git-svn-id: https://www.grenoble.prabi.fr/svn/LECASofts/ecoPCR/branches/refactoring@90 60f365c0-8329-0410-b2a4-ec073aeeaa1d

git-svn-id: https://www.grenoble.prabi.fr/svn/LECASofts/ecoPCR/branches/refactoring@15 60f365c0-8329-0410-b2a4-ec073aeeaa1d

Debug/.gdb_history

@@ -1,62 +0,0 @@
-r  -1acghtgd -2gctcagctagcta /Users/coissac/encours/ecoPCR/tools/ecodb 
-print put
-print out
-f ecoPCR
-r  -1GGGCAATCCTGAGCCAA -2CCATTGAGTCTCTGCACCTATC -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
-bt
-print label1
-up
-print label1
-print (char*)label1
-r  -1GGGCAATCCTGAGCCAA -2CCATTGAGTCTCTGCACCTATC -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
-bt
-up 3
-l
-b 38
-r
-r  -1GGGCAATCCTGAGCCAA -2CCATTGAGTCTCTGCACCTATC -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
-print label
-print ranks
-print *ranks
-print ranks->label +1
-print *ranks->label +1
-print *(ranks->label +1)
-print *(ranks->label +2)
-b ecotax.c:147
-r  -1GGGCAATCCTGAGCCAA -2CCATTGAGTCTCTGCACCTATC -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
-print current_taxon ;
-print current_taxon 
-n
-print current_taxon ;
-print current_taxon 
-print *current_taxon 
-print taxonomy->taxons[11]
-print taxonomy->taxons[2952]
-print taxonomy->taxons->taxon[2952]
-print taxonomy->ranks->rank[11]
-print taxonomy->ranks->label[11]
-print taxonomy->ranks->label[3]
-b ecotax.c:147
-r  -1GGGCAATCCTGAGCCAA -2CCATTGAGTCTCTGCACCTATC -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
-print current_taxon 
-print *current_taxon 
-n
-print *current_taxon 
-b ecotax.c:147
-r  -1GGGCAATCCTGAGCCAA -2CCATTGAGTCTCTGCACCTATC -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
-n
-print *current_taxon 
-r  -1GGGCAATCCTGAGCCAA -2CCATTGAGTCTCTGCACCTATC -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
-n
-print *current_taxon 
-b ecodna.c:70
-r  -1GGGCAATCCTGAGCC#A#A# -2CCATTGAGTCTCTGCACCTA#T#C# -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
-*sb
-print *sb
-print sb
-print str
-b 52
-r  -1GGGCAATCCTGAGCC#A#A# -2CCATTGAGTCTCTGCACCTA#T#C# -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
-print str
-r  -1GGGCAATCCTGAGCC#A#A# -2CCATTGAGTCTCTGCACCTA#T#C# -l5 -L200 -e2 /Users/coissac/encours/ecoPCR/tools/ecodb
-bt

Debug/makefile

@@ -1,46 +0,0 @@
-################################################################################
-# Automatically-generated file. Do not edit!
-################################################################################
-
--include ../makefile.init
-
-RM := rm -rf
-
-# All of the sources participating in the build are defined here
--include sources.mk
--include subdir.mk
--include src/libecoPCR/subdir.mk
--include src/libapat/subdir.mk
--include src/subdir.mk
--include objects.mk
-
-ifneq ($(MAKECMDGOALS),clean)
-ifneq ($(strip $(C_DEPS)),)
--include $(C_DEPS)
-endif
-endif
-
--include ../makefile.defs
-
-# Add inputs and outputs from these tool invocations to the build variables 
-
-# All Target
-all: ecoPCR
-
-# Tool invocations
-ecoPCR: $(OBJS) $(USER_OBJS)
-	@echo 'Building target: $@'
-	@echo 'Invoking: MacOS X C Linker'
-	gcc  -o "ecoPCR" $(OBJS) $(USER_OBJS) $(LIBS)
-	@echo 'Finished building target: $@'
-	@echo ' '
-
-# Other Targets
-clean:
-	-$(RM) $(OBJS)$(EXECUTABLES)$(C_DEPS) ecoPCR
-	-@echo ' '
-
-.PHONY: all clean dependents
-.SECONDARY:
-
--include ../makefile.targets

Debug/objects.mk

@@ -1,7 +0,0 @@
-################################################################################
-# Automatically-generated file. Do not edit!
-################################################################################
-
-LIBS := -lz
-
-USER_OBJS :=

Debug/sources.mk

@@ -1,19 +0,0 @@
-################################################################################
-# Automatically-generated file. Do not edit!
-################################################################################
-
-C_SRCS := 
-O_SRCS := 
-ASM_SRCS := 
-S_SRCS := 
-OBJ_SRCS := 
-OBJS := 
-EXECUTABLES := 
-C_DEPS := 
-
-# Every subdirectory with source files must be described here
-SUBDIRS := \
-src/libecoPCR \
-src/libapat \
-src \
-

Debug/src/libapat/CODES/subdir.mk

@@ -1,24 +0,0 @@
-################################################################################
-# Automatically-generated file. Do not edit!
-################################################################################
-
-# Add inputs and outputs from these tool invocations to the build variables 
-C_SRCS += \
-../src/libapat/CODES/gendual.c 
-
-OBJS += \
-./src/libapat/CODES/gendual.o 
-
-C_DEPS += \
-./src/libapat/CODES/gendual.d 
-
-
-# Each subdirectory must supply rules for building sources it contributes
-src/libapat/CODES/%.o: ../src/libapat/CODES/%.c
-	@echo 'Building file: $<'
-	@echo 'Invoking: GCC C Compiler'
-	gcc -DMAC_OS_X -O0 -g3 -Wall -c -fmessage-length=0 -MMD -MP -MF"$(@:%.o=%.d)" -MT"$(@:%.o=%.d)" -o"$@" "$<"
-	@echo 'Finished building: $<'
-	@echo ' '
-
-

Debug/src/libapat/subdir.mk

@@ -1,30 +0,0 @@
-################################################################################
-# Automatically-generated file. Do not edit!
-################################################################################
-
-# Add inputs and outputs from these tool invocations to the build variables 
-C_SRCS += \
-../src/libapat/apat_parse.c \
-../src/libapat/apat_search.c \
-../src/libapat/libstki.c 
-
-OBJS += \
-./src/libapat/apat_parse.o \
-./src/libapat/apat_search.o \
-./src/libapat/libstki.o 
-
-C_DEPS += \
-./src/libapat/apat_parse.d \
-./src/libapat/apat_search.d \
-./src/libapat/libstki.d 
-
-
-# Each subdirectory must supply rules for building sources it contributes
-src/libapat/%.o: ../src/libapat/%.c
-	@echo 'Building file: $<'
-	@echo 'Invoking: GCC C Compiler'
-	gcc -DMAC_OS_X -O0 -g3 -Wall -c -fmessage-length=0 -MMD -MP -MF"$(@:%.o=%.d)" -MT"$(@:%.o=%.d)" -o"$@" "$<"
-	@echo 'Finished building: $<'
-	@echo ' '
-
-

Debug/src/libecoPCR/subdir.mk

@@ -1,45 +0,0 @@
-################################################################################
-# Automatically-generated file. Do not edit!
-################################################################################
-
-# Add inputs and outputs from these tool invocations to the build variables 
-C_SRCS += \
-../src/libecoPCR/ecoError.c \
-../src/libecoPCR/ecoIOUtils.c \
-../src/libecoPCR/ecoMalloc.c \
-../src/libecoPCR/ecoapat.c \
-../src/libecoPCR/ecodna.c \
-../src/libecoPCR/ecorank.c \
-../src/libecoPCR/ecoseq.c \
-../src/libecoPCR/ecotax.c 
-
-OBJS += \
-./src/libecoPCR/ecoError.o \
-./src/libecoPCR/ecoIOUtils.o \
-./src/libecoPCR/ecoMalloc.o \
-./src/libecoPCR/ecoapat.o \
-./src/libecoPCR/ecodna.o \
-./src/libecoPCR/ecorank.o \
-./src/libecoPCR/ecoseq.o \
-./src/libecoPCR/ecotax.o 
-
-C_DEPS += \
-./src/libecoPCR/ecoError.d \
-./src/libecoPCR/ecoIOUtils.d \
-./src/libecoPCR/ecoMalloc.d \
-./src/libecoPCR/ecoapat.d \
-./src/libecoPCR/ecodna.d \
-./src/libecoPCR/ecorank.d \
-./src/libecoPCR/ecoseq.d \
-./src/libecoPCR/ecotax.d 
-
-
-# Each subdirectory must supply rules for building sources it contributes
-src/libecoPCR/%.o: ../src/libecoPCR/%.c
-	@echo 'Building file: $<'
-	@echo 'Invoking: GCC C Compiler'
-	gcc -DMAC_OS_X -O0 -g3 -Wall -c -fmessage-length=0 -MMD -MP -MF"$(@:%.o=%.d)" -MT"$(@:%.o=%.d)" -o"$@" "$<"
-	@echo 'Finished building: $<'
-	@echo ' '
-
-

Debug/src/subdir.mk

@@ -1,24 +0,0 @@
-################################################################################
-# Automatically-generated file. Do not edit!
-################################################################################
-
-# Add inputs and outputs from these tool invocations to the build variables 
-C_SRCS += \
-../src/ecopcr.c 
-
-OBJS += \
-./src/ecopcr.o 
-
-C_DEPS += \
-./src/ecopcr.d 
-
-
-# Each subdirectory must supply rules for building sources it contributes
-src/%.o: ../src/%.c
-	@echo 'Building file: $<'
-	@echo 'Invoking: GCC C Compiler'
-	gcc -DMAC_OS_X -O0 -g3 -Wall -c -fmessage-length=0 -MMD -MP -MF"$(@:%.o=%.d)" -MT"$(@:%.o=%.d)" -o"$@" "$<"
-	@echo 'Finished building: $<'
-	@echo ' '
-
-

Release/makefile

@@ -1,46 +0,0 @@
-################################################################################
-# Automatically-generated file. Do not edit!
-################################################################################
-
--include ../makefile.init
-
-RM := rm -rf
-
-# All of the sources participating in the build are defined here
--include sources.mk
--include subdir.mk
--include src/libecoPCR/subdir.mk
--include src/libapat/subdir.mk
--include src/subdir.mk
--include objects.mk
-
-ifneq ($(MAKECMDGOALS),clean)
-ifneq ($(strip $(C_DEPS)),)
--include $(C_DEPS)
-endif
-endif
-
--include ../makefile.defs
-
-# Add inputs and outputs from these tool invocations to the build variables 
-
-# All Target
-all: ecoPCR
-
-# Tool invocations
-ecoPCR: $(OBJS) $(USER_OBJS)
-	@echo 'Building target: $@'
-	@echo 'Invoking: MacOS X C Linker'
-	gcc  -o "ecoPCR" $(OBJS) $(USER_OBJS) $(LIBS)
-	@echo 'Finished building target: $@'
-	@echo ' '
-
-# Other Targets
-clean:
-	-$(RM) $(OBJS)$(EXECUTABLES)$(C_DEPS) ecoPCR
-	-@echo ' '
-
-.PHONY: all clean dependents
-.SECONDARY:
-
--include ../makefile.targets

Release/objects.mk

@@ -1,7 +0,0 @@
-################################################################################
-# Automatically-generated file. Do not edit!
-################################################################################
-
-LIBS := -lz
-
-USER_OBJS :=

Release/sources.mk

@@ -1,19 +0,0 @@
-################################################################################
-# Automatically-generated file. Do not edit!
-################################################################################
-
-C_SRCS := 
-O_SRCS := 
-ASM_SRCS := 
-S_SRCS := 
-OBJ_SRCS := 
-OBJS := 
-EXECUTABLES := 
-C_DEPS := 
-
-# Every subdirectory with source files must be described here
-SUBDIRS := \
-src/libecoPCR \
-src/libapat \
-src \
-

Release/src/libapat/subdir.mk

@@ -1,30 +0,0 @@
-################################################################################
-# Automatically-generated file. Do not edit!
-################################################################################
-
-# Add inputs and outputs from these tool invocations to the build variables 
-C_SRCS += \
-../src/libapat/apat_parse.c \
-../src/libapat/apat_search.c \
-../src/libapat/libstki.c 
-
-OBJS += \
-./src/libapat/apat_parse.o \
-./src/libapat/apat_search.o \
-./src/libapat/libstki.o 
-
-C_DEPS += \
-./src/libapat/apat_parse.d \
-./src/libapat/apat_search.d \
-./src/libapat/libstki.d 
-
-
-# Each subdirectory must supply rules for building sources it contributes
-src/libapat/%.o: ../src/libapat/%.c
-	@echo 'Building file: $<'
-	@echo 'Invoking: GCC C Compiler'
-	gcc -DMAC_OS_X -O3 -Wall -c -fmessage-length=0 -MMD -MP -MF"$(@:%.o=%.d)" -MT"$(@:%.o=%.d)" -o"$@" "$<"
-	@echo 'Finished building: $<'
-	@echo ' '
-
-

Release/src/libecoPCR/subdir.mk

@@ -1,45 +0,0 @@
-################################################################################
-# Automatically-generated file. Do not edit!
-################################################################################
-
-# Add inputs and outputs from these tool invocations to the build variables 
-C_SRCS += \
-../src/libecoPCR/ecoError.c \
-../src/libecoPCR/ecoIOUtils.c \
-../src/libecoPCR/ecoMalloc.c \
-../src/libecoPCR/ecoapat.c \
-../src/libecoPCR/ecodna.c \
-../src/libecoPCR/ecorank.c \
-../src/libecoPCR/ecoseq.c \
-../src/libecoPCR/ecotax.c 
-
-OBJS += \
-./src/libecoPCR/ecoError.o \
-./src/libecoPCR/ecoIOUtils.o \
-./src/libecoPCR/ecoMalloc.o \
-./src/libecoPCR/ecoapat.o \
-./src/libecoPCR/ecodna.o \
-./src/libecoPCR/ecorank.o \
-./src/libecoPCR/ecoseq.o \
-./src/libecoPCR/ecotax.o 
-
-C_DEPS += \
-./src/libecoPCR/ecoError.d \
-./src/libecoPCR/ecoIOUtils.d \
-./src/libecoPCR/ecoMalloc.d \
-./src/libecoPCR/ecoapat.d \
-./src/libecoPCR/ecodna.d \
-./src/libecoPCR/ecorank.d \
-./src/libecoPCR/ecoseq.d \
-./src/libecoPCR/ecotax.d 
-
-
-# Each subdirectory must supply rules for building sources it contributes
-src/libecoPCR/%.o: ../src/libecoPCR/%.c
-	@echo 'Building file: $<'
-	@echo 'Invoking: GCC C Compiler'
-	gcc -DMAC_OS_X -O3 -Wall -c -fmessage-length=0 -MMD -MP -MF"$(@:%.o=%.d)" -MT"$(@:%.o=%.d)" -o"$@" "$<"
-	@echo 'Finished building: $<'
-	@echo ' '
-
-

Release/src/subdir.mk

@@ -1,24 +0,0 @@
-################################################################################
-# Automatically-generated file. Do not edit!
-################################################################################
-
-# Add inputs and outputs from these tool invocations to the build variables 
-C_SRCS += \
-../src/ecopcr.c 
-
-OBJS += \
-./src/ecopcr.o 
-
-C_DEPS += \
-./src/ecopcr.d 
-
-
-# Each subdirectory must supply rules for building sources it contributes
-src/%.o: ../src/%.c
-	@echo 'Building file: $<'
-	@echo 'Invoking: GCC C Compiler'
-	gcc -DMAC_OS_X -O3 -Wall -c -fmessage-length=0 -MMD -MP -MF"$(@:%.o=%.d)" -MT"$(@:%.o=%.d)" -o"$@" "$<"
-	@echo 'Finished building: $<'
-	@echo ' '
-
-

src/Makefile

@@ -0,0 +1,84 @@
+EXEC=ecoPCR ecofind ecoisundertaxon
+
+PCR_SRC= ecopcr.c
+PCR_OBJ= $(patsubst %.c,%.o,$(PCR_SRC))
+
+FIND_SRC= ecofind.c
+FIND_OBJ= $(patsubst %.c,%.o,$(FIND_SRC))
+
+IUT_SRC= ecoisundertaxon.c
+IUT_OBJ= $(patsubst %.c,%.o,$(IUT_SRC))
+
+SRCS= $(PCR_SRC) $(FIND_SRC) $(IUT_SRC)
+
+LIB= -lecoPCR -lapat -lz -lm
+
+LIBFILE= libapat/libapat.a \
+         libecoPCR/libecoPCR.a
+
+
+include global.mk
+
+all: $(EXEC)
+
+
+########
+#
+# ecoPCR compilation
+#
+########
+
+# executable compilation and link
+
+ecoPCR: $(PCR_OBJ) $(LIBFILE) 
+	$(CC) $(LDFLAGS) -o $@ $< $(LIBPATH) $(LIB)
+	
+########
+#
+# ecofind compilation
+#
+########
+	
+# executable compilation and link
+
+ecofind: $(FIND_OBJ) $(LIBFILE)
+	$(CC) $(LDFLAGS) -o $@ $< $(LIBPATH) $(LIB)
+	
+########
+#
+# IsUnderTaxon compilation
+#
+########
+	
+# executable compilation and link
+
+ecoisundertaxon: $(IUT_OBJ) $(LIBFILE)
+	$(CC) $(LDFLAGS) -o $@ $< $(LIBPATH) $(LIB)
+
+########
+#
+# library compilation
+#
+########
+
+libapat/libapat.a:
+	$(MAKE) -C libapat
+	
+libecoPCR/libecoPCR.a:
+	$(MAKE) -C libecoPCR
+	
+	
+########
+#
+# project management
+#
+########
+
+clean:
+	rm -f *.o	
+	rm -f $(EXEC)
+	$(MAKE) -C libapat clean
+	$(MAKE) -C libecoPCR clean
+		
+
+		

src/ecofind.c

@@ -0,0 +1,345 @@
+#include "libecoPCR/ecoPCR.h"
+#include <regex.h>
+#include <string.h>
+#include <stdlib.h>
+#include <getopt.h>
+#include <stdio.h>
+#define VERSION "0.1"
+
+/**
+ * display the result
+ **/
+static void printresult(ecotx_t *taxon,econame_t* name,ecotaxonomy_t *taxonomy)
+{
+	char* rankname;
+	char*  classname;
+	char* matchedname=taxon->name;
+	
+	classname="scientific name";
+	if (name)
+	{
+		classname=name->classname;
+		matchedname=name->name;
+	}
+	
+	rankname= taxonomy->ranks->label[taxon->rank];	
+	
+	printf("%10d \t| %15s \t|\t %-50s \t|\t %15s \t|\t %s\n",
+			taxon->taxid,
+			rankname,
+			matchedname,
+			classname,
+			taxon->name);	
+}
+
+/**
+ * display header before printing any result
+ **/
+static void printheader(void)
+{
+	printf("# %12s \t| %15s \t|\t %-50s \t|\t %-15s \t|\t %s\n#\n",
+			"taxonomy id",
+			"taxonomy rank",
+			"name",
+			"class name",
+			"scientific name");
+}
+
+/**
+ * display son's list for given taxon
+ **/
+static void get_son(ecotaxonomy_t *taxonomy, ecotx_t *taxon, int32_t *count, char *rankname)
+{
+	int32_t		i;
+	ecotx_t 	*current_taxon;
+	
+	for (	i = 0, current_taxon = taxonomy->taxons->taxon;
+			i < taxonomy->taxons->count; 
+			i++, current_taxon++)
+	{	
+		if (taxon->taxid == current_taxon->parent->taxid)
+		{
+			if (rankname == NULL || !strcmp(rankname,taxonomy->ranks->label[current_taxon->rank]))
+			{
+				printresult(current_taxon, NULL, taxonomy);
+				(*count)++;	
+			}
+			get_son(taxonomy,current_taxon,count,rankname);
+		}
+	}
+}
+
+
+
+/**
+ * display list of rank filter option (-l option)
+ **/
+static void listfilteroptions(ecorankidx_t *ranks)
+{
+	int32_t		i;
+	
+	printf("#\n");
+	
+	for (	i=0;
+			i < ranks->count;
+			i++)
+	{
+		printf("#  %s \n",ranks->label[i]);
+	}
+	
+	printf("#\n");
+}
+
+
+/* ---------------------------------------- */
+/* get back on given taxid taxonomic parent	*/
+/* and display it							*/
+/* ---------------------------------------- */
+void gettaxidparents(int32_t taxid, ecotaxonomy_t *taxonomy, char *rankname)
+{
+	ecotx_t *next_parent;
+	int32_t	c = 0;
+	
+	next_parent = eco_findtaxonbytaxid(taxonomy, taxid);		
+	
+	printheader();
+	
+	printresult(next_parent, NULL,taxonomy);
+		
+	while ( strcmp(next_parent->name, "root") )
+	{
+		next_parent = next_parent->parent;
+		if (rankname == NULL || !strcmp(rankname,taxonomy->ranks->label[next_parent->rank]))
+		{
+			printresult(next_parent, NULL,taxonomy);
+			c++;
+		}
+	}
+	
+	printf("#  %d parent(s) found\n#\n",c);
+}
+
+
+/**
+ * printout usage and exit                     
+ **/
+#define PP fprintf(stderr, 
+
+static void ExitUsage(stat)
+        int stat;
+{
+        PP      "usage: ecofind [-d database] [-h] [-l] [-r taxonomic rank] [-p taxid] [-s taxid] <taxon name pattern> ... \n");
+        PP      "type \"ecofind -h\" for help\n");
+        if (stat)
+            exit(stat);
+}
+
+#undef  PP
+
+/**
+ * printout help
+ **/
+#define PP fprintf(stdout, 
+
+static void PrintHelp()
+{
+        PP      "------------------------------------------\n");
+        PP      " ecofind Version %s\n", VERSION);
+        PP      "------------------------------------------\n");
+        PP      "synopsis : searching for taxonomic and rank and\n");
+        PP		"           taxonomy id for given regular  expression patterns\n\n");
+        PP      "usage: ecofind [options] <patterns>\n");
+        PP      "------------------------------------------\n");
+        PP      "options:\n");
+        PP      "-a : [A]ll enable the search on all alternative names and not only scientific names.\n\n");        
+        PP      "-d : [D]atabase containing the taxonomy.\n");
+        PP		"     To match the expected format, the database\n");
+        PP		"     has to be formated first by the ecoPCRFormat.py\n");
+        PP		"     program located in the tools directory.\n");
+        PP		"     Write the database radical without any extension.\n\n");
+        PP      "-h : [H]elp - print <this> help\n\n");
+        PP      "-l : [L]ist all taxonomic rank available for -r option\n\n");
+        PP      "-p : [P]arents : specifiying this option displays all parental tree's information for the given taxid.\n\n");
+        PP      "-r : [R]estrict to given taxonomic rank\n\n");      
+        PP      "-s : [S]ons: specifiying this option displays all subtree's information for the given taxid.\n\n");
+        PP      "arguments:\n");        
+        PP      "<taxon> name pattern bearing regular expressions\n\n");
+        PP      "------------------------------------------\n");
+        PP		" http://www.grenoble.prabi.fr/trac/ecoPCR/\n");
+        PP      "------------------------------------------\n\n");
+}
+
+/* ----------------------------------------------- */
+
+#define PATTERN_NUMBER 	10
+#define PATTERN_LENGHT 	40
+#define	RESULT_LENGTH	100
+
+int main(int argc, char **argv) 
+{
+	int32_t     	carg		= 0;
+	int32_t			nummatch 	= 0;
+	int32_t 		k,j 		= 0;
+	int32_t     	errflag 	= 0;
+	int32_t			tax_count	= 0;
+	int32_t         alternative = 0;
+	char			*prefix		= NULL;
+	ecotaxonomy_t 	*taxonomy;	
+	econame_t		*name;
+	int32_t         name_count;
+	
+	int				re_error;
+	int				re_match;
+	regex_t			re_preg;
+	
+	int32_t 		uptree 		= 0;
+	int32_t 		subtree 	= 0;
+	char			*rankname	= NULL;
+	int32_t			rankfilter 	= 1;
+	int32_t			list 		= 0;
+	
+	ecotx_t 		*subtree_parent;
+	int32_t			count_son = 0;
+
+
+	while ((carg = getopt(argc, argv, "had:p:s:r:l")) != -1) {
+	    switch (carg) {                        
+	       case 's':               	/* path to the database     */
+	          sscanf(optarg,"%d",&subtree);
+	          break;
+
+	       case 'r':               	/* rank filter     */
+	          rankname = ECOMALLOC(strlen(optarg),"allocation rankname");
+	          strcpy(rankname,optarg);
+	          rankfilter = 0;
+	          break;
+
+	       case 'd':               	/* path to the database     */
+	          prefix = ECOMALLOC(strlen(optarg),"allocation prefix");
+	          strcpy(prefix,optarg);
+	          break;
+	          
+	       case 'l':               	/* list rank filter options */
+	          list = 1;
+	          break;
+	
+	       case 'a':               	/* allow alternative names  */
+	          alternative = 1;
+	          break;
+	
+	       case 'h':               	/* display help	           	*/      
+	          PrintHelp();
+	          exit(0);
+	          break;
+	          
+	       case 'p':               	/* taxid		           	*/      
+	          sscanf(optarg,"%d",&uptree);
+	          break;	          
+	           
+	       case '?':               	/* bad option   	        */
+	          errflag++;
+	     }
+	}
+	
+	if ((argc - optind) < 1)
+        errflag++;
+	
+	if (prefix == NULL)
+	{
+		prefix = getenv("ECOPCRDB");
+		if (prefix == NULL)
+			errflag++;
+	}
+		
+	if (errflag && !uptree && !rankname && !subtree && !list)
+		ExitUsage(errflag);
+		
+	/**
+	 * load taxonomy using libecoPCR functions
+	 **/
+	printf("# \n#  opening %s database\n",prefix);
+	
+	taxonomy = read_taxonomy(prefix,1);
+	tax_count = taxonomy->taxons->count;
+	name_count = taxonomy->names->count;
+		
+	
+	/* ----------------------------------------	*/
+	/* list -r option possibility		    	*/
+	/* ----------------------------------------	*/		
+	if (list)
+	{
+		listfilteroptions(taxonomy->ranks);
+		return 0;
+	}
+		
+	/* ----------------------------------------	*/
+	/* display taxid parent if -t option    	*/
+	/* specified in command line				*/
+	/* ----------------------------------------	*/	
+	if (uptree)
+	{
+		gettaxidparents(uptree,taxonomy,rankname);
+		return 0;	
+	}
+	
+	/* ----------------------------------------	*/
+	/* display taxid sons if -s option    		*/
+	/* specified in command line				*/
+	/* ----------------------------------------	*/		
+	if (subtree)
+	{
+		printheader();
+		subtree_parent = eco_findtaxonbytaxid(taxonomy,subtree);
+		printresult(subtree_parent, NULL,taxonomy);
+		get_son(taxonomy, subtree_parent,&count_son,rankname);
+		printf("#  %d son(s) found\n#\n",count_son);
+		return 0;
+	}
+	
+	printf("#  %d taxons\n", tax_count);
+		
+	/**
+	 * parse taxonomy
+	 **/
+	for (k=optind;k<argc;k++)
+	{
+		printf("#\n#  searching for '%s' pattern\n",argv[k]); 
+		
+		re_error = regcomp (&re_preg, argv[k], REG_NOSUB | REG_EXTENDED | REG_ICASE);
+		if (re_error)
+		{
+			fprintf(stderr,"#  misformed pattern '%s'\n",argv[k]);
+			exit(1);
+		}
+		
+		nummatch=0;
+		
+	    printheader();
+		
+		for (j=0,name=taxonomy->names->names;
+		     j < name_count;
+		     name++,j++)
+		{  			
+   			
+   			if(rankname)
+   				rankfilter = !(strcmp(rankname,taxonomy->ranks->label[name->taxon->rank]));
+
+   			re_match = regexec (&re_preg, name->name, 0, NULL, 0);
+   			
+   			if (!re_match && (alternative || name->is_scientificname) && rankfilter)
+   			{
+   				printresult(name->taxon,name,taxonomy);
+   				nummatch++;
+   			}
+   			
+		} 		
+			
+		printf("#  %d records found \n",nummatch);
+	   	regfree(&re_preg);
+	}		
+			
+	return 0;
+}
+
+

src/ecogrep.c

@@ -0,0 +1,403 @@
+#include "libecoPCR/ecoPCR.h"
+#include <stdio.h>
+#include <string.h>
+#include <stdlib.h>
+#include <getopt.h>
+#include <stdlib.h>
+#include <sys/stat.h>
+
+
+#define VERSION "0.1"
+
+void getLineContent(char *stream, ecoseq_t *seq, ecoseq_t *oligoseq_1, ecoseq_t *oligoseq_2){
+	
+	int		i;
+	char	*buffer;
+
+ 	for(	i=0, buffer = strtok(stream,"|");
+			buffer != NULL;
+			i++, buffer = strtok(NULL,"|"))
+	{
+			switch (i) {
+				case 0:
+					seq->AC = strdup(buffer);
+					break;
+				case 4:
+					sscanf(buffer,"%d",&seq->taxid);
+					break;
+				case 13:
+					oligoseq_1->SQ = strdup(buffer);
+					oligoseq_1->SQ_length = strlen(buffer);
+					break;
+				case 15:
+					oligoseq_2->SQ = strdup(buffer);
+					oligoseq_2->SQ_length = strlen(buffer);
+					break;
+				case 18:
+					seq->SQ = strdup(buffer);
+					seq->SQ_length = strlen(buffer);
+					break;
+				default:
+					break;
+			}
+	}
+}
+
+
+void freememory(char **tab, int32_t num){
+	int32_t i;
+	for (i=0;i<num-1;i++){
+		ECOFREE(tab[i],"Error in freememory function");	
+	}
+}
+
+/**
+ * Check if pattern match a string using mamberall libapat function
+ * @param	line		array containing sequence information
+ * @param	pattern		array containing patterns to test on the sequence
+ * @param	numpattern	number of pattern in pattern array
+ * @param	error_max	error rate allowed by the user
+ * 
+ * @return	int			1 if a pattern match, else 0
+ **/
+int	ispatternmatching(ecoseq_t *seq, PatternPtr pattern){
+	if (pattern != NULL)
+	{
+		SeqPtr 	apatseq	= NULL;
+		apatseq=ecoseq2apatseq(seq,apatseq);
+		return ManberAll(apatseq,pattern,0,0,apatseq->seqlen) > 0;
+	}
+	else return 0;
+}
+
+/* ----------------------------------------------- */
+/* printout help                                   */                                           
+/* ----------------------------------------------- */
+#define PP fprintf(stdout, 
+
+static void PrintHelp()
+{
+        PP      "\n------------------------------------------\n");
+        PP      " ecogrep Version %s\n", VERSION);
+        PP      "------------------------------------------\n");
+        PP      " synopsis : filtering ecoPCR result based on\n");
+        PP      " taxonomic id filter and regular expression pattern\n");
+        PP      " usage: ecogrep [options] filename\n");
+        PP      "------------------------------------------\n");
+        PP      " options:\n");
+        PP      " -1    : [FIRST] : compare the given pattern with direct strand oligonucleotide\n\n");
+        PP      " -2    : [SECOND] : compare the given pattern with reverse strand oligonucleotide\n\n");
+        PP      " -d    : [D]atabase containing taxonomic information\n\n");
+        PP      " -e    : [E]rrors : max error allowed in pattern match (option-1, -2 and -p) (0 by default)\n\n"); 
+        PP      " -p    : [P]attern : oligonucleotide pattern\n\n"); 
+        PP      " -h    : [H]elp : print <this> help\n\n");
+        PP      " -i    : [I]gnore subtree under given taxonomic id\n\n");
+        PP      " -r    : [R]estrict search to subtree under given taxomic id\n\n");
+        PP      " -v    : in[V]ert the sense of matching, to select non-matching lines.\n\n");
+        PP      " argument:\n");
+        PP      " ecoPCR ouput file name\n");
+        PP      "------------------------------------------\n\n");
+        PP		" http://www.grenoble.prabi.fr/trac/ecoPCR/\n");
+        PP      "------------------------------------------\n\n");
+}
+
+#undef PP
+
+/* ----------------------------------------------- */
+/* printout usage and exit                         */
+/* ----------------------------------------------- */
+
+#define PP fprintf(stderr, 
+
+static void ExitUsage(stat)
+        int stat;
+{
+        PP      "usage: ecogrep [-d database] [-p pattern] [-i taxid] [-r taxid] [-v] [-h] <file name>\n");
+        PP      "type \"ecogrep -h\" for help\n");
+
+        if (stat)
+            exit(stat);
+}
+
+#undef  PP
+
+/* ----------------------------------------------- */
+/* MAIN						                       */
+/* ----------------------------------------------- */
+
+#define LINE_BUFF_SIZE 10000
+
+int main(int argc, char **argv){
+	int32_t     	carg 			= 0;
+	int32_t			r				= 0;			// number of restricted taxid
+	int32_t			i				= 0;			// number of ignored taxid
+	int32_t			v				= 0;			// stores if -v mode is active
+	int32_t			k				= 0;			// file counter
+	int32_t			errflag			= 0;			
+	int32_t       	error_max		= 0;			// stores the error rate allowed by the user
+	int32_t			matchingresult 	= 0;			// stores number of matching result
+	
+	ecotaxonomy_t	*taxonomy;						// stores the taxonomy
+	
+	ecoseq_t		*seq				= NULL;		// stores sequence info
+	ecoseq_t		*oligoseq_1			= NULL;		// stores the oligo_1 info
+	ecoseq_t		*oligoseq_2			= NULL;		// stores the oligo_2 info
+	
+	char			*database			= NULL;		// stores the database path (for taxonomy)
+	
+	char			*p					= NULL;		// pattern for sequence 
+	PatternPtr		pattern				= NULL;		// stores the build pattern for sequence 
+	char			*o1					= NULL;		// pattern for direct strand oligo
+	PatternPtr		oligo_1				= NULL;		// stores the build pattern	for direct strand oligo
+	char			*o2					= NULL;		// pattern for reverse strand oligo
+	PatternPtr		oligo_2				= NULL;		// stores the build pattern for reverse strand oligo
+		
+	int32_t		  	*restricted_taxid 	= NULL;		// stores the restricted taxid
+	int32_t       	*ignored_taxid		= NULL;		// stores the ignored taxid
+
+	FILE			*file				= NULL;		// stores the data stream, stdin by default
+	char			*stream				= ECOMALLOC(sizeof(char *)*LINE_BUFF_SIZE,"error stream buffer allocation"); 
+	char			*orig				= ECOMALLOC(sizeof(char *)*LINE_BUFF_SIZE,"error orig buffer allocation"); 
+
+	int 			is_ignored 			= 0;		
+	int				is_included			= 0;
+	int				is_matching			= 0;
+	int 			match_o1			= 0;
+	int 			match_o2			= 0;
+	int				good				= 0;
+	
+	seq = new_ecoseq();
+	oligoseq_1 = new_ecoseq();
+	oligoseq_2 = new_ecoseq();
+	
+	/**
+	 * Parse commande line options
+	 **/
+	while ((carg = getopt(argc, argv, "1:2:p:d:i:r:e:vh")) != -1) {
+
+	    switch (carg) {                              
+	        case '1':
+	           o1 = ECOMALLOC(strlen(optarg)+1,
+	           						"Error on o1 allocation");
+	           strcpy(o1,optarg);
+	           break;
+
+	        case '2':
+	           o2 = ECOMALLOC(strlen(optarg)+1,
+	           						"Error on o2 allocation");
+	           strcpy(o2,optarg);
+	           break;
+	           	        
+	        case 'd':
+	           database = ECOMALLOC(strlen(optarg)+1,
+	           						"Error on datafile allocation");
+	           strcpy(database,optarg);
+	           break;
+	
+	        case 'i':   
+	           ignored_taxid = ECOREALLOC(	ignored_taxid,
+	           								sizeof(int32_t)*(i+1),
+	           								"Error on ignored_taxid reallocation");
+	           sscanf(optarg,"%d",&ignored_taxid[i]);
+	           i++;
+	           break;
+	        
+	        case 'r': 
+	           restricted_taxid = ECOREALLOC(	restricted_taxid, 
+	           									sizeof(int32_t)*(r+1),
+	           									"Error on restricted_taxid reallocation");  
+	           sscanf(optarg,"%d",&restricted_taxid[r]);
+	           r++;
+	           break;
+	           	           
+	        case 'v':     
+	           v = 1;
+	           break;
+	           
+	        case 'h':     
+	           PrintHelp();
+           	   exit(0);
+	           break;
+	           
+	        case 'e':	
+	           sscanf(optarg,"%d",&error_max);
+    	       break;
+
+	        case 'p':	
+	           p = ECOMALLOC(strlen(optarg)+1,
+	           						"Error on pattern allocation");		   
+	           strcpy(p,optarg);
+	           break;
+	           
+	        case '?':
+            	errflag++;
+	     }
+	}
+
+	/**
+	 * Check sequence pattern length and build it in PatternPtr format
+	 **/
+	if(p)
+	{
+		if (strlen(p) > 32){
+			printf("# Sorry, ecogrep doesn't handle pattern longer than 32 characters.\
+					\n# Please check it out : %s\n",p);
+			exit(EXIT_FAILURE);
+		}
+		else if ( (pattern = buildPattern(p,error_max)) == NULL)
+			exit(EXIT_FAILURE);
+	}
+	
+			
+			
+	/**
+	 * Check o1 pattern length and build it in PatternPtr format
+	 **/
+	if(o1)
+	{
+		if (strlen(o1) > 32){
+			printf("# Sorry, ecogrep doesn't handle pattern longer than 32 characters.\
+					\n# Please check it out : %s\n",o1);
+			exit(EXIT_FAILURE);
+		}
+		else if ( (oligo_1 = buildPattern(o1,error_max)) == NULL)
+			exit(EXIT_FAILURE);
+	}
+
+	/**
+	 * Check o2 pattern length and build it in PatternPtr format
+	 **/
+	if(o2)
+	{
+		if (strlen(o2) > 32){
+			printf("# Sorry, ecogrep doesn't handle pattern longer than 32 characters.\
+					\n# Please check it out : %s\n",o2);
+			exit(EXIT_FAILURE);
+		}
+		else if ( (oligo_2 = buildPattern(o2,error_max)) == NULL)
+			exit(EXIT_FAILURE);
+	}
+
+	/**
+	 * try to get the database name from environment variable
+	 * if no database name specified in the -d option
+	 **/
+	if (database == NULL)
+	{
+		database = getenv("ECOPCRDB");
+		if (database == NULL)
+			errflag++;
+	}
+	
+	/**
+	 * check at leat one processing is asked
+	 * either patterns or taxid filters
+	 **/			
+	if ( !p && !o1 && !o2 && restricted_taxid == NULL && ignored_taxid == NULL )
+	{
+		errflag++;
+	}		
+	if (errflag)
+    	ExitUsage(errflag);
+
+	/**
+	 * Get the taxonomy back
+	 **/
+	taxonomy = read_taxonomy(database,0);
+	 
+	/**
+	 * Parse the stream
+	 **/
+	for (k=0 ; argc >= optind ; optind++, k++){
+
+		matchingresult = 0;
+
+		if ( (file = fopen(argv[optind], "r")) == NULL)
+		{
+			if (isatty(fileno(stdin)) == 0)
+			{
+		 		file = stdin;
+		 		printf("# Processing standard input...\n");
+			}
+	 		else
+	 			break;	
+		}
+		else
+			printf("# Processing %s...\n",argv[optind]);
+		
+		while( fgets(stream, LINE_BUFF_SIZE, file) != NULL ){
+		 		
+		 	if (stream[0]!= '#')
+		 	{
+		 		
+		 		stream[LINE_BUFF_SIZE-1]=0;
+		 		
+		 		strcpy(orig,stream);
+		 		
+				getLineContent(stream,seq,oligoseq_1,oligoseq_2);	
+
+				/* -----------------------------------------------*/
+				/* is ignored if at least one option -i 		  */
+				/*  AND											  */
+				/* if current sequence is son of taxid 		 	  */
+				/* -----------------------------------------------*/ 	
+			    is_ignored = ( (i > 0) && (eco_is_taxid_included(	taxonomy, 
+			                            							ignored_taxid, 
+			                            							i, 
+			                            							seq->taxid))
+			                 );				
+
+				/* -----------------------------------------------*/
+				/* is included if no -r option					  */
+				/*  OR											  */
+				/*  if current sequence is son of taxid			  */
+				/* -----------------------------------------------*/ 				
+				is_included = ( (r == 0) || (eco_is_taxid_included(	taxonomy, 
+			                            									restricted_taxid, 
+			                            	 								r, 
+			                            									seq->taxid))
+			                  );
+
+				/* ----------------------------------------------------------- */
+				/* match if no pattern or if pattern match current sequence    */
+				/* ----------------------------------------------------------- */ 
+			    is_matching = ( !p || (ispatternmatching(seq,pattern)));
+			    
+			    /* ---------------------------------------------------------------------------- */
+				/* match if no direct oligo pattern or if pattern match current direct oligo    */
+				/* ---------------------------------------------------------------------------- */ 
+			    match_o1 = (!o1 || (ispatternmatching(oligoseq_1,oligo_1)));
+			    
+			    /* ------------------------------------------------------------------------------- */
+				/* match if no revesrse oligo pattern or if pattern match current reverse oligo    */
+				/* ------------------------------------------------------------------------------- */ 
+			    match_o2 = (!o2 || (ispatternmatching(oligoseq_2,oligo_2)));
+			        				
+			    good = (is_included  && 	is_matching && 	!is_ignored && match_o1 && match_o2);
+			    
+			    if (v)
+			       good=!good;
+			       			
+				if 	( good )
+				{
+					printf("%s",orig);
+	     			matchingresult++;
+				}
+		 	}
+		}
+		if ( file != stdin )
+    		fclose(file);
+    		
+    	printf("# %d matching result(s)\n#\n",matchingresult);
+	}
+	 	
+	/**
+	 * clean and free before leaving
+	 **/
+	ECOFREE(orig,"Error in free orig");
+	ECOFREE(stream,"Error in free stream");
+	ECOFREE(ignored_taxid,"Error in free stream");
+	ECOFREE(restricted_taxid,"Error in free stream");
+	
+	return 0;
+}

src/ecoisundertaxon.c

@@ -0,0 +1,123 @@
+#include "libecoPCR/ecoPCR.h"
+#include <getopt.h>
+#include <stdlib.h>
+
+#define VERSION "0.1"
+
+/* ----------------------------------------------- */
+/* printout verbose mode                           */                                           
+/* ----------------------------------------------- */
+static void printTaxon(ecotx_t *taxon){
+	printf("# taxid : %d | rank : %d | name : %s \n\n",taxon->taxid, taxon->rank, taxon->name);
+}
+
+/* ----------------------------------------------- */
+/* printout help                                   */                                           
+/* ----------------------------------------------- */
+#define PP fprintf(stdout, 
+
+static void PrintHelp()
+{
+        PP      "\n------------------------------------------\n");
+        PP      " ecoisundertaxon Version %s\n", VERSION);
+        PP      "------------------------------------------\n");
+        PP      " synopsis : searching relationship in taxonomy\n");
+        PP      " usage: ecoisundertaxon [options] database\n");
+        PP      "------------------------------------------\n");
+        PP      " options:\n");
+        PP      " -1    : [FIRST] taxomic id of the hypothetical son\n\n");
+        PP      " -2    : [SECOND] taxonomic id of the hypothetical parent\n\n");
+        PP      " -h    : [H]elp - print <this> help\n\n");
+        PP      " -v    : [V]erbose mode. Display taxonomic information for both\n");
+        PP      "       : taxonomic id.\n\n");
+        PP      "------------------------------------------\n");
+        PP      " database : to match the expected format, the database\n");
+        PP      " has to be formated first by the ecoPCRFormat.py program located.\n");
+        PP      " in the tools directory. Type the radical only, leaving out the extension\n");
+        PP      "------------------------------------------\n\n");
+        PP		" https://www.grenoble.prabi.fr/trac/ecoPCR/wiki");
+        PP      "------------------------------------------\n\n");        
+}
+
+#undef PP
+
+/* ----------------------------------------------- */
+/* printout usage and exit                         */
+/* ----------------------------------------------- */
+
+#define PP fprintf(stderr, 
+
+static void ExitUsage(stat)
+        int stat;
+{
+        PP      "usage: ecoisundertaxon [-1 taxid] [-2 taxid] [-v] [-h] datafile\n");
+        PP      "type \"ecoisundertaxon -h\" for help\n");
+
+        if (stat)
+            exit(stat);
+}
+
+#undef  PP
+
+/* ----------------------------------------------- */
+/* MAIN						                       */
+/* ----------------------------------------------- */
+
+int main(int argc, char **argv){
+	int32_t     	carg 		= 0;
+	int32_t			taxid_1		= 0;
+	int32_t			taxid_2		= 0;
+	int32_t			verbose		= 0;
+	int32_t			errflag		= 0;
+	ecotaxonomy_t 	*taxonomy	= NULL;
+	ecotx_t			*son		= NULL;
+	ecotx_t			*parent		= NULL;
+		
+	
+	while ((carg = getopt(argc, argv, "1:2:vh")) != -1) {
+	    switch (carg) {                              
+	        case '1':
+	           sscanf(optarg,"%d",&taxid_1);
+	           break;
+	
+	        case '2':     
+	           sscanf(optarg,"%d",&taxid_2);
+	           break;
+	           
+	        case 'v':     
+	           verbose = 1;
+	           break;
+	           
+	        case 'h':     
+	           PrintHelp();
+           	   exit(0);
+	           break;
+	           
+	        case '?':
+            	errflag++;
+	     }
+	}
+	
+	if ((argc -= optind) != 1)
+    	errflag++;
+    	
+    if (errflag)
+    	ExitUsage(errflag);
+  		
+	taxonomy = read_taxonomy(argv[optind],0);
+	
+	son = eco_findtaxonbytaxid(taxonomy, taxid_1);
+	
+	if (verbose){
+		parent = eco_findtaxonbytaxid(taxonomy, taxid_2);
+		printTaxon(son);
+		printTaxon(parent);
+	}
+	
+	if (eco_isundertaxon(son, taxid_2))
+		printf("# taxid_1 (%d) is son of taxid_2 (%d)\n",taxid_1, taxid_2);
+	else
+		printf("# taxid_1 (%d) is NOT son of taxid_2 (%d)\n",taxid_1, taxid_2);
+	
+	return 0;
+}

src/ecopcr.c

@@ -8,104 +8,69 @@
 #define VERSION "0.1"
 
 /* ----------------------------------------------- */
-/* printout help                                   */                                           /* ----------------------------------------------- */
-
+/* printout help                                   */                                           
+/* ----------------------------------------------- */
 #define PP fprintf(stdout, 
 
 static void PrintHelp()
 {
         PP      "------------------------------------------\n");
-        PP      " Apat Version %s\n", VERSION);
+        PP      " ecoPCR Version %s\n", VERSION);
         PP      "------------------------------------------\n");
-        PP      "synopsis : pattern(s) searching program\n");
-        PP      "usage: apat [options] patfile datafile\n");
+        PP      "synopsis : searching for sequence and taxonomy hybriding with given primers\n");
+        PP      "usage: ecoPCR [options] <nucleotidic patterns>\n");
         PP      "------------------------------------------\n");
         PP      "options:\n");
-        PP      "-a code         : [A]lphabet encoding for pattern\n");
-        PP      "                  code is one of : \n");
-        PP      "                  dna:   use IUPAC equivalences for dna/rna\n");
-        PP      "                  prot:  use IUPAC equivalences for proteins\n");
-        PP      "                  alpha: no equivalences, just treat plain symbols\n");
-        PP      "                  note: the equivalences are used in pattern only\n");
-        PP      "                  *not* in sequence(s) (see note (4) below)\n");
-        PP      "                  dft: alpha\n");
-        PP      "-c              : [C]ooccurences\n");
-        PP      "                  print patterns cooccurence matrix \n");     
-        PP      "                  dft: off\n");
-        PP      "-h              : [H]elp - print <this> help\n");
-        PP      "-m              : [M]ultiple occurences\n");
-        PP      "                  see -q option \n");
-        PP      "                  dft: off\n");
-        PP      "-o file         : [O]utput sequences\n");
-        PP      "                  additionaly output sequence(s) that match into\n");     
-        PP      "                  'file' in fasta format\n"); 
-        PP      "                  dft: off\n");
-        PP      "-p              : no [Print] - don't printout hits\n");
-        PP      "                  when just counts are needed\n");
-        PP      "                  dft: off\n");
-        PP      "-q nn           : [Quorum]\n");
-        PP      "                  printout result if at least nn\n");
-        PP      "                  different patterns are found on the sequence\n");
-        PP      "                  (with -m : at least nn different <hits>)\n");
-        PP      "                  dft: # of patterns read\n");
-        PP      "-s              : no [Sort] - don't sort hits before printing\n");
-        PP      "                  usually hits are printed by increasing position\n");
-        PP      "                  this option will list them by pattern\n");
-        PP      "                  dft: off\n");
-        PP      "-t              : [T]est sequence\n");
-        PP      "                  additionnaly check if sequences are uppercase\n");
-        PP      "                  this is mostly used for testing\n");
-        PP      "                  dft: off\n");
-        PP      "-u              : [U]pper\n");
-        PP      "                  force lower->upper sequence conversion\n");
-        PP      "                  without this option lowercase symbols in sequence\n");
-        PP      "                  will not be considered to as matches\n");
-        PP      "                  dft: off\n");
-        PP      "-v              : [V]erbose\n");
-        PP      "                  just display a kind of progress clock on stderr\n");
-        PP      "                  (this is only useful if you redirect stdout)\n");
-        PP      "\n");
-        PP      "patfile  : pattern file  (see below)\n");
-        PP      "datafile : database file (see below)\n");
-        PP      "------------------------------------------\n");
-        PP      "pattern file format :\n");
-        PP      "  one pattern/line\n");
-        PP      "  format : <pattern> <space> #errors\n");
-        PP      "           <pattern> := pattern<symbol>\n");
-        PP      "                 or     !pattern<symbol>\n");
-        PP      "                 or      pattern<symbol>#\n");
-        PP      "                 or     !pattern<symbol>#\n");
-        PP      "           <symbol>  := <letter>\n");
-        PP      "                 or     [<letter>....<letter>]\n");
-        PP      "           <letter>  := uppercase letter (A-Z)\n");
-        PP      "           <number>  := a positive number indicates max number of mismatches\n");
-        PP      "                        a negative number indicates max number of mismatches or indels\n");
-        PP      "  # means that no error is allowed at this position\n");
-        PP      "  ! complement the <symbol>\n");
-        PP      " [...] means that all symbols within [] are allowed\n");
-        PP      " in addition IUPAC equivalences may be used as symbols\n");
-        PP      " with the -a option\n");
-        PP      "\n");
-        PP      "example: G[DE]S#[GIV]!HP![DE]#  1\n");
+        PP      "-d    : [D]atabase : to match the expected format, the database\n");
+        PP      "        has to be formated first by the ecoPCRFormat.py program located.\n");
+        PP      "        in the tools directory.\n");
+        PP      "        ecoPCRFormat.py creates three file types :\n");
+        PP      "            .sdx : contains the sequences\n");
+        PP      "            .tdx : contains information concerning the taxonomy\n");
+        PP      "            .rdx : contains the taxonomy rank\n\n");
+        PP      "        ecoPCR needs all the file type. As a result, you have to write the\n");
+        PP      "        database radical without any extension. For example /ecoPCRDB/gbmam\n\n");        
+        PP      "-e    : [E]rror : max error allowed by oligonucleotide (0 by default)\n\n");
+        PP      "-h    : [H]elp - print <this> help\n\n");
+        PP      "-i    : [I]gnore the given taxonomy id.\n");
+        PP      "        Taxonomy id are available using the ecofind program.\n");
+        PP      "        see its help typing ecofind -h for more information.\n\n");        
+        PP      "-k    : [K]ingdom mode : set the kingdom mode\n");
+        PP      "        super kingdom mode by default.\n\n");
+        PP      "-l    : minimum [L]ength : define the minimum amplication length. \n\n");
+        PP      "-L    : maximum [L]ength : define the maximum amplicationlength. \n\n");
+        PP      "-r    : [R]estricts the search to the given taxonomic id.\n");
+        PP      "        Taxonomy id are available using the ecofind program.\n");
+        PP      "        see its help typing ecofind -h for more information.\n");
         PP      "\n");
         PP      "------------------------------------------\n");
-        PP      "datafile contains one or more sequences in\n");
-        PP      "Fasta format, with *uppercase* symbols \n");
-        PP      "\n");
+        PP      "first argument : oligonucleotide for direct strand\n\n");
+        PP      "second argument : oligonucleotide for reverse strand\n\n");
         PP      "------------------------------------------\n");
-        PP      "note (1): the maximum number of patterns is %d\n", MAX_PATTERN);
-        PP      "\n");
-        PP      "note (2): the maximum length for one pattern is %d\n", MAX_PAT_LEN);
-        PP      "\n");
-        PP      "note (3): indels are still experimental and are :\n");
-        PP      "     not handled gracefully with the # syntax\n");
-        PP      "     and hits are not printed very nicely\n");
-        PP      "\n");
-        PP      "note (4): the IUPAC equivalences (-a option) are used\n");
-        PP      "     in pattern only *not* in sequence(s).\n");
-        PP      "     for instance GATN (with option -a dna) is equivalent to GAT[ACGT]\n");
-        PP      "     and will match GATA/GATC/GATG/GATC but will not match GATN\n");
-        PP      "     (nor NNNN) in sequence.\n");
+        PP      "Table result description : \n");
+        PP      "column 1 : accession number\n");
+        PP      "column 2 : sequence length\n");
+        PP      "column 3 : taxonomic id\n");
+        PP      "column 4 : rank\n");
+        PP      "column 5 : species taxonomic id\n");
+        PP      "column 6 : scientific name\n");
+        PP      "column 7 : genus taxonomic id\n");
+        PP      "column 8 : genus name\n");
+        PP      "column 9 : family taxonomic id\n");
+        PP      "column 10 : family name\n");
+        PP      "column 11 : super kingdom taxonomic id\n");
+        PP      "column 12 : super kingdom name\n");
+        PP      "column 13 : strand (direct or reverse)\n");
+        PP      "column 14 : first oligonucleotide\n");
+        PP      "column 15 : number of errors for the first strand\n");
+        PP      "column 16 : second oligonucleotide\n");
+        PP      "column 17 : number of errors for the second strand\n");
+        PP      "column 18 : amplification length\n");
+        PP      "column 19 : sequence\n");
+        PP      "column 20 : definition\n");
+        PP      "------------------------------------------\n");
+        PP		" http://www.grenoble.prabi.fr/trac/ecoPCR/\n");
+        PP      "------------------------------------------\n\n");        
         PP      "\n");
 
 }
@@ -121,10 +86,8 @@ static void PrintHelp()
 static void ExitUsage(stat)
         int stat;
 {
-        PP      "usage: apat [-a dna|prot] [-c] [-h] [-m] [-o file] [-p]\n");
-        PP      "             [-q nn] [-t] [-u] [-v]\n");
-        PP      "       patfile datafile\n");
-        PP      "type \"apat -h\" for help\n");
+        PP      "usage: ecoPCR [-d database] [-l value] [-L value] [-e value] [-r taxid] [-i taxid] [-k] oligo1 oligo2\n");
+        PP      "type \"ecoPCR -h\" for help\n");
 
         if (stat)
             exit(stat);
@@ -306,7 +269,7 @@ int main(int argc, char **argv)
 	int32_t       errflag=0;
 	char          kingdom_mode=0;
 	
-	char          *prefix;
+	char          *prefix = NULL;
 	
 	int32_t       checkedSequence = 0;
 	int32_t       positiveSequence= 0;
@@ -330,43 +293,39 @@ int main(int argc, char **argv)
 	int32_t       erri;
 	int32_t		  errj;
 	
+	int32_t		  *restricted_taxid = NULL;
+	int32_t       *ignored_taxid	= NULL;
+	int32_t		  r=0;
+	int32_t		  g=0;	
 	
-    while ((carg = getopt(argc, argv, "h1:2:l:L:e:k")) != -1) {
 
+    while ((carg = getopt(argc, argv, "hd:l:L:e:i:r:k")) != -1) {
+    	
      switch (carg) {
                                 /* -------------------- */
-        case '1':               /* prenier oligo        */
+        case 'd':               /* database name        */
                                 /* -------------------- */
-           oligo1 = ECOMALLOC(strlen(optarg)+1,
-                              "Error on oligo 1 allocation");
-           strcpy(oligo1,optarg);
-           break;
-
-                                /* -------------------- */
-        case '2':               /* coocurence option    */
-                                /* -------------------- */
-           oligo2 = ECOMALLOC(strlen(optarg)+1,
-                              "Error on oligo 1 allocation");
-           strcpy(oligo2,optarg);
+           prefix = ECOMALLOC(strlen(optarg)+1,
+                              "Error on prefix allocation");
+           strcpy(prefix,optarg);
            break;
 
                                 /* -------------------- */
         case 'h':               /* help                 */
                                 /* -------------------- */
-            
            PrintHelp();
            exit(0);
            break;
 
-                                /* -------------------- */
-        case 'l':               /* lmin amplification   */
-                                /* -------------------- */
+                                /* ------------------------- */
+        case 'l':               /* min amplification lenght  */
+                                /* ------------------------- */
            sscanf(optarg,"%d",&lmin);
            break;
 
-                                /* -------------------- */
-        case 'L':               /* lmax amplification   */
-                                /* -------------------- */
+                                /* -------------------------- */
+        case 'L':               /* max amplification lenght   */
+                                /* -------------------------- */
           sscanf(optarg,"%d",&lmax);
           break;
 
@@ -374,11 +333,29 @@ int main(int argc, char **argv)
         case 'e':               /* error max            */
                                 /* -------------------- */
           sscanf(optarg,"%d",&error_max);
+          break;
+          		
+          						/* -------------------- */
+        case 'k':               /* set the kingdom mode */
+          kingdom_mode = 1;		/* -------------------- */
+          break;
+         
+         						/* ------------------------------------------ */
+        case 'r':               /* stores the restricting search taxonomic id */
+        						/* ------------------------------------------ */
+          restricted_taxid = ECOREALLOC(restricted_taxid,sizeof(int32_t)*(r+1),
+          									"Error on restricted_taxid reallocation");
+          sscanf(optarg,"%d",&restricted_taxid[r]);
+          r++;		
           break;
           
-        case 'k':               /* error max            */
-                                /* -------------------- */
-          kingdom_mode = 1;
+         						/* --------------------------------- */
+        case 'i':               /* stores the taxonomic id to ignore */
+        						/* --------------------------------- */
+		  ignored_taxid = ECOREALLOC(ignored_taxid,sizeof(int32_t)*(g+1),
+          									"Error on excluded_taxid reallocation");
+          sscanf(optarg,"%d",&ignored_taxid[g]);
+          g++;
           break;
           
                                 /* -------------------- */
@@ -389,25 +366,43 @@ int main(int argc, char **argv)
 
 	}
 	
-	if ((argc -= optind) != 1)
-            errflag++;
-            
+	/**
+	 * check the path to the database is given as last argument
+	 */
+	if ((argc -= optind) == 2)
+	{
+		
+		oligo1 = ECOMALLOC(strlen(argv[optind])+1,
+                              "Error on oligo1 allocation");
+		strcpy(oligo1,argv[optind]);
+		optind++;
+		oligo2 = ECOMALLOC(strlen(argv[optind])+1,
+                              "Error on oligo1 allocation");
+		strcpy(oligo2,argv[optind]);
+	}
+	else
+		errflag++;
+	
+	if (prefix == NULL)
+	{
+		prefix = getenv("ECOPCRDB");
+		if (prefix == NULL)
+			errflag++;
+	}
+	
+	                  
     if (!oligo1 || !oligo2)
     		errflag++;
 	
 	if (errflag)
 		ExitUsage(errflag);
 		
-	prefix = argv[optind];
-	
 	o1 = buildPattern(oligo1,error_max);
 	o2 = buildPattern(oligo2,error_max);
 	
 	o1c = complementPattern(o1);
 	o2c = complementPattern(o2);
 	
-	
-	
 	printf("#\n");
 	printf("# ecoPCR version %s\n",VERSION);
 	printf("# direct  strand oligo1 : %-32s ; oligo2c : %32s\n", o1->cpat,o2c->cpat);
@@ -427,102 +422,120 @@ int main(int argc, char **argv)
 		printf("# output in superkingdom mode\n");
 	printf("#\n");
 
-	taxonomy = read_taxonomy(prefix);
-	
+	taxonomy = read_taxonomy(prefix,0);
+
 	seq = ecoseq_iterator(prefix);
-	
-	
+		
 	checkedSequence = 0;
 	positiveSequence= 0;
 	amplifiatCount  = 0;
 	
 	while(seq)
-	{
+	{	
 		checkedSequence++;
-
-		scname = taxonomy->taxons->taxon[seq->taxid].name;
-		strncpy(head,seq->SQ,10);
-		head[10]=0;
-		strncpy(tail,seq->SQ+seq->SQ_length-10,10);
-		tail[10]=0;
-
+		/**
+		* check if current sequence should be included
+		**/
+		if ( (r == 0) || 
+		     (eco_is_taxid_included(taxonomy, 
+		                            restricted_taxid, 
+		                            r, 
+		                            taxonomy->taxons->taxon[seq->taxid].taxid)
+		     ) 
+		   )
+		     if ((g == 0) || 
+		         !(eco_is_taxid_included(taxonomy, 
+		                                 ignored_taxid, 
+		                                 g, 
+		                                 taxonomy->taxons->taxon[seq->taxid].taxid)
+		          )
+		        )
+		     {
 		
-		apatseq=ecoseq2apatseq(seq,apatseq);
+				scname = taxonomy->taxons->taxon[seq->taxid].name;
+				strncpy(head,seq->SQ,10);
+				head[10]=0;
+				strncpy(tail,seq->SQ+seq->SQ_length-10,10);
+				tail[10]=0;
 		
-		o1Hits = ManberAll(apatseq,o1,0,0,apatseq->seqlen);
-		o2cHits= 0;
-		
-		
-		if (o1Hits)
-		{
-			stktmp = apatseq->hitpos[0];
-			begin = stktmp->val[0] + o1->patlen;
-			
-			if (lmax)
-				length= stktmp->val[stktmp->top-1] + o1->patlen - begin + lmax + o2->patlen;
-			else
-				length= apatseq->seqlen - begin;
+				apatseq=ecoseq2apatseq(seq,apatseq);
 				
-			o2cHits = ManberAll(apatseq,o2c,1,begin,length);
-
-			if (o2cHits)
-				for (i=0; i < o1Hits;i++)
-				{
-					posi = apatseq->hitpos[0]->val[i];
-					erri = apatseq->hiterr[0]->val[i];
-					for (j=0; j < o2cHits; j++)
-					{
-						posj  =apatseq->hitpos[1]->val[j] + o2c->patlen;
-						errj  =apatseq->hiterr[1]->val[j];
-						length=posj - posi + 1  - o1->patlen - o2->patlen;
-						
-						if ((!lmin || (length >= lmin)) &&
-						    (!lmax || (length <= lmax)))
-						    printRepeat(seq,o1,o2c,'D',kingdom_mode,posi,posj,erri,errj,taxonomy);
-							//printf("%s\tD\t%s...%s (%d)\t%d\t%d\t%d\t%d\t%s\n",seq->AC,head,tail,seq->SQ_length,o1Hits,o2cHits,posi,posj,scname);
-					}
-				}
-		}
-			
-		o2Hits = ManberAll(apatseq,o2,2,0,apatseq->seqlen);
-		o1cHits= 0;
-		if (o2Hits)
-		{
-			stktmp = apatseq->hitpos[2];
-			begin = stktmp->val[0] + o2->patlen;
-			
-			if (lmax)
-				length= stktmp->val[stktmp->top-1] + o2->patlen - begin + lmax + o1->patlen;
-			else
-				length= apatseq->seqlen - begin;
+				o1Hits = ManberAll(apatseq,o1,0,0,apatseq->seqlen);
+				o2cHits= 0;
 				
-			o1cHits = ManberAll(apatseq,o1c,3,begin,length);
-			
-			if (o1cHits)
-				for (i=0; i < o2Hits;i++)
+				if (o1Hits)
 				{
-					posi = apatseq->hitpos[2]->val[i];
-					erri = apatseq->hiterr[2]->val[i];
-					for (j=0; j < o1cHits; j++)
-					{
-						posj=apatseq->hitpos[3]->val[j] + o1c->patlen;
-						errj=apatseq->hiterr[3]->val[j];
-						length=posj - posi + 1 - o1->patlen - o2->patlen;
+					stktmp = apatseq->hitpos[0];
+					begin = stktmp->val[0] + o1->patlen;
+					
+					if (lmax)
+						length= stktmp->val[stktmp->top-1] + o1->patlen - begin + lmax + o2->patlen;
+					else
+						length= apatseq->seqlen - begin;
 						
-						if ((!lmin || (length >= lmin)) &&
-						    (!lmax || (length <= lmax)))
-						    printRepeat(seq,o2,o1c,'R',kingdom_mode,posi,posj,erri,errj,taxonomy);
-							//printf("%s\tR\t%s...%s (%d)\t%d\t%d\t%d\t%d\t%s\n",seq->AC,head,tail,seq->SQ_length,o2Hits,o1cHits,posi,posj,scname);
-					}
+					o2cHits = ManberAll(apatseq,o2c,1,begin,length);
+		
+					if (o2cHits)
+						for (i=0; i < o1Hits;i++)
+						{
+							posi = apatseq->hitpos[0]->val[i];
+							erri = apatseq->hiterr[0]->val[i];
+							for (j=0; j < o2cHits; j++)
+							{
+								posj  =apatseq->hitpos[1]->val[j] + o2c->patlen;
+								errj  =apatseq->hiterr[1]->val[j];
+								length=posj - posi + 1  - o1->patlen - o2->patlen;
+								
+								if ((!lmin || (length >= lmin)) &&
+								    (!lmax || (length <= lmax)))
+								    printRepeat(seq,o1,o2c,'D',kingdom_mode,posi,posj,erri,errj,taxonomy);
+									//printf("%s\tD\t%s...%s (%d)\t%d\t%d\t%d\t%d\t%s\n",seq->AC,head,tail,seq->SQ_length,o1Hits,o2cHits,posi,posj,scname);
+							}
+						}
 				}
-		}	
-		
-		
+					
+				o2Hits = ManberAll(apatseq,o2,2,0,apatseq->seqlen);
+				o1cHits= 0;
+				if (o2Hits)
+				{
+					stktmp = apatseq->hitpos[2];
+					begin = stktmp->val[0] + o2->patlen;
+					
+					if (lmax)
+						length= stktmp->val[stktmp->top-1] + o2->patlen - begin + lmax + o1->patlen;
+					else
+						length= apatseq->seqlen - begin;
+						
+					o1cHits = ManberAll(apatseq,o1c,3,begin,length);
+					
+					if (o1cHits)
+						for (i=0; i < o2Hits;i++)
+						{
+							posi = apatseq->hitpos[2]->val[i];
+							erri = apatseq->hiterr[2]->val[i];
+							for (j=0; j < o1cHits; j++)
+							{
+								posj=apatseq->hitpos[3]->val[j] + o1c->patlen;
+								errj=apatseq->hiterr[3]->val[j];
+								length=posj - posi + 1 - o1->patlen - o2->patlen;
+								
+								if ((!lmin || (length >= lmin)) &&
+								    (!lmax || (length <= lmax)))
+								    printRepeat(seq,o2,o1c,'R',kingdom_mode,posi,posj,erri,errj,taxonomy);
+									//printf("%s\tR\t%s...%s (%d)\t%d\t%d\t%d\t%d\t%s\n",seq->AC,head,tail,seq->SQ_length,o2Hits,o1cHits,posi,posj,scname);
+							}
+						}
+				}	
+				
+		} /* End of taxonomic selection */
 		
 		delete_ecoseq(seq);
 		
 		seq = ecoseq_iterator(NULL);
 	}
+	
+	ECOFREE(restricted_taxid, "Error: could not free restricted_taxid\n");
+	ECOFREE(ignored_taxid, "Error: could not free excluded_taxid\n");
 		
 	return 0;
 }

src/global.mk

@@ -0,0 +1,18 @@
+MACHINE=MAC_OS_X
+LIBPATH= -Llibapat -LlibecoPCR
+MAKEDEPEND = gcc -D$(MACHINE) -M $(CPPFLAGS) -o $*.d $<
+
+CC=gcc
+CFLAGS= -W -Wall -O2 -g
+
+default: all
+
+%.o: %.c
+	$(CC) -D$(MACHINE) $(CFLAGS) -c -o $@ $<
+
+%.P : %.c
+	$(MAKEDEPEND)
+	@sed 's/\($*\)\.o[ :]*/\1.o $@ : /g' < $*.d > $@; \
+	rm -f $*.d; [ -s $@ ] || rm -f $@
+
+include $(SRCS:.c=.P)

src/libapat/Makefile

@@ -0,0 +1,23 @@
+
+SOURCES = apat_parse.c \
+         apat_search.c \
+         libstki.c
+         
+SRCS=$(SOURCES)
+
+         
+OBJECTS= $(patsubst %.c,%.o,$(SOURCES))
+
+LIBFILE= libapat.a
+
+
+include ../global.mk
+
+all: $(LIBFILE)
+
+clean:
+	rm -rf $(OBJECTS) $(LIBFILE)
+
+$(LIBFILE): $(OBJECTS)
+	ar -cr $@ $?
+	

src/libecoPCR/Makefile

@@ -0,0 +1,29 @@
+
+SOURCES = ecoapat.c \
+         ecodna.c \
+         ecoError.c \
+         ecoIOUtils.c \
+         ecoMalloc.c \
+         ecorank.c \
+         ecoseq.c \
+         ecotax.c \
+         ecofilter.c \
+         econame.c     
+
+SRCS=$(SOURCES)
+         
+OBJECTS= $(patsubst %.c,%.o,$(SOURCES))
+
+LIBFILE= libecoPCR.a
+
+
+include ../global.mk
+
+
+all: $(LIBFILE)
+
+clean:
+	rm -rf $(OBJECTS) $(LIBFILE)
+
+$(LIBFILE): $(OBJECTS)
+	ar -cr $@ $?

src/libecoPCR/ecoError.c

@@ -2,7 +2,15 @@
 #include <stdio.h>
 #include <stdlib.h>
 
-
+/*
+ * print the message given as argument and exit the program
+ * @param error		error number	
+ * @param message 	the text explaining what's going on
+ * @param filename	the file source where the program failed
+ * @param linenumber	the line where it has failed
+ * filename and linenumber are written at pre-processing 
+ * time by a macro
+ */
 void ecoError(int32_t error,
               const char* message,
               const char * filename,

src/libecoPCR/ecoIOUtils.c

@@ -16,20 +16,19 @@ int32_t is_big_endian()
 
 
 
-
-
-
 int32_t swap_int32_t(int32_t i)
 {
 	return SWAPINT32(i);
 }
 
 
-
-
-
-
-
+/**
+ * Read part of the file
+ * @param	*f	the database
+ * @param	recordSize the size to be read
+ * 
+ * @return	buffer
+ */
 void *read_ecorecord(FILE *f,int32_t *recordSize)
 {
 	static void *buffer    =NULL;
@@ -79,10 +78,14 @@ void *read_ecorecord(FILE *f,int32_t *recordSize)
 
 
 
-
-
-
-
+/**
+ * Open the database and check it's readable
+ * @param 	filename 		name of the database (.sdx, .rdx, .tbx)
+ * @param 	sequencecount	buffer - pointer to variable storing the number of occurence    
+ * @param 	abort_on_open_error		 	boolean to define the behaviour in case of error 
+ * 										while opening the database
+ * @return 	FILE type
+ **/
 FILE *open_ecorecorddb(const char *filename,
                        int32_t    *sequencecount,
                        int32_t    abort_on_open_error)

src/libecoPCR/ecoPCR.h

@@ -56,11 +56,11 @@ typedef struct {
 	
 } ecotxformat_t;
 
-typedef struct {
-	int32_t  taxid;
-	int32_t  rank;
-	int32_t  parent;
-	char     *name;
+typedef struct ecotxnode {
+	int32_t           taxid;
+	int32_t           rank;
+	struct ecotxnode  *parent;
+	char              *name;
 } ecotx_t;
 
 typedef struct {
@@ -80,12 +80,42 @@ typedef struct {
 	char*   label[1];
 } ecorankidx_t;
 
+/*
+ * 
+ * Taxonomy name types
+ * 
+ */
+
 typedef struct {
+ 	int32_t is_scientificname;
+	int32_t  namelength;
+	int32_t  classlength;
+	int32_t  taxid;
+	char     names[1];	
+} econameformat_t;
+ 
+ 
+ typedef struct {
+ 	char 	*name;
+ 	char 	*classname;
+ 	int32_t is_scientificname;
+ 	struct ecotxnode  *taxon;
+} econame_t;
+
+ 
+typedef struct {
+	int32_t count;
+	econame_t   names[1];
+} econameidx_t;
+
+
+ typedef struct {
 	ecorankidx_t *ranks;
+	econameidx_t *names;
 	ecotxidx_t   *taxons;
 } ecotaxonomy_t;
 
-
+ 
 /*****************************************************
  * 
  *  Function declarations
@@ -175,6 +205,9 @@ ecoseq_t         *readnext_ecoseq(FILE *);
 
 ecorankidx_t     *read_rankidx(const char *filename);
 
+econameidx_t     *read_nameidx(const char *filename,ecotaxonomy_t *taxonomy);
+
+
 
 	/**
 	 * Read taxonomy data as formated by the ecoPCRFormat.py script.
@@ -189,8 +222,11 @@ ecorankidx_t     *read_rankidx(const char *filename);
  
 ecotxidx_t       *read_taxonomyidx(const char *filename);
 
-ecotaxonomy_t    *read_taxonomy(const char *prefix);
+ecotaxonomy_t    *read_taxonomy(const char *prefix,int32_t readAlternativeName);
 
+ecotx_t *eco_findtaxonbytaxid(ecotaxonomy_t *taxonomy, int32_t taxid);
+
+int eco_isundertaxon(ecotx_t *taxon, int other_taxid);
 
 ecoseq_t *ecoseq_iterator(const char *prefix);
 
@@ -227,4 +263,7 @@ ecotx_t *eco_getfamily(ecotx_t *taxon,ecotaxonomy_t *taxonomy);
 ecotx_t *eco_getkingdom(ecotx_t *taxon,ecotaxonomy_t *taxonomy);
 ecotx_t *eco_getsuperkingdom(ecotx_t *taxon,ecotaxonomy_t *taxonomy);
 
+int eco_is_taxid_ignored(int32_t *ignored_taxid, int32_t tab_len, int32_t taxid);
+int eco_is_taxid_included(ecotaxonomy_t *taxonomy, int32_t *included_taxid, int32_t tab_len, int32_t taxid);
+
 #endif /*ECOPCR_H_*/

src/libecoPCR/ecofilter.c

@@ -0,0 +1,19 @@
+#include "ecoPCR.h"
+
+int eco_is_taxid_included(	ecotaxonomy_t *taxonomy, 
+							int32_t *restricted_taxid, 
+							int32_t tab_len, 
+							int32_t taxid)
+{
+	int i;
+	ecotx_t *taxon;
+	
+	taxon = eco_findtaxonbytaxid(taxonomy, taxid);
+	
+	for (i=0; i < tab_len; i++)
+		if ( (taxon->taxid == restricted_taxid[i]) ||
+			 (eco_isundertaxon(taxon, restricted_taxid[i])) )
+			return 1;
+	
+	return 0;
+}

src/libecoPCR/econame.c

@@ -0,0 +1,61 @@
+#include "ecoPCR.h"
+#include <string.h>
+#include <stdlib.h>
+
+static econame_t *readnext_econame(FILE *f,econame_t *name,ecotaxonomy_t *taxonomy);
+
+econameidx_t *read_nameidx(const char *filename,ecotaxonomy_t *taxonomy)
+{
+
+	int32_t      		count;
+	FILE         		*f;
+	econameidx_t		*indexname;
+	int32_t      		i;
+	
+	f = open_ecorecorddb(filename,&count,1);
+	
+	indexname = (econameidx_t*) ECOMALLOC(sizeof(econameidx_t) + sizeof(econame_t) * (count-1),"Allocate names");
+	
+	indexname->count=count;
+	                                    
+	for (i=0; i < count; i++){
+		readnext_econame(f,(indexname->names)+i,taxonomy);
+	}
+
+	return indexname;
+}
+
+econame_t *readnext_econame(FILE *f,econame_t *name,ecotaxonomy_t *taxonomy)
+{
+	
+	econameformat_t *raw;
+	int32_t  rs;
+	
+	raw = read_ecorecord(f,&rs);
+	
+	if (!raw)
+		return NULL;
+
+	if (is_big_endian())
+	{
+		raw->is_scientificname 	= swap_int32_t(raw->is_scientificname);
+		raw->namelength 	    = swap_int32_t(raw->namelength);
+		raw->classlength        = swap_int32_t(raw->classlength);
+		raw->taxid  	        = swap_int32_t(raw->taxid); 
+	}
+	
+	name->is_scientificname=raw->is_scientificname;
+	
+	name->name   	= ECOMALLOC((raw->namelength+1) * sizeof(char),"Allocate name");
+	strncpy(name->name,raw->names,raw->namelength);
+	name->name[raw->namelength]=0;
+	
+	name->classname = ECOMALLOC((raw->classlength+1) * sizeof(char),"Allocate classname");
+	strncpy(name->classname,(raw->names+raw->namelength),raw->classlength);
+	name->classname[raw->classlength]=0;
+	
+	name->taxon = taxonomy->taxons->taxon + raw->taxid;
+
+	return name;
+}
+

src/libecoPCR/ecoseq.c

@@ -79,7 +79,9 @@ ecoseq_t *new_ecoseq_with_data( char *AC,
 
 }
 
-
+/**
+ * ?? used ??
+ **/
 FILE *open_ecoseqdb(const char *filename,
                     int32_t    *sequencecount)
 {
@@ -140,6 +142,13 @@ ecoseq_t *readnext_ecoseq(FILE *f)
 	return seq;
 }
 
+/**
+ * Open the sequences database (.sdx file)
+ * @param	prefix	name of the database (radical without extension) 
+ * @param	index 	integer
+ * 
+ * @return	file object 
+ */
 FILE *open_seqfile(const char *prefix,int32_t index)
 {
 	char           filename_buffer[1024];
@@ -153,7 +162,7 @@ FILE *open_seqfile(const char *prefix,int32_t index)
 	                           prefix,
 	                           index);
 	                           
-			fprintf(stderr,"Coucou %s\n",filename_buffer);
+			fprintf(stderr,"# Coucou %s\n",filename_buffer);
 	                           
 
 	if (filename_length >= 1024)
@@ -164,7 +173,7 @@ FILE *open_seqfile(const char *prefix,int32_t index)
 	input=open_ecorecorddb(filename_buffer,&seqcount,0);
 	
 	if (input)
-		fprintf(stderr,"Reading file %s containing %d sequences...\n",
+		fprintf(stderr,"# Reading file %s containing %d sequences...\n",
 				filename_buffer,
 				seqcount);
 				

src/libecoPCR/ecotax.c

@@ -5,7 +5,11 @@
 
 static ecotx_t *readnext_ecotaxon(FILE *f,ecotx_t *taxon);
 
-
+ /** 
+ * Open the taxonomy database 
+ * @param	pointer to the database (.tdx file) 
+ * @return	a ecotxidx_t structure 
+ */
 ecotxidx_t     *read_taxonomyidx(const char *filename)
 {
 	int32_t      count;
@@ -18,14 +22,15 @@ ecotxidx_t     *read_taxonomyidx(const char *filename)
 	index = (ecotxidx_t*) ECOMALLOC(sizeof(ecotxidx_t) + sizeof(ecotx_t) * (count-1),
 	                                  "Allocate taxonomy");
 	 
-	index->count=count;                                 
-	          
-	for (i=0; i < count; i++)
+	index->count=count;                                         
+	for (i=0; i < count; i++){
 		readnext_ecotaxon(f,&(index->taxon[i]));
-			
+		index->taxon[i].parent=index->taxon + (int32_t)index->taxon[i].parent;
+	}					
 	return index;
 }
 
+
 int32_t delete_taxonomy(ecotxidx_t *index)
 {
 	int32_t i;
@@ -61,6 +66,15 @@ int32_t delete_taxon(ecotx_t *taxon)
 	return 1;
 }
 
+
+/**
+ * Read the database for a given taxon a save the data 
+ * into the taxon structure(if any found)
+ * @param	*f	pointer to FILE type returned by fopen
+ * @param	*taxon	pointer to the structure
+ * 
+ * @return	a ecotx_t structure if any taxon found else NULL 
+ */
 ecotx_t *readnext_ecotaxon(FILE *f,ecotx_t *taxon)
 {
 	
@@ -80,7 +94,7 @@ ecotx_t *readnext_ecotaxon(FILE *f,ecotx_t *taxon)
 		raw->taxid      = swap_int32_t(raw->taxid); 
 	}
 	
-	taxon->parent = raw->parent;
+	taxon->parent = (ecotx_t*)raw->parent;
 	taxon->taxid  = raw->taxid;
 	taxon->rank   = raw->rank;
 	
@@ -88,12 +102,12 @@ ecotx_t *readnext_ecotaxon(FILE *f,ecotx_t *taxon)
 	                          "Allocate taxon scientific name");
 	                          
 	strncpy(taxon->name,raw->name,raw->namelength);
-	
+		
 	return taxon;
 }
 
 
-ecotaxonomy_t    *read_taxonomy(const char *prefix)
+ecotaxonomy_t    *read_taxonomy(const char *prefix,int32_t readAlternativeName)
 {
 	ecotaxonomy_t *tax;
 	char          *filename;
@@ -115,10 +129,19 @@ ecotaxonomy_t    *read_taxonomy(const char *prefix)
 	
 	tax->taxons = read_taxonomyidx(filename);
 	
+	if (readAlternativeName)
+	{
+  	   snprintf(filename,buffsize,"%s.ndx",prefix);
+	   tax->names=read_nameidx(filename,tax);
+	}
+	else
+	   tax->names=NULL;
 	return tax;
 	
 }
 
+
+
 int32_t delete_ecotaxonomy(ecotaxonomy_t *taxonomy)
 {
 	if (taxonomy)
@@ -138,20 +161,19 @@ int32_t delete_ecotaxonomy(ecotaxonomy_t *taxonomy)
 }
 
 ecotx_t *eco_findtaxonatrank(ecotx_t *taxon,
-                                int32_t rankidx,
-                                ecotaxonomy_t *taxonomy)
+                                int32_t rankidx)
 {
 	ecotx_t *current_taxon;
 	ecotx_t *next_taxon;
 	
 	current_taxon = taxon;
-	next_taxon    = &(taxonomy->taxons->taxon[current_taxon->parent]);
+	next_taxon    = current_taxon->parent;
 	
-	while ((current_taxon!=next_taxon) &&
+	while ((current_taxon!=next_taxon) &&  // I' am the root node
 		   (current_taxon->rank!=rankidx))
 		   {
 		   	current_taxon = next_taxon;
-		   	next_taxon    = &(taxonomy->taxons->taxon[current_taxon->parent]);
+		   	next_taxon    = current_taxon->parent;
 		   }
 		   
 	if (current_taxon->rank==rankidx)
@@ -160,6 +182,61 @@ ecotx_t *eco_findtaxonatrank(ecotx_t *taxon,
 		return NULL;
 }
 
+/**
+ * Get back information concerning a taxon from a taxonomic id
+ * @param 	*taxonomy 	the taxonomy database
+ * @param	taxid		the taxonomic id 
+ * 
+ * @result	a ecotx_t structure containing the taxonimic information  
+ **/
+ecotx_t *eco_findtaxonbytaxid(ecotaxonomy_t *taxonomy, 
+							  int32_t taxid)
+{
+	ecotx_t    *current_taxon;
+	int32_t     taxoncount;
+	int32_t     i;
+	
+	taxoncount=taxonomy->taxons->count;
+	
+	for (current_taxon=taxonomy->taxons->taxon,
+	     i=0;
+	     i < taxoncount;
+	     i++,
+	     current_taxon++){
+	     if (current_taxon->taxid==taxid){
+	     	return current_taxon;
+	     }
+	 }
+	
+	return (ecotx_t*)NULL;	
+}
+
+/**
+ * Find out if taxon is son of other taxon (identified by its taxid)
+ * @param	*taxon son 		taxon
+ * @param	parent_taxid 	taxonomic id of the other taxon
+ * 
+ * @return 	1 is the other taxid math a parent taxid, else 0
+ **/
+int eco_isundertaxon(ecotx_t *taxon, 
+						int other_taxid)
+{
+	ecotx_t *next_parent;
+	
+	next_parent = taxon->parent;	
+	
+	while ( (other_taxid != next_parent->taxid) && 
+			(strcmp(next_parent->name, "root")) )
+	{
+		next_parent = next_parent->parent;
+	}
+		
+	if (other_taxid == next_parent->taxid)
+		return 1;
+	else
+		return 0;
+}
+
 ecotx_t *eco_getspecies(ecotx_t *taxon,
 						ecotaxonomy_t *taxonomy)
 {
@@ -175,7 +252,7 @@ ecotx_t *eco_getspecies(ecotx_t *taxon,
 	if (!tax || rankindex < 0)
 		ECOERROR(ECO_ASSERT_ERROR,"No taxonomy defined");
 		
-	return eco_findtaxonatrank(taxon,rankindex,tax);
+	return eco_findtaxonatrank(taxon,rankindex);
 }
 
 ecotx_t *eco_getgenus(ecotx_t *taxon,
@@ -193,7 +270,7 @@ ecotx_t *eco_getgenus(ecotx_t *taxon,
 	if (!tax || rankindex < 0)
 		ECOERROR(ECO_ASSERT_ERROR,"No taxonomy defined");
 		
-	return eco_findtaxonatrank(taxon,rankindex,tax);
+	return eco_findtaxonatrank(taxon,rankindex);
 }
 
 
@@ -212,7 +289,7 @@ ecotx_t *eco_getfamily(ecotx_t *taxon,
 	if (!tax || rankindex < 0)
 		ECOERROR(ECO_ASSERT_ERROR,"No taxonomy defined");
 		
-	return eco_findtaxonatrank(taxon,rankindex,tax);
+	return eco_findtaxonatrank(taxon,rankindex);
 }
 
 ecotx_t *eco_getkingdom(ecotx_t *taxon,
@@ -230,7 +307,7 @@ ecotx_t *eco_getkingdom(ecotx_t *taxon,
 	if (!tax || rankindex < 0)
 		ECOERROR(ECO_ASSERT_ERROR,"No taxonomy defined");
 		
-	return eco_findtaxonatrank(taxon,rankindex,tax);
+	return eco_findtaxonatrank(taxon,rankindex);
 }
 
 ecotx_t *eco_getsuperkingdom(ecotx_t *taxon,
@@ -248,5 +325,5 @@ ecotx_t *eco_getsuperkingdom(ecotx_t *taxon,
 	if (!tax || rankindex < 0)
 		ECOERROR(ECO_ASSERT_ERROR,"No taxonomy defined");
 		
-	return eco_findtaxonatrank(taxon,rankindex,tax);
+	return eco_findtaxonatrank(taxon,rankindex);
 }

tools/ecoPCRFilter.py

@@ -0,0 +1,303 @@
+#!/usr/bin/env python
+
+import struct
+import sys
+import os
+import gzip
+
+
+#####
+#
+# Generic file function
+#
+#####
+
+class Filter(object):
+    
+    
+    def __init__(self,path):
+        self._path = path
+        self._taxonFile =  "%s.tdx" % self._path
+        self._ranksFile =  "%s.rdx" % self._path
+        self._namesFile =  "%s.ndx" % self._path
+        self._taxonomy, self._index, self._ranks, self._name = self.__readNodeTable()
+
+
+    def __universalOpen(self,file):
+        if isinstance(file,str):
+            if file[-3:] == '.gz':
+                rep = gzip.open(file)
+            else:
+                rep = open(file)
+        else:
+            rep = file
+        return rep
+
+    def __universalTell(self,file):
+        if isinstance(file, gzip.GzipFile):
+            file=file.myfileobj
+        return file.tell()
+    
+    def __fileSize(self,file):
+        if isinstance(file, gzip.GzipFile):
+            file=file.myfileobj
+        pos = file.tell()
+        file.seek(0,2)
+        length = file.tell()
+        file.seek(pos,0)
+        return length
+    
+    def __progressBar(self,pos,max,reset=False,delta=[]):
+        if reset:
+            del delta[:]
+        if not delta:
+            delta.append(time.time())
+            delta.append(time.time())
+    
+        delta[1]=time.time()
+        elapsed = delta[1]-delta[0]
+        percent = float(pos)/max * 100
+        remain = time.strftime('%H:%M:%S',time.gmtime(elapsed / percent * (100-percent)))
+        bar = '#' * int(percent/2)
+        bar+= '|/-\\-'[pos % 5]
+        bar+= ' ' * (50 - int(percent/2))
+        sys.stderr.write('\r%5.1f %% |%s] remain : %s' %(percent,bar,remain))
+
+
+
+
+    #####
+    #
+    # Iterator functions
+    #
+    #####
+    
+    
+    
+    def __ecoRecordIterator(self,file):
+        file = self.__universalOpen(file)
+        (recordCount,) = struct.unpack('> I',file.read(4))
+    
+        for i in xrange(recordCount):
+            (recordSize,)=struct.unpack('>I',file.read(4))
+            record = file.read(recordSize)
+            yield record
+    
+               
+    def __ecoNameIterator(self):
+        for record in self.__ecoRecordIterator(self._namesFile):
+            lrecord = len(record)
+            lnames  = lrecord - 16
+            (isScientificName,namelength,classLength,indextaxid,names)=struct.unpack('> I I I I %ds' % lnames, record)
+            name=names[:namelength]
+            classname=names[namelength:]
+            yield (name,classname,indextaxid)
+    
+    
+    def __ecoTaxonomicIterator(self):
+        for record in self.__ecoRecordIterator(self._taxonFile):
+            lrecord = len(record)
+            lnames  = lrecord - 16
+            (taxid,rankid,parentidx,nameLength,name)=struct.unpack('> I I I I %ds' % lnames, record)
+            yield  (taxid,rankid,parentidx,name)
+    
+    
+    def __ecoSequenceIterator(self,file):
+        for record in self.__ecoRecordIterator(file):
+            lrecord = len(record)
+            lnames  = lrecord - (4*4+20)
+            (taxid,seqid,deflength,seqlength,cptseqlength,string)=struct.unpack('> I 20s I I I %ds' % lnames, record)
+            de = string[:deflength]
+            seq = gzip.zlib.decompress(string[deflength:])
+            yield  (taxid,seqid,deflength,seqlength,cptseqlength,de,seq)
+    
+            
+    def __ecoRankIterator(self):
+        for record in self.__ecoRecordIterator(self._ranksFile):
+            yield  record
+    
+    
+    #####
+    #
+    # Indexes
+    #
+    #####
+    
+    def __ecoNameIndex(self):
+        indexName = [x for x in self.__ecoNameIterator()]
+        return indexName
+
+    def __ecoRankIndex(self):
+        rank = [r for r in self.__ecoRankIterator()]
+        return rank
+
+    def __ecoTaxonomyIndex(self):
+        taxonomy = []
+        index = {}
+        i = 0;
+        for x in self.__ecoTaxonomicIterator():
+            taxonomy.append(x)
+            index[x[0]] = i 
+            i = i + 1
+        return taxonomy, index
+
+    def __readNodeTable(self):
+        taxonomy, index = self.__ecoTaxonomyIndex()
+        ranks = self.__ecoRankIndex()
+        name = self.__ecoNameIndex()
+        return taxonomy,index,ranks,name
+
+
+    def findTaxonByTaxid(self,taxid):
+        return self._taxonomy[self._index[taxid]]
+
+
+
+    #####
+    #
+    # PUBLIC METHODS
+    #
+    #####
+
+
+    def subTreeIterator(self, taxid):
+        "return subtree for given taxonomic id "
+        idx = self._index[taxid]
+        yield self._taxonomy[idx]
+        for t in self._taxonomy:
+            if t[2] == idx:
+                for subt in self.subTreeIterator(t[0]):
+                    yield subt
+    
+    
+    def parentalTreeIterator(self, taxid):
+        """
+           return parental tree for given taxonomic id starting from
+           first ancester to the root.
+        """
+        taxon=self.findTaxonByTaxid(taxid)
+        while taxon[2]!= 0: 
+            yield taxon
+            taxon = self._taxonomy[taxon[2]]
+        yield self._taxonomy[0]
+    
+    
+    def ecoPCRResultIterator(self, file):
+        "iteration on ecoPCR result file"
+        file = self.__universalOpen(file)
+        data = ColumnFile(file,
+                          sep='|',
+                          types=(str,int,int,
+                                 str,int,str,
+                                 int,str,int,
+                                 str,int,str,
+                                 str,str,int,
+                                 str,int,int,
+                                 str,str),skip='#')
+        
+        for ac, sq_len, taxid,\
+            rank, sp_taxid, species,\
+            ge_taxid, genus, fa_taxid,\
+            family, sk_taxid, s_kgdom,\
+            strand, oligo_1, error_1,\
+            oligo_2, error_2, amp_len,\
+            sq_des, definition in data:
+            
+            yield {'ac':ac, 'sq_len':sq_len, 'taxid':taxid,
+                   'rank':rank, 'sp_taxid':sp_taxid, 'species':species,
+                   'ge_taxid':ge_taxid, 'genus':genus, 'fa_taxid':fa_taxid,
+                   'family':family, 'sk_taxid':sk_taxid, 's_kgdom':s_kgdom,
+                   'strand':strand, 'oligo_1':oligo_1, 'error_1':error_1,
+                   'oligo_2':oligo_2, 'error_2':error_2, 'amp_len':amp_len,
+                   'sq_des':sq_des, 'definition':definition}
+    
+    def rankFilter(self,rankid,filter):
+        return self._ranks[rankid] == filter
+
+
+    def lastCommonTaxon(self,taxid_1, taxid_2): 
+        t1 = [x[0] for x in self.parentalTreeIterator(taxid_1)]
+        t2 = [x[0] for x in self.parentalTreeIterator(taxid_2)]
+        t1.reverse()
+        t2.reverse()
+        count = t1 < t2 and len(t1) or len(t2)
+        for i in range(count):
+            if t1[i] != t2[i]:
+               return t1[i-1]
+    
+    
+    
+
+class ColumnFile(object):
+    
+    def __init__(self,stream,sep=None,strip=True,types=None,skip=None):
+        if isinstance(stream,str):
+            self._stream = open(stream)
+        elif hasattr(stream,'next'):
+            self._stream = stream
+        else:
+            raise ValueError,'stream must be string or an iterator'
+        self._delimiter=sep
+        self._strip=strip
+        if types:
+            self._types=[x for x in types]
+            for i in xrange(len(self._types)):
+                if self._types[i] is bool:
+                    self._types[i]=ColumnFile.str2bool
+        else:
+            self._types=None
+        self._skip = skip
+            
+    def str2bool(x):
+        return bool(eval(x.strip()[0].upper(),{'T':True,'V':True,'F':False}))
+                    
+    str2bool = staticmethod(str2bool)
+            
+        
+    def __iter__(self):
+        return self
+    
+    def next(self):
+        ligne = self._stream.next()
+        while ligne[0] == self._skip:
+            ligne = self._stream.next()
+        data = ligne.split(self._delimiter)
+        if self._strip or self._types:
+            data = [x.strip() for x in data]
+        if self._types:
+            it = self.endLessIterator(self._types)
+            data = [x[1](x[0]) for x in ((y,it.next()) for y in data)]
+        return data
+    
+    def endLessIterator(self,endedlist):
+        for x in endedlist:
+            yield x
+        while(1):
+            yield endedlist[-1]
+
+
+class Table(list):
+    
+    def __init__(self, headers, types):
+        list.__init__(self)
+        self.headers = headers
+        self.types = types
+        self.lines = []
+        
+    def printTable(self):
+        for h in self.headers:
+            print "\t%s\t|" % h,
+        print "\n"
+        for l in self.lines:
+            for c in l:
+                print "\t%s\t|" % c
+            print "\n"
+            
+    def getColumn(self,n):
+        print "\t%s\n" % self.header[n]
+        for i in range(len(self.lines)):
+            print "\t%s\n" % i[n]
+        
+        
+        
+

tools/ecoPCRFormat.py

@@ -68,8 +68,7 @@ def endLessIterator(endedlist):
         yield x
     while(1):
         yield endedlist[-1]
-    
-    
+   
 class ColumnFile(object):
     
     def __init__(self,stream,sep=None,strip=True,types=None):
@@ -135,7 +134,7 @@ def bsearchTaxon(taxonomy,taxid):
     else:
         return None
         
-        
+    
     
 def readNodeTable(file):
 
@@ -149,7 +148,6 @@ def readNodeTable(file):
                               bool,bool,bool,str))
     print >>sys.stderr,"Reading taxonomy dump file..."
     taxonomy=[[n[0],n[2],n[1]] for n in nodes]
-    
     print >>sys.stderr,"List all taxonomy rank..."    
     ranks =list(set(x[1] for x in taxonomy))
     ranks.sort()
@@ -171,15 +169,14 @@ def readNodeTable(file):
         
     return taxonomy,ranks,index
 
-def scientificNameIterator(file):
+def nameIterator(file):
     file = universalOpen(file)
     names = ColumnFile(file, 
                        sep='|', 
                        types=(int,str,
                               str,str))
     for taxid,name,unique,classname,white in names:
-        if classname == 'scientific name':
-            yield taxid,name
+        yield taxid,name,classname
         
 def mergedNodeIterator(file):
     file = universalOpen(file)
@@ -201,8 +198,12 @@ def readTaxonomyDump(taxdir):
     taxonomy,ranks,index = readNodeTable('%s/nodes.dmp' % taxdir)
     
     print >>sys.stderr,"Adding scientific name..."
-    for taxid,name in scientificNameIterator('%s/names.dmp' % taxdir):
-        taxonomy[index[taxid]].append(name)
+
+    alternativeName=[]
+    for taxid,name,classname in nameIterator('%s/names.dmp' % taxdir):
+        alternativeName.append((name,classname,index[taxid]))
+        if classname == 'scientific name':
+            taxonomy[index[taxid]].append(name)
         
     print >>sys.stderr,"Adding taxid alias..."
     for taxid,current in mergedNodeIterator('%s/merged.dmp' % taxdir):
@@ -212,7 +213,7 @@ def readTaxonomyDump(taxdir):
     for taxid in deletedNodeIterator('%s/delnodes.dmp' % taxdir):
         index[taxid]=None
     
-    return taxonomy,ranks,index
+    return taxonomy,ranks,alternativeName,index
 
 
 #####
@@ -267,28 +268,52 @@ def genbankEntryParser(entry):
         Tx = None
     return {'id':Id,'taxid':Tx,'definition':De,'sequence':Sq}
 
-_fastaParseID = re.compile('(?<=^>)[^ ]+')
-_fastaParseDE = re.compile('(?<=^>).+',)   
-_fastaParseSQ = re.compile('^[^>].+',re.MULTILINE+re.DOTALL)
-_fastaParseTX = re.compile('(?<=[[Tt]axon:) *[0-9]+ *(?=])')
-  
-def fastaEntryParser(entry):
-    Id = _fastaParseID.findall(entry)[0]
-    De = _fastaParseDE.findall(entry)[0].split(None,1)[1:]
-    if not De:
-        De=''
-    else:
-        De=De[0]
-    Sq = cleanSeq(_fastaParseSQ.findall(entry)[0].upper())  
+######################
+
+_cleanDef = re.compile('[\nDE]')
+
+def cleanDef(definition):
+    return _cleanDef.sub('',definition)
+
+_emblParseID = re.compile('(?<=^ID {3})[^ ]+(?=;)',re.MULTILINE)   
+_emblParseDE = re.compile('(?<=^DE {3}).+?\. *$(?=[^ ])',re.MULTILINE+re.DOTALL)   
+_emblParseSQ = re.compile('(?<=^  ).+?(?=^//$)',re.MULTILINE+re.DOTALL)  
+_emblParseTX = re.compile('(?<= /db_xref="taxon:)[0-9]+(?=")')
+
+def emblEntryParser(entry):
+    Id = _emblParseID.findall(entry)[0]
+    De = ' '.join(cleanDef(_emblParseDE.findall(entry)[0]).split())
+    Sq = cleanSeq(_emblParseSQ.findall(entry)[0].upper())
     try:
-        Tx = int(_fastaParseTX.findall(entry)[0])
+        Tx = int(_emblParseTX.findall(entry)[0])
     except IndexError:
         Tx = None
-          
     return {'id':Id,'taxid':Tx,'definition':De,'sequence':Sq}
+
+
+######################
+
+def parseFasta(seq):
+    title = seq[0].strip()[1:].split(None,1)
+    id=title[0]
+    if len(title) == 2:
+        field = title[1].split('; ')
+    else:
+        field=[]
+    info = dict(x.split('=') for x in field if '=' in x)
+    definition = ' '.join([x for x in field if '=' not in x])
+    seq=(''.join([x.strip() for x in seq[1:]])).upper()
+    return id,seq,definition,info
+
+  
+def fastaEntryParser(entry):
+    id,seq,definition,info = parseFasta(entry)
+    Tx = info.get('taxid',None)   
+    if Tx is not None:
+        Tx=int(Tx)
+    return {'id':id,'taxid':Tx,'definition':definition,'sequence':seq}
     
 
-    
 def sequenceIteratorFactory(entryParser,entryIterator):
     def sequenceIterator(file):
         for entry in entryIterator(file):
@@ -381,6 +406,22 @@ def ecoRankPacker(rank):
     
     return packed
                 
+def ecoNamePacker(name):
+    
+    namelength = len(name[0])
+    classlength= len(name[1])
+    totalSize =  namelength + classlength + 4 + 4 + 4 + 4
+    
+    packed = struct.pack('> I I I I I %ds %ds' % (namelength,classlength),
+                         totalSize,
+                         int(name[1]=='scientific name'),
+                         namelength,
+                         classlength,
+                         name[2],
+                         name[0],
+                         name[1])
+    
+    return packed
     
 def ecoSeqWriter(file,input,taxindex,parser):
     output = open(file,'wb')
@@ -438,18 +479,40 @@ def ecoRankWriter(file,ranks):
         output.write(ecoRankPacker(rank))
 
     output.close()
+
+def nameCmp(n1,n2):
+    name1=n1[0].upper()
+    name2=n2[0].upper()
+    if name1 < name2:
+        return -1
+    elif name1 > name2:
+        return 1
+    return 0
+
+
+def ecoNameWriter(file,names):
+    output = open(file,'wb')
+    output.write(struct.pack('> I',len(names)))
+
+    names.sort(nameCmp)
+    
+    for name in names:
+        output.write(ecoNamePacker(name))
+
+    output.close()
     
 def ecoDBWriter(prefix,taxonomy,seqFileNames,parser):
     
     ecoRankWriter('%s.rdx' % prefix, taxonomy[1])
     ecoTaxWriter('%s.tdx' % prefix, taxonomy[0])
-    
+    ecoNameWriter('%s.ndx' % prefix, taxonomy[2])
+  
     filecount = 0
     for filename in seqFileNames:
         filecount+=1
         sk=ecoSeqWriter('%s_%03d.sdx' % (prefix,filecount), 
                      filename, 
-                     taxonomy[2], 
+                     taxonomy[3], 
                      parser)
         if sk:
             print >>sys.stderr,"Skipped entry :"
@@ -464,37 +527,58 @@ def ecoParseOptions(arguments):
            }
     
     o,filenames = getopt.getopt(arguments,
-                                'ht:n:gf',
+                                'ht:n:gfe',
                                 ['help',
                                  'taxonomy=',
                                  'name=',
                                  'genbank',
-                                 'fasta'])
+                                 'fasta',
+                                 'embl'])
     
     for name,value in o:
         if name in ('-h','--help'):
-            pass
+            printHelp()
+            exit()
         elif name in ('-t','--taxonomy'):
             opt['taxdir']=value
         elif name in ('-n','--name'):
             opt['prefix']=value
         elif name in ('-g','--genbank'):
             opt['parser']=sequenceIteratorFactory(genbankEntryParser,
-                                                  entryIterator
-                                                  )
+                                                  entryIterator)
+
         elif name in ('-f','--fasta'):
             opt['parser']=sequenceIteratorFactory(fastaEntryParser,
                                                   fastaEntryIterator)
+            
+        elif name in ('-e','--embl'):
+            opt['parser']=sequenceIteratorFactory(emblEntryParser,
+                                                  entryIterator)
         else:
             raise ValueError,'Unknown option %s' % name
 
     return opt,filenames
 
+def printHelp():
+    print "-----------------------------------"
+    print " ecoPCRFormat.py"
+    print "-----------------------------------"
+    print "ecoPCRFormat.py [option] <argument>"
+    print "-----------------------------------"
+    print "-e    --embl        :[E]mbl format"
+    print "-f    --fasta       :[F]asta format"
+    print "-g    --genbank     :[G]enbank format"
+    print "-h    --help        :[H]elp - print this help"
+    print "-n    --name        :[N]ame of the new database created"
+    print "-t    --taxonomy    :[T]axonomy - path to the taxonomy database"
+    print "                    :bcp-like dump from GenBank taxonomy database."
+    print "-----------------------------------"
+
 if __name__ == '__main__':
     
     opt,filenames = ecoParseOptions(sys.argv[1:])
     
     taxonomy = readTaxonomyDump(opt['taxdir'])
-    
+   
     ecoDBWriter(opt['prefix'], taxonomy, filenames, opt['parser'])
     

tools/ecoSort.py

@@ -0,0 +1,811 @@
+#!/usr/bin/env python
+
+import struct
+import sys
+import os
+import gzip
+import re
+import string
+
+from reportlab.graphics.shapes import *
+from reportlab.graphics.charts.barcharts import VerticalBarChart
+from reportlab.graphics.charts.piecharts import Pie
+from reportlab.lib.styles import getSampleStyleSheet
+from reportlab.lib.units import cm
+from reportlab.lib import colors
+from reportlab.platypus import *
+
+
+#####
+#
+# Generic file function
+#
+#####
+
+class Filter(object):
+    """
+       This object provides different iterators and method :
+        * findTaxonByTaxid
+        * subTreeIterator
+        * parentalTreeIterator
+        * ecoPCRResultIterator
+        * rankFilter
+        * lastCommonTaxon
+        
+        see each method for more informations
+    """
+    
+    def __init__(self,path):
+        self._path = path
+        self._taxonFile =  "%s.tdx" % self._path
+        self._ranksFile =  "%s.rdx" % self._path
+        self._namesFile =  "%s.ndx" % self._path
+        self._taxonomy, self._index, self._ranks, self._name = self.__readNodeTable()
+
+
+    def __universalOpen(self,file):
+        if isinstance(file,str):
+            if file[-3:] == '.gz':
+                rep = gzip.open(file)
+            else:
+                rep = open(file)
+        else:
+            rep = file
+        return rep
+
+    def __universalTell(self,file):
+        if isinstance(file, gzip.GzipFile):
+            file=file.myfileobj
+        return file.tell()
+    
+    def __fileSize(self,file):
+        if isinstance(file, gzip.GzipFile):
+            file=file.myfileobj
+        pos = file.tell()
+        file.seek(0,2)
+        length = file.tell()
+        file.seek(pos,0)
+        return length
+    
+    def __progressBar(self,pos,max,reset=False,delta=[]):
+        if reset:
+            del delta[:]
+        if not delta:
+            delta.append(time.time())
+            delta.append(time.time())
+    
+        delta[1]=time.time()
+        elapsed = delta[1]-delta[0]
+        percent = float(pos)/max * 100
+        remain = time.strftime('%H:%M:%S',time.gmtime(elapsed / percent * (100-percent)))
+        bar = '#' * int(percent/2)
+        bar+= '|/-\\-'[pos % 5]
+        bar+= ' ' * (50 - int(percent/2))
+        sys.stderr.write('\r%5.1f %% |%s] remain : %s' %(percent,bar,remain))
+
+
+
+
+    #####
+    #
+    # Iterator functions
+    #
+    #####
+    
+    
+    
+    def __ecoRecordIterator(self,file):
+        file = self.__universalOpen(file)
+        (recordCount,) = struct.unpack('> I',file.read(4))
+    
+        for i in xrange(recordCount):
+            (recordSize,)=struct.unpack('>I',file.read(4))
+            record = file.read(recordSize)
+            yield record
+    
+               
+    def __ecoNameIterator(self):
+        for record in self.__ecoRecordIterator(self._namesFile):
+            lrecord = len(record)
+            lnames  = lrecord - 16
+            (isScientificName,namelength,classLength,indextaxid,names)=struct.unpack('> I I I I %ds' % lnames, record)
+            name=names[:namelength]
+            classname=names[namelength:]
+            yield (name,classname,indextaxid)
+    
+    
+    def __ecoTaxonomicIterator(self):
+        for record in self.__ecoRecordIterator(self._taxonFile):
+            lrecord = len(record)
+            lnames  = lrecord - 16
+            (taxid,rankid,parentidx,nameLength,name)=struct.unpack('> I I I I %ds' % lnames, record)
+            yield  (taxid,rankid,parentidx,name)
+    
+    
+    def __ecoSequenceIterator(self,file):
+        for record in self.__ecoRecordIterator(file):
+            lrecord = len(record)
+            lnames  = lrecord - (4*4+20)
+            (taxid,seqid,deflength,seqlength,cptseqlength,string)=struct.unpack('> I 20s I I I %ds' % lnames, record)
+            de = string[:deflength]
+            seq = gzip.zlib.decompress(string[deflength:])
+            yield  (taxid,seqid,deflength,seqlength,cptseqlength,de,seq)
+    
+            
+    def __ecoRankIterator(self):
+        for record in self.__ecoRecordIterator(self._ranksFile):
+            yield  record
+    
+    
+    #####
+    #
+    # Indexes
+    #
+    #####
+    
+    def __ecoNameIndex(self):
+        indexName = [x for x in self.__ecoNameIterator()]
+        return indexName
+
+    def __ecoRankIndex(self):
+        rank = [r for r in self.__ecoRankIterator()]
+        return rank
+
+    def __ecoTaxonomyIndex(self):
+        taxonomy = []
+        index = {}
+        i = 0;
+        for x in self.__ecoTaxonomicIterator():
+            taxonomy.append(x)
+            index[x[0]] = i 
+            i = i + 1
+        return taxonomy, index
+
+    def __readNodeTable(self):
+        taxonomy, index = self.__ecoTaxonomyIndex()
+        ranks = self.__ecoRankIndex()
+        name = self.__ecoNameIndex()
+        return taxonomy,index,ranks,name
+
+
+    #####
+    #
+    # PUBLIC METHODS
+    #
+    #####
+
+    def findTaxonByTaxid(self,taxid):
+        """
+            Returns a list containing [taxid,rankid,parent_index,nameLength,name]
+            It takes one argument : a taxonomic id
+        """
+        return self._taxonomy[self._index[taxid]]
+
+
+    def subTreeIterator(self, taxid):
+        """
+            Returns subtree for given taxid from first child
+            to last child. It takes one argument : a taxonomic id
+        """
+        idx = self._index[taxid]
+        yield self._taxonomy[idx]
+        for t in self._taxonomy:
+            if t[2] == idx:
+                for subt in self.subTreeIterator(t[0]):
+                    yield subt
+    
+    
+    def parentalTreeIterator(self, taxid):
+        """
+           return parental tree for given taxonomic id starting from
+           first ancester to the root.
+        """
+        taxon=self.findTaxonByTaxid(taxid)
+        while taxon[2]!= 0: 
+            yield taxon
+            taxon = self._taxonomy[taxon[2]]
+        yield self._taxonomy[0]    
+    
+    
+    def ecoPCRResultIterator(self, file):
+        """
+           iteration on ecoPCR result file"
+           It returns a dictionnary
+        """
+        file = self.__universalOpen(file)
+        data = ColumnFile(file,
+                          sep='|',
+                          types=(str,int,int,
+                                 str,int,str,
+                                 int,str,int,
+                                 str,int,str,
+                                 str,str,int,
+                                 str,int,int,
+                                 str,str),skip='#')
+     
+        
+        for ac, sq_len, taxid,\
+            rank, sp_taxid, species,\
+            ge_taxid, genus, fa_taxid,\
+            family, sk_taxid, s_kgdom,\
+            strand, oligo_1, error_1,\
+            oligo_2, error_2, amp_len,\
+            sq_des, definition in data:
+            
+            yield {'ac':ac, 'sq_len':sq_len, 'taxid':taxid,
+                   'rank':rank, 'sp_taxid':sp_taxid, 'species':species,
+                   'ge_taxid':ge_taxid, 'genus':genus, 'fa_taxid':fa_taxid,
+                   'family':family, 'sk_taxid':sk_taxid, 's_kgdom':s_kgdom,
+                   'strand':strand, 'oligo_1':oligo_1, 'error_1':error_1,
+                   'oligo_2':oligo_2, 'error_2':error_2, 'amp_len':amp_len,
+                   'sq_des':sq_des, 'definition':definition}
+    
+    def rankFilter(self,rankid,filter):
+        """
+            boolean telling whether rankid match filter
+            takes 2 arguments : 
+            1- rankid
+            2- filter (i.e genus)
+        """
+        return self._ranks[rankid] == filter
+
+
+    def lastCommonTaxon(self,taxid_1, taxid_2):
+        """
+            returns a last common parent for two given taxon.
+            It starts from the root and goes down the tree
+            until their parents diverge.
+            It takes 2 arguments :
+            1- taxid 1
+            2- taxid 2
+        """
+        t1 = [x[0] for x in self.parentalTreeIterator(taxid_1)]
+        t2 = [x[0] for x in self.parentalTreeIterator(taxid_2)]
+        t1.reverse()
+        t2.reverse()
+        count = t1 < t2 and len(t1) or len(t2)
+        for i in range(count):
+            if t1[i] != t2[i]:
+               return t1[i-1]
+        return t1[count-1]
+       
+    
+    
+    
+
+class ColumnFile(object):
+    """
+        cut an ecoPCR file into a list
+    """
+    def __init__(self,stream,sep=None,strip=True,types=None,skip=None):
+        if isinstance(stream,str):
+            self._stream = open(stream)
+        elif hasattr(stream,'next'):
+            self._stream = stream
+        else:
+            raise ValueError,'stream must be string or an iterator'
+        self._delimiter=sep
+        self._strip=strip
+        if types:
+            self._types=[x for x in types]
+            for i in xrange(len(self._types)):
+                if self._types[i] is bool:
+                    self._types[i]=ColumnFile.str2bool
+        else:
+            self._types=None
+        self._skip = skip
+        self._oligo = {}
+            
+    def str2bool(x):
+        return bool(eval(x.strip()[0].upper(),{'T':True,'V':True,'F':False}))
+                    
+    str2bool = staticmethod(str2bool)
+            
+        
+    def __iter__(self):
+        return self
+    
+    def next(self):
+        ligne = self._stream.next()
+        while ligne[0] == self._skip:
+            ligne = self._stream.next()
+        data = ligne.split(self._delimiter)
+        if self._strip or self._types:
+            data = [x.strip() for x in data]
+        if self._types:
+            it = self.endLessIterator(self._types)
+            data = [x[1](x[0]) for x in ((y,it.next()) for y in data)]
+        return data
+    
+    def endLessIterator(self,endedlist):
+        for x in endedlist:
+            yield x
+        while(1):
+            yield endedlist[-1]
+        
+    def getOligo(self,line):
+        if line[2:8] == 'direct':
+            r = re.compile('(?<=direct  strand oligo1 : )[A-Z]+(?= *)')
+            self._oligo['o1'] = r.findall(line)
+        if line[2:9] == 'reverse':
+            r = re.compile('(?<=reverse strand oligo2 : )[A-Z]+(?= *)')
+            self._oligo['o2'] = r.findall(line) 
+        return None
+            
+            
+
+
+###########
+#
+# DATA STRUCTURE
+#
+###########
+
+
+class ecoTable(list):
+    """
+        Data object inheriting from list
+    """
+    def __init__(self, headers, types):
+        list.__init__(self)
+        self.headers = headers
+        self.types = types
+
+
+    def __setitem__ (self,key,value):
+        """
+            method overloaded to check data types
+        """
+        for e in range(len(value)):
+            value[e] = self.types[e](value[e])
+        list.__setitem__(self,key,value)
+        
+    def __getitem__(self,index):
+        newtable = ecoTable(self.headers,self.types)
+        if isinstance(index,slice):
+            newtable.extend(list.__getitem__(self,index))
+        else:
+            newtable.append(list.__getitem__(self,index))
+        
+        return newtable
+    
+    def getColumns(self,columnList):
+        newhead = [self.headers[x] for x in columnList]
+        newtype = [self.types[x] for x in columnList]
+        newtable = ecoTable(newhead,newtype)
+        for line in self:
+            newtable.append([line[x] for x in columnList])
+        
+        return newtable
+
+
+###########
+#
+# PARSE FUNCTIONS
+#
+###########
+
+def _parseOligoResult(filter,file,strand):
+    seq = {}
+    
+    if strand == 'direct':
+        key = 'oligo_1'
+    elif strand == 'reverse':
+        key = 'oligo_2'
+        
+    for s in filter.ecoPCRResultIterator(file):
+        o = s[key]
+        taxid = s['taxid']
+        if not seq.has_key(o):
+            seq[o] = [1,taxid]
+        else:
+            seq[o][0] = seq[o][0] + 1
+            seq[o][1] = filter.lastCommonTaxon(seq[o][1],taxid)
+    return seq
+
+    
+def _parseTaxonomyResult(table):
+    tax = {}
+    for l in table:
+        taxid = l[2]
+        scName = l[3]
+        count = l[1]
+        if not tax.has_key(taxid):
+            tax[taxid] = [1,scName,count]
+        else:
+            tax[taxid][0] = tax[taxid][0] + 1
+            tax[taxid][2] = tax[taxid][2] + count
+    return tax
+
+
+def _sortTable(e1,e2):
+    e1 = e1[1]
+    e2 = e2[1]
+    if e1 < e2:
+        return 1
+    if e1 > e2:
+        return -1
+    return 0 
+
+
+def _countOligoMismatch(o1,o2):
+    """
+        define mismatch between two oligonucleotids
+        return number of mismatch
+    """ 
+    mmatch = 0
+    if len(o1) < len(o2):
+        mmatch = int(len(o2) - len(o1))
+    for i in range(len(o1)):
+        try:
+            if o1[i] != o2[i]:
+                mmatch = mmatch + 1
+        except:
+            mmatch = mmatch + 1    
+
+    return mmatch
+
+###########
+#
+# TOOLS FUNCTIONS
+#
+###########
+
+def customSort(table,x,y):
+    """
+        
+    """
+    x = x-1
+    y = y-1
+    h = (table.headers[x],table.headers[y])
+    t = (table.types[x],table.types[y])
+    cTable = ecoTable(h,t)
+    
+    tmp = {}
+    
+    for l in table:
+        if tmp.has_key(l[x]):
+            tmp[l[x]] = tmp[l[x]] + l[y]
+        else:
+            tmp[l[x]] = l[y]
+    
+    for k,v in tmp.items():
+        cTable.append([k,v])
+    
+    return cTable
+    
+
+def countColumnOccurrence(table,x):
+    x = x-1
+    h = (table.headers[x],"count")
+    t = (table.types[x],int)
+    cTable = Table(h,t)
+    
+    tmp = {}
+    
+    for l in table:
+        if tmp.has_key(l[x]):
+            tmp[l[x]] = tmp[l[x]] + 1
+        else:
+            tmp[l[x]] = 1
+    
+    for k,v in tmp.items():
+        cTable.append([k,v])
+    
+    return cTable
+
+
+def buildSpecificityTable(table):
+    header =  ("mismatch","taxon","count")
+    type = (int,str,int)
+    speTable = ecoTable(header,type)
+    
+    tmp = {}
+    for l in table:
+        if not tmp.has_key(l[5]):
+            tmp[l[5]] = {}
+        if not tmp[l[5]].has_key(l[3]):
+            tmp[l[5]][l[3]] = l[1]
+        else:
+            tmp[l[5]][l[3]] = tmp[l[5]][l[3]] + l[1]
+    
+    for mismatch in tmp.items():
+        for taxon,count in mismatch[1].items():
+            speTable.append([mismatch[0],taxon,count])     
+
+    return speTable
+   
+
+def buildOligoTable(table, file, filter, oligoRef, strand='direct'):
+    """
+        Fills and sorts a Table object with ecoPCR result file
+        
+        Takes 4 arguments
+        1- Table object
+        2- ecoPCR result file path
+        3- Filter Object
+        4- the oligo used in ecoPCR
+        5- the oligo type : direct or reverse
+        
+    """
+    seq = _parseOligoResult(filter, file, strand)
+    
+    i = 0
+    for oligo, info in seq.items():
+        table.append(0)
+        count, lctTaxid = info[0], info[1]
+        scName = filter.findTaxonByTaxid(info[1])[3]
+        rank = filter._ranks[filter.findTaxonByTaxid(info[1])[1]]
+        mismatch = _countOligoMismatch(oligoRef,oligo)
+        table[i]=[oligo,count,lctTaxid,scName,rank,mismatch]
+        i = i + 1
+        
+    table.sort(_sortTable)
+
+ 
+def buildTaxonomicTable(table):
+    """
+        Fill a Table object with a taxonomic synthesis
+    """
+    taxHeaders = ("scName","numOfOligo","numOfAmpl","taxid")
+    taxTypes = (str, int, int, int)
+    taxTable = ecoTable(taxHeaders, taxTypes)
+    
+    tax = _parseTaxonomyResult(table) 
+  
+    i = 0
+    for taxid, info in tax.items():
+        taxTable.append(0)
+        numOfOligo, scName, numOfAmpl = info[0], info[1], info[2]
+        taxTable[i]=[scName,numOfOligo,numOfAmpl,taxid]
+        i = i + 1 
+
+    taxTable.sort(_sortTable)
+
+    return taxTable
+
+def _parseSequenceResult(filter,file,id):
+    sequences = {}
+    idIndex = {}
+    
+    if id == 'family':
+        key = 'fa_taxid'
+    elif id == 'genus':
+        key = 'ge_taxid'
+    else:
+        key = 'taxid'
+    
+    for s in filter.ecoPCRResultIterator(file):
+        seq = s['sq_des']
+        id = s[key]
+        if not idIndex.has_key(id):
+            idIndex[id] = []
+        if not sequences.has_key(seq):
+            sequences[seq] = [id]
+        else:
+            sequences[seq].append(id)
+    return sequences, idIndex
+
+
+def _sameValuesInList(array):
+    for i in range(len(array)-1):
+        if array[i] != array[i+1]:
+            return False
+    return True
+
+
+def _sortSequences(file,filter):
+    
+    sequences, idIndex = _parseSequenceResult(filter,file,'species')
+    
+    for s,id in sequences.items():
+        if len(id) == 1 or _sameValuesInList(id):
+            idIndex[id[0]].append(1)
+        else:
+            for e in id:
+                idIndex[e].append(0)
+    
+   
+    for id,values in idIndex.items():
+        idIndex[id] = float(values.count(1)) / float(len(values)) * 100
+
+            
+    identified = {}
+    non_identified = {}
+    ambiguous = {}
+     
+    return sequences, idIndex
+
+def getIntraSpeciesDiversity(table,file,filter):
+    
+    intraDiv = {} 
+    
+    seq, idIndex = _sortSequences(file,filter)
+    
+    for id,percent in idIndex.items():
+        if percent == 100:
+            intraDiv[id] = [0,[]]
+            for seq,idList in sequences.items():
+                if id in idList:
+                    intraDiv[id][0] = intraDiv[id][0] + 1
+                    intraDiv[id][1].append(seq)
+                    
+    for id, values in intraDiv.items():
+        table.append(id,values[0],values[1])
+                    
+    
+
+###########
+#
+# OUTPUT FUNCTIONS
+#
+###########
+
+def printTable(table):
+    """
+        Displays the content a of Table object
+        Take 1 arguments
+        1- Table object
+    """
+
+    format = ("%20s | " * len(table.headers))[:-3]
+    print format % tuple([str(e) for e in table.headers ]) +"\n" + "-"*23*len(table.headers)
+    for l in table:
+        print format % tuple([str(e) for e in l ])
+    print "# %d results" % len(table)
+       
+        
+def saveAsCSV(table,path):
+    """
+        Creates a csv file from a Table object
+        Takes 2 arguments
+        1- Table object
+        2- path of the file-to-be    
+    """
+    file = open(path,'w')
+    file.write(','.join([str(e) for e in table.headers ]) + "\n")
+    for l in table:
+        file.write(','.join([str(e) for e in l ]) + "\n")
+    file.close()
+
+
+def grepTable(table,col,pattern):
+    """
+        Filters a Table object with regular expression
+        Takes 3 arguments :
+        1- Table object
+        2- number of column to match with
+        3- regular expression pattern
+        
+        Returns a Table object
+    """
+    col = col -1
+    p = re.compile(pattern, re.IGNORECASE)
+    out = ecoTable(table.headers,table.types)
+    for l in table:
+        if p.search(l[col]):
+            out.append(l)
+    return out
+
+
+###########
+#
+# GRAPH FUNCTIONS
+#
+###########
+
+class EcoGraph(object):
+    
+    def __init__(self):
+        self._styles = getSampleStyleSheet()
+        
+        self._element = []
+        self._element.append(self._box(Paragraph("EcoPCR report",  self._styles['Title'])))
+        self._element.append(Spacer(0, 0.5 * cm))
+    
+    def _box(self,flt, center=True):
+        box_style = [('BOX', (0, 0), (-1, -1), 0.5, colors.lightgrey)]
+        if center:
+            box_style += [('ALIGN', (0, 0), (-1, -1), 'CENTER')]
+        return Table([[flt]], style=box_style)
+
+    def _addChart(self,chart,title):
+        drawing = Drawing(300, 250)
+        drawing.add(chart)
+        self._element.append(self._box(Paragraph(title, self._styles['Normal'])))
+        self._element.append(self._box(drawing))
+        self._element.append(Spacer(0, 0.5 * cm))
+    
+    def _formatData(self,table):
+        data, label = [],[]
+        for i in range(len(table)):
+            label.append(table[i][0])
+            data.append(table[i][1])
+        return data, label
+     
+    def makePie(self, table, title):
+        data, label = self._formatData(table)
+        pie = Pie()
+        pie.x = 100
+        pie.y = 100
+        pie.data = data
+        pie.labels = label
+        self._addChart(pie, title)
+    
+    def makeHistogram(self, table, title):    
+        data, label = self._formatData(table)
+        data = [tuple(data)]
+        
+        histo = VerticalBarChart() 
+        histo.x = 10 
+        histo.y = 70 
+        histo.height = 150 
+        histo.width = 300
+        histo.bars.strokeWidth = 1
+        histo.barSpacing = 1
+        histo.barLabels.dy = 5
+        histo.barLabelFormat = '%d'
+        histo.barLabels.fontSize = 9 - (len(data[0])/10)
+        histo.data = data
+        
+        histo.categoryAxis.labels.boxAnchor = 'e'
+        histo.categoryAxis.labels.textAnchor = 'start'        
+        histo.categoryAxis.labels.dx = -40
+        histo.categoryAxis.labels.dy = -50
+        histo.categoryAxis.labels.angle = 45
+        histo.categoryAxis.labels.width = 10
+        histo.categoryAxis.labels.height = 4
+        histo.categoryAxis.categoryNames = label
+        histo.categoryAxis.strokeWidth = 1
+        histo.categoryAxis.labels.fontSize = 8
+                
+        histo.valueAxis.valueMin = min(data[0])*0.7 
+        histo.valueAxis.valueMax = max(data[0])
+        step = (max(data[0]) - min(data[0])) / 10
+        histo.valueAxis.valueStep = step > 1 and step or 1
+        
+        self._addChart(histo, title)
+        
+    def makeReport(self,path):
+        doc = SimpleDocTemplate(path)       
+        doc.build(self._element)
+
+    
+###################### 
+
+ 
+def init():
+    file = "/Users/bessiere/Documents/workspace/ecoPCR/src/toto.tmp"
+    oligo = {'o1':'ATGTTTAAAA','o2':'ATGGGGGTATTG'}
+     
+    filter = Filter("/ecoPCRDB/gbmam")
+    
+    headers = ("oligo", "Num", "LCT Taxid", "Sc Name", "Rank", "distance")
+    types = (str, int, int, str, str, int)
+    
+    o1Table = ecoTable(headers, types)
+    o2Table = ecoTable(headers, types)
+    
+    buildOligoTable(o1Table, file, filter, oligo['o1'], 'direct')
+    buildOligoTable(o2Table, file, filter, oligo['o2'], 'reverse')
+
+ 
+    taxTable = buildTaxonomicTable(o1Table)
+    speTable = buildSpecificityTable(o1Table)
+       
+    return o1Table, o2Table, taxTable
+
+
+
+def start():
+    file = "/Users/bessiere/Documents/workspace/ecoPCR/src/toto.tmp"
+    filter = Filter("/ecoPCRDB/gbmam")
+       
+    speHeaders = ("taxid","num of seq","list of seq")
+    speTypes = (int,int,list) 
+    speTable = ecoTable(speHeaders,speTypes)
+        
+    getIntraSpeciesDiversity(speTable, file, filter)
+
+
+