Enhance OBITools4 installation script with version control and documentation

Update installation script to support specific version installation, list available versions, and improve documentation.

- Add support for installing specific versions with -v/--version flag
- Add -l/--list flag to list all available versions
- Improve help message with examples
- Update README.md to reflect new installation options and examples
- Add note on version compatibility between OBITools2 and OBITools4
- Remove ecoprimers directory
- Improve error handling and user feedback during installation
- Add version detection and download logic from GitHub releases
- Update installation process to use tagged releases instead of master branch

.github/workflows/release.yml

@@ -0,0 +1,172 @@
+name: Create Release on Tag
+
+on:
+  push:
+    tags:
+      - "Release_*"
+
+permissions:
+  contents: write
+
+jobs:
+  # First run tests
+  test:
+    runs-on: ubuntu-latest
+    steps:
+      - name: Setup Go
+        uses: actions/setup-go@v5
+        with:
+          go-version: "1.23"
+      - name: Checkout obitools4 project
+        uses: actions/checkout@v4
+      - name: Run tests
+        run: make githubtests
+
+  # Build binaries for each platform
+  build:
+    needs: test
+    strategy:
+      matrix:
+        include:
+          - os: ubuntu-latest
+            goos: linux
+            goarch: amd64
+            output_name: linux_amd64
+          - os: ubuntu-24.04-arm
+            goos: linux
+            goarch: arm64
+            output_name: linux_arm64
+          - os: macos-15-intel
+            goos: darwin
+            goarch: amd64
+            output_name: darwin_amd64
+          - os: macos-latest
+            goos: darwin
+            goarch: arm64
+            output_name: darwin_arm64
+
+    runs-on: ${{ matrix.os }}
+
+    steps:
+      - name: Checkout code
+        uses: actions/checkout@v4
+
+      - name: Setup Go
+        uses: actions/setup-go@v5
+        with:
+          go-version: "1.23"
+
+      - name: Extract version from tag
+        id: get_version
+        run: |
+          TAG=${GITHUB_REF#refs/tags/Release_}
+          echo "version=$TAG" >> $GITHUB_OUTPUT
+
+      - name: Install build tools (macOS)
+        if: runner.os == 'macOS'
+        run: |
+          # Ensure Xcode Command Line Tools are installed
+          xcode-select --install 2>/dev/null || true
+          xcode-select -p
+
+      - name: Build binaries
+        env:
+          GOOS: ${{ matrix.goos }}
+          GOARCH: ${{ matrix.goarch }}
+          VERSION: ${{ steps.get_version.outputs.version }}
+        run: |
+          make obitools
+          mkdir -p artifacts
+          # Create a single tar.gz with all binaries for this platform
+          tar -czf artifacts/obitools4_${VERSION}_${{ matrix.output_name }}.tar.gz -C build .
+
+      - name: Upload artifacts
+        uses: actions/upload-artifact@v4
+        with:
+          name: binaries-${{ matrix.output_name }}
+          path: artifacts/*
+
+  # Create the release
+  create-release:
+    needs: build
+    runs-on: ubuntu-latest
+    steps:
+      - name: Checkout code
+        uses: actions/checkout@v4
+        with:
+          fetch-depth: 0
+
+      - name: Extract version from tag
+        id: get_version
+        run: |
+          TAG=${GITHUB_REF#refs/tags/Release_}
+          echo "version=$TAG" >> $GITHUB_OUTPUT
+
+      - name: Download all artifacts
+        uses: actions/download-artifact@v4
+        with:
+          path: release-artifacts
+
+      - name: Prepare release directory
+        run: |
+          mkdir -p release
+          find release-artifacts -type f -name "*.tar.gz" -exec cp {} release/ \;
+          ls -lh release/
+
+      - name: Generate Release Notes
+        env:
+          VERSION: ${{ steps.get_version.outputs.version }}
+        run: |
+          PREV_TAG=$(git describe --tags --abbrev=0 HEAD^ 2>/dev/null || echo "")
+
+          echo "# OBITools4 Release ${VERSION}" > release_notes.md
+          echo "" >> release_notes.md
+
+          if [ -n "$PREV_TAG" ]; then
+            echo "## Changes since ${PREV_TAG}" >> release_notes.md
+            echo "" >> release_notes.md
+            git log ${PREV_TAG}..HEAD --pretty=format:"- %s" >> release_notes.md
+          else
+            echo "## Changes" >> release_notes.md
+            echo "" >> release_notes.md
+            git log --pretty=format:"- %s" -n 20 >> release_notes.md
+          fi
+
+          echo "" >> release_notes.md
+          echo "" >> release_notes.md
+          echo "## Installation" >> release_notes.md
+          echo "" >> release_notes.md
+          echo "Download the appropriate archive for your system and extract it:" >> release_notes.md
+          echo "" >> release_notes.md
+          echo "### Linux (AMD64)" >> release_notes.md
+          echo '```bash' >> release_notes.md
+          echo "tar -xzf obitools4_${VERSION}_linux_amd64.tar.gz" >> release_notes.md
+          echo '```' >> release_notes.md
+          echo "" >> release_notes.md
+          echo "### Linux (ARM64)" >> release_notes.md
+          echo '```bash' >> release_notes.md
+          echo "tar -xzf obitools4_${VERSION}_linux_arm64.tar.gz" >> release_notes.md
+          echo '```' >> release_notes.md
+          echo "" >> release_notes.md
+          echo "### macOS (Intel)" >> release_notes.md
+          echo '```bash' >> release_notes.md
+          echo "tar -xzf obitools4_${VERSION}_darwin_amd64.tar.gz" >> release_notes.md
+          echo '```' >> release_notes.md
+          echo "" >> release_notes.md
+          echo "### macOS (Apple Silicon)" >> release_notes.md
+          echo '```bash' >> release_notes.md
+          echo "tar -xzf obitools4_${VERSION}_darwin_arm64.tar.gz" >> release_notes.md
+          echo '```' >> release_notes.md
+          echo "" >> release_notes.md
+          echo "All OBITools4 binaries are included in each archive." >> release_notes.md
+
+      - name: Create GitHub Release
+        uses: softprops/action-gh-release@v1
+        with:
+          name: Release ${{ steps.get_version.outputs.version }}
+          body_path: release_notes.md
+          files: release/*
+          draft: false
+          prerelease: false
+        env:
+          GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}

.gitignore

@@ -16,12 +16,18 @@
 **/*.tgz
 **/*.yaml
 **/*.csv
+xx
 
 .rhistory
 /.vscode
 /build
+/bugs
 
 /ncbitaxo
 
 !/obitests/**
 !/sample/**
+LLM/** 
+*_files
+
+entropy.html

Makefile

@@ -2,8 +2,9 @@
 #export GOBIN=$(GOPATH)/bin
 #export PATH=$(GOBIN):$(shell echo $${PATH})
 
+GOFLAGS=
 GOCMD=go
-GOBUILD=$(GOCMD) build # -compiler gccgo -gccgoflags -O3
+GOBUILD=$(GOCMD) build $(GOFLAGS)
 GOGENERATE=$(GOCMD) generate
 GOCLEAN=$(GOCMD) clean
 GOTEST=$(GOCMD) test
@@ -16,6 +17,12 @@ PACKAGES_SRC:= $(wildcard pkg/*/*.go pkg/*/*/*.go)
 PACKAGE_DIRS:=$(sort $(patsubst %/,%,$(dir $(PACKAGES_SRC))))
 PACKAGES:=$(notdir $(PACKAGE_DIRS))
 
+GITHOOK_SRC_DIR=git-hooks
+GITHOOKS_SRC:=$(wildcard $(GITHOOK_SRC_DIR)/*)
+
+GITHOOK_DIR=.git/hooks
+GITHOOKS:=$(patsubst $(GITHOOK_SRC_DIR)/%,$(GITHOOK_DIR)/%,$(GITHOOKS_SRC))
+
 OBITOOLS_SRC:= $(wildcard cmd/obitools/*/*.go)
 OBITOOLS_DIRS:=$(sort $(patsubst %/,%,$(dir $(OBITOOLS_SRC))))
 OBITOOLS:=$(notdir $(OBITOOLS_DIRS))
@@ -53,35 +60,32 @@ endif
 
 OUTPUT:=$(shell mktemp)
 
-all: obitools
+all: install-githook obitools
 
-packages: $(patsubst %,pkg-%,$(PACKAGES))
 obitools: $(patsubst %,$(OBITOOLS_PREFIX)%,$(OBITOOLS))
 
+install-githook: $(GITHOOKS)
+
+$(GITHOOK_DIR)/%: $(GITHOOK_SRC_DIR)/%
+	@echo installing $$(basename $@)...
+	@mkdir -p $(GITHOOK_DIR)
+	@cp $< $@
+	@chmod +x $@
+
+
 update-deps:
 	go get -u ./...
 
-test:
+test: .FORCE
 	$(GOTEST) ./...
 
 obitests:
 	@for t in $$(find obitests -name test.sh -print) ; do \
-		bash $${t} ;\
+		bash $${t} || exit 1;\
 	done
 
 githubtests: obitools obitests
 
-man: 
-	make -C doc man
-obibook: 
-	make -C doc obibook
-doc: man obibook
-
-macos-pkg: 
-	@bash pkgs/macos/macos-installer-builder-master/macOS-x64/build-macos-x64.sh \
-		OBITools \
-		0.0.1
-
 $(BUILD_DIR):
 	mkdir -p $@
 
@@ -90,19 +94,61 @@ $(foreach P,$(PACKAGE_DIRS),$(eval $(call MAKE_PKG_RULE,$(P))))
 
 $(foreach P,$(OBITOOLS_DIRS),$(eval $(call MAKE_OBITOOLS_RULE,$(P))))
 
-pkg/obioptions/version.go: .FORCE
-ifneq ($(strip $(COMMIT_ID)),)
-	@cat $@ \
-	| sed  -E 's/^var _Commit = "[^"]*"/var _Commit = "'$(COMMIT_ID)'"/' \
-	| sed  -E 's/^var _Version = "[^"]*"/var _Version = "'"$(LAST_TAG)"'"/' \
+pkg/obioptions/version.go: version.txt .FORCE
+	@version=$$(cat version.txt); \
+	cat $@ \
+	| sed  -E 's/^var _Version = "[^"]*"/var _Version = "Release '$$version'"/' \
 	> $(OUTPUT)
 
 	@diff $@ $(OUTPUT) 2>&1 > /dev/null \
-    	|| echo "Update version.go : $@ to $(LAST_TAG) ($(COMMIT_ID))" \
-    	&& mv $(OUTPUT) $@
+    	|| (echo "Update version.go to $$(cat version.txt)" && mv $(OUTPUT) $@)
 
 	@rm -f $(OUTPUT)
-endif
 
-.PHONY: all packages obitools man obibook doc update-deps obitests githubtests .FORCE
+bump-version:
+	@echo "Incrementing version..."
+	@current=$$(cat version.txt); \
+	echo "  Current version: $$current"; \
+	major=$$(echo $$current | cut -d. -f1); \
+	minor=$$(echo $$current | cut -d. -f2); \
+	patch=$$(echo $$current | cut -d. -f3); \
+	new_patch=$$((patch + 1)); \
+	new_version="$$major.$$minor.$$new_patch"; \
+	echo "  New version: $$new_version"; \
+	echo "$$new_version" > version.txt
+	@echo "✓ Version updated in version.txt"
+	@$(MAKE) pkg/obioptions/version.go
+
+jjnew:
+	@echo "$(YELLOW)→ Creating a new commit...$(NC)"
+	@echo "$(BLUE)→ Documenting current commit...$(NC)"
+	@jj auto-describe
+	@echo "$(BLUE)→ Done.$(NC)"
+	@jj new
+	@echo "$(GREEN)✓ New commit created$(NC)"
+
+jjpush:
+	@echo "$(YELLOW)→ Pushing commit to repository...$(NC)"
+	@echo "$(BLUE)→ Documenting current commit...$(NC)"
+	@jj auto-describe
+	@echo "$(BLUE)→ Creating new commit for version bump...$(NC)"
+	@jj new
+	@$(MAKE) bump-version
+	@echo "$(BLUE)→ Documenting version bump commit...$(NC)"
+	@jj auto-describe
+	@version=$$(cat version.txt); \
+	tag_name="Release_$$version"; \
+	echo "$(BLUE)→ Pushing commits and creating tag $$tag_name...$(NC)"; \
+	jj git push --change @; \
+	git tag -a "$$tag_name" -m "Release $$version" 2>/dev/null || echo "Tag $$tag_name already exists"; \
+	git push origin "$$tag_name" 2>/dev/null || echo "Tag already pushed"
+	@echo "$(GREEN)✓ Commits and tag pushed to repository$(NC)"
+
+jjfetch:
+	@echo "$(YELLOW)→ Pulling latest commits...$(NC)"
+	@jj git fetch
+	@jj new master@origin
+	@echo "$(GREEN)✓ Latest commits pulled$(NC)"
+
+.PHONY: all obitools update-deps obitests githubtests jjnew jjpush jjfetch bump-version .FORCE
 .FORCE:

README.md

@@ -16,12 +16,17 @@ The easiest way to run it is to copy and paste the following command into your t
 curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash
 ```
 
-By default, the script installs the *OBITools* commands and other associated files into the `/usr/local` directory.
-The names of the commands in the new *OBITools4* are mostly identical to those in *OBITools2*.
-Therefore, installing the new *OBITools* may hide or delete the old ones. If you want both versions to be 
-available on your system, the installation script offers two options:
+By default, the script installs the latest version of *OBITools* commands and other associated files into the `/usr/local` directory.
 
+### Installation Options
 
+The installation script offers several options:
+
+>  -l, --list              List all available versions and exit.
+> 
+>  -v, --version           Install a specific version (e.g., `-v 4.4.3`).
+>                          By default, the latest version is installed.
+> 
 >  -i, --install-dir       Directory where obitools are installed 
 >                          (as example use `/usr/local` not `/usr/local/bin`).
 > 
@@ -30,14 +35,31 @@ available on your system, the installation script offers two options:
 >                          same time on your system (as example `-p g` will produce 
 >                          `gobigrep` command instead of `obigrep`).
 
-You can use these options by following the installation command:
+### Examples
 
+List all available versions:
+```{bash}
+curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --list
+```
+
+Install a specific version:
+```{bash}
+curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | bash -s -- --version 4.4.3
+```
+
+Install in a custom directory with command prefix:
 ```{bash}
 curl -L https://raw.githubusercontent.com/metabarcoding/obitools4/master/install_obitools.sh | \
       bash -s -- --install-dir test_install --obitools-prefix k
 ```
 
-In this case, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus, `obigrep` will be named `kobigrep`.
+In this last example, the binaries will be installed in the `test_install` directory and all command names will be prefixed with the letter `k`. Thus, `obigrep` will be named `kobigrep`.
+
+### Note on Version Compatibility
+
+The names of the commands in the new *OBITools4* are mostly identical to those in *OBITools2*.
+Therefore, installing the new *OBITools* may hide or delete the old ones. If you want both versions to be 
+available on your system, use the `--install-dir` and `--obitools-prefix` options as shown above.
 
 ## Continuing the analysis...
 

Release-notes.md

@@ -1,10 +1,66 @@
 # OBITools release notes
 
-## March 2nd, 2025. Release 4.3.0
+## New changes
+
+### Bug fixes
+
+- In `obipairing` correct the misspelling of the `obiparing_*` tags where the `i`
+  was missing to `obipairing_`.  
+
+- In `obigrep` the **-C** option that excludes sequences too abundant was not 
+  functional.
+
+- In `obitaxonomy` the **-l** option that lists all the taxonomic rank defined by
+  a taxonomy was not functional
+
+- The file type guesser was not using enough data to be able to correctly detect
+  file format when sequences were too long in fastq and fasta or when lines were
+  to long in CSV files. That's now corrected
+
+- Options **--fasta** or **--fastq** usable to specify input format were ignored.
+  They are now correctly considered
+
+- The `obiannotate` command were crashing when a selection option was used but
+  no editing option.
+  
+- The `--fail-on-taxonomy` led to an error on merged taxa even when the
+  `--update-taxid` option was used.
+
+- The `--compressed` option was not correctly named. It was renamed to `--compress`
+  
+### Enhancement
+
+- Some sequences in the Genbank and EMBL databases are several gigabases long. The 
+  sequence parser had to reallocate and recopy memory many times to read them, 
+  resulting in a complexity of O(N^2) for reading such large sequences. 
+  The new file chunk reader has a linear algorithm that speeds up the reading 
+  of very long sequences.
+
+- A new option **--csv** is added to every obitools to indicate that the input
+  format is CSV
+
+- The new version of obitools are now printing the taxids in a fancy way
+  including the scientific name and the taxonomic rank (`"taxon:9606 [Homo
+  sapiens]@species"`). But if you need the old fashion raw taxid, a new option
+  **--raw-taxid** has been added to get obitools printing the taxids without any
+  decorations (`"9606"`).
+
+
+## March 1st, 2025. Release 4.4.0
 
 A new documentation website is available at https://obitools4.metabarcoding.org.
 Its development is still in progress. 
 
+The biggest step forward in this new version is taxonomy management. The new
+version is now able to handle taxonomic identifiers that are not just integer
+values. This is a first step towards an easy way to handle other taxonomy
+databases soon, such as the GBIF or Catalog of Life taxonomies. This version
+is able to handle files containing taxonomic information created by previous
+versions of OBITools, but files created by this new version may have some
+problems to be analyzed by previous versions, at least for the taxonomic
+information.
+
+
 ### Breaking changes
 
 - In `obimultiplex`, the short version of the **--tag-list** option used to
@@ -75,8 +131,24 @@ Its development is still in progress.
 
 ### Enhancement
 
+-   All obitools now have a **--taxonomy** option. If specified, the taxonomy is
+    loaded first and taxids annotating the sequences are validated against that
+    taxonomy. A warning is issued for any invalid taxid and for any taxid that
+    is transferred to a new taxid. The **--update-taxid** option allows these
+    old taxids to be replaced with their new equivalent in the result of the
+    obitools command.
+
+-   The scoring system used by the `obipairing` command has been changed to be
+    more coherent. In the new version, the scores associated to a match and a
+    mismatch involving a nucleotide with a quality score of 0 are equal. Which
+    is normal as a zero quality score means a perfect indecision on the read
+    nucleotide, therefore there is no reason to penalize a match differently
+    from a mismatch (see 
+    https://obitools4.metabarcoding.org/docs/commands/alignments/obipairing/exact-alignment/).
+
 -   In every *OBITools* command, the progress bar is automatically deactivated
     when the standard error output is redirected.
+
 -   Because Genbank and ENA:EMBL contain very large sequences, while OBITools4
     are optimized As Genbank and ENA:EMBL contain very large sequences, while
     OBITools4 is optimized for short sequences, `obipcr` faces some problems
@@ -85,8 +157,10 @@ Its development is still in progress.
     features, currently only available for FASTA and FASTQ file readers, have
     been implemented to limit the memory impact of `obipcr` without changing the
     computational efficiency too much.
+
 -   Logging system and therefore format, have been homogenized.
 
+## August 2nd, 2024. Release 4.3.0
 
 ### Change of git repository
 

blackboard/Prospective/kmer_index_design.md

@@ -0,0 +1,213 @@
+# Index de k-mers pour génomes de grande taille
+
+## Contexte et objectifs
+
+### Cas d'usage
+
+- Indexation de k-mers longs (k=31) pour des génomes de grande taille (< 10 Go par génome)
+- Nombre de génomes : plusieurs dizaines à quelques centaines
+- Indexation en parallèle
+- Stockage sur disque
+- Possibilité d'ajouter des génomes, mais pas de modifier un génome existant
+
+### Requêtes cibles
+
+- **Présence/absence** d'un k-mer dans un génome
+- **Intersection** entre génomes
+- **Distances** : Jaccard (présence/absence) et potentiellement Bray-Curtis (comptage)
+
+### Ressources disponibles
+
+- 128 Go de RAM
+- Stockage disque
+
+---
+
+## Estimation des volumes
+
+### Par génome
+
+- **10 Go de séquence** → ~10¹⁰ k-mers bruts (chevauchants)
+- **Après déduplication** : typiquement 10-50% de k-mers uniques → **~1-5 × 10⁹ k-mers distincts**
+
+### Espace théorique
+
+- **k=31** → 62 bits → ~4.6 × 10¹⁸ k-mers possibles
+- Table d'indexation directe impossible
+
+---
+
+## Métriques de distance
+
+### Présence/absence (binaire)
+
+- **Jaccard** : |A ∩ B| / |A ∪ B|
+- **Sørensen-Dice** : 2|A ∩ B| / (|A| + |B|)
+
+### Comptage (abondance)
+
+- **Bray-Curtis** : 1 - (2 × Σ min(aᵢ, bᵢ)) / (Σ aᵢ + Σ bᵢ)
+
+Note : Pour Bray-Curtis, le stockage des comptages est nécessaire, ce qui augmente significativement la taille de l'index.
+
+---
+
+## Options d'indexation
+
+### Option 1 : Bloom Filter par génome
+
+**Principe** : Structure probabiliste pour test d'appartenance.
+
+**Avantages :**
+- Très compact : ~10 bits/élément pour FPR ~1%
+- Construction rapide, streaming
+- Facile à sérialiser/désérialiser
+- Intersection et Jaccard estimables via formules analytiques
+
+**Inconvénients :**
+- Faux positifs (pas de faux négatifs)
+- Distances approximatives
+
+**Taille estimée** : 1-6 Go par génome (selon FPR cible)
+
+#### Dimensionnement des Bloom filters
+
+```
+\mathrm{FPR} ;=; \left(1 - e^{-h n / m}\right)^h
+```
+
+
+| Bits/élément | FPR optimal | k (hash functions) |
+|--------------|-------------|---------------------|
+| 8            | ~2%         | 5-6                 |
+| 10           | ~1%         | 7                   |
+| 12           | ~0.3%       | 8                   |
+| 16           | ~0.01%      | 11                  |
+
+Formule du taux de faux positifs :
+```
+FPR ≈ (1 - e^(-kn/m))^k
+```
+Où n = nombre d'éléments, m = nombre de bits, k = nombre de hash functions.
+
+### Option 2 : Ensemble trié de k-mers
+
+**Principe** : Stocker les k-mers (uint64) triés, avec compression possible.
+
+**Avantages :**
+- Exact (pas de faux positifs)
+- Intersection/union par merge sort O(n+m)
+- Compression efficace (delta encoding sur k-mers triés)
+
+**Inconvénients :**
+- Plus volumineux : 8 octets/k-mer
+- Construction plus lente (tri nécessaire)
+
+**Taille estimée** : 8-40 Go par génome (non compressé)
+
+### Option 3 : MPHF (Minimal Perfect Hash Function)
+
+**Principe** : Fonction de hash parfaite minimale pour les k-mers présents.
+
+**Avantages :**
+- Très compact : ~3-4 bits/élément
+- Lookup O(1)
+- Exact pour les k-mers présents
+
+**Inconvénients :**
+- Construction coûteuse (plusieurs passes)
+- Statique (pas d'ajout de k-mers après construction)
+- Ne distingue pas "absent" vs "jamais vu" sans structure auxiliaire
+
+### Option 4 : Hybride MPHF + Bloom filter
+
+- MPHF pour mapping compact des k-mers présents
+- Bloom filter pour pré-filtrage des absents
+
+---
+
+## Optimisation : Indexation de (k-2)-mers pour requêtes k-mers
+
+### Principe
+
+Au lieu d'indexer directement les 31-mers dans un Bloom filter, on indexe les 29-mers. Pour tester la présence d'un 31-mer, on vérifie que les **trois 29-mers** qu'il contient sont présents :
+
+- positions 0-28
+- positions 1-29
+- positions 2-30
+
+### Analyse probabiliste
+
+Si le Bloom filter a un FPR de p pour un 29-mer individuel, le FPR effectif pour un 31-mer devient **p³** (les trois requêtes doivent toutes être des faux positifs).
+
+| FPR 29-mer | FPR 31-mer effectif |
+|------------|---------------------|
+| 10%        | 0.1%                |
+| 5%         | 0.0125%             |
+| 1%         | 0.0001%             |
+
+### Avantages
+
+1. **Moins d'éléments à stocker** : il y a moins de 29-mers distincts que de 31-mers distincts dans un génome (deux 31-mers différents peuvent partager un même 29-mer)
+
+2. **FPR drastiquement réduit** : FPR³ avec seulement 3 requêtes
+
+3. **Index plus compact** : on peut utiliser moins de bits par élément (FPR plus élevé acceptable sur le 29-mer) tout en obtenant un FPR très bas sur le 31-mer
+
+### Trade-off
+
+Un Bloom filter à **5-6 bits/élément** pour les 29-mers donnerait un FPR effectif < 0.01% pour les 31-mers, soit environ **2× plus compact** que l'approche directe à qualité égale.
+
+**Coût** : 3× plus de requêtes par lookup (mais les requêtes Bloom sont très rapides).
+
+---
+
+## Accélération des calculs de distance : MinHash
+
+### Principe
+
+Pré-calculer une "signature" compacte (sketch) de chaque génome permettant d'estimer rapidement Jaccard sans charger les index complets.
+
+### Avantages
+
+- Matrice de distances entre 100+ génomes en quelques secondes
+- Signature de taille fixe (ex: 1000-10000 hash values) quel que soit le génome
+- Stockage minimal
+
+### Utilisation
+
+1. Construction : une passe sur les k-mers de chaque génome
+2. Distance : comparaison des sketches en O(taille du sketch)
+
+---
+
+## Architecture recommandée
+
+### Pour présence/absence + Jaccard
+
+1. **Index principal** : Bloom filter de (k-2)-mers avec l'optimisation décrite
+   - Compact (~3-5 Go par génome)
+   - FPR très bas pour les k-mers grâce aux requêtes triples
+
+2. **Sketches MinHash** : pour calcul rapide des distances entre génomes
+   - Quelques Ko par génome
+   - Permet exploration rapide de la matrice de distances
+
+### Pour comptage + Bray-Curtis
+
+1. **Index principal** : k-mers triés + comptages
+   - uint64 (k-mer) + uint8/uint16 (count)
+   - Compression delta possible
+   - Plus volumineux mais exact
+
+2. **Sketches** : variantes de MinHash pour données pondérées (ex: HyperMinHash)
+
+---
+
+## Prochaines étapes
+
+1. Implémenter un Bloom filter optimisé pour k-mers
+2. Implémenter l'optimisation (k-2)-mer → k-mer
+3. Implémenter MinHash pour les sketches
+4. Définir le format de sérialisation sur disque
+5. Benchmarker sur des génomes réels

cmd/obitools/obiannotate/main.go

@@ -30,7 +30,11 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obiannotate.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obiannotate",
+		"edits the sequence annotations",
+		obiannotate.OptionSet,
+	)
 
 	_, args := optionParser(os.Args)
 
@@ -38,6 +42,11 @@ func main() {
 	obiconvert.OpenSequenceDataErrorMessage(args, err)
 
 	annotator := obiannotate.CLIAnnotationPipeline()
+
+	if obiannotate.CLIHasSetNumberFlag() {
+		sequences = sequences.NumberSequences(1, !obiconvert.CLINoInputOrder())
+	}
+
 	obiconvert.CLIWriteBioSequences(sequences.Pipe(annotator), true)
 
 	obiutils.WaitForLastPipe()

cmd/obitools/obiclean/main.go

@@ -11,7 +11,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obiclean.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obiclean",
+		"",
+		obiclean.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obicleandb/main.go

@@ -14,7 +14,10 @@ import (
 func main() {
 	obidefault.SetBatchSize(10)
 
-	optionParser := obioptions.GenerateOptionParser(obicleandb.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obicleandb",
+		"clean-up reference databases",
+		obicleandb.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obicomplement/main.go

@@ -11,7 +11,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obiconvert.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obicomplement",
+		"reverse complement of sequences",
+		obiconvert.OptionSet(true))
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obiconsensus/main.go

@@ -11,7 +11,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obiconsensus.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obiconsensus",
+		"ONT reads denoising",
+		obiconsensus.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obiconvert/main.go

@@ -14,7 +14,10 @@ func main() {
 	obidefault.SetStrictReadWorker(2)
 	obidefault.SetStrictWriteWorker(2)
 
-	optionParser := obioptions.GenerateOptionParser(obiconvert.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obiconvert",
+		"convertion of sequence files to various formats",
+		obiconvert.OptionSet(true))
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obicount/main.go

@@ -28,6 +28,8 @@ func main() {
 	// defer trace.Stop()
 
 	optionParser := obioptions.GenerateOptionParser(
+		"obicount",
+		"counts the sequences present in a file of sequences",
 		obiconvert.InputOptionSet,
 		obicount.OptionSet,
 	)

cmd/obitools/obicsv/main.go

@@ -10,7 +10,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obicsv.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obicsv",
+		"converts sequence files to CSV format",
+		obicsv.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obidemerge/main.go

@@ -15,7 +15,10 @@ func main() {
 	obidefault.SetStrictReadWorker(2)
 	obidefault.SetStrictWriteWorker(2)
 
-	optionParser := obioptions.GenerateOptionParser(obidemerge.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obidemerge",
+		"",
+		obidemerge.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obidistribute/main.go

@@ -11,7 +11,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obidistribute.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obidistribute",
+		"divided an input set of sequences into subsets",
+		obidistribute.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obigrep/main.go

@@ -30,7 +30,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obigrep.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obigrep",
+		"select a subset of sequences on various criteria",
+		obigrep.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obijoin/main.go

@@ -15,7 +15,10 @@ func main() {
 	obidefault.SetStrictReadWorker(2)
 	obidefault.SetStrictWriteWorker(2)
 
-	optionParser := obioptions.GenerateOptionParser(obijoin.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obijoin",
+		"merge annotations contained in a file to another file",
+		obijoin.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obikmermatch/main.go

@@ -31,7 +31,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obikmersim.MatchOptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obikmermatch",
+		"",
+		obikmersim.MatchOptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obikmersimcount/main.go

@@ -32,7 +32,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obikmersim.CountOptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obikmersimcount",
+		"",
+		obikmersim.CountOptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obilandmark/main.go

@@ -11,7 +11,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obilandmark.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obilandmark",
+		"",
+		obilandmark.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obilowmask/main.go

@@ -0,0 +1,47 @@
+package main
+
+import (
+	"os"
+
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obilowmask"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
+)
+
+func main() {
+
+	defer obiseq.LogBioSeqStatus()
+
+	// go tool pprof -http=":8000" ./obipairing ./cpu.pprof
+	// f, err := os.Create("cpu.pprof")
+	// if err != nil {
+	// 	log.Fatal(err)
+	// }
+	// pprof.StartCPUProfile(f)
+	// defer pprof.StopCPUProfile()
+
+	// go tool trace cpu.trace
+	// ftrace, err := os.Create("cpu.trace")
+	// if err != nil {
+	// 	log.Fatal(err)
+	// }
+	// trace.Start(ftrace)
+	// defer trace.Stop()
+
+	optionParser := obioptions.GenerateOptionParser(
+		"obimicrosat",
+		"looks for microsatellites sequences in a sequence file",
+		obilowmask.OptionSet)
+
+	_, args := optionParser(os.Args)
+
+	sequences, err := obiconvert.CLIReadBioSequences(args...)
+	obiconvert.OpenSequenceDataErrorMessage(args, err)
+
+	selected := obilowmask.CLISequenceEntropyMasker(sequences)
+	obiconvert.CLIWriteBioSequences(selected, true)
+	obiutils.WaitForLastPipe()
+
+}

cmd/obitools/obimatrix/main.go

@@ -31,6 +31,8 @@ func main() {
 	// defer trace.Stop()
 
 	optionParser := obioptions.GenerateOptionParser(
+		"obimatrix",
+		"",
 		obimatrix.OptionSet,
 	)
 

cmd/obitools/obimicrosat/main.go

@@ -30,7 +30,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obimicrosat.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obimicrosat",
+		"looks for microsatellites sequences in a sequence file",
+		obimicrosat.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obimultiplex/main.go

@@ -28,7 +28,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obimultiplex.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obimultiplex",
+		"demultiplex amplicons",
+		obimultiplex.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obipairing/main.go

@@ -30,7 +30,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obipairing.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obipairing",
+		"align forward with reverse reads with paired reads",
+		obipairing.OptionSet)
 
 	optionParser(os.Args)
 

cmd/obitools/obipcr/main.go

@@ -29,7 +29,10 @@ func main() {
 	obidefault.SetParallelFilesRead(obidefault.ParallelWorkers() / 4)
 	obidefault.SetBatchSize(10)
 
-	optionParser := obioptions.GenerateOptionParser(obipcr.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obipcr",
+		"simulates a PCR on a sequence files",
+		obipcr.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obireffamidx/main.go

@@ -11,7 +11,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obirefidx.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obireffamidx",
+		"",
+		obirefidx.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obirefidx/main.go

@@ -11,7 +11,10 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obirefidx.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obirefidx",
+		"",
+		obirefidx.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obiscript/main.go

@@ -31,7 +31,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obiscript.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obiscript",
+		"executes a lua script on the input sequences",
+		obiscript.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obisplit/main.go

@@ -31,7 +31,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obisplit.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obisplit",
+		"",
+		obisplit.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obisummary/main.go

@@ -33,7 +33,10 @@ func main() {
 	// trace.Start(ftrace)
 	// defer trace.Stop()
 
-	optionParser := obioptions.GenerateOptionParser(obisummary.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obisummary",
+		"resume main information from a sequence file",
+		obisummary.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/obitools/obitag/main.go

@@ -11,6 +11,7 @@ import (
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitag"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitaxonomy"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
 
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
@@ -39,7 +40,10 @@ func main() {
 	obidefault.SetStrictWriteWorker(1)
 	obidefault.SetBatchSize(10)
 
-	optionParser := obioptions.GenerateOptionParser(obitag.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obitag",
+		"realizes taxonomic assignment",
+		obitag.OptionSet)
 
 	_, args := optionParser(os.Args)
 
@@ -55,7 +59,7 @@ func main() {
 	}
 
 	if taxo == nil {
-		taxo, err = references.ExtractTaxonomy(nil)
+		taxo, err = references.ExtractTaxonomy(nil, obitaxonomy.CLINewickWithLeaves())
 
 		if err != nil {
 			log.Fatalf("No taxonomy specified or extractable from reference database: %v", err)
@@ -70,10 +74,12 @@ func main() {
 
 	var identified obiiter.IBioSequence
 
+	fsrb := fs.Rebatch(obidefault.BatchSize())
+
 	if obitag.CLIGeometricMode() {
-		identified = obitag.CLIGeomAssignTaxonomy(fs, references, taxo)
+		identified = obitag.CLIGeomAssignTaxonomy(fsrb, references, taxo)
 	} else {
-		identified = obitag.CLIAssignTaxonomy(fs, references, taxo)
+		identified = obitag.CLIAssignTaxonomy(fsrb, references, taxo)
 	}
 
 	obiconvert.CLIWriteBioSequences(identified, true)

cmd/obitools/obitagpcr/main.go

@@ -33,7 +33,10 @@ func main() {
 
 	obidefault.SetWorkerPerCore(1)
 
-	optionParser := obioptions.GenerateOptionParser(obitagpcr.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obitagpcr",
+		"split a paired raw read data set per sample",
+		obitagpcr.OptionSet)
 
 	optionParser(os.Args)
 	pairs, err := obipairing.CLIPairedSequence()

cmd/obitools/obitaxonomy/main.go

@@ -4,9 +4,11 @@ import (
 	"os"
 
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiitercsv"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obioptions"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obiconvert"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obicsv"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitools/obitaxonomy"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
 
@@ -14,30 +16,59 @@ import (
 )
 
 func main() {
-	optionParser := obioptions.GenerateOptionParser(obitaxonomy.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obitaxonomy",
+		"manipulates and queries taxonomy",
+		obitaxonomy.OptionSet)
 
 	_, args := optionParser(os.Args)
 
 	var iterator *obitax.ITaxon
 
-	switch {
-	case obitaxonomy.CLIDownloadNCBI():
+	if obitaxonomy.CLIDownloadNCBI() {
 		err := obitaxonomy.CLIDownloadNCBITaxdump()
 		if err != nil {
 			log.Errorf("Cannot download NCBI taxonomy: %s", err.Error())
 			os.Exit(1)
 		}
+		os.Exit(0)
+	}
 
+	if !obidefault.HasSelectedTaxonomy() {
+		log.Fatal("you must indicate a taxonomy using the -t or --taxonomy option")
+	}
+
+	switch {
+	case obitaxonomy.CLIAskForRankList():
+		newIter := obiitercsv.NewICSVRecord()
+		newIter.Add(1)
+		newIter.AppendField("rank")
+		go func() {
+			ranks := obitax.DefaultTaxonomy().RankList()
+			data := make([]obiitercsv.CSVRecord, len(ranks))
+
+			for i, rank := range ranks {
+				record := make(obiitercsv.CSVRecord)
+				record["rank"] = rank
+				data[i] = record
+			}
+			newIter.Push(obiitercsv.MakeCSVRecordBatch(obitax.DefaultTaxonomy().Name(), 0, data))
+			newIter.Close()
+			newIter.Done()
+		}()
+		obicsv.CLICSVWriter(newIter, true)
+		obiutils.WaitForLastPipe()
 		os.Exit(0)
 
 	case obitaxonomy.CLIExtractTaxonomy():
 		iter, err := obiconvert.CLIReadBioSequences(args...)
+		iter = iter.NumberSequences(1, true)
 
 		if err != nil {
 			log.Fatalf("Cannot extract taxonomy: %v", err)
 		}
 
-		taxonomy, err := iter.ExtractTaxonomy()
+		taxonomy, err := iter.ExtractTaxonomy(obitaxonomy.CLINewickWithLeaves())
 
 		if err != nil {
 			log.Fatalf("Cannot extract taxonomy: %v", err)
@@ -99,7 +130,12 @@ func main() {
 	}
 
 	iterator = obitaxonomy.CLITaxonRestrictions(iterator)
+
+	if obitaxonomy.CLIAsNewick() {
+		obitaxonomy.CLINewickWriter(iterator, true)
+	} else {
 		obitaxonomy.CLICSVTaxaWriter(iterator, true)
+	}
 
 	obiutils.WaitForLastPipe()
 

cmd/obitools/obiuniq/main.go

@@ -33,7 +33,10 @@ func main() {
 
 	obidefault.SetBatchSize(10)
 	obidefault.SetReadQualities(false)
-	optionParser := obioptions.GenerateOptionParser(obiuniq.OptionSet)
+	optionParser := obioptions.GenerateOptionParser(
+		"obiuniq",
+		"dereplicate sequence data sets",
+		obiuniq.OptionSet)
 
 	_, args := optionParser(os.Args)
 

cmd/test/main.go

@@ -3,13 +3,13 @@ package main
 import (
 	"os"
 
-	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obitax"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
 )
 
 func main() {
 
-	obitax.DetectTaxonomyFormat(os.Args[1])
+	obiformats.DetectTaxonomyFormat(os.Args[1])
 	println(obiutils.RemoveAllExt("toto/tutu/test.txt"))
 	println(obiutils.Basename("toto/tutu/test.txt"))
 

git-hooks/pre-push

@@ -0,0 +1,23 @@
+#!/bin/bash
+
+remote="$1"
+#url="$2"
+
+log() {
+    echo -e "[Pre-Push tests @ $(date)] $*" 1>&2
+}
+
+current_branch=$(git symbolic-ref --short head)
+
+cmd="make githubtests"
+
+if [[ $current_branch = "master" ]]; then
+    log "you are on $current_branch, running build test"
+    if ! eval "$cmd"; then
+        log "Pre-push tests failed $cmd" 
+        exit 1
+    fi
+fi
+
+log "Tests are OK, ready to push on $remote"
+exit 0

go.mod

@@ -1,11 +1,12 @@
 module git.metabarcoding.org/obitools/obitools4/obitools4
 
-go 1.23.1
+go 1.23.4
+
+toolchain go1.24.2
 
 require (
 	github.com/DavidGamba/go-getoptions v0.28.0
 	github.com/PaesslerAG/gval v1.2.2
-	github.com/TuftsBCB/io v0.0.0-20140121014543-22b94e9b23f9
 	github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df
 	github.com/buger/jsonparser v1.1.1
 	github.com/chen3feng/stl4go v0.1.1
@@ -19,19 +20,23 @@ require (
 	github.com/stretchr/testify v1.8.4
 	github.com/tevino/abool/v2 v2.1.0
 	github.com/yuin/gopher-lua v1.1.1
-	golang.org/x/exp v0.0.0-20231006140011-7918f672742d
+	golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa
 	gonum.org/v1/gonum v0.14.0
 	gopkg.in/yaml.v3 v3.0.1
 	scientificgo.org/special v0.0.0
 )
 
 require (
+	github.com/RoaringBitmap/roaring v1.9.4 // indirect
+	github.com/bits-and-blooms/bitset v1.12.0 // indirect
 	github.com/davecgh/go-spew v1.1.1 // indirect
 	github.com/goombaio/orderedmap v0.0.0-20180924084748-ba921b7e2419 // indirect
-	github.com/kr/pretty v0.3.0 // indirect
+	github.com/kr/pretty v0.3.1 // indirect
 	github.com/kr/text v0.2.0 // indirect
+	github.com/mschoch/smat v0.2.0 // indirect
+	github.com/pelletier/go-toml/v2 v2.2.4 // indirect
 	github.com/pmezard/go-difflib v1.0.0 // indirect
-	github.com/rogpeppe/go-internal v1.6.1 // indirect
+	github.com/rogpeppe/go-internal v1.12.0 // indirect
 )
 
 require (
@@ -44,8 +49,8 @@ require (
 	github.com/rivo/uniseg v0.4.4 // indirect
 	github.com/shopspring/decimal v1.3.1 // indirect
 	github.com/ulikunitz/xz v0.5.11
-	golang.org/x/net v0.17.0 // indirect
-	golang.org/x/sys v0.17.0 // indirect
-	golang.org/x/term v0.13.0 // indirect
+	golang.org/x/net v0.35.0 // indirect
+	golang.org/x/sys v0.30.0 // indirect
+	golang.org/x/term v0.29.0 // indirect
 	gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c
 )

go.sum

@@ -4,10 +4,12 @@ github.com/PaesslerAG/gval v1.2.2 h1:Y7iBzhgE09IGTt5QgGQ2IdaYYYOU134YGHBThD+wm9E
 github.com/PaesslerAG/gval v1.2.2/go.mod h1:XRFLwvmkTEdYziLdaCeCa5ImcGVrfQbeNUbVR+C6xac=
 github.com/PaesslerAG/jsonpath v0.1.0 h1:gADYeifvlqK3R3i2cR5B4DGgxLXIPb3TRTH1mGi0jPI=
 github.com/PaesslerAG/jsonpath v0.1.0/go.mod h1:4BzmtoM/PI8fPO4aQGIusjGxGir2BzcV0grWtFzq1Y8=
-github.com/TuftsBCB/io v0.0.0-20140121014543-22b94e9b23f9 h1:Zc1/GNsUpgZR9qm1EmRSKrnOHA7CCd0bIzGdq0cREN0=
-github.com/TuftsBCB/io v0.0.0-20140121014543-22b94e9b23f9/go.mod h1:PZyV4WA3NpqtezSY0h6E6NARAmdDm0qwrydveOyR5Gc=
+github.com/RoaringBitmap/roaring v1.9.4 h1:yhEIoH4YezLYT04s1nHehNO64EKFTop/wBhxv2QzDdQ=
+github.com/RoaringBitmap/roaring v1.9.4/go.mod h1:6AXUsoIEzDTFFQCe1RbGA6uFONMhvejWj5rqITANK90=
 github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df h1:GSoSVRLoBaFpOOds6QyY1L8AX7uoY+Ln3BHc22W40X0=
 github.com/barkimedes/go-deepcopy v0.0.0-20220514131651-17c30cfc62df/go.mod h1:hiVxq5OP2bUGBRNS3Z/bt/reCLFNbdcST6gISi1fiOM=
+github.com/bits-and-blooms/bitset v1.12.0 h1:U/q1fAF7xXRhFCrhROzIfffYnu+dlS38vCZtmFVPHmA=
+github.com/bits-and-blooms/bitset v1.12.0/go.mod h1:7hO7Gc7Pp1vODcmWvKMRA9BNmbv6a/7QIWpPxHddWR8=
 github.com/buger/jsonparser v1.1.1 h1:2PnMjfWD7wBILjqQbt530v576A/cAbQvEW9gGIpYMUs=
 github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
 github.com/chen3feng/stl4go v0.1.1 h1:0L1+mDw7pomftKDruM23f1mA7miavOj6C6MZeadzN2Q=
@@ -36,10 +38,9 @@ github.com/klauspost/compress v1.17.2/go.mod h1:ntbaceVETuRiXiv4DpjP66DpAtAGkEQs
 github.com/klauspost/cpuid v1.2.0/go.mod h1:Pj4uuM528wm8OyEC2QMXAi2YiTZ96dNQPGgoMS4s3ek=
 github.com/klauspost/pgzip v1.2.6 h1:8RXeL5crjEUFnR2/Sn6GJNWtSQ3Dk8pq4CL3jvdDyjU=
 github.com/klauspost/pgzip v1.2.6/go.mod h1:Ch1tH69qFZu15pkjo5kYi6mth2Zzwzt50oCQKQE9RUs=
-github.com/kr/pretty v0.1.0/go.mod h1:dAy3ld7l9f0ibDNOQOHHMYYIIbhfbHSm3C4ZsoJORNo=
 github.com/kr/pretty v0.2.1/go.mod h1:ipq/a2n7PKx3OHsz4KJII5eveXtPO4qwEXGdVfWzfnI=
-github.com/kr/pretty v0.3.0 h1:WgNl7dwNpEZ6jJ9k1snq4pZsg7DOEN8hP9Xw0Tsjwk0=
-github.com/kr/pretty v0.3.0/go.mod h1:640gp4NfQd8pI5XOwp5fnNeVWj67G7CFk/SaSQn7NBk=
+github.com/kr/pretty v0.3.1 h1:flRD4NNwYAUpkphVc1HcthR4KEIFJ65n8Mw5qdRn3LE=
+github.com/kr/pretty v0.3.1/go.mod h1:hoEshYVHaxMs3cyo3Yncou5ZscifuDolrwPKZanG3xk=
 github.com/kr/pty v1.1.1/go.mod h1:pFQYn66WHrOpPYNljwOMqo10TkYh1fy3cYio2l3bCsQ=
 github.com/kr/text v0.1.0/go.mod h1:4Jbv+DJW3UT/LiOwJeYQe1efqtUx/iVham/4vfdArNI=
 github.com/kr/text v0.2.0 h1:5Nx0Ya0ZqY2ygV366QzturHI13Jq95ApcVaJBhpS+AY=
@@ -50,15 +51,21 @@ github.com/mattn/go-runewidth v0.0.15 h1:UNAjwbU9l54TA3KzvqLGxwWjHmMgBUVhBiTjelZ
 github.com/mattn/go-runewidth v0.0.15/go.mod h1:Jdepj2loyihRzMpdS35Xk/zdY8IAYHsh153qUoGf23w=
 github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db h1:62I3jR2EmQ4l5rM/4FEfDWcRD+abF5XlKShorW5LRoQ=
 github.com/mitchellh/colorstring v0.0.0-20190213212951-d06e56a500db/go.mod h1:l0dey0ia/Uv7NcFFVbCLtqEBQbrT4OCwCSKTEv6enCw=
+github.com/mschoch/smat v0.2.0 h1:8imxQsjDm8yFEAVBe7azKmKSgzSkZXDuKkSq9374khM=
+github.com/mschoch/smat v0.2.0/go.mod h1:kc9mz7DoBKqDyiRL7VZN8KvXQMWeTaVnttLRXOlotKw=
 github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58 h1:onHthvaw9LFnH4t2DcNVpwGmV9E1BkGknEliJkfwQj0=
 github.com/pbnjay/memory v0.0.0-20210728143218-7b4eea64cf58/go.mod h1:DXv8WO4yhMYhSNPKjeNKa5WY9YCIEBRbNzFFPJbWO6Y=
+github.com/pelletier/go-toml/v2 v2.2.4 h1:mye9XuhQ6gvn5h28+VilKrrPoQVanw5PMw/TB0t5Ec4=
+github.com/pelletier/go-toml/v2 v2.2.4/go.mod h1:2gIqNv+qfxSVS7cM2xJQKtLSTLUE9V8t9Stt+h56mCY=
+github.com/pkg/diff v0.0.0-20210226163009-20ebb0f2a09e/go.mod h1:pJLUxLENpZxwdsKMEsNbx1VGcRFpLqf3715MtcvvzbA=
 github.com/pmezard/go-difflib v1.0.0 h1:4DBwDE0NGyQoBHbLQYPwSUPoCMWR5BEzIk/f1lZbAQM=
 github.com/pmezard/go-difflib v1.0.0/go.mod h1:iKH77koFhYxTK1pcRnkKkqfTogsbg7gZNVY4sRDYZ/4=
 github.com/rivo/uniseg v0.2.0/go.mod h1:J6wj4VEh+S6ZtnVlnTBMWIodfgj8LQOQFoIToxlJtxc=
 github.com/rivo/uniseg v0.4.4 h1:8TfxU8dW6PdqD27gjM8MVNuicgxIjxpm4K7x4jp8sis=
 github.com/rivo/uniseg v0.4.4/go.mod h1:FN3SvrM+Zdj16jyLfmOkMNblXMcoc8DfTHruCPUcx88=
-github.com/rogpeppe/go-internal v1.6.1 h1:/FiVV8dS/e+YqF2JvO3yXRFbBLTIuSDkuC7aBOAvL+k=
-github.com/rogpeppe/go-internal v1.6.1/go.mod h1:xXDCJY+GAPziupqXw64V24skbSoqbTEfhy4qGm1nDQc=
+github.com/rogpeppe/go-internal v1.9.0/go.mod h1:WtVeX8xhTBvf0smdhujwtBcq4Qrzq/fJaraNFVN+nFs=
+github.com/rogpeppe/go-internal v1.12.0 h1:exVL4IDcn6na9z1rAb56Vxr+CgyK3nn3O+epU5NdKM8=
+github.com/rogpeppe/go-internal v1.12.0/go.mod h1:E+RYuTGaKKdloAfM02xzb0FW3Paa99yedzYV+kq4uf4=
 github.com/rrethy/ahocorasick v1.0.0 h1:YKkCB+E5PXc0xmLfMrWbfNht8vG9Re97IHSWZk/Lk8E=
 github.com/rrethy/ahocorasick v1.0.0/go.mod h1:nq8oScE7Vy1rOppoQxpQiiDmPHuKCuk9rXrNcxUV3R0=
 github.com/schollz/progressbar/v3 v3.13.1 h1:o8rySDYiQ59Mwzy2FELeHY5ZARXZTVJC7iHD6PEFUiE=
@@ -79,25 +86,23 @@ github.com/ulikunitz/xz v0.5.11 h1:kpFauv27b6ynzBNT/Xy+1k+fK4WswhN/6PN5WhFAGw8=
 github.com/ulikunitz/xz v0.5.11/go.mod h1:nbz6k7qbPmH4IRqmfOplQw/tblSgqTqBwxkY0oWt/14=
 github.com/yuin/gopher-lua v1.1.1 h1:kYKnWBjvbNP4XLT3+bPEwAXJx262OhaHDWDVOPjL46M=
 github.com/yuin/gopher-lua v1.1.1/go.mod h1:GBR0iDaNXjAgGg9zfCvksxSRnQx76gclCIb7kdAd1Pw=
-golang.org/x/exp v0.0.0-20231006140011-7918f672742d h1:jtJma62tbqLibJ5sFQz8bKtEM8rJBtfilJ2qTU199MI=
-golang.org/x/exp v0.0.0-20231006140011-7918f672742d/go.mod h1:ldy0pHrwJyGW56pPQzzkH36rKxoZW1tw7ZJpeKx+hdo=
-golang.org/x/net v0.17.0 h1:pVaXccu2ozPjCXewfr1S7xza/zcXTity9cCdXQYSjIM=
-golang.org/x/net v0.17.0/go.mod h1:NxSsAGuq816PNPmqtQdLE42eU2Fs7NoRIZrHJAlaCOE=
+golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa h1:FRnLl4eNAQl8hwxVVC17teOw8kdjVDVAiFMtgUdTSRQ=
+golang.org/x/exp v0.0.0-20231110203233-9a3e6036ecaa/go.mod h1:zk2irFbV9DP96SEBUUAy67IdHUaZuSnrz1n472HUCLE=
+golang.org/x/net v0.35.0 h1:T5GQRQb2y08kTAByq9L4/bz8cipCdA8FbRTXewonqY8=
+golang.org/x/net v0.35.0/go.mod h1:EglIi67kWsHKlRzzVMUD93VMSWGFOMSZgxFjparz1Qk=
 golang.org/x/sys v0.0.0-20220715151400-c0bba94af5f8/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
 golang.org/x/sys v0.0.0-20220811171246-fbc7d0a398ab/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
 golang.org/x/sys v0.6.0/go.mod h1:oPkhp1MJrh7nUepCBck5+mAzfO9JrbApNNgaTdGDITg=
-golang.org/x/sys v0.17.0 h1:25cE3gD+tdBA7lp7QfhuV+rJiE9YXTcS3VG1SqssI/Y=
-golang.org/x/sys v0.17.0/go.mod h1:/VUhepiaJMQUp4+oa/7Zr1D23ma6VTLIYjOOTFZPUcA=
+golang.org/x/sys v0.30.0 h1:QjkSwP/36a20jFYWkSue1YwXzLmsV5Gfq7Eiy72C1uc=
+golang.org/x/sys v0.30.0/go.mod h1:/VUhepiaJMQUp4+oa/7Zr1D23ma6VTLIYjOOTFZPUcA=
 golang.org/x/term v0.6.0/go.mod h1:m6U89DPEgQRMq3DNkDClhWw02AUbt2daBVO4cn4Hv9U=
-golang.org/x/term v0.13.0 h1:bb+I9cTfFazGW51MZqBVmZy7+JEJMouUHTUSKVQLBek=
-golang.org/x/term v0.13.0/go.mod h1:LTmsnFJwVN6bCy1rVCoS+qHT1HhALEFxKncY3WNNh4U=
+golang.org/x/term v0.29.0 h1:L6pJp37ocefwRRtYPKSWOWzOtWSxVajvz2ldH/xi3iU=
+golang.org/x/term v0.29.0/go.mod h1:6bl4lRlvVuDgSf3179VpIxBF0o10JUpXWOnI7nErv7s=
 gonum.org/v1/gonum v0.14.0 h1:2NiG67LD1tEH0D7kM+ps2V+fXmsAnpUeec7n8tcr4S0=
 gonum.org/v1/gonum v0.14.0/go.mod h1:AoWeoz0becf9QMWtE8iWXNXc27fK4fNeHNf/oMejGfU=
 gopkg.in/check.v1 v0.0.0-20161208181325-20d25e280405/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0=
-gopkg.in/check.v1 v1.0.0-20180628173108-788fd7840127/go.mod h1:Co6ibVJAznAaIkqp8huTwlJQCZ016jof/cbN4VW5Yz0=
 gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c h1:Hei/4ADfdWqJk1ZMxUNpqntNwaWcugrBjAiHlqqRiVk=
 gopkg.in/check.v1 v1.0.0-20201130134442-10cb98267c6c/go.mod h1:JHkPIbrfpd72SG/EVd6muEfDQjcINNoR0C8j2r3qZ4Q=
-gopkg.in/errgo.v2 v2.1.0/go.mod h1:hNsd1EY+bozCKY1Ytp96fpM3vjJbqLJn88ws8XvfDNI=
 gopkg.in/yaml.v3 v3.0.0-20200313102051-9f266ea9e77c/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=
 gopkg.in/yaml.v3 v3.0.1 h1:fxVm/GzAzEWqLHuvctI91KS9hhNmmWOoWu0XTYJS7CA=
 gopkg.in/yaml.v3 v3.0.1/go.mod h1:K4uyk7z7BCEPqu6E+C64Yfv1cQ7kz7rIZviUmN+EgEM=

go.work

@@ -1,3 +1,5 @@
-go 1.23.1
+go 1.23.4
+
+toolchain go1.24.2
 
 use .

go.work.sum

@@ -2,7 +2,6 @@ git.sr.ht/~sbinet/gg v0.3.1 h1:LNhjNn8DerC8f9DHLz6lS0YYul/b602DUxDgGkd/Aik=
 git.sr.ht/~sbinet/gg v0.3.1/go.mod h1:KGYtlADtqsqANL9ueOFkWymvzUvLMQllU5Ixo+8v3pc=
 github.com/ajstarks/svgo v0.0.0-20211024235047-1546f124cd8b h1:slYM766cy2nI3BwyRiyQj/Ud48djTMtMebDqepE95rw=
 github.com/ajstarks/svgo v0.0.0-20211024235047-1546f124cd8b/go.mod h1:1KcenG0jGWcpt8ov532z81sp/kMMUG485J2InIOyADM=
-github.com/buger/jsonparser v1.1.1/go.mod h1:6RYKKt7H4d4+iWqouImQ9R2FZql3VbhNgx27UK13J/0=
 github.com/chzyer/logex v1.1.10 h1:Swpa1K6QvQznwJRcfTfQJmTE72DqScAa40E+fbHEXEE=
 github.com/chzyer/logex v1.1.10/go.mod h1:+Ywpsq7O8HXn0nuIou7OrIPyXbp3wmkHB+jjWRnGsAI=
 github.com/chzyer/logex v1.2.0 h1:+eqR0HfOetur4tgnC8ftU5imRnhi4te+BadWS95c5AM=
@@ -20,15 +19,20 @@ github.com/go-latex/latex v0.0.0-20230307184459-12ec69307ad9 h1:NxXI5pTAtpEaU49b
 github.com/go-latex/latex v0.0.0-20230307184459-12ec69307ad9/go.mod h1:gWuR/CrFDDeVRFQwHPvsv9soJVB/iqymhuZQuJ3a9OM=
 github.com/go-pdf/fpdf v0.6.0 h1:MlgtGIfsdMEEQJr2le6b/HNr1ZlQwxyWr77r2aj2U/8=
 github.com/go-pdf/fpdf v0.6.0/go.mod h1:HzcnA+A23uwogo0tp9yU+l3V+KXhiESpt1PMayhOh5M=
+github.com/go-quicktest/qt v1.101.0/go.mod h1:14Bz/f7NwaXPtdYEgzsx46kqSxVwTbzVZsDC26tQJow=
 github.com/goccmack/gocc v0.0.0-20230228185258-2292f9e40198 h1:FSii2UQeSLngl3jFoR4tUKZLprO7qUlh/TKKticc0BM=
 github.com/goccmack/gocc v0.0.0-20230228185258-2292f9e40198/go.mod h1:DTh/Y2+NbnOVVoypCCQrovMPDKUGp4yZpSbWg5D0XIM=
 github.com/golang/freetype v0.0.0-20170609003504-e2365dfdc4a0 h1:DACJavvAHhabrF08vX0COfcOBJRhZ8lUbR+ZWIs0Y5g=
 github.com/golang/freetype v0.0.0-20170609003504-e2365dfdc4a0/go.mod h1:E/TSTwGwJL78qG/PmXZO1EjYhfJinVAhrmmHX6Z8B9k=
+github.com/google/go-cmdtest v0.4.1-0.20220921163831-55ab3332a786/go.mod h1:apVn/GCasLZUVpAJ6oWAuyP7Ne7CEsQbTnc0plM3m+o=
 github.com/google/go-cmp v0.5.8 h1:e6P7q2lk1O+qJJb4BtCQXlK8vWEO8V1ZeuEdJNOqZyg=
 github.com/google/go-cmp v0.5.8/go.mod h1:17dUlkBOakJ0+DkrSSNjCkIjxS6bF9zb3elmeNGIjoY=
+github.com/google/renameio v0.1.0/go.mod h1:KWCgfxg9yswjAJkECMjeO8J8rahYeXnNhOm40UhjYkI=
+github.com/google/safehtml v0.1.0/go.mod h1:L4KWwDsUJdECRAEpZoBn3O64bQaywRscowZjJAzjHnU=
 github.com/hashicorp/errwrap v1.0.0/go.mod h1:YH+1FKiLXxHSkmPseP+kNlulaMuP3n2brvKWEqk/Jc4=
 github.com/hashicorp/go-multierror v1.1.1/go.mod h1:iw975J/qwKPdAO1clOe2L8331t/9/fmwbPZ6JB6eMoM=
 github.com/ianlancetaylor/demangle v0.0.0-20220319035150-800ac71e25c2 h1:rcanfLhLDA8nozr/K289V1zcntHr3V+SHlXwzz1ZI2g=
+github.com/jba/templatecheck v0.7.1/go.mod h1:n1Etw+Rrw1mDDD8dDRsEKTwMZsJ98EkktgNJC6wLUGo=
 github.com/k0kubun/go-ansi v0.0.0-20180517002512-3bf9e2903213 h1:qGQQKEcAR99REcMpsXCp3lJ03zYT1PkRd3kQGPn9GVg=
 github.com/klauspost/cpuid v1.2.0 h1:NMpwD2G9JSFOE1/TJjGSo5zG7Yb2bTe7eq1jH+irmeE=
 github.com/kr/pty v1.1.1 h1:VkoXIwSboBpnk99O/KFauAEILuNHv5DVFKZMBN/gUgw=
@@ -39,17 +43,22 @@ github.com/stretchr/objx v0.1.0 h1:4G4v2dO3VZwixGIRoQ5Lfboy6nUhCyYzaqnIAPPhYs4=
 github.com/stretchr/objx v0.5.0 h1:1zr/of2m5FGMsad5YfcqgdqdWrIhu+EBEJRhR1U7z/c=
 github.com/stretchr/objx v0.5.0/go.mod h1:Yh+to48EsGEfYuaHDzXPcE3xhTkx73EhmCGUpEOglKo=
 github.com/yuin/goldmark v1.4.13 h1:fVcFKWvrslecOb/tg+Cc05dkeYx540o0FuFt3nUVDoE=
+github.com/yuin/goldmark v1.4.13/go.mod h1:6yULJ656Px+3vBD8DxQVa3kxgyrAnzto9xy5taEt/CY=
 golang.org/x/crypto v0.14.0 h1:wBqGXzWJW6m1XrIKlAH0Hs1JJ7+9KBwnIO8v66Q9cHc=
 golang.org/x/crypto v0.14.0/go.mod h1:MVFd36DqK4CsrnJYDkBA3VC4m2GkXAM0PvzMCn4JQf4=
+golang.org/x/crypto v0.33.0/go.mod h1:bVdXmD7IV/4GdElGPozy6U7lWdRXA4qyRVGJV57uQ5M=
 golang.org/x/image v0.6.0 h1:bR8b5okrPI3g/gyZakLZHeWxAR8Dn5CyxXv1hLH5g/4=
 golang.org/x/image v0.6.0/go.mod h1:MXLdDR43H7cDJq5GEGXEVeeNhPgi+YYEQ2pC1byI1x0=
 golang.org/x/mod v0.13.0 h1:I/DsJXRlw/8l/0c24sM9yb0T4z9liZTduXvdAWYiysY=
 golang.org/x/mod v0.13.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
+golang.org/x/mod v0.14.0/go.mod h1:hTbmBsO62+eylJbnUtE2MGJUyE7QWk4xUqPFrRgJ+7c=
 golang.org/x/sync v0.0.0-20220722155255-886fb9371eb4 h1:uVc8UZUe6tr40fFVnUP5Oj+veunVezqYl9z7DYw9xzw=
 golang.org/x/text v0.13.0 h1:ablQoSUd0tRdKxZewP80B+BaqeKJuVhuRxj/dkrun3k=
 golang.org/x/text v0.13.0/go.mod h1:TvPlkZtksWOMsz7fbANvkp4WM8x/WCo/om8BMLbz+aE=
+golang.org/x/text v0.22.0/go.mod h1:YRoo4H8PVmsu+E3Ou7cqLVH8oXWIHVoX0jqUWALQhfY=
 golang.org/x/tools v0.14.0 h1:jvNa2pY0M4r62jkRQ6RwEZZyPcymeL9XZMLBbV7U2nc=
 golang.org/x/tools v0.14.0/go.mod h1:uYBEerGOWcJyEORxN+Ek8+TT266gXkNlHdJBwexUsBg=
+golang.org/x/tools v0.15.0/go.mod h1:hpksKq4dtpQWS1uQ61JkdqWM3LscIS6Slf+VVkm+wQk=
 golang.org/x/xerrors v0.0.0-20190717185122-a985d3407aa7 h1:9zdDQZ7Thm29KFXgAX/+yaf3eVbP7djjWp/dXAppNCc=
 gonum.org/v1/plot v0.10.1 h1:dnifSs43YJuNMDzB7v8wV64O4ABBHReuAVAoBxqBqS4=
 gonum.org/v1/plot v0.10.1/go.mod h1:VZW5OlhkL1mysU9vaqNHnsy86inf6Ot+jB3r+BczCEo=

install_obitools.sh

@@ -1,27 +1,56 @@
 #!/bin/bash
 
-INSTALL_DIR="/usr/local"
-OBITOOLS_PREFIX=""
-# default values
+# Default values
 URL="https://go.dev/dl/"
-OBIURL4="https://github.com/metabarcoding/obitools4/archive/refs/heads/master.zip"
+GITHUB_REPO="https://github.com/metabarcoding/obitools4"
 INSTALL_DIR="/usr/local"
 OBITOOLS_PREFIX=""
+VERSION=""
+LIST_VERSIONS=false
 
-# help message
+# Help message
 function display_help {
   echo "Usage: $0 [OPTIONS]"
   echo ""
   echo "Options:"
   echo "  -i, --install-dir       Directory where obitools are installed "
-  echo "                          (as example use /usr/local not /usr/local/bin)."
+  echo "                          (e.g., use /usr/local not /usr/local/bin)."
   echo "  -p, --obitools-prefix   Prefix added to the obitools command names if you"
   echo "                          want to have several versions of obitools at the"
-  echo "                          same time on your system (as example -p g will produce "
+  echo "                          same time on your system (e.g., -p g will produce "
   echo "                          gobigrep command instead of obigrep)."
+  echo "  -v, --version           Install a specific version (e.g., 4.4.8)."
+  echo "                          If not specified, installs the latest version."
+  echo "  -l, --list              List all available versions and exit."
   echo "  -h, --help              Display this help message."
+  echo ""
+  echo "Examples:"
+  echo "  $0                      # Install latest version"
+  echo "  $0 -l                   # List available versions"
+  echo "  $0 -v 4.4.8             # Install specific version"
+  echo "  $0 -i /opt/local        # Install to custom directory"
 }
 
+# List available versions from GitHub releases
+function list_versions {
+  echo "Fetching available versions..." 1>&2
+  echo ""
+  curl -s "https://api.github.com/repos/metabarcoding/obitools4/releases" \
+    | grep '"tag_name":' \
+    | sed -E 's/.*"tag_name": "Release_([0-9.]+)".*/\1/' \
+    | sort -V -r
+}
+
+# Get latest version from GitHub releases
+function get_latest_version {
+  curl -s "https://api.github.com/repos/metabarcoding/obitools4/releases" \
+    | grep '"tag_name":' \
+    | sed -E 's/.*"tag_name": "Release_([0-9.]+)".*/\1/' \
+    | sort -V -r \
+    | head -1
+}
+
+# Parse command line arguments
 while [ "$#" -gt 0 ]; do
   case "$1" in
     -i|--install-dir)
@@ -32,33 +61,67 @@ while [ "$#" -gt 0 ]; do
       OBITOOLS_PREFIX="$2"
       shift 2
       ;;
+    -v|--version)
+      VERSION="$2"
+      shift 2
+      ;;
+    -l|--list)
+      LIST_VERSIONS=true
+      shift
+      ;;
     -h|--help)
-      display_help  1>&2 
+      display_help
       exit 0
       ;;
     *)
       echo "Error: Unsupported option $1" 1>&2
+      display_help 1>&2
       exit 1
       ;;
   esac
 done
 
-# the directory from where the script is run
+# List versions and exit if requested
+if [ "$LIST_VERSIONS" = true ]; then
+  echo "Available OBITools4 versions:"
+  echo "=============================="
+  list_versions
+  exit 0
+fi
+
+# Determine version to install
+if [ -z "$VERSION" ]; then
+  echo "Fetching latest version..." 1>&2
+  VERSION=$(get_latest_version)
+  if [ -z "$VERSION" ]; then
+    echo "Error: Could not determine latest version" 1>&2
+    exit 1
+  fi
+  echo "Latest version: $VERSION" 1>&2
+else
+  echo "Installing version: $VERSION" 1>&2
+fi
+
+# Construct source URL for the specified version
+OBIURL4="${GITHUB_REPO}/archive/refs/tags/Release_${VERSION}.zip"
+
+# The directory from where the script is run
 DIR="$(pwd)"
 
-# the temp directory used, within $DIR
-# omit the -p parameter to create a temporal directory in the default location
-# WORK_DIR=$(mktemp -d -p "$DIR"  "obitools4.XXXXXX" 2> /dev/null || \
-#            mktemp -d -t "$DIR"  "obitools4.XXXXXX")
-
+# Create temporary directory
 WORK_DIR=$(mktemp -d "obitools4.XXXXXX")
 
-# check if tmp dir was created
+# Check if tmp dir was created
 if [[ ! "$WORK_DIR" || ! -d "$WORK_DIR" ]]; then
   echo "Could not create temp dir" 1>&2
   exit 1
 fi
 
+mkdir -p "${WORK_DIR}/cache" \
+  || (echo "Cannot create ${WORK_DIR}/cache directory" 1>&2
+      exit 1)
+
+# Create installation directory
 mkdir -p "${INSTALL_DIR}/bin" 2> /dev/null \
   || (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
       sudo mkdir -p "${INSTALL_DIR}/bin")
@@ -68,14 +131,20 @@ if [[ ! -d "${INSTALL_DIR}/bin" ]]; then
   exit 1
 fi
 
-INSTALL_DIR="$(cd $INSTALL_DIR && pwd)"
+INSTALL_DIR="$(cd ${INSTALL_DIR} && pwd)"
 
-echo WORK_DIR=$WORK_DIR  1>&2
-echo INSTALL_DIR=$INSTALL_DIR  1>&2
-echo OBITOOLS_PREFIX=$OBITOOLS_PREFIX  1>&2
+echo "================================" 1>&2
+echo "OBITools4 Installation" 1>&2
+echo "================================" 1>&2
+echo "VERSION=$VERSION" 1>&2
+echo "WORK_DIR=$WORK_DIR" 1>&2
+echo "INSTALL_DIR=$INSTALL_DIR" 1>&2
+echo "OBITOOLS_PREFIX=$OBITOOLS_PREFIX" 1>&2
+echo "================================" 1>&2
 
-pushd "$WORK_DIR"|| exit
+pushd "$WORK_DIR" > /dev/null || exit
 
+# Detect OS and architecture
 OS=$(uname -a | awk '{print $1}')
 ARCH=$(uname -m)
 
@@ -87,7 +156,9 @@ if [[ "$ARCH" == "aarch64" ]] ; then
     ARCH="arm64"
 fi
 
-GOFILE=$(curl "$URL" \
+# Download and install Go
+echo "Downloading Go..." 1>&2
+GOFILE=$(curl -s "$URL" \
             | grep 'class="download"' \
             | grep "\.tar\.gz" \
             | sed -E 's@^.*/dl/(go[1-9].+\.tar\.gz)".*$@\1@' \
@@ -95,35 +166,71 @@ GOFILE=$(curl "$URL" \
             | grep -i "$ARCH" \
             | head -1)
 
-GOURL=$(curl "${URL}${GOFILE}" \
+GOURL=$(curl -s "${URL}${GOFILE}" \
         | sed -E 's@^.*href="(.*\.tar\.gz)".*$@\1@')
 
-echo "Install GO from : $GOURL" 1>&2
+echo "Installing Go from: $GOURL" 1>&2
 
-curl "$GOURL" \
-    | tar zxf -
+curl -s "$GOURL" | tar zxf -
 
 PATH="$(pwd)/go/bin:$PATH"
 export PATH
+GOPATH="$(pwd)/go"
+export GOPATH
+export GOCACHE="$(pwd)/cache"
 
-curl -L "$OBIURL4" > master.zip
-unzip master.zip
+echo "GOCACHE=$GOCACHE" 1>&2
+mkdir -p "$GOCACHE"
 
-echo "Install OBITOOLS from : $OBIURL4"
+# Download OBITools4 source
+echo "Downloading OBITools4 v${VERSION}..." 1>&2
+echo "Source URL: $OBIURL4" 1>&2
 
-cd obitools4-master || exit
-
-if [[ -z "$OBITOOLS_PREFIX" ]] ; then
-  make
-else
-  make OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
+if ! curl -sL "$OBIURL4" > obitools4.zip; then
+  echo "Error: Could not download OBITools4 version ${VERSION}" 1>&2
+  echo "Please check that this version exists with: $0 --list" 1>&2
+  exit 1
 fi
 
+unzip -q obitools4.zip
+
+# Find the extracted directory
+OBITOOLS_DIR=$(ls -d obitools4-* 2>/dev/null | head -1)
+
+if [ -z "$OBITOOLS_DIR" ] || [ ! -d "$OBITOOLS_DIR" ]; then
+  echo "Error: Could not find extracted OBITools4 directory" 1>&2
+  exit 1
+fi
+
+echo "Building OBITools4..." 1>&2
+cd "$OBITOOLS_DIR" || exit
+mkdir -p vendor
+
+# Build with or without prefix
+if [[ -z "$OBITOOLS_PREFIX" ]] ; then
+  make GOFLAGS="-buildvcs=false"
+else
+  make GOFLAGS="-buildvcs=false" OBITOOLS_PREFIX="${OBITOOLS_PREFIX}"
+fi
+
+# Install binaries
+echo "Installing binaries to ${INSTALL_DIR}/bin..." 1>&2
 (cp build/* "${INSTALL_DIR}/bin" 2> /dev/null) \
-   || (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 
+   || (echo "Please enter your password for installing obitools in ${INSTALL_DIR}" 1>&2
        sudo cp build/* "${INSTALL_DIR}/bin")
 
-popd || exit
+popd > /dev/null || exit
 
+# Cleanup
+echo "Cleaning up..." 1>&2
+chmod -R +w "$WORK_DIR"
 rm -rf "$WORK_DIR"
 
+echo "" 1>&2
+echo "================================" 1>&2
+echo "OBITools4 v${VERSION} installed successfully!" 1>&2
+echo "Binaries location: ${INSTALL_DIR}/bin" 1>&2
+if [[ -n "$OBITOOLS_PREFIX" ]] ; then
+  echo "Command prefix: ${OBITOOLS_PREFIX}" 1>&2
+fi
+echo "================================" 1>&2

kmer_roaring_index/FREQUENCY_FILTER_FINAL.md

@@ -0,0 +1,292 @@
+# Filtre de Fréquence avec v Niveaux de Roaring Bitmaps
+
+## Algorithme
+
+```go
+Pour chaque k-mer rencontré dans les données:
+    c = 0
+    tant que (k-mer ∈ index[c] ET c < v):
+        c++
+    
+    si c < v:
+        index[c].insert(k-mer)
+```
+
+**Résultat** : `index[v-1]` contient les k-mers vus **≥ v fois**
+
+---
+
+## Exemple d'exécution (v=3)
+
+```
+Données:
+  Read1: kmer X
+  Read2: kmer X
+  Read3: kmer X  (X vu 3 fois)
+  Read4: kmer Y
+  Read5: kmer Y  (Y vu 2 fois)
+  Read6: kmer Z  (Z vu 1 fois)
+
+Exécution:
+
+Read1 (X):
+  c=0: X ∉ index[0] → index[0].add(X)
+  État: index[0]={X}, index[1]={}, index[2]={}
+
+Read2 (X):
+  c=0: X ∈ index[0] → c=1
+  c=1: X ∉ index[1] → index[1].add(X)
+  État: index[0]={X}, index[1]={X}, index[2]={}
+
+Read3 (X):
+  c=0: X ∈ index[0] → c=1
+  c=1: X ∈ index[1] → c=2
+  c=2: X ∉ index[2] → index[2].add(X)
+  État: index[0]={X}, index[1]={X}, index[2]={X}
+
+Read4 (Y):
+  c=0: Y ∉ index[0] → index[0].add(Y)
+  État: index[0]={X,Y}, index[1]={X}, index[2]={X}
+
+Read5 (Y):
+  c=0: Y ∈ index[0] → c=1
+  c=1: Y ∉ index[1] → index[1].add(Y)
+  État: index[0]={X,Y}, index[1]={X,Y}, index[2]={X}
+
+Read6 (Z):
+  c=0: Z ∉ index[0] → index[0].add(Z)
+  État: index[0]={X,Y,Z}, index[1]={X,Y}, index[2]={X}
+
+Résultat final:
+  index[0] (freq≥1): {X, Y, Z}
+  index[1] (freq≥2): {X, Y}
+  index[2] (freq≥3): {X}  ← K-mers filtrés ✓
+```
+
+---
+
+## Utilisation
+
+```go
+// Créer le filtre
+filter := obikmer.NewFrequencyFilter(31, 3) // k=31, minFreq=3
+
+// Ajouter les séquences
+for _, read := range reads {
+    filter.AddSequence(read)
+}
+
+// Récupérer les k-mers filtrés (freq ≥ 3)
+filtered := filter.GetFilteredSet("filtered")
+fmt.Printf("K-mers de qualité: %d\n", filtered.Cardinality())
+
+// Statistiques
+stats := filter.Stats()
+fmt.Println(stats.String())
+```
+
+---
+
+## Performance
+
+### Complexité
+
+**Par k-mer** :
+- Lookups : Moyenne ~v/2, pire cas v
+- Insertions : 1 Add
+- **Pas de Remove** ✅
+
+**Total pour n k-mers** :
+- Temps : O(n × v/2)
+- Mémoire : O(unique_kmers × v × 2 bytes)
+
+### Early exit pour distribution skewed
+
+Avec distribution typique (séquençage) :
+```
+80% singletons → 1 lookup (early exit)
+15% freq 2-3   → 2-3 lookups
+5% freq ≥4     → jusqu'à v lookups
+
+Moyenne réelle : ~2 lookups/kmer (au lieu de v/2)
+```
+
+---
+
+## Mémoire
+
+### Pour 10^8 k-mers uniques
+
+| v (minFreq) | Nombre bitmaps | Mémoire | vs map simple |
+|-------------|----------------|---------|---------------|
+| v=2 | 2 | ~400 MB | 6x moins |
+| v=3 | 3 | ~600 MB | 4x moins |
+| v=5 | 5 | ~1 GB | 2.4x moins |
+| v=10 | 10 | ~2 GB | 1.2x moins |
+| v=20 | 20 | ~4 GB | ~égal |
+
+**Note** : Avec distribution skewed (beaucoup de singletons), la mémoire réelle est bien plus faible car les niveaux hauts ont peu d'éléments.
+
+### Exemple réaliste (séquençage)
+
+Pour 10^8 k-mers totaux, v=3 :
+```
+Distribution:
+  80% singletons  → 80M dans index[0]
+  15% freq 2-3    → 15M dans index[1]
+  5% freq ≥3      → 5M dans index[2]
+
+Mémoire:
+  index[0]: 80M × 2 bytes = 160 MB
+  index[1]: 15M × 2 bytes = 30 MB
+  index[2]: 5M × 2 bytes = 10 MB
+  Total: ~200 MB ✅
+
+vs map simple: 80M × 24 bytes = ~2 GB
+Réduction: 10x
+```
+
+---
+
+## Comparaison des approches
+
+| Approche | Mémoire (10^8 kmers) | Passes | Lookups/kmer | Quand utiliser |
+|----------|----------------------|--------|--------------|----------------|
+| **v-Bitmaps** | **200-600 MB** | **1** | **~2 (avg)** | **Standard** ✅ |
+| Map simple | 2.4 GB | 1 | 1 | Si RAM illimitée |
+| Multi-pass | 400 MB | v | v | Si I/O pas cher |
+
+---
+
+## Avantages de v-Bitmaps
+
+✅ **Une seule passe** sur les données  
+✅ **Mémoire optimale** avec Roaring bitmaps  
+✅ **Pas de Remove** (seulement Contains + Add)  
+✅ **Early exit** efficace sur singletons  
+✅ **Scalable** jusqu'à v~10-20  
+✅ **Simple** à implémenter et comprendre  
+
+---
+
+## Cas d'usage typiques
+
+### 1. Éliminer erreurs de séquençage
+
+```go
+filter := obikmer.NewFrequencyFilter(31, 3)
+
+// Traiter FASTQ
+for read := range StreamFastq("sample.fastq") {
+    filter.AddSequence(read)
+}
+
+// K-mers de qualité (pas d'erreurs)
+cleaned := filter.GetFilteredSet("cleaned")
+```
+
+**Résultat** : Élimine 70-80% des k-mers (erreurs)
+
+### 2. Assemblage de génome
+
+```go
+filter := obikmer.NewFrequencyFilter(31, 2)
+
+// Filtrer avant l'assemblage
+for read := range reads {
+    filter.AddSequence(read)
+}
+
+solidKmers := filter.GetFilteredSet("solid")
+// Utiliser solidKmers pour le graphe de Bruijn
+```
+
+### 3. Comparaison de génomes
+
+```go
+collection := obikmer.NewKmerSetCollection(31)
+
+for _, genome := range genomes {
+    filter := obikmer.NewFrequencyFilter(31, 3)
+    filter.AddSequences(genome.Reads)
+    
+    cleaned := filter.GetFilteredSet(genome.ID)
+    collection.Add(cleaned)
+}
+
+// Analyses comparatives sur k-mers de qualité
+matrix := collection.ParallelPairwiseJaccard(8)
+```
+
+---
+
+## Limites
+
+**Pour v > 20** :
+- Trop de lookups (v lookups/kmer)
+- Mémoire importante (v × 200MB pour 10^8 kmers)
+
+**Solutions alternatives pour v > 20** :
+- Utiliser map simple (9 bytes/kmer) si RAM disponible
+- Algorithme différent (sketch, probabiliste)
+
+---
+
+## Optimisations possibles
+
+### 1. Parallélisation
+
+```go
+// Traiter plusieurs fichiers en parallèle
+filters := make([]*FrequencyFilter, numFiles)
+
+var wg sync.WaitGroup
+for i, file := range files {
+    wg.Add(1)
+    go func(idx int, f string) {
+        defer wg.Done()
+        filters[idx] = ProcessFile(f, k, minFreq)
+    }(i, file)
+}
+wg.Wait()
+
+// Merger les résultats
+merged := MergeFilters(filters)
+```
+
+### 2. Streaming avec seuil adaptatif
+
+```go
+// Commencer avec v=5, réduire progressivement
+filter := obikmer.NewFrequencyFilter(31, 5)
+
+// ... traitement ...
+
+// Si trop de mémoire, réduire à v=3
+if filter.MemoryUsage() > threshold {
+    filter = ConvertToLowerThreshold(filter, 3)
+}
+```
+
+---
+
+## Récapitulatif final
+
+**Pour filtrer les k-mers par fréquence ≥ v :**
+
+1. **Créer** : `filter := NewFrequencyFilter(k, v)`
+2. **Traiter** : `filter.AddSequence(read)` pour chaque read
+3. **Résultat** : `filtered := filter.GetFilteredSet(id)`
+
+**Mémoire** : ~2v MB par million de k-mers uniques  
+**Temps** : Une seule passe, ~2 lookups/kmer en moyenne  
+**Optimal pour** : v ≤ 20, distribution skewed (séquençage)  
+
+---
+
+## Code fourni
+
+1. **frequency_filter.go** - Implémentation complète
+2. **examples_frequency_filter_final.go** - Exemples d'utilisation
+
+**Tout est prêt à utiliser !** 🚀

kmer_roaring_index/examples_frequency_filter_final.go

@@ -0,0 +1,320 @@
+package main
+
+import (
+	"fmt"
+	"obikmer"
+)
+
+func main() {
+	// ==========================================
+	// EXEMPLE 1 : Utilisation basique
+	// ==========================================
+	fmt.Println("=== EXEMPLE 1 : Utilisation basique ===\n")
+
+	k := 31
+	minFreq := 3 // Garder les k-mers vus ≥3 fois
+
+	// Créer le filtre
+	filter := obikmer.NewFrequencyFilter(k, minFreq)
+
+	// Simuler des séquences avec différentes fréquences
+	sequences := [][]byte{
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X (freq=2)
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // Kmer X (freq=3) ✓
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Kmer Y
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Kmer Y (freq=2) ✗
+		[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // Kmer Z (freq=1) ✗
+	}
+
+	fmt.Printf("Traitement de %d séquences...\n", len(sequences))
+	for _, seq := range sequences {
+		filter.AddSequence(seq)
+	}
+
+	// Récupérer les k-mers filtrés
+	filtered := filter.GetFilteredSet("filtered")
+	fmt.Printf("\nK-mers avec freq ≥ %d: %d\n", minFreq, filtered.Cardinality())
+
+	// Statistiques
+	stats := filter.Stats()
+	fmt.Println("\n" + stats.String())
+
+	// ==========================================
+	// EXEMPLE 2 : Vérifier les niveaux
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 2 : Inspection des niveaux ===\n")
+
+	// Vérifier chaque niveau
+	for level := 0; level < minFreq; level++ {
+		levelSet := filter.GetKmersAtLevel(level)
+		fmt.Printf("Niveau %d (freq≥%d): %d k-mers\n",
+			level+1, level+1, levelSet.Cardinality())
+	}
+
+	// ==========================================
+	// EXEMPLE 3 : Données réalistes
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 3 : Simulation données séquençage ===\n")
+
+	filter2 := obikmer.NewFrequencyFilter(31, 3)
+
+	// Simuler un dataset réaliste :
+	// - 1000 reads
+	// - 80% contiennent des erreurs (singletons)
+	// - 15% vrais k-mers à basse fréquence
+	// - 5% vrais k-mers à haute fréquence
+
+	// Vraie séquence répétée
+	trueSeq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
+	for i := 0; i < 50; i++ {
+		filter2.AddSequence(trueSeq)
+	}
+
+	// Séquence à fréquence moyenne
+	mediumSeq := []byte("CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC")
+	for i := 0; i < 5; i++ {
+		filter2.AddSequence(mediumSeq)
+	}
+
+	// Erreurs de séquençage (singletons)
+	for i := 0; i < 100; i++ {
+		errorSeq := []byte(fmt.Sprintf("TTTTTTTTTTTTTTTTTTTTTTTTTTTT%03d", i))
+		filter2.AddSequence(errorSeq)
+	}
+
+	stats2 := filter2.Stats()
+	fmt.Println(stats2.String())
+
+	fmt.Println("Distribution attendue:")
+	fmt.Println("  - Beaucoup de singletons (erreurs)")
+	fmt.Println("  - Peu de k-mers à haute fréquence (signal)")
+	fmt.Println("  → Filtrage efficace !")
+
+	// ==========================================
+	// EXEMPLE 4 : Tester différents seuils
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 4 : Comparaison de seuils ===\n")
+
+	testSeqs := [][]byte{
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+		[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"), // freq=5
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"),
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"),
+		[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // freq=3
+		[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // freq=1
+	}
+
+	for _, minFreq := range []int{2, 3, 5} {
+		f := obikmer.NewFrequencyFilter(31, minFreq)
+		f.AddSequences(testSeqs)
+
+		fmt.Printf("minFreq=%d: %d k-mers retenus (%.2f MB)\n",
+			minFreq,
+			f.Cardinality(),
+			float64(f.MemoryUsage())/1024/1024)
+	}
+
+	// ==========================================
+	// EXEMPLE 5 : Comparaison mémoire
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 5 : Comparaison mémoire ===\n")
+
+	filter3 := obikmer.NewFrequencyFilter(31, 3)
+
+	// Simuler 10000 séquences
+	for i := 0; i < 10000; i++ {
+		seq := make([]byte, 100)
+		for j := range seq {
+			seq[j] = "ACGT"[(i+j)%4]
+		}
+		filter3.AddSequence(seq)
+	}
+
+	fmt.Println(filter3.CompareWithSimpleMap())
+
+	// ==========================================
+	// EXEMPLE 6 : Workflow complet
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 6 : Workflow complet ===\n")
+
+	fmt.Println("1. Créer le filtre")
+	finalFilter := obikmer.NewFrequencyFilter(31, 3)
+
+	fmt.Println("2. Traiter les données (simulation)")
+	// En pratique : lire depuis FASTQ
+	// for read := range ReadFastq("data.fastq") {
+	//     finalFilter.AddSequence(read)
+	// }
+
+	// Simulation
+	for i := 0; i < 1000; i++ {
+		seq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
+		finalFilter.AddSequence(seq)
+	}
+
+	fmt.Println("3. Récupérer les k-mers filtrés")
+	result := finalFilter.GetFilteredSet("final")
+
+	fmt.Println("4. Utiliser le résultat")
+	fmt.Printf("   K-mers de qualité: %d\n", result.Cardinality())
+	fmt.Printf("   Mémoire utilisée: %.2f MB\n", float64(finalFilter.MemoryUsage())/1024/1024)
+
+	fmt.Println("5. Sauvegarder (optionnel)")
+	// result.Save("filtered_kmers.bin")
+
+	// ==========================================
+	// EXEMPLE 7 : Vérification individuelle
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 7 : Vérification de k-mers spécifiques ===\n")
+
+	checkFilter := obikmer.NewFrequencyFilter(31, 3)
+
+	testSeq := []byte("ACGTACGTACGTACGTACGTACGTACGTACG")
+	for i := 0; i < 5; i++ {
+		checkFilter.AddSequence(testSeq)
+	}
+
+	var kmers []uint64
+	kmers = obikmer.EncodeKmers(testSeq, 31, &kmers)
+
+	if len(kmers) > 0 {
+		testKmer := kmers[0]
+
+		fmt.Printf("K-mer test: 0x%016X\n", testKmer)
+		fmt.Printf("  Présent dans filtre: %v\n", checkFilter.Contains(testKmer))
+		fmt.Printf("  Fréquence approx: %d\n", checkFilter.GetFrequency(testKmer))
+	}
+
+	// ==========================================
+	// EXEMPLE 8 : Intégration avec collection
+	// ==========================================
+	fmt.Println("\n=== EXEMPLE 8 : Intégration avec KmerSetCollection ===\n")
+
+	// Créer une collection de génomes filtrés
+	collection := obikmer.NewKmerSetCollection(31)
+
+	genomes := map[string][][]byte{
+		"Genome1": {
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"), // Erreur
+		},
+		"Genome2": {
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("ACGTACGTACGTACGTACGTACGTACGTACG"),
+			[]byte("GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"), // Erreur
+		},
+	}
+
+	for id, sequences := range genomes {
+		// Filtrer chaque génome
+		genomeFilter := obikmer.NewFrequencyFilter(31, 3)
+		genomeFilter.AddSequences(sequences)
+
+		// Ajouter à la collection
+		filteredSet := genomeFilter.GetFilteredSet(id)
+		collection.Add(filteredSet)
+
+		fmt.Printf("%s: %d k-mers de qualité\n", id, filteredSet.Cardinality())
+	}
+
+	// Analyser la collection
+	fmt.Println("\nAnalyse comparative:")
+	collectionStats := collection.ComputeStats()
+	fmt.Printf("  Core genome: %d k-mers\n", collectionStats.CoreSize)
+	fmt.Printf("  Pan genome: %d k-mers\n", collectionStats.PanGenomeSize)
+
+	// ==========================================
+	// RÉSUMÉ
+	// ==========================================
+	fmt.Println("\n=== RÉSUMÉ ===\n")
+	fmt.Println("Le FrequencyFilter permet de:")
+	fmt.Println("  ✓ Filtrer les k-mers par fréquence minimale")
+	fmt.Println("  ✓ Utiliser une mémoire optimale avec Roaring bitmaps")
+	fmt.Println("  ✓ Une seule passe sur les données")
+	fmt.Println("  ✓ Éliminer efficacement les erreurs de séquençage")
+	fmt.Println("")
+	fmt.Println("Workflow typique:")
+	fmt.Println("  1. filter := NewFrequencyFilter(k, minFreq)")
+	fmt.Println("  2. for each sequence: filter.AddSequence(seq)")
+	fmt.Println("  3. filtered := filter.GetFilteredSet(id)")
+	fmt.Println("  4. Utiliser filtered dans vos analyses")
+}
+
+// ==================================
+// FONCTION HELPER POUR BENCHMARKS
+// ==================================
+
+func BenchmarkFrequencyFilter() {
+	k := 31
+	minFreq := 3
+
+	// Test avec différentes tailles
+	sizes := []int{1000, 10000, 100000}
+
+	fmt.Println("\n=== BENCHMARK ===\n")
+
+	for _, size := range sizes {
+		filter := obikmer.NewFrequencyFilter(k, minFreq)
+
+		// Générer des séquences
+		for i := 0; i < size; i++ {
+			seq := make([]byte, 100)
+			for j := range seq {
+				seq[j] = "ACGT"[(i+j)%4]
+			}
+			filter.AddSequence(seq)
+		}
+
+		fmt.Printf("Size=%d reads:\n", size)
+		fmt.Printf("  Filtered k-mers: %d\n", filter.Cardinality())
+		fmt.Printf("  Memory: %.2f MB\n", float64(filter.MemoryUsage())/1024/1024)
+		fmt.Println()
+	}
+}
+
+// ==================================
+// FONCTION POUR DONNÉES RÉELLES
+// ==================================
+
+func ProcessRealData() {
+	// Exemple pour traiter de vraies données FASTQ
+
+	k := 31
+	minFreq := 3
+
+	filter := obikmer.NewFrequencyFilter(k, minFreq)
+
+	// Pseudo-code pour lire un FASTQ
+	/*
+	fastqFile := "sample.fastq"
+	reader := NewFastqReader(fastqFile)
+
+	for reader.HasNext() {
+		read := reader.Next()
+		filter.AddSequence(read.Sequence)
+	}
+
+	// Récupérer le résultat
+	filtered := filter.GetFilteredSet("sample_filtered")
+	filtered.Save("sample_filtered_kmers.bin")
+
+	// Stats
+	stats := filter.Stats()
+	fmt.Println(stats.String())
+	*/
+
+	fmt.Println("Workflow pour données réelles:")
+	fmt.Println("  1. Créer le filtre avec minFreq approprié (2-5 typique)")
+	fmt.Println("  2. Stream les reads depuis FASTQ")
+	fmt.Println("  3. Récupérer les k-mers filtrés")
+	fmt.Println("  4. Utiliser pour assemblage/comparaison/etc.")
+
+	_ = filter // unused
+}

obitests/obitools/obiannotate/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obiannotate
+CMD=obiannotate
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obiclean/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obiclean
+CMD=obiclean
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obicleandb/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obicleandb
+CMD=obicleandb
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obicomplement/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obicomplement
+CMD=obicomplement
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obiconsensus/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obiconsensus
+CMD=obiconsensus
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obiconvert/test.sh

@@ -0,0 +1,144 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obiconvert
+CMD=obiconvert
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+
+if [ -z "$TEST_DIR" ] ; then
+   TEST_DIR="."
+fi
+
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+((ntest++))
+if obiconvert -Z "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
+                 > "${TMPDIR}/xxx.fasta.gz" && \
+   zdiff "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
+                 "${TMPDIR}/xxx.fasta.gz" 
+then
+    log "$MCMD: converting large fasta file to fasta OK" 
+    ((success++))
+else
+    log "$MCMD: converting large fasta file to fasta failed" 
+    ((failed++))
+fi
+ 
+((ntest++))
+if obiconvert -Z --fastq-output \
+              "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
+                 > "${TMPDIR}/xxx.fastq.gz" && \
+   obiconvert -Z --fasta-output \
+              "${TMPDIR}/xxx.fastq.gz" \
+              > "${TMPDIR}/yyy.fasta.gz" && \
+   zdiff "${TEST_DIR}/gbpln1088.4Mb.fasta.gz" \
+                 "${TMPDIR}/yyy.fasta.gz" 
+then
+    log "$MCMD: converting large file between fasta and fastq OK" 
+    ((success++))
+else
+    log "$MCMD: converting large file between fasta and fastq failed" 
+    ((failed++))
+fi
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obicount/test.sh

@@ -5,6 +5,7 @@
 #
 
 TEST_NAME=obicount
+CMD=obicount
 
 ######
 #
@@ -15,6 +16,7 @@ TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
 OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
 export PATH="${OBITOOLS_DIR}:${PATH}"
 
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
 
 TMPDIR="$(mktemp -d)"
 ntest=0
@@ -38,9 +40,14 @@ cleanup() {
 
     if [ $failed -gt 0 ]; then
        log "$TEST_NAME tests failed" 
+        log
+        log
        exit 1
     fi
 
+    log
+    log
+
     exit 0
 }
 
@@ -79,6 +86,18 @@ log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
 ####
 ######################################################################
 
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
 ((ntest++))
 if obicount "${TEST_DIR}/wolf_F.fasta.gz" \
     > "${TMPDIR}/wolf_F.fasta_count.csv" 

obitests/obitools/obicsv/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obicsv
+CMD=obicsv
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obidemerge/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obidemerge
+CMD=obidemerge
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obidistribute/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obidistribute
+CMD=obidistribute
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obigrep/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obigrep
+CMD=obigrep
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obijoin/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obijoin
+CMD=obijoin
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obikmermatch/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obikmermatch
+CMD=obikmermatch
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obikmersimcount/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obikmersimcount
+CMD=obikmersimcount
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obilandmark/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obilandmark
+CMD=obilandmark
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obimatrix/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obimatrix
+CMD=obimatrix
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obimicrosat/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obimicrosat
+CMD=obimicrosat
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obimultiplex/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obimultiplex
+CMD=obimultiplex
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obipairing/test.sh

@@ -4,7 +4,8 @@
 # Here give the name of the test serie
 #
 
-TEST_NAME=obiparing
+TEST_NAME=obipairing
+CMD=obipairing
 
 ######
 #
@@ -15,6 +16,7 @@ TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
 OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
 export PATH="${OBITOOLS_DIR}:${PATH}"
 
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
 
 TMPDIR="$(mktemp -d)"
 ntest=0
@@ -38,9 +40,13 @@ cleanup() {
 
     if [ $failed -gt 0 ]; then
        log "$TEST_NAME tests failed" 
+       log
+       log
        exit 1
     fi
 
+    log
+    log
     exit 0
 }
 
@@ -79,6 +85,16 @@ log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
 ####
 ######################################################################
 
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
 ((ntest++))
 if obipairing -F "${TEST_DIR}/wolf_F.fastq.gz" \
               -R "${TEST_DIR}/wolf_R.fastq.gz" \
@@ -94,8 +110,8 @@ fi
 
 ((ntest++))
 if obicsv -Z -s -i \
-          -k ali_dir -k ali_length -k paring_fast_count \
-          -k paring_fast_overlap -k paring_fast_score \
+          -k ali_dir -k ali_length -k pairing_fast_count \
+          -k pairing_fast_overlap -k pairing_fast_score \
           -k score -k score_norm -k seq_a_single \
           -k seq_b_single -k seq_ab_match \
           "${TMPDIR}/wolf_paired_alignment.fastq.gz" \

obitests/obitools/obipcr/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obipcr
+CMD=obipcr
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obirefidx/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obirefidx
+CMD=obirefidx
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obiscript/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obiscript
+CMD=obiscript
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obisplit/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obisplit
+CMD=obisplit
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obisummary/some_uniq_seq.fasta

@@ -0,0 +1,9 @@
+>Seq_1 {"count":2,"merged_sample":{"15a_F730814":1,"29a_F260619":1}}
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agctyaaaactcaaaggacttggcggtgctttataccctt
+>Seq_2 {"count":22,"merged_sample":{"15a_F730814":12,"29a_F260619":10}}
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+atcttaaaactcaaaggacttggcggtgctttataccctt
+>Seq_3 {"count":22,"merged_sample":{"15a_F730814":15,"29a_F260619":7}}
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcgat
+agcttaaaactcaaaggacttggcggtgctttataccctt

obitests/obitools/obisummary/some_uniq_seq.json

@@ -0,0 +1,35 @@
+{
+  "annotations": {
+    "keys": {
+      "map": {
+        "merged_sample": 3
+      },
+      "scalar": {
+        "count": 3
+      }
+    },
+    "map_attributes": 1,
+    "scalar_attributes": 1,
+    "vector_attributes": 0
+  },
+  "count": {
+    "reads": 46,
+    "total_length": 300,
+    "variants": 3
+  },
+  "samples": {
+    "sample_count": 2,
+    "sample_stats": {
+      "15a_F730814": {
+        "reads": 28,
+        "singletons": 1,
+        "variants": 3
+      },
+      "29a_F260619": {
+        "reads": 18,
+        "singletons": 1,
+        "variants": 3
+      }
+    }
+  }
+}

obitests/obitools/obisummary/some_uniq_seq.yaml

@@ -0,0 +1,25 @@
+annotations:
+    keys:
+        map:
+            merged_sample: 3
+        scalar:
+            count: 3
+    map_attributes: 1
+    scalar_attributes: 1
+    vector_attributes: 0
+count:
+    reads: 46
+    total_length: 300
+    variants: 3
+samples:
+    sample_count: 2
+    sample_stats:
+        15a_F730814:
+            reads: 28
+            singletons: 1
+            variants: 3
+        29a_F260619:
+            reads: 18
+            singletons: 1
+            variants: 3
+

obitests/obitools/obisummary/test.sh

@@ -0,0 +1,152 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obisummary
+CMD=obisummary
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if obisummary "${TEST_DIR}/some_uniq_seq.fasta" \
+              > "${TMPDIR}/some_uniq_seq.json"
+then
+    log "$MCMD: formating json execution OK" 
+    ((success++))
+else
+    log "$MCMD: formating json execution failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if diff "${TEST_DIR}/some_uniq_seq.json" \
+        "${TMPDIR}/some_uniq_seq.json" > /dev/null
+then
+    log "$MCMD: formating json OK" 
+    ((success++))
+else
+    log "$MCMD: formating json failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if obisummary --yaml "${TEST_DIR}/some_uniq_seq.fasta" \
+              > "${TMPDIR}/some_uniq_seq.yaml"
+then
+    log "$MCMD: formating yaml execution OK" 
+    ((success++))
+else
+    log "$MCMD: formating yaml execution failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if diff "${TEST_DIR}/some_uniq_seq.yaml" \
+        "${TMPDIR}/some_uniq_seq.yaml" > /dev/null
+then
+    log "$MCMD: formating yaml OK" 
+    ((success++))
+else
+    log "$MCMD: formating yaml failed" 
+    ((failed++))
+fi
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obitag/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obitag
+CMD=obitag
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obitagpcr/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obipcr
+CMD=obipcr
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obitaxonomy/test.sh

@@ -0,0 +1,109 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obitaxonomy
+CMD=obitaxonomy
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obiuniq/test.sh

@@ -0,0 +1,205 @@
+#!/bin/bash
+
+#
+# Here give the name of the test serie
+#
+
+TEST_NAME=obiuniq
+CMD=obiuniq
+
+######
+#
+# Some variable and function definitions: please don't change them
+#
+######
+TEST_DIR="$(dirname "$(readlink -f "${BASH_SOURCE[0]}")")"
+OBITOOLS_DIR="${TEST_DIR/obitest*/}build"
+export PATH="${OBITOOLS_DIR}:${PATH}"
+
+MCMD="$(echo "${CMD:0:4}" | tr '[:lower:]' '[:upper:]')$(echo "${CMD:4}" | tr '[:upper:]' '[:lower:]')"
+
+TMPDIR="$(mktemp -d)"
+ntest=0
+success=0
+failed=0
+
+cleanup() {
+    echo "========================================" 1>&2
+    echo "## Results of the $TEST_NAME tests:" 1>&2
+
+    echo 1>&2
+    echo "- $ntest tests run" 1>&2
+    echo "- $success successfully completed" 1>&2
+    echo "- $failed failed tests" 1>&2
+    echo 1>&2
+    echo "Cleaning up the temporary directory..." 1>&2
+    echo 1>&2
+    echo "========================================" 1>&2
+
+    rm -rf "$TMPDIR"  # Suppress the temporary directory
+
+    if [ $failed -gt 0 ]; then
+       log "$TEST_NAME tests failed" 
+        log
+        log
+       exit 1
+    fi
+
+    log
+    log
+
+    exit 0
+}
+
+log() {
+    echo -e "[$TEST_NAME @ $(date)] $*" 1>&2
+}
+
+log "Testing $TEST_NAME..." 
+log "Test directory is $TEST_DIR" 
+log "obitools directory is $OBITOOLS_DIR" 
+log "Temporary directory is $TMPDIR" 
+log "files: $(find $TEST_DIR | awk -F'/' '{print $NF}' | tail -n +2)"
+
+######################################################################
+####
+#### Below are the tests
+####
+#### Before each test :
+####  - increment the variable ntest
+####
+#### Run the command as the condition of an if / then /else
+####  - The command must return 0 on success
+####  - The command must return an exit code different from 0 on failure
+####  - The datafiles are stored in the same directory than the test script
+####  - The test script directory is stored in the TEST_DIR variable
+####  - If result files have to be produced they must be stored
+####    in the temporary directory (TMPDIR variable)
+####
+#### then clause is executed on success of the command
+####  - Write a success message using the log function
+####  - increment the variable success
+####
+#### else clause is executed on failure of the command
+####  - Write a failure message using the log function
+####  - increment the variable failed
+####
+######################################################################
+
+
+
+((ntest++))
+if $CMD -h > "${TMPDIR}/help.txt" 2>&1 
+then
+    log "$MCMD: printing help OK" 
+    ((success++))
+else
+    log "$MCMD: printing help failed" 
+    ((failed++))
+fi
+
+((ntest++))
+if obiuniq "${TEST_DIR}/touniq.fasta" \
+    > "${TMPDIR}/touniq_u.fasta"
+then
+    log "OBIUniq simple: running OK" 
+    ((success++))
+else
+    log "OBIUniq simple: running failed"
+    ((failed++))
+fi
+
+obicsv -s --auto ${TEST_DIR}/touniq_u.fasta \
+| tail -n +2 \
+| sort \
+> "${TMPDIR}/touniq_u_ref.csv"
+
+obicsv -s --auto ${TMPDIR}/touniq_u.fasta \
+| tail -n +2 \
+| sort \
+> "${TMPDIR}/touniq_u.csv"
+
+((ntest++))
+if diff "${TMPDIR}/touniq_u_ref.csv" \
+        "${TMPDIR}/touniq_u.csv"  > /dev/null
+then
+    log "OBIUniq simple: result OK"
+    ((success++))
+else
+    log "OBIUniq simple: result failed"
+    ((failed++))
+fi
+
+((ntest++))
+if obiuniq -c a "${TEST_DIR}/touniq.fasta" \
+    > "${TMPDIR}/touniq_u_a.fasta"
+then
+    log "OBIUniq one category: running OK" 
+    ((success++))
+else
+    log "OBIUniq one category: running failed"
+    ((failed++))
+fi
+
+obicsv -s --auto ${TEST_DIR}/touniq_u_a.fasta \
+| tail -n +2 \
+| sort \
+> "${TMPDIR}/touniq_u_a_ref.csv"
+
+obicsv -s --auto ${TMPDIR}/touniq_u_a.fasta \
+| tail -n +2 \
+| sort \
+> "${TMPDIR}/touniq_u_a.csv"
+
+
+((ntest++))
+if diff "${TMPDIR}/touniq_u_a_ref.csv" \
+        "${TMPDIR}/touniq_u_a.csv"  > /dev/null
+then
+    log "OBIUniq one category: result OK"
+    ((success++))
+else
+    log "OBIUniq one category: result failed"
+    ((failed++))
+fi
+
+((ntest++))
+if obiuniq -c a -c b "${TEST_DIR}/touniq.fasta" \
+    > "${TMPDIR}/touniq_u_a_b.fasta"
+then
+    log "OBIUniq two categories: running OK" 
+    ((success++))
+else
+    log "OBIUniq two categories: running failed"
+    ((failed++))
+fi
+
+obicsv -s --auto ${TEST_DIR}/touniq_u_a_b.fasta \
+| tail -n +2 \
+| sort \
+> "${TMPDIR}/touniq_u_a_b_ref.csv"
+
+obicsv -s --auto ${TMPDIR}/touniq_u_a_b.fasta \
+| tail -n +2 \
+| sort \
+> "${TMPDIR}/touniq_u_a_b.csv"
+
+((ntest++))
+if diff "${TMPDIR}/touniq_u_a_b_ref.csv" \
+        "${TMPDIR}/touniq_u_a_b.csv"  > /dev/null
+then
+    log "OBIUniq two categories: result OK"
+    ((success++))
+else
+    log "OBIUniq two categories: result failed"
+    ((failed++))
+fi
+
+#########################################
+#
+# At the end of the tests
+# the cleanup function is called
+#
+#########################################
+
+cleanup

obitests/obitools/obiuniq/touniq.fasta

@@ -0,0 +1,16 @@
+>seq1 {"a":2, "b":4,"c":5}
+aaacccgggttt
+>seq2 {"a":3, "b":4,"c":5}
+aaacccgggttt
+>seq3 {"a":3, "b":5,"c":5}
+aaacccgggttt
+>seq4 {"a":3, "b":5,"c":6}
+aaacccgggttt
+>seq5 {"a":2, "b":4,"c":5}
+aaacccgggtttca
+>seq6 {"a":3, "b":4,"c":5}
+aaacccgggtttca
+>seq7 {"a":3, "b":5,"c":5}
+aaacccgggtttca
+>seq8 {"a":3, "b":5,"c":6}
+aaacccgggtttca

obitests/obitools/obiuniq/touniq_u.fasta

@@ -0,0 +1,4 @@
+>seq5 {"count":4}
+aaacccgggtttca
+>seq1 {"count":4}
+aaacccgggttt

obitests/obitools/obiuniq/touniq_u_a.fasta

@@ -0,0 +1,8 @@
+>seq5 {"a":2,"b":4,"c":5,"count":1}
+aaacccgggtttca
+>seq6 {"a":3,"count":3}
+aaacccgggtttca
+>seq1 {"a":2,"b":4,"c":5,"count":1}
+aaacccgggttt
+>seq2 {"a":3,"count":3}
+aaacccgggttt

obitests/obitools/obiuniq/touniq_u_a_b.fasta

@@ -0,0 +1,12 @@
+>seq5 {"a":2,"b":4,"c":5,"count":1}
+aaacccgggtttca
+>seq6 {"a":3,"b":4,"c":5,"count":1}
+aaacccgggtttca
+>seq7 {"a":3,"b":5,"count":2}
+aaacccgggtttca
+>seq1 {"a":2,"b":4,"c":5,"count":1}
+aaacccgggttt
+>seq2 {"a":3,"b":4,"c":5,"count":1}
+aaacccgggttt
+>seq3 {"a":3,"b":5,"count":2}
+aaacccgggttt

pkg/obialign/alignment.go

@@ -169,7 +169,7 @@ func BuildQualityConsensus(seqA, seqB *obiseq.BioSequence, path []int, statOnMis
 
 	right = len(*bufferQA) - right
 
-	// log.Warnf("BuildQualityConsensus: left = %d right = %d\n", left, right)
+	// obilog.Warnf("BuildQualityConsensus: left = %d right = %d\n", left, right)
 
 	for i, qA = range *bufferQA {
 		nA := (*bufferSA)[i]

pkg/obialign/dnamatrix.go

@@ -117,7 +117,7 @@ func _MatchScoreRatio(QF, QR byte) (float64, float64) {
 	term1 := _Logaddexp(qF, qR)
 	term2 := _Logdiffexp(term1, qF+qR)
 
-	// log.Warnf("MatchScoreRatio: %v, %v , %v, %v", QF, QR, term1, term2)
+	// obilog.Warnf("MatchScoreRatio: %v, %v , %v, %v", QF, QR, term1, term2)
 
 	match_logp := _Log1mexp(term2 + l3 - l4)
 	match_score := match_logp - _Log1mexp(match_logp)

pkg/obialign/fastlcsegf.go

@@ -4,33 +4,6 @@ import (
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
 )
 
-var _iupac = [26]byte{
-	//  a   b  c  d   e  f
-	1, 14, 2, 13, 0, 0,
-	//  g   h  i  j  k   l
-	4, 11, 0, 0, 12, 0,
-	//  m   n  o  p  q  r
-	3, 15, 0, 0, 0, 5,
-	//  s  t  u   v  w  x
-	6, 8, 8, 13, 9, 0,
-	//  y   z
-	10, 0,
-}
-
-func _samenuc(a, b byte) bool {
-	if (a >= 'A') && (a <= 'Z') {
-		a |= 32
-	}
-	if (b >= 'A') && (b <= 'Z') {
-		b |= 32
-	}
-
-	if (a >= 'a') && (a <= 'z') && (b >= 'a') && (b <= 'z') {
-		return (_iupac[a-'a'] & _iupac[b-'a']) > 0
-	}
-	return a == b
-}
-
 // FastLCSEGFScoreByte calculates the score of the Longest Common Subsequence (LCS) between two byte slices.
 //
 // The score is calculated using the following scoring matrix:
@@ -165,7 +138,7 @@ func FastLCSEGFScoreByte(bA, bB []byte, maxError int, endgapfree bool, buffer *[
 			default:
 				// We are in the middle of the matrix
 				Sdiag = _incpath(previous[x])
-				if _samenuc(bA[j-1], bB[i-1]) {
+				if obiseq.SameIUPACNuc(bA[j-1], bB[i-1]) {
 					Sdiag = _incscore(Sdiag)
 				}
 
@@ -265,7 +238,7 @@ func FastLCSEGFScoreByte(bA, bB []byte, maxError int, endgapfree bool, buffer *[
 				Sleft = _notavail
 			default:
 				Sdiag = _incpath(previous[x])
-				if _samenuc(bA[j-1], bB[i-1]) {
+				if obiseq.SameIUPACNuc(bA[j-1], bB[i-1]) {
 					Sdiag = _incscore(Sdiag)
 				}
 

pkg/obialign/locatepattern.go

@@ -1,6 +1,9 @@
 package obialign
 
-import log "github.com/sirupsen/logrus"
+import (
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
+	log "github.com/sirupsen/logrus"
+)
 
 // buffIndex converts a pair of coordinates (i, j) into a linear index in a matrix
 // of size width x width. The coordinates are (-1)-indexed, and the linear index
@@ -69,7 +72,7 @@ func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
 			// Mismatch score = -1
 			// Match score = 0
 			match := -1
-			if _samenuc(pattern[j], sequence[i]) {
+			if obiseq.SameIUPACNuc(pattern[j], sequence[i]) {
 				match = 0
 			}
 
@@ -103,7 +106,7 @@ func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
 		// Mismatch score = -1
 		// Match score = 0
 		match := -1
-		if _samenuc(pattern[jmax], sequence[i]) {
+		if obiseq.SameIUPACNuc(pattern[jmax], sequence[i]) {
 			match = 0
 		}
 
@@ -152,7 +155,7 @@ func LocatePattern(id string, pattern, sequence []byte) (int, int, int) {
 
 	}
 
-	// log.Warnf("from : %d to: %d error: %d match: %v",
+	// obilog.Warnf("from : %d to: %d error: %d match: %v",
 	// 	i, end+1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)],
 	// 	string(sequence[i:(end+1)]))
 	return i, end + 1, -buffer[buffIndex(len(sequence)-1, len(pattern)-1, width)]

pkg/obialign/readalign.go

@@ -53,10 +53,10 @@ func ReadAlign(seqA, seqB *obiseq.BioSequence,
 		over = min(seqA.Len(), seqB.Len())
 	}
 
-	// log.Warnf("fw/fw: %v shift=%d fastCount=%d/over=%d fastScore=%f",
+	// obilog.Warnf("fw/fw: %v shift=%d fastCount=%d/over=%d fastScore=%f",
 	// 	directAlignment, shift, fastCount, over, fastScore)
 
-	// log.Warnf(("seqA: %s\nseqB: %s\n"), seqA.String(), seqB.String())
+	// obilog.Warnf(("seqA: %s\nseqB: %s\n"), seqA.String(), seqB.String())
 
 	// At least one mismatch exists in the overlaping region
 	if fastCount+3 < over {

pkg/obiapat/obiapat.c

@@ -149,9 +149,9 @@ char *LowerSequence(char *seq)
         char *cseq;
 
         for (cseq = seq ; *cseq ; cseq++) 
-            if (IS_UPPER(*cseq))
+            if (IS_UPPER(*cseq)) {
                 *cseq = TO_LOWER(*cseq);
-
+			}
 		return seq;
 }
  
@@ -299,14 +299,14 @@ int32_t delete_apatseq(SeqPtr pseq,
         return 1;
 }
 
-PatternPtr buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel, 
+Pattern *buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel, 
 						int *errno, char **errmsg)
 {
-	PatternPtr pattern;
+	Pattern *pattern;
 	int32_t    patlen;
 	int32_t    patlen2;
 
-	patlen  = strlen(pat);
+	patlen  = (int32_t)strlen(pat);
 	patlen2 = lenPattern(pat);
 
 	pattern = ECOMALLOC(sizeof(Pattern) +                   // Space for struct Pattern
@@ -341,10 +341,10 @@ PatternPtr buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel,
 		
 }
 
-PatternPtr complementPattern(PatternPtr pat, int *errno, 
+Pattern *complementPattern(Pattern *pat, int *errno, 
 								char **errmsg)
 {
-	PatternPtr pattern;
+	Pattern *pattern;
 	
 	pattern = ECOMALLOC(sizeof(Pattern) + 
 							sizeof(char)      * strlen(pat->cpat) + 1 +

pkg/obiapat/obiapat.h

@@ -116,13 +116,13 @@ ecoseq_t *new_ecoseq_with_data( char *AC,
 
 
 
-int32_t  delete_apatseq(SeqPtr pseq, 
+int32_t  delete_apatseq(Seq *pseq, 
 				   int *errno, char **errmsg);
-PatternPtr buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel, int *errno, char **errmsg);
-PatternPtr complementPattern(PatternPtr pat, int *errno, char **errmsg);
+Pattern *buildPattern(const char *pat, int32_t error_max, uint8_t hasIndel, int *errno, char **errmsg);
+Pattern *complementPattern(Pattern *pat, int *errno, char **errmsg);
 
-SeqPtr new_apatseq(const char *in,int32_t circular, int32_t seqlen,
-                    SeqPtr out, 
+Seq *new_apatseq(const char *in,int32_t circular, int32_t seqlen,
+                    Seq *out, 
 					int *errno, char **errmsg);
 					
 char *ecoComplementPattern(char *nucAcSeq);

pkg/obiapat/pattern.go

@@ -26,7 +26,7 @@ var _AllocatedApaPattern = 0
 // ApatPattern stores a regular pattern usable by the
 // Apat algorithm functions and methods
 type _ApatPattern struct {
-	pointer *C.Pattern
+	pointer C.PatternPtr
 	pattern string
 }
 
@@ -72,6 +72,7 @@ var NilApatSequence = ApatSequence{nil}
 //
 // Returns an ApatPattern object and an error if the pattern is invalid.
 func MakeApatPattern(pattern string, errormax int, allowsIndel bool) (ApatPattern, error) {
+
 	cpattern := C.CString(pattern)
 	defer C.free(unsafe.Pointer(cpattern))
 	cerrormax := C.int32_t(errormax)
@@ -159,7 +160,7 @@ func (pattern ApatPattern) Free() {
 // Print method prints the ApatPattern to the standard output.
 // This is mainly a debug method.
 func (pattern ApatPattern) Print() {
-	C.PrintDebugPattern(C.PatternPtr(pattern.pointer.pointer))
+	C.PrintDebugPattern((*C.Pattern)(pattern.pointer.pointer))
 }
 
 // MakeApatSequence casts an obiseq.BioSequence to an ApatSequence.
@@ -410,8 +411,8 @@ func (pattern ApatPattern) FilterBestMatch(sequence ApatSequence, begin, length
 
 	best := [3]int{0, 0, 10000}
 	for _, m := range res {
-		// log.Warnf("Current : Begin : %d End : %d Err : %d", m[0], m[1], m[2])
-		// log.Warnf("Best    : Begin : %d End : %d Err : %d", best[0], best[1], best[2])
+		// obilog.Warnf("Current : Begin : %d End : %d Err : %d", m[0], m[1], m[2])
+		// obilog.Warnf("Best    : Begin : %d End : %d Err : %d", best[0], best[1], best[2])
 		if (m[0] - m[2]) < best[1]+best[2] {
 			// match are overlapping
 			// log.Warnln("overlap")
@@ -467,7 +468,7 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
 		// Recompute the start and end position of the match
 		// when the pattern allows for indels
 		if m[2] > 0 && pattern.pointer.pointer.hasIndel {
-			// log.Warnf("Locating indel on sequence %s[%s]", sequence.pointer.reference.Id(), pattern.String())
+			// obilog.Warnf("Locating indel on sequence %s[%s]", sequence.pointer.reference.Id(), pattern.String())
 			start := m[0] - m[2]*2
 			start = max(start, 0)
 			end := start + int(pattern.pointer.pointer.patlen) + 4*m[2]
@@ -489,7 +490,7 @@ func (pattern ApatPattern) AllMatches(sequence ApatSequence, begin, length int)
 			m[0] = start + pb
 			m[1] = start + pe
 
-			// log.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score,
+			// obilog.Warnf("seq[%d@%d:%d] %d: %s %d - %s:%s:%s", i, m[0], m[1], olderr, sequence.pointer.reference.Id(), score,
 			// 	frg, (*cpattern)[0:int(pattern.pointer.pointer.patlen)], sequence.pointer.reference.Sequence()[m[0]:m[1]])
 		}
 

pkg/obichunk/chunk.go

@@ -0,0 +1,22 @@
+package obichunk
+
+import (
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
+)
+
+func ISequenceChunk(iterator obiiter.IBioSequence,
+	classifier *obiseq.BioSequenceClassifier,
+	onMemory bool,
+	dereplicate bool,
+	na string,
+	statsOn obiseq.StatsOnDescriptions,
+	uniqueClassifier *obiseq.BioSequenceClassifier,
+) (obiiter.IBioSequence, error) {
+
+	if onMemory {
+		return ISequenceChunkOnMemory(iterator, classifier)
+	} else {
+		return ISequenceChunkOnDisk(iterator, classifier, dereplicate, na, statsOn, uniqueClassifier)
+	}
+}

pkg/obichunk/chunk_on_disk.go

@@ -10,6 +10,7 @@ import (
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiformats"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiiter"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiutils"
 )
 
 // tempDir creates a temporary directory with a prefix "obiseq_chunks_"
@@ -73,7 +74,13 @@ func find(root, ext string) []string {
 // is removed. The function logs the number of batches created and the processing
 // status of each batch.
 func ISequenceChunkOnDisk(iterator obiiter.IBioSequence,
-	classifier *obiseq.BioSequenceClassifier) (obiiter.IBioSequence, error) {
+	classifier *obiseq.BioSequenceClassifier,
+	dereplicate bool,
+	na string,
+	statsOn obiseq.StatsOnDescriptions,
+	uniqueClassifier *obiseq.BioSequenceClassifier,
+) (obiiter.IBioSequence, error) {
+	obiutils.RegisterAPipe()
 	dir, err := tempDir()
 	if err != nil {
 		return obiiter.NilIBioSequence, err
@@ -86,7 +93,7 @@ func ISequenceChunkOnDisk(iterator obiiter.IBioSequence,
 	go func() {
 		defer func() {
 			os.RemoveAll(dir)
-			log.Debugln("Clear the cache directory")
+			obiutils.UnregisterPipe()
 		}()
 
 		newIter.Wait()
@@ -111,11 +118,45 @@ func ISequenceChunkOnDisk(iterator obiiter.IBioSequence,
 				panic(err)
 			}
 
+			if dereplicate {
+				u := make(map[string]*obiseq.BioSequence)
+				var source string
+				uniqueClassifier.Reset()
+
+				for iseq.Next() {
+					batch := iseq.Get()
+					source = batch.Source()
+
+					for _, seq := range batch.Slice() {
+						// Use composite key: sequence + categories
+						code := uniqueClassifier.Code(seq)
+						key := uniqueClassifier.Value(code)
+						prev, ok := u[key]
+						if ok {
+							prev.Merge(seq, na, true, statsOn)
+						} else {
+							u[key] = seq
+						}
+					}
+				}
+
+				chunk := obiseq.MakeBioSequenceSlice(len(u))
+				i := 0
+
+				for _, seq := range u {
+					chunk[i] = seq
+					i++
+				}
+
+				newIter.Push(obiiter.MakeBioSequenceBatch(source, order, chunk))
+
+			} else {
 				source, chunk := iseq.Load()
 
 				newIter.Push(obiiter.MakeBioSequenceBatch(source, order, chunk))
 				log.Infof("Start processing of batch %d/%d : %d sequences",
-				order, nbatch, len(chunk))
+					order+1, nbatch, len(chunk))
+			}
 
 		}
 

pkg/obichunk/chunks_on_memory.go

@@ -9,7 +9,20 @@ import (
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
 )
 
-func ISequenceChunk(iterator obiiter.IBioSequence,
+// ISequenceChunkOnMemory processes a sequence iterator by distributing the sequences
+// into chunks in memory. It uses a classifier to determine how to distribute
+// the sequences and returns a new iterator for the processed sequences.
+//
+// Parameters:
+//   - iterator: An iterator of biosequences to be processed.
+//   - classifier: A pointer to a BioSequenceClassifier used to classify the sequences
+//     during distribution.
+//
+// Returns:
+// An iterator of biosequences representing the processed chunks.
+//
+// The function operates asynchronously.
+func ISequenceChunkOnMemory(iterator obiiter.IBioSequence,
 	classifier *obiseq.BioSequenceClassifier) (obiiter.IBioSequence, error) {
 
 	newIter := obiiter.MakeIBioSequence()

pkg/obichunk/unique.go

@@ -25,18 +25,35 @@ func IUniqueSequence(iterator obiiter.IBioSequence,
 
 	log.Infoln("Starting data splitting")
 
+	cat := opts.Categories()
+	na := opts.NAValue()
+
+	// Classifier for bucketing: Hash only to control number of chunks
+	bucketClassifier := obiseq.HashClassifier(opts.BatchCount())
+
+	// Classifier for uniqueness: Sequence + categories
+	var uniqueClassifier *obiseq.BioSequenceClassifier
+	if len(cat) > 0 {
+		cls := make([]*obiseq.BioSequenceClassifier, len(cat)+1)
+		cls[0] = obiseq.SequenceClassifier()
+		for i, c := range cat {
+			cls[i+1] = obiseq.AnnotationClassifier(c, na)
+		}
+		uniqueClassifier = obiseq.CompositeClassifier(cls...)
+	} else {
+		uniqueClassifier = obiseq.SequenceClassifier()
+	}
+
 	if opts.SortOnDisk() {
 		nworkers = 1
-		iterator, err = ISequenceChunkOnDisk(iterator,
-			obiseq.HashClassifier(opts.BatchCount()))
+		iterator, err = ISequenceChunkOnDisk(iterator, bucketClassifier, true, na, opts.StatsOn(), uniqueClassifier)
 
 		if err != nil {
 			return obiiter.NilIBioSequence, err
 		}
 
 	} else {
-		iterator, err = ISequenceChunk(iterator,
-			obiseq.HashClassifier(opts.BatchCount()))
+		iterator, err = ISequenceChunkOnMemory(iterator, bucketClassifier)
 
 		if err != nil {
 			return obiiter.NilIBioSequence, err
@@ -63,63 +80,25 @@ func IUniqueSequence(iterator obiiter.IBioSequence,
 		return neworder
 	}
 
-	var ff func(obiiter.IBioSequence,
-		*obiseq.BioSequenceClassifier,
-		int)
-
-	cat := opts.Categories()
-	na := opts.NAValue()
-
-	ff = func(input obiiter.IBioSequence,
-		classifier *obiseq.BioSequenceClassifier,
-		icat int) {
-		icat--
+	ff := func(input obiiter.IBioSequence,
+		classifier *obiseq.BioSequenceClassifier) {
 		input, err = ISequenceSubChunk(input,
 			classifier,
 			1)
 
-		var next obiiter.IBioSequence
-		if icat >= 0 {
-			next = obiiter.MakeIBioSequence()
-
-			iUnique.Add(1)
-
-			go ff(next,
-				obiseq.AnnotationClassifier(cat[icat], na),
-				icat)
-		}
-
-		o := 0
 		for input.Next() {
 			batch := input.Get()
-
-			if icat < 0 || len(batch.Slice()) == 1 {
-				// No more sub classification of sequence or only a single sequence
 			if !(opts.NoSingleton() && len(batch.Slice()) == 1 && batch.Slice()[0].Count() == 1) {
 				iUnique.Push(batch.Reorder(nextOrder()))
 			}
-			} else {
-				// A new step of classification must du realized
-				next.Push(batch.Reorder(o))
-				o++
 		}
-		}
-
-		if icat >= 0 {
-			next.Close()
-		}
-
 		iUnique.Done()
 	}
 
 	for i := 0; i < nworkers-1; i++ {
-		go ff(iterator.Split(),
-			obiseq.SequenceClassifier(),
-			len(cat))
+		go ff(iterator.Split(), uniqueClassifier.Clone())
 	}
-	go ff(iterator,
-		obiseq.SequenceClassifier(),
-		len(cat))
+	go ff(iterator, uniqueClassifier)
 
 	iMerged := iUnique.IMergeSequenceBatch(opts.NAValue(),
 		opts.StatsOn(),

pkg/obicorazick/worker.go

@@ -2,21 +2,75 @@ package obicorazick
 
 import (
 	log "github.com/sirupsen/logrus"
-
+	"sync"
+	"os"
 	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obiseq"
+	"git.metabarcoding.org/obitools/obitools4/obitools4/pkg/obidefault"
 	"github.com/rrethy/ahocorasick"
+	"github.com/schollz/progressbar/v3"
 )
 
 func AhoCorazickWorker(slot string, patterns []string) obiseq.SeqWorker {
 
-	matcher := ahocorasick.CompileStrings(patterns)
+	sizebatch:=10000000
+	nmatcher := len(patterns) / sizebatch + 1
+	log.Infof("Building AhoCorasick %d matcher for %d patterns in slot %s", 
+			 nmatcher, len(patterns), slot)
+
+	if nmatcher == 0 {
+		log.Errorln("No patterns provided")
+	}
+	
+	matchers := make([]*ahocorasick.Matcher, nmatcher)
+	ieme := make(chan int) 
+	mutex := &sync.WaitGroup{}
+	npar := min(obidefault.ParallelWorkers(), nmatcher)
+	mutex.Add(npar)
+
+	pbopt := make([]progressbar.Option, 0, 5)
+	pbopt = append(pbopt,
+		progressbar.OptionSetWriter(os.Stderr),
+		progressbar.OptionSetWidth(15),
+		progressbar.OptionShowCount(),
+		progressbar.OptionShowIts(),
+		progressbar.OptionSetDescription("Building AhoCorasick matcher..."),
+	)
+
+	bar := progressbar.NewOptions(nmatcher, pbopt...)
+	bar.Add(0)
+
+	builder := func() {
+		for i := range ieme  {		
+		matchers[i] = ahocorasick.CompileStrings(patterns[i*sizebatch:min((i+1)*sizebatch,len(patterns))])
+		bar.Add(1)
+		}
+		mutex.Done()
+	}
+
+	for i := 0; i < npar; i++ {
+		go builder()
+	}
+
+	for i := 0; i < nmatcher; i++ {
+		ieme <- i
+	}
+
+	close(ieme)
+	mutex.Wait()
 
 	fslot := slot + "_Fwd"
 	rslot := slot + "_Rev"
 
 	f := func(s *obiseq.BioSequence) (obiseq.BioSequenceSlice, error) {
-		matchesF := len(matcher.FindAllByteSlice(s.Sequence()))
-		matchesR := len(matcher.FindAllByteSlice(s.ReverseComplement(false).Sequence()))
+		matchesF := 0
+		matchesR := 0
+		b := s.Sequence()
+		bc := s.ReverseComplement(false).Sequence()
+
+		for _, matcher := range matchers {
+			matchesF += len(matcher.FindAllByteSlice(b))
+			matchesR += len(matcher.FindAllByteSlice(bc))
+		}
 
 		log.Debugln("Macthes = ", matchesF, matchesR)
 		matches := matchesF + matchesR

pkg/obidefault/compressed.go

@@ -1,15 +1,15 @@
 package obidefault
 
-var __compressed__ = false
+var __compress__ = false
 
 func CompressOutput() bool {
-	return __compressed__
+	return __compress__
 }
 
 func SetCompressOutput(b bool) {
-	__compressed__ = b
+	__compress__ = b
 }
 
-func CompressedPtr() *bool {
-	return &__compressed__
+func CompressOutputPtr() *bool {
+	return &__compress__
 }