as input.
|
|
||||||
|
|
||||||
|
|
||||||
### New features
|
### New features
|
||||||
|
|
||||||
- `obigrep` add a new **--valid-taxid** option to keep only sequence with a
|
|
||||||
valid taxid
|
|
||||||
|
|
||||||
- `obiclean` add a new **--min-sample-count** option with a default value of 1,
|
|
||||||
asking to filter out sequences which are not occurring in at least the
|
|
||||||
specified number of samples.
|
|
||||||
|
|
||||||
- `obitoaxonomy` a new **--dump|D** option allows for dumping a sub-taxonomy.
|
- `obitoaxonomy` a new **--dump|D** option allows for dumping a sub-taxonomy.
|
||||||
|
|
||||||
- Taxonomy dump can now be provided as a four-columns CSV file to the
|
- Taxonomy dump can now be provided as a four-columns CSV file to the **--taxonomy**
|
||||||
**--taxonomy** option.
|
option.
|
||||||
|
|
||||||
- NCBI Taxonomy dump does not need to be uncompressed and unarchived anymore. The
|
- NCBI Taxonomy dump does not need to be uncompressed and unarchived anymore. The
|
||||||
path of the tar and gziped dump file can be directly specified using the
|
path of the tar and gziped dump file can be directly specified using the
|
||||||
@@ -123,68 +37,54 @@ information.
|
|||||||
allow the processing of the rare fasta and fastq files not recognized.
|
allow the processing of the rare fasta and fastq files not recognized.
|
||||||
|
|
||||||
- In `obiscript`, adds new methods to the Lua sequence object:
|
- In `obiscript`, adds new methods to the Lua sequence object:
|
||||||
- `md5_string()`: returning the MD5 check sum as a hexadecimal string,
|
- `md5_string()`: returning the MD5 check sum as an hexadecimal string,
|
||||||
- `subsequence(from,to)`: allows extracting a subsequence on a 0 based
|
- `subsequence(from,to)`: allows to extract a subsequence on a 0 based
|
||||||
coordinate system, upper bound excluded like in go.
|
coordinate system, upper bound expluded like in go.
|
||||||
- `reverse_complement`: returning a sequence object corresponding to the
|
- `reverse_complement`: returning a sequence object corresponding to the reverse complement
|
||||||
reverse complement of the current sequence.
|
of the current sequence.
|
||||||
|
|
||||||
### Enhancement
|
### Change of git repositiory
|
||||||
|
|
||||||
- All obitools now have a **--taxonomy** option. If specified, the taxonomy is
|
- The OBITools4 git repository has been moved to the github repository.
|
||||||
loaded first and taxids annotating the sequences are validated against that
|
|
||||||
taxonomy. A warning is issued for any invalid taxid and for any taxid that
|
|
||||||
is transferred to a new taxid. The **--update-taxid** option allows these
|
|
||||||
old taxids to be replaced with their new equivalent in the result of the
|
|
||||||
obitools command.
|
|
||||||
|
|
||||||
- The scoring system used by the `obipairing` command has been changed to be
|
|
||||||
more coherent. In the new version, the scores associated to a match and a
|
|
||||||
mismatch involving a nucleotide with a quality score of 0 are equal. Which
|
|
||||||
is normal as a zero quality score means a perfect indecision on the read
|
|
||||||
nucleotide, therefore there is no reason to penalize a match differently
|
|
||||||
from a mismatch (see
|
|
||||||
https://obitools4.metabarcoding.org/docs/commands/alignments/obipairing/exact-alignment/).
|
|
||||||
|
|
||||||
- In every *OBITools* command, the progress bar is automatically deactivated
|
|
||||||
when the standard error output is redirected.
|
|
||||||
|
|
||||||
- Because Genbank and ENA:EMBL contain very large sequences, while OBITools4
|
|
||||||
are optimized As Genbank and ENA:EMBL contain very large sequences, while
|
|
||||||
OBITools4 is optimized for short sequences, `obipcr` faces some problems
|
|
||||||
with excessive consumption of computer resources, especially memory. Several
|
|
||||||
improvements in the tuning of the default `obipcr` parameters and some new
|
|
||||||
features, currently only available for FASTA and FASTQ file readers, have
|
|
||||||
been implemented to limit the memory impact of `obipcr` without changing the
|
|
||||||
computational efficiency too much.
|
|
||||||
|
|
||||||
- Logging system and therefore format, have been homogenized.
|
|
||||||
|
|
||||||
## August 2nd, 2024. Release 4.3.0
|
|
||||||
|
|
||||||
### Change of git repository
|
|
||||||
|
|
||||||
- The OBITools4 git repository has been moved to the GitHub repository.
|
|
||||||
The new address is: https://github.com/metabarcoding/obitools4.
|
The new address is: https://github.com/metabarcoding/obitools4.
|
||||||
Take care for using the new install script for retrieving the new version.
|
Take care for using the new install script for retrieving the new version.
|
||||||
|
|
||||||
```bash
|
```bash
|
||||||
curl -L https://metabarcoding.org/obitools4/install.sh \
|
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh \
|
||||||
| bash
|
| bash
|
||||||
```
|
```
|
||||||
|
|
||||||
or with options:
|
or with options:
|
||||||
|
|
||||||
```bash
|
```bash
|
||||||
curl -L https://metabarcoding.org/obitools4/install.sh \
|
curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh \
|
||||||
| bash -s -- --install-dir test_install --obitools-prefix k
|
| bash -s -- --install-dir test_install --obitools-prefix k
|
||||||
```
|
```
|
||||||
|
|
||||||
|
### CPU limitation
|
||||||
|
|
||||||
|
- By default, *OBITools4* tries to use all the computing power available on
|
||||||
|
your computer. In some circumstances this can be problematic (e.g. if you
|
||||||
|
are running on a computer cluster managed by your university). You can limit
|
||||||
|
the number of CPU cores used by *OBITools4* or by using the **--max-cpu**
|
||||||
|
option or by setting the **OBIMAXCPU** environment variable. Some strange
|
||||||
|
behaviour of *OBITools4* has been observed when users try to limit the
|
||||||
|
maximum number of usable CPU cores to one. This seems to be caused by the Go
|
||||||
|
language, and it is not obvious to get *OBITools4* to run correctly on a
|
||||||
|
single core in all circumstances. Therefore, if you ask to use a single
|
||||||
|
core, **OBITools4** will print a warning message and actually set this
|
||||||
|
parameter to two cores. If you really want a single core, you can use the
|
||||||
|
**--force-one-core** option. But be aware that this can lead to incorrect
|
||||||
|
calculations.
|
||||||
|
|
||||||
|
### New features
|
||||||
|
|
||||||
- The output of the obitools will evolve to produce results only in standard
|
- The output of the obitools will evolve to produce results only in standard
|
||||||
formats such as fasta and fastq. For non-sequential data, the output will be
|
formats such as fasta and fastq. For non-sequential data, the output will be
|
||||||
in CSV format, with the separator `,`, the decimal separator `.`, and a
|
in CSV format, with the separator `,`, the decimal separator `.`, and a
|
||||||
header line with the column names. It is more convenient to use the output
|
header line with the column names. It is more convenient to use the output
|
||||||
in other programs. For example, you can use the `csvtomd` command to
|
in other programs. For example, you can use the `csvtomd` command to
|
||||||
reformat the CSV output into a Markdown table. The first command to initiate
|
reformat the csv output into a markdown table. The first command to initiate
|
||||||
this change is `obicount`, which now produces a 3-line CSV output.
|
this change is `obicount`, which now produces a 3-line CSV output.
|
||||||
|
|
||||||
```bash
|
```bash
|
||||||
@@ -196,7 +96,7 @@ information.
|
|||||||
database for `obitag` is to use `obipcr` on a local copy of Genbank or EMBL.
|
database for `obitag` is to use `obipcr` on a local copy of Genbank or EMBL.
|
||||||
However, these sequence databases are known to contain many taxonomic
|
However, these sequence databases are known to contain many taxonomic
|
||||||
errors, such as bacterial sequences annotated with the taxid of their host
|
errors, such as bacterial sequences annotated with the taxid of their host
|
||||||
species. `obicleandb` tries to detect these errors. To do this, it first keeps
|
species. obicleandb tries to detect these errors. To do this, it first keeps
|
||||||
only sequences annotated with the taxid to which a species, genus, and
|
only sequences annotated with the taxid to which a species, genus, and
|
||||||
family taxid can be assigned. Then, for each sequence, it compares the
|
family taxid can be assigned. Then, for each sequence, it compares the
|
||||||
distance of the sequence to the other sequences belonging to the same genus
|
distance of the sequence to the other sequences belonging to the same genus
|
||||||
@@ -207,7 +107,7 @@ information.
|
|||||||
with the p-value of the Mann-Whitney U test in the **obicleandb_trusted**
|
with the p-value of the Mann-Whitney U test in the **obicleandb_trusted**
|
||||||
slot. Later, the distribution of this p-value can be analyzed to determine a
|
slot. Later, the distribution of this p-value can be analyzed to determine a
|
||||||
threshold. Empirically, a threshold of 0.05 is a good compromise and allows
|
threshold. Empirically, a threshold of 0.05 is a good compromise and allows
|
||||||
filtering out less than 1‰ of the sequences. These sequences can then be
|
to filter out less than 1‰ of the sequences. These sequences can then be
|
||||||
removed using `obigrep`.
|
removed using `obigrep`.
|
||||||
|
|
||||||
- Adds a new `obijoin` utility to join information contained in a sequence
|
- Adds a new `obijoin` utility to join information contained in a sequence
|
||||||
@@ -217,16 +117,16 @@ information.
|
|||||||
|
|
||||||
- Adds a new tool `obidemerge` to demerge a `merge_xxx` slot by recreating the
|
- Adds a new tool `obidemerge` to demerge a `merge_xxx` slot by recreating the
|
||||||
multiple identical sequences having the slot `xxx` recreated with its initial
|
multiple identical sequences having the slot `xxx` recreated with its initial
|
||||||
value and the sequence count set to the number of occurrences referred in the
|
value and the sequence count set to the number of occurences refered in the
|
||||||
`merge_xxx` slot. During the operation, the `merge_xxx` slot is removed.
|
`merge_xxx` slot. During the operation, the `merge_xxx` slot is removed.
|
||||||
|
|
||||||
- Adds CSV as one of the input format for every obitools command. To encode
|
- Adds CSV as one of the input format for every obitools command. To encode
|
||||||
sequence the CSV file must include a column named `sequence` and another
|
sequence the CSV file must includes a column named `sequence` and another
|
||||||
column named `id`. An extra column named `qualities` can be added to specify
|
column named `id`. An extra column named `qualities` can be added to specify
|
||||||
the quality scores of the sequence following the same ASCII encoding than the
|
the quality scores of the sequence following the same ascii encoding than the
|
||||||
fastq format. All the other columns will be considered as annotations and will
|
fastq format. All the other columns will be considered as annotations and will
|
||||||
be interpreted as JSON objects encoding potentially for atomic values. If a
|
be interpreted as JSON objects encoding potentially for atomic values. If a
|
||||||
column value can not be decoded as JSON it will be considered as a string.
|
calumn value can not be decoded as JSON it will be considered as a string.
|
||||||
|
|
||||||
- A new option **--version** has been added to every obitools command. It will
|
- A new option **--version** has been added to every obitools command. It will
|
||||||
print the version of the command.
|
print the version of the command.
|
||||||
@@ -235,8 +135,8 @@ information.
|
|||||||
quality scores from a BioSequence object.\
|
quality scores from a BioSequence object.\
|
||||||
|
|
||||||
- In `obimultuplex` the ngsfilter file describing the samples can be no provided
|
- In `obimultuplex` the ngsfilter file describing the samples can be no provided
|
||||||
not only using the classical ngsfilter format but also using the CSV format.
|
not only using the classical nfsfilter format but also using the csv format.
|
||||||
When using CSV, the first line must contain the column names. 5 columns are
|
When using csv, the first line must contain the column names. 5 columns are
|
||||||
expected:
|
expected:
|
||||||
|
|
||||||
- `experiment` the name of the experiment
|
- `experiment` the name of the experiment
|
||||||
@@ -252,34 +152,43 @@ information.
|
|||||||
|
|
||||||
Supplementary columns are allowed. Their names and content will be used to
|
Supplementary columns are allowed. Their names and content will be used to
|
||||||
annotate the sequence corresponding to the sample, as the `key=value;` did
|
annotate the sequence corresponding to the sample, as the `key=value;` did
|
||||||
in the ngsfilter format.
|
in the nfsfilter format.
|
||||||
|
|
||||||
The CSV format used allows for comment lines starting with `#` character.
|
The CSV format used allows for comment lines starting with `#` character.
|
||||||
Special data lines starting with `@param` in the first column allow configuring the algorithm. The options **--template** provided an over
|
Special data lines starting with `@param` in the first column allow to
|
||||||
commented example of the CSV format, including all the possible options.
|
configure the algorithm. The options **--template** provided an over
|
||||||
|
commented example of the csv format, including all the possible options.
|
||||||
|
|
||||||
### CPU limitation
|
### Enhancement
|
||||||
|
|
||||||
- By default, *OBITools4* tries to use all the computing power available on
|
- In every *OBITools* command, the progress bar are automatically deactivated
|
||||||
your computer. In some circumstances this can be problematic (e.g. if you
|
when the standard error output is redirected.
|
||||||
are running on a computer cluster managed by your university). You can limit
|
- Because Genbank and ENA:EMBL contain very large sequences, while OBITools4
|
||||||
the number of CPU cores used by *OBITools4* or by using the **--max-cpu**
|
are optimized As Genbank and ENA:EMBL contain very large sequences, while
|
||||||
option or by setting the **OBIMAXCPU** environment variable. Some strange
|
OBITools4 is optimised for short sequences, `obipcr` faces some problems
|
||||||
behavior of *OBITools4* has been observed when users try to limit the
|
with excessive consumption of computer resources, especially memory. Several
|
||||||
maximum number of usable CPU cores to one. This seems to be caused by the Go
|
improvements in the tuning of the default `obipcr` parameters and some new
|
||||||
language, and it is not obvious to get *OBITools4* to run correctly on a
|
features, currently only available for FASTA and FASTQ file readers, have
|
||||||
single core in all circumstances. Therefore, if you ask to use a single
|
been implemented to limit the memory impact of `obipcr` without changing the
|
||||||
core, **OBITools4** will print a warning message and actually set this
|
computational efficiency too much.
|
||||||
parameter to two cores. If you really want a single core, you can use the
|
- Logging system and therefore format, have been homogenized.
|
||||||
**--force-one-core** option. But be aware that this can lead to incorrect
|
|
||||||
calculations.
|
|
||||||
|
|
||||||
|
### Bug
|
||||||
|
|
||||||
|
- In `obitag`, correct the wrong assignment of the **obitag_bestmatch**
|
||||||
|
attribute.
|
||||||
|
- In `obiclean`, the **--no-progress-bar** option disables all progress bars,
|
||||||
|
not just the data.
|
||||||
|
- Several fixes in reading FASTA and FASTQ files, including some code
|
||||||
|
simplification and and factorization.
|
||||||
|
- Fixed a bug in all obitools that caused the same file to be processed
|
||||||
|
multiple times. when specifying a directory name as input.
|
||||||
|
|
||||||
## April 2nd, 2024. Release 4.2.0
|
## April 2nd, 2024. Release 4.2.0
|
||||||
|
|
||||||
### New features
|
### New features
|
||||||
|
|
||||||
- A new OBITools named `obiscript` allows processing each sequence according
|
- A new OBITools named `obiscript` allows to process each sequence according
|
||||||
to a Lua script. This is an experimental tool. The **--template** option
|
to a Lua script. This is an experimental tool. The **--template** option
|
||||||
allows for generating an example script on the `stdout`.
|
allows for generating an example script on the `stdout`.
|
||||||
|
|
||||||
@@ -287,7 +196,7 @@ information.
|
|||||||
|
|
||||||
- Two of the main class `obiseq.SeqWorker` and `obiseq.SeqWorker` have their
|
- Two of the main class `obiseq.SeqWorker` and `obiseq.SeqWorker` have their
|
||||||
declaration changed. Both now return two values a `obiseq.BioSequenceSlice`
|
declaration changed. Both now return two values a `obiseq.BioSequenceSlice`
|
||||||
and an `error`. This allows a worker to return potentially several sequences
|
and an `error`. This allow a worker to return potentially several sequences
|
||||||
as the result of the processing of a single sequence, or zero, which is
|
as the result of the processing of a single sequence, or zero, which is
|
||||||
equivalent to filter out the input sequence.
|
equivalent to filter out the input sequence.
|
||||||
|
|
||||||
@@ -295,12 +204,12 @@ information.
|
|||||||
|
|
||||||
- In `obitag` if the reference database contains sequences annotated by taxid
|
- In `obitag` if the reference database contains sequences annotated by taxid
|
||||||
not referenced in the taxonomy, the corresponding sequences are discarded
|
not referenced in the taxonomy, the corresponding sequences are discarded
|
||||||
from the reference database and a warning indicating the sequence *id* and the
|
from the reference database and a warning indicating the sequence id and the
|
||||||
wrong taxid is emitted.
|
wrong taxid is emitted.
|
||||||
- The bug corrected in the parsing of EMBL and Genbank files as implemented in
|
- The bug corrected in the parsing of EMBL and Genbank files as implemented in
|
||||||
version 4.1.2 of OBITools4, potentially induced some reduction in the
|
version 4.1.2 of OBITools4, potentially induced some reduction in the
|
||||||
performance of the parsing. This should have been now fixed.
|
performance of the parsing. This should have been now fixed.
|
||||||
- In the same idea, parsing of Genbank and EMBL files were reading and storing
|
- In the same idea, parsing of genbank and EMBL files were reading and storing
|
||||||
in memory not only the sequence but also the annotations (features table).
|
in memory not only the sequence but also the annotations (features table).
|
||||||
Up to now none of the OBITools are using this information, but with large
|
Up to now none of the OBITools are using this information, but with large
|
||||||
complete genomes, it is occupying a lot of memory. To reduce this impact,
|
complete genomes, it is occupying a lot of memory. To reduce this impact,
|
||||||
@@ -339,7 +248,7 @@ information.
|
|||||||
|
|
||||||
### New feature
|
### New feature
|
||||||
|
|
||||||
- In `obimatrix` a **--transpose** option allows transposing the produced
|
- In `obimatrix` a **--transpose** option allows to transpose the produced
|
||||||
matrix table in CSV format.
|
matrix table in CSV format.
|
||||||
- In `obitpairing` and `obipcrtag` two new options **--exact-mode** and
|
- In `obitpairing` and `obipcrtag` two new options **--exact-mode** and
|
||||||
**--fast-absolute** to control the heuristic used in the alignment
|
**--fast-absolute** to control the heuristic used in the alignment
|
||||||
@@ -347,7 +256,7 @@ information.
|
|||||||
the exact algorithm at the cost of a speed. **--fast-absolute** change the
|
the exact algorithm at the cost of a speed. **--fast-absolute** change the
|
||||||
scoring schema of the heuristic.
|
scoring schema of the heuristic.
|
||||||
- In `obiannotate` adds the possibility to annotate the first match of a
|
- In `obiannotate` adds the possibility to annotate the first match of a
|
||||||
pattern using the same algorithm as the one used in `obipcr` and
|
pattern using the same algorithm than the one used in `obipcr` and
|
||||||
`obimultiplex`. For that four option were added :
|
`obimultiplex`. For that four option were added :
|
||||||
- **--pattern** : to specify the pattern. It can use IUPAC codes and
|
- **--pattern** : to specify the pattern. It can use IUPAC codes and
|
||||||
position with no error tolerated has to be followed by a `#` character.
|
position with no error tolerated has to be followed by a `#` character.
|
||||||
@@ -428,7 +337,7 @@ information.
|
|||||||
|
|
||||||
### Bugs
|
### Bugs
|
||||||
|
|
||||||
- In the obitools language, the `composition` function now returns a map
|
- in the obitools language, the `composition` function now returns a map
|
||||||
indexed by lowercase string "a", "c", "g", "t" and "o" for other instead of
|
indexed by lowercase string "a", "c", "g", "t" and "o" for other instead of
|
||||||
being indexed by the ASCII codes of the corresponding letters.
|
being indexed by the ASCII codes of the corresponding letters.
|
||||||
- Correction of the reverse-complement operation. Every reverse complement of
|
- Correction of the reverse-complement operation. Every reverse complement of
|
||||||
@@ -441,18 +350,18 @@ information.
|
|||||||
duplicating the quality values. This made `obimultiplex` to produce fastq
|
duplicating the quality values. This made `obimultiplex` to produce fastq
|
||||||
files with sequences having quality values duplicated.
|
files with sequences having quality values duplicated.
|
||||||
|
|
||||||
### Be careful
|
### Becareful
|
||||||
|
|
||||||
GO 1.21.0 is out, and it includes new functionalities which are used in the
|
GO 1.21.0 is out, and it includes new functionalities which are used in the
|
||||||
OBITools4 code. If you use the recommended method for compiling OBITools on your
|
OBITools4 code. If you use the recommanded method for compiling OBITools on your
|
||||||
computer, there is no problem, as the script always load the latest GO version.
|
computer, their is no problem, as the script always load the latest GO version.
|
||||||
If you rely on your personal GO install, please think to update.
|
If you rely on you personnal GO install, please think to update.
|
||||||
|
|
||||||
## August 29th, 2023. Release 4.0.5
|
## August 29th, 2023. Release 4.0.5
|
||||||
|
|
||||||
### Bugs
|
### Bugs
|
||||||
|
|
||||||
- Patch a bug in the `obiseq.BioSequence` constructor leading to an error on
|
- Patch a bug in the `obiseq.BioSequence` constructor leading to a error on
|
||||||
almost every obitools. The error message indicates : `fatal error: sync:
|
almost every obitools. The error message indicates : `fatal error: sync:
|
||||||
unlock of unlocked mutex` This bug was introduced in the release 4.0.4
|
unlock of unlocked mutex` This bug was introduced in the release 4.0.4
|
||||||
|
|
||||||
@@ -471,7 +380,7 @@ If you rely on your personal GO install, please think to update.
|
|||||||
data structure to limit the number of alignments actually computed. This
|
data structure to limit the number of alignments actually computed. This
|
||||||
increase a bit the speed of both the software. `obirefidx` is nevertheless
|
increase a bit the speed of both the software. `obirefidx` is nevertheless
|
||||||
still too slow compared to my expectation.
|
still too slow compared to my expectation.
|
||||||
- Switch to a parallel version of the GZIP library, allowing for high speed
|
- Switch to a parallel version of the gzip library, allowing for high speed
|
||||||
compress and decompress operation on files.
|
compress and decompress operation on files.
|
||||||
|
|
||||||
### New feature
|
### New feature
|
||||||
@@ -515,12 +424,12 @@ If you rely on your personal GO install, please think to update.
|
|||||||
--unidentified not_assigned.fastq
|
--unidentified not_assigned.fastq
|
||||||
```
|
```
|
||||||
|
|
||||||
The command produced four files : `tagged_library_R1.fastq` and
|
the command produced four files : `tagged_library_R1.fastq` and
|
||||||
`tagged_library_R2.fastq` containing the assigned reads and
|
`tagged_library_R2.fastq` containing the assigned reads and
|
||||||
`not_assigned_R1.fastq` and `not_assigned_R2.fastq` containing the
|
`not_assigned_R1.fastq` and `not_assigned_R2.fastq` containing the
|
||||||
unassignable reads.
|
unassignable reads.
|
||||||
|
|
||||||
The tagged library files can then be split using `obidistribute`:
|
the tagged library files can then be split using `obidistribute`:
|
||||||
|
|
||||||
```{bash}
|
```{bash}
|
||||||
mkdir pcr_reads
|
mkdir pcr_reads
|
||||||
@@ -530,9 +439,9 @@ If you rely on your personal GO install, please think to update.
|
|||||||
|
|
||||||
- Adding of two options **--add-lca-in** and **--lca-error** to `obiannotate`.
|
- Adding of two options **--add-lca-in** and **--lca-error** to `obiannotate`.
|
||||||
These options aim to help during construction of reference database using
|
These options aim to help during construction of reference database using
|
||||||
`obipcr`. On `obipcr` output, it is commonly run `obiuniq`. To merge identical
|
`obipcr`. On obipcr output, it is commonly run obiuniq. To merge identical
|
||||||
sequences annotated with different taxids, it is now possible to use the
|
sequences annotated with different taxids, it is now possible to use the
|
||||||
following strategies :
|
following strategie :
|
||||||
|
|
||||||
```{bash}
|
```{bash}
|
||||||
obiuniq -m taxid myrefdb.obipcr.fasta \
|
obiuniq -m taxid myrefdb.obipcr.fasta \
|
||||||
@@ -563,7 +472,7 @@ If you rely on your personal GO install, please think to update.
|
|||||||
- Correction of a bug in `obiconsensus` leading into the deletion of a base
|
- Correction of a bug in `obiconsensus` leading into the deletion of a base
|
||||||
close to the beginning of the consensus sequence.
|
close to the beginning of the consensus sequence.
|
||||||
|
|
||||||
## March 31st, 2023. Release 4.0.2
|
## March 31th, 2023. Release 4.0.2
|
||||||
|
|
||||||
### Compiler change
|
### Compiler change
|
||||||
|
|
||||||
@@ -574,15 +483,15 @@ If you rely on your personal GO install, please think to update.
|
|||||||
- Add the possibility for looking pattern with indels. This has been added to
|
- Add the possibility for looking pattern with indels. This has been added to
|
||||||
`obimultiplex` through the **--with-indels** option.
|
`obimultiplex` through the **--with-indels** option.
|
||||||
- Every obitools command has a **--pprof** option making the command
|
- Every obitools command has a **--pprof** option making the command
|
||||||
publishing a profiling website available at the address :
|
publishing a profiling web site available at the address :
|
||||||
<http://localhost:8080/debug/pprof/>
|
<http://localhost:8080/debug/pprof/>
|
||||||
- A new `obiconsensus` command has been added. It is a prototype. It aims to
|
- A new `obiconsensus` command has been added. It is a prototype. It aims to
|
||||||
build a consensus sequence from a set of reads. The consensus is estimated
|
build a consensus sequence from a set of reads. The consensus is estimated
|
||||||
for all the sequences contained in the input file. If several input files,
|
for all the sequences contained in the input file. If several input files,
|
||||||
or a directory name are provided the result contains a consensus per file.
|
or a directory name are provided the result contains a consensus per file.
|
||||||
The *id* of the sequence is the name of the input file depleted of its
|
The id of the sequence is the name of the input file depleted of its
|
||||||
directory name and of all its extensions.
|
directory name and of all its extensions.
|
||||||
- In `obipcr` an experimental option **--fragmented** allows for splitting very
|
- In `obipcr` an experimental option **--fragmented** allows for spliting very
|
||||||
long query sequences into shorter fragments with an overlap between the two
|
long query sequences into shorter fragments with an overlap between the two
|
||||||
contiguous fragment insuring that no amplicons are missed despite the split.
|
contiguous fragment insuring that no amplicons are missed despite the split.
|
||||||
As a site effect some amplicon can be identified twice.
|
As a site effect some amplicon can be identified twice.
|
||||||
@@ -625,7 +534,7 @@ If you rely on your personal GO install, please think to update.
|
|||||||
### Enhancement
|
### Enhancement
|
||||||
|
|
||||||
- *OBITools* are automatically processing all the sequences files contained in
|
- *OBITools* are automatically processing all the sequences files contained in
|
||||||
a directory and its subdirectory\
|
a directory and its sub-directory\
|
||||||
recursively if its name is provided as input. To process easily Genbank
|
recursively if its name is provided as input. To process easily Genbank
|
||||||
files, the corresponding filename extensions have been added. Today the
|
files, the corresponding filename extensions have been added. Today the
|
||||||
following extensions are recognized as sequence files : `.fasta`, `.fastq`,
|
following extensions are recognized as sequence files : `.fasta`, `.fastq`,
|
||||||
@@ -642,7 +551,7 @@ If you rely on your personal GO install, please think to update.
|
|||||||
export OBICPUMAX=4
|
export OBICPUMAX=4
|
||||||
```
|
```
|
||||||
|
|
||||||
- Adds a new option --out\|-o allowing to specify the name of an output file.
|
- Adds a new option --out\|-o allowing to specify the name of an outpout file.
|
||||||
|
|
||||||
``` bash
|
``` bash
|
||||||
obiconvert -o xyz.fasta xxx.fastq
|
obiconvert -o xyz.fasta xxx.fastq
|
||||||
@@ -664,10 +573,10 @@ If you rely on your personal GO install, please think to update.
|
|||||||
matched files remain consistent when processed.
|
matched files remain consistent when processed.
|
||||||
|
|
||||||
- Adding of the function `ifelse` to the expression language for computing
|
- Adding of the function `ifelse` to the expression language for computing
|
||||||
conditional values.
|
conditionnal values.
|
||||||
|
|
||||||
- Adding two function to the expression language related to sequence
|
- Adding two function to the expression language related to sequence
|
||||||
composition : `composition` and `gcskew`. Both are taking a sequence as
|
conposition : `composition` and `gcskew`. Both are taking a sequence as
|
||||||
single argument.
|
single argument.
|
||||||
|
|
||||||
## February 18th, 2023. Release 4.0.0
|
## February 18th, 2023. Release 4.0.0
|
||||||
@@ -675,8 +584,8 @@ If you rely on your personal GO install, please think to update.
|
|||||||
It is the first version of the *OBITools* version 4. I decided to tag then
|
It is the first version of the *OBITools* version 4. I decided to tag then
|
||||||
following two weeks of intensive data analysis with them allowing to discover
|
following two weeks of intensive data analysis with them allowing to discover
|
||||||
many small bugs present in the previous non-official version. Obviously other
|
many small bugs present in the previous non-official version. Obviously other
|
||||||
bugs are certainly present in the code, and you are welcome to use the git
|
bugs are certainly persent in the code, and you are welcome to use the git
|
||||||
ticket system to mention them. But they seem to produce now reliable results.
|
ticket system to mention them. But they seems to produce now reliable results.
|
||||||
|
|
||||||
### Corrected bugs
|
### Corrected bugs
|
||||||
|
|
||||||
@@ -684,11 +593,11 @@ ticket system to mention them. But they seem to produce now reliable results.
|
|||||||
of sequences and to the production of incorrect file because of the last
|
of sequences and to the production of incorrect file because of the last
|
||||||
sequence record, sometime truncated in its middle. This was only occurring
|
sequence record, sometime truncated in its middle. This was only occurring
|
||||||
when more than a single CPU was used. It was affecting every obitools.
|
when more than a single CPU was used. It was affecting every obitools.
|
||||||
- The `obiparing` software had a bug in the right alignment procedure. This led
|
- The `obiparing` software had a bug in the right aligment procedure. This led
|
||||||
to the non-alignment of very sort barcode during the paring of the forward
|
to the non alignment of very sort barcode during the paring of the forward
|
||||||
and reverse reads.
|
and reverse reads.
|
||||||
- The `obipairing` tools had a non-deterministic comportment when aligning a
|
- The `obipairing` tools had a non deterministic comportment when aligning a
|
||||||
pair very low quality reads. This induced that the result of the same low
|
paor very low quality reads. This induced that the result of the same low
|
||||||
quality read pair was not the same from run to run.
|
quality read pair was not the same from run to run.
|
||||||
|
|
||||||
### New features
|
### New features
|
||||||
@@ -696,10 +605,11 @@ ticket system to mention them. But they seem to produce now reliable results.
|
|||||||
- Adding of a `--compress|-Z` option to every obitools allowing to produce
|
- Adding of a `--compress|-Z` option to every obitools allowing to produce
|
||||||
`gz` compressed output. OBITools were already able to deal with gziped input
|
`gz` compressed output. OBITools were already able to deal with gziped input
|
||||||
files transparently. They can now produce their results in the same format.
|
files transparently. They can now produce their results in the same format.
|
||||||
- Adding of a `--append|-A` option to the `obidistribute` tool. It allows appending the result of an `obidistribute` execution to preexisting files. -
|
- Adding of a `--append|-A` option to the `obidistribute` tool. It allows to
|
||||||
|
append the result of an `obidistribute` execution to preexisting files. -
|
||||||
Adding of a `--directory|-d` option to the `obidistribute` tool. It allows
|
Adding of a `--directory|-d` option to the `obidistribute` tool. It allows
|
||||||
declaring a secondary classification key over the one defined by the
|
to declare a secondary classification key over the one defined by the
|
||||||
`--category\|-c\` option. This extra key leads to produce directories in
|
'--category\|-c\` option. This extra key leads to produce directories in
|
||||||
which files produced according to the primary criterion are stored.
|
which files produced according to the primary criterion are stored.
|
||||||
- Adding of the functions `subspc`, `printf`, `int`, `numeric`, and `bool` to
|
- Adding of the functions `subspc`, `printf`, `int`, `numeric`, and `bool` to
|
||||||
the expression language.
|
the expression language.
|
||||||
@@ -1,213 +0,0 @@
|
|||||||
# Index de k-mers pour génomes de grande taille
|
|
||||||
|
|
||||||
## Contexte et objectifs
|
|
||||||
|
|
||||||
### Cas d'usage
|
|
||||||
|
|
||||||
- Indexation de k-mers longs (k=31) pour des génomes de grande taille (< 10 Go par génome)
|
|
||||||
- Nombre de génomes : plusieurs dizaines à quelques centaines
|
|
||||||
- Indexation en parallèle
|
|
||||||
- Stockage sur disque
|
|
||||||
- Possibilité d'ajouter des génomes, mais pas de modifier un génome existant
|
|
||||||
|
|
||||||
### Requêtes cibles
|
|
||||||
|
|
||||||
- **Présence/absence** d'un k-mer dans un génome
|
|
||||||
- **Intersection** entre génomes
|
|
||||||
- **Distances** : Jaccard (présence/absence) et potentiellement Bray-Curtis (comptage)
|
|
||||||
|
|
||||||
### Ressources disponibles
|
|
||||||
|
|
||||||
- 128 Go de RAM
|
|
||||||
- Stockage disque
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Estimation des volumes
|
|
||||||
|
|
||||||
### Par génome
|
|
||||||
|
|
||||||
- **10 Go de séquence** → ~10¹⁰ k-mers bruts (chevauchants)
|
|
||||||
- **Après déduplication** : typiquement 10-50% de k-mers uniques → **~1-5 × 10⁹ k-mers distincts**
|
|
||||||
|
|
||||||
### Espace théorique
|
|
||||||
|
|
||||||
- **k=31** → 62 bits → ~4.6 × 10¹⁸ k-mers possibles
|
|
||||||
- Table d'indexation directe impossible
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Métriques de distance
|
|
||||||
|
|
||||||
### Présence/absence (binaire)
|
|
||||||
|
|
||||||
- **Jaccard** : |A ∩ B| / |A ∪ B|
|
|
||||||
- **Sørensen-Dice** : 2|A ∩ B| / (|A| + |B|)
|
|
||||||
|
|
||||||
### Comptage (abondance)
|
|
||||||
|
|
||||||
- **Bray-Curtis** : 1 - (2 × Σ min(aᵢ, bᵢ)) / (Σ aᵢ + Σ bᵢ)
|
|
||||||
|
|
||||||
Note : Pour Bray-Curtis, le stockage des comptages est nécessaire, ce qui augmente significativement la taille de l'index.
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Options d'indexation
|
|
||||||
|
|
||||||
### Option 1 : Bloom Filter par génome
|
|
||||||
|
|
||||||
**Principe** : Structure probabiliste pour test d'appartenance.
|
|
||||||
|
|
||||||
**Avantages :**
|
|
||||||
- Très compact : ~10 bits/élément pour FPR ~1%
|
|
||||||
- Construction rapide, streaming
|
|
||||||
- Facile à sérialiser/désérialiser
|
|
||||||
- Intersection et Jaccard estimables via formules analytiques
|
|
||||||
|
|
||||||
**Inconvénients :**
|
|
||||||
- Faux positifs (pas de faux négatifs)
|
|
||||||
- Distances approximatives
|
|
||||||
|
|
||||||
**Taille estimée** : 1-6 Go par génome (selon FPR cible)
|
|
||||||
|
|
||||||
#### Dimensionnement des Bloom filters
|
|
||||||
|
|
||||||
```
|
|
||||||
\mathrm{FPR} ;=; \left(1 - e^{-h n / m}\right)^h
|
|
||||||
```
|
|
||||||
|
|
||||||
|
|
||||||
| Bits/élément | FPR optimal | k (hash functions) |
|
|
||||||
|--------------|-------------|---------------------|
|
|
||||||
| 8 | ~2% | 5-6 |
|
|
||||||
| 10 | ~1% | 7 |
|
|
||||||
| 12 | ~0.3% | 8 |
|
|
||||||
| 16 | ~0.01% | 11 |
|
|
||||||
|
|
||||||
Formule du taux de faux positifs :
|
|
||||||
```
|
|
||||||
FPR ≈ (1 - e^(-kn/m))^k
|
|
||||||
```
|
|
||||||
Où n = nombre d'éléments, m = nombre de bits, k = nombre de hash functions.
|
|
||||||
|
|
||||||
### Option 2 : Ensemble trié de k-mers
|
|
||||||
|
|
||||||
**Principe** : Stocker les k-mers (uint64) triés, avec compression possible.
|
|
||||||
|
|
||||||
**Avantages :**
|
|
||||||
- Exact (pas de faux positifs)
|
|
||||||
- Intersection/union par merge sort O(n+m)
|
|
||||||
- Compression efficace (delta encoding sur k-mers triés)
|
|
||||||
|
|
||||||
**Inconvénients :**
|
|
||||||
- Plus volumineux : 8 octets/k-mer
|
|
||||||
- Construction plus lente (tri nécessaire)
|
|
||||||
|
|
||||||
**Taille estimée** : 8-40 Go par génome (non compressé)
|
|
||||||
|
|
||||||
### Option 3 : MPHF (Minimal Perfect Hash Function)
|
|
||||||
|
|
||||||
**Principe** : Fonction de hash parfaite minimale pour les k-mers présents.
|
|
||||||
|
|
||||||
**Avantages :**
|
|
||||||
- Très compact : ~3-4 bits/élément
|
|
||||||
- Lookup O(1)
|
|
||||||
- Exact pour les k-mers présents
|
|
||||||
|
|
||||||
**Inconvénients :**
|
|
||||||
- Construction coûteuse (plusieurs passes)
|
|
||||||
- Statique (pas d'ajout de k-mers après construction)
|
|
||||||
- Ne distingue pas "absent" vs "jamais vu" sans structure auxiliaire
|
|
||||||
|
|
||||||
### Option 4 : Hybride MPHF + Bloom filter
|
|
||||||
|
|
||||||
- MPHF pour mapping compact des k-mers présents
|
|
||||||
- Bloom filter pour pré-filtrage des absents
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Optimisation : Indexation de (k-2)-mers pour requêtes k-mers
|
|
||||||
|
|
||||||
### Principe
|
|
||||||
|
|
||||||
Au lieu d'indexer directement les 31-mers dans un Bloom filter, on indexe les 29-mers. Pour tester la présence d'un 31-mer, on vérifie que les **trois 29-mers** qu'il contient sont présents :
|
|
||||||
|
|
||||||
- positions 0-28
|
|
||||||
- positions 1-29
|
|
||||||
- positions 2-30
|
|
||||||
|
|
||||||
### Analyse probabiliste
|
|
||||||
|
|
||||||
Si le Bloom filter a un FPR de p pour un 29-mer individuel, le FPR effectif pour un 31-mer devient **p³** (les trois requêtes doivent toutes être des faux positifs).
|
|
||||||
|
|
||||||
| FPR 29-mer | FPR 31-mer effectif |
|
|
||||||
|------------|---------------------|
|
|
||||||
| 10% | 0.1% |
|
|
||||||
| 5% | 0.0125% |
|
|
||||||
| 1% | 0.0001% |
|
|
||||||
|
|
||||||
### Avantages
|
|
||||||
|
|
||||||
1. **Moins d'éléments à stocker** : il y a moins de 29-mers distincts que de 31-mers distincts dans un génome (deux 31-mers différents peuvent partager un même 29-mer)
|
|
||||||
|
|
||||||
2. **FPR drastiquement réduit** : FPR³ avec seulement 3 requêtes
|
|
||||||
|
|
||||||
3. **Index plus compact** : on peut utiliser moins de bits par élément (FPR plus élevé acceptable sur le 29-mer) tout en obtenant un FPR très bas sur le 31-mer
|
|
||||||
|
|
||||||
### Trade-off
|
|
||||||
|
|
||||||
Un Bloom filter à **5-6 bits/élément** pour les 29-mers donnerait un FPR effectif < 0.01% pour les 31-mers, soit environ **2× plus compact** que l'approche directe à qualité égale.
|
|
||||||
|
|
||||||
**Coût** : 3× plus de requêtes par lookup (mais les requêtes Bloom sont très rapides).
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Accélération des calculs de distance : MinHash
|
|
||||||
|
|
||||||
### Principe
|
|
||||||
|
|
||||||
Pré-calculer une "signature" compacte (sketch) de chaque génome permettant d'estimer rapidement Jaccard sans charger les index complets.
|
|
||||||
|
|
||||||
### Avantages
|
|
||||||
|
|
||||||
- Matrice de distances entre 100+ génomes en quelques secondes
|
|
||||||
- Signature de taille fixe (ex: 1000-10000 hash values) quel que soit le génome
|
|
||||||
- Stockage minimal
|
|
||||||
|
|
||||||
### Utilisation
|
|
||||||
|
|
||||||
1. Construction : une passe sur les k-mers de chaque génome
|
|
||||||
2. Distance : comparaison des sketches en O(taille du sketch)
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Architecture recommandée
|
|
||||||
|
|
||||||
### Pour présence/absence + Jaccard
|
|
||||||
|
|
||||||
1. **Index principal** : Bloom filter de (k-2)-mers avec l'optimisation décrite
|
|
||||||
- Compact (~3-5 Go par génome)
|
|
||||||
- FPR très bas pour les k-mers grâce aux requêtes triples
|
|
||||||
|
|
||||||
2. **Sketches MinHash** : pour calcul rapide des distances entre génomes
|
|
||||||
- Quelques Ko par génome
|
|
||||||
- Permet exploration rapide de la matrice de distances
|
|
||||||
|
|
||||||
### Pour comptage + Bray-Curtis
|
|
||||||
|
|
||||||
1. **Index principal** : k-mers triés + comptages
|
|
||||||
- uint64 (k-mer) + uint8/uint16 (count)
|
|
||||||
- Compression delta possible
|
|
||||||
- Plus volumineux mais exact
|
|
||||||
|
|
||||||
2. **Sketches** : variantes de MinHash pour données pondérées (ex: HyperMinHash)
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Prochaines étapes
|
|
||||||
|
|
||||||
1. Implémenter un Bloom filter optimisé pour k-mers
|
|
||||||
2. Implémenter l'optimisation (k-2)-mer → k-mer
|
|
||||||
3. Implémenter MinHash pour les sketches
|
|
||||||
4. Définir le format de sérialisation sur disque
|
|
||||||
5. Benchmarker sur des génomes réels
|
|
||||||
@@ -30,11 +30,7 @@ func main() {
|
|||||||
// trace.Start(ftrace)
|
// trace.Start(ftrace)
|
||||||
// defer trace.Stop()
|
// defer trace.Stop()
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obiannotate.OptionSet)
|
||||||
"obiannotate",
|
|
||||||
"edits the sequence annotations",
|
|
||||||
obiannotate.OptionSet,
|
|
||||||
)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
@@ -42,11 +38,6 @@ func main() {
|
|||||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
||||||
|
|
||||||
annotator := obiannotate.CLIAnnotationPipeline()
|
annotator := obiannotate.CLIAnnotationPipeline()
|
||||||
|
|
||||||
if obiannotate.CLIHasSetNumberFlag() {
|
|
||||||
sequences = sequences.NumberSequences(1, !obiconvert.CLINoInputOrder())
|
|
||||||
}
|
|
||||||
|
|
||||||
obiconvert.CLIWriteBioSequences(sequences.Pipe(annotator), true)
|
obiconvert.CLIWriteBioSequences(sequences.Pipe(annotator), true)
|
||||||
|
|
||||||
obiutils.WaitForLastPipe()
|
obiutils.WaitForLastPipe()
|
||||||
|
|||||||
@@ -11,10 +11,7 @@ import (
|
|||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obiclean.OptionSet)
|
||||||
"obiclean",
|
|
||||||
"",
|
|
||||||
obiclean.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -14,10 +14,7 @@ import (
|
|||||||
func main() {
|
func main() {
|
||||||
obidefault.SetBatchSize(10)
|
obidefault.SetBatchSize(10)
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obicleandb.OptionSet)
|
||||||
"obicleandb",
|
|
||||||
"clean-up reference databases",
|
|
||||||
obicleandb.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -11,10 +11,7 @@ import (
|
|||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obiconvert.OptionSet)
|
||||||
"obicomplement",
|
|
||||||
"reverse complement of sequences",
|
|
||||||
obiconvert.OptionSet(true))
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -11,10 +11,7 @@ import (
|
|||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obiconsensus.OptionSet)
|
||||||
"obiconsensus",
|
|
||||||
"ONT reads denoising",
|
|
||||||
obiconsensus.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -14,10 +14,7 @@ func main() {
|
|||||||
obidefault.SetStrictReadWorker(2)
|
obidefault.SetStrictReadWorker(2)
|
||||||
obidefault.SetStrictWriteWorker(2)
|
obidefault.SetStrictWriteWorker(2)
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obiconvert.OptionSet)
|
||||||
"obiconvert",
|
|
||||||
"convertion of sequence files to various formats",
|
|
||||||
obiconvert.OptionSet(true))
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -28,8 +28,6 @@ func main() {
|
|||||||
// defer trace.Stop()
|
// defer trace.Stop()
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(
|
||||||
"obicount",
|
|
||||||
"counts the sequences present in a file of sequences",
|
|
||||||
obiconvert.InputOptionSet,
|
obiconvert.InputOptionSet,
|
||||||
obicount.OptionSet,
|
obicount.OptionSet,
|
||||||
)
|
)
|
||||||
|
|||||||
@@ -10,10 +10,7 @@ import (
|
|||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obicsv.OptionSet)
|
||||||
"obicsv",
|
|
||||||
"converts sequence files to CSV format",
|
|
||||||
obicsv.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -15,10 +15,7 @@ func main() {
|
|||||||
obidefault.SetStrictReadWorker(2)
|
obidefault.SetStrictReadWorker(2)
|
||||||
obidefault.SetStrictWriteWorker(2)
|
obidefault.SetStrictWriteWorker(2)
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obidemerge.OptionSet)
|
||||||
"obidemerge",
|
|
||||||
"",
|
|
||||||
obidemerge.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -11,10 +11,7 @@ import (
|
|||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obidistribute.OptionSet)
|
||||||
"obidistribute",
|
|
||||||
"divided an input set of sequences into subsets",
|
|
||||||
obidistribute.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -30,10 +30,7 @@ func main() {
|
|||||||
// trace.Start(ftrace)
|
// trace.Start(ftrace)
|
||||||
// defer trace.Stop()
|
// defer trace.Stop()
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obigrep.OptionSet)
|
||||||
"obigrep",
|
|
||||||
"select a subset of sequences on various criteria",
|
|
||||||
obigrep.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -15,10 +15,7 @@ func main() {
|
|||||||
obidefault.SetStrictReadWorker(2)
|
obidefault.SetStrictReadWorker(2)
|
||||||
obidefault.SetStrictWriteWorker(2)
|
obidefault.SetStrictWriteWorker(2)
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obijoin.OptionSet)
|
||||||
"obijoin",
|
|
||||||
"merge annotations contained in a file to another file",
|
|
||||||
obijoin.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -31,10 +31,7 @@ func main() {
|
|||||||
// trace.Start(ftrace)
|
// trace.Start(ftrace)
|
||||||
// defer trace.Stop()
|
// defer trace.Stop()
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obikmersim.MatchOptionSet)
|
||||||
"obikmermatch",
|
|
||||||
"",
|
|
||||||
obikmersim.MatchOptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -32,10 +32,7 @@ func main() {
|
|||||||
// trace.Start(ftrace)
|
// trace.Start(ftrace)
|
||||||
// defer trace.Stop()
|
// defer trace.Stop()
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obikmersim.CountOptionSet)
|
||||||
"obikmersimcount",
|
|
||||||
"",
|
|
||||||
obikmersim.CountOptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -11,10 +11,7 @@ import (
|
|||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obilandmark.OptionSet)
|
||||||
"obilandmark",
|
|
||||||
"",
|
|
||||||
obilandmark.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -31,8 +31,6 @@ func main() {
|
|||||||
// defer trace.Stop()
|
// defer trace.Stop()
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(
|
||||||
"obimatrix",
|
|
||||||
"",
|
|
||||||
obimatrix.OptionSet,
|
obimatrix.OptionSet,
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|||||||
@@ -3,17 +3,15 @@ package main
|
|||||||
import (
|
import (
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obimicroasm"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obilowmask"
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
|
|
||||||
defer obiseq.LogBioSeqStatus()
|
|
||||||
|
|
||||||
// go tool pprof -http=":8000" ./obipairing ./cpu.pprof
|
// go tool pprof -http=":8000" ./obipairing ./cpu.pprof
|
||||||
// f, err := os.Create("cpu.pprof")
|
// f, err := os.Create("cpu.pprof")
|
||||||
// if err != nil {
|
// if err != nil {
|
||||||
@@ -30,18 +28,15 @@ func main() {
|
|||||||
// trace.Start(ftrace)
|
// trace.Start(ftrace)
|
||||||
// defer trace.Stop()
|
// defer trace.Stop()
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obimicroasm.OptionSet)
|
||||||
"obimicrosat",
|
|
||||||
"looks for microsatellites sequences in a sequence file",
|
|
||||||
obilowmask.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
optionParser(os.Args)
|
||||||
|
|
||||||
sequences, err := obiconvert.CLIReadBioSequences(args...)
|
obidefault.SetStrictReadWorker(2)
|
||||||
obiconvert.OpenSequenceDataErrorMessage(args, err)
|
obidefault.SetStrictWriteWorker(2)
|
||||||
|
|
||||||
selected := obilowmask.CLISequenceEntropyMasker(sequences)
|
seq := obimicroasm.CLIAssemblePCR()
|
||||||
obiconvert.CLIWriteBioSequences(selected, true)
|
|
||||||
|
println(obiformats.FormatFasta(seq, obiformats.FormatFastSeqJsonHeader))
|
||||||
obiutils.WaitForLastPipe()
|
obiutils.WaitForLastPipe()
|
||||||
|
|
||||||
}
|
}
|
||||||
@@ -30,10 +30,7 @@ func main() {
|
|||||||
// trace.Start(ftrace)
|
// trace.Start(ftrace)
|
||||||
// defer trace.Stop()
|
// defer trace.Stop()
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obimicrosat.OptionSet)
|
||||||
"obimicrosat",
|
|
||||||
"looks for microsatellites sequences in a sequence file",
|
|
||||||
obimicrosat.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -28,10 +28,7 @@ func main() {
|
|||||||
// trace.Start(ftrace)
|
// trace.Start(ftrace)
|
||||||
// defer trace.Stop()
|
// defer trace.Stop()
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obimultiplex.OptionSet)
|
||||||
"obimultiplex",
|
|
||||||
"demultiplex amplicons",
|
|
||||||
obimultiplex.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -30,10 +30,7 @@ func main() {
|
|||||||
// trace.Start(ftrace)
|
// trace.Start(ftrace)
|
||||||
// defer trace.Stop()
|
// defer trace.Stop()
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obipairing.OptionSet)
|
||||||
"obipairing",
|
|
||||||
"align forward with reverse reads with paired reads",
|
|
||||||
obipairing.OptionSet)
|
|
||||||
|
|
||||||
optionParser(os.Args)
|
optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -29,10 +29,7 @@ func main() {
|
|||||||
obidefault.SetParallelFilesRead(obidefault.ParallelWorkers() / 4)
|
obidefault.SetParallelFilesRead(obidefault.ParallelWorkers() / 4)
|
||||||
obidefault.SetBatchSize(10)
|
obidefault.SetBatchSize(10)
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obipcr.OptionSet)
|
||||||
"obipcr",
|
|
||||||
"simulates a PCR on a sequence files",
|
|
||||||
obipcr.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -11,10 +11,7 @@ import (
|
|||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obirefidx.OptionSet)
|
||||||
"obireffamidx",
|
|
||||||
"",
|
|
||||||
obirefidx.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -11,10 +11,7 @@ import (
|
|||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obirefidx.OptionSet)
|
||||||
"obirefidx",
|
|
||||||
"",
|
|
||||||
obirefidx.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -31,10 +31,7 @@ func main() {
|
|||||||
// trace.Start(ftrace)
|
// trace.Start(ftrace)
|
||||||
// defer trace.Stop()
|
// defer trace.Stop()
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obiscript.OptionSet)
|
||||||
"obiscript",
|
|
||||||
"executes a lua script on the input sequences",
|
|
||||||
obiscript.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -31,10 +31,7 @@ func main() {
|
|||||||
// trace.Start(ftrace)
|
// trace.Start(ftrace)
|
||||||
// defer trace.Stop()
|
// defer trace.Stop()
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obisplit.OptionSet)
|
||||||
"obisplit",
|
|
||||||
"",
|
|
||||||
obisplit.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -33,10 +33,7 @@ func main() {
|
|||||||
// trace.Start(ftrace)
|
// trace.Start(ftrace)
|
||||||
// defer trace.Stop()
|
// defer trace.Stop()
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obisummary.OptionSet)
|
||||||
"obisummary",
|
|
||||||
"resume main information from a sequence file",
|
|
||||||
obisummary.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
@@ -11,7 +11,6 @@ import (
|
|||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitag"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitag"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitaxonomy"
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
@@ -40,10 +39,7 @@ func main() {
|
|||||||
obidefault.SetStrictWriteWorker(1)
|
obidefault.SetStrictWriteWorker(1)
|
||||||
obidefault.SetBatchSize(10)
|
obidefault.SetBatchSize(10)
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obitag.OptionSet)
|
||||||
"obitag",
|
|
||||||
"realizes taxonomic assignment",
|
|
||||||
obitag.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
@@ -59,7 +55,7 @@ func main() {
|
|||||||
}
|
}
|
||||||
|
|
||||||
if taxo == nil {
|
if taxo == nil {
|
||||||
taxo, err = references.ExtractTaxonomy(nil, obitaxonomy.CLINewickWithLeaves())
|
taxo, err = references.ExtractTaxonomy(nil)
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("No taxonomy specified or extractable from reference database: %v", err)
|
log.Fatalf("No taxonomy specified or extractable from reference database: %v", err)
|
||||||
@@ -74,12 +70,10 @@ func main() {
|
|||||||
|
|
||||||
var identified obiiter.IBioSequence
|
var identified obiiter.IBioSequence
|
||||||
|
|
||||||
fsrb := fs.Rebatch(obidefault.BatchSize())
|
|
||||||
|
|
||||||
if obitag.CLIGeometricMode() {
|
if obitag.CLIGeometricMode() {
|
||||||
identified = obitag.CLIGeomAssignTaxonomy(fsrb, references, taxo)
|
identified = obitag.CLIGeomAssignTaxonomy(fs, references, taxo)
|
||||||
} else {
|
} else {
|
||||||
identified = obitag.CLIAssignTaxonomy(fsrb, references, taxo)
|
identified = obitag.CLIAssignTaxonomy(fs, references, taxo)
|
||||||
}
|
}
|
||||||
|
|
||||||
obiconvert.CLIWriteBioSequences(identified, true)
|
obiconvert.CLIWriteBioSequences(identified, true)
|
||||||
|
|||||||
@@ -33,10 +33,7 @@ func main() {
|
|||||||
|
|
||||||
obidefault.SetWorkerPerCore(1)
|
obidefault.SetWorkerPerCore(1)
|
||||||
|
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obitagpcr.OptionSet)
|
||||||
"obitagpcr",
|
|
||||||
"split a paired raw read data set per sample",
|
|
||||||
obitagpcr.OptionSet)
|
|
||||||
|
|
||||||
optionParser(os.Args)
|
optionParser(os.Args)
|
||||||
pairs, err := obipairing.CLIPairedSequence()
|
pairs, err := obipairing.CLIPairedSequence()
|
||||||
|
|||||||
@@ -4,11 +4,9 @@ import (
|
|||||||
"os"
|
"os"
|
||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiitercsv"
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obicsv"
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitaxonomy"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitaxonomy"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
|
|
||||||
@@ -16,59 +14,30 @@ import (
|
|||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obitaxonomy.OptionSet)
|
||||||
"obitaxonomy",
|
|
||||||
"manipulates and queries taxonomy",
|
|
||||||
obitaxonomy.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
var iterator *obitax.ITaxon
|
var iterator *obitax.ITaxon
|
||||||
|
|
||||||
if obitaxonomy.CLIDownloadNCBI() {
|
switch {
|
||||||
|
case obitaxonomy.CLIDownloadNCBI():
|
||||||
err := obitaxonomy.CLIDownloadNCBITaxdump()
|
err := obitaxonomy.CLIDownloadNCBITaxdump()
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Errorf("Cannot download NCBI taxonomy: %s", err.Error())
|
log.Errorf("Cannot download NCBI taxonomy: %s", err.Error())
|
||||||
os.Exit(1)
|
os.Exit(1)
|
||||||
}
|
}
|
||||||
os.Exit(0)
|
|
||||||
}
|
|
||||||
|
|
||||||
if !obidefault.HasSelectedTaxonomy() {
|
|
||||||
log.Fatal("you must indicate a taxonomy using the -t or --taxonomy option")
|
|
||||||
}
|
|
||||||
|
|
||||||
switch {
|
|
||||||
case obitaxonomy.CLIAskForRankList():
|
|
||||||
newIter := obiitercsv.NewICSVRecord()
|
|
||||||
newIter.Add(1)
|
|
||||||
newIter.AppendField("rank")
|
|
||||||
go func() {
|
|
||||||
ranks := obitax.DefaultTaxonomy().RankList()
|
|
||||||
data := make([]obiitercsv.CSVRecord, len(ranks))
|
|
||||||
|
|
||||||
for i, rank := range ranks {
|
|
||||||
record := make(obiitercsv.CSVRecord)
|
|
||||||
record["rank"] = rank
|
|
||||||
data[i] = record
|
|
||||||
}
|
|
||||||
newIter.Push(obiitercsv.MakeCSVRecordBatch(obitax.DefaultTaxonomy().Name(), 0, data))
|
|
||||||
newIter.Close()
|
|
||||||
newIter.Done()
|
|
||||||
}()
|
|
||||||
obicsv.CLICSVWriter(newIter, true)
|
|
||||||
obiutils.WaitForLastPipe()
|
|
||||||
os.Exit(0)
|
os.Exit(0)
|
||||||
|
|
||||||
case obitaxonomy.CLIExtractTaxonomy():
|
case obitaxonomy.CLIExtractTaxonomy():
|
||||||
iter, err := obiconvert.CLIReadBioSequences(args...)
|
iter, err := obiconvert.CLIReadBioSequences(args...)
|
||||||
iter = iter.NumberSequences(1, true)
|
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("Cannot extract taxonomy: %v", err)
|
log.Fatalf("Cannot extract taxonomy: %v", err)
|
||||||
}
|
}
|
||||||
|
|
||||||
taxonomy, err := iter.ExtractTaxonomy(obitaxonomy.CLINewickWithLeaves())
|
taxonomy, err := iter.ExtractTaxonomy()
|
||||||
|
|
||||||
if err != nil {
|
if err != nil {
|
||||||
log.Fatalf("Cannot extract taxonomy: %v", err)
|
log.Fatalf("Cannot extract taxonomy: %v", err)
|
||||||
@@ -130,12 +99,7 @@ func main() {
|
|||||||
}
|
}
|
||||||
|
|
||||||
iterator = obitaxonomy.CLITaxonRestrictions(iterator)
|
iterator = obitaxonomy.CLITaxonRestrictions(iterator)
|
||||||
|
|
||||||
if obitaxonomy.CLIAsNewick() {
|
|
||||||
obitaxonomy.CLINewickWriter(iterator, true)
|
|
||||||
} else {
|
|
||||||
obitaxonomy.CLICSVTaxaWriter(iterator, true)
|
obitaxonomy.CLICSVTaxaWriter(iterator, true)
|
||||||
}
|
|
||||||
|
|
||||||
obiutils.WaitForLastPipe()
|
obiutils.WaitForLastPipe()
|
||||||
|
|
||||||
|
|||||||
@@ -33,10 +33,7 @@ func main() {
|
|||||||
|
|
||||||
obidefault.SetBatchSize(10)
|
obidefault.SetBatchSize(10)
|
||||||
obidefault.SetReadQualities(false)
|
obidefault.SetReadQualities(false)
|
||||||
optionParser := obioptions.GenerateOptionParser(
|
optionParser := obioptions.GenerateOptionParser(obiuniq.OptionSet)
|
||||||
"obiuniq",
|
|
||||||
"dereplicate sequence data sets",
|
|
||||||
obiuniq.OptionSet)
|
|
||||||
|
|
||||||
_, args := optionParser(os.Args)
|
_, args := optionParser(os.Args)
|
||||||
|
|
||||||
|
|||||||
+2
-2
@@ -3,13 +3,13 @@ package main
|
|||||||
import (
|
import (
|
||||||
"os"
|
"os"
|
||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
||||||
)
|
)
|
||||||
|
|
||||||
func main() {
|
func main() {
|
||||||
|
|
||||||
obiformats.DetectTaxonomyFormat(os.Args[1])
|
obitax.DetectTaxonomyFormat(os.Args[1])
|
||||||
println(obiutils.RemoveAllExt("toto/tutu/test.txt"))
|
println(obiutils.RemoveAllExt("toto/tutu/test.txt"))
|
||||||
println(obiutils.Basename("toto/tutu/test.txt"))
|
println(obiutils.Basename("toto/tutu/test.txt"))
|
||||||
|
|
||||||
|
|||||||
-1
Submodule ecoprimers deleted from b7552200bd
@@ -1,23 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
remote="$1"
|
|
||||||
#url="$2"
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[Pre-Push tests @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
current_branch=$(git symbolic-ref --short head)
|
|
||||||
|
|
||||||
cmd="make githubtests"
|
|
||||||
|
|
||||||
if [[ $current_branch = "master" ]]; then
|
|
||||||
log "you are on $current_branch, running build test"
|
|
||||||
if ! eval "$cmd"; then
|
|
||||||
log "Pre-push tests failed $cmd"
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
fi
|
|
||||||
|
|
||||||
log "Tests are OK, ready to push on $remote"
|
|
||||||
exit 0
|
|
||||||
@@ -1,14 +1,11 @@
|
|||||||
module git.metabarcoding.org/obitools/obitools4/obitools4
|
module git.metabarcoding.org/obitools/obitools4/obitools4
|
||||||
|
|
||||||
go 1.23.4
|
go 1.23.1
|
||||||
|
|
||||||
toolchain go1.24.2
|
|
||||||
|
|
||||||
require (
|
require (
|
||||||
github.com/DavidGamba/go-getoptions v0.28.0
|
github.com/DavidGamba/go-getoptions v0.28.0
|
||||||
github.com/PaesslerAG/gval v1.2.2
|
github.com/PaesslerAG/gval v1.2.2
|
||||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df
|
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df
|
||||||
github.com/buger/jsonparser v1.1.1
|
|
||||||
github.com/chen3feng/stl4go v0.1.1
|
github.com/chen3feng/stl4go v0.1.1
|
||||||
github.com/dlclark/regexp2 v1.11.4
|
github.com/dlclark/regexp2 v1.11.4
|
||||||
github.com/goccy/go-json v0.10.3
|
github.com/goccy/go-json v0.10.3
|
||||||
@@ -17,26 +14,28 @@ require (
|
|||||||
github.com/rrethy/ahocorasick v1.0.0
|
github.com/rrethy/ahocorasick v1.0.0
|
||||||
github.com/schollz/progressbar/v3 v3.13.1
|
github.com/schollz/progressbar/v3 v3.13.1
|
||||||
github.com/sirupsen/logrus v1.9.3
|
github.com/sirupsen/logrus v1.9.3
|
||||||
github.com/stretchr/testify v1.8.4
|
github.com/stretchr/testify v1.10.0
|
||||||
github.com/tevino/abool/v2 v2.1.0
|
github.com/tevino/abool/v2 v2.1.0
|
||||||
github.com/yuin/gopher-lua v1.1.1
|
github.com/yuin/gopher-lua v1.1.1
|
||||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa
|
golang.org/x/exp v0.0.0-20231006140011-7918f672742d
|
||||||
gonum.org/v1/gonum v0.14.0
|
gonum.org/v1/gonum v0.14.0
|
||||||
gopkg.in/yaml.v3 v3.0.1
|
gopkg.in/yaml.v3 v3.0.1
|
||||||
scientificgo.org/special v0.0.0
|
scientificgo.org/special v0.0.0
|
||||||
)
|
)
|
||||||
|
|
||||||
require (
|
require (
|
||||||
github.com/RoaringBitmap/roaring v1.9.4 // indirect
|
github.com/Clever/csvlint v0.3.0 // indirect
|
||||||
github.com/bits-and-blooms/bitset v1.12.0 // indirect
|
github.com/TuftsBCB/io v0.0.0-20140121014543-22b94e9b23f9 // indirect
|
||||||
|
github.com/buger/jsonparser v1.1.1 // indirect
|
||||||
|
github.com/chzyer/readline v0.0.0-20180603132655-2972be24d48e // indirect
|
||||||
github.com/davecgh/go-spew v1.1.1 // indirect
|
github.com/davecgh/go-spew v1.1.1 // indirect
|
||||||
|
github.com/ef-ds/deque/v2 v2.0.2 // indirect
|
||||||
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 // indirect
|
github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 // indirect
|
||||||
github.com/kr/pretty v0.3.1 // indirect
|
github.com/kr/pretty v0.3.0 // indirect
|
||||||
github.com/kr/text v0.2.0 // indirect
|
github.com/kr/text v0.2.0 // indirect
|
||||||
github.com/mschoch/smat v0.2.0 // indirect
|
|
||||||
github.com/pelletier/go-toml/v2 v2.2.4 // indirect
|
|
||||||
github.com/pmezard/go-difflib v1.0.0 // indirect
|
github.com/pmezard/go-difflib v1.0.0 // indirect
|
||||||
github.com/rogpeppe/go-internal v1.12.0 // indirect
|
github.com/rogpeppe/go-internal v1.6.1 // indirect
|
||||||
|
go.etcd.io/bbolt v1.4.0 // indirect
|
||||||
)
|
)
|
||||||
|
|
||||||
require (
|
require (
|
||||||
@@ -49,8 +48,8 @@ require (
|
|||||||
github.com/rivo/uniseg v0.4.4 // indirect
|
github.com/rivo/uniseg v0.4.4 // indirect
|
||||||
github.com/shopspring/decimal v1.3.1 // indirect
|
github.com/shopspring/decimal v1.3.1 // indirect
|
||||||
github.com/ulikunitz/xz v0.5.11
|
github.com/ulikunitz/xz v0.5.11
|
||||||
golang.org/x/net v0.35.0 // indirect
|
golang.org/x/net v0.17.0 // indirect
|
||||||
golang.org/x/sys v0.30.0 // indirect
|
golang.org/x/sys v0.29.0 // indirect
|
||||||
golang.org/x/term v0.29.0 // indirect
|
golang.org/x/term v0.13.0 // indirect
|
||||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c
|
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c
|
||||||
)
|
)
|
||||||
|
|||||||
@@ -1,19 +1,21 @@
|
|||||||
|
github.com/Clever/csvlint v0.3.0 h1:58WEFXWy+i0fCbxTXscR2QwYESRuAUFjEGLgZs6j2iU=
|
||||||
|
github.com/Clever/csvlint v0.3.0/go.mod h1:+wLRuW/bI8NhpRoeyUBxqKsK35OhvgJhXHSWdKp5XJU=
|
||||||
github.com/DavidGamba/go-getoptions v0.28.0 h1:18wgEvfZdrlfIhVDGEBO3Dl0fkOyXqXLa0tLMCKxM1c=
|
github.com/DavidGamba/go-getoptions v0.28.0 h1:18wgEvfZdrlfIhVDGEBO3Dl0fkOyXqXLa0tLMCKxM1c=
|
||||||
github.com/DavidGamba/go-getoptions v0.28.0/go.mod h1:zE97E3PR9P3BI/HKyNYgdMlYxodcuiC6W68KIgeYT84=
|
github.com/DavidGamba/go-getoptions v0.28.0/go.mod h1:zE97E3PR9P3BI/HKyNYgdMlYxodcuiC6W68KIgeYT84=
|
||||||
github.com/PaesslerAG/gval v1.2.2 h1:Y7iBzhgE09IGTt5QgGQ2IdaYYYOU134YGHBThD+wm9E=
|
github.com/PaesslerAG/gval v1.2.2 h1:Y7iBzhgE09IGTt5QgGQ2IdaYYYOU134YGHBThD+wm9E=
|
||||||
github.com/PaesslerAG/gval v1.2.2/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
|
github.com/PaesslerAG/gval v1.2.2/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
|
||||||
github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
|
github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
|
||||||
github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
|
github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
|
||||||
github.com/RoaringBitmap/roaring v1.9.4 h1:yhEIoH4YezLYT04s1nHehNO64EKFTop/wBhxv2QzDdQ=
|
github.com/TuftsBCB/io v0.0.0-20140121014543-22b94e9b23f9 h1:Zc1/GNsUpgZR9qm1EmRSKrnOHA7CCd0bIzGdq0cREN0=
|
||||||
github.com/RoaringBitmap/roaring v1.9.4/go.mod h1:6AXUsoIEzDTFFQCe1RbGA6uFONMhvejWj5rqITANK90=
|
github.com/TuftsBCB/io v0.0.0-20140121014543-22b94e9b23f9/go.mod h1:PZyV4WA3NpqtezSY0h6E6NARAmdDm0qwrydveOyR5Gc=
|
||||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
|
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
|
||||||
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
|
github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
|
||||||
github.com/bits-and-blooms/bitset v1.12.0 h1:U/q1fAF7xXRhFCrhROzIfffYnu+dlS38vCZtmFVPHmA=
|
|
||||||
github.com/bits-and-blooms/bitset v1.12.0/go.mod h1:7hO7Gc7Pp1vODcmWvKMRA9BNmbv6a/7QIWpPxHddWR8=
|
|
||||||
github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
|
github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
|
||||||
github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
|
github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
|
||||||
github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
|
github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
|
||||||
github.com/chen3feng/stl4go v0.1.1/go.mod h1:5ml3psLgETJjRJnMbPE+JiHLrCpt+Ajc2weeTECXzWU=
|
github.com/chen3feng/stl4go v0.1.1/go.mod h1:5ml3psLgETJjRJnMbPE+JiHLrCpt+Ajc2weeTECXzWU=
|
||||||
|
github.com/chzyer/readline v0.0.0-20180603132655-2972be24d48e h1:fY5BOSpyZCqRo5OhCuC+XN+r/bBCmeuuJtjz+bCNIf8=
|
||||||
|
github.com/chzyer/readline v0.0.0-20180603132655-2972be24d48e/go.mod h1:nSuG5e5PlCu98SY8svDHJxuZscDgtXS6KTTbou5AhLI=
|
||||||
github.com/creack/pty v1.1.9/go.mod h1:oKZEueFk5CKHvIhNR5MUki03XCEU+Q6VDXinZuGJ33E=
|
github.com/creack/pty v1.1.9/go.mod h1:oKZEueFk5CKHvIhNR5MUki03XCEU+Q6VDXinZuGJ33E=
|
||||||
github.com/davecgh/go-spew v1.1.0/go.mod h1:J7Y8YcW2NihsgmVo/mv3lAwl/skON4iLHjSsI+c5H38=
|
github.com/davecgh/go-spew v1.1.0/go.mod h1:J7Y8YcW2NihsgmVo/mv3lAwl/skON4iLHjSsI+c5H38=
|
||||||
github.com/davecgh/go-spew v1.1.1 h1:vj9j/u1bqnvCEfJOwUhtlOARqs3+rkHYY13jYWTU97c=
|
github.com/davecgh/go-spew v1.1.1 h1:vj9j/u1bqnvCEfJOwUhtlOARqs3+rkHYY13jYWTU97c=
|
||||||
@@ -23,6 +25,8 @@ github.com/dlclark/regexp2 v1.11.4/go.mod h1:DHkYz0B9wPfa6wondMfaivmHpzrQ3v9q8cn
|
|||||||
github.com/dsnet/compress v0.0.1 h1:PlZu0n3Tuv04TzpfPbrnI0HW/YwodEXDS+oPKahKF0Q=
|
github.com/dsnet/compress v0.0.1 h1:PlZu0n3Tuv04TzpfPbrnI0HW/YwodEXDS+oPKahKF0Q=
|
||||||
github.com/dsnet/compress v0.0.1/go.mod h1:Aw8dCMJ7RioblQeTqt88akK31OvO8Dhf5JflhBbQEHo=
|
github.com/dsnet/compress v0.0.1/go.mod h1:Aw8dCMJ7RioblQeTqt88akK31OvO8Dhf5JflhBbQEHo=
|
||||||
github.com/dsnet/golib v0.0.0-20171103203638-1ea166775780/go.mod h1:Lj+Z9rebOhdfkVLjJ8T6VcRQv3SXugXy999NBtR9aFY=
|
github.com/dsnet/golib v0.0.0-20171103203638-1ea166775780/go.mod h1:Lj+Z9rebOhdfkVLjJ8T6VcRQv3SXugXy999NBtR9aFY=
|
||||||
|
github.com/ef-ds/deque/v2 v2.0.2 h1:GQtDK1boBMu/qsNbSLQsqzwNptaioxZI39X3UxT5ALA=
|
||||||
|
github.com/ef-ds/deque/v2 v2.0.2/go.mod h1:hoZy4VooWLhRT4uS+sSCilfgBQUNptJU2FGqr08a5sc=
|
||||||
github.com/gabriel-vasile/mimetype v1.4.3 h1:in2uUcidCuFcDKtdcBxlR0rJ1+fsokWf+uqxgUFjbI0=
|
github.com/gabriel-vasile/mimetype v1.4.3 h1:in2uUcidCuFcDKtdcBxlR0rJ1+fsokWf+uqxgUFjbI0=
|
||||||
github.com/gabriel-vasile/mimetype v1.4.3/go.mod h1:d8uq/6HKRL6CGdk+aubisF/M5GcPfT7nKyLpA0lbSSk=
|
github.com/gabriel-vasile/mimetype v1.4.3/go.mod h1:d8uq/6HKRL6CGdk+aubisF/M5GcPfT7nKyLpA0lbSSk=
|
||||||
github.com/goccy/go-json v0.10.3 h1:KZ5WoDbxAIgm2HNbYckL0se1fHD6rz5j4ywS6ebzDqA=
|
github.com/goccy/go-json v0.10.3 h1:KZ5WoDbxAIgm2HNbYckL0se1fHD6rz5j4ywS6ebzDqA=
|
||||||
@@ -38,9 +42,10 @@ github.com/klauspost/compress v1.17.2/go.mod h1:ntbaceVETuRiXiv4DpjP66DpAtAGkEQs
|
|||||||
github.com/klauspost/cpuid v1.2.0/go.mod h1:Pj4uuM528wm8OyEC2QMXAi2YiTZ96dNQPGgoMS4s3ek=
|
github.com/klauspost/cpuid v1.2.0/go.mod h1:Pj4uuM528wm8OyEC2QMXAi2YiTZ96dNQPGgoMS4s3ek=
|
||||||
github.com/klauspost/pgzip v1.2.6 h1:8RXeL5crjEUFnR2/Sn6GJNWtSQ3Dk8pq4CL3jvdDyjU=
|
github.com/klauspost/pgzip v1.2.6 h1:8RXeL5crjEUFnR2/Sn6GJNWtSQ3Dk8pq4CL3jvdDyjU=
|
||||||
github.com/klauspost/pgzip v1.2.6/go.mod h1:Ch1tH69qFZu15pkjo5kYi6mth2Zzwzt50oCQKQE9RUs=
|
github.com/klauspost/pgzip v1.2.6/go.mod h1:Ch1tH69qFZu15pkjo5kYi6mth2Zzwzt50oCQKQE9RUs=
|
||||||
|
github.com/kr/pretty v0.1.0/go.mod h1:dAy3ld7l9f0ibDNOQOHHMYYIIbhfbHSm3C4ZsoJORNo=
|
||||||
github.com/kr/pretty v0.2.1/go.mod h1:ipq/a2n7PKx3OHsz4KJII5eveXtPO4qwEXGdVfWzfnI=
|
github.com/kr/pretty v0.2.1/go.mod h1:ipq/a2n7PKx3OHsz4KJII5eveXtPO4qwEXGdVfWzfnI=
|
||||||
github.com/kr/pretty v0.3.1 h1:flRD4NNwYAUpkphVc1HcthR4KEIFJ65n8Mw5qdRn3LE=
|
github.com/kr/pretty v0.3.0 h1:WgNl7dwNpEZ6jJ9k1snq4pZsg7DOEN8hP9Xw0Tsjwk0=
|
||||||
github.com/kr/pretty v0.3.1/go.mod h1:hoEshYVHaxMs3cyo3Yncou5ZscifuDolrwPKZanG3xk=
|
github.com/kr/pretty v0.3.0/go.mod h1:640gp4NfQd8pI5XOwp5fnNeVWj67G7CFk/SaSQn7NBk=
|
||||||
github.com/kr/pty v1.1.1/go.mod h1:pFQYn66WHrOpPYNljwOMqo10TkYh1fy3cYio2l3bCsQ=
|
github.com/kr/pty v1.1.1/go.mod h1:pFQYn66WHrOpPYNljwOMqo10TkYh1fy3cYio2l3bCsQ=
|
||||||
github.com/kr/text v0.1.0/go.mod h1:4Jbv+DJW3UT/LiOwJeYQe1efqtUx/iVham/4vfdArNI=
|
github.com/kr/text v0.1.0/go.mod h1:4Jbv+DJW3UT/LiOwJeYQe1efqtUx/iVham/4vfdArNI=
|
||||||
github.com/kr/text v0.2.0 h1:5Nx0Ya0ZqY2ygV366QzturHI13Jq95ApcVaJBhpS+AY=
|
github.com/kr/text v0.2.0 h1:5Nx0Ya0ZqY2ygV366QzturHI13Jq95ApcVaJBhpS+AY=
|
||||||
@@ -51,21 +56,15 @@ github.com/mattn/go-runewidth v0.0.15 h1:UNAjwbU9l54TA3KzvqLGxwWjHmMgBUVhBiTjelZ
|
|||||||
github.com/mattn/go-runewidth v0.0.15/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
|
github.com/mattn/go-runewidth v0.0.15/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
|
||||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2EmQ4l5rM/4FEfDWcRD+abF5XlKShorW5LRoQ=
|
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2EmQ4l5rM/4FEfDWcRD+abF5XlKShorW5LRoQ=
|
||||||
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
|
github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
|
||||||
github.com/mschoch/smat v0.2.0 h1:8imxQsjDm8yFEAVBe7azKmKSgzSkZXDuKkSq9374khM=
|
|
||||||
github.com/mschoch/smat v0.2.0/go.mod h1:kc9mz7DoBKqDyiRL7VZN8KvXQMWeTaVnttLRXOlotKw=
|
|
||||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
|
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
|
||||||
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58/go.mod h1:DXv8WO4yhMYhSNPKjeNKa5WY9YCIEBRbNzFFPJbWO6Y=
|
github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58/go.mod h1:DXv8WO4yhMYhSNPKjeNKa5WY9YCIEBRbNzFFPJbWO6Y=
|
||||||
github.com/pelletier/go-toml/v2 v2.2.4 h1:mye9XuhQ6gvn5h28+VilKrrPoQVanw5PMw/TB0t5Ec4=
|
|
||||||
github.com/pelletier/go-toml/v2 v2.2.4/go.mod h1:2gIqNv+qfxSVS7cM2xJQKtLSTLUE9V8t9Stt+h56mCY=
|
|
||||||
github.com/pkg/diff v0.0.0-20210226163009-20ebb0f2a09e/go.mod h1:pJLUxLENpZxwdsKMEsNbx1VGcRFpLqf3715MtcvvzbA=
|
|
||||||
github.com/pmezard/go-difflib v1.0.0 h1:4DBwDE0NGyQoBHbLQYPwSUPoCMWR5BEzIk/f1lZbAQM=
|
github.com/pmezard/go-difflib v1.0.0 h1:4DBwDE0NGyQoBHbLQYPwSUPoCMWR5BEzIk/f1lZbAQM=
|
||||||
github.com/pmezard/go-difflib v1.0.0/go.mod h1:iKH77koFhYxTK1pcRnkKkqfTogsbg7gZNVY4sRDYZ/4=
|
github.com/pmezard/go-difflib v1.0.0/go.mod h1:iKH77koFhYxTK1pcRnkKkqfTogsbg7gZNVY4sRDYZ/4=
|
||||||
github.com/rivo/uniseg v0.2.0/go.mod h1:J6wj4VEh+S6ZtnVlnTBMWIodfgj8LQOQFoIToxlJtxc=
|
github.com/rivo/uniseg v0.2.0/go.mod h1:J6wj4VEh+S6ZtnVlnTBMWIodfgj8LQOQFoIToxlJtxc=
|
||||||
github.com/rivo/uniseg v0.4.4 h1:8TfxU8dW6PdqD27gjM8MVNuicgxIjxpm4K7x4jp8sis=
|
github.com/rivo/uniseg v0.4.4 h1:8TfxU8dW6PdqD27gjM8MVNuicgxIjxpm4K7x4jp8sis=
|
||||||
github.com/rivo/uniseg v0.4.4/go.mod h1:FN3SvrM+Zdj16jyLfmOkMNblXMcoc8DfTHruCPUcx88=
|
github.com/rivo/uniseg v0.4.4/go.mod h1:FN3SvrM+Zdj16jyLfmOkMNblXMcoc8DfTHruCPUcx88=
|
||||||
github.com/rogpeppe/go-internal v1.9.0/go.mod h1:WtVeX8xhTBvf0smdhujwtBcq4Qrzq/fJaraNFVN+nFs=
|
github.com/rogpeppe/go-internal v1.6.1 h1:/FiVV8dS/e+YqF2JvO3yXRFbBLTIuSDkuC7aBOAvL+k=
|
||||||
github.com/rogpeppe/go-internal v1.12.0 h1:exVL4IDcn6na9z1rAb56Vxr+CgyK3nn3O+epU5NdKM8=
|
github.com/rogpeppe/go-internal v1.6.1/go.mod h1:xXDCJY+GAPziupqXw64V24skbSoqbTEfhy4qGm1nDQc=
|
||||||
github.com/rogpeppe/go-internal v1.12.0/go.mod h1:E+RYuTGaKKdloAfM02xzb0FW3Paa99yedzYV+kq4uf4=
|
|
||||||
github.com/rrethy/ahocorasick v1.0.0 h1:YKkCB+E5PXc0xmLfMrWbfNht8vG9Re97IHSWZk/Lk8E=
|
github.com/rrethy/ahocorasick v1.0.0 h1:YKkCB+E5PXc0xmLfMrWbfNht8vG9Re97IHSWZk/Lk8E=
|
||||||
github.com/rrethy/ahocorasick v1.0.0/go.mod h1:nq8oScE7Vy1rOppoQxpQiiDmPHuKCuk9rXrNcxUV3R0=
|
github.com/rrethy/ahocorasick v1.0.0/go.mod h1:nq8oScE7Vy1rOppoQxpQiiDmPHuKCuk9rXrNcxUV3R0=
|
||||||
github.com/schollz/progressbar/v3 v3.13.1 h1:o8rySDYiQ59Mwzy2FELeHY5ZARXZTVJC7iHD6PEFUiE=
|
github.com/schollz/progressbar/v3 v3.13.1 h1:o8rySDYiQ59Mwzy2FELeHY5ZARXZTVJC7iHD6PEFUiE=
|
||||||
@@ -76,9 +75,12 @@ github.com/sirupsen/logrus v1.9.3 h1:dueUQJ1C2q9oE3F7wvmSGAaVtTmUizReu6fjN8uqzbQ
|
|||||||
github.com/sirupsen/logrus v1.9.3/go.mod h1:naHLuLoDiP4jHNo9R0sCBMtWGeIprob74mVsIT4qYEQ=
|
github.com/sirupsen/logrus v1.9.3/go.mod h1:naHLuLoDiP4jHNo9R0sCBMtWGeIprob74mVsIT4qYEQ=
|
||||||
github.com/stretchr/objx v0.1.0/go.mod h1:HFkY916IF+rwdDfMAkV7OtwuqBVzrE8GR6GFx+wExME=
|
github.com/stretchr/objx v0.1.0/go.mod h1:HFkY916IF+rwdDfMAkV7OtwuqBVzrE8GR6GFx+wExME=
|
||||||
github.com/stretchr/testify v1.3.0/go.mod h1:M5WIy9Dh21IEIfnGCwXGc5bZfKNJtfHm1UVUgZn+9EI=
|
github.com/stretchr/testify v1.3.0/go.mod h1:M5WIy9Dh21IEIfnGCwXGc5bZfKNJtfHm1UVUgZn+9EI=
|
||||||
|
github.com/stretchr/testify v1.6.1/go.mod h1:6Fq8oRcR53rry900zMqJjRRixrwX3KX962/h/Wwjteg=
|
||||||
github.com/stretchr/testify v1.7.0/go.mod h1:6Fq8oRcR53rry900zMqJjRRixrwX3KX962/h/Wwjteg=
|
github.com/stretchr/testify v1.7.0/go.mod h1:6Fq8oRcR53rry900zMqJjRRixrwX3KX962/h/Wwjteg=
|
||||||
github.com/stretchr/testify v1.8.4 h1:CcVxjf3Q8PM0mHUKJCdn+eZZtm5yQwehR5yeSVQQcUk=
|
github.com/stretchr/testify v1.8.4 h1:CcVxjf3Q8PM0mHUKJCdn+eZZtm5yQwehR5yeSVQQcUk=
|
||||||
github.com/stretchr/testify v1.8.4/go.mod h1:sz/lmYIOXD/1dqDmKjjqLyZ2RngseejIcXlSw2iwfAo=
|
github.com/stretchr/testify v1.8.4/go.mod h1:sz/lmYIOXD/1dqDmKjjqLyZ2RngseejIcXlSw2iwfAo=
|
||||||
|
github.com/stretchr/testify v1.10.0 h1:Xv5erBjTwe/5IxqUQTdXv5kgmIvbHo3QQyRwhJsOfJA=
|
||||||
|
github.com/stretchr/testify v1.10.0/go.mod h1:r2ic/lqez/lEtzL7wO/rwa5dbSLXVDPFyf8C91i36aY=
|
||||||
github.com/tevino/abool/v2 v2.1.0 h1:7w+Vf9f/5gmKT4m4qkayb33/92M+Um45F2BkHOR+L/c=
|
github.com/tevino/abool/v2 v2.1.0 h1:7w+Vf9f/5gmKT4m4qkayb33/92M+Um45F2BkHOR+L/c=
|
||||||
github.com/tevino/abool/v2 v2.1.0/go.mod h1:+Lmlqk6bHDWHqN1cbxqhwEAwMPXgc8I1SDEamtseuXY=
|
github.com/tevino/abool/v2 v2.1.0/go.mod h1:+Lmlqk6bHDWHqN1cbxqhwEAwMPXgc8I1SDEamtseuXY=
|
||||||
github.com/ulikunitz/xz v0.5.6/go.mod h1:2bypXElzHzzJZwzH67Y6wb67pO62Rzfn7BSiF4ABRW8=
|
github.com/ulikunitz/xz v0.5.6/go.mod h1:2bypXElzHzzJZwzH67Y6wb67pO62Rzfn7BSiF4ABRW8=
|
||||||
@@ -86,23 +88,29 @@ github.com/ulikunitz/xz v0.5.11 h1:kpFauv27b6ynzBNT/Xy+1k+fK4WswhN/6PN5WhFAGw8=
|
|||||||
github.com/ulikunitz/xz v0.5.11/go.mod h1:nbz6k7qbPmH4IRqmfOplQw/tblSgqTqBwxkY0oWt/14=
|
github.com/ulikunitz/xz v0.5.11/go.mod h1:nbz6k7qbPmH4IRqmfOplQw/tblSgqTqBwxkY0oWt/14=
|
||||||
github.com/yuin/gopher-lua v1.1.1 h1:kYKnWBjvbNP4XLT3+bPEwAXJx262OhaHDWDVOPjL46M=
|
github.com/yuin/gopher-lua v1.1.1 h1:kYKnWBjvbNP4XLT3+bPEwAXJx262OhaHDWDVOPjL46M=
|
||||||
github.com/yuin/gopher-lua v1.1.1/go.mod h1:GBR0iDaNXjAgGg9zfCvksxSRnQx76gclCIb7kdAd1Pw=
|
github.com/yuin/gopher-lua v1.1.1/go.mod h1:GBR0iDaNXjAgGg9zfCvksxSRnQx76gclCIb7kdAd1Pw=
|
||||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa h1:FRnLl4eNAQl8hwxVVC17teOw8kdjVDVAiFMtgUdTSRQ=
|
go.etcd.io/bbolt v1.4.0 h1:TU77id3TnN/zKr7CO/uk+fBCwF2jGcMuw2B/FMAzYIk=
|
||||||
golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa/go.mod h1:zk2irFbV9DP96SEBUUAy67IdHUaZuSnrz1n472HUCLE=
|
go.etcd.io/bbolt v1.4.0/go.mod h1:AsD+OCi/qPN1giOX1aiLAha3o1U8rAz65bvN4j0sRuk=
|
||||||
golang.org/x/net v0.35.0 h1:T5GQRQb2y08kTAByq9L4/bz8cipCdA8FbRTXewonqY8=
|
golang.org/x/exp v0.0.0-20231006140011-7918f672742d h1:jtJma62tbqLibJ5sFQz8bKtEM8rJBtfilJ2qTU199MI=
|
||||||
golang.org/x/net v0.35.0/go.mod h1:EglIi67kWsHKlRzzVMUD93VMSWGFOMSZgxFjparz1Qk=
|
golang.org/x/exp v0.0.0-20231006140011-7918f672742d/go.mod h1:ldy0pHrwJyGW56pPQzzkH36rKxoZW1tw7ZJpeKx+hdo=
|
||||||
|
golang.org/x/net v0.17.0 h1:pVaXccu2ozPjCXewfr1S7xza/zcXTity9cCdXQYSjIM=
|
||||||
|
golang.org/x/net v0.17.0/go.mod h1:NxSsAGuq816PNPmqtQdLE42eU2Fs7NoRIZrHJAlaCOE=
|
||||||
golang.org/x/sys v0.0.0-20220715151400-c0bba94af5f8/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
golang.org/x/sys v0.0.0-20220715151400-c0bba94af5f8/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
||||||
golang.org/x/sys v0.0.0-20220811171246-fbc7d0a398ab/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
golang.org/x/sys v0.0.0-20220811171246-fbc7d0a398ab/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
||||||
golang.org/x/sys v0.6.0/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
golang.org/x/sys v0.6.0/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
|
||||||
golang.org/x/sys v0.30.0 h1:QjkSwP/36a20jFYWkSue1YwXzLmsV5Gfq7Eiy72C1uc=
|
golang.org/x/sys v0.17.0 h1:25cE3gD+tdBA7lp7QfhuV+rJiE9YXTcS3VG1SqssI/Y=
|
||||||
golang.org/x/sys v0.30.0/go.mod h1:/VUhepiaJMQUp4+oa/7Zr1D23ma6VTLIYjOOTFZPUcA=
|
golang.org/x/sys v0.17.0/go.mod h1:/VUhepiaJMQUp4+oa/7Zr1D23ma6VTLIYjOOTFZPUcA=
|
||||||
|
golang.org/x/sys v0.29.0 h1:TPYlXGxvx1MGTn2GiZDhnjPA9wZzZeGKHHmKhHYvgaU=
|
||||||
|
golang.org/x/sys v0.29.0/go.mod h1:/VUhepiaJMQUp4+oa/7Zr1D23ma6VTLIYjOOTFZPUcA=
|
||||||
golang.org/x/term v0.6.0/go.mod h1:m6U89DPEgQRMq3DNkDClhWw02AUbt2daBVO4cn4Hv9U=
|
golang.org/x/term v0.6.0/go.mod h1:m6U89DPEgQRMq3DNkDClhWw02AUbt2daBVO4cn4Hv9U=
|
||||||
golang.org/x/term v0.29.0 h1:L6pJp37ocefwRRtYPKSWOWzOtWSxVajvz2ldH/xi3iU=
|
golang.org/x/term v0.13.0 h1:bb+I9cTfFazGW51MZqBVmZy7+JEJMouUHTUSKVQLBek=
|
||||||
golang.org/x/term v0.29.0/go.mod h1:6bl4lRlvVuDgSf3179VpIxBF0o10JUpXWOnI7nErv7s=
|
golang.org/x/term v0.13.0/go.mod h1:LTmsnFJwVN6bCy1rVCoS+qHT1HhALEFxKncY3WNNh4U=
|
||||||
gonum.org/v1/gonum v0.14.0 h1:2NiG67LD1tEH0D7kM+ps2V+fXmsAnpUeec7n8tcr4S0=
|
gonum.org/v1/gonum v0.14.0 h1:2NiG67LD1tEH0D7kM+ps2V+fXmsAnpUeec7n8tcr4S0=
|
||||||
gonum.org/v1/gonum v0.14.0/go.mod h1:AoWeoz0becf9QMWtE8iWXNXc27fK4fNeHNf/oMejGfU=
|
gonum.org/v1/gonum v0.14.0/go.mod h1:AoWeoz0becf9QMWtE8iWXNXc27fK4fNeHNf/oMejGfU=
|
||||||
gopkg.in/check.v1 v0.0.0-20161208181325-20d25e280405/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0=
|
gopkg.in/check.v1 v0.0.0-20161208181325-20d25e280405/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0=
|
||||||
|
gopkg.in/check.v1 v1.0.0-20180628173108-788fd7840127/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0=
|
||||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c h1:Hei/4ADfdWqJk1ZMxUNpqntNwaWcugrBjAiHlqqRiVk=
|
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c h1:Hei/4ADfdWqJk1ZMxUNpqntNwaWcugrBjAiHlqqRiVk=
|
||||||
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c/go.mod h1:JHkPIbrfpd72SG/EVd6muEfDQjcINNoR0C8j2r3qZ4Q=
|
gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c/go.mod h1:JHkPIbrfpd72SG/EVd6muEfDQjcINNoR0C8j2r3qZ4Q=
|
||||||
|
gopkg.in/errgo.v2 v2.1.0/go.mod h1:hNsd1EY+bozCKY1Ytp96fpM3vjJbqLJn88ws8XvfDNI=
|
||||||
gopkg.in/yaml.v3 v3.0.0-20200313102051-9f266ea9e77c/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
|
gopkg.in/yaml.v3 v3.0.0-20200313102051-9f266ea9e77c/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
|
||||||
gopkg.in/yaml.v3 v3.0.1 h1:fxVm/GzAzEWqLHuvctI91KS9hhNmmWOoWu0XTYJS7CA=
|
gopkg.in/yaml.v3 v3.0.1 h1:fxVm/GzAzEWqLHuvctI91KS9hhNmmWOoWu0XTYJS7CA=
|
||||||
gopkg.in/yaml.v3 v3.0.1/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
|
gopkg.in/yaml.v3 v3.0.1/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
|
||||||
|
|||||||
+6
-12
@@ -5,8 +5,6 @@ github.com/ajstarks/svgo v0.0.0-20211024235047-1546f124cd8b/go.mod h1:1KcenG0jGW
|
|||||||
github.com/chzyer/logex v1.1.10 h1:Swpa1K6QvQznwJRcfTfQJmTE72DqScAa40E+fbHEXEE=
|
github.com/chzyer/logex v1.1.10 h1:Swpa1K6QvQznwJRcfTfQJmTE72DqScAa40E+fbHEXEE=
|
||||||
github.com/chzyer/logex v1.1.10/go.mod h1:+Ywpsq7O8HXn0nuIou7OrIPyXbp3wmkHB+jjWRnGsAI=
|
github.com/chzyer/logex v1.1.10/go.mod h1:+Ywpsq7O8HXn0nuIou7OrIPyXbp3wmkHB+jjWRnGsAI=
|
||||||
github.com/chzyer/logex v1.2.0 h1:+eqR0HfOetur4tgnC8ftU5imRnhi4te+BadWS95c5AM=
|
github.com/chzyer/logex v1.2.0 h1:+eqR0HfOetur4tgnC8ftU5imRnhi4te+BadWS95c5AM=
|
||||||
github.com/chzyer/readline v0.0.0-20180603132655-2972be24d48e h1:fY5BOSpyZCqRo5OhCuC+XN+r/bBCmeuuJtjz+bCNIf8=
|
|
||||||
github.com/chzyer/readline v0.0.0-20180603132655-2972be24d48e/go.mod h1:nSuG5e5PlCu98SY8svDHJxuZscDgtXS6KTTbou5AhLI=
|
|
||||||
github.com/chzyer/test v0.0.0-20180213035817-a1ea475d72b1 h1:q763qf9huN11kDQavWsoZXJNW3xEE4JJyHa5Q25/sd8=
|
github.com/chzyer/test v0.0.0-20180213035817-a1ea475d72b1 h1:q763qf9huN11kDQavWsoZXJNW3xEE4JJyHa5Q25/sd8=
|
||||||
github.com/chzyer/test v0.0.0-20180213035817-a1ea475d72b1/go.mod h1:Q3SI9o4m/ZMnBNeIyt5eFwwo7qiLfzFZmjNmxjkiQlU=
|
github.com/chzyer/test v0.0.0-20180213035817-a1ea475d72b1/go.mod h1:Q3SI9o4m/ZMnBNeIyt5eFwwo7qiLfzFZmjNmxjkiQlU=
|
||||||
github.com/chzyer/test v0.0.0-20210722231415-061457976a23 h1:dZ0/VyGgQdVGAss6Ju0dt5P0QltE0SFY5Woh6hbIfiQ=
|
github.com/chzyer/test v0.0.0-20210722231415-061457976a23 h1:dZ0/VyGgQdVGAss6Ju0dt5P0QltE0SFY5Woh6hbIfiQ=
|
||||||
@@ -19,46 +17,42 @@ github.com/go-latex/latex v0.0.0-20230307184459-12ec69307ad9 h1:NxXI5pTAtpEaU49b
|
|||||||
github.com/go-latex/latex v0.0.0-20230307184459-12ec69307ad9/go.mod h1:gWuR/CrFDDeVRFQwHPvsv9soJVB/iqymhuZQuJ3a9OM=
|
github.com/go-latex/latex v0.0.0-20230307184459-12ec69307ad9/go.mod h1:gWuR/CrFDDeVRFQwHPvsv9soJVB/iqymhuZQuJ3a9OM=
|
||||||
github.com/go-pdf/fpdf v0.6.0 h1:MlgtGIfsdMEEQJr2le6b/HNr1ZlQwxyWr77r2aj2U/8=
|
github.com/go-pdf/fpdf v0.6.0 h1:MlgtGIfsdMEEQJr2le6b/HNr1ZlQwxyWr77r2aj2U/8=
|
||||||
github.com/go-pdf/fpdf v0.6.0/go.mod h1:HzcnA+A23uwogo0tp9yU+l3V+KXhiESpt1PMayhOh5M=
|
github.com/go-pdf/fpdf v0.6.0/go.mod h1:HzcnA+A23uwogo0tp9yU+l3V+KXhiESpt1PMayhOh5M=
|
||||||
github.com/go-quicktest/qt v1.101.0/go.mod h1:14Bz/f7NwaXPtdYEgzsx46kqSxVwTbzVZsDC26tQJow=
|
|
||||||
github.com/goccmack/gocc v0.0.0-20230228185258-2292f9e40198 h1:FSii2UQeSLngl3jFoR4tUKZLprO7qUlh/TKKticc0BM=
|
github.com/goccmack/gocc v0.0.0-20230228185258-2292f9e40198 h1:FSii2UQeSLngl3jFoR4tUKZLprO7qUlh/TKKticc0BM=
|
||||||
github.com/goccmack/gocc v0.0.0-20230228185258-2292f9e40198/go.mod h1:DTh/Y2+NbnOVVoypCCQrovMPDKUGp4yZpSbWg5D0XIM=
|
github.com/goccmack/gocc v0.0.0-20230228185258-2292f9e40198/go.mod h1:DTh/Y2+NbnOVVoypCCQrovMPDKUGp4yZpSbWg5D0XIM=
|
||||||
github.com/golang/freetype v0.0.0-20170609003504-e2365dfdc4a0 h1:DACJavvAHhabrF08vX0COfcOBJRhZ8lUbR+ZWIs0Y5g=
|
github.com/golang/freetype v0.0.0-20170609003504-e2365dfdc4a0 h1:DACJavvAHhabrF08vX0COfcOBJRhZ8lUbR+ZWIs0Y5g=
|
||||||
github.com/golang/freetype v0.0.0-20170609003504-e2365dfdc4a0/go.mod h1:E/TSTwGwJL78qG/PmXZO1EjYhfJinVAhrmmHX6Z8B9k=
|
github.com/golang/freetype v0.0.0-20170609003504-e2365dfdc4a0/go.mod h1:E/TSTwGwJL78qG/PmXZO1EjYhfJinVAhrmmHX6Z8B9k=
|
||||||
github.com/google/go-cmdtest v0.4.1-0.20220921163831-55ab3332a786/go.mod h1:apVn/GCasLZUVpAJ6oWAuyP7Ne7CEsQbTnc0plM3m+o=
|
|
||||||
github.com/google/go-cmp v0.5.8 h1:e6P7q2lk1O+qJJb4BtCQXlK8vWEO8V1ZeuEdJNOqZyg=
|
github.com/google/go-cmp v0.5.8 h1:e6P7q2lk1O+qJJb4BtCQXlK8vWEO8V1ZeuEdJNOqZyg=
|
||||||
github.com/google/go-cmp v0.5.8/go.mod h1:17dUlkBOakJ0+DkrSSNjCkIjxS6bF9zb3elmeNGIjoY=
|
github.com/google/go-cmp v0.5.8/go.mod h1:17dUlkBOakJ0+DkrSSNjCkIjxS6bF9zb3elmeNGIjoY=
|
||||||
github.com/google/renameio v0.1.0/go.mod h1:KWCgfxg9yswjAJkECMjeO8J8rahYeXnNhOm40UhjYkI=
|
|
||||||
github.com/google/safehtml v0.1.0/go.mod h1:L4KWwDsUJdECRAEpZoBn3O64bQaywRscowZjJAzjHnU=
|
|
||||||
github.com/hashicorp/errwrap v1.0.0/go.mod h1:YH+1FKiLXxHSkmPseP+kNlulaMuP3n2brvKWEqk/Jc4=
|
github.com/hashicorp/errwrap v1.0.0/go.mod h1:YH+1FKiLXxHSkmPseP+kNlulaMuP3n2brvKWEqk/Jc4=
|
||||||
github.com/hashicorp/go-multierror v1.1.1/go.mod h1:iw975J/qwKPdAO1clOe2L8331t/9/fmwbPZ6JB6eMoM=
|
github.com/hashicorp/go-multierror v1.1.1/go.mod h1:iw975J/qwKPdAO1clOe2L8331t/9/fmwbPZ6JB6eMoM=
|
||||||
github.com/ianlancetaylor/demangle v0.0.0-20220319035150-800ac71e25c2 h1:rcanfLhLDA8nozr/K289V1zcntHr3V+SHlXwzz1ZI2g=
|
github.com/ianlancetaylor/demangle v0.0.0-20220319035150-800ac71e25c2 h1:rcanfLhLDA8nozr/K289V1zcntHr3V+SHlXwzz1ZI2g=
|
||||||
github.com/jba/templatecheck v0.7.1/go.mod h1:n1Etw+Rrw1mDDD8dDRsEKTwMZsJ98EkktgNJC6wLUGo=
|
github.com/inconshreveable/mousetrap v1.1.0/go.mod h1:vpF70FUmC8bwa3OWnCshd2FqLfsEA9PFc4w1p2J65bw=
|
||||||
github.com/k0kubun/go-ansi v0.0.0-20180517002512-3bf9e2903213 h1:qGQQKEcAR99REcMpsXCp3lJ03zYT1PkRd3kQGPn9GVg=
|
github.com/k0kubun/go-ansi v0.0.0-20180517002512-3bf9e2903213 h1:qGQQKEcAR99REcMpsXCp3lJ03zYT1PkRd3kQGPn9GVg=
|
||||||
github.com/klauspost/cpuid v1.2.0 h1:NMpwD2G9JSFOE1/TJjGSo5zG7Yb2bTe7eq1jH+irmeE=
|
github.com/klauspost/cpuid v1.2.0 h1:NMpwD2G9JSFOE1/TJjGSo5zG7Yb2bTe7eq1jH+irmeE=
|
||||||
github.com/kr/pty v1.1.1 h1:VkoXIwSboBpnk99O/KFauAEILuNHv5DVFKZMBN/gUgw=
|
github.com/kr/pty v1.1.1 h1:VkoXIwSboBpnk99O/KFauAEILuNHv5DVFKZMBN/gUgw=
|
||||||
github.com/mailru/easyjson v0.7.7/go.mod h1:xzfreul335JAWq5oZzymOObrkdz5UnU4kGfJJLY9Nlc=
|
github.com/mailru/easyjson v0.7.7/go.mod h1:xzfreul335JAWq5oZzymOObrkdz5UnU4kGfJJLY9Nlc=
|
||||||
github.com/mattn/go-isatty v0.0.17 h1:BTarxUcIeDqL27Mc+vyvdWYSL28zpIhv3RoTdsLMPng=
|
github.com/mattn/go-isatty v0.0.17 h1:BTarxUcIeDqL27Mc+vyvdWYSL28zpIhv3RoTdsLMPng=
|
||||||
github.com/smallnest/goroutine v1.1.1/go.mod h1:Fp8f6ZReubfdj0m4+NcUnW4IsAqKa+Pnrv9opEiD43E=
|
github.com/smallnest/goroutine v1.1.1/go.mod h1:Fp8f6ZReubfdj0m4+NcUnW4IsAqKa+Pnrv9opEiD43E=
|
||||||
|
github.com/spf13/cobra v1.8.1/go.mod h1:wHxEcudfqmLYa8iTfL+OuZPbBZkmvliBWKIezN3kD9Y=
|
||||||
|
github.com/spf13/pflag v1.0.6/go.mod h1:McXfInJRrz4CZXVZOBLb0bTZqETkiAhM9Iw0y3An2Bg=
|
||||||
github.com/stretchr/objx v0.1.0 h1:4G4v2dO3VZwixGIRoQ5Lfboy6nUhCyYzaqnIAPPhYs4=
|
github.com/stretchr/objx v0.1.0 h1:4G4v2dO3VZwixGIRoQ5Lfboy6nUhCyYzaqnIAPPhYs4=
|
||||||
github.com/stretchr/objx v0.5.0 h1:1zr/of2m5FGMsad5YfcqgdqdWrIhu+EBEJRhR1U7z/c=
|
github.com/stretchr/objx v0.5.0 h1:1zr/of2m5FGMsad5YfcqgdqdWrIhu+EBEJRhR1U7z/c=
|
||||||
github.com/stretchr/objx v0.5.0/go.mod h1:Yh+to48EsGEfYuaHDzXPcE3xhTkx73EhmCGUpEOglKo=
|
github.com/stretchr/objx v0.5.0/go.mod h1:Yh+to48EsGEfYuaHDzXPcE3xhTkx73EhmCGUpEOglKo=
|
||||||
|
github.com/stretchr/objx v0.5.2/go.mod h1:FRsXN1f5AsAjCGJKqEizvkpNtU+EGNCLh3NxZ/8L+MA=
|
||||||
github.com/yuin/goldmark v1.4.13 h1:fVcFKWvrslecOb/tg+Cc05dkeYx540o0FuFt3nUVDoE=
|
github.com/yuin/goldmark v1.4.13 h1:fVcFKWvrslecOb/tg+Cc05dkeYx540o0FuFt3nUVDoE=
|
||||||
github.com/yuin/goldmark v1.4.13/go.mod h1:6yULJ656Px+3vBD8DxQVa3kxgyrAnzto9xy5taEt/CY=
|
go.etcd.io/gofail v0.2.0/go.mod h1:nL3ILMGfkXTekKI3clMBNazKnjUZjYLKmBHzsVAnC1o=
|
||||||
golang.org/x/crypto v0.14.0 h1:wBqGXzWJW6m1XrIKlAH0Hs1JJ7+9KBwnIO8v66Q9cHc=
|
golang.org/x/crypto v0.14.0 h1:wBqGXzWJW6m1XrIKlAH0Hs1JJ7+9KBwnIO8v66Q9cHc=
|
||||||
golang.org/x/crypto v0.14.0/go.mod h1:MVFd36DqK4CsrnJYDkBA3VC4m2GkXAM0PvzMCn4JQf4=
|
golang.org/x/crypto v0.14.0/go.mod h1:MVFd36DqK4CsrnJYDkBA3VC4m2GkXAM0PvzMCn4JQf4=
|
||||||
golang.org/x/crypto v0.33.0/go.mod h1:bVdXmD7IV/4GdElGPozy6U7lWdRXA4qyRVGJV57uQ5M=
|
|
||||||
golang.org/x/image v0.6.0 h1:bR8b5okrPI3g/gyZakLZHeWxAR8Dn5CyxXv1hLH5g/4=
|
golang.org/x/image v0.6.0 h1:bR8b5okrPI3g/gyZakLZHeWxAR8Dn5CyxXv1hLH5g/4=
|
||||||
golang.org/x/image v0.6.0/go.mod h1:MXLdDR43H7cDJq5GEGXEVeeNhPgi+YYEQ2pC1byI1x0=
|
golang.org/x/image v0.6.0/go.mod h1:MXLdDR43H7cDJq5GEGXEVeeNhPgi+YYEQ2pC1byI1x0=
|
||||||
golang.org/x/mod v0.13.0 h1:I/DsJXRlw/8l/0c24sM9yb0T4z9liZTduXvdAWYiysY=
|
golang.org/x/mod v0.13.0 h1:I/DsJXRlw/8l/0c24sM9yb0T4z9liZTduXvdAWYiysY=
|
||||||
golang.org/x/mod v0.13.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
golang.org/x/mod v0.13.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
||||||
golang.org/x/mod v0.14.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
|
|
||||||
golang.org/x/sync v0.0.0-20220722155255-886fb9371eb4 h1:uVc8UZUe6tr40fFVnUP5Oj+veunVezqYl9z7DYw9xzw=
|
golang.org/x/sync v0.0.0-20220722155255-886fb9371eb4 h1:uVc8UZUe6tr40fFVnUP5Oj+veunVezqYl9z7DYw9xzw=
|
||||||
|
golang.org/x/sync v0.10.0/go.mod h1:Czt+wKu1gCyEFDUtn0jG5QVvpJ6rzVqr5aXyt9drQfk=
|
||||||
golang.org/x/text v0.13.0 h1:ablQoSUd0tRdKxZewP80B+BaqeKJuVhuRxj/dkrun3k=
|
golang.org/x/text v0.13.0 h1:ablQoSUd0tRdKxZewP80B+BaqeKJuVhuRxj/dkrun3k=
|
||||||
golang.org/x/text v0.13.0/go.mod h1:TvPlkZtksWOMsz7fbANvkp4WM8x/WCo/om8BMLbz+aE=
|
golang.org/x/text v0.13.0/go.mod h1:TvPlkZtksWOMsz7fbANvkp4WM8x/WCo/om8BMLbz+aE=
|
||||||
golang.org/x/text v0.22.0/go.mod h1:YRoo4H8PVmsu+E3Ou7cqLVH8oXWIHVoX0jqUWALQhfY=
|
|
||||||
golang.org/x/tools v0.14.0 h1:jvNa2pY0M4r62jkRQ6RwEZZyPcymeL9XZMLBbV7U2nc=
|
golang.org/x/tools v0.14.0 h1:jvNa2pY0M4r62jkRQ6RwEZZyPcymeL9XZMLBbV7U2nc=
|
||||||
golang.org/x/tools v0.14.0/go.mod h1:uYBEerGOWcJyEORxN+Ek8+TT266gXkNlHdJBwexUsBg=
|
golang.org/x/tools v0.14.0/go.mod h1:uYBEerGOWcJyEORxN+Ek8+TT266gXkNlHdJBwexUsBg=
|
||||||
golang.org/x/tools v0.15.0/go.mod h1:hpksKq4dtpQWS1uQ61JkdqWM3LscIS6Slf+VVkm+wQk=
|
|
||||||
golang.org/x/xerrors v0.0.0-20190717185122-a985d3407aa7 h1:9zdDQZ7Thm29KFXgAX/+yaf3eVbP7djjWp/dXAppNCc=
|
golang.org/x/xerrors v0.0.0-20190717185122-a985d3407aa7 h1:9zdDQZ7Thm29KFXgAX/+yaf3eVbP7djjWp/dXAppNCc=
|
||||||
gonum.org/v1/plot v0.10.1 h1:dnifSs43YJuNMDzB7v8wV64O4ABBHReuAVAoBxqBqS4=
|
gonum.org/v1/plot v0.10.1 h1:dnifSs43YJuNMDzB7v8wV64O4ABBHReuAVAoBxqBqS4=
|
||||||
gonum.org/v1/plot v0.10.1/go.mod h1:VZW5OlhkL1mysU9vaqNHnsy86inf6Ot+jB3r+BczCEo=
|
gonum.org/v1/plot v0.10.1/go.mod h1:VZW5OlhkL1mysU9vaqNHnsy86inf6Ot+jB3r+BczCEo=
|
||||||
|
|||||||
+6
-20
@@ -59,11 +59,6 @@ if [[ ! "$WORK_DIR" || ! -d "$WORK_DIR" ]]; then
|
|||||||
exit 1
|
exit 1
|
||||||
fi
|
fi
|
||||||
|
|
||||||
mkdir -p "${WORK_DIR}/cache" \
|
|
||||||
|| (echo "Cannot create ${WORK_DIR}/cache directory" 1>&2
|
|
||||||
exit 1)
|
|
||||||
|
|
||||||
|
|
||||||
mkdir -p "${INSTALL_DIR}/bin" 2> /dev/null \
|
mkdir -p "${INSTALL_DIR}/bin" 2> /dev/null \
|
||||||
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
|| (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
|
||||||
sudo mkdir -p "${INSTALL_DIR}/bin")
|
sudo mkdir -p "${INSTALL_DIR}/bin")
|
||||||
@@ -73,11 +68,11 @@ if [[ ! -d "${INSTALL_DIR}/bin" ]]; then
|
|||||||
exit 1
|
exit 1
|
||||||
fi
|
fi
|
||||||
|
|
||||||
INSTALL_DIR="$(cd ${INSTALL_DIR} && pwd)"
|
INSTALL_DIR="$(cd $INSTALL_DIR && pwd)"
|
||||||
|
|
||||||
echo "WORK_DIR=$WORK_DIR" 1>&2
|
echo WORK_DIR=$WORK_DIR 1>&2
|
||||||
echo "INSTALL_DIR=$INSTALL_DIR" 1>&2
|
echo INSTALL_DIR=$INSTALL_DIR 1>&2
|
||||||
echo "OBITOOLS_PREFIX=$OBITOOLS_PREFIX" 1>&2
|
echo OBITOOLS_PREFIX=$OBITOOLS_PREFIX 1>&2
|
||||||
|
|
||||||
pushd "$WORK_DIR"|| exit
|
pushd "$WORK_DIR"|| exit
|
||||||
|
|
||||||
@@ -110,13 +105,6 @@ curl "$GOURL" \
|
|||||||
|
|
||||||
PATH="$(pwd)/go/bin:$PATH"
|
PATH="$(pwd)/go/bin:$PATH"
|
||||||
export PATH
|
export PATH
|
||||||
GOPATH="$(pwd)/go"
|
|
||||||
export GOPATH
|
|
||||||
|
|
||||||
export GOCACHE="$(pwd)/cache"
|
|
||||||
echo "GOCACHE=$GOCACHE" 1>&2@
|
|
||||||
mkdir -p "$GOCACHE"
|
|
||||||
|
|
||||||
|
|
||||||
curl -L "$OBIURL4" > master.zip
|
curl -L "$OBIURL4" > master.zip
|
||||||
unzip master.zip
|
unzip master.zip
|
||||||
@@ -124,12 +112,11 @@ unzip master.zip
|
|||||||
echo "Install OBITOOLS from : $OBIURL4"
|
echo "Install OBITOOLS from : $OBIURL4"
|
||||||
|
|
||||||
cd obitools4-master || exit
|
cd obitools4-master || exit
|
||||||
mkdir vendor
|
|
||||||
|
|
||||||
if [[ -z "$OBITOOLS_PREFIX" ]] ; then
|
if [[ -z "$OBITOOLS_PREFIX" ]] ; then
|
||||||
make GOFLAGS="-buildvcs=false"
|
make
|
||||||
else
|
else
|
||||||
make GOFLAGS="-buildvcs=false" OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
|
make OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
|
||||||
fi
|
fi
|
||||||
|
|
||||||
(cp build/* "${INSTALL_DIR}/bin" 2> /dev/null) \
|
(cp build/* "${INSTALL_DIR}/bin" 2> /dev/null) \
|
||||||
@@ -138,6 +125,5 @@ fi
|
|||||||
|
|
||||||
popd || exit
|
popd || exit
|
||||||
|
|
||||||
chmod -R +w "$WORK_DIR"
|
|
||||||
rm -rf "$WORK_DIR"
|
rm -rf "$WORK_DIR"
|
||||||
|
|
||||||
|
|||||||
@@ -1,292 +0,0 @@
|
|||||||
# Filtre de Fréquence avec v Niveaux de Roaring Bitmaps
|
|
||||||
|
|
||||||
## Algorithme
|
|
||||||
|
|
||||||
```go
|
|
||||||
Pour chaque k-mer rencontré dans les données:
|
|
||||||
c = 0
|
|
||||||
tant que (k-mer ∈ index[c] ET c < v):
|
|
||||||
c++
|
|
||||||
|
|
||||||
si c < v:
|
|
||||||
index[c].insert(k-mer)
|
|
||||||
```
|
|
||||||
|
|
||||||
**Résultat** : `index[v-1]` contient les k-mers vus **≥ v fois**
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Exemple d'exécution (v=3)
|
|
||||||
|
|
||||||
```
|
|
||||||
Données:
|
|
||||||
Read1: kmer X
|
|
||||||
Read2: kmer X
|
|
||||||
Read3: kmer X (X vu 3 fois)
|
|
||||||
Read4: kmer Y
|
|
||||||
Read5: kmer Y (Y vu 2 fois)
|
|
||||||
Read6: kmer Z (Z vu 1 fois)
|
|
||||||
|
|
||||||
Exécution:
|
|
||||||
|
|
||||||
Read1 (X):
|
|
||||||
c=0: X ∉ index[0] → index[0].add(X)
|
|
||||||
État: index[0]={X}, index[1]={}, index[2]={}
|
|
||||||
|
|
||||||
Read2 (X):
|
|
||||||
c=0: X ∈ index[0] → c=1
|
|
||||||
c=1: X ∉ index[1] → index[1].add(X)
|
|
||||||
État: index[0]={X}, index[1]={X}, index[2]={}
|
|
||||||
|
|
||||||
Read3 (X):
|
|
||||||
c=0: X ∈ index[0] → c=1
|
|
||||||
c=1: X ∈ index[1] → c=2
|
|
||||||
c=2: X ∉ index[2] → index[2].add(X)
|
|
||||||
État: index[0]={X}, index[1]={X}, index[2]={X}
|
|
||||||
|
|
||||||
Read4 (Y):
|
|
||||||
c=0: Y ∉ index[0] → index[0].add(Y)
|
|
||||||
État: index[0]={X,Y}, index[1]={X}, index[2]={X}
|
|
||||||
|
|
||||||
Read5 (Y):
|
|
||||||
c=0: Y ∈ index[0] → c=1
|
|
||||||
c=1: Y ∉ index[1] → index[1].add(Y)
|
|
||||||
État: index[0]={X,Y}, index[1]={X,Y}, index[2]={X}
|
|
||||||
|
|
||||||
Read6 (Z):
|
|
||||||
c=0: Z ∉ index[0] → index[0].add(Z)
|
|
||||||
État: index[0]={X,Y,Z}, index[1]={X,Y}, index[2]={X}
|
|
||||||
|
|
||||||
Résultat final:
|
|
||||||
index[0] (freq≥1): {X, Y, Z}
|
|
||||||
index[1] (freq≥2): {X, Y}
|
|
||||||
index[2] (freq≥3): {X} ← K-mers filtrés ✓
|
|
||||||
```
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Utilisation
|
|
||||||
|
|
||||||
```go
|
|
||||||
// Créer le filtre
|
|
||||||
filter := obikmer.NewFrequencyFilter(31, 3) // k=31, minFreq=3
|
|
||||||
|
|
||||||
// Ajouter les séquences
|
|
||||||
for _, read := range reads {
|
|
||||||
filter.AddSequence(read)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Récupérer les k-mers filtrés (freq ≥ 3)
|
|
||||||
filtered := filter.GetFilteredSet("filtered")
|
|
||||||
fmt.Printf("K-mers de qualité: %d\n", filtered.Cardinality())
|
|
||||||
|
|
||||||
// Statistiques
|
|
||||||
stats := filter.Stats()
|
|
||||||
fmt.Println(stats.String())
|
|
||||||
```
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Performance
|
|
||||||
|
|
||||||
### Complexité
|
|
||||||
|
|
||||||
**Par k-mer** :
|
|
||||||
- Lookups : Moyenne ~v/2, pire cas v
|
|
||||||
- Insertions : 1 Add
|
|
||||||
- **Pas de Remove** ✅
|
|
||||||
|
|
||||||
**Total pour n k-mers** :
|
|
||||||
- Temps : O(n × v/2)
|
|
||||||
- Mémoire : O(unique_kmers × v × 2 bytes)
|
|
||||||
|
|
||||||
### Early exit pour distribution skewed
|
|
||||||
|
|
||||||
Avec distribution typique (séquençage) :
|
|
||||||
```
|
|
||||||
80% singletons → 1 lookup (early exit)
|
|
||||||
15% freq 2-3 → 2-3 lookups
|
|
||||||
5% freq ≥4 → jusqu'à v lookups
|
|
||||||
|
|
||||||
Moyenne réelle : ~2 lookups/kmer (au lieu de v/2)
|
|
||||||
```
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Mémoire
|
|
||||||
|
|
||||||
### Pour 10^8 k-mers uniques
|
|
||||||
|
|
||||||
| v (minFreq) | Nombre bitmaps | Mémoire | vs map simple |
|
|
||||||
|-------------|----------------|---------|---------------|
|
|
||||||
| v=2 | 2 | ~400 MB | 6x moins |
|
|
||||||
| v=3 | 3 | ~600 MB | 4x moins |
|
|
||||||
| v=5 | 5 | ~1 GB | 2.4x moins |
|
|
||||||
| v=10 | 10 | ~2 GB | 1.2x moins |
|
|
||||||
| v=20 | 20 | ~4 GB | ~égal |
|
|
||||||
|
|
||||||
**Note** : Avec distribution skewed (beaucoup de singletons), la mémoire réelle est bien plus faible car les niveaux hauts ont peu d'éléments.
|
|
||||||
|
|
||||||
### Exemple réaliste (séquençage)
|
|
||||||
|
|
||||||
Pour 10^8 k-mers totaux, v=3 :
|
|
||||||
```
|
|
||||||
Distribution:
|
|
||||||
80% singletons → 80M dans index[0]
|
|
||||||
15% freq 2-3 → 15M dans index[1]
|
|
||||||
5% freq ≥3 → 5M dans index[2]
|
|
||||||
|
|
||||||
Mémoire:
|
|
||||||
index[0]: 80M × 2 bytes = 160 MB
|
|
||||||
index[1]: 15M × 2 bytes = 30 MB
|
|
||||||
index[2]: 5M × 2 bytes = 10 MB
|
|
||||||
Total: ~200 MB ✅
|
|
||||||
|
|
||||||
vs map simple: 80M × 24 bytes = ~2 GB
|
|
||||||
Réduction: 10x
|
|
||||||
```
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Comparaison des approches
|
|
||||||
|
|
||||||
| Approche | Mémoire (10^8 kmers) | Passes | Lookups/kmer | Quand utiliser |
|
|
||||||
|----------|----------------------|--------|--------------|----------------|
|
|
||||||
| **v-Bitmaps** | **200-600 MB** | **1** | **~2 (avg)** | **Standard** ✅ |
|
|
||||||
| Map simple | 2.4 GB | 1 | 1 | Si RAM illimitée |
|
|
||||||
| Multi-pass | 400 MB | v | v | Si I/O pas cher |
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Avantages de v-Bitmaps
|
|
||||||
|
|
||||||
✅ **Une seule passe** sur les données
|
|
||||||
✅ **Mémoire optimale** avec Roaring bitmaps
|
|
||||||
✅ **Pas de Remove** (seulement Contains + Add)
|
|
||||||
✅ **Early exit** efficace sur singletons
|
|
||||||
✅ **Scalable** jusqu'à v~10-20
|
|
||||||
✅ **Simple** à implémenter et comprendre
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Cas d'usage typiques
|
|
||||||
|
|
||||||
### 1. Éliminer erreurs de séquençage
|
|
||||||
|
|
||||||
```go
|
|
||||||
filter := obikmer.NewFrequencyFilter(31, 3)
|
|
||||||
|
|
||||||
// Traiter FASTQ
|
|
||||||
for read := range StreamFastq("sample.fastq") {
|
|
||||||
filter.AddSequence(read)
|
|
||||||
}
|
|
||||||
|
|
||||||
// K-mers de qualité (pas d'erreurs)
|
|
||||||
cleaned := filter.GetFilteredSet("cleaned")
|
|
||||||
```
|
|
||||||
|
|
||||||
**Résultat** : Élimine 70-80% des k-mers (erreurs)
|
|
||||||
|
|
||||||
### 2. Assemblage de génome
|
|
||||||
|
|
||||||
```go
|
|
||||||
filter := obikmer.NewFrequencyFilter(31, 2)
|
|
||||||
|
|
||||||
// Filtrer avant l'assemblage
|
|
||||||
for read := range reads {
|
|
||||||
filter.AddSequence(read)
|
|
||||||
}
|
|
||||||
|
|
||||||
solidKmers := filter.GetFilteredSet("solid")
|
|
||||||
// Utiliser solidKmers pour le graphe de Bruijn
|
|
||||||
```
|
|
||||||
|
|
||||||
### 3. Comparaison de génomes
|
|
||||||
|
|
||||||
```go
|
|
||||||
collection := obikmer.NewKmerSetCollection(31)
|
|
||||||
|
|
||||||
for _, genome := range genomes {
|
|
||||||
filter := obikmer.NewFrequencyFilter(31, 3)
|
|
||||||
filter.AddSequences(genome.Reads)
|
|
||||||
|
|
||||||
cleaned := filter.GetFilteredSet(genome.ID)
|
|
||||||
collection.Add(cleaned)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Analyses comparatives sur k-mers de qualité
|
|
||||||
matrix := collection.ParallelPairwiseJaccard(8)
|
|
||||||
```
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Limites
|
|
||||||
|
|
||||||
**Pour v > 20** :
|
|
||||||
- Trop de lookups (v lookups/kmer)
|
|
||||||
- Mémoire importante (v × 200MB pour 10^8 kmers)
|
|
||||||
|
|
||||||
**Solutions alternatives pour v > 20** :
|
|
||||||
- Utiliser map simple (9 bytes/kmer) si RAM disponible
|
|
||||||
- Algorithme différent (sketch, probabiliste)
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Optimisations possibles
|
|
||||||
|
|
||||||
### 1. Parallélisation
|
|
||||||
|
|
||||||
```go
|
|
||||||
// Traiter plusieurs fichiers en parallèle
|
|
||||||
filters := make([]*FrequencyFilter, numFiles)
|
|
||||||
|
|
||||||
var wg sync.WaitGroup
|
|
||||||
for i, file := range files {
|
|
||||||
wg.Add(1)
|
|
||||||
go func(idx int, f string) {
|
|
||||||
defer wg.Done()
|
|
||||||
filters[idx] = ProcessFile(f, k, minFreq)
|
|
||||||
}(i, file)
|
|
||||||
}
|
|
||||||
wg.Wait()
|
|
||||||
|
|
||||||
// Merger les résultats
|
|
||||||
merged := MergeFilters(filters)
|
|
||||||
```
|
|
||||||
|
|
||||||
### 2. Streaming avec seuil adaptatif
|
|
||||||
|
|
||||||
```go
|
|
||||||
// Commencer avec v=5, réduire progressivement
|
|
||||||
filter := obikmer.NewFrequencyFilter(31, 5)
|
|
||||||
|
|
||||||
// ... traitement ...
|
|
||||||
|
|
||||||
// Si trop de mémoire, réduire à v=3
|
|
||||||
if filter.MemoryUsage() > threshold {
|
|
||||||
filter = ConvertToLowerThreshold(filter, 3)
|
|
||||||
}
|
|
||||||
```
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Récapitulatif final
|
|
||||||
|
|
||||||
**Pour filtrer les k-mers par fréquence ≥ v :**
|
|
||||||
|
|
||||||
1. **Créer** : `filter := NewFrequencyFilter(k, v)`
|
|
||||||
2. **Traiter** : `filter.AddSequence(read)` pour chaque read
|
|
||||||
3. **Résultat** : `filtered := filter.GetFilteredSet(id)`
|
|
||||||
|
|
||||||
**Mémoire** : ~2v MB par million de k-mers uniques
|
|
||||||
**Temps** : Une seule passe, ~2 lookups/kmer en moyenne
|
|
||||||
**Optimal pour** : v ≤ 20, distribution skewed (séquençage)
|
|
||||||
|
|
||||||
---
|
|
||||||
|
|
||||||
## Code fourni
|
|
||||||
|
|
||||||
1. **frequency_filter.go** - Implémentation complète
|
|
||||||
2. **examples_frequency_filter_final.go** - Exemples d'utilisation
|
|
||||||
|
|
||||||
**Tout est prêt à utiliser !** 🚀
|
|
||||||
@@ -1,320 +0,0 @@
|
|||||||
package main
|
|
||||||
|
|
||||||
import (
|
|
||||||
"fmt"
|
|
||||||
"obikmer"
|
|
||||||
)
|
|
||||||
|
|
||||||
func main() {
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 1 : Utilisation basique
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("=== EXEMPLE 1 : Utilisation basique ===\n")
|
|
||||||
|
|
||||||
k := 31
|
|
||||||
minFreq := 3 // Garder les k-mers vus ≥3 fois
|
|
||||||
|
|
||||||
// Créer le filtre
|
|
||||||
filter := obikmer.NewFrequencyFilter(k, minFreq)
|
|
||||||
|
|
||||||
// Simuler des séquences avec différentes fréquences
|
|
||||||
sequences := [][]byte{
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X (freq=2)
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X (freq=3) ✓
|
|
||||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Kmer Y
|
|
||||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Kmer Y (freq=2) ✗
|
|
||||||
[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // Kmer Z (freq=1) ✗
|
|
||||||
}
|
|
||||||
|
|
||||||
fmt.Printf("Traitement de %d séquences...\n", len(sequences))
|
|
||||||
for _, seq := range sequences {
|
|
||||||
filter.AddSequence(seq)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Récupérer les k-mers filtrés
|
|
||||||
filtered := filter.GetFilteredSet("filtered")
|
|
||||||
fmt.Printf("\nK-mers avec freq ≥ %d: %d\n", minFreq, filtered.Cardinality())
|
|
||||||
|
|
||||||
// Statistiques
|
|
||||||
stats := filter.Stats()
|
|
||||||
fmt.Println("\n" + stats.String())
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 2 : Vérifier les niveaux
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== EXEMPLE 2 : Inspection des niveaux ===\n")
|
|
||||||
|
|
||||||
// Vérifier chaque niveau
|
|
||||||
for level := 0; level < minFreq; level++ {
|
|
||||||
levelSet := filter.GetKmersAtLevel(level)
|
|
||||||
fmt.Printf("Niveau %d (freq≥%d): %d k-mers\n",
|
|
||||||
level+1, level+1, levelSet.Cardinality())
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 3 : Données réalistes
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== EXEMPLE 3 : Simulation données séquençage ===\n")
|
|
||||||
|
|
||||||
filter2 := obikmer.NewFrequencyFilter(31, 3)
|
|
||||||
|
|
||||||
// Simuler un dataset réaliste :
|
|
||||||
// - 1000 reads
|
|
||||||
// - 80% contiennent des erreurs (singletons)
|
|
||||||
// - 15% vrais k-mers à basse fréquence
|
|
||||||
// - 5% vrais k-mers à haute fréquence
|
|
||||||
|
|
||||||
// Vraie séquence répétée
|
|
||||||
trueSeq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
|
|
||||||
for i := 0; i < 50; i++ {
|
|
||||||
filter2.AddSequence(trueSeq)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Séquence à fréquence moyenne
|
|
||||||
mediumSeq := []byte("CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC")
|
|
||||||
for i := 0; i < 5; i++ {
|
|
||||||
filter2.AddSequence(mediumSeq)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Erreurs de séquençage (singletons)
|
|
||||||
for i := 0; i < 100; i++ {
|
|
||||||
errorSeq := []byte(fmt.Sprintf("TTTTTTTTTTTTTTTTTTTTTTTTTTTT%03d", i))
|
|
||||||
filter2.AddSequence(errorSeq)
|
|
||||||
}
|
|
||||||
|
|
||||||
stats2 := filter2.Stats()
|
|
||||||
fmt.Println(stats2.String())
|
|
||||||
|
|
||||||
fmt.Println("Distribution attendue:")
|
|
||||||
fmt.Println(" - Beaucoup de singletons (erreurs)")
|
|
||||||
fmt.Println(" - Peu de k-mers à haute fréquence (signal)")
|
|
||||||
fmt.Println(" → Filtrage efficace !")
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 4 : Tester différents seuils
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== EXEMPLE 4 : Comparaison de seuils ===\n")
|
|
||||||
|
|
||||||
testSeqs := [][]byte{
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // freq=5
|
|
||||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"),
|
|
||||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"),
|
|
||||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // freq=3
|
|
||||||
[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // freq=1
|
|
||||||
}
|
|
||||||
|
|
||||||
for _, minFreq := range []int{2, 3, 5} {
|
|
||||||
f := obikmer.NewFrequencyFilter(31, minFreq)
|
|
||||||
f.AddSequences(testSeqs)
|
|
||||||
|
|
||||||
fmt.Printf("minFreq=%d: %d k-mers retenus (%.2f MB)\n",
|
|
||||||
minFreq,
|
|
||||||
f.Cardinality(),
|
|
||||||
float64(f.MemoryUsage())/1024/1024)
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 5 : Comparaison mémoire
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== EXEMPLE 5 : Comparaison mémoire ===\n")
|
|
||||||
|
|
||||||
filter3 := obikmer.NewFrequencyFilter(31, 3)
|
|
||||||
|
|
||||||
// Simuler 10000 séquences
|
|
||||||
for i := 0; i < 10000; i++ {
|
|
||||||
seq := make([]byte, 100)
|
|
||||||
for j := range seq {
|
|
||||||
seq[j] = "ACGT"[(i+j)%4]
|
|
||||||
}
|
|
||||||
filter3.AddSequence(seq)
|
|
||||||
}
|
|
||||||
|
|
||||||
fmt.Println(filter3.CompareWithSimpleMap())
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 6 : Workflow complet
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== EXEMPLE 6 : Workflow complet ===\n")
|
|
||||||
|
|
||||||
fmt.Println("1. Créer le filtre")
|
|
||||||
finalFilter := obikmer.NewFrequencyFilter(31, 3)
|
|
||||||
|
|
||||||
fmt.Println("2. Traiter les données (simulation)")
|
|
||||||
// En pratique : lire depuis FASTQ
|
|
||||||
// for read := range ReadFastq("data.fastq") {
|
|
||||||
// finalFilter.AddSequence(read)
|
|
||||||
// }
|
|
||||||
|
|
||||||
// Simulation
|
|
||||||
for i := 0; i < 1000; i++ {
|
|
||||||
seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
|
|
||||||
finalFilter.AddSequence(seq)
|
|
||||||
}
|
|
||||||
|
|
||||||
fmt.Println("3. Récupérer les k-mers filtrés")
|
|
||||||
result := finalFilter.GetFilteredSet("final")
|
|
||||||
|
|
||||||
fmt.Println("4. Utiliser le résultat")
|
|
||||||
fmt.Printf(" K-mers de qualité: %d\n", result.Cardinality())
|
|
||||||
fmt.Printf(" Mémoire utilisée: %.2f MB\n", float64(finalFilter.MemoryUsage())/1024/1024)
|
|
||||||
|
|
||||||
fmt.Println("5. Sauvegarder (optionnel)")
|
|
||||||
// result.Save("filtered_kmers.bin")
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 7 : Vérification individuelle
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== EXEMPLE 7 : Vérification de k-mers spécifiques ===\n")
|
|
||||||
|
|
||||||
checkFilter := obikmer.NewFrequencyFilter(31, 3)
|
|
||||||
|
|
||||||
testSeq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
|
|
||||||
for i := 0; i < 5; i++ {
|
|
||||||
checkFilter.AddSequence(testSeq)
|
|
||||||
}
|
|
||||||
|
|
||||||
var kmers []uint64
|
|
||||||
kmers = obikmer.EncodeKmers(testSeq, 31, &kmers)
|
|
||||||
|
|
||||||
if len(kmers) > 0 {
|
|
||||||
testKmer := kmers[0]
|
|
||||||
|
|
||||||
fmt.Printf("K-mer test: 0x%016X\n", testKmer)
|
|
||||||
fmt.Printf(" Présent dans filtre: %v\n", checkFilter.Contains(testKmer))
|
|
||||||
fmt.Printf(" Fréquence approx: %d\n", checkFilter.GetFrequency(testKmer))
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// EXEMPLE 8 : Intégration avec collection
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== EXEMPLE 8 : Intégration avec KmerSetCollection ===\n")
|
|
||||||
|
|
||||||
// Créer une collection de génomes filtrés
|
|
||||||
collection := obikmer.NewKmerSetCollection(31)
|
|
||||||
|
|
||||||
genomes := map[string][][]byte{
|
|
||||||
"Genome1": {
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Erreur
|
|
||||||
},
|
|
||||||
"Genome2": {
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
|
|
||||||
[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // Erreur
|
|
||||||
},
|
|
||||||
}
|
|
||||||
|
|
||||||
for id, sequences := range genomes {
|
|
||||||
// Filtrer chaque génome
|
|
||||||
genomeFilter := obikmer.NewFrequencyFilter(31, 3)
|
|
||||||
genomeFilter.AddSequences(sequences)
|
|
||||||
|
|
||||||
// Ajouter à la collection
|
|
||||||
filteredSet := genomeFilter.GetFilteredSet(id)
|
|
||||||
collection.Add(filteredSet)
|
|
||||||
|
|
||||||
fmt.Printf("%s: %d k-mers de qualité\n", id, filteredSet.Cardinality())
|
|
||||||
}
|
|
||||||
|
|
||||||
// Analyser la collection
|
|
||||||
fmt.Println("\nAnalyse comparative:")
|
|
||||||
collectionStats := collection.ComputeStats()
|
|
||||||
fmt.Printf(" Core genome: %d k-mers\n", collectionStats.CoreSize)
|
|
||||||
fmt.Printf(" Pan genome: %d k-mers\n", collectionStats.PanGenomeSize)
|
|
||||||
|
|
||||||
// ==========================================
|
|
||||||
// RÉSUMÉ
|
|
||||||
// ==========================================
|
|
||||||
fmt.Println("\n=== RÉSUMÉ ===\n")
|
|
||||||
fmt.Println("Le FrequencyFilter permet de:")
|
|
||||||
fmt.Println(" ✓ Filtrer les k-mers par fréquence minimale")
|
|
||||||
fmt.Println(" ✓ Utiliser une mémoire optimale avec Roaring bitmaps")
|
|
||||||
fmt.Println(" ✓ Une seule passe sur les données")
|
|
||||||
fmt.Println(" ✓ Éliminer efficacement les erreurs de séquençage")
|
|
||||||
fmt.Println("")
|
|
||||||
fmt.Println("Workflow typique:")
|
|
||||||
fmt.Println(" 1. filter := NewFrequencyFilter(k, minFreq)")
|
|
||||||
fmt.Println(" 2. for each sequence: filter.AddSequence(seq)")
|
|
||||||
fmt.Println(" 3. filtered := filter.GetFilteredSet(id)")
|
|
||||||
fmt.Println(" 4. Utiliser filtered dans vos analyses")
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==================================
|
|
||||||
// FONCTION HELPER POUR BENCHMARKS
|
|
||||||
// ==================================
|
|
||||||
|
|
||||||
func BenchmarkFrequencyFilter() {
|
|
||||||
k := 31
|
|
||||||
minFreq := 3
|
|
||||||
|
|
||||||
// Test avec différentes tailles
|
|
||||||
sizes := []int{1000, 10000, 100000}
|
|
||||||
|
|
||||||
fmt.Println("\n=== BENCHMARK ===\n")
|
|
||||||
|
|
||||||
for _, size := range sizes {
|
|
||||||
filter := obikmer.NewFrequencyFilter(k, minFreq)
|
|
||||||
|
|
||||||
// Générer des séquences
|
|
||||||
for i := 0; i < size; i++ {
|
|
||||||
seq := make([]byte, 100)
|
|
||||||
for j := range seq {
|
|
||||||
seq[j] = "ACGT"[(i+j)%4]
|
|
||||||
}
|
|
||||||
filter.AddSequence(seq)
|
|
||||||
}
|
|
||||||
|
|
||||||
fmt.Printf("Size=%d reads:\n", size)
|
|
||||||
fmt.Printf(" Filtered k-mers: %d\n", filter.Cardinality())
|
|
||||||
fmt.Printf(" Memory: %.2f MB\n", float64(filter.MemoryUsage())/1024/1024)
|
|
||||||
fmt.Println()
|
|
||||||
}
|
|
||||||
}
|
|
||||||
|
|
||||||
// ==================================
|
|
||||||
// FONCTION POUR DONNÉES RÉELLES
|
|
||||||
// ==================================
|
|
||||||
|
|
||||||
func ProcessRealData() {
|
|
||||||
// Exemple pour traiter de vraies données FASTQ
|
|
||||||
|
|
||||||
k := 31
|
|
||||||
minFreq := 3
|
|
||||||
|
|
||||||
filter := obikmer.NewFrequencyFilter(k, minFreq)
|
|
||||||
|
|
||||||
// Pseudo-code pour lire un FASTQ
|
|
||||||
/*
|
|
||||||
fastqFile := "sample.fastq"
|
|
||||||
reader := NewFastqReader(fastqFile)
|
|
||||||
|
|
||||||
for reader.HasNext() {
|
|
||||||
read := reader.Next()
|
|
||||||
filter.AddSequence(read.Sequence)
|
|
||||||
}
|
|
||||||
|
|
||||||
// Récupérer le résultat
|
|
||||||
filtered := filter.GetFilteredSet("sample_filtered")
|
|
||||||
filtered.Save("sample_filtered_kmers.bin")
|
|
||||||
|
|
||||||
// Stats
|
|
||||||
stats := filter.Stats()
|
|
||||||
fmt.Println(stats.String())
|
|
||||||
*/
|
|
||||||
|
|
||||||
fmt.Println("Workflow pour données réelles:")
|
|
||||||
fmt.Println(" 1. Créer le filtre avec minFreq approprié (2-5 typique)")
|
|
||||||
fmt.Println(" 2. Stream les reads depuis FASTQ")
|
|
||||||
fmt.Println(" 3. Récupérer les k-mers filtrés")
|
|
||||||
fmt.Println(" 4. Utiliser pour assemblage/comparaison/etc.")
|
|
||||||
|
|
||||||
_ = filter // unused
|
|
||||||
}
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obiannotate
|
|
||||||
CMD=obiannotate
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obiclean
|
|
||||||
CMD=obiclean
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obicleandb
|
|
||||||
CMD=obicleandb
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obicomplement
|
|
||||||
CMD=obicomplement
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obiconsensus
|
|
||||||
CMD=obiconsensus
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
Binary file not shown.
@@ -1,144 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obiconvert
|
|
||||||
CMD=obiconvert
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
|
|
||||||
if [ -z "$TEST_DIR" ] ; then
|
|
||||||
TEST_DIR="."
|
|
||||||
fi
|
|
||||||
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if obiconvert -Z "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
|
|
||||||
> "${TMPDIR}/xxx.fasta.gz" && \
|
|
||||||
zdiff "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
|
|
||||||
"${TMPDIR}/xxx.fasta.gz"
|
|
||||||
then
|
|
||||||
log "$MCMD: converting large fasta file to fasta OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: converting large fasta file to fasta failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if obiconvert -Z --fastq-output \
|
|
||||||
"${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
|
|
||||||
> "${TMPDIR}/xxx.fastq.gz" && \
|
|
||||||
obiconvert -Z --fasta-output \
|
|
||||||
"${TMPDIR}/xxx.fastq.gz" \
|
|
||||||
> "${TMPDIR}/yyy.fasta.gz" && \
|
|
||||||
zdiff "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
|
|
||||||
"${TMPDIR}/yyy.fasta.gz"
|
|
||||||
then
|
|
||||||
log "$MCMD: converting large file between fasta and fastq OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: converting large file between fasta and fastq failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,163 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obicount
|
|
||||||
CMD=obicount
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if obicount "${TEST_DIR}/wolf_F.fasta.gz" \
|
|
||||||
> "${TMPDIR}/wolf_F.fasta_count.csv"
|
|
||||||
then
|
|
||||||
log "OBICount: fasta reading OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "OBICount: fasta reading failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if obicount "${TEST_DIR}/wolf_F.fastq.gz" \
|
|
||||||
> "${TMPDIR}/wolf_F.fastq_count.csv"
|
|
||||||
then
|
|
||||||
log "OBICount: fastq reading OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "OBICount: fastq reading failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if obicount "${TEST_DIR}/wolf_F.csv.gz" \
|
|
||||||
> "${TMPDIR}/wolf_F.csv_count.csv"
|
|
||||||
then
|
|
||||||
log "OBICount: csv reading OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "OBICount: csv reading failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if diff "${TMPDIR}/wolf_F.fasta_count.csv" \
|
|
||||||
"${TMPDIR}/wolf_F.fastq_count.csv" > /dev/null
|
|
||||||
then
|
|
||||||
log "OBICount: counting on fasta and fastq are identical OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "OBICount: counting on fasta and fastq are different failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if diff "${TMPDIR}/wolf_F.fasta_count.csv" \
|
|
||||||
"${TMPDIR}/wolf_F.csv_count.csv" > /dev/null
|
|
||||||
then
|
|
||||||
log "OBICount: counting on fasta and csv are identical OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "OBICount: counting on fasta and csv are different failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
Binary file not shown.
Binary file not shown.
Binary file not shown.
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obicsv
|
|
||||||
CMD=obicsv
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obidemerge
|
|
||||||
CMD=obidemerge
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obidistribute
|
|
||||||
CMD=obidistribute
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obigrep
|
|
||||||
CMD=obigrep
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obijoin
|
|
||||||
CMD=obijoin
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obikmermatch
|
|
||||||
CMD=obikmermatch
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obikmersimcount
|
|
||||||
CMD=obikmersimcount
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obilandmark
|
|
||||||
CMD=obilandmark
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obimatrix
|
|
||||||
CMD=obimatrix
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obimicrosat
|
|
||||||
CMD=obimicrosat
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obimultiplex
|
|
||||||
CMD=obimultiplex
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,150 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obipairing
|
|
||||||
CMD=obipairing
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if obipairing -F "${TEST_DIR}/wolf_F.fastq.gz" \
|
|
||||||
-R "${TEST_DIR}/wolf_R.fastq.gz" \
|
|
||||||
| obidistribute -Z -c mode \
|
|
||||||
-p "${TMPDIR}/wolf_paired_%s.fastq.gz"
|
|
||||||
then
|
|
||||||
log "OBIPairing: sequence pairing OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "OBIPairing: sequence pairing failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if obicsv -Z -s -i \
|
|
||||||
-k ali_dir -k ali_length -k pairing_fast_count \
|
|
||||||
-k pairing_fast_overlap -k pairing_fast_score \
|
|
||||||
-k score -k score_norm -k seq_a_single \
|
|
||||||
-k seq_b_single -k seq_ab_match \
|
|
||||||
"${TMPDIR}/wolf_paired_alignment.fastq.gz" \
|
|
||||||
> "${TMPDIR}/wolf_paired_alignment.csv.gz" \
|
|
||||||
&& zdiff -c "${TEST_DIR}/wolf_paired_alignment.csv.gz" \
|
|
||||||
"${TMPDIR}/wolf_paired_alignment.csv.gz"
|
|
||||||
then
|
|
||||||
log "OBIPairing: check aligned sequences OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "OBIPairing: check aligned sequences failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if obicsv -Z -s -i \
|
|
||||||
"${TMPDIR}/wolf_paired_join.fastq.gz" \
|
|
||||||
> "${TMPDIR}/wolf_paired_join.csv.gz" \
|
|
||||||
&& zdiff -c "${TEST_DIR}/wolf_paired_join.csv.gz" \
|
|
||||||
"${TMPDIR}/wolf_paired_join.csv.gz"
|
|
||||||
then
|
|
||||||
log "OBIPairing: check joined sequences OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "OBIPairing: check joined sequences failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obipcr
|
|
||||||
CMD=obipcr
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obirefidx
|
|
||||||
CMD=obirefidx
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obiscript
|
|
||||||
CMD=obiscript
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obisplit
|
|
||||||
CMD=obisplit
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,9 +0,0 @@
|
|||||||
>Seq_1 {"count":2,"merged_sample":{"15a_F730814":1,"29a_F260619":1}}
|
|
||||||
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
|
|
||||||
agctyaaaactcaaaggacttggcggtgctttataccctt
|
|
||||||
>Seq_2 {"count":22,"merged_sample":{"15a_F730814":12,"29a_F260619":10}}
|
|
||||||
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
|
|
||||||
atcttaaaactcaaaggacttggcggtgctttataccctt
|
|
||||||
>Seq_3 {"count":22,"merged_sample":{"15a_F730814":15,"29a_F260619":7}}
|
|
||||||
ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcgat
|
|
||||||
agcttaaaactcaaaggacttggcggtgctttataccctt
|
|
||||||
@@ -1,35 +0,0 @@
|
|||||||
{
|
|
||||||
"annotations": {
|
|
||||||
"keys": {
|
|
||||||
"map": {
|
|
||||||
"merged_sample": 3
|
|
||||||
},
|
|
||||||
"scalar": {
|
|
||||||
"count": 3
|
|
||||||
}
|
|
||||||
},
|
|
||||||
"map_attributes": 1,
|
|
||||||
"scalar_attributes": 1,
|
|
||||||
"vector_attributes": 0
|
|
||||||
},
|
|
||||||
"count": {
|
|
||||||
"reads": 46,
|
|
||||||
"total_length": 300,
|
|
||||||
"variants": 3
|
|
||||||
},
|
|
||||||
"samples": {
|
|
||||||
"sample_count": 2,
|
|
||||||
"sample_stats": {
|
|
||||||
"15a_F730814": {
|
|
||||||
"reads": 28,
|
|
||||||
"singletons": 1,
|
|
||||||
"variants": 3
|
|
||||||
},
|
|
||||||
"29a_F260619": {
|
|
||||||
"reads": 18,
|
|
||||||
"singletons": 1,
|
|
||||||
"variants": 3
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
@@ -1,25 +0,0 @@
|
|||||||
annotations:
|
|
||||||
keys:
|
|
||||||
map:
|
|
||||||
merged_sample: 3
|
|
||||||
scalar:
|
|
||||||
count: 3
|
|
||||||
map_attributes: 1
|
|
||||||
scalar_attributes: 1
|
|
||||||
vector_attributes: 0
|
|
||||||
count:
|
|
||||||
reads: 46
|
|
||||||
total_length: 300
|
|
||||||
variants: 3
|
|
||||||
samples:
|
|
||||||
sample_count: 2
|
|
||||||
sample_stats:
|
|
||||||
15a_F730814:
|
|
||||||
reads: 28
|
|
||||||
singletons: 1
|
|
||||||
variants: 3
|
|
||||||
29a_F260619:
|
|
||||||
reads: 18
|
|
||||||
singletons: 1
|
|
||||||
variants: 3
|
|
||||||
|
|
||||||
@@ -1,152 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obisummary
|
|
||||||
CMD=obisummary
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if obisummary "${TEST_DIR}/some_uniq_seq.fasta" \
|
|
||||||
> "${TMPDIR}/some_uniq_seq.json"
|
|
||||||
then
|
|
||||||
log "$MCMD: formating json execution OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: formating json execution failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if diff "${TEST_DIR}/some_uniq_seq.json" \
|
|
||||||
"${TMPDIR}/some_uniq_seq.json" > /dev/null
|
|
||||||
then
|
|
||||||
log "$MCMD: formating json OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: formating json failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if obisummary --yaml "${TEST_DIR}/some_uniq_seq.fasta" \
|
|
||||||
> "${TMPDIR}/some_uniq_seq.yaml"
|
|
||||||
then
|
|
||||||
log "$MCMD: formating yaml execution OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: formating yaml execution failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if diff "${TEST_DIR}/some_uniq_seq.yaml" \
|
|
||||||
"${TMPDIR}/some_uniq_seq.yaml" > /dev/null
|
|
||||||
then
|
|
||||||
log "$MCMD: formating yaml OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: formating yaml failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obitag
|
|
||||||
CMD=obitag
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obipcr
|
|
||||||
CMD=obipcr
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,109 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obitaxonomy
|
|
||||||
CMD=obitaxonomy
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,205 +0,0 @@
|
|||||||
#!/bin/bash
|
|
||||||
|
|
||||||
#
|
|
||||||
# Here give the name of the test serie
|
|
||||||
#
|
|
||||||
|
|
||||||
TEST_NAME=obiuniq
|
|
||||||
CMD=obiuniq
|
|
||||||
|
|
||||||
######
|
|
||||||
#
|
|
||||||
# Some variable and function definitions: please don't change them
|
|
||||||
#
|
|
||||||
######
|
|
||||||
TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
|
|
||||||
OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
|
|
||||||
export PATH="${OBITOOLS_DIR}:${PATH}"
|
|
||||||
|
|
||||||
MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
|
|
||||||
|
|
||||||
TMPDIR="$(mktemp -d)"
|
|
||||||
ntest=0
|
|
||||||
success=0
|
|
||||||
failed=0
|
|
||||||
|
|
||||||
cleanup() {
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
echo "## Results of the $TEST_NAME tests:" 1>&2
|
|
||||||
|
|
||||||
echo 1>&2
|
|
||||||
echo "- $ntest tests run" 1>&2
|
|
||||||
echo "- $success successfully completed" 1>&2
|
|
||||||
echo "- $failed failed tests" 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "Cleaning up the temporary directory..." 1>&2
|
|
||||||
echo 1>&2
|
|
||||||
echo "========================================" 1>&2
|
|
||||||
|
|
||||||
rm -rf "$TMPDIR" # Suppress the temporary directory
|
|
||||||
|
|
||||||
if [ $failed -gt 0 ]; then
|
|
||||||
log "$TEST_NAME tests failed"
|
|
||||||
log
|
|
||||||
log
|
|
||||||
exit 1
|
|
||||||
fi
|
|
||||||
|
|
||||||
log
|
|
||||||
log
|
|
||||||
|
|
||||||
exit 0
|
|
||||||
}
|
|
||||||
|
|
||||||
log() {
|
|
||||||
echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
|
|
||||||
}
|
|
||||||
|
|
||||||
log "Testing $TEST_NAME..."
|
|
||||||
log "Test directory is $TEST_DIR"
|
|
||||||
log "obitools directory is $OBITOOLS_DIR"
|
|
||||||
log "Temporary directory is $TMPDIR"
|
|
||||||
log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
|
|
||||||
|
|
||||||
######################################################################
|
|
||||||
####
|
|
||||||
#### Below are the tests
|
|
||||||
####
|
|
||||||
#### Before each test :
|
|
||||||
#### - increment the variable ntest
|
|
||||||
####
|
|
||||||
#### Run the command as the condition of an if / then /else
|
|
||||||
#### - The command must return 0 on success
|
|
||||||
#### - The command must return an exit code different from 0 on failure
|
|
||||||
#### - The datafiles are stored in the same directory than the test script
|
|
||||||
#### - The test script directory is stored in the TEST_DIR variable
|
|
||||||
#### - If result files have to be produced they must be stored
|
|
||||||
#### in the temporary directory (TMPDIR variable)
|
|
||||||
####
|
|
||||||
#### then clause is executed on success of the command
|
|
||||||
#### - Write a success message using the log function
|
|
||||||
#### - increment the variable success
|
|
||||||
####
|
|
||||||
#### else clause is executed on failure of the command
|
|
||||||
#### - Write a failure message using the log function
|
|
||||||
#### - increment the variable failed
|
|
||||||
####
|
|
||||||
######################################################################
|
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if $CMD -h > "${TMPDIR}/help.txt" 2>&1
|
|
||||||
then
|
|
||||||
log "$MCMD: printing help OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "$MCMD: printing help failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if obiuniq "${TEST_DIR}/touniq.fasta" \
|
|
||||||
> "${TMPDIR}/touniq_u.fasta"
|
|
||||||
then
|
|
||||||
log "OBIUniq simple: running OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "OBIUniq simple: running failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
obicsv -s --auto ${TEST_DIR}/touniq_u.fasta \
|
|
||||||
| tail -n +2 \
|
|
||||||
| sort \
|
|
||||||
> "${TMPDIR}/touniq_u_ref.csv"
|
|
||||||
|
|
||||||
obicsv -s --auto ${TMPDIR}/touniq_u.fasta \
|
|
||||||
| tail -n +2 \
|
|
||||||
| sort \
|
|
||||||
> "${TMPDIR}/touniq_u.csv"
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if diff "${TMPDIR}/touniq_u_ref.csv" \
|
|
||||||
"${TMPDIR}/touniq_u.csv" > /dev/null
|
|
||||||
then
|
|
||||||
log "OBIUniq simple: result OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "OBIUniq simple: result failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if obiuniq -c a "${TEST_DIR}/touniq.fasta" \
|
|
||||||
> "${TMPDIR}/touniq_u_a.fasta"
|
|
||||||
then
|
|
||||||
log "OBIUniq one category: running OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "OBIUniq one category: running failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
obicsv -s --auto ${TEST_DIR}/touniq_u_a.fasta \
|
|
||||||
| tail -n +2 \
|
|
||||||
| sort \
|
|
||||||
> "${TMPDIR}/touniq_u_a_ref.csv"
|
|
||||||
|
|
||||||
obicsv -s --auto ${TMPDIR}/touniq_u_a.fasta \
|
|
||||||
| tail -n +2 \
|
|
||||||
| sort \
|
|
||||||
> "${TMPDIR}/touniq_u_a.csv"
|
|
||||||
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if diff "${TMPDIR}/touniq_u_a_ref.csv" \
|
|
||||||
"${TMPDIR}/touniq_u_a.csv" > /dev/null
|
|
||||||
then
|
|
||||||
log "OBIUniq one category: result OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "OBIUniq one category: result failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if obiuniq -c a -c b "${TEST_DIR}/touniq.fasta" \
|
|
||||||
> "${TMPDIR}/touniq_u_a_b.fasta"
|
|
||||||
then
|
|
||||||
log "OBIUniq two categories: running OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "OBIUniq two categories: running failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
obicsv -s --auto ${TEST_DIR}/touniq_u_a_b.fasta \
|
|
||||||
| tail -n +2 \
|
|
||||||
| sort \
|
|
||||||
> "${TMPDIR}/touniq_u_a_b_ref.csv"
|
|
||||||
|
|
||||||
obicsv -s --auto ${TMPDIR}/touniq_u_a_b.fasta \
|
|
||||||
| tail -n +2 \
|
|
||||||
| sort \
|
|
||||||
> "${TMPDIR}/touniq_u_a_b.csv"
|
|
||||||
|
|
||||||
((ntest++))
|
|
||||||
if diff "${TMPDIR}/touniq_u_a_b_ref.csv" \
|
|
||||||
"${TMPDIR}/touniq_u_a_b.csv" > /dev/null
|
|
||||||
then
|
|
||||||
log "OBIUniq two categories: result OK"
|
|
||||||
((success++))
|
|
||||||
else
|
|
||||||
log "OBIUniq two categories: result failed"
|
|
||||||
((failed++))
|
|
||||||
fi
|
|
||||||
|
|
||||||
#########################################
|
|
||||||
#
|
|
||||||
# At the end of the tests
|
|
||||||
# the cleanup function is called
|
|
||||||
#
|
|
||||||
#########################################
|
|
||||||
|
|
||||||
cleanup
|
|
||||||
@@ -1,16 +0,0 @@
|
|||||||
>seq1 {"a":2, "b":4,"c":5}
|
|
||||||
aaacccgggttt
|
|
||||||
>seq2 {"a":3, "b":4,"c":5}
|
|
||||||
aaacccgggttt
|
|
||||||
>seq3 {"a":3, "b":5,"c":5}
|
|
||||||
aaacccgggttt
|
|
||||||
>seq4 {"a":3, "b":5,"c":6}
|
|
||||||
aaacccgggttt
|
|
||||||
>seq5 {"a":2, "b":4,"c":5}
|
|
||||||
aaacccgggtttca
|
|
||||||
>seq6 {"a":3, "b":4,"c":5}
|
|
||||||
aaacccgggtttca
|
|
||||||
>seq7 {"a":3, "b":5,"c":5}
|
|
||||||
aaacccgggtttca
|
|
||||||
>seq8 {"a":3, "b":5,"c":6}
|
|
||||||
aaacccgggtttca
|
|
||||||
@@ -1,4 +0,0 @@
|
|||||||
>seq5 {"count":4}
|
|
||||||
aaacccgggtttca
|
|
||||||
>seq1 {"count":4}
|
|
||||||
aaacccgggttt
|
|
||||||
@@ -1,8 +0,0 @@
|
|||||||
>seq5 {"a":2,"b":4,"c":5,"count":1}
|
|
||||||
aaacccgggtttca
|
|
||||||
>seq6 {"a":3,"count":3}
|
|
||||||
aaacccgggtttca
|
|
||||||
>seq1 {"a":2,"b":4,"c":5,"count":1}
|
|
||||||
aaacccgggttt
|
|
||||||
>seq2 {"a":3,"count":3}
|
|
||||||
aaacccgggttt
|
|
||||||
@@ -1,12 +0,0 @@
|
|||||||
>seq5 {"a":2,"b":4,"c":5,"count":1}
|
|
||||||
aaacccgggtttca
|
|
||||||
>seq6 {"a":3,"b":4,"c":5,"count":1}
|
|
||||||
aaacccgggtttca
|
|
||||||
>seq7 {"a":3,"b":5,"count":2}
|
|
||||||
aaacccgggtttca
|
|
||||||
>seq1 {"a":2,"b":4,"c":5,"count":1}
|
|
||||||
aaacccgggttt
|
|
||||||
>seq2 {"a":3,"b":4,"c":5,"count":1}
|
|
||||||
aaacccgggttt
|
|
||||||
>seq3 {"a":3,"b":5,"count":2}
|
|
||||||
aaacccgggttt
|
|
||||||
@@ -10,7 +10,6 @@ import (
|
|||||||
"strings"
|
"strings"
|
||||||
|
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
|
|
||||||
)
|
)
|
||||||
|
|
||||||
// // A pool of byte slices.
|
// // A pool of byte slices.
|
||||||
@@ -159,30 +158,12 @@ func BuildQualityConsensus(seqA, seqB *obiseq.BioSequence, path []int, statOnMis
|
|||||||
|
|
||||||
match := 0
|
match := 0
|
||||||
|
|
||||||
left := obiutils.Abs(path[0])
|
|
||||||
right := 0
|
|
||||||
if path[len(path)-1] == 0 {
|
|
||||||
right = path[len(path)-2]
|
|
||||||
}
|
|
||||||
|
|
||||||
right = obiutils.Abs(right)
|
|
||||||
|
|
||||||
right = len(*bufferQA) - right
|
|
||||||
|
|
||||||
// obilog.Warnf("BuildQualityConsensus: left = %d right = %d\n", left, right)
|
|
||||||
|
|
||||||
for i, qA = range *bufferQA {
|
for i, qA = range *bufferQA {
|
||||||
nA := (*bufferSA)[i]
|
nA := (*bufferSA)[i]
|
||||||
nB := (*bufferSB)[i]
|
nB := (*bufferSB)[i]
|
||||||
qB = (*bufferQB)[i]
|
qB = (*bufferQB)[i]
|
||||||
|
|
||||||
if statOnMismatch && i >= left && i < right && nA != nB {
|
if statOnMismatch && nA != nB && nA != ' ' && nB != ' ' {
|
||||||
if nA == ' ' {
|
|
||||||
nA = '-'
|
|
||||||
}
|
|
||||||
if nB == ' ' {
|
|
||||||
nB = '-'
|
|
||||||
}
|
|
||||||
mismatches[strings.ToUpper(fmt.Sprintf("(%c:%02d)->(%c:%02d)", nA, qA, nB, qB))] = i + 1
|
mismatches[strings.ToUpper(fmt.Sprintf("(%c:%02d)->(%c:%02d)", nA, qA, nB, qB))] = i + 1
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -202,13 +183,14 @@ func BuildQualityConsensus(seqA, seqB *obiseq.BioSequence, path []int, statOnMis
|
|||||||
|
|
||||||
q := qA + qB
|
q := qA + qB
|
||||||
|
|
||||||
|
if qA > 0 && qB > 0 {
|
||||||
if nA != nB {
|
if nA != nB {
|
||||||
q = qM - byte(math.Log10(1-math.Pow(10, -float64(qm)/40))*10+0.5)
|
q = qM - byte(math.Log10(1-math.Pow(10, -float64(qm)/30))*10+0.5)
|
||||||
}
|
}
|
||||||
|
|
||||||
if nA == nB {
|
if nA == nB {
|
||||||
match++
|
match++
|
||||||
}
|
}
|
||||||
|
}
|
||||||
|
|
||||||
if q > 90 {
|
if q > 90 {
|
||||||
q = 90
|
q = 90
|
||||||
|
|||||||
+14
-38
@@ -74,30 +74,6 @@ func _Logaddexp(a, b float64) float64 {
|
|||||||
return b + math.Log1p(math.Exp(a-b))
|
return b + math.Log1p(math.Exp(a-b))
|
||||||
}
|
}
|
||||||
|
|
||||||
func _Log1mexp(a float64) float64 {
|
|
||||||
if a > 0 {
|
|
||||||
log.Panic("Log1mexp: a > 0")
|
|
||||||
}
|
|
||||||
|
|
||||||
if a == 0 {
|
|
||||||
return 0
|
|
||||||
}
|
|
||||||
|
|
||||||
return (math.Log(-math.Expm1(a)))
|
|
||||||
}
|
|
||||||
|
|
||||||
func _Logdiffexp(a, b float64) float64 {
|
|
||||||
if a < b {
|
|
||||||
log.Panic("Log1mexp: a < b")
|
|
||||||
}
|
|
||||||
|
|
||||||
if a == b {
|
|
||||||
return math.Inf(-1)
|
|
||||||
}
|
|
||||||
|
|
||||||
return a + _Log1mexp(b-a)
|
|
||||||
}
|
|
||||||
|
|
||||||
// _MatchScoreRatio calculates the match score ratio between two bytes.
|
// _MatchScoreRatio calculates the match score ratio between two bytes.
|
||||||
//
|
//
|
||||||
// Parameters:
|
// Parameters:
|
||||||
@@ -107,25 +83,25 @@ func _Logdiffexp(a, b float64) float64 {
|
|||||||
// Returns:
|
// Returns:
|
||||||
// - float64: the match score ratio when a match is observed
|
// - float64: the match score ratio when a match is observed
|
||||||
// - float64: the match score ratio when a mismatch is observed
|
// - float64: the match score ratio when a mismatch is observed
|
||||||
func _MatchScoreRatio(QF, QR byte) (float64, float64) {
|
func _MatchScoreRatio(a, b byte) (float64, float64) {
|
||||||
|
|
||||||
|
l2 := math.Log(2)
|
||||||
l3 := math.Log(3)
|
l3 := math.Log(3)
|
||||||
l4 := math.Log(4)
|
|
||||||
l10 := math.Log(10)
|
l10 := math.Log(10)
|
||||||
qF := -float64(QF) / 10 * l10
|
lalea := math.Log(4) // 1 /(change of the random model)
|
||||||
qR := -float64(QR) / 10 * l10
|
lE1 := -float64(a)/10*l10 - l3 // log proba of sequencing error on A/3
|
||||||
term1 := _Logaddexp(qF, qR)
|
lE2 := -float64(b)/10*l10 - l3 // log proba of sequencing error on B/3
|
||||||
term2 := _Logdiffexp(term1, qF+qR)
|
lO1 := math.Log1p(-math.Exp(lE1 + l3)) // log proba no being an error on A
|
||||||
|
lO2 := math.Log1p(-math.Exp(lE2 + l3)) // log proba no being an error on B
|
||||||
|
lO1O2 := lO1 + lO2
|
||||||
|
lE1E2 := lE1 + lE2
|
||||||
|
lO1E2 := lO1 + lE2
|
||||||
|
lO2E1 := lO2 + lE1
|
||||||
|
|
||||||
// obilog.Warnf("MatchScoreRatio: %v, %v , %v, %v", QF, QR, term1, term2)
|
MM := _Logaddexp(lO1O2, lE1E2+l3) // Proba match when match observed
|
||||||
|
Mm := _Logaddexp(_Logaddexp(lO1E2, lO2E1), lE1E2+l2) // Proba match when mismatch observed
|
||||||
|
|
||||||
match_logp := _Log1mexp(term2 + l3 - l4)
|
return MM + lalea, Mm + lalea
|
||||||
match_score := match_logp - _Log1mexp(match_logp)
|
|
||||||
|
|
||||||
mismatch_logp := term2 - l4
|
|
||||||
mismatch_score := mismatch_logp - _Log1mexp(mismatch_logp)
|
|
||||||
|
|
||||||
return match_score, mismatch_score
|
|
||||||
}
|
}
|
||||||
|
|
||||||
func _InitNucPartMatch() {
|
func _InitNucPartMatch() {
|
||||||
|
|||||||
@@ -21,15 +21,15 @@ func encodeValues(score, length int, out bool) uint64 {
|
|||||||
return fo
|
return fo
|
||||||
}
|
}
|
||||||
|
|
||||||
// func _isout(value uint64) bool {
|
func _isout(value uint64) bool {
|
||||||
// const outmask = uint64(1) << dwsize
|
const outmask = uint64(1) << dwsize
|
||||||
// return (value & outmask) == 0
|
return (value & outmask) == 0
|
||||||
// }
|
}
|
||||||
|
|
||||||
// func _lpath(value uint64) int {
|
func _lpath(value uint64) int {
|
||||||
// const mask = uint64(1<<wsize) - 1
|
const mask = uint64(1<<wsize) - 1
|
||||||
// return int(((value + 1) ^ mask) & mask)
|
return int(((value + 1) ^ mask) & mask)
|
||||||
// }
|
}
|
||||||
|
|
||||||
func decodeValues(value uint64) (int, int, bool) {
|
func decodeValues(value uint64) (int, int, bool) {
|
||||||
const mask = uint64(1<<wsize) - 1
|
const mask = uint64(1<<wsize) - 1
|
||||||
@@ -57,3 +57,4 @@ func _setout(value uint64) uint64 {
|
|||||||
var _empty = encodeValues(0, 0, false)
|
var _empty = encodeValues(0, 0, false)
|
||||||
var _out = encodeValues(0, 30000, true)
|
var _out = encodeValues(0, 30000, true)
|
||||||
var _notavail = encodeValues(0, 30000, false)
|
var _notavail = encodeValues(0, 30000, false)
|
||||||
|
|
||||||
|
|||||||
@@ -4,6 +4,33 @@ import (
|
|||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
||||||
)
|
)
|
||||||
|
|
||||||
|
var _iupac = [26]byte{
|
||||||
|
// a b c d e f
|
||||||
|
1, 14, 2, 13, 0, 0,
|
||||||
|
// g h i j k l
|
||||||
|
4, 11, 0, 0, 12, 0,
|
||||||
|
// m n o p q r
|
||||||
|
3, 15, 0, 0, 0, 5,
|
||||||
|
// s t u v w x
|
||||||
|
6, 8, 8, 13, 9, 0,
|
||||||
|
// y z
|
||||||
|
10, 0,
|
||||||
|
}
|
||||||
|
|
||||||
|
func _samenuc(a, b byte) bool {
|
||||||
|
if (a >= 'A') && (a <= 'Z') {
|
||||||
|
a |= 32
|
||||||
|
}
|
||||||
|
if (b >= 'A') && (b <= 'Z') {
|
||||||
|
b |= 32
|
||||||
|
}
|
||||||
|
|
||||||
|
if (a >= 'a') && (a <= 'z') && (b >= 'a') && (b <= 'z') {
|
||||||
|
return (_iupac[a-'a'] & _iupac[b-'a']) > 0
|
||||||
|
}
|
||||||
|
return a == b
|
||||||
|
}
|
||||||
|
|
||||||
// FastLCSEGFScoreByte calculates the score of the Longest Common Subsequence (LCS) between two byte slices.
|
// FastLCSEGFScoreByte calculates the score of the Longest Common Subsequence (LCS) between two byte slices.
|
||||||
//
|
//
|
||||||
// The score is calculated using the following scoring matrix:
|
// The score is calculated using the following scoring matrix:
|
||||||
@@ -138,7 +165,7 @@ func FastLCSEGFScoreByte(bA, bB []byte, maxError int, endgapfree bool, buffer *[
|
|||||||
default:
|
default:
|
||||||
// We are in the middle of the matrix
|
// We are in the middle of the matrix
|
||||||
Sdiag = _incpath(previous[x])
|
Sdiag = _incpath(previous[x])
|
||||||
if obiseq.SameIUPACNuc(bA[j-1], bB[i-1]) {
|
if _samenuc(bA[j-1], bB[i-1]) {
|
||||||
Sdiag = _incscore(Sdiag)
|
Sdiag = _incscore(Sdiag)
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -238,7 +265,7 @@ func FastLCSEGFScoreByte(bA, bB []byte, maxError int, endgapfree bool, buffer *[
|
|||||||
Sleft = _notavail
|
Sleft = _notavail
|
||||||
default:
|
default:
|
||||||
Sdiag = _incpath(previous[x])
|
Sdiag = _incpath(previous[x])
|
||||||
if obiseq.SameIUPACNuc(bA[j-1], bB[i-1]) {
|
if _samenuc(bA[j-1], bB[i-1]) {
|
||||||
Sdiag = _incscore(Sdiag)
|
Sdiag = _incscore(Sdiag)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
@@ -1,9 +1,6 @@
|
|||||||
package obialign
|
package obialign
|
||||||
|
|
||||||
import (
|
import log "github.com/sirupsen/logrus"
|
||||||
"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
|
|
||||||
log "github.com/sirupsen/logrus"
|
|
||||||
)
|
|
||||||
|
|
||||||
// buffIndex converts a pair of coordinates (i, j) into a linear index in a matrix
|
// buffIndex converts a pair of coordinates (i, j) into a linear index in a matrix
|
||||||
// of size width x width. The coordinates are (-1)-indexed, and the linear index
|
// of size width x width. The coordinates are (-1)-indexed, and the linear index
|
||||||
@@ -72,7 +69,7 @@ func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
|
|||||||
// Mismatch score = -1
|
// Mismatch score = -1
|
||||||
// Match score = 0
|
// Match score = 0
|
||||||
match := -1
|
match := -1
|
||||||
if obiseq.SameIUPACNuc(pattern[j], sequence[i]) {
|
if _samenuc(pattern[j], sequence[i]) {
|
||||||
match = 0
|
match = 0
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -106,7 +103,7 @@ func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
|
|||||||
// Mismatch score = -1
|
// Mismatch score = -1
|
||||||
// Match score = 0
|
// Match score = 0
|
||||||
match := -1
|
match := -1
|
||||||
if obiseq.SameIUPACNuc(pattern[jmax], sequence[i]) {
|
if _samenuc(pattern[jmax], sequence[i]) {
|
||||||
match = 0
|
match = 0
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -155,7 +152,7 @@ func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
|
|||||||
|
|
||||||
}
|
}
|
||||||
|
|
||||||
// obilog.Warnf("from : %d to: %d error: %d match: %v",
|
// log.Warnf("from : %d to: %d error: %d match: %v",
|
||||||
// i, end+1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)],
|
// i, end+1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)],
|
||||||
// string(sequence[i:(end+1)]))
|
// string(sequence[i:(end+1)]))
|
||||||
return i, end + 1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)]
|
return i, end + 1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)]
|
||||||
|
|||||||
@@ -625,8 +625,6 @@ func PEAlign(seqA, seqB *obiseq.BioSequence,
|
|||||||
&arena.pointer.scoreMatrix,
|
&arena.pointer.scoreMatrix,
|
||||||
&arena.pointer.pathMatrix)
|
&arena.pointer.pathMatrix)
|
||||||
|
|
||||||
score = scoreR
|
|
||||||
|
|
||||||
path = _Backtracking(arena.pointer.pathMatrix,
|
path = _Backtracking(arena.pointer.pathMatrix,
|
||||||
len(rawSeqA), len(rawSeqB),
|
len(rawSeqA), len(rawSeqB),
|
||||||
&(arena.pointer.path))
|
&(arena.pointer.path))
|
||||||
@@ -643,7 +641,6 @@ func PEAlign(seqA, seqB *obiseq.BioSequence,
|
|||||||
len(rawSeqA), len(rawSeqB),
|
len(rawSeqA), len(rawSeqB),
|
||||||
&(arena.pointer.path))
|
&(arena.pointer.path))
|
||||||
isLeftAlign = true
|
isLeftAlign = true
|
||||||
score = scoreL
|
|
||||||
}
|
}
|
||||||
|
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -53,10 +53,10 @@ func ReadAlign(seqA, seqB *obiseq.BioSequence,
|
|||||||
over = min(seqA.Len(), seqB.Len())
|
over = min(seqA.Len(), seqB.Len())
|
||||||
}
|
}
|
||||||
|
|
||||||
// obilog.Warnf("fw/fw: %v shift=%d fastCount=%d/over=%d fastScore=%f",
|
// log.Warnf("fw/fw: %v shift=%d fastCount=%d/over=%d fastScore=%f",
|
||||||
// directAlignment, shift, fastCount, over, fastScore)
|
// directAlignment, shift, fastCount, over, fastScore)
|
||||||
|
|
||||||
// obilog.Warnf(("seqA: %s\nseqB: %s\n"), seqA.String(), seqB.String())
|
// log.Warnf(("seqA: %s\nseqB: %s\n"), seqA.String(), seqB.String())
|
||||||
|
|
||||||
// At least one mismatch exists in the overlaping region
|
// At least one mismatch exists in the overlaping region
|
||||||
if fastCount+3 < over {
|
if fastCount+3 < over {
|
||||||
|
|||||||
Executable → Regular
+7
-7
@@ -149,9 +149,9 @@ char *LowerSequence(char *seq)
|
|||||||
char *cseq;
|
char *cseq;
|
||||||
|
|
||||||
for (cseq = seq ; *cseq ; cseq++)
|
for (cseq = seq ; *cseq ; cseq++)
|
||||||
if (IS_UPPER(*cseq)) {
|
if (IS_UPPER(*cseq))
|
||||||
*cseq = TO_LOWER(*cseq);
|
*cseq = TO_LOWER(*cseq);
|
||||||
}
|
|
||||||
return seq;
|
return seq;
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -299,14 +299,14 @@ int32_t delete_apatseq(SeqPtr pseq,
|
|||||||
return 1;
|
return 1;
|
||||||
}
|
}
|
||||||
|
|
||||||
Pattern *buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel,
|
PatternPtr buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel,
|
||||||
int *errno, char **errmsg)
|
int *errno, char **errmsg)
|
||||||
{
|
{
|
||||||
Pattern *pattern;
|
PatternPtr pattern;
|
||||||
int32_t patlen;
|
int32_t patlen;
|
||||||
int32_t patlen2;
|
int32_t patlen2;
|
||||||
|
|
||||||
patlen = (int32_t)strlen(pat);
|
patlen = strlen(pat);
|
||||||
patlen2 = lenPattern(pat);
|
patlen2 = lenPattern(pat);
|
||||||
|
|
||||||
pattern = ECOMALLOC(sizeof(Pattern) + // Space for struct Pattern
|
pattern = ECOMALLOC(sizeof(Pattern) + // Space for struct Pattern
|
||||||
@@ -341,10 +341,10 @@ Pattern *buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel,
|
|||||||
|
|
||||||
}
|
}
|
||||||
|
|
||||||
Pattern *complementPattern(Pattern *pat, int *errno,
|
PatternPtr complementPattern(PatternPtr pat, int *errno,
|
||||||
char **errmsg)
|
char **errmsg)
|
||||||
{
|
{
|
||||||
Pattern *pattern;
|
PatternPtr pattern;
|
||||||
|
|
||||||
pattern = ECOMALLOC(sizeof(Pattern) +
|
pattern = ECOMALLOC(sizeof(Pattern) +
|
||||||
sizeof(char) * strlen(pat->cpat) + 1 +
|
sizeof(char) * strlen(pat->cpat) + 1 +
|
||||||
|
|||||||
Executable → Regular
+5
-5
@@ -116,13 +116,13 @@ ecoseq_t *new_ecoseq_with_data( char *AC,
|
|||||||
|
|
||||||
|
|
||||||
|
|
||||||
int32_t delete_apatseq(Seq *pseq,
|
int32_t delete_apatseq(SeqPtr pseq,
|
||||||
int *errno, char **errmsg);
|
int *errno, char **errmsg);
|
||||||
Pattern *buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel, int *errno, char **errmsg);
|
PatternPtr buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel, int *errno, char **errmsg);
|
||||||
Pattern *complementPattern(Pattern *pat, int *errno, char **errmsg);
|
PatternPtr complementPattern(PatternPtr pat, int *errno, char **errmsg);
|
||||||
|
|
||||||
Seq *new_apatseq(const char *in,int32_t circular, int32_t seqlen,
|
SeqPtr new_apatseq(const char *in,int32_t circular, int32_t seqlen,
|
||||||
Seq *out,
|
SeqPtr out,
|
||||||
int *errno, char **errmsg);
|
int *errno, char **errmsg);
|
||||||
|
|
||||||
char *ecoComplementPattern(char *nucAcSeq);
|
char *ecoComplementPattern(char *nucAcSeq);
|
||||||
|
|||||||
Executable → Regular
+6
-7
@@ -26,7 +26,7 @@ var _AllocatedApaPattern = 0
|
|||||||
// ApatPattern stores a regular pattern usable by the
|
// ApatPattern stores a regular pattern usable by the
|
||||||
// Apat algorithm functions and methods
|
// Apat algorithm functions and methods
|
||||||
type _ApatPattern struct {
|
type _ApatPattern struct {
|
||||||
pointer C.PatternPtr
|
pointer *C.Pattern
|
||||||
pattern string
|
pattern string
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -72,7 +72,6 @@ var NilApatSequence = ApatSequence{nil}
|
|||||||
//
|
//
|
||||||
// Returns an ApatPattern object and an error if the pattern is invalid.
|
// Returns an ApatPattern object and an error if the pattern is invalid.
|
||||||
func MakeApatPattern(pattern string, errormax int, allowsIndel bool) (ApatPattern, error) {
|
func MakeApatPattern(pattern string, errormax int, allowsIndel bool) (ApatPattern, error) {
|
||||||
|
|
||||||
cpattern := C.CString(pattern)
|
cpattern := C.CString(pattern)
|
||||||
defer C.free(unsafe.Pointer(cpattern))
|
defer C.free(unsafe.Pointer(cpattern))
|
||||||
cerrormax := C.int32_t(errormax)
|
cerrormax := C.int32_t(errormax)
|
||||||
@@ -160,7 +159,7 @@ func (pattern ApatPattern) Free() {
|
|||||||
// Print method prints the ApatPattern to the standard output.
|
// Print method prints the ApatPattern to the standard output.
|
||||||
// This is mainly a debug method.
|
// This is mainly a debug method.
|
||||||
func (pattern ApatPattern) Print() {
|
func (pattern ApatPattern) Print() {
|
||||||
C.PrintDebugPattern((*C.Pattern)(pattern.pointer.pointer))
|
C.PrintDebugPattern(C.PatternPtr(pattern.pointer.pointer))
|
||||||
}
|
}
|
||||||
|
|
||||||
// MakeApatSequence casts an obiseq.BioSequence to an ApatSequence.
|
// MakeApatSequence casts an obiseq.BioSequence to an ApatSequence.
|
||||||
@@ -411,8 +410,8 @@ func (pattern ApatPattern) FilterBestMatch(sequence ApatSequence, begin, length
|
|||||||
|
|
||||||
best := [3]int{0, 0, 10000}
|
best := [3]int{0, 0, 10000}
|
||||||
for _, m := range res {
|
for _, m := range res {
|
||||||
// obilog.Warnf("Current : Begin : %d End : %d Err : %d", m[0], m[1], m[2])
|
// log.Warnf("Current : Begin : %d End : %d Err : %d", m[0], m[1], m[2])
|
||||||
// obilog.Warnf("Best : Begin : %d End : %d Err : %d", best[0], best[1], best[2])
|
// log.Warnf("Best : Begin : %d End : %d Err : %d", best[0], best[1], best[2])
|
||||||
if (m[0] - m[2]) < best[1]+best[2] {
|
if (m[0] - m[2]) < best[1]+best[2] {
|
||||||
// match are overlapping
|
// match are overlapping
|
||||||
// log.Warnln("overlap")
|
// log.Warnln("overlap")
|
||||||
@@ -468,7 +467,7 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
|
|||||||
// Recompute the start and end position of the match
|
// Recompute the start and end position of the match
|
||||||
// when the pattern allows for indels
|
// when the pattern allows for indels
|
||||||
if m[2] > 0 && pattern.pointer.pointer.hasIndel {
|
if m[2] > 0 && pattern.pointer.pointer.hasIndel {
|
||||||
// obilog.Warnf("Locating indel on sequence %s[%s]", sequence.pointer.reference.Id(), pattern.String())
|
// log.Warnf("Locating indel on sequence %s[%s]", sequence.pointer.reference.Id(), pattern.String())
|
||||||
start := m[0] - m[2]*2
|
start := m[0] - m[2]*2
|
||||||
start = max(start, 0)
|
start = max(start, 0)
|
||||||
end := start + int(pattern.pointer.pointer.patlen) + 4*m[2]
|
end := start + int(pattern.pointer.pointer.patlen) + 4*m[2]
|
||||||
@@ -490,7 +489,7 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
|
|||||||
m[0] = start + pb
|
m[0] = start + pb
|
||||||
m[1] = start + pe
|
m[1] = start + pe
|
||||||
|
|
||||||
// obilog.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score,
|
// log.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score,
|
||||||
// frg, (*cpattern)[0:int(pattern.pointer.pointer.patlen)], sequence.pointer.reference.Sequence()[m[0]:m[1]])
|
// frg, (*cpattern)[0:int(pattern.pointer.pointer.patlen)], sequence.pointer.reference.Sequence()[m[0]:m[1]])
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|||||||
Some files were not shown because too many files have changed in this diff Show More
Reference in New Issue
Block a user